[med-svn] [minia] 02/05: New upstream version 2.0.7
Andreas Tille
tille at debian.org
Fri Dec 1 09:04:18 UTC 2017
This is an automated email from the git hooks/post-receive script.
tille pushed a commit to branch minia2
in repository minia.
commit ff0272fbd142a7759588b6bc40ace3f92fab86e0
Author: Andreas Tille <tille at debian.org>
Date: Sat Aug 12 17:59:35 2017 +0200
New upstream version 2.0.7
---
.gitignore | 1 +
.gitmodules | 3 +
Bank.cpp | 1087 -----
Bank.h | 200 -
Bloom.cpp | 474 --
Bloom.h | 248 -
CMakeLists.txt | 119 +
Debloom.cpp | 466 --
Debloom.h | 45 -
GraphOutput.cpp | 380 --
GraphOutput.h | 204 -
Hash16.cpp | 404 --
Hash16.h | 95 -
Hashing.cpp | 42 -
Hashing.h | 31 -
INSTALL | 20 +
Kmer.cpp | 373 --
Kmer.h | 84 -
LICENSE | 1175 +++--
LargeInt.cpp | 277 --
LargeInt.h | 48 -
LinearCounter.cpp | 47 -
LinearCounter.h | 29 -
Minia.cpp | 351 --
MultiConsumer.cpp | 144 -
MultiConsumer.h | 86 -
OAHash.cpp | 212 -
OAHash.h | 77 -
Pool.cpp | 156 -
Pool.h | 92 -
README | 18 -
README.md | 38 +
Set.cpp | 305 --
Set.h | 158 -
SortingCount.cpp | 847 ----
SortingCount.h | 27 -
Terminator.cpp | 410 --
Terminator.h | 79 -
Traversal.cpp | 955 ----
Traversal.h | 168 -
Utils.cpp | 647 ---
Utils.h | 103 -
doc/CMakeLists.txt | 13 +
doc/manual.tex | 142 +
lut.h | 272 --
makefile | 76 -
manual/manual.pdf | Bin 1155669 -> 0 bytes
manual/manual.tex | 124 -
rvalues.h | 131 -
simple_test.sh | 20 -
src/Minia.cpp | 296 ++
src/Minia.hpp | 61 +
src/NodeSelector.cpp | 244 +
src/NodeSelector.hpp | 125 +
src/main.cpp | 50 +
test/read50x_ref10K_e001.fasta | 10000 ---------------------------------------
test/result10K.fasta | 2 -
ttmath/ttmath.h | 2849 -----------
ttmath/ttmathbig.h | 6061 ------------------------
ttmath/ttmathint.h | 1924 --------
ttmath/ttmathmisc.h | 250 -
ttmath/ttmathobjects.h | 809 ----
ttmath/ttmathparser.h | 2765 -----------
ttmath/ttmaththreads.h | 250 -
ttmath/ttmathtypes.h | 667 ---
ttmath/ttmathuint.h | 4062 ----------------
ttmath/ttmathuint_noasm.h | 1017 ----
ttmath/ttmathuint_x86.h | 1602 -------
ttmath/ttmathuint_x86_64.h | 1146 -----
69 files changed, 1773 insertions(+), 43910 deletions(-)
diff --git a/.gitignore b/.gitignore
new file mode 100644
index 0000000..796b96d
--- /dev/null
+++ b/.gitignore
@@ -0,0 +1 @@
+/build
diff --git a/.gitmodules b/.gitmodules
new file mode 100644
index 0000000..e85471a
--- /dev/null
+++ b/.gitmodules
@@ -0,0 +1,3 @@
+[submodule "thirdparty/gatb-core"]
+ path = thirdparty/gatb-core
+ url = https://github.com/GATB/gatb-core.git
diff --git a/Bank.cpp b/Bank.cpp
deleted file mode 100644
index 7f4ad6b..0000000
--- a/Bank.cpp
+++ /dev/null
@@ -1,1087 +0,0 @@
-//
-// Bank.cpp
-//
-// Created by Guillaume Rizk on 28/11/11.
-//
-
-//TEST
-
-#define _LARGEFILE_SOURCE
-#define _FILE_OFFSET_BITS 64
-
-#include <algorithm>
-#include <iostream>
-#include <sys/stat.h>
-#include <inttypes.h>
- #include <stdio.h>
- #include <stdlib.h>
- #include <string.h>
-#include <cmath> // for log2f
-
-#include "Bank.h"
-#include "Kmer.h" // Bank (almost) doesn't need Kmer.h, but KmersBuffer certainly does
-#include "lut.h"
-#include <errno.h>
-using namespace std;
-
-off_t fsize(const char *filename) {
- struct stat st;
-
- if (stat(filename, &st) == 0)
- return st.st_size;
-
- return -1;
-}
-
-// just a macro to open file indexed by i
-void Bank::open_stream(int i)
-{
- buffered_file[i]->stream = gzopen(buffered_file[i]->fname,"r");
- if (buffered_file[i]->stream == NULL)
- {
- printf("error opening file: %s\n",buffered_file[i]->fname);
- exit(1);
- }
-}
-// and close it
-void Bank::close_stream(int i)
-{
- gzclose(buffered_file[i]->stream);
- buffered_file[i]->stream = NULL;
-}
-
-// the following functions are adapted from kseq.h by Heng Li (https://github.com/attractivechaos/klib)
-inline bool rebuffer(buffered_file_t *bf)
-{
- if (bf->eof)
- return false;
- bf->buffer_start = 0;
- bf->buffer_end = gzread(bf->stream, bf->buffer, BUFFER_SIZE);
- if (bf->buffer_end < BUFFER_SIZE)
- bf->eof = 1;
- if (bf->buffer_end == 0)
- return false;
- return true;
-}
-
-inline signed char buffered_getc(buffered_file_t *bf)
-{
- if (bf->buffer_start >= bf->buffer_end)
- if (! rebuffer(bf))
- return -1;
- return (signed char) ( bf->buffer[bf->buffer_start++] );
-}
-
-#define nearest_power_of_2(x) (--(x), (x)|=(x)>>1, (x)|=(x)>>2, (x)|=(x)>>4, (x)|=(x)>>8, (x)|=(x)>>16, ++(x))
-
-inline signed int Bank::buffered_gets(buffered_file_t *bf, variable_string_t *s, char *dret, bool append, bool allow_spaces)
-{
- if (dret) *dret = 0;
- if (!append)
- s->length = 0;
- if (bf->buffer_start >= bf->buffer_end && bf->eof)
- return -1;
- while (1)
- {
- int i;
- if (bf->buffer_start >= bf->buffer_end)
- if (! rebuffer(bf))
- break;
- if (allow_spaces)
- {
- for (i = bf->buffer_start; i < bf->buffer_end ; i++)
- if (bf->buffer[i] == '\n')
- break;
- }
- else
- {
- for (i = bf->buffer_start; i < bf->buffer_end ; i++)
- // isspace() answers yes for ' ', \t, \n, \v, \f, \r
- if (isspace(bf->buffer[i]))
- break;
- }
- if (s->max - s->length < (i - bf->buffer_start + 1))
- {
- s->max = s->length + (i - bf->buffer_start + 1);
- nearest_power_of_2(s->max);
- s->string = (char*)realloc(s->string,s->max);
- }
- memcpy(s->string + s->length, bf->buffer + bf->buffer_start, i - bf->buffer_start);
- s->length += i - bf->buffer_start;
- bf->buffer_start = i + 1;
- if (i < bf->buffer_end)
- {
- if (dret)
- *dret = bf->buffer[i];
- break;
- }
- }
- if (s->string == NULL)
- {
- s->max = 256;
- s->string = (char*)calloc(256,1);
- }
- else if ( allow_spaces && s->length > 1 && s->string[s->length-1] == '\r')
- s->length--;
- s->string[s->length]= '\0';
- return s->length;
-}
-
-void Bank::rewind_all()
-{
- for (int i=0; i<nb_files; i++)
- {
- if (buffered_file[i]->stream != NULL)
- {
- gzclose(buffered_file[i]->stream);
- buffered_file[i]->stream = NULL;
- }
- buffered_file[i]->last_char = buffered_file[i]->eof = buffered_file[i]->buffer_start = buffered_file[i]->buffer_end = 0;
- }
- index_file = 0;
- open_stream(index_file);
-}
-
-// THIS READS FASTQ or FASTA, compressed with gzip or not
-// no limit on read length, allows multi-line reads
-// returns true if a read was successfuly read
-// false if end of file
-// adapted from kseq.h by Heng Li (https://github.com/attractivechaos/klib)
-bool Bank::get_next_seq_from_file(char **nseq, char **cheader, int *len, int *hlen, int file_id)
-{
- signed char c;
- buffered_file_t *bf = buffered_file[file_id];
- if (bf->last_char == 0)
- {
- while ( (c = buffered_getc(bf)) != -1 && c != '>' && c != '@'); // go to next header
- if (c == -1)
- return false; // eof
- bf->last_char = c;
- }
- read->length = dummy->length = 0;
-
- if (buffered_gets(bf, header, (char *)&c, false, false) < 0) //ici
- return false; // eof
- if (c != '\n')
- buffered_gets(bf, dummy, NULL, true, true); // read header //dummy instead of header to stop before first space
-
- if (read->string == NULL)
- {
- read->max = 256;
- read->string = (char*) malloc(read->max);
- }
- while ( (c = buffered_getc(bf)) != -1 && c != '>' && c != '+' && c != '@')
- {
- if (c == '\n')
- continue; // empty line
- read->string[read->length++] = c;
- buffered_gets(bf, read, NULL, true, true);
- }
- if (c == '>' || c == '@')
- bf->last_char = c;
- if (read->length + 1 >= read->max)
- {
- read->max = read->length + 2;
- nearest_power_of_2(read->max);
- read->string = (char*) realloc(read->string, read->max);
- }
- read->string[read->length] = '\0';
- if (c == '+') // fastq
- {
- if (dummy->max < read->max) // resize quality to match read length
- {
- dummy->max = read->max;
- dummy->string = (char*)realloc(dummy->string, dummy->max);
- }
- while ( (c = buffered_getc(bf)) != -1 && c != '\n'); // read rest of quality comment
- while (buffered_gets(bf, dummy, NULL, true, true) >= 0 && dummy->length < read->length); // read rest of quality
- bf->last_char = 0;
- }
- *len = read->length;
- *nseq = read->string;
- if (cheader && hlen)
- {
- *cheader = header->string;
- *hlen = header->length;
- }
-
- return true;
-}
-
-// wrapper
-bool Bank::get_next_seq_from_file(char **nseq, int *len, int file_id)
-{
- return get_next_seq_from_file(nseq,NULL,len,NULL,file_id);
-}
-
-//wrapper with notif when changing file
-bool Bank::get_next_seq(char **nseq, char **cheader, int *len, int *hlen, int * id_file)
-{
- * id_file = index_file ;
- bool success = get_next_seq_from_file(nseq,cheader,len,hlen,index_file);
- if (success)
- return true;
-
- // cycle to next file if possible
- if ( index_file < nb_files-1 )
- {
- close_stream(index_file);
- index_file++;
- open_stream(index_file);
- return get_next_seq(nseq,cheader, len,hlen, id_file);
- }
- return false;
-}
-
-// wrapper
-bool Bank::get_next_seq(char **nseq, char **cheader, int *len, int *hlen)
-{
- bool success = get_next_seq_from_file(nseq,cheader,len,hlen,index_file);
- if (success)
- return true;
-
- // cycle to next file if possible
- if ( index_file < nb_files-1 )
- {
- close_stream(index_file);
- index_file++;
- open_stream(index_file);
- return get_next_seq(nseq,cheader, len,hlen);
- }
- return false;
-}
-
-// wrapper
-bool Bank::get_next_seq(char **nseq, int *len)
-{
- return get_next_seq(nseq,NULL,len,NULL);
-}
-
-// wrapper
-bool Bank::get_next_seq(char **nseq, int *len, int * id_file)
-{
- return get_next_seq(nseq,NULL,len,NULL,id_file);
-}
-
-
-// had to move the Bank(x,x) constructor to an init() to avoid calling a constructor inside the Bank(x) constructor
-void Bank::init(char **fname, int nb_files_)
-{
- int64_t i;
- nb_files = nb_files_;
- filesizes = 0;
-
- // open the reads file, don't know if it is a fasta/q file or a list of file names yet
- gzFile tempfile = gzopen(fname[0],"r");
- if (tempfile == NULL)
- {
- char *buffer = (char*)malloc(BUFSIZ);
- strerror_r( errno, buffer, BUFSIZ ); // get string message from errno
- printf("error during fopen, filename: %s (buffer: %p) \n", fname[0], buffer);
- free(buffer);
- exit(1);
- }
- char deb=(char)gzgetc(tempfile);
-
- char **nfname;// [MAX_NB_FILES][TAILLE_NOM];
- nfname = (char**) malloc(sizeof(char*)*MAX_NB_FILES);
- for(int jj=0; jj<MAX_NB_FILES; jj++ )
- nfname [jj] = (char*) malloc(sizeof(char)*TAILLE_NOM);
-
- if(deb=='>' || deb=='@' || deb==EOF)
- { // file is a fasta/q file
- gzclose(tempfile);
- }
- else // file contains a list of file names
- {
- char* ret;
- gzungetc(deb,tempfile);
- printf("File %s starts with character \"%c\", hence is interpreted as a list of file names\n",fname[0],deb );
- int ii;
- // get the filenames
- for (ii=0; ii<MAX_NB_FILES ; ii++)
- {
- ret = gzgets(tempfile, nfname[ii], BUFFER_SIZE);
- if (ret != NULL) {
- // remove \r \n chars
- char *endline = strchr(nfname[ii], '\n');
- if (endline)
- *endline='\0';
- endline = strchr(nfname[ii], '\r');
- if (endline)
- *endline='\0';
- }
- else // no more filenames
- break;
- }
- printf("Reading %i read files\n",ii);
- if(ii==MAX_NB_FILES)
- printf("Warning! using max number of read files (%i)\n",ii);
-
- nb_files = ii;
- fname = (char **) nfname;
- gzclose(tempfile);
-
- }
-
- // initialize the buffers
- buffered_file = (buffered_file_t**) malloc(sizeof(buffered_file_t *)*nb_files);
- for (i=0; i<nb_files; i++)
- {
- buffered_file[i] = (buffered_file_t *)calloc(1, sizeof(buffered_file_t));
- buffered_file[i]->buffer = (unsigned char*) malloc(BUFFER_SIZE);
- buffered_file[i]->fname = strdup(fname[i]);
- }
-
- // estimate total size of files
- for (i=0; i<nb_files; i++)
- {
- bool compressed = false;
- uint64_t estimated_filesize;
-
- if (strstr(fname[i],"gz") == (fname[i]+strlen(fname[i])-2) ) compressed=true;
- if (compressed)
- // crude hack, based on Quip paper reporting compression ratio (~0.3).
- // gzseek(SEEK_END) isn't supported. need to read whole file otherwise :/
- estimated_filesize = fsize(fname[i]) * 4;
- else
- estimated_filesize = fsize(fname[i]);
-
- buffered_file[i]->estimated_filesize = estimated_filesize;
- filesizes += estimated_filesize;
- }
-
- rewind_all(); // initialize the get_next_seq iterator to the first file
-
- // init read and dummy (for readname and quality)
- read = (variable_string_t*) calloc(1,sizeof(variable_string_t));
- dummy = (variable_string_t*) calloc(1,sizeof(variable_string_t));
- header = (variable_string_t*) calloc(1,sizeof(variable_string_t));
-
- for(int jj=0; jj<MAX_NB_FILES; jj++ )
- free (nfname [jj]);
- free(nfname);
-}
-
-Bank::Bank(char *fname0)
-{
- char *fname[1] = { fname0 };
- init(fname, 1);
-}
-
-
-Bank::Bank(char **fname, int nb_files_)
-{
- init(fname,nb_files_);
-}
-
-Bank::~Bank(){
- variable_string_t * to_free[3] = {read, dummy, header};
- for (int i = 0; i < 3; i++)
- {
- if (to_free[i])
-
- {
- if (to_free[i]->string)
- free(to_free[i]->string);
- free(to_free[i]);
- }
- }
- for (int i=0; i<nb_files; i++)
- {
- free(buffered_file[i]->buffer);
- free(buffered_file[i]);
- }
-}
-
-void Bank::close()
-{
- for (int i=0; i<nb_files; i++)
- gzclose(buffered_file[i]->stream);
-}
-
-// estimate the volume of all redundant kmers in the reads, if they were to be stored in 2bits
-// from the first 100k reads of each file
-uint64_t Bank::estimate_kmers_volume(int k)
-{
- char * rseq;
- int readlen;
- int kmer_nbits = sizeof(kmer_type)*8;
- rewind_all();
- uint64_t total_volume = 0;
-
- while ( index_file < nb_files )
- {
- open_stream(index_file);
- int NbRead = 0;
- uint64_t volume_for_file = 0;
- while (get_next_seq_from_file(&rseq,NULL,&readlen,NULL,index_file))
- {
- if (readlen >= k)
- volume_for_file += (readlen-k+1) * (uint64_t) kmer_nbits;
- if (NbRead++ == 100000) // somehow less than 100000 is bad for our ion torrent tag1.fasta file
- break;
- }
- if ( gztell(buffered_file[index_file]->stream) != 0) // would be empty file
- {
- volume_for_file = (uint64_t) ( ( (float) volume_for_file ) * ( ( (float)(buffered_file[index_file]->estimated_filesize)) / ((float) gztell(buffered_file[index_file]->stream)) ) );
- total_volume += volume_for_file;
- }
- close_stream(index_file);
- index_file++;
- }
-
- total_volume = total_volume / 1024 /1024 /8; // put it in MB
-
- if (total_volume == 0) // tiny files fix
- total_volume = 1;
-
- rewind_all();
- return total_volume;
-}
-
-// estimate the number of reads
-uint64_t Bank::estimate_nb_reads()
-{
- char * rseq;
- int readlen;
- int NbRead = 0;
- rewind_all();
-
- uint64_t volume = 0;
- while (get_next_seq(&rseq,&readlen))
- {
- volume += 1;
- if (NbRead++ == 1000)
- break;
- }
-
- if ( gztell(buffered_file[index_file]->stream) == 0) // empty file
- return 1;
-
- volume = (volume * filesizes) / gztell(buffered_file[index_file]->stream); // linear extrapolation from the first 1k reads
-
- rewind_all();
- return volume;
-}
-
-// estimate maximum read length
-// from the first 10000 reads of each file
-int Bank::estimate_max_readlen()
-{
- char * rseq;
- int readlen;
- rewind_all();
- int max_readlen = 0;
- uint64_t volume = 0;
-
- while ( index_file < nb_files )
- {
- open_stream(index_file);
- int NbRead = 0;
- while (get_next_seq_from_file(&rseq,NULL,&readlen,NULL,index_file))
- {
- max_readlen = max(readlen, max_readlen);
- if (NbRead++ == 10000)
- break;
- }
- close_stream(index_file);
- index_file++;
- }
-
- rewind_all();
- return max_readlen;
-}
-
-void Bank::save_position()
-{
- restore_index_file = index_file;
- restore_pos = gztell(buffered_file[index_file]->stream) - buffered_file[index_file]->buffer_end + buffered_file[index_file]->buffer_start;
-}
-
-void Bank::load_position()
-{
- close_stream(index_file);
- index_file = restore_index_file;
- open_stream(index_file);
- gzseek(buffered_file[index_file]->stream, restore_pos, SEEK_SET);
- buffered_file[index_file]->eof = false;
- rebuffer(buffered_file[index_file]);
-}
-
-
-// BinaryBank: a binary file containing kmers
-
-BinaryBank::BinaryBank(char *given_filename, int given_sizeElement, bool write) : sizeElement(given_sizeElement)
-{
- strcpy(filename,given_filename);
- open(write);
- buffer_size_nelem= (WRITE_BUFFER/given_sizeElement);
- buffer = (void *) malloc(given_sizeElement * buffer_size_nelem);
- cpt_buffer=0;
-}
-
-
-BinaryBankConcurrent::BinaryBankConcurrent(char *given_filename, int given_sizeElement, bool write, int given_nthreads) : BinaryBank(given_filename,given_sizeElement,write)
-{
- nthreads = given_nthreads;
-
- //free(buffer); buffer =NULL; //cannot do that
- bufferT = (void **) malloc(sizeof(void*) * nthreads);
-
- for (int i= 0; i< nthreads; i++)
- {
- ((void ** )bufferT)[i]= (void *) malloc( WRITE_BUFFER);
-
- }
- cpt_buffer_tid = (int *)malloc(sizeof(int) * nthreads);
- memset (cpt_buffer_tid,0,sizeof(int) * nthreads);
-}
-
-
-void BinaryBankConcurrent::write_element_buffered( void *element, int tid)
-{
- write_buffered(element, sizeElement, tid);
-}
-
-
-void BinaryBankConcurrent::write_buffered( void *element, int size, int tid)
-{
- write_buffered( element, size, tid, true);
-}
-
-void BinaryBankConcurrent::write_buffered( void *element, int size, int tid, bool can_flush)
-{
- if(cpt_buffer_tid[tid]>= WRITE_BUFFER -100 && can_flush)
- {
- flush(tid);
- }
-
- char * buf_pt = ((char**) bufferT)[tid];
- memcpy(buf_pt + cpt_buffer_tid[tid] , element, size);
-
- cpt_buffer_tid[tid]+=size;
- // cpt_buffer_tid[tid]++;
-
-
-}
-
-
-
-void BinaryBankConcurrent::flush(int tid)
-{
- flockfile(binary_read_file);
- if (!fwrite( ((void **)bufferT)[tid], 1, cpt_buffer_tid[tid], binary_read_file))
- {
- printf("error: can't fwrite (disk full?)\n");
- funlockfile(binary_read_file);
- exit(1);
- }
- cpt_buffer_tid[tid]=0;
- funlockfile(binary_read_file);
-
-}
-
-
-//should be called by only one of the threads
-void BinaryBankConcurrent::close()
-{
- //flush buffer // if close Bank in read mode with data in the readbuffer, will result in error
- for(int ii=0; ii< nthreads; ii++)
- {
- if(cpt_buffer_tid[ii])
- {
- if (!fwrite(((void **)bufferT)[ii], 1, cpt_buffer_tid[ii], binary_read_file))
- // if (!fwrite(((void **)bufferT)[ii], sizeElement, cpt_buffer_tid[ii], binary_read_file))
-
- {
- printf("error: can't fwrite (disk full?)\n");
- exit(1);
- }
- }
- cpt_buffer_tid[ii]=0;
- }
-
- fclose(binary_read_file);
-}
-
-
-void BinaryBank::write_element( void *element)
-{
- // flockfile(binary_read_file);
- // fprintf(stderr,"write elem %lli \n",*(int64_t *)element);
- if (!fwrite(element, sizeElement, 1, binary_read_file))
- {
- // funlockfile(binary_read_file);
- printf("error: can't fwrite (disk full?)\n");
- exit(1);
- }
- // funlockfile(binary_read_file);
-}
-
-
-void BinaryBank::write_element_buffered( void *element)
-{
-
- if(cpt_buffer==buffer_size_nelem)
- {
- if (!fwrite(buffer, sizeElement, buffer_size_nelem, binary_read_file))
- {
- printf("error: can't fwrite (disk full?)\n");
- exit(1);
- }
- cpt_buffer=0;
- }
-
- //((kmer_type *)buffer)[cpt_buffer]= *((kmer_type *)element);
- memcpy((unsigned char *)buffer + (cpt_buffer * sizeElement), element, sizeElement);
- cpt_buffer++;
-
-
-
-}
-
-
-
-size_t BinaryBank::read_element( void *element)
-{
- return fread(element, sizeElement,1, binary_read_file);
-}
-
-size_t BinaryBank::read_element_buffered( void *element)
-{
- if(cpt_buffer==0)
- {
- cpt_buffer=fread(buffer, sizeElement,buffer_size_nelem, binary_read_file);
- if (cpt_buffer==0) return 0;
- cpt_init_buffer = cpt_buffer;
- }
- //memcpy(element, (unsigned char *)buffer + (cpt_buffer-1) * sizeElement, sizeElement);//ca les depile en sens inverse de la lecture
- memcpy(element, (unsigned char *)buffer + (cpt_init_buffer -1 - (cpt_buffer-1)) * sizeElement, sizeElement);//ca les depile dans le meme sens que la lecture
-
- cpt_buffer --;
- return cpt_buffer+1; // nb remaining before read
-}
-
-// used to read/write raw information to the binary file (e.g. kmer count)
-
-void BinaryBank::write( void *element, int size)
-{
- if (!fwrite(element, size, 1, binary_read_file))
- {
- printf("error: can't fwrite (disk full?)\n");
- exit(1);
- }
-}
-
-size_t BinaryBank::read( void *element, int size)
-{
- return fread(element, size,1, binary_read_file);
-}
-
-
-void BinaryBank::rewind_all()
-{
- rewind(binary_read_file);
-}
-
-void BinaryBank::close()
-{
- //flush buffer // if close Bank in read mode with data in the readbuffer, will result in error
- if(cpt_buffer)
- {
- if (!fwrite(buffer, sizeElement, cpt_buffer, binary_read_file))
- {
- printf("error: can't fwrite (disk full?)\n");
- exit(1);
- }
- }
- cpt_buffer=0;
-
- fclose(binary_read_file);
-}
-
-void BinaryBank::open(bool write)
-{
- binary_read_file = fopen(filename,write?"wb":"rb");
- if( binary_read_file == NULL )
- {
- char *buffer = (char*)malloc(BUFSIZ);
- strerror_r( errno, buffer, BUFSIZ ); // get string message from errno
- printf("error during fopen: %s write %i %s\n",buffer,write,filename);
- free(buffer);
- exit(1);
- }
-
-}
-
-off_t BinaryBank::nb_elements()
-{
- return fsize(filename)/sizeElement;
-}
-
-
-BinaryBank::~BinaryBank()
-{
- if(buffer!=NULL)
- {
- free (buffer); //buffer =NULL;
- }
-}
-
-
-BinaryBankConcurrent::~BinaryBankConcurrent()
-{
-
- for (int i= 0; i< nthreads; i++)
- {
- free(((void ** )bufferT)[i]);
- ((void ** )bufferT)[i]=NULL;
- }
- free(bufferT);
-}
-
-
-
-/////////////class BinaryReads a file containing reads
-
-BinaryReads::~BinaryReads()
-{
- free (buffer); buffer = NULL;
-}
-
-
-BinaryReads::BinaryReads(char *given_filename, bool write)
-{
- read_write_buffer_size = BINREADS_BUFFER;
- strcpy(filename,given_filename);
- open(write);
- buffer = (unsigned char *) malloc(read_write_buffer_size*sizeof(unsigned char));
- cpt_buffer = 0;
-}
-
-
-void BinaryReads::rewind_all()
-{
- rewind(binary_read_file);
-}
-
-void BinaryReads::close()
-{
- unsigned int block_size =0;
- //flush buffer
- if(cpt_buffer)
- {
- //printf("close :write block %i \n",cpt_buffer);
- block_size = cpt_buffer;
- fwrite(&block_size, sizeof(unsigned int), 1, binary_read_file); // block header
- if (!fwrite(buffer, 1, cpt_buffer, binary_read_file))
- {
- printf("error: can't fwrite (disk full?)\n");
- exit(1);
- }
- }
- cpt_buffer=0;
-
- fclose(binary_read_file);
-}
-
-void BinaryReads::open(bool write)
-{
- binary_read_file = fopen(filename,write?"wb":"rb");
- if( binary_read_file == NULL )
- {
- char *buffer = (char*)malloc(BUFSIZ);
- strerror_r( errno, buffer, BUFSIZ ); // get string message from errno
- printf("error during fopen: %s write %i %s\n",buffer,write,filename);
- free(buffer);
- exit(1);
- }
-
-}
-
-
-void BinaryReads::mark_newfile()
-{
- unsigned int block_size =0;
- //flush previous buffer
- if(cpt_buffer)
- {
- //printf("close :write block %i \n",cpt_buffer);
- block_size = cpt_buffer;
- fwrite(&block_size, sizeof(unsigned int), 1, binary_read_file); // block header
- if (!fwrite(buffer, 1, cpt_buffer, binary_read_file))
- {
- printf("error: can't fwrite (disk full?)\n");
- exit(1);
- }
- }
- cpt_buffer=0;
-
- //then write empty block == mark of a new file
- block_size =0;
- fwrite(&block_size, sizeof(unsigned int), 1, binary_read_file); // block header with 0
-
-}
-
-//format is
-// 32 bit integer = readlen, then seq in binary
-// then next read..
-//32 bit len is overkill but simpler
-//also makes buffer then write block with header : size of block to read, with n reads .... will allow large fread when reading this file ...
-void BinaryReads::write_read(char * read, int readlen)
-{
- int tai = readlen;
- unsigned char rbin;
- char * pt = read;
- unsigned int block_size = 0;
-
- // printf("write read %i / %i readlen %i \n",cpt_buffer,read_write_buffer_size,readlen);
- //todo : also flush to disk sometimes (ie if very large buffer, to create smaller blocks..)
- if((cpt_buffer && cpt_buffer >= (read_write_buffer_size-readlen)) || cpt_buffer > 10000000 ) ////not enough space to store next read true space is 4 + readlen/4 + rem
- //flush buffer to disk
- {
-
- block_size = cpt_buffer;
-
- //printf("write block %i\n",block_size);
- if(block_size) fwrite(&block_size, sizeof(unsigned int), 1, binary_read_file); // block header
- if (!fwrite(buffer, 1, cpt_buffer, binary_read_file)) // write a block, it ends at end of a read
- {
- printf("error: can't fwrite (disk full?)\n");
- exit(1);
- }
- cpt_buffer=0;
- }
-
- //check if still not enough space in empty buffer : can happen if large read, then enlarge buffer
- if(read_write_buffer_size < readlen)
- {
- read_write_buffer_size = 2*readlen; // too large but ok
- buffer = (unsigned char *) realloc(buffer,sizeof(unsigned char) * read_write_buffer_size);
- }
-
- memcpy(buffer+cpt_buffer,&readlen,sizeof(int));
- cpt_buffer+= sizeof(int);
-
- //fwrite( (void *) &readlen, sizeof(int), 1, binary_read_file);
-
-
- for (tai=readlen; tai>=4 ; tai-=4)
- {
- rbin = code4NT(pt);
- // fwrite((void *) &rbin, 1,1,binary_read_file );
- buffer[cpt_buffer]=rbin; cpt_buffer++;
- pt +=4;
- }
-
- //then remaining
- if(tai)
- {
- rbin = code_n_NT(pt,tai);
- // fwrite( (void *) &rbin,1,1,binary_read_file);
- buffer[cpt_buffer]=rbin; cpt_buffer++;
- }
-}
-
-
-
-void compute_kmer_table_from_one_seq(int readlen, char * seq, kmer_type * kmer_table ) //,char * pkmer_table //pour remplissage table loc
-{
- kmer_type graine = codeSeed(seq);
- kmer_type graine_revcomp = revcomp(graine);
- kmer_table[0] = min(graine,graine_revcomp);
- seq++;
- for (int i=1; i<readlen-sizeKmer+1; i++)
- {
- graine = (graine * 4 + NT2int(seq[sizeKmer-1])) & kmerMask ;
- graine_revcomp = ((graine_revcomp >> 2) + ( ((kmer_type) comp_NT[NT2int(seq[sizeKmer-1])]) << (2*(sizeKmer-1)) ) ) & kmerMask ;
- kmer_table[i] = min(graine,graine_revcomp);
- seq++;
- }
-}
-
-
-
-
-
-////kmers buffer
-
-
-KmersBuffer::KmersBuffer(BinaryReads *bfile, int pbuffer_size, int nseq_task )
-{
-
- read_write_buffer_size = BINREADS_BUFFER;
- buffer = ( char *) malloc(read_write_buffer_size*sizeof( char));
- cpt_buffer = 0;
- cpt_binSeq_read =0; binSeq_toread =0;
- max_read_length = KMERSBUFFER_MAX_READLEN;
- binfile = bfile;
- buffer_size = pbuffer_size;
- kmers_buffer = (kmer_type *) malloc(sizeof(kmer_type) * buffer_size);
- // binSeq = (char *) malloc(sizeof(char) * max_read_length); // no need to alloc ram for binse : will points to buffer
- binSeq_extended = (char *) malloc(sizeof(char) * max_read_length);
- blocksize_toread =0;
-
-
- nseq_step = nseq_task;
- binary_read_file = bfile->binary_read_file;
-
-}
-
-
-void KmersBuffer::reset_max_readlen(int read_length)
-{
-
- max_read_length = read_length;
-
- // binSeq = (char *) realloc(binSeq,sizeof(char) * max_read_length);
- binSeq_extended = (char *) realloc(binSeq_extended,sizeof(char) * max_read_length);
-
-}
-
- KmersBuffer::~KmersBuffer()
-{
- free (kmers_buffer);
- free(buffer);
- //free(binSeq);
- free(binSeq_extended);
-}
-
-
-//now returns number of kmers read
-int KmersBuffer::readkmers()
-{
-
- int llen;
- int * len = & llen ;
- unsigned int block_size =0;
-
- //////reading new block from disk if needed
- // cpt_buffer == blocksize_toread tells we finished reading previous buffer
- // (binSeq_toread <= cpt_binSeq_read) tells we finished reading the last sequence
- if(cpt_buffer == blocksize_toread && (binSeq_toread <= cpt_binSeq_read))
- {
- flockfile(binary_read_file);
- if( ! fread(&block_size,sizeof(unsigned int),1, binary_read_file)) //read block header
- {
- funlockfile(binary_read_file);
- return -1; // no more blocks to read
- }
-
- // block_size = 0 is a marker to indicate new read file, when it happens return -2
- if(block_size==0)
- {
- return -2 ;
- }
- ///
-
- if(block_size >= read_write_buffer_size) // block buffer need to be enlarged
- {
- read_write_buffer_size = 2*block_size;
- buffer = ( char *) realloc(buffer,sizeof( char) * read_write_buffer_size);
- }
-
- fread(buffer,sizeof( char),block_size, binary_read_file); // read a block of sequences into the buffer
- funlockfile(binary_read_file);
- cpt_buffer = 0;
- blocksize_toread = block_size;
- }
- ///////////////////////
-
-
-
-
- //now parse the whole block in ram
-
- int i,j;
- int nchar;
- unsigned char fournt;
-
- nkmers = 0;
- int nseq_lues = 0;
- //cpt_buffer : how much we have already read in the buffer
- //blocksize_toread : how much there is to read in the buffer
- while(cpt_buffer < blocksize_toread || ( binSeq_toread > cpt_binSeq_read)) //while work to do
- {
-
- if( binSeq_toread <= cpt_binSeq_read)// read new sequence if needed //we will put one sequence into binSeq_extended
- {
- memcpy(len,buffer+cpt_buffer,sizeof(int)); // the sequence length
- cpt_buffer += sizeof(int);
- nseq_lues ++;
-
- if( (*len) > max_read_length) reset_max_readlen((int)(1.2*(*len))); // resize memory for sequence if needed
- nchar = ((*len)+3)/4; // number of bytes used to encode the sequence in its binary format (4 nt per byte)
-
- binSeq = buffer + cpt_buffer; // point binseq to correct place //cpt_buffer == where we are now in the buffer
- cpt_buffer += nchar;
-
- // on disk data was encoded with 4 nucleotides per bytes,
- // here we expand one sequence to one nucl per byte into binSeq_extended
- //nucleotides are still encoded in [0-3]
- j=0;
- for(i=0; i<nchar; i++)
- {
- fournt = binSeq[i];
- binSeq_extended[j+3]=fournt & 3; fournt = fournt >> 2;
- binSeq_extended[j+2]=fournt & 3; fournt = fournt >> 2;
- binSeq_extended[j+1]=fournt & 3; fournt = fournt >> 2;
- binSeq_extended[j+0]=fournt & 3;
- j+=4;
- }
- binSeq_toread = *len-sizeKmer+1; // binSeq_toread tells how many kmers there are in this sequence
- cpt_binSeq_read = 0; // tells how many kmers we have currently parsed in this sequence
-
- }
-
-
- {
- // binSeq_extended = beginning of the sequence,
- // cpt_binSeq_read = how much we have already read in this sequence (when kmers_buffer is full, we can halt parsing kmers (see below) in the middle of a sequence, so this value is not necessarily 0)
- char *seq = binSeq_extended+cpt_binSeq_read;
- kmer_type graine;
- kmer_type graine_revcomp;
- if( binSeq_toread > cpt_binSeq_read)
- // there are still unread kmers in this sequence, here we read the first one,
- // we put it in graine / graine_revcomp and store it in the kmers_buffer
- {
- graine = codeSeed_bin(seq);
- graine_revcomp = revcomp(graine);
-
- if(nkmers>=buffer_size)
- {
- return nkmers;
- }
- kmers_buffer[nkmers] = min(graine,graine_revcomp); nkmers++; cpt_binSeq_read ++;
- seq++;
- }
-
- while( binSeq_toread > cpt_binSeq_read) //while there remains kmers to be read in this sequence
- {
- graine = (graine * 4 + (seq[sizeKmer-1])) & kmerMask ; //parse next nucleotide to construc the next kmer
- graine_revcomp = ((graine_revcomp >> 2) + ( ((kmer_type) comp_NT[(int)(seq[sizeKmer-1])]) << (2*(sizeKmer-1)) ) ) & kmerMask;
- kmers_buffer[nkmers] = min(graine,graine_revcomp); nkmers ++; cpt_binSeq_read ++; //we store the kmer in the kmers_buffer
- seq++;
- if(nkmers>=buffer_size) //the kmers_buffer is full, we stop
- {
- return nkmers;
- }
- }
-
- }
- }
-
- // we stop when we finished one block, or when kmers_buffer is full,
- // it can happen in the middle of a sequence : the next time we call readkmers we will have to continue
- // from where we stopped in this sequence (counter cpt_binSeq_read tells us that)
-
- //while buffer is non empty, we 'expand' a sequence into binSeq_extended
- //then we parse binSeq_extended to store kmers in the kmers_buffer
-
- return nkmers;
-
-
-}
-
-
diff --git a/Bank.h b/Bank.h
deleted file mode 100644
index 7657f9c..0000000
--- a/Bank.h
+++ /dev/null
@@ -1,200 +0,0 @@
-//
-// Bank.h
-//
-// Created by Guillaume Rizk on 28/11/11.
-// Modified by Rayan Chikhi on 16/2/13
-//
-
-#ifndef Bank_h
-#define Bank_h
-#include <stdio.h>
-#include "Kmer.h"
-
-#include <zlib.h> // Added by Pierre Peterlongo on 02/08/2012.
-
-#define TAILLE_NOM 1024
-#define MAX_NB_FILES 2000
-
-#define BUFFER_SIZE 16384 // same as kseq.h
-
-#define WRITE_BUFFER 32768// 16384 //800000
-
-#define KMERSBUFFER_MAX_READLEN 4096 // grows dynamically if needed
-
-#define BINREADS_BUFFER 100000
-
-off_t fsize(const char *filename) ;
-
-// heavily inspired by kseq.h from Heng Li (https://github.com/attractivechaos/klib)
-typedef struct
-{
- gzFile stream;
- unsigned char *buffer;
- int buffer_start, buffer_end;
- bool eof;
- char last_char;
- char *fname;
- uint64_t estimated_filesize;
-} buffered_file_t;
-
-typedef struct
-{
- int length ,max;
- char *string;
-} variable_string_t;
-
-// supports opening multiple fasta/fastq files
-class Bank{
-
- public:
-
- Bank(char *fname);
- Bank(char **fname, int nb_files_);
- void init(char **fname, int nb_files_);
- void close();
-
- bool get_next_seq(char **nseq, int *len);
- bool get_next_seq_from_file(char **nseq, int *len, int file_id);
-
- bool get_next_seq_from_file(char **nseq, char **cheader, int *len, int *hlen, int file_id);
- bool get_next_seq(char **nseq, char **cheader, int *len, int *hlen);
-
- bool get_next_seq(char **nseq, char **cheader, int *len, int *hlen, int * id_file);//also return file id
- bool get_next_seq(char **nseq, int *len, int * id_file); //also return file id
-
- void open_stream(int i); // internal functions
- void close_stream(int i);
- void rewind_all();
-
- variable_string_t *read, *dummy, *header;
-
- int nb_files; // total nb of files
- int index_file; // index of current file
- uint64_t filesizes; // estimate of total size for all files
-
- signed int buffered_gets(buffered_file_t *bf, variable_string_t *s, char *dret, bool append, bool allow_spaces);
-
- ~Bank();
-
- uint64_t estimate_kmers_volume(int k);
- uint64_t estimate_nb_reads();
- int estimate_max_readlen();
-
- // functions that enable to read the same portion twice
- void save_position();
- void load_position();
- int restore_index_file;
- z_off_t restore_pos;
-
- buffered_file_t **buffered_file;
-};
-
-class BinaryBank
-{
- protected:
- char filename[TAILLE_NOM];
- FILE * binary_read_file;
- const int sizeElement;
- void * buffer;
- int cpt_buffer;
- int cpt_init_buffer;
-
- int buffer_size_nelem;
- public:
- BinaryBank(char *filename, int sizeElement, bool write);
- BinaryBank ();
- void write_element(void *element);
- size_t read_element(void *element);
- size_t read_element_buffered(void *element);
-
- void write( void *element, int size);
- void write_element_buffered(void *element);
-
- size_t read( void *element, int size);
- void rewind_all();
- void close();
- void open(bool write);
- off_t nb_elements();
- ~BinaryBank();
-
-};
-
-
-
-class BinaryBankConcurrent : public BinaryBank
-{
-
- int * cpt_buffer_tid; // this counter is now in bytes
- int nthreads ;
- void * bufferT;
- public:
- BinaryBankConcurrent(char *given_filename, int given_sizeElement, bool write, int given_nthreads) ;
- void write_element_buffered(void *element, int tid);
- void write_buffered( void *element, int size, int tid);
- void write_buffered( void *element, int size, int tid, bool can_flush);
- void flush(int tid);
-
- void close();
- ~BinaryBankConcurrent();
-
-};
-
-
-
-class BinaryReads
-{
- char filename[TAILLE_NOM];
- // const int sizeElement;
- unsigned char * buffer;
- int cpt_buffer;
- unsigned int read_write_buffer_size;
-
-
- public:
- FILE * binary_read_file;
-
- BinaryReads(char *filename, bool write);
- // void write_element(void *element);
- //size_t read_element(void *element);
- void write_read(char * read, int readlen);
- void rewind_all();
- void close();
- void open(bool write);
- void mark_newfile();
- ~BinaryReads();
-
-};
-
-
-
-class KmersBuffer
-{
-
- char * buffer;
- int cpt_buffer;
- int blocksize_toread;
-
- unsigned int read_write_buffer_size;
- int cpt_binSeq_read;
- int binSeq_toread;
-
- public:
- int max_read_length;
- BinaryReads * binfile;
- FILE * binary_read_file;
- int nkmers; //number of kmers in the buffer
- int nseq_step;
- int buffer_size;
- kmer_type * kmers_buffer;
- KmersBuffer(BinaryReads *bfile, int pbuffer_size, int nseq_task );
- int readkmers();
- char * binSeq;// [MAX_READ_LENGTH];
- char * binSeq_extended;//[MAX_READ_LENGTH];
- void reset_max_readlen(int read_length);
-
- ~KmersBuffer();
-};
-
-void compute_kmer_table_from_one_seq(int readlen, char * seq, kmer_type * kmer_table ) ;
-
-#endif
diff --git a/Bloom.cpp b/Bloom.cpp
deleted file mode 100644
index d846629..0000000
--- a/Bloom.cpp
+++ /dev/null
@@ -1,474 +0,0 @@
-//
-// Bloom.cpp
-//
-// Created by Guillaume Rizk on 9/02/12.
-//
-
-#include <iostream>
-#include <stdio.h>
-#include <string.h>
-
-#include "Bloom.h"
-
-
-
-Bloom::Bloom()
-{
- //empty default constructor
- nb_elem = 0;
- blooma = NULL;
-}
-
-BloomCpt::BloomCpt()
-{
- //empty default constructor
- nb_elem = 0;
- blooma = NULL;
-
-}
-void Bloom::setSeed(uint64_t seed)
-{
- if(user_seed==0)
- {
- user_seed = seed;
- this->generate_hash_seed(); //regenerate the hash with the new seed
- }
- else{
- fprintf(stderr,"Warning! you should not change the seed a second time!, resuming with previous seed %llu \n",(unsigned long long)user_seed);
- }
-}
-
-void Bloom::set_number_of_hash_func(int i)
-{
- if(i>NSEEDSBLOOM || i<1){
- fprintf(stderr,"%i is not a valid value for number of hash funcs, should be in [1-%i], resuming wild old value %i\n",i,NSEEDSBLOOM,n_hash_func );
- return;
- }
- n_hash_func = i;
-}
-
-void Bloom::generate_hash_seed()
-{
- unsigned int i;
- for ( i = 0; i < NSEEDSBLOOM; ++i)
- {
- seed_tab[i]= rbase[i];
- }
- for ( i = 0; i < NSEEDSBLOOM; ++i)
- {
- seed_tab[i]= seed_tab[i] * seed_tab[(i+3) % NSEEDSBLOOM] + user_seed ;
- }
-
-}
-
-#ifdef _largeint
-inline uint64_t Bloom::hash_func(LargeInt<KMER_PRECISION> elem, int num_hash)
-{
- // hash = XOR_of_series[hash(i-th chunk iof 64 bits)]
- uint64_t result = 0, chunk, mask = ~0;
- LargeInt<KMER_PRECISION> intermediate = elem;
- int i;
- for (i=0;i<KMER_PRECISION;i++)
- {
- chunk = (intermediate & mask).toInt();
- intermediate = intermediate >> 64;
-
- result ^= hash_func(chunk,num_hash);
- }
- return result;
-}
-#endif
-
-#ifdef _ttmath
-inline uint64_t Bloom::hash_func(ttmath::UInt<KMER_PRECISION> elem, int num_hash)
-{
- // hash = XOR_of_series[hash(i-th chunk iof 64 bits)]
- uint64_t result = 0, to_hash;
- ttmath::UInt<KMER_PRECISION> intermediate = elem;
- uint32_t mask=~0, chunk;
- int i;
- for (i=0;i<KMER_PRECISION/2;i++)
- {
- // retrieve a 64 bits part to hash
- (intermediate & mask).ToInt(chunk);
- to_hash = chunk;
- intermediate >>= 32;
- (intermediate & mask).ToInt(chunk);
- to_hash |= ((uint64_t)chunk) << 32 ;
- intermediate >>= 32;
-
- result ^= hash_func(to_hash,num_hash);
- }
- return result;
-}
-#endif
-
-#ifdef _LP64
-inline uint64_t Bloom::hash_func( __uint128_t elem, int num_hash)
-{
- // hash(uint128) = ( hash(upper 64 bits) xor hash(lower 64 bits))
- return hash_func((uint64_t)(elem>>64),num_hash) ^ hash_func((uint64_t)(elem&((((__uint128_t)1)<<64)-1)),num_hash);
-}
-#endif
-
-
-inline uint64_t Bloom::hash_func( uint64_t key, int num_hash)
-{
- uint64_t hash = seed_tab[num_hash];
- hash ^= (hash << 7) ^ key * (hash >> 3) ^ (~((hash << 11) + (key ^ (hash >> 5))));
- hash = (~hash) + (hash << 21); // hash = (hash << 21) - hash - 1;
- hash = hash ^ (hash >> 24);
- hash = (hash + (hash << 3)) + (hash << 8); // hash * 265
- hash = hash ^ (hash >> 14);
- hash = (hash + (hash << 2)) + (hash << 4); // hash * 21
- hash = hash ^ (hash >> 28);
- hash = hash + (hash << 31);
- return hash;
-}
-
-
-//tai is 2^tai_bloom
-Bloom::Bloom(int tai_bloom)
-{
- n_hash_func = 4 ;//def
- user_seed =0;
- nb_elem = 0;
- tai = (1LL << tai_bloom);
- nchar = tai/8LL;
- blooma =(unsigned char *) malloc( nchar *sizeof(unsigned char)); // 1 bit per elem
- memset(blooma,0,nchar *sizeof(unsigned char));
- //fprintf(stderr,"malloc Power-of-two bloom %lli MB nchar %llu %llu\n",(long long)((tai/8LL)/1024LL/1024LL),(unsigned long long)nchar,(unsigned long long)(tai/8));
- this->generate_hash_seed();
-}
-
-
-
-
- Bloom::Bloom(uint64_t tai_bloom)
- {
- //printf("custom construc \n");
- n_hash_func = 4 ;//def
- user_seed =0;
- nb_elem = 0;
- tai = tai_bloom;
- nchar = (1+tai/8LL);
- blooma =(unsigned char *) malloc( nchar *sizeof(unsigned char)); // 1 bit per elem
- memset(blooma,0,nchar *sizeof(unsigned char));
- //fprintf(stderr,"malloc bloom %lli MB \n",(tai/8LL)/1024LL/1024LL);
- this->generate_hash_seed();
- }
-
-
-
-
-
-// //tai is 2^tai_bloom
-BloomCpt::BloomCpt(int tai_bloom)
-{
-
- n_hash_func = 2;
- user_seed = 0;
- nb_elem = 0;
- tai = (1LL << tai_bloom);
- blooma =(unsigned char *) malloc( (tai/2) *sizeof(unsigned char)); //4bits per elem
- memset(blooma,0,(tai/2) *sizeof(unsigned char));
-
- fprintf(stderr,"malloc bloom cpt %lli MB \n",(tai/2LL)/1024LL/1024LL);
- this->generate_hash_seed();
-}
-
-
-// //tai is 2^tai_bloom
-BloomCpt3::BloomCpt3(int tai_bloom)
-{
-
- n_hash_func = 2;
- user_seed = 0;
- nb_elem = 0;
- tai = (1LL << tai_bloom);
- //blooma =(unsigned char *) malloc( (tai/2) *sizeof(unsigned char)); //4bits per elem
- blooma3 = (uint64_t*) malloc( ((tai/21)+1) *sizeof(uint64_t)); //3bits per elem, 21 elem per uint64
-
- memset(blooma3,0, ((tai/21)+1) *sizeof(uint64_t));
-
- fprintf(stderr,"malloc bloom cpt64 3 bits %lli MB \n",8*(tai/21LL)/1024LL/1024LL);
- this->generate_hash_seed();
-}
-
-
-// //tai is 2^tai_bloom
-BloomCpt2::BloomCpt2(int tai_bloom)
-{
-
- n_hash_func = 2;
- user_seed = 0;
- nb_elem = 0;
- tai = (1LL << tai_bloom);
- //blooma =(unsigned char *) malloc( (tai/2) *sizeof(unsigned char)); //4bits per elem
- blooma2 = (uint64_t*) malloc( (tai/32) *sizeof(uint64_t)); //2bits per elem, 32 elem per uint64
-
- memset(blooma2,0, (tai/32) *sizeof(uint64_t));
-
- fprintf(stderr,"malloc bloom cpt64 2 bits %lli MB \n",8*(tai/32LL)/1024LL/1024LL);
- this->generate_hash_seed();
-}
-
-
-
-
-
-Bloom::~Bloom()
-{
- if(blooma!=NULL)
- free(blooma);
-}
-
-BloomCpt3::~BloomCpt3()
-{
- if(blooma3!=NULL)
- free(blooma3);
-}
-
-
-BloomCpt2::~BloomCpt2()
-{
- if(blooma2!=NULL)
- free(blooma2);
-}
-
-
-
-
-void Bloom::dump(char * filename)
-{
- FILE *file_data;
- file_data = fopen(filename,"wb");
- fwrite(blooma, sizeof(unsigned char), nchar, file_data); //1+
- printf("bloom dumped \n");
-
-}
-
-
-void Bloom::load(char * filename)
-{
- FILE *file_data;
- file_data = fopen(filename,"rb");
- printf("loading bloom filter from file, nelem %lli \n",nchar);
- fread(blooma, sizeof(unsigned char), nchar, file_data);
- printf("bloom loaded\n");
-
-
-}
-
-long Bloom::weight()
-{
- // return the number of 1's in the Bloom, nibble by nibble
- const unsigned char oneBits[] = {0,1,1,2,1,2,2,3,1,2,2,3,2,3,3,4};
- long weight = 0;
- for(uint64_t index = 0; index < nchar; index++)
- {
- unsigned char current_char = blooma[index];
- weight += oneBits[current_char&0x0f];
- weight += oneBits[current_char>>4];
- }
- return weight;
-}
-
-
-void Bloom::add(bloom_elem elem)
-{
- uint64_t h1;
- int i;
- for(i=0; i<n_hash_func; i++)
- {
-#if CUSTOMSIZE
- h1 = hash_func(elem,i) % tai;
-#else
- h1 = hash_func(elem,i) & (tai-1);
-#endif
- blooma [h1 >> 3] |= bit_mask[h1 & 7];
- }
-
- //nb_elem++;
-
-}
-
-
-
-int Bloom::contains(bloom_elem elem)
-{
- uint64_t h1;
- int i;
- for(i=0; i<n_hash_func; i++)
- {
-#if CUSTOMSIZE
- h1 = hash_func(elem,i) % tai;
-#else
- h1 = hash_func(elem,i) & (tai-1);
-#endif
-
- if ((blooma[h1 >> 3 ] & bit_mask[h1 & 7]) != bit_mask[h1 & 7])
- return 0;
- }
-
-
- return 1;
-}
-
-
-
-void BloomCpt::add(bloom_elem elem)
-{
- uint64_t h1;
- unsigned char val,cpt_per_key;
-
- int i;
- for(i=0; i<n_hash_func; i++)
- {
-
- h1 = hash_func(elem,i) & (tai-1);
- val = blooma [h1 / cpt_per_char];
- cpt_per_key = (val & cpt_mask[h1 & 1]) >> (4* (h1 & 1)) ;
- cpt_per_key++;
- if(cpt_per_key==16) cpt_per_key = 15; //satur at 15
- val &= ~ cpt_mask[h1 & 1];
- val |= cpt_per_key << (4* (h1 & 1)) ;
- blooma [h1 / cpt_per_char] = val;
- }
-
-
-}
-
-
-//9698232370296160
-int BloomCpt::contains_n_occ(bloom_elem elem, int nks)
-{
- uint64_t h1;
- unsigned char cpt_per_key;
- int i;
-
- for(i=0; i<n_hash_func; i++)
- {
- h1 = hash_func(elem,i) & (tai-1);
-
- cpt_per_key = (blooma [h1 / cpt_per_char] & cpt_mask[h1 & 1]) >> (4* (h1 & 1));
-
- if(cpt_per_key<nks) return 0;
- }
-
- return 1;
-
-}
-
-
-
-
-
-
-void BloomCpt3::add(bloom_elem elem)
-{
- uint64_t h1,val;
- uint64_t cpt_per_key;
-
- int i;
- // printf("Add elem \n");
- // printf ("\nadd3 elem %lli \n",elem);
-
- for(i=0; i<n_hash_func; i++)
- {
-
- h1 = hash_func(elem,i) & (tai-1);
- // printf("--h1 %lli %lli m%016llX\n",h1, h1%21,cpt_mask21[h1 % 21]);
- val = blooma3 [h1 / 21]; //21 elem per uint64
- //if(elem==9698232370296160) printf("--%016llX\n", val);
-
- cpt_per_key = (val & cpt_mask21[h1 % 21]) >> (3* (h1 %21)) ;
- cpt_per_key++;
- if(cpt_per_key==8) cpt_per_key = 7; //satur at 7
- val &= ~ cpt_mask21[h1 % 21];
- val |= cpt_per_key << (3* (h1 % 21)) ;
- blooma3 [h1 / 21] = val;
- // if(elem==9698232370296160) printf("--%016llX %i\n", val,cpt_per_key);
-
- }
-
-
-}
-
-
-int BloomCpt3::contains_n_occ(bloom_elem elem, int nks)
-{
- uint64_t h1;
- unsigned char cpt_per_key;
- int i;
- // printf("--contains-- \n");
- // if(elem==9698232370296160) printf ("\nquery3 elem %lli \n",elem);
-
- for(i=0; i<n_hash_func; i++)
- {
- h1 = hash_func(elem,i) & (tai-1);
- // printf("h1 %lli \n",h1);
-
- cpt_per_key = (blooma3 [h1 / 21] & cpt_mask21[h1 % 21]) >> (3* (h1 % 21));
-
- //printf("%016llX\n", blooma3 [h1 / 21]);
- //printf("cpt %i \n", cpt_per_key);
- //if(elem==9698232370296160) printf("bloocpt3 %i \n", cpt_per_key);
-
- if(cpt_per_key<nks) return 0;
- }
-
- return 1;
-
-}
-
-
-
-
-void BloomCpt2::add(bloom_elem elem)
-{
- uint64_t h1,val;
- uint64_t cpt_per_key;
-
- int i;
- // printf("Add elem \n");
- // printf ("\nadd3 elem %lli \n",elem);
-
- for(i=0; i<n_hash_func; i++)
- {
-
- h1 = hash_func(elem,i) & (tai-1);
- val = blooma2 [h1 / 32]; //32 elem per uint64
-
- cpt_per_key = (val & cpt_mask32[h1 & 31]) >> (2* (h1 & 31)) ;
- cpt_per_key++;
- if(cpt_per_key==4) cpt_per_key = 3; //satur at 3
- val &= ~ cpt_mask32[h1 & 31];
- val |= cpt_per_key << (2* (h1 & 31)) ;
- blooma2 [h1 / 32] = val;
- // if(elem==9698232370296160) printf("--%016llX %i\n", val,cpt_per_key);
-
- }
-
-
-}
-
-int BloomCpt2::contains_n_occ(bloom_elem elem, int nks)
-{
- uint64_t h1;
- unsigned char cpt_per_key;
- int i;
-
- for(i=0; i<n_hash_func; i++)
- {
- h1 = hash_func(elem,i) & (tai-1);
-
- cpt_per_key = (blooma2 [h1 / 32] & cpt_mask32[h1 & 31]) >> (2* (h1 & 31));
-
-
- if(cpt_per_key<nks) return 0;
- }
-
- return 1;
-
-}
diff --git a/Bloom.h b/Bloom.h
deleted file mode 100644
index 742e53a..0000000
--- a/Bloom.h
+++ /dev/null
@@ -1,248 +0,0 @@
-//
-// Bloom.h
-//
-// Created by Guillaume Rizk on 9/02/12.
-//
-
-#ifndef Bloom_h
-#define Bloom_h
-#include <stdlib.h>
-#include <inttypes.h>
-#include <stdint.h>
-
-// not using kmer_type from Kmer.h because I don't want this class to depend on Kmer.h
-#ifdef _largeint
-#include "LargeInt.h"
-typedef LargeInt<KMER_PRECISION> bloom_elem;
-#else
-#ifdef _ttmath
-#include "ttmath/ttmath.h"
-typedef ttmath::UInt<KMER_PRECISION> bloom_elem;
-#else
-#if (! defined kmer_type) || (! defined _LP64)
-typedef uint64_t bloom_elem;
-#else
-typedef kmer_type bloom_elem;
-#endif
-#endif
-#endif
-
-
-
-#define NSEEDSBLOOM 10
-#define CUSTOMSIZE 1
-
-
-static const int bits_per_char = 0x08; // 8 bits in 1 char(unsigned)
-static const unsigned char bit_mask[bits_per_char] = {
- 0x01, //00000001
- 0x02, //00000010
- 0x04, //00000100
- 0x08, //00001000
- 0x10, //00010000
- 0x20, //00100000
- 0x40, //01000000
- 0x80 //10000000
-};
-
-
-static const int cpt_per_char = 2;
-static const unsigned char cpt_mask[cpt_per_char] = {
- 0x0F, //00001111
- 0xF0, //11110000
-};
-
-static const uint64_t cpt_mask21[21] = {
- 0x0000000000000007ULL,//00000....00000111
- 0x0000000000000038ULL,
- 0x00000000000001C0ULL,
- 0x0000000000000E00ULL,
- 0x0000000000007000ULL,
- 0x0000000000038000ULL,
- 0x00000000001C0000ULL,
- 0x0000000000E00000ULL,
- 0x0000000007000000ULL,
- 0x0000000038000000ULL,
- 0x00000001C0000000ULL,
- 0x0000000E00000000ULL,
- 0x0000007000000000ULL,
- 0x0000038000000000ULL,
- 0x00001C0000000000ULL,
- 0x0000E00000000000ULL,
- 0x0007000000000000ULL,
- 0x0038000000000000ULL,
- 0x01C0000000000000ULL,
- 0x0E00000000000000ULL,
- 0x7000000000000000ULL
-
-};
-
-
-static const uint64_t cpt_mask32[32] = {
- 0x0000000000000003ULL,//00000....00000011
- 0x000000000000000CULL,
- 0x0000000000000030ULL,//00000....000110000
- 0x00000000000000C0ULL,
- 0x0000000000000300ULL,
- 0x0000000000000C00ULL,
- 0x0000000000003000ULL,
- 0x000000000000C000ULL,
- 0x0000000000030000ULL,
- 0x00000000000C0000ULL,
- 0x0000000000300000ULL,
- 0x0000000000C00000ULL,
- 0x0000000003000000ULL,
- 0x000000000C000000ULL,
- 0x0000000030000000ULL,
- 0x00000000C0000000ULL,
- 0x0000000300000000ULL,
- 0x0000000C00000000ULL,
- 0x0000003000000000ULL,
- 0x000000C000000000ULL,
- 0x0000030000000000ULL,
- 0x00000C0000000000ULL,
- 0x0000300000000000ULL,
- 0x0000C00000000000ULL,
- 0x0003000000000000ULL,
- 0x000C000000000000ULL,
- 0x0030000000000000ULL,
- 0x00C0000000000000ULL,
- 0x0300000000000000ULL,
- 0x0C00000000000000ULL,
- 0x3000000000000000ULL,
- 0xC000000000000000ULL
-};
-
-
-
-/* static const unsigned char incr_cpt_table[2][255] =
- {
- {1, 2,3},
- {3, 4,3},
- };
- */
-
-static const uint64_t rbase[NSEEDSBLOOM] =
-{
- 0xAAAAAAAA55555555ULL,
- 0x33333333CCCCCCCCULL,
- 0x6666666699999999ULL,
- 0xB5B5B5B54B4B4B4BULL,
- 0xAA55AA5555335533ULL,
- 0x33CC33CCCC66CC66ULL,
- 0x6699669999B599B5ULL,
- 0xB54BB54B4BAA4BAAULL,
- 0xAA33AA3355CC55CCULL,
- 0x33663366CC99CC99ULL
-};
-
-
-/*
-
- 0x2E7E5A8996F99AA5,
- 0x74B2E1FB222EFD24,
- 0x8BBE030F6704DC29,
- 0x6D8FD7E91C11A014,
- 0xFC77642FF9C4CE8C,
- 0x318FA6E7C040D23D,
- 0xF874B1720CF914D5,
- 0xC569F575CDB2A091,
- */
-
-//static uint64_t pri1=0x5AF3107A401FULL;
-//static uint64_t pri2 =0x78C27CE77ULL;
-
-class Bloom{
-
-protected:
-
-#ifdef _largeint
- inline uint64_t hash_func(LargeInt<KMER_PRECISION> elem, int num_hash);
-#endif
-#ifdef _ttmath
- inline uint64_t hash_func(ttmath::UInt<KMER_PRECISION> elem, int num_hash);
-#endif
-#ifdef _LP64
- inline uint64_t hash_func(__uint128_t key, int num_hash);
-#endif
- inline uint64_t hash_func(uint64_t key, int num_hash);
-
- inline void generate_hash_seed();
-
- uint64_t user_seed;
- uint64_t seed_tab[NSEEDSBLOOM];
- int n_hash_func;
- uint64_t nchar;
-public:
- unsigned char * blooma;
-
- void setSeed(uint64_t seed) ;
- void set_number_of_hash_func(int i) ;
-
- void add(bloom_elem elem);
- int contains(bloom_elem elem);
-
- uint64_t tai;
- uint64_t nb_elem;
-
- void dump(char * filename);
- void load(char * filename);
-
- long weight();
-
- Bloom(int tai_bloom);
- Bloom(uint64_t tai_bloom);
-
- Bloom();
-
-
- ~Bloom();
-
-};
-
-
-
-class BloomCpt: public Bloom {
- public :
- BloomCpt(int tai_bloom);
- BloomCpt();
-
- void add(bloom_elem elem);
-
- int contains_n_occ(bloom_elem elem, int nks);
-
-
-};
-
-
-class BloomCpt3: public BloomCpt {
- public :
- BloomCpt3(int tai_bloom);
- ~BloomCpt3();
-
- uint64_t * blooma3;
- void add(bloom_elem elem);
-
- int contains_n_occ(bloom_elem elem, int nks);
-
-};
-
-
-
-class BloomCpt2: public BloomCpt {
- public :
- BloomCpt2(int tai_bloom);
- ~BloomCpt2();
-
- uint64_t * blooma2;
- void add(bloom_elem elem);
-
- int contains_n_occ(bloom_elem elem, int nks);
-
-};
-
-
-
-
-#endif
-
diff --git a/CMakeLists.txt b/CMakeLists.txt
new file mode 100644
index 0000000..2216c55
--- /dev/null
+++ b/CMakeLists.txt
@@ -0,0 +1,119 @@
+project(minia)
+
+cmake_minimum_required (VERSION 2.6)
+
+################################################################################
+# The version number.
+################################################################################
+# The default version number is the latest official build
+SET (gatb-tool_VERSION_MAJOR 2)
+SET (gatb-tool_VERSION_MINOR 0)
+SET (gatb-tool_VERSION_PATCH 7)
+
+# But, it is possible to define another release number during a local build
+IF (DEFINED MAJOR)
+ SET (gatb-tool_VERSION_MAJOR ${MAJOR})
+ENDIF()
+IF (DEFINED MINOR)
+ SET (gatb-tool_VERSION_MINOR ${MINOR})
+ENDIF()
+IF (DEFINED PATCH)
+ SET (gatb-tool_VERSION_PATCH ${PATCH})
+ENDIF()
+
+set (gatb-tool-version ${gatb-tool_VERSION_MAJOR}.${gatb-tool_VERSION_MINOR}.${gatb-tool_VERSION_PATCH})
+
+# However, continuous integration has priority over local compilation
+IF (DEFINED JENKINS_TAG)
+ SET (gatb-tool-version ${JENKINS_TAG})
+ENDIF()
+
+################################################################################
+# Define cmake modules directory
+################################################################################
+SET (GATB_CORE_HOME ${PROJECT_SOURCE_DIR}/thirdparty/gatb-core/gatb-core)
+SET (CMAKE_MODULE_PATH ${GATB_CORE_HOME}/cmake)
+
+################################################################################
+# SUPPORTED KMER SIZES
+################################################################################
+
+# One can uncomment this line and set the wanted values
+#set (KSIZE_LIST "32 64 96 128 160 192 224 256")
+
+################################################################################
+# THIRD PARTIES
+################################################################################
+
+# We don't want to install some GATB-CORE artifacts
+SET (GATB_CORE_EXCLUDE_TOOLS 1)
+SET (GATB_CORE_EXCLUDE_TESTS 1)
+SET (GATB_CORE_EXCLUDE_EXAMPLES 1)
+
+# GATB CORE
+include (GatbCore)
+
+################################################################################
+# TOOL
+################################################################################
+
+# We add the compilation options for the library
+add_definitions (${gatb-core-flags})
+
+# We add the gatb-core include directory
+include_directories (${gatb-core-includes})
+
+# We add the path for extra libraries
+link_directories (${gatb-core-extra-libraries-path})
+
+set (PROGRAM_SOURCE_DIR ${PROJECT_SOURCE_DIR}/src)
+set(CMAKE_RUNTIME_OUTPUT_DIRECTORY ${CMAKE_BINARY_DIR}/bin)
+
+include_directories (${PROGRAM_SOURCE_DIR})
+file (GLOB_RECURSE ProjectFiles ${PROGRAM_SOURCE_DIR}/*)
+add_executable(${PROJECT_NAME} ${ProjectFiles})
+target_link_libraries(${PROJECT_NAME} ${gatb-core-libraries})
+
+################################################################################
+# DOC
+################################################################################
+set (SKIP_DOC 1)
+if (NOT DEFINED SKIP_DOC)
+ add_subdirectory (doc)
+endif()
+
+################################################################################
+# PACKAGING
+################################################################################
+# We set the version number
+SET (CPACK_PACKAGE_DESCRIPTION_SUMMARY "gatb-tool ${PROJECT_NAME}")
+SET (CPACK_PACKAGE_VENDOR "Genscale team (INRIA)")
+SET (CPACK_PACKAGE_VERSION_MAJOR "${gatb-tool_VERSION_MAJOR}")
+SET (CPACK_PACKAGE_VERSION_MINOR "${gatb-tool_VERSION_MINOR}")
+SET (CPACK_PACKAGE_VERSION_PATCH "${gatb-tool_VERSION_PATCH}")
+SET (CPACK_PACKAGE_VERSION "${gatb-tool-version}")
+
+# We set the kind of archive
+SET (CPACK_GENERATOR "TGZ")
+SET (CPACK_SOURCE_GENERATOR "TGZ")
+
+# We ignore unwanted files for the source archive
+SET (CPACK_SOURCE_IGNORE_FILES
+ "^${PROJECT_SOURCE_DIR}/\\.git/" ;
+ "^${PROJECT_SOURCE_DIR}/\\.gitmodules" ;
+ "^${PROJECT_SOURCE_DIR}/\\.gitignore" ;
+ "^${PROJECT_SOURCE_DIR}/build/" ;
+ "^${GATB_CORE_HOME}/\\.cproject" ;
+ "^${GATB_CORE_HOME}/\\.git/" ;
+ "^${GATB_CORE_HOME}/\\.project" ;
+ "^${GATB_CORE_HOME}/\\.gitignore"
+)
+
+# We copy the project binary to the 'bin' directory
+INSTALL (TARGETS ${PROJECT_NAME} DESTINATION bin)
+INSTALL (FILES LICENSE README.md DESTINATION bin/..)
+
+# We include the "bin" tag into binary archive file name
+set (CPACK_PACKAGE_FILE_NAME ${PROJECT_NAME}-${CPACK_PACKAGE_VERSION}-bin-${CMAKE_SYSTEM_NAME})
+
+include (CPack)
diff --git a/Debloom.cpp b/Debloom.cpp
deleted file mode 100644
index 5389b6e..0000000
--- a/Debloom.cpp
+++ /dev/null
@@ -1,466 +0,0 @@
-#include "Debloom.h"
-
-// GUS: the false positive set can be either FPSet or FPSetCascading4,
-// both inheriting from Set. The choice is made by the function called
-// to load the false positives: load_false_positives() or
-// load_false_positives_cascading4().
-Set *false_positives;
-
-
-FILE * F_debloom_read;
-FILE * F_debloom_write;
-uint64_t n_false_positives=0;
-
-Hash16 * hasht1;
-
-void end_debloom_partition(bool last_partition)
-{
-
- int value;
- char false_positive_kmer_char[sizeKmer+1];
- FILE *file_false_positive_kmers =NULL;
- kmer_type graine;
-
- /////////////////////////begin write files
- rewind (F_debloom_read);
- rewind (F_debloom_write);
-
- #ifndef MINGW
- ftruncate(fileno(F_debloom_write), 0); //erase previous file
- #else // tempfix? fileno is not accepted by mingw
- fclose(F_debloom_write);
- F_debloom_write = fopen(return_file_name("debloom2"),"wb+");
- #endif
-
- if (last_partition)
- {
- // write false positive kmers to fasta file
- file_false_positive_kmers = fopen(return_file_name(false_positive_kmers_file),"wb");
- }
-
- n_false_positives = 0;
- while(fread(&graine, sizeof(graine),1, F_debloom_read)){
-
- if(hasht1->get(graine,&value)==0) //kmer not present == kmer not solid
- {
- n_false_positives ++;
-
- if (!fwrite(&graine, sizeof(graine), 1, F_debloom_write))
- {
- printf("error: can't fwrite (disk full?)\n");
- exit(1);
- }
-
-
- if (last_partition)
- {
- code2seq(graine,false_positive_kmer_char);
- fprintf(file_false_positive_kmers,">fp\n");
- fputs(false_positive_kmer_char,file_false_positive_kmers);
- fprintf(file_false_positive_kmers,"\n");
- }
- }
- //else kmer is a true positive, do nothing
-
- }
-
- if (last_partition)
- fclose(file_false_positive_kmers);
-}
-
-int debloom(int order, int max_memory)
-{
- // read bloo1 from disk dump
- Bloom *bloo1 = bloom_create_bloo1((BloomCpt *)NULL);
-
- STARTWALL(pos);
-
- FILE * debloom_file = fopen(return_file_name("debloom"),"wb+");
- FILE * debloom_file_2 = fopen(return_file_name("debloom2"),"wb+");
- FILE * F_tmp;
-
- F_debloom_read = debloom_file;
- F_debloom_write = debloom_file_2;
-
- BinaryBank *SolidKmers = new BinaryBank(return_file_name(solid_kmers_file),sizeof(kmer_type),0);
-
- uint64_t cc=0;
- kmer_type new_graine, kmer;
- int nt;
-
- uint64_t NbSolidKmer =0;
- // write all positive extensions in disk file
- while (SolidKmers->read_element(&kmer))
- {
-
- //8 right extensions (4F and 4R); left extensions are redundant by revcomplementation
- for(nt=0; nt<4; nt++)
- {
- int strand;
- for (strand = 0; strand < 2 ; strand++)
- {
- int current_strand = strand;
- new_graine = next_kmer(kmer,nt, ¤t_strand);
-
- if(bloo1->contains(new_graine)){ // extension is positive
-
- // maybe do more lax deblooming; if it's a dead-end, it's no big deal, don't pass it to the false positive test
- // what would have been needed if i decided to enable order>0 (but actually this won't happen):
- // - better estimate of structure size in the presence of order>0 deblooming
- if (order == 1) // this case just detects tips
- {
- bool is_linked = false;
- for(int tip_nt=0; tip_nt<4; tip_nt++)
- {
- int new_strand = current_strand;
- kmer_type kmer_after_possible_tip = next_kmer(new_graine,tip_nt, &new_strand);
- if(bloo1->contains(kmer_after_possible_tip))
- {
- is_linked = true;
- break;
- }
- }
- if (!is_linked)
- continue; // it's a tip, because it's linked to nothing
- }
-
- if (order > 1) // general case. should work for order = 1, but i coded an optimized version above
- {
- Frontline frontline( new_graine, current_strand, bloo1, NULL, NULL, NULL);
- while (frontline.depth < order)
- {
- frontline.go_next_depth();
- if (frontline.size() == 0)
- break;
- // don't allow a breadth too large anywqy
- if (frontline.size()> 10)
- break;
- }
- if (frontline.size() == 0)
- continue; // it's a deadend
- }
-
- if (!fwrite(&new_graine, sizeof(new_graine), 1, debloom_file))
- {
- printf("error: can't fwrite (disk full?)\n");
- exit(1);
- }
- cc++;
- }
-
- }
- }
- NbSolidKmer++;
- if ((NbSolidKmer%10000)==0) fprintf (stderr,"%c Writing positive Bloom Kmers %lld",13,NbSolidKmer);
- }
- nbkmers_solid = NbSolidKmer; // GUS: it's global now
-
- fprintf(stderr,"\n%lli kmers written\n",cc);
-
- STOPWALL(pos,"Write all positive kmers");
-
- STARTWALL(deb);
-
- double bl1tai = (double)bloo1->tai ;
- delete bloo1;
-
- // now that bloo1 is deleted, initialize hasht1
- int NBITS_HT = max( (int)ceilf(log2f((0.1*max_memory*1024L*1024L)/sizeof(cell_ptr_t))), 1); // set hasht1 cells to occupy 0.1 * [as much mem as poss]
- hasht1 =new Hash16(NBITS_HT);
-
- //////////////////////////////////////////////////////////////// --find false positive, with hash table partitioning
- uint64_t max_kmer_per_part = (uint64_t) (0.8*max_memory*1024LL*1024LL /sizeof(cell<kmer_type>));
- //adapter taille ht en fonction
-
-
- printf("%d partitions will be needed\n",(int)(nbkmers_solid/max_kmer_per_part));
-
- NbSolidKmer =0;
- int numpart = 0;
- SolidKmers->rewind_all();
-
- // deblooming:
- // read the list of (non-redundant) solid kmers and load it, in chunks, into a hash table
- // at each pass, check all the positive extensions and keep those which are not indicated, by the current chunk, as solid kmers
- // at the end, only the positive extensions which are not solid are kept
- while (SolidKmers->read_element(&kmer))
- {
- hasht1->add(kmer);
-
- NbSolidKmer++;
- if ((NbSolidKmer%10000)==0) fprintf (stderr,"%cBuild Hash table %lld",13,NbSolidKmer);
-
- if(hasht1->nb_elem >max_kmer_per_part) //end partition, find false positives
- {
- fprintf(stderr,"End of debloom partition %lli / %lld \n",hasht1->nb_elem,max_kmer_per_part);
-
- end_debloom_partition(false);
-
- //swap file pointers
- F_tmp = F_debloom_read;
- F_debloom_read = F_debloom_write;
- F_debloom_write = F_tmp;
- /////////end write files
-
- //reset hash table
- hasht1->empty_all();
-
- fprintf(stderr,"\n%lli false positives written , partition %i \n",n_false_positives,numpart);
-
- numpart++;
- } ///end partition
-
-
- }
- //fprintf(stderr,"Nb kmers stored in the bloom table %lld\n",nbkmers_solid);
-
-
- ///////////////////////// last partition, will write all the FP's to the good file
-
- end_debloom_partition(true);
-
- /////////end write files
-
-
- fprintf(stderr,"Total nb false positives stored in the Debloom hashtable %lli \n",n_false_positives);
-
- delete hasht1;
-
-
- STOPWALL(deb,"Debloom");
-
- // GUS: will use to output summary later
- b1_size = (uint64_t) bl1tai;
-
- fclose(debloom_file);
- fclose(debloom_file_2);
- SolidKmers->close();
-
-
- return 1;
-
-}
-
-uint64_t countFP(Bank *FalsePositives)
-{
- char * rseq;
- int readlen;
- uint64_t nbFP = 0;
-
- while (FalsePositives->get_next_seq(&rseq,&readlen))
- nbFP++;
-
- FalsePositives->rewind_all();
- return nbFP;
-}
-
-Set *load_false_positives()
-{
- int64_t NbInsertedKmers = 0;
- char * rseq;
- int readlen;
- kmer_type kmer, graine, graine_revcomp;
-
- Bank *FalsePositives = new Bank(return_file_name(false_positive_kmers_file));
-
- // alloc false positives with the just the right estimated size
-
- uint64_t nbFP = countFP(FalsePositives);
-
- FPSet *fp = new FPSet(nbFP);
-
- while (FalsePositives->get_next_seq(&rseq,&readlen))
- {
- kmer = extractKmerFromRead(rseq,0,&graine,&graine_revcomp);
-
- fp->insert(kmer);
-
- NbInsertedKmers++;
-
- if ((NbInsertedKmers%10000)==0) fprintf (stderr,(char*)"%cInsert false positive Kmers in hash table %lld",13,NbInsertedKmers);
- }
- fp->finalize(); // always call this when finishing to create a FPSet
-
- fprintf (stderr,"\nInserted %lld false positive kmers in the hash structure.\n\n",NbInsertedKmers);
-
-// print_size_summary(fp);
-
- return fp;
-}
-
-
-Set *dummy_false_positives()
-{
- FPSet *fp = new FPSet((uint64_t)1);
- return fp;
-}
-
-Set *load_false_positives_cascading4()
-{
- int64_t NbInsertedKmers;
- char * rseq;
- int readlen;
- kmer_type kmer, graine, graine_revcomp;
-
-
- // **** Initialize B2, B3, B4 and T4 ****
- Bank *FalsePositives = new Bank(return_file_name(false_positive_kmers_file));
- uint64_t nbFP = countFP(FalsePositives);
-
- FPSetCascading4 *fp = new FPSetCascading4;
-
- fp->bloom2 = new Bloom((uint64_t)(nbFP * NBITS_PER_KMER));
- fp->bloom2->set_number_of_hash_func((int)floorf(0.7*NBITS_PER_KMER));
-
- uint64_t estimated_T2_size = max((int)ceilf(nbkmers_solid * (double)powf((double)0.62, (double)NBITS_PER_KMER)), 1);
- uint64_t estimated_T3_size = max((int)ceilf(nbFP * (double)powf((double)0.62, (double)NBITS_PER_KMER)) ,1);
-
- fp->bloom3 = new Bloom((uint64_t)(estimated_T2_size * NBITS_PER_KMER));
- fp->bloom3->set_number_of_hash_func((int)floorf(0.7*NBITS_PER_KMER));
-
- fp->bloom4 = new Bloom((uint64_t)(estimated_T3_size * NBITS_PER_KMER));
- fp->bloom4->set_number_of_hash_func((int)floorf(0.7*NBITS_PER_KMER));
-
-
- // **** Insert the false positives in B2 ****
- NbInsertedKmers = 0;
- while (FalsePositives->get_next_seq(&rseq,&readlen))
- {
- kmer = extractKmerFromRead(rseq,0,&graine,&graine_revcomp);
-
- fp->bloom2->add(kmer);
-
- NbInsertedKmers++;
- // if ((NbInsertedKmers%10000)==0)
- // fprintf (stderr,"%cInsert false positive B2 %lld",13,NbInsertedKmers);
- }
- //fprintf (stderr,"%cInsert false positive B2 %lld", 13,NbInsertedKmers);
- FalsePositives->close();
-
- DEBUGE(("\nInserted %lld (estimated, %lld) kmers in B2.\n", NbInsertedKmers, nbFP));
-
-
- // **** Insert false positives in B3 and write T2
- int addKmers = 0;
- NbInsertedKmers = 0;
- FILE *T2_file = fopen(return_file_name("t2_kmers"), "w+"); // We will read this file later, when filling T4
- BinaryBank *SolidKmers = new BinaryBank(return_file_name(solid_kmers_file),sizeof(kmer),0);
- while(SolidKmers->read_element(&kmer))
- {
- if (fp->bloom2->contains(kmer))
- {
- if (!fwrite(&kmer, sizeof(kmer), 1, T2_file))
- {
- printf("error: can't fwrite (disk full?)\n");
- exit(1);
- }
-
- fp->bloom3->add(kmer);
- addKmers++;
- }
-
- NbInsertedKmers++;
- //if ((NbInsertedKmers%10000)==0)
- //fprintf (stderr,(char*)"%cInsert false positive B3 %lld",13,NbInsertedKmers);
- }
- // fprintf (stderr,(char*)"%cInsert false positive B3 %lld",13,NbInsertedKmers);
- SolidKmers->close();
-
- DEBUGE(("\nInserted %d (estimated, %llu) kmers in B3.\n", addKmers, estimated_T2_size));
-
-
- // **** Insert false positives in B4 (we could write T3, but it's not necessary)
- FalsePositives = new Bank(return_file_name(false_positive_kmers_file));
- NbInsertedKmers = 0;
- addKmers = 0;
- while (FalsePositives->get_next_seq(&rseq,&readlen))
- {
- kmer = extractKmerFromRead(rseq,0,&graine,&graine_revcomp);
-
- if (fp->bloom3->contains(kmer))
- {
- fp->bloom4->add(kmer);
- addKmers++;
- }
-
- NbInsertedKmers++;
- //if ((NbInsertedKmers%10000)==0)
- //fprintf (stderr,"%cInsert false positive B4 %lld",13,NbInsertedKmers);
- }
- //fprintf (stderr,"%cInsert false positive B4 %lld", 13,NbInsertedKmers);
- FalsePositives->close();
-
- DEBUGE(("\nInserted %d (estimated, %lld) kmers in B4.\n", addKmers, estimated_T3_size));
-
-
- // **** Count and insert false positives in T4
- rewind(T2_file);
- addKmers = 0;
- while (fread(&kmer, sizeof(kmer), 1, T2_file))
- if (fp->bloom4->contains(kmer))
- addKmers++;
-
- fp->false_positives = new FPSet(addKmers);
- rewind(T2_file);
- addKmers = 0;
- NbInsertedKmers = 0;
- while (fread(&kmer, sizeof(kmer), 1, T2_file))
- {
- if (fp->bloom4->contains(kmer))
- {
- fp->false_positives->insert(kmer);
- addKmers++;
- }
-
- NbInsertedKmers++;
- // if ((NbInsertedKmers%10000)==0)
- // fprintf (stderr,"%cInsert false positive T4 %lld",13,NbInsertedKmers);
- }
- fp->false_positives->finalize();
- // fprintf (stderr,"%cInsert false positive T4 %lld", 13,NbInsertedKmers);
- fclose(T2_file);
-
- DEBUGE(("\nInserted %d (estimated, %lld) kmers in T4.\n\n", addKmers, (uint64_t)fp->false_positives->capacity()));
-
-// print_size_summary(fp);
-
- return fp;
-}
-
-double toMB(double value)
-{
- return value / 8LL/1024LL/1024LL;
-}
-
-void print_size_summary(FPSet *fp)
-{
- int bits_per_FP_element = FPSet::bits_per_element;
-
- uint64_t size_B1 = b1_size,
- size_T1 = fp->capacity() * FPSet::bits_per_element;
- double total_size = (double)(size_B1 + size_T1);
-
- fprintf(stderr,"Size of the Bloom table : %.2lf MB\n", toMB(size_B1) );
- fprintf(stderr," %.2lf bits / solid kmer\n", b1_size/(double)(nbkmers_solid) );
- fprintf(stderr, "Size of the FP table : %lli FP x %d bits = %.2lf MB \n", fp->capacity(), bits_per_FP_element, toMB((double)(size_T1)) );
- fprintf(stderr," actual implementation : %.2lf bits / solid kmer\n", size_T1/(double)nbkmers_solid);
- fprintf(stderr," assuming list of kmers, i.e. sizeof(kmer_type) bits / FP : %.2lf bits / solid kmer \n\n",(fp->capacity()*sizeof(kmer_type)*8LL)/(double)(nbkmers_solid));
- fprintf(stderr," Total %.2lf MB for %lld solid kmers ==> %.2lf bits / solid kmer\n\n", toMB(total_size), nbkmers_solid, total_size / nbkmers_solid);
-}
-
-void print_size_summary(FPSetCascading4 *fp)
-{
- uint64_t size_B1 = b1_size,
- size_B2 = fp->bloom2->tai,
- size_B3 = fp->bloom3->tai,
- size_B4 = fp->bloom4->tai,
- size_T4 = fp->false_positives->capacity() * FPSet::bits_per_element;
- double total_size = (double)(size_B1 + size_B2 + size_B3 + size_B4 + size_T4);
-
- DEBUGE((stderr,"Size of the Bloom table (B1) : %.2lf MB\n", toMB((double)size_B1)));
- DEBUGE((stderr,"Size of the Bloom table (B2) : %.2lf MB\n", toMB((double)size_B2)));
- DEBUGE((stderr,"Size of the Bloom table (B3) : %.2lf MB\n", toMB((double)size_B3)));
- DEBUGE((stderr,"Size of the Bloom table (B4) : %.2lf MB\n", toMB((double)size_B4)));
- DEBUGE((stderr,"Size of the FP table (T4) : %.2lf MB\n", toMB((double)size_T4)));
- fprintf(stderr," Total %.2lf MB for %lld solid kmers ==> %.2lf bits / solid kmer\n\n", toMB(total_size), nbkmers_solid, total_size / nbkmers_solid);
-}
diff --git a/Debloom.h b/Debloom.h
deleted file mode 100644
index 1564a50..0000000
--- a/Debloom.h
+++ /dev/null
@@ -1,45 +0,0 @@
-#include <stdio.h>
-#include <stdlib.h>
-#include <time.h>
-#include <sys/time.h>
-#include <string.h>
-#include <inttypes.h>
-#include <cmath> // for log2f
-#include <algorithm> // for max
-#include <unistd.h> // for truncate
-
-#ifndef DEBLOOM_H
-#define DEBLOOM_H
-
-#include "Bank.h"
-#include "Bloom.h"
-#include "Kmer.h"
-#include "Hash16.h"
-#include "Utils.h"
-#include "Traversal.h"
-
-#define DEBUGE(a) //printf a
-
-using namespace std;
-
-extern uint64_t b1_size ;
-extern uint64_t nbkmers_solid ;
-
-
-typedef ListSet FPSet; // list-based
-//typedef HashSet FPSet; // hash-based
-
-// GUS: see comment in Debloom.cpp, where false_positive is been declared
-extern Set *false_positives;
-
-int debloom(int order, int max_memory);
-void end_debloom_partition(bool last_partition);
-
-Set *dummy_false_positives();
-Set *load_false_positives();
-Set *load_false_positives_cascading4();
-
-void print_size_summary(FPSet *fp);
-void print_size_summary(FPSetCascading4 *fp);
-
-#endif
diff --git a/GraphOutput.cpp b/GraphOutput.cpp
deleted file mode 100644
index d32f1a2..0000000
--- a/GraphOutput.cpp
+++ /dev/null
@@ -1,380 +0,0 @@
-#include "GraphOutput.h"
-const string GraphOutput::graph_file_suffix = ".graph";
-const string GraphOutput::nodes_file_suffix = ".nodes";
-const string GraphOutput::edges_file_suffix = ".edges";
-const string GraphOutput::xml_file_suffix = ".xgmml";
-const string GraphOutput::json_nodes_file_suffix = ".json_nodes";
-const string GraphOutput::json_edges_file_suffix = ".json_edges";
-const string GraphOutput::json_file_suffix = ".json";
-
-/************************************************************************************************************************/
-/* init function initialize the files need to construct graph file or sequences file */
-/* */
-/************************************************************************************************************************/
-void GraphOutput::init(bool erase){
- //printf("create a graph erase=%s graph_format=%d first_id_nodes=%d first_id_edges=%d\n"", erase?"true":"false", graph_format, first_id_els.node, first_id_els.edge);
- graph_file_name=(prefix+graph_file_suffix);
- nodes_file_name=(prefix+nodes_file_suffix);
- edges_file_name=(prefix+edges_file_suffix);
- xml_file_name=(prefix+xml_file_suffix);
- json_nodes_file_name=(prefix+json_nodes_file_suffix);
- json_edges_file_name=(prefix+json_edges_file_suffix);
- json_file_name=(prefix+json_file_suffix);
-
- switch (graph_format){
- case 0:// FORMAT .GRAPH
- graph_file = fopen(graph_file_name.c_str(),erase?"w":"a");
- fprintf(graph_file,"digraph dedebruijn {\n");
- break;
-
- case 1: // FORMAT .NODES AND .EDGES
- nodes_file = fopen(nodes_file_name.c_str(),erase?"w":"a");
- edges_file = fopen(edges_file_name.c_str(),erase?"w":"a");
- break;
-
- case 2 :// FORMAT .XGMML
- graph_file = fopen(xml_file_name.c_str(),erase?"w":"a");
- //fprintf(graph_file,"<?xml version=\"1.0\"?>\n<!DOCTYPE graph SYSTEM \"http://www.cs.rpi.edu/~puninj/XGMML/xgmml.dtd\">\n<graph directed=\"1\">\n");
- fprintf(graph_file,"<graph label=\"%s\"\n", (char *)prefix.c_str());
- fprintf(graph_file,"xmlns:dc=\"http://purl.org/dc/elements/1.1/\" \n");
- fprintf(graph_file,"xmlns:xlink=\"http://www.w3.org/1999/xlink\" \n");
- fprintf(graph_file,"xmlns:rdf=\"http://www.w3.org/1999/02/22-rdf-syntax-ns#\" \n");
- fprintf(graph_file,"xmlns:cy=\"http://www.cytoscape.org\" \n");
- fprintf(graph_file,"xmlns=\"http://www.cs.rpi.edu/XGMML\" \n");
- fprintf(graph_file,"directed=\"1\">\n");
- break;
-
- case 3: // FORMAT .json
- nodes_file = fopen(json_nodes_file_name.c_str(),erase?"w":"a");
- edges_file = fopen(json_edges_file_name.c_str(),erase?"w":"a");
- graph_file = fopen(json_file_name.c_str(),erase?"w":"a");
- break;
- }
-}
-
-/************************************************************************************************************************/
-/* printf GraphOutput and initialize files (files are not erasing) */
-/* */
-/************************************************************************************************************************/
-GraphOutput::GraphOutput(string prefix, int graph_format, id_els first_id_els) : prefix(prefix), graph_format(graph_format), first_id_els(first_id_els)
-{ // PIERRE: need something different than 0 for the first node
- printf("graph_format=%d first_id_nodes=%d first_id_edges=%d\n", graph_format, first_id_els.node, first_id_els.edge);
- init(true);
-}
-
-/************************************************************************************************************************/
-/* Initialize first elements and files (files are erasing) */
-/* */
-/************************************************************************************************************************/
-GraphOutput::GraphOutput(string prefix, int graph_format) : prefix(prefix), graph_format(graph_format)
-{
- first_id_els.node=0;
- first_id_els.edge=0;
- printf("graph_format=%d first_id_nodes=%d first_id_edges=%d\n", graph_format, first_id_els.node, first_id_els.edge);
- init(true);
-}
-
-/************************************************************************************************************************/
-/* write graph file or sequence file */
-/* */
-/************************************************************************************************************************/
-void GraphOutput::close()
-{
- switch (graph_format){
-
- case 0:
- fprintf(graph_file,"}\n");
- fclose(graph_file);
- break;
-
- case 1:
- fclose(nodes_file);
- fclose(edges_file);
- break;
-
- case 2:
- fprintf(graph_file,"</graph>\n");
- fclose(graph_file);
- break;
-
- case 3:
-
- // We need to store all nodes and then all edges in the final .json file
- fclose(nodes_file);
- fclose(edges_file);
- ifstream nodes(json_nodes_file_name.c_str(), ios::in);
- ifstream edges(json_edges_file_name.c_str(), ios::in);
-
- if(!edges || !nodes){fprintf(stderr,"Cannot open file %s, %s or %s, exit\n", json_edges_file_suffix.c_str(), json_nodes_file_suffix.c_str()); exit(1);}
-
- string line;
-
- fprintf(graph_file,"{\n \"Starter\":[\n{");
- fprintf(graph_file,"\n \"nodes\": [\n");
- getline(nodes,line);
- fprintf(graph_file,"%s",line.c_str()); // prints the first node without comma before
- //for each node
- while(getline(nodes,line)){
- fprintf(graph_file,",\n%s",line.c_str()); // prints the other nodes
- };
- fprintf(graph_file,"\n],\n");
- fprintf(graph_file,"\"edges\": [\n");
- getline(edges,line);
- fprintf(graph_file,"%s",line.c_str()); // prints the first edge without comma before
- //for each edge
- while(getline(edges,line)) {
- fprintf(graph_file,",\n%s",line.c_str()); // prints the others edges
- };
-
- //end of graph file en close file
- fprintf(graph_file,"\n]\n}\n");
- nodes.close(); remove(json_nodes_file_name.c_str());
- edges.close(); remove(json_edges_file_name.c_str());
- fclose(graph_file);
- }
-}
-
-
-/************************************************************************************************************************/
-/* recalculate length for a node (more efficient than capture length in string and convert the in integer) */
-/* */
-/************************************************************************************************************************/
-long GraphOutput::sequence_length(string line)
-{
- string seq_char;
- int err,match,start, end;
- regex_t preg;
- long seq_len=0;
- size_t nmatch, size;
- const char *str_regex ="([A-Z]+)"; //regex capture sequences characters
- const char *line_c =NULL;
-
- line_c = line.c_str();
- err = regcomp (&preg, str_regex, REG_EXTENDED);
-
- if (err == 0)//security for error string snapshot and if regex match
- {
- nmatch = 0;
- nmatch = preg.re_nsub;
- regmatch_t *pmatch=NULL;
- pmatch = (regmatch_t*) malloc (sizeof (*pmatch) * nmatch);
- if (pmatch)
- {
- match = regexec (&preg, line_c, nmatch, pmatch, 0);
- regfree (&preg);
- if (match == 0)
- {
- char *seq_char =NULL;
- start = pmatch[0].rm_so;
- end = pmatch[0].rm_eo;
- size = end - start;
- seq_len = sizeof(line_c[start])*(size);
- }
- }
- }
- else
- {
- fprintf (stderr, "LOW MEMORY !\n");
- exit (EXIT_FAILURE);
- }
-return seq_len;
-}
-
-/************************************************************************************************************************/
-/* output a single node to a file */
-/* */
-/************************************************************************************************************************/
-void GraphOutput::print_node(long index, char *ascii_node) // output a single node to a file
-{
- int len;
- switch (graph_format){
- case 0: // DOT format
- fprintf(graph_file,"%ld [label=\"%s\"];\n",index,ascii_node);
- break;
-
- case 1: // kissplice format
- fprintf(nodes_file,"%ld\t%s\n",index,ascii_node);
- break;
-
- case 2: // XGMML format
- fprintf(graph_file,"<node id=\"%ld\" label=\"%s\">\n</node>\n",index,ascii_node);
- break;
-
- case 3: // json format
- string seq = ascii_node;
- len = seq.size();
- fprintf(nodes_file," { \"data\": { \"id\":\"%ld\", \"length\":%d, \"sequence\":\"%s\"}}\n",index,len,ascii_node);
- break;
- }
-}
-
-
-/************************************************************************************************************************/
-/* output a single edges to a file */
-/* */
-/************************************************************************************************************************/
-void GraphOutput::print_edge(long index, long id, long id2, string label)
-{
- switch (graph_format){
- case 0: // DOT format
- fprintf(graph_file,"%ld -> %ld [label=\"%s\"];\n",id,id2,label.c_str());
- break;
-
- case 1: // kissplice format
- fprintf(edges_file,"%ld\t%ld\t%s\n",id,id2,label.c_str());
- break;
-
- case 2: // XGMML format
- fprintf(graph_file,"<edge source=\"%ld\" target=\"%ld\" label=\"%s\">\n</edge>\n",id,id2,label.c_str());
- break;
-
- case 3: // json format
- fprintf(edges_file,"{ \"data\":{ \"id\": \"%ld\", \"source\": \"%ld\",\"target\": \"%ld\",\"direction\": \"%s\"}}\n",index, id,id2,label.c_str());
- //fprintf(edges_file,"{ \"data\":{ \"source\": %ld,\"target\": %ld,\"direction\": \"%s\"}}\n",id,id2,label.c_str());
- break;
- }
-
-}
-
-/************************************************************************************************************************/
-/* load nodes extremities */
-/* */
-/************************************************************************************************************************/
-void GraphOutput::load_nodes_extremities(string linear_seqs_name)
-{
- kmer_links.clear(); // PIERRE: reset previous stored kmer links
-
- Bank *Nodes = new Bank((char *)linear_seqs_name.c_str());
- long nb_nodes = first_id_els.node; //PIERRE;
- char * rseq;
- int readlen;
-
- sizeKmer--; // nodes extremities overlap by (k-1)-mers, so let's extract (k-1)-mers
-
- while (Nodes->get_next_seq(&rseq,&readlen))
- {
- kmer_type left_kmer, right_kmer, left_kmer_fw, left_kmer_rc, right_kmer_fw, right_kmer_rc;
- left_kmer = extractKmerFromRead(rseq,0,&left_kmer_fw,&left_kmer_rc, false);
- right_kmer = extractKmerFromRead(rseq,readlen-sizeKmer,&right_kmer_fw,&right_kmer_rc, false);
- Strand left_strand = (left_kmer == left_kmer_fw)?FW:RC;
- Strand right_strand = (right_kmer == right_kmer_fw)?FW:RC;
-
- kmer_links[left_kmer].insert(node_strand(nb_nodes, left_strand, LEFT));
- kmer_links[right_kmer].insert(node_strand(nb_nodes, right_strand, RIGHT));
-
- nb_nodes++;
- }
- Nodes->close();
- delete Nodes;
-
- sizeKmer++; // make sure to restore k
-}
-
-
-/************************************************************************************************************************/
-/* construct node file and edge file for graph file */
-/* */
-/************************************************************************************************************************/
- id_els GraphOutput::construct_graph(string linear_seqs_name) // PIERRE: i need to know the last nb_nodes
-{
- Bank *Nodes = new Bank((char *)linear_seqs_name.c_str());
- id_els nb_els = first_id_els; //Alexan: stucture for print id elements in graph output
-
- char * rseq;
- int readlen;
-
- Nodes->rewind_all();
-
- sizeKmer--; // nodes extremities overlap by (k-1)-mers, so let's extract (k-1)-mers
-
- // for each node, output all the out-edges (in-edges will correspond to out-edges of neighbors)
- while (Nodes->get_next_seq(&rseq,&readlen))
- {
-
- kmer_type left_kmer, right_kmer, left_kmer_fw, left_kmer_rc, right_kmer_fw, right_kmer_rc;
- set<node_strand>::iterator it;
-
- left_kmer = extractKmerFromRead(rseq,0,&left_kmer_fw,&left_kmer_rc, false);
- right_kmer = extractKmerFromRead(rseq,readlen-sizeKmer,&right_kmer_fw,&right_kmer_rc, false);
- Strand left_strand = (left_kmer == left_kmer_fw)?FW:RC;
- Strand right_strand = (right_kmer == right_kmer_fw)?FW:RC;
-
-
- // left edges (are revcomp extensions)
- for (it = kmer_links[left_kmer].begin(); it != kmer_links[left_kmer].end(); it++)
- {
- long cur_node = it->node;
- Strand cur_strand = it->strand;
- LeftOrRight cur_left_or_right = it->left_or_right;
-
- if (cur_node ==nb_els.node) // prevent self loops on same kmer
- if (readlen == sizeKmer)
- continue;
-
- string label = "R";
-
- if (cur_left_or_right == LEFT)
- {
- if (cur_strand != left_strand)
- label+=(string)"F";
- else
- continue;
- }
- else
- {
- if (cur_strand == left_strand)
- label+=(string)"R";
- else
- continue;
- }
-
-
- print_edge(nb_els.edge, nb_els.node,cur_node,label);
- nb_els.edge++;
- }
-
- // right edges
- for (it = kmer_links[right_kmer].begin(); it != kmer_links[right_kmer].end(); it++)
- {
- long cur_node = it->node;
- Strand cur_strand = it->strand;
- LeftOrRight cur_left_or_right = it->left_or_right;
-
- if (cur_node == nb_els.node) // prevent self loops on same kmer
- if (readlen == sizeKmer)
- continue;
-
- string label = "F";
-
- if (cur_left_or_right == LEFT)
- {
- if (cur_strand == right_strand)
- label+=(string)"F";
- else
- continue;
- }
- else
- {
- if (cur_strand != right_strand)
- label+=(string)"R";
- else
- continue;
- }
-
- print_edge(nb_els.edge, nb_els.node,cur_node,label);
- nb_els.edge++;
- }
-
- //nodes
- print_node(nb_els.node, rseq);
-
- nb_els.node++;
- }
-
- sizeKmer++; // make sure to restore k
- Nodes->close();
- delete Nodes;
- return nb_els;
-}
-
-
diff --git a/GraphOutput.h b/GraphOutput.h
deleted file mode 100644
index c5fb760..0000000
--- a/GraphOutput.h
+++ /dev/null
@@ -1,204 +0,0 @@
-#if __cplusplus > 199711L
-//#if __clang__
-#include <unordered_map>
-#include <functional>
-#else
-#include <tr1/unordered_map>
-#include <tr1/functional>
-#endif
-
-#include <set>
-#include <stdlib.h> // for exit()
-#include <iostream>
-#include <fstream>
-#include <stdio.h>
-#include <stdlib.h>
-#include <string.h>
-#include <regex.h>
-#include <assert.h>
-
-#include "../minia/Kmer.h"
-#include "../minia/Bank.h"
-
-#ifndef _GRAPHOUTPUT_H
-#define _GRAPHOUTPUT_H
-
-using namespace std;
-
-#if __cplusplus <= 199711L
-//#if ! __clang__
-using namespace tr1;
-#endif
-
-// hash functions for unordered_map with various kmer_type's
-namespace std
-{
-
- //structure for print id nodes and edges in graph output
- struct id_els{
- long node;
- long edge;
- };
-
-#if __cplusplus <= 199711L
-//#if ! __clang__
-namespace tr1
-{
-#endif
-
- #ifdef _LP64
- template <>
- struct hash<__uint128_t> : public unary_function<__uint128_t, size_t>
- {
- size_t operator()(const __uint128_t& elem) const
- {
- hash<uint64_t> hash_func;
- return hash_func((uint64_t)(elem>>64)) ^ hash_func((uint64_t)(elem&((((__uint128_t)1)<<64)-1)));
- }
- };
- #endif
-
- #ifdef _ttmath
- template <>
- struct hash<ttmath::UInt<KMER_PRECISION> > : public unary_function<ttmath::UInt<KMER_PRECISION>, size_t>
- {
- size_t operator()(const ttmath::UInt<KMER_PRECISION>& elem) const
- {
- hash<uint64_t> hash_func;
-
- // hash = XOR_of_series[hash(i-th chunk iof 64 bits)
- uint64_t result = 0, to_hash;
- ttmath::UInt<KMER_PRECISION> intermediate = elem;
- uint32_t mask=~0, chunk;
- int i;
- for (i=0;i<KMER_PRECISION/2;i++)
- {
- // retrieve a 64 bits part to hash
- (intermediate & mask).ToInt(chunk);
- to_hash = chunk;
- intermediate >>= 32;
- (intermediate & mask).ToInt(chunk);
- to_hash |= ((uint64_t)chunk) << 32 ;
- intermediate >>= 32;
-
- result ^= hash_func(to_hash);
- }
- return result;
- }
- };
- #endif
-
- #ifdef _largeint
- template <>
- struct hash<LargeInt<KMER_PRECISION> > : public unary_function<LargeInt<KMER_PRECISION>, size_t>
- {
- size_t operator()(const LargeInt<KMER_PRECISION>& elem) const
- {
- hash<uint64_t> hash_func;
-
- // hash = XOR_of_series[hash(i-th chunk iof 64 bits)
- uint64_t result = 0, to_hash;
- LargeInt<KMER_PRECISION> intermediate = elem;
- uint32_t mask=~0, chunk;
- int i;
- for (i=0;i<KMER_PRECISION/2;i++)
- {
- // retrieve a 64 bits part to hash
- chunk = (intermediate & mask).toInt();
- to_hash = chunk;
- intermediate = intermediate >> 32;
- chunk = (intermediate & mask).toInt();
- to_hash |= ((uint64_t)chunk) << 32 ;
- intermediate = intermediate >> 32;
-
- result ^= hash_func(to_hash,num_hash);
- }
- return result;
- }
- };
- #endif
- #if __cplusplus <= 199711L
- //#if ! __clang__
-}
-#endif
-}
-
-class GraphOutput {
-
-public:
-
- string prefix;
- string graph_file_name;
- string nodes_file_name;
- string edges_file_name;
- string json_starters_file_name;
- string xml_file_name;
- string json_nodes_file_name;
- string json_edges_file_name;
- string json_file_name;
- int graph_format;
- id_els first_id_els;
-
- long edge_id; // the json format needs an id on the nodes.
-
- static const string graph_file_suffix;
- static const string starters_file_suffix;
- static const string nodes_file_suffix;
- static const string edges_file_suffix;
- static const string xml_file_suffix;
- static const string json_starters_file_suffix;
- static const string json_nodes_file_suffix;
- static const string json_edges_file_suffix;
- static const string json_file_suffix;
-
- bool original; // The extended kmer comes originally from the starter (true), or (false) if is it a degenerated kmer (one substitution or one indel).
-
- FILE *graph_file,*nodes_file,*edges_file,*starters_file;
-
- GraphOutput(string prefix, int graph_format);
- GraphOutput(string prefix, int graph_format, id_els first_id_els); //PIERRE
- GraphOutput(string prefix);
- GraphOutput(string prefix, id_els first_id_els); //PIERRE
- void close();
-
- long sequence_length(string line);
- void print_node(long index, char *ascii_node);
- void print_edge(long index, long id, long id2, string label);
- void print_edge(long index, long id, long id2, string label, string comment);
- void print_starter_head(int index, char* sequence);
- void print_starter_end();
-
-
-
- enum LeftOrRight { LEFT=0, RIGHT=1 };
- enum Strand { FW=0, RC=1 };
- struct node_strand {
- long node;
- Strand strand;
- LeftOrRight left_or_right;
- node_strand(long node, Strand strand, LeftOrRight left_or_right) : node(node), strand(strand), left_or_right(left_or_right) {}
- bool operator<(const node_strand &other) const {
- if (node != other.node)
- return (node < other.node);
- if (left_or_right != other.left_or_right)
- return left_or_right < other.left_or_right;
- return (strand < other.strand);
- }
- };
-
-#if __cplusplus > 199711L
-//#if __clang__
- std::unordered_map<kmer_type,set<node_strand> > kmer_links;
-#else
- std::tr1::unordered_map<kmer_type,set<node_strand> > kmer_links;
-#endif
-
- id_els construct_graph(string linear_seqs_name, const string direction); // PIERRE: added the return value
- id_els construct_graph(string linear_seqs_name); // PIERRE: added the return value
- void load_nodes_extremities(string linear_seqs_name);
-
- private:
- void init(bool erase); // PIERRE
-};
-#endif //_GRAPHOUTPUT_H
-
diff --git a/Hash16.cpp b/Hash16.cpp
deleted file mode 100644
index 948c99b..0000000
--- a/Hash16.cpp
+++ /dev/null
@@ -1,404 +0,0 @@
-//
-// Hash16.cpp
-//
-// Created by Guillaume Rizk on 19/02/12.
-//
-
-#include <iostream>
-#include <stdio.h>
-#include <string.h>
-#include <algorithm> // for max
-
-#include "Hash16.h"
-
-using namespace::std;
-
-
-
-
-Hash16::Hash16()
-{
- //empty default constructor
- nb_elem = 0;
-
-}
-
-//tai is 2^tai_Hash16
-//max is 32
-Hash16::Hash16(int tai_Hash16)
-{
- if(tai_Hash16>32){
- fprintf(stderr,"max size for this hash is 2^32, resuming with max value \n");
- tai_Hash16=32;
- }
- nb_elem = 0;
- tai = (1LL << tai_Hash16);
- mask = tai-1 ;
- datah = (cell_ptr_t *) malloc( tai * sizeof(cell_ptr_t)); //create hashtable
- memset(datah,0, tai * sizeof(cell_ptr_t));
-
- // fprintf(stderr,"sizeof hashtable %lli MB\n",tai * sizeof(cell_ptr_t)/1024/1024);
-
- storage = new Pool<hash_elem>;
-
-}
-
-
-
-
-
-
-Hash16::~Hash16()
-{
-
- free(datah);
- delete storage;
-}
-
-
-//if graine already here, overwrite old value
-void Hash16::insert(hash_elem graine, int value)
-{
-
- unsigned int clef ;
- cell<hash_elem> * cell_ptr, *newcell_ptr;
- cell_ptr_t newcell_internal_ptr;
-
- clef = (unsigned int) (hashcode(graine) & mask);
-
- cell_ptr = storage->internal_ptr_to_cell_pointer(datah[clef]);
-
- while(cell_ptr != NULL && cell_ptr->graine != graine)
- {
- cell_ptr = storage->internal_ptr_to_cell_pointer(cell_ptr->suiv);
- }
- if (cell_ptr==NULL) //graine non trouvee , insertion au debut
- {
- newcell_internal_ptr = storage->allocate_cell();
- newcell_ptr = storage->internal_ptr_to_cell_pointer(newcell_internal_ptr);
- newcell_ptr->val=value;
- newcell_ptr->graine=graine;
- newcell_ptr->suiv=datah[clef];
- datah[clef] = newcell_internal_ptr;
- nb_elem++;
- }
- else cell_ptr->val=value; // graine trouvee
-
-}
-
-
-//add graine, and count how many times it was added
-//return 1 if graine first time seen
-int Hash16::add(hash_elem graine)
-{
-
-
-
- unsigned int clef ;
- cell<hash_elem> * cell_ptr, *newcell_ptr;
- cell_ptr_t newcell_internal_ptr;
-
- clef = (unsigned int) hashcode(graine) & mask;
-
-
- cell_ptr = storage->internal_ptr_to_cell_pointer(datah[clef]);
-
- while(cell_ptr != NULL && cell_ptr->graine != graine)
- {
-
- cell_ptr = storage->internal_ptr_to_cell_pointer(cell_ptr->suiv);
- }
- if (cell_ptr==NULL) //graine non trouvee , insertion au debut
- {
-
- newcell_internal_ptr = storage->allocate_cell();
- newcell_ptr = storage->internal_ptr_to_cell_pointer(newcell_internal_ptr);
- newcell_ptr->val=1;
- newcell_ptr->graine=graine;
- newcell_ptr->suiv=datah[clef];
- datah[clef] = newcell_internal_ptr;
- nb_elem++;
- return 1;
- }
- else {
- (cell_ptr->val)++; // graine trouvee
- return 0;
- }
-
-}
-
-int Hash16::has_key( hash_elem graine)
-{
- return get(graine,NULL);
-}
-
-int Hash16::get( hash_elem graine, int * val)
-{
- unsigned int clef ;
- cell<hash_elem> * cell_ptr;
-
- clef = (unsigned int) hashcode(graine) & mask;
-
- cell_ptr = storage->internal_ptr_to_cell_pointer(datah[clef]);
- while(cell_ptr != NULL && cell_ptr->graine != graine)
- {
- cell_ptr = storage->internal_ptr_to_cell_pointer(cell_ptr->suiv);
- }
-
-
- if (cell_ptr==NULL)
- {
- return 0;
-
- }
- else
- {
- if (val != NULL)
- *val = cell_ptr->val;
- return 1;
- }
-
-
-}
-
-
-
-int Hash16::remove( hash_elem graine, int * val)
-{
- unsigned int clef ;
- cell<hash_elem>* cell_ptr;
- cell_ptr_t * cellprec_ptr;
-
- clef = (unsigned int) hashcode(graine) & mask;
-
- cell_ptr = storage->internal_ptr_to_cell_pointer(datah[clef]);
- cellprec_ptr = & (datah[clef]);
-
- while(cell_ptr != NULL && cell_ptr->graine != graine)
- {
- cellprec_ptr = & (cell_ptr->suiv);
- cell_ptr = storage->internal_ptr_to_cell_pointer(cell_ptr->suiv);
- }
-
-
- if (cell_ptr==NULL)
- {
- if (val != NULL)
- *val = 0;
- return 0;
-
- }
- else
- {
- if (val != NULL)
- *val = cell_ptr->val;
- //delete the cell :
- *cellprec_ptr = cell_ptr->suiv ;
-
- return 1;
- }
-
-
-}
-
-// (note: Hash16 uses 32 bits hashes)
-
-#ifdef _largeint
-inline uint64_t Hash16::hashcode(LargeInt<KMER_PRECISION> elem)
-{
- // hash = XOR_of_series[hash(i-th chunk iof 64 bits)]
- uint64_t result = 0, chunk, mask = ~0;
- LargeInt<KMER_PRECISION> intermediate = elem;
- int i;
- for (i=0;i<KMER_PRECISION;i++)
- {
- chunk = (intermediate & mask).toInt();
- intermediate = intermediate >> 64;
- result ^= hashcode(chunk);
- }
- return result;
-}
-#endif
-
-#ifdef _ttmath
-inline uint64_t Hash16::hashcode(ttmath::UInt<KMER_PRECISION> elem)
-{
- // hash = XOR_of_series[hash(i-th chunk iof 64 bits)]
- uint64_t result = 0, to_hash;
- ttmath::UInt<KMER_PRECISION> intermediate = elem;
- uint32_t mask=~0, chunk;
- int i;
- for (i=0;i<KMER_PRECISION/2;i++)
- {
- // retrieve a 64 bits part to hash
- (intermediate & mask).ToInt(chunk);
- to_hash = chunk;
- intermediate >>= 32;
- (intermediate & mask).ToInt(chunk);
- to_hash |= ((uint64_t)chunk) << 32 ;
- intermediate >>= 32;
-
- result ^= hashcode(to_hash);
- }
- return result;
-}
-#endif
-
-#ifdef _LP64
-inline unsigned int Hash16::hashcode( __uint128_t elem )
-{
- // hashcode(uint128) = ( hashcode(upper 64 bits) xor hashcode(lower 64 bits)) & mask
- return (hashcode((uint64_t)(elem>>64)) ^ hashcode((uint64_t)(elem&((((__uint128_t)1)<<64)-1))));
-}
-#endif
-
-inline unsigned int Hash16::hashcode( uint64_t elem )
-{
- uint64_t code = elem;
-
- code = code ^ (code >> 14); //supp
- code = (~code) + (code << 18);
- code = code ^ (code >> 31);
- code = code * 21;
- code = code ^ (code >> 11);
- code = code + (code << 6);
- code = code ^ (code >> 22);
-
- return ((unsigned int) code );
-
-}
-
-
-void Hash16::empty_all()
-{
- storage->empty_all();
- nb_elem=0;
- memset(datah,0, tai * sizeof(cell_ptr_t));
-
-}
-
-// call start_iterator to reinit the iterator, then do a while(next_iterator()) {..} to traverse every cell
-void Hash16::start_iterator()
-{
- iterator.cell_index = -1;
- iterator.cell_ptr = NULL;
- iterator.cell_internal_ptr = 0;
-}
-
-// returns true as long as the iterator contains a valid cell
-bool Hash16::next_iterator()
-{
- while (1)
- {
- // if the current cell is empty, search datah for the next non-empty one
- if (iterator.cell_internal_ptr == 0)
- {
- while (iterator.cell_internal_ptr == 0)
- {
- iterator.cell_index++;
- if ((unsigned int )iterator.cell_index==tai)
- return false;
-
- iterator.cell_internal_ptr = datah[iterator.cell_index];
- }
- }
- else // if the current cell is non-empty, go to the next cell
- {
- iterator.cell_internal_ptr = iterator.cell_ptr->suiv;
- if (iterator.cell_internal_ptr == 0)
- continue; // if the next cell is empty, proceed to the "current cell is empty" case
- }
- // at this point we either gave up (return false) or have a non-empty cell
- iterator.cell_ptr = storage->internal_ptr_to_cell_pointer(iterator.cell_internal_ptr);
- break;
- }
- return true;
-}
-
-//file should already be opened for writing
-void Hash16::dump(FILE * count_file)
-{
- cell<hash_elem> * cell_ptr;
- start_iterator();
- while (next_iterator())
- {
- cell_ptr = iterator.cell_ptr;
-
- fwrite(&cell_ptr->graine, sizeof(cell_ptr->graine), 1, count_file);
- fwrite(&cell_ptr->val, sizeof(cell_ptr->val), 1, count_file);
- }
-}
-
-int64_t Hash16::getsolids(Bloom* bloom_to_insert, BinaryBank* solids, int nks)
-{
- cell<hash_elem> * cell_ptr;
- start_iterator();
- int64_t nso=0;
- while (next_iterator())
- {
- cell_ptr = iterator.cell_ptr;
-
- if(cell_ptr->val>=nks)
- {
- nso++;
- solids->write_element(&cell_ptr->graine);
- if (bloom_to_insert != NULL)
- bloom_to_insert->add(cell_ptr->graine);
- }
- }
- return nso;
-}
-
-//print stats of elem having their value >=nks
-int Hash16::printstat(int nks, bool print_collisions)
-{
- fprintf(stderr,"\n----------------------Stat Hash Table ---------------------\n");
-
-
- long long NbKmersolid = 0;
- int ma=0,mi=99999,cpt=0;
- uint64_t i;
- int maxclef=0;
-
- cell<hash_elem> * cell_ptr;
- cell_ptr_t cell_internal_ptr;
-
- int distrib_colli[512];
- long long nb_cell=0;
- for (i=0;i<512;i++){distrib_colli[i]=0;}
-
- for (i=0; i<tai; ++i)
- {
-
- cell_internal_ptr = datah[i];
- cell_ptr = storage->internal_ptr_to_cell_pointer(cell_internal_ptr);
-
- cpt=0;
- while(cell_internal_ptr!=0 )
- {
- nb_cell++;
- cpt++;
- if(cell_ptr->val >= nks) NbKmersolid++;
- cell_internal_ptr = cell_ptr->suiv;
- cell_ptr = storage->internal_ptr_to_cell_pointer(cell_internal_ptr);
-
- }
- if(cpt>ma) {ma=cpt;maxclef=i;}
- ma = max(ma,cpt); mi = min(mi,cpt);
- distrib_colli[cpt]++;
- }
- fprintf(stderr,"taille hashtable %llu\n",(unsigned long long)tai);
- fprintf(stderr,"kmer solid/total : %lli / %lli %g %% (%lli elem < %i) \n",(long long)NbKmersolid, (long long)nb_cell, 100*(float)NbKmersolid /nb_cell,(long long)(nb_cell-NbKmersolid),nks);
-
- fprintf(stderr,"max collisions = %i pour clef %i nb_elem total %lli reparties sur %llu clefs %g elem/clef \n",ma,maxclef,nb_cell,(unsigned long long)(tai-distrib_colli[0]), (float)nb_cell/(float)(tai-distrib_colli[0]));
-
- if(print_collisions)
- for (i=0; i<10; i++)
- {
- fprintf(stderr," %9llucollisions : %9i \n",(unsigned long long)i,(distrib_colli[i]));
- }
-
- return NbKmersolid;
-}
-
-
diff --git a/Hash16.h b/Hash16.h
deleted file mode 100644
index 1f1dff2..0000000
--- a/Hash16.h
+++ /dev/null
@@ -1,95 +0,0 @@
-//
-// Hash16.h
-//
-// Created by Guillaume Rizk on 19/02/12.
-//
-
-#ifndef Hash16_h
-#define Hash16_h
-#include <stdlib.h>
-#include <inttypes.h>
-#include <stdint.h>
-#include "Pool.h"
-#include "Bloom.h"
-#include "Bank.h"
-
-
-//memory usage : sizeof(cell_ptr_t)*tai + sizeof(cell)*Nb_inserted
-// ie 4B*tai + 16B*nb_inserted
-
-#ifdef _largeint
-#include "LargeInt.h"
-typedef LargeInt<KMER_PRECISION> hash_elem;
-#else
-#ifdef _ttmath
-#include "ttmath/ttmath.h"
-typedef ttmath::UInt<KMER_PRECISION> hash_elem;
-#else
-#if (! defined kmer_type) || (! defined _LP64)
-typedef uint64_t hash_elem;
-#else
-typedef kmer_type hash_elem;
-#endif
-#endif
-#endif
-
-class Hash16{
-
-protected:
-
- cell_ptr_t * datah;
-
- Pool<hash_elem>* storage;
- uint64_t mask ;
-
-#ifdef _largeint
- inline uint64_t hashcode(LargeInt<KMER_PRECISION> elem);
-#endif
-#ifdef _ttmath
- inline uint64_t hashcode(ttmath::UInt<KMER_PRECISION> elem);
-#endif
-#ifdef _LP64
- unsigned int hashcode( __uint128_t elem);
-#endif
- unsigned int hashcode( uint64_t elem);
-public:
-
- //print stats of elem having their value >=nks
- // void printstat(int nks);
- int printstat(int nks, bool print_collisions=0);
-
- void empty_all();
- void insert(hash_elem graine, int val);
- int add(hash_elem elem);
- void dump(FILE * count_file);//file should already be opened for writing
-
- int64_t getsolids( Bloom* bloom_to_insert, BinaryBank* solids, int nks);
-
- int get( hash_elem elem, int * val);
- int has_key( hash_elem elem);
- int remove( hash_elem graine, int * val);
-
- // iterator functions:
- struct
- {
- int64_t cell_index;
- cell<hash_elem> * cell_ptr;
- cell_ptr_t cell_internal_ptr;
- } iterator;
- void start_iterator();
- bool next_iterator();
-
- uint64_t tai;
- uint64_t nb_elem;
- Hash16(int tai_Hash16);
- Hash16();
- ~Hash16();
-
-};
-
-
-
-
-
-#endif
-
diff --git a/Hashing.cpp b/Hashing.cpp
deleted file mode 100644
index cb30a9c..0000000
--- a/Hashing.cpp
+++ /dev/null
@@ -1,42 +0,0 @@
-#include "Hashing.h"
-
-#ifdef _largeint
-// sadly inlining this provokes a linker error..
-uint64_t Hashing::hashcode(LargeInt<KMER_PRECISION> elem)
-{
- // hash = XOR_of_series[hash(i-th chunk iof 64 bits)]
- uint64_t result = 0, chunk, mask = ~0;
- LargeInt<KMER_PRECISION> intermediate = elem;
- int i;
- for (i=0;i<KMER_PRECISION;i++)
- {
- chunk = (intermediate & mask).toInt();
- intermediate = intermediate >> 64;
- result ^= hashcode(chunk);
- }
- return result;
-}
-#endif
-
-#ifdef _LP64
-uint64_t Hashing::hashcode( __uint128_t elem )
-{
- // hashcode(uint128) = ( hashcode(upper 64 bits) xor hashcode(lower 64 bits))
- return (hashcode((uint64_t)(elem>>64)) ^ hashcode((uint64_t)(elem&((((__uint128_t)1)<<64)-1))));
-}
-#endif
-
-uint64_t Hashing::hashcode( uint64_t elem )
-{
- // RanHash from Numerical Recipes 3rd edition
- uint64_t v = elem * 3935559000370003845ULL + 2691343689449507681ULL;
- v = v ^ (v >> 21);
- v = v ^ (v << 37);
- v = v ^ (v >> 4);
- v = v * 4768777513237032717ULL;
- v = v ^ (v << 20);
- v = v ^ (v >> 41);
- v = v ^ (v << 5);
- return v;
-}
-
diff --git a/Hashing.h b/Hashing.h
deleted file mode 100644
index fc5f616..0000000
--- a/Hashing.h
+++ /dev/null
@@ -1,31 +0,0 @@
-#ifndef Hashing_h
-#define Hashing_h
-#include <stdlib.h>
-#include <inttypes.h>
-#include <stdint.h>
-
-#ifdef _largeint
-#include "LargeInt.h"
-#else
-#ifdef _ttmath
-#include "ttmath/ttmath.h"
-#endif
-#endif
-
-// hash functions: [ any integer type, e.g. 64 bits, 128 bits or ttmath ] -> [ 64 bits hash ]
-
-class Hashing
-{
-public:
-#ifdef _largeint
- static uint64_t hashcode(LargeInt<KMER_PRECISION> elem);
-#endif
-
-#ifdef _LP64
- static uint64_t hashcode( __uint128_t elem );
-#endif
-
- static uint64_t hashcode( uint64_t elem );
-};
-
-#endif
diff --git a/INSTALL b/INSTALL
new file mode 100644
index 0000000..7ab8426
--- /dev/null
+++ b/INSTALL
@@ -0,0 +1,20 @@
+# CMake is required to compile software (http://www.cmake.org/cmake/resources/software.html)
+# you can install software by executing this file: sh INSTALL
+#
+
+# Prepare GATB sub-module
+git submodule init
+git submodule update
+
+# Prepare directories:
+rm -rf build
+mkdir build
+
+# Go in the 'build' directory
+cd build
+
+# Prepare the makefile
+cmake ..
+
+# Run the newly created makefile:
+make -j8
diff --git a/Kmer.cpp b/Kmer.cpp
deleted file mode 100644
index 9bd617b..0000000
--- a/Kmer.cpp
+++ /dev/null
@@ -1,373 +0,0 @@
-#ifndef ASSERTS
-#define NDEBUG // disable asserts, they're computationnally intensive
-#endif
-
-#include <stdio.h>
-#include <assert.h>
-#include <algorithm> // for min
-#include "Kmer.h"
-#include "lut.h"
-
-using namespace std;
-
-int sizeKmer;
-uint64_t nsolids = 0;
-kmer_type kmerMask;
-kmer_type kmerMaskm1;
-
-int NT2int(char nt)
-{
- int i;
- i = nt;
- i = (i>>1)&3; // that's quite clever, guillaume.
- return i;
-}
-
-int revcomp_int(int nt_int)
-{
- return (nt_int<2)?nt_int+2:nt_int-2;
-}
-
-
-unsigned char code4NT(char *seq)
-{
- int i;
- unsigned char x;
-
- x=0;
- for (i=0; i<4; ++i)
- {
- x = x*4 + NT2int(seq[i]);
- }
- return x;
-}
-
-unsigned char code_n_NT(char *seq, int nb)
-{
- int i;
- unsigned char x;
-
- x=0;
- for (i=0; i<nb; ++i)
- {
- x = x*4 + NT2int(seq[i]);
- }
- x = x << ((4-nb)*2) ;
- return x;
-}
-
-
-kmer_type codeSeed(char *seq)
-{
- return codeSeed(seq, sizeKmer, kmerMask);
-}
-
-kmer_type codeSeed(char *seq, int sizeKmer, kmer_type kmerMask)
-{
- int i;
- kmer_type x;
-
- x=0;
- for (i=0; i<sizeKmer; ++i)
- {
- x = x*4 + NT2int(seq[i]);
- }
- return x;
-}
-kmer_type codeSeedRight(char *seq, kmer_type val_seed, bool new_read)
-{
- return codeSeedRight(seq, val_seed, new_read, sizeKmer, kmerMask);
-}
-
-kmer_type codeSeedRight(char *seq, kmer_type val_seed, bool new_read, int sizeKmer, kmer_type kmerMask)
-{
- if (new_read) return codeSeed(seq, sizeKmer, kmerMask);
- // shortcut
- return (val_seed * 4 + NT2int(seq[sizeKmer-1])) & kmerMask ;
-}
-
-kmer_type codeSeedRight_revcomp(char *seq, kmer_type val_seed, bool new_read)
-{
- return codeSeedRight_revcomp(seq, val_seed, new_read, sizeKmer, kmerMask);
-}
-
-kmer_type codeSeedRight_revcomp(char *seq, kmer_type val_seed, bool new_read, int sizeKmer, kmer_type kmerMask)
-{
-
- if (new_read) return revcomp( codeSeed(seq, sizeKmer, kmerMask), sizeKmer );
- // shortcut
- return ((val_seed >> 2) + ( ((kmer_type) comp_NT[NT2int(seq[sizeKmer-1])]) << (2*(sizeKmer-1)) ) ) & kmerMask;
-
-}
-
-// warning: only call this function for sequential enumeration of kmers (no arbitrary position)
-kmer_type extractKmerFromRead(char *readSeq, int position, kmer_type *graine, kmer_type *graine_revcomp)
-{
- return extractKmerFromRead(readSeq, position, graine, graine_revcomp, true);
-}
-
-kmer_type extractKmerFromRead(char *readSeq, int position, kmer_type *graine, kmer_type *graine_revcomp, bool sequential)
-{
- return extractKmerFromRead(readSeq, position, graine, graine_revcomp, sequential, sizeKmer, kmerMask);
-}
-
-kmer_type extractKmerFromRead(char *readSeq, int position, kmer_type *graine, kmer_type *graine_revcomp, bool sequential, int sizeKmer, kmer_type kmerMask)
-{
- assert(graine != graine_revcomp); // make sure two different pointers
- bool new_read = (position == 0) || (!sequential); // faster computation for immediately overlapping kmers
-
- *graine = codeSeedRight(&readSeq[position], *graine, new_read, sizeKmer, kmerMask);
- *graine_revcomp = codeSeedRight_revcomp(&readSeq[position], *graine_revcomp, new_read, sizeKmer, kmerMask);
-
- return min(*graine,*graine_revcomp);
-}
-
-
-int first_nucleotide(kmer_type kmer)
-{
- int result;
-#ifdef _largeint
- LargeInt<KMER_PRECISION> t = kmer;
- result = t.toInt()&3;
-#else
-#ifdef _ttmath
- ttmath::UInt<KMER_PRECISION> t = kmer&3;
- t.ToInt(result);
-#else
- result = kmer&3;
-#endif
-#endif
- return result;
-}
-
-int code2seq (kmer_type code, char *seq)
-{
- return code2seq (code, seq, sizeKmer, kmerMask);
-}
-
-int code2seq (kmer_type code, char *seq, int sizeKmer, kmer_type kmerMask)
-{
- int i;
- kmer_type temp = code;
- char bin2NT[4] = {'A','C','T','G'};
-
- for (i=sizeKmer-1; i>=0; i--)
- {
- seq[i]=bin2NT[first_nucleotide(temp&3)];
- temp = temp>>2;
- }
- //printf("sizeKmer = %d\n", sizeKmer);
- seq[sizeKmer]='\0';
- return sizeKmer;
-}
-
-// return the i-th nucleotide of the kmer_type kmer
-int code2nucleotide( kmer_type code, int which_nucleotide)
-{
- kmer_type temp = code;
- temp = temp >> (2*(sizeKmer-1-which_nucleotide));
- return first_nucleotide(temp&3);
-}
-
-uint64_t revcomp(uint64_t x, int size) {
- int i;
-
- uint64_t revcomp = x;
- // printf("x %x revcomp %x \n",x,revcomp);
- unsigned char * kmerrev = (unsigned char *) (&revcomp);
- unsigned char * kmer = (unsigned char *) (&x);
-
- for (i=0; i<8; ++i)
- {
- kmerrev[7-i] = revcomp_4NT[kmer[i]];
- }
-
- return (revcomp >> (2*( 4*sizeof(uint64_t) - size)) ) ;
-}
-
-uint64_t revcomp(uint64_t x) {
- return revcomp(x,sizeKmer);
-}
-
-#ifdef _largeint
-LargeInt<KMER_PRECISION> revcomp(LargeInt<KMER_PRECISION> x, int size) {
- int i;
-
- kmer_type revcomp = x;
- // printf("x %x revcomp %x \n",x,revcomp);
- unsigned char * kmerrev = (unsigned char *) (&(revcomp.array[0]));
- unsigned char * kmer = (unsigned char *) (&(x.array[0]));
-
- for (i=0; i<8*KMER_PRECISION; ++i)
- {
- kmerrev[8*KMER_PRECISION-1-i] = revcomp_4NT[kmer[i]];
- }
-
- return (revcomp >> (2*( 32*KMER_PRECISION - size)) ) ;
-}
-
-LargeInt<KMER_PRECISION> revcomp(LargeInt<KMER_PRECISION> x) {
- return revcomp(x,sizeKmer);
-}
-#endif
-
-#ifdef _ttmath
-ttmath::UInt<KMER_PRECISION> revcomp(ttmath::UInt<KMER_PRECISION> x, int size) {
- int i;
-
- kmer_type revcomp = x;
- // printf("x %x revcomp %x \n",x,revcomp);
- unsigned char * kmerrev = (unsigned char *) (&revcomp);
- unsigned char * kmer = (unsigned char *) (&x);
-
- for (i=0; i<4*KMER_PRECISION; ++i)
- {
- kmerrev[4*KMER_PRECISION-1-i] = revcomp_4NT[kmer[i]];
- }
-
- return (revcomp >> (2*( 16*KMER_PRECISION - size)) ) ;
-}
-
-ttmath::UInt<KMER_PRECISION> revcomp(ttmath::UInt<KMER_PRECISION> x) {
- return revcomp(x,sizeKmer);
-}
-#endif
-
-#ifdef _LP64
-__uint128_t revcomp(__uint128_t x, int size)
-{
- // ---64bits-- ---64bits--
- // original kmer: [__high_nucl__|__low_nucl___]
- //
- // ex: [ AC | .......TG ]
- //
- //revcomp: [ CA | .......GT ]
- // \_low_nucl__/\high_nucl/
- uint64_t high_nucl = (uint64_t)(x>>64);
- int nb_high_nucl = size>32?size - 32:0;
- __uint128_t revcomp_high_nucl = revcomp(high_nucl, nb_high_nucl);
- if (size<=32) revcomp_high_nucl = 0; // srsly dunno why this is needed. gcc bug? uint64_t x ---> (x>>64) != 0
-
- uint64_t low_nucl = (uint64_t)(x&((((__uint128_t)1)<<64)-1));
- int nb_low_nucl = size>32?32:size;
- __uint128_t revcomp_low_nucl = revcomp(low_nucl, nb_low_nucl);
-
- return (revcomp_low_nucl<<(2*nb_high_nucl)) + revcomp_high_nucl;
-}
-
-__uint128_t revcomp(__uint128_t x) {
- return revcomp(x,sizeKmer);
-}
-#endif
-
-// will be used by assemble()
-void revcomp_sequence(char s[], int len)
-{
-#define CHAR_REVCOMP(a,b) {switch(a){\
- case 'A': b='T';break;case 'C': b='G';break;case 'G': b='C';break;case 'T': b='A';break;default: b=a;break;}}
- int i;
- unsigned char t;
- for (i=0;i<len/2;i++)
- {
- t=s[i];
- CHAR_REVCOMP(s[len-i-1],s[i]);
- CHAR_REVCOMP(t,s[len-i-1]);
- }
- if (len%2==1)
- CHAR_REVCOMP(s[len/2],s[len/2]);
-
-}
-
-
-kmer_type next_kmer(kmer_type graine, int added_nt, int *strand)
-{
- assert(added_nt<4);
- assert(graine<=revcomp(graine));
- assert((strand == NULL) || (*strand<2));
-
- kmer_type new_graine;
- kmer_type temp_graine;
-
- if (strand != NULL && *strand == 1)// the kmer we're extending is actually a revcomp sequence in the bidirected debruijn graph node
- temp_graine = revcomp(graine);
- else
- temp_graine = graine;
-
- new_graine = (((temp_graine) * 4 ) + added_nt) & kmerMask;
- //new_graine = (((graine) >> 2 ) + ( ((kmer_type)added_nt) << ((sizeKmer-1)*2)) ) & kmerMask; // previous kmer
- kmer_type revcomp_new_graine = revcomp(new_graine);
-
- if (strand != NULL)
- *strand = (new_graine < revcomp_new_graine)?0:1;
-
- return min(new_graine,revcomp_new_graine);
-}
-
-
-//////////////////////////funcs for binary reads
-
-
-kmer_type codeSeed_bin(char *seq)
-{
- int i;
- kmer_type x;
-
- x=0;
- for (i=0; i<sizeKmer; ++i)
- {
- x = x*4 + (seq[i]);
- }
- return x;
-}
-
-inline kmer_type codeSeedRight_bin(char *seq, kmer_type val_seed, bool new_read)
-{
-
- if (new_read) return codeSeed_bin(seq);
- // shortcut
- return (val_seed * 4 + (seq[sizeKmer-1])) & kmerMask ;
-
-}
-
-inline kmer_type codeSeedRight_revcomp_bin(char *seq, kmer_type val_seed, bool new_read)
-{
-
- if (new_read) return revcomp(codeSeed_bin(seq));
- // shortcut
- return ((val_seed >> 2) + ( ((kmer_type) comp_NT[(int)(seq[sizeKmer-1])]) << (2*(sizeKmer-1)) ) ) & kmerMask;
-
-}
-
-
-
-kmer_type extractKmerFromRead_bin(char *readSeq, int position, kmer_type *graine, kmer_type *graine_revcomp, bool use_compressed)
-{
- assert(graine != graine_revcomp); // make sure two different pointers
-
- bool new_read = (position == 0);
- if(!use_compressed)
- {
- *graine = codeSeedRight(&readSeq[position], *graine, new_read);
- *graine_revcomp = codeSeedRight_revcomp(&readSeq[position], *graine_revcomp, new_read);
- }
- else
- {
- *graine = codeSeedRight_bin(&readSeq[position], *graine, new_read);
- *graine_revcomp = codeSeedRight_revcomp_bin(&readSeq[position], *graine_revcomp, new_read);
- }
- return min(*graine,*graine_revcomp);
-}
-
-
-// debug only: convert a kmer_type to char*
-char debug_kmer_buffer[1024];
-char* print_kmer(kmer_type kmer)
-{
- return print_kmer(kmer,sizeKmer,kmerMask);
-}
-
-char* print_kmer(kmer_type kmer, int sizeKmer, kmer_type kmerMask)
-{
- code2seq(kmer,debug_kmer_buffer, sizeKmer, kmerMask);
- return debug_kmer_buffer;
-}
diff --git a/Kmer.h b/Kmer.h
deleted file mode 100644
index 5ec860f..0000000
--- a/Kmer.h
+++ /dev/null
@@ -1,84 +0,0 @@
-#ifndef Kmer64_h
-#define Kmer64_h
-
-#include <stdint.h>
-
-#ifdef _largeint
-#include "LargeInt.h"
-typedef LargeInt<KMER_PRECISION> kmer_type;
-#else
-#ifdef _ttmath
-#include "ttmath/ttmath.h"
-typedef ttmath::UInt<KMER_PRECISION> kmer_type;
-#else
-#if (! defined kmer_type) || (! defined _LP64)
-typedef uint64_t kmer_type;
-#endif
-#endif
-#endif
-
-extern int sizeKmer;
-extern kmer_type kmerMask;
-extern kmer_type kmerMaskm1;
-
-extern uint64_t nsolids;
-
-int NT2int(char nt);
-int revcomp_int(int nt_int);
-kmer_type codeSeed(char *seq, int sizeKmer, kmer_type kmerMask);
-kmer_type codeSeed(char *seq);
-kmer_type codeSeedRight(char *seq, kmer_type val_seed, bool new_read);
-kmer_type codeSeedRight(char *seq, kmer_type val_seed, bool new_read, int sizeKmer, kmer_type kmerMask);
-kmer_type codeSeedRight_revcomp(char *seq, kmer_type val_seed, bool new_read);
-kmer_type codeSeedRight_revcomp(char *seq, kmer_type val_seed, bool new_read, int sizeKmer, kmer_type kmerMask);
-unsigned char code_n_NT(char *seq, int nb);
-unsigned char code4NT(char *seq);
-
-uint64_t revcomp(uint64_t x);
-uint64_t revcomp(uint64_t x, int size);
-
-#ifdef _largeint
-LargeInt<KMER_PRECISION> revcomp(LargeInt<KMER_PRECISION> x);
-LargeInt<KMER_PRECISION> revcomp(LargeInt<KMER_PRECISION> x, int size);
-#endif
-#ifdef _ttmath
-ttmath::UInt<KMER_PRECISION> revcomp(ttmath::UInt<KMER_PRECISION> x);
-ttmath::UInt<KMER_PRECISION> revcomp(ttmath::UInt<KMER_PRECISION> x, int size);
-#endif
-#ifdef _LP64
-__uint128_t revcomp(__uint128_t x);
-__uint128_t revcomp(__uint128_t x, int size);
-#endif
-
-int code2seq ( kmer_type code,char *seq);
-int code2seq ( kmer_type code,char *seq, int sizeKmer, kmer_type kmerMask);
-int code2nucleotide( kmer_type code, int which_nucleotide);
-
-kmer_type extractKmerFromRead(char *readSeq, int position, kmer_type *graine, kmer_type *graine_revcomp);
-kmer_type extractKmerFromRead(char *readSeq, int position, kmer_type *graine, kmer_type *graine_revcomp, bool sequential);
-kmer_type extractKmerFromRead(char *readSeq, int position, kmer_type *graine, kmer_type *graine_revcomp, bool sequential, int sizeKmer, kmer_type kmerMask);
-
-// compute the next kmer w.r.t forward or reverse strand, e.g. for ACTG (revcomp = CAGT)
-// it makes sure the result is the min(kmer,revcomp_kmer)
-// indicates if the result is the revcomp_kmer by setting *strand
-// examples:
-// next_kmer(ACTG,A,&0)=CTGA with strand = 0 (because revcomp=TCAG);
-// next_kmer(ACTG,A,&1)= (revcomp of ACTG + A = CAGT+A = ) AGTA with strand = 0 (because revcomp = TACT)
-kmer_type next_kmer(kmer_type graine, int added_nt, int *strand);
-
-void revcomp_sequence(char s[], int len);
-
-
-kmer_type codeSeed_bin(char *seq);
-
-kmer_type codeSeedRight_bin(char *seq, kmer_type val_seed, bool new_read);
-
-kmer_type codeSeedRight_revcomp_bin(char *seq, kmer_type val_seed, bool new_read);
-
-kmer_type extractKmerFromRead_bin(char *readSeq, int position, kmer_type *graine, kmer_type *graine_revcomp, bool use_compressed);
-
-char* print_kmer(kmer_type kmer); // debugging
-char* print_kmer(kmer_type kmer, int sizeKmer, kmer_type kmerMask); // debugging
-
-
-#endif
diff --git a/LICENSE b/LICENSE
index 115866f..dba13ed 100644
--- a/LICENSE
+++ b/LICENSE
@@ -1,514 +1,661 @@
- FREE SOFTWARE LICENSING AGREEMENT CeCILL
- ========================================
-
-
-Notice
-------
-
-
-This Agreement is a free software license that is the result of discussions
-between its authors in order to ensure compliance with the two main
-principles guiding its drafting:
- - firstly, its conformity with French law, both as regards the law of
- torts and intellectual property law, and the protection that it offers
- to authors and the holders of economic rights over software.
- - secondly, compliance with the principles for the distribution of free
- software: access to source codes, extended user-rights.
-
-The following bodies are the authors of this license CeCILL (Ce : CEA, C :
-CNRS, I : INRIA, LL : Logiciel Libre):
-
-Commissariat à l'Energie Atomique - CEA, a public scientific, technical and
-industrial establishment, having its principal place of business at 31-33
-rue de la Fédération, 75752 PARIS cedex 15, France.
-
-Centre National de la Recherche Scientifique - CNRS, a public scientific
-and technological establishment, having its principal place of business at
-3 rue Michel-Ange 75794 Paris cedex 16, France.
-
-Institut National de Recherche en Informatique et en Automatique - INRIA, a
-public scientific and technological establishment, having its principal
-place of business at Domaine de Voluceau, Rocquencourt, BP 105, 78153 Le
-Chesnay cedex.
-
-
-PREAMBLE
---------
-
-
-The purpose of this Free Software Licensing Agreement is to grant users the
-right to modify and redistribute the software governed by this license
-within the framework of an "open source" distribution model.
-
-The exercising of these rights is conditional upon certain obligations for
-users so as to ensure that this status is retained for subsequent
-redistribution operations.
-
-As a counterpart to the access to the source code and rights to copy, modify
-and redistribute granted by the license, users are provided only with a
-limited warranty and the software's author, the holder of the economic
-rights, and the successive licensors only have limited liability.
-
-In this respect, it is brought to the user's attention that the risks
-associated with loading, using, modifying and/or developing or reproducing
-the software by the user given its nature of Free Software, that may
-mean that it is complicated to manipulate, and that also therefore means
-that it is reserved for developers and experienced professionals having
-in-depth computer knowledge. Users are therefore encouraged to load and test
-the Software's suitability as regards their requirements in conditions
-enabling the security of their systems and/or data to be ensured and, more
-generally, to use and operate it in the same conditions of security.
-This Agreement may be freely reproduced and published, provided it is
-not altered, and that no Articles are either added or removed herefrom.
-
-This Agreement may apply to any or all software for which the holder of the
-economic rights decides to submit the operation thereof to its provisions.
-
-
-Article 1 - DEFINITIONS
-------------------------
-
-
-For the purposes of this Agreement, when the following expressions commence
-with a capital letter, they shall have the following meaning:
-
-Agreement: means this Licensing Agreement, and any or all of its subsequent
-versions.
-
-Software: means the software in its Object Code and/or Source Code form
-and, where applicable, its documentation, "as is" at the time when the
-Licensee accepts the Agreement.
-
-Initial Software: means the Software in its Source Code and/or Object Code
-form and, where applicable, its documentation, "as is" at the time when it
-is distributed for the first time under the terms and conditions of the
-Agreement.
-
-Modified Software: means the Software modified by at least one
-Contribution.
-
-Source Code: means all the Software's instructions and program lines to
-which access is required so as to modify the Software.
-
-Object Code: means the binary files originating from the compilation of the
-Source Code.
-
-Holder: means the holder of the economic rights over the Initial
-Software.
-
-Licensee(s): mean(s) the Software user(s) having accepted the Agreement.
-
-Contributor: means a Licensee having made at least one Contribution.
-
-Licensor: means the Holder, or any or all other individual or legal entity,
-that distributes the Software under the Agreement.
-
-Contributions: mean any or all modifications, corrections, translations,
-adaptations and/or new functionalities integrated into the Software by any
-or all Contributor, and the Static Modules.
-
-Module: means a set of sources files including their documentation that,
-once compiled in executable form, enables supplementary functionalities or
-services to be developed in addition to those offered by the Software.
-
-Dynamic Module: means any or all module, created by the Contributor, that
-is independent of the Software, so that this module and the Software are in
-two different executable forms that are run in separate address spaces,
-with one calling the other when they are run.
-
-Static Module: means any or all module, created by the Contributor and
-connected to the Software by a static link that makes their object codes
-interdependent. This module and the Software to which it is connected, are
-combined in a single executable.
-
-Parties: mean both the Licensee and the Licensor.
-
-These expressions may be used both in singular and plural form.
-
-
-Article 2 - PURPOSE
--------------------
-
-
-The purpose of the Agreement is to enable the Licensor to grant the
-Licensee a free, non-exclusive, transferable and worldwide License for the
-Software as set forth in Article 5 hereinafter for the whole term of
-protection of the rights over said Software.
-
-
-Article 3 - ACCEPTANCE
-----------------------
-
-
-3.1. The Licensee shall be deemed as having accepted the terms and
-conditions of this Agreement by the occurrence of the first of the
-following events:
-- (i) loading the Software by any or all means, notably, by downloading
- from a remote server, or by loading from a physical medium;
-- (ii) the first time the Licensee exercises any of the rights granted
- hereunder.
-
-3.2. One copy of the Agreement, containing a notice relating to the
-specific nature of the Software, to the limited warranty, and to the
-limitation to use by experienced users has been provided to the Licensee
-prior to its acceptance as set forth in Article 3.1 hereinabove, and the
-Licensee hereby acknowledges that it is aware thereof.
-
-
-Article 4 - EFFECTIVE DATE AND TERM
------------------------------------
-
-
-4.1. EFFECTIVE DATE
-
-The Agreement shall become effective on the date when it is accepted by the
-Licensee as set forth in Article 3.1.
-
-4.2. TERM
-
-The Agreement shall remain in force during the whole legal term of
-protection of the economic rights over the Software.
-
-
-Article 5 - SCOPE OF THE RIGHTS GRANTED
----------------------------------------
-
-
-The Licensor hereby grants to the Licensee, that accepts such, the
-following rights as regards the Software for any or all use, and for the
-term of the Agreement, on the basis of the terms and conditions set forth
-hereinafter.
-
-Otherwise, the Licensor grants to the Licensee free of charge exploitation
-rights on the patents he holds on whole or part of the inventions
-implemented in the Software.
-
-5.1. RIGHTS OF USE
-
-The Licensee is authorized to use the Software, unrestrictedly, as regards
-the fields of application, with it being hereinafter specified that this
-relates to:
-- permanent or temporary reproduction of all or part of the Software by
- any or all means and in any or all form.
-- loading, displaying, running, or storing the Software on any or all
- medium.
-- entitlement to observe, study or test the operation thereof so as to
- establish the ideas and principles that form the basis for any or all
- constituent elements of said Software. This shall apply when the
- Licensee carries out any or all loading, displaying, running,
- transmission or storage operation as regards the Software, that it is
- entitled to carry out hereunder.
-
-5.2. entitlement to make CONTRIBUTIONS
-
-The right to make Contributions includes the right to translate, adapt,
-arrange, or make any or all modification to the Software, and the right to
-reproduce the resulting Software.
-
-The Licensee is authorized to make any or all Contribution to the Software
-provided that it explicitly mentions its name as the author of said
-Contribution and the date of the development thereof.
-
-5.3. DISTRIBUTION AND PUBLICATION RIGHTS
-
-In particular, the right of distribution and publication includes the right
-to transmit and communicate the Software to the general public on any or
-all medium, and by any or all means, and the right to market, either in
-consideration of a fee, or free of charge, a copy or copies of the Software
-by means of any or all process.
-The Licensee is further authorized to redistribute copies of the modified
-or unmodified Software to third parties according to the terms and
-conditions set forth hereinafter.
-
-5.3.1. REDISTRIBUTION OF SOFTWARE WITHOUT MODIFICATION
-
-The Licensee is authorized to redistribute true copies of the Software in
-Source Code or Object Code form, provided that said redistribution complies
-with all the provisions of the Agreement and is accompanied by:
-- a copy of the Agreement,
-- a notice relating to the limitation of both the Licensor's warranty
- and liability as set forth in Articles 8 and 9,
-and that, in the event that only the Software's Object Code is
-redistributed, the Licensee allows future Licensees unhindered access to
-the Software's full Source Code by providing them with the terms and
-conditions for access thereto, it being understood that the additional cost
-of acquiring the Source Code shall not exceed the cost of transferring the
-data.
-
-5.3.2. REDISTRIBUTION OF MODIFIED SOFTWARE
-
-When the Licensee makes a Contribution to the Software, the terms and
-conditions for the redistribution of the Modified Software shall then be
-subject to all the provisions hereof.
-
-The Licensee is authorized to redistribute the Modified Software, in Source
-Code or Object Code form, provided that said redistribution complies with
-all the provisions of the Agreement and is accompanied by:
-- a copy of the Agreement,
-- a notice relating to the limitation of both the Licensor's warranty
- and liability as set forth in Articles 8 and 9,
-and that, in the event that only the Modified Software's Object Code is
-redistributed, the Licensee allows future Licensees unhindered access to
-the Modified Software's full Source Code by providing them with the terms
-and conditions for access thereto, it being understood that the additional
-cost of acquiring the Source Code shall not exceed the cost of transferring
-the data.
-
-
-5.3.3. redistribution OF DYNAMIC MODULES
-
-When the Licensee has developed a Dynamic Module, the terms and conditions
-hereof do not apply to said Dynamic Module, that may be distributed under
-a separate Licensing Agreement.
-
-5.3.4. COMPATIBILITY WITH THE GPL LICENSE
-
-In the event that the Modified or unmodified Software is included in a code
-that is subject to the provisions of the GPL License, the Licensee is
-authorized to redistribute the whole under the GPL License.
-
-In the event that the Modified Software includes a code that is subject to
-the provisions of the GPL License, the Licensee is authorized to
-redistribute the Modified Software under the GPL License.
-
-
-Article 6 - INTELLECTUAL PROPERTY
-----------------------------------
-
-
-6.1. OVER THE INITIAL SOFTWARE
-
-The Holder owns the economic rights over the Initial Software. Any or all
-use of the Initial Software is subject to compliance with the terms and
-conditions under which the Holder has elected to distribute its work and no
-one shall be entitled to and it shall have sole entitlement to modify the
-terms and conditions for the distribution of said Initial Software.
-
-The Holder undertakes to maintain the distribution of the Initial Software
-under the conditions of the Agreement, for the duration set forth in
-article 4.2..
-
-6.2. OVER THE CONTRIBUTIONS
-
-The intellectual property rights over the Contributions belong to the
-holder of the economic rights as designated by effective legislation.
-
-6.3. OVER THE DYNAMIC MODULES
-
-The Licensee having developed a Dynamic Module is the holder of the
-intellectual property rights over said Dynamic Module and is free to choose
-the agreement that shall govern its distribution.
-
-6.4. JOINT PROVISIONS
-
-6.4.1. The Licensee expressly undertakes:
-- not to remove, or modify, in any or all manner, the intellectual
- property notices affixed to the Software;
-- to reproduce said notices, in an identical manner, in the copies of
- the Software.
-
-6.4.2. The Licensee undertakes not to directly or indirectly infringe the
-intellectual property rights of the Holder and/or Contributors and to take,
-where applicable, vis-à-vis its staff, any or all measures required to
-ensure respect for said intellectual property rights of the Holder and/or
-Contributors.
-
-
-Article 7 - RELATED SERVICES
------------------------------
-
-
-7.1. Under no circumstances shall the Agreement oblige the Licensor to
-provide technical assistance or maintenance services for the Software.
-
-However, the Licensor is entitled to offer this type of service. The
-terms and conditions of such technical assistance, and/or such
-maintenance, shall then be set forth in a separate instrument. Only the
-Licensor offering said maintenance and/or technical assistance services
-shall incur liability therefor.
-
-7.2. Similarly, any or all Licensor shall be entitled to offer to its
-Licensees, under its own responsibility, a warranty, that shall only be
-binding upon itself, for the redistribution of the Software and/or the
-Modified Software, under terms and conditions that it shall decide upon
-itself. Said warranty, and the financial terms and conditions of its
-application, shall be subject to a separate instrument executed between the
-Licensor and the Licensee.
-
-
-Article 8 - LIABILITY
-----------------------
-
-
-8.1. Subject to the provisions of Article 8.2, should the Licensor fail to
-fulfill all or part of its obligations hereunder, the Licensee shall be
-entitled to claim compensation for the direct loss suffered as a result of
-a fault on the part of the Licensor, subject to providing evidence of it.
-
-8.2. The Licensor's liability is limited to the commitments made under this
-Licensing Agreement and shall not be incurred as a result , in particular:
-(i) of loss due the Licensee's total or partial failure to fulfill its
-obligations, (ii) direct or consequential loss due to the Software's use or
-performance that is suffered by the Licensee, when the latter is a
-professional using said Software for professional purposes and (iii)
-consequential loss due to the Software's use or performance. The Parties
-expressly agree that any or all pecuniary or business loss (i.e. loss of
-data, loss of profits, operating loss, loss of customers or orders,
-opportunity cost, any disturbance to business activities) or any or all
-legal proceedings instituted against the Licensee by a third party, shall
-constitute consequential loss and shall not provide entitlement to any or
-all compensation from the Licensor.
-
-
-Article 9 - WARRANTY
----------------------
-
-
-9.1. The Licensee acknowledges that the current situation as regards
-scientific and technical know-how at the time when the Software was
-distributed did not enable all possible uses to be tested and verified, nor
-for the presence of any or all faults to be detected. In this respect, the
-Licensee's attention has been drawn to the risks associated with loading,
-using, modifying and/or developing and reproducing the Software that are
-reserved for experienced users.
-
-The Licensee shall be responsible for verifying, by any or all means, the
-product's suitability for its requirements, its due and proper functioning,
-and for ensuring that it shall not cause damage to either persons or
-property.
-
-9.2. The Licensor hereby represents, in good faith, that it is entitled to
-grant all the rights on the Software (including in particular the rights
-set forth in Article 5 hereof over the Software).
-
-9.3. The Licensee acknowledges that the Software is supplied "as is" by the
-Licensor without any or all other express or tacit warranty, other than
-that provided for in Article 9.2 and, in particular, without any or all
-warranty as to its market value, its secured, innovative or relevant
-nature.
-
-Specifically, the Licensor does not warrant that the Software is free from
-any or all error, that it shall operate continuously, that it shall be
-compatible with the Licensee's own equipment and its software
-configuration, nor that it shall meet the Licensee's requirements.
-
-9.4. The Licensor does not either expressly or tacitly warrant that the
-Software does not infringe any or all third party intellectual right
-relating to a patent, software or to any or all other property right.
-Moreover, the Licensor shall not hold the Licensee harmless against any or
-all proceedings for infringement that may be instituted in respect of the
-use, modification and redistribution of the Software. Nevertheless, should
-such proceedings be instituted against the Licensee, the Licensor shall
-provide it with technical and legal assistance for its defense. Such
-technical and legal assistance shall be decided upon on a case-by-case
-basis between the relevant Licensor and the Licensee pursuant to a
-memorandum of understanding. The Licensor disclaims any or all liability as
-regards the Licensee's use of the Software's name. No warranty shall be
-provided as regards the existence of prior rights over the name of the
-Software and as regards the existence of a trademark.
-
-
-Article 10 - TERMINATION
--------------------------
-
-
-10.1. In the event of a breach by the Licensee of its obligations
-hereunder, the Licensor may automatically terminate this Agreement thirty
-(30) days after notice has been sent to the Licensee and has remained
-ineffective.
-
-10.2. The Licensee whose Agreement is terminated shall no longer be
-authorized to use, modify or distribute the Software. However, any or all
-licenses that it may have granted prior to termination of the Agreement
-shall remain valid subject to their having been granted in compliance with
-the terms and conditions hereof.
-
-
-Article 11 - MISCELLANEOUS PROVISIONS
---------------------------------------
-
-
-11.1. EXCUSABLE EVENTS
-
-Neither Party shall be liable for any or all delay, or failure to perform
-the Agreement, that may be attributable to an event of force majeure, an
-act of God or an outside cause, such as, notably, defective functioning, or
-interruptions affecting the electricity or telecommunications networks,
-blocking of the network following a virus attack, the intervention of the
-government authorities, natural disasters, water damage, earthquakes, fire,
-explosions, strikes and labor unrest, war, etc.
-
-11.2. The fact that either Party may fail, on one or several occasions, to
-invoke one or several of the provisions hereof, shall under no
-circumstances be interpreted as being a waiver by the interested Party of
-its entitlement to invoke said provision(s) subsequently.
-
-11.3. The Agreement cancels and replaces any or all previous agreement,
-whether written or oral, between the Parties and having the same purpose,
-and constitutes the entirety of the agreement between said Parties
-concerning said purpose. No supplement or modification to the terms and
-conditions hereof shall be effective as regards the Parties unless it is
-made in writing and signed by their duly authorized representatives.
-
-11.4. In the event that one or several of the provisions hereof were to
-conflict with a current or future applicable act or legislative text, said
-act or legislative text shall take precedence, and the Parties shall make
-the necessary amendments so as to be in compliance with said act or
-legislative text. All the other provisions shall remain effective.
-Similarly, the fact that a provision of the Agreement may be null and
-void, for any reason whatsoever, shall not cause the Agreement as a whole
-to be null and void.
-
-11.5. LANGUAGE
-
-The Agreement is drafted in both French and English. In the event of a
-conflict as regards construction, the French version shall be deemed
-authentic.
-
-
-Article 12 - NEW VERSIONS OF THE AGREEMENT
--------------------------------------------
-
-
-12.1. Any or all person is authorized to duplicate and distribute copies of
-this Agreement.
-
-12.2. So as to ensure coherence, the wording of this Agreement is protected
-and may only be modified by the authors of the License, that reserve the
-right to periodically publish updates or new versions of the Agreement,
-each with a separate number. These subsequent versions may address new issues
-encountered by Free Software.
-
-12.3. Any or all Software distributed under a given version of the
-Agreement may only be subsequently distributed under the same version of
-the Agreement, or a subsequent version, subject to the provisions of
-article 5.3.4.
-
-
-Article 13 - GOVERNING LAW AND JURISDICTION
--------------------------------------------
-
-
-13.1. The Agreement is governed by French law. The Parties agree to
-endeavor to settle the disagreements or disputes that may arise during the
-performance of the Agreement out-of-court.
-
-13.2. In the absence of an out-of-court settlement within two (2) months as
-from their occurrence, and unless emergency proceedings are necessary, the
-disagreements or disputes shall be referred to the Paris Courts having
-jurisdiction, by the first Party to take action.
-
-
- Version 1.1 of 10/26/2004
-
-
-
-
-
-
-
-
-
-
-
-
+ GNU AFFERO GENERAL PUBLIC LICENSE
+ Version 3, 19 November 2007
+
+ Copyright (C) 2007 Free Software Foundation, Inc. <http://fsf.org/>
+ Everyone is permitted to copy and distribute verbatim copies
+ of this license document, but changing it is not allowed.
+
+ Preamble
+
+ The GNU Affero General Public License is a free, copyleft license for
+software and other kinds of works, specifically designed to ensure
+cooperation with the community in the case of network server software.
+
+ The licenses for most software and other practical works are designed
+to take away your freedom to share and change the works. By contrast,
+our General Public Licenses are intended to guarantee your freedom to
+share and change all versions of a program--to make sure it remains free
+software for all its users.
+
+ When we speak of free software, we are referring to freedom, not
+price. Our General Public Licenses are designed to make sure that you
+have the freedom to distribute copies of free software (and charge for
+them if you wish), that you receive source code or can get it if you
+want it, that you can change the software or use pieces of it in new
+free programs, and that you know you can do these things.
+
+ Developers that use our General Public Licenses protect your rights
+with two steps: (1) assert copyright on the software, and (2) offer
+you this License which gives you legal permission to copy, distribute
+and/or modify the software.
+
+ A secondary benefit of defending all users' freedom is that
+improvements made in alternate versions of the program, if they
+receive widespread use, become available for other developers to
+incorporate. Many developers of free software are heartened and
+encouraged by the resulting cooperation. However, in the case of
+software used on network servers, this result may fail to come about.
+The GNU General Public License permits making a modified version and
+letting the public access it on a server without ever releasing its
+source code to the public.
+
+ The GNU Affero General Public License is designed specifically to
+ensure that, in such cases, the modified source code becomes available
+to the community. It requires the operator of a network server to
+provide the source code of the modified version running there to the
+users of that server. Therefore, public use of a modified version, on
+a publicly accessible server, gives the public access to the source
+code of the modified version.
+
+ An older license, called the Affero General Public License and
+published by Affero, was designed to accomplish similar goals. This is
+a different license, not a version of the Affero GPL, but Affero has
+released a new version of the Affero GPL which permits relicensing under
+this license.
+
+ The precise terms and conditions for copying, distribution and
+modification follow.
+
+ TERMS AND CONDITIONS
+
+ 0. Definitions.
+
+ "This License" refers to version 3 of the GNU Affero General Public License.
+
+ "Copyright" also means copyright-like laws that apply to other kinds of
+works, such as semiconductor masks.
+
+ "The Program" refers to any copyrightable work licensed under this
+License. Each licensee is addressed as "you". "Licensees" and
+"recipients" may be individuals or organizations.
+
+ To "modify" a work means to copy from or adapt all or part of the work
+in a fashion requiring copyright permission, other than the making of an
+exact copy. The resulting work is called a "modified version" of the
+earlier work or a work "based on" the earlier work.
+
+ A "covered work" means either the unmodified Program or a work based
+on the Program.
+
+ To "propagate" a work means to do anything with it that, without
+permission, would make you directly or secondarily liable for
+infringement under applicable copyright law, except executing it on a
+computer or modifying a private copy. Propagation includes copying,
+distribution (with or without modification), making available to the
+public, and in some countries other activities as well.
+
+ To "convey" a work means any kind of propagation that enables other
+parties to make or receive copies. Mere interaction with a user through
+a computer network, with no transfer of a copy, is not conveying.
+
+ An interactive user interface displays "Appropriate Legal Notices"
+to the extent that it includes a convenient and prominently visible
+feature that (1) displays an appropriate copyright notice, and (2)
+tells the user that there is no warranty for the work (except to the
+extent that warranties are provided), that licensees may convey the
+work under this License, and how to view a copy of this License. If
+the interface presents a list of user commands or options, such as a
+menu, a prominent item in the list meets this criterion.
+
+ 1. Source Code.
+
+ The "source code" for a work means the preferred form of the work
+for making modifications to it. "Object code" means any non-source
+form of a work.
+
+ A "Standard Interface" means an interface that either is an official
+standard defined by a recognized standards body, or, in the case of
+interfaces specified for a particular programming language, one that
+is widely used among developers working in that language.
+
+ The "System Libraries" of an executable work include anything, other
+than the work as a whole, that (a) is included in the normal form of
+packaging a Major Component, but which is not part of that Major
+Component, and (b) serves only to enable use of the work with that
+Major Component, or to implement a Standard Interface for which an
+implementation is available to the public in source code form. A
+"Major Component", in this context, means a major essential component
+(kernel, window system, and so on) of the specific operating system
+(if any) on which the executable work runs, or a compiler used to
+produce the work, or an object code interpreter used to run it.
+
+ The "Corresponding Source" for a work in object code form means all
+the source code needed to generate, install, and (for an executable
+work) run the object code and to modify the work, including scripts to
+control those activities. However, it does not include the work's
+System Libraries, or general-purpose tools or generally available free
+programs which are used unmodified in performing those activities but
+which are not part of the work. For example, Corresponding Source
+includes interface definition files associated with source files for
+the work, and the source code for shared libraries and dynamically
+linked subprograms that the work is specifically designed to require,
+such as by intimate data communication or control flow between those
+subprograms and other parts of the work.
+
+ The Corresponding Source need not include anything that users
+can regenerate automatically from other parts of the Corresponding
+Source.
+
+ The Corresponding Source for a work in source code form is that
+same work.
+
+ 2. Basic Permissions.
+
+ All rights granted under this License are granted for the term of
+copyright on the Program, and are irrevocable provided the stated
+conditions are met. This License explicitly affirms your unlimited
+permission to run the unmodified Program. The output from running a
+covered work is covered by this License only if the output, given its
+content, constitutes a covered work. This License acknowledges your
+rights of fair use or other equivalent, as provided by copyright law.
+
+ You may make, run and propagate covered works that you do not
+convey, without conditions so long as your license otherwise remains
+in force. You may convey covered works to others for the sole purpose
+of having them make modifications exclusively for you, or provide you
+with facilities for running those works, provided that you comply with
+the terms of this License in conveying all material for which you do
+not control copyright. Those thus making or running the covered works
+for you must do so exclusively on your behalf, under your direction
+and control, on terms that prohibit them from making any copies of
+your copyrighted material outside their relationship with you.
+
+ Conveying under any other circumstances is permitted solely under
+the conditions stated below. Sublicensing is not allowed; section 10
+makes it unnecessary.
+
+ 3. Protecting Users' Legal Rights From Anti-Circumvention Law.
+
+ No covered work shall be deemed part of an effective technological
+measure under any applicable law fulfilling obligations under article
+11 of the WIPO copyright treaty adopted on 20 December 1996, or
+similar laws prohibiting or restricting circumvention of such
+measures.
+
+ When you convey a covered work, you waive any legal power to forbid
+circumvention of technological measures to the extent such circumvention
+is effected by exercising rights under this License with respect to
+the covered work, and you disclaim any intention to limit operation or
+modification of the work as a means of enforcing, against the work's
+users, your or third parties' legal rights to forbid circumvention of
+technological measures.
+
+ 4. Conveying Verbatim Copies.
+
+ You may convey verbatim copies of the Program's source code as you
+receive it, in any medium, provided that you conspicuously and
+appropriately publish on each copy an appropriate copyright notice;
+keep intact all notices stating that this License and any
+non-permissive terms added in accord with section 7 apply to the code;
+keep intact all notices of the absence of any warranty; and give all
+recipients a copy of this License along with the Program.
+
+ You may charge any price or no price for each copy that you convey,
+and you may offer support or warranty protection for a fee.
+
+ 5. Conveying Modified Source Versions.
+
+ You may convey a work based on the Program, or the modifications to
+produce it from the Program, in the form of source code under the
+terms of section 4, provided that you also meet all of these conditions:
+
+ a) The work must carry prominent notices stating that you modified
+ it, and giving a relevant date.
+
+ b) The work must carry prominent notices stating that it is
+ released under this License and any conditions added under section
+ 7. This requirement modifies the requirement in section 4 to
+ "keep intact all notices".
+
+ c) You must license the entire work, as a whole, under this
+ License to anyone who comes into possession of a copy. This
+ License will therefore apply, along with any applicable section 7
+ additional terms, to the whole of the work, and all its parts,
+ regardless of how they are packaged. This License gives no
+ permission to license the work in any other way, but it does not
+ invalidate such permission if you have separately received it.
+
+ d) If the work has interactive user interfaces, each must display
+ Appropriate Legal Notices; however, if the Program has interactive
+ interfaces that do not display Appropriate Legal Notices, your
+ work need not make them do so.
+
+ A compilation of a covered work with other separate and independent
+works, which are not by their nature extensions of the covered work,
+and which are not combined with it such as to form a larger program,
+in or on a volume of a storage or distribution medium, is called an
+"aggregate" if the compilation and its resulting copyright are not
+used to limit the access or legal rights of the compilation's users
+beyond what the individual works permit. Inclusion of a covered work
+in an aggregate does not cause this License to apply to the other
+parts of the aggregate.
+
+ 6. Conveying Non-Source Forms.
+
+ You may convey a covered work in object code form under the terms
+of sections 4 and 5, provided that you also convey the
+machine-readable Corresponding Source under the terms of this License,
+in one of these ways:
+
+ a) Convey the object code in, or embodied in, a physical product
+ (including a physical distribution medium), accompanied by the
+ Corresponding Source fixed on a durable physical medium
+ customarily used for software interchange.
+
+ b) Convey the object code in, or embodied in, a physical product
+ (including a physical distribution medium), accompanied by a
+ written offer, valid for at least three years and valid for as
+ long as you offer spare parts or customer support for that product
+ model, to give anyone who possesses the object code either (1) a
+ copy of the Corresponding Source for all the software in the
+ product that is covered by this License, on a durable physical
+ medium customarily used for software interchange, for a price no
+ more than your reasonable cost of physically performing this
+ conveying of source, or (2) access to copy the
+ Corresponding Source from a network server at no charge.
+
+ c) Convey individual copies of the object code with a copy of the
+ written offer to provide the Corresponding Source. This
+ alternative is allowed only occasionally and noncommercially, and
+ only if you received the object code with such an offer, in accord
+ with subsection 6b.
+
+ d) Convey the object code by offering access from a designated
+ place (gratis or for a charge), and offer equivalent access to the
+ Corresponding Source in the same way through the same place at no
+ further charge. You need not require recipients to copy the
+ Corresponding Source along with the object code. If the place to
+ copy the object code is a network server, the Corresponding Source
+ may be on a different server (operated by you or a third party)
+ that supports equivalent copying facilities, provided you maintain
+ clear directions next to the object code saying where to find the
+ Corresponding Source. Regardless of what server hosts the
+ Corresponding Source, you remain obligated to ensure that it is
+ available for as long as needed to satisfy these requirements.
+
+ e) Convey the object code using peer-to-peer transmission, provided
+ you inform other peers where the object code and Corresponding
+ Source of the work are being offered to the general public at no
+ charge under subsection 6d.
+
+ A separable portion of the object code, whose source code is excluded
+from the Corresponding Source as a System Library, need not be
+included in conveying the object code work.
+
+ A "User Product" is either (1) a "consumer product", which means any
+tangible personal property which is normally used for personal, family,
+or household purposes, or (2) anything designed or sold for incorporation
+into a dwelling. In determining whether a product is a consumer product,
+doubtful cases shall be resolved in favor of coverage. For a particular
+product received by a particular user, "normally used" refers to a
+typical or common use of that class of product, regardless of the status
+of the particular user or of the way in which the particular user
+actually uses, or expects or is expected to use, the product. A product
+is a consumer product regardless of whether the product has substantial
+commercial, industrial or non-consumer uses, unless such uses represent
+the only significant mode of use of the product.
+
+ "Installation Information" for a User Product means any methods,
+procedures, authorization keys, or other information required to install
+and execute modified versions of a covered work in that User Product from
+a modified version of its Corresponding Source. The information must
+suffice to ensure that the continued functioning of the modified object
+code is in no case prevented or interfered with solely because
+modification has been made.
+
+ If you convey an object code work under this section in, or with, or
+specifically for use in, a User Product, and the conveying occurs as
+part of a transaction in which the right of possession and use of the
+User Product is transferred to the recipient in perpetuity or for a
+fixed term (regardless of how the transaction is characterized), the
+Corresponding Source conveyed under this section must be accompanied
+by the Installation Information. But this requirement does not apply
+if neither you nor any third party retains the ability to install
+modified object code on the User Product (for example, the work has
+been installed in ROM).
+
+ The requirement to provide Installation Information does not include a
+requirement to continue to provide support service, warranty, or updates
+for a work that has been modified or installed by the recipient, or for
+the User Product in which it has been modified or installed. Access to a
+network may be denied when the modification itself materially and
+adversely affects the operation of the network or violates the rules and
+protocols for communication across the network.
+
+ Corresponding Source conveyed, and Installation Information provided,
+in accord with this section must be in a format that is publicly
+documented (and with an implementation available to the public in
+source code form), and must require no special password or key for
+unpacking, reading or copying.
+
+ 7. Additional Terms.
+
+ "Additional permissions" are terms that supplement the terms of this
+License by making exceptions from one or more of its conditions.
+Additional permissions that are applicable to the entire Program shall
+be treated as though they were included in this License, to the extent
+that they are valid under applicable law. If additional permissions
+apply only to part of the Program, that part may be used separately
+under those permissions, but the entire Program remains governed by
+this License without regard to the additional permissions.
+
+ When you convey a copy of a covered work, you may at your option
+remove any additional permissions from that copy, or from any part of
+it. (Additional permissions may be written to require their own
+removal in certain cases when you modify the work.) You may place
+additional permissions on material, added by you to a covered work,
+for which you have or can give appropriate copyright permission.
+
+ Notwithstanding any other provision of this License, for material you
+add to a covered work, you may (if authorized by the copyright holders of
+that material) supplement the terms of this License with terms:
+
+ a) Disclaiming warranty or limiting liability differently from the
+ terms of sections 15 and 16 of this License; or
+
+ b) Requiring preservation of specified reasonable legal notices or
+ author attributions in that material or in the Appropriate Legal
+ Notices displayed by works containing it; or
+
+ c) Prohibiting misrepresentation of the origin of that material, or
+ requiring that modified versions of such material be marked in
+ reasonable ways as different from the original version; or
+
+ d) Limiting the use for publicity purposes of names of licensors or
+ authors of the material; or
+
+ e) Declining to grant rights under trademark law for use of some
+ trade names, trademarks, or service marks; or
+
+ f) Requiring indemnification of licensors and authors of that
+ material by anyone who conveys the material (or modified versions of
+ it) with contractual assumptions of liability to the recipient, for
+ any liability that these contractual assumptions directly impose on
+ those licensors and authors.
+
+ All other non-permissive additional terms are considered "further
+restrictions" within the meaning of section 10. If the Program as you
+received it, or any part of it, contains a notice stating that it is
+governed by this License along with a term that is a further
+restriction, you may remove that term. If a license document contains
+a further restriction but permits relicensing or conveying under this
+License, you may add to a covered work material governed by the terms
+of that license document, provided that the further restriction does
+not survive such relicensing or conveying.
+
+ If you add terms to a covered work in accord with this section, you
+must place, in the relevant source files, a statement of the
+additional terms that apply to those files, or a notice indicating
+where to find the applicable terms.
+
+ Additional terms, permissive or non-permissive, may be stated in the
+form of a separately written license, or stated as exceptions;
+the above requirements apply either way.
+
+ 8. Termination.
+
+ You may not propagate or modify a covered work except as expressly
+provided under this License. Any attempt otherwise to propagate or
+modify it is void, and will automatically terminate your rights under
+this License (including any patent licenses granted under the third
+paragraph of section 11).
+
+ However, if you cease all violation of this License, then your
+license from a particular copyright holder is reinstated (a)
+provisionally, unless and until the copyright holder explicitly and
+finally terminates your license, and (b) permanently, if the copyright
+holder fails to notify you of the violation by some reasonable means
+prior to 60 days after the cessation.
+
+ Moreover, your license from a particular copyright holder is
+reinstated permanently if the copyright holder notifies you of the
+violation by some reasonable means, this is the first time you have
+received notice of violation of this License (for any work) from that
+copyright holder, and you cure the violation prior to 30 days after
+your receipt of the notice.
+
+ Termination of your rights under this section does not terminate the
+licenses of parties who have received copies or rights from you under
+this License. If your rights have been terminated and not permanently
+reinstated, you do not qualify to receive new licenses for the same
+material under section 10.
+
+ 9. Acceptance Not Required for Having Copies.
+
+ You are not required to accept this License in order to receive or
+run a copy of the Program. Ancillary propagation of a covered work
+occurring solely as a consequence of using peer-to-peer transmission
+to receive a copy likewise does not require acceptance. However,
+nothing other than this License grants you permission to propagate or
+modify any covered work. These actions infringe copyright if you do
+not accept this License. Therefore, by modifying or propagating a
+covered work, you indicate your acceptance of this License to do so.
+
+ 10. Automatic Licensing of Downstream Recipients.
+
+ Each time you convey a covered work, the recipient automatically
+receives a license from the original licensors, to run, modify and
+propagate that work, subject to this License. You are not responsible
+for enforcing compliance by third parties with this License.
+
+ An "entity transaction" is a transaction transferring control of an
+organization, or substantially all assets of one, or subdividing an
+organization, or merging organizations. If propagation of a covered
+work results from an entity transaction, each party to that
+transaction who receives a copy of the work also receives whatever
+licenses to the work the party's predecessor in interest had or could
+give under the previous paragraph, plus a right to possession of the
+Corresponding Source of the work from the predecessor in interest, if
+the predecessor has it or can get it with reasonable efforts.
+
+ You may not impose any further restrictions on the exercise of the
+rights granted or affirmed under this License. For example, you may
+not impose a license fee, royalty, or other charge for exercise of
+rights granted under this License, and you may not initiate litigation
+(including a cross-claim or counterclaim in a lawsuit) alleging that
+any patent claim is infringed by making, using, selling, offering for
+sale, or importing the Program or any portion of it.
+
+ 11. Patents.
+
+ A "contributor" is a copyright holder who authorizes use under this
+License of the Program or a work on which the Program is based. The
+work thus licensed is called the contributor's "contributor version".
+
+ A contributor's "essential patent claims" are all patent claims
+owned or controlled by the contributor, whether already acquired or
+hereafter acquired, that would be infringed by some manner, permitted
+by this License, of making, using, or selling its contributor version,
+but do not include claims that would be infringed only as a
+consequence of further modification of the contributor version. For
+purposes of this definition, "control" includes the right to grant
+patent sublicenses in a manner consistent with the requirements of
+this License.
+
+ Each contributor grants you a non-exclusive, worldwide, royalty-free
+patent license under the contributor's essential patent claims, to
+make, use, sell, offer for sale, import and otherwise run, modify and
+propagate the contents of its contributor version.
+
+ In the following three paragraphs, a "patent license" is any express
+agreement or commitment, however denominated, not to enforce a patent
+(such as an express permission to practice a patent or covenant not to
+sue for patent infringement). To "grant" such a patent license to a
+party means to make such an agreement or commitment not to enforce a
+patent against the party.
+
+ If you convey a covered work, knowingly relying on a patent license,
+and the Corresponding Source of the work is not available for anyone
+to copy, free of charge and under the terms of this License, through a
+publicly available network server or other readily accessible means,
+then you must either (1) cause the Corresponding Source to be so
+available, or (2) arrange to deprive yourself of the benefit of the
+patent license for this particular work, or (3) arrange, in a manner
+consistent with the requirements of this License, to extend the patent
+license to downstream recipients. "Knowingly relying" means you have
+actual knowledge that, but for the patent license, your conveying the
+covered work in a country, or your recipient's use of the covered work
+in a country, would infringe one or more identifiable patents in that
+country that you have reason to believe are valid.
+
+ If, pursuant to or in connection with a single transaction or
+arrangement, you convey, or propagate by procuring conveyance of, a
+covered work, and grant a patent license to some of the parties
+receiving the covered work authorizing them to use, propagate, modify
+or convey a specific copy of the covered work, then the patent license
+you grant is automatically extended to all recipients of the covered
+work and works based on it.
+
+ A patent license is "discriminatory" if it does not include within
+the scope of its coverage, prohibits the exercise of, or is
+conditioned on the non-exercise of one or more of the rights that are
+specifically granted under this License. You may not convey a covered
+work if you are a party to an arrangement with a third party that is
+in the business of distributing software, under which you make payment
+to the third party based on the extent of your activity of conveying
+the work, and under which the third party grants, to any of the
+parties who would receive the covered work from you, a discriminatory
+patent license (a) in connection with copies of the covered work
+conveyed by you (or copies made from those copies), or (b) primarily
+for and in connection with specific products or compilations that
+contain the covered work, unless you entered into that arrangement,
+or that patent license was granted, prior to 28 March 2007.
+
+ Nothing in this License shall be construed as excluding or limiting
+any implied license or other defenses to infringement that may
+otherwise be available to you under applicable patent law.
+
+ 12. No Surrender of Others' Freedom.
+
+ If conditions are imposed on you (whether by court order, agreement or
+otherwise) that contradict the conditions of this License, they do not
+excuse you from the conditions of this License. If you cannot convey a
+covered work so as to satisfy simultaneously your obligations under this
+License and any other pertinent obligations, then as a consequence you may
+not convey it at all. For example, if you agree to terms that obligate you
+to collect a royalty for further conveying from those to whom you convey
+the Program, the only way you could satisfy both those terms and this
+License would be to refrain entirely from conveying the Program.
+
+ 13. Remote Network Interaction; Use with the GNU General Public License.
+
+ Notwithstanding any other provision of this License, if you modify the
+Program, your modified version must prominently offer all users
+interacting with it remotely through a computer network (if your version
+supports such interaction) an opportunity to receive the Corresponding
+Source of your version by providing access to the Corresponding Source
+from a network server at no charge, through some standard or customary
+means of facilitating copying of software. This Corresponding Source
+shall include the Corresponding Source for any work covered by version 3
+of the GNU General Public License that is incorporated pursuant to the
+following paragraph.
+
+ Notwithstanding any other provision of this License, you have
+permission to link or combine any covered work with a work licensed
+under version 3 of the GNU General Public License into a single
+combined work, and to convey the resulting work. The terms of this
+License will continue to apply to the part which is the covered work,
+but the work with which it is combined will remain governed by version
+3 of the GNU General Public License.
+
+ 14. Revised Versions of this License.
+
+ The Free Software Foundation may publish revised and/or new versions of
+the GNU Affero General Public License from time to time. Such new versions
+will be similar in spirit to the present version, but may differ in detail to
+address new problems or concerns.
+
+ Each version is given a distinguishing version number. If the
+Program specifies that a certain numbered version of the GNU Affero General
+Public License "or any later version" applies to it, you have the
+option of following the terms and conditions either of that numbered
+version or of any later version published by the Free Software
+Foundation. If the Program does not specify a version number of the
+GNU Affero General Public License, you may choose any version ever published
+by the Free Software Foundation.
+
+ If the Program specifies that a proxy can decide which future
+versions of the GNU Affero General Public License can be used, that proxy's
+public statement of acceptance of a version permanently authorizes you
+to choose that version for the Program.
+
+ Later license versions may give you additional or different
+permissions. However, no additional obligations are imposed on any
+author or copyright holder as a result of your choosing to follow a
+later version.
+
+ 15. Disclaimer of Warranty.
+
+ THERE IS NO WARRANTY FOR THE PROGRAM, TO THE EXTENT PERMITTED BY
+APPLICABLE LAW. EXCEPT WHEN OTHERWISE STATED IN WRITING THE COPYRIGHT
+HOLDERS AND/OR OTHER PARTIES PROVIDE THE PROGRAM "AS IS" WITHOUT WARRANTY
+OF ANY KIND, EITHER EXPRESSED OR IMPLIED, INCLUDING, BUT NOT LIMITED TO,
+THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
+PURPOSE. THE ENTIRE RISK AS TO THE QUALITY AND PERFORMANCE OF THE PROGRAM
+IS WITH YOU. SHOULD THE PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF
+ALL NECESSARY SERVICING, REPAIR OR CORRECTION.
+
+ 16. Limitation of Liability.
+
+ IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN WRITING
+WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MODIFIES AND/OR CONVEYS
+THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU FOR DAMAGES, INCLUDING ANY
+GENERAL, SPECIAL, INCIDENTAL OR CONSEQUENTIAL DAMAGES ARISING OUT OF THE
+USE OR INABILITY TO USE THE PROGRAM (INCLUDING BUT NOT LIMITED TO LOSS OF
+DATA OR DATA BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY YOU OR THIRD
+PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER PROGRAMS),
+EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE POSSIBILITY OF
+SUCH DAMAGES.
+
+ 17. Interpretation of Sections 15 and 16.
+
+ If the disclaimer of warranty and limitation of liability provided
+above cannot be given local legal effect according to their terms,
+reviewing courts shall apply local law that most closely approximates
+an absolute waiver of all civil liability in connection with the
+Program, unless a warranty or assumption of liability accompanies a
+copy of the Program in return for a fee.
+
+ END OF TERMS AND CONDITIONS
+
+ How to Apply These Terms to Your New Programs
+
+ If you develop a new program, and you want it to be of the greatest
+possible use to the public, the best way to achieve this is to make it
+free software which everyone can redistribute and change under these terms.
+
+ To do so, attach the following notices to the program. It is safest
+to attach them to the start of each source file to most effectively
+state the exclusion of warranty; and each file should have at least
+the "copyright" line and a pointer to where the full notice is found.
+
+ <one line to give the program's name and a brief idea of what it does.>
+ Copyright (C) <year> <name of author>
+
+ This program is free software: you can redistribute it and/or modify
+ it under the terms of the GNU Affero General Public License as published by
+ the Free Software Foundation, either version 3 of the License, or
+ (at your option) any later version.
+
+ This program is distributed in the hope that it will be useful,
+ but WITHOUT ANY WARRANTY; without even the implied warranty of
+ MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ GNU Affero General Public License for more details.
+
+ You should have received a copy of the GNU Affero General Public License
+ along with this program. If not, see <http://www.gnu.org/licenses/>.
+
+Also add information on how to contact you by electronic and paper mail.
+
+ If your software can interact with users remotely through a computer
+network, you should also make sure that it provides a way for users to
+get its source. For example, if your program is a web application, its
+interface could display a "Source" link that leads users to an archive
+of the code. There are many ways you could offer source, and different
+solutions will be better for different programs; see section 13 for the
+specific requirements.
+
+ You should also get your employer (if you work as a programmer) or school,
+if any, to sign a "copyright disclaimer" for the program, if necessary.
+For more information on this, and how to apply and follow the GNU AGPL, see
+<http://www.gnu.org/licenses/>.
diff --git a/LargeInt.cpp b/LargeInt.cpp
deleted file mode 100644
index 926d916..0000000
--- a/LargeInt.cpp
+++ /dev/null
@@ -1,277 +0,0 @@
-#ifndef ASSERTS
-#define NDEBUG // disable asserts; those asserts make sure that with PRECISION == [1 or 2], all is correct
-#endif
-
-// some 64-bit assert macros
-#if defined(_LP64) && defined(_largeint)
-#define assert128(x) assert(precision != 2 || (x));
-#else
-#define assert128(x) ;
-#endif
-
-#include <assert.h>
-#include <stdio.h>
-#include "LargeInt.h"
-
-using namespace std;
-
-template<int precision>
-LargeInt<precision>::LargeInt()
-{
-}
-
-template<int precision>
-LargeInt<precision>::LargeInt(const uint64_t &c)
-{
- array[0] = c;
- for (int i = 1; i < precision; i++)
- array[i] = 0;
-}
-
-
-template<int precision>
-LargeInt<precision> LargeInt<precision>::operator+ (const LargeInt<precision>& other) const
-{
- LargeInt<precision> result;
- int carry = 0;
- for (int i = 0 ; i < precision ; i++)
- {
- result.array[i] = array[i] + other.array[i] + carry;
- carry = (result.array[i] < array[i]) ? 1 : 0;
- }
-
- assert(precision != 1 || (result == other.array[0] + array[0]));
- assert128(result.toInt128() == other.toInt128() + toInt128());
- return result;
-}
-
-template<int precision>
-LargeInt<precision> LargeInt<precision>::operator- (const LargeInt<precision>& other) const
-{
- LargeInt<precision> result;
- int carry = 0;
- for (int i = 0 ; i < precision ; i++)
- {
- result.array[i] = array[i] - other.array[i] - carry;
- carry = (result.array[i] > array[i]) ? 1 : 0;
- }
-
- assert(precision != 1 || (result == array[0] - other.array[0]));
- assert128(result.toInt128() == toInt128() - other.toInt128());
- return result;
-}
-
-
-template<int precision>
-LargeInt<precision> LargeInt<precision>::operator* (const int& coeff) const
-{
- LargeInt<precision> result (*this);
- // minia doesn't have that many multiplications cases
-
- if (coeff == 2 || coeff == 4)
- {
- result = result << (coeff / 2);
- }
- else
- {
- if (coeff == 21)
- {
- result = (result << 4) + (result << 2) + result;
- }
- else
- {
- printf("unsupported LargeInt multiplication: %d\n",coeff);
- exit(1);
- }
- }
-
- assert(precision != 1 || (result == array[0] * coeff));
- assert128(result.toInt128() == toInt128() * coeff);
- return result;
-}
-
-
-template<int precision>
-LargeInt<precision> LargeInt<precision>::operator/ (const uint32_t& divisor) const
-{
- LargeInt<precision> result;
- fill( result.array, result.array + precision, 0 );
-
- // inspired by Divide32() from http://subversion.assembla.com/svn/pxcode/RakNet/Source/BigInt.cpp
-
- uint64_t r = 0;
- uint32_t mask32bits = ~0;
- for (int i = precision-1; i >= 0; --i)
- {
- for (int j = 1; j >= 0; --j) // [j=1: high-32 bits, j=0: low-32 bits] of array[i]
- {
- uint64_t n = (r << 32) | ((array[i] >> (32*j)) & mask32bits );
- result.array[i] = result.array[i] | (((n / divisor) & mask32bits) << (32*j));
- r = n % divisor;
- }
- }
- assert(precision != 1 || (result == array[0] / divisor));
- assert128(result.toInt128() == toInt128() / divisor);
- return result;
-}
-
-
-template<int precision>
-uint32_t LargeInt<precision>::operator% (const uint32_t& divisor) const
-{
- uint64_t r = 0;
- uint32_t mask32bits = ~0;
- for (int i = precision-1; i >= 0; --i)
- {
- for (int j = 1; j >= 0; --j) // [j=1: high-32 bits, j=0: low-32 bits] of array[i]
- {
- uint64_t n = (r << 32) | ((array[i] >> (32*j)) & mask32bits );
- r = n % divisor;
- }
- }
-
- assert(precision != 1 || (r == array[0] % divisor));
- assert128(r == toInt128() % divisor);
- return (uint32_t)r;
-}
-
-template<int precision>
-LargeInt<precision> LargeInt<precision>::operator^ (const LargeInt& other) const
-{
- LargeInt<precision> result;
- for (int i=0 ; i < precision ; i++)
- result.array[i] = array[i] ^ other.array[i];
-
- assert(precision != 1 || (result == (array[0] ^ other.array[0])));
- assert128(result.toInt128() == (toInt128() ^ other.toInt128()));
- return result;
-}
-
-template<int precision>
-LargeInt<precision> LargeInt<precision>::operator& (const LargeInt& other) const
-{
- LargeInt<precision> result;
- for (int i=0 ; i < precision ; i++)
- result.array[i] = array[i] & other.array[i];
-
- assert(precision != 1 || (result == (array[0] & other.array[0])));
- assert128(result.toInt128() == (toInt128() & other.toInt128()));
- return result;
-}
-
-
-template<int precision>
-LargeInt<precision> LargeInt<precision>::operator~ () const
-{
- LargeInt<precision> result;
- for (int i=0 ; i < precision ; i++)
- result.array[i] = ~array[i];
-
- assert(precision != 1 || (result == ~array[0]));
- assert128(result.toInt128() == ~toInt128());
- return result;
-}
-
-template<int precision>
-LargeInt<precision> LargeInt<precision>::operator<< (const int& coeff) const
-{
- LargeInt<precision> result (0);
-
- int large_shift = coeff / 64;
- int small_shift = coeff % 64;
-
- for (int i = large_shift ; i < precision-1; i++)
- {
- result.array[i] = result.array[i] | (array[i-large_shift] << small_shift);
- if (small_shift == 0) // gcc "bug".. uint64_t x; x>>64 == 1<<63, x<<64 == 1
- result.array[i+1] = 0;
- else
- result.array[i+1] = array[i-large_shift] >> (64 - small_shift);
-
- }
- result.array[precision-1] = result.array[precision-1] | (array[precision-1-large_shift] << small_shift);
-
- assert(precision != 1 || (result == (array[0] << coeff)));
- assert128(result.toInt128() == (toInt128() << coeff));
- return result;
-}
-
-template<int precision>
-LargeInt<precision> LargeInt<precision>::operator>> (const int& coeff) const
-{
- LargeInt<precision> result (0);
-
- int large_shift = coeff / 64;
- int small_shift = coeff % 64;
-
- result.array[0] = (array[large_shift] >> small_shift);
-
- for (int i = 1 ; i < precision - large_shift ; i++)
- {
- result.array[i] = (array[i+large_shift] >> small_shift);
- if (small_shift == 0 && large_shift > 0) // gcc "bug".. uint64_t x; x>>64 == 1<<63, x<<64 == 1
- {
- result.array[i-1] = result.array[i-1];
- }
- else
- {
- result.array[i-1] = result.array[i-1] | (array[i+large_shift] << (64 - small_shift));
- }
- }
-
- assert(precision != 1 || ( small_shift == 0 || (result == array[0] >> coeff)));
- assert128(small_shift == 0 || (result.toInt128() == (toInt128() >> coeff)));
- return result;
-}
-
-template<int precision>
-bool LargeInt<precision>::operator!= (const LargeInt& c) const
-{
- for (int i = 0 ; i < precision ; i++)
- if( array[i] != c.array[i] )
- return true;
- return false;
-}
-
-template<int precision>
-bool LargeInt<precision>::operator== (const LargeInt& c) const
-{
- for (int i = 0 ; i < precision ; i++)
- if( array[i] != c.array[i] )
- return false;
- return true;
-}
-
-template<int precision>
-bool LargeInt<precision>::operator< (const LargeInt& c) const
-{
- for (int i = precision-1 ; i>=0 ; --i)
- if( array[i] != c.array[i] )
- return array[i] < c.array[i];
-
- return false;
-}
-
-template<int precision>
-bool LargeInt<precision>::operator<=(const LargeInt& c) const
-{
- return operator==(c) || operator<(c);
-}
-
-template<int precision>
-uint64_t LargeInt<precision>::toInt() const
-{
- return array[0];
-}
-
-#ifdef _LP64
-template<int precision>
-__uint128_t LargeInt<precision>::toInt128() const
-{
- return ((__uint128_t)array[0]) + (((__uint128_t)array[1]) << ((__uint128_t)64));
-}
-#endif
-
-#ifdef KMER_PRECISION
-template class LargeInt<KMER_PRECISION>; // since we didn't define the functions in a .h file, that trick removes linker errors, see http://www.parashift.com/c++-faq-lite/separate-template-class-defn-from-decl.html
-#endif
diff --git a/LargeInt.h b/LargeInt.h
deleted file mode 100644
index 51958c7..0000000
--- a/LargeInt.h
+++ /dev/null
@@ -1,48 +0,0 @@
-/*
- * arbitrary-precision integer library
- * very limited: only does what minia needs (but not what minia deserves)
- */
-
-#ifndef LargeInt_h
-#define LargeInt_h
-
-#include <stdint.h>
-#include <algorithm>
-
-template<int precision>
-class LargeInt
-{
-
- public:
- uint64_t array[precision];
- LargeInt(const uint64_t &);
- LargeInt();
-
- // overloading
- LargeInt operator+(const LargeInt &) const;
- LargeInt operator-(const LargeInt &) const;
- LargeInt operator*(const int &) const;
- LargeInt operator/(const uint32_t &) const;
- uint32_t operator%(const uint32_t &) const;
- LargeInt operator^(const LargeInt &) const;
- LargeInt operator&(const LargeInt &) const;
- LargeInt operator~() const;
- LargeInt operator<<(const int &) const;
- LargeInt operator>>(const int &) const;
- bool operator!=(const LargeInt &) const;
- bool operator==(const LargeInt &) const;
- bool operator<(const LargeInt &) const;
- bool operator<=(const LargeInt &) const;
-
- // custom
- uint64_t toInt() const;
- #ifdef _LP64
- __uint128_t toInt128() const;
- #endif
-
-
-// c++ fun fact:
-// "const" will ban the function from being anything which can attempt to alter any member variables in the object.
-};
-
-#endif
diff --git a/LinearCounter.cpp b/LinearCounter.cpp
deleted file mode 100644
index ec0795f..0000000
--- a/LinearCounter.cpp
+++ /dev/null
@@ -1,47 +0,0 @@
-#include <algorithm> // for max
-#include "LinearCounter.h"
-
-using namespace std; // for max
-
-// counter the number of distinct kmers
-// implements a linear counter following [1] K. Whang, B. T. Vander-Zaden, H.M. Taylor. A Liner-Time Probabilistic Counting Algorithm for Database Applications
-// an easier presentation is there: http://highlyscalable.wordpress.com/2012/05/01/probabilistic-structures-web-analytics-data-mining/
-// here, it's implements as a wrapper around a special Bloom
-
-LinearCounter::LinearCounter(long size) : desired_size(size)
-{
- int bloom_nbits = max( (int)ceilf(log2f(size)), 1);
- bloom = new Bloom(bloom_nbits);
- bloom->set_number_of_hash_func(1);
- bloom_size = 1L << bloom_nbits;
-}
-
-void LinearCounter::add(bloom_elem kmer)
-{
- bloom->add(kmer);
-}
-
-int LinearCounter::contains(bloom_elem kmer)
-{
- // dummy, because bloom_pass_reads wants this method to be exposed
- return 0;
-}
-
-long LinearCounter::count()
-{
- long weight = bloom->weight();
- //printf("linear counter load factor: %0.2f\n",(1.0*weight/bloom_size));
- return (long) ( (-1.0*bloom_size) * logf( (1.0*bloom_size - weight) / bloom_size ) ); // linear counter cardinality estimation
-}
-
-bool LinearCounter::is_accurate()
-{
- long weight = bloom->weight();
- float load_factor = (1.0*weight/bloom_size);
- return load_factor < 0.99;
-}
-
-LinearCounter::~LinearCounter()
-{
- delete bloom;
-}
diff --git a/LinearCounter.h b/LinearCounter.h
deleted file mode 100644
index 589eae8..0000000
--- a/LinearCounter.h
+++ /dev/null
@@ -1,29 +0,0 @@
-//
-// LinearCounter.h
-
-#ifndef LinearCounter_h
-#define LinearCounter_h
-#include <stdlib.h>
-#include <inttypes.h>
-#include <stdint.h>
-#include <cmath> // for log2f
-#include "Bank.h"
-#include "Bloom.h"
-
-class LinearCounter{
-
-protected:
-
- Bloom *bloom;
- unsigned long desired_size, bloom_size;
-public:
- void add(bloom_elem kmer);
- long count();
- int contains(bloom_elem kmer); // dummy, because bloom_pass_reads wants this method to be exposed
- bool is_accurate();
-
- LinearCounter(long size);
- ~LinearCounter();
-};
-
-#endif
diff --git a/Minia.cpp b/Minia.cpp
deleted file mode 100644
index a04ce1a..0000000
--- a/Minia.cpp
+++ /dev/null
@@ -1,351 +0,0 @@
-#include <stdio.h>
-#include <stdlib.h>
-#include <time.h>
-#include <string.h>
-#include <unistd.h>
-#include <sys/types.h>
-#include <inttypes.h>
-#include <stdint.h>
-#include <algorithm> // for max/min
-#include <vector> // for sorting_kmers
-#include <sys/time.h>
-
-#define NNKS 4 // default minimal abundance for solidity
-#define MIN_CONTIG_SIZE (2*sizeKmer+1)
-
-int max_memory; // the most memory one should alloc at any time, in MB
-
-int order = 0; // deblooming order; 0 = debloom everything; 1 = don't debloom 1-node tips (experimental, untested, shouldn't work);// (made extern int in Traversal.h)
-
-#include "Bank.h"
-#include "Hash16.h"
-#include "Set.h"
-#include "Pool.h"
-#include "Bloom.h"
-#include "Debloom.h"
-#include "Utils.h"
-#include "SortingCount.h"
-#include "Terminator.h"
-#include "Kmer.h"
-#include "Traversal.h"
-#include "rvalues.h" // for 4bloom
-
-
-int64_t genome_size;
-Bloom * bloo1;
-
-
-inline void assemble()
-{
-
- //////-------------------------------------------------------------------------------------------
- fprintf (stderr,"______________________________________________________ \n");
- fprintf (stderr,"___________ Assemble from bloom filter _______________ \n");
- fprintf (stderr,"______________________________________________________ \n\n");
-
- //////-------------------------------------------------------------------------------------------
-
-
- long long len_left = 0;
- long long len_right = 0;
- long long contig_len =0;
- long long maxlen=10000000;
-
- char *left_traversal = (char *) malloc(maxlen*sizeof(char));
- char *right_traversal = (char *) malloc(maxlen*sizeof(char));
- char *contig = (char *) malloc(2*(maxlen+sizeKmer)*sizeof(char));
- kmer_type kmer;
-
- long long nbContig =0;
- long long nbSmallContig =0;
- long long totalnt=0;
- long long max_contig_len=0;
- long long mlenleft=0,mlenright=0;
- int64_t NbBranchingKmer=0;
- char kmer_seq[sizeKmer+1];
- FILE * file_assembly = fopen(return_file_name(assembly_file),"w+");
-
- BinaryBank *SolidKmers = new BinaryBank(return_file_name(solid_kmers_file),sizeof(kmer_type),0);
-
- STARTWALL(assembly);
-
- char *assemble_only_one_region = NULL; // debugging, set to a ASCII kmer to activate, NULL to desactivate
- bool LOAD_BRANCHING_KMERS=false; // debugging
- bool DUMP_BRANCHING_KMERS=false;
-
- BranchingTerminator *terminator;
-
- if (LOAD_BRANCHING_KMERS)
- {
- BinaryBank *BranchingKmers = new BinaryBank(return_file_name(branching_kmers_file),sizeof(kmer_type),false);
- terminator = new BranchingTerminator(BranchingKmers,SolidKmers, bloo1,false_positives);
- BranchingKmers->close();
- }
- else
- terminator = new BranchingTerminator(SolidKmers,genome_size, bloo1,false_positives);
-
- if (DUMP_BRANCHING_KMERS)
- {
- BinaryBank *BranchingKmers = new BinaryBank(return_file_name(branching_kmers_file),sizeof(kmer_type),true);
- terminator->dump_branching_kmers(BranchingKmers);
- BranchingKmers->close();
- }
-
-#ifdef UNITIG
- SimplePathsTraversal *traversal = new SimplePathsTraversal(bloo1,false_positives,terminator);
- fprintf (stderr,"_________________Assembling in Unitig mode ..._____________________ \n\n");
-#else
- MonumentTraversal *traversal = new MonumentTraversal(bloo1,false_positives,terminator);
-#endif
- //RandomBranchingTraversal *traversal = new RandomBranchingTraversal(bloo1,false_positives,terminator);
- traversal->set_maxlen(maxlen);
- traversal->set_max_depth(500);
- traversal->set_max_breadth(20);
-
- while (terminator->next(&kmer))
- {
- // keep looping while a starting kmer is available from this kmer
- // everything will be marked during the traversal()'s
- kmer_type starting_kmer;
-#ifdef UNITIG
- while (traversal->get_new_starting_node_improved(kmer,starting_kmer))
-#else
- while (traversal->find_starting_kmer(kmer,starting_kmer))
-#endif
- {
- code2seq(starting_kmer,kmer_seq); // convert starting kmer to nucleotide seq
- traversal->revert_stats(); // set stats from the last commit (discard stats from find_starting_kmer / small contigs)
-
- if (assemble_only_one_region != NULL)
- {
- kmer_type dummy;
- starting_kmer = extractKmerFromRead(assemble_only_one_region,0,&kmer,&dummy,false);
- }
-
- // right extension
- len_right = traversal->traverse(starting_kmer,right_traversal,0);
- mlenright= max(len_right,mlenright);
-
- // left extension, is equivalent to right extension of the revcomp
- len_left = traversal->traverse(starting_kmer,left_traversal,1);
- mlenleft= max(len_left,mlenleft);
-
- // form the contig
- revcomp_sequence(left_traversal,len_left);
- strcpy(contig,left_traversal); // contig = revcomp(left_traversal)
- strcat(contig,kmer_seq);// + starting_kmer
- strcat(contig,right_traversal);// + right_traversal
-
- contig_len=len_left+len_right+sizeKmer;
-
- // save the contig
- if(contig_len >= MIN_CONTIG_SIZE)
- {
- max_contig_len = max(max_contig_len,contig_len);
- fprintf(file_assembly,">%lli__len__%lli \n",nbContig,contig_len);
- fprintf(file_assembly,"%s\n",contig);
- nbContig++;
- totalnt+=contig_len;
- traversal->commit_stats();
- }
- else
- {
- traversal->revert_stats();
- nbSmallContig++;
- }
- if (assemble_only_one_region != NULL)
- break;
- }
-
- NbBranchingKmer++;
- if ((NbBranchingKmer%300)==0) fprintf (stderr,"%cLooping through branching kmer n° %lld / %lld total nt %lld ",13,(long long int) NbBranchingKmer,(long long int) terminator->nb_branching_kmers, (long long int)totalnt );
-
- if (nbContig > 0 && assemble_only_one_region != NULL)
- break;
-
- }
- fclose(file_assembly);
-
- fprintf (stderr,"\n Total nt assembled %lli nbContig %lli\n",totalnt,nbContig);
- fprintf (stderr," Max contig len %lli (debug: max len left %lli, max len right %lli)\n",max_contig_len,mlenleft,mlenright);
- fprintf (stderr,"\n Debug traversal stats: %ld ends of contigs (%lld unsaved small contigs), among them:\n",traversal->final_stats.ended_traversals,nbSmallContig);
- fprintf (stderr," %ld couldn't validate consensuses\n",traversal->final_stats.couldnt_validate_consensuses);
- fprintf (stderr," %ld large bubble breadth, %ld large bubble depth, %ld marked kmer, %ld no extension\n",traversal->final_stats.couldnt_traverse_bubble_breadth,traversal->final_stats.couldnt_traverse_bubble_depth,traversal->final_stats.couldnt_because_marked_kmer,traversal->final_stats.couldnt_find_extension);
- fprintf (stderr," %ld in-branchin large depth, %ld in-branching large breadth, %ld in-branching other\n",traversal->final_stats.couldnt_inbranching_depth,traversal->final_stats.couldnt_inbranching_breadth,traversal->final_stats.couldnt_inbranching_other);
-
- STOPWALL(assembly,"Assembly");
-
- free(left_traversal);
- free(right_traversal);
- free(contig);
- SolidKmers->close();
-}
-
-int main(int argc, char *argv[])
-{
-
- if(argc < 6)
- {
- fprintf (stderr,"usage:\n");
- fprintf (stderr," %s input_file kmer_size min_abundance estimated_genome_size prefix\n",argv[0]);
- fprintf (stderr,"hints:\n min_abundance ~ 3\n estimated_genome_size is in bp, does not need to be accurate, only controls memory usage\n prefix is any name you want the results to start with\n");
-
- return 1;
- }
-
- bool FOUR_BLOOM_VERSION = true;
-
- // shortcuts to go directly to assembly using serialized bloom and serialized hash
- int START_FROM_SOLID_KMERS=0; // if = 0, construct the fasta file of solid kmers, if = 1, start directly from that file
- int LOAD_FALSE_POSITIVE_KMERS=0; // if = 0, construct the fasta file of false positive kmers (debloom), if = 1, load that file into the hashtable
- int NO_FALSE_POSITIVES_AT_ALL=0; // if = 0, normal behavior, if = 1, don't load false positives (will be a probabilistic de bruijn graph)
- int max_disk_space = 0;// let dsk decide
- for (int n_a = 6; n_a < argc ; n_a++)
- {
- if (strcmp(argv[n_a],"--original") == 0)
- FOUR_BLOOM_VERSION = false;
-
- if (strcmp(argv[n_a],"--dont-count")==0)
- START_FROM_SOLID_KMERS = 1;
-
- if (strcmp(argv[n_a],"--dont-debloom")==0)
- LOAD_FALSE_POSITIVE_KMERS = 1;
-
- if (strcmp(argv[n_a],"--just-assemble")==0)
- {
- START_FROM_SOLID_KMERS = 1;
- LOAD_FALSE_POSITIVE_KMERS = 1;
- }
-
- if (strcmp(argv[n_a],"--titus-mode")==0)
- NO_FALSE_POSITIVES_AT_ALL = 1;
-
-
- if (strcmp(argv[n_a],"-d")==0)
- max_disk_space = atoi(argv[n_a+1]);
-
-
- if (strcmp(argv[n_a],"-maxc")==0)
- max_couv = atoi(argv[n_a+1]);
-
- if (strcmp(argv[n_a],"--le-changement")==0)
- {printf("c'est maintenant!\n");exit(0);}
- }
-
-
- // kmer size
- sizeKmer=27; // let's make it even for now, because i havnt thought of how to handle palindromes (dont want to stop on them)
- if(argc >= 3)
- {
- sizeKmer = atoi(argv[2]);
- if (sizeKmer%2==0)
- {
- sizeKmer-=1;
- printf("Need odd kmer size to avoid palindromes. I've set kmer size to %d.\n",sizeKmer);
- }
- if (sizeKmer>((int)sizeof(kmer_type)*4))
- {
- printf("Max kmer size on this compiled version is %lu\n",sizeof(kmer_type)*4);
- exit(1);
- }
- }
-
- if (sizeKmer == (int)(sizeof(kmer_type)*4))
- kmerMask = -1;
- else
- kmerMask=(((kmer_type)1)<<(sizeKmer*2))-1;
-
- double lg2 = log(2);
-
- if (sizeKmer > 128)
- {
- FOUR_BLOOM_VERSION = false;
- printf("Reverted to single Bloom filter implementation for k>128\n");
- }
-
- if (!FOUR_BLOOM_VERSION)
- NBITS_PER_KMER = log(16*sizeKmer*(lg2*lg2))/(lg2*lg2); // needed to process argv[5]
- else
- NBITS_PER_KMER = rvalues[sizeKmer][1];
-
- // solidity
- nks =NNKS;
- if(argc >= 4)
- {
- nks = atoi(argv[3]);
- if (nks==0) nks=1; // min abundance can't be 0
- }
-
-
- if(argc >= 5)
- {
- genome_size = atoll(argv[4]);
- // int estimated_bloom_size = max( (int)ceilf(log2f(genome_size * NBITS_PER_KMER )), 1);
- uint64_t estimated_bloom_size = (uint64_t) (genome_size * NBITS_PER_KMER);
-
- uint64_t estimated_nb_FP = (uint64_t)(genome_size * 4 * powf(0.6,11)); // just indicative
-
- //max_memory = max( (1LL << estimated_bloom_size)/8LL /1024LL/1024LL, 1LL );
- max_memory = max((int64_t) estimated_bloom_size/8LL /1024LL/1024LL,1LL);
-
- printf("estimated values: nbits Bloom %lli, nb FP %lld, max memory %i MB\n",estimated_bloom_size,estimated_nb_FP,max_memory);
-
- }
-
- // output prefix
- if(argc >= 6)
- {
- strcpy(prefix,argv[5]);
- }
-
-
-
-
- fprintf (stderr,"taille cell %lu \n", sizeof(cell<kmer_type>));
-
- STARTWALL(0);
-
- Bank *Reads = new Bank(argv[1]);
-
- // counter kmers, write solid kmers to disk
- if (!START_FROM_SOLID_KMERS)
- {
- int verbose = 0;
- bool write_count = false;
- bool skip_binary_conversion = false;
-
- sorting_count(Reads,prefix,max_memory,max_disk_space,write_count,verbose, skip_binary_conversion);
- }
-
- // debloom, write false positives to disk, insert them into false_positives
- if (! LOAD_FALSE_POSITIVE_KMERS)
- {
- debloom(order, max_memory);
- }
-
- bloo1 = bloom_create_bloo1((BloomCpt *)NULL, false);
-
- if (! NO_FALSE_POSITIVES_AT_ALL)
- {
- // load false positives from disk into false_positives
- if (!FOUR_BLOOM_VERSION)
- false_positives = load_false_positives();
- else
- false_positives = load_false_positives_cascading4();
- }
- else
- {
- // titus mode: no FP's
- false_positives = dummy_false_positives();
- }
-
- // return 1;
- assemble();
-
- STOPWALL(0,"Total");
-
- delete Reads;
- return 0;
-}
-
-
diff --git a/MultiConsumer.cpp b/MultiConsumer.cpp
deleted file mode 100644
index 1e0f2fe..0000000
--- a/MultiConsumer.cpp
+++ /dev/null
@@ -1,144 +0,0 @@
-#include "MultiConsumer.h"
-
-template<typename Task>
-MultiConsumer<Task>::MultiConsumer() : sizeBuffer(0), maxSizeBuffer(NB_PACKETS), allDone(false)
-{
- mutex = new pthread_mutex_t;
- mutex2 = new pthread_mutex_t;
- pthread_mutex_init(mutex, NULL);
- pthread_mutex_init(mutex2, NULL);
-
- notFull = new pthread_cond_t;
- notEmpty = new pthread_cond_t;
- pthread_cond_init(notFull, NULL);
- pthread_cond_init(notEmpty, NULL);
-
-}
-
-template<typename Task>
-void MultiConsumer<Task>::produce(Task *task) {
-
- pthread_mutex_lock(mutex);
- while (sizeBuffer == maxSizeBuffer) {
- pthread_cond_wait(notFull, mutex);
- }
-
- buffer[sizeBuffer++] = task;
-
- pthread_cond_signal(notEmpty);
-
- pthread_mutex_unlock(mutex);
-}
-
-template<typename Task>
-Task *MultiConsumer<Task>::consume() {
-
- Task *task;
- pthread_mutex_lock(mutex);
-
- while (sizeBuffer == 0) {
-
- if (isAllDone()) {
- pthread_mutex_unlock(mutex);
- return NULL;
- }
-
- pthread_cond_wait(notEmpty, mutex);
- }
-
- task = buffer[--sizeBuffer];
-
- pthread_cond_signal(notFull);
-
- pthread_mutex_unlock(mutex);
-
- return task;
-}
-
-template<typename Task>
-void MultiConsumer<Task>::setAllDone() {
- pthread_mutex_lock(mutex2);
- allDone = true;
- pthread_cond_signal(notEmpty);
- pthread_mutex_unlock(mutex2);
-}
-
-template<typename Task>
-bool MultiConsumer<Task>::isAllDone() {
- bool res;
- pthread_mutex_lock(mutex2);
- res = allDone;
- pthread_mutex_unlock(mutex2);
- return res;
-}
-
-
-// wrapper around MultiConsumer to bundle 10 MB of reads together
-
-MultiReads::MultiReads(int thread_id) : thread_id(thread_id)
-{
- mc = new MultiConsumer<reads_packet>();
- new_packet();
-}
-
-void MultiReads::new_packet()
-{
- current_packet = new reads_packet;
- nbRead = 0;
- nbNucleotides = 0;
-}
-
-void MultiReads::produce(char *read, int readlen) {
- if (nbRead > 0 && nbNucleotides > MAX_NUCL_IN_PACKET)
- {
- mc->produce(current_packet);
- //printf("%d - produced (%d in stack)\n", thread_id, mc->sizeBuffer);
- new_packet();
- }
-
- current_packet->reads.push_back(read);
- nbRead++;
- nbNucleotides += readlen;
-}
-
-void MultiReads::setAllDone() {
- if (nbRead > 0) // produce that last packet
- {
- mc->produce(current_packet);
- }
- mc->setAllDone();
-}
-
-bool MultiReadsConsumer::is_finished_packet()
-{
- return nbRead == current_packet->reads.size();
-}
-
-void MultiReadsConsumer::consume(char* &read, int &readlen)
-{
- if (!has_packet || is_finished_packet())
- {
- if (current_packet != NULL)
- {
- delete current_packet;
- }
-
- //printf("%d - attempting to consume (%d remaining)\n", thread_id, mc->sizeBuffer);
- current_packet = mc->consume();
- //printf("%d - consumed (%d remaining)\n", thread_id, mc->sizeBuffer);
-
- nbRead = 0;
- has_packet = true;
-
- if (current_packet == NULL) // no more reads, all done
- {
- readlen = 0;
- return;
- }
- }
-
- readlen = current_packet->reads[nbRead].length();
- read = (char *)current_packet->reads[nbRead].c_str();
-
- nbRead++;
-}
diff --git a/MultiConsumer.h b/MultiConsumer.h
deleted file mode 100644
index 273ae9d..0000000
--- a/MultiConsumer.h
+++ /dev/null
@@ -1,86 +0,0 @@
-#include <stdio.h>
-#include <stdlib.h>
-#include <string>
-#include <string.h>
-#include <vector>
-#include <pthread.h>
-
-#ifndef MultiConsumer_H
-#define MultiConsumer_H
-
-using namespace std;
-
-#define NB_PACKETS 5
-
-#define MAX_NUCL_IN_PACKET 10000000
-
-template<typename Task>
-class MultiConsumer
-{
- Task *buffer[NB_PACKETS];
-
- int maxSizeBuffer;
-
- pthread_mutex_t *mutex;
- pthread_mutex_t *mutex2;
-
- pthread_cond_t *notFull;
- pthread_cond_t *notEmpty;
-
- bool allDone;
-
- public:
- int sizeBuffer;
- MultiConsumer();
- void produce(Task *task);
- Task *consume();
-
- void setAllDone();
- bool isAllDone();
-};
-
-// a producer that group reads
-
-struct reads_packet
-{
- vector<string> reads;
-};
-
-class MultiReads
-{
- protected:
- reads_packet *current_packet;
- int packetOffset;
- int nbRead;
- int nbNucleotides;
- int thread_id;
-
- void new_packet();
-
- public:
- MultiConsumer<reads_packet> *mc;
-
- MultiReads(int thread_id);
- void produce(char *read, int readlen);
- void setAllDone();
-};
-
-// a consumer for the above producer
-
-class MultiReadsConsumer
-{
- reads_packet *current_packet;
- int packetOffset;
- int nbRead;
- int thread_id;
-
- bool has_packet;
- MultiConsumer<reads_packet> *mc;
-
- public:
- MultiReadsConsumer(MultiReads m, int thread_id) : has_packet(false), mc(m.mc), current_packet(NULL), thread_id(thread_id) {}
- bool is_finished_packet();
- void consume(char* &read, int &readlen);
-};
-
-#endif
diff --git a/OAHash.cpp b/OAHash.cpp
deleted file mode 100644
index d73802c..0000000
--- a/OAHash.cpp
+++ /dev/null
@@ -1,212 +0,0 @@
-// open-addressing hash table with linear probing, follows wikipedia
-// to reduce memory, elements with [value == 0] are UNOCCUPIED, deal with it.
-
-#include <iostream>
-#include <stdio.h>
-#include <string.h>
-#include <algorithm> // for max
-
-#include "OAHash.h"
-
-using namespace::std;
-
-
-OAHash::OAHash(uint64_t max_memory) // in bytes
-{
- hash_size = max_memory / sizeof(element_pair);
- if (hash_size == 0)
- {
- printf("empty OAHash allocated\n");
- exit(1);
- }
- nb_inserted_keys = 0;
- data = (element_pair *) calloc( hash_size, sizeof(element_pair)); //create hashtable
-}
-
-OAHash::~OAHash()
-{
- free(data);
-}
-
-int OAHash::size_entry()
-{
- return sizeof(element_pair);
-}
-
-// hash functions: [ any integer type, e.g. 64 bits, 128 bits or ttmath ] -> [ 64 bits hash ]
-#ifdef _largeint
-inline uint64_t OAHash::hashcode(LargeInt<KMER_PRECISION> elem)
-{
- // hash = XOR_of_series[hash(i-th chunk iof 64 bits)]
- uint64_t result = 0, chunk, mask = ~0;
- LargeInt<KMER_PRECISION> intermediate = elem;
- int i;
- for (i=0;i<KMER_PRECISION;i++)
- {
- chunk = (intermediate & mask).toInt();
- intermediate = intermediate >> 64;
- result ^= hashcode(chunk);
- }
- return result;
-}
-#endif
-
-#ifdef _ttmath
-inline uint64_t OAHash::hashcode(ttmath::UInt<KMER_PRECISION> elem)
-{
- // hash = XOR_of_series[hash(i-th chunk iof 64 bits)
- uint64_t result = 0, to_hash;
- ttmath::UInt<KMER_PRECISION> intermediate = elem;
- uint32_t cmask=~0, chunk;
- int i;
- for (i=0;i<KMER_PRECISION/2;i++)
- {
- // retrieve a 64 bits part to hash
- (intermediate & cmask).ToInt(chunk);
- to_hash = chunk;
- intermediate >>= 32;
- (intermediate & cmask).ToInt(chunk);
- to_hash |= ((uint64_t)chunk) << 32 ;
- intermediate >>= 32;
-
- result ^= hashcode(to_hash);
- }
- return result;
-}
-#endif
-
-#ifdef _LP64
-inline uint64_t OAHash::hashcode( __uint128_t elem )
-{
- // hashcode(uint128) = ( hashcode(upper 64 bits) xor hashcode(lower 64 bits))
- return (hashcode((uint64_t)(elem>>64)) ^ hashcode((uint64_t)(elem&((((__uint128_t)1)<<64)-1))));
-}
-#endif
-
-inline uint64_t OAHash::hashcode( uint64_t elem )
-{
- uint64_t code = elem;
-
- code = code ^ (code >> 14); //supp
- code = (~code) + (code << 18);
- code = code ^ (code >> 31);
- code = code * 21;
- code = code ^ (code >> 11);
- code = code + (code << 6);
- code = code ^ (code >> 22);
-
- return code;
-
-}
-
-bool OAHash::is_occupied(element_pair *element)
-{
- return (element->value != 0);
-}
-
-OAHash::element_pair * OAHash::find_slot(key_type key)
-{
- uint64_t ptr = hashcode(key) % hash_size;
- element_pair *element = data+ptr;
- uint64_t retries = 0;
-
- // search until we either find the key, or find an empty slot.
- while ( ( is_occupied(element)) && ( element->key != key ) && (retries < hash_size))
- {
- ptr = (ptr + 1) % hash_size;
- element = data+ptr;
- retries++;
- }
- if (retries == hash_size)
- {
- printf("OAHash: max rehashes reached: %lld (notify a developer)\n",(long long)hash_size);
- exit(1);
- }
-
- return element;
-}
-
-//if graine already here, overwrite old value
-void OAHash::insert(key_type graine, int value)
-{
- element_pair *element = find_slot(graine);
- if (!is_occupied(element))
- {
- element->key = graine;
- nb_inserted_keys++;
- }
- element->value = value;
-}
-
-// increment the value of a graine
-void OAHash::increment(key_type graine)
-{
- element_pair *element = find_slot(graine);
- if (!is_occupied(element))
- {
- element->key = graine;
- nb_inserted_keys++;
- }
- if( element->value == -1) element->value = 0; //special case, emulate 0 value with -1, (0 is not a valid value, used for empty cell)
-
- element->value = element->value + 1;
-}
-
-bool OAHash::get( key_type graine, int * val)
-{
- element_pair *element = find_slot(graine);
- if (!is_occupied(element))
- return false;
- if ((element->key) == graine && (val != NULL))
- *val = element->value;
-
- if( element->value ==-1) *val = 0; // 0 is emulated with -1
- return true;
-}
-
-bool OAHash::has_key(key_type graine)
-{
- return get(graine,NULL);
-}
-
-
-// call start_iterator to reinit the iterator, then do a while(next_iterator()) {..} to traverse every cell
-void OAHash::start_iterator()
-{
- iterator = data-1;
-}
-
-
-// returns true as long as the iterator contains a valid cell
-bool OAHash::next_iterator()
-{
- while (1)
- {
- iterator++;
- if (iterator == data+hash_size)
- return false;
- if (iterator->value != 0)
- break;
- }
- return true;
-}
-
-
-float OAHash::load_factor()
-{
- return (float)nb_inserted_keys/(float)hash_size;
-}
-
-
-uint64_t OAHash::memory_usage()
-{
- return hash_size* sizeof(element_pair); // in bits
-}
-
-void OAHash::printstat()
-{
- fprintf(stderr,"\n----------------------Stat OA Hash Table ---------------------\n");
-
- fprintf(stderr,"max elements: %lld, memory usage: %lld\n",(long long)hash_size,(long long)memory_usage());
- fprintf(stderr,"load factor: %.2f\n",load_factor());
-}
diff --git a/OAHash.h b/OAHash.h
deleted file mode 100644
index 6eb4cee..0000000
--- a/OAHash.h
+++ /dev/null
@@ -1,77 +0,0 @@
-#ifndef OAHash_h
-#define OAHash_h
-#include <stdlib.h>
-#include <inttypes.h>
-#include <stdint.h>
-
-#ifdef _largeint
-#include "LargeInt.h"
-typedef LargeInt<KMER_PRECISION> key_type;
-#else
-#ifdef _ttmath
-#include "ttmath/ttmath.h"
-typedef ttmath::UInt<KMER_PRECISION> key_type;
-#else
-#if (! defined kmer_type) || (! defined _LP64)
-typedef uint64_t key_type;
-#else
-typedef kmer_type key_type;
-#endif
-#endif
-#endif
-
-class OAHash{
-
-protected:
-
- struct element_pair
- {
- key_type key;
- //uint32_t value;
- int32_t value;
-
- };
-
-
- uint64_t hash_size;
- uint64_t nb_inserted_keys;
- element_pair* data;
-
-#ifdef _largeint
- inline uint64_t hashcode(LargeInt<KMER_PRECISION> elem);
-#endif
-#ifdef _ttmath
- inline uint64_t hashcode(ttmath::UInt<KMER_PRECISION> elem);
-#endif
-#ifdef _LP64
- uint64_t hashcode( __uint128_t elem);
-#endif
- uint64_t hashcode( uint64_t elem);
-
- bool is_occupied(element_pair *element);
-
-public:
-
- static int size_entry();
-
- // iterator functions:
- element_pair *iterator;
- void start_iterator();
- bool next_iterator();
-
-
- OAHash(uint64_t max_elements);
- ~OAHash();
- element_pair * find_slot(key_type key);
- void insert(key_type graine, int value);
- void increment(key_type graine);
- bool get( key_type graine, int * val);
- bool has_key(key_type graine);
- void printstat();
- uint64_t memory_usage();
- float load_factor();
-
-};
-
-#endif
-
diff --git a/Pool.cpp b/Pool.cpp
deleted file mode 100644
index 4fe2be3..0000000
--- a/Pool.cpp
+++ /dev/null
@@ -1,156 +0,0 @@
-//
-// Pool.cpp
-// memory pool for hashtable to avoid mallocs
-//
-// Created by Guillaume Rizk on 24/11/11.
-//
-
-#include <iostream>
-#include <stdio.h>
-
-#include "Pool.h"
-#include<stdint.h>
-
-
-
-
-
-
-
-/**
- * Constructeur par dÈfaut
- */
-template <typename graine_type>
-Pool<graine_type>::Pool()
-{
- n_pools = 0; n_cells=0;
- //allocation table de pool :
- tab_pool = (cell<graine_type>**) malloc(N_POOL*sizeof(cell<graine_type> *) );
-
- tab_pool[0]=NULL;n_pools++; // la premiere pool est NULL, pour conversion null_internal -> null
-
- //allocation de la premiere pool :
- pool_courante =(cell<graine_type>*) malloc(TAI_POOL*sizeof(cell<graine_type>) );
- tab_pool[n_pools] = pool_courante;
- n_pools++;
-}
-
-
-
-/**
- * Destructeur
- */
-template <typename graine_type>
-Pool<graine_type>::~Pool()
-{
-
- unsigned int i;
-
- for(i=1;i<n_pools;i++) // la pool 0 est NULL
- {
- free( tab_pool[i] );
- }
-
- free(tab_pool);
-}
-
-
-template <typename graine_type>
-void Pool<graine_type>::empty_all()
-{
-
- unsigned int i;
-
- for(i=2;i<n_pools;i++) // garde la premiere pool pour usage futur
- {
- free( tab_pool[i] );
- }
-
- //on repasse sur premiere pool
- pool_courante = tab_pool[1];
- n_cells=0;
- n_pools=2;
-
-}
-
-
-//cell * Pool::allocate_cell_in_pool()
-//{
-//
-// // ncells = nb de cells deja utilisees
-// if (n_cells <TAI_POOL)
-// {
-// n_cells ++;
-// return (pool_courante + n_cells -1 );
-// }
-// else // la piscine est pleine, on en alloue une nouvelle
-// {
-// pool_courante =(cell*) malloc(TAI_POOL*sizeof(cell) );
-// tab_pool[n_pools] = pool_courante;
-// n_pools++;
-// n_cells = 1;
-// return (pool_courante);
-//
-// }
-//
-//}
-
-
-//
-template <typename graine_type>
- cell<graine_type> * Pool<graine_type>::internal_ptr_to_cell_pointer(cell_ptr_t internal_ptr)
-{
- unsigned int numpool = internal_ptr & 1023;
- unsigned int numcell = internal_ptr >> 10;
-
- return (tab_pool[numpool] + numcell);
-
-}
-
-
-template <typename graine_type>
-cell_ptr_t Pool<graine_type>::allocate_cell()
-{
-
- cell_ptr_t internal_adress = 0;
- // ncells = nb de cells deja utilisees
- if (n_cells <TAI_POOL)
- {
- internal_adress = n_pools -1; // low 10 bits : pool number
- internal_adress |= n_cells <<10 ; // 22 high bits : cell number in pool
- n_cells ++;
-
- return internal_adress;
- }
- else // la piscine est pleine, on en alloue une nouvelle
- {
- if(n_pools>= N_POOL)
- {
- fprintf(stderr,"Internal memory allocator is full!\n");
- return 0;
- // will happen when 4G cells are allocated, representing 64 Go
- }
- pool_courante =(cell<graine_type>*) malloc(TAI_POOL*sizeof(cell<graine_type>) );
- tab_pool[n_pools] = pool_courante;
- n_pools++;
- n_cells = 1;
-
- internal_adress = n_pools -1; // low 8 bits : pool number
- // 22 high bits are 0
-
- return internal_adress;
- }
-
-}
-
-// trick to avoid linker errors: http://www.parashift.com/c++-faq-lite/templates.html#faq-35.15
-template class Pool<uint64_t>;
-#ifdef _LP64
-template class Pool<__uint128_t>;
-#endif
-#ifdef _ttmath
-template class Pool<ttmath::UInt<KMER_PRECISION> >;
-#endif
-#ifdef _largeint
-template class Pool<LargeInt<KMER_PRECISION> >;
-#endif
diff --git a/Pool.h b/Pool.h
deleted file mode 100644
index 4118de7..0000000
--- a/Pool.h
+++ /dev/null
@@ -1,92 +0,0 @@
-//
-// Pool.h
-// memory pool for hashtable to avoid mallocs
-//
-// Created by Guillaume Rizk on 24/11/11.
-//
-
-#ifndef compress_Pool_h
-#define compress_Pool_h
-#include <stdlib.h>
-#include <algorithm> // for max/min
-
-#ifdef _ttmath
-#include "ttmath/ttmath.h"
-#endif
-#ifdef _largeint
-#include "LargeInt.h"
-#endif
-
-
-typedef unsigned int cell_ptr_t;
-
-template <typename graine_type>
-struct cell
-{
- graine_type graine;
- cell_ptr_t suiv;
- int val;
-};
-
-#define TAI_POOL 4194304 //16777216//4194304 // 2^22 16 M cells *16 o blocs de 256 Mo
-#define N_POOL 1024 //256//1024 // 2^10 soit 4 G cells max
-/**
- * \class Pool,
- * \brief Cette class dÈfinit une pool memoire pour allocation rapide de la table de hachage utilisee quand seed >14
- */
-
-template <typename graine_type>
-class Pool{
-public:
-
- /**
- * table de cell, pour usage courant,
- */
- cell<graine_type> * pool_courante;
- /**
- * stockage de tous les pointeurs pool
- */
- cell<graine_type> ** tab_pool;
- /**
- * nombre de piscines remplies
- */
- unsigned int n_pools;
-
- /**
- * niveau de remplissage de la piscine courante
- */
- unsigned int n_cells;
-
-
-
- /**
- * Constructeur par dÈfaut
- */
- Pool();
-
- /**
- * alloue une cellule dans la piscine
- */
- cell<graine_type> * allocate_cell_in_pool();
-
- // allocate cell, return internal pointer type ( 32bits)
- cell_ptr_t allocate_cell();
-
- cell<graine_type> * internal_ptr_to_cell_pointer(cell_ptr_t internal_ptr);
-
-
- /**
- * vide toutes piscines
- * (garde juste une pool vide)
- */
- void empty_all();
-
- /**
- * Destructeur
- */
- ~Pool();
-
-};
-
-
-#endif
diff --git a/README b/README
deleted file mode 100644
index d699851..0000000
--- a/README
+++ /dev/null
@@ -1,18 +0,0 @@
-type `make` then `./minia` for usage.
-
-short manual: ./manual/manual.pdf
-
-we have set up a Q&A website, see the Support section in http://minia.genouest.org
-
-to contact an author directly: rayan.chikhi at ens-cachan.org
-
-if you read the source code, disregard any code where (order > 0).
-
-[internal information] list of projects which import minia as svn:external:
-
-dsk
-minia-graph
-ultimategf
-kissnp2
-mapsembler2
-kmergenie
diff --git a/README.md b/README.md
new file mode 100644
index 0000000..c91b0eb
--- /dev/null
+++ b/README.md
@@ -0,0 +1,38 @@
+# Minia
+
+| **Linux** | **Mac OSX** |
+|-----------|-------------|
+[](https://ci.inria.fr/gatb-core/view/Minia/job/tool-minia-build-debian7-64bits-gcc-4.7/) | [](https://ci.inria.fr/gatb-core/view/Minia/job/tool-minia-build-macos-10.9.5-gcc-4.2.1/)
+
+[](http://www.gnu.org/licenses/agpl-3.0.en.html)
+
+# What is Minia ?
+
+Minia is a short-read assembler based on a de Bruijn graph, capable of assembling a human genome on a desktop computer in a day. The output of Minia is a set of contigs. Minia produces results of similar contiguity and accuracy to other de Bruijn assemblers (e.g. Velvet).
+
+# Getting the latest source code
+
+## Requirements
+
+CMake 2.6+; see http://www.cmake.org/cmake/resources/software.html
+
+c++ compiler; compilation was tested with gcc and g++ version>=4.5 (Linux) and clang version>=4.1 (Mac OSX).
+
+## Instructions
+
+ # get a local copy of minia source code
+ git clone --recursive https://github.com/GATB/minia.git
+
+ # compile the code on your computer
+ cd minia
+ sh INSTALL
+
+# User manual
+
+Type `minia` without any arguments for usage instructions.
+
+Short manual: http://minia.genouest.org/files/minia.pdf
+
+#Contact
+
+To contact a developer, request help, etc: https://gatb.inria.fr/contact/
diff --git a/Set.cpp b/Set.cpp
deleted file mode 100644
index 85888fe..0000000
--- a/Set.cpp
+++ /dev/null
@@ -1,305 +0,0 @@
-#include "Set.h"
-
-
-int ListSet::bits_per_element = sizeof(set_elem)*8;
-
-ListSet::ListSet(uint64_t taille_approx)
-{
- liste.reserve(taille_approx);
-}
-ListSet::ListSet()
-{
-}
-
-void ListSet::insert(set_elem elem)
-{
- liste.push_back(elem);
-}
-
-void ListSet::finalize()
-{
- sort(liste.begin(), liste.end());
-}
-
-bool ListSet::contains(set_elem elem)
-{
- return binary_search(liste.begin(), liste.end(), elem);
-}
-
-//Raluca
-bool ListSet::containsNotBinary(set_elem elem)
-{
- int i;
- for (i=0; i<liste.size(); i++)
- if (liste[i]==elem)
- return true;
-
- return false;
-}
-
-//--------------
-// plain old expensive hash
-
-int HashSet::bits_per_element = sizeof(cell<hash_elem>)*8;
-
-HashSet::HashSet(uint64_t taille_approx)
-{
- int NBITS_HT = max( (int)ceilf(log2f(taille_approx)) , 1);
- hash = new Hash16(NBITS_HT);
-}
-
-void HashSet::insert(set_elem elem)
-{
- hash->insert(elem,1); // dummy value
-}
-
-void HashSet::finalize()
-{
- // NOP
-}
-
-bool HashSet::contains(set_elem elem)
-{
- return hash->has_key(elem);
-}
-
-
-
-//--------------
-// emulates a hash table with two lists
-// benefits: lower memory usage
-// but logarithmic acess instead of constant
-
-
-void AssocSet::finalize()
-{
- sort(liste.begin(), liste.end());
- liste_value.assign(liste.size(),0);
-}
-
-
-int AssocSet::get( set_elem elem, set_value_t * val)
-{
-
- vector<set_elem>::iterator it;
-
- it = lower_bound(liste.begin(), liste.end(),elem);
- if (it == liste.end() || elem != *it) return 0;
-
- size_t rank = it - liste.begin();
-
- *val = liste_value[rank];
- return 1;
-}
-
-AssocSet::AssocSet()
-{
-}
-
-//return -1 if elem is not in the set
-int AssocSet::set(set_elem elem, set_value_t val)
-{
- vector<set_elem>::iterator it;
-
- it = lower_bound(liste.begin(), liste.end(),elem);
- if (it == liste.end() ||elem != *it) return 0;
-
- size_t rank = it - liste.begin();
-
- liste_value[rank]=val;
-
- return 1;
-}
-
-
-void AssocSet::start_iterator()
-{
- iterator = liste.begin()-1;
-
-}
-
-bool AssocSet::next_iterator()
-{
- iterator++;
- if (iterator==liste.end()) return false;
-
- return true;
-
-}
-
-void AssocSet::print_total_size()
-{
- printf("Assoc set size: %li\n",liste.size());
- printf("Assoc set capacity: listekmer %li liste val%li\n",liste.capacity(),liste_value.capacity());
- printf("%li *%li + %li* %li = %li MB \n",liste.capacity(),sizeof(set_elem),liste_value.capacity(),sizeof(set_value_t),
- (liste.capacity()*sizeof(set_elem)+liste_value.capacity()*sizeof(set_value_t))/1024/1024
- );
-}
-
-void AssocSet::clear()
-{
- liste_value.assign(liste_value.size(),0);
-// liste_value.clear();
-
-}
-
-
-//Raluca
-//--------------
-// emulates a hash table with two lists for paired reads (elements=branching kmers in the second read file, values=pairs of corresponding kmers in the first read file + next nucleotide in the second read file)
-
-void copy_nt_kmer (nt_kmer_t from, nt_kmer_t* to){
- to->nt = from.nt;
- to->prev_kmer = from.prev_kmer;
-}
-
-
-void copy_pair_nt_kmer (pair_nt_kmer_t from, pair_nt_kmer_t* to){
- copy_nt_kmer(from.nk1, &(to->nk1));
- copy_nt_kmer(from.nk2, &(to->nk2));
-}
-
-
-void AssocPairedSet::finalize()
-{
-
- sort(liste.begin(), liste.end());
- //liste_value.assign(liste.size(),0);
- liste_value.reserve(liste.size());
- // printf("finalize %i elems \n",liste_value.size());
-
- liste_value.resize(liste.size());
-
-
- int i;
- for (i=0; i<liste_value.size(); i++)
- {
- liste_value[i].nk1.nt = 0;
- liste_value[i].nk2.nt = 0;
- }
-}
-
-
-int AssocPairedSet::get( set_elem elem, pair_nt_kmer_t * val)
-{
- vector<set_elem>::iterator it;
- it = lower_bound(liste.begin(), liste.end(),elem);
- if (it == liste.end() || elem != *it) return 0;
-
- size_t rank = it - liste.begin();
-
- copy_pair_nt_kmer(liste_value[rank], val);
-
- return 1;
-}
-
-
-
-AssocPairedSet::AssocPairedSet()
-{
-}
-
-
-//return -1 if elem is not in the set
-int AssocPairedSet::set(set_elem elem, pair_nt_kmer_t val)
-{
- vector<set_elem>::iterator it;
-
- it = lower_bound(liste.begin(), liste.end(),elem);
- if (it == liste.end() ||elem != *it) return 0;
-
- size_t rank = it - liste.begin();
-
- copy_pair_nt_kmer(val, &liste_value[rank]);
-
- return 1;
-}
-
-
-
-void AssocPairedSet::start_iterator()
-{
- iterator = liste.begin()-1;
-
-}
-
-
-bool AssocPairedSet::next_iterator()
-{
- iterator++;
- if (iterator==liste.end()) return false;
-
- return true;
-
-}
-
-
-void AssocPairedSet::print()
-{
- int i;
- char seq[100];
-
- printf("print %lu elems \n",liste.size());
-
-
- for (i=0; i<liste.size(); i++)
- {
- code2seq(liste[i], seq);
- printf("%s=(", seq);
-
- code2seq(liste_value[i].nk1.prev_kmer, seq);
- printf("%s,%c) (", seq, liste_value[i].nk1.nt);
-
- code2seq(liste_value[i].nk2.prev_kmer, seq);
- printf("%s,%c)\n", seq, liste_value[i].nk2.nt);
- }
-}
-
-
-void AssocPairedSet::load_branching(BinaryBank * branches)
-{
- // load branching kmers
- branches->rewind_all();
- kmer_type kmer;
- while (branches->read_element(&kmer))
- liste.push_back(kmer);
-
- printf("done loaded branching kmers in AssocPairedSet \n");
-}
-
-
-void AssocPairedSet::dump(char * filename)
-{
- FILE *file_data;
- file_data = fopen(filename,"wb");
- fwrite(&liste_value[0], sizeof(pair_nt_kmer_t), liste_value.size(), file_data); //1+
- printf("liste_value dumped \n");
-
-}
-
-
-void AssocPairedSet::load(char * filename)
-{
- FILE *file_data;
- file_data = fopen(filename,"rb");
- printf("loading assoc paired kmer index from file\n");
-
- liste_value.reserve(liste.size());
- liste_value.resize(liste.size());
-
- fread(&liste_value[0], sizeof(pair_nt_kmer_t), liste_value.size(), file_data);
- printf("assoc paired loaded\n");
-
-}
-
-
-void AssocPairedSet::print_total_size()
-{
- printf("Assoc paired set size: %li\n",liste.size());
- printf("Assoc paired set capacity: listekmer %li liste val%li\n",liste.capacity(),liste_value.capacity());
- printf("%li *%li + %li* %li = %li MB \n",liste.capacity(),sizeof(set_elem),liste_value.capacity(),sizeof(set_value_t),
- (liste.capacity()*sizeof(set_elem)+liste_value.capacity()*sizeof(set_value_t))/1024/1024
- );
-
-}
-
diff --git a/Set.h b/Set.h
deleted file mode 100644
index 1780358..0000000
--- a/Set.h
+++ /dev/null
@@ -1,158 +0,0 @@
-#ifndef Set_h
-#define Set_h
-#include <stdlib.h>
-#include <inttypes.h>
-#include <stdint.h>
-#include "Hash16.h"
-
-#include <cmath> // for log2f
-#include <algorithm> // for max/min
-#include <vector>
-
-// didn't want to "typedef kmer_type set_elem" because Set is an independent file
-#ifdef _largeint
-#include "LargeInt.h"
-typedef LargeInt<KMER_PRECISION> set_elem;
-#else
-#ifdef _ttmath
-#include "ttmath/ttmath.h"
-typedef ttmath::UInt<KMER_PRECISION> set_elem;
-#else
-#if (! defined kmer_type) || (! defined _LP64)
-typedef uint64_t set_elem;
-#else
-typedef kmer_type set_elem;
-#endif
-#endif
-#endif
-
-using namespace std;
-
-// abstract class
-class Set{
- public:
- virtual void insert(set_elem elem) = 0;
- virtual void finalize() = 0;
- virtual bool contains(set_elem elemn) = 0;
-};
-
-class HashSet : public Set{
-
- Hash16 *hash;
-
- public:
- void insert(set_elem elem);
- void finalize();
- bool contains(set_elem elemn);
- static int bits_per_element ;
-
- HashSet(uint64_t taille_approx);
-};
-
-class ListSet : public Set{
-
- protected:
- vector<set_elem> liste;
-
- public:
- void insert(set_elem elem);
- void finalize();
- bool contains(set_elem elemn);
- //Raluca
- bool containsNotBinary(set_elem elem);
-
- uint64_t capacity() {return (uint64_t)liste.capacity();}
-
- static int bits_per_element ;
-
- ListSet(uint64_t taille_approx);
- ListSet();
-
-};
-
-
-//typedef unsigned char set_value_t;
-typedef unsigned short int set_value_t; // need 9 bits for Terminator now
-
-
-class AssocSet : public ListSet {
-
- vector<set_value_t> liste_value;
- public:
- int get( set_elem elem, set_value_t * val);
- int set(set_elem graine, set_value_t val);
- void finalize();
- AssocSet();
- void print_total_size();
- void clear();
-
- void start_iterator();
- bool next_iterator();
-
-
- vector<set_elem>::iterator iterator;
-
-
-
-};
-
-//Raluca
-typedef struct nt_kmer{
- char nt;
- kmer_type prev_kmer;
-}nt_kmer_t;
-
-typedef struct pair_nt_kmer{
- nt_kmer_t nk1, nk2;
-}pair_nt_kmer_t;
-
-
-void copy_nt_kmer (nt_kmer_t from, nt_kmer_t* to);
-void copy_pair_nt_kmer (pair_nt_kmer_t from, pair_nt_kmer_t* to);
-
-
-class AssocPairedSet : public ListSet {
-
- vector<pair_nt_kmer_t> liste_value;
-public:
- int get(set_elem elem, pair_nt_kmer_t * val);
- int set(set_elem graine, pair_nt_kmer_t val);
- void finalize();
- AssocPairedSet();
- void print_total_size();
-
- void start_iterator();
- bool next_iterator();
-
- void load_branching(BinaryBank * branches);
- void load(char * filename);
- void dump(char * filename);
-
-
- vector<set_elem>::iterator iterator;
-
- void print();
-
-};
-
-class FPSetCascading4 : public Set{
- public:
- Bloom *bloom2, *bloom3, *bloom4;
- ListSet *false_positives;
- bool contains(set_elem elemn)
- {
- if (bloom2->contains(elemn))
- {
- if (!bloom3->contains(elemn))
- return true;
- else if (bloom4->contains(elemn) && !false_positives->contains(elemn))
- return true;
- }
- return false;
- };
- void insert(set_elem elem) {fprintf (stderr, "Error can't insert in FPSetCascading!\n"); exit(0); };
- void finalize() {fprintf (stderr, "Error can't finalize in FPSetCascading!\n"); exit(0);};
- bool is_false_positive(set_elem elemn) {return contains(elemn);};
-};
-
-#endif
diff --git a/SortingCount.cpp b/SortingCount.cpp
deleted file mode 100644
index f70bc09..0000000
--- a/SortingCount.cpp
+++ /dev/null
@@ -1,847 +0,0 @@
-#include "SortingCount.h"
-#include "inttypes.h"
-#include <sys/resource.h> // for getrlimit()
-#if OMP
-#include "omp.h"
-#endif
-
-#define SINGLE_BAR 1
-
-#define SEP
-bool clear_cache = false; // clear file cache from memory (for timing only)
-
-bool hybrid_mode = false;
-bool use_hashing = true; // use hashing instead of sorting (better control of memory)
-float load_factor = 0.7;
-
-bool separate_count = true ; // count separately the multiple read sets, only works with use_hashing, needs define SEP and use_hashing=true
-
-bool use_compressed_reads = true ; // true; // write compressed read file
-int optimism = 1; // optimism == 1 mean that we garantee worst case the memory usage, any value above assumes that, on average, a k-mer will be seen 'optimism' times
-
-bool output_histo;
-
-
-// main k-mer counting function, shared between minia and dsk
-// verbose == 0 : stderr progress bar
-// verbose >= 1 : print basic status
-// verbose >= 2 : print extra partition information
-// write_count == True: include kmer count in results file, in that form:
-// - save kmer count for each kmer in the resulting binary file
-// - the very first four bytes of the result file are the kmer length
-void sorting_count(Bank *Sequences, char *prefix, int max_memory, int max_disk_space, bool write_count, int verbose, bool skip_binary_conversion)
-{
-
- // create a temp dir from the prefix
- char temp_dir[1024];
- sprintf(temp_dir,"%s_temp",prefix);
-
- // clear the temp folder (needs to be done before estimating disk space)
- DIR* dp;
- struct dirent* ep;
- char p_buf[512] = {0};
- dp = opendir(temp_dir);
- while ( (dp != NULL) && ((ep = readdir(dp)) != NULL)) {
- sprintf(p_buf, "%s/%s", temp_dir, ep->d_name);
- remove(p_buf);
- }
- if(dp != NULL)
- closedir(dp);
-
- if (max_disk_space == 0)
- {
- // default max disk space
- struct statvfs buffer ;
- char current_path[1000];
- getcwd(current_path,sizeof(current_path));
- // int ret =
- statvfs(current_path, &buffer);
- uint32_t available = (uint32_t)(((double)buffer.f_bavail * (double)buffer.f_bsize) / 1024.0 / 1024.0);
- printf("Available disk space in %s: %d MB\n",current_path,available); // not working in osx (is that a TODO then?)
- uint32_t input_size = max(1, (int)(( (double)(Sequences->filesizes) ) / 1024.0 / 1024.0));
- max_disk_space = min(available/2, input_size);
- }
- if (max_disk_space == 0) // still 0?
- max_disk_space = 10000; // = default for osx
-
- // estimate number of iterations
- uint64_t volume = Sequences->estimate_kmers_volume(sizeKmer);
- uint32_t nb_passes = ( volume / max_disk_space ) + 1;
-
- int nb_threads=1;
-
-#if OMP
- use_compressed_reads = true;
- nb_threads = 8;
- max_memory /= nb_threads;
- max_memory = max (max_memory,1);
-#endif
-
- // temp bugfix: don't use compressed reads for long reads
- if (Sequences->estimate_max_readlen() > 1000000)
- use_compressed_reads = false;
-
-
- uint64_t volume_per_pass;
- uint32_t nb_partitions;
-
-
- // loop to lower the number of partitions below the maximum number of simulatenously open files
- do
- {
- volume_per_pass = volume / nb_passes;
- nb_partitions = ( volume_per_pass / max_memory ) + 1;
-
- // if partitions are hashed instead of sorted, adjust for load factor
- // (as in the worst case, all kmers in the partition are distinct and partition may be slightly bigger due to hash-repartition)
- if (use_hashing)
- {
- nb_partitions = (uint32_t) ceil((float) nb_partitions / load_factor);
- nb_partitions = ((nb_partitions * OAHash::size_entry()) + sizeof(key_type)-1) / sizeof(key_type); // also adjust for hash overhead
- nb_partitions = max((int)(nb_partitions/optimism), 1);
- if (verbose)
- printf("Updated number of partitions for hash-based k-mer counting: %d\n",nb_partitions);
- }
-
- // round nb_partitions to mulitple of nthreads, for better perf
- // nb_partitions = ((nb_partitions + nb_threads - 1) / nb_threads) * nb_threads;
-
- if (verbose)
- printf("Estimate of number of partitions: %d, number of passes: %d\n",nb_partitions, nb_passes);
-
- // get max number of open files
- struct rlimit lim;
- int max_open_files = 1000;
- int err = getrlimit(RLIMIT_NOFILE, &lim);
- if (err == 0)
- max_open_files = lim.rlim_cur / 2;
- if (nb_partitions >= max_open_files)
- {
- if (verbose)
- printf("Number of partitions higher than max. number of open files (%d), need to increase the number of passes\n", max_open_files);
- nb_passes++;
- }
- else
- break;
- }
- while (1);
-
-
- // volume / (sizeof(kmer_type)*4) is approx size of read file stored in binary, read nb_passes -1 times
- uint64_t total_IO = volume * 2LL * 1024LL*1024LL ;// in bytes + nb_passes * ( volume / (sizeof(kmer_type)*4) ) ; // in bytes
- uint64_t temp_IO = 0;
- //if (nb_passes==1) use_compressed_reads=false;
- BinaryBankConcurrent * redundant_partitions_file[nb_partitions];
- char redundant_filename[nb_partitions][256];
- kmer_type kmer;
- int max_read_length = KMERSBUFFER_MAX_READLEN;
- kmer_type * kmer_table_seq = (kmer_type * ) malloc(sizeof(kmer_type)*max_read_length); ;
-
-
- fprintf(stderr,"Sequentially counting ~%llu MB of kmers with %d partition(s) and %d passes using %d thread(s), ~%d MB of memory and ~%d MB of disk space\n", (unsigned long long)volume, nb_partitions,nb_passes, nb_threads, max_memory * nb_threads, max_disk_space);
-
- STARTWALL(count);
-
- mkdir(temp_dir, S_IRWXU | S_IRWXG | S_IROTH | S_IXOTH);
-
- BinaryBankConcurrent * SolidKmers = new BinaryBankConcurrent(return_file_name(solid_kmers_file),sizeof(kmer),true,nb_threads);
-
- if (write_count)
- {
- // write k-mer nbits as the first 4 bytes; and actual k-mer size as the next 4 bits
- uint32_t kmer_nbits = sizeof(kmer) * 8;
- SolidKmers->write_buffered(&kmer_nbits, 4,0);
- SolidKmers->write_buffered(&sizeKmer, 4,0);
- SolidKmers->flush(0);
- }
-
- int64_t estimated_NbReads = Sequences->estimate_nb_reads(); // only used in progress prints
- char * rseq;
- int readlen;
- int64_t NbSolid = 0;
- int64_t * NbSolid_omp = (int64_t *) calloc(nb_threads,sizeof(int64_t));
-
-#ifdef SEP
-
- long total_kmers_per_partition[nb_partitions]; //guillaume probably commented it because updating this variable would require synchronization
-
- for (int jj=0; jj<nb_partitions; jj++) {
- total_kmers_per_partition[jj]=0;
- }
-
- long kmers_perparti_perfile[nb_partitions][1000];//store cumulated counter
- for (int ii=0; ii<nb_partitions; ii++) {
- for (int jj=0; jj<1000; jj++) {
- kmers_perparti_perfile[ii][jj]=0;
- }
- }
-
-#endif
-
- long distinct_kmers_per_partition[nb_partitions];
- uint64_t * histo_count = (uint64_t *) calloc(10001,sizeof(uint64_t));
-
-
-#if OMP
- printf("coucou coucou coucou \n \n \n");
- uint64_t ** histo_count_omp = (uint64_t **) calloc(nb_threads,sizeof(uint64_t *));
- for(int ii=0;ii<nb_threads;ii++)
- {
- histo_count_omp[ii]= (uint64_t *) calloc(10001,sizeof(uint64_t));
- }
-#endif
-
-
-
-
- //start by the conversion of the file to binary format
- BinaryReads * binread = NULL;
- if (skip_binary_conversion)
- {
- binread = new BinaryReads(return_file_name(binary_read_file),false);
- binread->close();
- }
-
- if(use_compressed_reads && (!skip_binary_conversion))
- {
- char * pt_begin;
- int idx =0 ;
- int64_t NbRead = 0;
- Progress progress_conversion;
- // progress_conversion.timer_mode=1; // to switch to timer mode (show elapsed and estimated remaining time)
- progress_conversion.init(estimated_NbReads,"First step: Converting input file into Binary format");
-
- binread = new BinaryReads(return_file_name(binary_read_file),true);
-#ifdef SEP
- int file_id =0;
- int prev_file_id =0;
-#endif
-
- Sequences->rewind_all();
- while(1)
- {
-#ifdef SEP
- if(! Sequences->get_next_seq(&rseq,&readlen,&file_id)) break; // read original fasta file
- if(separate_count && (file_id != prev_file_id))
- {
- //printf("new file \n");
- prev_file_id = file_id;
- binread->mark_newfile();
- }
-#else
- if(! Sequences->get_next_seq(&rseq,&readlen)) break; // read original fasta file
-#endif
- if(readlen > max_read_length) // realloc kmer_table_seq if needed
- {
- max_read_length = 2*readlen;
- kmer_table_seq = (kmer_type * ) realloc(kmer_table_seq,sizeof(kmer_type)*max_read_length);
- }
-
- pt_begin = rseq;
-
- //should be ok
- while (pt_begin < (rseq+ readlen))
- {
- idx=0; // start a new read
-
- //skips NN
- while (*pt_begin =='N' && pt_begin < (rseq+ readlen))
- {
- pt_begin ++;
- }
- // goes to next N or end of seq
- while ( (pt_begin[idx] !='N') && ((pt_begin +idx) < (rseq+ readlen)) )
- {
- idx++;
- }
-
- //we have a seq beginning at pt_begin of size idx ,without any N, will be treated as a read:
- binread->write_read(pt_begin,idx);
- pt_begin += idx;
- }
-
- // binread->write_read(rseq,readlen);
-
-
- NbRead++;
- if ((NbRead%10000)==0)
- {
- progress_conversion.inc(10000);
- }
- }
- progress_conversion.finish();
- binread->close();
-
- }
- ///fin conversion
-
- if (clear_cache)
- {
-#ifdef OSX
- system("purge");
-#else
- system("echo 3 > /proc/sys/vm/drop_caches");
-#endif
- }
-
-
-
-#if SINGLE_BAR
- Progress progress;
- char message[1000];
- sprintf(message,"Counting kmers");
- progress.timer_mode=1;
- if (verbose == 0 )
- progress.init(total_IO,message);
-#endif
-
-
- // nb_passes = how many times we will traverse the whole reads file (has an influence on temp disk space)
- for (uint32_t current_pass = 0; current_pass < nb_passes; current_pass ++)
- {
-
-#ifdef SEP
- if(separate_count)
- {
- for (int jj=0; jj<nb_partitions; jj++) {
- total_kmers_per_partition[jj]=0;
- }
-
- for (int ii=0; ii<nb_partitions; ii++) {
- for (int jj=0; jj<1000; jj++) {
- kmers_perparti_perfile[ii][jj]=0;
- }
- }
- }
-#endif
-
- if(use_compressed_reads ) //open binary reads for reading
- binread->open(false);
-
- STARTWALL(debpass);
- STARTWALL(debw);
-
- for (uint32_t p=0;p<nb_partitions;p++)
- {
- sprintf(redundant_filename[p],"%s/partition%d.redundant_kmers",temp_dir,p);
- redundant_partitions_file[p] = new BinaryBankConcurrent (redundant_filename[p],sizeof(kmer_type),true, nb_threads);
- distinct_kmers_per_partition[p]=0;
- }
-
- // partitioning redundant kmers
-
- Sequences->rewind_all();
-#if !SINGLE_BAR
- Progress progress;
- progress.timer_mode=1; // to switch to timer mode (show elapsed and estimated remaining time)
- char message[1000];
- sprintf(message,"Pass %d/%d, Step 1: partitioning",current_pass+1,nb_passes);
- if (verbose == 0 )
- progress.init(estimated_NbReads,message);
-#endif
-
-
- int file_id=0;
- //current_pass> 0 &&
-#if OMP
-#pragma omp parallel if(use_compressed_reads && ! separate_count) num_threads(nb_threads)
-#endif
- {
- int64_t nbkmers_written =0;
- int tid =0;
- int64_t NbRead = 0;
- int64_t nread =0;
- int64_t tempread =0;
-#if OMP
-
- tid = omp_get_thread_num();
-#endif
- int nreads_in_buffer= 1000;
- KmersBuffer * kbuff =NULL;
- if(use_compressed_reads)
- {
- kbuff = new KmersBuffer (binread, 1000000, nreads_in_buffer); //buffer size (in nb of kmers), seq per task // the buffer is per thread
- kbuff->binary_read_file = binread->binary_read_file;
- }
-
- kmer_type * kmer_table ;
- while(1)
- {
-
- //read the fasta file
- if(use_compressed_reads) // && current_pass>0
- {
- nread = kbuff->readkmers();
-#ifdef SEP
- if(separate_count && (nread == -2))
- {
- //printf("New file notified, filling parti\n");
- for (int kk=0; kk< nb_partitions; kk++) {
- kmers_perparti_perfile[kk][file_id] = total_kmers_per_partition [kk];
- //printf(".. total_kmers_per_partition[%i] = %li\n",kk, total_kmers_per_partition [kk]);
- }
- file_id++;
- continue;
- }
-#endif
-
- if(nread < 0) break;
- NbRead+= nread;
- tempread+= nread;
- }
- else
- {
- if(! Sequences->get_next_seq(&rseq,&readlen)) break; // read original fasta file
- if(readlen > max_read_length) // realloc kmer_table_seq if needed
- {
- max_read_length = 2*readlen;
- kmer_table_seq = (kmer_type * ) realloc(kmer_table_seq,sizeof(kmer_type)*max_read_length);
- }
- }
-
-// if(use_compressed_reads ) //write compressed read file at first pass //&& current_pass==0
-// binread->write_read(rseq,readlen);
-
- int i;
- int nbkmers =readlen-sizeKmer+1;
-
- if( use_compressed_reads) //current_pass >0 &&
- {
- nbkmers = kbuff->nkmers;
- kmer_table = kbuff->kmers_buffer;
- // printf("nb kmers read %lli \n",nbkmers);
- // NbRead+= nreads_in_buffer;
- }
- else //old fashion
- {
- compute_kmer_table_from_one_seq(readlen,rseq,kmer_table_seq);
- nbkmers =readlen-sizeKmer+1;
- kmer_table = kmer_table_seq;
- NbRead++;
- }
-
- //printf("Encountering empty block \n");
- nbkmers_written= 0;
- //compute the kmers stored in the buffer kmer_table
- for (i=0; i<nbkmers; i++)
- {
- kmer_type lkmer;
-
- // kmer = extractKmerFromRead(rseq,i,&graine,&graine_revcomp);
-
- lkmer = kmer_table[i];
-
- // some hashing to uniformize repartition
- kmer_type kmer_hash = lkmer ^ (lkmer >> 14);
- kmer_hash = (~kmer_hash) + (kmer_hash << 18);
- kmer_hash = kmer_hash ^ (kmer_hash >> 31);
- kmer_hash = kmer_hash * 21;
- kmer_hash = kmer_hash ^ (kmer_hash >> 11);
- kmer_hash = kmer_hash + (kmer_hash << 6);
- kmer_hash = kmer_hash ^ (kmer_hash >> 22);
-
- // check if this kmer should be included in the current pass
- if ((kmer_hash % nb_passes ) != current_pass)
- continue;
-
- kmer_type reduced_kmer = kmer_hash / nb_passes;
-
- int p;// compute in which partition this kmer falls into
-
-#ifdef _ttmath
- (reduced_kmer % nb_partitions).ToInt(p);
-#else
- p = reduced_kmer % nb_partitions;
-#endif
-
- nbkmers_written++;
-
-
-
- redundant_partitions_file[p]->write_element_buffered(&lkmer,tid); // save this kmer to the right partition file
-#ifdef SEP
- if(separate_count)
- total_kmers_per_partition[p]++; // guillaume probably commented it because updating this variable would require synchronization
-#endif
-
- }
- //NbRead++;
-#if SINGLE_BAR
- if(verbose==0)
- {
- if (nb_threads == 1)
- progress.inc(nbkmers_written * sizeof(kmer_type));
- else
- progress.inc(nbkmers_written * sizeof(kmer_type),tid);
- }
-#endif
- // if ((NbRead%10000)==0)
- if(tempread> 10000)
- {
- tempread -= 10000;
- if (verbose)
- fprintf (stderr,"%cPass %d/%d, loop through reads to separate (redundant) kmers into partitions, processed %lluM reads out of %lluM",13,current_pass+1,nb_passes,(unsigned long long)(NbRead/1000/1000),(unsigned long long)(estimated_NbReads/1000/1000));
-#if !SINGLE_BAR
- else
- if (nb_threads == 1)
- progress.set(NbRead);
- else
- progress.inc(10000,tid);
-#endif
- }
- } //end while
-
- if(use_compressed_reads)
- delete kbuff;
- } // end OMP
-
-
-
-#if !SINGLE_BAR
- if (verbose == 0)
- {
- if (nb_threads == 1)
- progress.finish();
- else
- progress.finish_threaded(); // here only one thread
-
- sprintf(message,"Pass %d/%d, Step 2: computing kmer count per partition",current_pass+1,nb_passes);
- progress.init(nb_partitions+1,message);
- }
-#endif
-
- if (verbose)fprintf(stderr,"\n");
-
- if (verbose >= 2)
- {
- STOPWALL(debw,"Writing redundant kmers");
- }
- STARTWALL(debtri);
-
- // close partitions and open them for reading
-
- for (uint32_t p=0;p<nb_partitions;p++)
- {
- redundant_partitions_file[p]->close();
- redundant_partitions_file[p]->open(false);
- }
-
-
-
- // for better timing: clear the file cache, since the partitions may still be in memory, that's unfair to low mem machines
- if (clear_cache)
- {
-#ifdef OSX
- system("purge");
-#else
- system("echo 3 > /proc/sys/vm/drop_caches");
-#endif
- }
-
-
- //quick and dirty parall with omp, testing
- //todo if we want omp and histo : separate histo_count tab per thread that needs to be merged at the end
- // TODO to guillaume: remove that todo above, because it is done, right?
-#if OMP
- //omp_set_numthreads(2); //num_threads(2) //if(!output_histo) num_threads(nb_threads)
-#pragma omp parallel for if (! separate_count) private (p) num_threads(nb_threads)
-#endif
- // load, sort each partition to output solid kmers
- for (int p=0;p<nb_partitions;p++)
- {
- kmer_type lkmer;
-
- bool use_hashing_for_this_partition = use_hashing;
- if(hybrid_mode)
- {
- // printf("max mem %i MB , parti size %i MB\n",max_memory,(redundant_partitions_file[p]->nb_elements()*sizeof(kmer_type))/1024LL/1024LL);
- if( (redundant_partitions_file[p]->nb_elements()*sizeof(kmer_type)) < (max_memory*1024LL*1024LL) )
- use_hashing_for_this_partition = false;
- else
- use_hashing_for_this_partition = true;
- }
- int tid =0;
-#if OMP
- tid = omp_get_thread_num();
-#endif
-
- if (use_hashing_for_this_partition)
- {
- // hash partition and save to solid file
- OAHash hash(max_memory*1024LL*1024LL);
- uint64_t nkmers_read=0;
-
- uint64_t nkmers_read_all=0;
-
- file_id = 0;
- while (redundant_partitions_file[p]->read_element_buffered (&lkmer))
- {
-
-
- hash.increment(lkmer);
- nkmers_read++;
-#ifdef SEP
- nkmers_read_all++;
- if( separate_count && (kmers_perparti_perfile[p][file_id]==nkmers_read_all))
- {
- //printf("Parsing parti .. detected end of file %i at %lli parti %i \n",file_id,nkmers_read_all,p);
- file_id++;
-
- //faire raz des cpts < seuil de la hash, devrait etre suffisant ...
- hash.start_iterator();
- while (hash.next_iterator())
- {
- if (hash.iterator->value < nks)
- {
- hash.iterator->value = -1 ; // 0 is not valid in oahash, emulate it with -1
- }
- }
- }
-
-#endif
-
-#if SINGLE_BAR
- if(verbose==0 && nkmers_read==10000)
- {
- if (nb_threads == 1)
- progress.inc(nkmers_read*sizeof(kmer_type));
- else
- progress.inc(nkmers_read*sizeof(kmer_type),tid);
- nkmers_read=0;
- }
-#endif
- }
-
- //single bar
-
-
- if (verbose >= 2)
- printf("Pass %d/%d partition %d/%d hash load factor: %0.3f\n",current_pass+1,nb_passes,p+1,nb_partitions,hash.load_factor());
-
- hash.start_iterator();
- while (hash.next_iterator())
- {
-
-#ifdef SEP
- int value = hash.iterator->value;
- if(value==-1) value = 0; // desemulate -1
- uint_abundance_t abundance = value;
-
-#else
- uint_abundance_t abundance = hash.iterator->value;
-
-#endif
- if(output_histo)
- {
- uint_abundance_t saturated_abundance;
- saturated_abundance = (abundance >= 10000) ? 10000 : abundance;
-#if OMP
- histo_count_omp[tid][saturated_abundance]++;
-#else
- //printf("histo_count 0 1 2 %i %i %i \n",histo_count[0],histo_count[1],histo_count[2]);
-
- histo_count[saturated_abundance]++;
-#endif
- }
- if (abundance >= nks && abundance <= max_couv)
- {
-
- SolidKmers->write_element_buffered(&(hash.iterator->key),tid);
-
- NbSolid_omp[tid]++;
- if (write_count)
- SolidKmers->write_buffered(&abundance, sizeof(abundance),tid, false);
-
- }
- distinct_kmers_per_partition[p]++;
- }
- }
-
- else
- {
- // sort partition and save to solid file
- vector < kmer_type > kmers;
- uint64_t nkmers_read=0;
-
-
-
- while (redundant_partitions_file[p]->read_element_buffered (&lkmer))
- {
- kmers.push_back (lkmer);
- nkmers_read++;
-#if SINGLE_BAR
- if(verbose==0 && nkmers_read==10000)
- {
- if (nb_threads == 1)
- progress.inc(nkmers_read*sizeof(kmer_type));
- else
- progress.inc(nkmers_read*sizeof(kmer_type),tid);
- nkmers_read=0;
- }
-#endif
- }
-
-
- sort (kmers.begin (), kmers.end ());
-
- kmer_type previous_kmer = *(kmers.begin ());
- uint_abundance_t abundance = 0;
- for (vector < kmer_type >::iterator it = kmers.begin (); it != kmers.end ();
- it++)
- {
- kmer_type current_kmer = *it;
-
- if (current_kmer == previous_kmer)
- abundance++;
- else
- {
- if(output_histo)
- {
- uint_abundance_t saturated_abundance;
- saturated_abundance = (abundance >= 10000) ? 10000 : abundance;
-#if OMP
- histo_count_omp[tid][saturated_abundance]++;
-#else
- histo_count[saturated_abundance]++;
-#endif
-
- }
- if (abundance >= nks && abundance <= max_couv)
- {
- NbSolid_omp[tid]++;
- SolidKmers->write_element_buffered(&previous_kmer,tid);
-
- if (write_count)
- SolidKmers->write_buffered(&abundance, sizeof(abundance),tid, false);
- }
- abundance = 1;
- distinct_kmers_per_partition[p]++;
- }
- previous_kmer = current_kmer;
- }
-
- //last kmer
- distinct_kmers_per_partition[p]++;
- if(output_histo)
- {
- uint_abundance_t saturated_abundance;
- saturated_abundance = (abundance >= 10000) ? 10000 : abundance;
-#if OMP
- histo_count_omp[tid][saturated_abundance]++;
-#else
- histo_count[saturated_abundance]++;
-#endif
-
- }
- if (abundance >= nks && abundance <= max_couv)
- {
- NbSolid_omp[tid]++;
- SolidKmers->write_element_buffered(&previous_kmer,tid);
-
- if (write_count)
- SolidKmers->write_buffered(&abundance, sizeof(abundance),tid, false);
-
- }
-
- }
-
-
- if (verbose >= 1)
- fprintf(stderr,"%cPass %d/%d, loaded and sorted partition %d/%d, found %lld solid kmers so far",13,current_pass+1,nb_passes,p+1,nb_partitions,(long long)(NbSolid_omp[tid]));
-
- if (verbose >= 2)
- printf("\nPass %d/%d partition %d/%d %ld distinct kmers\n",current_pass+1,nb_passes,p+1,nb_partitions,/*total_kmers_per_partition[p],*/distinct_kmers_per_partition[p]);
-
-#if !SINGLE_BAR
- if (verbose == 0 && nb_threads==1)
- progress.inc(1);
- else if (verbose == 0 && nb_threads>1)
- progress.inc(1,tid);
-#endif
-
-
-
- redundant_partitions_file[p]->close();
- remove(redundant_filename[p]);
-
- } // end for partitions
-
-#if OMP
- //merge histo
- if(output_histo)
- {
- for (int cc=1; cc<10001; cc++) {
- uint64_t sum_omp = 0;
- for(int ii=0;ii<nb_threads;ii++)
- {
- sum_omp += histo_count_omp[ii][cc];
- }
- histo_count[cc] = sum_omp;
- }
- }
-#endif
-
-#if !SINGLE_BAR
- if (verbose == 0 && nb_threads == 1)
- progress.finish();
- else if (verbose == 0 && nb_threads > 1 )
- progress.finish_threaded();
-#endif
-
- if (verbose) fprintf(stderr,"\n");
-
- if (verbose >= 2)
- {
- STOPWALL(debtri,"Reading and sorting partitions");
- STOPWALL(debpass,"Pass total");
-
- }
-
- if(use_compressed_reads)
- binread->close();
-
- //delete
- for (uint32_t p=0;p<nb_partitions;p++)
- {
- delete redundant_partitions_file[p] ;
- }
-
- }
-
- //single bar
-#if SINGLE_BAR
- if (verbose == 0 && nb_threads == 1)
- progress.finish();
- else if (verbose == 0 && nb_threads > 1 )
- progress.finish_threaded();
-#endif
-
- if(output_histo)
- {
- FILE * histo_file = fopen(return_file_name(histo_file_name),"w");
- for (int cc=1; cc<10001; cc++) {
- fprintf(histo_file,"%i\t%llu\n",cc,(unsigned long long)(histo_count[cc]));
- }
- fclose(histo_file);
- }
- free(histo_count);
-
- NbSolid = NbSolid_omp[0];
-#if OMP
- NbSolid=0;
- for(int ii=0;ii<nb_threads;ii++)
- {
- NbSolid += NbSolid_omp[ii];
- }
-#endif
-
- SolidKmers->close();
- printf("\nSaved %lld solid kmers\n",(long long)NbSolid);
- rmdir(temp_dir);
-
- STOPWALL(count,"Counted kmers");
- fprintf(stderr,"\n------------------ Counted kmers and kept those with abundance >=%i, \n",nks);
-}
-
-
-
diff --git a/SortingCount.h b/SortingCount.h
deleted file mode 100644
index 13550dc..0000000
--- a/SortingCount.h
+++ /dev/null
@@ -1,27 +0,0 @@
-#include <stdio.h>
-#include <stdlib.h>
-#include <time.h>
-#include <sys/time.h>
-#include <string.h>
-#include <inttypes.h>
-#include <sys/stat.h> // for S_IRWXU etc
-#include <vector>
-#include <sys/statvfs.h> // to determine available disk space
-#include <dirent.h> // to clear the temp directory
-
-#ifndef SORTINGCOUNT_H
-#define SORTINGCOUNT_H
-
-#include "Bank.h"
-#include "Kmer.h"
-#include "Utils.h"
-#include "OAHash.h"
-
-
-using namespace std;
-
-typedef uint32_t uint_abundance_t;
-void sorting_count(Bank *Sequences, char *prefix, int max_memory, int max_disk_space, bool write_count, int verbose, bool skip_binary_conversion = false);
-extern int optimism;
-
-#endif
diff --git a/Terminator.cpp b/Terminator.cpp
deleted file mode 100644
index 4768359..0000000
--- a/Terminator.cpp
+++ /dev/null
@@ -1,410 +0,0 @@
-//
-// Terminator.cpp
-//
-
-#ifndef ASSERTS
-#define NDEBUG // disable asserts, they're computationnally intensive
-#endif
-
-#include <iostream>
-#include <stdio.h>
-#include <string.h>
-#include <stdlib.h>
-#include <assert.h>
-#include <algorithm> // for max
-
-#include "Terminator.h"
-#include "Traversal.h" // for extensions()
-
-using namespace::std;
-bool Terminator::verbose = true;
-
-// common terminator functions (actually, more like Kmer64 + bloom + debloom)
-
-// we define a structure 2x4 bits which indicates which nucleotides correspond to in- and out-branching of a kmer
-// let's see an example (bidirected debruijn graph):
-//
-// ACT [G] -\/-> [C] CAG [T] <-- [C] CCA
-// --- X --- ---
-//[C] AGT -/\- > [A] CTG [G] --> TGG [G]
-//
-// structure for the node CAG/CTG: (forward:)0010(reverse:)0001 (the order is ACTG); T forward (to the right) and G reverse (to the right)
-unsigned char Terminator::branching_structure(kmer_type graine)
-{
- assert(graine<=revcomp(graine));
- kmer_type new_graine;
- unsigned char result = 0;
- int nt;
- int strand;
-
- for(nt=0; nt<4; nt++)
- {
- // forward right extensions
- strand=0;
- new_graine = next_kmer(graine,nt,&strand);
- if(bloom_solid_kmers->contains(new_graine) && !debloom->contains(new_graine)){
- result|=1<<nt;
- }
-
- // reverse right extensions
- strand=1;
- new_graine = next_kmer(graine,nt,&strand);
- if(bloom_solid_kmers->contains(new_graine) && !debloom->contains(new_graine)){
- result|=1<<(nt+4);
- }
- }
- return result;
-}
-
-// determines if a kmer is branching or not
-bool Terminator::is_branching(kmer_type graine)
-{
- assert(graine<=revcomp(graine));
-
- // method specific to order=0 (remember that order>0 is never used)
- if (order == 0)
- {
- // cannot really be optimized, because most kmers will be non-branching, hence computing branching_structure() takes optimal time
- int nb_forward_links = 0, nb_reverse_links = 0;
- int i;
- unsigned char branching = branching_structure(graine);
-
- for (i=0;i<4;i++)
- nb_forward_links += (branching>>i)&1;
-
- for (i=4;i<8;i++)
- nb_reverse_links += (branching>>i)&1;
-
- return !(nb_forward_links == 1 && nb_reverse_links == 1);
- }
- else
- {
- if (order==1 && is_tip(graine,bloom_solid_kmers,debloom))// algo fixme-order>0: order=1, tips are ignored as branching kmers. should find a more general code for order>1
- return false;
-
- // any order>=0: check that this node really yields a true branching, as opposed to branching yielding tips
- for (int strand=0;strand<2;strand++)
- {
- int osef;
- int nb_extensions = traversal_extensions(graine,strand,osef, bloom_solid_kmers, debloom);
- if (nb_extensions != 1)
- return true;
- }
- }
- return false;
-}
-
-// [branching kmers]-based terminator
-// most kmers should have 1 in-neighbor and 1 out-neighbor
-// this terminator indexes all the other kmers (ie., branching or dead-end kmers)
-// it will miss circular regions tho..
-
-// mark a kmer (the kmer has to be a branching kmer or a neighbor of one, else no effect)
-void BranchingTerminator::mark(kmer_type graine)
-{
- assert(graine<=revcomp(graine));
- bool could_mark = false;
-
- // if it is a branching kmer, mark it directly (it may have no branching neighbor)
- if (is_indexed(graine))
- {
- set_value_t val;
- branching_kmers->get(graine,&val);
- branching_kmers->set(graine,val|(1<<8));
- could_mark = true;
- }
-
- // enumerate all the neighbors
- for (int strand=0; strand < 2; strand++)
- {
- for(int nt=0; nt<4; nt++)
- {
- // test if the neighbor is a branching kmer
- int neighbor_strand = strand;
- kmer_type neighbor = next_kmer(graine,nt,&neighbor_strand);
- if( (!bloom_solid_kmers->contains(neighbor)) || debloom->contains(neighbor) )
- continue;
- if (!is_indexed(neighbor))
- continue;
-
- // mark the kmer in that neighbor
- int revStrand ;
- int revNT;
- revStrand = 1-neighbor_strand;
- if (strand == 0)
- revNT = revcomp_int(code2nucleotide(graine,0));
- else
- revNT = code2nucleotide(graine,sizeKmer-1);
-
- mark(neighbor,revNT,revStrand);
-
- could_mark = true;
- }
- }
- if (could_mark)
- assert(is_marked(graine));
-}
-
-// record info into a branching kmer
-void BranchingTerminator::mark(kmer_type graine, char nt, int strand)
-{
- assert(nt<4);
- assert(strand<2);
- assert(graine<=revcomp(graine));
-
- // BranchingTerminator ignores non-branching kmers
- if (!is_indexed(graine))
- return;
-
- //int val = 0;
- set_value_t val=0;
- branching_kmers->get(graine,&val);
-
- // set a 1 at the right NT & strand position
- if (strand==0)
- val|=1<<(nt);
- else
- val|=1<<(nt+4);
-
- // printf ("mark, graine = %llx val: %x branching structure: %x\n",graine,val,branching_structure(graine));
-
- branching_kmers->set(graine,val); //was insert for Hash16
-
- assert(is_marked(graine,nt,strand));
-}
-
-// test if a kmer is marked, providing that the kmer is a branching kmer or a neighbor of one (else, considered unmarked)
-bool BranchingTerminator::is_marked(kmer_type graine)
-{
- assert(graine<=revcomp(graine));
-
- // if it is a branching kmer, read marking directly (it may have no branching neighbor)
- if (is_indexed(graine))
- return is_marked_branching(graine);
-
- // enumerate all the neighbors
- for (int strand=0; strand < 2; strand++)
- {
- for(int nt=0; nt<4; nt++)
- {
- // test if the neighbor is a branching kmer
- int neighbor_strand = strand;
- kmer_type neighbor = next_kmer(graine,nt,&neighbor_strand);
- if( (!bloom_solid_kmers->contains(neighbor)) || debloom->contains(neighbor) )
- continue;
- if ( !is_indexed(neighbor) )
- continue;
-
- // test the kmer w.r.t that neighbor
- int revStrand ;
- int revNT;
- revStrand = 1-neighbor_strand;
- if (strand == 0)
- revNT = revcomp_int(code2nucleotide(graine,0));
- else
- revNT = code2nucleotide(graine,sizeKmer-1);
-
- if ( is_marked(neighbor,revNT,revStrand) )
- return true;
- }
- }
- return false;
-}
-
-// test if a branching kmer is marked (using the special marker for branching kmers only)
-bool BranchingTerminator::is_marked_branching(kmer_type graine)
-{
- assert(graine<=revcomp(graine));
- assert(is_branching(graine));
- assert(is_indexed(graine));
-
- set_value_t val;
- branching_kmers->get(graine,&val);
- return (val&(1<<8)) != 0;
-}
-
-// that function returns false for non-indexed kmers
-bool BranchingTerminator::is_marked(kmer_type graine, char nt, int strand)
-{
- assert(nt<4);
- assert(strand<2);
- assert(graine<=revcomp(graine));
-
- set_value_t val = 0;
- int is_present = branching_kmers->get(graine,&val);
-
- if (!is_present)
- return false;
-
- //printf ("is_marked, graine = %llx val: %x branching structure: %x\n",graine,val,branching_structure(graine));
-
- int extension_nucleotide_marked;
- if (strand==0)
- extension_nucleotide_marked = (val>>nt)&1;
- else
- extension_nucleotide_marked = (val>>(nt+4))&1;
-
- return extension_nucleotide_marked == 1;
-}
-
-bool BranchingTerminator::is_indexed(kmer_type graine)
-{
- return branching_kmers->contains(graine);
-}
-
-BranchingTerminator::BranchingTerminator(BinaryBank *given_SolidKmers, uint64_t genome_size, Bloom *given_bloom, Set *given_debloom) : Terminator(given_SolidKmers,given_bloom,given_debloom)
-{
- // estimate, from the first million of kmers, the number of branching kmers, extrapolating given the estimated genome size
- // TODO: erwan noticed that this code isn't useful anymore with AssocSet, feel free to remove it sometimes
- uint64_t nb_extrapolation = 3000000;
- SolidKmers->rewind_all();
- uint64_t nb_kmers = 0;
- nb_branching_kmers = 0;
- kmer_type kmer;
- uint64_t previous_estimated_nb_branching_kmers, estimated_nb_branching_kmers;
- while (SolidKmers->read_element(&kmer))
- {
- if (is_branching(kmer))
- nb_branching_kmers++;
-
- if ((nb_branching_kmers%1000)==0 && nb_branching_kmers>0)
- {
- previous_estimated_nb_branching_kmers = estimated_nb_branching_kmers;
- estimated_nb_branching_kmers = (uint64_t)((1.0*nb_branching_kmers)/nb_kmers * genome_size);
- // minor todo: stop when previous_.. - estimated < threshold (pourquoi pas = 10% estimated)
- fprintf (stderr,"%cExtrapolating the number of branching kmers from the first %dM kmers: %lld",13,(int)ceilf(nb_extrapolation/1024.0/1024.0),estimated_nb_branching_kmers);
- }
-
- if (nb_kmers++ == nb_extrapolation)
- break;
- }
- estimated_nb_branching_kmers = (uint64_t)((1.0*nb_branching_kmers)/nb_kmers * genome_size); // final estimation
- int estimated_NBITS_TERMINATOR = max( (int)ceilf(log2f(estimated_nb_branching_kmers)), 1);
- fprintf (stderr,"\n");
-
- // call Hash16 constructor
- // branching_kmers = new Hash16(estimated_NBITS_TERMINATOR);
- branching_kmers = new AssocSet();
-
- // index, once and for all, all the branching solid kmers
- SolidKmers->rewind_all();
- nb_branching_kmers = 0;
- uint64_t nb_solid_kmers = 0;
- while (SolidKmers->read_element(&kmer))
- {
- if (is_branching(kmer))
- {
- // branching_kmers->insert(kmer,0);
- branching_kmers->insert(kmer);
- nb_branching_kmers++;
- }
-
- nb_solid_kmers++;
- if ((nb_branching_kmers%500)==0) fprintf (stderr,"%cIndexing branching kmers %lld / ~%lld",13,nb_branching_kmers,estimated_nb_branching_kmers);
- }
-
- if (nb_branching_kmers == 0)
- printf("\n**** Warning\n\nNo branching kmers were found in this dataset (it is either empty or a tiny circular genome) - Minia will not assemble anything.\n\n****\n\n");
-
- branching_kmers->finalize();
-// branching_kmers->print_total_size();
-// fprintf (stderr,"\n\nAllocated memory for marking: %lld branching kmers x (%lu+%lu) B \n",nb_branching_kmers,sizeof(kmer_type),sizeof(set_value_t));
-// fprintf (stderr," actual implementation: (sizeof(kmer_type) = %lu B) + (sizeof(set_value_t) = %lu B) per entry: %.2f bits / solid kmer\n",sizeof(kmer_type),sizeof(set_value_t),(nb_branching_kmers*((sizeof(kmer_type)+sizeof(set_value_t))*8.0))/nb_solid_kmers);
-
- // init branching_kmers iterator for what happens next
- branching_kmers->start_iterator();
-}
-
-// constructor that simply loads a dump of branching kmers
-BranchingTerminator::BranchingTerminator(BinaryBank *branchingKmers, BinaryBank *given_SolidKmers, Bloom *given_bloom, Set *given_debloom) : Terminator(given_SolidKmers,given_bloom,given_debloom)
-{
- nb_branching_kmers = branchingKmers->nb_elements();
- int NBITS_TERMINATOR = max( (int)ceilf(log2f(nb_branching_kmers)), 1);
-
- // call Hash16 constructor
- // branching_kmers = new Hash16(NBITS_TERMINATOR);
- branching_kmers = new AssocSet();
-
- // load branching kmers
- branchingKmers->rewind_all();
- kmer_type kmer;
- while (branchingKmers->read_element(&kmer))
- branching_kmers->insert(kmer); //,0 for Hash16
-
- branching_kmers->finalize();
-
- if (verbose)
- fprintf (stderr,"\nLoaded %lld branching kmers x %lu B = %.1f MB\n",nb_branching_kmers,sizeof(cell<kmer_type>),((1<<NBITS_TERMINATOR)*sizeof(cell<kmer_type>)*1.0)/1024.0/1024.0);
-
- // init branching_kmers iterator for what happens next
- branching_kmers->start_iterator();
-}
-
-BranchingTerminator::~BranchingTerminator()
-{
- delete branching_kmers;
-}
-
-bool BranchingTerminator::next(kmer_type *kmer)
-{
- if (branching_kmers->next_iterator())
- {
- //*kmer = branching_kmers->iterator.cell_ptr->graine; //for Hash16
- *kmer = *(branching_kmers->iterator);
-
- return true;
- }
- return false;
-}
-
-void BranchingTerminator::dump_branching_kmers(BinaryBank *BranchingKmers)
-{
- // init branching_kmers iterator for what happens next
- branching_kmers->start_iterator();
-
- while (branching_kmers->next_iterator())
- {
- //kmer_type kmer = branching_kmers->iterator.cell_ptr->graine;//for Hash16
- kmer_type kmer = *( branching_kmers->iterator);
-
- BranchingKmers->write_element(&kmer);
- }
- fprintf (stderr,"Dumped branching kmers\n");
-}
-
-
-// reset all marking information: everything is now unmarked
-void BranchingTerminator::reset()
-{
- branching_kmers->clear();
-}
-
-//--------------------------------------------------------
-
-
-// bloom-based terminator (untested, totally unused)
-BloomTerminator::BloomTerminator(int tai_Bloom)
-{
- bloo2 = new Bloom(tai_Bloom); // to mark kmers already used for assembly ... taille a changer
-}
-
-void BloomTerminator::mark(kmer_type graine, char nt, int strand)
-{
- bloo2->add(graine);
-}
-
-bool BloomTerminator::is_marked(kmer_type graine, char nt, int strand)
-{
- return bloo2->contains(graine);
-}
-
-bool BloomTerminator::is_fully_marked(kmer_type graine)
-{
- return is_marked(graine,0,0);
-}
-
-bool BloomTerminator::next(kmer_type *kmer)
-{
- return SolidKmers->read_element(kmer);
-}
-
diff --git a/Terminator.h b/Terminator.h
deleted file mode 100644
index a908cc2..0000000
--- a/Terminator.h
+++ /dev/null
@@ -1,79 +0,0 @@
-//
-// Terminator.h
-
-#ifndef Terminator_h
-#define Terminator_h
-#include <stdlib.h>
-#include <inttypes.h>
-#include <stdint.h>
-#include <cmath> // for log2f
-
-#include "Bloom.h"
-#include "Kmer.h"
-#include "Set.h"
-#include "Bank.h"
-
-class Terminator{
-
-protected:
-
- BinaryBank *SolidKmers;
- Bloom *bloom_solid_kmers;
- Set *debloom;
-
- unsigned char branching_structure(kmer_type graine);
-public:
- static bool verbose;
- virtual void mark(kmer_type graine, char nt, int strand){ return; };
- virtual bool is_marked(kmer_type graine, char nt, int strand){ return (1); };
- virtual void mark(kmer_type graine){ return; };
- virtual bool is_marked(kmer_type graine){ return (1); };
- virtual bool is_marked_branching(kmer_type graine) {return 1;};
- virtual void reset() {return;};
- bool is_branching(kmer_type graine);
- bool next(kmer_type *kmer);
-
- Terminator(BinaryBank *given_SolidKmers, Bloom *given_bloom, Set *given_debloom) : SolidKmers(given_SolidKmers), bloom_solid_kmers(given_bloom), debloom(given_debloom) { }
-};
-
-
-class BloomTerminator {
-protected:
- Bloom * bloo2;
- BinaryBank *SolidKmers;
-public: // is there a way to not repeat the declaration of Terminator functions?
- bool is_fully_marked(kmer_type graine);
- void mark(kmer_type graine, char nt, int strand);
- bool is_marked(kmer_type graine, char nt, int strand);
- bool next(kmer_type *kmer);
-
- BloomTerminator(int tai_Bloom);
- ~BloomTerminator();
-};
-
-class BranchingTerminator: public Terminator{
- bool is_indexed(kmer_type graine);
- int genome_size;
- // Hash16 *branching_kmers;
- AssocSet *branching_kmers;
-public:
- bool is_fully_marked(kmer_type graine);
- void mark(kmer_type graine, char nt, int strand);
- bool is_marked(kmer_type graine, char nt, int strand);
- void mark(kmer_type graine);
- bool is_marked(kmer_type graine);
- bool is_marked_branching(kmer_type graine);
- bool next(kmer_type *kmer);
- int64_t nb_branching_kmers;
- void dump_branching_kmers(BinaryBank *BranchingKmers);
- void reset();
-
- BranchingTerminator(BinaryBank *given_SolidKmers, uint64_t genome_size, Bloom *given_bloom, Set *given_debloom);
- BranchingTerminator(BinaryBank *branchingKmers, BinaryBank *given_SolidKmers, Bloom *given_bloom, Set *given_debloom);
- ~BranchingTerminator();
-};
-
-
-
-
-#endif
diff --git a/Traversal.cpp b/Traversal.cpp
deleted file mode 100644
index de82f2e..0000000
--- a/Traversal.cpp
+++ /dev/null
@@ -1,955 +0,0 @@
-#include <stdio.h>
-#include <algorithm> // for max()
-#include "Traversal.h"
-
-using namespace std;
-
-Traversal::~Traversal()
-{
-}
-
-
-void Traversal::set_maxlen(int given_maxlen)
-{
- maxlen = given_maxlen;
-}
-
-void Traversal::commit_stats()
-{
- final_stats = stats;
-}
-
-void Traversal::revert_stats()
-{
- stats = final_stats;
-}
-
-
-// --------------------------
-// generic structure for traversals
-
-void Traversal::set_max_depth(int given_max_depth)
-{
- max_depth = given_max_depth;
-}
-
-void Traversal::set_max_breadth(int given_max_breadth)
-{
- max_breadth = given_max_breadth;
-}
-
-// mark recorded extensions
-void Traversal::mark_extensions(set<kmer_type> *extensions_to_mark)
-{
- if (terminator == NULL)
- return;
- for(set<kmer_type>::iterator it = extensions_to_mark->begin(); it != extensions_to_mark->end() ; ++it)
- {
- terminator->mark(*it);
- }
-}
-
-// return the number of extension possibilities, the variable nt will contain one of them
-// order=0: just examine immediate neighbors
-// order>0: don't return extensions yielding to deadends of length <= order
-// todo-order>0: there is probably a minor bug: it is likely to return 0 extensions too early for end of contigs
-int traversal_extensions(kmer_type kmer, int strand, int &nt, Bloom *bloom_solid_kmers, Set *debloom)
-{
- if (order==0) // faster order=0 extensions (note: in fact, order is always equal to 0)
- {
- int nb_extensions = 0;
- for(int test_nt=0; test_nt<4; test_nt++)
- {
- int current_strand = strand;
- kmer_type current_kmer = next_kmer(kmer,test_nt,¤t_strand);
-
- if (bloom_solid_kmers->contains(current_kmer) && !debloom->contains(current_kmer))
- {
- nt = test_nt;
- nb_extensions ++;
- }
- }
- return nb_extensions;
- }
- else
- {
- if (order==1) // optimized code for order=1 (copied from assemb.cpp)
- {
- int nb_extensions = 0;
- for(int test_nt=0; test_nt<4; test_nt++)
- {
- int current_strand = strand;
- kmer_type current_kmer = next_kmer(kmer,test_nt, ¤t_strand);
-
- if(bloom_solid_kmers->contains(current_kmer) && !debloom->contains(current_kmer)){
-
- bool is_linked = false;
- for(int tip_nt=0; tip_nt<4; tip_nt++)
- {
- int new_strand = current_strand;
- kmer_type kmer_after_possible_tip = next_kmer(current_kmer,tip_nt, &new_strand);
- if(bloom_solid_kmers->contains(kmer_after_possible_tip) && !debloom->contains(kmer_after_possible_tip))
- {
- is_linked = true;
- break;
- }
- }
- if (!is_linked)
- continue; // it's a tip, because it's linked to nothing
-
- nt = test_nt;
- nb_extensions++;
- }
- }
- return nb_extensions;
- }
- else
- { // slower, general code for order>=0
- Frontline frontline( kmer, strand, bloom_solid_kmers, debloom, NULL, 0);
- while (frontline.depth <= order) // go one step further than order
- {
- frontline.go_next_depth();
- if (frontline.size() <= 1) // stop when no more ambiguous choices
- break;
- if (frontline.size() > 10) // don't allow a breadth too large anyway
- break;
- }
- if (frontline.size() > 0) // recover the nt that lead to this node
- nt = frontline.front().nt;
- return frontline.size();
- }
- }
-}
-
-int Traversal::extensions(kmer_type kmer, int strand, int &nt)
-{
- return traversal_extensions(kmer,strand,nt,bloom,debloom);
-}
-
-/*
- * this function is actually only used when order > 0
- * tip is:
- * one strand: 0 extension
- * other strand: 1 extension to N
- * N: >= 3 neighbors
- * */
-bool is_tip(kmer_type kmer, Bloom *bloom_solid_kmers, Set *debloom)
-{
- int nb_extensions[2]={0};
- kmer_type N=0;
- int N_strand=0;
- for (int strand=0;strand<2; strand++)
- {
- for(int test_nt=0; test_nt<4; test_nt++)
- {
- int current_strand = strand;
- kmer_type current_kmer = next_kmer(kmer,test_nt, ¤t_strand);
- if(bloom_solid_kmers->contains(current_kmer) && !debloom->contains(current_kmer)){
- N = current_kmer;
- N_strand = current_strand;
- nb_extensions[strand]++;
- }
- }
- }
- /* if (nb_extensions[0] != 0 && nb_extensions[1] != 0)
- return false;*/
- // fixme-order>0: too strict, because includes ends of contigs
- if (nb_extensions[0] == 0 || nb_extensions[1] == 0)
- return true;
-
- // now test degree of N
- int N_degree = 0;
- for(int test_nt=0; test_nt<4; test_nt++)
- {
- int current_strand = N_strand;
- kmer_type current_kmer = next_kmer(N,test_nt, ¤t_strand);
-
- if(bloom_solid_kmers->contains(current_kmer) && !debloom->contains(current_kmer)){
- N_degree++;
- }
- }
- return N_degree>=3;
-
-}
-
-// from a branching kmer, get a new node that has never been used before
-// (very simple initial k-mer selection, current used in minia-graph)
-bool Traversal::get_new_starting_node(kmer_type branching_kmer, kmer_type &starting_kmer)
-{
- char newNT[2];
- int nt;
-
- // start with the branching kmer itself
- if ( ! terminator->is_marked(branching_kmer) )
- {
- terminator->mark(branching_kmer);
- starting_kmer = branching_kmer;
- return true;
- }
-
- for (int current_strand = 0; current_strand<2 ; current_strand++)
- {
- for(nt=0; nt<4; nt++)
- {
- int strand = current_strand;
- kmer_type current_kmer;
- current_kmer = next_kmer(branching_kmer,nt,&strand);
-
- if (bloom->contains(current_kmer) && !debloom->contains(current_kmer))
- {
- // only start from an unmarked nt/strand combo
- if (terminator->is_marked(current_kmer))
- continue;
-
- terminator->mark(current_kmer);
-
- starting_kmer = current_kmer;
- return true;
- }
- }
- }
-
- return false;
-}
-
-// improved version of the code above
-// TODO: port minia-graph to use this version, make sure it doesn't break the simple paths traversal
-bool Traversal::get_new_starting_node_improved(kmer_type branching_kmer, kmer_type &starting_kmer)
-{
- char newNT[2];
- int nt;
-
- for (int current_strand = 0; current_strand<2 ; current_strand++)
- {
- for(nt=0; nt<4; nt++)
- {
- int strand = current_strand;
- kmer_type current_kmer;
- current_kmer = next_kmer(branching_kmer,nt,&strand);
-
- if (bloom->contains(current_kmer) && !debloom->contains(current_kmer))
- {
- // alright let's use this convention now:
- // to select new kmers: mark non-branching neighbors of branching nodes
- // to mark as used in assembly: mark branching nodes
-
- // only start from a non-branching k-mer
- if (terminator->is_branching(current_kmer))
- continue;
-
- if (terminator->is_marked(current_kmer))
- continue;
- terminator->mark(current_kmer);
-
- starting_kmer = current_kmer;
- return true;
- }
- }
- }
-
- // actually never start in a branching k-mer
-// if ( ! terminator->is_marked(branching_kmer) )
-// {
-// terminator->mark(branching_kmer);
-// starting_kmer = branching_kmer;
-// return true;
-// }
-
- return false;
-}
-
-
-
-/* the initial k-mer selection function from original Minia release (up until fall 2013) was:
- detect a 2k+2 simple path (anything NOT deadend or snp) around the branching kmer and start to extend from it
- the rationale was:
- -> what if it's a simplepathtraversal and it chooses to start in a deadend?
- -> what if it's a monumenttraversal and the kmer is a true branching: won't be traversed
- yet, branching kmers are the only indexed ones
- //bool Traversal::find_starting_kmer_inside_simple_path(kmer_type branching_kmer, kmer_type &starting_kmer)
- * this function was unused since fall 2013 and to prevent bugs due to new marking conventions, it has been removed on 10 Feb 2014.
- * now we use this:
- -> get a better starting point than a branching kmer inside a long (~2k) simple path:
- -> a k-mer that isn't inside a bubble/tip
-*/
-bool MonumentTraversal::find_starting_kmer(kmer_type branching_kmer, kmer_type &starting_kmer)
-{
- char newNT[2];
- int nt;
- bool debug=false;
- int sum_depths = 0;
-
- if (!get_new_starting_node_improved(branching_kmer, starting_kmer))
- return false;
-
- if (debug) printf("getting new starting kmer\n");
-
- for (int strand = 0; strand<2 ; strand++)
- {
- kmer_type previous_kmer = 0;
- int previous_strand = 0;
-
- // do a BFS to make sure we're not inside a bubble or tip
- Frontline frontline( starting_kmer, strand, bloom, debloom, terminator, NULL, 0, false);
-
- do
- {
- bool should_continue = frontline.go_next_depth();
- if (!should_continue)
- {
- if (debug) printf("strand %d shouldnt continue\n", strand);
- break;
- }
-
- // put the same contraints as in a bubble
- if (frontline.depth > max_depth || frontline.size() > max_breadth)
- {
- if (debug) printf("strand %d reached max depth or breadth (%d %d)\n",strand, frontline.depth,frontline.size());
- break;
- }
-
- // stopping condition: nothing more to explore
- if (frontline.size() == 0)
- {
- if (debug) printf("strand %d nothing more to explore\n", strand);
- break;
- }
-
- char useless_string[max_depth+1];
- int useless_int;
-
- if (frontline.size() <= 1)
- {
- kmer_type current_kmer = 0;
- if (frontline.size() == 1)
- {
- node current_node = frontline.front();
- current_kmer = current_node.kmer;
- }
-
- if ((previous_kmer != 0) && terminator->is_branching(previous_kmer))
- {
- /* the current situation is:
- *
- * current_kmer previous_kmer
- * -O-------------O------------- ... ---starting_kmer
- * \_....
- *
- * or
- *
- * [no extension] previous_kmer
- * X O------------- ... ---starting_kmer
- * \_....
- *
- * so, by looking one k-mer ahead, we make sure that previous_kmer only branches to the right
- *
- */
- set<kmer_type> all_involved_extensions;
- Terminator *save_terminator = terminator;
- terminator = NULL; // do not use terminator in the following bubble traversal
- if (explore_branching(previous_kmer, 1-previous_strand, (char*)useless_string, useless_int, current_kmer, &all_involved_extensions))
- {
- if (debug) printf("depth %d useless int %d and starting belongs %d nb involved nodes %lu\n",frontline.depth,useless_int,all_involved_extensions.find(starting_kmer) != all_involved_extensions.end(),all_involved_extensions.size());
- if (all_involved_extensions.find(starting_kmer) != all_involved_extensions.end())
- {
- terminator = save_terminator;
- return false; // starting_kmer is in a tip/bubble starting from current_kmer
- }
-
- }
- terminator = save_terminator;
- }
- }
- // update previous_kmer
- if (frontline.size() == 1)
- {
- node current_node = frontline.front();
- kmer_type current_kmer = current_node.kmer;
- previous_kmer = current_kmer;
- previous_strand = current_node.strand;
- }
- else
- previous_kmer = 0;
- }
- while (1);
-
- if (debug) printf("strand %d depth %d\n",strand,frontline.depth);
- sum_depths += frontline.depth;
- }
-
- // don't even assemble those regions which have no chance to yield a long contig
- if (sum_depths < (sizeKmer+1))
- return false;
-
- return true;
-}
-
-// main traversal function, which calls avance()
-// important:
-// for MonumentTraversal, either "previous_kmer" is unspecified and then "starting_kmer" is required to be non-branching,
-// or, if starting_kmer is branching, please specify the "previous_kmer" parameter, corresponding to a left k-mer that will
-// be ignored during in-branching checks
-int Traversal::traverse(kmer_type starting_kmer, char* resulting_sequence, int starting_strand, kmer_type previous_kmer)
-{
- kmer_type current_kmer = starting_kmer;
- int current_strand = starting_strand; // 0 = forward, 1 = reverse;
- int len_extension = 0;
- char newNT[max_depth+1];
- int nnt = 0;
- bool looping = false;
-
- int bubble_start, bubble_end;
- bubbles_positions.clear();
-
- //printf(" traversing %llX strand:%d\n",starting_kmer,current_strand);
-
- while( (nnt=avance(current_kmer, current_strand, len_extension == 0, newNT, previous_kmer)))
- {
- if (nnt < 0) // found branching or marked kmers
- break;
-
- if (nnt > 1) // it's a bubble for sure
- bubble_start = len_extension;
-
- // keep re-walking the nucleotides we just discovered, to append to consensus and mark kmers as we go
- for (int cur_nt = 0; cur_nt < nnt; cur_nt++)
- {
- resulting_sequence[len_extension]=newNT[cur_nt];
- len_extension++;
- previous_kmer = current_kmer;
-
- current_kmer = next_kmer(current_kmer,NT2int(newNT[cur_nt]),¤t_strand);
-#ifndef DONTMARK
- terminator->mark(current_kmer); // mark kmer as used in the assembly
-#endif
-
- if (current_kmer == starting_kmer) // perfectly circular regions with no large branching can happen (rarely)
- looping = true;
- }
-
- if (nnt > 1)
- {
- bubble_end = len_extension;
- bubbles_positions.push_back(std::make_pair(bubble_start,bubble_end));
- }
-
- if (looping)
- break;
-
- if (len_extension > maxlen)
- {
- // fprintf(stderr,"max contig len reached \n");
- break;
- }
- }
- resulting_sequence[len_extension]='\0';
- return len_extension;
-}
-
-
-// ----------------
-// random branching traversal
-
-char Traversal::random_unmarked_avance(kmer_type kmer, int current_strand, bool first_extension, char * newNT)
-{
- char bin2NT[4] = {'A','C','T','G'};
-
- int nt;
- for(nt=0; nt<4; nt++) //takes first branch we find
- {
- int strand = current_strand;
-
- kmer_type new_graine = next_kmer(kmer,nt,&strand);
-
- if(bloom->contains(new_graine) && !debloom->contains(new_graine) && !terminator->is_marked(kmer, nt, current_strand)){
- *newNT = bin2NT[nt];
- return 1;
- }
- }
- return 0;
-}
-
-char RandomBranchingTraversal::avance(kmer_type kmer, int current_strand, bool first_extension, char * newNT, kmer_type previous_kmer)
-{
- return random_unmarked_avance(kmer,current_strand,first_extension,newNT);
-}
-
-// ----------------
-// simple paths traversal
-// invariant: the input kmer has no in-branching.
-// returns:
-// 1 if a good extension is found
-// 0 if a deadend was reached
-// -1 if out-branching was detected
-// -2 if no out-branching but next kmer has in-branching
-int Traversal::simple_paths_avance(kmer_type kmer, int strand, bool first_extension, char * newNT)
-{
- char bin2NT[4] = {'A','C','T','G'};
-
- int nb_extensions = 0, in_branching_degree = 0;
- int good_nt;
-
- // return the number of possible forward extensions
- nb_extensions = extensions(kmer, strand, good_nt);
-
- if (nb_extensions == 1)
- {
- // if the next kmer has in-branching, don't extend the current kmer
- int second_strand = strand;
- kmer_type second_kmer = next_kmer(kmer,good_nt,&second_strand);
- int osef;
- in_branching_degree = extensions(second_kmer,1-second_strand,osef);
- if (in_branching_degree > 1)
- return -2;
-
- *newNT = bin2NT[good_nt];
- return 1;
- }
-
- if (nb_extensions > 1) // if this kmer has out-branching, don't extend it
- return -1;
-
- return 0;
-}
-
-char SimplePathsTraversal::avance(kmer_type kmer, int current_strand, bool first_extension, char * newNT, kmer_type previous_kmer)
-{
- return max(simple_paths_avance(kmer,current_strand,first_extension,newNT),0);
-}
-
-
-// ----------------
-//
-// Monument traversal
-
-
-// a frontline is a set of nodes having equal depth in the BFS
-Frontline::Frontline(kmer_type starting_kmer, int starting_strand, Bloom *bloom, Set *debloom, Terminator *terminator, set<kmer_type> *all_involved_extensions, kmer_type previous_kmer, bool check_in_branching) :
- starting_kmer(starting_kmer), starting_strand(starting_strand), bloom(bloom), debloom(debloom), terminator(terminator), all_involved_extensions(all_involved_extensions), previous_kmer(previous_kmer), check_in_branching(check_in_branching), depth(0)
-{
- already_frontlined.insert(starting_kmer);
- already_frontlined.insert(previous_kmer);
-
- node first_node(starting_kmer,starting_strand,-1);
- frontline.push(first_node);
-}
-
-bool Frontline::go_next_depth()
-{
- // extend all nodes in this frontline simultaneously, creating a new frontline
- stopped_reason=NONE;
- queue_nodes new_frontline;
- while (!frontline.empty())
- {
- node current_node = frontline.front();
- frontline.pop();
- kmer_type current_kmer = current_node.kmer;
- int current_strand = current_node.strand;
-
- // make sure this node doesn't have large in-branching.
- if ( check_in_branching && check_inbranching(current_kmer,current_strand))
- {
- //printf("######## found large in-branching (depth=%d)\n",depth);
- return false; // detected that the bubble isn't simple (there is large in-branching inside)
- }
-
- // enqueue all neighbors of this node, except these that were already in a frontline
- for(int nt=0; nt<4; nt++)
- {
- kmer_type new_kmer = current_kmer;
- int new_strand = current_strand;
-
- // propagate information where this node comes from
- int from_nt = (current_node.nt == -1) ? nt : current_node.nt;
-
- // go to next kmer
- new_kmer = next_kmer(new_kmer,nt,&new_strand);
-
- // test if that node hasn't already been explored
- if (already_frontlined.find(new_kmer)!= already_frontlined.end())
- continue;
-
- if(bloom->contains(new_kmer) && ((debloom == NULL) || (!debloom->contains(new_kmer))))
- {
-
- // if this bubble contains a marked (branching) kmer, stop everyone at once (to avoid redundancy)
- if (terminator != NULL && terminator->is_branching(new_kmer))
- if (terminator->is_marked_branching(new_kmer))
- {
- stopped_reason=Frontline::MARKED;
- return false;
- }
-
- node new_node(new_kmer,new_strand,from_nt);
- new_frontline.push(new_node);
- already_frontlined.insert(new_kmer);
-
- //if (check_in_branching)
- //printf("frontline _depth: %d enqueuing kmer %s\n",depth ,print_kmer(new_kmer));
-
- // since this extension is validated, insert into the list of involved ones
- if (all_involved_extensions != NULL)
- all_involved_extensions->insert(new_kmer);
- }
- }
- }
- frontline = new_frontline;
- ++depth;
- return true;
-}
-
-int Frontline::size()
-{
- return frontline.size();
-}
-
-node Frontline::front()
-{
- return frontline.front();
-}
-
-// new code, not in monument, to detect any in-branching longer than 3k
-bool Frontline::check_inbranching(kmer_type from_kmer, int from_strand)
-{
- int nt;
-
- for(nt=0; nt<4; nt++)
- {
- int strand = 1-from_strand;
- kmer_type current_kmer;
- current_kmer = next_kmer(from_kmer,nt,&strand);
-
- // only check in-branching from kmers not already frontlined
- // which, for the first extension, includes the previously traversed kmer (previous_kmer)
- // btw due to avance() invariant, previous_kmer is always within a simple path
- if (already_frontlined.find(current_kmer) != already_frontlined.end())
- continue;
-
- if (bloom->contains(current_kmer) && !debloom->contains(current_kmer))
- {
-
- // create a new frontline inside this frontline to check for large in-branching (i know, we need to go deeper, etc..)
- Frontline frontline( current_kmer, strand, bloom, debloom, terminator, all_involved_extensions,from_kmer, false);
-
- do
- {
- bool should_continue = frontline.go_next_depth();
- if (!should_continue)
- {
- stopped_reason=Frontline::IN_BRANCHING_OTHER;
- break;
- }
- // don't allow a depth > 3k
- if (frontline.depth > 3 * sizeKmer)
- {
- stopped_reason=Frontline::IN_BRANCHING_DEPTH;
- break;
- }
-
- // don't allow a breadth too large
- if (frontline.size()> 10)
- {
- stopped_reason=Frontline::IN_BRANCHING_BREADTH;
- break;
- }
-
- // stopping condition: no more in-branching
- if (frontline.size() == 0)
- break;
- }
- while (1);
-
- if (frontline.size() > 0)
- return true; // found large in-branching
- }
- }
-
- // didn't find any in-branching
- return false;
-}
-
-// similar to Monument's extension_graph.py:find_end_of_branching
-// basically do a bounded-depth, bounded-breadth BFS
-int MonumentTraversal::find_end_of_branching(kmer_type starting_kmer, int starting_strand, kmer_type &end_kmer, int &end_strand, kmer_type previous_kmer, set<kmer_type> *all_involved_extensions)
-{
- bool check_in_branching = true;
- Frontline frontline( starting_kmer, starting_strand, bloom, debloom, terminator, all_involved_extensions, previous_kmer, check_in_branching);
-
- do
- {
- bool should_continue = frontline.go_next_depth();
- if (!should_continue)
- {
- if (frontline.stopped_reason == Frontline::MARKED)
- stats.couldnt_because_marked_kmer++;
- if (frontline.stopped_reason == Frontline::IN_BRANCHING_DEPTH)
- stats.couldnt_inbranching_depth++;
- if (frontline.stopped_reason == Frontline::IN_BRANCHING_BREADTH)
- stats.couldnt_inbranching_breadth++;
- if (frontline.stopped_reason == Frontline::IN_BRANCHING_OTHER)
- stats.couldnt_inbranching_other++;
- return 0;
- }
-
- // don't allow a depth too large
- if (frontline.depth > max_depth)
- {
- stats.couldnt_traverse_bubble_depth++;
- return 0;
- }
-
- // don't allow a breadth too large
- if (frontline.size()> max_breadth)
- {
- stats.couldnt_traverse_bubble_breadth++;
- return 0;
- }
-
- // stopping condition: frontline is either empty, or contains only 1 kmer
- // needs the kmer to be non-branching, in order to avoid a special case of bubble immediatly after a bubble
- // affects mismatch rate in ecoli greatly
- if (frontline.size() == 0)
- {
- stats.couldnt_find_extension++;
- return 0;
- }
-
-// if (frontline.size() == 1) // longer contigs but for some reason, higher mismatch rate
- if (frontline.size() == 1 && (terminator == NULL || ( !terminator->is_branching(frontline.front().kmer) )))
- break;
- }
- while (1);
-
- if (frontline.size()==1)
- {
- node end_node = frontline.front();
- end_kmer = end_node.kmer;
- end_strand = end_node.strand;
- return frontline.depth;
- }
-
- return 0;
-}
-
-// similar to Monument's extension_graph.py:all_paths_between
-set<string> MonumentTraversal::all_consensuses_between(kmer_type start_kmer, int start_strand, kmer_type end_kmer, int end_strand, int traversal_depth, set<kmer_type> used_kmers, string current_consensus, bool &success)
-{
- char bin2NT[4] = {'A','C','T','G'};
- //printf("all consensuses between traversal_depth: %d kmer %s success %d\n",traversal_depth,print_kmer(start_kmer),success);
- set<string> consensuses;
-
- // find_end_of_branching and all_consensues_between do not always agree on clean bubbles ends
- // until I can fix the problem, here is a fix
- // to reproduce the problem: SRR001665.fasta 21 4
- if (traversal_depth < -1)
- {
- success = false;
- return consensuses;
- }
-
- if (start_kmer == end_kmer)// not testing for end_strand anymore because find_end_of_branching doesn't care about strands
- {
- consensuses.insert(current_consensus);
- return consensuses;
- }
-
- // visit all neighbors
- for(int nt=0; nt<4; nt++)
- {
- // craft neighbor node
- int new_strand = start_strand;
- kmer_type new_graine = next_kmer(start_kmer,nt,&new_strand);
-
- // check if the neighbor node is valid
- if(bloom->contains(new_graine) && !debloom->contains(new_graine)){
-
- // don't resolve bubbles containing loops
- // (tandem repeats make things more complicated)
- // that's a job for a gapfiller
- if (used_kmers.find(new_graine) != used_kmers.end())
- {
- success = false;
- return consensuses;
- }
-
- // generate extended consensus sequence
- string extended_consensus(current_consensus);
- extended_consensus.append(1,bin2NT[nt]);
-
- // generate list of used kmers (to prevent loops)
- set<kmer_type> extended_kmers(used_kmers);
- extended_kmers.insert(new_graine);
-
- // recursive call to all_consensuses_between
- set<string> new_consensuses = all_consensuses_between(new_graine, new_strand, end_kmer, end_strand, traversal_depth - 1, extended_kmers, extended_consensus, success);
- consensuses.insert(new_consensuses.begin(), new_consensuses.end());
-
- // mark to stop we end up with too many consensuses
- if (consensuses.size() > (unsigned int )max_breadth)
- success = false;
- }
-
- // propagate the stop if too many consensuses reached
- if (success == false)
- return consensuses;
- }
- return consensuses;
-}
-
-// just a wrapper
-set<string> MonumentTraversal::all_consensuses_between(kmer_type start_kmer, int start_strand, kmer_type end_kmer, int end_strand, int traversal_depth, bool &success)
-{
- set<kmer_type> used_kmers;
- used_kmers.insert(start_kmer);
- string current_consensus;
- success = true;
- //printf("all cons between - end kmer = %s\n",print_kmer(end_kmer));
- return all_consensuses_between(start_kmer, start_strand, end_kmer, end_strand, traversal_depth, used_kmers, current_consensus, success);
-}
-
-// similar to Monument's extension_graph.py:validate_paths
-// return true if, basically, the consensuses aren't too different
-bool MonumentTraversal::validate_consensuses(set<string> consensuses, char *result, int &result_length)
-{
- bool debug = false;
- // compute mean and stdev of consensuses
- int mean = 0;
- int path_number = 0;
- for(set<string>::iterator it = consensuses.begin(); it != consensuses.end() ; ++it)
- {
- if (debug) printf("bubble path %d: %s (len=%lu)\n",path_number,(*it).c_str(),(*it).length());
- mean+=(*it).length();
- path_number++;
- }
- mean/=consensuses.size();
- double stdev = 0;
- for(set<string>::iterator it = consensuses.begin(); it != consensuses.end() ; ++it)
- {
- int consensus_length = (*it).length();
- stdev += pow(fabs(consensus_length-mean),2);
- }
- stdev = sqrt(stdev/consensuses.size());
-
- // don't traverse large bubbles
- if (mean > max_depth)
- return false;
-
- // don't traverse large deadends (here, having one consensus means the other paths were large deadends)
- if (consensuses.size() == 1 && mean > sizeKmer+1) // deadend length should be < k+1 (most have length 1, but have seen up to 10 in ecoli)
- return false;
-
- if (debug) printf("%lu-bubble mean %d, stdev %.1f\n",consensuses.size(),mean,stdev);
-
- // traverse bubbles if paths have roughly the same length
- if (stdev>mean/5)
- return false;
-
- // check that all consensuses are similar
- if (! all_consensuses_almost_identical(consensuses))
- return false;
-
- // if all good, an arbitrary consensus is chosen
- string chosen_consensus = *consensuses.begin();
- result_length = chosen_consensus.length();
- if (result_length> max_depth) // it can happen that consensus is longer than max_depth, despite that we didn't explore that far (in a messy bubble with branchings inside)
- return false;
-
- chosen_consensus.copy(result, result_length);
- return true;
-}
-
-bool MonumentTraversal::all_consensuses_almost_identical(set<string> consensuses)
-{
- for (set<string>::iterator it_a = consensuses.begin(); it_a != consensuses.end(); it_a++)
- {
- set<string>::iterator it_b = it_a;
- advance(it_b,1);
- while (it_b != consensuses.end())
- {
- if (needleman_wunch(*it_a,*it_b) * 100 < consensuses_identity)
- return false;
- advance(it_b,1);
- }
- }
- return true;
-}
-
-
-// similar to Monument's extension_graph.py:explore_branching
-// return true if the branching can be traversed, and mark all involved nodes
-bool MonumentTraversal::explore_branching(kmer_type start_kmer, int start_strand, char *consensus, int &consensus_length, kmer_type previous_kmer, set<kmer_type> *all_involved_extensions)
-{
- kmer_type end_kmer;
- int end_strand;
-
- // find end of branching, record all involved extensions (for future marking)
- // it returns false iff it's a complex bubble
- int traversal_depth = find_end_of_branching(start_kmer, start_strand, end_kmer, end_strand, previous_kmer, all_involved_extensions);
- if (!traversal_depth)
- {
- stats.couldnt_find_all_consensuses++;
- return false;
- }
-
- // find all consensuses between start node and end node
- set<string> consensuses;
- bool success;
- consensuses = all_consensuses_between(start_kmer, start_strand, end_kmer, end_strand, traversal_depth+1, success);
- // if consensus phase failed, stop
- if (!success)
- return false;
-
- // validate paths, based on identity
- bool validated = validate_consensuses(consensuses, consensus, consensus_length);
- if (!validated)
- {
- stats.couldnt_validate_consensuses++;
- return false;
- }
-
- // the consensuses agree, mark all the involved extensions
- // (corresponding to alternative paths we will never traverse again)
- mark_extensions(all_involved_extensions);
-
- return true;
-}
-
-// wrapper
-bool MonumentTraversal::explore_branching(kmer_type start_kmer, int start_strand, char *consensus, int &consensus_length, kmer_type previous_kmer)
-{
- set<kmer_type> *all_involved_extensions = new set<kmer_type>;
- bool res = explore_branching(start_kmer, start_strand, consensus, consensus_length, previous_kmer, all_involved_extensions);
- delete all_involved_extensions;
- return res;
-}
-
-
-// invariant here:
-// kmer is always obtained after traversing a non-branching kmer
-// in other words, the only in-branching of that kmer is previous_kmer
-char MonumentTraversal::avance(kmer_type kmer, int current_strand, bool first_extension, char * newNT, kmer_type previous_kmer)
-{
-
- // if we're on a simple path, just traverse it
- int is_simple_path = simple_paths_avance(kmer, current_strand, first_extension, newNT);
- if (is_simple_path > 0)
- return 1;
-
- // the following function does:
- // * a bfs from the starting kmer, stopping when:
- // - breadth > max_breadth
- // or
- // - depth > max_depth
- // * check if there a single end point
- // * computing all possible paths between start and end
- // * returns one flattened consensus sequence
- int newNT_length;
- bool success = explore_branching(kmer, current_strand, newNT, newNT_length, previous_kmer);
- if (!success)
- {
- stats.ended_traversals++;
- return 0;
- }
-
- return newNT_length;
-}
diff --git a/Traversal.h b/Traversal.h
deleted file mode 100644
index 9e40ad0..0000000
--- a/Traversal.h
+++ /dev/null
@@ -1,168 +0,0 @@
-#ifndef Traversal_h
-#define Traversal_h
-
-#include <set>
-#include <queue>
-#include <string>
-#include <cmath> // only for pow()
-
-#include "Kmer.h"
-#include "Terminator.h"
-#include "Bloom.h"
-#include "Set.h"
-#include "Utils.h" // for needleman_wunch
-
-using namespace std;
-
-// types using in advanced traversal functions
-struct kmer_strand_nt {
- kmer_type kmer;
- int strand;
- int nt;
- kmer_strand_nt(kmer_type kmer, int strand, int nt) : kmer(kmer), strand(strand), nt(nt) {}
- bool operator<(const kmer_strand_nt &other) const {
- // need to define a strict weak ordering
- if (kmer != other.kmer)
- return (kmer < other.kmer);
- if (strand != other.strand)
- return (strand < other.strand);
- return (nt < other.nt); }
-};
-
-// in traversals, a node is just a tuple (kmer, strand, nt initially chosen to reach that node)
-// so it just happens that it's the same type as kmer_strand_nt
-typedef kmer_strand_nt node;
-typedef queue<node> queue_nodes;
-
-// some stats
-struct TraversalStats
-{
- long ended_traversals;
- long couldnt_find_all_consensuses;
- long couldnt_validate_consensuses;
- long couldnt_traverse_bubble_breadth;
- long couldnt_traverse_bubble_depth;
- long couldnt_because_marked_kmer;
- long couldnt_inbranching_depth;
- long couldnt_inbranching_breadth;
- long couldnt_inbranching_other;
- long couldnt_find_extension;
-};
-
-// semi-abstract class. implements traverse but not avance
-class Traversal{
-
-protected:
- Bloom *bloom;
- Set *debloom;
- Terminator *terminator;
- int maxlen;
- int max_depth;
- int max_breadth;
-
- virtual char avance(kmer_type graine, int current_strand, bool first_extension, char * newNT, kmer_type previous_kmer) = 0;
-
- void mark_extensions(set<kmer_type> *extensions_to_mark);
-
-public:
- Traversal(Bloom *given_bloom, Set *given_debloom, Terminator *given_terminator) : bloom(given_bloom), debloom(given_debloom), terminator(given_terminator), maxlen(1000000),max_depth(500),max_breadth(20), stats(TraversalStats()), final_stats(TraversalStats()) { }
- ~Traversal();
-
- void set_maxlen(int);
- void set_max_depth(int);
- void set_max_breadth(int);
- int traverse(kmer_type starting_kmer, char* resulting_sequence, int current_strand, kmer_type previous_kmer = 0);
-
- // n-order extension function, to ignore tips
- int extensions(kmer_type kmer, int strand, int &nt);
-
- // useful atomic avance functions
- int simple_paths_avance(kmer_type graine, int current_strand, bool first_extension, char * newNT);
- char random_unmarked_avance(kmer_type graine, int current_strand, bool first_extension, char * newNT);
-
- // high level starting kmer selection
- bool get_new_starting_node(kmer_type branching_kmer, kmer_type &starting_kmer);
- bool get_new_starting_node_improved(kmer_type branching_kmer, kmer_type &starting_kmer);
- bool find_starting_kmer_inside_simple_path(kmer_type kmer, kmer_type &starting_kmer); // now unused
-
- vector<pair<int, int> > bubbles_positions; // record the start/end positions of traversed bubbles (only from the latest traverse() call)
-
- TraversalStats final_stats, stats;
- void commit_stats(); // save current stats into final stats
- void revert_stats(); // discard changes in stats (because discarded contig)
-};
-
-// n-order extension function, to ignore tips
-extern int order; // declared and initialized in assemb.cpp
-int traversal_extensions(kmer_type kmer, int strand, int &nt, Bloom *bloom_solid_kmers, Set *debloom);
-bool is_tip(kmer_type kmer, Bloom *bloom_solid_kmers, Set *debloom);
-
-class RandomBranchingTraversal: public Traversal
-{
-protected:
- char avance(kmer_type graine, int current_strand, bool first_extension, char * newNT, kmer_type previous_kmer);
-
-public:
- RandomBranchingTraversal(Bloom *given_bloom, Set *given_debloom, Terminator *given_terminator) : Traversal(given_bloom,given_debloom,given_terminator) {}
-
-};
-
-
-class SimplePathsTraversal: public Traversal
-{
- char avance(kmer_type graine, int current_strand, bool first_extension, char * newNT, kmer_type previous_kmer);
-public:
- SimplePathsTraversal(Bloom *given_bloom, Set *given_debloom, Terminator *given_terminator) : Traversal(given_bloom,given_debloom,given_terminator) {}
-
-};
-
-// auxiliary class that is used by MonumentTraversal and deblooming
-class Frontline
-{
- kmer_type starting_kmer; int starting_strand; Bloom *bloom; Set *debloom; Terminator *terminator; set<kmer_type> *all_involved_extensions; kmer_type previous_kmer;
- queue_nodes frontline;
- // set<node, CompareWithoutNT> already_frontlined;
- set<kmer_type> already_frontlined; // making it simpler now
-public:
- bool check_in_branching;
- int depth;
- Frontline(kmer_type starting_kmer, int starting_strand, Bloom *bloom, Set *debloom, Terminator *terminator, set<kmer_type> *all_involved_extensions, kmer_type previous_kmer = 0, bool check_in_branching = true);
- bool go_next_depth();
- int size();
- node front();
- bool check_inbranching(kmer_type from_kmer, int current_strand);
- enum reason
- {
- NONE,
- ALREADY_FRONTLINED,
- IN_BRANCHING_DEPTH,
- IN_BRANCHING_BREADTH,
- IN_BRANCHING_OTHER,
- MARKED
- };
- reason stopped_reason;
-
-};
-
-class MonumentTraversal: public Traversal
-{
- //int max_length_deadend = 150; // replaced by sizeKmer+1
- static const int consensuses_identity = 90; // traversing bubble if paths are all pair-wise identical by > 90%
- char avance(kmer_type graine, int current_strand, bool first_extension, char * newNT, kmer_type previous_kmer);
-
- set<string> all_consensuses_between(kmer_type start_kmer, int start_strand, kmer_type end_kmer, int end_strand, int traversal_depth, set<kmer_type> used_kmers, string current_consensus, bool &success);
- set<string> all_consensuses_between(kmer_type start_kmer, int start_strand, kmer_type end_kmer, int end_node, int traversal_depth, bool &success);
- int find_end_of_branching(kmer_type starting_kmer, int starting_strand, kmer_type &end_kmer, int &end_strand, kmer_type previous_kmer, set<kmer_type> *all_involved_extensions);
- bool explore_branching(kmer_type start_kmer, int start_strand, char *consensus, int &consensus_length, kmer_type previous_kmer);
- bool explore_branching(kmer_type start_kmer, int start_strand, char *consensus, int &consensus_length, kmer_type previous_kmer, set<kmer_type> *all_involved_extensions);
- bool validate_consensuses(set<string> consensuses, char *result, int &result_length);
-
-public:
- static bool all_consensuses_almost_identical(set<string> consensuses);
- MonumentTraversal(Bloom *given_bloom, Set *given_debloom, Terminator *given_terminator) : Traversal(given_bloom,given_debloom,given_terminator) {}
-
- bool find_starting_kmer(kmer_type kmer, kmer_type &starting_kmer);
-
-};
-
-#endif
diff --git a/Utils.cpp b/Utils.cpp
deleted file mode 100644
index 400bab0..0000000
--- a/Utils.cpp
+++ /dev/null
@@ -1,647 +0,0 @@
-#include "Utils.h"
-#include "Bank.h"
-
-// some globals that don't really belong anywhere
-int nks; // min abundance
-uint32_t max_couv = 2147483646; // note: uint_abundance_t is 32 bits in SortingCount.cpp
-struct timeval tim;
-uint64_t nbkmers_solid = 0, b1_size = 0;
-
-const char *solid_kmers_file = (char *)"solid_kmers_binary";
-const char *false_positive_kmers_file = (char *)"false_positive_kmers";
-const char *bloom_file = (char *)"bloom_data";
-const char *assembly_file = (char *)"contigs.fa";
-const char *branching_kmers_file = (char *)"branching_kmers"; // (only useful for multiple assemblies with same bloom&debloom structure (ie debugging))
-const char *binary_read_file = (char *)"reads_binary";
-const char *histo_file_name = (char *)"histo";
-const char *breakpoints_file_name = (char *)"breakpoints";
-
-const char *assoc_kmer_file = (char *)"paired_kmer";
-
-
-// prefix-based output files naming
-char prefix[1024];
-char fileName[1024];
-char *return_file_name(const char *suffix)
-{
- if (strlen(prefix)>0)
- sprintf(fileName,"%s.%s",prefix,suffix);
- else
- sprintf(fileName,"%s",suffix);
- return fileName;
-}
-
-
-int readlen;
-
-#ifndef NO_BLOOM_UTILS
-template <typename T, typename U>
-// T can be Bloom, BloomCpt, BloomCpt3 or LinearCounter (just needs to support add(kmer_type) and possibly contains(kmer_type))
-// U can be BloomCpt or BloomCpt3
-void bloom_pass_reads(Bank *Sequences, T *bloom_to_insert, U *bloom_counter, char *stderr_message)
-{
- int64_t NbRead = 0;
- int64_t NbInsertedKmers = 0;
- Sequences->rewind_all();
- char * rseq;
- long i;
- kmer_type kmer, graine, graine_revcomp;
-
-
- while (Sequences->get_next_seq(&rseq,&readlen))
- {
- for (i=0; i<readlen-sizeKmer+1; i++)
- {
- kmer = extractKmerFromRead(rseq,i,&graine,&graine_revcomp);
-
- if (bloom_counter != NULL)
- {
- // discard kmers which are not solid
- if( ! bloom_counter->contains_n_occ(kmer,nks)) continue;
- }
-
- bloom_to_insert->add(kmer);
- NbInsertedKmers++;
-
- }
- NbRead++;
- if ((NbRead%10000)==0) fprintf (stderr,stderr_message,13,NbRead);
- }
-// fprintf (stderr,"\nInserted %lld %s kmers in the bloom structure.\n",(long long)NbInsertedKmers,"(redundant)");
-
-}
-
-
-template <typename T> // T can be Bloom, BloomCpt or BloomCpt3
-void bloom_pass_reads_binary(T *bloom_to_insert, BloomCpt *bloom_counter, char *stderr_message)
-{
- //fprintf(stderr,"binary pass \n");
- int64_t NbRead = 0;
- int64_t NbInsertedKmers = 0;
- kmer_type kmer;
-
- // read solid kmers from disk
- BinaryBank * SolidKmers = new BinaryBank(return_file_name(solid_kmers_file),sizeof(kmer),0);
-
- while(SolidKmers->read_element(&kmer))
- {
- // printf("kmer %lld\n",kmer);
- bloom_to_insert->add(kmer);
- NbInsertedKmers++;
- NbRead++;
- if ((NbRead%10000)==0) fprintf (stderr,stderr_message,13,(long long)NbRead);
- }
-// fprintf (stderr,"\nInserted %lld %s kmers in the bloom structure.\n",(long long)NbInsertedKmers,"solid");
- SolidKmers->close();
-
-}
-
-int estimated_BL1;
-uint64_t estimated_BL1_freesize;
-
-float NBITS_PER_KMER = 11 ; // number of bits per kmer that optimizes bloo1 size
-
-
-
-// loading bloom from disk
-template <typename T> //bloocpt or bloocpt3
-Bloom *bloom_create_bloo1(T *bloom_counter, bool from_dump)
-{
-
- BinaryBank * SolidKmers ;
-
- if(from_dump && nsolids) // from dump and known number of solid kmers
- {
- //nsolids is sotred in a config file
- //number of solid kmers cannot be computed precisely from bloom file, imprecision of 0-7
- estimated_BL1 = max( (int)ceilf(log2f(nsolids*NBITS_PER_KMER)), 1);
- estimated_BL1_freesize = (uint64_t)(nsolids*NBITS_PER_KMER);
- b1_size = (uint64_t) estimated_BL1_freesize; nbkmers_solid = nsolids ; // for correct printf in print_size_summary
-
- printf("load bloom from dump, containing %lli solid kmers b1_size %lli\n",nsolids,b1_size);
-
- }
- else
- {
- // get true number of solid kmers, in order to precisely size the bloom filter
- SolidKmers = new BinaryBank(return_file_name(solid_kmers_file),sizeof(kmer_type),0);
- estimated_BL1 = max( (int)ceilf(log2f(SolidKmers->nb_elements()*NBITS_PER_KMER)), 1);
- estimated_BL1_freesize = (uint64_t)(SolidKmers->nb_elements()*NBITS_PER_KMER);
- //printf("nelem %lli nbits %g \n",(long long)(SolidKmers->nb_elements()),NBITS_PER_KMER);
- }
-
- //printf("Allocating %0.1f MB of memory for the main Bloom structure (%g bits/kmer)\n",(1LL<<estimated_BL1)/1024.0/1024.0/8.0,NBITS_PER_KMER);
- if(estimated_BL1_freesize ==0) estimated_BL1_freesize =10;
-
- //printf("freesize %lli estimated_BL1_freesize %0.1f MB of memory for the main Bloom structure (%g bits/kmer)\n",(long long)estimated_BL1_freesize,(estimated_BL1_freesize)/1024.0/1024.0/8.0,NBITS_PER_KMER);
-
- Bloom *bloo1;
-#if CUSTOMSIZE
- bloo1 = new Bloom((uint64_t)estimated_BL1_freesize);
-#else
- bloo1 = new Bloom(estimated_BL1);
-#endif
-
- bloo1->set_number_of_hash_func((int)floorf(0.7*NBITS_PER_KMER));
-
- if (from_dump)
- bloo1->load(return_file_name(bloom_file)); // just load the dump
- else
- {
- bloom_pass_reads_binary(bloo1, bloom_counter, (char*)"%cInsert solid Kmers in Bloom %lld"); // use the method reading SolidKmers binary file, was useful when varying Bloom size (!= dumped size)
- //bloo1->dump(return_file_name(bloom_file)); // create bloom dump
- SolidKmers->close();
- }
-
- return bloo1;
-}
-
-// wrapper for default behavior: don't load from dump
-template <typename T> //bloocpt or bloocpt3
-Bloom *bloom_create_bloo1(T *bloom_counter)
-{
- return bloom_create_bloo1(bloom_counter, false);
-}
-
-template Bloom *bloom_create_bloo1<BloomCpt>(BloomCpt *bloom_counter); // trick to avoid linker errors: http://www.parashift.com/c++-faq-lite/templates.html#faq-35.13
-template Bloom *bloom_create_bloo1<BloomCpt>(BloomCpt *bloom_counter, bool from_dump);
-
-// --------------------------------------------------------------------------------
-// below this line: unused kmer counting code
-
-FILE * F_kmercpt_read;
-FILE * F_kmercpt_write;
-
-//in last partition : create solid kmers file, and load solid kmers in bloo1 bloom
-void end_kmer_count_partition(bool last_partition, Hash16 *hasht1)
-{
-
- int value;
- int cptk=0;
- int64_t nso=0;
- /////////////////////////begin write files
- rewind (F_kmercpt_read);
- rewind (F_kmercpt_write);
-
-#ifndef MINGW
- ftruncate(fileno(F_kmercpt_write), 0); //erase previous file
-#else // tempfix? fileno is not accepted by mingw
- fclose(F_kmercpt_write);
- F_kmercpt_write = fopen("kmer_count2","wb+");
-#endif
- BinaryBank * SolidKmers = NULL;
- kmer_type graine;
-
- if (last_partition)
- SolidKmers = new BinaryBank(return_file_name(solid_kmers_file),sizeof(kmer_type),1);
-
- while(fread(&graine, sizeof(graine),1, F_kmercpt_read)){
- fread(&cptk, sizeof(cptk), 1, F_kmercpt_read);
-
- hasht1->remove(graine,&value); // if graine is present, get value of graine and remove graine, else value=0
- cptk += value;
-
- fwrite(&graine, sizeof(graine), 1, F_kmercpt_write);
- fwrite(&cptk, sizeof(cptk), 1, F_kmercpt_write);
-
- if (last_partition && cptk >= nks)
- // if last partition, also need to search for solid kmers in remaining of hasht1, so this is not enough:
- {
- SolidKmers->write_element(&graine);
- nso++;
- }
-
- }
- hasht1->dump(F_kmercpt_write); // dump remaining of hasht1
-
- if (last_partition)
- {
- nso+=hasht1->getsolids(NULL,SolidKmers,nks); // get remaining solids of hasht1
- fprintf(stderr,"nsolid kmers = %lli \n",(long long)nso);
-
- SolidKmers->close();
-
-#ifndef MINGW
- ftruncate(fileno(F_kmercpt_read), 0); //erase previous file
-#else // tempfix? fileno is not accepted by mingw
- fclose(F_kmercpt_read);
- F_kmercpt_read = fopen("kmer_count2","wb+");
-#endif
-
- }
-}
-
-
-
-template <typename T>
-void exact_kmer_count(Bank *Sequences, T *bloom_counter, unsigned long max_memory)
-{
- FILE * count_file = fopen("kmer_count","wb+");
- FILE * count_file_2 = fopen("kmer_count2","wb+");
- FILE * F_tmp;
-
- F_kmercpt_read = count_file ;
- F_kmercpt_write = count_file_2;
-
- Sequences->rewind_all();
-
- unsigned int max_kmer_per_part = max_memory*1024LL*1024LL /sizeof(cell<kmer_type>);
- int numpart = 0;
- char * rseq;
- long i;
- int64_t NbRead = 0;
- int64_t NbInserted = 0;
- int64_t NbInserted_unique = 0;
- kmer_type kmer, graine, graine_revcomp;
-
- // that code makes hasht1 occupy full memory. should probably be reduced (but we're deprecating that procedure, right?)
- int NBITS_HT = max( (int)ceilf(log2f((max_memory*1024L*1024L)/sizeof(cell_ptr_t))), 1);
- Hash16 *hasht1 =new Hash16(NBITS_HT);
-
- // partitioned exact kmer counting based on Bloom filter for solidity:
- // the bloom filter enables membership test for a set S of supposedly solid kmers (contains false positives)
- // read the (redundant) kmers from the reads, and load only those in S, in chunks, into a hash table
- // at each pass, update a file containing the true count of non-redundant supposedly solid kmers (S)
- // at the end, analyze the file to keep only those with true count >= solid
- while (Sequences->get_next_seq(&rseq,&readlen))
- {
- for (i=0; i<readlen-sizeKmer+1; i++)
- {
- kmer = extractKmerFromRead(rseq,i,&graine,&graine_revcomp);
-
- // discard kmers which are not solid
- if( ! bloom_counter->contains_n_occ(kmer,nks)) continue;
-
- //insert into hasht1
- NbInserted_unique += hasht1->add(kmer);
- NbInserted++;
-
- if(hasht1->nb_elem >max_kmer_per_part) //end partition
- {
-
- fprintf(stderr,"End of Kmer count partition %lli / %i \n",(long long)(hasht1->nb_elem),max_kmer_per_part);
-
- if(numpart==0)
- hasht1->dump(F_kmercpt_write);
- else
- end_kmer_count_partition(false,hasht1);
-
- //swap file pointers
- F_tmp = F_kmercpt_read;
- F_kmercpt_read = F_kmercpt_write;
- F_kmercpt_write = F_tmp;
- /////////end write files
-
- //reset hash table
- hasht1->empty_all();
-
- numpart++;
- } ///end partition
-
- }
- NbRead++;
- if ((NbRead%10000)==0) fprintf (stderr,"%cLoop through reads for exact kmer count %lld",13,(long long)NbRead);
- }
- fprintf (stderr," \nTotal Inserted in hash (ie output of Bloom) unique %lli / %lli redundants \n",(long long)NbInserted_unique,(long long)NbInserted);
- ///////////////////////// last partition
- end_kmer_count_partition(true,hasht1);
- delete hasht1;
- }
-
-
-void bloom_count(Bank *Reads, unsigned long max_memory)
-{
-
-#define NBITS_BLOOMCPT 23 // 33 :4GB (4 bits/elem) // size of the bloom counter table to count kmers
-
- fprintf(stderr,"nbits bloom counter: %i \n",NBITS_BLOOMCPT);
-
- BloomCpt3 * bloocpt = new BloomCpt3(NBITS_BLOOMCPT);
- BloomCpt3 * bloocpt2 = new BloomCpt3(NBITS_BLOOMCPT);
-
- bloocpt->setSeed( 0x4909FEA3A68CC6A7LL);
- bloocpt2->setSeed( 0x0CD5DA28467C5492LL);
-
- // bloocpt->set_number_of_hash_func(4);
- // bloocpt2->set_number_of_hash_func(6);
-
-
- ///////////////////////////////////first pass ; count kmers with Bloom cpt
-
-
- bloom_pass_reads(Reads,bloocpt, (BloomCpt * ) NULL, (char*)"%cFirst pass %lld");
-
-
- fprintf (stderr,"\n ____________ Second bloom counter _________\n");
-
- bloom_pass_reads(Reads,bloocpt2, bloocpt, (char*)"%cSecond pass %lld");
-
-STARTWALL(count);
-
- fprintf(stderr,"\n------------------ second pass bloom counter \n\n");
-
- delete bloocpt;
-
- ////////////////////////////////////// exact kmer count with hash table partitionning,
- //also create solid kmers file and fills bloo1
-
- exact_kmer_count(Reads,bloocpt2,max_memory);
-
- //////////////////////////////////////
-
- STOPWALL(count,"Counted kmers");
-
- fprintf(stderr,"\n------------------ Counted kmers and kept those with abundance >=%i \n\n",nks);
-
-
- ////////////////////////////////////////////////////fin bloom insert
-
- //delete bloocpt2;
-}
-
-
-
-void estimate_distinct_kmers(unsigned long genome_size, Bank *Reads)
-{
- int size_linearCounter = genome_size * 8; // alloc 8 bits * genome size for counting, i.e. ~ as much as the assembly Bloom size
- LinearCounter *linearCounter = new LinearCounter(size_linearCounter);
-
- bloom_pass_reads(Reads,linearCounter, (BloomCpt * ) NULL, (char*)"%cEstimating number of distinct kmers (%lld reads processed so far)");
-
- long nb_distinct_kmers = linearCounter->count();
-
- if (linearCounter->is_accurate())
- printf("Estimated that %ld distinct kmers are in the reads\n",nb_distinct_kmers);
- else
- printf("Cannot estimate the number of distinct kmers. Allocate a larger counter\n");
- delete linearCounter;
-}
-
-uint64_t extrapolate_distinct_kmers(Bank *Reads)
-{
- // start with 100MB RAM estimation and grow if necessary
- return extrapolate_distinct_kmers_wrapped(100000000L, Reads);
-}
-
-uint64_t extrapolate_distinct_kmers_wrapped(unsigned long nbytes_memory, Bank *Reads)
-{
- unsigned long size_linearCounter = nbytes_memory * 8L; // alloc 8 bits * nbytes for counting
- LinearCounter *linearCounter = new LinearCounter(size_linearCounter);
- int stops = 100000;
-
- // variant of bloom_pass_reads
-
- int64_t NbRead = 0;
- int64_t NbInsertedKmers = 0;
- Reads->rewind_all();
- char * rseq;
- long i;
- kmer_type kmer, graine, graine_revcomp;
-
- long nb_distinct_kmers = 0;
- long previous_nb_distinct_kmers = 0;
- uint64_t estimated_nb_reads = Reads->estimate_nb_reads();
- bool stop = false;
-
- while (Reads->get_next_seq(&rseq,&readlen))
- {
- if (stop)
- break;
-
- for (i=0; i<readlen-sizeKmer+1; i++)
- {
- kmer = extractKmerFromRead(rseq,i,&graine,&graine_revcomp);
-
- linearCounter->add(kmer);
- NbInsertedKmers++;
-
- if (NbInsertedKmers % stops == 0 && NbRead != 0)
- {
- previous_nb_distinct_kmers = nb_distinct_kmers;
- nb_distinct_kmers = linearCounter->count()*estimated_nb_reads/NbRead;
- //printf("estimated now: %ld\n",nb_distinct_kmers);
-
- // the following condition will grossly over-estimate the number of distinct kmers
- // I expect the correct result to be in the same order of magnitude
- if (abs((int)(nb_distinct_kmers-previous_nb_distinct_kmers)) < previous_nb_distinct_kmers/20) // 5% error
- stop = true;
-
- if (!linearCounter->is_accurate())
- stop = true;
- }
- }
- NbRead++;
- if ((NbRead%10000)==0) fprintf (stderr,(char*)"%cExtrapolating number of distinct kmers %lld",13,NbRead);
- }
-
- if (!linearCounter->is_accurate())
- {
- printf("Inaccurate estimation, restarting with %lu MB RAM\n",(2*nbytes_memory)/1024/1024);
- delete linearCounter;
- return extrapolate_distinct_kmers_wrapped(2*nbytes_memory, Reads);
- }
- nb_distinct_kmers = linearCounter->count()*estimated_nb_reads/NbRead; // this is a very rough estimation
-
- printf("Linear estimation: ~%ld M distinct %d-mers are in the reads\n",nb_distinct_kmers/1000000L,sizeKmer);
- delete linearCounter;
- return nb_distinct_kmers;
-}
-#endif
-
-
-float needleman_wunch(string a, string b)
-{
- float gap_score = -5;
- float mismatch_score = -5;
- float match_score = 10;
- #define nw_score(x,y) ( (x == y) ? match_score : mismatch_score )
-
- int n_a = a.length(), n_b = b.length();
- float ** score = (float **) malloc (sizeof(float*) * (n_a+1));
- for (int ii=0; ii<(n_a+1); ii++)
- {
- score [ii] = (float *) malloc (sizeof(float) * (n_b+1));
- }
-
- // float score[n_a+1][n_b+1]; //stack is too small
- // float pointer[n_a+1][n_b+1];
-
- for (int i = 0; i <= n_a; i++)
- score[i][0] = gap_score * i;
- for (int j = 0; j <= n_b; j++)
- score[0][j] = gap_score * j;
-
- // compute dp
- for (int i = 1; i <= n_a; i++)
- {
- for (int j = 1; j <= n_b; j++)
- {
- float match = score[i - 1][j - 1] + nw_score(a[i-1],b[j-1]);
- float del = score[i - 1][j] + gap_score;
- float insert = score[i][j - 1] + gap_score;
- score[i][j] = max( max(match, del), insert);
- }
- }
-
- // traceback
- int i=n_a, j=n_b;
- float identity = 0;
- while (i > 0 && j > 0)
- {
- float score_current = score[i][j], score_diagonal = score[i-1][j-1], score_up = score[i][j-1], score_left = score[i-1][j];
- if (score_current == score_diagonal + nw_score(a[i-1], b[j-1]))
- {
- if (a[i-1]== b[j-1])
- identity++;
- i -= 1;
- j -= 1;
- }
- else
- {
- if (score_current == score_left + gap_score)
- i -= 1;
- else if (score_current == score_up + gap_score)
- j -= 1;
- }
- }
- identity /= max( n_a, n_b); // modif GR 27/09/2013 max of two sizes, otherwise free gaps
-
-
-
- for (int ii=0; ii<(n_a+1); ii++)
- {
- free (score [ii]);
- }
- free(score);
-
- //printf("---nw----\n%s\n%s -> %.2f\n--------\n",a.c_str(),b.c_str(),identity);
- return identity;
-}
-
-
-
-void Progress::init(uint64_t ntasks, const char * msg)
-{
- gettimeofday(×tamp, NULL);
- heure_debut = timestamp.tv_sec +(timestamp.tv_usec/1000000.0);
-
- fprintf(stderr,"| %-*s |\n",98,msg);
-
- todo= ntasks;
- done = 0;
- partial =0;
- for (int ii=0; ii<16;ii++) partial_threaded[ii]=0;
- for (int ii=0; ii<16;ii++) done_threaded[ii]=0;
- subdiv= 100;
- steps = (double)todo / (double)subdiv;
-
- if(!timer_mode)
- {
- fprintf(stderr,"[");fflush(stderr);
- }
-}
-
-void Progress::finish()
-{
- set(todo);
- if(timer_mode)
- fprintf(stderr,"\n");
- else
- fprintf(stderr,"]\n");
-
- fflush(stderr);
- todo= 0;
- done = 0;
- partial =0;
-
-}
-
-
-void Progress::finish_threaded()// called by only one of the threads
-{
- done = 0;
- double rem = 0;
- for (int ii=0; ii<16;ii++) done += (done_threaded[ii] );
- for (int ii=0; ii<16;ii++) partial += (partial_threaded[ii] );
-
- finish();
-
-}
-
-void Progress::inc(uint64_t ntasks_done, int tid)
-{
- partial_threaded[tid] += ntasks_done;
- done_threaded[tid] += ntasks_done;
- while(partial_threaded[tid] >= steps)
- {
- if(timer_mode)
- {
- struct timeval timet;
- double now;
- gettimeofday(&timet, NULL);
- now = timet.tv_sec +(timet.tv_usec/1000000.0);
- uint64_t total_done = 0;
- for (int ii=0; ii<16;ii++) total_done += (done_threaded[ii] );
- double elapsed = now - heure_debut;
- double speed = total_done / elapsed;
- double rem = (todo-total_done) / speed;
- if(total_done > todo) rem =0;
- int min_e = (int)(elapsed / 60) ;
- elapsed -= min_e*60;
- int min_r = (int)(rem / 60) ;
- rem -= min_r*60;
-
- fprintf(stderr,"%c%-5.3g %% elapsed: %6i min %-4.0f sec estimated remaining: %6i min %-4.0f sec ",13,100*(double)total_done/todo,min_e,elapsed,min_r,rem);
-
- }
- else
- {
- fprintf(stderr,"-");fflush(stderr);
- }
- partial_threaded[tid] -= steps;
-
- }
-
-}
-
-void Progress::inc(uint64_t ntasks_done)
-{
- done += ntasks_done;
- partial += ntasks_done;
-
-
- while(partial >= steps)
- {
- if(timer_mode)
- {
- gettimeofday(×tamp, NULL);
- heure_actuelle = timestamp.tv_sec +(timestamp.tv_usec/1000000.0);
- double elapsed = heure_actuelle - heure_debut;
- double speed = done / elapsed;
- double rem = (todo-done) / speed;
- if(done>todo) rem=0;
- int min_e = (int)(elapsed / 60) ;
- elapsed -= min_e*60;
- int min_r = (int)(rem / 60) ;
- rem -= min_r*60;
-
- fprintf(stderr,"%c%-5.3g %% elapsed: %6i min %-4.0f sec estimated remaining: %6i min %-4.0f sec ",13,100*(double)done/todo,min_e,elapsed,min_r,rem);
- }
- else
- {
- fprintf(stderr,"-");fflush(stderr);
- }
- partial -= steps;
- }
-
-
-}
-
-
-void Progress::set(uint64_t ntasks_done)
-{
- if(ntasks_done > done)
- inc(ntasks_done-done);
-}
-
-
diff --git a/Utils.h b/Utils.h
deleted file mode 100644
index 8983bd2..0000000
--- a/Utils.h
+++ /dev/null
@@ -1,103 +0,0 @@
-#include <stdio.h>
-#include <stdlib.h>
-#include <time.h>
-#include <sys/time.h>
-#include <string.h>
-#include <string>
-#include <inttypes.h>
-#include <cmath> // for log2f
-#include <algorithm> // for max
-#include <unistd.h> // for truncate
-#include <limits.h> // for INT_MAX
-
-#ifndef UTILS_H
-#define UTILS_H
-
-#include "Bank.h"
-#include "Kmer.h"
-
-#ifndef NO_BLOOM_UTILS
-#include "Bloom.h"
-#include "Hash16.h"
-#include "LinearCounter.h"
-#endif
-
-using namespace std;
-
-#
-extern struct timeval tim;
-#define STARTWALL(TT) \
-gettimeofday(&tim, NULL);\
-double wdebut ## TT =tim.tv_sec +(tim.tv_usec/1000000.0);
-
-
-#define STOPWALL(TT,MESSAGE) \
-gettimeofday(&tim, NULL);\
-double wfin ## TT =tim.tv_sec +(tim.tv_usec/1000000.0); \
- fprintf(stderr,"-------------------%s time Wallclock %g s\n",MESSAGE, wfin ## TT-wdebut ## TT );
-
-// global variables
-extern int nks;
-extern uint32_t max_couv;
-
-extern char prefix[1024];
-extern float NBITS_PER_KMER;
-
-// constants
-extern const char *solid_kmers_file;// = (char *)"solid_kmers_binary";
-extern const char *false_positive_kmers_file ;//= (char *)"false_positive_kmers";
-extern const char *bloom_file ;//= (char *)"bloom_data";
-extern const char *assembly_file ;//= (char *)"contigs.fa";
-extern const char *branching_kmers_file ;//= (char *)"branching_kmers"; // (only useful for multiple assemblies with same bloom&debloom structure (ie debugging))
-extern const char *binary_read_file;// = (char *)"reads_binary";
-extern const char *histo_file_name ;//= (char *)"histo";
-extern const char *breakpoints_file_name; // = (char *)"breakpoints";
-extern const char *assoc_kmer_file ;
-
-
-char *return_file_name(const char *suffix);
-
-void estimate_distinct_kmers(unsigned long genome_size, Bank *Reads);
-uint64_t extrapolate_distinct_kmers(Bank *Reads);
-uint64_t extrapolate_distinct_kmers_wrapped(unsigned long nbytes_memory, Bank *Reads);
-
-#ifndef NO_BLOOM_UTILS
-void bloom_count(Bank * reads, unsigned long max_memory);
-template<typename T> Bloom *bloom_create_bloo1(T *bloom_counter);
-template<typename T> Bloom *bloom_create_bloo1(T *bloom_counter, bool from_dump);
-template<typename T>void bloom_pass_reads_binary(T *bloom_to_insert,BloomCpt *bloom_counter,char *stderr_message);
-template<typename T,typename U>void bloom_pass_reads(Bank *Sequences,T *bloom_to_insert,U *bloom_counter,char *stderr_message);
-#endif
-
-float needleman_wunch(string a, string b);
-
-
-class Progress
-{
-public:
- int timer_mode;
- struct timeval timestamp;
- double heure_debut, heure_actuelle ;
-
- uint64_t done;
- uint64_t todo;
- int subdiv ; // progress printed every 1/subdiv of total to do
- double partial;
- double partial_threaded[16];
- uint64_t done_threaded[16];
-
- double steps ; //steps = todo/subidv
-
- void init(uint64_t ntasks, const char * msg);
- void finish();
- void finish_threaded();// called by only one of the threads
-
- void inc(uint64_t ntasks_done);
- void inc(uint64_t ntasks_done, int tid); //threads collaborate to this same progress bar
- void set(uint64_t ntasks_done);
- Progress () : timer_mode(0) {}
- //include timer, to print ETA ?
-};
-
-
-#endif
diff --git a/doc/CMakeLists.txt b/doc/CMakeLists.txt
new file mode 100644
index 0000000..7ab1613
--- /dev/null
+++ b/doc/CMakeLists.txt
@@ -0,0 +1,13 @@
+
+################################################################################
+# DOC
+################################################################################
+
+# http://public.kitware.com/Wiki/CMakeUserUseLATEX
+INCLUDE (UseLATEX)
+
+# We define our document. This will add a 'pdf' target in our makefile
+ADD_LATEX_DOCUMENT (manual.tex)
+
+# We tell what doc files to be installed
+install (FILES ${CMAKE_CURRENT_BINARY_DIR}/manual.pdf DESTINATION doc/minia/)
diff --git a/doc/manual.tex b/doc/manual.tex
new file mode 100644
index 0000000..73f2bcf
--- /dev/null
+++ b/doc/manual.tex
@@ -0,0 +1,142 @@
+\documentclass[a4paper]{article}
+\usepackage{fancyvrb}
+\usepackage{pdfpages}
+\begin{document}
+
+\newcommand\vitem[1][]{\SaveVerb[% to use verb in description
+ aftersave={\item[\textnormal{\UseVerb[#1]{vsave}}]}]{vsave}}
+
+\title{\Huge \texttt{Minia-GATB} --- Short manual}
+
+\author{R. Chikhi \& G. Rizk \& E. Drezen \& D. Lavenier\\
+ {\small{rayan.chikhi at ens-cachan.org}}}
+\maketitle
+
+\begin{abstract}
+\noindent {\normalsize Minia is a software for ultra-low memory DNA sequence assembly. It takes as input a set of short genomic sequences (typically, data produced by the Illumina DNA sequencer). Its output is a set of contigs (assembled sequences), forming an approximation of the expected genome. Minia is based on a succinct representation of the de Bruijn graph. The computational resources required to run Minia are significantly lower than that of other assemblers.}
+\end{abstract}
+
+\tableofcontents
+
+\section{Forewords}
+
+Minia-GATB is the codename of a new version of Minia using the GATB library. We will drop the "-GATB" suffix and just refer to it as "Minia".
+In terms of features, not much has changed: Minia remains a contigs assembler using very low memory. Notable changes are:
+\begin{itemize}
+ \item Different command line format
+ \item Much faster $k$-mer counting step
+ \item Bubbles are collapsed using the most covered path (coverage information is now available for each node in the graph)
+\end{itemize}
+
+\section{Installation}
+
+Downlad the binary and run Minia using the comand \verb+./minia+.
+
+To install Minia from the sources, just type: \\ \verb+mkdir build && cd build && cmake .. && make -j 4+ \\
+Minia has been tested on Linux and MacOS systems.
+
+\section{Parameters}
+
+The basic usage is:\\
+
+\begin{verbatim}
+ ./minia -in [input file] -kmer-size [kmer size] \
+ -abundance-min [abundance value] -out [prefix]
+\end{verbatim}
+
+
+An example command line is:\\
+
+
+\verb+./minia -in reads.fastq -kmer-size 31 -abundance-min 3 -out minia_assembly_k31_m3+\\
+
+The main parameters are:
+
+\begin{enumerate}
+
+ \item \verb+in+ -- the input file(s) (see Section 5 for inputting multiple files)
+
+ \item \verb+kmer-size+ -- k-mer length (integer)
+
+ \item \verb+abundance-min+ -- specifies how many times a $k$-mer must be seen in the reads to be considered correct (integer)
+
+\item \verb+prefix+ -- any prefix string to store output contigs as well as temporary files for this assembly
+
+\end{enumerate}
+
+Minia now uses the Cascading Bloom filters improvement (http://arxiv.org/abs/1302.7278) by default, thanks to Gustavo Sacomoto for the implementation in Minia. Launch Minia with the \verb!-debloom original! option to revert to the original data structure.
+
+
+\section{Explanation of parameters}
+\begin{description}
+
+\vitem+kmer-size+
+The $k$-mer length is the length of the nodes in the de Bruijn graph. It strongly depends on the input dataset. We recommend that you use the KmerGenie software to automatically find the best $k$ for your dataset.
+
+\vitem+abundance-min+
+The \verb+abundance-min+ is used to remove erroneous, low-abundance $k$-mers. This parameter also strongly depends on the dataset. Any $k$-mer that appears strictly less than \emph{abundance-min} times in the reads will be discarded. A typical value is $3$. It is also called "coverage cut-off" in other software (e.g. Velvet).
+
+KmerGenie has an experimental feature (in the output of the command, not in the HTML report) that reports an optimal coverage cut-off (synonymous to abundance) parameter that exactly corresponds to the abundance-min parameter of Minia.
+
+\textbf{Setting \emph{abundance-min} to $1$ is not recommended}, as no erroneous $k$-mer will be discarded, which will likely result in a very large memory usage. In particular, if KmerGenie tells you to set abundance to 1, then still, set it to 2. If the dataset has high coverage, try larger values.
+
+\vitem+prefix+
+The \verb+prefix+ parameter is any arbitrary file name prefix, for example, \verb+test_assembly+.
+
+\end{description}
+
+\section{Input}
+
+\begin{description}
+\item \emph{Larger $k$-mer lengths}
+
+Minia supports arbitrary large $k$-mer lengths. To compile Minia from the source, to support $k$-mer lengths up to, say, 160, type this in the build folder:
+\begin{verbatim}
+rm -Rf CMake* && cmake -Dk4=160 .. && make
+\end{verbatim}
+
+\item \emph{FASTA/FASTQ}
+
+Minia assembles any type of Illumina reads, given in the FASTA or FASTQ format. Giving paired or mate-pairs reads as input is OK, but keep in mind that Minia won't use pairing information.
+\item \emph{Multipe Files}
+
+ Minia can assemble multiple input files. Just create a text file containing the list of read files, one file name per line, and pass this list as the first parameter of Minia (instead of a FASTA/FASTQ file). Therefore the parameter \verb+input_file+ can be either (i) the read file itself (FASTA/FASTQ/compressed), or (ii) a file containing a list of file names.
+
+\item \emph{Line format}
+
+ In FASTA files, each read can be split into multiple lines, whereas in FASTQ, each read sequence must be in a single line.
+
+\item \emph{Gzip compression}
+
+Minia can direclty read files compressed with gzip. Compressed files should end with '.gz'. Input files of different types can be mixed (i.e. gzipped or not, in FASTA or FASTQ)
+
+\item \emph{Graph input}
+
+Minia can take as input a graph in the HDF5 format, constructed using the dbgh5 program, or a different GATB tool, or from a previous run of Minia (useful when one wants to tweak assembly parameters). Use the \verb+-graph+ parameter to specify the graph, instead of the \verb+-in+ parameter.
+
+\end{description}
+
+\section{Output}
+
+The output of Minia is a set of contigs in the FASTA format, in the file \verb+[prefix].contigs.fa+.
+
+\subsection*{Creating unitigs}
+
+Minia supports the creation of unitigs. Use the following command line:
+\begin{verbatim}
+-starter simple -no-length-cutoff -traversal unitig
+\end{verbatim}
+
+The \verb+-starter simple+ option is to turn off Minia's heuristics for starting node selection (which avoid starting inside a bubble).
+Note that there is a known bug in the \verb+-starter simple+ behavior: some of the unitigs of length k won't be returned (technically: the branching nodes which are neighbors of branching nodes are not returned).
+
+\section{Memory usage}
+
+We estimate that the memory usage of Minia is roughly $1$ GB of RAM per gigabases in the target genome to assemble. It is independent of the coverage of the input dataset, provided that the \verb!abundance-min! parameter is correctly set. For example, a human genome was assembled in $5.7$ GB of RAM. This was using the original data structure; the current implementation relies on Cascading Bloom filters and uses $\approx 4$ GB. A better estimation of the memory usage can be found in the M [...]
+
+\section{Disk usage}
+
+Minia writes large temporary files during the k-mer counting phase. These files are written in the working directory when you launched Minia. For better performance, run Minia on a local hard drive.
+
+\end{document}
+
diff --git a/lut.h b/lut.h
deleted file mode 100644
index 4218ff5..0000000
--- a/lut.h
+++ /dev/null
@@ -1,272 +0,0 @@
-#ifndef CODE_H
-#define CODE_H
-
-
-//look up table conversion (with A,C,T,G <--> 0,1,2,3)
-
-//complement of one NT
-const unsigned char comp_NT[4] = {
- 2,3,0,1
-};
-
-//reverse complement of 4NT, ie one byte
-const unsigned char revcomp_4NT[256] = {
- 0xaa,
- 0xea,
- 0x2a,
- 0x6a,
- 0xba,
- 0xfa,
- 0x3a,
- 0x7a,
- 0x8a,
- 0xca,
- 0xa,
- 0x4a,
- 0x9a,
- 0xda,
- 0x1a,
- 0x5a,
- 0xae,
- 0xee,
- 0x2e,
- 0x6e,
- 0xbe,
- 0xfe,
- 0x3e,
- 0x7e,
- 0x8e,
- 0xce,
- 0xe,
- 0x4e,
- 0x9e,
- 0xde,
- 0x1e,
- 0x5e,
- 0xa2,
- 0xe2,
- 0x22,
- 0x62,
- 0xb2,
- 0xf2,
- 0x32,
- 0x72,
- 0x82,
- 0xc2,
- 0x2,
- 0x42,
- 0x92,
- 0xd2,
- 0x12,
- 0x52,
- 0xa6,
- 0xe6,
- 0x26,
- 0x66,
- 0xb6,
- 0xf6,
- 0x36,
- 0x76,
- 0x86,
- 0xc6,
- 0x6,
- 0x46,
- 0x96,
- 0xd6,
- 0x16,
- 0x56,
- 0xab,
- 0xeb,
- 0x2b,
- 0x6b,
- 0xbb,
- 0xfb,
- 0x3b,
- 0x7b,
- 0x8b,
- 0xcb,
- 0xb,
- 0x4b,
- 0x9b,
- 0xdb,
- 0x1b,
- 0x5b,
- 0xaf,
- 0xef,
- 0x2f,
- 0x6f,
- 0xbf,
- 0xff,
- 0x3f,
- 0x7f,
- 0x8f,
- 0xcf,
- 0xf,
- 0x4f,
- 0x9f,
- 0xdf,
- 0x1f,
- 0x5f,
- 0xa3,
- 0xe3,
- 0x23,
- 0x63,
- 0xb3,
- 0xf3,
- 0x33,
- 0x73,
- 0x83,
- 0xc3,
- 0x3,
- 0x43,
- 0x93,
- 0xd3,
- 0x13,
- 0x53,
- 0xa7,
- 0xe7,
- 0x27,
- 0x67,
- 0xb7,
- 0xf7,
- 0x37,
- 0x77,
- 0x87,
- 0xc7,
- 0x7,
- 0x47,
- 0x97,
- 0xd7,
- 0x17,
- 0x57,
- 0xa8,
- 0xe8,
- 0x28,
- 0x68,
- 0xb8,
- 0xf8,
- 0x38,
- 0x78,
- 0x88,
- 0xc8,
- 0x8,
- 0x48,
- 0x98,
- 0xd8,
- 0x18,
- 0x58,
- 0xac,
- 0xec,
- 0x2c,
- 0x6c,
- 0xbc,
- 0xfc,
- 0x3c,
- 0x7c,
- 0x8c,
- 0xcc,
- 0xc,
- 0x4c,
- 0x9c,
- 0xdc,
- 0x1c,
- 0x5c,
- 0xa0,
- 0xe0,
- 0x20,
- 0x60,
- 0xb0,
- 0xf0,
- 0x30,
- 0x70,
- 0x80,
- 0xc0,
- 0x0,
- 0x40,
- 0x90,
- 0xd0,
- 0x10,
- 0x50,
- 0xa4,
- 0xe4,
- 0x24,
- 0x64,
- 0xb4,
- 0xf4,
- 0x34,
- 0x74,
- 0x84,
- 0xc4,
- 0x4,
- 0x44,
- 0x94,
- 0xd4,
- 0x14,
- 0x54,
- 0xa9,
- 0xe9,
- 0x29,
- 0x69,
- 0xb9,
- 0xf9,
- 0x39,
- 0x79,
- 0x89,
- 0xc9,
- 0x9,
- 0x49,
- 0x99,
- 0xd9,
- 0x19,
- 0x59,
- 0xad,
- 0xed,
- 0x2d,
- 0x6d,
- 0xbd,
- 0xfd,
- 0x3d,
- 0x7d,
- 0x8d,
- 0xcd,
- 0xd,
- 0x4d,
- 0x9d,
- 0xdd,
- 0x1d,
- 0x5d,
- 0xa1,
- 0xe1,
- 0x21,
- 0x61,
- 0xb1,
- 0xf1,
- 0x31,
- 0x71,
- 0x81,
- 0xc1,
- 0x1,
- 0x41,
- 0x91,
- 0xd1,
- 0x11,
- 0x51,
- 0xa5,
- 0xe5,
- 0x25,
- 0x65,
- 0xb5,
- 0xf5,
- 0x35,
- 0x75,
- 0x85,
- 0xc5,
- 0x5,
- 0x45,
- 0x95,
- 0xd5,
- 0x15,
- 0x55
-};
-
-#endif
diff --git a/makefile b/makefile
deleted file mode 100644
index 878f831..0000000
--- a/makefile
+++ /dev/null
@@ -1,76 +0,0 @@
-CFLAGS+= -O4 -D_FILE_OFFSET_BITS=64 # needed to handle files > 2 GB on 32 bits systems
-SRC=Pool.cpp Bank.cpp Bloom.cpp Hash16.cpp LargeInt.cpp Kmer.cpp Terminator.cpp Traversal.cpp LinearCounter.cpp Set.cpp Utils.cpp SortingCount.cpp Debloom.cpp OAHash.cpp
-EXEC=minia
-OBJ= $(SRC:.cpp=.o)
-
-ifeq ($(prof),1)
- CFLAGS+= -pg
-endif
-
-ifeq ($(unitig),1)
- CFLAGS+= -DUNITIG
-endif
-
-
-ifeq ($(deb),1)
- CFLAGS+= -O0 -DASSERTS -g
-endif
-
-ifeq ($(omp),1)
- CFLAGS=-O4 -fopenmp -DOMP=1
-endif
-
-
-k := 0$(k) # dummy k if not specified
-K_BELOW_32 := $(shell echo $(k)\<=32 | bc)
-K_BELOW_64 := $(shell echo $(k)\<=64 | bc)
-ARCH := $(shell getconf LONG_BIT) # detects sizeof(int)
-USING_UINT128 := 0
-largeintlib := 0
-
-ifeq ($(K_BELOW_32),0)
-
- # use uint128 when k<=64 and 64-bit architecture
- ifeq ($(K_BELOW_64),1)
- ifeq ($(strip $(ARCH)),64)
- CFLAGS += -Dkmer_type=__uint128_t
- USING_UINT128 := 1
- endif
- endif
-
- # use a bigint library otherwise
- ifeq ($(USING_UINT128),0)
- largeintlib := largeint#ttmath
- endif
-endif
-
-# ttmath (now, largeint) is used when you type "make k=[kmer size]" with a kmer size longer than supported integer type,
-ifeq ($(largeintlib),ttmath)
- KMER_PRECISION := $(shell echo \($(k)+15\)/16 | bc)
-endif
-ifeq ($(largeintlib),largeint)
- KMER_PRECISION := $(shell echo \($(k)+31\)/32 | bc)
-endif
-ifneq ($(largeintlib),0)
- CFLAGS += -D_$(largeintlib) -DKMER_PRECISION=$(KMER_PRECISION)
-endif
-
-all:
- $(MAKE) clean
- $(MAKE) $(EXEC)
-
-minia: $(OBJ) Minia.cpp
- $(CXX) -o $@ $(OBJ) Minia.cpp $(CFLAGS) -lz
-
-%.o: %.cpp %.h
- $(CXX) -o $@ -c $< $(CFLAGS)
-
-
-%.o: %.c %.h
- $(CXX) -o $@ -c $< $(CFLAGS)
-
-clean:
- rm -rf *.o
-
-install:
- cp minia /usr/local/bin
diff --git a/manual/manual.pdf b/manual/manual.pdf
deleted file mode 100644
index b37bb4c..0000000
Binary files a/manual/manual.pdf and /dev/null differ
diff --git a/manual/manual.tex b/manual/manual.tex
deleted file mode 100644
index e6d6ceb..0000000
--- a/manual/manual.tex
+++ /dev/null
@@ -1,124 +0,0 @@
-\documentclass[a4paper]{article}
-\usepackage{fancyvrb}
-\usepackage{pdfpages}
-\begin{document}
-
-\newcommand\vitem[1][]{\SaveVerb[% to use verb in description
- aftersave={\item[\textnormal{\UseVerb[#1]{vsave}}]}]{vsave}}
-
-\title{\Huge \texttt{Minia} --- Short manual}
-
-\author{R. Chikhi \& G. Rizk\\
- {\small{rayan.chikhi at ens-cachan.org}}}
-\maketitle
-
-\begin{abstract}
-\noindent {\normalsize Minia is a software for ultra-low memory DNA sequence assembly. It takes as input a set of short genomic sequences (typically, data produced by the Illumina DNA sequencer). Its output is a set of contigs (assembled sequences), forming an approximation of the expected genome. Minia is based on a succinct representation of the de Bruijn graph. The computational resources required to run Minia are significantly lower than that of other assemblers.}
-\end{abstract}
-
-\tableofcontents
-
-\section{Installation}
-
-To install Minia, just type \verb+make+ in the Minia folder.
-Minia has been tested on Linux and MacOS systems.
-To run Minia, type \verb+./minia+.
-
-\section{Parameters}
-
-The usage is:\\
-
-
-\verb+./minia [input_file] [kmer_size] [min_abundance] [estimated_genome_size] [prefix]+\\
-
-
-An example command line is:\\
-
-
-\verb+./minia reads.fastq 31 3 100000000 minia_assembly_k31_m3+\\
-
-All the parameters need to be specified, in the following order:
-
-\begin{enumerate}
-
-\item \verb+input_file+ -- the input file
-
-\item \verb+kmer_size+ -- k-mer length
-
-\item \verb+min_abundance+ -- filters out k-mers seen less than the specified number of times
-
-\item \verb+estimated_genome_size+ -- rough estimation of the size of the genome to assemble, in base pairs.
-
-\item \verb+prefix+ -- any prefix string to store unique temporary files for this assembly
-
-\end{enumerate}
-
-Minia now uses the Cascading Bloom filters improvement (http://arxiv.org/abs/1302.7278) by default, thanks to Gustavo Sacomoto for the implementation in Minia. Launch Minia with the \verb!--original! option to revert to the original data structure.
-
-
-\section{Explanation of parameters}
-\begin{description}
-
-\vitem+kmer_size+
-The $k$-mer length is the length of the nodes in the de Bruijn graph. It strongly depends on the input dataset. A typical value to try for short Illumina reads (read length above $50$) is 27. For longer Illumina reads ($\approx 100$ bp) with sufficient coverage ($>$ 40x), we had good results with $k=43$.
-
-\vitem+min_abundance+
-The \verb+min_abundance+ is used to remove erroneous, low-abundance $k$-mers. This parameter also strongly depends on the dataset. It corresponds to the smallest amount of times a correct $k$-mer appears in the reads. A typical value is $3$. Setting it to $1$ is not recommended\footnote{as no erroneous $k$-mer will be discarded, which will likely result in a very large memory usage}. If the dataset has high coverage, try larger values.
-
-\vitem+estimated_genome_size+
-
-The estimated genome size parameter (in base pairs) only controls the memory usage during the first phase of Minia (graph construction). \emph{It has no impact on the assembly}.
-
-\vitem+prefix+
-The \verb+prefix+ parameter is any arbitrary file name prefix, for example, \verb+test_assembly+.
-
-\end{description}
-
-\section{Input}
-
-\begin{description}
-\item \emph{FASTA/FASTQ}
-
-Minia assembles any type of Illumina reads, given in the FASTA or FASTQ format. Paired or mate-pairs reads are OK, but keep in mind that Minia discards pairing information.
-\item \emph{Multipe Files}
-
- Minia can assemble multiple input files. Just create a text file containing the list of read files, one file name per line, and pass this list as the first parameter of Minia (instead of a FASTA/FASTQ file). Therefore the parameter \verb+input_file+ can be either (i) the read file itself (FASTA/FASTQ/compressed), or (ii) a file containing a list of file names.
-\item \emph{line format}
-
- In FASTA files, each read can be split into multiple lines, whereas in FASTQ, each read sequence must be in a single line.
-
-\item \emph{gzip compression}
-
-Minia can direclty read files compressed with gzip. Compressed files should end with '.gz'. Input files of different types can be mixed (i.e. gzipped or not, in FASTA or FASTQ)
-
-\end{description}
-
-\section{Output}
-
-The output of Minia is a set of contigs in the FASTA format, in the file \verb+[prefix].contigs.fa+.
-
-\section{Memory usage}
-
-We estimate that the memory usage of Minia is roughly $2$ GB of RAM per gigabases in the target genome to assemble. It is independent of the coverage of the input dataset, provided that the \verb!min_abundance! parameter is correctly set. For example, a human genome was assembled in $5.7$ GB of RAM. This was using the original data structure; the current implementation relies on Cascading Bloom filters and should use $\approx 1-2$ GB less memory. A better estimation of the memory usage c [...]
-
-\section{Disk usage}
-
-Minia writes large temporary files during the k-mer counting phase. These files are written in the working directory when you launched Minia. For better performance, run Minia on a local hard drive.
-
-\section{Larger $k$-mer lengths}
-
-Minia supports arbitrary large $k$-mer lengths. To compile Minia for $k$-mer lengths up to, say, 100, type:
-\begin{verbatim}
-make clean && make k=100
-\end{verbatim}
-
-\section{Appendixes}
-
-The rest of this manual describes the data structure used by Minia.
-The first text is from an original research article published at WABI 2012. The second text is an improvement made and implemented in Minia by other authors, published at WABI 2013.
-
-\includepdf[pages=-]{../paper/wabi12.pdf}
-\includepdf[pages=-]{../paper/cascading-wabi13.pdf}
-
-\end{document}
-
diff --git a/rvalues.h b/rvalues.h
deleted file mode 100644
index a4124b3..0000000
--- a/rvalues.h
+++ /dev/null
@@ -1,131 +0,0 @@
-static const double rvalues[129][2] = {
- { 0.00000, 5.29625 },
- { 0.00000, 0.00000 },
- { 0.00000, 0.00000 },
- { 0.00000, 0.00000 },
- { 0.00000, 0.00000 },
- { 5.64856, 5.49117 },
- { 5.85164, 5.52333 },
- { 6.02772, 5.55385 },
- { 6.18398, 5.58291 },
- { 6.32492, 5.61065 },
- { 6.45362, 5.63721 },
- { 6.57225, 5.66268 },
- { 6.68244, 5.68717 },
- { 6.78544, 5.71075 },
- { 6.88221, 5.73350 },
- { 6.97353, 5.75548 },
- { 7.06004, 5.77674 },
- { 7.14227, 5.79733 },
- { 7.22066, 5.81730 },
- { 7.29558, 5.83669 },
- { 7.36734, 5.85553 },
- { 7.43623, 5.87386 },
- { 7.50248, 5.89171 },
- { 7.56630, 5.90910 },
- { 7.62788, 5.92605 },
- { 7.68737, 5.94260 },
- { 7.74494, 5.95876 },
- { 7.80069, 5.97455 },
- { 7.85477, 5.98999 },
- { 7.90726, 6.00510 },
- { 7.95826, 6.01989 },
- { 8.00786, 6.03437 },
- { 8.05615, 6.04856 },
- { 8.10319, 6.06247 },
- { 8.14904, 6.07611 },
- { 8.19378, 6.08950 },
- { 8.23745, 6.10264 },
- { 8.28012, 6.11555 },
- { 8.32181, 6.12822 },
- { 8.36260, 6.14068 },
- { 8.40250, 6.15293 },
- { 8.44157, 6.16497 },
- { 8.47983, 6.17682 },
- { 8.51733, 6.18848 },
- { 8.55409, 6.19995 },
- { 8.59015, 6.21125 },
- { 8.62553, 6.22238 },
- { 8.66025, 6.23334 },
- { 8.69435, 6.24413 },
- { 8.72784, 6.25478 },
- { 8.76075, 6.26527 },
- { 8.79310, 6.27562 },
- { 8.82490, 6.28582 },
- { 8.85619, 6.29589 },
- { 8.88697, 6.30582 },
- { 8.91725, 6.31562 },
- { 8.94707, 6.32530 },
- { 8.97643, 6.33485 },
- { 9.00534, 6.34428 },
- { 9.03383, 6.35360 },
- { 9.06189, 6.36280 },
- { 9.08956, 6.37189 },
- { 9.11683, 6.38088 },
- { 9.14372, 6.38975 },
- { 9.17024, 6.39853 },
- { 9.19640, 6.40721 },
- { 9.22221, 6.41578 },
- { 9.24768, 6.42427 },
- { 9.27282, 6.43265 },
- { 9.29764, 6.44095 },
- { 9.32214, 6.44916 },
- { 9.34634, 6.45728 },
- { 9.37024, 6.46532 },
- { 9.39385, 6.47328 },
- { 9.41717, 6.48115 },
- { 9.44023, 6.48894 },
- { 9.46301, 6.49666 },
- { 9.48552, 6.50430 },
- { 9.50778, 6.51186 },
- { 9.52979, 6.51935 },
- { 9.55156, 6.52677 },
- { 9.57308, 6.53412 },
- { 9.59437, 6.54140 },
- { 9.61543, 6.54861 },
- { 9.63627, 6.55576 },
- { 9.65688, 6.56284 },
- { 9.67729, 6.56986 },
- { 9.69748, 6.57682 },
- { 9.71747, 6.58371 },
- { 9.73725, 6.59055 },
- { 9.75684, 6.59732 },
- { 9.77624, 6.60404 },
- { 9.79544, 6.61070 },
- { 9.81446, 6.61731 },
- { 9.83330, 6.62386 },
- { 9.85196, 6.63035 },
- { 9.87045, 6.63680 },
- { 9.88876, 6.64319 },
- { 9.90691, 6.64953 },
- { 9.92489, 6.65582 },
- { 9.94271, 6.66206 },
- { 9.96037, 6.66825 },
- { 9.97787, 6.67439 },
- { 9.99522, 6.68049 },
- { 10.01241, 6.68654 },
- { 10.02946, 6.69254 },
- { 10.04637, 6.69850 },
- { 10.06313, 6.70441 },
- { 10.07975, 6.71029 },
- { 10.09623, 6.71611 },
- { 10.11258, 6.72190 },
- { 10.12879, 6.72764 },
- { 10.14488, 6.73335 },
- { 10.16083, 6.73901 },
- { 10.17665, 6.74463 },
- { 10.19235, 6.75022 },
- { 10.20793, 6.75577 },
- { 10.22339, 6.76127 },
- { 10.23873, 6.76674 },
- { 10.25394, 6.77218 },
- { 10.26905, 6.77757 },
- { 10.28404, 6.78293 },
- { 10.29892, 6.78826 },
- { 10.31369, 6.79355 },
- { 10.32835, 6.79881 },
- { 10.34290, 6.80403 },
- { 10.35735, 6.80922 },
- { 10.37169, 6.81437 },
- { 10.38593, 6.81950 }
-};
diff --git a/simple_test.sh b/simple_test.sh
deleted file mode 100644
index 86c7717..0000000
--- a/simple_test.sh
+++ /dev/null
@@ -1,20 +0,0 @@
-#!/bin/bash
-#simple assembly test of a synthetic 10 K genome, to verify not completely broken
-
-rm -f t10.contigs.fa
-
-./minia test/read50x_ref10K_e001.fasta 25 3 10000 t10 &> /dev/null
-
-
-diff t10.contigs.fa test/result10K.fasta > /dev/null
-
-var=$?
-
-if [ $var -eq 0 ]
-then
- echo Test PASSED
- exit 0
-else
- echo Test FAILED
- exit 1
-fi
diff --git a/src/Minia.cpp b/src/Minia.cpp
new file mode 100644
index 0000000..c07541a
--- /dev/null
+++ b/src/Minia.cpp
@@ -0,0 +1,296 @@
+/*****************************************************************************
+ * GATB : Genome Assembly Tool Box
+ * Copyright (C) 2014 INRIA
+ * Authors: R.Chikhi, G.Rizk, E.Drezen
+ *
+ * This program is free software: you can redistribute it and/or modify
+ * it under the terms of the GNU Affero General Public License as
+ * published by the Free Software Foundation, either version 3 of the
+ * License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU Affero General Public License for more details.
+ *
+ * You should have received a copy of the GNU Affero General Public License
+ * along with this program. If not, see <http://www.gnu.org/licenses/>.
+*****************************************************************************/
+
+/********************************************************************************/
+// We include required definitions
+/********************************************************************************/
+
+#include <Minia.hpp>
+#include <NodeSelector.hpp>
+
+#include <fstream>
+
+using namespace std;
+
+/********************************************************************************/
+
+#define DEBUG(a) //a
+
+/********************************************************************************/
+
+static const char* STR_TRAVERSAL_KIND = "-traversal";
+static const char* STR_STARTER_KIND = "-starter";
+static const char* STR_CONTIG_MAX_LEN = "-contig-max-len";
+static const char* STR_BFS_MAX_DEPTH = "-bfs-max-depth";
+static const char* STR_BFS_MAX_BREADTH = "-bfs-max-breadth";
+static const char* STR_NO_LENGTH_CUTOFF = "-no-length-cutoff";
+static const char* STR_FASTA_LINE_SIZE = "-fasta-line";
+
+static const char* progressFormat0 = "Assembly ";
+
+/*********************************************************************
+** METHOD :
+** PURPOSE :
+** INPUT :
+** OUTPUT :
+** RETURN :
+** REMARKS :
+*********************************************************************/
+Minia::Minia () : Tool ("minia")
+{
+ // reinit the parser to get rid of options added by the Tool class, as we'll add them again in the Graph parser
+ setParser (new OptionsParser ("minia"));
+
+ /** We add options specific to Minia (most important at the end). */
+ OptionsParser* assemblyParser = new OptionsParser ("assembly");
+
+ assemblyParser->push_front (new OptionOneParam (STR_FASTA_LINE_SIZE, "number of nucleotides per line in fasta output (0 means one line)", false, "0"));
+ assemblyParser->push_front (new OptionOneParam (STR_BFS_MAX_BREADTH, "maximum breadth for BFS", false, "0" ));
+ assemblyParser->push_front (new OptionOneParam (STR_BFS_MAX_DEPTH, "maximum depth for BFS", false, "0" ));
+ assemblyParser->push_front (new OptionOneParam (STR_CONTIG_MAX_LEN, "maximum length for contigs", false, "0" ));
+ assemblyParser->push_front (new OptionOneParam (STR_STARTER_KIND, "starting node ('best', 'simple')", false, "best" ));
+ assemblyParser->push_front (new OptionOneParam (STR_TRAVERSAL_KIND, "traversal type ('contig', 'unitig')", false, "contig" ));
+ assemblyParser->push_front (new OptionNoParam (STR_NO_LENGTH_CUTOFF, "turn off length cutoff of 2*k in output sequences", false));
+ assemblyParser->push_front (new OptionOneParam (STR_URI_INPUT, "input reads (fasta/fastq/compressed)", false));
+ assemblyParser->push_front (new OptionOneParam (STR_URI_GRAPH, "input graph file (hdf5)", false));
+
+ getParser()->push_back (assemblyParser);
+
+ // when we input reads, dbgh5 is executed, so its options are needed here
+ IOptionsParser* graphParser = Graph::getOptionsParser(false, true);
+
+ // we hide the STR_URI_INPUT option, otherwise we would have it twice
+ if (IOptionsParser* p = graphParser->getParser(STR_URI_INPUT)) { p->setVisible(false); }
+
+ getParser()->push_back(graphParser, 1);
+}
+
+/*********************************************************************
+** METHOD :
+** PURPOSE :
+** INPUT :
+** OUTPUT :
+** RETURN :
+** REMARKS :
+*********************************************************************/
+void Minia::execute ()
+{
+ Graph graph;
+
+ if (getInput()->get(STR_URI_GRAPH) != 0)
+ {
+ graph = Graph::load (getInput()->getStr(STR_URI_GRAPH));
+ }
+ else if (getInput()->get(STR_URI_INPUT) != 0)
+ {
+ graph = Graph::create (getInput());
+ }
+ else
+ {
+ throw OptionFailure (getParser(), "Specifiy -graph or -in");
+ }
+
+ /** We build the contigs. */
+ assemble (graph);
+
+ /** We gather some statistics. */
+ getInfo()->add (1, getTimeInfo().getProperties("time"));
+}
+
+/*********************************************************************
+** METHOD :
+** PURPOSE :
+** INPUT :
+** OUTPUT :
+** RETURN :
+** REMARKS :
+*********************************************************************/
+void Minia::assemble (const Graph& graph)
+{
+ TIME_INFO (getTimeInfo(), "assembly");
+
+ string output = (getInput()->get(STR_URI_OUTPUT) ?
+ getInput()->getStr(STR_URI_OUTPUT) :
+ System::file().getBaseName (
+ (getInput()->get(STR_URI_INPUT) ? getInput()->getStr(STR_URI_INPUT) :
+ getInput()->getStr(STR_URI_GRAPH))
+ )
+ )+ ".contigs.fa";
+
+ /** We setup default values if needed. */
+ if (getInput()->getInt (STR_CONTIG_MAX_LEN) == 0) { getInput()->setInt (STR_CONTIG_MAX_LEN, Traversal::defaultMaxLen); }
+ if (getInput()->getInt (STR_BFS_MAX_DEPTH) == 0) { getInput()->setInt (STR_BFS_MAX_DEPTH, Traversal::defaultMaxDepth); }
+ if (getInput()->getInt (STR_BFS_MAX_BREADTH) == 0) { getInput()->setInt (STR_BFS_MAX_BREADTH, Traversal::defaultMaxBreadth); }
+
+ /** We create the output bank. Note that we could make this a little bit prettier
+ * => possibility to save the contigs in specific output format (other than fasta). */
+ IBank* outputBank = new BankFasta (output);
+ LOCAL (outputBank);
+
+ /** We set the fasta line size. */
+ BankFasta::setDataLineSize (getInput()->getInt (STR_FASTA_LINE_SIZE));
+
+ /** We get an iterator over the branching nodes. */
+ ProgressGraphIterator<BranchingNode,ProgressTimerAndSystem> itBranching (graph.iterator<BranchingNode>(), progressFormat0);
+
+ /** We create the Terminator. */
+ BranchingTerminator terminator (graph);
+
+ /** We create the starting node selector according to the user choice. */
+ INodeSelector* starter = NodeSelectorFactory::singleton().create (getInput()->getStr(STR_STARTER_KIND), graph, terminator);
+ LOCAL (starter);
+
+ /** We create the Traversal instance according to the user choice. */
+ Traversal* traversal = Traversal::create (
+ getInput()->getStr(STR_TRAVERSAL_KIND),
+ graph,
+ terminator,
+ getInput()->getInt (STR_CONTIG_MAX_LEN),
+ getInput()->getInt (STR_BFS_MAX_DEPTH),
+ getInput()->getInt (STR_BFS_MAX_BREADTH)
+ );
+ LOCAL (traversal);
+
+ Path consensusRight;
+ Path consensusLeft;
+
+ u_int64_t nbContigs = 0;
+ u_int64_t nbSmallContigs = 0;
+ u_int64_t totalNt = 0;
+ u_int64_t maxContigLen = 0;
+ u_int64_t maxContigLenLeft = 0;
+ u_int64_t maxContigLenRight = 0;
+
+ bool isNoLengthCutoff = getParser()->saw(STR_NO_LENGTH_CUTOFF);
+
+ Sequence seq (Data::ASCII);
+
+ /** We loop over the branching nodes. */
+ for (itBranching.first(); !itBranching.isDone(); itBranching.next())
+ {
+ DEBUG ((cout << endl << "-------------------------- " << graph.toString (itBranching.item()) << " -------------------------" << endl));
+
+ Node startingNode;
+
+ // keep looping while a starting kmer is available from this kmer
+ // everything will be marked during the traversal()'s
+ while (starter->select (itBranching.item(), startingNode) == true)
+ {
+ /** We compute right and left extensions of the starting node. */
+ int lenRight = traversal->traverse (startingNode, DIR_OUTCOMING, consensusRight);
+ int lenLeft = traversal->traverse (graph.reverse(startingNode), DIR_OUTCOMING, consensusLeft);
+
+ int lenTotal = graph.getKmerSize() + lenRight + lenLeft;
+
+ /** We keep this contig if its size is long enough. */
+ if (lenTotal >= 2*graph.getKmerSize()+1 || isNoLengthCutoff)
+ {
+ /** We create the contig sequence. */
+ buildSequence (graph, startingNode, lenTotal, nbContigs, consensusRight, consensusLeft, seq);
+
+ /** We add the sequence into the output bank. */
+ outputBank->insert (seq);
+
+ nbContigs += 1;
+ totalNt += lenTotal;
+
+ traversal->commit_stats();
+
+ if (lenTotal > maxContigLen) { maxContigLen = lenTotal; }
+ if (lenLeft > maxContigLenLeft) { maxContigLenLeft = lenLeft; }
+ if (lenRight > maxContigLenRight) { maxContigLenRight = lenRight; }
+ }
+ else
+ {
+ traversal->revert_stats();
+ nbSmallContigs++;
+ }
+
+ } /* end of while (starter->select() */
+
+ } /* end of for (itBranching.first() */
+
+ /** We add the input parameters to the global properties. */
+ getInfo()->add (1, getInput());
+
+ /** We gather some statistics. */
+ getInfo()->add (1, "stats");
+ getInfo()->add (2, "traversal", "%s", traversal->getName().c_str());
+ getInfo()->add (2, "start_selector", "%s", starter->getName().c_str());
+ getInfo()->add (2, "nb_contigs", "%d", nbContigs);
+ getInfo()->add (2, "nb_small_contigs_discarded","%d", nbSmallContigs);
+ getInfo()->add (2, "nt_assembled", "%ld", totalNt);
+ getInfo()->add (2, "max_length", "%d", maxContigLen);
+ getInfo()->add (2, "max_length_left", "%d", maxContigLenLeft);
+ getInfo()->add (2, "max_length_right", "%d", maxContigLenRight);
+
+ getInfo()->add (2, "debugging traversal stats");
+ getInfo()->add (2, "large breadth", "%d", traversal->final_stats.couldnt_traverse_bubble_breadth);
+ getInfo()->add (2, "large depth", "%d", traversal->final_stats.couldnt_traverse_bubble_depth);
+ getInfo()->add (2, "marked kmer inside traversal", "%d", traversal->final_stats.couldnt_because_marked_kmer);
+ getInfo()->add (2, "traversal ends with dead-ends", "%d", traversal->final_stats.couldnt_find_extension);
+ getInfo()->add (2, "in-branching large depth", "%d", traversal->final_stats.couldnt_inbranching_depth);
+ getInfo()->add (2, "in-branching large breadth", "%d", traversal->final_stats.couldnt_inbranching_breadth);
+ getInfo()->add (2, "in-branching other", "%d", traversal->final_stats.couldnt_inbranching_other);
+ getInfo()->add (2, "couldn't validate consensuses", "%d", traversal->final_stats.couldnt_validate_consensuses);
+}
+
+/*********************************************************************
+** METHOD :
+** PURPOSE :
+** INPUT :
+** OUTPUT :
+** RETURN :
+** REMARKS :
+*********************************************************************/
+void Minia::buildSequence (
+ const Graph& graph,
+ const Node& startingNode,
+ size_t length,
+ size_t nbContigs,
+ const Path& consensusRight,
+ const Path& consensusLeft,
+ Sequence& seq
+)
+{
+ /** Shortcuts. */
+ Data& data = seq.getData();
+ size_t lenRight = consensusRight.size();
+ size_t lenLeft = consensusLeft.size ();
+
+ /** We set the sequence comment. */
+ stringstream ss1;
+ ss1 << nbContigs << "__len__" << length;
+ seq._comment = ss1.str();
+
+ /** We set the data length. */
+ seq.getData().resize (length);
+
+ size_t idx=0;
+
+ /** We dump the left part. */
+ for (size_t i=0; i<lenLeft; i++) { data[idx++] = ascii (reverse(consensusLeft [lenLeft-i-1])); }
+
+ /** We dump the starting node. */
+ string node = graph.toString (startingNode);
+ for (size_t i=0; i<node.size(); i++) { data[idx++] = node[i]; }
+
+ /** We dump the right part. */
+ for (size_t i=0; i<lenRight; i++) { data[idx++] = ascii (consensusRight[i]); }
+}
diff --git a/src/Minia.hpp b/src/Minia.hpp
new file mode 100644
index 0000000..1d73217
--- /dev/null
+++ b/src/Minia.hpp
@@ -0,0 +1,61 @@
+/*****************************************************************************
+ * GATB : Genome Assembly Tool Box
+ * Copyright (C) 2014 INRIA
+ * Authors: R.Chikhi, G.Rizk, E.Drezen
+ *
+ * This program is free software: you can redistribute it and/or modify
+ * it under the terms of the GNU Affero General Public License as
+ * published by the Free Software Foundation, either version 3 of the
+ * License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU Affero General Public License for more details.
+ *
+ * You should have received a copy of the GNU Affero General Public License
+ * along with this program. If not, see <http://www.gnu.org/licenses/>.
+*****************************************************************************/
+
+#ifndef _GATB_TOOLS_MINIA_HPP_
+#define _GATB_TOOLS_MINIA_HPP_
+
+/********************************************************************************/
+
+#include <gatb/gatb_core.hpp>
+
+/********************************************************************************/
+
+/**
+ */
+class Minia : public gatb::core::tools::misc::impl::Tool
+{
+public:
+
+ /** Constructor. */
+ Minia ();
+
+private:
+
+ /** \copydoc Tool::execute. */
+ void execute ();
+
+ /** */
+ void assemble (const Graph& graph);
+
+ /** */
+ void buildSequence (
+ const Graph& graph,
+ const Node& startingNode,
+ size_t length,
+ size_t nbContigs,
+ const Path& consensusRight,
+ const Path& consensusLeft,
+ Sequence& seq
+ );
+};
+
+/********************************************************************************/
+
+#endif /* _GATB_TOOLS_MINIA_HPP_ */
+
diff --git a/src/NodeSelector.cpp b/src/NodeSelector.cpp
new file mode 100644
index 0000000..be4fde1
--- /dev/null
+++ b/src/NodeSelector.cpp
@@ -0,0 +1,244 @@
+/*****************************************************************************
+ * GATB : Genome Assembly Tool Box
+ * Copyright (C) 2014 INRIA
+ * Authors: R.Chikhi, G.Rizk, E.Drezen
+ *
+ * This program is free software: you can redistribute it and/or modify
+ * it under the terms of the GNU Affero General Public License as
+ * published by the Free Software Foundation, either version 3 of the
+ * License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU Affero General Public License for more details.
+ *
+ * You should have received a copy of the GNU Affero General Public License
+ * along with this program. If not, see <http://www.gnu.org/licenses/>.
+*****************************************************************************/
+
+/********************************************************************************/
+// We include required definitions
+/********************************************************************************/
+
+#include <NodeSelector.hpp>
+
+using namespace std;
+
+/*********************************************************************
+** METHOD :
+** PURPOSE :
+** INPUT :
+** OUTPUT :
+** RETURN :
+** REMARKS :
+*********************************************************************/
+INodeSelector* NodeSelectorFactory::create (const std::string& type, const Graph& graph, Terminator& terminator)
+{
+ if (type == "simple") { return new NodeSelectorSimplePath (graph, terminator); }
+ else if (type == "best") { return new NodeSelectorBest (graph, terminator); }
+ else { return new NodeSelectorBest (graph, terminator); }
+}
+
+/*********************************************************************
+** METHOD :
+** PURPOSE :
+** INPUT :
+** OUTPUT :
+** RETURN :
+** REMARKS :
+*********************************************************************/
+bool NodeSelectorSimplePath::select (const Node& branchingNode, Node& startingNode)
+{
+
+ /** We retrieve the neighbors of the provided node. */
+ Graph::Vector<Edge> neighbors = _graph.neighbors<Edge>(branchingNode.kmer);
+
+ /** We loop these neighbors. */
+ for (size_t i=0; i<neighbors.size(); i++)
+ {
+ /** make sure this kmer isnt branching */
+ if (_terminator.is_branching (neighbors[i].to)) { continue; }
+ /* FIXME: if we skip unitigs that are just one branching kmer, it means that we don't return ALL unitigs */
+
+ if (_terminator.is_marked (neighbors[i].to)) { continue; }
+
+ /** only start from an unmarked nt/strand combo */
+ if (_terminator.is_marked (neighbors[i])) { continue; }
+
+ /** We mark the current neighbor edge. */
+ _terminator.mark (neighbors[i]);
+
+ size_t len_extension = 0;
+
+ /** We loop successive node on a simple path. */
+ Graph::Iterator<Node> itNodes = _graph.simplePath<Node> (neighbors[i].to, neighbors[i].direction);
+
+ for (itNodes.first(); !itNodes.isDone(); itNodes.next())
+ {
+ bool only_simple_path_longer_than_2k = false;
+ /* no reason to discard small unitigs -- we generally want them all;
+ * anyhow, minia has another length filter in output
+ */
+
+ startingNode = itNodes.item();
+
+ if (len_extension++ > 2*_graph.getKmerSize() || (!only_simple_path_longer_than_2k))
+ {
+ /** NOTE: By convention, the returned node is understood as the forward part of the node in the
+ * bi-directional De Bruijn graph. */
+ startingNode.strand = STRAND_FORWARD;
+
+ /** Ok, we found a starting point. */
+ return true;
+ }
+ }
+ }
+
+ return false;
+}
+
+/*********************************************************************
+** METHOD :
+** PURPOSE :
+** INPUT :
+** OUTPUT :
+** RETURN :
+** REMARKS :
+*********************************************************************/
+bool NodeSelectorImproved::select (const Node& source, Node& result)
+{
+ /** We retrieve the neighbors of the provided node. */
+ Graph::Vector<Node> neighbors = _graph.neighbors<Node>(source.kmer);
+
+ /** We loop these neighbors. */
+ for (size_t i=0; i<neighbors.size(); i++)
+ {
+ /** Shortcut. */
+ Node& node = neighbors[i];
+
+ // alright let's use this convention now:
+ // to select new kmers: mark non-branching neighbors of branching nodes
+ // to mark as used in assembly: mark branching nodes
+
+ // only start from a non-branching k-mer
+ if (_terminator.is_branching(node)) { continue; }
+
+ if (_terminator.is_marked(node)) { continue; }
+
+ _terminator.mark(node);
+
+ result = node;
+
+ /** NOTE: By convention, the returned node is understood as the forward part of the node in the
+ * bi-directional De Bruijn graph. */
+ result.strand = STRAND_FORWARD;
+
+ return true;
+ }
+
+ return false;
+}
+
+/*********************************************************************
+** METHOD :
+** PURPOSE : This is the NodeSelector to use when you're doing contigs traversal -- it avoids starting inside a bubble
+** INPUT :
+** OUTPUT :
+** RETURN :
+** REMARKS :
+*********************************************************************/
+bool NodeSelectorBest::select (const Node& source, Node& result)
+{
+ Direction dir = DIR_OUTCOMING;
+ int sum_depths = 0;
+
+ /** First selection. */
+ if (_firstSelector.select (source, result) == false) { return false; }
+
+ /** We use a monument traversal. */
+ MonumentTraversal monument (_graph, NullTerminator::singleton());
+
+ /** We try each direction (outcoming and incoming). */
+ Node nodes[] = { result, _graph.reverse(result) };
+
+ for (size_t i=0; i<ARRAY_SIZE(nodes); i++)
+ {
+ Node current = nodes[i];
+ Node previousNode;
+ bool hasPreviousNode = false;
+
+ // do a BFS to make sure we're not inside a bubble or tip
+ Frontline frontline (dir, _graph, _terminator, current);
+
+ do
+ {
+ bool should_continue = frontline.go_next_depth();
+ if (!should_continue) { break; }
+
+ // put the same contraints as in a bubble
+ if (frontline.depth() > monument.getMaxDepth() || frontline.size() > monument.getMaxBreadth()) { break; }
+
+ // stopping condition: nothing more to explore
+ if (frontline.size() == 0) { break; }
+
+ if (frontline.size() <= 1)
+ {
+ Node currentNode;
+ if (frontline.size() == 1) { currentNode = frontline.front().node; }
+
+ if (hasPreviousNode && _terminator.is_branching(previousNode))
+ {
+ /* the current situation is:
+ *
+ * current_kmer previous_kmer
+ * -O-------------O------------- ... ---starting_kmer
+ * \_....
+ *
+ * or
+ *
+ * [no extension] previous_kmer
+ * X O------------- ... ---starting_kmer
+ * \_....
+ *
+ * so, by looking one k-mer ahead, we make sure that previous_kmer only branches to the right
+ *
+ */
+ set<Node> all_involved_extensions;
+ Path consensus;
+
+ if (monument.explore_branching (_graph.reverse(previousNode), dir, consensus, currentNode, all_involved_extensions))
+ {
+ if (all_involved_extensions.find(current) != all_involved_extensions.end())
+ {
+ return false; // starting_kmer is in a tip/bubble starting from current_kmer
+ }
+ }
+ }
+ }
+
+ // update previous_kmer
+ if (frontline.size() == 1)
+ {
+ previousNode = frontline.front().node;
+ hasPreviousNode = true;
+ }
+ else
+ {
+ hasPreviousNode = false;
+ }
+ }
+ while (1);
+
+ sum_depths += frontline.depth();
+ }
+
+ // don't even assemble those regions which have no chance to yield a long contig
+ if (sum_depths < (_graph.getKmerSize()+1)) { return false; }
+
+ /** NOTE: By convention, the returned node is understood as the forward part of the node in the
+ * bi-directional De Bruijn graph. */
+ result.strand = STRAND_FORWARD;
+
+ return true;
+}
diff --git a/src/NodeSelector.hpp b/src/NodeSelector.hpp
new file mode 100644
index 0000000..f98c044
--- /dev/null
+++ b/src/NodeSelector.hpp
@@ -0,0 +1,125 @@
+/*****************************************************************************
+ * GATB : Genome Assembly Tool Box
+ * Copyright (C) 2014 INRIA
+ * Authors: R.Chikhi, G.Rizk, E.Drezen
+ *
+ * This program is free software: you can redistribute it and/or modify
+ * it under the terms of the GNU Affero General Public License as
+ * published by the Free Software Foundation, either version 3 of the
+ * License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU Affero General Public License for more details.
+ *
+ * You should have received a copy of the GNU Affero General Public License
+ * along with this program. If not, see <http://www.gnu.org/licenses/>.
+*****************************************************************************/
+
+#ifndef _GATB_TOOLS_NODE_SELECTOR_HPP_
+#define _GATB_TOOLS_NODE_SELECTOR_HPP_
+
+/********************************************************************************/
+
+#include <gatb/gatb_core.hpp>
+
+/********************************************************************************/
+
+/** */
+class INodeSelector : public SmartPointer
+{
+public:
+
+ virtual ~INodeSelector() {}
+
+ virtual bool select (const Node& source, Node& result) = 0;
+
+ virtual std::string getName () const = 0;
+};
+
+/********************************************************************************/
+
+class NodeSelectorFactory
+{
+public:
+
+ static NodeSelectorFactory& singleton() { static NodeSelectorFactory instance; return instance; }
+
+ INodeSelector* create (const std::string& type, const Graph& graph, Terminator& terminator);
+};
+
+/********************************************************************************/
+
+/** Abstract factorization. */
+
+class NodeSelectorAbstract : public INodeSelector
+{
+public:
+
+ NodeSelectorAbstract (const Graph& graph, Terminator& terminator)
+ : _graph(graph), _terminator(terminator) {}
+
+protected:
+ const Graph& _graph;
+ Terminator& _terminator;
+};
+
+/********************************************************************************/
+
+// initial k-mer selection function from original Minia release (up until summer 2013)
+/* rationale:
+ * it's established that it's not a good idea to assemble from a branching kmer
+ * -> what if it's a simplepathtraversal and it chooses to start in a deadend?
+ * -> what if it's a monumenttraversal and the kmer is a true branching: won't be traversed
+ * yet, branching kmers are the only indexed ones
+ * solution:
+ * detect a 2k+2 simple path (anything NOT deadend or snp) around the branching kmer and start to extend from it
+ */
+class NodeSelectorSimplePath : public NodeSelectorAbstract
+{
+public:
+
+ NodeSelectorSimplePath (const Graph& graph, Terminator& terminator)
+ : NodeSelectorAbstract (graph, terminator) {}
+
+ bool select (const Node& source, Node& result);
+
+ std::string getName () const { return "simple"; }
+};
+
+/********************************************************************************/
+
+class NodeSelectorImproved : public NodeSelectorAbstract
+{
+public:
+
+ NodeSelectorImproved (const Graph& graph, Terminator& terminator)
+ : NodeSelectorAbstract (graph, terminator) {}
+
+ bool select (const Node& source, Node& result);
+
+ std::string getName () const { return "improved"; }
+};
+
+/********************************************************************************/
+
+class NodeSelectorBest : public NodeSelectorAbstract
+{
+public:
+
+ NodeSelectorBest (const Graph& graph, Terminator& terminator)
+ : NodeSelectorAbstract (graph, terminator), _firstSelector (graph, terminator) {}
+
+ bool select (const Node& source, Node& result);
+
+ std::string getName () const { return "best"; }
+
+private:
+ NodeSelectorImproved _firstSelector;
+};
+
+/********************************************************************************/
+
+#endif /* _GATB_TOOLS_NODE_SELECTOR_HPP_ */
+
diff --git a/src/main.cpp b/src/main.cpp
new file mode 100644
index 0000000..29b3de1
--- /dev/null
+++ b/src/main.cpp
@@ -0,0 +1,50 @@
+/*****************************************************************************
+ * GATB : Genome Assembly Tool Box
+ * Copyright (C) 2014 INRIA
+ * Authors: R.Chikhi, G.Rizk, E.Drezen
+ *
+ * This program is free software: you can redistribute it and/or modify
+ * it under the terms of the GNU Affero General Public License as
+ * published by the Free Software Foundation, either version 3 of the
+ * License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU Affero General Public License for more details.
+ *
+ * You should have received a copy of the GNU Affero General Public License
+ * along with this program. If not, see <http://www.gnu.org/licenses/>.
+*****************************************************************************/
+
+/********************************************************************************/
+
+#include <Minia.hpp>
+
+using namespace std;
+
+/********************************************************************************/
+
+int main (int argc, char* argv[])
+{
+ // We define a try/catch block in case some method fails (bad filename for instance)
+ try
+ {
+ /** We execute dsk. */
+ Minia().run (argc, argv);
+ }
+
+ catch (OptionFailure& e)
+ {
+ return e.displayErrors (cout);
+ }
+
+ catch (Exception& e)
+ {
+ cerr << "EXCEPTION: " << e.getMessage() << endl;
+ return EXIT_FAILURE;
+ }
+
+ return EXIT_SUCCESS;
+}
+
diff --git a/test/read50x_ref10K_e001.fasta b/test/read50x_ref10K_e001.fasta
deleted file mode 100644
index 2e19327..0000000
--- a/test/read50x_ref10K_e001.fasta
+++ /dev/null
@@ -1,10000 +0,0 @@
->read0_contig0_position4505_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGTCCTCCCTCGGCTAATCATGAACACCGGTCAGGCATGCTTACCTCCTGCGACGGCATTGGCGATTATGGGCGTGCATAGAGTCCCGCAGTGTCGGAG
->read1_contig0_position3781_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGGGTAAGAACACCTAGCCTGGCAATTACCCCTTTGTTATTCTAGTCAAGTGAAGAACCCGGGCCCAAAATTGGAACCCGTAAGCTTCAAGTGAATCAT
->read2_contig0_position7320_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGATGTCTAAAAGCGCCAGATCGACTTGACTCTACGTGCTGCAATCGAGAACCGCGGAAGGAACACTTTCTGGTGCGACTCGAGACCGCCCTCCCCGACC
->read3_contig0_position2000_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGGTTGAAGGCTGCGCATCGAGCAGCGTGCATTGGTCTTTCAGTCCCCAGTCACCGGAGACGTCCGAGCTCGAACCCATCCGGCTAAGAGGCAGGCAGT
->read4_contig0_position3003_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAATTGGCTTGAAACCGCCTAGCTCGGACCACCAAAGAGCAAGACTCTATGACTAGCGGGTGTCGTCAATGAAAACTGATCGAGCACTGTCCGCGAAACA
->read5_contig0_position5834_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCCTTCTCAGATAGACTAATAGAACGAAGTCCATATAACAGCTGATTTAAGAGGAAAAATTGAACATCAACGGAAGTACTATCGCATGCTCACCAGCAT
->read6_contig0_position1118_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCTTTGAATGTGTACGGCAATAGGAGAAACTCGGCCACGTACGTGTCAACATGGCGCGGCTCTCTATACCTCGCAAAGAATCACTCTATGGGTCATCTT
->read7_contig0_position7419_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCATATGCAGTTTCTGCATACACCGGGTAGACAACATTCTCAGCCCTTCGTTGAAAGGAGAATACAAATGACGGGAACTCTGACGAGAGGGTGCTTGAGC
->read8_contig0_position8925_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGAGTTGTAAAACATTAGCTCACGCGCCACCTTCATATGCTGCATATTGAGACAGGGTTGAAAACCTGTCTGAAGTCCGTGCTTCCCTAACCAGCCTAT
->read9_contig0_position4791_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGGCGAGTGCTCTGAAACGTTACATTCGTCTATCCGCACACACCGCCGTTGGATGTGTCCCACAGTGTTTTATACGGGACGGTGGCCACGGGGTGAGCA
->read10_contig0_position1767_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TACGGTTGATGTTATTACCAACTCCACTTCTGCAAATTGTTATGAGCAAGCATACAACTTAGCCGGCCCACAAATCGACGTGTGTATTTGTTCAATGGCA
->read11_contig0_position1248_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTCTGCTCCGAGACTTCGGCATAAATCTAAGTATGGACTCTTATATTCCCTCCTGCGTAGTGCTCTCCCATAATAAGTGAACCCATGGGTCGCGCTGTA
->read12_contig0_position5557_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTAATCGACTGCCTTCGTCGGGCCGCTTATTGGTTCACCCAATCTGGCCATTGCAAGTTTGGCAGACGCGAGGTTGCGTGGTCAACCGGACGTTGCTTTC
->read13_contig0_position7406_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCCCTCCCCGACCCATATGCAGTTTCTGCATACACCGGGTAGACAACATTCTCAGCCCTTCGTTGAAAGGAGAATACAAATGACGGGAACTCTGACGAG
->read14_contig0_position2303_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTTAACATCGGCAAATGCGCCATAGATACCTGCGGCTTCACTCCACAGTGTAAGAGTTGACGGGACTAAAACAGTATTGGGCGGTGAGGGGTACCCGTC
->read15_contig0_position8052_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGAGAATATGCATTCGACCAAATGAAAATGTCAATAATCTCGACCCTGTAGTCCGCGGCCAATCAGCACGATCAAGCTAAAGACAGGGATTATGCACTA
->read16_contig0_position6180_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATAACAGTCGACTAAAAGACGTAACCGATTCTGCTACGTTATAAAAAAGGGACGAGTGGGGTCAACAGTTCTTCTTCTTTCCTGTACGGTAATGCTTCCG
->read17_contig0_position2026_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-CGTGCATTGGTCTTTCAGTCCCCAGTCACCGGAGACGTCCGAGCTCGAACCCGTCCGGCTAAGAGACAGCAAGTCGCTGCATGTGTACGCAGCGGTGTAT
->read18_contig0_position4295_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTATTAATGATCCGTGTCCCCCGACCGTGTGCTGAGGAGACCCGTAATGCATGGAAAGTGCCAATATCCCCGGGAGTCCCGCACTACTGAGACGAAGTC
->read19_contig0_position5579_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGCTTATTGGTTCACCCAATCTGGCCATTGCAAGTTTGGCAGACGCGAGGTTGCGTGGTCAACCGAACGTTGCTTTCCTTAGGGTACCGAGTATATTAG
->read20_contig0_position2465_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGAACAACTCAATTAGGTAGTGTGCGCGAGGTAGAGTATGCAGATTTCGTACCTTGCCACTGCTACATCCGGCATATGGGCGTGCTATAAATGCGGGAGT
->read21_contig0_position4643_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAATCTGCTGGCTTGTGCATTCGTCGGCCTATTAGATACGGTACGGAATATTGGGTAACCTCCTCTTCACTGATATCATCCTATCGGCGTTCAAAGTAT
->read22_contig0_position5690_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGCGCGTTAACTACTTATAGTTCAGAAGATCACTGTCCGCCTCGAACCACTACAATAAGATTACGGATAGCCTGTGGCTTGGTTGTTTTCTGAATTGTG
->read23_contig0_position6154_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCCACTCATAAGGCACGCGCGGGCCATAACAGTCGACTAAAAGGCGTAACCGATTCTGCTACGTTATAAAAAAGGGACGAGCGGGGTCAACAGTTCTTC
->read24_contig0_position195_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTAACTGTATGGAGACCATAGGCATTTACCTTATTCTCATCGCCACGCCCCAAGATCTTTAGGACCCAGCATTCCTTTAACCACTAACATAACGCGTGT
->read25_contig0_position5992_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTAACGTTTGGACGGGTCTTGTGTTCCCTCAACACGTACGTTGACAGAGCTAACAATCCGTCGACTGAATGTGATTCCTTTGTTATTTCACACTATTGTT
->read26_contig0_position8496_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCTATATGACCCCTAGCGAGAAGTTATAGTCTAATAATGAATGGTGAACAGCACATCTTTTCGTCCTGAGGCCATATTAATTCTACTCAGATTGTCTGT
->read27_contig0_position7720_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACAAGCCATGAGGACTGGAGCGGTAATGTGGTAGTGTAGTTGCCGGCCCCTGTGCTGACCTTATGTCCATATCGATACACGAAGGCCAGTGCGGAAGCGG
->read28_contig0_position4354_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGACAATATCCCCGGGAGTCCCGCCCTACTGAGACGAAGTCTAGCTAGCTTGACTCGGCTGATAAAGAAAACAATCTATATGGAACCGAGGGGCGGGATG
->read29_contig0_position1265_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGCATAAATCTAAGTATGGACTCTTATATTCCCTCGTGCGTAGTGCTCACCCATAATAAGTGAACCCATGGGTCGCGCTGTACTTTTGTACGGCTTGAT
->read30_contig0_position7998_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GACACGAAGATTGTCATACTAGCTTTCAGTCATTCCCCCTCAGTTTTGTCCATGTGGAGAATATGCATTCGACCAAATGAAAATGTCAATAATCTCGACC
->read31_contig0_position36_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTAACGAGCTACCGTTTCTTTTAACCTGCCAGACGGTGACCAGGGCCGTTCGGCGTTGCATCGAGCGGTGTCGCTAGCGCAATGCGCAAGATTTTGACAT
->read32_contig0_position1620_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCTTCGATAGGACATGCACCCGGTCCGTTGACATACCAACTTGATCGCCAGTGAGTGAGCGGTGGTTTATCTGTTGAGTAGCCACTTTTCCCTATCTGC
->read33_contig0_position4710_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCACTGATATCATCCTATCGGCGTTCAAAGTATTCGGCGGATGTATTAGAGCCAAAGCAGTAGGTTACCGTCGGCGCATAACCGGCGAGTGCTTTGAAAC
->read34_contig0_position9629_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCAGTACCATAGCTTGGCCACATGTGATGCTCGTACTCGAAGCGGGAGTCACCTTACTTAATCGGCTGGGGTAACGGCTGGTTGTGTACTACGGTATGG
->read35_contig0_position2044_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCCCAGTCACCGGAGACGTCCGAGCACGAACCCGTCCGGCTAAGAGGCAGGCACTCGGTGCATGTGTACGCAGCGGTCTATGCTACAGGTATTACGGAG
->read36_contig0_position1799_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CAAATTGTTATGAGCAAGCATACAAGTTGGCCGGCCCACAAATCGACGTGTGTATTTGTTCAATGGCAGGAGGTTAACTGTGCGGAGCTCAACCTATAAC
->read37_contig0_position1024_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTCCGCATTGGCGCAAAGGTACCGCAAAGGGCCTGTATGACCCTGGTTACGCGTTATTACCGGTCAGCTCCAGTTACGTCACGGACGTAGAGAGCCTTT
->read38_contig0_position3200_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGGTAATCTCTCATCTACTAAGCGCCCTAAAGGTCGTATGGTTGGAGGGCGGTTACACACCCTTCAGTACCGAACGATAGAGCACCCGTCTAGGAGGGC
->read39_contig0_position912_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAGTTCTTTCAGGCCGATCAAGTGGTTAGAGACCTAGGTCTATGCCAGACGATCGCAGCGGAGTCGATATAATTGCAGTATCATGTATCCCTGATTGTG
->read40_contig0_position4360_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TATCCCCGGGAGTCCCGCACTACTGAGACGAAGTCTAGCTAGCTTGACTCGGCTGATAAAGAAAACAATCTATATGGAACCGAGGGGCGGGATGATAATT
->read41_contig0_position7942_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTTACGCAAACTACTCGACGAACAACAGCAAGATTCGACGATCAAACTCGCCGGCGACACGAAGATTGTCATACTTGCTTTCAGTCATTCCCCCTCAGT
->read42_contig0_position1412_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGAGAGGACATTTCGCAGCGCCCTTTCATCTCTATTGCTAGGTCTCTTAAGCCTAATCACGATCATAGATGGCCAATTATTGACCACAGGTAGGGGCGA
->read43_contig0_position5887_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAAAAATTGAACATCAACGGAAGTACTATAGCAGGCTCACCAGCATGAAAGACATCCTCATTGTGAACCCGGCATCTCGTGATTCGAGCCTAACAGCAC
->read44_contig0_position7070_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTAATCTGGCCAATATACCCTGGGGGGAGCTAATATATCGCGGCGTCGAGTTACCGTTGCCCCACCTCCAAGTGTCCATCGGAGTCCGCTTCCCGGGCT
->read45_contig0_position5901_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCAACGGAAGTACTATAGCAGGCTCACCAGCATGAAAGACATCCTCATTGTGAACCCGGCATCTCGTGATTCGAGCCTAACAGCATGCCATCTAACGTTT
->read46_contig0_position7489_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGGGAACTCTGACGAGAGGGTGCTTGAACGAGAGAAGCTAACAGTCATTGCGATGACGAGAACAGCCCTACTGCCCGCCGTGAACGAGAACAAGCGTGT
->read47_contig0_position5573_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCGGGCCGCTTATTGGTTCGCCCAATCTGGCCATTGCAAGTTTGGCAGACGCGAGGTTGCGTGGTCAACCGAACGTTGCTTCCCTTAGGGTACCGAGTA
->read48_contig0_position8760_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTGGTGATACCTACTCTTGACTGGGGGCTTACTGAGAACACTTCATCTGTATGGCAAAGTTGCGACACCGCGCCACACAGCAGTTTATTGTTAACACGC
->read49_contig0_position7341_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGACTTGACTCTACGTGCTGCAATGGAGAACCGCGGAAGGAACACTTTCTGGTGCCACTCGAGACCGCCCTCCCCGACCCATATGCAGTTTCTGCATACA
->read50_contig0_position7178_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCCATCGGTTAATTCAATGTGCGTCAATCGGGTTGGCCAAAAATTCTACCTGTCCACCTGTCCGCTAGAAGCAGATTATACGGAATACATATCCCGACA
->read51_contig0_position9695_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGGGGTAACGGCTGGTTTTGTACTCCGGTATGGGAACCCGTTTGCCGAACGTCTGGAAATCTGTCGAGTCATATCGATGAACAGAGACTAAATGTCCTT
->read52_contig0_position1947_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TATATTTGTCCTAACTTAGCACTATTGCACCACAAAATTTCAGCATAAAGCATCCGGTTGAAGGCTGCGTATCGAGCAGCGTGCATTGGTCTTTCAGTCC
->read53_contig0_position2071_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGAACCCGTCCGGCTAAGAGGCTGGCAGTCGCTGCATGTGTACGCAGCGGTCTATGCTACAGGTATTACGGAGTGAAACGGCTGCGAGCATCTCATAATC
->read54_contig0_position6379_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCTCAAGCAATCATACATGGCGGAATGCCTGTCCACCGGGGGTTCTACTGTACCACAGTGGCCTGGATAGCTAAGTTGGTCCTGGATTGGCATGTCATC
->read55_contig0_position6924_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTATGGTCTTAATTGAGTGTTCAGAGTTGGTGGTCACAGATGAGCGTTCCGATTGTCCTTTCCCAGGCTACGGCCTTATACCAAAGACTTCTAGACCGG
->read56_contig0_position2745_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTACTCCCGGGATCCACTGCGTCTATTGTAAGAAATGCAATGCGTGGCCAGTTTGTTCCGGCAGGACACCACTCTTTGAAGGTGCCCATTGCATTGTAGC
->read57_contig0_position5100_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCATAACCCGATGAGGCCAAGGTGTTACGTGAAGTCGCGTTGTCGCTAGTAACAGATTGGGAGGTCTCGGCCAATTCGTTGTATTGATCGCTGTGCACT
->read58_contig0_position9826_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTCGGCCGCTTGCTCAGAAATCGGAACACAAGTACGCGATCACTTTTCTAGTCACCAGCCTCAGGCATTCGCAAATTTCGGTCATGCACGCCACGGGTC
->read59_contig0_position2020_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGCAGCGTGCATTGGTCTTTCAGTCCCCAGTCACCGGAGACGTCCGAGCTCGAACCCGTCCGGCTAAGAGGCAGGCAGTCGCTGCATGTGTACGCAGCG
->read60_contig0_position1601_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGTACATTCACCTTTGGACGCTTCGATAGGACATGCACCCGGTCCGTTGACTTACCAACTTGATCGCCAGTGAGTGAGCGGTGGTTTATCTGTTGAGTG
->read61_contig0_position3742_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCACCTTAGACGCGGGAATAAATTCGACACGGGGTACGAAGGGTAAGAACACCTAGCCTGGCAATTACCCCTTTGTTATTCTAGTCAAGTGAAGAACCC
->read62_contig0_position8903_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGATAAGGATGGTTGAAATAGAACGAGTTGTAAAACATTAGCTCACGCGCCACCGTCATAGGCTGCATATTGAGACAGGGTTGAAAACCTGTCTGAAGTC
->read63_contig0_position5215_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTTAACCAAAGCATATTAATATGCCAGCCGCGCAGGGTGGTATATATGATCCTTGATAGCTTTATGGCCATCATCATAGTAAATTTTTTCAGATTACCC
->read64_contig0_position575_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGGTGGCTCTTCTGTCTCTGGCGGGGACGGCTATGTGAGTTCATAAATCTCAATGTCGAAACTCCGATGGGCAGAAGCTAAAACTGAACAACGAGTGGG
->read65_contig0_position2680_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTGGGGCGCGAGTCTCGAGTCTCTCGACTCCAAAGGGTCTGCCCGAGACAGGTTCACCGAGTCGTTACTCCCGGGATCCACTGCGTCTATTGTAAGAAA
->read66_contig0_position3210_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCATCTACTAAGCGCCCTAAACGTCGTATGGTTGGAGGGCGGTTACACACCCTTAAGTACCGAACGATAGAGCACCCGTCTAGGAGGGCGTGCAGGGTC
->read67_contig0_position3582_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTCGGGAGAAGACCCATGTGAGATGTATCCATCCCTACCACACGCGTCCGCCACCTCCGGGTCTAGTAAACCAGAGATTCCATGGACTCTCTGTTTCGT
->read68_contig0_position1672_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGAGTGAGCGGTGGTTTATCTGTTGATTGGCCACTTTTCCCTATCTGCTGGGACGGCACTGGAGATCTGGAACATTAGATAGGATATAATAGTAATACGG
->read69_contig0_position6384_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGCAATCATACATGGCGGAATGCCTGTCCACCGGGGGTTCTACTGTACCACAGTGGCCTGGATAGCTAAGCAGGTCCTGGATTGGCATGTCATCCGGAG
->read70_contig0_position5451_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTGGAGTGCCAGCGATAGTATCTCAGAGGCGAAAGCGCTTGTCACCTCATCTAAAATCGCGACTATAGATCTGTTTAGAACCACGACCCAGAAATCTTT
->read71_contig0_position8271_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTGCACGTGACTTGAGGCTCGGACTCGTATCTGTCTCCGTGTTCCTTTCGATAACTCTGCGACCTGAATGACCTTGGGCCCGTCGACATTCCTGGTAGT
->read72_contig0_position1837_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CAAAACGACGTGTGTATTTGTTCAATGGCAGGAGGTTAACTTTGCGGAGCTCAACCTATAACGATAATCTAATTGAGACAGACGAGTTGGAGTGTTTTGA
->read73_contig0_position2965_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGTAGCCCAATTGCGCTCCCGAACAACGCGTGAGTTTAAAATTGACTTGAAACCGCCTAGCTCGGACCACCAAAGAGCACGACTCTATGACTAGCGGGTG
->read74_contig0_position6375_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGCAGCTCAAGCAATCATACATGGCGGAATGCCTGTCCACCGGGGGTTCTACTGTACCACAGTGGCCTGGATAGCTAAGCAGGTCCTGGATTGGCATGT
->read75_contig0_position9209_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTAGTCAGGTCGGAACCGCTGGCAGAGCAGCTCCGAGGGCCTTTATACCCATACTGCCACTCCAGTACCTGGGCCGCGTGTTGTACGCTGTGTATCTTG
->read76_contig0_position5646_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGTTGCTTTCCTTAGGGTACCGAGTATATTAACTTTATGAAATTAGCTCGTTAACTACTTAAAGTTCAGAAGATCACTGTCCGCCTCGAACCACTACAA
->read77_contig0_position3812_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTTTGTTATTCTAGTCAAGTGAAGAACCCGGGCCCAAAATTGGAACCCGTAATCTTCAAGTGAATCATCCGATCATGCAAACCTGATTATCTGCACGAC
->read78_contig0_position7198_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCGTCAATCGGGATGGCCAAAAATTCTACCTGTCCACCTGTCCGCTAGAAGCAGATTATACGGAATACATATCCCGATACCGGCAGCTGAAATGATGCA
->read79_contig0_position1872_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTAACTTTGCGAAGCTCAACCTATAACGATAATCAAATTGAGACAGACGAGTTGGAGTGTTTTGATGAGCGGTGTTATATTTGTCCTAACTTAGCACTAT
->read80_contig0_position8005_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGATTGTCATACTAGCTTTCAGTCATTCCCCCTCAGTTTTGTCCATGTGGAGAATATGCATTCGACCAAATGAAAATGTCAATAATCTCGACCCTGTAGT
->read81_contig0_position5464_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGATAGTATCTCAGAGGCGAAAGCGCTTGTCACCTCATCTAAAATCGCGACTATAGATCTGTTTAGAACCACGACCCAGAAATCTTTAGCTAAGTAATCG
->read82_contig0_position395_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCTAGTAGTGTCGCGGTTATCGGACAGAGGATTATGTAAGGTTACCGAAGACCGGGTAGCGTAGTTAGTAACTTCAATCCGCGTTACGCTTTGTCCTCT
->read83_contig0_position4361_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCCCCGGGAGTACCGCACTACTGAGACGAAGTCTACCTAGCTTGACTCGGCTGATAAAGAAAACAATCTATACGGAACCGAGGGGCGGGATGATAATTG
->read84_contig0_position295_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CATCTAGTTCTAGCATACTCCGCCTTGGGCCACACAATTAATATAAGACGGGATAATGGCTTCATGCTCATGTTCTATACCGAGCAGAGAGGTTGGGTCT
->read85_contig0_position1043_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTACCGCAAAGGGCCTGTATGACCCTGGTTACGCGTTATTACCGGTCAGCTCCAGTTACGTCACGGACGTAGAGAGCCTTTGAATGTGTACGGCAATAGG
->read86_contig0_position9120_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AATCGCTTCTGTGATGACAGACCGAAGCCCACCTGTCCTGACCTCACCGCACGCATCGAGTCTAACTCTGATTCGAGAGACGGATGTAATTTAGTCAGGT
->read87_contig0_position303_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTAGCATACTCCGCCTTGGGCCACACAATTAATATAAGACGGGATAATGGCTTCATGCTCATGTTCTATACCGAGCAGAGAGGTCGGGTCTACCTAGTA
->read88_contig0_position1586_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCTAACCATCGGGTATGTACATTCACCTTTGGACGCTTCGATAGGACATGCACCCGGTCCGTTGACTTACCAACTTGATCGCCAGTGAGTGAGCGGTGG
->read89_contig0_position1049_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAAAGGGCCTGTATGACCCTGATTACGCGTTATTACCGGTCAGCTCCAGTTACGTCACGGACGTAGAGAGCCTTTGAATGTGTACGGCAATAGGAGAAAC
->read90_contig0_position405_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCGCGGTTATCGGACAGAGGATTATGTAAGGTTACCGAAGACCGGGTAGCGTAGTTAGTAACTTCAATCCGCGTTACGCTTTGTCCTCTGCTACGGCTC
->read91_contig0_position9215_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGGTCGGAACCGCTGGCAGAGCAGCTCCGAGGGCCTTTATACCCATACTGCCACTCCAGTACCTGGGCCGCGTGTTGTCTGCTGTGTATCTTGAGAGCG
->read92_contig0_position1265_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGCATACATCTAAGTATGGACTCTTATATTCCCTCCTGCGTAGTGCTCTCCCATAATAAGTGAACCCATGGGTCGCGCTGTATTTTTGTACGGCTTGAT
->read93_contig0_position8233_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGCTGCGACTGCTTGCAGCTCCGACCGCTTTCCAATCGTTGCACATGACTTGAGGCTCGGACTCGTATCTGTCTCCGTGTTCCGTTCGATAAATCTGCG
->read94_contig0_position6456_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGTCCTGGATTGGCATGTCATCCGGAGTGATAGGCACTGCTCACGACCAGCTTGCGGACAAACGGGGTGCCCGCGCCTGCGTCCGGTAGACGAGCGATG
->read95_contig0_position5793_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCTCAAATTGGGACCTAGTGTTGGCCAATAAGCCTCATATCGCCTTCTCAGATAGACGAATAGAACGAAGTCCATATAACAGCTGATTTAAGAGGAAAA
->read96_contig0_position3441_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTGGTAGTACTGCCTGCCGTCGCCTCGCGCCCATAATGTTTGGAACTCGCAAACCTTTGCACTCATCACATAGCAGGTTCCACCCGAACCGCGCGTAGT
->read97_contig0_position4453_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GATAATTGTTCTTAGTATAGTGACCGTTATGGACGACGGACATAACTACTGAGTGTCCGCCCTCGGCTAATCATGAACAACGGTCAGGCATGCTTACCTC
->read98_contig0_position4606_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GATAGGGAGGACGTAAACGCCAATTCCGCTCAATAGCGGAATCTGCTGGCTTGTGCATTCGTCGGCCTATTAGATACGGTACGGAATATTGGGTAACCTC
->read99_contig0_position1158_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TACGTGTCAACATGGCGCGGCTCTCTATACCTCGCAAAGAATCACTCTATGGGTCATCTTGAGAGAATAGTCGACTAGTAGCGAATATATGTTCTGCTCC
->read100_contig0_position2471_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTCAATTAGGTAGTGTGCGCGAGGTAGAGTATGCAGATTTCGTACCTTGCCACTGCTACCTCCGGCATATGGGCGTGCTATAAATGCGGGAGTAAGGAC
->read101_contig0_position5428_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGGCAGCGGGAACCGCTTTGACTCTGGAGTGCCAGCGATAGTATCTCAGAGGCGAAAGCGCTTGTCACCTCATCTAAAATCGCGACTATAGATCTGTTT
->read102_contig0_position6531_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCTGCGTCCGGTAGACGAGCGATGGATTTAGACCGTTCACTGAACCCTCTAATAGGACCTCTTGCCCATCCGAGGCTTAAGCAGCGACTCCACATGGAG
->read103_contig0_position9373_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCAACACTTTCACACAGGTAGCCGAACAGGTATTACTCAGACTGGAGAGGAATCTTCATTGGTCGTGCAGACATTGTCGCTGCGTACCAAAGTAACTGGA
->read104_contig0_position8651_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCCAGAATAGGGTTCAACGGTGTATGAGCAAACGATGCGGTAAGACGAGCGCTCCGACCCCCCTTGGCTCTGCTACATCGAATTCAGCGTGTAAGAGCC
->read105_contig0_position905_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GATCGTCGGAGTTCTTTCAGGCCGATCAAGTGGTTAGAGACCTAGGTCTATGCCAGACTATCGCAGCGGAGTCGATATAATTGCAGTATCATGTATCGCT
->read106_contig0_position9004_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGCTTCCCTAACCAGCCTATGCGCCTTAACTTTATGCATACTCGTTTAGTACAGGGCCGCGCCCCATGAGGCCATATGCGCCTGTCACGGGCATGCTGA
->read107_contig0_position4924_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGTGACATAAAGGTGCGGGACGCGGAAGCGCACCTCGTATAACGTTAGGGGTATCGTCACTGCATAGCAGAATGGGCGATCGGCCTACAAGAGTACAGT
->read108_contig0_position2695_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGAGCCTCTCGACTCCAAAGGATCTGCCCGAGACAGGTTCACCGAGTCGTTACTCCCGGGATCCACTGCGTCTATTGTAAGAAATGCAATGCGTGGCCA
->read109_contig0_position722_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCACGATCAATGTTATTAACCGCGACGGTGTATTCCACGACCTAATTTTTCCCGTCTCTGTGGTCAACCTGGACGCACAAACCCTAGTCCCATATAAAG
->read110_contig0_position6599_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCCGAGGCTTAAGCAGCGACTCCACATGGAGCGATGGGTCCTCAAGGCAGTATAAAATGGACTGCTATCTAGGCGTTAAAGTAGTAGAACGAGGGTCGG
->read111_contig0_position2226_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GATGGTAGCATCCCGGCTTCTGGGGCAATTTCTGACGATTCGAGTGACCAGCGATAGTGCGTTCCTTTTGTACTGAGTCTTAACATCGGCAAATGCGCCC
->read112_contig0_position5287_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CATCATAGTAAATTTTTTCAGATTACCCTGCAGACGTCCGCCTAAGATCCTAGTTGAATTGATCAATTGAGTCCAGTACACCATATCCACAGCTTGATCG
->read113_contig0_position5351_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AATTGAGTCCAGTACACCATATCAACAGCTTGATCGTTCCACTTCAATCAGCAAGACGGGCGACCGTACCCGGACACCTGGCAGCGGGAACCGCTTTGAC
->read114_contig0_position924_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCCGATCAAGAGGTTAGAGACCTAGGTCTATGCCAGACGATCGCAGCGGAGTCGATATAATTGCAGTATCATGTATCGCTGATGGTGGGGGGCATGGGT
->read115_contig0_position4689_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAATATTGGGTAACCTCCTCTTCACTGATATCATCCTATCGGCGTTCAAAGTATTCGGCGGATGAATTAGAGCCAAAGCAGTAGGTTACCGTCGGCGCAT
->read116_contig0_position1366_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCAGGGTCAGTTTGGGCGCCGGTATGTCTGTGTAAGGTTGGGCCAATCGAGAGGACATTTCGCAGCGCCCTTTCATCTCTATTGCTAGGTCTCTTAAGCC
->read117_contig0_position5951_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGAACCCGGCATCTCGTGATTCGAGCCTAACAGCATGCCATCTAACGTTTGGACGGGTCTTGTGTTCCCTCAACACGTACGTTGACAGAGCTAACAATCC
->read118_contig0_position1726_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGACTGGAGATCTGGAACATTAGATAGGATATAAAAGTAATACGGTTGATGTTATTACCAACTCCACTTCTGCAAAGTGTTATGAGCAAGCATACAAGT
->read119_contig0_position1413_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGAGAGGACATTTCGCAGCGCCCTTTCATCTCTATTGCTAGGTATCTTAAGCCTAATCAGGATCATAGATGGCCAATTATTGACCACAGGTAGGGGCGCG
->read120_contig0_position1990_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CATAAAGCATCCGGTTGAAGGCTGCGCATCGAGCAGCGTGCATTGGTCTTTCAGTCCCCAGTCACCGGAGACGTCCGAGCTCGAACCCGACCGGCTAAGA
->read121_contig0_position4597_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTCGGAGGGATAGGGAGGACGTAAACGCCAATTCCGCTTAACAGCGGAATCTGCTGGCTTGTGCATTCGTCGGCCTATTAGATACGGTACGGAATATTG
->read122_contig0_position6000_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGACGGGTCTTGTGTTCCCTCAACACGTACGTTGACAGAGCTAACAATCCGTCGACTGAATGTGATTCCTTTGTTATTTCACACTATTGTTCGGTGCGT
->read123_contig0_position2356_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGAGTTGACGGGACTAAAACAGTATTGGGCGGTGAGGGGTACCCGACGCCTCTGCTGTCAAAGTGGAAAATCCAGTCTCGACTATATCTACTATGTCATG
->read124_contig0_position432_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TAAGGTTACCGAAGACCAGGTAGCGTAGTTAGTAACTTCAATCCGCGTTACGCTTTGTCCTCTGCTACGCCTCGATTGGTTTCAGCTCACGTGGGACCCA
->read125_contig0_position6443_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGATAGCTATGCAGGTCCTGGCTTGGCATGTCATCCGGAGTGATAGGCACTGCTCACGACCAGCTTGCGGACAAACGGGGTGCCCGCGCCTGCGTCCGG
->read126_contig0_position3334_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTCTGGGCAAGCTGAACAACGGATGGGATTAAGCTCAGCAGTCCGCCTCCAATCTCTCCGACGTTCATTCTCAAGGGTGTAGTTTTAGAGACTGAGAAC
->read127_contig0_position4192_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTCCCGCTGATATGATTGTGATCGATATTCAGACTCTAACAAGTGGTCAGTACAGGTTCGACCATACGCGACGGCAAACAGAATCGCACGTCAACTATC
->read128_contig0_position8761_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGGTGATACCTACTATTGACTGGGGGCTTACTGAGAACACTTCATCTGTATGGCAAAGTTGCGACACCGCGCCACACAGCAGTTTATTGTTAACACGCG
->read129_contig0_position7896_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGTTGTGCCGTGTCACTCTGTAGCTCTAATACCAATTGAAATGGAGCTTACGCAAACTACTCGACGAACAACAGCAAGATTCGACGATCAAACTCGCCG
->read130_contig0_position5800_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTGGGACCTAGTGTTGGCCAATAAGCTTCATATCGCCTTCTCAGATAGACTAATAGAACGAAGACCATATAACAGCTGATTTAAGAGGAAAAATTGAAC
->read131_contig0_position1673_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGTGAGCGGTGGTTTATCTGTTGAGTGGCCACTTTTCCCTATCTGCTGGGACGGCACTGGAGATCTGGAACATTAGATAGGATATAAAAGTAATACGGT
->read132_contig0_position8111_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCAATCAGCACGATCAAGCTAAAGACAGGGATTATGCACTAGCACGACCGCCGCAGGAAAGATCCGAGGCATTTTCCAGGGTAAAATGATGGACTCATTG
->read133_contig0_position7430_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCTGCATACACCGGGTAGACAACATTCTCAGCCCTTCGTTGAAAGGAGAATACAAATGACGGGAACTCTGACGAGAGGGTGCTTGAACGAGAGAAGCTA
->read134_contig0_position4980_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCACTGCATAGCAGAATGGGCGATCGGCCTACAAGAGTACAGTACTAACGGTCTGGCCTTATACAGCGCCACATCCGCCAATTCGCTAGGTTGTAGCCA
->read135_contig0_position3676_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTCGTCGATTGTCTGAATATCGTGCAGTAAGTTTCTCTTAGGTTCCTCAACGGAAACGTCTCAGACCCACCTTAGACGCGGGAATAAATTCGACACGGG
->read136_contig0_position6094_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGCGTGCGCTGCTCAGGCTGGTGTGACCCTTACAGCGTTATCCGTCCCGAACTGGCTTGAGCCACTCATAAGGCACGCGCGGGCCATAACAGTCGACTA
->read137_contig0_position6323_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTGCAAGCTACTTCTAGACCTTATTACGTGCCCAGGAATTCCTAGGAAGGCGCGCAGCTCAAGCAATCATACATGGCGGAATGCCTGTCCACCGGGGGT
->read138_contig0_position451_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTAGCGTAGTTAGTAACTTCAATCCGCGTTACGCTTTGTCCTCTGCTACGCCTCGATTGGTTTCAGCTCACGTGGGACGCATGTACTTACCTAACATGAA
->read139_contig0_position7554_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCCTACTGCCCGGCGTGAACGAGAACAAGCGTGTGGAGAGTGACTGACTATCACGAGGAATTACGGATAACAGCCCACTTGGAGTGTGCTGAGGGCCGA
->read140_contig0_position1933_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGATGAGCGGTGTTATATTTGTCCTAACTTAGCACTATTGCACCACAAAATTTCAGCATAAAGCATCCGGTTGAAGGCTGCGCATCGAGCAGCGTGCAT
->read141_contig0_position3773_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGGTACGAAGGGTAAGAACACCTAGCCAGGCAATTACCCCTTTGTTATTCTAGTCAAGTGAAGAACCCGGGCCCAAAATTGGAACCCGTAATCTTCAAG
->read142_contig0_position6129_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGTTATCCGTGCCGAACTGGCTTGAGCCACTCATAAGGCACGCGCGGGCCATAACAGTCGACTAAAAGGCGTAACCGATTCTGCTACGTTATAAAAAAG
->read143_contig0_position757_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCACGACCTAATTTTTCCCGTCTCTGTGGTCAACCTGGACGCACAAACCCTAGTCCCATATAAAGCTATTCCACGCCGGGTGGCCTGGACGTCGTTTGTG
->read144_contig0_position6863_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCATACATTTAACCCTTAGTCATAAGATGATACTTCATCTGCATGCGCGCATCTTCCTATTTTATGGTCTTAATTGAGTGTTCAGAGTTGGGGGTCACA
->read145_contig0_position5790_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTATCTCAAATTGGGACCTAGTGTTGGCCAATAAGCTTCATATCGCCTTCTTAGATAGGCTAATAGAACGAAGTCCATATAACAGCTGATTTAACAGGA
->read146_contig0_position6913_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CATCTTCCTATTTTATGGTCTTAATTGAGTGTTCAGAGTTGGGGGTCACAGATGAGCGTTCCGATTGTCCTTCCCCAGGCTACGGCGTTATACCAAAGAC
->read147_contig0_position9450_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCTGCGTACCAAAGTAATTGGACGCCCATACCCCTTTGTCTACAGACGCTCATGGATAAGAGTGTGCGAATAACATCACTTGTTACTTCACGGAACGCT
->read148_contig0_position9641_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTTGGCCACATGTGATGCTCGTACTCGAAGGGGGAATCACCTTACTTAATCGGCTGGGGTCAAGGCTGGTTTTGTACTACGGTATGGGAACGCGTTTGC
->read149_contig0_position6305_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTACCCTTCTAATATTGTGTGCAAGCTACTTCTAGACCTTATTAAGTGCCCAGGAATTCCTAGGAAGGCGCGCAGCTCAAGCAATCATACATGGCGGAA
->read150_contig0_position8847_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTGTTAACACGCGATACAAGAGGGTTAGGAGCTAAGAATCCGGTGCATCACCGTACGAAAAGGATGGTTGAAATAGAACGAGTTGTAAAACATTAGCTC
->read151_contig0_position7987_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AACTCGCCGGCGACACGAAGATTGTCATACTAGCTTTCAGTCATTCCCCCTCAGTTTTGTCCATGTGGAAAATATGCATTCGACCAAATGAAAATGTCAA
->read152_contig0_position4166_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCACATAGTGTACGTTGAGGCGGGAACTTCCCGCGGATATGATTGTGATCGATATTCAGACTCTAACAAGTGGTCAGTACAGGTTCGACCATACGCGACG
->read153_contig0_position4160_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTGTCGCACATAGTGTACGTTGAGGCGGGAACTTCCCGCTGATATGATTGTGATCGATATTCAGACTCTAACAAGTGGTCAGTACAGGTTCGACCATAC
->read154_contig0_position2318_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGCGCCCTAGATACCTGCGGCTTCACTCCACAGTGTAAGAGTTGACGGGACTAAAACAGTATTGGGCGGTGAGGGGTACCCGACGCCTCTGCTGTCAAA
->read155_contig0_position4750_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGAATTAGAGCCAAAGCAGTAGGTTACCGTCGGCGCATAATCGGCGAGTGCTCTGAAACGTTACATTCGTCTATCCGCACCCACCGCCGTTGGATGTGT
->read156_contig0_position1276_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAAGTATGGACTCTTATATTCCCTCCTGCGTAGTGCTCTCCCATAATAAGTGAACCCATGGGTCGCGCTGTATTTTTGTACGGCTTGATGTCAGGGTCAG
->read157_contig0_position7931_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTGAAATGAAGCTTACGCAAACTACTCGACGAACAACAGCAAGACTCGACGATCAAACTCGCCGGCGACACGAAGATTGTCATACTAGCTTTCAGTCAT
->read158_contig0_position1348_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTTTGTACGGCTTGATGTCAGGGTCAGTTTGGGCGCCGGTATGTCTGTGTCAGGTTGGGCCAATCGAGAGGACATTTCGCAGCGCCCTTTCATCTCTAT
->read159_contig0_position7455_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCTCAGCCCTTCGTTGAAAGGAGAATACAAATGACGGGAACTCTGACGAGAGGGTGCTTGAACGAGAGAAGCTAACAGTCATTGCGATGACGAGAACAG
->read160_contig0_position9208_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTTAGTCAGGTCGGAACCGCTGGCAGAGCAGCTCCGAGGGCCTTTATACCCATACTGCCACTCCAGTACCTGGGCCGCGTGTTGTACGCTGTGTATCTT
->read161_contig0_position3865_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTTCAAGTGAATCATCCGATCATGCAAACCTGATTATCTGCACGACTCTTAAAATCATGCACTAAGCATAGAATGCACGACTACTTGTTACTGAAGTCG
->read162_contig0_position8420_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCCACGGTTAATGGGCCACTTATTTCGACATTCATGGCGCCGATATCCTGCTTAGGCAGTACGGCCAATGCCCGACCCTATATGACCCCTAGCGAGAAG
->read163_contig0_position6965_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGAGCGTTCCGATTGTCCTTTCCCAGGCTACGGCCTTATACCAAAGACTTCTAGACCGGAGAGACTACTTCCAGCCACGAATTCGTGTGATAACCGCCTA
->read164_contig0_position3983_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTAATGATATATGCTCTTGGACAACACGAGGTCGTAATTATTTCCTGAGATGGTTTTAGTGAGAGCAGCAGATGCACTCTTAGCTCCGCTGATAACGAT
->read165_contig0_position255_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGGACCCAGCATTCCTTTAACCACTAACATAACGCGTGTCATCTTGTTCTAGCATACTCCGCCTTGGGCCACACAATTAATATAAGACGGGATAATGTC
->read166_contig0_position3429_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGAACTCACCCTATTGGTAGTACTGCCTGCCGTCGCCTCGCGCCCATAATGTTTGGAACTCGCAAACCTTTACACTCATCACATAGCAGGTTCCACCCGA
->read167_contig0_position7312_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CACTCCGCCGATGTCTAAAAGCGCCAGATCGACTTGACTCTACGTGCTGCAATGGAGAACCGCGGAAGGAACACTTTCTGGTGCCACTCGAGACCGCCCT
->read168_contig0_position3045_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GACTCTATGACTAGCGGGTGTCGTCAATGATAACTGATCGAGCACTGTCAGCGAAACATTATTCAGTACAGCGACTTTTACCCTCGTGGTCTGAATGTTA
->read169_contig0_position4161_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGTCGCACATAGTGTACGTTGAGGCGGAAACTTCCCGCTGATATGATTGTGATCGATATTCATACTCTAACAAGTGGTCAGTACAGGTTCGACCATACG
->read170_contig0_position3687_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCTGAATATCGTGCAGTAAGTTTCTCTTAGGTTCCTCAACGGAAACGTCTCAGACCCACCTTAGACGCGGGAATAAATTCGACACGGGGTACGAAGGGT
->read171_contig0_position4166_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCACATAGTGTACGTTGAGGCGGGAACTTCCCGCTGATATGATTGTGATCGATATTCAGACTCTAACAAGTGGTCAGTACAGGTTCGACCATACGCGACG
->read172_contig0_position6827_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTCACCCACGACTGTACCCCGGTTAAGATTTATAAACCATACATTTAACCCTTAGTCATAAGATGATACTTCATCTGCATGCGCGCATCTTCCTATTTT
->read173_contig0_position7875_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCCGGCGCGTCCAGGTGCGAACGTTGTGCCGTGTCACTCTGTAGCTCTAATAGCAATTGAAATGAAGCTTACGCAAACTACTCGACGAACAACAGCAAG
->read174_contig0_position3768_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GACACGGGGTACGAAGGGTAAGAACACCTAGCCTGGCAATTACCCCTTTGTTATTCTAGTCAAGTGAAGAACCCGGGCCCAAAATTGGAACCCGTAATCT
->read175_contig0_position9011_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTAACCAGCCTATGCGCCTTAACTTTATGCATACTCGTTTAGTACAGGGCCGCGCCCCATGAGGCCATATGCGCCTGTCACGGGCATGCTGAAAGCGGC
->read176_contig0_position7040_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CACGAATTCGTGTGATAACCGCCTAAACAGTCTAATCTGGCCAATATACCCTGGGGGGAGCTAATATATCGCGGCGTCGAGTTACCGTTGCACCACCTCC
->read177_contig0_position797_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCACAAACCCTAGTCCCATATAAAGCTATTCCACGCCGGGTGGCCTGGACGGCGTTTGTGGATGGCTTTGGGAATCACTAGGTAATTACTGTTGGCTCCT
->read178_contig0_position2818_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTTGAAGGTGCCCATTGCATTGTAGCCGGAACTATTAGCAATCCTAAGCCCATAAGCCCTGCCCCACGGGGGCTACAATCCAGCAGTGAACGCGTTTAC
->read179_contig0_position5369_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATATCAACAGCTTGATCGTTCCACTTCAATCAGCAAGACGGGCGACCGTACCCGGACACCTGGCAGCGGGAACCGCTTTGACTCTGGAGTGCCAGCGATA
->read180_contig0_position2978_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCTCCCGAACAACGCGTGAATTTAAAATTGACTTGAAACCGCCTAGCTCGGACCACCAAAGAGCAAGACTCTATGACTAGCGGGTGTCGTCAATGAAAA
->read181_contig0_position7887_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGGTGCGAACGTTGTGCCGTGTCACTCTGTAGCTTTAATACCAATTGAAATGAAGCTTACGCAAACTACTCGACGAACAACAGCAAGATTCGACGATCA
->read182_contig0_position4693_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTGGGTAACCTCCTCTTCACTGATATCATCCTATCGGCGTTCAAAGTATTCGGCGGATGAATTAGAGCCAAAGCAGTAGGTTACCGTCGGCGCATAACC
->read183_contig0_position3908_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGACTCTTAAAATCATGCACTAAGCATAGAATGCACGACTACTTGTTACTGAAGTCGGCATGACTATCACACCTATTTAATGATATATGCTCTTGGACAA
->read184_contig0_position6751_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AATGTCGGGCACCGCCTTATCGGCTATACTAGTTAGAGCCTCGCTTGGGTCTCTACATCCGCTGATACGCGCGAGCTTTCACCCACGACTGTACCCCGGT
->read185_contig0_position8243_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCTTGCTGCTCCGACCGCTTTCCAATCGTTGCACATGACTTGAGGCTCGGACTCGTATCTGTCTCCGTGTTCCTTTCGATAACTCTGCGACCTGAATGA
->read186_contig0_position4914_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCCATGACGTTGTGACATAAAGGTGCGGGACGCGGAAGCGCACCTCGTATAACGTTAGGGGTATCGTCACTGCATAGCAGAATGGGCGATCGGCCTACA
->read187_contig0_position2436_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTATATCTACTATGTCATGCTTGTCGAATGAACAACTCAATTAGGTAGTGTGCGCGAGGTAGAGTATGCAGATTTCGTACCTTGCCACTGCTACCTCCG
->read188_contig0_position7359_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCAATGGAGAACCGCGGAAGGAACACTTTCTGGTGCCACTCGAGACCGCCCTCCCCGACCCATATGCAGTTTCTGCATACACCGGGTAGACAACATTCT
->read189_contig0_position8906_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAAGGATGGTTGAAATAGACCGAGTTGTAAAACATTAGCTCACGCGCCACCGTCATAGGCTGCATATTGAGACAGGGTTGAAAACCTGTCTGAAGTCCGT
->read190_contig0_position6548_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGCGATGGATTTAGACCGTTCACTGAACGCTCTAATAGGACCTCTTGCCCATCCGAGGCTTAAGCAGCTACTCCACATGGAGCGATGGGTCATCAAGGC
->read191_contig0_position1403_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGGGCCAATCGAGAGGACATTTCGCAGCGCCCTTTCATCTCTATTGCTAGGTCTCTTAAGCCTAATCAGGATCATAGATGGCCAATTATTGACCACAGG
->read192_contig0_position377_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCAGAGAGGTTGGGTCTACCTAGTAGTGTCGTGGTTATCGGACAGAGGATTATGTAAGGTTACCGAAGACCGGGTAGCGTAGTTAGTAACTTCAATCCG
->read193_contig0_position2697_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGCCTCTCGACTCCAAAGGGTCTGCCCGAGACAGGTTCACCGAGTCGTTACTCCCAGGATCCACTGCGTCTATTGTAAGAAATGCAATGCGTGGCCAGT
->read194_contig0_position3099_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AACATTATTCAGTACAGCGACTTTTACCCTCGTGGTCTGAATGTTATGCCGTCCGACTCTTGCGCTCGGATGTCCGCAATGGGTTATCAAATGCCTATGT
->read195_contig0_position8837_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACAGCAGTTTATTGTTAACACGCGATACAAGAGGGTTAGGAGCTAAGAAACCGGTGCATCACCGTACGAAAAGGATGATTGAAATAGAACGAGTTGTAAA
->read196_contig0_position3980_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTATTTAATGATATATGCTCTTGTACAACACGAGGTCGTAATTATTTCCTGAGATGGTTTTAGTGAGAGCAGCAGATGCACTCTTAGCTCCGCTGATAAC
->read197_contig0_position4257_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TACGCGACGGCAAACAGACTCGCACGTCAACTATCCCCTTTATTAATGATCCGTGTCCCCCGACCGTGTGCTGAGGAGACCCGTAATGCATGGAAAGTGC
->read198_contig0_position1553_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCACAACTGCACACTCCGATGCTCTGCCGAGCCTTCTAACCATCGGGAATGTACATTCACCTTTGGACGCTTCGATAGGACATGCACCCGGTCCGTTGAC
->read199_contig0_position1780_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTACCAACTCCACTTCTGCAAATTGTTATGAGCAAGCATACAAGTTAGCCGGCCCACAAATCGACGTGTGTATTTGTTCAATGGCAGGAGGTTAACTTT
->read200_contig0_position5021_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTACTAACGGTCTGGCCTTATACAGCGCCACATCCGCCAATTCGCTAGGTTGTAGCCAGGAAGTCTGTAGTACAGGTGCCCATAACCCGATGAGTCCAA
->read201_contig0_position6732_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGAACGTACGGACGGAGAAAATGTCGGACACCGCCTTATCGGCTATACTAGTTAGAGCCTCGCTTGGGTCTCTACATCCGCTGATACGCGCGAGCTCTCA
->read202_contig0_position9744_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGTCTGGAAATCTGTCGAGTCATATCGATGAACAGAGACTAAATGTCCTTAAATCTCTAACACGATTTTAGTAGGTCTACTACTAGGCCGCTTGCTCAG
->read203_contig0_position6897_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCATCGGCATGCGCGCATCTTCCTATTTTATGGTCTTAATTGAGTGTTCAGAGTTGGGGGTCACAGACGAGCGTTCCGATTGTCCTTTCCCAGGCTACG
->read204_contig0_position1611_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCTTTGGACGCTTCGATACGACATGCACCCGGTCCGTTGACTTACCAACTTGATCGCCAGTGAGGGAGCGGTGGTTTATCTGTTGAGTGGCCACTTTTC
->read205_contig0_position3497_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTACACTCATCACATAGCAGGTTCCACCCGAACCGCGCGTATTCTGCGACAGCATGAATCGTGTATCTCTGCTCGGTTATACGCCCTCGGGAAAAAACC
->read206_contig0_position6587_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GACCTCTTGCCCATCCGAGGCTTAAGCAGCGACTCCACATGGAGCGATGGGTCCTCAAGGCAGTATAAAATGGACTGCTATCTAGGCGTTAAAGTAGTAG
->read207_contig0_position5684_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGAAATTAGCGCGTTAACTACTTAAAGTTCAGAAGATCACTGTCCGCCTCGAACCACTACAATAAGATTACGGATAGCCCGTGGCTTGGTTGTTTTCTGA
->read208_contig0_position1103_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCACGGACGTAGAGAGCCTTTGAATGTGTACGGCAATAGGAGAAACTCGGCCACGTACGTGTCAACATGGCGCGGCTCTCTATACCTCGCAAAGAATCAC
->read209_contig0_position3475_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAATGTTTGGAACTCGCAAACCTTTACACTCATCACATAGCAGGTTCCACCCGAACCGCGCGTATTCTGCGATAGCATGAATCGTGTAACTCTGCTCGGT
->read210_contig0_position4391_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTCTAGCTAGCTTGACTCGGCTGATAAAGAAAACAATCTATATGGAGCCGAGGGGCGGGATGATAATTGTTCTTAGTATAGTGACCATTATGGACGACG
->read211_contig0_position5877_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGATTTACGAGGAAAAATTGAACATCAACGGAAGTACTATAGCAGGCTCACCAGCATGACAGACATCCTCATTGTGAACCCGGCATCTCGTGATTCGAGC
->read212_contig0_position5499_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CAACTAAAATCGCGACTATAGATCTGTTTAGAACCACGACCCAAAAATCTTTAGCTTAGTAATCGACTGCCTTCGTCGGGCCGCTTATTGGTTCACCCAA
->read213_contig0_position95_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCGAGCGGTGTCGCTAGCGCAATGCGCAAGATTTTGACATTTACAAGGCAACATTGCAGCGTCCGATGGTCCGGTGGCCTCCAGATAGTGTCCAGTCGC
->read214_contig0_position5085_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTGTAGTACAGGTGCCCATAACCCGATGAGGCCAAGGTGTTACGTGAAGTCGCGTTGTCGCTAGTAACAGATTGGGAGGTCTCGGCCAATTCGTTGTAT
->read215_contig0_position7171_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCCGCGTCCCATCTGTTAATTCAATGTCCGTCAATCGGGTTGGCCAAAAATTCTACCTGTCCACCTGTCCGCTAGAAGCAGATTATACGGAATACATAT
->read216_contig0_position4925_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTGACATAAAGGTGCGGGACGCGGAAGCGCACCTCGTATAACGTTAGGGGTATCGTCACTGCATAGCAAAATGGGCGATCGGCCTACAAGGGTACAGTA
->read217_contig0_position8692_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAAGACGAGCGCTCCGACCCCCCTTGGCTCTGCTACATCGAATTCAGCGTGTAAGAGCCCGCTTATCCGGTGGTGATACCTACTATTGACTGGGGGCTTA
->read218_contig0_position6948_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGTTGGGGGTCACAGATGAGCGTTCCGATTGTCCTTTCCCAGGCTACGGCCTTATACCAAGGACTTCTAGACCGGAGAGACTACTTCCAGCCACGAATT
->read219_contig0_position7851_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCCAGCCCGTTTGGGGTGATTTGTGCCGGCGCGTCCAGGTGCGAACGATGTGCCGTGTCACTCTGTAGCTCTAATACCAATTGAAATGAAGCTTACGCA
->read220_contig0_position5134_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCGCGTTGTCGCTAGTAACAGATTGGGAGGTCTCGGCCAATTCGTTGTATTGATCGCTGTGCACTTTAAAATTCGGAACATCTTAACCAAAGCATATTA
->read221_contig0_position3540_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTGCGACAGCATGAATCGTGTAACTCTGCTCGGTTATACGCCCTCGGGAGAAGACCCATGTAAGATGTAACTATCCCTACCACACGCGTCCGCCACCTC
->read222_contig0_position9371_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGCAACACTTTCACACAGGGAGCCGAACAGGTATTACTCAGACTGGAGAGGAATCTTCATTGGTCGTGCAGACATTATCGCTGCGTACCAAAGTAACTG
->read223_contig0_position1814_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGCATACAAGTTAGCCGGCCCACAAATCGACGTGTGAATTTGTTCAATGGCAGGAGGTTAACTTTGCGGAGCTCAACCTATAACGATAATCAAATTGAG
->read224_contig0_position6026_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGTACGTTGACAGAGCTAACAATCCGTCGACTGAATGTGATTCCTTTGTTATTTCACACTATTGTTCGGTGCGTGCGCTGCTCAGGCTGGTGCGACCCTT
->read225_contig0_position4072_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGATAACGGTTACTATAAGTCAGCGAATCTAACATCAATCTGCAACACGAATATCGTCCAAGACGTTTTGAGCCGGTGACTAATTCGGTTGTCGCACAT
->read226_contig0_position2064_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGAGCTCGAACCCGTCCGGCTAAGAGGCAGGCAGTCGCTGCATGTGTACGCAGCGGTCGATGCTACAGGTATTACGGAGTGAAAGGGCTGCGAGCATCT
->read227_contig0_position6619_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCGACATGAAGCGATGGGTCCTCAAGGCAGTATAAAATGGACTGCTATCTAGGCGTTAAAGTAGTAAAACGAGGGTCGGGCGATTTGTTTTGGTAGTGG
->read228_contig0_position1607_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTCACCTTTGGACGCTTCGATAGGACATGCACCCGGTCCGTTGACTTACCAACTTGATCGCCAGTGAGTGAGCGGTGGTTTATCTGTTGAGTGGCCACT
->read229_contig0_position2647_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AATTGGCTTTATCCACCCCCCCTACTGGCCACCACTGGGGCGCGGGTCTCGAGCCTCTCGACTCCAAAGGGTCTGCCCGAGACAGGTTCACCGAGTCGTT
->read230_contig0_position2089_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGCAGGCAGTCGCTGCATGTGTACGCAGCGGTCTATGCTACAGGTATTACGGAGTGAAACGGCTGCGAGCATCTCATAATCGGGCCACCCGATTTCAGC
->read231_contig0_position583_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTTCTGTCTCTGGCGGGGACGGCTATGTGAGTTCATAAATCTCAATGTCCAAACTCCGATGGGCAGAAGCTAAAACTGAACAACGAGTGGGACACCGGC
->read232_contig0_position1347_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTTTTGTACGGCTTGATGTCAGGGTCAGTTTGGGCGCCGGTATGTCTGTGTAAGGTTGGGCCAATCGAGAGGACATTTCGCAGCGACCTTTCATCTCTA
->read233_contig0_position9666_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGAAGGGGGAATCACCTTACTTAATCGGCTGAGGTAACGGCTGGTTTTGTACTACGGTATGGGAACCCGTTTGCCGAACGTCTGGAAATCTGTCGAGTC
->read234_contig0_position3280_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGCACACGTCTAGGAGGGCGTGCAGGGTCTCCCGCTAGCTAATGGTCACGGCCTCTCTGGGAAAGCTGAACAACGGATGGGATTAAGCTCAGCAGTCCG
->read235_contig0_position997_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTATCGCTGATTGTGGGGGGCATGGGGGTTCCGCATTGGCGCAAAGGTACCGCAAAGGGCCTGTATGACCCTGGTTACGCGTTATTACCGGTCAGCTCCA
->read236_contig0_position2880_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCCACGGGGGCTACAATCCAGCAGTGTACGCGTTTACCTTAAGACGAAAGAGTCAGTAGAGTTGGGGTTCGTGCTTTAATGACCCGTAGCCCAATTGCG
->read237_contig0_position6615_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGACTCCACATGGAGCGATGGGTCCTCAAGGCAGTATAAAATGGACTGCTATCTAGGCGTTAAAGTAGTAGAACGAGGGTCGGGCGATTTGTTTTGGTA
->read238_contig0_position9589_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-ACAAACACTCGATTGAGCAGTGGTCAGGTCATTATTGAACATCAGTACCATAGCTTGGCCACATGTGATGCTCGGACTCGAAGGGGGAATCACCTTACTT
->read239_contig0_position9559_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGAGCTCCCCCGCGATTAACCTATGTCGGGACAAACGCTCGATTGAGCAGTGGTCATGTCATTATTGTACATCAGTACCATAGCTTGGCCACATGTGATG
->read240_contig0_position9198_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCGGATGTAATTTAGTCAGGTCGGAACCGCTGGCAGAGCAGCTCCGAGGGCTTTTATACCCGTACTGCCACTCCAGTACCTGGGCCGCGTGTTGTACGC
->read241_contig0_position4799_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCTCTGAAACGTTACATTCGTCTATCCGCACACACCGCCGTTGGATGTGTCCCACAGTGTTTTATACGGGACGGTGGCCAGGGGGTGAGCACATGAATG
->read242_contig0_position3760_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATAAATTCGACACGGGGTACGAAGGGTAAGAACACCTAGCCTGGCAATTACCCCTTTGTTATTCTAGTCAAGTGAAGAACCCGGGCCCAAAATTGGAACC
->read243_contig0_position8385_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCTGCGGTACCGAGCAGCTTTGAGTTTTTGTAAGTGCCACGGTTAATGGGCCACTTATTTCGACATTCATGGCGCCGATATCCTGCTTAGGCAGTGCGG
->read244_contig0_position2433_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGACTATGTCTACTATGTCATGCTTGTCGAATGAACAACTCAATTAGGTAGTGTGCGCGAGGTACAGTATGCAGATTTCGTACCTTGCCACTGCTACCT
->read245_contig0_position1006_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTGTGGGGGGCATGGGGGTTCCGCATTGGCGCAAAGGTACCGCAAAGGGCCTGTATGACCCTGGTTACGCGTTATTACCGGTCAGCTCCAGTTACGTCA
->read246_contig0_position1518_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AATTAGTGGATTCACTTCCCTTTGACATCTTGTTCTCACAACTGCACACTCCGATGCTCTGCCGAGCCTTCTAACCATCGGGTATGTACATTCAACTTTG
->read247_contig0_position5074_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGCCAGGAAGTCTGTAGTACAAGTGCCCATAACCCGATGAGGCCAAGGTGTTTCGTGAAGTCGCGTTGTCGCTAGTAACAGATTGGGAGGTCTCGGCCA
->read248_contig0_position4875_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCCACGGGGTGAGCACATGAATGGGGTACGATTTTACCGTCCATGACGTTGTGACATAAAGGTGCGGGACGCGGAAGCGCACCTCGTATAACGTTAGGG
->read249_contig0_position5683_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGAAATTAGCGCGTTAACTACTTAAAGTTCAGAAGATCACTGTCCGCCTCGAACCACTACAATAAGATTACGGATAGCCCGTGGCTTGGTTGTTTTCTG
->read250_contig0_position6532_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTGCGTCCGGTAGACGAGCGATGGATTTAGACCATTCACTGAACCCTCTAATAGGACCTCTTGCCCATCCGAGGCTTAAGCAGCGACTCCACATGGAGC
->read251_contig0_position5287_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CATCATATTAAATTTTTTCAGATTACCCTGCAGACGTCCGCCTAAGATCCTAGTTGAATTGATCAATTGAATCCAGTACACCATATCAACAGCTTGATCG
->read252_contig0_position1834_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CCACAAATCGACGTGTGCATTTGTTCAATGGCAGGAGGTTAGCTTTGCGGAGCTCAACCTATAACGATAATCAAATTGAGACAGACGAGTTGGAGTGTTT
->read253_contig0_position994_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CATGTATCGCTGATTGTGGGGGGCATGGGGGTTCCGCATTGGCGCAAAGTTACCGCAAAGGGCCTGTATGACCCAGGTTACGCGTTATTACCGGTCAGCT
->read254_contig0_position1426_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCAGCGCCCTTTCATCTCTATTGCTAGGTCTCTTAAGCCTAATCAGGATCATCGATGGCCAATTATTGACCACAAGTAGGGGCGAGGTATAAATTAGTG
->read255_contig0_position8753_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTATCCGGTGGTGATACCTACTATTGACTGGGGGCTTACTGAGAACACTTCATCTGTATGGCAAAGTTGCGACACCGCGCCACACAGCAGTTTATTGTT
->read256_contig0_position4966_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGTTAGGGGTATCGTCACTGCATAGCAGAATGGGCGATCGGCCTACAAGAGTACAGTACTAACGGTCTGGCCTTATACAGCGCCACATCCGCCAATTCG
->read257_contig0_position780_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGTGGTCAACCTGGACGCACAAACCCTAGTCCCATATAAAGCTATTGCACGCCGGGTGGCCTGGACGTCGTTTGTGGATGGCTTTGGGAATCACTAGGT
->read258_contig0_position3614_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCCTACCACACGCGTCCGCCACCTCCGGGTCTAGTAAACCAGAGATTCCATGGACTGTCTGTTTCGTCGATTGTCTGAATATCGTGCAGTAAGTTTCTC
->read259_contig0_position5597_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AATCTGGCCATTGCAAGTTTGGCAGACGCGAGGTTGCGTGGTCAACCGAACGTTGCTTTCCTTAGGGTACCGATTATATTAACTTTATGAAATTAGCGCG
->read260_contig0_position2320_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGCCCTAGATACCTGCGGCTTCACTCCACAGTGTAAGAGTTGACGGGACTAAAACAGTATTGGGCGGTGAGGGGTTCCCGACGCCTCTGCTGTCAAAGT
->read261_contig0_position4505_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGTCCGCCCTCGGCTAATCATGAACACCGGTCAGGCATGCTTACCTCCTGCGACGGCATTGGCGATTATGGGCGTGCATAGATTCCCGCAGTGTCGGAG
->read262_contig0_position2070_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGAACCCGTCCGGCTAAGAGGCAGGCAGTCGCTGCATGTGTACGCAGCGGTCTATGCTACAGGTATTACGGAGTGAAACGGCTGCGAGCATCCCATAAT
->read263_contig0_position5198_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTTAAAATTCGGAACATCTTAACCAAAGCATATTAATATGCCAGCCGCGCAGGGTGGTATATATGATCCTTGATAGCTTTATGGCCATCATCATAGTAA
->read264_contig0_position7013_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCTAGACCGGAGAGACTACTTCCAGCCACGAATTCGTGTGATAACCGCCTAAACAGTCTAATCTGGCCAATATACCCTGGAGGGAGCTAATATATCGCG
->read265_contig0_position4017_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTAATTATTTCCTGAGATGGTTTTAGTGAGAGCAGCAGATGCACTCTTAGCTCCGCTGATAACGATTACTATAAATCAGCGAATCTAACATCAACCTGCA
->read266_contig0_position6695_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGGGCGATTTGTTTTGGTAGTGGTTATCGCATTGCAAGAACGTGCGGACGGACAAAAGGTCGGACACCGCCTTATCGGCTATACTAGTTAGAGCCTCGC
->read267_contig0_position1463_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCTAATCAGGATCATAGATGGCCAATTATTGACCACAGGTAGGGGCGAGGTATAAATTAGTGGATTCACTTCCCTTTGACATCTTGTTCTCACAACTGC
->read268_contig0_position6337_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTAGACCTTATTAAGTGCCCAGGAAGTCCTAGGAAGGCGCGCAGCTCAAGCAATCATACATGGCGGAATGCCTGTCCACCGGGGGTTCTACTGTACCACA
->read269_contig0_position33_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGCTAACGAGCTACCGTTTCCTTTAACCTGCCAGACGGTGACCAGGGCCGTTCGGGGTTGCATCGACCGGTGTCGCTAGCGCAATGCGCAAGATTTTGA
->read270_contig0_position3127_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCGTGGTCTGAATGTTATGCCGTCCGACTCTTGCGCTCGGATGTCCTCAATGGGTTATCAAATGCCTATGTTCCGGTAATCTCTCATCTACTAAGCGCC
->read271_contig0_position3379_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCTCCAATCTCTCCGACGTTCATTCTCAAGGGTGTAGTTTTAGAGACTGAGAACTCACCCTATTGGTAGTACTGCCTGCCGTCGCCTCGCGCCCATAAT
->read272_contig0_position2410_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGCCAAAGTGGGAAATCCAGTCTCGACTATATCTACTATGTCATGCTTGTCGAATGAACAACTCAATTAGGTAGTGTGCGCGAGGTAGAGTATGCAGAT
->read273_contig0_position9658_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTCGTACTCGAAGGGGGAATCACCTTACTTAATCGGCTGGGGTAACGGCTGGTTTTGTACTACGGTATGGGAACCCGTTTGCCGAACGTCTGGAAATCT
->read274_contig0_position9158_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGACCTCACCGCAGGCATCGCGTCTAACTCTGATTCTAGAGACGGATGTAATTTAGTCAGGTCGGAACCGCTGGCAGAGCAGCTCCGAGGGCCTTTATAC
->read275_contig0_position5673_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TATTAACTTTATGAAATTAGCGCGTTAACTACTTAAAGTTCAGAAGATCACTGTCCGCCTCGAACCACTACAATAAGATTACGGATAGCCCGTGGCTTGG
->read276_contig0_position5047_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCCACATCCGCCAATTCGCTAGGTTGTAGCCAGGACGTCTGTAGTACAGGTGCCCATAACCCGATGCGGCCAAGGTGTTACGTGTAGTCGCGTTGTCGC
->read277_contig0_position7524_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGCCAACAGTCATTGCGATGACGAGAACAGCCCTACTGCCCGCCGTGAACGAGAACAAGCGTGTGGAGAGTGACTGACTATCACGAGGAATTACGGATA
->read278_contig0_position6301_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAATTTACCCTTCTAATATTGTGTGCAAGCTACTTCTAGACCTTATTAAGTGCCCAGGAATTCCTAGGAAGGCGCGCAGCTCAAGCAATCATACATGGC
->read279_contig0_position5687_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AATTAGCGCGTTAACTACTTAAAGTTCAGAAGATCACTGTCCGCCTCGAACCACTACAATAAGATTACGGATAGCCCGTGGCTTGGTTGTTTTCTGAATT
->read280_contig0_position569_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CACTAGTCGGTGGCTCTTCTGTCTCTGGCGGGGACGGCTATGTGAGTTCATAAATCTCAATGTCGAAACTCCGATGGGCAGAAGCTAAAACTGAACAACG
->read281_contig0_position9388_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGTAGCCGAACAGGTATTACTCAGACTGGAGAGGAATCTTCATTGGTCGTGCAGACATTGTCGCTGCGTACCAAAGTAACTGGACGCCCATACCCCTTT
->read282_contig0_position8648_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTGTCCAGAATAGGGTTCAACGGTGTATGAGCAAACGATGCGGTAAGACGAACGCTCCGACCCCCCTTGGCTCTGCTACATCGAATTCAGCGTGTAAGA
->read283_contig0_position7030_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TACTTCGAGCCACGAATTCGTGTGATAAACGCCTAAAAAGTCTAATCTGGCCAATATACCCTGGGGGGAGCTAATATATCGCGGCGTCGAGTTACCGTTG
->read284_contig0_position935_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGTTCGAGACCTAGGTCTATGCCAGACGATCGCAGCGGAGTCGATATAATTGCAGTATCATGTATCGCTGATTGTGGGGGGCATGGGGGTTCCGCATTG
->read285_contig0_position8749_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCGCTTATCCGGTGGTGATACCTACTATTGACTGGGGGCTTACTGAGAACACTTCATCTGTATGGCAAAGTTGCGACACCGCGCCACACAGCAGTTTAT
->read286_contig0_position6064_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GATTCCTTTGATATTTCACACTATTGTTCGGTGCGTGCGCTGCTCAGGCTGGTGCGACCCTTACAGCGTTATCCGTCCCGAACTGGCTTGAGCCACTCAT
->read287_contig0_position1979_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CAAAATTTCAGCATAAAGCATCCGGTTGAAGGCTGCGCATCGAGCAGCGTGCATTGGTCTTTCAGTCCCCAGTCACCGGAGACGTCCGAGCTCGAACCCG
->read288_contig0_position994_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CATGTATCGCTGATTGTGGGGGGCATGGGGGTTCCACATTGGCGCAAAGGTACCGCAAAGGGCCTGTATGACCCTGGTTACGCGTTATTACCGGTCAGCT
->read289_contig0_position7492_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAACTCTGACGAGAGGGTGCTTGAACGAGAGAAGCTAACAGTCGTTGCGATGACGAGAACAGCCCTACTGCCCGCCGTGAACGAGAACAAGCGTGTGGA
->read290_contig0_position3081_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCGAGCACTGTCCGCGAAACATTATTCAGTACAGCGACTTTTACCCTCGTGGTCTGAATGTTATGCCGTCCGACTCTTGCGCTCGGATGTCCGCAATCG
->read291_contig0_position8971_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTGAGACAGGGTTGAAAACCTGTCTGAAGTCCGTGCTTCCCTAACCAGCCTATGCGCCTTAACTTTATGCATACTCGTTTAGTACAGGGCCGCGCCCCA
->read292_contig0_position973_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGTCGATATAATTGCAGTATCATGTATCGCTGATTGTGGGGGGCATGGGGGTTCCGCATTGGCGCAAAGGTACCGCAAAGGGCCTGTATGACCCTGGTT
->read293_contig0_position8364_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGTAGTAATCCGATCTCAATTCCTGCGGTACCGAGCAGCTTTGAGTTTTTGTAAGTCCCACGGTTAATGGGCCACTTATTTCGACATTCATGGCGCCGA
->read294_contig0_position3162_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTCGGATGTCCGCTATGGGTTATCAAATGCCTATGATCCGGTAATCTCTCATCTACTAAGCGCCCTAAAGGTCGTATGGTTGGAGGGCGGATACACACC
->read295_contig0_position2847_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAACTATTAGCAATCCTAAGCCCATAAGCCCTGCCCCACGGGGGTTACAATCCAGCAGTGAACGCGTTTACCTTAAGACGAAAGAGTCAGTAGAGTTGGG
->read296_contig0_position6020_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCAACACGTACGTGGACAGAGCTAACAATCCGTCGACTGAATGTGATTCCTTTGTTATTTCACACTATTGTTCGGTGCGTGCGCTGCTCAGGCTGGTGCG
->read297_contig0_position5050_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CACATCCGCCAATTCGCTAGGTTGTAGCCAGGAAGTCTGTAGTACAGGTGCCCATAACCCGATGAGGCCAAGGTGTTACGTGAAGTCGCGTTGTCGCTAG
->read298_contig0_position8555_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTCGTCCTGAGGCCATATTAATTCTACTCAGATTGTCTGTAACCGGAGCTTCGGACGTATTTTAGCGTAAGACACTGCCTAAAGGGAACATATGTGTCC
->read299_contig0_position3831_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGAAGAACCCGGGCCCAAAATTGGAACCCGGAATCTTCAAGTGAATCATCCGATCATGCAAACCTGATTATCTGCACGACTCTTAAAATCATGCACTAA
->read300_contig0_position6231_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGAGTGGGGTCAACAGTTCTTCTTCTTTCCTGTACGGTAATGCTTCCGCGCATCTAAGTGATATTCGCCGGAAATTACCCTTCTAATATTGTGTGCAAG
->read301_contig0_position3114_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCTACTTTTACCCTCGTGGTCTGAATGTTATGCCGTCCGACTCTTGCGCTCGGATGTCCGCAATGGGTTATCAAATGCCAATGTTCCGGTAATCTCTCA
->read302_contig0_position8684_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGATGCGGTAAGACGAGCGCTCCGACCCCCCTTGGCTCTGCTACATCGAATTCAGCGCGTAAGAGCCCGCTTATCCGGTGGTGATACCTCCTATTGACTG
->read303_contig0_position3668_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTCTCTGTTTCGTCGATTGTCTGAATATCGTGCAGTAAGTTTCTCTTAGGTTCCTCAACGGAAACGTCTCAGACCCACCTTAGACGCGGGAATAAATTC
->read304_contig0_position9395_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGAACAGGTATTACTCAGACTGGAGAGGAATCTTCATTGGTCGTGCAGACATTGTCGCTGCGTAGCAAAGTAACTGGACGCCCATACCCCTTTGTCTACA
->read305_contig0_position6543_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGACGAGCGATGGATTTAGACCGTTCACTGAACCCTCTAATAGGACCTCTTGCCCATCCGAGGCTTAAGCAGCGACTCCACATGGAGCGATGGGTCCTC
->read306_contig0_position9609_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGTCATGTCATTATTGTACATCAGTACCATAGCTTGGCCACATGTGATGCTCGTACTCGAACGGGGAATCACCTTACTTAATCGGCTGGGGTCACGGTT
->read307_contig0_position4790_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCGGCGAGTGCTCTGAAACGTTACATTCGTCTATCCGCACACACCGCCGTTGGATGTGTCCGACAGTGTTTTATACGGGACGGTGGCCACGGGGTGAGC
->read308_contig0_position9075_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCATATGCGCCTGTCACGGGCATGCTGAAAGCGGCGGTTACATTAATCGCTTCTGTGATGACAGACCGAAGCCCACCTGTCCTTACCTCACCGCAGGCA
->read309_contig0_position8918_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAATAGAACGAGTTGTAAAACATTAGCTCACGCGCCACCGTCATAGGCTGCATATTGAGATAGGGTTGAAAACCTGTCTGAAGTCCGTGCTTCCCTAACC
->read310_contig0_position8450_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATACATGGCGCCGATATCCTGCTTAGGCAGCACGGCCAATGCACGACCCTATATGACCCCTAGCGAGAAGTTATAGTCTAATAATGAATGGTGAACAGCA
->read311_contig0_position8169_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGATCCGAGGCCTTTTCCAGGGTAAAATGATGGACTCATTGACCAACCCCTATTATTAGGAGAGGGCTGCGACTTCTTGCAGCTCCGACCGCTTTCCAA
->read312_contig0_position7251_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGATTATACGGAATACATATCCCGACACCGGCAGCTGAAATGATGCAGAAGCCTTGCTTGCCACTCCGCCGATGTCTAAAAGCGCCAGATCGACTTGACT
->read313_contig0_position2024_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCGTGCATTGGTCTTTCAGTCCCCAGTCACCGGAGACCTCCGAGCTCGAACCCGTCCGGCTAAGAGGCAGGCAGTCGCTGCATGTGTACGCAGCGGTCT
->read314_contig0_position3185_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCAAATGCCTATGTTCCGGTAATCTCTCATCCACTAAGCGCCCTAAAGGTCGTATGGTTGGAGGGCGGTTACACACCCTTAAGTACCGAACGATAGAGCA
->read315_contig0_position6105_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTCAGGCTGGTGCGAACCTTACAGCGTTATCCGTCCCGAACTGGCTTGAGCCACTCATAAGGCACGCGCGGGCCATAACAGTCGACTAAAAGGCGTAAC
->read316_contig0_position4239_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCAGTACAGGTTCGACCATACGCGACGGCAGACAGAATCGCACGTCAACTATCCCCTTTATTAATGATCCGTGTCCCCCGACCGTGTGCTGAGGAGACCC
->read317_contig0_position7604_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCACGAGGAATTACGGATAACAGCCCACTTGGAGTGTGCTGAGAGCCGACGCCCGGGGACCGTGATATCCTTGCGAGTGGAATGCGAAAACGGCATAAG
->read318_contig0_position8826_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CACCGCGCCACGCAGCAGTTTATTGTTAAAACGCGATACAAGAGGGTTAGGAGCTAAGAAACCGGTGCATCACCGTACGAAAAGGATGGTTGAAATAGAA
->read319_contig0_position5130_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGAAGTCGCGTTGTCGCTAGTAACAGATTGGGAGGTCTCGGCCAATTCGTTGTATTGATCGCTGTGCACTTTAAAATTCGGAACATCTTAACCAAAGCAT
->read320_contig0_position3157_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTGCGCTCGGATGTCCGCAATGGGTTATCAAATGCCTATGTTCCGGTAATCTCTCATCTACTAAGCGCCCTAAAGGTCGTATGGTTGGAGGGCGGTTAC
->read321_contig0_position3432_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTCACCCTATTGGTAGTACTGCCTGCCGTCGTCTCGCGCCCATAATGTTTGGAACTCGCAAACCTTTACACTCATCACATAGCAGGTTCCACCCGAACC
->read322_contig0_position8902_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGAAAAGGATGGTTGAAATAGAACGAGTTGTAAAACATTAGCTCACGCGCCACCGTCATAGGCTGCATATTGAGACAGGGTTGAAAACCTGTCTGAAGT
->read323_contig0_position3625_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCGTCCGCCACCTCCGGGTCTAGTAAACCAGAGATTCCATGGACTCTCTGTTTCGTCGATTGTCTGAATATCGTGCAGTAAGTTTCTCTTAGGTTCCTC
->read324_contig0_position4399_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGCTTGACTCGGCTGATAAAGAAAACAATCTATATGGAACCGAGGGGCGGGATGATAATTGTTCTTAGTATAGTGACCGTTATGGACGACGGACATAAC
->read325_contig0_position7671_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCCTTGCGAGTGGAATGCGAAAACGGCATAAGCGCAATGACCGAGGTAACAAGCCATGAGGACTGGAGCGGTAATGTGGTAGTGTAGTTGCCGGCCCCT
->read326_contig0_position421_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGAGGATTATGTAAGGTTACCGAAGACCGGGTAGCGTAGTTAGTAACTACAATCCGCGTTACGCTTTGTCCTCTGCTACGCCTCGATTGGTTTCAGCTCA
->read327_contig0_position2479_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGTAGTGTGCGCGAGGTAGAGTATGCAGATTTCGTACCTTGCCACTGCTACCTCCGGCATATGGGCGTGCTATAAATGCGGGAGTCAGGACGATAGAGC
->read328_contig0_position8114_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCAGCACGATCAAGCTAAAGACAGGGATTATGCACTAGCACGACCGCCGCAGGAAAGATCCGAGGCCTTTTCCAGGGTAAAATGATGGACTCATTGACC
->read329_contig0_position4615_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GACGTAAACGCCAATTCCGCTTAATAGCGGAATCTGCTGGCTTGTGCATTCGTCGGCCTATTAGATACGGTACGGAATATTGGGTAACCTCCTCTTCACT
->read330_contig0_position4068_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCGCTGATAACGATTACTATAAATCAGCGAATCTAACATCAATCTGCACCACGAATGTCGTCCAAGACGTTTTGAGCCGGTGACTAATTCGGTTGTCGC
->read331_contig0_position3179_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGTTATCAAATGCCTATGTTCCGGTAATCTCTCATCTACTAAGCGCCCTAAAGGTCGTATGGTTGGAGGGCGGTTACACACCCTTAAGTACCGAACGAT
->read332_contig0_position6124_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTACAGCGTTATCCGTCCCGAACTGGCTTGAGCCACTCATAAGGCACGCGCGGGCCATAACAGTCGACTAAAAGGCGTAACCGATTCTGCTACGTTATAA
->read333_contig0_position9821_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CTACTACTAGGCCGCTTGCTCAGAAATCGTAACACAAGTACACGATCTCTTTTCTAGTCACCAGCCTCAGGCATTCGCAAATTTCATTCATGCACGCAAC
->read334_contig0_position4439_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGAGGGGCGGGATGATAATTGTTCTTAGTATAGTGACCGTTATGGACGACGGACATAACTACTGAGTGTCCGCCCTCGGCTAATCATGAACACCGGTCA
->read335_contig0_position5944_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCATTGTGAACCCGGCATCTCGTGGTTCGAGCCTAACAGCATGCCATCTAACGTTTGGACGGGGCTTGTGTTCCCTCAACACGTACGTTGACAGAGCTA
->read336_contig0_position5253_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGTATATATGATCCTTGATAGCTTTATGGCCATCATCATAGTAAATTTTTTCAGATTACCCTGCAGACGTCCGCCTAAGATCCTAGTTGAATTGATCAA
->read337_contig0_position2986_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AACAACGCGTGAGTTTAAAATTGACTTGAAACCGCCTAGCTCGGACCACCAAAGAGCAAGACTCTATGACTAGCGGGTGTCGTCAATGAAAACTGATCGA
->read338_contig0_position5652_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTTCCTTAGGGTACCGAGTTTATTAACTTTATGAAATTAGCGCGTTAACTACTTAAAGTTCAGAAGATCACTGTCCGCCTCGAACCACTACAATAAGAT
->read339_contig0_position4246_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGTTCGACCATACGCGACGGCAAACAGAATCGCAGGTCAACTATCCCCTTTATTAATGATCCGTGTCCCCCGACCGTGTGCTGAGGAGACCCTTAATGC
->read340_contig0_position9775_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AACAGAGACTAAATGTCCTTAAATCTCTAACACGATTTTCGTAGGTCTACTAGTAGGCCGCTTGCTCAGAAATCGGAACACAAGTACGCGATCTCTTTTC
->read341_contig0_position6518_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGGGATGCCCGTGCCTGGGTCCGGTAGACGAGCGATGGATTTAGACCGTTCACTGAACCCTCTAATAGGACCTCTTGCCCATCCGAGGCTTAAGCAGCG
->read342_contig0_position712_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGTAGAAGCACCCACGATCAATGTTATTAACCGCGACGGTGTATTCCACGACCTAATTTTTCCCGTCTCTGTGGTCAACCTGGACGCACAAACCCTAGTC
->read343_contig0_position2655_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTATCCACCCCCCCTACTGGCCACCACTGGGGCGCGAGTCTCGAGCCTCTCGACTCCAAAGGGTCTGCCCGAGACAGGTTCACCGAGTCGTTACTCCCGG
->read344_contig0_position2484_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGTGCGCGAGGTAGAGTATGCAGATTTCGTACCTGGCCACTGCTACCTCCGGCATATGGGCGTGCTATAAATGCGGGAGTCAGGACGATAGAGCGAAGT
->read345_contig0_position5575_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGGCCGCTTATTGGTTCACCCAATCTGGCCCTTGCAAGTTTGGCAGACGCGAGGTTGCGTGGTCAACCGCACGTTGCTTTCCTTAGGGTACGGAGTATA
->read346_contig0_position9170_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGCATCGAGTCTAACTCTGATTCGAGAGACGGATGTAATTTAGTCAGGTCGGAACCGCTGGCAGAGCAGCTCCGAGGGCCTTTATACCCATACTGCCAC
->read347_contig0_position175_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCAGATAGTGTCCAGTCGCTCTAACTGTATGGAGACCATAGGCATTTACCTTATTCTCATCGCCACGCCCCATGATCTTTAGGACCCAGCATTCCTTTA
->read348_contig0_position9350_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGCGTATCCTGACCATGGAGCTGCAACACTTTCACACAGGTAGCCGAACAGGTATTACTCAGACTGGAGAGGAATCTTCATTGGTCGTGCAGACATTGT
->read349_contig0_position2990_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGCGTGAGTTTAAAATTGACTTGAAACCGCCTAGCTCGGACCACCAAAGAGCAAGACTCTATGACTAGCGGGTGTCGTCAATGAAAACTGATCGAGCAC
->read350_contig0_position3796_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGCCTGACAATTACCCCTTTGTTATTCTAGTCAAGTGAAGAACCCGGGCCCAAAATTGGAACCCATAATCTTCAAGTGAATCATCCGATCATGCAAACC
->read351_contig0_position5958_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCATCTCGTGATTCGAGACTAACAGCATGCCATCTAACGTTTGGACGGGTCTTGTGTTCCCTCAACACGTACGTTGACAGAGCTAACAATCCGTCGACT
->read352_contig0_position6300_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGAATTTACCCTTCTAATATTGTGTGCAAGCTACTTCTAGACCTTATTAAGTGCCCAGGAATTGCTAGGAAGGCGCGCAGCTCAAGCAATCATACATGG
->read353_contig0_position4736_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAAGTATTCGGCGGATGAATTAGAGCCAAAGCAGTAGGTTACCGTCGGCGCATAACCGGCGAGTGCTCTGAAACGTTACATTCGTCTATCCGCACACACC
->read354_contig0_position7661_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGACCGTGATATCCTTGCGAGTGGAATGCGAAAACGGCATAAGCGCAATGACCGAGGTAACAAGCCATGAGGACTGGAGCGGTAATGTGGTAGTGTAGTT
->read355_contig0_position5372_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCAACAGCTTGATCGTTCCACCTCAATCAGCAAGACGGGCGACCGTACCCGGACACCTGGCAGCGGGAACCGCTTTGACTCTGGAGTGCCAGCGATAGTA
->read356_contig0_position6540_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGTAGACGAGAGATGGATTTAGACCGTTCACTGAACCCTCTAATAGGACCTCTTGCCCATCCGAGGCTTAAGCAGCGACTCCACATGGAGCGATGGGTC
->read357_contig0_position2802_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGGCAGGACACCACTCTTTGAAGGTGCCCATTTCATTGTAGCCTGAACTATTAGCAATCCTAAGCCCATAAGCCCTGCCCCACGGGGGCTACAATCCAG
->read358_contig0_position4676_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGATACGGTACGGAATATTGGGTAACCTCCTCTTCACTGATATCATCCTATCGGCGTTCAAAGTATTCGGCGGATGAATTAGAGCCAAAGCAGTAGGTT
->read359_contig0_position7447_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGACAACATTCTCAGCCCTTCGTTGAAAGGAGAATACAAATGACGGGAACTCTGACGAGAGGGTGCTTGAACGAGAGAAGCTAACAGTCATTGCGATGAC
->read360_contig0_position8978_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGGGTTGAAAACCTGTCTGAAGTCCGTGCTTCCCTAACCAGCCTATGCGCCTTAACTTTATGCATACTCGTTTAGTACAGGGCCGCGCCCCATGAGGCC
->read361_contig0_position7116_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGAGTTACCGTTGCACCACCTCCAAGTGTCCATCGGAGTCCGCTTCCCGGGCTTGTCCGCGTCCCATCGGTTAATTCAATGTCCGTCAATCGGGTTGGC
->read362_contig0_position9761_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGTCATATCAATGAACAGAGACTAAATGTCCTTAAATCTCTAACACGAATTTAGTAGGTCTACTACTAGGCCGCTTGCTCAGAAATCGGAACACAAGTA
->read363_contig0_position4066_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTCCGCTGATAACGATTACTATAAATCAGCGAATCTAACATCAATCTGCACCACGAATATCGTCCAAGACGTTTTGAGCCGGTGACTAATTCGGTTGTC
->read364_contig0_position5142_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCGCTAGTAACAGATTGGGAGGTCTCGGCCAATTCGTTGTATTGATCGCTGTGCACTATAAAATTCGGAACATCTTAACCAAAGCATATTAATATGCCA
->read365_contig0_position1619_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGCTTCGATAGGACATGCACCCGGTCCGTTGACTTACCAACTTGATCGCCAGTGAGTGAGCGGTGGTTTATCTGTTGAGTGGCCACTTTTCCCTATCTG
->read366_contig0_position9576_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-AACCTATGTCGGGACAAACACTCGATTGAACAGTGGTCATGTCATTATTGTGCATCAGTACCATAGCTGGGCCACATGTGATGCTCGTACTCGAAGGGGG
->read367_contig0_position8881_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGAAACCGGTGCATCACCGTACGAAAAGGATGGTTGAAATAGAACGAGTTGTAAAACATTAGCTCACGCGCCACCGTCATAGGCTGCATATTGAGACAG
->read368_contig0_position7341_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGACTTGACTCTACGTGCTGCAATGGAGAACCGCGGAAGGAACACTTTCTGGTGCCACGCGAGACCGCCCTCCCCGACCCATATGCAGTTTCTGCATACT
->read369_contig0_position3746_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTTAGACGCGGGAATAAATTCGACACGGGGTACGAAGGGTAAGAACACCTAGCCTGGCAATTACCCCTTTGTTATTCTAGTCAAGTGAAGAACCCGGGC
->read370_contig0_position7249_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCAGATTATACGGAATACATATCCCGACACCGGCAGCTGAAATGATGCAGAAGCCTTGCTTGCCACTCCGCCGATGTCTAAAAGCGCCAGATCGACTTGA
->read371_contig0_position5768_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTGGTTGTTTTCTGAATTGTGGCTATCTCAAATTGGGACCTAGTGTTGGCCAATAAGCTTCATATCGCCTTCTCAGACAGACTAATAGAACGAAGTCCA
->read372_contig0_position3717_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTCCCTCAACGGAAACGTCTCAGACCCACCTTAGACGCGGGAATAAATTCGACACGGGGTACGAAGGGTAAGAACACCTAGCCTGGCAATTACCCCTTT
->read373_contig0_position3338_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGGAAAGCTGAACAACGGATGGGATTAAGCTCAGCAGTCCGCCTCCAATCTCTCCGACGTTCATTCTAAAGGGTGTAGTTTTAGAGACTGAGAACTCAC
->read374_contig0_position2804_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCAGGACACCACTCTTTGAAGGTGCCCATTGCATTGTAGCCTGAACTATTAGCAATCCTAAGCCCATAAGCCCTGCCCTACGGGGGCTACAATCCAGCA
->read375_contig0_position9743_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AACGTCTGGAAATCTGTCGAGTCATATCGATGAACAGAGACTAAATGTCCTTAAATCTCTAACACGATTTTAGTAGGTCTACTACTAGGCCGCTTGCTCA
->read376_contig0_position7645_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGGGCCGACGCCCGGGGACCGTGATATCCTTGCGAGTGGAATGCGAAAACGGCATAAGCGCAATGACCGAGGTAGCAAGCCATGAGGACTGGAGCGGTA
->read377_contig0_position734_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTATTAACCGCGACGGTGTATTCCACGACCTAATTTTCCCCGTCTCTGTGGTCAACCTGGACGCAAAAACCCTAGTCCCATATAAAGCTATTCCACGAC
->read378_contig0_position4356_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ACAATATCCCCGGGAGTCCCGCACTACTGAGACGAAGTCTAGCTAGCTTGACTCGGCTGATAAAGAAAACAATCTATATGGAAACGAGGGGCGGGATGAT
->read379_contig0_position1672_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGAGTGAGCGGTGGTTTATCTGTTGAGTGGCCACTTTTCCCTATCTGCTGGGACGGCACTGGAGATCTGGAACATTAGATAGGATATAAAAGTAGTACGG
->read380_contig0_position1255_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCGAGACTTCGGCATAAATCTAAGTATGGTCTCTTATATTCCCTCCTGCGTAGTGCTCTCCCATAATAAGCGAACCCATGGGTCGCGCTGTATTTTTGT
->read381_contig0_position9133_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGACAGACCGAAGCCCACCTGTCCTGACCTCACCGCAGGCATCGAGTCTAACTCTGATTCGAGAGACGGATGTAATTTAGTCAGGTCGGAACCGCTGGC
->read382_contig0_position7544_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GACGAGAACAGCCCTACTGCCCGCCGTGAACGAGAACAAGCGTGTGGAGAGTGACTGACTATCACGAGGAATTACGGATAACAGCCCACTTGGAGTGTGC
->read383_contig0_position9686_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTAATCGGCTGCGGTAACGGCTGGTTTTGTACTACGGTATGGGAACCCGTTTGCCGAACGTCTGGAAATCTGTCGAGTCATATCGATGAACAGAGACTA
->read384_contig0_position9278_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGGGCCGCGTGTTGTACGCTGTGTATCTTGAGAGCGTCTCTCCGTATCGAAATGTTCCGCTGTAAAGAACCTGGCGTATCCTCACCATGGAGCTTCAAC
->read385_contig0_position8165_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGAAAGATCCGAGGCCTTTTCCAGGGTAAAATGATGGACTCATTGACCAACCCCTATTATTAGGAGAGGGCTGCGACTGCTTGCAGCTCCGACCGCTTT
->read386_contig0_position1991_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-ATAAAGCATCCGGTCGAAGGCTGCGCATCGAGCAGCGTGCATTGGTCTTTCAGTCCTCAGTCACCGGAGGCGTCCCAGCTCGAACCCGTCCGGCTAAGAG
->read387_contig0_position91_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGCATCGAGCGGTGCCGCTAGCGCAATGCGCAAGATTTTGACATTTACAAGGCAACATTGCAGCGTCCGATGGTCCGGTGGCCTCCAGATAGTGTCCAG
->read388_contig0_position7884_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGCAGGTGCGAACGTTGTGCCGTGTCACTCTGTAGCTCTAATACCAATTGAAATGAAGCTTACGCAAACTACTCGACGAACAACAGCAAGATTCGACGA
->read389_contig0_position128_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTGACATTTACAAGGCAACATTGCAGCGTCCGATGGTCCGGTGGCCTCCAGATAGTGTCCAGTCGCTCTAACTGTATGGAGACCATAGGCATTTACCTT
->read390_contig0_position4487_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GACGGACATAACTACTGAGTGTCCGCCCTCGGCTAATCATGAACACCGGTCCGGCATGCTTACCTCCTGCGACGGCATTGGCGATTATGGGCGTGCATAG
->read391_contig0_position1936_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGAGCGGTGTTATATTTGTCCTAACTTAGCACTATCGCACCACAAAATTTCAGCATAAAGCATCCGGTTGAAGGCTGCGCATCGAGCAGCGTGCATTGG
->read392_contig0_position8748_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCCGCTTCTCCGGTGGTGATACCTACTATTGACTGGGGGCTTACTGAGAACACTTCATTTGGATGGCAAAGTTGCGACACCGCGCCACACAGCAGTTTA
->read393_contig0_position458_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTTAGTAACTTCAATCCGCGTTACGCTTTGTCCTCTGCTACGCATCGATTGGTTTCAGCTCACGTGGGACGCATGTACTTACCGAACATGAAGCGGTAA
->read394_contig0_position2954_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTTAATGACGCGTAGCCCAATTGCCCTCCCGAACAACGCGTGAGTTTAAAATTGACTTGAAACCGCCTAGCTCGGACCACCAAAGAGCAAGACTCTATG
->read395_contig0_position3135_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGAATGTTATGCCGTCCGACTCTTGCGCTCGGATGTCCCCAATGGGTTATCAAATGCCTATGTTCCGGTAATCTCTCATCTACTAAGCGCCCTAAAGGT
->read396_contig0_position4361_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCCCCGGGAGTCCCGCACAACTGAGACGAAGTCTAGCTAGCTTGACTCGGCTGATAAAGAAAACAATCTATATGGAACCGAGGGGCGGGGTGATAATTG
->read397_contig0_position2856_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCAATCCTAAGCCCATAAGCCCTGCCCCACGGGGGCTACAATCCAGCAGTGAACGCGTTTAACTTAAGACGAAAGAGTCAGTAGAGTTGGGGTTCGTGCT
->read398_contig0_position4006_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AACACGAGGTCGTAATTATTTCCTGAGATGGTTTTAGTGAGAGCAGCAGATGCACTCTTAGCTCCGCTGATAACGATTACGATAAATCAGCGAATCTAAC
->read399_contig0_position7595_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGACTGACTATCACGAGGAATTACGGATAACAGCCCACTTGGAGTGTGCTCAGGGCCGACGCCCGGGGACCGTGATATCCTTGCGAGTGGAATGCGAAAA
->read400_contig0_position7218_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAAATTCTACCTGTCCACCTGTCCGCTAGAAGCAGATTATACGGAATACATATCCCGACACCGGCAGCTGAAATGATGCAGAAGCCTTGCTTGCCACTCC
->read401_contig0_position4520_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAATCATGAACACCGGTCAGGCATGCTTACCTCCTGCGACGGCATTGGCGATTATGGGCGTGCATAGAGTCCCGCAGTGTCGGAGCGATAGGGAGGACGT
->read402_contig0_position3930_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCATAGAATGCACGACTACTTGTTACTGAAGTCGGCATGACTATCAAACCTATTTAATGATATATGCTCTTGGACAACACGAGGTCGTAATTCTTTCCT
->read403_contig0_position312_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCCGCCTTGGGCCACACAATTAATATAAGACGGGATAATGGCTTCAGGCTCATGTTCTATACCGAGCAGAGAGGTTGGGTCTATCTAGTAGTGTCGCGG
->read404_contig0_position2348_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACAGTGTAAGAGTTGACGGGACTAAAACAGTATTGGGCGGTGAGGGGTACCCGACGCCGCTGCTGTCAAAGTGGGAAATCCAGTCTCGACTATATCTACT
->read405_contig0_position2260_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGATTCGAGTGACCAGCGGTAGTACGTTCCTCTTGTACTGAGTCTTAACGTCGGCAAATGCGCCCTAGATACCTGCGGCTTCACTCCACAGTGTAAGAG
->read406_contig0_position2070_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGAACCCGTCCGGCTAAGAGGCAGGCAGTCGCTGCATGTGTACGCAGCGGTCTATGCTACAGGTATTACGGAGTGCAACGGCTGCGAGCATCTCATAAT
->read407_contig0_position7240_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGCTAGAAGCAGATTATACGGAATACATATCCCGACACCGGCAGCTGAAATGATGCAGAAGCCTTGCTTGCCACTCCGCCGATGTCTAAAAGCGCCAGA
->read408_contig0_position9238_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCTCCGAGGGCCTTTATACCCATACTGCCACTCCAGTACCTGGGCCGCGTGTTGTACGCTGTGTATCTTGAGAGCGTTTCTCCGTATCGAAATGTTCCG
->read409_contig0_position7411_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCCCGACCCATATGCAGTTTCTGCATACACCGGGTAGACAACATTCTCAGCCCTTCGTTGAAAGGAGAATACAAATGACGGGAACTCTGACGAGAGGGT
->read410_contig0_position5922_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTCACCAGCATGAAAGACATCCTCATTGTGAACCCGGCATCTCGTGATTCGAGCCTAACAGCATGCCATCTAACGTTTGGACGGGTCTTGTGTTCCCTC
->read411_contig0_position262_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGCATTCCTTTAACCACTAACATAACGCGTGTCATCTGGATCTAGCATACTCCGCCTTGGGCCACACAATTAATATAAGACGGGATGATGGCTTCATAC
->read412_contig0_position5716_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGATCACTGTCCGCCTCGAACCACTACAATAACATTACGGATAGCCCGTGGATTGGTTGTTTTCTGAATTGTGGCTATCTCAAATTGGGACCTAGTGTT
->read413_contig0_position123_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGATTTTGACATTTACAAGGCAACATTGCAGCGTCCGATGGTCCGGTGGCCTCCAGATAGTGTCCAGTCGCTCTAACTGTATGGAGACCATAGGCATTT
->read414_contig0_position6106_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCAGGGTGGTGCGACCCTTACAGCGTTATCCGTCCCGAACTGGCTTGAGCCACTCATAAGGCACGCGCGGGCCATAACAGTCGACTAAAAGGCGTAACC
->read415_contig0_position2224_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGATGGTAGCATCCCGGCTTCTGGGGCAATTTCTGACGATTCGAGTGACCAGCGATAGTACGTTCCTTTTGTACTGAGTCTTCACATCGGCAAATGCGC
->read416_contig0_position8968_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CATATTGAGACTGGGTTGAAAACCTGTCTGAACTCCGTGCTTCCCTAACCAGCCTATGCGCCTTAACTTTATGCATACTCGTTTAGTACAGGGCTGCGCC
->read417_contig0_position3809_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCCCTTTGTTATTCTAGTCAAGTGAAGAACCTGGGCCCAAAATTGGAACCCGTAATCTTCAAGTGAATCATCCGTTCATGCAAACCTGATTATCTGCAC
->read418_contig0_position4459_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTTCTTAGTATAGTGACCGTTATGGACGACGGACATAACTACTGAGTGTCCGCCCTCGGCTAATCCTGAACGCCGGTCAGGCATGCTTACCTCCTGCGA
->read419_contig0_position2440_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TATCTACTATGTCATGCTTGTCGAATGAACAACTCAATTGGGTAGTGTGCGCGAGGTAGAGTATGCAGATTTCGTACCTTGACACTGCTACCTCCGGCAT
->read420_contig0_position1225_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGTCGACTAGTAGCGAATATATGTTCTGCTCCGAGACTTCGGCATAAATCTAAGTATGGACTCTTATATTCCCTCCTGCGTAGTGCTCTCCCATAATAA
->read421_contig0_position7369_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AACCGCGGCAGGAACACTTTCTGGTGCCACTCGAGACCGCCCTCCCCGACCCATATGCAGTTTCTGCATACACCGGGTAGACAACATTCTCAGCCCTTCG
->read422_contig0_position1066_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTGGTTACGCGTTATTACCGGTCAGCTCCAGTTACGTCACGGACGTAGAGAGCCTTTGAATGTGTACGGCAATAGGAGAAACTCGGCCACGTACGTGTC
->read423_contig0_position1127_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTGTACGGCAATAGGAGAAACTCGGCCACGTACGTGTCAACATGGCGCGGCTCTCTATACCTCGCAAAGAATCACTCTATGGGTCATCTTGAGAGAATA
->read424_contig0_position51_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCCTTTAACCTGGCAGACGGTGACCAGGGCCGTTCGGCGTTGCGTCGAGCGGTGTCGCTAGCGCAATGCGCAAGATTTTGACATTTACAAGGCAACATT
->read425_contig0_position8584_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGATTGTCTGTAACCGGAGCTTCGGGCGTATTTTTGCGTAAGACAATGCCTAAAGGGAACATATGTGTCCAGAATACGGTTCAACGGTGTATGAGCAAA
->read426_contig0_position8898_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGTACGATAAGGATGGTTGAAATAGAACGAGTTGTAAAACATTAGCTCACGCGCCACCGTCATAGGCTGCATATTGAGACAGGGTTGAAAACCTGTCTG
->read427_contig0_position3603_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGATGTATCCATCCCTACCACACGCGTCCGCCACCTCCGGGTCTAGTAAACCAGAGATTCCATGGACTCTCTGTTTCGTCGATTGTCTGAATATCGTGCA
->read428_contig0_position7219_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAATACTACCTGTCCACCTGTCCGCTAGAAGCAGATTATACGGAATACATATCCCGACACCGGCAGCTGAAATGATGCAGAAGCCTTGCTTGCCACTCCG
->read429_contig0_position3098_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAACATTATTCAGTACAGCGACTTTTACCCTCGTGGTCTGAATGTTATGCCGTCCGACTCTTGCGCTCGGATGTCCGCAATGGGTTATCAAATGCCTATG
->read430_contig0_position6271_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGCTTCCGCGCATCTCAGTGATATTCGCCGGAATTTACCCTTCTAATATTGTGTGCAAGCTACTTCTAGACCTTATTAAGTGCCCAGGAATTCCTAGGA
->read431_contig0_position868_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAATCACTAGGTAATTACTGTTGGCTCCTTTCTTCATGATCGTCGGAGTTCTTTCAGGCCGATCAAGTGGTAAGAGACCTAGGTCTATGCCAGACGATCG
->read432_contig0_position6402_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAATGCCTGTCCACCGGGGGGTCTACTGTACCACAGTGGCCTGGATAGCTAAGCAGGTCCTGGATTGGCATGTCATCCGGAGTGATAGGCACTGCTCACG
->read433_contig0_position8940_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTAGCTCACGCGCCACCGTCATAGGCTGCATATTGAGAAAGGGTTGAAAACCTGTCTGAAGTCCGTGCTTCCCTAACCAGCCTATGCGCCTTAACTTTAT
->read434_contig0_position2148_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGGCTGCGAGCATCTCATAATCGGGCCACCCGATTTCAGCTTGGCCACAACAGAGACTAGCCACCAAGAGATGGGTTGATGGTAGCATCCCGGCTTCTG
->read435_contig0_position8122_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GATCAAGCTAAAGACAGGGATTATGCACTAGCACGACCGCCGCAGGAAAGATCCGAGGCCTTTTCCAGGGTAAAATGATGGACTCATTGACCAACCCCTA
->read436_contig0_position5520_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCTGTTTAGAACCACGACCCAGAAATCTTTAGCTAAGTAATCGACTGCCTTCGTCGGGCCGCTTATTGGTTCACCCAATCTGGCCATTGCAAGTTTGGC
->read437_contig0_position2213_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAAGAGATGGGTTGATGGTAGCATCCCGGCTTCTGGGGCAATTTCTGACGATTCGAGTGACGAGCGATAGTACGTTCCTTTTGTACTGAGTCTTAACATC
->read438_contig0_position7565_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCCGTGAACGAGAACAAGCGTGTGGAGAGTGACTGACTATCACGAGGAATTACGGATAACAGCCCACTTGGAGTGTGCTGAGGGCCGACGCCCGGGGAC
->read439_contig0_position8544_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACAGCACATCTTTTCGTCCTGAGGCCATATTAATTCTACTCAGATTGTCTGTAACCGGAGCTTCGGGCGTATTTTTGCGTAAGAGACTGCCTAAAGGGAA
->read440_contig0_position8208_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGACCAACCCCTATTATTAGGAGAGGGCTGCGACTGCTTGCAGCTCCGACCGCTTTCCAATCGTTGCACATGACTTGAGGCTCGGACTCGTATCTGTCT
->read441_contig0_position9044_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTCGTTTAGTACAGGGCCGCGCCCCATGAGGCCATATGCGCCTGTCACGGGCATGCTGAAAGCGGCGGTTACATTAATCGCTTCTGTGATGACAGACCG
->read442_contig0_position1597_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGTATGTACATTCACCTTTGGACGCTTCGATAGGACATGCACCCGGTCCGTTGACTTACCAACTTGATCGCCAGTGAGTGAGCGGTGGTTTATCTGTTG
->read443_contig0_position6878_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTAGTTATAAGATGATACTTCATCTGCATGCGCGCATCTTCGTATTTTATGGTCTTAATTGAGTGTTCAGAGTTGGGGGTCACAGATGAGCGCTCCGAT
->read444_contig0_position4215_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGATATTCAGACTCTAACAAGTGGTCAGTACAGGTTCGACCATACGCGACGGCAAACAGAATCGCATGTCAACTATCCCCTTTATTAATGATCCGTGTCC
->read445_contig0_position9669_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGGGGGAATCACTTTACTTAATCGGCTGGGGTAACGGCTGGTTTTGTACTACGGTATGGGAACCCGTTTGCCGAACGTCTGGAAATCTGTCGAGTAATA
->read446_contig0_position1370_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTCAGTTTGGGCGCCGGTATGTCTGTGTAAGGTTGGGCCAATCGAGAGGACAGTTCGCAGCGCCCTTTCATCTCTATTGCTAGGTCTCTTAAGCCCAAT
->read447_contig0_position2119_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTCTATGCTACAGGTATTACGGAGTGAAACGGCTGCGAGCATCTCATAATCGGGCCACCCGATTTCAGCCTGGCCACAACAGAGACTAGCCACCAAGAG
->read448_contig0_position1217_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGAGAGAATAGGCGACTAGTAGCGAATATATGTTCTGCTCCGAGACTTCGGCATAAATCTAAGTATGGACTCTTATATTCCCTCCTGCGTAGTGCTCTCC
->read449_contig0_position5187_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCGCTGTGCACTTAAAAATTCGGAACATCTTAACCAAAGCATATTAATATGCCAGCCGCGCAGGGTGGTATATATGATCCTTGATAGCTTTATGGCCAT
->read450_contig0_position8679_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCAAACGATGCGGTAAGACGAGCGCTCCGACCCCACTTGGCTCTGCTACATCGAATTCAGCGTGTAAGAGCCCGCTTATCCGGTGGTGATACCTACTATT
->read451_contig0_position8109_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCCAATCAGCACGATCAAGCTAAAAACAGGGATTATGCACTAGCACGACCGCCGCAGGAAAGATCCGAGGCCTTTTCCAGTGTAAAATGATGGACTCAT
->read452_contig0_position6624_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CATGGAGCGATGGGTCCTCAAGGCAGTATAAAATGGACTGCTATCTAGGCGTTAAAGTAGTAGAACGAGGGTCGGGCGATTTGTTTTGGTAGTGGTTATC
->read453_contig0_position8258_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGCTTTCCAATCGTTGCACATGACTTGAGGCTCGGACTCGTATCTGTCTCCGTGTTCCTTTTGATAACTCTGCGACCTGAATGACGTTGGGCTCGTCGA
->read454_contig0_position5442_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCTTTGACTCTGGAGTGCCAGCGATAGTATCTCAGAGGCGAAAGCGCTTGTCACCTCATCTAAAATCGCGACTATAGATCTGTTTAGAACCACGACCCA
->read455_contig0_position2040_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCAGTCCCCAGTCACCGGAGACGTCCGAGCTCGAACCCGTCCGGCTAAGAGGCAGGCAGTCGCTGCATGTGTAAGCAGCGGTCTATGCTACAGGTCTTAC
->read456_contig0_position7135_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTCCAAGTGTCCATCGGAGTCCGCTTCCCGGGCTTGTCCGCGTCCCATCGGTTAATTCAATGTCCGTCGATCGGGTTGGCCAAAAATTCTACCTGTCCA
->read457_contig0_position5780_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGAATTGTGGCTATCTCAAATTGGGACCTAGTGTTGGCCAATAAACTTCATATCGCCTTCTCAGATAGACTAATAGAACCAAGTCCATATAACAGCTGA
->read458_contig0_position8364_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGTAGTAATCCGATCTCAATTCCTGCGGTACCGAGCATCTTTGAGTTTTTGTAAGTCCCACGGTTAATGGGCCACTTATATCGACATTCATGGCGCCGA
->read459_contig0_position7112_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCGTCGAGTTACCGTTGCACCACCTCCAAGTGTCCATCGGAGTCCGCTTCCCGGGCTTGTCCGCGTCCCATCGGTTAATTCAATGTCCGTCAATCGGGT
->read460_contig0_position6085_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TATTGTTCGGTGCGTTCGCTGCTCAGGCTGGTGCGACCCTTACAGCGTTATCCGTCCCGAACTGGCTTGAGCCACTCATAAGGCACGCGCGGGCTATGAC
->read461_contig0_position5958_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCATCTCGTGATTCGAGCCTAACAGCATGCCATCTTACGTTTGGACGGGTCTTGTGTTCCCTCAACACGTACGTTTACAGAGCTAACAATCCGTCGACT
->read462_contig0_position2020_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGCAGCGTGCATTGGTCTTTCAGTCCCCAGTCACCGGAGACGTCCGAGCTCGAACCCGTCCGGCTAAGAGGCAGGCAGTCGCTGCATGTGTACGCAGCG
->read463_contig0_position5075_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCCAGGAAGTCTGTAGTACAGGTGCCCAAAACCCGATGAGGCCAAGGTGTTACGTGAAGTCGCGCTGTCGCTAGTAACAGATTGGGAGGTCTCGGCCAA
->read464_contig0_position9416_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAGAGGAATCTTCATTGGTCGTGCAGACATTGTCGCTGCGTACCAAAGTAACAGGACGCCCATACCCCTTTGTCTACATAAGATCATGGATAAGAGTGT
->read465_contig0_position1863_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCAGGAGGTTAACTTTGCGGAGCTCAACCTATAACGATAATCAAATTGAGACAGACGAGTTGGAGTGTTTTGATGAGCGGTGTTATATATGTCCTGACT
->read466_contig0_position9538_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCACGGAACGCTTCTTGATCCTGAGCTCCCCCGCGATTAACCTATGTCGGGACAAACACTCGATTGAGCAGTGGTCATGTCATTATTGTACATCAGTACC
->read467_contig0_position2564_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCAGGACGATAGAGCGAAGTAGTTACGGTGATTACCCGTCGATCGATGCCCCTCCTGTCCCGAAGCCTTAAAATCTAACCCTGAATTGGCTTTAACCACC
->read468_contig0_position9132_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GATGACAGACCGAAGCCCACCTGTCCTGACATCACCGCAGGCATCGAGTCTAACTCTGATTCGAGAGACGGATGTAATTTAGTCAGGTCGGAAGCGCTGG
->read469_contig0_position1245_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TATGTTCTGCTCCGAGACTTCGGCATAAACCTAAGTATGGACTCTTATATTCCCTCCTGCGTAGTGCTCTCCCATAATAAGTGAACCCATGGGTCGCGCT
->read470_contig0_position5078_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGGAAGTCTGTAGTACAGGTGCCCATAACCCGATGAGGCCAAGGTGTTACGTGAAGTCGCGTTGTCGCTAGTAACAGATTGGGAGGTCTCGGCCAATTC
->read471_contig0_position4620_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAACGCCAATTCCGCTTAATAGCGGAGTCTGCTGGCTTGTGCATTCGTCGGCCTATTAGATACGGTACGGAATATTGGGTAACCTCCTCTTCACTGATAT
->read472_contig0_position3562_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AACTCTGCTCGGTTATACGCCCTCGGGAGAAGACCCATGTAAGATGTATACATCCCTACCACACGCGTCCGCCACCTCCGGGTCTAGTAAACCAGAGATT
->read473_contig0_position9415_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGAGAGGAATCTTCATTGGTCGTGCAGACATTGTCGCTGCGTACCAAAGTAACTGGACGCCCATACCCCTTTGTCTACAGAAGCTCATGGATAAGAGTG
->read474_contig0_position976_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGATATAATTGCAGTATCATGTATCGCTGATTGTGGGGGGCATGGGGGTTCCGCATTGGCGCAAAGGTACCGCAAAGGGCCTGTATGACCCTGGTTACG
->read475_contig0_position8430_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AATGGGCCACTTATTTCGACATTCATGGCGCCGATATACTGCTTAGGCAGTACGGCCAATGCACGACCCTATATGACCCCTAGCGAGAAGTTATAGTCTA
->read476_contig0_position5361_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTACACCATATCAACAGCTTGATCGTTCCACTTCAATCAGCAAGACGGGCGACCGTACCCGGACACCTGGCAGCGGGAACCGCTTTGACTCTGGAGTGC
->read477_contig0_position6587_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GACCTCTTGCCCATCCGAGGCTTAAGCAGCGACTCCACTTGGAGCGATGGGTCCTCAAGGCAGTATAAAATGGACTGCTATCTAGGCGTTAAAGTAGTAG
->read478_contig0_position6504_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGCTTACGGACAAACGGGGTGCCCGCGCCTGCGTCCGGTAGACGAGCGATGGATTTAGACCGTTCACTGAACCCTCTAATAGGACCTCTTGCCCATCCG
->read479_contig0_position9680_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCTTACTTAATCGGCTGGGGTAACGGCTGGTTTTGTACTACGGTATGGGAACCCGTTTGCCGAACGTCTGGAAATCTGTCGAGTCATATCGATGAACAG
->read480_contig0_position8154_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGACCGCCGCAGGAAAGATCCGAGGCCTTTTCCAGGGTAAAAGGATGGACTCATTGACCAACCCCTATTATTAGGAGAGGGCTGCGACTGCTTGCAGCT
->read481_contig0_position1967_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-AATATCGCACCACAAAATTTCAGCATAAAGCATCCGTTTGAAGGCTGCGCATCGAGCAGCGTGCATTGGTCTTTAAGTCCCCAGTCACCGGAGACGTCCG
->read482_contig0_position4099_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCTAACATCAATCTGCACCACGAATATCGTCCAAGACGTTTAGAGCCGGTGACTAATTCGGTTGTCGCACATAGTGTACGTTGAGGCGGGAACTTCCCG
->read483_contig0_position5414_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGTACCCGGACACCTGGCAGCGGGAACCGCTTTGACTCTGGAGTGCCAGCGATAGTATGTCAGAGGCGAAAGCGCTTGTCACCTCATCTAAAATCGCGA
->read484_contig0_position9466_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AACTGGACGCCCATACCCCTTTGTCTACAGAAGCTCATGGATAAGAGTGTGCGAATAACATCACTTGTTACTTCACGGAACGCTTCTTGATCCTGAGCTC
->read485_contig0_position2237_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCGGCTTCTGGGGCAATTTCTGACGATTCGAGTGACCAGCGATGGTACGTTCCTTTTGTACTGAGTCTTAACATCGGCAAATGCGCCCTAGATACCTGC
->read486_contig0_position7329_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAAGCGCCAGATCGACTTAACTCTACGTGCTGCAATGGAGAACCGCGGAAGGAACACTTTCTGGTGCCACTCGAGACCGCCCTCCCCGACCCATATGCAG
->read487_contig0_position9147_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCACCTGTCCTGACCTCACCGCAGGCATCGAGTCAAACTCTGATTCGAGAGACGGATGTAATTTAGTCAGGTCGGAACCGCTGGCAGAGCAGCTCCGAG
->read488_contig0_position4378_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTACTGAGACGAAGTCTAGCTAGCTTGACTCGGCTGATAAAGAAAACAATCTATATGGAACCGAGGGGCGGGATGATAATTGTTCTTAGTATAGTGACC
->read489_contig0_position3642_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTCTAGTAAACCAGAGATTCCATGGACTCTCTATTTCGCCGATTGTCTGAATATCGTGCAGTAAGTTTCTCTTAGGTTCCTCAACGGAAACGTCTCAGA
->read490_contig0_position8082_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCAATAATCTCGACCCTGCAGTCTGCGGCCAATCAGCACGATCAAGCTAAAGACAGGGATTATGCACTAGCACGAGCGCCGCAGGAAAGATCCGAGGCC
->read491_contig0_position4512_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCTCGGCTAATCATGAACACCGGTCAGGCATGCTTACCTCCTGCGACGGCATTGGCGATTATGGGCGTGCATAGAGTCCCGCAGTGTCGGAGCGATAGG
->read492_contig0_position7517_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGAGAGAAGCTAACAGTCATTGCGATGACGAGAACAGCCCTACTGCCCGCCGTGAACGAGAACGAGCGTGTGGAGAGTGACTGACTATCACGAGGAATT
->read493_contig0_position2374_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ACAGTATTGGGCGGTGAGCGGTACCCGACGCCTCTGCTGTCAAAGTGGGAAATCCAGTCTCGACTATATCTACTATGTCATGCTTGTCGAATCAACAACT
->read494_contig0_position7458_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCAGCCCTTCGTTGAAAGGAGAATACAAATGATGGGAACTCTGACGAGAGGGTGCTTGAAAGAGAGAAGCTAACAGTCATTGCGATGACGAGAACAGCCC
->read495_contig0_position6665_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TATCTAGGCGTTAAAGTAGTAGAACGAGGTTCGGGCGATTTGTTTTGGTAGTGGTTATCGCATTCCAAGAACGTACGGACGGACAAAATGTCGGACACCG
->read496_contig0_position3293_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAGGGCGTGCAGGGTCTCCCGCTAGCTCATGGTCACGGCCTCTCTGGGAAAGCTGAACAACGGATGGGATTAAGCTCAGCAGTCCGCCTCCAATCTCTC
->read497_contig0_position1_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTCGCGGGGAATTGTGGGGCGGACCACGCTCTGGCTAACGACCTACCGTTTCCTTTAACCTGCCAGACGGTGACCAGGGCCGTTCGACGTTGCATCGAG
->read498_contig0_position8050_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTGGAGAATATGCATTCGACCAAATGCAAATGTCAATAATCTCGACCCTGTAGTCCGCGGCCAATCAGCACGATCAAGCTAAAGACAGGGATTATGCAC
->read499_contig0_position7711_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCGAGGTAACAAGCCATGAGGACTGGAGCGGTAATGTGGTAGTGTAGTTGCCGGCCCCTGTGCTGACCTTATGTCCATATCGATACATGAAGGCCACTG
->read500_contig0_position5889_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAAAATTGAACATCAACGGAAGTACTATAGCAGGCTCACCAGCATGAAAGACATCCTCATTGTGAACCCGGCAGCTCGTGATTCGAGCCTAACAGCATGC
->read501_contig0_position5825_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTTCATATCGCCTTCTCAGATAGACTAATAGAACGAAGTCCATATAACAGCTGATTTAAGAGGAAAAATTGAACATCAACGGAAGTACTATAGCAGGCT
->read502_contig0_position2662_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCCCCCTACTGGCCACCACTGGCTCGCGAGTCTCGAGCCTCTCGACTCCAAAGGGTCTGCCCGAGACAGGTTCACCGAGTCGTTACTCCCGGGATCCAC
->read503_contig0_position4077_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AACGATTACTATAAATCAGCGAATCTAACATCAATCTGCACCACGAATATCGTCCAAGACGTTTTGAGCCGGTGACTAATTCGGTTGTCGCACATAGTGT
->read504_contig0_position6304_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTTACCCTTCTAATATTGTGTGCAAGCTACTTCTAGACCTTATTAAGTGCCCAGGAATTCCTAGGAAGGCGCGCAGTTCAAGCAATCATACATGGCGGA
->read505_contig0_position5035_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCCTTATACAGCGCCACATCCGCCAATTCGCTAGGTTGTAGCCAGGACGTCTGTAGTACAGGTGCCCATAACCCGATGAGGCCAAGGTGTTACGTGAAG
->read506_contig0_position5068_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGTTGTAGCCAGGAAGTCTGTAGTACAGGTGCCCATAACCCGATGAGGCCAAGGTGTTACGTGAAGTCGCGTTGTCGCTAGTAACAGATTGGGAGGTCT
->read507_contig0_position8974_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGACAGGGTTGAAAACCTGTCTGAAGTCCGTGCTTCCCTAACCAGCCTATGCGCCTTAACTTTATGCATACTCGTATAGTACAGGGCCGCGCCGCATGA
->read508_contig0_position6368_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAAGGCGCGCAGCTCAAGCAATCATACATGGCGGAATGCCTGTCCACCGGGGGTTCTACTGTACCACAGTGGCCTGGATAGCTAAGCAGGTCCTGGATT
->read509_contig0_position1966_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CACTATCGCACCACAAAATTTCAGCATAAAGCATCCGGTTGAAGGCTGCGCATCGAGCAGCGGGCATTGGTCTTTCAGTCCCCAGTCACCGGAGACGTCC
->read510_contig0_position4617_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGAAACGCCAATTCCGCTTAATAGCGGAATCTGCTGGCTTGTGCATTCGTCGGCCTATTAGATACGGTACGGAATATTGGGTAACCTCCTCTTCACTGA
->read511_contig0_position1197_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AATCACTCTATGGGTCATCTTGAGAGAATAGTCGACTAGCAGCGAATATATGTTCTGCTCCGAGACTTCGGCATAAATCTAAGTATGGACACTTATATTC
->read512_contig0_position8903_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGAAAAGGATGGTTGAAATAGAACGAGTTGTAAAACATTAGCTCACGCGCCACCGTCATAGGCTGCATATTGAGAAAGGGTTGAAAACCTGTCTGAAGTC
->read513_contig0_position6431_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCACAGTGGCCTGGATAGCTAAGCAGGTCCTGGATTGGCATGTCATCCGGAGTTATAGGCACTGCTCACGACCAGCTTGCGGACAAACGGGGTGCCCGC
->read514_contig0_position8407_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGTTTTTGTAAGTCCCACGGTTAATGGGCCACTTATTTCGACATTCATGGCGCCGATATCCTGCTTAGGCAGTACGGCCAATGCACGACCCTATATGAC
->read515_contig0_position8592_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGTAACCGGGGCTTCGGGCGTATTTTTGCGTAAGACACTGCCTAAAGGGAACATATGTGTCCAGAATAGGGTTCAACGGTGTATGAGCAAACGATGCGG
->read516_contig0_position1844_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGTGTGTATTTGTTCAATGGCAGGAGGTTAACTTTGCGGAGCTCAACCTATAACGATAATCAAATTGAGACAGACGAGTTGGAGTGTTTTGATGAGCGG
->read517_contig0_position3554_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AATCGTGTAACTCTGCTCGGTTATACGCCCTCGGGAGAAGACCCATGTAAGATGTATCCATCCCTACCACACGCGTCCGCCACCTCCGGGTCTAGTAAAC
->read518_contig0_position2891_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTACAATCCAGCAGTGAACGCGTTTACCTTAAGACGAAAGAGTCAGTAGAGTTGGGGTTCGTGCTTTAATGACCCGTAGCCCAATTGCGCTCCCGGACAA
->read519_contig0_position2317_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AATGCGCCCTAGATACCTGCGGCTTCACTCCACAGTGTAAGACTTGACGGGACTAAAACAGTATTGGGCGGTGAGGGGTACCCGACGCCTCTGCTGTCAA
->read520_contig0_position5331_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGATCCTCGTTGAATTGAACAATTGAGTCCAGTACACCATATCAACAGCTTGATCGTTCCACTTCAATCAGCAAGACGGGCGACCGTACCCGGACACCTG
->read521_contig0_position5927_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CCAGCATGAAAGACATCCTCATTGTGAAACCGGCATCTCGTGATGCGAGCCTAACAGCATGCCATCTAACGTTTGGACGGGTCTTGTGTTCCCTCAACAC
->read522_contig0_position369_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTATACCGAGCAGAGAGGTTGGGTCTACCTAGTAGTGTCGCGGTTATCGGACAGAGGATTATGTAAGGTTACCGAAGACCGGGTAGCGTAGTTAGTAACT
->read523_contig0_position2122_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTATGCTACAGGTATTACGGAGTGAAACGGCTGCGAGCATCTCATAATCGGGCCACCCGATTTCAGCTTGGCCACAACAGAGACTAGCCACCAAGAGATG
->read524_contig0_position4472_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGACCGTTATGGACGACGGACATAACTACTGAGTGTCCGCCCTCGGCTAATCATGAACACCGGTCATGCATGCTTACCTCCTGCGACGGCATTGGCGAT
->read525_contig0_position4518_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTAATCATGAACACCGGTCAGGCATGCTTACCTCCTGCGACGGCATTGGCGATTATGGGCGTGCATAGAGTCCCGCAGTGTCGGAGCGATAGGGAGGAC
->read526_contig0_position2811_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CACCACTCTTTGAAGGTGCCCATTGCATTGTAGCCTGAACTATTAGCAATCCTAAGCCCATAAGCCCTGCCCCACGGGGGCTACAATCCAGCAGTGAACG
->read527_contig0_position9439_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCAGACATTGTCGCTGCGTACCAAAGTAACTGGACGCCCATACCCCTTTGTCTACAGAAGCTCATGGATAAGAGTGTGCGAATAACATCACTTGTTACTT
->read528_contig0_position5139_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTGTCGCTAGTAACAGATTGGGAGGTCTCGGCCAATTCGTTGTATTGATCGCTGTGCACTTTAAAATTCGGAACATCTTAACCAAAGCATATTAATCTG
->read529_contig0_position2059_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GACGTCCGAGCTCGAACCCGTCCGGCTAAGAGGCAGGCAGTCGCTGCATGTGTACGCAGCGGTCTATGCTACAGGTATTACGGAGTGAAACAGCTGCGAG
->read530_contig0_position143_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GCAACATTGCAGGGTCCGATGGTCCGGTGGCCTCCAGATAGTGTCCAGTCGCTCTAACTGTATGGAGACCATAGGCATTTACCTTATTCTCATCGCCGCG
->read531_contig0_position6773_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTATACTAGTTAGAGCCTCGCTTGGGTCTCTACATCCGCTGATACGCGCGAGCTCTCACCCACGACTGTACCCCGGTTAAGATTTATAAACCATACATT
->read532_contig0_position1863_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCAGGAGGTTAACTTTGCGGAGCTCAACCTATAACGATAATCAACTTGAGACAGACGAGTTGGAGTGTTTTGATGAGCGGTGTTATATTTGTCCTAACT
->read533_contig0_position8467_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTGCTTAGGCAGTACGGCCAATGCACGACTCTATATGACCCCTAGCGAGAAGTTATAGTCTAATAATGAATGGTGAACAGCACATCTTTTCGTCCTGAG
->read534_contig0_position7555_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCTACTGCCCGCCGTGAACGAGAACAAGCGTGTGGAGAGTGACTGACTATCACGAGGAATTACGGATAACAGCCCACTTGGAGTGTGCTGAGGGCCGAC
->read535_contig0_position2330_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TACCTGCGGCTTCACTCCACAGTGTAAGAGTTGACGGGACTAAAACAGTATTGGGCGGTGAGGGGTACCCGACGCCTCTGCTGTCAAAGTGGGAAATCCA
->read536_contig0_position3832_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGAAGAACCCGGCCCCAAAATTGGAACCCGTAATCTTCAAGAGAATCATCCGATCATGCAAACCTGATTATCTGCACGACTCTTAAAATCATGCACTAAG
->read537_contig0_position9051_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGTACAGGGCCGCGCCCCATGAGGCCATATGCGCCTGTCACGGGCATGCTGAAAGCGGCGGTTACATTAATCGCTTCTGTGATGACAGACCGAAGCCCA
->read538_contig0_position2409_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTGTCAAAGTGGGAAATCCAGTCTCGACTATATCTACTATGTGATGCTTGTCGAAGGAACAACTCCATTAGGTAGTGTGCGCGAGGTAGAGTATGCAGA
->read539_contig0_position7344_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTGACTCTACGTGCTGCAATGGAGAACCGCGGAAGGAACACTTTCTGGTGCCACTCGAGACCGCCCTCCCCGACCCATATGCAGTTTCTTCATACACCG
->read540_contig0_position5440_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCGCTTTGACTCTGGAGTGCCAGCGATAGTATCTCAGAGGCGAAAGCGCTTGTCACCTCATCTAAAATCGCGACTATAGATCTGTTTAGAACCACGACC
->read541_contig0_position4460_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTCTTAGTATAGTGACCGTTATGGACGACGGACATAACTACTGAGTGTCCGCCCTCGGCTAATCATGAACACCGGTCAGGCATGCTTACCTCCTGCGAC
->read542_contig0_position6965_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGAGCGTTCCGATTGTCCTTTCCCATGCTACGGCCTTATACCAAAGACTTCTAGACCGGAGAGACTACTTCCAGCCACGAATTCGTGTGATAACCGCCTA
->read543_contig0_position3951_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTTACTGAAGTCGACATGACTATCAAACCTATTTAATGATATATGCTCTTGGACAACACGAGGTCGTAATTATTTCCTGAGATGGTTTTAGTGAGAGCA
->read544_contig0_position5575_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGGCCGCTTATTGGTTCACCCAATCTGGCCATTGCAAGTTTGGCAGACGCGAGGTTGCGTGGTCAACCGAACGTTGCTTTCCTTAGGGTACCGAGTATA
->read545_contig0_position224_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTTATTCTCATCGCCACGCCCCAAGATCTTTAGGACCCAGCATTCCTTTAACCACTAACATAACGCGTGTCATCTAGTTCTAGCATACTCCGCCTTGGG
->read546_contig0_position30_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCTGGCTAACGAGCTACCGTTTCCTTTAACCTGCCAGACGGTGACCAGGGCCGTTCGGCGTTGCATCGAGCGGTGTCGATAGCGCAATGCGCAAGATTT
->read547_contig0_position6691_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGGTCGGGTGATTTGTTTTGGCAGTGGTTATCGCATTGCAAGAACGTACGGACGGACAAAATGTCGGACACCGCCTTATCGGCTATACTAGTTAGAGCC
->read548_contig0_position7696_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCATAAGCGCAATGACCGAGGTAACAAGCCATGAGGACTGGAGCGCTAATGTGGTAGTGTAGTCGCCGGCGCGTGTGCTGACCTTATGTCCATATCGAT
->read549_contig0_position3346_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGAACAACGGATGGGATTAAGCTCAGCAGTCCGCCTCCAATCCCTCCGACGTTCATTCTCAAGGGTGTAGTTTTAGAGACTGAGAACTCACCCTATTGG
->read550_contig0_position5442_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCTTTGACTCTGGAGTGCCAGCGATAGTATCTCAGAGGCGAAAGCGCTTGTCACCTCATCTAAAATCGCGACTATAGATCTGTTTAGAACCACGACCCA
->read551_contig0_position7676_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCGAGTGGAATGCGAAAACGGCATAAGCGCAATGACCGAGGTAACAAGCCATGAGGACTGGAGCGGTAATGTGGTAGTGTAGTTGCCGGCCCCTGTGCT
->read552_contig0_position349_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AATGGCTTCATGCTCATGTTCTATACCGAGCAGAGAGGTTGGGTCTACCTAGTAGTGTCGCGGTTATCGGACAGAGGATTATGTAAGGTTACCGAAAACC
->read553_contig0_position9283_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGCGTGTTGTACGCTGTGTATCTTGAGAGCGTTTCTCCGTATCGAAATGTTCCGCTGTAAAGAACCTGGCGTATCCTGACCATGGAGCTGCAACACTTT
->read554_contig0_position35_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTAACGAGCTACCGCTTCCTTTAACCTGCCTGACGGTGACCAGGGCCGTTCGGCGTTGCATCGAGCGGTGTCTCTAGCGCAATGCGCAAGATTTTAACA
->read555_contig0_position6781_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTTAGAGCCTCGCTTGGGTCTCTACATCCGCTGATACGCGCGAGCTCTCACCCACGACTGTACCCCGGTTAAGATTTATAAACCATACATTTAACCCTT
->read556_contig0_position125_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AATTTTGACATTTACAAGGCAACATTGCAGCGTCCGATGGTCCGGTGGCCTCCAGATAGTGTCCAGTCGCTCTAACTGTATGGAGACCATAGGCATTTAC
->read557_contig0_position9028_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTTAACTTTATGCATACTCGTTTAGTACAGGGCCGCGCCCCATGAGGCCATATGCGCCTCTCACGGGCATGCTGAAAGCGGCGGTTACATTAATCGCTT
->read558_contig0_position1129_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTACGGCAATAGGAGAAACTCGGCCACGTACGTTTCAACATGGCGCGGCTCTCTATACCTCGCAAAGAATCACTCTATGGGTCATCTTGAGAGAATAGT
->read559_contig0_position1815_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCATAGAAGTTAGCCGGCCCACAAATCGACGTGTGTATTTGTTCAATGGCAGGAGGTTAACTTTGCGGAACTCAACCTATAACGATAATCAAATTGAGA
->read560_contig0_position3352_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AACGGATGGGATTAAGCTCAGCAGTCCACCTCCAATCTCTCCGACGTTCATTCTCAAGGGTGTAGTTTTAGAGACTGAGAACTCACCCTATTGGTAGTAC
->read561_contig0_position5509_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCAACTATAGATCTGTTTAGAACCACGACCCAGAAATCTTTAGCTAAGTAATCGACTGCCTTCGTCGGGCCGCTTATTGGTTCACCCAATCTGGCCACT
->read562_contig0_position7257_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TACGGAATACATATCCCGACACCGGCAGCTGAAATGATGCAGAAGCCTTGCTTGCCACTCCGCCGATGTCTAAAAGCGCCAGATCGACTTGACTCTACGT
->read563_contig0_position2531_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCCGGCATATGGGCGTGCTATAAATGCGGGAGTCAGGACGATAGAGCGAAGTAGTTACGGTGATTACCCGTCCACCGATGCCCCTCCTGTCCCGAAGCC
->read564_contig0_position6082_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CACTATTGTTCGGTGCGTGCGCTGCTCAGGTTGGTGCGACCCTTACAGCGTTATCCGTCCCGAACTGGCTTGAGCCACTCATAAGGCACGCGCGGGCCAT
->read565_contig0_position7188_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TAATTCAATGTCCGTCAATCGGGTTGGCCAAAAATTCTACCTGTCCACCTGTCCGCAAGAAGCAGATTGTACGGAATACATATCCCGACACCGGCAGCTG
->read566_contig0_position6564_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGTTCACTGAACCCTCTAATAGGACCTCTTGCCCATCCGAGGCTTAAGCAGCGACTCCACATGGGGCGATGGGTCCTCAAGGCAGTATAAAATGGACTG
->read567_contig0_position1292_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TATTCCCTCCTGCGTAGTGCTCTCCCATAATAAGTGAACCCATGGGTCGCGCTGTATTTTTGTACGGCTTGATGTCAGGGTCAGTTTGGGCGCCGGTATG
->read568_contig0_position3456_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCCGTCGCCTCGCGCGCATAATGTTTGGAACTCGCAAACCTTTACACTCATCACATAGCAGGTTCCACCCGAACCGCGCGTATTCCGCGACAGCATGAA
->read569_contig0_position4_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCGGGGAATTGGGGGGCGGACCACGCTCTGGCTAACGAGCTACCGTTTCCTTTAACCTGCCAGACGGTGACCAGGGCCGTTCGGCGTTGCATCGAGCGG
->read570_contig0_position3647_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTAAACCAGAGATTCCATGGACTCTCTGTTTCGTCGATTGTCTGAATATCGTGCAGTAAGTTTCTCTTAGGTTCCTCAACGGAAACGTCTCAGACCCAC
->read571_contig0_position7344_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTGACTCTACGTGCTGCAATGGAGAACAGCGGAAGGAACACTTTCTGGTGCCACTCGAGACCGCCCTCCCCGACCCATATGCAGTTTCTGCATACACCG
->read572_contig0_position8275_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CACATGACTTGAGGCTCGGACTCGTATCTGTCTCCGTGTTCCTTTCGATAACTCTGCGACCAGAATGACCTTGGGCTCGTCGACATTCCTGGTAGTAATC
->read573_contig0_position6264_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TACGGTAATGCTTCCGCGCATCTAAGTGATATTCGCCGGAATTTACGCTTCTAATATTGTGTGCAAGCTACTTCTAGACCTTATTAAGTGCCCAGGAATT
->read574_contig0_position3481_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGGAACTCGCAAACCTTTACACTCATCACATAGCAGGTTCCACGCGAACCGCGCGTATTCTGCGACAGCATGAACCGTGTAACTCTGCTCGGTTATACG
->read575_contig0_position4490_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGACATAACTACTGAGTGTCCGCCCTCGGCTAATCATGAACACCGGTCAGGCATGCTTACCTCCTGCGACGACATTGGCGATTATGGGCGTGCATAGAGT
->read576_contig0_position7547_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGAACATCCCTATTGCCCGCCGTAAACGAGAACAAGCGTGTGGAGAGTGACTGACTATCACGAGGAATTACGGATAACAGCCCACTTGGAGTGTGCTGA
->read577_contig0_position8328_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGCGACCTGAATGACCTTGGCCTCGTCGACATTCATGGTAGTAATCCGATCTCAATTCCTGCGGTACCGAGCAGCTTTGAGTTTTTGTAAGTCCCACGG
->read578_contig0_position9117_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTAATCGCTTCTGTGATGCCTGACCGAAGCCCACCTGTCCTGACCTCACCGCAGGCATCGAGTCTAACTCTGATTCGAGAGAAGGATGTAATTTAGTCA
->read579_contig0_position6871_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTAACCCTTAGTCATAAGATGATACTTCATCTGCATGCGCGCATCTTCCTATTTTATGGTCTTAATTGAGTGTTCAGAGTTGGGGGTCACAGATGAGCG
->read580_contig0_position6858_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TATAAACCATACATTTAACCCTTAGTCATAAGATGATACTTCATCTGCATGCGCGCATCTTCCTATTTTATGGTCTTAATTGAGTGTTCAGAGTTGGGGG
->read581_contig0_position9035_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTAATGCATACTCGTTTAGTACAGGGCCGCGCCCCAGGAGGCCATATGCGCCTGTCACGGGCATGCTGAAAGCGGCGGTTACATTAATCGCTTCTGTGAT
->read582_contig0_position5710_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTCAGAATATCACTGTCCGCCTCGAACCACTACAATAAGATTACGGATAGCCCGTGGCTTGGTTGTTTTCTGAATTGTTGCTATCTCAAATTGGGACCT
->read583_contig0_position9050_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTAGTACAGGGCCGCGCCCCATGAGGCCATATGCGCCTGTCACGGGCATGCTAAAAGCGGCGGTTACATTAATCGCTTCTGTGATGACAGACCGAAGCCC
->read584_contig0_position2087_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGAGGCAGGCAGTCGCTGCATGTGTACGCAGCGGTCTATGCTACAGGTATTACGGAGTGAAACGGCTGCGAGCATCTCATAATCGGGCCACCCCATTTCA
->read585_contig0_position3645_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTAGTAAACCAAAGATTCCATGGACTCTCTGTTTCATCGATTGTCTGAATATCGTGCAGTAAGTTTCTCTTAGGTTCCTCAACGGAAACGTCTCAGACCC
->read586_contig0_position2535_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCATATGGGCGTGCTATAAATGCGGGAGTCAGGACGATAGAGCGAAGTAGTTACGGTGATTACACGTCCATCGATGCCCCTCCTGTCCCGAAGCCTTAA
->read587_contig0_position3199_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCGGTAATCTCTCATCTACTAAGCGTCCTAAAGGTCGTATGGTTGGAGGGCGGTTACACACCCTTAAGTACCGAACGATAGAGCACCCGTCTAGGTGGG
->read588_contig0_position913_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGTTCTTTCAGGCCGATCAAGTGGTTAGAGACCTAGGTCTATGCCAGACGATCGCAGCGGAGTCGATATAATTGCAGTATCATGTATCGCTGATTGTGG
->read589_contig0_position6970_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTCCGATTGTCCTTTCCCAGGCTACGGCCTTATACCAAAGACTTCTAGACCGGAGAGACTACTTCCAGCCACGAATTCGTGTGATAACCGCCTAAACAG
->read590_contig0_position3765_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCGACACGGGGTACGAAGGGTAAGAACACCTAGCCTGGCAACTACCCCTTTGTTATTCTAGTCAAGTTTAGAACCCGGGCCCAAAATTGGAACCCGTAA
->read591_contig0_position6949_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTTGAGGGTAACAGATGAGCGTTCCGATTGTCCTTTCCCAGGCTACGGCCTTATACCAAAGACTTCTAGACCGGAGAGAGTACTTCCAGCCACGAATTC
->read592_contig0_position3279_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGAGCACCCGTCTAGGAGGGCGTGCAGGGTCTCCCGCTAGCTAATGGTCACGACCTCTCTGGGAAAGCTGAACAACGGATGGGATTAAGCTCAGCAGTCC
->read593_contig0_position7052_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGATAACCGCCTAAACAGTCTAATCTGGCCAATATACCCTGGGGGGAGCTAATATATCGCGGCGTCGAGTTACCGTTGCACCACCTCCAAGTTTCCATCG
->read594_contig0_position7599_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGACTATCACGAGGAATTACGGATAACAGCCCACTTGGAGTGTGCTGAGGACCGACGCCCGGGGACCTTGATATCCTTGCGAGTGGAATGCGAAAACGGC
->read595_contig0_position2087_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGAGGCAGGCAGTCGCTGCATGTGTACGCAGCGGTCTATGCTACAGGTATTACGGAGTGAAACGGCTGCGAGCATCTCATAATCGGGCCACCCGATTTTA
->read596_contig0_position2839_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTAGCCTGAACTATTAGCAATCCTTAGCCCATAAGCCCTGCCCCACGGGGGCTACAATCCAGCAGTGAACGCGTTTACGTTAAGACGAAAGAGTCAGTA
->read597_contig0_position4019_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AATTATTTCCTGAGATGGTTTTAGTGAGAGCAGCAGATGCACTCTTAGCTCCGCTGATAACGATTACTATAAATCAGCGAATCTAACATCAATCTGCACC
->read598_contig0_position1878_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGCGGAGCTGAACCTATAACGATAATCAAATTGAGACGGACGAGTTGGAGTGTTTTGATGAGCGGTGTTATATTTGTCCTAACTTAGCACTATCGCACC
->read599_contig0_position3573_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTATACGCCCTCGGGAGAAGACCCATGTAAGATGTATCCATCCCTACCACACGCGTCCGCCACCTCCGGGTCTAGTAAACCAGAGATTCGATGGACTCT
->read600_contig0_position8866_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGAGGGTTAGGAGCTAAGAAACCGGTGCATCACCGTACGAAAAGGATGGTTGAAATAGAACGAGTTGTAAAACATTAGCTCACGCGCCACCGTCATAGGC
->read601_contig0_position6282_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CATCTAAGTGATATTCGCCGGAATTTACCCTTCTAATATTGTGTGCAAGCTACTTCTAGACCTTATTAAGTGCCCAGGAATTCCTCGGAAGGCGCGCAGC
->read602_contig0_position7419_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CAATATGCAGTTTCTGCATGCACCGGGTAGACAACATTCTCAGCCCTTCGTTGAAAGGAGAATACAAATGACGGGAACTCTGACGAGAGGGTGCTTGAAC
->read603_contig0_position1907_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AATTGAGACAGACAAGTTGGAGTGTTTTGATGAGCGGTGTTATATTTGTCCTAACTTAGCACTATGGCACCACAAAATTTCAGCATAAAGCATCCGGTTG
->read604_contig0_position4091_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCAGCGAATCTAACATCAGTCTGCACCACGAATATCGTCCAAGACGTTTTGAGCCGGAGACTAATTCGGTTGTCGCACATAGTGTACGTTGAGGCGGGA
->read605_contig0_position7307_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTGCCACTCCGCCGATGTCTAAAAGCGCCAGATCGACTTCACTCTACGTGCTGCAATGGAGAACCGCGGAAGGAACACTTTCTGGTGCCACTCGAGACC
->read606_contig0_position4208_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGTGATCGATATTCAGACTCTAACAAGTGGTCAGTACAGGTTCGACCATACGCGACGGCAAACAGAATCGCACGTCAACTATCCCCTTTATTAATGATC
->read607_contig0_position4725_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TATCGGCGTTCCAAGTATTCGGCGGATGAATTAGAGCCAAAGCAGTAGGTTACCGTCGGCGCATAACCGGCGAGTGCTCTGAAACGTTACATTCGTCTAT
->read608_contig0_position4510_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCCCTCGGCTAATCATGAACACCGGTCAGGCATGCTTACCTCCTGCGACGGCATTGGCGATTATGGGCGTGCATAGAGTCCCGAAGTGTCGGAGCGATA
->read609_contig0_position3362_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTAAGCTCAGCAGTCCGCCTCCAATCTCTCCGACGTTCATTCTCAAGGGTGTAGTTTTAGAGACTGAGAACTCACCCTATTGGTAGTACTGCCTGCCGT
->read610_contig0_position6736_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CGTACGGACGGACAAAATGTCGGACACCGCCTTATCGGCTATACTAGTTAAAGCCTCGCTTGGGACTCTACATCTGCTGATACGCGCGAGCTCTCACCCA
->read611_contig0_position9379_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTTCACACAGGTAGCCGAACAGGTATTACTCAGACTGGAGAGGAATCTTCATTGGTCGTGCAGACATTGTCGCTGCGTACCAAAGTAACTGGACGCCCA
->read612_contig0_position6555_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGATTTAGACCGTTCACTGAACCCTCTAATAGGACCTCTTGCCCATCCGAGGCTTAAGCAGCGACTCCACATGGAGCGATGGGTCCTCAAGGCAGTATAA
->read613_contig0_position4621_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AACGCCAATTCCGCTTAATAGCGGAATCTGCTGGCTTGTGCATTCGTCGGCCTATTAGATACGGAACGGAATATTGGGTAACCTCCTCTTCACTGATATC
->read614_contig0_position850_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTTGTGGATGGCTTTGGGAATCACTAGGTAATTACGGTTGGCTCCTTTCTTCATGATCGTCGGAGTTCTTTCAGGCCGATCAAGTGGTTAGAGACCTAG
->read615_contig0_position453_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCGTAGTTAGTAACTTCCATCCGCGTTACGCTTTGTCCTCTGCTACGCCTCGATTGGTTTCAGCTCACGTGGGACGCATGTACTTACCTAACATGAAGC
->read616_contig0_position6356_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGGAATTCCTAGGAAGGCGCGCAGCTCAAGCAATCATACATGGCGGAATGCCTGTCCACCGGGGGTTCTACTGTACCACAGTGGCCTGGATAGCTAAGC
->read617_contig0_position6187_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGACTAAAAGGCGTAACCGATTCTGCTACGTTATAAAAAAGGGACGAGTGGGGTCAACAGTTCTTCTTCCTTCCTGTACGGTAATGCTTCCGCGCATCT
->read618_contig0_position1205_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TATGGGTCATCGTGAGAGAATAGTCGACTAGTAGCGAATATAGGTTCTGCTCCGAGACTTCGGCATAAATCTAAGTATGGACTCTTATATTCCCTCCTGC
->read619_contig0_position2582_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTAGTTACGGTGATTACCCGTCCATCGATGCCCCTCCTGTCCCGAAGCCTTAAAATCTAACCCTGAATTGGATTTATCCACCCCCCCTACTGGCCACCAC
->read620_contig0_position1414_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGAGGACATTTCGCAGCGCCCTTTCATCTCTATTGCTAGGTCTCTTAAGCCTAATCAGGATCATAGATGGCCAATTATTGACCACAGGTAGGGGCGAGG
->read621_contig0_position4788_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAACCGGCGAGTGCTCTGAAACGTTACATTCGTCTATCCGCACACACCGCCGTTGGATGTGTCCCACAGTGTTTTATACGGGACGGTGGCCACGGGGTGA
->read622_contig0_position97_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGAGCGGTGTCGCTAGCGCAATGCGCAAGATTTTGACATTTACAAGGCAACATTGCAGCGTCCGATGGTCCGGTGGCCTCCAGATAGTGTCCAGTCGCTC
->read623_contig0_position976_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGATATAATTGCAGTATCATGTATCGCTGATTGTGGGGGGCATGGGGGTTCCGCATAGGCGCAAAGGTACCGCAAAGGGCCTGTATGACCCTGGTTACG
->read624_contig0_position4833_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCGCCGTTGGATGTGTCCCACAGTGTTTTATACGGGACGGTGGCCACGGGGTGAGCACATGAATGGGGTACGGTTTTACCGTCCATGACGTTGTGACAT
->read625_contig0_position1054_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCCTGTATGACCCTGGTTACGCGTTATTACCGGTCACCTCCAGTTACGTCACGGACGTAGAGAGCCTTTGAATGTGTACGGCAATAGGAGAAACTCGGC
->read626_contig0_position8556_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCGTCCTGAGGCCATATTAATTCTACTCAGATTGTCTGTAACCGGAGCTTCGGGCGTATTTTTGCGTAAGACACTGCCTAAAGGGAACATATGTGTCCA
->read627_contig0_position4162_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTCGCACATAGTGTACGTTGAGGCGGGAACTTCCCGCTGATATGCTTGTGATCGATATTCAGACTCTAACAAGTGGTCAGTACAGGTTCGACCATACGC
->read628_contig0_position727_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GATAAATGTTATTAACCGCGACGGTGTATTCCACGACCTAATTTTTCCCGTCTCTGTGGTCAACCTGGACGCACAAACCCTAGTCCCATATAAAGCTATT
->read629_contig0_position6709_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGGTAGTGGCTATCGCATTGCAAGAACGTACGGACGGACAAAATGTCGGACACCGCCTTATCGCCTATACTAGTTAGAGCCTCGCTTGGGTCACTACAT
->read630_contig0_position7936_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AATGAAGCTTACGCAAACTACTCGACGAACAACAGCAAGATTCGACGATCAAACTCGCCGGCGACACGAAGATTGTCATACTAGCTTTCAGTCATTCCCC
->read631_contig0_position4623_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCCAATTCCGCTTAATAGCGGAATCTGCTGGCTTGTGCATTCGTCGGCCTATTAGATACGGTACGGAATATTGGGTAACCTCCTCTTCACCGATATCAT
->read632_contig0_position5548_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTAGCTAAGTAATCGACTGCCTTCGCCGGGCCGCTTATTGGTTCACCCAATCTGGCCATTGCAAGTTTGGCAGACGCCAGGTTGCGTGGTCAACCGAAC
->read633_contig0_position9080_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGCGCCTGTCACGGGCATGCTGAAAGCGGCGGTTACATTAATCGCTTCTGTGATGACAGACCGAAGCCCACCTGTCCTGACCTCACCGCAGGCATCGAG
->read634_contig0_position4150_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GACTAATTCGGTTGTCGGACATAGTGTACGTTGAGGCGGGAACTTCCCGCTGATATGATTGTGATCGGTATTCAGACTCTAACAAGTGGTCAGTACAGGT
->read635_contig0_position9630_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCAGTACCATAGCTTGGCCACATGTGATGCTCGTACTCGAAGGGGGAATCACCTTACTGAATCGGCTGGGGTAACGGCTGGTTTTGTACTACGGTATGGG
->read636_contig0_position8498_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTATATGACCCCTAGCGAGAAGTTATAGTCTAATAATGAATGGTGAACAGCACATCTTTTCGTCCTGAGGCCATATTAATTCTACTCAGATTGTCTGAAA
->read637_contig0_position7829_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCCGTTACTGACTGATTGACAATCCAGCCCGTTTGGGGTGATTTGTGCCGGCGCGTCCAGGTGCGAACGTTGTGCCGTGTCACTCTGTAGCTCTAATAC
->read638_contig0_position8166_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAAAGATCCGAGGCCTTTTCCAGGGTAAAATGATGGACTCATTGACCAATCCCTATTATTAGGAGAGGGCTGCGACTGCTTGCAGCTCCGACCGTTTTC
->read639_contig0_position5165_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTCGGCCAATTCGTTGTATTGATCGCTGTGCACTTTAAAACTCGGAACATCTTAACCAAAGCAGATTAATATGCCAGCCGCGCAGGGTGGTATATACGA
->read640_contig0_position4061_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTTAGCTCCGCTGATAACGATTACTATAAATCAGCGAACCTAACATCAATCTGCACCACGAATATCGTCCAAGACGTTTTGAGCCGGTGACTAATTCGG
->read641_contig0_position4512_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCTCGGCTAATCATGAACACCGGTCAGGCATGCTTACCTCCTGCGACGGCATTGGCGATTATGGGCGTGCATAGAGTCCCGCAGTGTCGGAGCGATAGG
->read642_contig0_position955_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCCAGACGATCGCAGCGGAGTCGCTATAATTGCAGTATCATGTATCGCTGATTGTGGGGGGCATGGGGGTTCCGCATTGGCGCAAAGGTACCGCAAAGG
->read643_contig0_position7905_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGTGTCACTCTGTAGCTCTAATACCAATTGAAATGAAGCTTACGCAAACTACTCGACGAACAACAGCAAGATTCGACGATCAAACTCGCCGGCGACACGA
->read644_contig0_position5923_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCACCAGCATGAAAGACATCCTCATTGTGAACCCGGCATCTCGTGATTCGAGCCTAACAGCATGCCATCTAACGTTTGGACGGGTCTTGTGTTGCCTCA
->read645_contig0_position3079_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGATCGAGCACTGTCCGCGAAACATTATTCAGTACAGCGACTTTTACCCTCGTGGTCTGAATGTTATGCCGTCCGACTCTTGCGCTCGGATGTCCGCAAT
->read646_contig0_position5877_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGATTTAAGAGGAAAAATTGAACATCAACGGAAGTACTATAGCAGGCTCACCAGCATGAAAGACATCCTCATTGTGAACCCGGCATCTCGTGATTCGAGC
->read647_contig0_position5831_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TATCGCCTTCTCAGATAGACTAATAGAACGAAGTCGATATAACAGCTGATTTAAGAGGAAAAATTGAACATCAACGGAAGTACTATAGCAGGCTCACCAG
->read648_contig0_position6530_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCCTGCGTCCGGTAGACGAGCGATGGATTTAGACCGTTCACTGAACCCTCTAATAGGACCTCTTGCCCATCCGAGGCTTAAGCAGCGACTCCACATGGA
->read649_contig0_position3456_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCCGTCGCCTCGCGCCCATAATGTTTGGAACTCGCAAACCTTTACACTCATCACATAGCAGGTTCCACCCGAACCGCGCGTATTCTGCGACAGCATGAA
->read650_contig0_position995_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGTATCGCTGATTGCGGGGGGCATGGGGGTTCCGCATTGGCGCAAAGGTGCCGCAAAGGGCCTGTAGGACCCTGGTTACGCGTTATTACCGGTCAGCTC
->read651_contig0_position4234_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTGGTCAGTACAGGTTCGACCATACGCGACGGCAAACAGAATCGCACGTCAACTATCCCCTTTATTAATGATCCGTGTCCCCCGACCGTGTGCTGAGGA
->read652_contig0_position8847_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTGTTAACACGCGATACAAGAGGGTTAGGAGCTAAGAAACCGGTGCATCACCGTACGAAATGGATGGTTGAAATAGAACGAGTTGTAAAACATTAGCTC
->read653_contig0_position5517_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGATCTGTTTAGAACCACGACCCAGAAATCTTTAGCTAAGTAATCGACTGCCTTCGTCGGGCCGCTTATTGGTTCACCCAATCTGCCCATTGCAAGTTT
->read654_contig0_position9097_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGCTGAAAGCGGCGGTTACATTAATCGCTTCTGGGATGACAGACCGAAGCCCACCTGTCCTGACCTCACCGCAGGCATCGAGTCTAACTCTGATTCGAG
->read655_contig0_position1541_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GACATCTTGTTCTCACAACTGCACACTCCGATGCTCTGCCGAGCCTTCTAACCATCGGGTATGTACATTCACCTTTGGACGCTTCGATAGGACATGCATC
->read656_contig0_position1730_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGGAGATCTGGAACATTAGATAGGATATAAAAGTAATACGGTTGATGTTATTACCAACTCCACTTCTGCAAATTGTTATGAGCAAGCATACAAGTTAGC
->read657_contig0_position1193_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAAGAATCACTCTATGGGTCATCTTGAGAGAATAGTCGACTAGTAGCGAATATATGTTCTGCTCCGAGACTTCGGCATAAATCTAAGTATGGACTCTTAT
->read658_contig0_position2466_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GAACAACTCAATTAGGCAGTGTGCGCGAGGTAGAGTATGCAGATTTCGTACCTTGCCACTGCTACCTACGGCATATGGGCGTGCTATAAATGCGGGAGTC
->read659_contig0_position7256_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATACGGAATACATATCCCGACACCGGCAGCTGAAATGATGCAGAAGCCTTGCTTGCCACTCCGCCGATGTCTAAAAGCGCCATATCGACTTGACTTTACG
->read660_contig0_position7453_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CATTCTCAGACCTTCGTTGAAAGGAGAATACAAATGACGGGAACTCTGACGAGAGGGTGCTTGAACGAGAGAAGCTAACAGTCATTGCGATGACGAGAAC
->read661_contig0_position95_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCGAGCGGTGTCGCTAGCGCAATGCGCAAGATTTTGACATTTACAAGGCAACATTGCAGCGTCCGATGGTCCGGTGGCCTCCAGATAGTGTCCAGTCGC
->read662_contig0_position6565_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGTTCACTGAACCCTCTAATAGGAGCTCTTGCCCATCCGAGGCTTAAGCAGCGACTCCACATGGAGCGATGGGTCCTCAAGGCAGTATAAAATCGACTGC
->read663_contig0_position701_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGTAGAATCGCGTAGAAGCACCCACGATCAATGTTATTAACCGCGACGGTGTATTCCACGACCTAATTTTTCCCGTCTCTGTGGTCAACCTAGACGCAC
->read664_contig0_position6934_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAATTGAGTGTTCAGAGTTGGGGGTCACAGATGAGCGTTCCGAGTGTCCTTTCCCAGGCTACGGCCTTATACCAAAGACTTCTAGACCGGAGAGACTACT
->read665_contig0_position4618_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTAAACGCCAATTCCGCTTAATAGCGGAATCTGCTGGCTTGTGCATTCGTCGGCCTATTAGATACGGTACGGAATATTGGGTAACCTCCTCTTCACTGAT
->read666_contig0_position7371_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGCGGAAGGAACAATTTCTGGTGCCACTCGAGACCGCCCTCCCCGACCCATATGCAGTTTCTGCATACACCGGGTAGACAACATTATCAGCCCTTCGTT
->read667_contig0_position1578_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCGAGCCTTCTAACCATCGGGTATGTACATTCACCTTTGGACGCTTCGATAGGACATGCACCCGGTCCGTTGACTTACCAACTTGATCGCCAGTGAGTG
->read668_contig0_position3431_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AACTCACCCTATTGGTAGTACTGCCTGCCGTCGCCTCGCGCCCATAATGTTTGTAACTCGCAAACCTTTACACTCATCACATAGCAGGTTCCACCCGAAC
->read669_contig0_position6955_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGTCACAGATGAGCGTTCCGATTGTCCTTTCCCAGGCTACGGCCTTATACCAAAGACTTCTAGACCGGAGAGACTACTTCCAGCCACGAATTCGTGTGA
->read670_contig0_position408_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGGTTATAGGACAGAGGATTATGTAAGGTTACCGAAGACCGGGTAGCGTAGTTAGTAACTTCAATCCGCGTTACGCTTTGTCCTCTGCTACGCCTCGAT
->read671_contig0_position5714_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGAAGATCACTGTCCGCCTCGAACCACTACAATAAGATTACGGATAGCCCGTGGCTTGGTTGTTTTCTGAATTTTGGCTATCTCAAATTGGGACCTAGTG
->read672_contig0_position9148_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCACCTGTCCTGACCTCACCGCAGGCATCGAGTCTAACTCTGCTTCGAGAGACGGATGTAATTTAGTCAGGTCGGAACCGCTGGCAGAGCAGCTCCGAGG
->read673_contig0_position9731_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCCGTTTGCCGAACGTCTGGAAATCTGTCGAGTCATAGCGATGAACAGAGACTAAATGTCCTTAAATCTCTAACACGATTTTAGTAGGTCTACTACTAG
->read674_contig0_position3405_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCAAGGGTGTAGTTTTAGAGACGGAGAACTCACCCTATTGGTAGTACTGCCTGCCGTCGCCTCGCGCCCATAATGTTTGGAACTCGCAAACCTTTACACT
->read675_contig0_position7766_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCCTGTGCTGACCTTATGTCCATATCGATACACGAAGGCCAGTGCGGAAGCGGAGCCACACTCGCCGTTACTGACTGATTGACAATCCAGCCCGTTTGG
->read676_contig0_position4649_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCTGGCTTGTGCATTCGTCGGCCTATTAGATACGGTACGGAATATTGGGTAACCTCCGCTTCACTGTTATCATCCTATCGGCGTTCAAAGTATTCGGAG
->read677_contig0_position3480_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTGGAACTCGCAAACCTTTACACACATCACATAGCAGGTTCCACCCGAACCGCGCGTATTCTGCGACAGCATGAATCGTGTAACTCTGCTCGGTTATAC
->read678_contig0_position4849_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCCACAATGTTTTATACGGGACGCTGGCCACGGGGTGAGCACATGAATGGGGTACCGTTTTACCGTCCATGACGTTGTGACATAAAGGTGCGGGACGCG
->read679_contig0_position673_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGACACCGGCCTACTACATTATACAGTAAGGTAGAATCGCGTAGAAGCACCCACGATCAATGTTATTAACCGCGACGGTGTATTCCACGACCTAATTTTT
->read680_contig0_position8051_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGGAGAATATGCATTCGACCAAATGAAAATGTCAATAATCTCGACCCTGTAGTCCGCGGCCAATCAGCACGATCAAGCTAAAGACAGGGATTATGCACT
->read681_contig0_position8160_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCGCAGGAAAGATCCGAGGCCTTTTCCAGGGTTAAATGATGGACTCATTGACCAACCCGTTTTATTAGGAGAGGGCTGCGACTGCTTGCAGCTCCGACC
->read682_contig0_position7655_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCCGGGGACCGTGATATCCTTGCGAGTGGAATGCGAAAACGGCATAAGCGCAATGACCGAGGAAACAAGCCATGAGGACTGGAGCGGTAATGTGGTAGT
->read683_contig0_position703_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTAGAATCGCGTAGAAGCACCCACGATCAATGTTATTAACCGCGACGGTGTATTCCACGACCTAATTTTTCCCGTCTCTATGGTCAACCTGGACGCACAA
->read684_contig0_position4225_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTCTAACAAGTGGTCAGTACAGGTTCGACCATACGCGACGGCAAACAGAATCGCACGTCAACCATCCCCATTATTAATGATCCGTGTCCCCCGACCGTG
->read685_contig0_position9177_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGTCTAACTCTGATTCGAGAGACGGATGTAATTTAGTCAGGTCGAAACCGCTGGCAGAGCAGCTCCGAGGGCCTTTATACCCATACTGCCACTCCAGTA
->read686_contig0_position163_M5_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTCCGGTGGCCTCCAGACAGTGTCCCGTCGCTCTAACTGTATGGAGACCATCGGCATTTACCTTATTCTCATCGCGACGCCCTAAGATCTTTAGGACCC
->read687_contig0_position4286_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTATCCCCTTTATTAATGATCCGTGTCCCCCGACCGTGTGCTGAGGAGACCCGTAATGCATGGAAAGTGCCAATATCCCCGGGAGTCCCGGACTACTGA
->read688_contig0_position5027_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AACGGTCTGGCCTTATACAGCGCCACATCCGCCAATTCGCTAGGTTGTAGCCAGGAAGTCTGTAGTACAGGTGCCCATAACCCGATGAGGCCAAGGTGTT
->read689_contig0_position4190_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AACTTCCCGCTGATATGATTGTGATCGATATTCAGACTCTAACAAGTGGTCAGTAGAGGTTCGACCATACGCGACGGCAAACAGAATCGCACGTCAACTA
->read690_contig0_position3681_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGATTGTCTGAATATCGTGCAGTAAGTTTCTCTTAGGTTCCTCAACGGAAACGTCTCAGACCCACCTTAGACGCGGGAATAAATTCGACACGGGGTACG
->read691_contig0_position4135_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGCTTTGAGCCGGTGACTAATTCGGTTGTCGCACATAGTGTACGTTGAGGCGGGAACTTCCCGCTGATATGATTGTGATCGATATTCAGACTCTAACAA
->read692_contig0_position506_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTGGTTTCGGCTCACGTGGGACGCATGTACTTACTAAACATGAAGCGGTAATGGAGCTCGAACACTAGTCGGTGGCTCTTCTGTCTCTGGCGGGGACGG
->read693_contig0_position217_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCATTTACCTTATTCTCATCGCCACGCCCCAAGATCTTTAGGACCCAGCATTCCTTTAACCACTAACATAACGCGTGTCATCTAGTTCTAGCATAATCCG
->read694_contig0_position2837_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCGTAGCCTGAACTATTAGCAGTCCTAAGCCCATAAGCCCTGCCCCACGGGGGCTACAATCCAGCAGTGAACGCGTTTACCTTAAGACGAAAGAGTCAG
->read695_contig0_position9015_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCAGCCTATGCGCCTTAACTTTATGCATACTCGTTTAGTACAGGGCCGCGCCCCATGAGGCCATACGCGCCTGTCACGGGCATGCTGAAAGCGGCGGTT
->read696_contig0_position5181_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTATTGATCGCTGTGCACTTTAAAATTCGGAACATCTTAACCAAAGCATATTAATGTGCCAGCCGCGCAGGTTGGTATATATGATCCTTGATAGCTTTAT
->read697_contig0_position500_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCTCGATTGGTTTCAGCTCACGTGGGACGCATGTACTTACCTAACATGAAGCGGTAATGGAGCTCGAACACTAGTCGGTGGCTCTTCTGTCTCTGGCGG
->read698_contig0_position6359_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAATTCCTAGGAAGGCGCGCAGCTCAAGCAATCATACATGGCGGAATGCCTGTCCACCGGGGGTTCTACTGTACCACAGTGGCCTGGATAGCTTAGCAGG
->read699_contig0_position6411_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCACCGGGGGTTCTACTGTACCACAGTGGCCTGGATAGCTAAGCAGGTCCTGGATTGGCATGTCATCCGGAGTGATAGGCACTGCTCACGACCAGCTTG
->read700_contig0_position9756_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGTCGAGTCATATCGATGAACAGAGACTAAATGTCCTTAAATCTCTAACACGATTTTGGTAGGTCGACTACTAGGCCGCTTGCTCAGAAATCGGAACAC
->read701_contig0_position2840_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTAGCCTGAACTATTAGCAATCCTAAGCCCATAAGCCCTGCCCCACAGGGGCTACAATCCAGCAGTGAACGCGTTTACCTTAAGACGAAAGAGTCAGTAG
->read702_contig0_position6314_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTAATATTGTGTGCAAGCTACTTCTAGACCGTATTAAGTGCCCAGGAATTCCTAGGAAGGCGCGCAGCTCAAGCAATCATACATGGCGGAATGCCTGTCC
->read703_contig0_position8535_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GAATGGTGAACAGCACATCTTTTCGTCCTGAGGCCATATTAATTCTACTCAGATTGTCTGTAACCCGAGCTTCTGGCGTATTTTTGCGTATGACACTGCC
->read704_contig0_position5475_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGAGGCGAAAGCGCTTGTCACCTCATCTAAAATCGCGACTCTAGATCTGTTTAGAACCACGACCCAGAAATCTTTAGCTAAGTAATCGACTGCCTTCGT
->read705_contig0_position5353_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGAGTCCAGTACACCATATCAACAGCTTGATCGTTCCACTTCAATCAGCAAGACGGGCGACCGTACCCGGACACCTGGCAGCGGGAACCGCTTTGACTC
->read706_contig0_position3022_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGCTCGGACTACCAAAGAGCACGACTCTATGACTAGCGGGTGTCGTCAATGAAAACTGATCGAGCACTGTCCGCGAAACAGTATTCAGTACAGCGACTT
->read707_contig0_position4953_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCACCTCGTATAACGTTAGGGGTATCGTCACTGCATAGCAGAATGGGCGATCGGCCTACAAGAGTACAGTATTAACGGTCTGGCCTTATACAGCGCCAC
->read708_contig0_position3217_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTAAGCGCCCTAAAGGTCGTATGGTTGGAGGGCGGTTACACACCCTTAAGTACCGAGCGATAGAGCACCCGTCTAGGAGGGCGTGCAGGGTCTCCCGCT
->read709_contig0_position1111_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTAGAGAGCCTTTGAATGTGTACGGCAATAGGAGAAACTCGGCCACGTACGTGTCAACATGGCGCGGCTCTCTATACCTCGCAAAGAATCACTCTATGGG
->read710_contig0_position7898_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTGTGCCGTGTCACTCTGTAGCTCTAATACCATTTGAAATGAAGCTTACGCAAACTACTCGACGAACAACAGCAAGATTCGACGATCAAACTCGCCGGC
->read711_contig0_position7931_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTGAAATGAAGCTTACGCAAACTACTCGACGAACAACAGCAAGATTCGACGATCAAACTCGCCGGCGACACGAAGATTGTCATACTAGCTTTCAGTCAT
->read712_contig0_position765_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAATTTTTCCCGTCTCTGTGGTCAACCTGGACGCACAAACCCTAGTCCCATATAAAGCTATTCCACGCCGGGTGGCCTGGACGTCGTTTGTGGATGGCTT
->read713_contig0_position2723_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGAGACAGGTTCACCGAGTCGTTACTCCCGGGATGCACTGCGTCTATTGTAAGAAATGCAATGCGTGGCCAGTTTGTTCCGGCAGGACACCACTCTTTG
->read714_contig0_position6014_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTCCCTCAACACGTACGTTGACAGAGCTAACAATCCGTCGACTGAATGTGATTCCTTTGTTATTTCACACTATTGTTCGGTGCGTGCGCTGCTCAGCCT
->read715_contig0_position671_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGGACACCGGCCTACTACATTATACAGTAAGGTAGAATCGCGTAGAAGCACCCACGATGAATGTTATTAACCGCGACGGTGTATTCCACGACCTAATTT
->read716_contig0_position3181_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTATCAAATGCCTATGTTCCGGTAATCTCTCATCTACTAAGCGCCCTAAAGGTCGTATGGTTGGAGGGCGGTTACACACCCTTAAGTACCGAACGATAG
->read717_contig0_position340_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGACGGGATAATGGCTTCATGCTCATGTTCTATACCGAGCAGAGAGGTTGGGTCTACCTAGTAGTGTCGCGGTTATCGGACAGAGGATTATGTAAGGTTA
->read718_contig0_position6556_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GATTTAGACCGTTCACTGAACCCTCTAATAGGACCTCTTGCCCATCCGAGGCTTAAGCAGCGACTCCACATGGAGCGATGGGTCCTCAAGGCAGTATAAA
->read719_contig0_position4298_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTAATGATCCGTGTCCCCCGACCGTGTGCTGAGGAGACCCGTAATGCATGGAAAGTGCCAATATCCCCGGGAGTCCCGCACTACTGAGACGAAGTCTAG
->read720_contig0_position5396_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AATCAGCAAGACGGGCGACCGTACCCGGACACCTGGCAGCGGGAACCGCTTTGACTCTGGAGTGCCAGCGATAGTATCTCAGAGGCGAAAGCGCTTGTCA
->read721_contig0_position4268_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAACAGAATCGCACGTCAACTATCCCCTTTATTAATGATCCGTGTCCCCCGACCGTGTGCCGAGGAGACCCGTAATGCATGGAAAGTGCCAATATCCCCG
->read722_contig0_position1386_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTATGTCTGTGTAAGGTTGGGCCAATCGAGAGGACATTTCGCAGCGCCCTTTCATCTCTATTGCTAGGTCTCTTAAGCCTAATCAGGAACATAGATGGC
->read723_contig0_position1807_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TATGAGCAAGCATACAAGTTAGCCGGCCCACAAATGGACGTGTGTATTTGTTCAAAGGCAGGAGGTTAACTTTGCGGAGCTCAACCTATAACGATAATCA
->read724_contig0_position9721_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGTATGGGAACCCGTTTGCCGAACGTCTGGAAATCTGTCGAGTCATATCGATGAACAGAGACTAAATGTCCTTAAATCTCTAACACGATTTTAGTAGGT
->read725_contig0_position3852_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGGAACCCGTAATCTTCAAGTGAATCATCCGATCATGCAAACCTGATTATCTGCACGACTCTTAAAATCATGCACTAAGCATAGAATGCACGACTACTT
->read726_contig0_position2635_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AATCTAACCCTGAATTGGCTTTATCCACCCCCCCTACTGGCCACCACTGGGGCGCGAGTCTCGAGCCTCTCGACTCCAAAAGGTCTGCCCGAGACAGGTT
->read727_contig0_position7716_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTAACAAGCCATGAGGACTGGAGCGGTAATGTGGTAGTGTAGTTGCCGCCCCCTGTGCTGACCTTATGTCCATATCGATACACGAAGGCCAGTGCGGAA
->read728_contig0_position6686_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAACGAGGGTCGGGCGATTTGTTTTGGTAGTGGTTATCGCATTGCAAGAACGTACGGACGGACAAAATGTCGGACACCGCCTTATCGGCTATACTAGTTA
->read729_contig0_position9081_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCGCCTGTCACGGGCATGCTGAAAGCGGCGGTTACATTAATCACTTCTGTGATGACAGACTGAAGCCCACCTGTCCTGTCCTCACCGCAGGCATCGAGT
->read730_contig0_position9012_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTAACCAGCCTATGCGCCTTAACTTTATGCATACTCGTTTAGTACAGGGCCGCGCCGCATGAGGCCATATGCGCCTGTCACGGGCATGCTGAAAGCGGCG
->read731_contig0_position8383_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTCCTGCGGTACCGAGCAGGTTTGAGTTTTTGTAAGTCCCACGGTTAATGGGCCACTTATTTCGACATTCATGGCGCCGACATCCTGCTTAGGCAGTAC
->read732_contig0_position3579_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCCCTCGGGAGAAGACCCATGTAAGATGTATCCATCCCTACCACACGCGTCCGCCACCTCCGGGTCTAGTAAACCAGAGATTCCATGGACTCTCTGTTT
->read733_contig0_position2283_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TACGTTCCTATTGTACTGAGTCTTAACATCGGCAAATGCGCCCTAGATACCTGCGGCTTCACTCCACAGTGTAAGAGTTGACGGGACTAAAACAGTATTG
->read734_contig0_position8916_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGAAATAGAACGAGTTGTAAAACATTAGGTCACGCGCCACCGTCATAGGCTGCATATTGAGACAGGGTTGAAAACCTGTCTGAAGTCCGTGCTTCCCTAA
->read735_contig0_position2630_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTAAAATCTAACCCTGAATTGGCTTTATCCACCCCCCCTACTGGCCACCACTGGGGCGCGAGTCTCGAGCCTCTCGACTCCAAAGGGTCTGCCCGAGAC
->read736_contig0_position7412_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCCGACCCATACGCAGTTTCTGCATACACCGGGTAGACAACATTCTCAGCCCTTCGTTGAAAGGAGAATACAAATGACGGGAACTCTGACGAGAGGGTG
->read737_contig0_position6462_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGATTGGCATGTCATCCGGAGTGATAGGCACTGCTCACGACCAGCTTGCGGACAAACGGGGTGCCCGCGCCTGCGTCCGGTAGACGAGCGATGGATTTA
->read738_contig0_position9032_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AACTTTATGCATACTCGTTTAGTACAGGGCCGCCCCCCATGAGGCCATTTGCGCCTGTCACGGGCATGCTGAAAGCGGCGGTTACATTAATCGCTTCTGT
->read739_contig0_position8610_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGTATTTTTGCGTAAGACACTGCCTAAAGGGAACATATGTGTCCAGAATAGGGTTCAACGGTGTGTGAGCAAACGATGCGGTAAGACGAGCGCTCCGAC
->read740_contig0_position3777_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TACGAAGGGTAAGAACACCTAGCCTGGCAATTAGCCCTTTGTTATTCTAGTCAAGTGAAGAACCCGGGCCCAAAATTGGAACCCGTAATCTACAAGTGAA
->read741_contig0_position7368_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGACCGCGGAAGGAACACTTTCTGGTGCCACTCGAGACCGCCCTCCCCGACCCATATGCAGTTTCTGCATACACCGGGTAGACAACATTCTCAGCCCTCC
->read742_contig0_position2581_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTAGTTCCGGTGATTACCCGTCCATCGATGCCCCACCTGTCCCGAAGCCTTAAAATCTAACCCTGAATTGGCTTTATCCACCCCCCCTACTGGCCACCA
->read743_contig0_position7914_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGTAGCTCTAATACCAATTGAAATGAAGCTTACGCAAACTACTCGACGAACAACAGCAAGATTCGACGATCAAACTCGCCGGCGACACGAAGATTGTCA
->read744_contig0_position5403_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGACGGGCGACCGTACCCGGAAACCTGGCAGCGGGAACCGCTTTGACTCTGGAGTGCCAGCGATAGTATCTCAGAGGCGAAAGCGCTTGTCACCTCATC
->read745_contig0_position3671_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCTGTTTCGTCGATTGTCTGAATATCGTGCAGTAAGTTTCTCTTAGGTTCCTCAACGGAAACGTGTCAGACCCACCTTAGACGCGGGAATAAATTCGAC
->read746_contig0_position342_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGGGATAATGGCTTCATGCTCATGTTCTATACCGAGCAGAGAGGTTGGGTCTACCTAGTAGTGTCGCGGTTATCGGACAGAGGATTATGTAAGGTTACG
->read747_contig0_position8539_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTGAACAGCACATCTTTTCGTCCTGAGGCCATATTAATTCTACTCAGATTGTCTGTAACCGGAGCTTCGGGCGTATTTTTGCGTAAGACACTGCCTAAA
->read748_contig0_position5755_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGATAGCCCGTGGCTTGGTTGTTTTCTGAATTGTGGCTATCTCAAATTGGGACCTAGTGTTGGCCAATAAGCTTCATATCGCCTTCTCACATAGACTAAT
->read749_contig0_position4184_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCGGGAACTTCCCGCTGATATGATTGTGATCGATATTCAGACTCTAACAAGTGGTCAGTACAGGTTCGACCATACGCGACGGCAAACAGAATCGCACGT
->read750_contig0_position1914_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACAGACGAGTTGGAGTGTTTTGATGAGCGGTGTTATATTTGTCCTAACTTAGCACTATCGCACCACAAAATTTCAGCATAAAGCATCCGGTTGAAGGCTG
->read751_contig0_position2894_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAATCCAGCAGTGAACGCGTTTACCCTAAGACGAAAGAGTCAGTAGAGTTGGGGTTCGTGCTTTAATGACCCGTAGCCCAATTGCGCTCCCGAACAACGC
->read752_contig0_position83_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTCGGCGTTGCATCGAGCGGTGTCGCTGGCGCAATGCGCAAGATTTTGACATTTACAAGGCAACATTGCAGCGTCCGATGGTCCGGTGGCCTCCAGATA
->read753_contig0_position4965_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AACGTTAGGGGTATCGTCACTGCATAGCAGAATGGGCGATCGGCCTACAAGAGTACAGTACTAACGGTCTGGCCTTATACAGCGCCACATCGGCCAATTC
->read754_contig0_position8471_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTAGGCAGTACGGCCAATGCACGAGCCTATATGACCCCTAGCGAGAAGTTATAGTCTAATAATGAATGGTGAACAGCCCATCTTTTCGTCCTGAGGCCA
->read755_contig0_position3346_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGAACAACGGATGGGATTAAGCTCAGCAGTCCGGCTCCAATCTCTCCGACGTTCATTCTCAAGGGTGTAGTTTTAGAGACTGAGAACTCACCCTATTGG
->read756_contig0_position1730_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGGAGATCTGGAACATTAGATAGGATATAAAAGTAATACGGTTGATGTTATTACCAACTCCACTTCTGCAAATTCTTTTGAGCAAGCATACAAGTTAGC
->read757_contig0_position8904_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GAAAAGGATGGTTGAAATAGAACGAGTTGTAAAACATTAGCTCACGCCCCACCGTCATAGGCTGCATATTGAGACAGGTTTGAAAACCTGTCTGAAGTCC
->read758_contig0_position9784_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-TAAATGTACTTAAATCTCTAACACGATTTTAGTAGGTCTACTACTAGGCCGCTTGCTTAGAAATCGGAACTCAAGTACGCGATCTCTTTTCAAGTCACCA
->read759_contig0_position7495_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTCTGACGAGAGGGTGCTTGAACGAGAGAAGCTAACAGTCATTGCGATGACGAGAACAGCCCTACTGCCCGCCGTGAACGAGAACAAGCTTGTGGAGAG
->read760_contig0_position966_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCAGCGGAGTCGATATAATTGCAGTATCATGTATCGCTGATTGTGGGGGGCATGGGGGTTCCGCATTGGCGCAAAGGTAGCCCAAAGGGCCTGTATGAC
->read761_contig0_position2167_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AATCGGGCCACCCGATTTCAGCTTGGCCACAACAGAGACTAGCCACCAAGAGATGGGTTGATGGTAGCATCCCGGCTTCTGGGGCAATTTCTGACGATTC
->read762_contig0_position1070_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTACGCGTTATTACCGGTCAGCTCCAGTTACGTCACGGACGTAGAGAGCCTTTGAATGTGTACGGCAATAGGAGAAACTCGGCCACGTACGTGTCAACA
->read763_contig0_position8547_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCACATCTTTTGGTCCTGAGGCCATATTAATTCTACTCAGATTGTCTGTAACCGGAGCTTCGGGCGTATTTTTGCGTAAGACACTGCCTAAAGGGAACAT
->read764_contig0_position6802_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTACATCCGCTGATACGCGCGAGCTCTCACCCACGACTGTACCCCGGTTAAGATTTATAAACCATACATTTAACCCTTAGTCATAAGATGATACTTCAT
->read765_contig0_position5023_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TACTAACGGTCTGGCCTTATACAGCGCCACATCCGCCAATTCGCTAGGTTGTAGCCAGGAAGTCTGTAGTACAGGTGCCCATAACCCGATGAGGCCAAGG
->read766_contig0_position7812_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAAGCGGAGCCACACTCGCCGTTACTGACTGATTGACAATCCAGCCCGTTTGGGGTGATTTGTGCCGGCGCGTCCAGGTGCGAACGTTGTGCCGTGTCA
->read767_contig0_position7409_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTCCCCGAACCATATGCAGTTTCTGCATTCACCGGGTAGACAACATTCTCAGCCCGTCGTTGCAAGGAGAATACAAATGACGGGAACTCTGACGAGAGG
->read768_contig0_position2547_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCTATAAATGCGGGAGTCAGGACGCTAGAGCGAAGTAGTGACGGTGATTACCCGTCCATCGATGCCCCTCCTGTCCCGAAGCCTTAAAATCTAACCCTG
->read769_contig0_position7666_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGATATCCTTGCGAGTGGAATGCGAAAACGGCATAAGCGCAATGACCGAGGTCACAAGCCATGAGGACTGGAGCGGTAATGTGGTAGTGTAGTTGTCGG
->read770_contig0_position725_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGATCAATGTTATTAACCGCGACGGTGTATTCCACGACCTAATTTTTCCCGGCTCTGTGGTCCACCTGGACGCACAAACCCTAGTCCCATATAAAGCTA
->read771_contig0_position6037_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGAGCTAACAATCCGTCGACTGAATGTGATTCCTTTGTTATTTCACACTATTGTTCGGTGCGTGCGCTGCTCAGGCTGGTGCGACCCTGACAGCGTTATC
->read772_contig0_position8595_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAACCGGAGCTTCGGGCGTATTTTTGCGTAAGACACTGACTAAAGGGAACATATGTGTCCAGAATAGGGTTCAACGGTGTATGAGCAAACGATGCGGTAA
->read773_contig0_position4861_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTATACGGGACGGTGGCCACGGGGTGAGCACATGAATGGGGTACGGTTTTACCGGCCATGACGTTGTGACATAAAGGTGCGGGACGCGGAAGCGCACCTC
->read774_contig0_position4589_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCCGCAGTGTCGGAGCGATAGGGAGGACGTAAACGCCAAGTCCGCTTATTAGCGGAATCTGCTGGCTTGTGCATTCGTCGGCCTATTAGATACGGTACG
->read775_contig0_position9213_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCAGTTCGGTACCGCTGGCAGAGCAGCTCCGAGGGCCTTTATACCCATACTGCCACTCCAGTACCTGGGCCGCGTGTTGTACGCTGTGTATCCTGAGAG
->read776_contig0_position221_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTACCTTATTCTCATCGCCACGCCCCAAGATCTTTAGGACCCAGCATTCCTTTAACCACTAACATAACGCGTGTCATCTAGTTCTAGCATACTCCGCCTT
->read777_contig0_position5490_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGTCACCTCATCTAAAATCGCGACTATAGATCTGTTAAGAACCACGACCCAGAAATCTTTAGCTAAGTAATCGACTGCCTTCGTCGGGCCGCTTTTTGG
->read778_contig0_position6335_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCTAGACCTTATTAAGTGCCCAGGTATTCCTAGGAAGGCGCGCAGCTCAAGCAATCATACATGGCGGAATGCCTGTCCACCGGGGGTTCTATTGTACCA
->read779_contig0_position5682_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TATGAAATTAGCGCGTTAACTACTTAAAGTTCAGAAGATCACTGTCCGCCTCGAACCACTACAATAAGATTACGGATAGCCCGTGGCTTGGTTGTTTTCT
->read780_contig0_position1132_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGGCAATAGGAGAAACTCGGCCACGTACGTGTCAACATGGCGCGGCTCTCTATACCTCGCAAAGAATCACTCTATGGGTCATCTTGAGAGAATAGTCGA
->read781_contig0_position8223_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TATTAGGAGTGGGCTGCGACTGCTTGCAGCTCCGACCGCTTTCCAATTGTTGCACATGACTTGAGGCTCGGACTCGTAACTGTCTCCGTGTTCCTTTCGA
->read782_contig0_position6269_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAATGCTTCCGCGCATCTAAGCGATATTCGCCGGAATTTACCCTTCTAATATTGTGTGCAAGCTACTTCTAGACCTTATTAAGTGCCCAGGAATTCCTAG
->read783_contig0_position5285_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCATCATAGTAAATTTTTTCAGATTACCCTGCAGACGTCCGCCTAAGATCCTAGTTGAATTGATCAATTGAGTCCAGTACACCATATCAACAGCTTGAT
->read784_contig0_position6399_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGGAATGCCTGTCCACCGGGGGTTCTACTGTACCACAGTGGCCTGGATAGCTAAGCAGGTCCTGGATTGGCATGTCATCCGGAGTGATAGGCACTGCTC
->read785_contig0_position151_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCAGCGTCCGATGGTCCGGTGGCCTCCAGATAGTGTCCAGTCGCTCTAACTGTATGGAGACCATAGGCATTTACCTTATTCTCATCGCCACGGCCCAAGA
->read786_contig0_position4717_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TATCAACCTATCGGCGTTCAAAGTTTTCGGCGGATGAATTAGAGCCAAAGCAGTAGGTTACCGTCGGCGCATAACCGGCGAGTGCTCTGAAACGTTACAT
->read787_contig0_position1348_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTTTGTACGGCTTGATGTCAGGGTCAGTTTGGGCGCCGGTATGTCTGTGTAAGGTTGCGCCAATCGAGAGGACATTTCGCAGCGCCCTTTCATCTCTAT
->read788_contig0_position9467_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTGGACGCCCATACCCCTTTGTCTACAGAAGCTCATGGATAAGAGTGTGCGAATAACATCACTTGTTACTTCACGGAAGGCTTCTTGATCCTGAGCTCC
->read789_contig0_position8400_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGCTTTGAGTTTTTGTAAGTCCCACGGTTAATGGGCCACTTATTTCGACAGTCATGGCGCCGATATCCTCCTTAGGCAGTACGGCCAATGCACGACCCT
->read790_contig0_position7013_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCTAGACCGGAGAGACTACTTCCAGCCACGAATTCGTGCGATAACCGCCTCAACAGTCTAATCTGGCCAATATACCCTGGGGGGAGCTAATATATCGCG
->read791_contig0_position4779_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCGGGGCATAACCGGCGAGTGCTCTGAAACGTTACATTCGTCTATCCGCACACACCGCCGTTGGATGTGTCCCACAGTGTTTTATACGGGACGGTGGCC
->read792_contig0_position40_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGAGCTACCGTTTCCTTTAACCTGCCAGACGGTGACCAGGGCCGTTCGGCGTTGCATCGACCGGTGTCGCTAGCGCAATGCGCAAGATTTTGACATTTAC
->read793_contig0_position5081_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAAGTCTGTAGTACAGGTGCCCATAACCCGATGAGGCCAAGGTGTTACGTGAAGTCGCGTTGTCGCTAGTAAGAGATTGGGAGGTCTCGGCCAATTCGTT
->read794_contig0_position672_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGACACCGGCCTACTACATTATACAGTAAGGTAGAATCGCGTAGAAGCACCCACGATCAATGTTATTAACCGCGACGGTGTATTCCACGACCTAATTTT
->read795_contig0_position5188_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGCTGTGCACTTTAAAATTCGGAACATCTTAACCAAAGCATATTAATATGCCAGCCGCGCAGGGTGGTATATATGATCCTTGATAGCTTTATGGCCATC
->read796_contig0_position8367_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGTAATCCGATCTCAATTCCTGCGGTACCGAGCAGCTTTGAGTTTTTGTAAGTCCCACGGTTAATGGGCCACTTATTTCGACATTCATGGCGCCGATAT
->read797_contig0_position4950_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGCGCACCTCGTATAACGTTAGGGGGATCGTCACTGCATAGCAGAATGGGCGATCGGCCTACAAGAGTACAGTACTAACGGTCTGGCCTTATACAGCGC
->read798_contig0_position9004_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGATTCCCTAACCAGCCTATGCGCCTTAACTTTATGCATACTCGTTTAGTACAGGGCCGCGCCCCATGAGGCCATATGCGCCTGTCACGGGCATGCTGA
->read799_contig0_position9141_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGAAGCCCACCTGTCCTGACCTCACCGCAGGCATCGAGTCTAACTCTGATTCGAGAGACGGATGTAATTTAGTCAGGTCGGAACCGCTGGCAGAGCAGC
->read800_contig0_position899_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTCATGCTCGTCGGAGTTCTTTCAGGCCGATCAAGTGGTTAGAGACCTAGGTCTATGCCAGACGATCGCAGCGGAGTCGATATAATTGCAGTATCATGT
->read801_contig0_position393_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTACCTAGTAGTGTCGCGGTTATCGGACAGAGGATTATGTAAGGTTACCGAAGACCGGATAGCGTAGTTAGTAACTTCAATCCGCGTTACGCTTTGTCCT
->read802_contig0_position90_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTGCATCGAGCGGTGTCGCTAGCGCAATGCGCAAGATTTTGACATTTACAAGGCAACATTGCAGCGTCCGATGGTCCGGTGGCCTCCAGATAGTGTCCA
->read803_contig0_position42_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCTACCGTTTCCTTTAACCTGCCAGACGGTGACCAGGGCCGTTCGGCGTTGCATCGAGCGGTGTCGCTAGCGCAATGCGCAAGATTTTGACATTTACAA
->read804_contig0_position6128_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCGTTATCCGTCCCGAACTGGCTTGAGCCACTCATAAGGCACGCGCGGGCCATAACAGTCGACTAAAAGGCGTAACCGATTCTGCTACGTTATAAAAAA
->read805_contig0_position1329_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ACACATGGGTCGCGCTGTATTTTTGTACGGCTTGATGTCAGGGTCAGTTTAGGCGCCGGTATGTCTGTGTAAGGTTGGGCCAATCGAGAGGACATTTCGC
->read806_contig0_position1492_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGACCACAGGTAGGGGCGAGGTATAAATTAGTGGATTCACTTCCCTTTGACATCTTGTTCTCACAAATGCACACTCCGATGCTCTGCCGGGCCTTCTAA
->read807_contig0_position4349_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAAAGTGCCAATATCCCCGGGAGTCCCGCACTACTGAGACGAAGTCTAGCTAGCTTGACTCGGCTGATAAAGAAAACAATCTATATGGAACCGAGGGGCG
->read808_contig0_position7748_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGTAGTGTAGTTGCCGGCCCCTGTGCTGACCTTATGTCCATATCGATACACGAAGGCCAGTGCGGAAGCGGAGCCACACTCGCCGTTACTGACTGATTG
->read809_contig0_position2752_M5_I0_D0_NG0______er0.01__indel0__rgeom0
-CGAGATCCGCTGCGTCTATTGTAAGAAATGCAATGCTTGGCCAGTTTGTTCCGGCAGGACACCACTATTTGAAGGTGACCATTGCATTGTAGCCTGAACT
->read810_contig0_position227_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TATTCTCATCGCCACGCCCCAAGATCTTAAGGACCCAGCATTCCTTTAACCACTAACATAACGCGTGTCATCTAGTTCTAGCATACTCCGCCTTGGGCCA
->read811_contig0_position5273_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCTTTATGGCCATCATCATAGTAAATTTTTTCAGATTACCCTGCAGACGTCCGCCTAAGATCCTAGTTGAATTGATCAATTGAGTCCAGTACACCATAT
->read812_contig0_position122_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CAAGATTTTGACATTTACAAGGCAACATTGCAGCGTCCGATGGTCCGGTGGCCTCCAGATAGTGTCCAGTCGCTCTAACTGTATGGAGACCATAGGCATT
->read813_contig0_position7079_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCAATATACCCTGGGGGGAGCTAATATATCGCGGCGTCGAGTTACCGTTGCACCACCTCCAAGTGTCCATCGGAGTCCGCTTCCCGGGCTTGTCCGCGT
->read814_contig0_position4593_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCAGTGTCGGAGCGATAGGGAGGACGTAAACGCCAATTCCGCTTAATAGCGGAATCTGCTGGCTTGTGCATTCGTCGGCCTATTAGATACGGTACGGAAT
->read815_contig0_position8778_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGACTGGGGGCTTACTGAGAACACTTCATCTGTATGGCAAAGTTGCGACACCGCGCCACACAGCAGTTTATTGTTAACACGCGATACAAGAGGGTTAGGA
->read816_contig0_position6733_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GAACGTACGGACGGACAAAATGTCGGACACCGCCTTCTCGGCTATACTAGTTAGAGCCTCGCGTGGGTCTCTATATCCGCTGATACGCGCGAGCTCTCAC
->read817_contig0_position511_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTCAGCTCACGTGGGACGCATGTACTTACCTAACATGAAGCGGTAATGGAGCTCGAACACTAGTCGGTGGCTCTTCTGTCTCTGGCGGGGACGGCTATG
->read818_contig0_position9248_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCTTTATACCCATACTGCCACTCCAGTACCTGGGCCGCGTGTTGTACGCTGTGTATCTTCAGAGCGTTTCTCCGTATCGAAATGTCCCGCTGTAAAGAA
->read819_contig0_position6505_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCTTGCGGACAAACGGGGTGCCCGCGCCTGCGTCCGGTAGACGAGCGATGGATTTAGACCGTTCAATGAACCCTCTAATAGGACCTCTTGCCCATCCGA
->read820_contig0_position7126_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTGCACCACCTCCAAGTGTCCATCGGAGTCCGTTTCCCGGGCTTGTCCGCGTCCCATCGGTTAATTCAATGTCCGTCAATCGGGTTGGCCAAAAATTCT
->read821_contig0_position4373_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCGCACTACTGAGACGAAGTCTAGCTAGCTAGACTCGGCTGATAAAGAAAACAATCTATATGGAACCGAGGGGCGGGATGATAATTGTGCTTAGTATAG
->read822_contig0_position5798_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAATTGGGACCTAGTGTTGGCCAATAAGCTTCATATCGCCTTCTCAGATAGACTAATAGAACGAAGTCCATATAACAGCTAATTTAAGAGGAAAAATTGA
->read823_contig0_position7562_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCCGCCGTGAGCGAGAACAAGCGTGTGGAGAGTGACTGACTATCACGAGGAATTACGGATAACAGCCCACTTGGAGTGTGCTGAGGGCCGACGCCCGGG
->read824_contig0_position6816_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TACGCGCGAGCTTTCACCCACGACTGTACCCCGGTTAAGATTTATAAACTATACATTTAACCCTTAGTCATAAGATGATACTTCATCTGCATGCGCGCAT
->read825_contig0_position9402_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTATTACTCAGACTGGAGAGGAATCTTCATTGGTCGTGCAGACATTGTCGCTGCGTACCAAAGTAACTGGACGCCCATACCCCTTTGTCTACAGAAGCTC
->read826_contig0_position7075_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTGGCCAATATACCCTGGGGGGAGCTAATATATCGCGGCGTCGAGTTACCGTTGCACCACCTCCAAGTGTCCATCGGAGTCCGCTTCCCGGGCTTGTCC
->read827_contig0_position4236_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGTCAGTACAGGTTCGACCATACGCGACGGCAAACAGAATCGCACGTCAACCATCCCCTTTATTAATGATCCGTGTCCCCCGACCGTGTGCTGAGGAGA
->read828_contig0_position2707_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTCCAAAGGGTCTGCCCGAGACAGGTTCACCGAGTCGTTACTCCCGGGCTCCACTGCGTCTATTGTAAGAAATGCAACGCGTGGCCGGTTTGTTCCGGC
->read829_contig0_position3003_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAATTGACTTGAAACCGCCTAGCTCGGACCACCAAAGAGCAAGACTCTATGACTAGCGGGTGTCGTAAATGAAAACTGATCGAGCACTGTCCGCGAAACA
->read830_contig0_position8843_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTTATTGTTAACACGCGATACAAGAGGGTTAAGAGCTAAGAAACCGGTGCATCACCGTACGAAAAGGATGGTTGAAATAGAACGAGTTGTAAAACATTA
->read831_contig0_position4359_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATATCCCCGGGAGTCCCGCACTACTGAGACGAAGTCTAGCTAGCTTGACTCGGCTGATAAAGAAAACAATCTATATGGAACCGAGGGGCGGGATGATAAT
->read832_contig0_position9660_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGTACTCGAAGGGGGAATCACCTTACTTAATCGGCTGGGGTAACGGCTGGTTTTGTACTACGGTATGGGAACCCGTTTGCCGAACGTCTGGAAATCTGT
->read833_contig0_position1267_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCATAAATCTAAGTATGGACTCTTATATTCCCTCCTGCGTAGTGCTCTCCCATAATAAGTGAACCCATGGGTCGCGGTGTATTTTTGTACGGCTTGATGT
->read834_contig0_position7334_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCAGATCGACTTGACTCTACGTGCTGCAATGGAGAACCGCGGAAGGAACACTTTCTGGTGCCACTCGAGACCGCCCTCCCCGACCCATATGCAGTTTCT
->read835_contig0_position8876_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGCTATAAAACAGGTGCATCACCGTACGAAGAGGATGGTTGAAATAGAACGAGTTGTAAAACATTAGCTCACGCGCCACCGTCATAGGCTGCATATTGA
->read836_contig0_position4747_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGATGAATTAGAGCCAAAGCAGTAGGTTACCGTCGGCGCATAACCGGCGAGTGCTCTGAAACGTTACATTCGTCAATCCGCACACACCGCCGTTGGATG
->read837_contig0_position834_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGTGGCCTGGACGTCGTTTGTGGATGGCTTTGGGAATCACTAGGTAATTATTGTTGGCTCCTTTCTTCATGATCGTCGGAGTTCTTTCAGGCCGATCAA
->read838_contig0_position6842_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TACCCCGGTTAAGATTTATAAACCATACATTTAACCCTTAGTCATAAGATGATACTTCATCTGCATGCGCGCATCTTCCTATTTTATGGTCTTAATTGAG
->read839_contig0_position2965_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGTAGCCCAATTGCGCTCCCGAACAACGCGTGAGTTTAAAATTGACTTGAGACCGCCTAGCTCGGACCACCAAAGAGCAAGACTCTAAGACTAGCGGGTG
->read840_contig0_position2403_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCTCTGCTGTCAAAGTGGGGAATCCAGTCTCGACTATATCTACTATGTAATGCTTGTCGAATGAACAACTCAATTAGGTAGTGTGCGCGAGGTAGAGTA
->read841_contig0_position6512_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GAACAAACGGGGTGCCCGCGCCTGCGTCCGGTAGACGAGCGATGGATTTAGACCGTTCACTGAAGCCTCTAATAGGACCTCTTGCCCATCCGAGGCTTAA
->read842_contig0_position827_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCACGCCGGGTGGCCTGGACGTCGTTTGTGGATGGCTTTGGGAATCACTAGGTAATTACTGGTGGCTCCTTTCTTCATGATCGTCGGAGTTCTTTCAGGC
->read843_contig0_position3328_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGGCCTCTCTGGGAAAGCTTAACAACGGATTGGATTAAGCTCAGCAGTCCGCCTCCAATCTCTCCGACGTTCATTCTCAAGGGTGTAGTTTTAGAGACT
->read844_contig0_position7029_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTACTTACAGCCACGAATTCGTGTGATAACCGCCTAAACAGTCTAATCTGGCCAATATACCCTGGGGGGAGCTAATATATCGCGGCGTCGAGTTACCGTT
->read845_contig0_position8290_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGGACTCGTATCTGTCTCCGTGTTCCTTTCGATAACTCTGCGACCTGAATGACCTTGGGCTCGTCGACATTCCTGGTAGTAATCCGATCTCAATTCCTG
->read846_contig0_position8061_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCATTCGACCAAATGAAAATGTCAATAATCTCGACCCTGTAGTCCGCGGCCAATCAGCACGATCAAGCTAAAGACAGGGATTATGCACTAGCACGACCG
->read847_contig0_position5598_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCTGGCCATTGCAAGTTTGGCAGACGCGAGGTTGCGTGGTCAACCGAACGTTGCTTTCCTTAGGGTACCGAGTATATTAACTTTATGAAATTAGCGCGT
->read848_contig0_position4087_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATAAATCAGCGAATCTAACATCAATCTGCACCACGAATATCGTCCAAGACGTTTTGAGCCGGTGACTAATTCGGTTGTCGCACATAGTGTACGTTGAGGC
->read849_contig0_position6785_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGAGCCTCGCTTGGGTCTCTACATCCGCTGATACGCGCGAGCTCTCACCCACGACTGTACCCCGGTCAAGATTTATAAACCATACATTTAACCCTTAGTC
->read850_contig0_position6403_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AATGCCTGTCCACCGGGGGTTCTACTGTACCACAGTGGCCTGGATAGCTAAGCAGGTCCTGTATTGGCATGTCATCCGGAGTGATAGGCACTGCTCACGA
->read851_contig0_position891_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTCCTTTCTTCATGATCGTCGGAGTTCTTCCAGGCCGATCAAGTGGTTAGAGACCTAGGTCTATGCCAGACGATCGCAGCGGAGCCGATATAATTGCAG
->read852_contig0_position6104_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCTCAGGCTGGTGCGACCCTTACAGCGTTATCCGTCCCGAACTGGCTTGAGCCACTCATAAGGCACGCGTGGGCCATAACACTCGACTAAAAGGCGTAA
->read853_contig0_position6312_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCTAATATTGTGTGCAAGCTACTTCTAGACCTTGTTAGGTGCCCAGGAATTCCTAGGAAGGCGCGCAGCTCAAGCAATCAAACATGGCGGAATGCCTGT
->read854_contig0_position334_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AATATAAGACGGGATAATGGCTTCATGCTCCTGTTGTATACCGAGCAGAGAGGTTGGGTCTACCTAGTAGTGTCGCGGTTATCGGACAGAGGATTATGTA
->read855_contig0_position8429_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAATGGGCCACTTATTTCGATATTCATGGCGCCGATATCCTGCTTAGGCAGTACGGCCAATGCACGACCCTATATGACCCCTAGCGAGAAGTTATAGTCT
->read856_contig0_position6960_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACAGATGAGCGTTCCGATTGTCCTTTCCCAGGCTACGGCCTTATACCAAAGACTTCTAGGCCGGAGAGACTACTTCCAGCCACGAATTCGTGTGATAACC
->read857_contig0_position7306_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTTGCCACTCCGCCGATGTCTAAAAGCGCCAGATCGACTTGACTCTACGTGCTGCAATGGAGAACCGCGGAAGGAACACTTTCTGGTGCCACTCGAGAC
->read858_contig0_position1196_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAATCACTCTATGGGTCATCTTGAGAGAATAGTCGACTAGTAGCGAATATATGTTCTGCTCCGAGACTTCGGCATAAATTTAAGTATGGACTCTTATATT
->read859_contig0_position6372_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCGCGCAGCTCAAGCAATCATACATGGCGGAATGCCTGTCCACCGGGGGTTCTACTGTACCACAGTGGCCTGGATAGCTAAGCAGGTCCTGGATTCGCA
->read860_contig0_position2304_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTAACATCGGCAAATGCGCCCTAGATACCTGCGGCTTCACTCCACAGTGTAAGAGTTGACGGGACTAAAACAGTATTGGGCGGTGAGGGGTACCCGACG
->read861_contig0_position9303_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCTTGAGAGCGTTTCTCCGTATCGAAATGTTCCGCTGTAAAGAACCTGGCGTATCCTGACCATGGAGTTGCAACACTTTCACACAGGTAGCCGCGCAGG
->read862_contig0_position3552_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGAATCGTGTAACTCTGCTCGGTTATACGCCCTCGGGAGAAGACCCATGTAAGATGTATCCATCCCTACCACACGCGTCCGCCACCTCCGGGTCTAGTAA
->read863_contig0_position704_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGAATCGCGTAGAAGCACCCACGATCAATGTTATTAACCGCGACGGTGTATTCCACGACCTAATTTTTCCCGTCTCTGTGGTCAACCTGGACGCACAAA
->read864_contig0_position5864_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCATATAACAGCTGATTTAAGAGGAAAAATTGAACATCAACGGAAGTACTATAGCAGGCTCACCAGCATGAAAGACATCCTCATTGTGAACCCGGCATC
->read865_contig0_position7574_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGAGAACAAGCGTGTGGAGAGTGACTGACTAACACGAGGAATTACAGATAACAGCCCACTTGGAGTGTGCTGAGGGCCGACGCCCGGGGACCGTGATATC
->read866_contig0_position6328_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGCTACTTCTAGACCTTATTAAGTGCCCAGGAATTCCTAGGAAGGCGCGCAGCTCAAGCAATCATACATGGCGGAATGCCTGTCCACCGGGGGTTCTAC
->read867_contig0_position7145_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCATCGGAGTCCGCTTCCCGGGCTTGTCCGCGTCCCATCGGTTAATTCAATGTCCGTCCATCGGGTTGGCCAAAAATTCTACCTATCCACCTGTCCGCT
->read868_contig0_position5536_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GACCCAGAAATCTTTAGCTAAGTAATCGACTGCCTTCGTCGGGCCGCTTATTGGTTCACCCAATATGGCCATTGGAAGTTTGGCAGACGCGAGGTTGCGT
->read869_contig0_position3452_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCCTGCCGTCGCCTCGCGCCCATATTGTTTGGAACTCGCAAACCTTTACACTCATCACATAGCAGGTTCCACCCGAACCGCGCGTATTCTGCGACAGCA
->read870_contig0_position3140_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTTATGCCGTCCGACTCTTGCGCTCGGATGTCCGCAATGGGTTATCAAATCCCTATGTTCCGGTAATCTCTCATCTACTAAGCGCCCTAAAGGTCGTAT
->read871_contig0_position3450_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTGCCTGCCGTCGCCTCGCGCCCATAATGTTTGGAACTCGCAAACCTTTACACTCATCACATAGCAGGTTCCACCCGAACCGCGCGTATTCTGCGAAAG
->read872_contig0_position2672_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGCCACCACTGGGGCGCGAGTCTCGAGCCTCTCGACTCCAAAGGGTCTGCCCGAGACAGGTTCACCGAGTCGTTACTCCCGGGATCCACTGCGTCTATT
->read873_contig0_position1662_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGATCGCCAGTGAGTGAGCGGTGGTTTATCTGTTGAGTGGCCACTTTTCCCTATCTGCTGGGACGGCACAGGAGATCTGGAACATTAGATAGGATATAAA
->read874_contig0_position2509_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTCGTACCTTGCCACTGCTACCTCCGGCATATGGGCGTGCTATAAATGCGGGAGTCAGGACGATAGAGCGAAGTAGTTACGGTAATTACCCGTCCATCG
->read875_contig0_position8209_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGACCAACCCCTATTATTAGGAGAGGGCTGCGACTGCTTGCAGCTCCGACCGCTTTCCAATGGTTGCACATGACTTGAGGCTCGCACTCGTATCTGTCTC
->read876_contig0_position4098_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AATCTAACATCAATCTGCACCACGAATATCGTCCAAGACGTTTGGAGCCGGTGACTAATTCGGTTGTCGCACATAGTGTACGTTGAGGCGGGAACTTCCC
->read877_contig0_position7490_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGGAACTCTGACGAGAGGGTGCTTGAACGATAGAAGCTAACAGTCATTGCGATGACGAGAACAGCCCTACTGCCCGCCGTGAACGAGAACAAGCGTGTG
->read878_contig0_position3288_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCTAGGAGGGCGTGCAGGGTCTCCCGCTAGCTAATGGTCACGGCCTCTCTGGGAAAGCTGAACAACGGATGGGATTAAGCTCAGCAGTCCGCCGCCAAT
->read879_contig0_position6824_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCTCTCACCCACGACTGTACCCTGGTTAAGATTTATAAACCATACATTTAACCCTTAGTCATAAGATGATACTTCATCTGCATGCGCGCATTTTCCTAT
->read880_contig0_position1368_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGGTCAGTTTGGGCGCCGGTATGTCTGTGTAAGGTTGGGCCAATCGAGAGGACATTTCGCAGCGCCCTATCATCTCTATTGCTAGGTCTCTTAAGCCTA
->read881_contig0_position23_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GACCACGCTCTGGCTAACGAGCTACCGTTTCCTTTAACGTGCCAGACGGTGACCAGGGCCGTTCGGCGTTGCATCGAGCGGTGTCGCTAGCGCAATGCGC
->read882_contig0_position1367_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGGGTCAGTTTGGGCGCCGGTATGTCTGTGTAAGGTTGGGCCAATCGAGAGGACAATTCGCAGCGCCCTTTCATCTCTATTGCTAGGTCTCTTAAGCCT
->read883_contig0_position1948_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATATTTGTCCTAACTTAGCACTATCGCACCACAAAATTTCAGCATAAAGCATCCGGTTGAAGGCTGCGCATCGAGCTGCGTGCATTGGTCTTTCAGTCCC
->read884_contig0_position2284_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGTTCCTTTTGTACTGAGTCTTAACATCGGCAAATGCGCCCTAGATACCTGCGGCTTCACTCCACAGTGTAAGAGTTGACGGGACTAAAACAGTACTGG
->read885_contig0_position7329_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAAGCGCCAGATCGACTTGACTCTACGTGCTGCAATGGAGAACCGCGGAAGGAACACTTTCTGGTGCCACTCGAGACCGCCCTCCCCGACCCATATGCAG
->read886_contig0_position1640_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGGTCCGTTGACTTACCAACTTGATCGCCAGTGAGTGACCGGTGGTTTATCTGTAGAGTCGCCACTTTTCCCTATCTGCTGGGACGGCACTGGAGATCT
->read887_contig0_position4621_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCGCCAATTCCGCTTAATAGCGGAATCTGCTGGCTTGTGCATTCGTCGGCCTATTAGATACGGTACGGAATATTGGGTAACCTCCTCTTCACTGATATC
->read888_contig0_position8379_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCAATTCCTGCGGTACCGAGCAGCTTTGAGTTTTTGTAAGTCCCACGGTTAGTGGGCCACTTATTTCGACATTCATGGCGCCGATATCCTGCTTAGGCA
->read889_contig0_position7193_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAATGTCCGTCAATCGGGTTGGCCAAAAATTCTACCTGTCGACCTGTCCGCTAGAAGCAGATTATACGGAATACATATCCCGACACCGGCAGCTGAAATG
->read890_contig0_position5384_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGTTCCACTTCAATCAGCAAGACGGGCGACCGTACCCGGACACCTGGCAGCGGGAACCGCTTTGACTCTGGAGTGCCAGCGATAGTATCTCAGAGGCGA
->read891_contig0_position6136_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGTCCCGAACTGGCTTGAGCCACTCATAAGGCACGCGCGGGCCATAACAGTCGACTAAAAGGCGTAACCGATTCTGCTACGTTATAAAAAAGGGACGAG
->read892_contig0_position7239_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCGCTAGAAGCAGATTATACGGAATACATATCCCGACACCGGCAGCTGTAATGATGCAGAAGCCTTGCTTGCCACACCGCCGATGTCTAAAAGCGCCAG
->read893_contig0_position6031_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTGACAGAGCTAACAATCCGTCGACTGAATGTGATTCCTTTGTTATTTCACACTATTGTTCGGTGCGAGCGCTGCTCAGGCTGGTGCGACCCTTACAGC
->read894_contig0_position797_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCACAAACCCTAGTCCCATATAAAGCTATTCCACGCCGGGTGGCCTGGACGTCGTTTGTGGATGGCTTTGGGAATCACTAGGTAATTACTGTTGGCTCCT
->read895_contig0_position9591_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAACACTCGATTGAGCAGTGGTCATGTCATTATTGTACATCAGTACCATAGCTTGGCCACATGTGATGCTCGTACTCGAAGGGGGAATCACCTTACTTAA
->read896_contig0_position8832_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCACACAGCAGTTTATTGTTAACACGCGATACATGAGGGTTAGGAGCGAAGAAACCGGTGCATCACCGTACGAAAAGGATGGTTGAAATAGAACGAGTT
->read897_contig0_position5279_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGGCCATCATCATAGTAAATTTTTTCATATTACCCTGCAGACGTCCGCCTAAGATCCTAGTTGAATTGATCAATTGAGTCCAGGACACCATATCAACTG
->read898_contig0_position1813_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CAAGCATACAAGTTAGCCGGCCCACAAATCGACGTGTGTATTTGTTCAATGGCAGGAGGTTAACTTTGCGGAGCTCAACCTATAACGATAATCAAATTGA
->read899_contig0_position8600_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAGCTTCGGGCGTATTTTTGCGTAAGACACTGCCTAAAGGGAACATATGTGTCCAGAATAGGGTTCAACGGTGTATGAGCAAACGATGCGGTAAGACGA
->read900_contig0_position8910_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GATGGTTGAAATAGAACGAGTTGTAAAACATTAGCTCACGCGCCACCGTCATAGGCTGCATATTGAGAGAGGGTTGAAAACCTGTCTGAAGTCCGTGCTT
->read901_contig0_position6038_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGCTAACAATCCGTCGACTCAATGTGATTCCTTTGTTATTTCACACTATTGTTCGGTGCGTGCGCTGCTCAGGCTTGTGCGACCCTTACAGCGTTATCC
->read902_contig0_position9363_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCATGGAGCTGCAACACTTTCACACAGGTAGCCGAACAGGTATTACTCAGACTGGAGAGGAATCTTCATTGGTCGTGCAGACATGGTCGCTGCGTACCAA
->read903_contig0_position8695_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GACGAGCGCTCCGACCCCCCTTGGCTCTGCTACATCGAATTCAGCGTGTAAGAGCCCGCTTATCCGGTGGTGATACCTATTATTGACTGGGGGCTTACTG
->read904_contig0_position4620_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAACGCCAATTCCGCTTAATAGCGGAATCTGCTGGCTTGTGCATTCGTCGGCCTATTAGATACGGTACGGAATATTGGGTAACCTCCTCTTCACTGATAT
->read905_contig0_position7212_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGCCAAAAATTCTACCTGTCCACCTGTCCGCTAGAAGCAGATTATACGGAATACATATCCCGACACCGGCAGCTGAAATGATGCAGAAGCTTTGCTTGC
->read906_contig0_position7796_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACACGAAGGCCAGTGCAGAAGCGGAGCCACACTCGCCGTTACTGACTGATTGACAATCCAGCCCGTTTGGGGTGATTTGTGCCGGCGCGTCCAGGTGCGA
->read907_contig0_position8997_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAAGTCCGTGCTTCCCTAACCAGCCTATGCGCCTTCACTTTATGCATACTCGTTTAGTACAGGGCCGCGCCCCATGAGGCCATATGCGCCTGTCACGGGC
->read908_contig0_position1775_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGTTATTACCAACTCCACTTCTGCAAATTGTTATGAGCAAGCATACAAGTTAGCCGGCCCACAAATCGACGTGTGTATTTGTTCAATGGCAGGAGGTTA
->read909_contig0_position1160_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGTGTCAACATGGCGCGGCTCTCTATACCTCGCAAAGAATCACTCTATGGGTCATCTTGAGAGAATAGTCGACTAGTAGCGAATATATGTTCTGCTCCGA
->read910_contig0_position4295_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTATTAATGATCCGTGTCCCCCGACCGTGTGCTGAGGAGACCCGTAATGCATGGAAAGTGCCAATATCCCCGGGAGTCCCGCACTACTGAGACGAAGTC
->read911_contig0_position3797_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCCTGGCAATTACCCCTTTGTTATTCTAGTCAAGTGAAGAACCCGGGCCCAAAATTGGAACCCGTAATCTTCAAGTGAATCATCCGATCATGCAAACCT
->read912_contig0_position1544_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCTTGTTCTCACAACTGCACACTCCGATGCTCTGCCGAGCCTTCTAACCATCGGGTATGTACATTCACCTTTGGACGCTTCGATAGGACATGCACCCGG
->read913_contig0_position8533_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGGATGGTGAACAGCACATCTTTTCGTCCTGAGGCCATATTAATTCTACTCAGATTGTCTGTGACCGGAGCTTCGGGCGTATTTTTGCGTAAGACACTG
->read914_contig0_position5885_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGGAAAAATTGAACATCAACGCAAGTAATATAGCAGGCTCACCAGCATGAAAGACATCCTCATTGTGAACCCGGCATCTCGTGATTCGAGCCTAACAGC
->read915_contig0_position5644_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GAACGTTGCTTTCCTTAGGGTACCGGGTATATTAACTTTATGAAATTAGTGCGTTAACTACTTAAAGTTCAGAAGATCACTGTCCGCCTCGAACCACTAC
->read916_contig0_position7411_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCCCGACCCATATGCAGTTTCTGCATACACCGGGTAGACAACATTCTCAGCCCTTCGTTGAAAGGAGAATACAAATGACGGGAACTCTGACGAGAGGGT
->read917_contig0_position9664_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTCGAAGGGGGAATTACCTTACTTAATCGGCTGGGGTAACGGCTGGTTTTGTACTACGGTATGGGAACCCGTTTGCCGAACGTCTGGAAATCTGTCGAG
->read918_contig0_position4951_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCGCACCTCGTATAACGTTAGGGGTATCGTCACTGCAGAGCAGAATGGGCGATCGGCCTACAAGAGTACAGTACTAACGGGCTGGCCTTATACAGCGCC
->read919_contig0_position1005_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GATTGTGGGGGTCATGGGGGTTCCGCATTGGCGCAAAGGTACCGCAAAGGGCCTGTATGACCCTGGTTACGCGTTATTACCGGTCAGCTCCAGTTACGTC
->read920_contig0_position9699_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTAACGGCTGGTTTTGTACTACGGTATGGGAACCCGTTTGCCAAACGTCTGGAAATCTGTCGAGTCATATCGATGAACAGAGACTAAATGTCCTTAAAT
->read921_contig0_position5485_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCGCTTGTCACCTCATCTAAAATCGCGACTATAGATCTGTTTAGAACCACGACCCAGAAATCTTTAGCTAAGTAATCGACTGCCTTCGTCGGGCCGCTT
->read922_contig0_position4459_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTTCTTAGTATAGTGACCGTTATGGACGACGGACTTAACTTCTGAGTGTCCGCCCTCGGCTAATCATGAACACCGGTCAGGCATGCTTACCTCCTGCGA
->read923_contig0_position5524_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTTAGAACCACGACCCAGAAATCTTTAGCTAAGTAATCGACTGCCTTCGTCGGGCCGCTTATTGGTTCACCCAATCTGGCCAATGCAAGTTGGGCAGAC
->read924_contig0_position5238_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCAGCCGCGCAGGGTGGTATATATGATCCTTGATAGCTTTATGGCCATGATCATAGTAAATGTTTTCAGATTACCCTGCAGACGTCCGCCTAAGATCCT
->read925_contig0_position4044_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGAGCAGCAGATGCACTCTTAGCTCCGCTGATAACGATTACTCTAAATCAGCGAATCTAACATCAATCTGCACCACGAATATCGTCCAAGACGTTTTGA
->read926_contig0_position1736_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCTGGAACATTAGATAGGATATAAAAGTAATACGGTTGATGTTATTACCAACTCCACTTCTGCAAATTGTTATGAGCAAGCATACAAGTTAGCCGGCCC
->read927_contig0_position6273_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTTCCGCGCATCTAAGTGATATTCGCCGGAATTTACCCTTCTAATATTGCGTGCAAGCAACTTCTAGACCTTATTAAGTGCCCAGGAATTCCTAGGAAG
->read928_contig0_position5491_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTCACCTCATCTAAAATCGCGACTATAGATCTGTTTAGAACCACGACCCAGAAATCTTTAGCTAAGTAATCGACTGCCTTCGTCGGGCCGCTTATTGGT
->read929_contig0_position1161_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGTCAACATGGCGCGGCTCTCTATACCTCGCAAAGAATCACTCTATGGGTCATCTTGAGAGAATAGTCGACTAGTAGCGAATATATGTTCTGCTCCGAG
->read930_contig0_position5621_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GACGCGAGGTTGCGTGGTCAACCGAACGTTGCTTTCCTTAGGGTACCGAGTATATTGACTTTATGAAATTAGCGCGTTAACTACTTAAAGTTCAGAAGAT
->read931_contig0_position3097_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAACCATTATTCAGTACAGCGACTTTTACCCTCGTGGTCTGAATGTTATGCCGTCCGACTCTTGCGCTCGGATGTCCGCAATGGGTTATCAAATGCCTAT
->read932_contig0_position187_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCAGTCACTCTAACTGTATGGAGACCATAGGCATTTACCTTATTCTCATCGCCACGCCCCAAGATCTTTAGGACCCAGCATTCCTTTAACCACTAACATA
->read933_contig0_position9060_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCGCGCCCCATGAGTCGATATGCGCCTGTCACGGGCATGCTGAAAGCGGGGGTTACATTAATCGCTTCTGTGATGACAGACCGAAGCCCACCTGTCCTG
->read934_contig0_position3402_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCTCAAGGGTGTACTTTTAGAGACTGAGAATTCACCCTATTGGTAGTACTGCCTGCCGTCGCCTCGCGCCCATAATGTTTGGAACTCGCAAACCTTTAC
->read935_contig0_position8869_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGTTAGGAGCTAAGAAACCGGTGCATCACCGTACGAAAAGGATGGTTGAAATAGAACGAGTTGTAAAACATTAGCTCACGCGCCACCGTCATAGGCTGC
->read936_contig0_position3823_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTAGTCAAGTGAAGAACCCGGGCCCAAAATTGGAACCCGTAATCTTCAAGTGAATCATCCGATCGTGCAAACCTGATTATCTGCACGACTCTTAAAATCA
->read937_contig0_position145_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AACATTGCAGCGTCCGATGGTCCGGTGGCCTCCAGATAGTGTCCAGTCGCTCTAACTGTATGGAGACCATAGGCATTTACCTTATTCTCATCGCCACGCC
->read938_contig0_position8095_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCCTGTAGTCCGCGGCCAATCAGCACGATCAAGCTAAAGACAGGGATTATGCACTAGCACGACCGCCGCAGGAAAGATCCGAGGCCTTTTCCAGGGTAA
->read939_contig0_position5296_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAATTTTTTCAGATTACCCTGCAGACGTCCGCCTAAGATCCTAGTTGAATTGATCAATTGAGTCCAGTACACCATATCAACAGCTTGATCGTTCCACTTC
->read940_contig0_position5749_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GATTACGGATAGCCAGTGGCTTGGTTGTTTTCTGAATTGTGGCTATCTCAAATTGGGACCTAGTGTTGGCCAATAAGCTTCATATCGCCTTCTCAGATAG
->read941_contig0_position8810_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TATGGCAAAGTTGCGACACCGCGCCACACAGCAGTTTATTGTTAACACGCGATACAAGAGGGTGAGGAGCTAAGAAACCGGTGCATCACCGTACGAAAAG
->read942_contig0_position1232_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTAGTAGCGAATATATGTTCTGCTCCGAGACTTCGGCATAAATCTAAGGATGGACTCTTATAATCCCTCCTGCGTAGTGCTCTCCCATAATAAGTGAACC
->read943_contig0_position8249_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGCTCCGACCGCTTTCCAATCGTTGCACATGACTTGAGGCTCGGACTCGTATCTGTGTCCGTGTTCCTTTCGATAACTCTGCGACCTGAATGACCTTGG
->read944_contig0_position235_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGCCACGCCCCAAGATCTTTAGGACCCAGCATTCCTTTAACCACTAACATAACGCGTGTCATCTAGTTCTAGCATACTCGGCCTTGGGCCACACAATTA
->read945_contig0_position9169_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGGCATCGAGTCTAACTCTGATTCGAGAGACGGATGTAATTTAGTCAGGTCGGAACCGCTGGCAGAGCAGCTCCGAGGGCCTTTATACGCATACTGCCA
->read946_contig0_position5386_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTCCACTTCAATTAGCAAGACGGGCGCCCGTACCCGGACACCTGGCAGCGGGAACCGCTTTGACTCTGGAGTGCCAGCGATAGTATCTCAGAGGCGAAA
->read947_contig0_position4532_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGGTCAGGCATGCTTACCTCCTGCGACGGTATTGGCGATTATGGGCGTGCATAGAGTCCCGCAGTGTCGGAGCGATAGGGAGGACGTAAACGCCAATTC
->read948_contig0_position5412_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GACCGTACCTGGACACCTGGCAGCGGGAACCGCTTTGACTCTGGAGTGCCAGCGATAGTATCTCAGAGGCGAAAGCGCTTGTCACCTCATCTAAAATCGC
->read949_contig0_position991_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TATCATGTATCGCTGATTGTGGGGGGCATGGGGGTTCCGCATTGGCGCAAAGGTACCGCAAAGGGCCTGTATGACCCTGGTTACGCGTTATTACCGGTCA
->read950_contig0_position3825_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTCAAGTGAAGACCCCGGGCCCAAAATTGGAGCCCGTAATCTTCAAGTGAATCATCCGATCATGCAAACCTGATTATCTGCACGACTCTTAAAATCATG
->read951_contig0_position7348_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTCTACGTGCTGCAATGGAGAACCGCGGAAGGAACACTTTCTGGTGCCACTCGAGACCGCCCTCCCCGACCCATATGCAGTTTCTGCATACACCGGGTA
->read952_contig0_position9011_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTAACCAGCCTATGCGCCTTAACTTTATGCATACTCGTTTAGTACAGGGCCGCGCCCCATGAGGCCATATGCGCCTGTCACGGGCATGCTGAAAGCGGC
->read953_contig0_position4961_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTATAACGTTAGGGGTATCGTCACTGCATAGCAGAATGGGCGATCGGCCTACAAGAGTACAGTACTAACGGTCTGGCCTAATACAGCGCCACATCCGCCA
->read954_contig0_position1780_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTACCAACTCCACTTCTGCAAATTGTTATGAGCAAGCATACAAGTTAGCCGGCCCACAAATCGACGTGTGTATTTGTTCAATGGCAGGAGGTTAACTTT
->read955_contig0_position5643_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGAACGATGCTTTCCTTAGGGTACCGAGTATATTAACTTTATGAGATTAGCGCGTTAACTACTTAAAGTTCAGAAGATCACTGTCCGCCTCGAACCACTA
->read956_contig0_position3667_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GACTCTCTGTTTCGTCGATTGTCTGAATATCGTGCAGTAAGTTTCTCTTAGGTTCCTCAACGGGAACGTCTCAGACCCACCTTAGACGCGGGAATAAATT
->read957_contig0_position6440_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCTGGATAGCTAAGAAGGTCCTGGATTGGCATGTCATCCGGAGTGATAGGCACTGCTCACGACCAGCTTGCGGACAAACGGGTTGCCCGCGCCTGCGTC
->read958_contig0_position8368_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTAATCCGATCTCAGTTCCTGCGGTACCGAGCAGCTTTGAGTTTTTGTAAGTCCCACGGTTAATGGGCCACTTATTTCGACATTCATGGCGCCGATATC
->read959_contig0_position8271_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTGCACATGACTTGAGGCTCGGACTGGTATCTGTCTCCGTGTTCCTTTCGATAACTCTGCGACCTGAATGACCTTGGGCTCGTCGACATTCCTGGTAGT
->read960_contig0_position7667_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGATATCCTTGCGAGTGGAATGCGAAAACGGCATAAGCGCAATGACCGAGGTAACAAGCCATGAGGACTGGAGCGGTAATGTGGTAGTGTAGTTGCCGGT
->read961_contig0_position9187_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGATTCGAGAGACGGATGTAATTTAGTCAGGTCGGAACCGCTGGCAGAGCAGCTCCGAGGGCCTTTATACCCATACTGCCACTCCAGTACCTGGGCCGC
->read962_contig0_position3275_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGATAGAGCACCCGTCTAGGAGGGCGTGCAGGGTCTCCCGCTAGCTAATGGTCACGGCCTCTCTGGGAAAGCTGAACCACGGATGGGATTAAGCTCAGCA
->read963_contig0_position5632_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGTGGTCAACCGAACGTTCCTTTCATTAGGGTACCGAGTATATTAACTTTATGAAATTAGCGCGTTAACTACTTAAAGTTCAGAAGATCACTGTCCGCC
->read964_contig0_position1230_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GACTAGTAGCGAATATATGTTCTGCTCCGAGACTTCGGCATAAATCTAAGTATGGACTCTTATATTCCCTTCTGCGTAGTGCTCTCCCATAATAAGTGAA
->read965_contig0_position6674_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTAAAGTAGTAGAACGAGGGTCGGGCGATTTGTTTTGGTAGTGGTTATCGCATTGCAAGAACGTACGGACGGACAAAATGTCGGACACCGCCTGATCGG
->read966_contig0_position9773_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CGAACAGAGACAAAATGTCGTTAAATCTCTAACACGATTTTAGTAGGTCTACTACTAGGCCGCTTGCTCAGAAATCGGAACACAAGTACGCGATCTCTTT
->read967_contig0_position3663_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CATGGACTCTCTGTTTCGTCGATTGTCTGAATATCGTGCAGTAAGTTTCTCTTAGGTTCCTCCACGGAAACGTCTCAGACCCACCTTAGACCCGGGAATA
->read968_contig0_position2176_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCCGATTTCAGCTTGGCCACAACAGAGACTAGCCACCAAGAGATGGGTTGATGGTAGCATCCCGGCTTCTGGGGCAATTACTGACGATTCGAGTGACTA
->read969_contig0_position8529_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AATAATGAATGGTGAACAGCACATCTTTTCGTCCTGAGGCCATATTAATTCTACTCAGATTGTCTGTAACCGGAGCTTCGGGCGTATTTTTGCGTAAGAC
->read970_contig0_position4085_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CTATAAATCTGCGAATCTAACATCAATCTGCACCACGAATATCGTCCAACACGTTTTGAGCCGGTTACTAATTCGGTTGTCGCACATAGTGTACGTTGAG
->read971_contig0_position8593_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTAACCGGAGCTTCGGGCGTATTTTTGCGTAAGACACTGCCTAAAGGGAACATATGTGTCCAGAATAGGGTTCAACGGTGTATGAGCAAACGATGCGGT
->read972_contig0_position7391_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTTCCACTCGAGACCGCCCTCCCCGACCCATATGCAGTTTCTGCATACACCGGGTAGACAACATTCTCAGCCCTTCGTTGAAAGGAGAATACAAATGAC
->read973_contig0_position8679_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GCAAACGATGCGGTCAGACGAGCGCTCCGACCCCCCTTGGCTCTGCTACATCGAATTCAGCGCGTAAGAGCCCGCTTATCCGGTGGTGATACCTATTATT
->read974_contig0_position4833_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCGCCGTTGGATGTGTCCCACAGTGTTTTATACCGGACGGTGGCCACGGGGTGAGCACATGAATGGGGTACGGTTTTACCGTCCATGACGTTGTGACAT
->read975_contig0_position7172_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCGCGTCCCATCGGTTAATTCAATGTCCGTCAATCGGGTTGGCCAAAAATTCTACCTGTCCACCTGGCCGCTAGAAGCAGATTATACGGAATACATATC
->read976_contig0_position2369_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTAAAACAGTATTGGGCGGTGAGGGGTACCCGACGCCTCTGCTGTCAAAATGGGAAATCCAGTCTCGACTATATCTACTATGTCATGCTTGTCGAATGAA
->read977_contig0_position7885_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCAGGTGCGAACGTTGTGCCGTGTCACTCTGTAGCTCTAATACCAATTGAAATGAAGCTTACGCAAACTACTCGACGAACAACAGCAAGATTCGACGAT
->read978_contig0_position4290_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCCCTTTATTAATGATCCGTGTCCCCCGACCGTGTGCTGAGGAGACCCGTAATGCATGGAAAGTCCCAATATCCCCGGGAGTCCCGCACTACTGAGACG
->read979_contig0_position8336_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGAATGACCTTGGGCTCGTCGACATTCCTGGTAGTAATCCGATCTCAATTCCTGCGGTACCGAGCAGCTTTGAGTTTTTGTAAGTCCCACGGTTAATGGG
->read980_contig0_position1844_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGTGTGTATTTGTTCAATGGCAGGAGGTTAACTTTGCGGAGCTCAACCTATAACGATAATCAAATTGAGACAGACGAGTTGGAGTGTTTTGATGAGCGG
->read981_contig0_position5537_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCCAGAAATCTTTAGCTAAGTAATCGACTGCCTTCGTCGGGCCGCTTATTGGTTCACCCAATCTGGCCATTGCAAGTTTGGCAGACGCGAGGTTGCGTG
->read982_contig0_position3115_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGACTTTTACCCTCGTGGTCTGAATGTTATGCCGACCGACTCTTGCGCTCGGATGTCCCCAATGGGTTATCAAATGCCTATGTTCCGGTAATCTCTCAT
->read983_contig0_position4010_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGAGGTCGTAATTATTTCCTGAGATGGTTTTAGTGAGAGCAGCAGATGCACTCATAGCTCCGCTGATAACGATTACTATAAATCAGCGAATCTAACATCA
->read984_contig0_position7564_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGCCGTGAACGAGAACAAGCGTGTGGAGAGTGACTGACTATCACGAGGAATTACGGATAACAGCCCACTTGGAGTGTGCTGAGGGCCGACGCCCGGGGA
->read985_contig0_position4101_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTAACATCAATCTGCACCACGAATATCGTCCAAGAAGTTTTGAGCCGGTGACTAATTCGGTTGTCGCACATAGTGTACGTTGAGGCGGGAACTTCCCGCT
->read986_contig0_position8814_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCAAAGTTGCGACACCGCGCCACACAGCAGTTTATTGTTAACACGCGATACAAGAGGGTTAGGAGCTAAGAAACCGGTGCATCACCGTACGAAAAGGATG
->read987_contig0_position2196_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GAACAGTGACTAGCCACCAAGAGATGGGTTGATGGTAGCATCCCGGCTTCTGGGGCAATTTTTGACGATTCGAGTGACCAGCGATAGTACGTTCCTTTTG
->read988_contig0_position2998_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTCAAAATTGACTTGAAACCGCCTAGCTCGGACCACCAAAGAGCAAGACTCTATGACTAGCGGGTGTCGTCAATGAAAACTTATCGAGCACTGTCCGCG
->read989_contig0_position7065_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AACAGTCTAATCTGGCCAATATACCCTGGGGGGAGCTAATATATCGCGGCGTCGAGTTACCGTTGCACCACCTCCAAGTGTCCATCGGAGTCCGCTTCCC
->read990_contig0_position2319_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCGCCCTCGATACCTGCGGCTTCACGCCACAGTGTAAGAGTTGACGGGACTAAAACAGTATTGGGCGGTGAGGGGTACCCGACGCCTCTGCTGTCAAAG
->read991_contig0_position1759_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAAAGTAATACGGTTGATGTTATTACCAACTCCACTTCTGCAAATTGTTATGAGCAAGCATACAAGTTAGCCGGCCCACAAATCGACGTGTGTATTTGTT
->read992_contig0_position3306_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTCTCCCGCTAGCTAATGGTCACGGCCTCTCTGGGAAAGCTGAACAACGGATGGGATTAAGCTCAGCAGTCCGCCTCCAATCTCTCCGACGTTCATTCT
->read993_contig0_position8616_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTTGCGTAAGACACTGCCTAAAGGGAACATATGTTTCCAGAATAGGGTTCAACGGTGTATGAGCAAACGATGCGGTAAGACGAGCGCTCCGACCCCCCT
->read994_contig0_position9496_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGCTCATGGATAAGAGTGTGCGAATAACATCACTTGTTATTTCACGGAACGCTTCTTGATCCTGAGCTCCCCCGCGATTAACCTATGTCGGGACAAACA
->read995_contig0_position9119_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAATCGCTTCTGTGATGACAGACCGAAGCCCACCTGTCCTGACCTCACCGCAGGCATCGAGTCTAACTCTGATTCGAGCGACGGATGTAATTTAGTCAGG
->read996_contig0_position1606_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CATTCACCTTTGGACGCTTCGATAGGACATGCACTCGGTCCGTTGACTTACCAACTTGATCGCCAGTGAGTGAGCGGTGGTTGATCTGTTGAGTGGCCAC
->read997_contig0_position9446_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGTCGCTGCGTACCAAAGTAACTGGACGCCCATACCCCTTTGCCTACAGAAGCACATGGATAAGAGTGTGCGAATAACATCACTTGTTACTTCACGGAA
->read998_contig0_position9275_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TACCTGGGCCGCGTGTTGTACGCTGTGTATCTTGAGAGCGTTTCTCCGTATCGAAATGTTCCGCTGTAAAGAACCTGGCGTATTCTGACCATGGAGCTGC
->read999_contig0_position786_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCAACCTGGACGCACAAACCCTAGTCCCATATAAAGCTATTCCACGCCGGGTGGCCTGGACGTCGTTTGTGGACGGCTTTGGGAATCACTAGGTAATTAC
->read1000_contig0_position1732_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAGATCTGGAACATTAGATAGGATATAAAAGTAATACGGTTGATGTTATTACCAACTCCACTTCTGCGAATTGTTATGAGCAAGCATACAAGTTAGCCG
->read1001_contig0_position877_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTAATTACTGTTGGCTCCTTTCTTCATGATCGTCGGAGCTCTTTCAGGCCGATCAAGTGGTTAGAGACCTAGGTCTATGCCAGACGATCGCAGCGGAGT
->read1002_contig0_position3928_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TAAGCATAGAATGCACGCCTACTTGTTACTGAAGTCGGCATGACTATCAAACCTATTTAATGATATATGCTCTTGGACAACACGAGGGCGTAATTATGTC
->read1003_contig0_position746_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GACGGTGTATTCCACGACCTAATTTTTCCCGTCTCTGTGGTCAACCTGGACGCACAAACCCTAGTCCCATATAAAGCTATTCCACGCCGGGTGGCCTGGA
->read1004_contig0_position1066_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTGGTTACGGCTTATTACCGGTCAGCTCCAGTTACGTCACGGACGTAGAGAGCCTTTGAATGTGTACGGCAATAGGAGAAACCCGGCCACGTAGGTGTC
->read1005_contig0_position26_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CACGCTCTGGCTAACGAGCTACCGTTTCCTTTAACCTGCCAGACGGTGACCAGGGCCGTTCGGCGTTGCATCGAGCGGGGTCGCTAGCGCAATGCGCAAG
->read1006_contig0_position7893_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGAACGTTGTGCCGTGTCACTCTGTAGCTCTAATACCAATTGAAATGGAGCTTACGCAAACTACTCGACGAACAACAGCAAGATTCGACGATCAAACTCC
->read1007_contig0_position2926_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GCAAGAGTCAGTAGAGTTGGGGTTCGTGCATTAATGACCCGTAGCCCAATTGCGCTCCCGAACAACGCGTGAGTTTAAAATTGACTTGAAACCGCCTAGC
->read1008_contig0_position4949_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAAGCGCACCTCGTATAACGTTAGGGGTATCGTCACTGCATAGCAGAATGGGCGATCGGCCTACAAGAGTACAGTACTAACGGTCTGGCCTTATACAGCG
->read1009_contig0_position3439_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTATTGGTAGTACTGCCTGCCGTCGCCTCGCGCCCATAATGTTTGGAACTCGCAAACCTTTACACTCATCACATAGCAGGTTCCACCCGAACCGCGCGTA
->read1010_contig0_position4560_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCATTGGCGATTATGGGCGTGCATAGAGTCCCGCAGTGTCGGAGCGATAGGGAGGACGTAAACGCCAATTCCGCTTAATAGCGGAATCTGCTGGCTTGT
->read1011_contig0_position443_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGACCGGGTAGCGTAGTTAGTAACTTCAATCCGCGCTACGCTTTGTCCTCTGCTACGCCTCGATTGGTTTCAGCTCACGTGGGACGCATGTACTTACCT
->read1012_contig0_position2960_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGACCCGTAGCCCAATTGCGCTCCCGAACTACGCGTGAGTTTAAAATTGACTTGAAACCGCGTAGCTCGGACCACCAAAGAGCAAGACTCTATGACTAGC
->read1013_contig0_position4967_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGTTAGGGGTATCGTCACTGCATAGCAGAATGGGCGATCGGCCTACAAGAGTACAGTACTAACGGTCTGGCCTTATACAGCGCCACATCCGCCAATTCGC
->read1014_contig0_position2336_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGCTTCACTCCACAGTGTAAGAGTTGACGGGACTAAAACAGTATTGGGCGGTGAGGGGTACCCGACGCCTCTGCTGTCAAAGTGGGAAATCCAGTCTCG
->read1015_contig0_position2676_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CACCACTGGGGCGCGAGTCTCGAGCCTCTCGACTCCAAAGGGTCTGCCCGAGACAGGTTCACCGAGTCGTTACTCCCGGGATCCACTGCGTCTATTGTAA
->read1016_contig0_position6228_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGACGAGTGGGGTCAACAGTTCTTCTTCTTTCCTGTACGGTAATGCTTCCGCGCATCTAAGTGATATTCGCCGGAATTTACCCTTCTAATATTGTGTGC
->read1017_contig0_position7098_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCTAATATATCGCGGCGTCGAGTTACCGTTGCAACACCTCCAAGTGTCCATCGGAGTCCGCTTCCCGGGCTTGTCCGCGTCCCATCGGTTAATTCAATG
->read1018_contig0_position6400_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGAATGCCTGTCCACCGGGGGTTCTACTGTACCACAGTGGCCTGGATAGCTAAGCAGGTCCTGGATTGGCCTGTCATCCGGAGTGATAGGCACTGCTCA
->read1019_contig0_position5752_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TACGGATAGCCTGTGGCTTGGTTGTTTTCTGAATTGTGGCCATCTCAAATTGGGACCTAGTGTTGGCCAATAAGCTTCATATCGCCTTCTCAGATAGACT
->read1020_contig0_position4953_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCACCTCGTATAACGTTAGGGGTATCGTCACTGCATAGCAGAATGGGCGATCGGCCTACAAGAGTACAGTACTAACGGTCTGGCCTTATACAGCGCCAC
->read1021_contig0_position417_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGACAGAGGATTATGTAAGGTTACCGAAGACCGGGTAGCGGAGTTAGTAACTTCAATCCGCGTTACGCTTTGTCCTCTGATACGCCTCGATTGGTTTCAG
->read1022_contig0_position8303_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTCTCCGTGTTCCTTTCGATAACTCTGCGACCTGAGTGACCTTGGGCTCGTCGACATTCCTGGTAGTAATCCGATCTCAATTCCTGCGGTACCGAGCAG
->read1023_contig0_position109_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTAGCGCAATGCGCAAGATTTTGACATTTACAAGGCAACATTGCAGCGTCCGATGGTCCGGTGGCCTCCAGATAGTGTCCAGTCGCTCTAACTGTATGGA
->read1024_contig0_position9306_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGAGAGCGTTTCTCCGTATCGAAATGTTCCGCTGTAAAGAACCTGGCGTATCCTGACCATGGAGCTGCAACACTTTCACACAGGTAGCCGAACAGGTAT
->read1025_contig0_position6758_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GACACCGCCTTATCGGCTATACTAGTTAGAGCCTCGCTTGGGTCTCTACATCCGCTGATACGCGCGAGCTCTCACCCACGACTGTACCCCGGTTAAGATT
->read1026_contig0_position3701_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGTAAGTTTCTCGTAGGTACCTCAACGGAAACGTCTCAGACCCACCTTAGACGCGGGAATAAATTCGACACGGGGTACGAAGGGTAAGAACACCTAGCC
->read1027_contig0_position6203_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCGATTCTGCTACGTTATAAAAAAGGGACGAGTGGGGTCCACAGTTCTTCTTCTTTCCTGTACGGTAATGCTTCCGCGCATCTAAGTGATATTCGCCGG
->read1028_contig0_position8867_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGGGTTAGGAGCTAAGAAACCGGTGCATCACCGTACGAAAAGGATGGTTGAAATAGAACGAGTTGTAAAACATTAGCTCACGCGCCACCGTCATAGGCT
->read1029_contig0_position8902_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGAAAAGGATAGTTGAAATAGAACGAGTTGTAAAACATTAGCTCACGCGCCACCGTCATAGGCTGCATATTGAGACAGGGTTGAAAACCTGTCTGAAGT
->read1030_contig0_position9378_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTTTCACACAGGTAGCCGAACAGGTATTACTCAGACTGGAGAGGAATCTTCATTGGTCGTGCAGACATTGTCGCTGCGTACCAAAGTAACTGGACGCCC
->read1031_contig0_position5001_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGATCGGCCTACAAGAGTACAGTACTAACGGTCTGGCCTTATACAGCGCCACATCCGCCAATTCGCTAGGTTGTAGCCAGGAAGTCTGTAGTACAGGTGC
->read1032_contig0_position2495_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTAGAGTATGCCGATTTCGTACCTTGCCACTGCTAACTCCGGCATATGGGCGTGCTATAAATGCGGGAGTCAGGACGATAGAGCGAAGTAGTTACGGTGA
->read1033_contig0_position5121_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTGTTACGTGAAGTCGCGTTGTCGCTAGTAACAGATTGGGAGGTCTCGGCCAATTCGTTGTATTGATCGCTGTGCACTTTAAAATTCGGAACATCTTAA
->read1034_contig0_position459_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTAGTAACTTCAATCCGCGTTACGCTTTGTACTTTGCTACGCCTCGATTGGTTTCAGCTCACGTGGGACGCATGTACTTACCTAACATGAAGCGGTAAT
->read1035_contig0_position261_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCAGCATTCCTTTAACCACTAACATAACGCGTGTCATCTAGTTCTAGCATACTCCGCCTTGGGCCACACAATTAATATAAGACGGGATAATGGCTTCATG
->read1036_contig0_position2668_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTACTGGCCACCACTGGGGCGCGAGTCTCGAGCCTCTCGACTCCAAAGGGTCTGCCCGAGACAGGTTCACCGAGTCGTTACTCCCGGGATCCACTGCGTC
->read1037_contig0_position9334_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCGTTGTAAAGAACCTGGCGTATCCTGACCATGGAGCTGCAACACTTTCACACAGGTAGCCGAACAGGTATTACTCAGACTGGAGAGGAATCTTCATTG
->read1038_contig0_position9632_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTACCATAGCTTGGCCACATGTGATGCTCGTACTCGAAGGGGGAATCACCTTACTTAATCGGCTGGGGTAACAGCTGGTTTTGTACTACGGTATGGGAA
->read1039_contig0_position4944_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGCGGAAGCGCACCTCGTATAACGTTAGGGGTATCGTCACTGCATAGCAGAATGGGCGATCGGCCTACAAGAGTACAGTACTAACGGTCTGGCCTTATA
->read1040_contig0_position1292_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TATTCCCTCCTGCGTAGTGCTCTCCCATAATAAGTGAACCCATGGGTCGCGCTGTATTTTTGTACGGCTTGATGTCAGGGTCAGTTTGGGCGCCGGTATG
->read1041_contig0_position6645_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCAGTATAAAATGGACTGCTATCTAGGCGTTAAAGTAGTAGAACGAGGGTCGGGCGATTTGTTTTGGTATTGGTTATCGCATTGCAAGAACGTACGGAC
->read1042_contig0_position6506_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTTGCGGACAAACGGGGTGCCCGCGCCTGCGTCCGGTAGACGAGCGATGGATTTAGACCGTTCACTGAACCCTCTAATAGGACCTCTTGCCCATCCGAG
->read1043_contig0_position9788_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTCCTTTAATCTCTAACACGATTTTAATAGGTCTACTACTAGGCCGCTTGCTCAGAAATCGGAACACAAGTACGCGATCTCTTTTCTAGTCACCAGCAT
->read1044_contig0_position9411_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-AGACTGGAGAGGAATCTTCATTGGTCGTGCAGACAGTGTCGCTGCGTACCAAAGTAACTGGACGCCCATACCCCTTGGTCTAAAGAAGCTCATGGATAAG
->read1045_contig0_position3113_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGCGACTTTTACCCTCGTGGTCTGGATGTTATGCCGTCCGACTCTTGCGCTCGGATGTCCGCAATGGGTTATCAAATGCCTATGTTCCGGTAATCTCTC
->read1046_contig0_position191_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGCTCTAACTGTATGGAGACCATAGGCATTTACCTTATTCTCATCGCCACGCCCCAAGATCTTTAGGACCCAGCATTCCTTTAACCACTAACATAACGC
->read1047_contig0_position5487_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCTTGTCACCTCATCTAAAATCGCGACTATAGATCTGTTTAGAACCACGACCCAGAAATCTTTAGCTAAGAAATCGACTGCCTTCGTAGGGCCGCTTAT
->read1048_contig0_position6352_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCACAGGAATTCCTAGGAAGGCGCGCAGCTCAAGCAATCATACATGGCGGAATGCCTGTCCACCGGGGGTTCTACTGTACCACAGTGGCCTGGATAGCT
->read1049_contig0_position6479_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGAGTGATAGGCACTGCTCACGACCAGCTTGCGGACAAACGGGGTGCCCGCGCCTGCGTCCGGTAGACGAGCGATGGATTTAGACCGTTCACTGAACCC
->read1050_contig0_position1500_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGTAGGGGCGAGGTATAAATTAGTGGATTCACTTCCCTTTGACATCTTGTTCTCACAACTGCACACTCCGATGCTCTGCCGAGCCTTCTAACCATCGGG
->read1051_contig0_position5675_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTAACTTTATGAAATTAGCCCGTTAACTACTTAAAGTTCAGAAGATCACTGTCCGCCTCGAACCACTACAATAAGATTACGGATAGCCCGTGGCTTGGTT
->read1052_contig0_position9721_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGTATGGGAACCCGTTTGCCGAACGTCTGGAAATCTGTCGAGTCACATCGATGAACAGAGACTAAATGTCCTTAAATCTCTAACACCATTTTAGTAGGT
->read1053_contig0_position6644_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGCAGTATAAAATGGACTGCTATCTAGGCGTTAAAGTAGTAGAACGAGGGTCGGGCGATTTGTTTTGGTAGTGGTTATCGCATTGCAAGAACGTACGGA
->read1054_contig0_position9395_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGAACAGGTATTACTCAGACTGGAGAGGAATCTTCATTGGTCGTGCAGACATTGTCGCTGCGTACCAAAGTAACTGGACGCCCATACCCCTTTGTCTACA
->read1055_contig0_position1636_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCACCCGGTCCGTTGACTTACCAACTTGATCGCCAGTGAGTGAGCGGTGGTTTATCTGTTGAGTGGCCACTTTTCCCTATCTGCTGGGACGGCACTGGAG
->read1056_contig0_position2697_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGCCTCGCGACTCCAAAGGGCCTGCCCGAGACAGGTTCACCGAGTCGTTACTCCCGGGATCCACGGCGTCTATTGTAAGAAATGCATTGCGTGGCCAGT
->read1057_contig0_position4827_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCACACACCGCCGTTGGATGTGTCCCACAGTGTTTTATACGGGACGTTGGCCACGGGGTGAGCACATGAATGGGGTACGGTTTTACCGTCCATGACGTTG
->read1058_contig0_position4040_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGTGAGAGCAGCAGATGCACTCTTAGCTCCGCTGATAACGATTACTATAAATCAGCGAATCTAACATCAATCTGCACCACGAATATCGTCCAAGACGTT
->read1059_contig0_position3698_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGCAGTAAGTTTCTCTTAGGTTCCTCAACGGAAACGTCTCAGACCCACCTTAGACGCGGGAATAAATTCGACACGGGGTACGAAGGGTAAGAACATCTA
->read1060_contig0_position7379_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAACACTTTCTGGTGCCACTCGAGACCGCCCTCCCCGACCCATATGCAGTTTCTGCATACACCGGGTAGACAACGTTCTCAGCCCTTCGTTGAAAGAAG
->read1061_contig0_position8752_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTTATCCGGTGGTGATACCTACTATTGACTGGGGGCTTACTGAGAACACTTCATCTGTATGGCAAAGTTGCGACACCGCGCCACACAGCAGTTTATTGT
->read1062_contig0_position5444_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTTGACTCTGGAGTGCCAGCGATAGTATCTCAGAGGCGAAAGCGCTTGTCACCTCATCTAAAATCGCGACTATAGATCTGTTTAGAACCACGACCCAGA
->read1063_contig0_position3989_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GATATATGCTCTTCGACAACACGAGGTCGTAATTATTTCCTGAGATGGTTTTAGTGAGAGCAGCAGATGCACTCTTAGCTCCGCTGATAACGATTACTAT
->read1064_contig0_position5617_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCAGACGCGAGGTTGCGTGGTCAACCGAACGTTGCTTTCCTTAGGGTACCGAGTATATTAACTTTATGAAATTAGCGCGTTAACTACTTAAAGTTCAGA
->read1065_contig0_position9527_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CACTTGTTACTTCACGGAACGCTTCTTGATCCTGAGCTCCCCAGCGATTAACCTATGTCGGGACAAACACTCGTTTGAGCAGTGGTCATGTCATTATTGT
->read1066_contig0_position5403_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGACGGGCGACCGTACCCGGACACCTGGCAGCGGGAACCGCTTTGACTCTGGAGTGCCAGCGATAGTATCTCAGAGGCGAAAGCGCTTGTCACCTCATC
->read1067_contig0_position3820_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTCTAGTCAAGTGAAGAACCCGGGCCCAAAATTGGAACCCGGATTCTTCAAGTGAATCATCCGATCATGCAAACCTCATTATCTGCACGACTCTTAAAA
->read1068_contig0_position6243_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AACAGTTCTTCTTCTTTCCTGTACGGTAATGCTTCCGCGCATCTAAGTGATATTCGCCGGAATATACCCTTCTAATATTGTGTGCAAGCTACTTCTAGAC
->read1069_contig0_position5868_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TATAACAGCTGATTTAAGAGGAAAAATTGAACATCAACGGAAGTACTATAGCAGGCTCACCAGCATGAAAGACATCCTCATTGTGAACCCCGCATCTCGT
->read1070_contig0_position7069_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCTAATCTGGCCAATATACCCTGGGGGGAGCTAATATATCGCGGCGTCGAGTTACCGTTGCACCACCTCCAAGTGTCCATCGGCGTCCGCTTCCCGGGC
->read1071_contig0_position6117_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGACCCTTACAGCGTTATCCGTCCCGAACTGGCTTGAGCCACTCATAAGGCACGCGCGGGCCATAACAGTCGCCTAAAAGGCGTAACCGATTCTGCTAC
->read1072_contig0_position943_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GACCTAGGTCTATGCCAGACGATCGCAGCGGAGTCGATATAATTGCAGTATCATGTATCGCTGATTGTGGGGGGCATGGGGGTTCCGCATTGGCGCAAAG
->read1073_contig0_position2568_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GACGATAGAGCGAAGTAGTTACGGTGATTACCCATCCATCGATGCCCCTCCTGTCCCGAAGCCTTAAAATCTAACCCTGAATTGGCTTTATCCACCCCCC
->read1074_contig0_position5418_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCCGTACACCTGGCAGCGGGAACCGCTTTGACTCTGGAGTGCCAGCGATAGTATCTCAGAGGCGAAAGCGCTTGTCACCTCATCTAAAATCGCGACTAT
->read1075_contig0_position3168_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGTCCGCAATGGGTTATCAAATGCCTATGTTCCGGTAATCTCTCATCTACTAAGCGCCCTAAAGGTCGTATGGTTGGAGGGCGGTTACACACCCTTAAG
->read1076_contig0_position4913_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGTCCATGACGTTGTGACAGAAAGGTGCGGGACGCGGAAGCGCACCTCGTATAACGTTAGGGGTATCGTCACTGCATAGCAGAATGGGCGATCGGCCTAC
->read1077_contig0_position2471_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTCAATTAGGTAGTGTGCGCGAGGTAGAGTATGCAGATTTCGTACCTTGCCACTGCTACCTCCGGCATATGGGCGTGCTATAAATGCGGGAGTCAGGAC
->read1078_contig0_position6954_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGGTCACAGATGAGCGTTCCGATTGTCCTTTCCCAGACTACGGCCTTATACCAAAGACTTCTAGACCGGAGAGACTACTTCCAGCCACGAATTCGTGTG
->read1079_contig0_position5663_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTACCGAGTATATTAACTTTATGAAATTAGCGCGTTAACTACTTAAAGTTCAGAAGATCACTGTCCGCCTCGAACCACTACAATAAGATTACGGATAGCC
->read1080_contig0_position6609_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAAGCAGCGACTCCACATGGAGCGATGGGTCCTCAAGGCAGTATAAAATGGACTGCTATCTAGGCGTTAAAGTAGTAGAACGAGGGTCGGGCGATTTGTT
->read1081_contig0_position4683_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTACGGAATATTGGGTAACCTCCTCTTCACTGATATCATCCTATCGGCGTTCAAAGTATTCGGCGGATGAATTAGAGCCAAAGCAGTAGGTTACCGTCG
->read1082_contig0_position4223_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGACTCTAACAAGTGGTCAGTACAGGTTCGACCATACGCGACGGCAAACAGAATCGCACGTCAACTATCCCCTTTATTAATGATCCGTGTCCCCCGACCG
->read1083_contig0_position1924_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGAGTGTTTTGATGAGCGGTGTTATATTTGTCCTAACTTAGCACTATCGCACCACAAAATTTCAGCATAAAGCATCCGGTTGAAGGCTGCGAATCGATC
->read1084_contig0_position2967_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGCCCAATTGCGCTCCCGAACAACGCCTGAGTTTAAAATTGACTTGAAACCGCCTAGCTCGGACCACCAAAGAGCAAGACTCTATGACTAGCGGGTGTC
->read1085_contig0_position2161_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTCATAATCGGGCCACCCGATTTCAGCTTGGCCACAACAGAGACTAGCCACCAAGAGATGGGTTGATGGTAGCATCCCGGCTTCTGGGGCAATTTCTGA
->read1086_contig0_position8231_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGGGCTGCGACTGCTTGCAGCTCCGACCGCTTTCCAATCGTTGCACATGACTAGAGGCTCGGACTCGTATCTGTCTCCGTGTTCCTTTCGATAACTCTG
->read1087_contig0_position2580_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGTAGTTCCGATGATTACCCGTCCATCGATGCCCCTCCTGTCCCGAAGCCTTAAAATCTAACCCTGAATTGGCTTTATCCACCCCCCCTACTGGCCACC
->read1088_contig0_position8625_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGACACTGCCTAAAGGGAACATATGTGTCCAGAATAGGGTTCAACGGTGTATGAGCAAACGATGCGGTAAGACGAGCGCTCCGACCCCCCTTGGCTTTGC
->read1089_contig0_position7805_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCAGTGCGGAAGCGGAGCCACACTAGCCGTTACTGACTGATTGACAATCCAGCCCGTTTGGGGTGATTTGTGCCGGCGCGTCCAGGTGCGAACGTTGTGC
->read1090_contig0_position2378_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TATTGGGCGGTGAGGGGTACCCGACGCCTCTGCTGTCAAAGTGGGAAATCCAGTCGCGACTATATCTACTATGTCATGCTTGTCGAATGAACAACTCAAT
->read1091_contig0_position2722_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCGAGACAGGTTCACCGAGTCGTTACTCCCGGGATCCACTGCGTATATTGTAAGAAATGCAATGCGTGGCCAGTTTGTTCCGGCAGGACACCACTCTTT
->read1092_contig0_position4541_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-CATGCTTACCTCCTGCGACGGCATTGGCGATTATGGGCGTGCATAGAGTCCCGCAGTATCGGAGCGATAGGGAGGACGTTAACGCCAATTCCGCTGAACA
->read1093_contig0_position6210_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGCTACGTTATAAAAAAGGGACGTGTGGGGTCAACAGTTCTTCTTCTTTCCTGTAGGGTAATGCTTCCGCGCATCTAAGTGATATTCGCCGGAATTTAC
->read1094_contig0_position8613_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TATTTTTGCGTAAGACACTGCCTAAAGGGAACATATGTGTCCAGAATAGGGTTCAACGGTGTATGAGCAAACGATGCGGTAAGACGAGCGCTCCGACCCC
->read1095_contig0_position9064_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCCCCATGAGGCCATATGCGCCTGTCACGGGCATGCTGAAAGCGGCGGTTACGTTAATCGCTTCTGTGATGACAGACCGAAGCCCACCTGTCCTGACCT
->read1096_contig0_position3563_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTCTGCTCGGTTATACGCCCTCGTGAGAAGACCCATGTAAGATGTATCCATCCCTACCACACGCGTCCGCCACCTCCAGGTCTAGTAAACCAGAGATTC
->read1097_contig0_position1008_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTGGGGGGCATGGGGGTTCCGCATTGGCGCAAAGGTACCGCAAAGGGCCTGTATGACCCTGGTTACGCGTTATTACCGGTCAGCTCCAGTTACGTCACG
->read1098_contig0_position1686_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTATCTGTTGGGTGGCCACTTTTCGCTATCTGCTGGGACGGCACTGGAGATCTGGAACATTAGATAGGATATAAAAGTAATACGGTTGATGTTATTACC
->read1099_contig0_position7306_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTTGCCACTCCGCCGATGTCTAAAAGCGCCAGATTGACTTGACTCTACGTGCTGCAATGGAGAACCGCGGAAGGAACACTTTCTGGTGCCACTCGAGAC
->read1100_contig0_position3261_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTTAAGTACCGAACGATAGAGCACCCGTCTAGGAGGGCGTGCAGGGTCTCCCGCTAGCTAATGGTCACGGCCTCTCTGGGAAAGCTGAACAACGGATGG
->read1101_contig0_position6766_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTATCGGCTATACTAGTTAGAGCCTCGCTTGGGTCTCTACATCCGCTGATACGCGCGAGCTCTCACCCACGACTGTACCCCGGTTAAGATTTATAAACC
->read1102_contig0_position8846_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TATTGTTAACACGCGATACAAGAGGGTTAGGAGCTAAGAAACCGGTGGATCACCGTACGAAAAGGATGGTTGAAATAGAACGAGTTGTAAAACATTAGCT
->read1103_contig0_position2139_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGAGTGAAACGGCTGCGAGCATCTCATAATCGGGCCACCCGATTTCAGCTTGGCCACAACAGAGACTAGCCACCAAGAGATGGGCTGATGGTAGCATCC
->read1104_contig0_position1828_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCGGCCCACAAATCGACGTGTGTATTTGTTCAATGGCAGGAGGTTAACTTTGCGGAGCTCAACCTATAACGATAATCAAATTGAGACAGACGAGTTGGA
->read1105_contig0_position771_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCCCGTCTCTGTGGTCAACCTGGACGCACAAACCCTAGTCCCATATAAAGCTATTCCACGCCGGGTGGCCTGGACGTCGTTTGTGGATGGCTTTGGGAA
->read1106_contig0_position1959_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AACTTAGCACTATCGCACCACAAAATTTCAGCATAAAGCATCCGGTTGAAGGCTGCGCATCGAGCAGCGTGCATTGGTCTTTCAGTCCCCAGTCACCGGA
->read1107_contig0_position5706_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TAAAGTTCAGAAGATCACTGTCCGCCTCGAACCACTACAGTAAGATTACGGATAGCTCGTGGCTTGGTTGTTTTCTGAATTGTGGCTATCTCAAATTGGG
->read1108_contig0_position94_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CATCGAGCGGTGTCGCTAGCGCAATGCGCAAGATTTTGACATTTACAAGGCAACATTGCAGCGTCCGATGGTCCGGTGGCCTCCAGATAGTGTCCAGTCG
->read1109_contig0_position7456_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTCAGCCCTTCGTTGAAAGGAGAATACAAATGACGGGAACTCTGACGAGAGGGTGCTTGAACGAGAGAAGCTAACAGTCATTGCGATGACGAGAACAGC
->read1110_contig0_position7640_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGCTGAGGGCCGACGCCCGGGGACCGTGATATCCTTGCGAGTGGAATGCGAAAACGGCATAAGCGCAATGACCGAGGTAACAAGCCATGAGGACTGGAG
->read1111_contig0_position1531_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTTCCCTTTGACATCTTGTTCTCACAACTGCACACTCCGATGCTCTGCCGAGCCTTCTAACCCTCGCGTATGTACATTCACCTTTGGACGCTTCGATAG
->read1112_contig0_position3822_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTAGTCAAGTGAAGAACCCGGGCCTAAAATTGGAACCCGTAATCTTCAAGTGAATCATCCGACCATGCAAACCTGATTATCTGCACGACTCTTAATATC
->read1113_contig0_position5144_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCTAGTAACAGACTGGGAGGTCTCGGCCAATTCGTTGTCTTGAACGCTGTGCACTTTAAAATTCGGAACATCTTAACCAAAGCATATTAATATGCCAGC
->read1114_contig0_position8389_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGGTACCGAGCAGCTTTGAGTTTTTGTAAGTCCCACGGTTAATGGGCCACTTATTTCGACATTCATGGCGCCGATATCCTGCTTAGGCAGTACGGCCAA
->read1115_contig0_position1778_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTATTACCAACTCCACTTCTGCAAATTGTTATGAGCAAGCATACAAGTTAGCCGGCCCACAAAACGACGTGTGTATTTGTTCAATGGGAGGAGGTTAACT
->read1116_contig0_position8931_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTAAAACTTTAGCTCACGCGCCACCGTCATAGGCTGCATATTGAGACAGGGTTGAAAACCTGTCTGAAGTCCGTGCTTCCCTAACCAGCCTATGCGCCA
->read1117_contig0_position3004_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AATTGACTTGAAACCGCCTAGCTCGGACCACCAAAGAGCAAGAGTCTATGACTAGCGGGTGTCGTCAATGAAAACTGATCGAGCACTGTCCGCGAAACAT
->read1118_contig0_position4105_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CATCAATCTGCACCACGAATATCGTCCAAGACGTTTTGAGCCGGTGACTAATTCGGTTGTCGCACATAGTGTACGTTGAGGCGGGAACTTCCCGCTGATA
->read1119_contig0_position4183_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGCGGGAACTTCCCGCTGATATGATTGTGATCGATATTGAGACTCTAACAAGTGGTCAGTACAGGTTCGACCATACGCGACGGCAAACAGAATCGCACG
->read1120_contig0_position5495_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCTCATCTAAAATCGCGACTATAGATCTGTTTAGAACCACGACCCAGAAATCTTTAGCTAAGTAATCGACTGCCTTCGTCGGGCCGATTATTGGTTCAC
->read1121_contig0_position721_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCCACGATCAATGTTATTAAGCGCGACGGTGTATTCCACGACCTAATTGTTCCCGTCTCTGTGGTCAACCTGGACGCACAAACCCTAGTCACATATAAA
->read1122_contig0_position7538_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCGATGACGAGAACAGCCCTACTGCCCGCCGTGAACGAGAACAAGCGTGTGGAGAGTGACTGACTATCACGAGGAATTACGGATAACAGCCCACTTGGA
->read1123_contig0_position3388_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCTCCGACGTTCATTCTCAAGGGTGTAGTTTTAGAGACTGAGAACTCACCCTATTGGTAGTACTGCCTGCCGTCGCCTCGTGCCCATAATGTTTGGAAC
->read1124_contig0_position343_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGGATAATGGCTTCATGCTCAAGTTCTATACCGAGCAGAGAGGTTGGGTCTACCTAGTAGTGTCGCGGTTATCGGACAGAGGATTATGTAAGGTTACCG
->read1125_contig0_position8845_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTATTGTTAACACGCGATACAAGAGGGTTAGGAGCTAAGAAACCGGTGCATCACCGTACGAAAAGGATGGATGAAATTGAACGAGTTGTAAAACATTAGC
->read1126_contig0_position6042_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAACAACCCGTCGACTGAATGTGATTCCTTTGTTATTTCACACTATTGTTCGGTGCGTGCGCTGCTCAGGCTGGTGCGACCCTTACAGCGTTATCCGTCC
->read1127_contig0_position1014_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGCATGGGGGTTCCGCATTGGCGCAAAGGTACCGCAAAGGGCCTGTATGACCCTGGTTACGCGTTATTACCGGTCAGCTCCAGTTACGTCACGGACGTA
->read1128_contig0_position14_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTGGGGCGGACCACGCTCTGGCTAACGAGCTACCGTTTCCTTTAACCTGCCAGACGGTGACCAGGGCCGTTCGGTGTTGCATCGAGCGGTGTCGCTAGC
->read1129_contig0_position7464_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTCGTTGAAAGGAGAATACAAATGACGGGAACTCTGACGAGAGGGTGCTTGAACGAGAGAAGCTAACAGTCATTGCGATGACGAGAACAGCCCTACTGC
->read1130_contig0_position9706_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTGGTTTTGTACTACGGTATGGGAACCCGTTTGCCTAACGTCTGGAAATCTGTCGAGTCATATCGATGAACAGAGACTAAATGTCCTTAAATCTCTAAC
->read1131_contig0_position9616_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCATTATTGTACATCAGTACCATAGCTTGCCCACATGTGATGCTCGTACTCGAAGGGGGAATCACCTTACTTAATCGGCTGGGGTAACGGCTGGTTTTG
->read1132_contig0_position6139_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCCGAACTGGCTTGAGCCACTCATAAGGCACGCGCGGGCCATAACAGTCGACTAAAAGGCGTAGCCGATTCTGCTACGTTATAAAAAACGGACGAGTGG
->read1133_contig0_position67_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GACGGTGACCAGGGCCGTTCGGCGTTGCATCGAGCGGTGTCGCTAGCGCAATGCGCAAGATTTTGACATTTACAAGGCAACATTGCAGCGTCCGATGGTC
->read1134_contig0_position4391_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTCTAGCTAGCTTGACTCGGCTGATAAAGAAAACAATCTATATGGAACCGAGGGGCGGGATGATAATTGTTCTTAGTATAGTGACCGTTATGGACGACG
->read1135_contig0_position4876_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCACGGGGTGAGCACATGAATGGGGTACGGTTTTATCGTCCATGACGTTGTGACATAAAGGTGCGGGACGCGGAAGCGCACCTCGTATAACGTTAGGGG
->read1136_contig0_position2800_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCCGGCAGGACACCACTCTTTGAAGGTGCCCATTGCATTGTAGCCTGAACTATTAGCAATCCTAAGCCCATAAGCCCTGCCCCACGGGGGCTACAATCC
->read1137_contig0_position6866_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATACATTTAACCCTTAGTCATAAGATGATACTTCATCTGCATGCGCGCATCTTCCTATTTTATGGTCTTAATTGAGTGTGCAGAGTTGGGGGTCACAGAT
->read1138_contig0_position7551_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACAGCCCTACTGCCCGCCGTGAACGAGAACAAGCGTGTGGAGAGTGACTGACTATCACGAGGAATTACGGATAACAGCCCACTTGGAGTGTGCTGAGGGC
->read1139_contig0_position1526_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GATTCACTTCCCTTTGACATCTTGTTCTCACAACTGCATACTCCGATGCTCTGCCGAGCCTTCTAACCATCGGGTATGTACATTCACCTTTGGACGCTTC
->read1140_contig0_position8357_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACATTCCTGGTAGTAATCCGATCTCAATTCCTGCGGTACCGAGCAGCTTTGAGTTTTTGTAAGTCCCACGGTTAATGGGCCACTTATTTCGACATTCATG
->read1141_contig0_position6893_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATACTTCATCTGCATGCGCGTATCTTCCTATTTTATGGTCTTAATTGAGTGTTCAGAGTTGGGGGTCACAGATGAGCGTGCCGATTGTCCTTTCCCAGGC
->read1142_contig0_position1464_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTAATCAGGATCATAGATGGCCAATTATTGACCACAGGTAGGGGCGAGGTATAAATTAGTGGATTCACTTCCCTTTGACATCTTGTTCTCACAACTGCA
->read1143_contig0_position2997_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTTTAAAATTGACTGGAAACCGCCTAGCTCGGACCACCAAAGAGCAAGACTCTATGACTAGCGGGTGTCGTCAATGAAAACTGATCGAGCACTGTCCGC
->read1144_contig0_position6034_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GACAGAGCTAACAATCCGTCCACTGAATGTGATTCCTTTGTTATTTCACACTATTGTTCGGTGCGTGCGCTGCTCAGGCTGGTGCGACCCTTACAGCGTT
->read1145_contig0_position6436_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTGGCCAGGATAGCTAAGCAGGTCCTGGATTGGCATGTCATCCGGAGTGATAGGCACTCCTCACGACCAGCTTGCGGACAAACGGGGTGCCCGCGCCTG
->read1146_contig0_position5337_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGTTGAATTGATCAATTGAGTCCAGTACACCATATCAACAGCTTGATCGTTCCACTTCAATCAGCACGACGGGCGACCGTACCCGGACACCTGGCAGCG
->read1147_contig0_position1564_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CACTCCGATGCTCTGCCGAGCCTTCTAACCATCGGGTATGTACATTCACCTTTGGACGCTTCGGTAGGACATGCACCCGGTCCGTTGACTTACCAACTTG
->read1148_contig0_position2982_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCGAACAACGCGTGAGTTTAAAATTGACTTGAAACCGCCTAACTGGGACCACCAAAGAGCAAGACTCTATGACTAGCGGGTGTCGTCAATGAAAACTGA
->read1149_contig0_position9322_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTATCGAAATGTTCCGCTGTAAAGAACCTGGCGTATCCTGACCATGGAGCTGCAACACTTTCATACAGGTAGCCGAACAGGTATTACTCAGACTGGAGAG
->read1150_contig0_position8217_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCTATTATTAGGAGAGGGCTGCGACTGCTTGCAGCTCCGACCGCTTTCCAATCGTTGCACATGACTTGAGGCTCGGACTCGTATCAGTCTCCGTGTTCC
->read1151_contig0_position2923_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GACGAAAGAGTCAGTAGAGTTGGGGTTCGTCTTTTAATGACCCGTAGCCCAATTGCGCTCCCGAACAACGCGTGAGTTTAAAATTGACTTGAAACCGCCT
->read1152_contig0_position4081_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTACTATAAATCAGCGAATCTAACATCAATCTGCACCACGAATATCGTCCAAGACGTTTTGAGCCGGTGACTAATTCGGTTGTCCCACATAGTGTACGT
->read1153_contig0_position2587_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TACGGTGATTACCCGTCCATCGATGCCCCTCCTGTCCCGAAGCCTTAAAATCTAACCCTGAATTGGCTTTATCCACCCCCCCTACTGGCCACCACTGGGG
->read1154_contig0_position3823_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTAGTCAAGTGATGAACCCGGGCCCAAAATTGGAACCCGTAATCTTCAAGTGAATCATCCGATCATGCAAACCTGATTATCTGCACGACTCTTAAAATCA
->read1155_contig0_position1294_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCCCTCCTGCGTAGTGCTCTCCAATAATAAGTGAACCCATGGGTCGCGCTGTATTTTTGTACGGCTTGATGTCAGGGTCAGTTTGGGCGCCGGTATGTC
->read1156_contig0_position6440_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCTGGATAGCTAAGCGGGTCCTGGATTGGCATGTCATCCGGAGTGATAGGCACTGCTCACGACCAGCTTGCGGACAAACGGGGTGCCCGCGCCTGCGTC
->read1157_contig0_position986_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCAGTATCATGTATCGCTGATTGTGGGGGGCATGGGGGTTCCGCATTGGCGCAAAGGTACCGCAAAGGGCCTGAATGACCCTGTTTACGCGTTATTACC
->read1158_contig0_position3260_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCGTAAGTACCGAACGATAGAGCACCCGTCTAGAAGGGCGTGCAGGGTCTCCCGCTAGCTAATGGTCACGGCCTCTCTGGGAAAGCTGAACAACGGATG
->read1159_contig0_position4553_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGCGACGGCATTGGCGATTATGGGCGTGCATAGAGTCCCGCAGTGTCGGAGCGATAGGGAGGACGTAAACGCCAATTCCGCTTAATAGCGGAGTCTGCT
->read1160_contig0_position2844_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTGAACTATTAGCAATCCTAAGCCCATAAGCCCTGCCCCACGGGGGCTACAATCCAGCAGTGAACGCGTTTACCTTAAGACGAAAGAGTCGGTAGAGTT
->read1161_contig0_position2200_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGAGACTAGCCACCAAGAGATGGGTTGATGGTAGCATCCCGGCTGCTGGGGCAATTTCTGACGATTCGAGTGACCAGCGATAGTACGTTCCTTTTGTACT
->read1162_contig0_position4217_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATATTCAGACTCTAACAAGTGGTCAGTACAGGTTCGACCATACGCGACGGCAAACAGAATCGCACGTCAACTATCCCCTTTATTAATGATCCGTGTCCCC
->read1163_contig0_position5468_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTATCTCAGAGGAGAAAGCGCTTGTCACCTCATCTAAAATCGCGACTATAGATCTGTTTAGAACCACGACCCAGAAATCTTTAGCTAAGTAATCGACTG
->read1164_contig0_position674_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GACACCGGCCTACTACATTATACAGTAAGGTTGAATCGCGTAGAAGCACCCACGATCAATGTTATTAACCGCGACGGTGTATTCCACGACCTAATTTTTC
->read1165_contig0_position3417_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTTAGAGACTGAGAACTCACCCTATTGGTAGTACTGCCTGCCGTCGCCTCGCGCCCATAATGTTTGGAACTCGCAAACCTTTACACTCATGACATAGCA
->read1166_contig0_position9080_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGCGCCTGTCACGGGCATGCTGAAAGCGACGGTTACATTAATCGCTTCTGTGATGACAGACCGAAGCCCACCTGTCCTGACCTCACCCCAGGCATCGAG
->read1167_contig0_position2901_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCAGTGAACGCGTTTACCTTAAGACGAAAGAGTCAGTAGAGTTGGGGTTCGTGCTTTAATGACCCGTAGCCCACTTGCGCTCCCGAACAACGCGTGAGTT
->read1168_contig0_position5089_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGTACAGGTGCCCATAACCCGATGAGGCCAAGGTGTTACGTGAAGTCGCGTTGTCGCTAGTAACAGATTGGGAGGTCTCGGCCAATTCGTTGTATTGAT
->read1169_contig0_position2504_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GCAGATTTCGTACCTTGCCACTGCTACCTCCGGCATATGGGGGTGCTATAAATGCGGGAGTCAGGACGATAGAGCGAAGTAGTTTCGGTGATTACCCGTC
->read1170_contig0_position7759_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGCCGGCCCCTGTGCTGACCTTATGTCCATAGCGATACACGAAGGCCAGTGCGGAAGCGGAGCCACACTCGCCGTTACTGACTGATTGACAATCCAGCC
->read1171_contig0_position8337_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAATGACCTTGGGCTCGTCGACATTCCTGGTAGTAATCCGATCTCAATTCCTGCGGTACCGAGCAGCTTTGAGTTTTTGTAAGTCCCTCGGTTAATGGGC
->read1172_contig0_position2608_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GATGCCCCTCCTGTCCCGAAGCCTTAAAATCAAACCCTGAATTGGCTTTGTCCACCCCCCCTACTGGCCACCACTGGGGCGCGAGTCTCGAGCCTCTCGA
->read1173_contig0_position7561_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCCCGCCGTGAACGAGAACAAGCGTGTGGAGAGTGACTGACTATCACGAGGAATTACGGATAACAGCCCACTTGGAGTGTGCTGAGGGCCGACGCCCGG
->read1174_contig0_position2173_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCACCCGATTTCAGCTTGGCCACAACAGAGACTAGCCACCAAGAGATGGGTTGATGGTAGCATCCCGGCTTCTGGGGCAATTTCTGACGATTCGAGTGA
->read1175_contig0_position6521_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGTGCCCGCGCCTGCGTCCGGTAGACGAGCGATGGATTTAGACCGTTCACTGAACCCTCTAATAGGACCTCTTGCCTATCCGAGGCTTAAGCAGCGACT
->read1176_contig0_position2247_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGGCAATTTCTGACGATTCGAGTGACCAGCGATAGTACGTTCCTTTTGTACTGAGTCTTAACATCGGCAAATGCGCTCTAGATACCTCCGGCTTCACTC
->read1177_contig0_position6533_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGCGTCCGGTAGACGAGCGATGGATTTAGACCGTTCACTGAACCCTCTAATAGGACCTCTTGCCCATCCGAGGCTTAAGCAGCGACTCCACATGGAGCG
->read1178_contig0_position8511_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCGAGAAGTTATAGTCTAATAATGAATGGTGAACAGCACTTCTTTTCGTCCTGAGGCCATATTAATTCTACTCAGATTGTCTGTAACCGCAGATTCGGG
->read1179_contig0_position8772_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGTATTGACTGGGGGCTTACTGAGAACACTTCATCTGTATGGCAAGGTTGCGACACCGCGCCACACAGCAGTTTATTGTTAACACGCGATACAAGAGGG
->read1180_contig0_position9214_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACAGGTCGGAACCGCTGGCAGAGCAGCTCCGAGGGCCTTTATACCCATACTGCCACTCCAGTACCTGGGCCGCGTGTTGTACGCTGTGTATCTTGAGAGC
->read1181_contig0_position3128_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGTGGTCTGAATGTTATGCCGTCCGACTCTTGCGCTCGGATGTCCGCAGTGGGTTATCATATGCCTATGTTCCGGTAATCTCTCATCTACTAAGCGCCC
->read1182_contig0_position8982_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTGAAAACCTGTCTGAAGTCCTTGCTTCCCTAACCAGCCTATGCGCCTTAACTTTATGCATACTCGTTTAGTACAGGGCCGCGCCCCATGAGGCCATAT
->read1183_contig0_position4545_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTACCTCCTGCGACGGCATTGGCGATTATGGGCGTGCATAGAGTCCCGCAGTGTCGGAGCGATAGGGAGGACGTAAACGCCAATTCCGCTTAATAGCGG
->read1184_contig0_position8227_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGAGAGGGCTGCGACTGCTTGCAGCTCCGACCGCTTTCCAATCGTTGCACATGACTTGAGGCTCGGACTCGTATCTGTCTCCGTGTTCCTTTCGATAAC
->read1185_contig0_position3216_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TACTAAGCGCCCTAAAGGTCGTATGGTTGGAGGGCGGTTACACACCCTTAAGTACCGAACGATAGAGCACGCGTCTAGGAGGGCGTGCAGGGTCTCCCGC
->read1186_contig0_position1250_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTGCTCCGAGACTTCGGCATAAATCGAAGTATGGACTCTTATATTCCCTCCTTCGTAGTGCTCTCCCATAATAAGTGAACCCATGGGTCGCGCTGTATT
->read1187_contig0_position3603_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGATGTATCCATCCCTACCACACGCGTCCGCCACCTCCGGGTCTAGTAAACCAGAGATTCCATGGACTCTCTGTTTCGTCGATTGTCTGAATATCGTGCA
->read1188_contig0_position2279_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATAGTACGTTCCTTTTGTACTGAGTCTTAACATCGGCAAATGCGCCCTAGATACCTGCGGCTTCACTCCACAGTGTAAGAGTTGACGGGACTAAAACAGT
->read1189_contig0_position8200_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGACTCATTGACCAACCCCTATTATTAGGAGAAGGCTGCGACTGCTTGCATCTCCGACCGCTTTCCAATCGTTGCACATGACTTGAGGCTCGGACTCGT
->read1190_contig0_position8724_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CTACATCGAATTCAGCGTGTAAGAGCCCGCTTATCCGGTGGTGAGACCTACTAGTGACTGGGGGCTTACTGAGAACACTTCATCTGTATGGCCAAGTTGC
->read1191_contig0_position8372_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCCGATCTCAATCCCTGCGGTACCGAGCAGCTTTGAGTTTTTGTAAGTCCCACGGTTAATGGGCCACTTATTTCGACATTCATGGCGCCGATATCCTGC
->read1192_contig0_position1323_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGTGAACCCATGGGTCGCGCTGTATTTTTGTACGGCTTGATGTCAGGGTCAGTTTGGGCGCCGGTATGTCTGTGTAAGGTTGGGCCAATCGAGAGGACA
->read1193_contig0_position2929_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGAGTCAGTAGAGTTGGGGTTCGTGCTTTAATGACCCGTAGCCCAATTGCGCTCCCGTACAACGCGTGAGTTTAAAATTGACTTGAAACCGCCTAGCTCG
->read1194_contig0_position3967_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGACTATCAAACCTATTTAATGATATATGCTCTTGGACAACACGAGGTCGTAATTATTTTCTGAGATGGTTTTAGTGAGACCAGCAGATGCACTCTTAG
->read1195_contig0_position886_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTTGGCTCCTTTCTTCATGATCGTCGGAGTTCTTTCAGGCCGATCAAGTGGTTAGAGACGTAGGTCTATGCCAGAGGATCGCAGCGGAGTCGATATAAT
->read1196_contig0_position8435_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCACTTATATCGACATTCATGGCGCCGATATCCTGCTTAGGCAGTACGGCCAATGCACGACCCTATATGACCCCTAGCGAGAAGTTATAGACTAATAAT
->read1197_contig0_position184_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTCCAGTCGCTCTAACTGTATGGAGACCATAGGCATTTACCTTATTCTCATCGCCACGCCCCAAGATCTTTAGGACCCAGCATTCCTTTAACCACTAAC
->read1198_contig0_position6802_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTACATCCGCTGATACGCGCGAGCTCTCACTCACGACTGTACCCCGGTTAAGATTTATGAACCATACATTTAACCCTTAGTCATAAGATGATACTTCAT
->read1199_contig0_position7641_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCTGAGGGCCGACGCCCGGGGACCGTGCTATCCTTGCGAGTGGAATGCGAAAACGGCATAAGCGCAATGACCGAGGTAACAAGCCATGACGACTGGAGC
->read1200_contig0_position6708_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTGGTAGTGGTTATCGCATTGCAAGAACGTACGGACGGACAAAATGTCGGACACCGCCTTATCGGCTATACTAGTTAGAGCCTCGCTTGGGTCTCTACA
->read1201_contig0_position7144_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCCATCGGAGTCCGCTTCCCGGGCTTGTCCGCGTCCCATCGGTTAATTCAATGTCCGTCAATCGGGTTGGCCAAAAATTCTACCTGTCCACCTGTCCGC
->read1202_contig0_position6155_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCACTCATAAGGCACGCGCGGGCCATAACAGTCGACTAAAAGGCGTAACCGATTCTGCTACGTTATAAAAAAGGGACGAGTGGGGTCAACAGTTCTTCT
->read1203_contig0_position128_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTGACATTTACAAGGCAACATTGCAGCGTCCGATGGTCCGGTGGCCTCCAGATAGTGTCCAGTCGCTCTAACTGTATGGAGACCATAGGCATTTACCTT
->read1204_contig0_position6087_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGTTCGGTGCGTGCGCTGCTCAGGCTGGTGCGACCCTTACAGCGTTATCCGTCCCGAACTGGCTTGAGCCACTCATAAGGCACGCGCGGGCCATAACAG
->read1205_contig0_position2874_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCCTGCCCCACGGGGGCTACAATCCAGCAGTGAACGCGTTTACCTTAAGACGAAAGAGTCAGTAGAGTTGGGGTTCGTGCTTTAATGACCCGTAGCCCA
->read1206_contig0_position5485_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCGCTTGTCACCTCATCTAAAATCGCGACTATAGATCTGTTTAGAACCACGACCCAGAAATCTTTAGCTAAGTAATCGACTGCCTTCGTCGGGCCGCTT
->read1207_contig0_position6356_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGGAATTCCTAGGAAGGCGCGCAGCTCAAGCAATCATACATGGCGGAATGCCTGTCCACCGGGGGTTCTACTGTACCACAGTGGCCTGGATAGCTAAGC
->read1208_contig0_position4803_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGAAACGTTACATTCGTCTATCCGCACACACCGCCGTTGGATGTGTCCCACAGTGTTTTATACGGGACGGTGGCCACGGGGTGTGCACATGAATGGGGT
->read1209_contig0_position9298_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTGTATCTTGAGAGCGTTTCTCCGTATCGAAATGCTCCGTTGTAAAGAACCTGGCGTATCCTGACCATGGAGCTGCAACACTTTCACACAGGTAGCCGA
->read1210_contig0_position9338_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGTAAAGAACCTGGCGTATCCTGACCATGGAGCTGCAACACTTTCACACAGGTAGCCGAACAGGTATTACTCAGACTGGAGAGGAATCTTCATTGGTCG
->read1211_contig0_position801_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAACCCTAGTCCCATATAAAGCTATTCCACGCCGGGTGGCCTGGACGTCGTTTGTGGATGGCTTTGTGAATCACTAGGTAATTACTGTTGGCTCCTTTCT
->read1212_contig0_position4586_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGTCCCGCAGTGTCGGAGCGGTAGGGAGGACGTAAACGCCAATTCCGCTTAATAGCGGAATCTGCTGGCTTGTGCATTCGTCGGCCTATTAGATACGGT
->read1213_contig0_position8705_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGACCCCCCTTGGCTCTGCTGCATCGAATTCAGCGTGTAAGAGCCCGCTTATCCGGTGGTGATACCTACTATTGACTGGGGGCTTACTGAGAACACTTC
->read1214_contig0_position268_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCTTTAACCACTAACATAACGCGTGTCATCTAGTTCTAGCATACTCCGCCTTGGGCCACACAATTAATATAAGACGGGATAATGGCTTCATGCTCATGT
->read1215_contig0_position3850_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-AATTGGAACCAGTAATCTTCAAGTGAATCATCCGTTCATGCAAACCTGTTTATCTGCACGACTCTTAAAATCATGCACTAAGCATAGAATGCACGACTAC
->read1216_contig0_position8609_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCGTATTTTTGCGTAAGAAACTGCCTAAAGGGAACATATGTGTCCAGAATAGGGTTCAACGGTGTATGAGCAAACGATGCGGTAAGACGAGCGCTCCGA
->read1217_contig0_position5957_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGCATCTCGTGATTCGAGCCTAACAGCATGCCATCTATCGTTTGGACGGGTCTTGTGTTCCCTCAACACGCACGTTGACAGAGCTAACAATCCGTCGAC
->read1218_contig0_position2509_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTCGTACCTTGCCACTGCTACCTCCGGCATATGGGCGTGCTATAAATGCGGGAGTCAGGACGATAGAGCGAAGTAGTTACGGTGATTACCCGTCCATCG
->read1219_contig0_position8959_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CATAGGCTGCATATTGAGACCGGGTTGAAAACCTGTCTGAAGTCCGTGCTTCCCTAACCAGCCTATGCGCCTTAACTTTATGCATACTCGTTTAGTACAG
->read1220_contig0_position7031_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTTCCAGCCACGAATTCGTGTGATAACCGCCTAAACAGTCTAATCTGGCCAATATACCCTGGGGGGAGCTAATATATCGCGGCATCGAGTTACCGTTGC
->read1221_contig0_position4197_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCTGATATGATTGTGATCGATATTCAGACTCTAACAAGTGGTCAGTACAGGTTCGACCATACGCGACGGCAAACAGAATCGCACGTCAACTATCCCCTT
->read1222_contig0_position2666_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCTACTGGCCACCACTGGGGCGCGAGTCTCGAGCCTCTCGACTCCAAAGGGTCTGCCCGAGACAGGTTCACCGAGTCGTTACTCCCGGGATCCACTGCG
->read1223_contig0_position7493_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAACTCTGACGAGAGGGTGCTTGAACGAGAGAAGCTAACAGTCATTGTGATGACGAGAACAGCCCTACTGCCCGCCGTGAACGAGAACAAGCGTGTGGAG
->read1224_contig0_position1942_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTGTTATATTTGTCCTAACTTAGCACTATCGCACTACAAAATTTCATCATAAAGCATCCGGTTGAAGGCTGCGCATCGAGCAGCGTGCATTGGTCTTTC
->read1225_contig0_position4793_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCGAGTGCTCTGAAACGTTACATTCGTCTATCCGCACACACCGCCGTTGGATGCGTCCCACAGTGTTTTATACGGGACGGTGGCCACGGCGTGAGCACA
->read1226_contig0_position6525_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCCGCGCCTGCGTCCGGTAGACGAGGGATGGATTTAGTCCGTTCACTGAACCCTCTAATAGGACCTGTTGCCCATCCGAGGCTTAAGCAGCGACTCCAC
->read1227_contig0_position3396_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGTTCATTCTCAAGGGTGTAGTTTTAGAGACTGAGAACTCACCCTATTGGTAGTACTGCCTGCCGTCGCCTCGCGCCCATAATGTTTGGAACTCGCAAAC
->read1228_contig0_position6413_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CACCGGGGGTTCTACTGTACCACAGTGGCCTGGATAGCTAAGCAGGTCCTGGATTGGCATGTCATCCGGAGTGATAGGCACTGCTCACGACCAGCTTGCG
->read1229_contig0_position8191_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTAAAATGATGGACTCATTGACCAACCCCTATTATTAGGAGAGGGCTGCGACTGCTTGCAGCTCCGACCGCTTTCCAATCGTTGCACATGACTTGTGGCT
->read1230_contig0_position2875_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCTGCCCCACGGGGGCTACAATCCAGCAGTGAACGCGTTTACCTTAAGACGAAAGAGTCAGTAGAGTTGGGGTTCGTGCTTTAATGACCCGTAGCCCAA
->read1231_contig0_position2168_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCGGGCCACCCGATTTCAGCTTGGCCACAACAGAGACTAGCCACCAAGAGATGGGTTGATGGTAGCATCCCGGCTTCTGGGGCAATTTCTGACGATTCG
->read1232_contig0_position8156_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GACCGCCGCAGGAAAGATCCGAGGCCTTTTCCAGGGTAAAATGATGGACTCATTGACCAACCCCTATTATTAGGAGAGGGCTGCGACTGCTTGCAGCTCC
->read1233_contig0_position1537_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTTGACATCTTGTTCTCACAACTGCACACTCCGATGCTCTGCCGAGCCTTCTAACCATCGGGTATGTACATTCACCTTTGGACGCTTCGATAGGACATG
->read1234_contig0_position4696_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGTAACCTCCTCTTCACTGATATCATCCTATCGGCGTTCAAAGTATTCGGCGGATGAATTATAGCCAAAGCAGTAGGTTACCGTCGGCGCATAACCGGC
->read1235_contig0_position4071_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTGATAACGATTACTATAAATCAGCGAATCTAACATCAATCTGCACCACGAATATCGTCCAAGACGTTTTGAGCCGGTGACTAATTCGGTTGTCGCACA
->read1236_contig0_position6493_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGCTCACGACCAGCTTGCGGACAAACGGGGTGCCCGCGCCTGCGTCCGGTAGACGAGCGATGGATTTAGACCGTTCACTGAACCCTCTAATAGGACCTC
->read1237_contig0_position8967_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCATATTGAGACAGGGTTGAAAACCTGTCTGAAGTCCGTGCTTCCCTAACCAGCCTATGCGCCTTAACTTTATGCATACTCGTTTAGTACAGGGCCGCGC
->read1238_contig0_position797_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCACAAACCCTCGTCCCATATAAAGCTATTCCACGCCGGGTGGCCTGGACGTCGTTTGTGGATGGCTTTGGGAATCACTAGGTAATTACTGTTGGCTCCT
->read1239_contig0_position7899_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGTCCCGTGTCACGCTGTAGCTCTAATACCAATTGAAATGAAGCTTACGCAAACTACTCGACGAACAACAGCAAGATTCGACGATCAAACTCGCCGGCG
->read1240_contig0_position515_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCTCACGTGGGACGCATGTACTTACCTAACATGAAGCGGTAATGGAGCTCGAACACTAGTCGGTGGCTCTTCTGTCTCTGGCTGGGACGGCTATGTGAG
->read1241_contig0_position1865_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGGAGGTTAACTTTGCGGAGCTCAAACTATAACGATAATCAAATTGAGACAGACGAGTTGGAGTGTTTTAATGAGCGGTGTTATATTTGTCCTAACTTA
->read1242_contig0_position8020_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTTCAGTCATTCCCCCTCAGTTTTGTCCATGTGGAGAATATGCATTCGACCAAATGAAAATGTCAATAATCTCGACCCTGTAGTCCGCGGCCAATCAGC
->read1243_contig0_position5122_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGTTACGTGAAGTCGCGTTGTGGCTAGTAACAGATTGGGAGGTCTCGGCCAATTCGTTGTTTTGATCGCTGTGCACTTTAAAATTCGGAACATCTTAAC
->read1244_contig0_position7238_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCCGCTAGAAGCAGATTATACGGAATACATATCCCGACACCGGCAGCTGAAATGATGCAGAAGCCTTGCTTGCTACTCCGCCGATGTCTAAAAGCGCCA
->read1245_contig0_position6513_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GACAAACGGGGTGCCCGCGCCTGCGTCCGGTAGACGAGCGATGGATTTAGACCGTTCACTGAACCCTCTAATAGGACCTCTTGCCCATCCGAGGCTTAAG
->read1246_contig0_position4186_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGGAACTTCCCGCTGATATGATTGTGATCGATATTCAGACTCTAACAAGTGGTCAGTACAGGTTCGACCATACGCGACGGCAAACAGAATCGCACGTCA
->read1247_contig0_position4692_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TATTGGGTAACCTCCTCTTCACTGATATCATCCTATCGGCGTTCAAAGTATTCGGCGGATGAATTAGAGCCAAAGCAGTAGGTTACCGTCGGCGCATAAC
->read1248_contig0_position8469_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCTTAGGCAGTACGGCCAATGCACGACCCTATATGACCCCTAGCGAGAAGTTATAGTCTAATAATGAATGGTGAACAGCACATCTTTTCGTCCTGAGGC
->read1249_contig0_position739_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAACCGCGACGGTGTATTCCACGACCTAATTTTTCCCGTCTCTGTGGTCAACCTGGACGCACAAACCCTAGTCCCATATAAAGCTATTCCACGCCGGGTG
->read1250_contig0_position7759_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGCCGGCCCCTGTGCTGACCTTATGTCCATATCGATACACGAAGGCCAGTGCGGAAGCGGAGCCACACTCGCCGTTACTGACTGATTGACAATCCAGCC
->read1251_contig0_position341_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GACGGGATAATGGCTTCATGCTAATGTTCTATACCGAGCAGAGAGGTTGGGTCTACCTAGTAGTGTCGCGGTTATCGGACAGAGGATTATGTAAGGTTAC
->read1252_contig0_position4674_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTAGATACGGTACGGAATATTGGGTAACCTCCTCTTCACTGATATCATCCTATCGGCGTTCAAAGTATTCGGCGGATGAATTAGAGCCAAAGCAGTAGG
->read1253_contig0_position2056_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAGACGTCCGAGCTCGAACCCGTCCGGCTAAGAGGCAGGCAGTCGCTGCATGTGTACGCAGCGGTCTATGCTACAGGTATTACGGAGTGAAACGGCTGC
->read1254_contig0_position4494_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATAACTACTGAGTGTCCGCCCTCGGCTAATCATGAACACCGGTCAGGCATGCTTACCTCCTGCGACGGCATTGGCGATTATGGGCGTGCATAGAGTCCCG
->read1255_contig0_position4560_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCATTGGCGATTATGGGCGTGCATAGAGTCCCGCAGTGTCGGAGCGATAGGGAGGACGTAAACCCCAATTCCGCTTAATAGCGGAAGCTGCTGGCTTGT
->read1256_contig0_position4284_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAACTATCCCCTTTATTAATGATCCGTGTCCCCCGACCGTGTGCTGAGGAGACCCGTAATGCATGGAAAGAGCCAATATCCCCGGGAGTCCCGCACTACT
->read1257_contig0_position2354_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAAGAGTTGACGGGACTAAAACAGTATTGGGCGGTGAGGGGTACCCGACGCCTCTGCTGTCAAAGTGGGAAATCCAGTCTCGACTATATATACTATGTCA
->read1258_contig0_position3294_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGGGCGTGCAGGGTCTCCCGCTAGCTAATGGTCACGGCCTCTCTCGGAAAGCTGAACAACGGATGGGATTAAGCTCAGCAGTCCGCCTCCAATCTCTCC
->read1259_contig0_position731_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AATGTTATTACCCGCGACGGTGTATTCCACGACCTAATTTTGCCCGTCTCTGTGGTCAACCTGGACGCACAAACCCTAGTCCCATATAAAGCTATTCCAC
->read1260_contig0_position4838_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGTTGGATGTGTCCCACAGTGTTTTATACGGGACGGTGGCCACGGGGTGAGCACATGAATGGGGTACGGTTTTACCGTCCATGACGTAGTGACATAAAGG
->read1261_contig0_position6553_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGGATTTAGACCGTTCACTGAACCCTCTAATAGGACCTCTTGCCCATCCGAGGCTTAAGCAGCGACTCCACATGGAGCGATGGGTCCTCAAGGCAGTAT
->read1262_contig0_position2883_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CACGGGGGCTACAATCCAGCAGTGAACGCGTTTACCTTAAGACGAAAGAGTCAGTAGAGTTGGGGTTCGTGCTTTAATGGCCCGTAGCCCAATTGCGCTC
->read1263_contig0_position6955_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGTCACAGATGAGCGTTCCGATTGTCCTTTCCCAGGCTACGGCCTTATACCAAAGACTTCTAGACCGGAGAGACTACTTCCAGCCACGAATTCGTGTGA
->read1264_contig0_position2642_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCTGAATTGGCTTTATCCACCCCCCCTACTGGCCACCACTGGGGCGCGAGTCTCGAGCCTCTCGACTCCAAAGCGTCTGCCCGAGACAGGTTCACCGAG
->read1265_contig0_position8895_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCACCGTACGAAAAGGATGGTTGAAATAGAACGAGTTGTAAAACATTAGCTCACGCGCCACCGTCATAGGCTGCATATTGAGACAGGGTTGAAAACCTGT
->read1266_contig0_position8624_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGACACTGCCTAAAGGGAACATATGTGTCCAGAATAGGGTTCAACGGTGTATGAGCAAACGATGCGGTAGGACGAGCGCTCCGACCCCCCTTGGCTCTG
->read1267_contig0_position6857_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGATAAACCATACATTTAACCCTTAGTCATAAGATGATACTTCATCTGCATGCGCGCATCTTCCTATTTTATGGTCTTAATTGAGTGTTCAGAGTTGGGG
->read1268_contig0_position8877_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCTAATAAACCGGTGCATCACCGTACGAAAAGGATGGTTGAAATAGAACGAGTTGTAAAACATTAGCTCACGCGCCACCGTCATAGGCTGCATATTGAG
->read1269_contig0_position6618_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTCCACATGGAGCGATGGGTCCTCAAGGCAGTATAAAATGGACTGCTATCTAGGCGTTAAAGTAGTAGAACGAGGGTCGGGCGATTTGTTTTGGTAGTG
->read1270_contig0_position4551_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCTGCGACGGCATTGGCGATTATGGGCGTGCATAGAGTCCCGCAGTGTCGGAGCGATAGGGAGGACGTAAACGCCAATTCCGCTTAATAGCGGAATCTG
->read1271_contig0_position9583_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCGGGACAAACACTCGATTGAGCAGTGGTCATGTCATTATTGTACATCAGTACCATAGCTTGGCCACATGTGATGCTCGTACTCGAAGGGGGAATCACC
->read1272_contig0_position7212_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGCCAAAAATTCGACCTGTCCACCTGTCTGCTAGAAGCAGATTATACGGATTACATATCCCGACACCGGCAGCTGAAATGATGCAGAAGCCTTGCTTGC
->read1273_contig0_position5397_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCAGCAAGACGGGCGACCGTACCCGGACACCTGGCAGCGGGAACCGCTTTGACTCTGGAGTGCCAGCGATAGTATCTCAGAGGCGAAAGCGCTTGTCAC
->read1274_contig0_position9036_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTATGCATACTCGTTTAGTACAGGGCCGCGCCCCATGAGGCCATATGCGCCTGTCACGGGCATGCTGAAAGCGGCGGTTACATTAATCGCTTCTGTGATG
->read1275_contig0_position6021_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CAACACGTACGTTGACAGAGCTAACAATCCGTCGACTGAATGTGATTCCTTTGTTATTTCACACTATTGTTCGGTGCGTGCGCTGCTCAGGCTGGTGCGA
->read1276_contig0_position4079_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGATTACTATAAATCAGCGAATCTAACATCGATCTGCACCACGAATATCGTCCAAGACGTTTTGAGCCGGTGACTAATTCGGTTGTCGCACATAGTGTAC
->read1277_contig0_position4508_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCGCCCTCGGCTAATCATGAACACCGGTCAGGCATGCTTACCTCCTGCGACGGCATTGGCGATTATGGGCGTGCATAGAGTCCCGCAGTGTCGGAGCGA
->read1278_contig0_position1499_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGGTAGGGGCGAGATATAAATTAGTGGATTCACTTCCCTTTGACATCTTGTTCTCACAACTGCACACTCCGATGCTCTGCCGAGCCTTCTAACCATCGG
->read1279_contig0_position3631_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCCACCTCCGGGTCTAGTAAACCAGAGATTCCATGGACTCTCTGTGTCGTCGATTGTCTGAATATCGTGCAGTAAGTTTCTCTTAGGTTCCTCAACGGA
->read1280_contig0_position6507_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTGCGGACAAACGGGGTGCCCGCGCCTGCGTCCGGTAGACGAGCGATGGATTTAGACCGTTCACTGAACCCTCTAATAGGACCTCTTGCCCATCCGAGG
->read1281_contig0_position1400_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGTTGGGCCAATCGAGAGGACATTTCACAGCGCCCTTTCATCTCTATTGCTAGGTCTCTTAAGCCTAATCAGGATCATAGATGGCCAATTATTGACCAC
->read1282_contig0_position6403_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AATGCCTGTCCACCGGGGGTACTACTGTACCACAGTGGCCTGGATAGCTAAGCAGGTCCTGGATTGGCATGTCATCCGGAGTGATAGGCACTGCTCACGA
->read1283_contig0_position5489_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTGTCACCTCATCTAAAATCGCGACTATAGATCTGTTTAGAACCACGACCCAGAAATCTTTAGCTAAGTAATCGACTGCCTTCGTCGGGCCGCATATTG
->read1284_contig0_position4344_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCATGGAAAGTGCCAATATCCCCGGGAGTCCCGCACTACTGAGACGAAGTCTAGCTAGCTTGACTCGGCTGATAAGGAAAACAATCTATATGGAACCGAG
->read1285_contig0_position2528_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TACCTCCGGCATATGGGCGTGCTATAAATGCGGGAGTCAGGACGATAGAGCGAAGTAGTTACGGTGATTACCCGTCCATCGATGCCCCTCCTGTCCCGAA
->read1286_contig0_position3949_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTGTTACTGAAGTCGGCATGACTATCAAACCTATTTAATGATATATGCTCTTGGACAACACGAGGTCGTAATTATTTCCTGAGATGGTTTTAGTGAGAG
->read1287_contig0_position3667_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GACTCTCTGTTTCGTCGATTGTCTGAATATCGTGCAGTAAGTTTCTCTTAGGTTCCTCAACGGAAACGTCTCAGACCCACCTTAGACGCGGGAATAAATT
->read1288_contig0_position8267_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AATCGTTGCACATGACTTGAGGCTCGGACTCGTATCTGTCTCCGTGTTCCTTTCGATAACTATGCGACCTGAATGACCTTGGGCTCGTCGACATTCCTGG
->read1289_contig0_position9554_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GATCCTGAGCTCCCCCGCGATTAACCTATATCGGGACAAACACTCGATTGAGCAGTGGTCATGTCATTATTGTACATCAGTACCATAGCTTGGCCACATG
->read1290_contig0_position9213_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCCGGTCGGAACCGCTGGCAGAGCAGCTCCGAGGGCCTTTATACCCATACTGCCACTCCAGTACCTGGGCCGCGTGTTGTACGCTGTGTATCTTGAGAG
->read1291_contig0_position9381_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCACACAGTTAGCCGAACAGGTATTACTCAGACTGGAGAGGAATCTTCATTGGTCGTGCAGACATTGTCGCTGCGTACCAAAGTAACTGGACGCCCATA
->read1292_contig0_position4989_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGCAGAATGGGCGATCGGCCTACAAGAGTACAGTACTAACGGTCTGGCCTTATACAGCGCCACATCCGCCAATTCGCTAGGTTGTAGCCAGGAAGTCTG
->read1293_contig0_position4244_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACAGGTTCGACCATACGCGACGGCAAACAGAATCGCACGTCAACTATCCCCTTTATTAATGATCCGTGTCCCCCGACCGTGTGCTGAGGAGACCCGTAAT
->read1294_contig0_position8198_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GATGGACTCATTGACCAATCCCTATTATTAGGAAAGGGCTGCGACTGCTTGCAGCTCCGACCGCTTTCCAATCGTTGCACATGACTTGAGGCTCGGACTC
->read1295_contig0_position3597_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CATGTAAGAAGTATCCATCCCTACCACACGCGTCCGCCACCTCCGGGTCTAGTAAACCAGAGATTCCATGGACTCTCTGTTTCGTCGATTGTCTGAATAT
->read1296_contig0_position711_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGTAGAAGCACCCACGATCAATGTTATTAACCGCGACGGTGTATTCCACGACCTAATTTTTCCCGTCTCTGTGGTCAACCTGGACGCACAAACCCTAGT
->read1297_contig0_position5865_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCATATAACAGCTGATTTAAGAGGAAAAATTGAACATCAACGGAAGTACTATAGCAGGCTCACCAGCATGAAAGACATCCTCATTGTGAACCCGGCATCT
->read1298_contig0_position800_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CAAACCCTAGTCCCATATAAAGCTATTCCACGCAGGGTGGCCTGGACGTCGTTTGTGGATGGCTTTGGGAATCACTTGGTAATTACTGTTGGCTCCTTTC
->read1299_contig0_position722_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCACGATCAATGTTATTAACCGCGACGGTGTATTCCACGACCTAATTTTTCCCGTCTCTGTGGTCAACCTGGACGCACGAACCCTAGTCCCATATAAAG
->read1300_contig0_position3722_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCAACGGAAACGTCTCAGACCCACCTTAGACGCGGGAATAAATTCGACACGGGGTACGAAGGGTAAGAACACCTAGCCTGGCAATTACCCCTTTGTTAT
->read1301_contig0_position4325_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCTGAGGAGACCCGTAATGCATGGAAAGTGCCAATATCCCCGGGAGTCCCGCACTACTGAGACGAAGTCTAGCTAGCTTGACTCGGCTGATAAAGAAAA
->read1302_contig0_position3055_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTAGCGGGTGTCGTCAATGAAAACTGATCGAGCACTGTCCGCGAAACATTATTCAGTACAGCGACTTTTACCCTCGTGGTCTGAATGTTATGGCGTCCGA
->read1303_contig0_position8887_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGGTGCATCACCGTACGAAAAGGATGGTTGAAATAGAACGAGTTGTAAAACATTAGCTCACGCGCCACCGTCATAGGCTGCATATTGAGACAGGGTTGA
->read1304_contig0_position9412_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GACTGGAGAGGAATCTCCATTGGTCGTGCAGACATTGTCGCTGCGTACCAAAGTAACTGGACGCCCATACCCCTTTGTCTACAGAAGCTCATGGATAAGA
->read1305_contig0_position7596_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GACTGACTATCACGAGGAATTACGGATAACAGCCCACTTGGAGTGTGCTGAGGGCCGACGCCCGGGGACCGTGATATCCTTGCGAGTGGAATGCGAAAAC
->read1306_contig0_position8251_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTCCGACCGCTTTCCAATCGTTGCACATGAATTGAGGCTCGGACTCGTATCTGTCTCCGTGTTCCTTTCGATAACTCTGCGACCTGAATGACCTTGGGC
->read1307_contig0_position3074_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAAACTGATCGAGCACTGTCCGCGAAACATTATTCAGTACAGCGACTTTCACCCTCGTGGTCTGAATGTTATGCCGTCCGACTCTTGCGCTCGGATGTCC
->read1308_contig0_position2091_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCAGGCAGTCGCTGCATGTGTACGCAGCGGTCTATGCTACAGGTATTACGGAGTGAAACGGCTGCGAGCATCTCATAATCGGGCCACCCGATTTCAGCTT
->read1309_contig0_position8372_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCCGATCTCAATTCCTGCGGTACCGAGCAGCTTTGAGTTTTTGTAAGTCCCACGGTTAATGGGCCACTTATTTCGACATTCATGGCGCCGATATCCTGC
->read1310_contig0_position1111_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTAGAGAGCCTTTGAATGTGTACGGCAATAGGAGAAACTCGGCCACGTACGTGTCAACATGGCGCGGCTCTCTATACCTCGCAAAGAATCACTCTATGGG
->read1311_contig0_position167_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGTGGCCTCCAGATAGTGTCCAGTCGCTCTAACTGTATGGAGACCATAGGCATTTACCTTATTCTCATCGCCACGCCCCAAGATCTTTAGGACCCAGCA
->read1312_contig0_position6230_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GACGAGTGGGGTCAACAGTTCTTCTTCTTTCCTGTACGGTAATGCTTCCGCGCATCTAAGTGATATTCGCCGGAATTTACCCTTCTAATATTGTGTGCAA
->read1313_contig0_position8510_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGCGAGAAGTTATAGTCTAATAATGAATGGTGAACAGCACATCTTTTCGTCCTGAGGCCACATTAATTCTACTCAGATTGTCTGTAACCGGAGCTTCGG
->read1314_contig0_position153_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCGTCCGATGGTCCGCTGGCCTCCAGATAGTGTCCAGTCGCTCTAACTGTATGGAGACCATAGGCATTTACCTTATTCTCATCGCCACGCCCCAAGATC
->read1315_contig0_position3594_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCCATGTAAGATGTATCCATCCCTACCACACGAGTCCGCCACCTCCGGGTCTAGTAAACCCGAGATTCCATGGACACTCTGTTTCGTCGATTGTCTGAA
->read1316_contig0_position9400_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGTACTACTCAGACTGGAGAGGGATCTTCATTGGTCGTGCAGACATTGTCGCTGCGTATCAAAGTAACTGGACGCCCATACCCCTTTGTCTACAGAAGC
->read1317_contig0_position7199_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGTCAATCGGGTTGGCCAAAAATCCTACCTGTCCACCTGTCCGCTAGAAGCAGATTATACGGAATACATATCCCGACACCGGCAGCTGAAATGATGCAG
->read1318_contig0_position5283_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCATCATCATAGTAAATTTTTTCAGATTACCCTGCAGACGTCCGCCTAAGATCCTAGTTGAATTGATCAATTGAGTACAGTACACCATATCAACAGCTTG
->read1319_contig0_position7812_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAAGCGGAGCCACACTCGCCGTTACTGACTGATTGACAATCCAGCCCGTTTGGGGTGATTTGTGCCGGCGCGTCCAGGTGCGAACGTTGTGCCGTGTCA
->read1320_contig0_position8840_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCAGTTTATTGTTAACACGCGATACAAGAGGGTTAGGAGCTAAGAAACCGGTGCATCACCGTACGAAAAGGATGGTTGAAATAGAACGAGTTGTAAAACA
->read1321_contig0_position7644_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGAGGCCCGACGCCCGGGGACCGTGATATCCTTGCGAGTGGAATGCGAAAACGGCATAAGCGCAATGACCGAGGTAACAAGCCATGAGGACTGGAGCGGT
->read1322_contig0_position6241_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCAACAGTTCTTCTTCTTTCCTGTACGGTAATGCTTCCGCGCATCTAAGTGACATTCGCCGGAATTTACCCTTCTAATATTGTGTGCAAGCTACTTCTAG
->read1323_contig0_position2634_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAATCTAACCCTGAATTGGCTTTATCCACCCCCCCTACTGGCCACCACTGGGGCGCGAGTCTCGAGCCTCTCGACTCCAAAGGGTCTGCCCGAGACAGGT
->read1324_contig0_position4766_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCAGTAGGTTACCGTCGGCGCATAACCGGCGAGTGCTCTGAAACGTTACATTCGTCTATCCGCACACACCGCCGTTGGATGTGTCCCACAGTGTTTTATA
->read1325_contig0_position2367_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GACTAAAACAGTATTGGGCGGTGAGGGGTACCCGACGCCTCTGCTGTCAAAGTGGGAAATCCAGTCTCGACTATATCTACTATGTCATGCTTGTCGAATG
->read1326_contig0_position496_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTACGCCTCGATTGGTTTCAGCTCACGTGGGACGCATGTACTTGCCTAACATGAAGCGGTAATGGAGCTCGAACACTAGTCGGTGGCTCTTCTGTCTCTG
->read1327_contig0_position6033_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGACAGAGCTAACAATCCGTCGACTGAATGTGATTCCTTTGTTATTTCACACTATTGTTCGGTGCGTGCGCTGCTCAGGCTGGTGCGACCCTTACAGCGT
->read1328_contig0_position7355_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGCGGCAATGGAGAACCGCGGAAGGAACACTTTCTGGTGCCACTCGTGACCGCACTCCCCGACCCATATGCAGTTTCTGCATACACCGGGTAGACAACA
->read1329_contig0_position1416_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGGACATTTCGCAGCGCCCTTTCATCTCTACTGCTAGGTCTCTTAAGCCTAATCAGGATCATAGATGGCCAATTATTGACCACAGGTAGGGGCGAGGTA
->read1330_contig0_position9661_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGTACTCGAAGGGGGAATCACCTTACTTAATCGGCTGGGGTAACGGCTGGTTTTGTACTACGGTATGGGAACCCGTTTGCCGAACGTCTGGAAATCTGTC
->read1331_contig0_position9332_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTCCGCTGTAAAGAACCTGGCGTATCCTGACCATGGAGCTGCAACACTTTCACACAGGTAGCCGAACAGGTATTACTCGGACTGGAGAGGAATCTTCAT
->read1332_contig0_position8954_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCGTCATAGGCTGCATATTGAGACAGGGTTGAAAACCTGTCTGAAGTCCGTGCTTCCCTAACCAGCCTATGCGCCTTAACTTTATGCTAACTCGTTTAG
->read1333_contig0_position42_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCTACCGTTTCCTTTAACCTGCCAGACGGTGACCAGGGCCGTTCGGCGTTGCATCGAGCGGTGACGCTAGCGCAATGCGCAAGATTTTGACATTTACAA
->read1334_contig0_position2151_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTGCGAGCATCTCATAATCGGGCCACCCGATTTCAGCTTGGCCACAACAGAGACTAGCCACCAAGAGATGGGTTGACGGTAGCATCCCGGCTTCTGGGG
->read1335_contig0_position6455_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGGTCCTGGATTGGCATGTCATCCGGAGTGATAGGCACTGCTCACGACCAGCTAGCGGACAAACGGGGTGCCCGCGCCTGCGTCCGGTAAACGAGCGAT
->read1336_contig0_position7915_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTAGCTCTAATACCAATTGAAATGAAGCTTACGCAAACTACTCGACGAACAACAGCAAGATTCGACGATCAAACTCGCCGGCGACACGAAGATTGTCAT
->read1337_contig0_position9117_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTAATCGCTTCTGTGATGACAGACCGAAGCCCACCTGTCCTGAGCTCACCGCAGGCATCGAGTCTAACTCTGATTCGAGATACGGATGTAATTTAGTCA
->read1338_contig0_position2686_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGCGAGTCTCGAGCCTCTCGACTCCAAAGGGTCTGACCGAGACAGGTTCACCGAGTCGTTACTCCCGGGATCCACTGCGTCTATTGTAAGAAATCCAAT
->read1339_contig0_position5037_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTTATACAGCGCCACATCCGCCAATTCGCTAGGTTGTAGCCAGGAAGTCTGTAGTACAGGTGCCCATAACACGATGAGGCCAAGGTGTTACGTGAAGTC
->read1340_contig0_position3340_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAAAGCTGAACAACGGATGGGATTAAGCTCAGCAGTCCGCCTCCAATCGCGCCGACGTTCATTCTCAAGGGTGTAGTTTTAGAGACTGAGAACTCACCC
->read1341_contig0_position2004_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGAAGGCTGCGCATCGAGCAGCGTGCATTGGTCTTTCAGTCCCCAGTCACCGGATACGTCTGAGCTCGAACCCGTCCGGCTAAGAGGCAGGCAGTCGCT
->read1342_contig0_position747_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGGTGTATTCCACGACCTAATCTTTCCCGTCTCTGTGGTCAACCTGGACGCACAAACCCTAGTCCCATATAAAGCTATTCCACGCCGGGTGGCCTGGAC
->read1343_contig0_position7475_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAGAATACAAATGACGGGAACTCTGACGAGAGGGTGCGTGAACGAGAGAAGCCAACAGTCATTGCGATGACGAGAACAGCCCTACTGCCCGCCGTGAAC
->read1344_contig0_position154_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGTCCGATGGTCCGGTGGCCTCCAGATAGTGTCCAGTCGCTCTAACTGTATGGAGACCATAGGCATTTACCTTATTCTCATCGCCACGCCCCAAGATCT
->read1345_contig0_position3752_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGCGGGAATAAATTCGAAACGGGGTACGAAGGGTAAGAACACCTAGCCTGGCAATTACCCCGTTGTTATTCTAGTCAAGTGAAGAACCCGGGCCCAAAA
->read1346_contig0_position1205_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TATGGGTCATCTTGAGAGAATAGTCGACTAGTAGCGAATATATGTTCTGCTCCGAGACTTCGGCATAAATCTAAGTCTGGACTCTTATATTCCCTCCTGC
->read1347_contig0_position1217_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TGAGAGAATAGTCGACTTGAAGCGAATAAATGTTCTGCTCCGAGACTTCGGCATAAATCTAAGTATGGACTCTTATATTCCCTCCTGCGTAGTGCTCTCC
->read1348_contig0_position2371_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAAACAGTATTGGGCGGTGAGGGGTACCCGACGCCTCTGCTGTCAAAGTGGGAAATCCAGTCTCGACTATATCTACTATGTCATGCTTGTCGAATGAACA
->read1349_contig0_position4994_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAATGGGCGATCGGCCTACAAGAGTACAGTACTAACGGTCTGGCCTTATACAGCGCCACATCCGCCAACTCGCTAGGTTGTAGCCAGGAAGTCTGTAGTA
->read1350_contig0_position7103_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATATATCGCGGCGTCGAGTTACCGTTGCACCACCTCCAAGTGTCCATCGGAGTCCGCTTCCCGGGCTTGTCGGCGCCCCATCGGTTAATTCAATGTCCGT
->read1351_contig0_position9162_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCACCACAGGCATCGAGTCTAACTCTGATTCGAGAGACGGATGTAATTTAGTCAGGTCGGAACCGCTGGCAGAGCAGCTCCGAGGGCCTTTATACCCAT
->read1352_contig0_position6410_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCCACCGGGGGTTCTACTGTACCACAGTGGCCTGGATAGCTAAGCAGGTCCTGGATTGGCATGTCATCCGGAGTGATAGGCACTGCTCACGACCAGCTT
->read1353_contig0_position3400_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CATTCTCAAGGGTGTAGTTTTACAGACTGAGAACTCACCCTATTGGTAGTACTGCCTGCCGTCGCCTCGCGCCCATAATGTTTGGAACTCGCAAACCTTT
->read1354_contig0_position3710_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTCTTAGGTTCCTCAACGGAAACGTCTCAGACCCACCTTAGGCGCGGGAATAAATTCGACACGGGGTACGAAGGGTAAGAACACCTAGCCTGGCAATTA
->read1355_contig0_position4606_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GATAGGGAGGACGTAAACGCCAATTCCGCTTAATAGCGGAATCTGCTGGCTTGTGCATTCGTCGGCCTATTAGATACGGTACGGAATATTGGGTAACCTC
->read1356_contig0_position1612_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTTTGGACGCTTCGATAGGACATGCACCCGGTCCGTTGACTTACCAACTTGATCGCCAGTGAGTGAGCGGTGGTTTATCTGTTGAGTGGCCACTTTTCC
->read1357_contig0_position5627_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGTTGCGTGGTCAACCGAACGTTGCTTTCCTTAGGGTACCGAGTACATTAACTTTATGAAATTAGCGCGGTAACTACTTAAAGTTCAGAAGATCACTGT
->read1358_contig0_position7386_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTCTGGTGCCACTCGAGACCGCCCTCCCCGACCCATATGCAGTTTCTGCATACACCTGGTAGACAACATTCTCAGCCCTTCGTTGAAAGGAGAATACAA
->read1359_contig0_position2000_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGGTTGAAGGCTGCGCATCGAGCAGCGTGCATTGGTCTTTCAGTCCCCAGTCACCGGAGACGTCCGAGCTCGAACCCGTCCGGCTAAGAGGCAGGCAGT
->read1360_contig0_position1343_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGTATTTTTGTACGGCTTGATGTCAGGGTCATTTTGGGCGCCGGTATGTCTGTGTAAGGTTGGGCCAATTGAGAGGACATTTAGCAGCGCCCTTTCATC
->read1361_contig0_position2251_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAATTTCTGACGATTCGAGTGACCAGCTATAGTACGTTCCTTTTGTACTGAGTCTTAACATCGGCAAATGCGCCCTAGATACCTGCGGCTTCACTCCACA
->read1362_contig0_position5071_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGTAGCCAGGAAGTCTGTAGTACAGGTGCCCGTAACCCGATGAGGCCAAGGTGTTACGTGAAGTCGCGTTGTCGCTAGTAACAGATTGGGAGGTCTCGG
->read1363_contig0_position4018_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GAATTATTTCCTGAGATGGTTTTAGCGAGAGCAGCAGATGCACTCTTAGCTCCGCTGATAACGATTACTATAAATCAGCGAATCTAACATCAATCTGCAC
->read1364_contig0_position7624_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ACAGCCCACTTGGAGTGTGCTGAGGGCCGACACCCGGGGACCGTGATATCCTTGCGAGTGGAATGCGAAAACGGCATAAGCGCAATGACCGAGGTAAGAA
->read1365_contig0_position2998_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTTTAAATTGACTTGAAACCGCCTAGCTCGGACCACCAAAGAGCAAGACTCTATGACTAGCGGGTGTCGTCAATAAAAACCGATCGAGCACTGTCCGCG
->read1366_contig0_position5276_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTGTGGCCATCATCATAGTAAATTTTTTCAGATTACCCTGCAGACGTCCGCCTAAGATCCTAGTTGAATTGATCAATTGAGTCCAGTACACCATATCAA
->read1367_contig0_position8649_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGTCCAGAATAGGGTTCAACGGTGTATGAGCAAACGATGCGGTATGACGAGCGCTCCGACCCCCCTTGGCTCTGCTACATCGAATTCAGCGTGTAAGAG
->read1368_contig0_position2111_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TACGCAGCGGTCTATGCTACAGGTATTACGGAGTGATACGGCAGCGAGCATCTCATAATCGGGCCACCCGATTTCAGCTTGGCCACAACAGAGACTAGCC
->read1369_contig0_position4504_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTCTCCGCCCTCGGCTAATCATGAACACCGGTCAGGCATGCTTACCTCCTGCGACGGCATTGGCGATTATGGGCGTGCATAGAGTACCGCAGTGTCGGA
->read1370_contig0_position3494_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCTTTACACTCATCACATAGCAGGTTCCACCCGAAGCGCGCGTATTCTGCGACAGCATGAATCGTGTAACTCTGCTCGGTTATACGCCCTCGGGAGAAG
->read1371_contig0_position478_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTACGCTTTGTCCTCTGCTACGCCTCCATTGGTTTCAGCTCACGTGGGACGCATGTACTTACCTAACATGAAGCGGTAATGGAGCTCGAACACTAGTCG
->read1372_contig0_position5492_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCACCTCATCTAAAATCGCGACTATAGATCTGTTTAGAATCACGACCCAGAAATCTTTAGCTAAGTAATCGACTGCCTTCGTCGGGCCGCTTATTGGTT
->read1373_contig0_position9407_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTTAGACTGGAGAGGAATCTTCATTGGTCGTGCAGACATTGTCGCTGCGTACCAAAGTAACTGGACGCCCATACCCCTTTGTCTACAGAAGCTCATGGA
->read1374_contig0_position9413_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTGGAGAGGAATCTTCATTGGTCGTGCAGACATTGTCGCTGCGTACCAAAGTAACTGGACGCCCATACCCCTTTGTCTACAGAAGCTCATGGATAAGAG
->read1375_contig0_position915_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTCTTTCAGGCCGATCAAGTGGTTAGAGACCTAGGTCTATGCCAGACGATCGCAGCGGGGTCGAAATAATTGCAGTATCATGTATCGCTGATTGTGGGG
->read1376_contig0_position4322_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGTGCTGAGGAGACCCGTAATGCATGGAAATTGCCAATATCCCCGGGAGTCCCGTACTACTGAGACGAAGTCTAGCTAGCTTGACTCGGCTGACAAAGA
->read1377_contig0_position2345_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCACAGTGTAAGAGTTGACGGGACTAAAACAGTATTGGGCGGTGAGGGGTACCCGACGCCTCTGCTGTCAAAGTGGGAAATCCAGTCTCGACTATATCT
->read1378_contig0_position6155_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCACTCATAAGGCACGCGCGGGCCATAACAGTCGACTAAAAGGCGTAACCGATTCTGCTACGTTATAAAAAAGGGACGAGTGGTGTCAACAGTTCTTCT
->read1379_contig0_position7323_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTCTAAAAGCGCCAGATCGACTTGACTCTACGTGCTGCAATGGAGAACCGCGGAAGGAACACTTTCTGGTGCCACTCGAGACCGCCCTCCCCGACCCAT
->read1380_contig0_position2153_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCGAGCATCTCATAATCGGGCCACCCGATTTCAGCTTGGCCACAACAGAGACTAGCCACCAAGAGATGGGTTGATGGTAGCATCCCGGCTTCTGGGGCA
->read1381_contig0_position6716_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGTTATCGCATTGCAAGAACGTACGGACGGACAAAATGTCGGACACCGCCTTATCGGCTATACTAGTTCGAGCCTCGCTTGGGTCTCTACATCCGCTGA
->read1382_contig0_position3926_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTAAGCATAGAATGCACGACTACTTGTTACTGAAGTCGGCACGACTATCAAACCTATTTAATGATATATGCTCTTGGACAACACGAGGTCGTAATTATT
->read1383_contig0_position1183_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TAAACCTCGCAAAGAATCAGTCTATGGGTCATCTTGAGAGAATAGTCGACTAGTAGCGAATATATGTTCTGCTCCGAGACTTCGGCATAAATCTAAGTAT
->read1384_contig0_position5186_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GATTGCTGTGCACTTTAAAATTCGGAACATCTTAACCAAAGCATATTAATATGCCAGCCGCGCAGGCTGGTATATATGATCCTTGATAGCTTTATGGCCA
->read1385_contig0_position7604_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCACGAGGAATTACGGATAATAGCCCACTTGGAGTGTGCTGAGGGCCGACGCCCGGGGACCGTGATATCCTTGCGAGTGGAATGCGAAAACGGCATAAG
->read1386_contig0_position5419_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCGGACACCTGGCAGCGGGAACCGCTTTGACTCTGGAATGCCAGCGATAGTATCTCAGAGGCGAAAGCGCTTGTCACGTCATCTAAAATCGCGACTATA
->read1387_contig0_position1297_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTCCTGCGTAGTGCTCTCCCATAATAAGTGAACCCATGGGTCGCGCTGTATTTTTGTACGGCTTGATGTCAGGGTCAGTTTGGGTGCCGGTATGTCTGT
->read1388_contig0_position4942_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGACGCGGAAGCGCACCTCGTATAACGTTAGGGGTATCGTCACTGCATAGCAGAATGGGGGATCGGCCTACAAGAGTACAGTACTAACGGTCTGGCGTTA
->read1389_contig0_position1815_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCATACAAGTTAGGCGGCCCACAAATCGCCGTGTGTATTTGTTCAATGGCAGGAGGTTAACTTTGCGGAGCTCAACCGATAACGATAATCAACTTGAGA
->read1390_contig0_position4396_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCTAGCTTGACTCGGCTGATAAAGAAAACAATCTATATGGAACCGAGGGGCGGGATGATAATTGTTCTTAGTATAGTGACCGTTATGGACGACGGACAT
->read1391_contig0_position1318_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATAATAAGTGAACCCATGGGTCGCGCGGTATTTTTGTACGGCTTGATGTCAGGGTCAGTTTGGGCGCCGGTATGTCTGTGTAGGGTTGGGCCAATCGAGA
->read1392_contig0_position7658_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGGGACCGTGATATCCTTGCGAGTGGAATGCGAAAACGGCATAAGCGCAATGACCGAGGTAACAAGCCATGAGGACTGGAGCGGTAATGTGGTAGTGTA
->read1393_contig0_position912_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAGTTCTTTCAGGCCGATCAAGTGGTTAGAGACCTAGGTCTATGCAAGACGATCGCAGCGGAGTCGATATAATTGCAGTATCATGTATCGCTGATTGTG
->read1394_contig0_position4851_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCACAGTGTTTTATACGGGACGGTGGCCACGGGGTGAGCACATGAATGGGGTACGGTTTTACCGTCCATGACGTTGTGACATAAAGGTGCGGGACGCGGA
->read1395_contig0_position4809_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGTTACATTCGTCTATCCGCACACACCGCCGTTGGATGTGTCCCACAGTGTTTTATACGGGACGGTGGCCACGGGGTGAGCACATGAATGGGGTACGATT
->read1396_contig0_position9212_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTCAGGTCGGAACCGCTGGCAGAGCAGCTCCGAGGGCCTTTATACCCATACTGCCACTCCAGTACCTGGGCCGCGTGTTGTACGCTGTGTATCTTGAGA
->read1397_contig0_position5178_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTGTATTGATCGCTGTGCACTTTAAAATTCGGAACATCTTAACCAAAGCATATTAATATGCCAGCCGCGCAGGGTGGTATATATGATCCTTTATAGCTT
->read1398_contig0_position804_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCTAGTCCCATATAAAGCTATTCCACGCCGGGTGGCCTGGACGTCGTTTGTGGATGGCTTTGGGAATCACTAGGTAATTACTGTTGGCTCCTTTCTTCA
->read1399_contig0_position1261_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTTCGGCATAAATCTAAGTATGGACTCTTATATTCCCTCCTGCGTAGTGCTCTCCCATAATAAGTGAACCCATGGGTCGCGCTGTATTTTTGTACGGCT
->read1400_contig0_position1786_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AACTCCACTTCTGCAAATTGTTATGAGCAAGCATACAAGTTAGCCGGCCCACAAATCGACGTGTGTATTTGTTCAATGGCAGGAGGTTAACTTTGCGGAG
->read1401_contig0_position8393_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TACCGAGCACCTTTGAGTTTTTGTAAGTCCCACGGTTAATGGGCCACTTATTTCGACATTCATGGCGCCGATATCCTGCTTAGGCAGTACAGCCAATGCA
->read1402_contig0_position3879_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCGGATCATGCAAACCTGATTATCTGCACGACTCTTAAAATCATGCACTAAGCATAGGATGCACGACTACTTGTTACTGAAGTCGGCATGACTATCAAA
->read1403_contig0_position3164_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGGATGTCCGCAATGGGTTATCAAATGCCTATGTTCCGGTAATCTCTCATCTACTAAGCGCCCTCAAGGTCGTATGGTTGGAGGGCGGTTACACACCCT
->read1404_contig0_position3385_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AATCTCTCCGACGTTCATTCTCAAGGGTGTAGTTTTAGAGACTGAGAACTCACCCTATTGGTAGTACTGCCTGCCGTCGCCTCGCGCCCATAATGTTTGG
->read1405_contig0_position9492_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACAGAAGCTCATGGATAAGAGTGTGCGAATAACATCACTTGTTACTTCACGGAACGCTTCTTGATCCTGAGCTCCCCCGCGATTAACCTATGTCGGGACA
->read1406_contig0_position5827_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCATATCGCCTTCTCAGATAGACTAATAGAACGAAGTCCATATAACAGCTGATTTAAGAGGAAAAATTGAACATCAACGGAAGTACTATAGCAGGCTCA
->read1407_contig0_position450_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTAGCGTAGTTAGTAACTTCAATCCGCGTTACGCTTTGTCCTCTGCTACGCCTCGATTGGGTTCAGCTCACGTGGGACGCATGTACTTACCTAACATGA
->read1408_contig0_position2134_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TATTACGGAGTGAAACGGCTGCGAGCATCTCATAATCGGGCCACCCGATTTCAGCTTGGCCACAACAGAGACTAGCCACCAAGAGATGGGTTGATGGTAG
->read1409_contig0_position625_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCAATGTCGAAACTCCGATGGGCAGAAGCTAAAACTGAACAACGAGTGGGACACCGGCCTACTACATTATACAGTAAGGTAGAATCGCGTAGAAGCACCC
->read1410_contig0_position6672_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGTTAAAGTAGTAGAACGAGGGTCGGGCGATTTGTTTTGGTAGTGGTTATCGCATTGCAAGAACGTACGGACGGACAAAATGTCGGACACCGCCTTATC
->read1411_contig0_position5313_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCGCAGACGTCCGCCTAAGATCCTAGTTGAATTGATCAATTGAGTCAAGTACACCATATCAACAGCTTGATCGTTCCACTTCAATCAGCAAGACGGGCG
->read1412_contig0_position7687_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCGAAAACAGCATAAGCGCAATGACCGAGGTAACAAGCCATGAGGACTGGAGCGGTAATGTGGTAGTGTAGTTGCCGGCCCCTGTGCTGACCTTATGTC
->read1413_contig0_position7674_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTGCGAGTAGAATGCGAAAACGGCATAAGCGCAATGACCGAGGTAACAAGCCATGAGGACTGGAGCGGTAATGTGGTAGTGTAGTTGCCGGCCCCTGTG
->read1414_contig0_position3657_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGATTCCATGGACTCTCTGTCTCGTCGATTGTCTGAATATCGTGCAGTAAGTTTCTCTTAGGTTCCACAACGGAAACGTCTCAGACCCACCTTAGACGCG
->read1415_contig0_position1182_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTATACCTCGCAAAGAATCACTCTATGGGTCATCTTGAGAGAATAGTCGACTAGTAGCGAATATATGTTCTGCTCCGAGACTTCGGCATAAATCTAAGTA
->read1416_contig0_position6610_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGCAGCGACTCCACATGGAGCGATGGGTCCTCAAGGCAGTATAAAATGGACTGCTATCTAGGCGTTAAAGTAGTAGAACGAGGGTCGGGCGATTTGTTT
->read1417_contig0_position9043_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TACTCGTTTAGTACAGGGCCGCGCCCCATGAGGCCATATGCGCCTGTCACGGGCATGCTGAAAGCGGCGGTTACATTAATCGCTTCTGTGATGGCAGACC
->read1418_contig0_position3190_M6_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCCTATGTTCCGGTAACTCCTTATCTACTAAGCGCCCTAAGGGTCGTATGGTTGGAGGGCGGTTACATACCCTTAAGTACCGAACGATAGAGCACCCGT
->read1419_contig0_position6882_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCATACGATGATACTTCATCTGCATGCGCGCATCTTCCTATTTTATGGTCTTAATTGAGTGTTCAGAGTTGGGGGTCACAGATGAGCGTTCCGATTGTC
->read1420_contig0_position3791_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACACCTAGCCTGGCAATTACCCCTTTGTTATTCTAGTCAAGTGAAGAACCCGGGCCCAAAATTGGAACCCGTAATCTTCAAGTGAATCATCCGATCATGC
->read1421_contig0_position1166_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AACATGGCGCGGCTCTCTATACCTCGCAAAGAATCACTCTATGGGTCATCTTGAGAGAATTGTCGACTAGTAGCGAATATATGTTCTGCTCCGAGACTTC
->read1422_contig0_position7062_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTAAACAGTCTAATCTGGCCAATATACCCTGGGGGGAGCTAATATATCGCGGCGTCGAGTTACCGTTGCACCACCTCCAAGTGTCCATCGGAGTCCGCTT
->read1423_contig0_position3802_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCAATTACCCCTTTGTTATTCGAGTCAAGTGAAGAACCCGGGCCCTAAATTGGAACCCGTAATCTTCAAGTGAATCATCCGATCATGCAAACCTGATTA
->read1424_contig0_position3947_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TACTTGTTACTGATGTCGGCATGACTATCAAACCTATTTAATGATATATGCTCTTGGACAACACGAGGTCGTCATTATTTCCTGAGATGGTTTTAGTGAG
->read1425_contig0_position5860_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAAGTCCATATAACAGCTGATTTAAGAGGAAAAATTGAACATCAACGGAAGTACTATAGCAGGCTCACCAGCATGAAAGACATCCTCAGTGTGAACCCGG
->read1426_contig0_position9535_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTTCACGGAACGCTTCTTGATCCTGAGCTCCCCCGCGATTAACCTATGTCGGGACAAACACTCGATTGAGCAGTGGTCATGTCATTATTGTACATCAGT
->read1427_contig0_position5708_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGTTCAGAAGATCACTGTCCGCCTCGAACCACTACAATAAGATTACGGATAGCCCGTGGCTTGGTTGTTTTCTGAATTGTGGCTATCTCAAATTGGGAC
->read1428_contig0_position2881_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCACGGGGGCTACAATCCAGCAGGGAACGCGTTTACCTTAAGACGAAAGAGTCAGTAGAGTTGGGGTTCGTGCTTTAATGACCCGTAGCCCAATTGCGC
->read1429_contig0_position2349_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGTGTAAGAGTTGACGGGACTAAAACAGTATTGGGCGGTGAGGGGTACCAGACGCCTCTGCTGTCAAAGTGGGAAATCCAGTCTCGACTATATCTACTA
->read1430_contig0_position9138_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGACCGAAGCCCACCTGTCCTGACCTCACCGCAGGCATCGAGTCTAACTCTGATTCGAGAGACGGATGTAATTTAGTCAGGTCGGAACCGCTGGCAGAGC
->read1431_contig0_position580_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCTCTTCTGTCTCTGGCGGGGACGGCTATGTGAGTTCATAAATCTCAATGTCGAAACTCCGATGGGCAGAAGCTAAAATTGAACAACGAGTGGGACACC
->read1432_contig0_position1307_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTGCTCTCCCATAATAAGTGAACCCATGGGTCGCGCTGTATTTTTGTACGGCTTGATGTCAGGGTCAGTTTGGGCGCCGGTATGTCTGTGTAAGGTTGG
->read1433_contig0_position7315_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCGCCGATGTCTAAAAGCGCCAGATCGACTTGACTCTACGTGCTGCAATGGAGAACCGCGGAAGGAACACTTTCTGGTGCCACTCGAGACCGCCCTCCC
->read1434_contig0_position9403_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TATTACTCAGACTGGAGAGGAATCTTCATTGGTCGTGCAGACATTGTCGCTGCGTACCAAAGTAACTGGACGCCCATACCCCTTTGTCTACAGAAGCTCA
->read1435_contig0_position4063_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTAGCTCCGCTGATAACGATTACTATAAATCAGCGAATCTAACATCAATCTGCACCACGAATATCGTCCAAGACGTTTTGAGCCGGTGACTAATTCGGTT
->read1436_contig0_position9180_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTAACTCTGATTCGAGAGACGGATGTAATTTATTCAGGTCGGAACCGCTGGCAGAGCAGCTCCGAGGGCCTTTATACCCCTACTGCCACTCCAGTACCT
->read1437_contig0_position7869_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GATTTGTGCCGGCGCGTCCAGGTGCGACCGTTGTGCCGTGTCAGTCTGTAGCTCTAATACCAATTGAAATGAAGCTTACGCAAACTACTCGACGAACAAC
->read1438_contig0_position786_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TCAACCTGGACGCACAAACCCGAGTCCCATATAAAGCTATTCAACGCCGGGTGGCCTGGACTTCGTTTGTGGATGGCTTTGGGAATCACTAGGTAATTAC
->read1439_contig0_position4048_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCAGCAGATGCACTCTTAGCTCCGCTGATAACGATTACTATAAATCAGCGAATCTAACATCAATGTGCACCACGAATATCGTCCAAGACGTTTTGAGCCG
->read1440_contig0_position1568_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGATGCTCTGCCGAGCCTTCTAACCATCGGGTATGTACATTCACCATTGGACGCTTCGATAGGACATGCACCCGGTCCGTTGACTTACCAACTTGATCG
->read1441_contig0_position6596_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCATCCGAGGCTTAAGCAGCGACTCCACATGGAGCGATGGGTCCTCAAGGCAGTATAAAATGGACTGCTATCTAGGCGTTAAAGTAGTAGAACGAGGGT
->read1442_contig0_position8257_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCGCTTTCCAATCGTTGCACATGACTTGAGGCTCGGACTCGTATCTGTCTCCGTTTTCCTTTCGATAACTCTGCGACCTGAATGACCTTGGGCTCGTCG
->read1443_contig0_position561_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCTCGAACACTAGTCGGTGGCTCTTCTGTCTCTGGCGGGGACGGCTATGTGAGTTCATAAATCTCAATGTCGAAACTCCAATGGGCAGAAGCTAAAACT
->read1444_contig0_position6619_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCCACATGGAGCGATGGGTCCTCAAGGCAGTATAAAATGGACTGCTATCTAGGCGTTAAAGTAGTAGAACGAGGGTCGGGCGATTTGTTTTGGTAGTGG
->read1445_contig0_position6690_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGGGTCGGGCGATTTGTTTTGGTAGTGGTTATCGCATTGCAAGAACGTACGGACGGCCAAAATGTCGGACACCGCCTTATCGGCTATACTAGTTAGAGC
->read1446_contig0_position8488_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGCACGACCCTTTATGACCCCTAGCGAGGAGTTATAGTCTAATAGTGAATGGTGAACAGCACATCTTTTCGTCCTGAGGCCATATTAATTCTACTCAGA
->read1447_contig0_position871_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCACTAGGTAATTACTGTTGGCTCCTTTCTTCATGATCGTCGGAGTTCTTTCAGGCCGATCAAGTGGTTAGAGACCTAGGTCTATGCCAGACGATCGCAG
->read1448_contig0_position6171_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGCGGGCCATAACAGTCGACTAAAAGGCGTAACCGATTCTGCTACGTTATAAAAAAGGGACGAGTGGGGTCAACAGTTCTTCTTCTTTCCTGTACGGTA
->read1449_contig0_position6603_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGGCTTAAGCAGCGACTCCACATGGAGCGATGGGTCCTCAAGGCAGTATAAAATGGACTGCTATCTAGGCGTTAAAGTAGTAGAACGAGGGTCGCGCGA
->read1450_contig0_position3357_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGGGATTAAGCTCAGCAGTCCGCCTCCAATCTCTCCGACGTTCATTCTCAAGGGTGTAGTTTTAGAGAATGAGAACTCACCCTATTGGTAGTACTGCCT
->read1451_contig0_position4684_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTACGGAATATTGGGTAACCTCCTCTTCACTGATATCATCCTATCGGCGTTCAAAGTAGTCGGCGGATGAATTAGAGCCAAAGCAGTAGGTTACCGTCGG
->read1452_contig0_position9504_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGATAAGAGTGTGCGAAGAACATCACTTGTTACTTCACGGAACGCTTCTTGATCCTGAGCTCCCCCGCGATTAACCTATGTCGGGACAAACACTCGATTG
->read1453_contig0_position4177_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGTTGAGGCGGGAACTTCCCGCTGATATGATGGTGATCGATATTCCGACTCTAACAAGTGGTCATTACAGGTTCGACCATACGCGACGGCAAACAGAAT
->read1454_contig0_position734_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTATTAACCGCGACGGTGTATTCCACGACCTAATTTTTCCCGTCTCTGTGGTCAACCTGGCCGCACAAACCCTAGTCCCATATAAAGCTATTCCACGCC
->read1455_contig0_position5411_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGACCCTACCCGGACACCTGGCAGCGGGAACCGCTTTGACTCTGGAGTGCCAGCGATAGTATCTCAGAGGCGAAAGCGCTTGTCACCTCATCTAAAATCG
->read1456_contig0_position1072_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TACGCGTTATTACCGGTCAGCTCCAGTTACGTGACGGACGTAGAGAGCCTTTGAATGTGTACGGCAATAGGAGAAACTCGGCCACGTACGTGTCAACATG
->read1457_contig0_position3560_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTAACTCTGCTCGGTTCTACGCCCTCGGGAGAAGACCCATGTAAGATGTATCCATCCCTACCACACGCGTCCGCCACCTCCGGGTCTAGTAAACCAGAGA
->read1458_contig0_position272_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTAACCACTAACATAACGCGTGTCATCTAGTTCTAGCATACTCCGCCTTGGGCCACACAATTAATATAAGACGGGATAATGGCTTCATGCTCATGTTCTA
->read1459_contig0_position4916_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CCATGACGTTGTGACATAAAGGTGCGGGACGCGGAAGCGCACCTCGTATAACGTTAGGGGTATCGTCGCTGCATAGGAGAATGGGCGATCGGCCTACAAG
->read1460_contig0_position7945_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TACGCAAACTACACGACGAACAACAGCAAGATTCGACGATCAAACTCGCCGGCGACACGAAGATTGTCATACTAGCTTTCAGTCATTCCCCCTCAGTTTT
->read1461_contig0_position6457_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTCCTGGATTGGCATGTCATCCGGAGTGATAGGCACTGCTCACGACCAGCTTGCGGACAAACGGGGTGCCCGCGCCTGCGTCCGGTAGACGAGCGATGG
->read1462_contig0_position983_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AATTGCAGTATCATGTATCGCTGATTGTGGGGGGCATGGGGGTTCCGCATTGGCGCAAAGGTACCGCAAAGGGCCTGTATGACCCTGGTTACGCGTTAGT
->read1463_contig0_position7159_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTCCCGGGCTTGTCCGCGTCCCATCGGTTAATTCAATGTCCGTCAATCGGTTTGGCCAAAAATTCTACCTGTCCACCTGTCCGCTAGAAGCAGATTATA
->read1464_contig0_position9423_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AATCTTCATTGGTCGTGCAGACATTGTCGCTGCGTACCAAAGTAACTGGACGCCCATACTCCTTTGTCTACAGAAGCTCATGGATAAGAGTGTGCGAATA
->read1465_contig0_position3323_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGTCACGGCCTCTCTGGGAAAGCTGAACAACGGATGGGATTAAGCTCAGCAGTCCGCCTCCAATCTCTCCGACGTTCATTCTCAAGGGTGTAGTTTTAG
->read1466_contig0_position5740_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTACAATAAGATTACGGATAGCCCGTGGCTTGGTTGTTTTCTGAATTGTGGCTATCTCAAATTGGGACCTAGTGTTGGCCAATAAGCTTCATATCGCCTT
->read1467_contig0_position8576_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTCTACTCAGATTGTCTGTAACCGGAGCTTCGGGCGTATTTTTGCGTAAGACACTGCCTAAAGGGAACATATGTGTCCAGAATAGGGTTCAACGGTGGA
->read1468_contig0_position2502_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGCAGATTTCGTACGTTGCCACTGCTACCTCCGGCATATGGGCGTGCTATAAATGCGGGAGTCAGGACGATAGAGCGAAGTAGTTACGGTGATTACCCG
->read1469_contig0_position3535_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGTATTCTGCGACAGCATGAATCGTGTAACTCTGCTCGGTTATACGCCCTCGGGAAAAGACCCATGTAAGATGTATCCATCCCTACCACACGCGTCCGCC
->read1470_contig0_position5429_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGCAGCGGGAACCGCTTCGACTCTGGAGTGCCAGCGATAGTATCTCAGAGGCGAAAGCGCTTGTCACCTCATCTAAAATCGCGACTATAGATCTGTTTA
->read1471_contig0_position8879_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CTAAGAAACCGGTGCATCACCGTACGAAAAGGATGGTTGAAATAGAACGAGTTGTAAAACATTAGCTCACGCGACACCGTCGTAGGCTGCGTATTGAGAC
->read1472_contig0_position5501_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTAAAATCGCGACTATAGATCTGTTTAGAACCACGACCCAGAAATCTTTAGCTAAGTAATCGACTGCCTTCGTCGGGCCGCTTATTGGTTCACCCAATC
->read1473_contig0_position4715_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GATATCATCCTATCGGCGTTCAAAGTATTCGGCGGATGAATTAGAGCCAAAGCAGTAGGTTACCGTCGGCGCATAACCGGCGAGTGCTCTGAAACGTTAC
->read1474_contig0_position8224_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTAAGAGAGGGCTGCGACTGCTTGCAGCTCCGACCGCTTTCCAATCGTTGCACATGACTTGAGGCTCGGACTCGTATCTGTCTCCGTGTTCATTTCGAT
->read1475_contig0_position1351_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGTACGGCTTGATGTCAGGGTCAGCTTGGGCGCCGGTATGTCTGTGTAAGGTTGGGCCAGTCGAGAGGACATTTCGCAGCGCCCTTTCATCTCTATTGC
->read1476_contig0_position3029_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GACCACCAAAGAGCAAGACTCTATGACTAGCGGGTGTCGTCAATGAAAACTGATCGAGCACTGTCCGCGAAACATTATTCAGTACAGCGACTTTTACCCT
->read1477_contig0_position4670_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCTATTAGATACGGTACGGAATATTGGGTAACCTCCTCTTCACTGATATCATCCTATCGGCGTTCAAAGTATTCGGCGGATGAATTAGAGCCAAAGCAG
->read1478_contig0_position4297_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TATTAATGATCCGTGTCCCCCGACCGTGTGCTGAGGAGACCCGTAATGCATGGAAAGTGCCAATATCCCCGGGAGTCCCGAACTACTGAGACGAAGTCTA
->read1479_contig0_position8505_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCCCTAGCGAGAAGTTATAGTCTAATAATGAATGGTGAACAGCACATCTTTTCGTCCTGAGGCCATATTAATTCTACTCAGATTGTCTGTAACCGGAGC
->read1480_contig0_position5969_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTCGAGCCTAACAGCATGCCATCTAACGTTTGGACGGGTCTTGTGTTCCCTCAACACGTACGTTGACAGAGCTAACAATCCGTCGACTGAATGTGATTC
->read1481_contig0_position9843_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAAATCGGAACACAAGTACGCGATCTCTTTTCTAGTCACCAGCCTCAGGCATTCGCAAATTTCGTTCATGCACGCAACGGGTCGAATAATATGCCGATGT
->read1482_contig0_position5809_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGTGTTGGCCAATAAGCTTCATATCGCCTTCTCTGATAGACTAATAGAACGAAGTCCATATAACAGCTGATTTAAGAGGAAAAATTGAACATCAACGGA
->read1483_contig0_position2194_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CACAACAGAGGCTAGCCACCAAGAGATGGGTTGATGGTAGCATCCCGGCTTCTGGGGCAATTTCTGACGATTCGAGTGACCAGCGATAGTACGTTCCTTT
->read1484_contig0_position5968_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GATTCGAGCCTAACAGCATGCCATCTAACGTTTGGACGGGTCTTGTGTTCCCTCAACACGTACGTTGACAGAGCTAACAATCCGTCGACTGAATGTGATT
->read1485_contig0_position5851_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAATAGAACGAAGTCCATATAACAGCTGATTTAAGAGGAAAAATTGAACATCAACGGAAGTACTATAGCAGGCTCACCAGCATGAAAGACATCCTCATTG
->read1486_contig0_position7737_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGCGGTAATGTGGTAGTGTAGTTGCCGGCCCCTGCGCTGACCTTATGTCCATATCGATACACGAAGGCCAGTGCGGAAGCGGAGCCACACTCGCCGTTA
->read1487_contig0_position6537_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCCGGTAGACGAGCGATGGATTAAGACCGTTCACTGAGCCCTCTAATAGGACCTCTTGCCCATCCGAGGCTTAAGCAGCGACTCCACATGGAGCGATGG
->read1488_contig0_position5648_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTGCTTTCCTTAGGGTACCGAGTATATTAACTTTATGAAATTAGCGCGTTAACTACTTAAAGCTCAGAAGATCCCTGTCCGCCTCGAACCACTACAATA
->read1489_contig0_position6740_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGACGGACAAAATGTCGGACACCGCCTTATCGGCTATACTAGTTAGAGCCTCGCTTGGGTCTCTACATCCGCTGATACGCGCGAGCTCTCACCCACGAC
->read1490_contig0_position136_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTACAAGGCAACATTGCAGCGTCCGATGGTCCGGTGGCCTCCAGATAGTGTCCAGTCGCTCTAACTGTATGGAGACCATAGGCATTTACCTTATTCTCAT
->read1491_contig0_position3212_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CATCTACTAAGCGCCCTAAAGGTCGTATGGTTGGAGGGCGGTTACACACCCTTAAGTACCGAACGATAGAGCACCCGTCTAGGAGGACGTGCAGGGTCTC
->read1492_contig0_position2055_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGAGACGTCCGAGCTCGAACCCGTCCGGCTAAGAGGCAGGCAGTCGCTGCATGTGTACGTAGCGGTCTATGCTACAGGTATTACGGAGTGAAACGGCTG
->read1493_contig0_position3670_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTCTGTTTCGTCGATTGTCTGAATATCGTGCAGTAAGTTTCTATTAGGCTCCTCAACGGAAACGTCTCAGCCCCACCTTAGACGCGGGAATAAATTCGA
->read1494_contig0_position4133_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGACGTTTTGAGCCGGTGACTAATTCGGTTGTCGCACATAGTGTACGTTGAGGCGGGAACTTCCCGCTGATATGATTGTGATCGATATTCAGACTCTAAC
->read1495_contig0_position4477_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CGTTATGGACGACGGACATAACTAGTGAGTGTCCGCCCTCGGCTAATCATGGACACCGGTCAGGCATGCTTACCTCCTGCGACGGCATTGGCGCTTATGG
->read1496_contig0_position9437_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGCAGACATTGTCGCTGCGTACCAAAGTAACTGGACGCCCATACCCCTTTGTCTACAGAAGCTCATGGATAAGAGTGTGCGAATAACCTCACTTGTTAC
->read1497_contig0_position8327_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTGCGACCTGAATGACCTTGGGCTCGTCGACATTCCTGGTAGTAATCCGATCTCAATTCCTGCGGTACCGAGCAGCTTTGAGTTTTTGTAAGTCCCACG
->read1498_contig0_position2383_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCGGTGAGGGGTACCCGACGCCTCTGCTGTCAAAGTGGGAAATCCAGTCTCGACTATAACTACTATGTCATGCTTGTCGAATGACCAACTCAATTAGGT
->read1499_contig0_position3608_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TATCCATCCCTACCACACGCGTCCGCCACCTCCGGGTCTAGTAAACCAGAGATTCCATGGACTCTCTGTTTCGTCGATTGTCTGAATATCGTGCAGTAAG
->read1500_contig0_position6074_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTATTTCACACTATTGTTCGGTGCGTGCGCTGCTCAGGCTGGTGCGACCCTTACAGCGTTATCCGTCCCGAACTGGCTTGAGCCACTCATAAGGCACGCG
->read1501_contig0_position939_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGAGACCTAGGTCTATGCCAGACGATCGCAGCGGAGTCGATATAATTGCAGTATCATGTATCGCTGATTGTGGGGGGCATGGGGGTTCCGCATTGGCGC
->read1502_contig0_position360_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTCATGTTCGATACCGAGCAGAGAGGTTGGGTCTACCTAGTAGTGTCGCGGTTATCGGACAGAGGATTATGTAAGGTTACCGAAGACCGGGTAGCGTAG
->read1503_contig0_position6594_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCCCATCCGAGGCTTAAGCAGCGACTGCACATGGAGCGATGGGTCCTCAAGGCAGTATAAAATGGACTGCTATCTAGGCGTTAAAGTAGTAGAACGAAG
->read1504_contig0_position6923_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTTATGGTCTTAATTGAGTGTTCAGAGTTGGGGGTCACAGATGAGCGTTCCGATTGTCCTTTCCCAGGCTACGGCCTTATACCAAAGACTTCTAGACCG
->read1505_contig0_position785_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCAACCTGGACGCACAAACCCTAGTCCCATATAAAGCTATTCCACGCCGGGTGGCCTGGACGTCGTTTGTGGATGGCTTTGGGAATCACTAGGTAATTA
->read1506_contig0_position2971_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCAATTGCGCTCCCGAACAACGCGTGAGTTTAAAATTGACTTGAAACCGCCTAGCTCGGACCACCAAAGAGCAAGACTCTATGACTAGCGGGTGTCGTCA
->read1507_contig0_position168_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTGGCCTCCAGATAGTGTCCAGTCGCTCTAACTGTATGGAGACCATAGGCATTTACCTTATTCTCATCGCCACGCCCCAAGATCTTTAGGACCCAGCAT
->read1508_contig0_position6678_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGTAGTAGAACGAGGGTCGGGCGATTTGTTTTGGTAGTGGTTATCGCCTTGCAAGAACGTACGGACGGACAAAATGTCGGACACCGCCTTATCGGCTAT
->read1509_contig0_position7294_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCAGAAGCCTTGCTTGCCACTCCGCCGATGTCTAAAAGCGCCAGATCGACTTGACTCTACGTGCTGCAATGGAGAACCGCGGAAGGAACACTTTCTGGT
->read1510_contig0_position819_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGCTATTCCACGCCGGGTGGCCTGGACGTCGTTTGTGGATGGCTATCGGAATCACTAGGTAATTACTGTTGGCTCCTTTCTTCATGATCGTCGGAGTTC
->read1511_contig0_position520_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGTGGGACCCATGTACTTACCTAACATGAAGCGGTAATGGAGCTCGAACACTAGTCGGTGGATCTTATGTCTCTGGCGGGGACGGCTATGTGAGTTCAT
->read1512_contig0_position6413_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CACCGGTGGTTCTACTGTACCACAGTGGCCTGGATAGCTAAGCAGGTCCCGGATTGGCATGTAATCCGGAGTGATAGGCACTGCTCACGACCAGCTTGCG
->read1513_contig0_position898_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTTCATGATCGTCGGAGTTCTTTCAGGCCGATCAAGTGGTTAGAGACCTAGGTCTATGCCAGACGATCGCAGCGGAGTCGATATAATTGCAGTATCATG
->read1514_contig0_position1046_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGCAAAGGGCCTGTATGACTCTGGTTACGCGTTATTACCGGTCAGCTCCAGTTACGTAACGGACGTAGAGAGCCTTTGAATGTGTACGGCAATAGGAGA
->read1515_contig0_position131_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GACATTTACAAGGCAACATTGCAGCGTCCGATGGTCCGGTGGCCTCCAGATAGTGTCCAGTCGCTCTAACTGTATGGAGACCATAGGCATTTACCTTATT
->read1516_contig0_position8131_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-AAAGACAGGGATTCTGCGCTAGCACGACCGCCGCAGGAAAGATCCGAGGCCTTTTCCAGGGTAAAATGATGGACTCATTGACCAACCCCTATTTTTAGGA
->read1517_contig0_position5134_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCGCGTTGTCGCTAGTAACAGATTGGGAGGTCTCGGCCAATTCGTTGTATTGATCGCTGTGCACTTTAAAATTCGGAACATCTTAACCAAAGCATATTA
->read1518_contig0_position6291_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GATATTCGCCGGAATTTACCCTTCTAATATTGTGTGCAAGCTACTTCTAGACCTTATTAAGTGCCCAGGAATTCCTAGGAAGGCGCGCAGCTCAAGCAAT
->read1519_contig0_position293_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCATCTAGTTCTAGCATACTCCGCCTTGGGCCACACAGTTAATATAAGACGGGATAATGGCTTCATGCTCATGTTCTATACCGAGCAGAGAGGTTGGGT
->read1520_contig0_position827_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCACGCCGGGTGGCCTGGACGTCGTTTGTGGATGGCTTTGGGAATCACTAGGTAATTACTGTTGGCTCCTTTCTTCATGATCGTCGGAGTTCTTTCAGGC
->read1521_contig0_position2298_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGAGTCTTAACATCGGCAAATGCGCCCTAGATACCTGCGGCTTCACTGCACAGTGTAAGAGTTGACGGGACTAAAACAATATTGGGCGGTGAGGGGTAC
->read1522_contig0_position6445_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GATAGCTAAGCAGGTCCTGGATTGGCATGTCATCCGGAGTGATAGGCACTGCTCACGACCAGCTTGCGGACAAACGGGGTGCCCGCGCCTGCGTCCGGTA
->read1523_contig0_position327_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CACAATTAATATAAGACGGGATAATGGCTTCATGCTCATGTTCTATACCGAGCAGAGAGGTTGGGTCTACCTAGTAGTGTCGCGGTTATCGGACAGAGGA
->read1524_contig0_position5874_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCTGATTTAAGAGGAAAAATTGAACATCAACGGAAGTACTATAGCAGGCTCACCAGCATGAAAGACATCCTCATTGTGAACCCGGCATCTCGTGATTCG
->read1525_contig0_position8479_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTACGGCCAATGCACGACCCTATATGACCCCTAGCGAGAAGTTATAGTCTAATAATGAATGGTGAACAGCACATCTTTTCGTCCTGAGGCCATATTAATT
->read1526_contig0_position7995_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCGACACGAAGATTGTCATACTAGCTTTCAGTCATTCCCCCTCAGTTTTGTCCATGTGGAGAATATGCATTCGACCAAATGAAAATGTCAATAATCTCG
->read1527_contig0_position8510_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGCGAGAAGTTATAGTCTAATAATGAATGGTGAACAGCACATCTTTTCGTCCTGAGGCGATATTAATTCTACTCAGATTGTCTGTAACCGGAGCTTCGG
->read1528_contig0_position8416_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAAGTCCCACGGTTAATGGGCCACTTATTTCGACATTCATGGCGCCGATATCCTGCTTAGGCCGTACGGCCAATGCACGACCCTATATGACCCCTAGCGA
->read1529_contig0_position6431_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCACTGTGGCCTGGATAGCTAAGCAGGTCCTGGATTGGCACGTCATCCGGAGTGATAGGCACTGCTCACGACCATCTTGCGGACAAACGGGGTGCCCGC
->read1530_contig0_position7574_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGAGAACAAGCGTGTGGAGAGTGACTGACTATCACGAGGAATTACGGATAACAGCCCACTTGGAGTGTGCTGAGGGCCGACGCCCGGGGACCGTGATATC
->read1531_contig0_position3826_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCAAGTGAAGAACCCGGGCCCAAAATTGGAACCCGTAATCTTCAAGTGAATTATCCGATCATGCAAACCTGATTATCTGCACGACTCTTAAAATCATGC
->read1532_contig0_position7608_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGAGGAATTACGTATAACAGCCCACTTGGAGTGTGCTGAGGGCCGACGCCCGGGGACCGTGATATCCTTGCGAGTGGAATGCGAAAACGGCATAAGCGCA
->read1533_contig0_position3975_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CAAACCTATTTAATGATATATTCTCTTGGACAACACGAGGTCGTAATTATTTCCTGAGATGGTTTTAGTGAGAGCAGCCGATGCACTCTTAGCTCCGCTG
->read1534_contig0_position9083_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCCTGTCACGGGCATGCTGAAAGCGGCGGTTACATTAATCGCTTCTGTGATGACAGACCGAAGCCCACCTGTCCTGACCTCACCGCAGGCATCGAGTCT
->read1535_contig0_position3563_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTCTGCTCGGTTATACGCCCTCGGGAGAAGACCCGTGTAAGATGTATCCATCCCTACCACACGCGTCCGCCACCTCCGGGTCTAGTAAACCAGAGATTC
->read1536_contig0_position7045_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTCGTGTGATAACCGCCTAAACAGTCTAATCTGGCCAATATTCCCTGGGGGGAGCTAATATATCGCGGCGTCGAGTTACCGTTGCACCACCTCCAAGTG
->read1537_contig0_position4036_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTTTAGTGAGAGCAGCAGATGCACTCTTAGCTCCGCTGATAACGATTACTATAAATCAGCGAATCTAACATCAATCTGCACCACGAATATCGTCCAAGA
->read1538_contig0_position629_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTCGAAACTCCGATGGGCAGAAGCTAAAACTGAACAACGAGTGGGACACCGGCCTACTACATTATACAGTAGGGTAGAATCGCGTAGAAGCACCCACGA
->read1539_contig0_position8983_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGAAAACCTGTCTGAAGTCCGTGCTTCCCTAACCAGCCTATGCGCCTTAACTTTATGCATACTCGTTTAGTACAGGGCCGCGCCCCATGAGGCCATATG
->read1540_contig0_position6299_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGGAATTTACCCTTCTAATATTGTGTGCAAGCTACTTCTAGACCTTATTAAGTGCCCAGGAATTCCTAGGAAGGCGCGCAGCTCAAGCAATCATACATC
->read1541_contig0_position6755_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGGACACCGCCTTATCGGCTATACTAGTTAGAGCCTCGCTTGGGTCTCTACATCCGCTGATACGCGCGAGCTCTCACCCACGACTGTACCCCGGTTAAG
->read1542_contig0_position8916_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGAAATAGAACGAGTTGTAAAACATTAGCTCACGCGCCACCGTCATAGGCTGCATATTGAGACAGGGTTGAAAACCTGTCTGAAGTCCGTGCTTCCCTAA
->read1543_contig0_position1825_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTAGCCGGCCCACAAATCGACGTGTGTATTTGTTCAATGGCAGGAGTTTAACTTTGCGGAGCTCAACCTATAACGATAATCAAATTGAGACAGACGGGTT
->read1544_contig0_position2255_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCTGACGATTCGATTGACCATCGATAGTACGTTCCTTTTGTACTGAGTCTTAACATCGGCAAATGCGCCCTAGATACCTGCGGCTTCACTCCACAGTGT
->read1545_contig0_position6895_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTTCATATGCATGCGCGCATCTTCCTATTTTATGGTCTTAATTGAGTGTTCAGAGTTGGGGGTCACAGATGAGCGTTCCGATTGTCCTTTCCCAGGCTA
->read1546_contig0_position8556_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCGTCCTGAGGCCATATTAATTCTACTCAGATTGTCTGTAACCGGAGCTTCGGGCGTATTTTTGCGTAAGACACTGCCTAAAGGGAACATATGTGTCCA
->read1547_contig0_position1171_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCGCGGCTCTCTATACCTCGCAAAGAATCACTCTATGGGTCATCTTGGGAGAATAGTCGACTAGTCGCGAATATATGTTCTGCTCCGAGACTTCGGCAT
->read1548_contig0_position8496_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCTATATGACCCCTAGCGAGAAGTTATAGTCTAATAATGAATGGTGAACAGCACATCTTTTCGTCCTGAGGCCATATTAATTCTACTCAGATTGTCTGT
->read1549_contig0_position3456_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCCGTCGCCTCGCGCCCATAATGTTTGGAACTCGCAAACCTTTACACTCATCACATAGCAGGTTCCACCCGAACCGCGCGTATTCTGCGACAGCATGAA
->read1550_contig0_position3176_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AATGGGTTATCAAATGCCTATGTTCCGGTAATCTCTCATCTACTAAGCGCCCTAAAGGTCGTATGGTTGGAGGGCGGTTACACACCCTTGAGTACCGAAC
->read1551_contig0_position1726_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCACTGGAGATCTGGAACATTAGATAGGATATAAAAGTAATACGGTTGATGTTATTACCAACTCCACTTCTGCAAATTGTTATGAGCAAGCATACAAGT
->read1552_contig0_position1040_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGGTACCGCAAAGGGCCTGTATGACCCTGGTTACGCGTTATTACCGGTCAGCTCCAGTTACGTCACGGACGTAGAGAGCGTTTGAATGTGTACAGCAAT
->read1553_contig0_position4390_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGTCTAGCTAGCTTGACTCGGCTGATAAAGAAAACAATCTATTTGGAACCGAGGGGCGGGATGATAATTGTTCTTAGTATAGTGACCGTTATGGACGAC
->read1554_contig0_position1214_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTTGAGAGAATAGTCGACTAGTAGCGAATATATGTTCTGCTCCGAGACTTCGGCATAAATCTAAGTATGGACTCTTATATTCCCTCCTGCGTAGTGCTC
->read1555_contig0_position7761_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCGGCCCCTGTGCTGACCTTATGTCCATATCGATACACGAAGGCCAGTGCGGAAGCGGAGCCACACTCGCCGTTACTGACTGATTGACAATCCAGCCCG
->read1556_contig0_position5268_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGATAGCTTTATGGCCATCATCATAGTAAATTTTTTCAGATTACCCTGCCGACGTCCGCCTAAGATCCTAGTTGAATTGATCAATTGAGTCCAGTACAC
->read1557_contig0_position6713_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGTGGTTATCGCATTGCAAGAACGTACGGACGGACAAAATGTCGGACACCGCCTTATCGGCTATACTAGTTAGAGCCTCGCTTGGGTCTCTACATTCGC
->read1558_contig0_position5386_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTCCACTTCAATCAGCAAGACGGGCGACCGTACCCGGACACCTGGCAGCGGGAACCGCTTTGACTCTGGAGTGCCAGCGATAGTATCTTAGAGGCGAAA
->read1559_contig0_position1255_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCGAGACTTCGGCATAAATCTAAGTATGGACTCTTAGATTCCCTCCTGCGTAGTGCACTCCCATAATAAGAGAACCCATGGGTCGCGCTGTATTTTTGT
->read1560_contig0_position8041_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTTGTCCATGTGGAGAATATGCATTCGACCAAATGAAAATGTCAATAATCTCGACCCTGTAGTCCGCGGCCAATCAGCACGATCAAGCTAAAGACAGGG
->read1561_contig0_position8339_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGACCTTGGGCTCGTCGACATTGCTGGTAGTAATCCGATCTCAATTCCTGCGGTACCGAGCAGCTTTGAGTTTTTGTAAGTCCCACGGTTAATGGGCCA
->read1562_contig0_position307_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCATACTCCGCCTTGGGCCACACAATTAATATAAGACGGGATAATGGCTTCATGCTCATGTTCTATACCGAGCAGAGAGGTTGGGTCTACCTAGTAGTGT
->read1563_contig0_position578_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGGCTCTTCTGTCTCTGGCGGGGACGGCTATGTGAGTTCATAAATCTCAATGTCGAAACTCCGATGGGCAGAAGCTAAAACTGAACAACGAGTGGGACA
->read1564_contig0_position3318_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTAATGGTCACGGCCTCTCTGGGAAAGCTGAACAACGGATGGGATTAAGCTCAGCAGTCCGCCTCCAATCTCTCCGACGTTCATTCTCAAGGGTGTAGT
->read1565_contig0_position1807_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TATGAGCAAGCATACAAGTTAGCCGGCCCACAAATCGACGTGTGTATTTGTACAATGGCAGGAGGTTAACTTTGCGGAGCTCAACCTATAACGATAATCA
->read1566_contig0_position5644_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAACGTTGCTTTCCTTAGGGTACCGAGTATATTAACTTTATGAAATTAGCGCGTTAACTACTTAAAGTTCAGAAGATTACTGTCCGCCTCGAACCACTAC
->read1567_contig0_position5089_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGTACAGGTGCCCATAACCCGATGAGGCCATGGTGTTACGTGAAGTCGCGTTATCGCTAGTAACAGATTGGGAGGTCTCGGCCAATTCGTTGTATTGAT
->read1568_contig0_position8381_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CAATTCCTGCGGTACCGAGCAGCTTTGAGTTTTTGTAAGTCCCACGGTTAATGGGCCACTTATTTCGACCTTCATGGCGCCGATGTCCTGCTAAGGCAGT
->read1569_contig0_position2041_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGTCCCCAGTCACCGGAGACGTCCGAGCTCGAACCCGTCCGGCTAAGAGGCAGGCAGTCGCTGCATGTGTACGCAGCGGTCTATGCTACAGGTATTACG
->read1570_contig0_position5387_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCCCCTTCAATCAGCAAGACGGGCGACCGTACCCGGACACCTGGCAGCGGGAACCGCTTTGACTCTGGAGTGCCAGCGATAGTATCTCAGAGGGGAAAG
->read1571_contig0_position325_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CACACAATTAATATAAGACGGGATAATGGCTTCATGCTCATGTTCTATACCGAGCAGAGAGGTTGGGTCTACCTAGTAGTGTCGCGGTTATCGGACAGAG
->read1572_contig0_position6684_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGAACGAGGGTCGGGCGATTTGTTTTGGTAGTGGTTATCGCATTGCAAGAACGTACGGACGGACAAAATGTCCGACACCGCCTTATCGGCTATACTAGT
->read1573_contig0_position9546_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCTTCTTGATCCTGAGCTCCCCCGCGATTAACCTATGTCGCGACAAACACTCGATTGAGCAGTGGTCATGTCATTATTGTACATCAGTACCATAGCTAG
->read1574_contig0_position5594_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCAATCTGGCCATTGCAAGTTTGTCAGACGCGAGGTTGCGTGGTCAACCGAACGTTGCTTTCCTTAGGGTACCGAGTATATTAACTTTATGAAATTAGC
->read1575_contig0_position9498_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTCATGGATAAGAGTGTGGGAATAACATCACTTGTTACTTCACGGAACGCTTCTTGATCCTGAGCTCCCCCGCGATTAACCTATGTCGGGACAAACACT
->read1576_contig0_position3883_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GATCATGCAAAACTGATTATCTGCACGACTCTTAAAATCATGCACTAAGCATAGAATGCACGACTACTTGTTACTGAAGTCGGCATGACTATCAACCCTA
->read1577_contig0_position3421_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGAGACTGAGAACTCACCCTATTGGTAGTACTGCCTGCCGTCGCCTCGCGCCCATAATGTTTGGAACTCGCAAACCTTTACACTCATCACATAGCAGGTT
->read1578_contig0_position6001_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTACGGGTCTTGTGTTCCCTCAACACGTACGTTGACAGAGCTAACAATCCGTCGACTGAATGTGATTCCTTTGTTATTTCACACTATTGTTCGGTGCGTG
->read1579_contig0_position9240_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCCGAAGGCCTTTATACCCATACTGCCACTCCAGTACCTGGGCCGCGTGTTGTACGCTCTGTATCTTGAGAGCGTTTCTCCTTATCGAAATGTTCCGCT
->read1580_contig0_position7199_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGTCAATCGGGTTGTCCAAAAATTCTACGTGTCCACCTGTCCGCTAGAAGCAGATTATACGGAATACATATCCCGACACCGGCAGCTCAAATGATGCAG
->read1581_contig0_position4562_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CATTGGCGATTATGGGCGTGCATAGAGTCCCGCAGTGTCGGAGCGATAGGGAGGACGTAAACGCCAATTCCGCTTAATAGCGGAATCTGCTGGCTTGTGC
->read1582_contig0_position2323_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCTAGATACCTGCGGCTTCACTCCACAGTGTAAGAGTTGACGGGACTAAAACAGTATGGGGCGGTGAGGGGTACCCGACGCCTCTGCTGTCAAAGTGGG
->read1583_contig0_position2677_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCACTGGGGCGCGAGTCTCGAGCCTCTCGACTCCAAAGGGTCTGCCCGAGACAGGTTCACCGAGTCGTTACTCCCGGGATCCACTGCGTCTATTGTAAG
->read1584_contig0_position9019_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCTGTGCGCCTTAACTTTATGCATACTCGTTTAGTACAGGGCCGCGCCCCTTGAGGCCATATGCGCCTGTCACGGGCATGCTGAAAGCGGCGGTTACAT
->read1585_contig0_position5952_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAACCCGGCATCTCGTGATTCGAGCCTAACAGCATGCCATCTAACGTTTGGACGGGTCTTGTGTTCCCTCAACACGTACGTTGACAGAGCTAACAATCCG
->read1586_contig0_position4410_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCTGATAAAGAAAACAATCTATATGGAACCGAGGGGCGGGATGATAATTGTTCTTAGTATAGTGACCGTTATGGACGACGGACATAACTACTGAGTGTC
->read1587_contig0_position3163_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCGGATGTCCGCAATGGGTTATCAAATGCCTATGTTCCGGTAATCTCTCATCTACTAAGCGCCCTAAAGGTCGTATGGTTGGAGGGCGGTTACACACCC
->read1588_contig0_position3885_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCATGCAAACCTGATTATCTGCACGACTCTTAAAATCATGCACTAAGCATAGAATGCACGACTACTTGTTACTGAAGTCGGCATGACTATCTAACCTATT
->read1589_contig0_position866_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGAATCACTAGGTAATTACTGTTGGCTCCTTTCTTCATAATCGTCGGAGTTCTTTCAGGCCGGTCAAGTGGTTAGAGACCTAGGTCTATGCCAGACGAT
->read1590_contig0_position3790_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AACACCTAGCCTGGCAATTACCCCTTTGTTATTCTAGTCAAGTGAAGAACCCGGGCCCAAAATTGGAACACGTAATCTTCAAGGGAATCATCCGATCATG
->read1591_contig0_position4795_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CGAGTGCTCTGAAAGGTTACATTCGTCTATCCGCACACACCGCCGTTGGATGTGTCCCACAGTGTTTTAGAAGGGACGGTGGCCACGGGGTGAGCACATG
->read1592_contig0_position2447_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TATGTCATGCTTGTCGAATGAACAACTCAATTAGGTAGTGTGCGCGAGGTAGAGTATGCAGATTTCGTACCTTGCCACTGCTACCTCCGGCATATGGGCG
->read1593_contig0_position3456_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCCGTCGCCTCGCGCCCATAATGTTTGGAACTCGCAAACCTTTACACTCATCACATAGCAGGTTCCACCCGAACCGCGCGTATTCTGCGACAGCATGAA
->read1594_contig0_position6361_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTCCTAGGAAGGCGCGCAGCTCAAGCAATCATACATGGCGGAATGCCTGTCCACCGGGGGTTCTACTGTACCACAGTGGCCTGGATAGCTAAGCAGGTC
->read1595_contig0_position2526_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTACCTCCGGCATATGGGCGTGCTATAATTGCGGGAGTCAGGACGATAGAGCGAAGTAGTTACGGTGATTACCCGTCCATCGATGCCCCTCCTGTCCCG
->read1596_contig0_position1904_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCAAATTGAGACAGACGAGTTGGAGTGTTTTGATGAGCGGTGTTATATTTGTCCTACCTTAGCACTATCGCACCACAAAATTTCAGCATAAAGCATCCGG
->read1597_contig0_position4017_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTAATTATTTCCTGAGATGGTTTTAGTGAGAGCAGAAGATGCACTCTTAGCTCCGCTGATAACGATTACTATAAATCAGCGAATCTAACATCAATCTGCA
->read1598_contig0_position1501_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTAGGGGCGAGGTATAAATTAGTGGATTCACTTCCCTTTGACATCTTGTTCTCACAACTGCACACTCCGATGCTCTGCCGAGCCTTCTAACCATCGGGT
->read1599_contig0_position1019_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGGGGTTCCGCATTGGCGCAAAGGTACCGCAAAGGGCCTGTATGACCCTGGTTACGCGTTATTACCTGTCAGCTCCAGTTACGTCACGGACGTAGAGAG
->read1600_contig0_position1185_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-TACCTCGCAAAGAATCACTCTATGGGTCATCTTGAGAGAACAGTCGACTAGTAGCGAATATATGTTATCCTCCGAGACTTCGGCATAAATCTAGGTATGG
->read1601_contig0_position696_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGTAAGGTAGAATCGCGTAGAATCACCCACGATCAATGTTATTAACCGCGACGGTGTATTCCACGACCTAATTTTTCACGTCTCTGTGGCCAACCTGGA
->read1602_contig0_position3510_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CATAGCAGGTTCCACCCGAACCGCGCGTATTCTGCGACAGCATGAATCGTGTAACTCTGCTCGGTTATACGCCCTCGGGAGAAGACCCATGTAAGATGTA
->read1603_contig0_position3724_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CAACGGAAACGTCTCAGACCCACCTTAGACGCGGGAATAAATTCGACACGGGGTACGAAGGGTAAGAACACCTAGCCTGGCAATTACCCCTTTGTTATTC
->read1604_contig0_position2210_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CACCAAGAGATGGGTTGATGGTAGCATCCCGGCTTCTGGGGCAATTTCTGACGATTCGAGTGACCAGCGATAGTACGTTCCTTTTGTACTGAGTCTTAAC
->read1605_contig0_position7898_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTGTGCCGTGTCACTCTGTAGCTCTAATACCAATTGAAATGAAGCTTACGCAAACTACTCGACGAACAACAGCAAGATTCGACGATCAAACTCGCCGGC
->read1606_contig0_position3422_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGATTGAGAACTCACCCTATTGGTAGTACTGCCTGCCGTCGCCTCGCGCCCATAATGTTTGGAACTCGCAAACCTTTACACTCATCACATAGCAGGTTC
->read1607_contig0_position8504_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GACCCCTAGCGAGAAGTTATAGTCTAATAATGAATGGTGAACAGCACATCTTCTAGTCCTGAGGCCATATTAATTCTACTCAGATTGTCTGTAACCGGAG
->read1608_contig0_position5182_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TATTGATCGCTGTGCACTTTAAAATTCGGAACATCTTAACCAAAGCATATTAATAAGCCAGCCGCGGAGGGTGGTATATATGATCCTTGATAGCTTTATG
->read1609_contig0_position618_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATAAATCTCAATGTCGAAACTCCGATGGGCCGAAGCTAAAACTGAACAACGAGTGGGACACCGGCCTACTACATTATACAGTAAGGTAGAATCGCGTAGA
->read1610_contig0_position9809_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTTTAGTAGGTCTACTACTAGGCCGCTTGCTCAGAAATCGGAACACAAGTACGCGATCTCTTTTCTAGTCACCAGCCTTAGGCATTCGCAAATTTCGTT
->read1611_contig0_position4551_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCTGCGACGGCATTGGCGATTATGGGCGTGCATAGAATCCCGCAGTGTCGGAGCGATAGGGAGGACGTAAACGCCAATTCCGCTTAATAGCGGAATCTG
->read1612_contig0_position19_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCGGACCACGCTCTGGCTAACGAGCTACCGTTTCCTTTAACCTGCCAGACGGTGCCCAGGGCCGTTCGGCGGTGCATCGAGCGGTGTCGCTAGCGCAAT
->read1613_contig0_position7285_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGAAATTATGCAGAAGCCTTGCTTGCCACTCCGCCGATGTCTAAAAGCGCCAGATCGACTTGACTCTACGTGCTGCAATGGAGAACCGCGGAAGGAACA
->read1614_contig0_position2390_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGGGTACCCGACGCCTCTGCTGTCAAAGTGGGAAATCCAGTCTCGACTATATCTACTATGTCATGCTTGTCGAATGAACAACTCAATTAGGTAGTGTGC
->read1615_contig0_position5946_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CATTGTGAACCCGGCATCTCGTGATTCGAGCCTAACAGCATGCCATCTAACGTTTGGACGGGTCTTGTGTTCCCTCAACACGTACGTTGACAGAGCTAAC
->read1616_contig0_position3451_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGCCTGCCGTCGCCTCGCGCCCATAATGTTTGGAACTCGCATACCTTTACACTCATCACATAGCAGGTTCCACCCGAACCGCGCGTATTATGCGACAGC
->read1617_contig0_position3901_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCTGCACGACTCTTAAAATCATGCACTAAGCATAGAATGCACGACTACTTGTTACTGAAGTCGGCATGACTATCAAACCTATTTAATTATATATGCTCT
->read1618_contig0_position957_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCAGACGATCGCAGCGGAGTCGAAATAATTGCAGTATCATGTATCGCTGATTGTGGGGGGCATGGGGGTTCCGCATTGGCGCAAAGGTACCGCAAAGGGC
->read1619_contig0_position8193_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AAAATGATGGACTCATTGCCCAACCCATATTATTAGGAGAGGGCTGCGACTGCTTGCAGCTCCGACCGCTTTCCAATCGTTGCACATGACTTGAGGCTCG
->read1620_contig0_position226_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTATTCTCATCGCCACGCCCCAAGATCTTTAGGACCCAGCATTCCTTAAACCACTAAGATAACGCGTGTCATCTAGTTCTAGCATACTCCGCCTTGGGCC
->read1621_contig0_position2614_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTCCTGTCCCGAAGCCTTAAAATCTAACCCTGAATTGGCTTTATCCACCCCCCCTACTGGCCACCACTGGGGCGCGAGTCTCGAGCCTCTCGACTCCAA
->read1622_contig0_position859_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGCTTTGGGAATCACTAGGTAATTACTGTTGGCTCCTTTCTTCATGATCGTCGGAGTTCTTTCAGGCCGATCAAGTGGTTTGAGACCTAGGTCTATGCC
->read1623_contig0_position8178_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCCTTTTCCAGGGTAAAATGATGGACTCATTGACCAACCCCTATTATTAGGAGAGGGCTGCGACTGCTTGCAGCTCCGACCGCTTTCCAATCGTTGCAC
->read1624_contig0_position3342_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAAGCTGAACAACGGATGGGATTAAGCTCAGCAGTCCGCCTCCAATCTCTCCGACGTTCATTCTCAAGGGTGTAGTTTTAGAGACTGAGAACTCACCCTA
->read1625_contig0_position9071_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGAGGCCATATGCGCCTGTCACGGGCATGCTGAAAGCGGCGGTTACATTAATCGCTTCTGTGATGACAGACCGAAGCCCACCGGTCCTGACCTCACCGCA
->read1626_contig0_position2643_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTGAATTGGCTTTATCCACCCCCCCTACTGGCCACCACTGGGGCGCGAGTCTCGAGCCTCTCGACTCCAAAGGGTCTGCCCGAGACAGGTTCACCGAGT
->read1627_contig0_position7145_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCATCGGAGTCCGCTTCCCGGGCTTGTCCGCGTCCCATCGGTTAATTCAATGTCCGTCAATCGGGTTGGCCAAAAATTCTACCTGTCCACCTGTCCGCT
->read1628_contig0_position4429_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTATATGGACCCGAGGGGCGGGATGATAATTGTTCTTAGTATAGTGACCGTTATGGACGACGGACATAACTACTGAGTGTCCGCCCTCGGCTAATCATGA
->read1629_contig0_position1277_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGTATGGACTCATATATTCCCTCCTGCGTAGTGCTCTCCCATAATAAGTGAACCCATGGGTCGCGCTGTATTTTTGTACGGCTTGATGTCAGGGTCAGT
->read1630_contig0_position8369_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTAATCCGATCTCAATTCCTGCGGTACCGAGCAGCTTTGAGTTTTTGTAAGTCCCACGGTTAATGGGCCACTTATTTCGACATTCATGGCGCCGATATCC
->read1631_contig0_position2029_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCATTGGTCTTTCAGTCCCCAGTCACCGGAGACGTCCGAGCTCGAACCCGTCCGGCTAAGAGGCAGGCAGTCCCTGCATGTGTACGCAGCGGTCTATGCT
->read1632_contig0_position684_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TACTACATTATACAGTAAGGTAGAATCGCCTAGAAGCACCCACGATCAATGTTAATAACCGCGACGGTGTATTCCACGACCTAATTTTTCCCGTCTCTGT
->read1633_contig0_position668_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGTGGGACACCGGCCTACTACATTACACAGTAAGGTAGAATCGCGCAGAAGCACCCACGATCAATGTTATTAACCGCGACGGTGTATTCCACGACCTAA
->read1634_contig0_position5578_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCGCTTATTGGTTCACCCAATCTGGCCATTGCAAGTTTGGCAGACGCGAGGTTGCGTGGTCAACCGAACGTTGCTTTGCTTAGGGTACCGAGTATATTA
->read1635_contig0_position4107_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCAATCTGCACCACGAATATCGTCCAAGACGTTTTGAGCCGGTCACTAATTCGGTTGTCGCACATAGTGTACGTTGAGGCGGGAACTTCCCGCTGATATG
->read1636_contig0_position9440_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGACATTGTCGCTGCGTACCAAAGTAACTGGACGCCCATACCCCTTTGTCTACAGAAGCTCATGGATAACAGTGTGCGAATAACATCACTTGTTACTTC
->read1637_contig0_position86_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGCGTGGCATCGAGCGGTGTCGCTAGCGCAATGCGTAAGATTTTGACATTTACAAGACAACATTGCAGCGTCCGATGGTCCGGTGGCCTCCAGATAGTG
->read1638_contig0_position7381_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AACACTTTCTGGTGCCACTCGAGACCGCCCTCCCCGACCCATATGCAGTTTCTGCATACACCGGGTAGACAACATTCTCAGCCCTTCGTTGAAAGGAGAA
->read1639_contig0_position5506_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AATCGCGACTATAGATCTGTTTAGAACCACGACCCAGAAATCTTTAGCTAAGTAATCGACTGCCTTCGTCGGGCCGCTTATTGGTTCACCCAATCTGGCC
->read1640_contig0_position4015_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGTAATTATTTCCAGAGATGGTTTTAGTGAGAGCAGCAGATGCACTCTTAGCTCCGCTGATAACGATTACTATAAATCAGCGAATCTAACATCAATCTG
->read1641_contig0_position3867_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCAAGTGAATTATCCGATCATGCAAACGTGATTATCTGCACGACTCTTAAAATCATGCACTAAGCATAGAATGCACGACTACTTGTTACTGAAGTCGGC
->read1642_contig0_position304_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTAGCATACTCCGCCTTGGGCCAAACAATTAATATAAGACGGGATAATGGCTTCATGGTCATGTTCTATACCGAGCAGAGAGGTTGGGTCTACCTAGTAG
->read1643_contig0_position414_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCGGACAGAGGATTATGGAAGGTTACCGAAGACCGGGTAGCGTAGTTAGTAACTTCAATTCGCGTTACGCTTTGTCCTCTGCTACGCCTCGAGTCGTTT
->read1644_contig0_position4346_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGGAAAGTGCCAATATCCCCGGGAGTCCCGCACTACTGAGACGAAGTCTAGCTAGCTTGACTCGGCTGATAAAGAAAACAATATATATGGAACCGAGGG
->read1645_contig0_position4892_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGAATGGGGTACGGTTTTACCGTCCATGAGGTTGTGACATAAAGGTGTGGGACGCGGAAGCGTACCCCGTATAACGTTAGGGGTATCGTCACTGCATAG
->read1646_contig0_position4369_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGTCCCGCACTACTGAGACGAAGTCTAGCTAGCTTGACTCGGCTGATAAAGAAAACAATCTATATGGAACCGAGGGGCGGGATGATAATTGTTCTTAGT
->read1647_contig0_position888_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGGCTCCTTTCTTCATGATCGTCGGAGTTCTTTCAGGCCGATCAAGTGGTTAGAGACCTAGGTCTATGCCAGACGATCGCAGCGGAGTCGATATAATTG
->read1648_contig0_position434_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGTTACCGAAGACCGGGTCGCGTAGTTAGTAACTTCAATCCCCGTTACGCTTTGTCCTCTGCTACGCCTCGATTGGTTTCAGCTCACGTGGGACGCATG
->read1649_contig0_position3696_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGTGCAGTAAGTTTCTCTTAGGTTCCTCAACGGAAACGTCTCAGACCCACCTTAGACGCGGGAATAAATTCGACACGGGGTACGAAGGGTAAGAACACC
->read1650_contig0_position6437_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGGCCTGGATAGCTAAGCAGGTCCTGGATTGGCATGTCATCCGGAGTGATAGGCACTGCTCACGACCAGCTTGCGGACAAACGGGGTGCCCGCGCCTGC
->read1651_contig0_position9148_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCACCTGTCCTGACCTCACCGCAGGCATCGAGTCTAACTCTGATTCGAGAGACGGATGTAACTTAGTCAGGTCGGAACCGCTGGCAGAGCAGCTCCGAGG
->read1652_contig0_position8020_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTTCAGCCATTCCCCCTCAGTTTTGTACCTGTGGAGAATATGCATTCGACCAAATGAAAATGTCAATAATCTCGACCCTGTTGTCCGCGGCCAATCAGC
->read1653_contig0_position7682_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGAATGCGAAAACGGCATAAGCGCAATGACCGAGTTAACAAGCCATGAGGACTGGAGCGGTAATGTGGTAGTGTAGTTGCCGGCCCCTGTGCTGACCTT
->read1654_contig0_position2029_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCATTGGTCTTTCAGTCCCCAGTCACCGGAGACGTCCGAGCTCGAACCCGTCCGGCTAAGAGGCAGGCAGTCGCTGCATGTGTACGCAGCGGTCTATGCT
->read1655_contig0_position1542_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACATCTTGTTCTCACAACTGCACACTCCGATGCTCTGCCGAGCCTTCTAACCATCGGGTATGTACATTCACCTTTGGACGCTTCGATAGGACATGCACCC
->read1656_contig0_position5818_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCAATAAGCTTCATATCGCCTTCTCAGATAGACTAATAGAACGAAGTCCATATAACAGCTGATTTAAGAGGAAAAATTGAACATCAACGGAAGTACTATA
->read1657_contig0_position8233_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGCTGCGACTGCTTGCAGCTCCGACCGCTTACCAATCGTTGCACATGACTTGAGGCTCGGACTCGTATCTGTCTCCGTGTTCCTTTCGATAACTCTGCG
->read1658_contig0_position1648_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGACTTACCAACTTGATCGCCAGTGAGTGAGCGGTGGTTTATCTGTTGAGTGGCCACGTTTCCCTATCTGCTGGGACGGCACTGGAGATCTGGAACATT
->read1659_contig0_position2384_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGGAGAGGGGTACCCGACGCCTCTGCTGTCAAAGTGGGAAATCCAGTCTCGACTATATCTACTATGTCATGCTTGTCGAATGAACAACTCAATTAGGTA
->read1660_contig0_position2106_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGTGTACGCAGCGGTCTATGCTACAGGTATTACGGAGTGAAACGGCTGCGAGCATCTCATAATCGGGCCACCCGATTTCAGCTTGGCCACAACAGAGAC
->read1661_contig0_position4457_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTGTTCTTAGTATAGTGACCGTTATGGACGACGGACATGACCACTGAGTGTCCGCCCTCGGCTAATCATGAACTCCGGTCAGGCATGCTTACCTCCTGC
->read1662_contig0_position3989_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GATATATGCTCTTGGACAACACGAGGTCGTAATTTTTTCCTGAGATGGTTTTAGTGAGAGCAGCAGATGCACTCTTAGCTCCGCTGATAACGATTACTAT
->read1663_contig0_position8785_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGCTTACTGAGAACACTTCATCTGTATGGCAAAGTTGCGACACCGCGCCACACAGCAGTTTATTGTTAACACGCGATACAATAGGGTTAGGAGCTAAGA
->read1664_contig0_position4246_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGTTCGACCATACGCGACGGCAAACAGAATCGCACGTCAACTATCCCCTTTATTAATGATCCGTGTCCCCCGACCGTGTGCTGAGGATACCCGTAATGC
->read1665_contig0_position9495_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAAGCTCATGGATAAGAGTTTGCGAATAACATCACTTGTTACTTCACGGAACGCTTCTTGATCCTGAGCTCCCCCGCGATTAACCTATGTCGGGACAAAC
->read1666_contig0_position4694_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGGGTAACGTCCTCTTCACTGATATCATCCTATCGGCGTTCAAAGTATTCGGCGGATGAATTAGAGCCAAAGCAGTAGGTTACCGTCGGCGCATAACCG
->read1667_contig0_position6202_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AACCGATTCTGCTACGTTATAAAAAAGGGACGAGTGGGGTCAACAGTTCTTCTTCTTTCCTGTACGGTAATGCTTCCGCGCATCTAAGTGATATTCGCCG
->read1668_contig0_position7555_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCTACTGCCCGCCGTGAACGAGAACAAGCGTGTGGAGAGTGACTGACTATCACGAGGAATTACGGATAACAGCCCACTTGTAGTGTGCTGAGGGCCGAC
->read1669_contig0_position3880_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCGATCATGCAAACCTGATTATCTGCACGACTCTTAAAATCATGCACTAAGCATAGAATGCACGACTACTTGTTACTGAAGTCGGCATGACTATCAAAC
->read1670_contig0_position3214_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTACTAAGCGCCCTAAAGGTCGTATGGTTGGAGGGCGGTTACACACCCTTAAGTACCGAACGATAGAGCACCCGTCTAGGAGGGCGTGCAGGGGCTCCC
->read1671_contig0_position3208_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCTCATCTACTAAGCGCCCTAAAGGTAGTATGGTTGGAGGGCGGTTACACACCCTTAAGTACCGAACGATAGAGCACCCGTCTAGGAGGGCGTGCAGGG
->read1672_contig0_position7950_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAACTACTCGACGAACAACAGCAAGATTCGACGATCAAACTCGCCGGCGACACGAAGATTGTCATACTAGCTTTCAGTCATTCCCCCTCAGTTTTGTCCA
->read1673_contig0_position3087_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CACTGTCCGCGAAACATTATTCAGTACAGCGACTTTTACCCTTGTGGTCTGAATGTTATGCCGTCCGACTCTTGCGCTCGGATGTCCGCAATGGGTTATC
->read1674_contig0_position1895_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAACGATAATCAAATTGAGACAGACGAGTTGGAGTGTTTTGATGAGCGGTGTTATATTTGTCCTAACTTAGCACTATCGCACCACAAAATTTCAGCATAA
->read1675_contig0_position6387_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CAATCATACATGGCGGAAAGCCTGTCCACCGGGGGTTCTACTGTACCACAGTGGCCTGGATAGCTAAGCAGGTCCTGGATTGGCATGTCACCCGGAGTGA
->read1676_contig0_position7100_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTAATATATCGCGGCGTCGAGTTACCGTTGCACCACCTCCAAGTGTCCATCGGAGTCCGCTTCCCGGGCTTGTCCGCGTCCCATCGGTTAATTCAATGTC
->read1677_contig0_position2124_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGCTACAGGTATTACGGAGTGAAACGGCTGCGAGCATCTCATAATCGGGCCACCCGATTTCAGCTTGGCCACAACCGAGACTAGCCACCAAGAGATGGG
->read1678_contig0_position4517_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCTAATCATGAACACCGGTCAGGCATGCTTACCTCCTGCGACGGCATTGGCGATTATGGGCGTTCATAGAGTCCCGCAGTGTCGGAGCGATAGGGAGGA
->read1679_contig0_position951_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTATGACAGACGATCGCAGCGGAGTCGATATAATTGCAGTATCATGTATCGCTGATTGTGGGGGGCATGGGGGTTCCGCATTGGCGCAAAGGTACCGGA
->read1680_contig0_position9727_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGAACCCGTTTGCCGAACGTCTGGAAATCTGTCGAGTCATATCGATGAACAGAGACTAAATGTCCTTAAATCTCTAACACGATTTTAGTAGGTCTACTA
->read1681_contig0_position9670_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGGGGAATCACCTTACTTAATCGGCTGGGGTAACGGCTGGTTTTGTACTACGGTATGGGAACCCGTTTGCCGAACGTCTGGAAATCTGTCGAGTCATAT
->read1682_contig0_position7239_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCGCTAGAAGCAGATTATACGGAATACATATCCCGACACCGGCAGCTGAAATGATGCAGAAGCCTTGCTTGCCACTCCGCCGATGTCTAAAAGCGCCAG
->read1683_contig0_position9647_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCACATGTGATGCTCGTACTCGAAGGGGGAATCACCTTACTTAATCGGCTGGGGTAACGGCTGGTTTTGTACTACGGTATGGGAACCCCTTTGCCGAACG
->read1684_contig0_position8448_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACATTCATGGCGCCGATATCCTGCTTAGGCAGTACGGCCAATGCACGACCCTATATGACCCCTAGCGAGAAGTTATAGTCTAATAATGAATGGTGAACAG
->read1685_contig0_position6646_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCAGTATAAAATGGACTGCTATCTAGGCGTTAAAGTAGTAGAACGAGGGTCGGGCGATTTGTTTTGGTAGTGGTTATCGCATTGCAAGAACGTACGGACG
->read1686_contig0_position2795_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTTGTTCCGGCAGGACACCACTCTTTGAAGGTGCCCATTGCATCGTAGCCTGAACTATTAGCAATCCTAAGCCCATAAGCCCTGCCCCACGGGGGCTAC
->read1687_contig0_position4940_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGGACGCGGAAGCGCACCTCGTATAACGTTAGGGGTATCGTCACTGCATAGCAGAATGGGCGATCGGCCTACAAGAGTACAGTACTAACGGTCTGGCCT
->read1688_contig0_position3710_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTCTTAGGTTCCTCAACGGAAACGTCTCAGTCCCACCTTAGACGCGGGAATAAATTCGACACGGGGTACGAAGGGTAAGAACACCTAGCCTGGCAATTA
->read1689_contig0_position3984_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTAATGATATATGCTCTTGGACAACACGAGGTCGTAATTATTTCCTGAGATGGTTTTAGTGAGAGCAGCAGATACACTCTAAGCTCCGCTGATAACGATT
->read1690_contig0_position6137_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGTCCCGAACTGGCTTGAGCCACTCATAAGGCACGCGCGGGCCATAACAGTCGACTAAAAGGCGTAACCGATTCTGCTACGTTATAAAAAAGGGGCGAGT
->read1691_contig0_position3786_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-GAAGAACACCTAGCCTGGCAATTACCCCTTTGTTATTCTAGTCAATAGAAGAACCCGGGCCCAAAATTGGAACCCGTAGTCTTCAAGTGAATCATCCGAT
->read1692_contig0_position1675_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGAGCGGTGGTTTATCTGTTGAGTGGCCACTTTTCCCTATCTGCTGGGACGGCACTGGAGATCCGGAACATTAGATAGGATATAAAAGTAATACGGTTG
->read1693_contig0_position4043_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGAGAGCAGCAGATGCACTCTTAGCTCCGCTGATAACGATTACTATAAATCAGCGAATCTAACATCAATCTGCACCACGAATATCGTCCAAGACGTTTTG
->read1694_contig0_position5784_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTGTGGCTATCTCAAATTGGGACCTAGTGTTGGCCAATAAGCTTCATATCGCCTTCTCAGATAGACTAATAGAACGAAGTCCATATAACAGCTGATTTA
->read1695_contig0_position8070_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCAAATGAAAATGTCAATAATCTCGACCCTGTAGTCCGCGGCCAATCAGCACGATCAAGCTAAAGACAGGGATAATGCACTAGCACGACCGCCGCAGGAA
->read1696_contig0_position1323_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGTGAACCCATGGGTCGCGCTGTATTTTTGTACGGCATGATGTCAGGGTCAGTTTGGGCGCCGGTAGGTCTGTGTAAGGTTGGGCCAATCGAGAGGACA
->read1697_contig0_position7390_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGTGCCACTCGAGACCGTCCTCCCCGACCCATATGCAGTTTCTGCATACACCGGGTAGACAACATTCTCAGCCCTTCGTTGAAAGGAGAATACAAATGA
->read1698_contig0_position3407_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGGGTGTAGTTTTAGAGACTGAGAACTCACCCTATTGGTAGTACTGCCTGCCGTCGCCTCGCGCCCATAATGTTTGGAACTCGCAAACCTTTACACTCA
->read1699_contig0_position4808_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGTTACATTCGTCTATCCGCACACACCGCCGTTGGATGTGTCCCACAGTGTTTTATACGGGACGGTGGCCACGGGGTGAGCACATGAATGTGGTACGGT
->read1700_contig0_position6318_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TATTGTGTGCAAGCTACTTCTAGACCTTATTAAGAGCCCAGGAATTCCTAGGAAGGCGCGCAGCTCAAGCAATCATACATGGCGGAATGCCTGTCCACCG
->read1701_contig0_position9713_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGTACTACGGTATGGGAACCCGTTTGCCGAACGTCTGGAAATCTGTCGAGTCATATCGATGAACAGAGACTAAATGTCATTAAATCTCTAACACGATTT
->read1702_contig0_position2493_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGTAGAGTATGCAGATTTCGTACCTTGCCACTGCTACCTCCGGCATATGGGCGTGCTATAAATGCGGGAGTCAGGACGATAGAGCGAAGTAGTTACGGT
->read1703_contig0_position961_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGATCGCAGCGGAGTCGATATAATTGCAGTATCATGTATCGCTGATTGTGGGGGGCATGGGGGTTCCGCATTGGCGCAAAGGTACCGCAAAGGGCCTGT
->read1704_contig0_position295_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CATCTAGTTCTAGCATACTCCGCCTTGGGCCACACAATTAATATAAGACGGGATAATGGCTTCATGCTCATGTTCTATACCGAGCAGAGAGGTTGGGTCT
->read1705_contig0_position8422_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CCACGGTTAATGGGCCACTTATTTCGACAATCATGGCGCCGATATCCTGCTTAGGCAGTACGGCCAATGCACGACCCTATATGACCCCTTGCGAGAAGTT
->read1706_contig0_position3781_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGGCTAAGAACACCTAGCCTGGCAATTACCCCTTTGATATTCTTGTCAAGTGAAGAACCCGGGCCCAAAATTGGAACCCGTAATCTTCACGTGAATCAT
->read1707_contig0_position6947_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGAGTTGGGGGTCACAGATGAGCGTTCCGATTGTCCTTTCCCAGGCTACGGCCTTATACCAAAGACTTCTAGACCGGAGAGACTACTTCCAGCCACGAAT
->read1708_contig0_position5471_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCTCAGAGGCGAAAGCGCTTGTCACCTCATCTAAAATCGCGACTATAGATCTGTTTAGAACCACGACCCAGAAATCTTTAGCTAAGTAATCGACTGCCT
->read1709_contig0_position6444_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGACAGCTAAGCAGGTCCTGGATTGGCATGTCATCCGGAGTGATAGGCACTGCTCACGACCAGCTTGCGGACAAACGGGGTGCCCGCGCCTGCGTCCGGT
->read1710_contig0_position5630_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGCGTGGTCAACCGAACGTTGCTTTCCTTAGGGTACCGAGTATATTAACTTTATGAAATTAGCGCGTTAACTACTTAAAGTTAAGAAGATCACTGTCCG
->read1711_contig0_position2532_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCGGCATATGGGCGTGCTATAAATGCGGGAGTCAGGACGATAGAGCGAAGTAGTTACGGTGATTACCCGTCCATCGATGCCCCTCCTGTCCCGAAGCCT
->read1712_contig0_position8514_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGAAGTTATAGTCTAATAATGAATGGTGAACAGCACGTCTTTTCGTCCTGAGGCCATATTAATTGTACTCAGATTGTCTGTAACCGGAGCTTCGGGCGT
->read1713_contig0_position8710_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCCCTTGGCTCTGCTACATCGAATTCAGCGTGTAAGAGCCCGCTTATCCGGTGGTGATACCTACTATTGACTGGGGGCTTACTGAGAACACTTCATCTG
->read1714_contig0_position3706_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTTTCTCTTAGGTTCCTCAACGGAAACGTCTCAGACCCACCTTAGACGCGGGAATAAATTCGACACGGGGTACGAAGGGTAAGAACACCTAGCCTGGCA
->read1715_contig0_position9532_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTACTTCACGGAACGCTTCTTGATCCTGAGCTCCCCCGCGATTAACCTATGTCGGGACAAACACTCGATTGAGCAGTGGTCATGTCATTATTGTACATC
->read1716_contig0_position7229_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTCCACCTGTCCGCTAGAAGCAGATTATACGGAATACATATCCCGACACCGGCAGCTGAAATGATGCAGAAGCCTTGCTTGCCACTCCGCCGATGTCTA
->read1717_contig0_position550_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCGGTAATGGAGCTCGAACACTAGTCGGTGGCTCTTCTGTCTCTGGCGGGGACGGCTATGTGAGTTCATAAATCTCAATGTCGAAACTCCGATGGGCAG
->read1718_contig0_position3370_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGCAGTCCGCCTCCAATCTCTCCGACGTTCATTCTCAAGGGTGTAGTTTTAGAGACTGAGAACTCACCCTATTGGTAGTACTGCCTGCCGTCGCCTCGC
->read1719_contig0_position1142_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGAAACTCGGCCACGTACGTGTCAACATGGCGCGGCTCTCTATACCTCGCAAAGAATCACTCTATGGGTCATCTTGAGAGAATAGTCGACTAGTAGCGA
->read1720_contig0_position389_M5_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGTCCACATAGTAGAGGCGCGGTTATCGGACAGAGGCTTATGTAAGGTTACCGAAGACCGGGTAGCGTAGTTAGTAACTTCAATCCGCGTTACGCTTTG
->read1721_contig0_position8609_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCGTATTTTTGCGTAAGACACTGCCTAAAGGGAACATATGTGTCCATAATAGGGTTCAACGGTGTATGAGCAAACGATGCGGTAAGACGAGCGCTCCGA
->read1722_contig0_position2990_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGCGTGAGTTTAAAATTGACTTGAAACCGCCTAGCTCGGACCACCAAAGAGCAACACTCTATGACTAGCGGGTGTCGTCAATGAAAACTGATCGAGCAC
->read1723_contig0_position7619_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGATAACAGCCCACTTGGAGTGTGCTGAGGGCCGACGCCCGGGGACCGTGATATCCTTGCGAGTGGAATGCGAAAACGGCATAAGCGCAATGACCGAGGT
->read1724_contig0_position6231_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGAGTTGGGTCAACAGTTCTTCTTCTTTCCTGTACGGTAATGCTTCCGCGCCTCTAAGTGATATTCGCCGGAATTTACCCTTCTAATATTGTGTGCAAG
->read1725_contig0_position647_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGAAGCTCAAACTGAACAACGAGTGGGACACCGGCCTACTATATTATACAGTAAGGTAGAATCGCGTAGAAGCACCCACGATCAATGTTATTAACCGCG
->read1726_contig0_position9190_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTCGAGAGACGGATGTAATTTAGTCAGGTCGGAACCGCTGGCAGAGCAGCTCCGAGGGCCTTTATACCCATACTGCCACTCCAGTACCTGGGCCGCGTG
->read1727_contig0_position2267_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGTGACCAGCGATAGTACGTTCCTTTTGTACTGAGTCTTAACATCGGCAAATGCGCCCTAGATACCTGCGGCTTCACTCCACAGTGTAAGAGTTGACGG
->read1728_contig0_position7589_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAGAGTGACTGACTATCACGAGGAATTACGGATAACAGCCCACTTGGAGTGTGCTGAGGGCCGACGCCCGGGGACCGTGATATCCTTGCGAGTGGAACG
->read1729_contig0_position211_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCATGGGCATTTACCTTATTCTCATCGCCACGCCCCAAGATCTTTAGGACCCAGCATTCCTTTAACCACTAACATAACGCGTGTCATCTAGTTCTAGCAT
->read1730_contig0_position2195_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACAACAGAGACTAGCCACCAAGAGATGGGTTTATGGTAGCATCCCGGCTTCTGGGGCAATTTCTGACGATTCGAGTGACCAGCGATAGTACGTTCCTTTT
->read1731_contig0_position3543_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGACAGCATGAATCGTGTAACTCTGCTCGGTTATACGCCCTCGGGAGAAGACCCATGTAAGATGTGTCCATCCCTACCACACGCGTCCGCCACCTCCGG
->read1732_contig0_position4909_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTACCGTCCATGACGTTGTGACATAAAGGTGCGGGACGCGGAAGCGCACCTCGTATAACGTTAGGGGTATCGTCACTGCATAGCAGAATGGGCGATCGGC
->read1733_contig0_position6176_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCCATAACAGTCGACTAAAAGGCGTAACCGATTCTGCTACGTTATAAAAAAGGGACGAGTGGGGTCAACAGTTCTTCTTCTTTCCTGTACGGTAATGCT
->read1734_contig0_position2458_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTCGAATGAACAACTCAATTAGGTAGTGTGCGCGAGGTAGAGTATGCAGATTTCGTACCTTGCCACTGCTACCTCCGGCATATGGGCGTGCTATAAATG
->read1735_contig0_position1042_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTACCGCAAAGGGCCTGTATGACCCTGGTTACGCGTTATTACCGGTCAGCTCCAGTTACGTCACGGACGTAGAGAGCCTTTGAATGTGTACGGCAATAG
->read1736_contig0_position8933_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAAAACATTAGCTCACGCGCCACCGTCATAGGCTGCATATTGAGACAGGGTTGAAAACCTTTCTGAAGTCCGTGCTTCCCTAACCAGCCTATGCGCCTTA
->read1737_contig0_position7586_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTGGAGAGTGACTGACTATCACGAGAAATTACGGATAACAGCCCACTTGGAGTGTGCTGAGGGCCGACGCCCGGGGACCGTGATATCCTTGCGAGTGGA
->read1738_contig0_position2332_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTGCGGCTTCACTCCACAGTGTAAGAGTTGACGGGACTAAAACAGTATTGGGCGGTGAGGGGTACCCGACGCCTCTGCTGTCAAAGTGGGAAATCCAGT
->read1739_contig0_position8535_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAATGGTGAACAGCACATCTTTTCGTCCTGAGGCCATATTAATTCTAGTCAGATTGTCTGTAACCGGAGCTTCGGGCGTATTTTTGCGTAAGACACTGCC
->read1740_contig0_position112_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGCAATGCGCAAGATTTTGACATTTACAAGGCAACATTGCAGCGTCCGATGGTCCGGTGGCCTCCAGATAGTGTCCAGTCGCTCTAACTGTATGGAGAC
->read1741_contig0_position5107_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCGATGAGGCCAAGGTGTTACGTGAAGTCGCGTTGTCGCTAGTAACAGATTGGGAGGTCTCGGCCAATTCGTTGTATTGATCGCTGTGCACTTTAAAAT
->read1742_contig0_position3188_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AATGCCTATGTTCCGGTAATCTCTCATCTACTAAGCGGCCTAAAGGTCGTATGGTTGGAGGGCGGTTACACACCCTTAAGTACCGAACGATAGAGCACCC
->read1743_contig0_position6401_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAATGCCTGTCCACCGGGGGTTCTACTGTACCACAGTGGCCTGGATAGCTAAGCAGGTCCTGCATTGGCATATCATCCGGAGTGATAGGCACTGCTCAC
->read1744_contig0_position3451_M5_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGCCTGCCGTCGCCTCGCGCCCATAATGTTTGGAACTCGCAAACCTTTAAACTCATCACATAGCAGGTTCTACCCGAACCGCGCCTATTCTACGTCAGC
->read1745_contig0_position5333_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCCTAGTTGAATTGATCAATTGAGTCCAGTACAGCATATCAACAGCTTGATCGTTCCACTTCAATCAGCAAGACGGGCGACCGTACCCGGACACCTGGC
->read1746_contig0_position4339_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTAATGCATGGAAAGTGCCAATATCCCCGGGAGTCCCGCACTACTGAGACGAAGTCTAGCTAGCTTGACTCGGCTGATAAAGAAAACAATCTATATGGAA
->read1747_contig0_position9010_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCTAACCAGCCTATGCGCCTTAACATTATGCATACTCGTTTAGTACAGGGCCGCGCCACATGAGGCCATATGCGCCTGTCACGGGCATGCTGAAAGCGG
->read1748_contig0_position2806_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGGACACCACTCTTTGAAGGTGCCCATTGCATTGTAGCCTGAACTATTAGCAATCCTAAGCCCATAAGCCCTGCCCCACGGGGGCTACAATCCAGCAGT
->read1749_contig0_position1191_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCAAAGAATCACTCTATGGGTCATCTTGAGAGAATAGTCGACTAGTAGCGAATATATGTTCTGCTCCGAGACTTCGGCATAAATCTAAGTATGGACTCTT
->read1750_contig0_position1563_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-ACACTCCGATACTCTGCCGAGCCTTCTAACCAACGGGTATGTACATTCACCTTTGGACGCTTCGATAAGACATGCACCCGGTCCGTTGACTTACCAACGT
->read1751_contig0_position4274_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AATCGCACGTCAACTATCCCCTTTATTAATGATCCGTGTCCCCCGACCGTGTGCTGAGGAGACCCGTAATGCATGGAAAGTGCCAATATCCCCGGGAGTC
->read1752_contig0_position3917_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAATCATGCACTAAGCATAGAATGCACGACTACTTGTTACTGAAGTCGGCATGACTATCAAACCTATTTAATGATATATGCTCTTGGACAACACGAGGTC
->read1753_contig0_position420_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGAGGATTATGTAAGGTTACCGAAGACCGGGTAGCGTAGTTAGTAACTTCAATCCGCGTTACGCTTTGTCCTCTGCTACGCCTCGATTGGTTTCAGCTC
->read1754_contig0_position435_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTTACCGAAGACCGGGTAGCGTAGTTCGTAACTTCAATCCGCGTTACGCTTTGTCCTCTGCTACGCCTCGATTGGTTTCAGCTCACGTGGGACGCATGT
->read1755_contig0_position2294_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTACTGGGTCTTAACATCGGCAAATGCGCCCTAGATACCTGCGGCTTCACTCCACAGTGTAAGAGTTGACGGGTCTAAAACAGTATTGGGCGGTGAGGG
->read1756_contig0_position718_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCACCCACGATCAATGTTATTAACCGCGACGGTGTATTCCACGACCTAATTTTTCCCGTCTCTGTGGTCAACCTGGACGCACAAACCCTAGTCCCATAT
->read1757_contig0_position9706_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTGGTTTTGTACTACGGTATGGGAACCCGTTTGCCGAACGTCTGGAAATCTGTCGAGTCATATCGATGAACAGAGACTAAATGTCCTTAAATCTCTAAC
->read1758_contig0_position4726_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCGGCGTTCAAAGTATTCGGCGGATGAATTAGAGCCAAAGCAGTAGGTTACCGTCGGCGCATAACCGGCGAGTGCTCTGAAACGTTACATTCGTCTATC
->read1759_contig0_position4275_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCGCACGTCAACTATCCCCTTTATTAATGATCCGTGTCCCCCGACCGTGTGCTGAGGAGACCCGTAATGCATGGAAAGTGCCAATATCCCCGGGAGTCC
->read1760_contig0_position354_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTCATGCTCATGTTCTATACCGAGCAGAGAGGTTGGGTCTACCTAGTAGTGTCGCGGTTATCGGACAGAGGATTATGTAAGGTTACCGAAGACCGGGTA
->read1761_contig0_position5088_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTAGTACAGGTGCCCATAACCCGATGAGGCCAAGGTGTTACGTGAAGTCGCGTTGTCGCTAGTAACAGATTGGGAGGTCTCGGCCAATTCGTTGTATTGA
->read1762_contig0_position441_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGAAGACCGGGTAGCGTAGTTAGTAACTTCAATCCGCGTTACGCTTTGTCCTCTGCTACGCCTCGATTGGTTTCAGCTCACGTGGGACGCATGTACTTAC
->read1763_contig0_position5799_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AATTGGGACCTAGTGTTGGCCAATAAGCTTCATATCGCCTTCTCAGATAGACTAATAGAACGAAGTCCATTTAACAGCTGATTTAAGAGGAAAAATTGAA
->read1764_contig0_position1444_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-ATATTGGTAGGTCTCTTAAGCCTAATCAGGATCATAGATGGCCAATTATTGACCACAGGTAGGGGCCAGGTATAAATTAGTGGATTCACTTCCCTTTGAC
->read1765_contig0_position8710_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCCCATGGCTCTGCTACATCGAATTCAGCGTGTAAGAGGCCGCTTATCCGGTGGTGATACCTACCCTTGACTGGGGGCTTACTGAGAACACTTCATCTG
->read1766_contig0_position3766_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGACACGGGGTACGAAGGGTAAGAACACCTAGCCTGGCAATTACCCCTTTGTTATTCTAGTCAAGTGAAGAACCCGGGCCCAAAATTGGAACCCGTAAT
->read1767_contig0_position5357_M5_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCCAGTACACCATATCAACAGCTTGATCGTACCACTCCAATCAGCAAGACGTGCGACCGTACCCGGACACCTGGCAGGAGGAACCGCTTTGACTCTGGA
->read1768_contig0_position2866_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCCATAAGCCCTGCCCCACGGGGGCTACAATCCAGCACTGCACGCGTTTACCTTAAGACGAAAGAGTCAGTAGAGTTGGGGTTCGTGCTTTAATGACCC
->read1769_contig0_position2600_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGTCCATCGATGCCCCTCCTGTCCCGAAGCCTTAACATCTAACCCTGAATTGGCTTTATCCACCCCCCCTAATGGCCACCACTGGGGCGCGAGTCTCGAG
->read1770_contig0_position9386_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACAGGTAGCCGAACAGGTATTACTCAGACTGGAGAGGAATCTTCATTGGTCGTGCAGACATTGTTGCTGCGTACCAAAGTAACTGGACGCCCATACCCCT
->read1771_contig0_position3244_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAGGGCGGTTACACACCCTTAAGTACAGAACGATAGAGCACCCGTCTAGGAGGGCGTGCAGGGTCTCCCGCTAGCTAATGGTCACGGCCTCTCTGGGAA
->read1772_contig0_position9004_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGCTTCCCTAACCAGCCTATGCGCCTTAACTTTATGCATACTCGTTTAGTACAGGGCCGCGCCCCATGAGGCCATATGCGCCTGTCACGGCCATGCCGA
->read1773_contig0_position7466_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGTTGAAAGGAGAATACAAATGACGGGAACTCTGACGAGAGGGTGCTTGAACGAGAGAAGCTAACAGTCATTGCGATGACGAGAACAGCCCTACTGCCC
->read1774_contig0_position4362_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCCCGGGAGTCCCGCACTACTGAGACGAAGTCTAGCTAGCTTGACTCGGCTGATAAAGAAAACAATCTATATGGAACCGAGGGGCGGGATGATAATTGT
->read1775_contig0_position9241_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCGAGGGCCTTTATACCCATACTGCCACTCCAGTACCTGGGCCGCGTGTTGTACGCTGTGTATCTTGAGAGCGTTTCTCCGTATCGAAATGTTCCGCTG
->read1776_contig0_position1439_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CATCTCTATTGCTAGGTCTCTTAAGCCTAATCAGGATCATAGATGGCCAATTATTGACCACAGGTAGGGGCGAGGTATAAATTAGTGGATTCACTTCCCT
->read1777_contig0_position3768_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GACACGGGGTACGACGGGTAAGTACACCTAGCCTGGCAATTACCCCTTTGTTATTCTAGTCAAGTGAAGAACCCGGGCCCAAAATTGGAACCCTTAATCT
->read1778_contig0_position5272_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGCTTTATGGCCATCATCATAGTAAATTTTTTCAGATTACCCTGCAGACGTCCGCCTAAGCTCCTAGTTGAATTGATCAATTGAGTCCAGTACACCATA
->read1779_contig0_position5505_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAATCGCGACTATAGATCTGTTTAGAACCACGACCCAGAAATCTTTAGCTAAGTAATCGACTGCCTTCGTCGGGCCGCTTATTGGTTCACCCAATCTGGC
->read1780_contig0_position5623_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCGAGGTTGCGTGGTCAACCGAACGTTGCTTTCCTTAGGGTACCGAGTATATTAACTTTATGAAATTAGCGCGTTAACTACTTAAAGTTCAGAAGATCA
->read1781_contig0_position141_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGCAACATTGCAGCGTCCGATGGTCCGGTGGCCTCCAGATTGTGTCCAGTCGCTCTAACTGTATGGAGACCATAGGCATTTACCTTATTCTCATCGCCA
->read1782_contig0_position9384_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACACAGGTAGCCGAACAGGTATTACTCAGACTGGAGAGGAATCTTCATTGGTCGTGCAGACATTGTCGCTGCGTACCAAAGTAACTGGACGCCCATACCC
->read1783_contig0_position5301_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTTCAGATTACCCTGCAGACGTCCGCCTAAGATCCTAGTTGAATTGATCAATTGAGTCCAGTACACCATATCAACAGCTTGATCGTTCCACTTCAATCA
->read1784_contig0_position1251_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGCTCCGAGACTTCGGCATAAATCTAAGTATGGACTCTTATATTCACTCCTGCGTAGTGCTCTCCCATAATAAGTGAACCCATGGGTCGCGCTGTATTT
->read1785_contig0_position2663_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCCCCTACTGGCCACCACTGGGGCGCGAGTCTAGAGCCTCTCGACTCCAAAGGGTCTGCCCGAGACAGGTTCACCGAGTCGTTACTCCCGGGATCCACT
->read1786_contig0_position9383_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CACACAGGTAGCCGAACAGTTATTACTCAGACTGAAGAGGAATCTTCATTGGTCGTGCAGACATTGTCGCTGCGTACCAAAGTAACTGGACGCCCATACC
->read1787_contig0_position7895_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AACGTTGGGCCGTGTCACTCTGTAGCTCTAATACCAATTGAAATGAAGCTTACGCAAACTACTCGACGAACAACAGCAAGATTCGACGATCAAACTCGCC
->read1788_contig0_position482_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCTTTGTCCTCTGCTACGCCTCGATTGGTTTCAGCTCACGTGGGACGCATGTACTTACCTAACATGAAGCGGTAATGGAGCTCGAACACTAGTCGGTGG
->read1789_contig0_position2174_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCACCCGATTTCAGCTTGGCCACAACAGAGACTAGCCAACAAGAGATGGGTTGATGGTAGCATCCCGGCTTCTGGGGCAATTTCTGACGATTCGAGTGAC
->read1790_contig0_position3286_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGTCTAGGAGGGCGTGCAGGGTCTCCCGCTAGCTAATGGTCACGGCCTCTCTGGGAAAGCTGAACAACGGATGGGATTAAGCTCAGCAGTCCGCCTCCA
->read1791_contig0_position1268_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CATAAATCTAAGTATGGACTCTTATATTCCCTCCTGCGTAGTGCTCTCCCCTAATAAGTGAACCCATGGGTTGCGCTGTATTTTTGTACGGCTTGATGTC
->read1792_contig0_position63_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCAGACGGTGACCAGGGCCGTTCGGCGTTGCATCGAGCGGTGTCGCTAGCGCAATGCGCAAGATTTTGGCATTTACAAGGCAACATTGCAGCGTCCGAT
->read1793_contig0_position6023_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-ACACGTACGTTGACCGAGCTAACAATCCGTCGACTGAATGTGATTCATTTGTTATTTCACACTATTGTTCGGTGCGTGCGCTGCTCAGGCTGATGCGACC
->read1794_contig0_position4755_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTAGAGCCAAAGCAGTAGGTTACCGTCGGCGCATAACCGGCGAGTGCTCTGAAACGTTACATTCGTCTATCCGCACACACCGCCGTTGGATGTGTCCCAC
->read1795_contig0_position7751_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGTGTAGTTGCCGGCCCCTGTGCTGACCTTATGTCCATATCGATACACGAAGGCCAGTGCGGAAGCGGAGCCACACTCGCCGTTACTGACTGATTGACA
->read1796_contig0_position8763_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTGATACCTACTATTGACTGGGGGCTTACTGAGAACACTTCATCTGTATGGCAAAGTTGCGACACCTCGCCACACAGCAGTTTATTGTTAACACGCGAT
->read1797_contig0_position8761_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGGTGATACCTACTATTGACTGGGGGCTTACTGAGAACAATTCATCTGTATGGCAAAGTTGCGACACCGCGCCACACAGCAGTTTATTGTTAACACGCG
->read1798_contig0_position8308_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGTATTCCTTTCGATAACTCTGCGACCTGAATGACCTTGAGCTCGTCGACATTCCTGGTAGTAATCCGATCTCAATTCCTGCGGTACCGAGCAGCTTAC
->read1799_contig0_position1405_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGCCAATCGAGAGGACATTTCGCAGCGCCCTTTCATCTCTATTGCTAGGTCTCTTAAGCCTAATCAGGATCATAGATGGCCAATTATTGACCACAGGTA
->read1800_contig0_position8521_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TATAGTCTAATTATGAATGGTGAACAGCACATCTTTTCGTCCTGAGGCCATATTAATTCTACTCAGATTGTCTGTAACCGGAGTTTCGGGCGTATTTTTG
->read1801_contig0_position1185_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TACATCGCAAAGAATCACTCTATGGGTCATCTTTAGAGAATAGTCGACTAGTAGCGAATATATGTTCTGCTCCGAGACTTCGGCATAAATCTAAGTATGG
->read1802_contig0_position7492_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAACTCTGACGAGAGGGTGCTTGAACGAGAGAAGCTAACAGTCATTGCGATGACGAGAACAGCCCTACTGCCCGCCGTGAACGAGAACAAGCGTGTGGA
->read1803_contig0_position6662_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCTATCTAGGCGTTAAAGTAGTAGAACGAGGGTCGGGCGATTTGTTTTGGTAGTGGTTACCGCATTGCAAGAACGTACGGACGGACAAAATGTCGGACA
->read1804_contig0_position8585_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGATTGTCTGTAACCGGAACTTCGGGCGTATTTTTGCGTAAGACACTGCCTAAAGGGAACATATGTGTCCAGAATAGGGTTCAACGGTGTATGAGCAAAC
->read1805_contig0_position4861_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTATACGGGACGGTGGCCACGGGGTGAGCACATGAATGGGGTACGGTTTTACCGTCCATGACGTTGTGACATAAAGGTGCGGGACGCGGAAGCGCACCTC
->read1806_contig0_position9272_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGTACCTGGGCCGCGTGTTGGACGCTGTGTATCTTGAGAGCGTTTCTCCGTATCGAAATGCTCCGCTGTAAAGAACCTGGCGTATCCTGACCATGGAGC
->read1807_contig0_position1138_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATAGGAGAAACTCGGCCACGTTCGTGTCAACATGGCGCGGCTCTCTATACCTCGAAAAGAATCACTCTATGGGTCATCTTGAGAGAATAGTCGACTAGTA
->read1808_contig0_position7328_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AAAAGCGCCAGATCGACTTGACTCTACGTGCTGCAATGGAGAACCGCGGAAGGAACACTTTCTGGTGCCACTCGAGACCGCCCCCCCCGACCCATTTGCA
->read1809_contig0_position8954_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCGTCATAGGCTGCATATTGAGACAGGGTTGAAAACCAGTCTGAAGTCCGTGCTTCCCTAACCAGCCTATGCGACTTAACTTTATGCATACTCGTTTAG
->read1810_contig0_position3843_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCCCAAAATTGGAACCCGTAATCTTCAAGTGAATCATCCGATCATGCAAACCTGATTATCTGCACGACTCTTGAAATCATGCACTGAGCATAGAATGCA
->read1811_contig0_position3678_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGTCGATTGTCTGAATATCGTGCAGTAAGTTTCTCTTAGGTTCCTCATCGGAAACGTCTCAGACCCACCTTAGACGCGGGAATAAATTCGACAGGGGGT
->read1812_contig0_position2292_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTGTACTGAGTCTTAACATCGGCAAATGCGCCCTAGATACCTGCGGCTTCACTCCACAGTGTAAGAGTTGACGGGACTAAAACAGTATTGGGCGGTGAG
->read1813_contig0_position4177_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGTTGAGGCGGGAACTTCCCGCTGATATGATTGTGATCGATATTCAGACTCTAACAAGTGGTCAGTACAGGTTCGACCATACGCGACGGCAAACAGAAT
->read1814_contig0_position5435_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGGAACCGCTTTGACTCTGGAGTGCCAGCGATAGTATCTCAGAGGCCAAAGCGCTTGTTACCTCATCTAAAATCGCGACTATAGATCTGTTTAGAACCA
->read1815_contig0_position98_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGCGGTGTCGCTAGCGCAATGCGCAAGATTTTGACATTTACAAGGCAACAGTGCAGCGTCCGATGGTCCGGTGGCCTCCAGATAGTGTCCAGTCGCTCT
->read1816_contig0_position5358_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCAGTAAACCATATCAACAGCTTGATCGTTCCACTTCAATCAGCAAGACGGGCGACCGTACCCGGACACCTGGCAGCGGGAACCGCTTTGACTCTGGAG
->read1817_contig0_position5024_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTAACGGTCTGGCCTTATACAGCGCCACATCCGCCAGTTCGCTAGGTTGTAGCCAGGAAGTCTGTAGTACAGGTGCCCATAACCCGATGAGGCCAAGGT
->read1818_contig0_position36_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTAACGAGCTACCGTTTCCTTTAACCTGCCAGACGGTGACCAGGGCCGTTCGGCGTTGCATCGAGCGGTGTCGCTAGCGCAATGCGCAAGATTTTGACAT
->read1819_contig0_position6339_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGACCTTATTAAGTGCCCAGGAATTCCTAGGAAGGCGCGCAGCTCAAGCAATCATACATGGCGGAATGCCTGTCCACCGGGGGTTCTACTGTACCACAGT
->read1820_contig0_position5590_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCACCCAATCTGGCCATTGCAAGTTTGGCAGACGCGAGGTTGCGTGGTCAACCGAACGTTGATTTCCTTAGGGTACCGAGTATATTAACTTTATGAAAT
->read1821_contig0_position8965_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGCATATTGAGACAGGGTTGAAAACCTGTCTGAAGTCCGTGCTTCCCTAACCAGCCTATGCGCCTTAACTTTATGCATACTCGTTTAGTACAGGGCCGC
->read1822_contig0_position7922_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTAATACCAATTGAAATGAAGCTTACGCAAACCACTCGACGAACAACAGCAAGATTCGACGATCAAACTCGCGGGCGACACGAAGATTGTCATACTAGCT
->read1823_contig0_position6352_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCCCAGGAATTCCTAGGAAGGCGCGCAGCTCAAGCAATCATACATTGCGGAATGCCTGTCCACCGGGGGTTCTACTGTACCACAGTGGCCTGGATAGCT
->read1824_contig0_position2365_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGACTAAAACAGTATTGGGCGGTGAGGGGTACCCGACGCCTCTGCTGTCAAAGTAGGAAATCCAGTCTCGCCTATATCTACTATGTCATGCTTGTCGAA
->read1825_contig0_position8377_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCTCAATTCCTGCGGTACCGAGCAGCTTTGAGTTTTTGTAAGTCCCACGGTTAATGGGCCACTTATTTCGACATTCATGGCGCCGATATCCTGCTTAGG
->read1826_contig0_position2614_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTCCTGTCCCGAAGCCTTAAAATCTAACCCTGAATTTGCTTTATCCACCCCCCCTACTGGCCACCACTGGGGCGCGAGTCTCGAGCCTCTCGACTCCAA
->read1827_contig0_position7788_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATATCGATACACGAAGGCCAGTGCGGAAGCGGAGCCACACTCGCCGTTACTGACTGATTGACAATCCAGCCCGTTTGCGGTGATTTGTGCCGGCGCGTCC
->read1828_contig0_position1342_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTCTATTTTTGTACGGCTTGATGTCAGGGTCAGTTTGGGCGCCGGTATGTCTGTGTAAGGTTGGGCCAATCGAGAGGACATTTCGCAGCGCCCTTTCAT
->read1829_contig0_position9810_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTTAGTAGGTCTACTACTAGGCCGCTTGCTCAGAAATCGGAACACAAGTACGCGATCTCTTTTCTAGTCACCAGCCTCAGGCATTCGCAAATTTCGTTC
->read1830_contig0_position1974_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CACCACAAAATTTCAGCATAAAGCATCCGGTTGAAGGCTGCGCATCGAGCAGCGTGCATTGGTCTTTCAGTCCCCAGTCACCGGAGACGTCCGAGCTCGA
->read1831_contig0_position5490_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGTCACCTCATCTAAAATCGCGACTATAGATCTGTTTAGAACCACGACCCAGAAATCTTTAGCTAAGTAATCGACTGCCTTCGTCGGGCCGCTTATTGG
->read1832_contig0_position6249_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTTCTTCTTTCCTGTACGGTAATGCTTCCGCGCATCTAAGTGATATTCGCCGGAATTTACCCTTCTAATATTGTGTGCAAGCTACTTCTATACCTTATT
->read1833_contig0_position5218_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAACCAAAGCATATTAATATGCCAGCCGCGCAGGGTGGTATATATGATCCTTGATAGCTTTATGGCCATCATCATAGTAAATTTTTTCAGATTACCCTGC
->read1834_contig0_position3544_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGACAGCATGGATCGTGTAACTCTGCTCGGTTATACGCCCTCGGGAGAAGACCCATGTAAGATGTATCCATCCCTACCACACGCGTCCGCCACCTCCGGG
->read1835_contig0_position5027_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AACGCTCTGGCCTTATACAGCGCCACATCCGCCAATTCGCTAGGTTGTAGCCAGGAAGTCTGTAGTACAGGTGCCCATAACCCGATGAGGCCAAGGTGTT
->read1836_contig0_position1069_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTTACGCGTTATTACCGGTCAGCTCCAGTTACGTCACGGACGTAGAGAGCCTTTGAATGTGTACGGCAATAGGAGAAACTCGGCCACGTACGTGTCAAC
->read1837_contig0_position5366_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCATATCAACAGCTTGATCGTTCCACTTCAATCAGCAAGACGGGCGACCGTACCCGGACACCTGGCAGCGGGAACCGCTTTGACTCTGGAGTGCCAGCG
->read1838_contig0_position6518_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGGGGTGCCCGCGCCTGCGTCCGGTAGACGAGCGATGGATTTAGACCGTTCACTGAACCCTCTAATAGGACCTCTTGCCCATCCGAGGCTTAAGCAGCG
->read1839_contig0_position7460_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCCCTTCGTTGAAAGGAGAATACAAATGACGGGAACTCTGACGGGAGGGTGCTTGAACGAGAGAAGCTAACAGTCATTGGGATGACGAGAACAGCCCTA
->read1840_contig0_position183_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGTCCAGTCGCTCTAACTGTATGGAGACCATAGGCATTTACCTTATTCTCATCGCCACGCCCCAAGATCTTTAGGACCCAGCATTCCTTTAACCACTAA
->read1841_contig0_position6107_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCAGGCTGGTGCGACCCTTACAGCGTTATCCGTCCCGAACTGGCTTGAGCCACTCATAAGGCACGCGCGGGCCATAACAGTCGACTAAAAGGCGTAACCG
->read1842_contig0_position9255_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TACCCATACTGCCACTCCAGTACCTGGGCCGCGTGTTGTACGCTGTGTATCTTGAGAGCGTTTCTCCGTATCGAAATGTTCCGCTGGAAAGAACCTGCCG
->read1843_contig0_position5219_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AACCAAAGCATATTAATATGCCAGCCGCGCAGGGTGGTATATATGATCCTTGATAGCTTTATGGCCATCATCATAGTAAATTTTTTCAGATTACCCTGCA
->read1844_contig0_position7077_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGCCAATATACCCTGGGGGGAGCTAATATATCGCGGCGTCGAGTTACCGTTGCACCACCTCCAAGCGTCCATCGGAGTCCGCTTCCCGGGCTTGTCCGC
->read1845_contig0_position8778_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGACTGGGGGCTTACTGAGAACACTTCATCTGTATGGCAAAGTTGCGACACCGCGCCACACAGCAGTTTATTGTTAACACGCGATACAAGAGGGTTAGGA
->read1846_contig0_position4593_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GCAGTGTTGGAGCGATAGGGGGGACGTAAACGCCAATTCCGCTTAATCGCGGAATCTGCTGGCTTGTGCATTCGTCGGCCTATTAGATACGGTACGGAAT
->read1847_contig0_position6973_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGATTGTCCTTTCCCAGGCTACGGCCTTGTACCAAAGACTTCTAGACCGGAGAGACTACTTCCAGCCACGAATTCGTGTGATAACCGCCTAAACAGTCT
->read1848_contig0_position5162_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGTCTCGGCCAATTCGTTGTATTGATCGCTGTGCACTTTAAAATTCGGAACATCTTAACCAAAGCATATTAATATGCCAGCCGCGCAGGGTGGTATATA
->read1849_contig0_position69_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGTGACCAGGGCCGTTCGGCGTTTCATCGAGCGGTGTCGCTAGCGCAATGCGCAAGATTTTGACATTTACATGGCAACATTGCAGCGTTCGATGGTCCG
->read1850_contig0_position8747_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCCCGCTTATCCGGTGGTGATACCTACTATTGACTGGGGGCTTACTGAGAACACTTCATCTGTATGGCAAAGTTGCGACACCGCGCCACACAGCAGTTT
->read1851_contig0_position6272_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCTTCCGCGCATCTAAGTGATATTCGCCGGAATTTACCCTTCTAATATTGTGTGCAAGCTACTTCTAGACCTTATTAAGTGCCCAGGAATTCCTAGGAA
->read1852_contig0_position2912_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTTACCTTAAGACGAAAGAGTCAGTAGAGTTGGGGTTCGTGCTTTAATGACCCGTAGCCCAATTGCGCTCCCGAACAACGCGTGAGTTTAAAATTGACT
->read1853_contig0_position757_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGACGACCTAATTTTTCCCGTCTCTGTGGTCAACCTGGACGCACAAACCCTAGTCCCATATAAAGCTATTCCACGCCGGGTGGCCTGGACGTCGTTTGTG
->read1854_contig0_position9366_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGAGCTGCAACACTTTCACACAGGTAGCCGAACAGGTATTACTCAGACTGGAGAGGAATCTTCATAGGTCGTGCAGACATTGTCGCTGCGTACCAAAGT
->read1855_contig0_position6567_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCACTGAACCCTCTAATAGGACCTCTTGCCCATCCGAGGCTTAAGCAGCGACTCCACATGGAGCGATGGGTCCTCAAGGCAGTATAAAATGGACTGCTA
->read1856_contig0_position2056_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAGACGTCCGAGCTCGAACCCGTCCGGCTAAGAGGCAGGCAGTCGCTGCATGTGTACGCAGCGGTCTATGCTACAGGTATTACGGAGTGAAACGGCTGC
->read1857_contig0_position7519_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGAGAAGCTAACAGTCATTGCGATGACGAGAACAGCCCTACTGCCCGCCGTGAACGAGAACAAGCGTGTGGAGAGTGACTGACTATCACGAGGAATGGC
->read1858_contig0_position7430_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCTGCATACACCGGGTAGACAACATTCTCAGCCCTTCGTTGAAAGGAGAATACAAATGACGGGAACTCTGACGAGAGGGTGCTTGAACGAGAGAAGCTA
->read1859_contig0_position328_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-ACAATTAATATAAGACGGTATAATGGCTTCATGCTCATGTTCTATACCGAGCAGAGAGGTTGGGTCTACCTGGTAGTGTCGCGGTTATCGGACACAGGAT
->read1860_contig0_position3996_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTCTTGGACGACACGAGGTCGTAATTATTTCCTGAGATGGTTTTAGTGAGAGCAGCAGATGCACTCTTAGCTCCGCTGATAACGATTACTATAAATCAG
->read1861_contig0_position2365_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGACTAAACCAGTATTGGGCGGTGAGGGGTACCCGACGCCTCTGCTGTCAAAGTGGGAAATCCAGTCTCGACTATATCTACTATGTCATGCTTGTCGAA
->read1862_contig0_position5080_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAAGTCTGTAGTACAGGTGCCCATAACCCGATGAGGCCAAGGTGTTACGTGAAGTCGCGTTGTCGCTAGTAACAGATTGGGAGGTCTCGGCCAATTCGT
->read1863_contig0_position789_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGTGGACGCACAAACCCTAATCCCATATAAAGCTATTCCACGCCGGGTGGCCTGGACGTCGTTTGTGGATGGCTTTGGGAATCACTAGGTAATAACTGT
->read1864_contig0_position4753_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AATTAGAGCCAAAGCAGTAGGTTACCGTCGGCGCATAACCGGCGAGTGCTCTGAAACGTTACATTCGTCTATCCGCACACACCGCCGTTGGATGTGTCCC
->read1865_contig0_position8361_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCTGGTAGTAATCCGATCTCAATTCCTGCGGTACCGAGCAGCTTTGAGTTTTTGTAAGTCCCACGGTTAATGGGCCACTTATTTCGACATTCATGCCGC
->read1866_contig0_position4445_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCGGGATGATAATTTTTCTTAGTATAGTGACCGTTGTGGACGACGGACATAACTACTGAGTGTCCGCCCTCGGCTAATCATGAACACCGGTCAGGCATG
->read1867_contig0_position7963_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AACAACAGCAAGATTCGACGATCAAACGCGCCGGCGACACGAAGATTGTCATACTAGCTTTCAGTCATTCCCCCTCAGTTTTGTCCATGTGGAGAATATG
->read1868_contig0_position8913_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTTGAAATAGAACGAGTTGTAAAACATTAGCTCACGCGCCACCGTCATAGGCTGCATATTGAGACAGGGTTGAAAACCTGTCTGAAGTCCGTGCTTCCC
->read1869_contig0_position7393_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCCACTCGAGACCGCCCTCCCCGACCCATATGCAGTTTCTGCATACACCGGGTAGACAACATTCTCAGCCCTTCGTTGAAAGGAGAATACAAATGACGG
->read1870_contig0_position4851_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCACAGTGTTTTATACGGGACGGTGGCCACGGGGTGAGCACATGAATGGGGTACGGTTTTACCGTCCATGACGTTGTGACATAAAGGTGCGGGACGCGGA
->read1871_contig0_position8837_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACAGCAGTTTATTGTTAACACGCGATACAAGAGGGTTAGGAGCTAAGAAACCGGTGCATCACCGTACGAAAAGGATGGGTGAAATAGAACGAGTTGTAAA
->read1872_contig0_position5707_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-AAAGTTCAGAAGATCTCTGTCCGCCTCGAACCACTACAATAAGATTACGGAGAGCCCGTGGCTTGGTTGTTTGCTGAATTGTGGCTATCTCAAATTGGGA
->read1873_contig0_position4388_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGAAGTCTAGCTAGCTTGACTCGGCTGATAAAGAAAACAATCTATATGGAACCGAGGGGCGGGATGATAATTGTTCTTAGTATAGTGACCGTTATCGACG
->read1874_contig0_position2800_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCCGGCAGGACACCACTCTTTGAAGGTGCCCATTGCATTATAGCCTGAACTATTAGCAATCCTAAGCCCATAAGCCCTGCTCCACGGGGGCTACAATCC
->read1875_contig0_position1315_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCATAATAAGTGAACCCATGGGTCGCGCTGTATTTTTGTTCGGCTTGATGTCAGGGTCAGTTTGGGCGCCGGTATGTCTGTGTAAGGTTGGGCCAATCG
->read1876_contig0_position1293_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTCCGTCCTGCGTAGTGCTCTCCCATAATAAGTGAACCCGTGGGTCGTGCTGTATTTTTGTACGGCTTGATGTCAGGGTCAGTTTGGGCGCCGGTATGT
->read1877_contig0_position1271_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAATCTAAGTATGGACTCTTATATTCCCTCCTGCGTCGTGCTCTCCCATAATAAGTGAACCCATGGGTCGCGCTGTATTTTTGTACGGCTTGATGTCAGG
->read1878_contig0_position9259_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CATACTGCCACTCCAGTACCTGGGCCGCGTGTTGTACGCTGCGTATCTTGAGAGCGTTTCTCCGTATCGAAATGTTCCGCTGTAAAGAACCTGGCGTATC
->read1879_contig0_position5913_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTATAGCAGGCTCACCAGCATGAAAGACATCCTCATTGTGAACCCGGCATCTCGTGATTCGAGCCTAACAGCATGCCATCTAACGTTTGGACGGGTCTTG
->read1880_contig0_position5562_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTACTGCCTTCGTCGGGACGCTTATTGGTTCACCCAATCTGGCCATTGCAAGTTTGGCAGACGCGAGGTTGCGTGGTCAACCGAACGTTGCTTTCCTTAG
->read1881_contig0_position8744_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGAGCCCGCTTATCCGGTGGTGATACCTACTATTGACTGGGGGCTTACTGAGAACACTTCATCTGTATGGCAAAGTTGCGACACCGCGCCACACAGCAG
->read1882_contig0_position927_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGATCAAGTGGTTAGAGACCTAGGTCTATGCCAGACGATCGCAGCGGAGTCGATATAATTGCAGTATCATGTATCGCTGATTGTGGGGGGCATGGGGGTT
->read1883_contig0_position7559_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTGCCCGCCGTGAACGAGAACAAGCGTGTGGAGAGTGACTGACTATCACGAGGAATTACGGATAACAGCCCACTTGGAGTGTGCTGAGGGCCGACGCCC
->read1884_contig0_position9482_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCGTTGTCTACAGAAGCTCATGGATAAGAGTGTGCGAATAACATCACTTGTTACTTCACGGAACGCTTCTTGATCCTGAGCTCCCCCGCGATTAACCTA
->read1885_contig0_position4476_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGTTATGGACGACGGACATAACTACTGAGTGTCCGCCCTCGGCTTATCATGAACACCGGTCAGGCATGCTTACTTCCTGCGACGGCATTGGCGATTATG
->read1886_contig0_position9645_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCCACATGTGATGCTCGTACTCGAAGGGGGAATCACCTTACTTAATCGGCTGGGGTAACGGCTGGTTTTGTACTACGGTATGGGAACCCGTTTGCCGAA
->read1887_contig0_position3758_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GAATAAATTCGACACGGGGTACGAAGGGTAAGACCACCTAGCCTGGCAATTACCCCTTTGTCATTCTAGTCAAGTGAAGAACCCGGGCCCAAAATTGGAA
->read1888_contig0_position2836_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CATTGTAGCCTGAACTATTAGCAATCCTAAGCCCATAAGCCCTGCCCCACGGGGGCTACAATCCAGCAGTGAACGCGTTTACCTTAAGACGAAAGAGTCA
->read1889_contig0_position6321_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTGTGCAAGCTACTGCTAGACCTTATTAAGTGCCCAGGAATTCCTAGGAAGGCGCGCAGCTCAAGCAATCATACATGGCGGAATGCCTGTCCACCGGGG
->read1890_contig0_position3848_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAAATTGGAACCCGTAATCTTCAAGTGAATCATCCGATCATGCAAACCTGATTATCTGCACGACTCTTAAAATCATGCACTAAGCATAGAATGCACGACT
->read1891_contig0_position6723_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCATTGCAAGAACGTACGGACGGACAAAATGTCGGACACCGCCTTATCGGCTATACTAGTTAGAGCCTCGCTTGGGTCTCTACATCCGCTGATACGCGC
->read1892_contig0_position8025_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTCATTCCCCCTTAGTTTTGTCCATGTGGAGAATATGCATTCGACCAAATGAAAATGTCAATAATCTCGACCCTGTAGTCCGCGGCCAATCAGCACGAT
->read1893_contig0_position1778_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTATTACCAACTCCACTTCTGCAAATTGTTATGAGCAAGCATACAAGTTAGCCGGCCCACAAATCGACGTGTGTATTTGTTCAATGGCAGGAGGTTAACT
->read1894_contig0_position6403_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AATGCCTGTCCACCGGGGGTTCTACTGTACCACAGTGGCCTGGATAGCTAAGCAGGTCCTGGATTGGCATGACATCCGGAGTGATAGGCACTGCTCACGA
->read1895_contig0_position4547_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TACCTCCTGCGACGGCATTGGCGATTATGGGCGTGCATAGAGTCCCGCAGTGTCGGAGCGATAGGGGGGACGTAAACGCCAATTCCGCTTAATAGCGGAA
->read1896_contig0_position8488_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGCACGACCCTATATGACCCCTAGCGAGAAGTTATAGTCTAATAATGAATGGTGAACAGCACATGTTTTCGCCCTGAGGCCATATTAATTCTACTCAGG
->read1897_contig0_position7712_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGAGGTAACAAGCCATGAGGACTGGAGCGGTAATGTGGTAGTGTAGTTGCCGGCCCCTGTGCTGACCTTATGTCCATATCGATACACGAAGGCCAGTGC
->read1898_contig0_position497_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TACGCCTCGATTGGTTTCAGCTCACGTGGGACGCATGTACTTACCTAACATGAAGCGGTAATGGAGCTCGAACACTAGTCGGTGGCTCTTCTGTCTCTGG
->read1899_contig0_position9725_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGGGAACCCGTTTGCCGAACGTCTGGAAATCTGTCGAGTCATATCGATGAACAGAGACTAAATGTCCTTAAATCTCTAACACGATTTTAGTAGGTCTAC
->read1900_contig0_position6156_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCACTCATAAGGCACGCGCGGGCCATAACAGTCGACTAAAAGGCGTAACAGATTCTGCTACGTTATAAAAAAGGGACGAGTGGGGTCAACAGTTCTTCTT
->read1901_contig0_position4282_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCAACTATCCCCTTTATTAATGATCCGTGTCCCCCGACCGTGTGCTGAGGAGACCCGTAATGCATGGAAAGTGCCAATATCCCCGGGAGTCCCGCACTA
->read1902_contig0_position1060_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TATGACCCTGGTTACGCGTTATTACCGGTCAGCTCCAGTTACGTCACGGACGTAGAGAGCCTTTGAATGTGTACGGCAATAGGAGAAACTCGGCCACGTA
->read1903_contig0_position685_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTACATTATACAGTAAGGTAGAATCGCGTAGAAGCACCCACGATCAATGTTATTAACCGCGACGGTGTATCCCACGACCTAATTTTTCCCGTCTCTGTG
->read1904_contig0_position203_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TATGGAGACCATAGGCATTTAACTTATTCTCATCGCCACGCCCCAAGATCTTTAGGACACAGCATTCCTTTAACCACTAACATAACGCGTGTCATCTAGT
->read1905_contig0_position7660_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGACCGTGATATCCCTGCGAGTGGGATGCGAAAACGGCATAAGCGCAATGACCGAGGTAACAAGCCATGAGGACTGGAGCGGTAATGTGGTAGTGTAGT
->read1906_contig0_position276_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCACTAACATAACGCGTGTCATCTAGTTCTCGCATACTCCGCCTTGGGCCACACAATTAATATAAGACGGGATAATGGCTTCATGCTCATGTTCTATACC
->read1907_contig0_position6484_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGATAGGCACTGCTCACGACCAGCTTGCGGACAAACGGGGTGCCCGCGCCTGCGTCCGGTAGACGAGCGATGGATTTAGACCGTTCACTGAACCCTCTAA
->read1908_contig0_position1556_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAACTGCACACTCCGAGGCTCTGCCGAGCCTTCTAACCATCGGGTATGTACATTCACCTTTGGACGCTTCGATAGGACATGCACCCGGTCCGTTGACTTA
->read1909_contig0_position2879_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCCCACGGGGGCTACAATCCAGCAGTGAACGCGTTTACCTTAAGACGAAAGAGTCAGTAGAGTTGGGGTTCGTGCTTTAATGACCCGTAGCCCAATTGC
->read1910_contig0_position6181_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAACAGTCGACTAAAAGGCGTAACCGATTCTGCTATGTTATAAAAAAGGGACGAGTGGGGTCAACAGTTCTTCTTCTTTCCTGTACGGTAATGCTTCCGC
->read1911_contig0_position1370_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTCAGTTTGGGCGCCGGTATGTCTGTGTAAGGTTGGGCCAATCGAGAGGACATTTCGCAGCGCCCTTTCATCTCTATTGCTAGGTCTCTTAAGCCTAAT
->read1912_contig0_position5464_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGATAGTATCTCAGAGGCGAAAGCGCTTGTCACCTCATCTAAAATCGCGACTATAGATCTGTTTAGAACCACGACCCAGAAATCTTTAGCTAAGTAATCG
->read1913_contig0_position4193_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCCCGCTGATATGATTGTGATCGATATTCAGACTCTAACAAGTGGTCAGTACAGGTTCGACCATACGCGACGGCAAACAGAATCGCACGTCAACTATCC
->read1914_contig0_position6004_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGGTCTTGTGTTCCCTCAACACGTACGTTGACAGAGCTAACAATCCGTCGACTGAATCTGATTCCTTTGTTATTTCACACTATTGTTCGGTGCGTGCGC
->read1915_contig0_position7530_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACAGTCATTGCGATGACGAGAACAGCCCTACTGCCCGCCGTGAACGAGAACAAGCGTGTGGAGAGTGACTGACTATCACGAGGAATTACGGATAACAGCC
->read1916_contig0_position394_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TACCTAGTAGTGTCGCGGTTATCGGACAGAGGATTATGTAAGGTTACCGAAGACCGGGTAGCGTAGTTAGTAACTTCAATCCGCGTTACGCTTTGTCCTC
->read1917_contig0_position6312_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCTAATATTGTGTGCAAGCTACTCCTAGACCTTGTTAAGTGCCCAGGAATTCCTAGGAAGGCGCGCAGCTCAAGCAATCATACATGGCGGAATGCCTGT
->read1918_contig0_position4547_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TACCTCCTGCGACGGCATTGGCGATTATGGGCGTGCATAGAGTCCCGCAGTGTCGGAGCGATAGGGAGGACGTAAACGCCACTTCCGCTTAATAGCGGAA
->read1919_contig0_position1628_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGGACATGCACCCGGTCCGTTGACTTACCAACTTGATCGCCAGTGAGTGAGCGGTGGTTTAACTGTTGAGTGGCCACTTTTCCCTATCTGCTGGGACGG
->read1920_contig0_position228_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTCTCATCGCCACGCCCCAAGATCTTTAGGACCCAGCATTCCTTTAACCACTAACATAACGCGTGTCATCTAGTTCTAGCATACTCCGCCTTGGGCCAC
->read1921_contig0_position7621_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATAACAGCCCACTTGGAGTGTGCTGAGGGCCGACGCCCGGGGACCGTGATATCCTTGCGAGTGGAATGCGAAAACGGCATAAGCGCAATGACCGATGTAA
->read1922_contig0_position3817_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTATTCTAGTCAAGTGAAGAACCCGGGCCCAAAATTGGAACCCGTAATCTTCAAGTGAATCATCCGATCATGCAAACCTGATTATCTGCACGACTCTTA
->read1923_contig0_position5264_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCCTTGATAGCTTTATGGCCATCATCATAGTAAATTTTTTCAGGTTACCCTGCAGACGTCCGCCTAAGATCCTAGTTGAATTGATCAATTGAGTCCAGT
->read1924_contig0_position4722_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCTATCGGCGTTCAAAGTATTCGGCGGATGAATTAGAGCCAAAGCAGTAGGTTACCGTCGGCGCATAACCGGCGAGTGCTCTGAAACGTTACATTCGTC
->read1925_contig0_position3393_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGACGTTCATTCTCAAGGGTGTAGTTTTAGAGACTGAGAACTCACCCTATTGGTAGTACTGCCTGCCGTCGCCTCGCGCCCATAATGTTTGGAACTCGCA
->read1926_contig0_position739_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CAACCGCGACGGTGTGTTCCACGACCTAATTTTTCCCGTCTCTGTGGTCAACCTGGACGCAGAAACCCTAGTCCCATATAAAGCTATTCCACGCCGGGTG
->read1927_contig0_position5883_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGAGGAAAAATTGAACATCAACGGAAGTACTATAGCAGGCTCACCAGCATGAAAGACATCCTCATTGTGAACCCGGCATCTCGTGATTCGAGCCTAACA
->read1928_contig0_position3586_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGAGAAGACCCATGTAAGATGTATCCATCCCTACCACACGCGTCCGCCACCTCCGGGTCTAGTAAACCAGAGATTCCATGGACTCTCTGTTTCGGCGAT
->read1929_contig0_position7862_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGGGGTGATTTGTGCCGGCGCGTCCAGGTGCGAACGTTGTGCCGTGTCACTCTGTAGCTCTAATACCAATTGAAATGAAGCTTACGCAAACTACTCGAC
->read1930_contig0_position275_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCACTAACATAACGCGTGTCATCTAGTTCTAGCATACTCCGCCTTGGGCCACACAATTAATATAAGACGGGATAATGGCTTCATGCTCATGTTCTATAC
->read1931_contig0_position4585_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGAGTCCCGCAGTGTCGGAGCGATAGGGAGGACGTAAACGCCAATTCCGCTTAATAGCGGAATCTGCTGGCTTGTGCATTCGTCGGCCTATTAGATACGG
->read1932_contig0_position5059_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CAATTCGCTAGGTTGTAGCCAGGAAGTCTGTAGTACAGGTGCCCATAACCCGATGAGGCCAAGGTGTTACGTGAAGTCGCGTTGTCGCTAGTAACAGATT
->read1933_contig0_position5147_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGTAACAGCTTGGGAGGTCTCGGCCAATTCGTTGTATTGATCGCTCTGCACTTTAAAATTCGGAGCATCTTAACCAAAGCATATTAATATGCCAGCCGC
->read1934_contig0_position5164_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCTCGGCCAATTCGTTGTATGGATCGCTGTGCACTTTAAAATTCGGAACATCTAAACCAAAGCATATTAATATGCCAGCCGCGCAGGGTGGTATATATG
->read1935_contig0_position8288_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTCGGACTCGTATCTGTCTCCGTGTTCCTTTCGATAACTCTGCGACCTGAATGACCTTGGGCTCGTCGACATTCCTGGTAGTAATCCGATCTCAATTCC
->read1936_contig0_position6326_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCAAGCTACTTCTAGACCTTATTAAGTGCCCAGGAATTCCTAGGAAGGCGCGCAGCTCAAGCAATCATACATGGCGGAATGCCTGTCCACCGGGGGTTCT
->read1937_contig0_position7599_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGACTATAACGAGGAATTACGGATAACAGCCCACTTGGAGTGTGCTGAGGGCCGACGCCCGGGGACCGTGATATCCTTGCGAGTGGAATGCGAAAACGGC
->read1938_contig0_position6126_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACAGCGTTATCCGTCCCGAACTGGCTTGAGCCACTCATAAGGCACGCGCGGGCCATAACAGTCGACTAAAAGGCGTAACCGATTCGGCTACGTTATAAAA
->read1939_contig0_position7876_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCGGCGCGTCCAGGTGCGAACGTTGTGCCGTGTCACTTTGTAGCTCTAATACCAATTGAAATGAAGCTTACGCAAACTACTCGACGAACAACAGCAAGA
->read1940_contig0_position168_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTGGCCTCCAGATAGTGTCCAGTCGCTCTAACTGTATGGAGACCATAGGCATTTACCTTATTCTCATCGCCACGCCCCAAGATCTTTAGGACCCAGCAT
->read1941_contig0_position5729_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCTCGAACCACTACAATAAGATTACGGATAGCACGTGGCTTGGTTGTTTTCTGAATTGTGGCTATCTCAAATTGGGACCTAGTGTTGGCCAATAAGCTT
->read1942_contig0_position8261_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTTCCAATCGTTGCACATGACTTGAGTCTCGGACTCGTATCTGTCTCCGTGTTCCTTTCGATAACTCTGCGACCTGAATGACCTTGGGCTCGTCGAAAT
->read1943_contig0_position6733_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAACGTAAGGACGGACAAAATGTCGGACACCGCCTTATCGGCTATACTAGTTAGAGCCTCGCTTGGGTCTCTACATCCGCTGATACGCGCGAGCTCTCAC
->read1944_contig0_position7636_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGTGTGCTGAGGGCCGACGCCCGGGGACCGTGATGTCCTTGCGAGTGGAATGCGAAAACGGCATAAGCGCAATGACCGAGGTTACAAGCCATGAGGACT
->read1945_contig0_position2359_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTGACGGGACTAAAACAGTATTGGGCGGTGAGGGGTACCCGACGCCTCTGCTGTCAAAGTGGGAAATCCAGTCTCGACTATATCTACTATGTCATGCTT
->read1946_contig0_position247_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGATCTTTAGGACCCAGCATTCCTTTAACCACTAACATAACGCGTGTTATCTAGTTCTAGCATACTCGGCCTTGGGCCACACAATTAATATAAGACGGG
->read1947_contig0_position9373_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCAACACTTTCACACAGGTAGCCGAACAGGTATTACTCAGACTGGAGAGGAATCTTCATTGGTCGTGCAGACATTGTCGCTGCGTACCAAAGTAACTGGA
->read1948_contig0_position3583_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCGGGAGAAGACCCATGTAAGATGTATCCATCCCTACCACACGCGTCCGCCACCTCCGGGTCTAGTAAACCAGAGATTCCATGGACTCTCTGTTTCGTC
->read1949_contig0_position412_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTATCGGACAGAGGATTATGTAAGGTTACCGAAGACCGGGTAGCGTAGTTAGTAACTTCAATCCGCGTTACGCTTTGTCCTCTGCTACGCCTCGATTGGT
->read1950_contig0_position6542_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTAGACGAGCGATGGATTTAGACCGTTCACTGAACCCTCTAATAGGACCTCTTGCCCATCCGAGGCTTAAGCAGCGACTCCACATGGAGCGATGGGTCCT
->read1951_contig0_position341_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GACGGGATAATGGCTTCATGCTCATGTTCTATACCGAGCAGAGAGGTTGGGTCTACCTAGTAGTGTCGCGGTTATCGGACAGAGGATTATGTAAGGTTAC
->read1952_contig0_position8558_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGTCCTGAGGCCATATTAATTCTACTCAGATTGTCTGTAACCGGAGCTTCGGGCGTATTTTTGCGTAAGACACTGCCTAAAGGGAACATATGTGTCCAGA
->read1953_contig0_position3874_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAATCATCCGATCATGCAAACCTGATTATCTGCACGACTCTTAAAATCATGCACTAAGCATAGAATGCACGACTACTTGTTACTGAAGTCGGCATGACTA
->read1954_contig0_position224_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GATTATTCTCATCGCCACGCCCCAAGATCTTTAGGAACCAGCATTCCTTTAACCACTAACATAACGCGTGTCATCTAGTTCTAGCATACTCCGCCTTGGG
->read1955_contig0_position8728_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCGAATTCAGCGTGTAAGAGCCCGCTTATCCGGTGGTGATACCTACCATTGACTGGGGGCTTACTGAGAACACTTCATCTGTATGGCAAAGTTGCGACA
->read1956_contig0_position8513_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGAGAAGTTATAGTCTAATAATGAATGGTGAACAGCACATCTTTTCGTCCTGAGGCCATATTAATTCTACTCAGATTGTCTGTAACCGGAGTTTCGGGCG
->read1957_contig0_position6085_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TATTGTTCGGTGCGTGCGCTGCTCAGGCTGGTGCGACTCTTACAGCGTTATCCGTCCCGAACTGGCTTGAGCCACTCATAAGGCAGGCGCGGGCCATAAC
->read1958_contig0_position7203_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CAATCGGGTTGGCCAAAAATTCTACCTGTCCACCTGTCCGCTAGAAGCAGATTATACGGAATACATATCCCGACACCGGCAGCTGAAATGATGCAGAAGC
->read1959_contig0_position9110_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGTTACATTAATCGCTTCTGAGATGACAGACCGAAGCCCACCTGCGCTGACCTCACCGCAGGCATCGAGTCTAACTCTGATTCGAGAGACGGATGTAAT
->read1960_contig0_position6243_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AACAGTTCTTCTTCTTTCCTGTACGGTAATGCTTCCGCGCATCTAAGTGATATTCGCCGGAATTTACCCTTCTAATATTGTGTGCAAGCTACTTCTAGAC
->read1961_contig0_position9233_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGAGCAGCTCCGAGGGCCTTTATACCCATACTGCCACTCCAGTACCTGGGCCGCGTGTTGTACGCTGTGTATCTTGAGAGCGTTTCTCCGTATCGAAATG
->read1962_contig0_position5898_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACATCAACGGAAGTACTATAGCAGGCTCACCAGCATGAAAGACATCCTCATTGTGAACCCGGCATCTCGTGATTCGAGCCTAACAGCATGCCATCTAACG
->read1963_contig0_position1446_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTGCTAGGTCTCTTAAGCCTAATCAGGATCATAGATGGCGAATTATTGACCACAGGTAGGGGCGAGGTATAAATTAGTGGATTCACTTCCCTTTGACAT
->read1964_contig0_position6044_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ACAATCCGTCGACTGAATGTGAGTCCTTTGTTATTTCACACTATTGTTCGGTGCGTGCGCTGCTCAGGCAGGTGCGACCCTTACAGCGTTATCCGTCCCG
->read1965_contig0_position3448_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTACTGCCTGCCGTCGCCTCGCGCCCATAATGTTTGGAACTCGCAAACCTTTACACTCATCACATAGCAGGTTCCACCCGAACCGCGCGTATTCTGCGAC
->read1966_contig0_position3663_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CATGGACTCTCTGTTTAGTCGATTGTCTGAATATCGTGCAGTAAGTTTCTCTTAGGTTCCTCAACGGAAACGTCTCAGACCCACCTGAGACGCGGGAATA
->read1967_contig0_position4201_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GATATGATTGTGATCGATATTCAGACTCTAACAAGTGGTCAGTACAGGTTCGACCATACGCGAGGGCAAACAGAATCGCTCGTCAACTATCCCCTTTATT
->read1968_contig0_position5829_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CATATCGACTTCTCAGATAGACTAATAGAACGAAGTCCATATAACAGCTGATTTAAGAGGAAAAATTGAACATCAACGGAAGTACTATGGCAGGCTCACC
->read1969_contig0_position3151_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGACTCTTGCGCTCGGATGTCCGCAATGGGTTATGAAATGCCTATGTTTCGGTAATCTCTCATCTACTAAGCGCCCTAAAGGTCGTATGGTTGGAGGGC
->read1970_contig0_position8943_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTCACGCGCCACCGTCATAGGCTGCATATTGAGACAGGGTTGAAAACCTGTCTGAAGCCCGTGCTTCCCTAACCAGCCTATGCGCCTTAACTTTATGCA
->read1971_contig0_position2631_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTAAAATCTAACCCTGAATTGGCTTTATCCACCCCCCCTACTGGCCACCACTGGGGCGCGAGTCTCGAGCCTCTCGACTCCAAAGGGTCTGCCCGAGCCA
->read1972_contig0_position736_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TATTAACCGCGACGGTGTATTCCACGACCTAATTTTTCCCGTCTCTGTGGTCAACCTGGACGCACAAACCCTAGTCCCATATAAAGCTATTCCACGCCGG
->read1973_contig0_position3998_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTTGGACACCACGAGGTCGTAATTATTTCCTGAGATGGTTTTAGTGAGAGCAGCAAATGCACTCTTAGCTCCGCTGATAACGATTACTATAAATCAGCG
->read1974_contig0_position2268_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTGACCAGCGATAGTACGTTCCTTTTGTACTGAGTCTTAACATCGGCAAATGCGCCCTAGATACCTGCGGCTTCACTCCACAGTGTAAGAGTTGACAGG
->read1975_contig0_position932_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGTGGTTAGAGACCTAGGTCTATGCCAGACGATCGCAGCGGAGTCGATATAATTGCAGTATCATGTATCGCTGATTGTGGGGGGCGTGGGGGTTCCGCA
->read1976_contig0_position3571_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGTTATACGCCCTCGGGAGAAGAACCATGTAAGATGTATCCATCCCTACCACACGCGTCCGCCACCTCCGGGTCTAGTAAACCAGAGATTCCATGGACT
->read1977_contig0_position2740_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTCGTTACTCCCGGGATCCACTGCGTCTATTGTAAGAAATGCAATGCGTGGCCAGTTTGTTCCGGCAGGACACCACTCTTTGAAGGTGCTCATTGCATT
->read1978_contig0_position2960_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGACCCGTAGCCCAATTGCGATCCCGAACAACGCGTGAGTTTAAAATTGACTTGAAACCGCCTAGCTCGGACCACCAAAGAGCAAGACTCTATGACTAGC
->read1979_contig0_position1901_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAATCAAATTGAGACAGACGAGTTGGAGTGTTTTGATGAGCGGTGTTATATTTGTCCTAACTTAGCACTATCGCACCACAAAATTTCAGCATAAAGCATC
->read1980_contig0_position9274_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTATCTGGGCCGCGCGTTGTACGCTGTGTATCTTGAGAGCGTTTCTCCGTATCGAAATGTTCCGCTGTAAAGAACCTGGCGTATCCTGACCATGGAGCTG
->read1981_contig0_position3051_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGACTAGCGGGTGTCGTCAATGAAAACTGTTCGAGCACTGTCCGCGAAACTTTATTCAGTACAGCGACTTTTACCCTCGTGGTCTGAATGTTATGCCGT
->read1982_contig0_position2289_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTTTTGCACTGAGTCTTAACATCGGCAAATGCGCCCTAGATACCTGCGGCTTCACTCCACAGTGTAAGAGTTGACGGGACTAAGACAGTATTGGGCGGT
->read1983_contig0_position7728_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGAGGACTGGAGCGGTAATGTGGTAGTGTAGTTGCCGGCCCCTGTGCTGACCTTATGTCCATATCTATACACGAAGGCCAGTGCGGAAGCGGGGCCACAC
->read1984_contig0_position8530_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATAATGAATGGTGAACAGCACATCTTTTCGTCCTGAGGCCATATTAATTCTACTCAGATTGTCTGTAACCGGAGCTTCGGGCGTATTTTTGCGTAAGACA
->read1985_contig0_position6435_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGTGGCCTGGATAGCTAAGCAGGTCCTGGATTGGCATGTCATCCGGAGTGATAGGCACTGCTCACGACCAGCTTGCGGACAAACGGGGTGCCCGCGCCT
->read1986_contig0_position7521_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGAAGCTAACAGTCATTGCGATGACGAGAACAGCCCTACTGCCCGCCGTGAACGAGAACAAGCGTGTGGAGAGTGACTGACTATCACGAGGAATTACGG
->read1987_contig0_position6550_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGATGGATTTAGACCGTTCACTGAACCCTCTAATAGGACCTCTTGCCCATCCGAGGCTTAAGCAGCGACTCCACATGGAGCGATGGGTCCTCAAGGCAG
->read1988_contig0_position2566_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGACGATAGAGCGAAGTAGTTACTGTGATTACCCGTCCATCGATGCCCCTCCTGTCCCGAAGCCTTAAAATCTAACCCTGAATTGGCTTTATCCACCCC
->read1989_contig0_position2766_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTATTGTAAGAAATGCAACGCGTGGCCAGTTTGTTCCGGCAGGACACCACTCTTTGAAGGTGCCCATTGCATTGTAGCCTGAACTATTAGCAATCCTAA
->read1990_contig0_position8155_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CGACCGCCGCAGGAAAGATCCGAGGCCTTTTCCAGGGTAAAATCATGGACTCATTGTCGAACCCCTATTATTAGGAGAGGGCTGCGACTGCTTGCAGCTC
->read1991_contig0_position8354_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGACATTCCTGGTAGTAATCCGATCTCAATTCCTGCGGTACCGAGCAGCTTTGAGTTTTTGTAAGTCCCACGGTTAATGGGCCACTTATTTCGACATTC
->read1992_contig0_position2917_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTTAAGACGAAAGAGTCAGTAGCGTTGGGGTTCGTGCTTTAATGACCCGCAGCCCAATTGCGCTCCCGAACGACGCGTGAGTTTAAAATTGACTTGAAA
->read1993_contig0_position2499_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTATGCAGATTTCGTACCTTGCCACTGCTATCTCCGGCATATGGGCGTGCTATAAATGCGGGAATCAGGACGATAGAGCGAAGTAGTTACGGTGATTAC
->read1994_contig0_position3673_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGTTTCGTCTATTGTCTTAATATCCTGCAGTAAGTTTCTCTTAGGTTCCTCAACGGAAACGTCTCAGACCCACCTTAGACGCGGCAATAAATTCGACAC
->read1995_contig0_position4588_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCCCGCAGTGTCGGAGCGATAGGGAGGACGTAAACGCCAATTCCGCTTAATAGCGGAATCTGCTGGCTTGTGCATTCGTCGGCCTATTAGATACGGTAC
->read1996_contig0_position3028_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGACCACCAAAGAGCAAGACTCTATGACTAGCGGGTTTAGTCAATGAAAACTGATCGAGCACTGTCCGCGAAACATTATTCAGTACAGCGACTTTTACCC
->read1997_contig0_position8595_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAACCGGAGCTTCGGGCGTATTTTTGCGTAAGACACTGCCTAAAGGGAACATATGTGTCCAGAATAGGGTTCAACGGTGTATGAGCAAACGATGCGGTAA
->read1998_contig0_position6864_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCATACATTTAACCCTTAGTCATAAGATGATACTTCATCTGCATGCGCGCATCTTCCTATTTTATGGTCTTAATTGAGTGTTCAGAGTTGGTGGTCACAG
->read1999_contig0_position3085_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCACTTTCCGCGAAACATTATTCAGTACAGCGACTTTTACCCTCGTGGTCTGAATGTTATGCCGTCCGACTCTTGCGCTCGGATGTCCGCAATGGGTTA
->read2000_contig0_position1354_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TAAGGTTTGATGTCAGGGTCAGTTTGGGCGCCGGTATGTCTGTGTAAGGTTGGGCCAATCGAGAGGACATTTCGCAGCGCCCTTTCATCTCTATTGCTAG
->read2001_contig0_position828_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CACGCCGGGTGGCCTGGACGTCGTTTGTGGATGGCTTTGGGAATCACTAGGTAATTACTGTTGGCTCCTTTCTTCATGATCGTCGGAGTTCTTTCAGGCC
->read2002_contig0_position8529_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AATAATGAATGGTGAACAGCACATCTTTTCGTCCTGAGGCCATATTAATTCTACTCAGATTGTCTGTAACCGGAGCTTCGGGCGTATTTTTGCGTAAGAC
->read2003_contig0_position5883_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGAGGAAAAATTGAACATCAACGGAAGTACTATAGCAGGCTCAACAGCATGAAAGACATCCTCATTGTGAACCCGGCATCTCGTGATTCGAGCCTGACA
->read2004_contig0_position4162_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTCGCACATAGTGTACGTTGAGGCGGGAACTTCCCGCTGATATGATTGTGATCGATATTCAGACTCTAACAAGTGGTCAGTACAGGTTCGACCATACGC
->read2005_contig0_position4065_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCTCCGCTGATAACGATTACTATAAATCAGCGAATCTACCATCAATCTGCACCACGAATATCGTCCAAGACGTTTTGAGCCGGTGACTAATTCGGTTGT
->read2006_contig0_position6174_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGGCCATAGCAGTCGACTAAAAGGCGTAACCGATTCTGCTACGTTATAAAAAAGGGACGAGTGGGGTCAACAGTTCTTCTTCTTTCCTGTACGGTAATG
->read2007_contig0_position2747_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTCCCGGGATCCACTGCGTCTATTGTAAGAAATGCAATGCGTGGCCAGTTTGTTCCGGCAGGACACCACTCTTTGAAGGTGCCCATTGCATTGTAGCCT
->read2008_contig0_position3416_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTTTAGAGACTGAGAACTCACCCTATTGGTAGTACTGCCTGCCGTCGCCTCGCGCCCATAATGTTTGGAACTCGCAAACCTTTACACTCATCACATAGC
->read2009_contig0_position6361_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTCCTAGGAAGGCGCGCAGCTCAAGCAATCATACATGCCGGAATGCCTGTCCACCGGGGGTTCTACTGTACCACAGTGGCCTGGATAGCTCAGCAGGTC
->read2010_contig0_position8773_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTATTGAATGGGGGCTTACTGAGAACACTTCATCTGTATGGCAATGTTGCGACACCGCGCCACACAGCAGTTTATTGTTAACACGCGATACAAGAGGGT
->read2011_contig0_position6576_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCTCTAATAGGACCTCTTGCCCATCCGAGGCTTAAGCAGCGACTCCACATGGAGCGATGGGTCCTCAAGGCAGTATAAAATGGACTGCTATCTAGGCGT
->read2012_contig0_position76_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGGGCCGTTCGGCGTTGCATCGAGCGGTGTCGCTAGCGCAATGCGCAAGATTTTGACATTTACAAGGCAACATTGCAGCGTCCGATGGTCCGGTGGCCT
->read2013_contig0_position8741_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTAAGAGCCCGCTTATCCGGTGGTGTTACCTACTATTGACTGGGGGCTTACTGAGAACACTTCATCTGAATGGCAAAGTTGCGACACCGCGCCACACAG
->read2014_contig0_position5174_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTCGTTGTATGGATCGCTGTGCACTTTAAAATTCGGAACATCTTAACCAAAGCATATTAATATGCCAGCCGCGCAGGGTGGTATATATGATCCTTGATA
->read2015_contig0_position5980_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-ACAGCATGCCACCTAACGTTTGGACGGGTCTTGTGTTCCCTCAACACGTACGTTGACAGAGCCAACCATCAGTCGACTGAATGTGATTCCTTTGTTATTT
->read2016_contig0_position983_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AATTGCAGTATCATGTATCGCTGATTGTGGGGGGCATGGGGGTTCCGCATTGGCGCAAAGGTACCGCAAAGGGCCTGTATGACCCTGGTTACGCGTTATA
->read2017_contig0_position831_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCGGGTGGCCTAGACGTCGTTTGTGGATGGCTTTGGGAATCACTAGGTAATTACTGTTGGCTCCTTTCTTCATGATCGTCGGAGTTCTTTCAGGCCGAT
->read2018_contig0_position8049_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGTGGAGAATATGCATTCGACCAAATGAAAATGTCAATAATCTCGACCCTGTAGTCCGCGGCCAATCAGCACGATCAAGCTAAAGACAGGGATTATGCA
->read2019_contig0_position9332_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTCCGCTGTAAAGAACCTGGCGTATCCTGACCATGGAGCTGCAACACTTTCACACAGGTAGCCGAACACGTATTACTCAGACTGGAGAGGAATCTTCAT
->read2020_contig0_position6895_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTTCATCTGCATGCACGCATCTTCCTATTTTGTGGTCTTAATTGAGTGTTCAGAGTTGGGGGTCACAGATGAGCGTTCCGATTGTCCTTTCCCAGGCTA
->read2021_contig0_position6144_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AACTGGCTTGAGCCACTCATAAGGCACGCGCGGGCCATAACAGTCGACTAAAAGGCGTAACCGATTCTGCTACGTTATAAAAAAGGGACGAGTGGGGTCA
->read2022_contig0_position2104_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GCATGTGTACGCAGCGGTCTATGCTACAGGTATTGCGGAGTGAAACGGCTGCGAGCATCTCATAATCGGGCCACCCGATTTCAGCTTGGCAACAACAGAG
->read2023_contig0_position3868_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCAAGTGAGTCATCCGATCATGCAAACCTGATTATCTGCACGACTCTTACAATCATGCACTAAGCATAGAATGCACGACTACTTGTTACTGAAGTCGGCA
->read2024_contig0_position1437_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCATCTCTATTGCTAGGTCTCTTAAGCCTAATCAGGATCATAGACGGCCAATTATTGACCACAGGTAGGGGCGAGGTATAAATTAGTGGATTCACTTCC
->read2025_contig0_position3601_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAAGATGTATCCATCCCTACCACACGCGTCCGCCACCTCCGGGTCTAGTAAACCAGAGATTCCATGGACTCTCTGTTTCGTCGATTGTCTGAATATCGTG
->read2026_contig0_position4360_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TATCCCCGGGAGTCCCGCACTTCTGAGACGAAGTCTAGCTAGCTTGACTCGGCTGATAAAGAAAACAATCTATATGGAACCGAGGGGCGGGATGATAATT
->read2027_contig0_position1201_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTCTATGGGTCATCTTGAGGGAATAGTCGACTAGTAGCGAATATATGTTCTGCTCCGAGACTTCGGCATAAATCTAAGTATGGACTCTTATATTCCCTC
->read2028_contig0_position9704_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGCTGGTTTTGCACTACGGTATGGGAACGCGTTTACCGAACGTCTGGAAATCTGTCGAGTCATATCGATGAACAGAGACTAAATGTCCTTAAATCTCTA
->read2029_contig0_position8168_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAAGATCCGAGGCCTTTTCCAGGGTAAAATGATGGACTCATTGACCAACCCCTATTATTAGGAGAGGGCTGCGACTGCTTGCAGCTCCGACGGCTTTCCA
->read2030_contig0_position1477_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATAGATGGCCAATTATTGACCACAGGTAGGGGCGAGGTATAAATTAGTGGATTCACTTCCCTTTGACATCTTGTTCTCACAACTGCACACTCCGATGCTC
->read2031_contig0_position3851_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTGGAACCCGTAATCTTCAAGTGAATCATCCGATCACGCAAACCTGATTATCTGCACGACTCTTAAAATCATGCACTAAGCATAGAATGCAAGACTACT
->read2032_contig0_position5841_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCAGATAGATTAATAGAACGAAGTCCATATAACAGCTGATTTAAGAGGAAAAATTGAACATCAACGGAAGTACTATAGCAGGCTCACCAGCATGTAAGAC
->read2033_contig0_position9036_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTATGCATACTCGTTTAGTACAGGGCCGCGCCCCATGAGGCCATATGCGCCTGTCACCGGCATGCTGAAAGCGGCGGTTACATTAATCGCTTCTGTGATG
->read2034_contig0_position317_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTTGGGCCACACAATTAATATAAGACGGGATAATGGCTTCATGCTCATGTTCTATACCGAGCAGAGAGGTTGGGTCTACCTAGTAGTGTCGCGGTTATC
->read2035_contig0_position6057_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGAATGTGATTCCTTTGTTATTTCACACTATTGTTCGGTGCGTGCGCTGCTCAGGGTGGTGCGACCCTTACAGCGTTATCCGTCCCGAACTGGCTTGAGC
->read2036_contig0_position6945_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCAGAGTTGGGGGTCACAGATGAGCGTTCCGATTGTCCTTTCCCAGGCTACGGCCTTATACCAAAGACTTCTAGACCGGAGAGACTACTTCCAGCCACGA
->read2037_contig0_position9274_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTACCTGGGCCGCGTGTTGTACGCTGTGTATCTTGAGAGCGTTTCTCCGTATCGAAATGGTCCGCTGTAAAGAACCTGGCGTATCCTGACCATGGAGCTG
->read2038_contig0_position4211_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGATCGATATTCAGACTCTAACAAGTGGTCAGTACAGGTTCGACCATACGCGACGGCAAACAGAATCGCACGTCAACTATCCCCTTTATTAATGATCCGT
->read2039_contig0_position2289_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTTTTGTACTGAGTCTTAACATCGGCAAATGCGCCCTAGATACCTGCGGCTTCACTCCACAGTGTAAGAGTTGACGGGACTAAAACAGTATTGGGCGGT
->read2040_contig0_position6808_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGGCTGATACGCGCGAGCTCTCACCCACGACTGTACCCCGGTTAAGATTTATAAACCATACATTTAACCCTTAGTCATAAGATGATACGTCATCTGCAT
->read2041_contig0_position2826_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGCCCATTGCATTGTAGCCTGAACTATTAGCAATCCTAAGCCCATAAGCCCTGCCCCACGGGGGCTACAATCCAGCAGTGAACGCGTTTACCTTAAGAC
->read2042_contig0_position5299_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTTTTCAGATTACCCTGCAGACGTCCGCCTAAGATCCTAGTTGAATTGATCAATTGAGTCCAGTACACCATATCAACAGCTTGATCGTTCCACTTCAAT
->read2043_contig0_position7395_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCACTCGAGACCGCCCTCCCCGACCCATATGCAGTTTCTGCATACACCGGGTAGACAACATTCTCAGCCCTTCGTTGAAAGGAGAATACAAATGACGGGA
->read2044_contig0_position7850_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AATCCAGCCCGTTTGGGGTGATTTGTGCCGGCGCGTCCAGGTGCGAACGTTGTGCCGTGTCACTCTGTAGCTCTAATACCAATTGAAATGAAGCTTACGC
->read2045_contig0_position9230_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCAGAGCAGCTCCGAGGGCCTTTATACCCATACTGCCACTCCAGTACATGGGCCGCGTGTTGTACGCAGTGTATCTTGAGAGCGTTTCTCCGTATCGAA
->read2046_contig0_position2793_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGTTTGTTCCGGCAGGACACCACTCTTTGAAGGTGCCCATTGCATTGTAGCCTGAACTATTAGCAATCCTAAGCCCATAAGCCCTGCCCCAAGGGGGCT
->read2047_contig0_position6163_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAAGGCACGCGCGGGCCACAACAGTCGACTAAAAGGCGTAACCGATTCTGCTACGTTATAAAAAAGGGACGAGTGGGGTCAACAGTTCTTCTTCTTTCCT
->read2048_contig0_position1828_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCGGCCCACAAATCGACGTGTGTATTTGTTCAATGGCAGGAGGTTAACTTTGCGGAGCTCAACCTATAACGATAATCAAATTGAGACAGACGAGTTGGA
->read2049_contig0_position1520_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTAGTGGATTCACTTCCCTTTGACATCTTGTTCTCACAACTGCACACTCCGATGCTCTGCCGAGCCTTCTAACCATCGGGTATGTACATTCACCTTTGGA
->read2050_contig0_position7877_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGGCGGGTCCAGGTGCGAACGTTGTGCCGTGTCACTCTGTAGCTCTAATACCAATTGAAATGAAGCTTACGCAAACTACTCGACGAACAACAGCAAGAT
->read2051_contig0_position9020_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTATGCGCCTTAACTTTATGCATACTCGTTTAGTACAGGGCCGCGCCCCATGAGGCCATATGCGCCTGTCACGGGCATGCTGAAAGCGGCGGTTACATT
->read2052_contig0_position2215_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGAGATGGGTTGATGGTAGCATCCCGGCTTCTGGGGCAATTTCTGCCGATTCGAGTGACCAGCGATAGAACGTTCCTTTTGTACTGAGTCTTAACATCGG
->read2053_contig0_position5075_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCCAGGAAGTCTGTAGTACAGGTGCCCATAACCCGATGAGGCCAAGGTGTTACGTGAAGTCGCGTTGGCGCTAGTAACAGATTGGGAGGTCTCGGCCAA
->read2054_contig0_position6286_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAAGTGATATTCGCCGGAATTTACCCTTCTAATATTGTGTGCAAGCTACTTCTAGACCTTATTAAGTGCCGAGGAATTCCTAGGAAGGCGCGCAGCTCAA
->read2055_contig0_position1910_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGAGACAGACGAGTTGGAGTGTTTTGATGAGCGGTGTTATATTTGTACTAACTTAGCACTATCGCACCACAAAATTTCAGCATAAAGCATCCGGTTGAAG
->read2056_contig0_position4527_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAACACCGGTCAGGCATGCTTACCTCCAGCGACGGCATTGGCGATTATGGGCGTGCATAGAGTCCCGCAGTGTCGGAGCGATAGGGAGGACGTAAACGCC
->read2057_contig0_position3675_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTTCGTCGATTGTCTGAATATCGTGCAGTAAGTTTCTCTTAGGTTCCTCAACGGAAACGTCTCAGACCCACCTTAGACCCGGGAATAAATTCGACACGG
->read2058_contig0_position4911_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCGTCCATGACGTTGTGACATAAAGGTGCGGGACGCGGAAGCGCACCTCGTATAACGTTAGGGGTATCGTCACTGCATAGCAGAATGGGCGATCGGCCT
->read2059_contig0_position2960_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGACCCGTAGCCCAATTGCGCTCCCGAACAACGCGTGAGTTTAAAATTGACTTGAAACCGCCTAGCTCGCACCACCAAAGAGCAAGACTCTATGACTAGC
->read2060_contig0_position4743_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGGCGGATGAATTAGAGCCAAAGCAGTAGGTTACCGTCGGCGCATAACCGGCGAGTGCTCTGAAACGTTACATTTGTCTATCCGCACACACCGCCGTTG
->read2061_contig0_position7880_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGCGTCCAGTTGCGAACGTTGTGCCGTGTCACTCTGTAGCTCTAATACCAATTGAAATGAAGCTTACGCAAACTACTCGACGAACAACAGCAAGATTCG
->read2062_contig0_position5572_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGTCGGGCCGCTTATTGGTTCACCCAATCTGGCCATTGCAAGTTTGGCAGACGCGAGGTTGCGTGGTCAACCGAACGTTGCTTTCCTTAGGGTACCGAGT
->read2063_contig0_position9159_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GACCTCACCGCAGGCATCGAGTCTAACTCTGATTCGAGAGACGGATGTAATTTAGTCAGGTCGGAAGCGCTGGCAGAGCAGCTACGAGGGCCTTTATACC
->read2064_contig0_position5389_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCACTTCAATCCGCAAGACGGGCGACCGTACCCGGACACCTGGCAGCGGGAACCGCTTTGACTCTGGAGTGCCAGCGATAGTATCTCAGAGGCGAAAGCG
->read2065_contig0_position3701_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGTAAGTTTCTCTTAGGTTCCTCAACGGAAACGTCTCAGACCCACCTTAGACGCGGGAATAAATTCGACACGGGGTACGAAGGGTAAGAACACCTAGCC
->read2066_contig0_position9818_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTCTACTACTAGGCCGCTTGCTCAGAAATCGGAACACAAGTACGCGATCTCTTTTCTAGTCACCAGCCTCAGGCATTCGCAAATTTCGTTCATGCACGC
->read2067_contig0_position3722_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCAACGGAAACGTCTCAGACCCACCTTAGACGCGGGAATAAATTCGACACGGGGTACGAAGGGTAAGAACACCTAGCCTGGCAATTACCCCTTTGTTAT
->read2068_contig0_position1457_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTTAAGCCTAAACAGGATCATAGATGGCCAATTATTGACCACAGGTAGGGGCGAGGTATAAATTAGTGGATTCACTTCCCTTTGACATCTTGTTCTCAC
->read2069_contig0_position1983_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTTCAGCATAAAGCATCCGGTTGAAGGCTGCGCATCGAGCAGCGTGCATTGGTCTTTCAGTCCCCAGTCACCGGAGACGTCCGAGCTCGAACCCGTCCG
->read2070_contig0_position7556_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTACTGCCCGCCGTGAACGAGAACAAGCGTGTGGAGAGTGACTGACTATCACGAGGAATTACGGATAACAGCCCACTTGGAGTGTGCTGAGGGCCGACG
->read2071_contig0_position7151_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAGTCCGCTTCCCGGGCTTGTCCGCGTCCCATCGGTTAATTCAATGTCCGTCAATCGGGTTGGCCAAAAATTCTACCTGTCCACCTGTCCGCTAGAAGC
->read2072_contig0_position7888_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGTGCGAACGTTGTGCCGTGTCACTCTGTAGCTCTAATACCAATTGAAATGAAGCTTACGCAAAGTACTCGACGAGCAACAGCAAGATTCGACGATCAA
->read2073_contig0_position5759_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCCCGTGGTTTGGTTGTTTTCTGAATTGTGGCTATCTCAAATTGGGACCTAGTGTTGGCCAATAAGCTTCATATCGCCTTCTCAGATAGACTAATAGAA
->read2074_contig0_position7492_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAACTCTGACGAGAGGGTGCTTGAACGAGAGAAGCTAACAGTCATTGCGATGACGAGAACAGCCCTACTGCCCGCCGTGATCGAGAACAAGCGTGTGGC
->read2075_contig0_position9048_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTTAGTACAGGGCCGCGCCCCATGAGGCCATATGCGCCTGTCACGGGCATGCTGAAAGCGGCTGTTACATTAATCGCTTCTGTAATGACAGACCGAAGC
->read2076_contig0_position799_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ACAAACCCTAGTCCCATATAAAGCTATTCCACGCCGGGTGGCCTGGACGTCGTTTGTGGATGGCTTTGGGAATCGCTAGGTAATTACCGTTGGCTCCTTT
->read2077_contig0_position1333_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGGGTCGCGCTGTATTTTTGTACGGCTTGATGTCAGGGTCAGTTTGGGCGCCGGTATGTCTGTGTAAGGTTGGGCCAATCGAGAGGACATTTCGCAACG
->read2078_contig0_position6091_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGGTGCGTGCGCTGCTCAGGCTGGTGCGACCCTTACAGAGTTATCCGTCCCGAACTGGCTTGAGCCACTCATAAGGCACGCGCGGGCCATAACAGTCGA
->read2079_contig0_position7795_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TACACGAAGGCCAGTGCGGAAGCGGAGCCACACTCGCCGTTACTGACTGATTGACAATCCAGCCCGTTTGGGGTGATTTGTGCCGGCGCGTCCAGGTGCG
->read2080_contig0_position9687_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTAATCGGCTGGGGTAACGGCTGGTTTTGTACTACGGTATGGGTACCCGTTTGCCGAACGTCTGGAAATCTGTCGAGTCATATGGATGAACAGAGACTAA
->read2081_contig0_position2204_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTAGCCACCAAGAGATGGGTTGATGGTAGCATCCCGGCTTCTGGGGCAATTTCTGACGATTCGAGTGACCAGCGATAGTACGTTCCTTTTGTACTGAGT
->read2082_contig0_position1488_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTATTGACCACAGGTAGGGGCGAGGTATAAATTAGTGGATTCACTTCCCTTTGACATCTTGTTCTCACGACTGCACACTCCGATGCTCTGCCGAGCCTT
->read2083_contig0_position118_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCGCAAGATTTTGACATTTACAAGGCAACATTGCAGCGTCCGATGGTCCGGTGGCCTCCACATAGTGTCCAGTCGCTCTAACTGTAGGGAGACCATAGG
->read2084_contig0_position9559_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGAGCTCCCCCGCGATTAACCTATGTCGGGACAAACACTCGATTGAGCAGTGGTCATGTCATTATTGTACATCAGTACCATAGCTTGGCCACATGTGATG
->read2085_contig0_position5717_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGATCACTGTCCGCCTCGAACCACTACAATAAGATTACAGATAGCCCGTGGCTTGGTTGTTTTCTGAATTGTGGCTATCTCAAAATGGGACCTAGTGTTG
->read2086_contig0_position4158_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGTTGTCGCACATAGTGTACGTTGAGGCGGTAACTTCCCGCTGATATGATTGTGATCGATATTCAGACTCTAACAAGTGGTCAGTTCAGGTTCGACCAT
->read2087_contig0_position5171_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCAATTCGTTGTATTGATCGCTGTGCACTTTAAAATTCGGAACATCTTAACCAAAGCATATTAATATGCCAGCCGCGCAGGGTGGTATATATGATCCTTG
->read2088_contig0_position969_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCGGAGTCGATATAATTGCAGTATCATGTATCGCTGATTGTGGGGGGCATGGGGGTTCCGCATTGGCGCAATGGTACCGCAAAGGGCCTGTATGACCCT
->read2089_contig0_position457_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGTTAGTAACTTCAATCCGCGTTACGCTTTGTCCTCTGCTACGCCTCGATTGGTTTCAGCTCACGTGGGACGCATGTACTTACCTAACATGAAGCGGTA
->read2090_contig0_position9637_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CATAGCTTGGCCACATGTGATGCTCGTACTCGAAGGGGGAATCACCTTACTTAATCGGCTGGGGTAACGGCTGGTTTTGTACTACGGTATGGCAACCCGT
->read2091_contig0_position9831_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCGCTTGCTCAGAAATCGGAACACAAGTACGCGCTCTCTTTTCTAGTCACCAGCCTCAGGCATTCGCAAATTTCGTTCATGCACGCAACGGGTCGAATA
->read2092_contig0_position2659_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCACCCCCCCTACTGGCCACCACTGGGGCGCGAGTCTCGAGCCTCTCGACTCCAAAGGGTCTGCCCGAGACAGGTTCACCGAGTCGTTACTCCCGGGATC
->read2093_contig0_position5263_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GATCCTTGATAGCTTTATGGCCATCATCATAGTAAATTTTTTCAGATTACCCTGCAGACGTCCGCCTAAGTTCCTAGTTGAATTGATCAATTGAGTCCAG
->read2094_contig0_position7793_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GATACACGAAGGCCAGTGCGGAAGCGGATCCACACTCGCCGTTACTGACTGAATGACAATTCAGCCCGTTTGGGGTGATTTGTGCCGGCGCGTCCAGGTG
->read2095_contig0_position7464_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTCGTTGAAAGGAGAATACAAATGACGGGAACTCTGACGAGAGGGTGCTTGTATGAGAGAAGCTAACAGTCATTGCGATGACGAGAACAGCCCTACTGC
->read2096_contig0_position6011_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTGTTCCCTCAAAACGTACGTTGACAGAGCTAACAATCCGTCGACTGAATGTGATTCCTTTGTTATTTCACACTATTGTTCGGTGCGTGCGCTGCTCAG
->read2097_contig0_position8310_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGTTCCTTTCGATAACTCTGCGACCTGAATGACCTTGGGCTCGTCGACATTCCTGGTAGTAATCCGATCTCAATTCCTGCGGTACCGAGCAGCTTTGAG
->read2098_contig0_position331_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTAATATAAGACGGGATAATGGCTTCATGCTCATGTTCTATACCGAGCAGAGACGTTGGGTCTACCTAGTAGTGTCGCGGTTATCGGACAGAGGATTAT
->read2099_contig0_position719_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GCACCCACGAACAATGGTATTAACCGCGACGGTGTATTCCACGACCTAATTTTTCCCGTCTCTGTGGTCAACCTGGACGCACAAACCCTAGTCCCATATA
->read2100_contig0_position6286_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAAGTGATATTCGCCGGAATTTACCCTTCTAATATTGTGTGCAAGCTACTTCTAGACCTTATTAAGTGCCCAGGAATTCCTAGGAAGGCGCGCAGCTCAA
->read2101_contig0_position3533_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCGTAGTCTGCGACAGCATGAATCGTGTAACTCTGCTCGGTTATACGCCCTCGGGAGAAGACCCATGTAAGATGTATCCATCCCTACCACACGCGTCCG
->read2102_contig0_position9211_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGTCAGGTCGGATCCGCTGGCAGAGCAGCTCTGAGGGCCTTTATACCCATACTGCCACTCCAGTACCTGGGCCGCGTGTTGTACGCTGTGTATCTTGAG
->read2103_contig0_position7445_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTAGACAACATACTCAGCCCATCGTTGAAAGGAGAATACAAATGACGGGAACTCTGACGAGAGGGTGCTTGAACGAGAGAAGCTAACAGTCATTGCGATG
->read2104_contig0_position3513_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCAGGTTCCACCCGAACCGCGCGTATTCTGCGACATCATGAATCGTGTAACTGTGCTCGGTTATACGCCCTCGGGAGAAGACCCATGTAAGATGTATCC
->read2105_contig0_position4451_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGATAATTGTTCTTAGTATAGTGACCATTATGGACGACGGACATAACTACTGAGTGTCCGCCCTCGGCTAATCATGAACACCGGTCAGGCATGCTTACC
->read2106_contig0_position2510_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCGTACCTTGCCACTGCTACCTCCGGCATATGGGCGTGCTATAAATGCGGGAGTCAGGACGATAGAGCGAAGTAGTTACGGTGATTACCCGTCCATCGA
->read2107_contig0_position7494_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AACTCTGACGAGAGGGTGCTTGAACGAGAGAAGCTAACAGTCATTGCGATGACGAGAACAGCCCTACTGCCCGCCGTGAACGAGAACAAGCGTGTGGAGA
->read2108_contig0_position3067_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCAATGAAAACTGATCGAGCACTGTCCGCGAAACTTTATTCAGTACAGCGACTTTTACCCTCGTGGTCTGAATGTTATGCCGTCCGACTCTTGCGCTCG
->read2109_contig0_position5799_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AATTGGGACCTAGTGTTGGCCAATAAGCTTCATATCGCCTTCTCAGATAGACTAATAGAACGAAGTCCATATAACAGCTGATTTAAGAGGAAAAATTGAA
->read2110_contig0_position649_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAAGCTAAAACTGAACTACGAGTGGGACACCGGCCTACTACATTATACAGTAAGGTAGAATCGCGTAGAAGCACCCACGATCAATGTTATTAACCGCGAC
->read2111_contig0_position7228_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGTCCACCTGTCCGCTAGAAGCCGATTATACGGAATACATATCCCGACACCGGCAGCTGAAATGATGCAGAAGCCTTGCTTGCCACTCCGCCGATATCT
->read2112_contig0_position6506_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTTGCGGACAAACGGGGTGCCCGCGCCTGCGTCCGGTAGACGAGCGATGGATTTAGACCGTTCACTGAACCCTCTAATAGGACCTCTTGCCCATCCGAG
->read2113_contig0_position8045_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCCATGTGGAGAATATGCATTCGACCAAATGAAAATGTCAATAATCTCGACCCTGTAGTCCGCGGCGAATCAGCACGATCAAACTAAAGACAGGGATTA
->read2114_contig0_position4277_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCACGTCAACTATCCCCTTTATTAATGATCCGTGTCCCCCGACCGTGTGCTGAGGAGACCCGTAATGCATGGAAAGTGCCAATATCCCCGGGAGTCCCG
->read2115_contig0_position9096_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CATGCTGAAAGCGGTGGTTACATTAATCGCTTCTGTGATGACAGACCGAAGCCCACCTGTCCTGACCTCACCGCAGGCATCGAGTCTAACTCTGATTCGA
->read2116_contig0_position7292_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GATGCAGAAGCCTTGCTTGCCACTCCGCCGATGTCTAAAAGCGCCAGATCGACTTGACTCTACGTGTTGCAATGGAGAACCGCGGAAGGAACACTTTCTG
->read2117_contig0_position51_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCCTTTAACCTGCCAGACGGTGACCAGGGCCGTTCGGCGTTGCATCGAGCGGTGTCGCTAGCGCAATGCGCAAGACTTTGACATTTACAAGGCAACATT
->read2118_contig0_position3880_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCGATCATGCAAACCTGATTATCTGCACGACTCTTAAAATCATGCACTAAGCATAGAATGCACAACTACTTGTTACTGACGTCGGCATGACTATCAAAC
->read2119_contig0_position9302_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TATCTTGAGAGCGTTTCTCCCTATCGAAATGTTCCGCTGTAAAGAACCTGGCGTATCCTGACCATGGAGCTGCAACACTTTCACACAGGTAGCCGAACTG
->read2120_contig0_position4415_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-ATAAAGAAAACAATCTATATGGAACCGAGGGGCGGGATGTTAATTTTTCTTAGTATAGTGACCGTTATGTACGACGGACATAACTACTGAGTGTCCGCCC
->read2121_contig0_position4919_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGACGTTCTGACATAAAGGTGCGGGACGCGGAAGCGCACCTCATATAACGTTAGGGGTATCGTCACTGCATAGCAGAATGGGCGATCGGCCTACAAGAGT
->read2122_contig0_position4532_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGGTCAGGCATGCTTACCTCCTGCGACGGCATTGGCGATTATGGGCGTGCATAGAGTCCCGCAGTGTCGGAGCGATAGGGAGGACGTAAACGCCAATTC
->read2123_contig0_position5815_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGCCAATAAGCTTCATATCGCCTTCTCAGATAGTCTGATAGAACGAAGTCCATATAACAGCTGATTTAAGAGGAAAAATTGAACATCAACGGAAGTACT
->read2124_contig0_position8520_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTATAGTCTAATAATGAATGGTGAACAGCACATCTTTTCGTCCTGAGGCCATATTAATTCTACTCAGATTGTCTGTAACCGGAGCTTCGGGCGTATTTTT
->read2125_contig0_position408_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGGTTATCGGACAGAGGATTATGTAAGGTTACCGGAGACCGGGTAGCGTAGTTAGTAACTTCAATCCGCGTTACGCTTTATCCCCTGCTACGCCTCGAT
->read2126_contig0_position1768_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGGTTGATGTTATTACCAACTCCACTTCTGTAGATTGTTATGAGCAAGCATACAAGTTAGCCGGCCCACAAATCGACGTGTGTATTTGTTCAATGGCAG
->read2127_contig0_position9722_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTATGGGAATCCGTTTGCCGAACGTCTGGAAATCTGTCGAGTCATATCGATGAACAGAGACTAAATGTCCTTAAATCTCTAACACGATTTTAGTAGGTC
->read2128_contig0_position4241_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTACAGGTTCGACCATACGCGACGGCAGACAGAATCGCACGTCAACTATCCCCTTTATTAATGATCCGTGTCCCCCGACCGTGTGCTGAGGAGACCCGT
->read2129_contig0_position1246_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGTTCTGCTCCGAGACTTCGGCATAAATCTAAGTATGGACTCTTATATTCCCTCCTGCGTAGTGCTCTCCCATAATAAGTGAACCCATGGGTCGCGCTG
->read2130_contig0_position6950_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTGGGGGTCACAGATGAGCGTTCCGATTGTCCTTTCCCAGGCTACGGCCTCATACCAAAGACTTCTAGACCGGAGAGACTACTTCCAGCCACGAATTCG
->read2131_contig0_position5077_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCAGGAAGTCTGTAGTACAGGTGCCCATAACCCGATGAGGCCAAGGTGTTACGTGAAGTCGCGTTGTCGCTAGTAACAGATTGGGAGGGCTCGGCCAATT
->read2132_contig0_position8369_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTAATTCGATCTCAATTCCTGCGGTACCGAGCAGCTTTGAGTTTTTGTAAGTCCCACGGTTAATGGGCCTCTTATTTCGACATTCATGGCGCCGATATCC
->read2133_contig0_position4915_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCATGACGTTGTGACATAAAGGTGCGGGACGCGGAAGCGCACCTCGTATAACGTTAGGGGTATCGTCACTGCATAGCAGAATGGGCGATCGGCCTACAA
->read2134_contig0_position2650_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGCTTTATCCACCCCCCCGACTGGCCACCACTGGGGCGCGAGTCTCGAGCCTCTCGACTCCAAAGGGTCTGCCCGAGACAGGTTCACCGAGTCGTTACT
->read2135_contig0_position5217_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTAACCAAAGCATATTAATATGCCAGCCGCGCAGTGTGGTATATATGATCCTTGATAGCTTTATGGCCATCATCATAGTAAATTTTTTCAGATTACCCTG
->read2136_contig0_position9274_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTACCTGGGCCGCATGTTGTACGCTGTGTATCTTGAGAGCGTTTCTCCGCATCGAAATGTTCCGCTGTAAAGAACCTGGCGTATCCTGACCATGGAGCTG
->read2137_contig0_position4607_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATAGGGAGGACGTAAACGCCAATTCCGCTTAATAGCGGAATCTGGTGGCTTGTGCATTCGTCGGCCTATTAGATACGGTACGGAATATTGGGTAACCTCC
->read2138_contig0_position7860_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTTGGGGTGATTTGTGCCGGCGCGTCCAGGTGCGAACGTTGTGCCGTGTCACTCTGTAGCTCTAATACCAATTGAAATGAAGCTTACGCAAACTACTCG
->read2139_contig0_position7732_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GACTGGAGCGGTAATGTGGTAGTGTCGTTGCCGGTCCCTGTGCTGACCTTATGTCCATATCGATACACGAAGGCCAGTGCGGAAGCGGAGCCACACTCGC
->read2140_contig0_position5803_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGACCTAGTGTTGGCCAATAAGCTTCATATCGCCTTCTCAGATAGACTAATAGAACGAAGTCCATATAACGGCTGATTTAAGAGGAAAAATTGAACATC
->read2141_contig0_position5493_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACACCTCATCTAAAATCGCGACTATAGATCTGTTTAGAACCACGACCCAGAAATCTTTAGCTAAGTAATCGACTGCCTTCGTCGGGCCGCTTATTGGTTC
->read2142_contig0_position5256_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TATATATGATCCTTGATAGCTTTATGGCCATCATCATAGTAAATTTTTTCAGATTACCCTGCAGACGTCCGCCTAAGATCCTAGTTGAATTGATCAATTG
->read2143_contig0_position7718_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TAACAAGCCATGGGGACTGGAGCGGTAATGTGGTAGTGTAGTTGCCGGCCCCTGTGCTGACCTTATGTCCATATCGATACACGAAGGCCAGTTCGGAAGC
->read2144_contig0_position7146_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCATCGGAGTCCGCTTCCCGGGCTTGTCCGCGTCCCATCGGTTAATTCAATGTCCGTCAATCGGGTTGGCCAAAAATTCTACCTGTCCACCTGTCCGCTA
->read2145_contig0_position4641_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGGAATCTGCTGGCTTGTGCATTCGTCGGCCTATTAGATACGGTACGGAATATTGGGTAACCTCCTCTTCACTGATATCATCCTATCGGCGTTCAAAGT
->read2146_contig0_position6629_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCGATGGGTCCTCAAGGCAGTATAAAATGGACTGCTATCTAGGCGTTAAAGTAGTAGAACGAGGGTCGGGCGATTTGTTTTGGTAGTGGTTATCGCATT
->read2147_contig0_position8268_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCGTTGCACATGACTTGAGGCTCGGACTCGTATCTGTCTCCGTGTTCCTTTCGATAACTCTGCGACCTGAAAGACCTTGGGCTCGTCGACATTCCTGGT
->read2148_contig0_position4934_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGGTGCGGGACGCGGAAGCGCACCTCGTATAACGTTAGGGGTATCGTCATTGCATAGCAGAATGGGCGATCGGCCTACAAGAGTACAGTACTAACGGTC
->read2149_contig0_position7415_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGACCCATATGCAGTTTCTGCATACACCGGGTAGACAACATTCTCATCCCCTCGTTGAAAGGAGAATACAAATGACGGGAACTCTGACGAGAGGGTGCTT
->read2150_contig0_position5508_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGCGACTATAGATCTGTTTAGAACCACGACCCAGAAATCTTTAGCTAAGTAATCGACTGCCTTCGTCGGGCCACTTATTGGTTCACCCAATCTGGCCAT
->read2151_contig0_position8367_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGTAATCCGATCTCAATTCCTGCGGGACCGAGCAGCTTTGAGTTTTTGTAAGCCACACGGTTAATGGGCCACTTATTTCGACATTCATGGCGCCGATAT
->read2152_contig0_position4356_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCAATATCCCCGGGAGTCCCGCACTACTGAGACGAAGTCTAGCTAGCTTGACTCGGCTGATAAAGAAAACAATCTATATGGAACCGAGGGGCGGGATGAT
->read2153_contig0_position8567_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCATATTAATTCTACTCAGATTGTCTGTAACCGGAGCTTCGGGCGTATTTTTGCGTAAGACACTGCCTAAAGGGAACATATGTGTCCAGAATAGGGTTC
->read2154_contig0_position920_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCAGGCCGATCAAGTGGTTAGAGACCTAGGCCTATGCCAGACGATCGCAGCGGAGTCGATATAATTGCAGTATCATGTATCGCTGATTGTGGGGGGCAC
->read2155_contig0_position3451_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGCCTGCCGTCGCCTCGCGCCCATAATGTTTGGAACTCGCAAACCTTTACACTCATCACATAGCAGGTTCCACCCCAACCGCGCTTATTCTGCGACAGC
->read2156_contig0_position7398_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCGAGACCGCCCTCCCCGACCCATATGCAGTTTCTGCATACACCGGGTAGACAACATTCTCAGCCCTTCGTTGAAAGGAGAATACAAATGACGGGAACT
->read2157_contig0_position608_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGTGAGTTCATAAATCTCAATGTGGAAACTCCGATGGGCAGAAGCTAAAACTGAACAACGAGTGGGACACCGGCCTACTACATTATACAGTAAGGTAGA
->read2158_contig0_position4518_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTAATCATGAACACCGGTCAGTCATGCTTACCTCCTACGACGCCATTGGCGATTATGGGCGTGCATAGAGTCCCGCTGTGTCGGAGCGATAGGGAGGAC
->read2159_contig0_position9616_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCATTTTTGTACATCAGTACCATAGCTTGGCCACATGTGATGCTCGTACTCGAAGGGGGAATCACCTTACTTAATCGGCTGGGGTAACGGCTGGTTTTG
->read2160_contig0_position7632_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTGGAGTGTGCTGAGGGCCGACGCCCGGGGACCGTGATATCCTTGCGAGTGGAATGCGAAAACGGCATAAGCGCAATGACCGAGGTAACAAGCCATGAG
->read2161_contig0_position7969_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCAAGATTCGACGATCAAACTCGCCGGCGACACGAAGATTGTCATACAAGCTTTCAGTCATTCCCCCTCAGTTTTGTCCATGTGGAGAATATGCATTCG
->read2162_contig0_position7120_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTACCGTTGCACCACCTCCAAGTGTCCATCGGAGTCCGCTTGCCGGGCTTGTCCGCGTCCCATCGGTTAATTCAGTGTCCGTCAATCGGGTTGGCCAAA
->read2163_contig0_position2829_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCATTGCATTGTAGCCTGAACTATTAGCAATCCTAAGCCCATAAGCCCTGCCCCACGGGGGCTACAATCCAGCAGTGAACGCGTTTACCTTAAGACGAA
->read2164_contig0_position1775_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGTTATTACCAACTCCACTTCTGCAAATTGTTATGAGCAAGCATACAAGTTAGCCGGCCCACAAATCGACGTGTGTATTTGTTCAATGGCAGGAGGTTA
->read2165_contig0_position8415_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTAAGTCCCACGGTTAATGGTCCACTTATTTCGACATTCATGGCGCCGATATCCTGCTTAGGCAGTACGGCCAATGCACGACCCTATATGACCCCTAGCG
->read2166_contig0_position1616_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGACGCTTCGATAGGACATGCACCCGGTCCGTTGACTTAGCAACTTGATCGCCAGTGAGTGAGCGGTGGTTTATCTGTTGAGTGGCCACTTTTCCCTAT
->read2167_contig0_position9525_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCACTTGTTACTTCACGGAACGCTTCTTGATCCTGAGCTCCCCCGCGATTAACCTATGTCGGGACAAACACTCGATTGAGAAGTGGTCATGTCATTATT
->read2168_contig0_position5599_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTGGCCATTGCAAGTTTGGCAGACGCGAGGTTGCGTGGTCAACCGAACGTTGATTTCCTTAGGGTACCGAGTATATTAACTTTATGAAATTAGCGCGTT
->read2169_contig0_position9696_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGGGTAACGGCTGGTTTTGTACTACGGTATGGGAACCCGTTTGCCGAACGTCTGGAAATCTGTCGAGTCATATCGATGAACAGAGACTAAATGTCTTTA
->read2170_contig0_position4422_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AATCAATCTATATGGAACCGAGGGGCGGGATGATAATTGTTCGTAGTATAGTGACCGTTATGGACGACGGACATAACTACTGAGTGTCCGCCCTCGGCTA
->read2171_contig0_position7984_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCAAACTCGCCGGCGACACGAAGATTGTCATACTAGCTTTCAGTCATTCCCCCTCAGTTTTGTCCATGTGGAGAATATGCATTCGACCAAATGAAAGTGT
->read2172_contig0_position8812_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGCAAAGTTGCGACACCGCGCCACACAGCAGTTTATTGTTAACACGCGATACAAGAGGGTTAGGAGCTAAGAAACCGGTGCATCGCCGTACGAAAAGGA
->read2173_contig0_position8000_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CACGAAGATTGTCATACTAGCTTTCAGTCATTCCCCCTCAGTTTTGTCCATGTGGAGAATATGCATTCGACCAAATGAAAATGTCAATTATCTCGACCCT
->read2174_contig0_position624_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCAATGTCGAAACTCCGATGGGCAGAAGCTAAAACTGAACAACGAGTGGGACACCGGCCTACTACATTATACAGTAAGGTAGAATCGCGTAGAAGCACC
->read2175_contig0_position709_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGCGTAGCAGCACCCACGATCAATGTTATTAACCGCGACGGTGTATTCCACGACCTAATTTTTCCCGTCTCTGTGGTCAACCTGGACGCACTAACCCTA
->read2176_contig0_position6268_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTAATGCTTCCGCGCATCTAAGTGATATTCGCCGGAATTTACCCTTCTAATATTGTGTGCAAGCTACTTCTAGACCTTATTAAGTGCGCAGGAATTCCTA
->read2177_contig0_position374_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGAGCATAGAGGTTGGGTCTACCTAGTAGTGTCGCGGTTATCGCAAAGAGGATTATGTAAGGTTACCGAAGACCGGGTAGCGTAGTTAGTAACTTCAAT
->read2178_contig0_position8265_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCAATCGTTGCACATGACTTGAGGCTCGGACTCGTATCTGTCTCCGTGTTCCTTTCGATAACTCTGCGACCTGAATGACCTTGGGCTCGTCGACATTCCT
->read2179_contig0_position1332_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CATAGGTCGCGCTGTATTTTTGTACGGCTTGATGTCAGGGTCAGTTTGGGCGCCGGTATGTCTGTGTAACGTTGGGCCAATCGAGAGGACATTTCGCAGC
->read2180_contig0_position5041_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATACAGCGCCACATCCGCCAATTCGCTAGGTTGTAGCCAGGAAGTCTGTAGTACAGGTGCCCATAACCCGATGAGGCCAAGGTGTTACGTGAAGTCGCGT
->read2181_contig0_position7229_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTCCACCTGTCCGCTAGAAGCAGATTATACGGAATAGATATCCCGACACCGGCAGCTGAAATGATGCAGAAGCCTTGCTTGCCATTCCGCCGATGTCTA
->read2182_contig0_position8729_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGAATTCAGCGTGTAAGAGCACGCTTATCCGGTGGTGATACCTACTATTGACTGGGGGCTTACTGAGAACACTTCATCTGTATGGCAAAGTTGCGACAC
->read2183_contig0_position4629_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCCGCTTAATAGCGGAATCTGCTGGCTTGTGCATTCGTCGGCCTATTAGATACGGTACGGAATATTGGGTAACCTCCTCTTCACTGATATCATCCTATC
->read2184_contig0_position5671_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TATATTAACTTTATGAAATTAGCGCGTTAACTACTTAAAGTTCAGAAGATCACTGTCCGCTTCGAACCACTACAATAAGATTACGGATAGCCCGTGGCTT
->read2185_contig0_position1712_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CTATCTGCTGGGACGGCACTGGAGCTCTGGAACATTAGATAGGATATAAAAGTAATGCGGTTGATGTTATTACCAACTCCACTTATGCAAATTGTTATGA
->read2186_contig0_position9676_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AATCACCTTACTTAATCGGCTGGGGTAACGGCTGGTTTTGTACTACGGTATGGGAACCCGTTTGCCGAACGTCTGGAAATCTGTCGAGTCATATCGATGA
->read2187_contig0_position7483_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CAAATGACGGGAACTCTGACGAGAGGGTGCTTGAACGAGAGAAGCTAACAGTCATTGCGATGACGAGAACAGGCCTATTGCCCGCCGTGAACGAGAACAA
->read2188_contig0_position1345_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTATTTTTGTACGGCTTGATGTCAGGGTCAGTTTGGGCGCCGGTATGTCTGTGTAAGGTTGGGCCAATCGAGAGGACATTTCGCAGCGCCCTTTCATCTC
->read2189_contig0_position274_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AACCACTAACATAACGCGTGTCATCTAGTTCTAGCATACTCCGCCTTAGGCCACACAATTAATATAAGACGGGCTAATGGCTTCATGCTCATGTTCTATA
->read2190_contig0_position7657_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGGGGACCGTGATATCCTTGCGAGTGGAATGCGAAAACGGCATAAGCGCAATGACCGAGGTAACAAGCCATGAGGACTGGAGCGGTAATGTGGTAGTGT
->read2191_contig0_position2259_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GATGATTCGAGTGACCAGCGATAGTACGTTCCTTTTGTACTGAGTCTTAACATCGGCAACTGCGCCCTAGATACCTGCGGCTTCACTCCACAGTGTAAGA
->read2192_contig0_position1461_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGCCTAATCAGGATCATAGATGGCCAATTATTGACCACAGGTAGGGGCGAGGTATAAATTAGTGGATTCACTTCCCTTTGACATCTTGTTCTCACAACT
->read2193_contig0_position5031_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCTGGCCTTATACAGCGCCACATCCGCCAATTCGCTAGGTTGTAGCCAGGAAGTCTGTAGTACAGGTGCCCATAACCCGATGAGGCCAAGGTGTTACGT
->read2194_contig0_position2287_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCCTTTTGTACTGAGTCTTAACATCGGCAAATGCGCCCTAGATACCTGCGGCTTCACTCCACAGTGTAAGAGTTGACGGGACTAAAACAGTATTGGGCG
->read2195_contig0_position9026_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCCTTAACTTTATGCATACTCGTTTAGTACAGGGCCGCGCCCCATGAAGCAATATGCGCCTGTCACGGGCATGCTGAAAGCGGCGGCTACATTAATCGC
->read2196_contig0_position7793_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GATACACGAAGGCCAGTGCGGAAGCGGAGCCACACTCGCCGTTACTGACTGATAGACAATCCAGCCCGTTTGGGGTGATTTGTGCCGGCGCGTCCAGGTG
->read2197_contig0_position7250_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGATTATACGGAAGACATATCCCGACACCGGCAGCTGAAATGATGCAGAAGCCTTGCTTGCCACTCCGCCGATGTCTAAAAGCGCCAGATCGACTTGAC
->read2198_contig0_position3055_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTAGCGGGTGTCGTCAATGAAAACTGATCGAGCACTGTCGGCGAAACATTATTCAGTACAGCGACTTTTACCCTCGTGGTCTGAATGTTATGCCGTACGA
->read2199_contig0_position949_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTCTATGCCAGACGATCGCAGCGGAGTCGATATAATTGCAGTATCATGTATCGCTGATTGTGGGGGGCATGGGGGTTCCGCATTGGCGCAAAGGTACCG
->read2200_contig0_position76_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGGGCCGTTCGGCGTTGCATCGAGCGGTGTCGCTAGCGCAATGCGCAAGATCTTGACATTTACAAGGCAACATTGCAGCGTCCGATGGTCCGGTGGCCT
->read2201_contig0_position4661_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CATTCGTCGGCCTATTAGATACGGTACGGAATATTGGGTAACCTCCTCTTCACTGATATCATCCTATCGGCGTTCAAAGTATTCGGCGGATGAATTAGAG
->read2202_contig0_position3711_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCCTAGGTTCCTCAACGGAAACGTCTCAGACCCACCTTAGACGCGGGAATAAATTCGACACGGGGTACGAAGGGTAAGAACACCTAGCCTGGCAATTAC
->read2203_contig0_position8506_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCCTAGCGAGAAGTTATAGTCTAATAATGAATAGTGAACAGCACATCTTTTCGTCCTGAGGCCATATTAATTCTACTCAGATTGTCTGTAACCGGAGCT
->read2204_contig0_position1738_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGGAACATTAGATAGGATATAAAAGTAAAACGGTTGATGTTATTACCAACTCCACTTCTGCAAATTGTTATGAGCAAGCATACAATTTAGCCGGCCCAC
->read2205_contig0_position7808_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGCGGAAGCGGAGCCACACTCGCCGTTACTGACTGATTGACAATCCAGCCCGTTTGGGGTGATTTGTGCCGGCGCGTCCAGGTGCGAACGTTGTGCCGT
->read2206_contig0_position5423_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GACACCTGGCAGCGGGAACCGCTTTGACTCTGGAGTGCCAGCGATAGTATCTCAGAGGCAAAAGCGCTTGTCACCTCATCTAAAATCGCGACTATAGATC
->read2207_contig0_position2154_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGAGCATCTCATAATCGGGCCACCCGATTTCAGCTTGGCCACAACAGAGACTCGCCACCAAGAGATGGGTTGATGGTAGCATCCCGGCTTCTGGGGCAA
->read2208_contig0_position2847_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAACTATTAGCAATCCTAAGCCCATAGGCCCTGCCCCACGGGGGCTACAATCCAGCAGTGAACGCGTTTACCTTAAGACGAAAGAGTCAGTAGAGTTGGG
->read2209_contig0_position5342_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAATTGATCAATTGAGTCCAGTACACCATATCAACAGCTTGATCGTTCCACTTCAATCAGCAAGACGGGCGACCGTACCCGGACACCTGGCAGCGGGAAC
->read2210_contig0_position9217_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTCGGAACCGCTGGCAGAGCAGCTCCGAGGGCCTTTATACCCATACTGCCACTCCAGTACCTGGGCCGCGTGTTGTACGCTGTGTATCTTGAGAGCGTT
->read2211_contig0_position3232_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTCGTATGTTTGGAGGGCGGTTACACACCCTTAAGTAGCGAACAATAGAGCACCCGTCTAGGAGGGCGTGCAGGGTCTCCCGCTAGCTAATGGTCACGG
->read2212_contig0_position2947_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTCGTGCTTTAATGACCCGTAGCCCAATTGCGCTCCCGAACAACGCGTAAGTTTAAAATTGACTTGAAACCGCCTAGCTCGGGCCACCAAAGAGCAAGA
->read2213_contig0_position1375_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTTGGGCGCCGGTATGTCTGTGTAAGGTTGGGCCAATCGAGAGGACATTTCGCAGCGCCCTTTCATCTCTATTGCTAGGTCTCTTAAGCCTAATTAGGA
->read2214_contig0_position8251_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTCCGACCGCTTTCCAATCGTTGCACATGACTTGAGGCTCGGACTCGTATCTGTCTCCGTGTTCGTTTCGATAACTCTGCGACATGAATGACCTTGGGC
->read2215_contig0_position3435_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CACCCTATTGGTAGTACTGCCTGCCGTCGACTCGCGCCCATAATGTTTGGAACTCGCAAACCTTTACACTCATCACATAGCAGGTTCCACCCGAACCGCG
->read2216_contig0_position6256_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTTCCTGTACGGTAATGCTTCCGCGCATCTAAGTGATATTCGCCGGAATTTACCCTTCTAATATTGTGTGCAAGCAACTTCTAGACCTTATTAAGTGCC
->read2217_contig0_position4254_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCATACGCGACGGCAAACAGAATCGCACGTCAACTATCCCCTTTATTAATGATCCGTGTCCCCCGACCGTGTGCTGAGGAGACCCGTAATGCATGGAAAG
->read2218_contig0_position8884_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAACCGGTGCATCACCGTACGAAAAGGATGGTTGAAATAGAACGAGTTGTAAAACATTAGCTCACGCGCCACCGTCATAGGCTGCATAGTGAGACAGGGT
->read2219_contig0_position5617_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCAGACGCGAGGTTGCGTGGTCAACCGAACGTTGCTTTCCTTAGGGTACCGAGTATATTAACTTTATGAAATTAGCGCGTTAACTACTTAAAGTTCAGA
->read2220_contig0_position6699_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGATTTGTTTTGGTAGTGGTTATCGCATTGCAAGAACGTACGGACGGACAAAATGTCGGACACCGCCTTATCGGCTATACTAGTTAGAGCCTCGCTTGG
->read2221_contig0_position1917_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GACGAGTTGGAGTGTTTTGATGAGCGGAGTTATATTTCTCCTAACTTAGCACTATCGCACCACAAAATTTCAGCATAAAGCATCCGGTTGAAGGCTGCGC
->read2222_contig0_position6177_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCATAACAGTCGACTAAAAGGCGTAACCGATTCTGCTACGTTATAAAAAAGGGACGAGTGGGGTCAACAGTTCTTCTTCTTTCCTGTACGGTAATGCTT
->read2223_contig0_position6434_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACAGTGGCCTGGATAGCTAAGCAGGTCCTGGATTGGCATGTCATCCGGAGTGATAGGCACTGCTCACGACCAGCTTGCGGACAAACGGGGTGCCCGCGCC
->read2224_contig0_position4627_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AATTCCGCTTAATAGCGGAATCTGCTGGCTTGTGCATTCGTCGACCTATTAGATACGGTACGGAATATTGGGTAACCTCCTCTTCACTGATATCATCCTA
->read2225_contig0_position8055_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGAATATGCATTCGACCAAATGAAAATGTCAATAATCTCGACCCTGTAGTCCGCGGCCAATCAGCACGATCAAGCTAAAGACAGGGATTATGCACTAGCA
->read2226_contig0_position9010_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCTAACCAGCCTATGCGCCTTAACTTTATGCATACTCGTTTAGTACAGGGCCGCGCCCCATGAGGCCATATGCGCCTGTCACGGGCATGCTTAAAGCGG
->read2227_contig0_position5615_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGGCAGACGCGAGGTTGCGTGGTCACCCGAACGTTGCTTTCCTTAGGGTACCGAGTATATTAACTTTATGAAATTAGCGCGTTAACTACTTAAAGTTCA
->read2228_contig0_position9578_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTATGTCGGGACAAACACTCGATTGAGCAGTGGTCATGTCATTATTGTACCTCAGTACCATAGCTTGGCCACATGTGATGCTCGTACTCGAAGGGGGAA
->read2229_contig0_position5510_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGACTATAGATCTGTTTAGAACCACGTCCCAGAAATCTTTAGCTAAGTAATCGACTGCCTTCGTCGGGCCGCTTATTGGTTCACCCAATCTGGCCATTG
->read2230_contig0_position1806_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTATGAGCAAGCATACAAGTTAGCCGGCCCACAAATCGACGTGTGTATTTGTTCAATGGCAGGAGGTTAACTTTGCGGAGCTCAACCTATAACGATAATC
->read2231_contig0_position5886_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGAAAAATTGAACATCAAAGGAAGTACTATAGCAGGCTCACCAGCATGAAAGACATCCTCATTGTGAACCCGGCATCTCGTGATTCGAGCCTAACAGCA
->read2232_contig0_position3467_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCGCCCATAATTTTTGGAACTCGCAAACCTTTACACTCATCACATAGCAGGTTCCACCCGAACCGCGCGTATTCTGCGACAGCATGAATCGTGTAAGTC
->read2233_contig0_position6992_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTACGGCCTTATACCAAAGACTTCTAGACCGGAGAGACTACTTCCAGCCACGAATTCGTGTGATAATCGCCTAAACAGTCTAATCTGGCCAATATACCCT
->read2234_contig0_position3140_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTTCTCCCGTCCGACTCTTGCGCTCGGATGTCCGCAATGGGTTATCAAATGCCTATGTTCCGGTAATCTCTCATCAACTAAGCGCCCCAAAGGTCGTAT
->read2235_contig0_position5410_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGACCGTACCCGGACAGCAGGCAGCGGGAACCGCTTTGACTCTGGAGTACCAGCGATAGTATCTCAGAGGCGAAAGCGCTTGTCACCTCATCTAAAATC
->read2236_contig0_position885_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGTTGGCTCCTTTCTTCCTGATCGTCGGAGTTCTTTCAGGCCGATAAAGTGGTTAGAGACCTAGGTCTATGCCAGACGATCGCAGCGGAGTCGATATAA
->read2237_contig0_position6334_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTCTAGACCTCATTAAGTGCCCAGGAATTCCTAGGTCGGCGCGCAGCTTAAGCAATCATACATGGCGGAATGCCTGTCCACCGGGGGTTCTACTGTACC
->read2238_contig0_position6186_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCGACTAAAAGGCGTCACCGATTCTGCTACGTTATAAAAAAGGGACGAGTGGGGTCAACAGTTCTTCTTCTTTCTTGTACGGTAATGCTTCCGCGCATC
->read2239_contig0_position7716_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTAACAAGCCATGAGGACTGGAGCGGTAATGTGGTAGTGTAGTTGCCGGCCCCTGTGCTGACCTTATGTCCATATCGATACACGAAGGCCAGTGCGGAA
->read2240_contig0_position7515_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCACGAGAGAAGCTAACAGTCATTGCGATGACGAGAACAGCCCTACTGCCCGCCGTGAACGAGAACAAGCGTGTGGAGAGTGACTGACTATCACGAGGAA
->read2241_contig0_position2737_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGAGTCGTTACTCCCGGGATCCACTGCGTCTATTGTAAGAAATGCAATGCGTGGCCAGTTTGTTCCGGCAGGACACCACTCATTGAAGGTGCCTATTGC
->read2242_contig0_position4949_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GAAGCGCACCTCGTATAACGTTAGGGGTATCGTCACTGCATAGCAGAATTGGCGATCGGCCTACAAGAGTACCGTACTAACGGTCTGGCCTTATACAGCG
->read2243_contig0_position910_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGGAGTTCTTTCAGGCCGATCAAGTGGTTAGAGACCTAGGTCTATGCCAGACGATCGCAGCGGATTCGATATAATTGCAGTATCATGTATCGCTGATTG
->read2244_contig0_position2277_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-CGATTGTACGTTCCTTTTGTACTGAGTCTTAACATCGGCAAATGCGCCCTAGATACCTGCGGCTTCACTCCACTGTGTAAGAGTTGACGGGACTAGAACT
->read2245_contig0_position1515_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATAAATTAGTGGATTCACTTCCCTTTGACATCTTGTTCTCACAACTGCACACTCCGATGCTCTGCCGAGCCTTCTAACCATCGGGTATGTACATTCACCT
->read2246_contig0_position6186_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCGACTAAAAGGCGTAACCGATTCTGCTACGTTATAAAAAAGGGACGAGTGGGGTCAACAGTTCTTCTTCTTTCCTGTACGGTAATGCTTCCGCGCATC
->read2247_contig0_position2251_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CAATTTCTGACGATTCGAGTGACCAGCGATAGTACGTTCCTTTTGTACTGAGTCTTAACATCGGCAAATGCGCCCTAGATAGCTGCGACTTCACTCCACA
->read2248_contig0_position4546_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTACCTCCTGCGACGGCATTGGCGATTATGTGCGTGCATAGAGTCCCGCAGTGTCGGAGCGATAGGGAGGACGTAAACGCCAATTCCGCTTAATAGCGGA
->read2249_contig0_position8241_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTGCTTCCAGCTCCGACCGCTTTCCAATCGTTGCACATGACTTGAGGCTCGGACTCGTATCTGTCTCCGTGTTCCTTTCGATAACTCTGCGACCTGAAT
->read2250_contig0_position4594_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGTGTCGGAGCGATAGGGAGGACGTAAACGCCAATTCCGCTTAATAGCGGAATCTGCTGGCTTGTGCATTCGTCGGCCGATTAGATACGGTACGGCATA
->read2251_contig0_position1284_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GACTCTTATATTCCCTCCTGCGTAGTGCTCTCCCATAATAAGTGAACCCATGGGTCGCGCTGTATTTTTGTACGGCTTGATGCCAGGGTCAGTTTGGGCG
->read2252_contig0_position5089_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGTACAGGTGCCCATAACCCGATGAGGCCAAGGTGTTACGTGAAGTCGCGTTGTCGCTAGTAACAGATTGGGAGGTCTCGGCCAATTCGTTGTATTGAT
->read2253_contig0_position6370_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGGCGCGCAGCTCAAGCAATCATACATGGCGGAATGCCTGTCCACCGGGGGTTCTACTGTACCACAGTGGCCTGGATAGCTAAGCAGGTCCTGGATTGG
->read2254_contig0_position3031_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CCACCAAAGAGCAAGACTATATGACTAGCAGGTGTCGTCAATGAAAACTGATCGAGCACTGTCCGCGAAACATTATTCAGTACAGCGACTTTTACCCTCG
->read2255_contig0_position8971_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTGAGACAGGGTTGAAAACATGTCTGAAGTCCGTGCTTCCCTAACCAGCCTATAGGCCTTAACTTTATGCATACTCGTTTAGTACAGGGCCGCGCCCCA
->read2256_contig0_position8256_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GACCGCTTTCCATTCGTTGCACATGACTTGAGGCTCGGACTCGTATCTGTCTCCGTGTTCCTTTCGATAACTCTGCGACCTGAATGACCTTGGGCTCGTC
->read2257_contig0_position2379_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTGGGCGGTGAGGGGTACCCGACGCCTCTGCTGTCAAAGTGGGAAATCCAGTCACGACTATATCTACTATGTCATGCTTGTCGAATGAACAACTCACTT
->read2258_contig0_position5830_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATATCGCCTTCTCAGATAGACTAATAGAACGAAGTCCATATAACAGCTGATTTAAGAGGAAAATTTGAACTTCAACGGAAGTACTATAGCAGGCTCACCA
->read2259_contig0_position7068_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTCTAATCAGGCCAATATACCCTGGGGGGAGCTAATATATCGCGGCGTCGAGTTACCGTTGCACCACCTCCAAGTGTCCATCGGAGTCCGCTTCCCGGG
->read2260_contig0_position8270_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGTTGCACATGACTTGAGGCTCGGACTCGTATCTGTCTCCGTGTTCCTTTCGATAACTCTGCGACCTGAATGACCTTGGGCTCGTCGACATTCCAGGTAG
->read2261_contig0_position1086_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTCAGCTCCAGTTACGTCACGGACGTAGAGAGCCTTTGAATGTGTACGGCAATAGGAGAAACTCGGCCACGTACGTGTCAACATGGCGCGGCTCTCTAT
->read2262_contig0_position9020_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTAAGCGCCTTAACTTTATGCATACTCGTTTAGTACAGGGCCGCGCCCCATGAGGCCATATGCGCCTGTCACGGGCATGCTGAAAGCGGCGGTTATATT
->read2263_contig0_position1510_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGGTATAAATCAGTGGATTCACTTCCCTTTGACATCTTGTTCTCACAACTGCACACTCCGATGCTCTGCCGAGCCTTCTAACCATCGGGTATGTACATT
->read2264_contig0_position9795_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAATCTCTAACACGATTTTAGTAGGTCTACTACTAGGCCGCTTGCTCAGAAATCGGAACACAAGTACGCGATCTCTTTTCTAGTCACCAGCCTCAGGCAT
->read2265_contig0_position7460_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCCCTTCGTTGAAAGGAGAATACAAATGACGGGAACTCTGACGAGAGGGTGCTTGATCGAGAGAAGCTAACAGTCATTGCGATGACGAGAACAGCCCTA
->read2266_contig0_position5063_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGCTAGGTTGTAGCCAGGACGTCTGTAGTACAGGTGCCCATAACCCGATGAGCCCAAGGTGTTACGTGAAGTCGCGTTGTCGCTAGTAACAGATGGGGA
->read2267_contig0_position1693_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTGAGTGGCCACTTTTCCCTATCTGCTGGGACGGCACTGGAGATCTGGAACATTAGATAGGATATAGAAGTAATACGGTTGATGTTATTACCAACTCCA
->read2268_contig0_position3418_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTAGAGACTGAGAACTCACCCTATTGGGAATACTGCCTGCCGTCGCCTCGCACCCATAATGTTTGGAACTCGCAAACCTATACACTCATCACATAGCAG
->read2269_contig0_position3643_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCTAGTAAACCAGATATTCCATGGACTCTCTGTTTCGTCGATTGTCTGAATATCGTGCAGTAAGTTTCTCTTAGGTTCCTCAACGGAAACGTCTCAGAC
->read2270_contig0_position2460_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGAATGAACAACTCAATTAGGTAGTGTGCGCGAGGTAGAGTATGCAGATTTCGTACCTTGCCACTGCTACCTCCGGCATATGGGCGTGCTATAAATGCG
->read2271_contig0_position6644_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGCAGTATAAAATGGACTGCTATCTAGGCGTTAAAGTAGTAGAACGAGGGTCGGGCGATTTGTTTTGGTAGTGGTTATCGCATTGCAAGAACGTACGGA
->read2272_contig0_position7897_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGTTGTGCCGTGTCACTCTGTAGCTCCAATACCAATTGAAATGAAGCTTACGCAAACTACTCGACGAACAACAGCAAGATTCGACGATCAAACTCGCCGG
->read2273_contig0_position1789_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCACTTCTGCAAATTGTTATGAGCAAGCATACAAGTTAGCCGGCCCACAAATCGACGTGTGTATTTGTTCAATGTCAGGAGGTTAACTTTGCGGAGCAC
->read2274_contig0_position3825_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTCAAGTGAAGAACCCGGGCCCAAAATTGGAACCCGTAATCTTCAAGTGAATCATCCGATCATGCAACCTTGATTATCTGCACGACTCTTAATATCATG
->read2275_contig0_position2355_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGAGTTGACGGGACTAAAACAGTATTGGGCGGTGAGGGGTACCCGACGCCTCTGCTGTCAAAGTGGGAAATCCAGTCTCGACTATATCTACTATGTCAT
->read2276_contig0_position445_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GACCGGGTAGCGTAGTTAGTAACTTCAATCCGCGTTACGCTTTGTCCTCTGCTACGCCTCGATTGGTTTCAGCTCACGTGGGACGCATGTACTTACCTAA
->read2277_contig0_position9680_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCTTACTTAATCGGCTGGGGTAACGGCTGGTTTTGTACTACGGTATGGGAACCCGTTTGCCGAACGTCTGGAAATCTGTCGAGTCATATCCATGAACAG
->read2278_contig0_position635_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AACTCCGATGGGCAGAAGCTAAAACTGAACAACGAGTGGGACACCGGCCTACTACATTATACAGTAAGGTAGAATCGCGTAGAAGCACCCACGATCAATG
->read2279_contig0_position8344_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTGGGCTCGTCGACATTCCTGGTAGTAATCCGATCTCAATTCCTGCGGTACCGAGCAGCTTTGAGTTTTTGTAAGTCCCACGGTTAATGGGCCACTTAT
->read2280_contig0_position5629_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTGCGTGGTCAACCGAACGTTGCTTTCCTTAGGGTACCGAGTATATGAACTTTATGAAATTAGCGCGTTAACTACTTAAAGTTCAGAAGATCACTGTCC
->read2281_contig0_position492_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTGCTACGCCTCGATTGGTTTCAGCTCACGTGGGACGCATGTACTTACCTAACATGAAGCGGTAATGGAGCTCGAACACTAGTCGGTGGCTCTTCTGTC
->read2282_contig0_position6531_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCTGCGTCCGGTAGACGAGCGTTGGATTTAGACCGCTCACTGAACCCTCTAATAGGACCTCTTGCCCATCCGAGGCTTAAGCAGCGACTCCACATGGAG
->read2283_contig0_position7454_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTCTCAGCCGTTCGTTGAAAGGAGAATACAAATGACGGGAACTCTGACGAGAGGGTGCTTGTACGAGAGAAGCTAACAGTCATTGCGATGACGATAAAA
->read2284_contig0_position2434_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGACTATATCTACTATGACATGCTTGTCGAATGAACAACTCAATTAGGTAGTGTGCGCGAGGTAGAGTATGCAGATGTCGTACCTTGCCACTGCTACCTC
->read2285_contig0_position1571_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGCTCTGCCGAGCCTTCTAACCATCGGGTATGTACATTCACCTTTGGACGCTTCGATAGGACATGCACCCGGTCCGTTGACTTACCAACTTGATCGCCA
->read2286_contig0_position9621_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TATTGTACATCAGTACCATAGCTTGGCCACATGTGATGCTCGTACTCGAAGGGGGAATCACCTTACTTAATCGGCTGGGGTAACGGCTGGTTTTGTACTA
->read2287_contig0_position7393_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCCACTCGAGACCGCCCTCCCCGACCCATATGCAGTTTCTGCATACACCGGGTAGACAACATTCTCAGCCCTTCGTTGAAAGGAGAATACAAATGACGG
->read2288_contig0_position8676_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CGAGCAAACGATGCGGTAAGACGAGCGCTCCGACCCCCCTTGGCTCTGCTACAACGAATTCAGCGTGTAAGAGCCCGCTTATCCGGTGGTGATACCTACC
->read2289_contig0_position4246_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGTTCGACCATACGCGACGGCAAACAGAATCGCACGTCAACTATCCCCTTTATTAATGATCCGTGTCCCCCGACCGTGTGCTGAGGAGACCCGTAATGC
->read2290_contig0_position3330_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCCTCTCTGGGACAGCTGAACAACGGACGGGATTAAGCTCAGCAGTCCGCCTCCAATCTCTCCGACGTTCATTCTCAAGAGTGTAGTTTTAGAGACTGA
->read2291_contig0_position8008_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGTCATACTAGCTTTCAGTCATTCCCCCTCAGTTTTGTCCATGTGAAGAATATGCATTCGACCAAATCAAAATGTCAATAATCTCGACCCTGTAGTCCG
->read2292_contig0_position3043_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGACTCTATGACTAGCGGGTGTCGTCAAGGAAAACTGATCGAGCACTGTCCGCGAAACATTATTCAGTACAGCGACTTTTACCCTCGTGGTCTGAATGT
->read2293_contig0_position574_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCGGTGGCCCTTTTGTCTCTGGCGGGGACGGCTATGTGAGTTCATAAATCTCAATGTCGAAACTCCGATGGGCAGAAGCTAAAACTGAACAACGAGTGG
->read2294_contig0_position5849_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTAATAGAACGAAGTCCATATAACAGCTGATTTAAGAGGAAAAATTGAACATCAACGGAAGTACTATAGCAGGCTCACCAGCATGAAAGACATCCTCAT
->read2295_contig0_position6919_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTATTTTATGGTCTTAATTGAGTGTTCAGAGTTGGGGGTCACAGATGAGCGTTCCGATTGTCCTTTCCCAGGCTACGGCCTTATACCAAAGACTTCTAG
->read2296_contig0_position1914_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACAGACGAGTTGGAGTGTTTTGATGAGCGGTGTTATATTTGTCCTAACTTAGCACTATCGCACCACAAAATTCCAGCATAAAGCATCCGGTTGAAGGCTG
->read2297_contig0_position793_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGACGCACAAACCCTAGTCCCATATAAAGCTATTCCACGCCGGGTGGCCTGGACGTCGTTTGTGGATGGCTTTGGGAATCACTAGGTAATTACTGTTGGC
->read2298_contig0_position2417_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTGGGAAATCCAGTCTCGACTATATCTACTATGTCATGCTTGTCGAATGAACAACTCAATTAGATAGTGTGCGCGAGGTAGAGTATGCAGATTTCGTAC
->read2299_contig0_position5552_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTAAGTAATCGACTGCCTTCGTCGGGCCGCTTATTGGTTCACCCAATCTGGCCATTGCAAGTTTGGCAGACGCGAGGTTGCGTGGTCAACCGAACGTTG
->read2300_contig0_position9251_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTATACCCATACTGCCACTCCAGTACCTGGGCCGCGTGTTGTACGCTGTGAATCTTGAGAGCATTTCTCCGTATCGAAATGTTCCGCTGTAAAGAACCT
->read2301_contig0_position2235_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCCCGGCTTTTGGGGCAATTTCTGACGATTCGAGTGACCAGCGATAGTACGTTCCTTTTGTACTGAGTCTTAACATCGGCAAATGCGCCCTAGATACCT
->read2302_contig0_position5704_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTAAAGTTCAGATGATCACTGTCCGCCTCGAACCACTACAATAAGATTACGGATAGCCCGTGGCTTGGTTGTTTTCTGAATTGTGGCTATCTCAAATTG
->read2303_contig0_position3156_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTTGCGCTCGGATGTCCGCAATGGGTTATCAAATGCCTATGTTCCGGTAATCTCTCATCTACTAAGCGCCCTAAAGGTCGTATGGTTGGAGGGCGGTTA
->read2304_contig0_position9491_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TACAGAAGCTCATGGATAAGAGTGTGCGAATAACATCACTTGTTACTTCACGGAACGCTTCTTGATCCTGAGCTCCCCCGCGATTAACCTATGTCGGGAA
->read2305_contig0_position7250_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGATTATACGGAATACATATGCCGACACCGGCAGCTGAAATGATGCAGAAGCCTTGCTTGCCACTCCGCCGATGTCTAAAAGCGCCAGATCGACTTGAC
->read2306_contig0_position2182_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTCAGCTTGGCCACAACAGAGACTAGCCACCAAGAGATGGGTTGATGGTAGCATCCCGGCTTCTGAGGCAATTTCTGACGATTCGAGTGACCAGCGATA
->read2307_contig0_position9200_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGATGTAACTTAGTCAGCTCGGAACCGCTGGCAGAGCAGCTCCGAGGGCCTTTATACCCATACTGCCACTCCAGTACCTGGGCCGCGTGTTGTACGCTG
->read2308_contig0_position4045_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGAGCAGCAGATGCACTCTTAGCTCCGCTGATAACGATTACTATAAATCAGCGAATCTAACATCAATCTGCACCACGAATATCGTCCAAGACGTTTTGAG
->read2309_contig0_position7498_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGACGAGAGGGTGCTTGAACGAGAGAAGCTAACAGTCATTGCGATGACGAGAACAGCCCTACTGCCCGCCGTGAACGAGAACAAGCGTGTGGAGAGTGA
->read2310_contig0_position7492_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAACTCTGACGAGAGGGTGCTTGAACGAGAGAAGCTAACAGTCATTGCGATGACGAGAACAGCCCTACTGCCCGCGGTGAACGAGAACAAGCGTGTGGA
->read2311_contig0_position7412_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCCGACCCATATGCAGTTTCTGCATACACCGGGTAGACAACATTCTCAGCCCTTCGTTGAAAGGAGAATACAAATGACGGGAACTCTGACGAGAGGGTG
->read2312_contig0_position8453_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CATGGCGCCGATATCCTGCTTAGGCAGTACGGCCAATTCACGACCCTATATGACCCCTAGCGAGAAGTTATAGGCTAATAATGAATGGTGAACAGCACAT
->read2313_contig0_position5970_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCGAGCCTAACTGCATGCCATCTAACGTTTGGACGGGTCTTGTGTTCCTTCAAGACGTACGTTGACAGAGCTAACAATCCGTCGAGTGAATGTGATTCC
->read2314_contig0_position29_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTCTGGCTAACGAGCTACCGTTTCATTTAACCTGACAGACGGTGACCAGGGCCGTTCGGCGTTGCATCGAGCGGTGTCGCTAGCGCAATGCGCAAGATT
->read2315_contig0_position1081_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTACCGGTCAGCTCCAGTTACGTCACGGACGTAGAGAGCCTTTGAATGTGTACGGCAATAGGAGAAACTCGGCCACGTACGAGTCAACATGGCGCGGCTC
->read2316_contig0_position3906_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CACGACTCTTAAAATCATGCACTAAGCATAGAATGCACGAGTACTTGTTACTGAAGTAGGCATGACTATCAAACCTATTAAATGATATATGCTCTTGGAC
->read2317_contig0_position2754_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGATCCACTGCGTCTATTGTAAGAAATGCAATGCGTGGCCAGTTTGTTCCGGCAGGACACCACTCTTTGAAGGTGCCCATTGCGTTGTAGCCTGAACTAT
->read2318_contig0_position1928_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGTTTTGATGAGCGGTGTTATATTTGTCCTAACTTAGCACTATCGCACCACAAAATTTCAGCATAAAGCATCCGGTTGAAGGCTGCGCATCGAGCAGCG
->read2319_contig0_position3095_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGAAACATTATTCAGTACAGCGACTTTTACCCTCGTGGTCTGAATGTTATGCCGTCCGACTCTTGCGCTCGGATGTACGCAATGGGTTATCAAATGCCT
->read2320_contig0_position2698_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCCTCTCGACTCCAAAGGGTCTGCCCGAGACAGGTTCACCGAGTCGTTACTCCCGGGATCCACTGCGTCTATTGTAAGAAATGCAATGCGTGGCCAGTT
->read2321_contig0_position6233_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGTGGGGTCAACAGTTCTTCTTCTTTCCTGTACGGTAATGCTTCCGCGCATCTAAGTGATATTCGCCGGAATTTACCCTTCTAATATTGTGTGCAAGCT
->read2322_contig0_position2276_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGATATTACGTTCCTTTTGTACTGAGTGTTAACATCGGCAAATGCGCCCTAGATACCTGCGGCTTCACTCCACAGTGTAAGAGTTGACGGGATTAAAAC
->read2323_contig0_position6807_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCCGCTGATACGCGCGAGCTCTCACCCACGACTGTACCCCGGTTAAGATTTATAAACCATACATTTAACCCTTAGTCATAAGATGATACTTCATCTGCA
->read2324_contig0_position8401_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCTTTGAGTTTTTGTAAGTCCCACGGTTAATGGGCCACTTATTTCGACATTCATGGCGCCGATATCCTGCTTAGGCAGTACTGCCAATGCACGACCCAA
->read2325_contig0_position6874_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AACCCTTAGTCAAAAGATGATACTTCATCTGCATGCGCGCATCTTCCTATTTTATGGTCTTAATTGAGTGTTCAGAGTTGGGGGTCACAGATGAGCGTTC
->read2326_contig0_position6149_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTTGAGCCACTCATAAGGCACGCGCGGGCCATAACAGTCGACTAAAAGGCGTAACCGATTCTGCTACGTTATAAAAAAGTGACGAGTGGGGTCAACAGT
->read2327_contig0_position6796_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGGTCTCTACATCCGCTGATACGCGCGAGCTCTCACCCACGACTGTACCCCGGTTAAGATTTATAAACCATACATTTAACCCTTAGTCATAAGATGATA
->read2328_contig0_position1093_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCAGTTACGTCACGGACGTAGAGAGCCTTTGAATGTGTACGGCAATAGGAGAAACTCGGACACGTACGTGTCAACATGGCGCGGCTCTCTATACCTCGC
->read2329_contig0_position3793_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCTAGCCTGGCAATTACCCGTTTGTTATTCTAGTCAAGTGAAGAACCCGGGCCCAAAATTGCAACCCGTAATCTTCAAGTGAATCATCCGATCATGCAA
->read2330_contig0_position805_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTACTCCCATATAAAGCTATTCCACGCCGGGTGGCCTGGACGTCGTTTGTGGATGGCTTGGGGAATCACTAGGTAATTACTGTTGGCTCCTTTCTTTAT
->read2331_contig0_position5116_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCAAGGTGTTACGTGAAGTCGCGTTGTCGCTAGTAACAGAGTGGGAGGTCTCGGCCAATTCGTTGTATTGATCGCTGTGCACTTTAAAATTCGGAACAT
->read2332_contig0_position458_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTTAGTAACTTCAATCCGCGTTACGCTTTGTCCTCTGCTACGCCTCGATTGGTTTCAGCTCACGTGGGACGCATGTACTTACCTAACATGAAGCGGTAA
->read2333_contig0_position6389_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCATACATGGCGGAATGCCTGTCCACCGGGGGTTCTACTGTACCACAGTGGCCTGGATAGCTAAGCAGGTCCTGGATTGGCATGTCATCCGGAGTGATA
->read2334_contig0_position5353_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGAGTCCAGTACACCATATCAACAGCTTGATCGTTTCACTTAAATCAGCAAGACGGGCGACCGTACCCGGACACCTGGCAGCGGGAACCGCTTTGACTC
->read2335_contig0_position9158_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGACCTCACCGCAGGCATCGAGTCTAACTCTGATTCGAGAGACGGATGTAATTTAGTCAGGTCGGAACCGCTGGCAGAGCAGCTCCGAGGGCCTTTATAC
->read2336_contig0_position6716_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGTTATCGCATTGCAAGAACGTACGGACGGACAAAATGTCGGACACCGCCTTATCGGCTATACTAGTTAGAGCCTCGCTTGGGTCTCTACATTCGCTGA
->read2337_contig0_position998_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TATCGCTGATTGTGGGGGGCATGGGGGTTCTGCATTGGGGCAAAGGTACCGCAAAGGGCCTGTAGGACCCTGGTTACGCGTTATTACCGGTCAGCTCCAG
->read2338_contig0_position1396_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTAAGGTTGGGCCAATCGAGAGGACATTTCGCAGCGCCCTTTCATCTCTATGGCTAGGTCTCTTAAGCCTAATCAGGATCATAGATGGCCAATTATTGA
->read2339_contig0_position4445_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCGGGATGATAAGTGTTATTAGTATAGTGACCGTTATGGACGACGGACATAACTACTGAGTGTCCGCCCTCGGCTAATCATGGACACCGGTCAGGCATG
->read2340_contig0_position8757_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCGGTGGTGATACCTACTATTGACTGGGGGCTTACTGAGAACACTTCATCTGTATGGCAAAGTTGCGAAACCGCGCCACACAGCAGTTTATTGTTAACA
->read2341_contig0_position2259_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GACGATTCGAGTGACCAGCGATAGTACGTTCCTTTTGTACTGAGTCTTAACATCGGCAAATGCGCCCTAGATACCTGCGGCTTCACTCCACAGTGTAAGA
->read2342_contig0_position9274_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTACCTGGGCCGCGTGTTGTACGCTGTGTATCTTGAGAGCGTTTCTCCGTATCGAAATGTTCCGCTGTAAAGAACCTGGCGTATCCTGACCATGGAGCTG
->read2343_contig0_position2542_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGCGTGCTATAAATGCGGGAGTCAGGACGATAGAGCGAAGTAGTTACGGTGATTACCCGTCCATCGATGCCCCTCCTGTCCCGAAGCCTTAAAATCTAA
->read2344_contig0_position9132_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GATGACAGACCGAAGCCCACCTGTCCTCACCTCACCGCAGGCATCGAGTCTAACTCTGATTCGAGAGACGGATGTAATTTAGTCAGGTCGGAACCGCTGG
->read2345_contig0_position714_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGGAGCACCCACGATCAATGTTATTAACCGCGACGGTGTATTCCACGACCTAATTTTTCCCGTCTCTGAGGTCAACCTGGACGCACAAACCCTAGTCCC
->read2346_contig0_position675_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACACCGGCCTACTACATTATACAGTAAGGTAGAATCGCGTAGAAGCACCCACGATCAATGTTATTAACCGCGACGGTGTATTCCACGACCTAATTTTTCC
->read2347_contig0_position4977_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCGTCACTGCATAGCAGAATGGGCGATCGGCCTACAAGAGTACAGTACTAACGGTCTGGCCTTATACAGCGCCACATCCGCCAATTCGCTAGGTTGTAG
->read2348_contig0_position8985_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAAAACCTGTCTGAAGTCCGTGCTTCCCTAACCAGCCTATGCGCCTTAACTTTATGCATACTCGTTTAGTACAGGGCCGCGCCCCATGAGGCCATATGCG
->read2349_contig0_position4679_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATACGGTACGGAATATTGGGTAACCTCCTCTTCACTGATATCATCCTATCGGCGTTCAAAGTATTCGGCGGATGAATTAGAGCCAAAGCAGTAGGTTACC
->read2350_contig0_position2376_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTATTGGGCGGTGAGGGGTACCCGACGCCTCTGCTGTCAAAGTGGGAAATCCAGTCTCGACTATATCTACTATGTCATGCTTGTCGAATGAACAACTCA
->read2351_contig0_position5784_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTGTGGCTATCTCAAATTGGGACCTAGTGTTGGCCAATAAGCTTCAGATCGCCTTCTCAGATAGACTAATAGAACGAAGTCCATATAACAGCTGATTTA
->read2352_contig0_position538_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TACCTAACATGAAGCGGTAATGGAGCTCGAACACTAGTCGGTGGCTCTTCTGTCTCTGGCGGGGACGGCTATGTGAGTTCATAAATCTCAATGTCGAAAC
->read2353_contig0_position7897_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGTTGTGCCGTGTCACTCTGTAGCTCTAATACCAATTGAAATGAAGCTTACGCAAACTACTCGACGAACAACAGCAAGATTCGACGATCAAACTCGCCGG
->read2354_contig0_position1602_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTACATTCACCTTTGGACGCTTCGATAGGACATGCACCCGGTCCGTTGACTTACCAAGTTGATCGCCAGTGAGTGAGCGGTGGTTTATCTGTTGAGTGG
->read2355_contig0_position2837_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTGTAGCCTGAACTATTAGCAATCCTAAGCCCATAAGCCCTGCCCCACGGGGGCTACAATCCAGCAGTGAACGCGTTTACCTTAAGACGAAAGAGTCAG
->read2356_contig0_position7662_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GACCGTGATATCCTTGCGAGTGGAATGCGAAAACCGCATAAGCGCAATGACCGAGGTAACAAGCCATGAGGACTGGAGCGGTAATGTGGTAGTGTAGATG
->read2357_contig0_position3337_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGGGAAAGCTGAACAACGGATGGGATTAAGCTCAGCAGTCCGCCTCCAATCTCTCCGACCTTCATTCTCAAGGGTGTAGTTTTAGAGACTGAGAACTCA
->read2358_contig0_position1465_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTAATCAGGATCATAGATCGCCAATTATTGACCACAGGTAGGGGCGAGGTATAAATTAGTGGATTCACTTCCCTTTGACATCTTGTTCTCACAACTGCAC
->read2359_contig0_position4345_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CATGGAAAGTGCCAATATCCCCGGGAGTCCCGCACTACTGAGACGAAGTCTAGCTAGCTTGACTCGGCTGATAAAGAAAACAATCTATATGGAACCGAGG
->read2360_contig0_position8424_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGGTTAATGGGCCACTTATTTCGACATTCATGGCGCCGATATCCTGCTAAGGCAGTACGGCCAATGCACGACCCTATATGACCCCTAGCGAGAAGTTAT
->read2361_contig0_position5885_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGGAAAAATTGAACATCAACGGAAGTACTATAGCAGGCTCACCAGCATGAAAGACATCCTCATTGTGAACCCGGCATCTCGTGATTCGAGCCTAACAGC
->read2362_contig0_position6389_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCATACATGGCGGAATGCCTGTCCACCGGGGGTTCTACTGTACCACAGTGGCCTGGATAGCTAAGCAGGTCCTGGATTGGCATGTCATCCGGAGTGATA
->read2363_contig0_position1506_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGCGAGGTATAAATTAGTGGATTCACTTCCCTTTGACATCTTGTTCTCACAACTGCACACTCCGATGCTCTGCCGAGCCTTCTAACCATCGGGTATGTA
->read2364_contig0_position8742_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTAAGAGCCCGCTTATCCGGTGGTGATACCTACTATTGACTGGGGGCTTACTGAGAGCACTTCATCTGTATGGCAAAGTTGCGACACCGCGCCACACAGC
->read2365_contig0_position2233_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCTCCCGGCTTCTGGGGCAATTTCTGTCGATTCGAGTGACCAGCGATAGTACGTTCCTTTTGTACTGAGTCTTAACATCGGAAAATGCGCCCTAGATAC
->read2366_contig0_position6396_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGGCGGAATGCCTGTCCACCGGGGGTTCTACTGTACCACAGTGGCCTGGATAGCTAAGCAGGTCCTGGATTGGCATGTCATCCGGAGTGATAGGCACTG
->read2367_contig0_position9474_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCCATACCCCTTTGTCTACAGAAGCTCATGGATAAGAGTGTGCGAATAACATCACTTGTTACTTCACGGAACGCTTCTTGATCCTGAGCTCCCCCGCGA
->read2368_contig0_position1428_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGCGCCCTTTCATCTCTATTGCTAGGTCTCTTAAGCCTAATCAGGATCATAGATGGCCAATAATTGACCACAGGTAGGGGCTAGGTATAAATTAGTGGA
->read2369_contig0_position2119_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTCTATGCTACAGGTATTTCGGAGTGAAACGGCTGCGAGCATCTCATAATCGGCCCACCCGATTTCAGCTTGGCCACAACAGAGACTAGCCACCAAGAG
->read2370_contig0_position3129_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGTGGTCTGAATGTTATGCCGTCCGACTCTTGCGCTCGGATGTCCGCAATGGGTTATCAAATGCCTATGTTCCGGTAATCTCTCATCTACTAAGCGCCCT
->read2371_contig0_position8183_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTCCAGGGTAAAATGATGGACTTATTGACCAACCCCTATTATTAGGAGAGGGCTGCGTCTGCTTGCAGCTCCAACCGCTTTCCAATCGTTGCACATGAC
->read2372_contig0_position2640_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AACCCTGAATTGGCTTTATCCACCCCCCCTACTGGCCACCACTGGGGCGCGCGTCTCGAGCCTCTCGACTCCAAAGGGTCTGCCCGAGACAGGTTCACCG
->read2373_contig0_position4211_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGATCGATATTCAGACTCTAACAAGTGGTCAGTACAGGTTCGACCATACGCGACGGCAAACAGAATCGCACGTCAACTATCCCGTTTATTAATGATCCGT
->read2374_contig0_position4850_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCACAGTGTTTTATACGGGACGGTGGCCACGGGGTGAGCACATGAATGGGGTACGGTTTTACCGTCCATGACGTTGTGACATAAAGGTGCGGGACGCGG
->read2375_contig0_position9569_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCGATTAACCTATGTCGGGACAAACACTCGATTGAGCAGTGGTCATGTCATTATTGTACATCAGTACCATAGCTTGGCCACATATGATGCTCGTACTCG
->read2376_contig0_position1876_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTTGCGGAGCTCAACCTATAACGATAATCAAATTGAGACAGACGAGTAGGAGAGTTTTGATGAGCGGTGTTATATTTGTCCTAACTTAGCACTATCGCA
->read2377_contig0_position3777_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TACGAAGGGTAAGAACACCTAGCCTGGCAATTACCCCTTTGTTATTCTAGTCAAGTGAAGAACCCGGGCCCAAAATTGGAACCCGTAATCTTCAAGTGAA
->read2378_contig0_position7864_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGGTGATTTGTGCGGGCGCGTCCAGGTGCGAACGTTGTGCCGTGGCACTCTGTAGCTCTAATACCAATTGAAATGAAGCTTACGCAAACTACTCGACGA
->read2379_contig0_position4192_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTCCCGCTGATATGATTGTGATCGATATTCAGACTCTAACAAGTGGTCAGTACAGGTTCGACCATACGCGACGGCAAACAGAATCGCACGTCAACTATC
->read2380_contig0_position3802_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCAATTACCCCTTTGATATTCTAGTCAAGTGAAGAACCCGGGCCCTAAATTGGAACCCGTAATCTTCAAGTGAATCATCCGATCATGCAAACCTGATTA
->read2381_contig0_position4759_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCCAAAGCAGTAGGTTACCGTCGGCGCATAACCGGCGAGTGCTCTGAAACGTTACATTCGTCTATCCGCACACACCGCCGTTGGATGTGTCCCACAGTG
->read2382_contig0_position2250_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCAATTTCTGACGATTCGAGTGACCAGCGATAGTACGTTCCTTTTGTACTGAGTCTTAACATCGGCAAATGCGCCCAAGATACCTGCGGCTTCACTCCAC
->read2383_contig0_position4250_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGACCATACGCGACGGCAAACAGAATCGCACGTCAACTATCCCCTTTATTAATGATCCGTGTCCCCCGACCGTGTGCTGAGGAGACCCGTAATGCATGG
->read2384_contig0_position5975_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCTAACAGCATGCCATCAAACGTTTGGACGGGTCTTGTGTTCCCTCATCACGTACGTTGACAGAGCTAACAATCCGTCGACTGAATGTGATTCCTTTGT
->read2385_contig0_position1983_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTTCAGCATAAAGCATCCGGTTGAAGGCTGCGCATCGAGCAGCGTGCATTGGTCTTTCAGTCCCCAGTCACTGGAGACGTCCGAGCTCGAACCCGTCCG
->read2386_contig0_position4252_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GACCATACGCGACGGCAAACAGAATCGCACGTCAACTATCCCCTTTATTAATGATCCGTGTCCCCCGACCGTGTGCTGAGGAGACCCGTAATGCATGGAA
->read2387_contig0_position6368_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAAGGCGCGCAGCTCAAGCAATCATACATGGCGGAATGCCTGTCCACCGGTGGTTCTACTGTACCACAGTGGCCTGGATAGCTAAGCAGGTCCTGGATT
->read2388_contig0_position2878_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCCCCACGGGGGCTACAATCCAGCAGTGAACGCGTTTACCTTAAGACGAAAGAGTCAGTAGAGTTGGGGTTCGTGCTTTAATGACCCGTAGCCCAATTG
->read2389_contig0_position7879_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCGCGTCTAGGTGCGAACGTTGTGCCGTGTCACTCTGTAGCTCTAATACCAATTGAAATGAAGCTTACGCAAACTACTCGACGAACAACAGCAAGATTC
->read2390_contig0_position1322_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAAGTGAACCCATGGGTCGCGCTGTATTTTTGTACGGCTTGATGTCAGGGTCAGTTTGGGCGCCGGTATGTCTGTGTAAGGTTGGGCCAATCGAGAGGAC
->read2391_contig0_position5591_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTACCCAATCTGGCCATTGCAAGTTTGGCAGACGCGAGGTTGCGTGGTCAACCGAACGTTGCTTTCCTTAGGGTACCGAGTATATTAACTTTATGAAATT
->read2392_contig0_position7754_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTAGTTGCCGGCCCCTGTGCTGACCTTATGTCCATATCGATACACGAAGGCCAGTGCGGAAGCGGAGCCACACTCGCCGTTACTGACTGATTGACAATC
->read2393_contig0_position4528_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCACCGGTCAGGCATGCTTACCTCCTGCGACGGCATTGGCGATTATGGGCGTGCATAGAGTCCCGCAGTGTCGGAGCGATGGGGAGGACGTAAACGCCA
->read2394_contig0_position604_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCTATGTGAGTTCATAAATCTCAATGTCGAAACTCCGATGGGCAGAAGCTAAAACTGAAAAACGAGTGGGACACCGGCCTACTACATTATACAGTAAGG
->read2395_contig0_position3867_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCAAGTGAATCATCCGATCATGCAAACCTGATTATCTGCACGACTCTTAAAATCATGCACTAAGCATAGAATGCACGACTACTTGTTACTGAAGTCGGC
->read2396_contig0_position5184_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGATCGCTGTGCACTTTAAAATTCGGAACATCTTAACCAAAGCATATTAATATGCCAGCCGCGCAGGGTGGTATATATGATCCTTGATAGCTTTATGGC
->read2397_contig0_position6012_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGTTCCCTCAACACGTACGTTGACAGAGCTAACAATCCGTCGACTGAATGTGATTCCTTTGTTATTTCACACTATTGTTCGGTGCGTGCGCTGCTCAGG
->read2398_contig0_position2559_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGAGTCAGGACGGTAGAGCGAAGTAGTTACGGTGATTACCCGTTCATCGATGCCCCTCCTGTCCCGAAGCCTTAAAATCTAACCCTGAATTGCCTTTAT
->read2399_contig0_position384_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGTTGGGTCTACCTAGTAGTGTCGCGGTTATCGGACAGAGGATTATGTAAGGTTACCGAAGACCGGGTAGCGTAGTTAGTAACTTCAATCCGCGTTACG
->read2400_contig0_position7001_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TATACCAAAGACTTCTAGACCGGAGAGACTACTTCCAGCCACGAATTCGTGTGATAACCGCCTAAACAGTCTAATCTGGCCAATATACCCTGGGGGGAGC
->read2401_contig0_position5848_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GACTAATAGAACGAAGTCCATATAACAGCTGATTTAAGAGGAAAAATTGAACATCAACGGAAGTACTATAGCAAGCTCACCAGCATGAAAGACATCCTCA
->read2402_contig0_position1355_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGGCTTGATGTCAGGGTCAGTTTGGGCGCCGGTATGTCTGTGTAAGGTTGGGCCAATCGAGAGGACATTTCGCAGCGCCCTTTCATCTCTATTGCTAGG
->read2403_contig0_position8324_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AACTCTGCGACCTGAATGACCTTGGGCTCGTCGACATTCCTGGTAGTAATCCGATCTCAATTCCTGCGGTACCGAGCAGCTTTGAGTTTTTGTAAGTCCC
->read2404_contig0_position1224_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATAGTCGACGAGTAGCGAATATATGTTCTGCTCCGAGACTTCGGCATAAAACTAAGTATGGACTCTTATATTCCCTCCTGCGTAGTGCTCTCCCATAATA
->read2405_contig0_position3670_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTCTGTTTCGTCGATTCTCTGAATATCGTGCAGTAAGTTTGTCTTAGGTTCCTCAACGGAAACGTCTCAGACCCACCTTACACGCGGGAATAAATTCGA
->read2406_contig0_position6436_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTAGCCTGGATAGCTAAGCAGGTCCTGGATTGGCATGTCATCCGGAGTGATAGGCACTGGTCACGACCAGCTTGCGGACAAACGGGGTGCCCGCGCCTG
->read2407_contig0_position8735_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCAGCGTGTAAGAGCCCGCTTATCCGGTGGTGATACCTACTGTTGACTGGGGGCTTACTGAGAACACTTCATCTGTATGGCAAAGTTGCGACACCGCGCC
->read2408_contig0_position2836_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CATTGTAGCCTGAACTATTAGCAATCCTAAGCCCATAAGCCCTGCCCCACGGGGGCTACAATCCAGCAGTGAACGCGTTTACCTTAAGACGAAAGAGTCA
->read2409_contig0_position4281_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGTCAACTATCCCCTTTATTAATGATCCGTGTCCCCCGACCGTGTGCTGAGGAGACCCGTAACGCATGGAAAGTGCCAATATCCCCGGGAGTCCCGCACT
->read2410_contig0_position2134_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TATTACGGAGTGAAAAGGCTGCGAGCATCTCATAATCGGGCCACCCGATTTCTGCTTGGCCACAACAGAGACTAGGCACCAAGAGATGGGTTGATGGTAG
->read2411_contig0_position4013_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTCGTAATTATTTCCTGAGATGGTTTTAGTGAGAGCAGTAGATGCACTCTTAGCTCCGCTGATAACGATTACTATAAATCAGCGAATCTAACATCAATC
->read2412_contig0_position1796_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGCAAATTGTTATGAGCAAGCATACAAGTTAGCCGGCCCACAAATCGACGTGTGTATTTGTTCAATGGCAGGAGGTTAACTTTGCGGAGCTCAACCTAT
->read2413_contig0_position7113_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGTCGAGTTACCGTTGCACCAGCTCCAAGTGTCCATCGGAGTCCGCTTCCCGGGCTTGTCCGCGTCCCATCGGTTAATTCAATATCCGTCAATCGGGTT
->read2414_contig0_position5559_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AATCGACTGCCTTCGACGGGCCGCTTATTGGTTCACCCAATCTGGCCATTGCAAGTTTGGCAGACGCGAGGTTGCGTGGTCAACCGAACGTTGCTTTCCT
->read2415_contig0_position3050_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TATGACTAGCGGGTGTCGTCAATGAAAACTGATCGAGCACTGTCCGCGAAAAATTATTCAGTACAGCGACTTTTACCCTCGTGGTCTGCATGGTATGCCG
->read2416_contig0_position1553_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCACAACTGCACACTCCGTTGCTCTGCCGAGCCTTCTAACCATCGGGTATGTACATTCACCTTTGGACGCTTCGATAGGACATGCACCCGGTCCGTTGAC
->read2417_contig0_position8551_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCTTTTCGTCCTGAGGCCATATTAATTCTACTCAGATTGTCTGTGACCGGAGCTTCGGGCGTATTTTTGCGTAAGACTCTGCCTAAAGGGAACATATGT
->read2418_contig0_position4946_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGGAAGCGCACCTCGTATAACGTTAGGGGTATCGTCACTGCATAGCAGAATGGGCGATCGGCCTACAAGAGTACAGTACTAACGGTCTGGCCTTATAAA
->read2419_contig0_position7524_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGCTAACAGTCATTGCGATGACGAGAACAGCCCTACTGCCCGCCGTGAACGAGAACAAGTGTGTGGAGAGTGACTGACTATCACGAGGAATTACGGATA
->read2420_contig0_position2969_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCCAATTGCGCTCCCGAACAACGCGTGAGTTTAAAATTGACTTGAAACCGCCTAGGTCGGACCACCAAAGAGCAAGACTCTATGACTAGCGGGTGTCGT
->read2421_contig0_position8038_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGTTTTGTCCATGTGGAGAATATGCATTCGACCAAATGAAAATGTCAATAATCTCGACCCTGTAGTCCGTGGCCAATCAGCACGATCAAGCTAAAGACA
->read2422_contig0_position1338_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGCGCTGTATTTTTGTACGGCTTGATGTCAGGGTCAGTTTGGGCGCCGGTATGTCTGTGTAAGGTTGGGCCAATCGAGAGGACATTTCGCAGCGCCCAT
->read2423_contig0_position810_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCCATATAAAGCTATTCCACGCCGGGTGGCCTGGACGTCGTTTGTGGATGGCTTTGGGAATCACTAGGTAATTACGGTTGGCTCCTTTCTTCATGATCG
->read2424_contig0_position437_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTACCGAAGACCGGGTAGCGTAGTTAGTAACTTCAATCCGCGTTACGCTTTGTCCTCTGCTCCGCCTCGATTGGTTTCAGCTCACGTGGGACGCATGTAC
->read2425_contig0_position4777_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGTCGACGCATAACCGGGGAGTGCTCTGAAACGTTACATTCGTCTATCCGCACACACCGCCGTTGGATGTGTCCCACAGTGTTTTATACGGGACGCTGA
->read2426_contig0_position2867_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCATAAGCCCTGCCCCACGGGGGCTACAATCCAGCAGTGAACGCGTTTACCTTAAGACGAACGAGTCAGTAGAGTTGGGGTTCGTGCTTTAATGACCCG
->read2427_contig0_position8089_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCTCGACCCTGTAGTCCGCGGCCAATCAGCACGATCAAGCTAAAGACAGGGATTATACACTAGCACGACCGCCGCAGTAAAGATCCGAGGCCTTTTCCA
->read2428_contig0_position4033_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGGTTTTAGTGAGAGCAGCAGATGCACTCTTAGCTCCGCTGATAACGATTACTATAAATCAGCGAATCTAACATCAATCTGCACCACGAATAACGTCCA
->read2429_contig0_position7002_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATACCAAAGACTTCTAGACCGGAGAGACTACTTCCAGCCACGAATTCGTGTGATAACCGCCTAAACAGTCTAATCTGGCCAATATACCCTGGGGGGAGCT
->read2430_contig0_position4526_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAAACACCGGTCAGGCATGCTTACCTCCTGCGACGGCATTGGCGATTATGGGCGTGCATAGAGTCCCGCAGTGTCGGAGCGATAGGGAGGACGTAAACGC
->read2431_contig0_position5652_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTTCCTTAGGGTACCGAGTATATTAACTTTATGAAATTAGCGCGTTAACTACTTAAAGTTCAGAAGATCACTGTCCGCCTCGAACCACTACAATAAGAT
->read2432_contig0_position1539_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGACATCTTGTTCTCACAACTGCACACTCCGATGCTCTGCCGAGCCTTATAACCATCGGGTATGAACATTCACCTTTGGACGCTTCGATAGGACATGCA
->read2433_contig0_position4861_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TTATAAGGGACGGGGGCCACGGGGTGAGCACATGAATGGGGTACGGTCTTACCGTCCATGACGTTGTGACATAAAGGTGCGGGACGCGGAAGCGCACCTC
->read2434_contig0_position3347_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGAACAACGGATGGGATTAAGCTCAGCAGTCCGCCTCCAATCTCTCCGACGTTCATTCTCAAGGGTGTAATTTTAGAGACTGAGAACTCACCCTATTGGT
->read2435_contig0_position2142_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTGAAACGGCTGCGAGCATCTCATAATCGGGCCACCCGATTTCAGCTTGGCCACAACAGAGACTAGCCACCAAGAGATGGGTTGATGGTAGCATCCCGG
->read2436_contig0_position107_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCTAGCGCAATCCGCAAGATTTTGACATTTACAAGGCAACATTGCAGCGTCCGATGGTCCGGTGGCCTCCAGATAGTGTCCAGTCGCTCTAACTGTATG
->read2437_contig0_position2622_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCGAAGCCTTAAAATCTAACCCTGAATTGGCTTTATCCAACCCCCCTACTGGCCACCACTGGGGCGCGAGTCTCAAGCCTCTCGACTCGAAAGGGTCTG
->read2438_contig0_position7308_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGCCACTCCGCCGATGTCTAAAAGCGCCAGATCGACTTGACTCTACGTGCTGCAATGGAGAACCGCGGAAGGAACACTTTCTGGTGCCACTCGAGACCG
->read2439_contig0_position6494_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCTCACGACCAGCTTGCGGACAAACGGGGTGCCCGCGCCTGCGTCCGGTAGACGAGCGATGGATTTAGACCGTTCACTGAACCCTCTAATAGGACCTCT
->read2440_contig0_position517_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCACGTGGGACGCATGTACTTACCTAACATGTAGCGGTAATGGAGCTCGAACACTAGTCGGTGGCTCTTCTGTCTCTGGCGGGGACGGCTATCTGAGTT
->read2441_contig0_position447_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGGGTAGCGTAGTTAGTAACTTCAATCCGCGTTACGCTTTGTCCTCTGCTACGCCTCGATTGGTTTCAGCTCACGTGGGACGCATGTACTTACCTAACA
->read2442_contig0_position570_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTAGTCGGTGGCTCTTCTGTCTCTGGCGGGGACGGCTATGTGAGTTCATAAATCTCAATGTCGAAACTCCGATGGGCAGAAGCTAAAACTGAACAACGA
->read2443_contig0_position7838_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGACTGATTGACAATCCAGCCCGTTTGGGGTGATTTGTGCCGGCGCGTCCAGGTGCGAACGTTGTGCCGTGTCACTCTGTAGCTCTAATACCAATTGAAA
->read2444_contig0_position3452_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCCTGCCGTCGCCTCGCGCCCATAATGTTTGGAACTCGCAAACCTTTACACTCATCACATAGCAGGTTCCACCCGAACCGCGCGTATTCTGCGACAGCA
->read2445_contig0_position4067_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCCGCTGATAACGATTACTATAAATCAGCGAATCTAACATCAATCTGCACCACGAATATCGTCCAAGACGTTTTGAGCCGGTGACTAATTCGGTTGTCG
->read2446_contig0_position3461_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGCCACGCGCCCATAATGTTTGGAACTCGCAAACCTTTACACTCATCACATAGCAGGTTCCACCCGAACCGCGCGTATTCTGCGACAGCATGAATCGTG
->read2447_contig0_position6940_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTGTTCAGAGTTGGGGGCCACAGATGAGCGTGCCGATTGTCCTTTCCCAGGCTACGGCCTTATACCAAAGACTACTAGACCGGAGAGACTACTTCCAGC
->read2448_contig0_position5791_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTATCTCAAATTGGGACCTAGTGTTGGCCAATAAGCTACATATCGCCTTCTCAGATAGACGAATAGAACGAAGTCCATATAACAGCTGATTTAAGAGGAA
->read2449_contig0_position7311_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCACTCGGCCGATGTCTAAAAGCGCCAGATCGACTTGACTCTACGTGCTGCAATGGAGAACCGCGGAAGGAACACTTTCTGGTGCCACTCGAGACCGCCC
->read2450_contig0_position3667_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GACTCTCTGTTTCGTCGATTGTCTGAATATCGTGCAGTAAGTTTCTCTTAGGTTCCTCAACGGAAACGTCTCAGACCCACCTTAGACGCGGGAATAAATT
->read2451_contig0_position4252_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GACCATACGCGACGGCAAACAGAATCGCACGTCAACTATCCCCTTCATTAATGATCCGTGTCCCCCGACCGTGTGCTGAGGAGACCCGTAATGCATGGAA
->read2452_contig0_position207_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGACCATATGCATTTACCTTATTCTCATCGCCACGCCCCAAGATCTTTAGGACCCAGCATTCCTTTAACCACTAACATAACGCGTGTCATCTAGTTCTA
->read2453_contig0_position2471_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTCAATTAGGTAGTGTTTGCGAGGTAGAGTATGCAGATTTCGTACCTTGCCACTGCTACCTCCGGCATATGGGCGTGCTATAAATGCGGGAGTCAGGAC
->read2454_contig0_position8652_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCAGAATAGAGTTCAACGGTGTATGAGCAAACGATGCGGTAAGACGAGCGCTCCGACCCCCCTTGGCTCTGCTACATCGAATTCAGCGTGTAAGAGCCC
->read2455_contig0_position2426_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCAGTCTCGACTATATCTACTATGTCATGCTTGTCGAATGAACAACTCAATTAGGTAGTGTGCACGAGGTAGAGTATGCAGATTTCGTACCTTGCCACG
->read2456_contig0_position2909_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCGTTTACCTTAAGACGAAAGAGTCAGTAGAGTTGGGGTTCGTGCTTTAATGACCCGTAGCCCAATTGCGCTGCCGAACAACGCGTGAGTTTAGAATTG
->read2457_contig0_position524_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGACGCATGTACTTACGTAACATGAAGCGGTAATGGAGCTCGAACACTAGTCGGTGGCTCTTCTGTCTCTGGCGGGGACGGCTATGTGAGTTCATAAAT
->read2458_contig0_position6126_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACAGCGTTATCCGTCCCGAACTGGCTTGAGCCACTCATAAGGCACGCGCGGGCCATAACAGTCGACTAAAAGGCGTAACCGATTCTGCTACGTTATAAAA
->read2459_contig0_position6247_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTCTTCTTCTTTCCTGTACGGTAATGCTTCCGCGCATCTAAGTGATATTCGCCGGAATTTACCCTTCTAATATTGTGTGCAAGCTACTTCTAGACCTTA
->read2460_contig0_position24_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCACGCTCTGGCTAAAGAGCTACCGTTTCCTTTAACCTGCCAGACGGTGACCAGGGCCGTTCTGCGTTGCATCGAGCGGTGTCGCTAGCGCAATGCGCA
->read2461_contig0_position1878_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGCGGAGCTCAACCTATAACGATAATCAAATTGAGACAGACGAGTTGGAGTGTTTTGATGAGCGGTGTTATATTTGTCCTAACTTAGCACTATCGCACC
->read2462_contig0_position6070_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTGTTATTTCACACTATTGTTCGGTGCGTGCGCTGCTCAGGCTGGTGCGACCCTTACAGCGTTATCCGTCCCGAACTGGCTTGAGCCACTCATAAGGCA
->read2463_contig0_position9368_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGCTGCAACACTTTCACACAGGTAGCCGTACAGGTATTACTCAGACTGGAGAGGAATCTTCATTGGTCGTGCAGACATTGTCGCTGCGTACCAAAGTAA
->read2464_contig0_position9104_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGCGGCGGTTACATTAATCGCTTCTGTGATGACGGACCGAAGCCCACCTGTCCTGACCTCACCGCAGGCATCGAGTCTAACTCTGATTCGAGAGACGGA
->read2465_contig0_position5697_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTAACTACTTAAAGTTCAGAAGATCACTGTCCGCCTCGAACCACTACAATAAGATTACGGATAGTCCGTGGCTTGGTTGTTTTCTGAATTGTGGCTATCT
->read2466_contig0_position6071_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGTTATTTCACACTATTGTTCGGTGCGTGCGCTGCTCAGGCTGGTGCGCCCCTTACAGCGTTATCCGTCCCGAACTGGCTTGAGCCACTCATAAGGCAC
->read2467_contig0_position1342_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTGTATTTTTGTACGGCTTGATGTCAGGGTCAGTTTGGGCGCCGGTATGTCTGTGTAAGGTTGGGCCAATCGAGAGGACATTTCGCAGCGCCCTTTCAT
->read2468_contig0_position6653_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAAATGGACTGCTATCTAGGCGTTCAAGTAGTAGAACGAGGGTCGGGCGATTTGTTTTGGTAGTGGTTATCGCATTGCAAGAACGTACGGACGGACAAAA
->read2469_contig0_position5407_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGGCGACCGTACCCGGACACCTGGCAGCGGGAACCGCTTTGACTCTGGAGTGCCAGCGATAGTATCTCAGAGGCGAAAGCGCTTGTCACCTCATCTAAA
->read2470_contig0_position61_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGCCAGACGGTGACCAGGGCCGTTCGGCGTTGCATCGAGCGGTGTCGCTAGCGCAATGCGCAAGATTTTGACATTTACAAGGCAACATTGCAGCGTCCG
->read2471_contig0_position2735_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CACCGAGTCGATACTCCCGGGATCCACTGCGTCTATTGTAAGAAATGCAATGCGGGGCCAGTTTGTTCCGGCAGGACACCACTCTTTGAAGGTGCCCATT
->read2472_contig0_position3653_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTGAGATTCCATGGACTCTCTGTTTCGTCGATTGTCTGAATATCGTGCAGTAAGTTTCTCTTAGGTTCCTCAACGGAAACGTCTCAGACCCACCTTAGA
->read2473_contig0_position5408_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGCGACCGTACCCGGACACCTGGCAGCGGGAACCGCTTTGACTCTGGATTGCCAGCGATAGTATCTCAGAGGCGAAAGCGCTTGTCACCTCATCTAAAA
->read2474_contig0_position3329_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGCCTCTGTGGGACAGCTGAACAACGGATGGGATTAAGCTCAGCAGTCCGCCTCCAATCTCTCCGACGTTCATTCTCAAGGGTGTAGTTTTAGAGACTG
->read2475_contig0_position3925_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CACTAAGCATAGAATGCACGACTACTTGTTACTGAAGTCGGCATGACTATGAAACCTATTTAATGATATATGCTCTTGGACAACACGAGGTCGTAATTAT
->read2476_contig0_position7084_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TATACCCTGGGGGGAGCTAATATATCGCGGCGTCGAGTTACCGTTGCTCCACCTCCAAGTGTCCATCGGAGTCCGCTTCCCGGGCTTGTCCGCGTCCCAT
->read2477_contig0_position8690_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTAAGACGAGCGCTCCGACCCCCCTTGGCTCTGCTACATCGAATTCAGCGTGTAAGAGCCCGCTTATCCGGTGGTGATACCTACTATTGACTGGGGGCT
->read2478_contig0_position2516_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTTGCCACTGCTACCTCCGGCATATGGGCGTGCTATAAATGCGGAAGTCAGGACGATAGAGCGAAGTAGTTACGGTGATTACCCGTCCATCGATGCCCC
->read2479_contig0_position8055_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGACTATGCATTCCACCAAATGAAAATGTCAATAATCTCGACCCTGTAGTCCGCGGCCAATCAGCACGATCAAGCTAAAGACAGGGATTATGCACTAGCA
->read2480_contig0_position5303_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCAGATTACACTGCAGACGTCCGCGTAAGATCCTAGTTGAATTGATCAATTGAGTGCAGTACACCATATCAACAGCTTGATCGTTCCACTTCAATCAGC
->read2481_contig0_position8814_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCAAAGTTGCGACACCGCGCCACACAGCAGTTTATTGTTAACACGCGATACAAGAGGGTTAGGAGCTAAGAAACCGGTGCATCACCCTACGAAAAGGATG
->read2482_contig0_position7872_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGTGCCGGCGCGTCCAGGTGCGAACGTTGTGCCGTGTCACTCTGTAGCTCTAATACCAATTGAAATGAAGCTTACGCAAACTACTCGACGAACAACAGC
->read2483_contig0_position9658_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTCGTACTCGAAGGGGGAATCACCTTACTTAATCGGCTGGGGTAACGGCTGGTTTTGTACGACGGTATGGGAACCCGTTTGCCGAACGTCTGGAAATCT
->read2484_contig0_position2465_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCACAACTCAATTAGGTAGTGTGCGCGAGGTAGAGTATTCAGATTTCGTACCTTGCCACTGCTACCTCCGGCATATGGGCGTGCTATAAATGCGGGAGT
->read2485_contig0_position1359_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTGATGTCAGGGTCAGTTTGGGCGCCGGTATGTCTGTGTAAGGTTGGGCCAATGGAGAGGACATTTCGCAGCGCCTTTTCATCTCTATTGCTAGGTCTC
->read2486_contig0_position8223_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TATTAGGAGAGGGCTGAGACTGCTTGCAGCTCCGACCGCTTTCCAATCGTTGCACATGACTTGAGGCTCGGACTCGTATCTGTCTCCGTGTTCCTTTCGA
->read2487_contig0_position2406_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTGCTGTCAAAGTGGGAAATCCAGTCTCGACTATATCTACTATGTCATGCTTGTCGAATGAACAACTCAATTAGGTAGTGTGCGCGTGGTAGAGTATGC
->read2488_contig0_position2359_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTGACGGGACTAAAACAGTATTGGGCGGTGAGGGGTACCCGACGCCTCTGCTGTCAAAGTGGGAAATCCAGTCTCGACTATATGTACTATGTCATTATT
->read2489_contig0_position7494_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AACTCTGACGAGAGGGTGCTTGAACGAGAGAAGCTTACAGTCATTGCGATGACGAGAACAGCCCTACTGCCCGCCGTGAACGAGAACAACCGTGTGGAGA
->read2490_contig0_position9196_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGACGGATGTAATTTAGTCAGGTCGGAACCGCTGGCAGAGCAGCTCCGAGGGCCTTCATACCCATACTGCCACTCCAGTACCTGGGCCGCGTGTTGTAC
->read2491_contig0_position2339_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTCACTCCACAGTGTACGAGTTGACGGGACTAAAACAGTATTGGGCGGTGAGGGGTACCCGACGCCTCTGCTGTCAAAGTGGGAAATCCAGTCTCGACT
->read2492_contig0_position1100_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGTCACGGACGTAGAGAGCCTTTGAATGTGTACGGCAATAGGAGAAACTCGGCCACGTACGTGTCAACATGGCGCGGCTCTCTATACCTCGCAAAGAAT
->read2493_contig0_position1465_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTAATCAGGATCATAGATGGCCAATTATTGACCACAGGTAGGGGCGAGGTATAAATTAGTGGATTCACTTCCCTTTGACATCTTGTTCTCACAACTGCAC
->read2494_contig0_position1963_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGCACTAACCCACCACAAAATTTCAGCATAAAGCATCCGGTTGAAGGCTGCGCATCGAGCAGCGTGCATTGGTCTTTCAGTCCCCAGTCACCGGAGACG
->read2495_contig0_position8943_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTCACGCGCCACCGTCATAGGCTGCATATTGAGACAGGGTTGAAAACATGTCTGAAGTCCGTGCTTCCCTAATCAGCCTATGCGCCTTAACTTTATGCA
->read2496_contig0_position1412_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGAGAGGACATTTCGCAGCGCCCTTTCATCTCTATTGCTAGGTCTCTTAAGCCTAATCAGGATCATAGATGGCCAATTATTGACCACAGGTAGGGGCGA
->read2497_contig0_position1829_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGGCCCACAAATCGACGTGTGTATTTGTTCAATGGCAGGAGGTTAACTTTGCGGAGCTCAACCTATAACGATAATCAAATTGAAACAGACGAGTTGGAG
->read2498_contig0_position7183_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGGTTAATTCAATGTCCGTCAATCGGGTTGGCCAAAAATTCTACCTGTCCACCTGTCCGCTAGAAGCAGATTATACGGAATACATATCCCGACACCGGC
->read2499_contig0_position9172_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCATCGAGTCTAACTCTGATTCGAGAGACGGATGTAATTTAGTCAGGTCGGAACCGCTGGCAGACCAGCTCCGAGGGCCTTTATACCCATACTGCCACTC
->read2500_contig0_position9384_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACACAGGTAGCCGAACAGGTATTACTCAGACTGGAGAGGAATCTTCATTGGTCGTGCAGACATTGTCGCTGCGTACCAAAGTAACTGGACGCCCATACCC
->read2501_contig0_position8334_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTGAATGACCTTGGGCTCGTCGACATTCCTGGTAGTAATCCGATCTCAATTCCTGCGGTACCGAGCAGCTTTGAGTTTTTGTAAGTCCCACGGTTAATG
->read2502_contig0_position6393_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TACATGGCGGAATGCCTGTCCACCGGGGGTTCTACTGTACCACAGTGGCCTGGATAGCTAAGCAGGTCCTGGATTGGCATGTCATCCGGAGTGATAGGCA
->read2503_contig0_position7379_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAACACTTTCTGGTGCCACTCGAGACCGCCCTCCCCGACCCATATGCAGTTTCTGCATACACCGGGTAGACAACATTCTCAGCCCTTCGTTGAAAGGAG
->read2504_contig0_position2966_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GTATCCCGATTGCGCTCCCGAACAACGCGTGAGTTTAAAATTGACTTGAAACCGGCTAGCTCGGACCACCAAAGAGCAAGACTCTATGACTAGCGGGTGT
->read2505_contig0_position7838_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGACTGATTGACAATCCAGCCCGTTTGGGGTGATTTGTGCCGGCGCGTCCAGGTGCGAACGTTGTGCCGTGTCACTCTGTAGCTCTAATACCAATTGAAA
->read2506_contig0_position4714_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGATATCATCCTATCGGCGTTCAAAGTATTCGGCGGATGAATTAGATCCAAAGCAGTAGGTTACCGTCGGCGCATAACCGGCGAGTGCTCTGAAACGTTA
->read2507_contig0_position6965_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGAGCGTTCCGATTGTCCTCTCCCAGGCTACGGACTTATACCAAAGACTTCTAGACCGGAGAGACTACTTCCAGCCACGAATTCGTGTGATAACCGCCTA
->read2508_contig0_position8025_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTCATTCCCCCTCAGTTTTGTCCATGTGGAGAATATGCATTCGACCAAATGATAATGTCAATAATCTCGACCCTGTAGTCCGCGGCCAATCAGCACGAT
->read2509_contig0_position8975_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGACAGGGTTGAAAACCTGTCTGAAGTCCGTGCTTCGCTAACCAGCCTATGCGCCTTAACTTTATGCATACTCGTTTAGTACAGGGCCGCGCCCCATGAG
->read2510_contig0_position5202_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAAATTCGGAACATCTTAACCAAAGCATATTAATATGCCAGCCGCGCAGGGTGGTATATATGATCCTTGATAGCTTTATGGCCATCCTCATAGTAAATTT
->read2511_contig0_position7521_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGAAGCTAATAGTCATTGCGATGACGAGAACAGCCCTACTGCCCGCCGTGAACGAGAACAAGCGTGTGGAGAGTGACTGACAATCACGAGGAATTACGG
->read2512_contig0_position5566_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCCTTCGTCGGGCCGCTTATTGGTTCACCCAATCTGGCCATTGCAAGTTTGGCAGACGCGAGGTTGCGTGGTCAAACGAACGTTGCTTTCCTTAGGGTA
->read2513_contig0_position4621_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AACGCCAATTCCGCTAAATAGCGGAATCTGCTGGCTTGTGCATTCGTCGGTCTATTAGATACGGTACGGAATATTGGGTAACCTCCTCTTCACTGATATC
->read2514_contig0_position6677_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AAAGTAGTAGAACGAGGGTCGGGCGATTTGTTTTGGTAGTGGTTATCGCATTGCAGGAACGTACGGACGGAAAAAATGTCGGACACCGCCTTATCGGCTA
->read2515_contig0_position7627_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCCACTTGGAGTGTGCTGAGGGCCGACGCCCGGGGACCGTGATATCCTTGCGAGTGGAATGCGAAAACGGCATAAGCGCAATGACCGAGGTAACAAGCC
->read2516_contig0_position4591_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGCAGTGTCGGAGCGATAGGGAGGACGTAAACGACAATTCCGCTTAATAGCGGAATCTGCTGGGTTGTGCATTCGTCGGCCTATTAGATACGGTACGGA
->read2517_contig0_position909_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCGGAGTTCTTTCAGGCCGATCAAGTGGTTAGAGACCTAGGTCTATGCCAGACGATAGGAGCGGAGTCGATATAATTGCAGTATCATGTATCGCTGATT
->read2518_contig0_position2792_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCAGTTTGTTCCGGCAGGACACCACTCTTTGAAGGTGCCCATTGCATTGTAGCCTGAACTATTCGCAATCCTAAGCCCATAAGCCCTGCCCCACGGGGGC
->read2519_contig0_position2487_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCGCGAGGTAGAGTATGCAGATTTCGTACCTTGCCACTGCTACCTCCGGCTTATGGGCGTGCTATAAATGCGGGAGTCAGGACGATAGAGCGAAGTAGT
->read2520_contig0_position3431_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AACTCACCATATTGGTAGTACTGCCTGCCGTCGCCTCGCGCCCATAATGTTTGGAACTCGCAAACCTTTACACTCATCACATAGCAGGTTCCACCCGAAC
->read2521_contig0_position8602_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCTTCGGGCGTAGTTTTGCGTAAGACACTGCCTAAAGGGAACATATGTGTCCAGAATAGGGTTCAACGGTGTATGAGCAAACGATGCGGTAAGACGAGC
->read2522_contig0_position5769_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGGTTGTTTTCTGAATTGTGGCTATCTCAAATTGGGACCTAGTGTTGGCCAATATGCTTCATATCGCCTTCTCAGATAGACTAATAGAACGAAGTCCAT
->read2523_contig0_position2515_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCTTGCCACTGCTACCTCCGGCATATGGGCGTGCTATAAATTCGGGAGTCAGGACGATAGAGCGAAGTAGTTACGGTGATTACCCGTCCATCGATGCCC
->read2524_contig0_position139_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CAAGGCAACATTGCAGCGTCCGATGGTCCGGTGGCCTCCAGATAGTGTCCAGTCGCTCTAACTGTATGGAGACCATAGGCATTTACCTTATTCTCATCGC
->read2525_contig0_position5211_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AACATCTTAACCAAAGCATATTAATATGCCAGCCGCGCAGGGTGGTATATATGATCCTTGATAGCTTTATGGCCATCATCATAGTAAATTTTTTCAGATT
->read2526_contig0_position2171_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGCCACCCGATTTCAGCTTGGCCACAACAGAGACTAGCCACCTAGAGATGGGTTGATAGTGGCATCCCGGCTTCTGGGGCAATTCCTGACGATTCGAGT
->read2527_contig0_position5174_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTCGTTGTATTGATCGCTGTGCACTTTAAAATTCGGAACATCTGAACCAAAGCATATTAATATGCCAGCCGCGCAGGGTGGTATATATGATCCTTGATA
->read2528_contig0_position5706_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAAAGTTCAGAAGATCACTGTCCGCCTCGAACCACTACAATAAGATTACGGATAGCCCGTGGCTTGGTTGTTTTCTGAATTGTGGCTATCTCAAATTGGG
->read2529_contig0_position5889_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAAAATTGAACATCAACGGAAGTACTATAGCAGGCTCACCAGCATGAAAGACATCCTCATTGTGAACACGGCATCTCGTGATTCGAGCCTAACAGCATGC
->read2530_contig0_position1805_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTATGAGCAAGCATACAAGTTAGCCGGCCCACAAATCGACGTGTGTATTTGTTCAATGGCAGGAGGTTAACTTTGCGGAGCTCAACCTATAACGATAAT
->read2531_contig0_position2069_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCGAACCCGTCCGGCTAAGAGGCAGGCAGTCGCTGCATGTGTACGCAGCGGTCTATGCTACAGGTATTACGGAGTGAAACGGCTGCGAGCATCTCATAA
->read2532_contig0_position3872_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGAATCATCCGATCATGCAAACCTGATTATCTGCACGACTCTTAAAATCATGCACTAAGTATAGAATGCACGACTACTAGTTACTGAAGTCGGCATGAC
->read2533_contig0_position1090_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCTCCAGTTACGTCACGGACGTAGAGAGCCTTGGAATGTGTACGGCAATAGGAGAAACTCGGCCACGTACGTGTCAACATGGCGCGGCTCTCTATACCT
->read2534_contig0_position9470_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-GGATGCCCATACCCCTTTGTCTACAGAAGCTAATGGATAAGAGTGTGCGAATAACAGCACTTGTTACTTCACGGAACGCCTCTTGATCCTGAGCTCCCCC
->read2535_contig0_position9806_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGATTTTAGTAGGTCTACTACTAGGCCGCTTGCTCAGAAATCGGAACACAAGTACGCGACCTCTTTTCTAGTCACCAGCCTCAGGCATTCGCAAATTTC
->read2536_contig0_position7631_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTTGGAGTGTGCTGAGGGCCGACGCCCGGGGACCGTGATATCCTTGCGAGTGGAATGCGAAAACGGCATAAGCGCAATGACCGAGGTAACAAGCCATGA
->read2537_contig0_position3145_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCCGTCCGACTCTTGCGCTCGGATGTCCGCAATGGGTTATCAAATGCCTATGTTCCGGTAATCTCTCATCTACTAAGCGCCCTAAAGGTCGTATGGTTG
->read2538_contig0_position898_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTTCATGATCGTCGGAGTTCTTTCAGGCCGATCAAGTGGTTAGAGACCTAGGTCTATGCCAGACGATCGCAGCGGAGTCGATATAATTGCAGTTTCAAG
->read2539_contig0_position6117_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGACCCTTACAGCGTTATCCGTCCCGAACTGGCTTGAGCCACTCATAAGGCACGCGCGGGCCATAACAGTCGACTAAAAGGCGTAACCGATTCTGCTAC
->read2540_contig0_position5865_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCATATAACAGCTGATTTAAGAGGAAAAATTGAACATCAACGGAAGTACTATAGCAGGCTCACCAGCATGAAAGACATCCTCATTGTGAACCCGGCATCT
->read2541_contig0_position7261_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAATACATATCCCGACACCGGCAGCTGAAATGATGCAGAAGCCTTGCTTGCCACTCCGCCGATGTCTAAAAGCGCCAGATCGACTTGACTCTACGTGCTG
->read2542_contig0_position9655_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GATGCTCGTACTCGAAGGGGGAATCACCTTACTTAATCGGCTCGGGTAACGGCTGGTTTTGTACTACGGTATGGGAACCCGTTTGCCGAACGTCTGGAAA
->read2543_contig0_position3948_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTTGTTACTGAAGTCGGCATGACTATCAAACCTATTTAATGATATATGCTCTTGGACAACACGAGGTCGTAATTATTTCCTGAGATGGTTTTAGTGAGA
->read2544_contig0_position779_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTGTGGTCAACCTGGACGCACAAACCCTAGTCCCATATAAAGCTATTCCACGCCGGGTGGCCTGGACGTCGTTTGTGGATGGCTTTGGGAATCACTAGG
->read2545_contig0_position494_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCTACGCCTCGATTGGTTTCAGCTCACGTGGGACGCATGTACTTACCTAACATGAAGCGGTAATGGAGCTCGAACACTAGTCGGTGGCTCTTCTGTCTC
->read2546_contig0_position738_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTAACCGCGACGGTGTATTCCACGACCTAATTTTTCCCGTCTCTGTGGTCAACCTGGACGCACAAACCCTAGTCGCATATAAAGCTATTCCACGCCGGGT
->read2547_contig0_position1853_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTGTTCAATGGCAGGAGGTTAACTTTGCGGAGCTCAACCTATAACGATATTCAAATTGAGACAGACGAGTTGGAGTGTTTTGATGAGCGGTGTTATATT
->read2548_contig0_position4238_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCAGTACAGGTACGACCATACGCGACGGCAAACAGAATCGCACGTCAACTATCCCCTTTATTAATGATCCGTGTCCCCCGACGGTGTGCTGAGGAGACC
->read2549_contig0_position4490_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGACATAACTACTGAGTGTCCGCCCTCGGCTAATCATGAACACCGGTCAGGCATGCTTACCTCCTGTGACGGCATTGGCGATTATGGGGGTGCATAGAGT
->read2550_contig0_position1043_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTACCGCAAAGGGCCTGTATGACCCTGGTTACGCGTTATTACCGGTCAGCTCCAGTTACGTCACGGACGTAGAGAGCCTTTGAATGTGTACGGCAATAGG
->read2551_contig0_position969_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCGGAGTCGATATAATTGCAGTATCATGTATCGCTGATTGTGGAGGGCATGGGGGTTCCGCATTGGCGCAAAGGTACCGCAAAGGGCCTGTATGACCCT
->read2552_contig0_position3809_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCCCTTTGTTATTCTAGTCAAGTGAAGAACCCGGGCCCAAAATTGGAACCCGTAATCTTCAAGTGAATCATCCGATCATGCAAACCTGATTATCTGCAC
->read2553_contig0_position7909_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCACTCTGTAGCTCTAATACCAATTGAAATGAAGCTTACGCAAACTACTCGACGAACAACAGCAAGATTCGACGATCAAACTCGCCGGCGACACGGAGAT
->read2554_contig0_position286_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AACGCGTGTCATCTAGTTCTAGCATACTCCGCCTTGGGCCACACAATTAATATAAGACGGGATAATGGCTTCATGCTCATGTTCTATACCGAGCAGAGAG
->read2555_contig0_position5038_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTATACAGCGCCACATCCGCCAATTCGCTAGGTTGTAGCCAGGAAGTCTGTAGTACAGGTGCCCATAACCCGATGAGGCCAAGGTGTTACGTGAAGTCG
->read2556_contig0_position5701_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTACTTAAAGTTCAGAAGATCACTGTCCGCCTCGAACCACTACAATAAGATTACGGATAGCCCGTGGTTTGGTTGTTTTCTGAATGGTGGCTATCTCAAA
->read2557_contig0_position8058_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATATGCATTCGACCAAATGAAAATGTCAATAATCTCGACCCTGTAGTCCGCGGCCAATCAGCACGATCAAGCTAAAGACAGGGATTATGCACTAGCACGA
->read2558_contig0_position6395_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CATGGCGGAATGCCTGTCCACCGGGGGTTCTACTGTACCACAGTGGCCTGGATAGCTAAGCATGTCCTGGATTGGCATGTCATCCGGAGTGATAGGCACT
->read2559_contig0_position5556_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTAATCGACTGCCTTCGTCGGGCCGCTTATTGGTTCACCCAATCTGGCCATTGCAAGTTTGGCAGACGCGAGGTTGCGTGGTCAACCGAACGTTGCTTT
->read2560_contig0_position289_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGTGTCATCTAGTTCTAGCATACTCCGCCTTGGGCCACACAATTAATATAAGACGGGATAATGGCTTCATGCTCATGTTCTATACCGAGCAGAGAGCTT
->read2561_contig0_position2166_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAATCGGGCCACCCGATTTCAGCTTGGCCACAACAGAGACTAGCCACCAAGAGATGGGTTGATGGTAGCATCCCGGCTTCTGGGGCAATTTCTGACGATT
->read2562_contig0_position4414_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GATAAAGAAAACAATCTATATGGAACCGAGGGGCGGGATGATAATTGTTCTTAGAATAGTGACCGTTATGGACGACGGACATCACTACTGAGTGTCCGCC
->read2563_contig0_position4081_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTACTATAAATCAGCGAATCTAACATCAATCTGCACCACGAATATCGTCCAAGACGTTTTGAGCCGGTGACTAATTCGGTTGTCGCACATAGTGTACGT
->read2564_contig0_position608_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGTGAGTTCATAAATCTCAATGTCGAAACTCCGATGGGCAGAAGCTAAAACTGAACAACGAGTGGGACACCGGCCTACTACATTATACAGTAAGGTAGA
->read2565_contig0_position9684_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TACTTAATCGGCTGGGGTAACGGCTGGTTTTGTACTACGGTATGGGCACCCGTTTGCCGAACGTCCGGAAATCTGTCGAGTCATATCGATGAACAGAGAC
->read2566_contig0_position1891_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTATAACGATAATCAAATTGAGACAGACGAGTTGGAGTGTTTTGATGAGCGGTGTTATATTTGTCCTAACTTAGCACTATCGCACCACAAAATTTCAGC
->read2567_contig0_position3679_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGTAGATTGTCTGAATATCGTGCAGTAAGTTTCTCTTAGGTTCCTCAACGGAAACGTCTCAGACCCACCTTAGACGCGGGAATAAATTCGACACGGGGTA
->read2568_contig0_position4312_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCCCCGACCGTGTGCTGAGGAGACCCGTAATGCATGGAAAGTGCCAATATCCCCGGGAGTCCCGCGCTACTGAGACGAAGTCTAGCTAGCTTGACTCGG
->read2569_contig0_position1288_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTATATTCCCTCCTGCGTAGTGGTCTCCCATAATAAGTGAACCCATGGGTCGCGCTGTATTTTTGTACGGCTTGATGTCAGGGTCAGTTTGGGCGCCGG
->read2570_contig0_position1101_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGTCACGGACGTAGAGAGCCTTTGAATGTGTACGGCAATAGGAGAAACTCGGCCACGTACGTGTCAACATGGCGCGGCTCTCTATACCTCGCAAAGAATC
->read2571_contig0_position3572_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTTATACGCCCTCGGGAGAAGACCCATGTAAGATGTATCCATCTCTATCACACGCGTCCGCCACCTCCGGGTCTAGTAAACCAGAGATTCCATGGACTC
->read2572_contig0_position9607_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTGGTCATGTCATTATTGTACATCAGTACCATAGCTTGGCCACATGTGATGCTCGTACTCGAAGGGGGAATCACCTTACTTAATCGGCTGGGGTAACGG
->read2573_contig0_position9649_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACATGTGATGCTCGTACTCGAAGGGGGAATCACCTTACTTAATCGGCTGGGGTAACGGCTGGTTTTGTACTACGGTATGGGAACCCGTTTGCCGAACGTC
->read2574_contig0_position8600_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAGCTTCGGGCGTATTTTTGCGTAAGACACTGCCTAAAGGGAACATATGTGTCCAGAATAGGGTTCAACGGTGTATGAGCAAACGATGCGGTAAGACGA
->read2575_contig0_position67_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GACGGTGACCAGGGCCGTTCGGCGTTGCATCGAGCGGTGTCGCTAGCGCAATGCGCAAGATTTTGACATTTACAAGGCAACATTGCAGCGTCCGATGGTC
->read2576_contig0_position763_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGAATTTTTCCCGTCTCTGTGGTCAACCTGGACGCACAAACCCTAGTCCCATATAAAGCTATTCCACGCCGGGTGGCCTGGACGTCGTTTGTGGATGGC
->read2577_contig0_position4553_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGCGACGGCATTGGCGATTATGGGCGTGCATAGAGTCCCGCAGTGTCGGAGCGATAGGGAGGCCGTAAACGCCAATTCCGCTTAATAGCGGATTCTGCT
->read2578_contig0_position793_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGACGCACAAACCCTAGTCCCAAATAAAGCTATTCCACGCCGGGTGGCCTGGACGTCGTTTGTGGATGGCTTTGGGAATCACTAGGTAATTACTGTTGGC
->read2579_contig0_position3189_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGCCTATGTTCCGGTAATCTCTCATCTACTAAGCGCCCTAAAGGTCGTATGGTTGGAGGGCGGTTACTCACCCTTAAGTACCGAACGATAGAGCACCCG
->read2580_contig0_position1941_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGTGTTATATTTGCCCTAACTTAGCACTATCGCACCACAAAATTTCAGCATAAAGCATCCGGTTGAAGGCTGCGCATCGAGCAGCGTGCATTGGTCTTT
->read2581_contig0_position7205_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCGGGTTGGCCAAAAATTCTACCTGTCCACCTGTCCGCTAGAAGCAGATTATACGGAATACATATCCCGACACCGGCAGCTGAAATGATGCAGAAGCCT
->read2582_contig0_position2861_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTAAGCCCATAAGCCCTGCCCCACGGGGGTTACAATCCAGCAGTGAACGCGTTTACCTTAAGACGAAAGAGTCGGTAGAGTTGGGGTTCGTGCTTTAAT
->read2583_contig0_position5855_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGAACGAAGTCCATATAACAGCTGATTTAAGAGGAAAAATTGAACATCAACGGAAGTACTATAGCAGGCTCACCAGCATGAAAGACATCCTCATTGTGAA
->read2584_contig0_position3368_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCAGCAGTACGCCTCCAATCTCTCCGACGTTCATTCTCAAGGGTGTAGTTTTAGAGACTGAGAACTCACCCTATTGGTAGTACTGCCTGCCGTCGCCTC
->read2585_contig0_position3687_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCTGAATATCGTGCAGTAAGTTTCTCTTAGGTTCCTCAACGGAAACGTCTCAGACCCACCTTATACGCGGGAATAAATTCGACACGGGGTACGAAGGGT
->read2586_contig0_position7726_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CATGAGGACTGGAGCGGTAATGTGGTAGTGTAGTTGCCGGCCCCTGTGCTGACCTTATGTCCATATCGATACACGAAGGCCAGTGCGGAAGCGGAGCCAC
->read2587_contig0_position7358_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGCAATGGAGAACCGCGGAAGGAACACTTTCTGGTGCCACTCGAGACCGCCCTCCCCGACCCATATGCAGTTTCTTCATACACCGGGTAGACAACATTC
->read2588_contig0_position8060_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGCATTCGACCAAATGAAAATGTCAATAATCTCGACCCTGTAGTCCGCGGCCAATCAGCACGATCAAGCTAAAGACAGGGATTATGCACTAGCACGACC
->read2589_contig0_position6688_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGAGGGTCGGGCGATTTGTTTTGGTAGTGGTTATCGCATTGCAAGAACGTAGGGACGGACAAAATGTCGGACACCGCCTTATCGGCTATACTAGTTAGA
->read2590_contig0_position4691_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATATTGGGTAACCTCCTCTTCACTGATATCATCCTATCGGCGTTCAAAGTATTCGGCGGATGAATTAGAGCCAAAGCAGTAGGTTACCGTCGGCGCATAA
->read2591_contig0_position3133_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCTGAATGTTATGCCGTCCGACTCTTGCGCTCGGATGTCCGCAATGGGCTATCAAATGCCTATGTTCCGGTAATCTCTCATCTACTAAGCGCCCTAAAG
->read2592_contig0_position5777_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTCTGAATTGTGGCTATCTCAAATTGGGACCTAGTGTTGGCCAATAAGCTTCATATCGCCTTCTCAGATAGACTAATAGAACGAAGTCCATATAACAGA
->read2593_contig0_position4541_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CATGCTTACCTCCTGCGACGGCATTGGCGATTATGGGCGTGAATAGAGTCCCGCAGTGTCGGAGCGATAGGGAGGACGTAAACGCCAATTCCGCTTAATA
->read2594_contig0_position8680_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CAAACGATGCGGTAAGACGAGCGCTCCGACCCCCCTTGGCTCTGCTACATCGAATTCAGCATGTAAGTGCCCGCTTATCCGGTGGTGATACGTACTATTG
->read2595_contig0_position5730_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTCGAACCGCTACAATAAGATTACGGATACCCCGTGGCTTGGTTGTTTTCTGAATTGTGGCTATCTCTAATTGGGACCTAGTGTTGGCCAATAAGCTTC
->read2596_contig0_position2618_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGTCCCGAAGCCTTAAAATCTAACCCTGAATTGGCTTTATCCACCCCCCCTACTGGCCACCACTGGGGCGCGAGTCTCGAGCCTCTCGACTCCAAAGGG
->read2597_contig0_position1135_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GCAATAGGAGAAACTCGGCCTCGTACGTGTCAACATGGCGCGGCTCTCTATACCTCGCAAAGAATCACTCTATGGGTCATCTTGAGAGAATAGTCGAATA
->read2598_contig0_position2813_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCACTCTTTGAAGGTGCCCATTGCATTGTAGCCTGAACTATTAGCAATCCTAAGCCCATAAGCCCTGCCCCACGGGGGCTACAATCCAGCAGTGAACGCG
->read2599_contig0_position7696_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTATAAGCGCAATAACCGAGGTAACAAGCCATGAGGACTGGAGCGGTAATGTGGTAGTGTAGTTGCCGGCCCCTGTGCTGACCTTTTGTCCATATCGAT
->read2600_contig0_position5098_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCCCATAACCCGATGAGGCCAAGGTGTTACGTGAAGTCGCGTTGTCGCTACTAACAGATTGGGAGGTCTCGGCAAATTCGTTGTATTGATCGCTGTGCA
->read2601_contig0_position6910_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGCATCTTCCTATTTTATGGTCTTAATTGAGTGTTCAGAGTTGGGGGTCACAGATGAGCGTTCCGATTGTCCTTTCCCAGGCTACGGCCTTAGACCAAA
->read2602_contig0_position8109_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCCAATCAGCACGATCAAGCTAAAGACAGGGATTATGCACTAGCACGACCGCCGCAGGAAAGATCCGAGGCCTTTTCCAGGGTAAAATGATGGACTCAT
->read2603_contig0_position3520_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCACCCGAACCGCGCGTATTCTGCGACAGCATGAATCGTGTAACTCTGCTCGGTTATACGCCCTCGGGAGAAGACCCATGTAAGATGTATCCATCCCTA
->read2604_contig0_position9134_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGACAGACCGAAGCCCACCTGTCCTGACCTCACCGCAGGCATCGAGTCTAACTCTGATTCGAGAGACGGATGTAATTTAGTCAGGTCGGAACCGCTGGCA
->read2605_contig0_position4459_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTTCTTAGTATAGTGACCGTTATGGACGACGGACATAACTACTGAGTGTCCGCCCTCGGCTAATCATGAACACCGGTCAGGCATGCTTACCTCCTGCGA
->read2606_contig0_position9791_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTTAAATCTCTAACACGATTTTAGTAGGTCTACTACTAGGCCGCTTGCTCAGAAATCGGAACACAAGTACGCGATCTCTTTTCTAGTCACCAGCCTCAG
->read2607_contig0_position7520_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGAGAAGCTAACAGTCATTGCGATGACGACAACAGCCCTACTGCCCGCCGTGAACGTGAACAAGCGTGTGGAGAGTGACTGACTATCACGAGGAATTACG
->read2608_contig0_position7940_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGCTTACGCAAACTACTCGACGAACAACAGCAAGATTCGACGATCAAACTCGCCGGCGACACGAAGATTGTCATACTAGCTTTCAGTCATTCCCCCTCA
->read2609_contig0_position8191_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTAAAATGATGGACTCATTGACCGACCCCTATTATTACGAGAGGGCTGCGACTGCTTGCAGCTCCGACCGCTTTCCAATCGTTGCACATGACTTGAGGCT
->read2610_contig0_position1370_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTCAGTTTGGGCGCCGGTACGTCTGTGTAAGGTTGGGCCAATCGAGAGGACATTTCGCAGCGCCCTTTCATCTCTATAGCTAGGTCTCTTAAGCCTAAT
->read2611_contig0_position7359_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCAATGGAGAACCGCGGAAGGAACACTTTCTGGTGCCACTCGAGACCGCCCTCCCCGACCCATATGCAGTTTCTGCATACACCGGGTAGACAACATTCT
->read2612_contig0_position5109_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGATGAGGCCAAGGTGTTACGTGAAGTCGCGTTGTCGCTAGTAACAGATTGGGAGGTCTCGGCCAATTCGTTGTATTGATCGCTGTGCACTTTAAAATTC
->read2613_contig0_position2138_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGGAGTGAAACGGCTGCGAGCATCTCATAATCGGGCCACCCGATTTCAGCTTGTCCACAACAGAGACTAGCCACCAAGAGATGGGTTGATGTTAGCTTC
->read2614_contig0_position5227_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CATATTAATATGCCAGCCGCGCAGGGCGGTATATATGATCCTTGATAGCTTTATGGCCATCATCATAGTAAATTTTTTCAGATTACCCTGCAGACGTCCG
->read2615_contig0_position4051_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCAGATGCACTCTTAGCTCCGCTGATAACGATTACTATAAATCAGCGAATCTAACATCAATCTGCACCACGAATATCGTCCAAGACGTTTTGAGCCGGTG
->read2616_contig0_position7961_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CGAACAACAGCAAGATTCGAAGATCAAACTCGCCGGCGACACGAAGATTGTAATACTAGCTTTCAGTCATTCCCCCTCAGTTTCGTCCATGTGGAGAATA
->read2617_contig0_position6197_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCGTAATCGATTCTGCTACGTTATAAAAAAGGGACGAGTGGGGTCAACAGTTCTTCTTCTTTCCTGTACGGTAATGCTTCCGCGCATCTAAGTGATATT
->read2618_contig0_position8686_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGCGGTAAGACGAGCGCTCCGACCCCCCTTGGCGCTGCTACATCGAATTCAGCGTGTAAGAGCCCGCTTATCCGGTGGTGATACCTACTATTGACTGGG
->read2619_contig0_position7182_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCGGTTAATTAAATGTCCGTCAATCGGGTTGGCCAAAAATTCTACCCGTCCACCTGTCCGCTAGAAGCAGATTATACGGAATACATATCCCGACACCGG
->read2620_contig0_position528_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGAATGTACTTACCTAACATGAAGCGGTAATGGAGCTCGAACACTAGTCGGTGGCTCTTCTGTCTCTGGCGGGGACGGCTATGTGAGTTCATAAATCTCA
->read2621_contig0_position7898_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTGTGCCGTGTCACTCTGTAGCTCTAGTACCAATTGAAATGAAGCTTACGCAAACTACTCGACGAACAACAGCAAGATTCGACGATCAAACTCGCCGGC
->read2622_contig0_position6047_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCCGTCGACTGAATGTGATTCCTTTGTTATTTCACACTATTGTTCGGTGCGTGCGCTGCTCAGGCTGGTGCGACCCTGACAGCGTTATCCGTCCCGAAC
->read2623_contig0_position7842_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-TGATTGACAATCCAGCCCGTTTGGGCTGATTTGTGCCGGCGCGTCCAGTTGCGAACGTCGTGCCGTGTCACTCTGTGGCTCTAATACCAATTGAAATGAA
->read2624_contig0_position2532_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCGGCATATGGGCGTGCTATAAATGCGGGAGTCAGGACGATAGAGCGAAGTAGTTACGGTGATTACCCGTCCATCGATGCCCCTCCTGTCCCGAAGCCT
->read2625_contig0_position8478_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTACGGCCAATGCACGACCCTATATGACCCCTAGCGAGAAGTTATAGTCTAATAATGAATGGTGAACAGCACATCTTTTCGTCCTGAGGCCATATTAAT
->read2626_contig0_position2271_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GACCAGCGATAGTACGTTCCTTTTGTACTGAGTCTTAACATCGGCAAATGCGCCCTAGATACCTGCGGCTTCACTCCACAGTGTAAGAGTTGACGGGACT
->read2627_contig0_position3856_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AACCCGTAATCTTCAAGTGAATCATCCGATCATGCAAACCTGATTATGTGCACGACTCTTAAAATCATGCACTAAGCAGAGAATGCACGACTACTTGTTA
->read2628_contig0_position6235_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGGGGTCAACAGTTCTTCTTCTTTCCTGTACGGTAATGCTTCCGCGCATCTAAGTGATATTCGCCGGAATTTACCCTTCTAATATTGTGTGCAAGCTAC
->read2629_contig0_position1674_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTGAGCGGTGGTTTATCTGTTGAGTGGCCACTTTTCCCTATCTGCTGGGACGGCAGTGGAGATCTGGAACAATAGATAGGATATAAAAGAAATACGGTT
->read2630_contig0_position6276_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCGCGCATCTAAGTGATATTCGCCGGAATTTACCCTTCTAATATTGTGTGCAAGCTACTTCTAGACCTTATTAAGTGCCCAGGAATTCCTAGGAAGGCG
->read2631_contig0_position6868_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ACATTTAACCCTTAGTCATAAGATGATACTTCATCTGCATGCGCGCATCTTCCTATTTTATGTTCTTAATTGAGTGTTCATAGTTGGGGGTCACAGATGA
->read2632_contig0_position5571_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGTCGGGCCGCTTATTGCTTCACCCAATCTGACCATTGCAAGTTTGGCAGACGCGAGGTGGCGTGGTCAACCGAACGTTGCTTTCCTTAGGGTACCGAG
->read2633_contig0_position5123_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTTACGTGAAGTCGCGTTGTCGCTAGTAACAGATTGGGAGGTCTCGCCCAACTCGTTGTATTGATCGATGTGCACTTTAAAATTCGGAACATCTTAACC
->read2634_contig0_position7479_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGACAAATGACGGGAACTCTGACGAGAGGGTGCTTGAACGAGAGAAGCTAACAGTCATTGCGATGACGAGAACAGCCCTACTGCCCGCCGTGAACGAGA
->read2635_contig0_position6010_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGTGTTCCCTCAACACGTACGTTGACAGAGATAACAATCCGTCGACTGAATGTGATTCCTTTGTTATTTCACACTATTGTTCGGTGCGTGCGCTGCTCA
->read2636_contig0_position6464_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GATTGGCATGTCATCCGGAGTGATAGGCACTGCTCACGACCAGCTTGCGGACAAACGGGGTGCCCGCGCCTGCATCCGGTAGACGAGCGATGGATTTAGA
->read2637_contig0_position2307_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AACATCGGCAAATGCGCCCTAGATACCTGCGGCTTCACTCCACAGTGTAAGAGTTGACGGGACTAAAACAGTATTGGGCGGTGAGGGGTACCCGACGCCT
->read2638_contig0_position6330_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTACTTCTAGACCTTATTAAGTGCCCAGGAATTCCTAGGAAGGCGCGCAGCTCAAGCAATCATACATGGCGGAATGCCTGTCCACCGGGGGTTCTACTG
->read2639_contig0_position127_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTTGCCAGTTACAAGGCAACATTGCAGCGTCCGATGGTCCGGTGGCCTCCAGATAGTGTCCAGTCGCTCTAACTGTATGGAGACCATAGGCATTTACCT
->read2640_contig0_position5181_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTATTGATCGCTGTGCCCTTTAAAATTCGGAACATCTTAACCAAAGAATATTAATATGCCAGCCGCGCAGGGTGGTATATATGATCCTTGATAGCTTTAT
->read2641_contig0_position9204_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTAATTTAGTCAGGTCGGAACCGCTGGCAGAGCAGCTCCGAGGGCCTTTATACCCATACTGCCACTCCAGTACCTGGGCCGCGTGTTGTACGCTGTGTA
->read2642_contig0_position3452_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCCTGCCGTCGCCTCGCGCCCATAATGTTTGGAACTCGCAAACCTTTACACTCATCACATAGCAGGTTCTACCCGAACCGCGCGTATTCTGCGACAGCA
->read2643_contig0_position7542_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGACAAGAACAGCCCTACTGCCCGCCGTGAACGAGAACATGCGTGTGGAGAGTGACTGACTATCACGAGGAATTACGGATAACAGCCCACTTTGAGTGT
->read2644_contig0_position7172_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCGCGCCCCATCGGTTAATTCAATGTCCGTCAATGGGGTTGGCCAAAAATTCCACCTGTCCACCTGTCCGCTAGAAGCAGATTATACGGAATACATATC
->read2645_contig0_position485_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTGTCCTCTGCTACGCCTCGATTGGTTTCAGCTCACGTGGGACGCATGTACTAACCTAACATGAAGCGGTAATGGAGCTCGAACACTAGTCGGTGGGTC
->read2646_contig0_position9554_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GATCCTGAGCTCCCGCGCGATTAACCTATGTCGGGACAAACACTCGATTGAGCAGTGGTCATGTCATTATTGTACATCAGTACCATAGCTTGGCCACATG
->read2647_contig0_position9464_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTAACTGGACGCCCATACCCCTTTGTCTACAGAAGCTCATGGATAAGAGTGTCCGAATAACATCACTTGTTACTTCACGGAACGCTTCTTGATCCTGAGC
->read2648_contig0_position5013_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGAGTACAGTACTAACGGTCTGGCCTTATACAGCGCCACATCCGCCAATTCGCTAGGATGTAGCCAGGAAGTCTGTAGTACAGGTGCCCATAACCCGAT
->read2649_contig0_position612_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGTTCATAAATCTCAATGTCGAAACTCCGATGGGCAGAAGCTAAAACTGAACAACGAGTGGGACACCGGCCTACTACATTATACAGTAAGGTAGAATCG
->read2650_contig0_position8877_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCTAAGAAACCGGTGCATCACCGTACGAAAAGGATGGTTGAAATAGAACGAGTTGTAAAACATTAGCTCACGCGCCACCGTCATAGGCTGCATATTGAG
->read2651_contig0_position7270_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCCGACACCGGCAGCTGAAATGATGCAGAAGCCTTGCTTGCCACTCCGCCGATGTCTAAAAGCGCCAGATCGACTTGACTCTACGTGCCGCAATGGAGA
->read2652_contig0_position4261_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGACGGCAAACAGAATCGCACGTCAACTATCCCCTTTATTAATGATCCGTGTCCCCCGACCGTGTGCTGAGGAGACCCGTAATGCATGGAAAGTGCCAAT
->read2653_contig0_position3655_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGAGATTCCATGGACTCTCTGTTTCGTCGATTGTCTGAATATCGTGCAGTAAGTTTCTCTTAGGTTCCTCAACGGAAACGTCTCAGACCCACCTTAGACG
->read2654_contig0_position4263_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGGCAAACAGAATCGCACGTCAACTATCCCCTTTATTAATGATCCGTGTCCCCCGACCGTGTGCTGAGGAGACCCGTAATGCATGGAAAGTGCCAATAT
->read2655_contig0_position7553_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCCCTACTGCCCGCCGTGAACGAGAACAAGCGTGTGGAGAGTGACTGACTATCACGAGGAATTACGGATAACAGCCCACTTGGAATGTGCTGAGGGCCG
->read2656_contig0_position1504_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGGGCGAGGTATAAATTAGTGGATTCACTTCCCTTTGACATCTTGTTCTCACAACTGCAAACTCCGATGCTCTGCCGAGCCTTCTAACCATCGGGTATG
->read2657_contig0_position7062_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTAAACAGTCTAATCTGGCCAATATACCCTGGGGGGAGCTAGTATATCGCGGCGTCGAGTTACCGTTGCACCACCTCCAAGGGTCCATCGGAGTCCGCTT
->read2658_contig0_position7064_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAACAGTCTAATCTGGCCAATATACCCTGAGGGGAGCTAATATATCGCGGCGTCGAGTTACCGTTGCACCACCTCCAAGTGTCCATCGGAGTCCGCTTCC
->read2659_contig0_position5266_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTTGATAGCTTTATGGCCATCATCATAGTAAAGTTTTTCAGATTACCCTGCAAACGTCCGCCTAAGATCCTAGTTGAAGTGATTAATTGAGTCCAGTAC
->read2660_contig0_position2321_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCCCTAGATACCTGCGGCTTCACTCCACAGTGTAAGAGTTGACGGGACTAAAACAGTATTGGGCGGTGAGGGGTACCCGACGCCTCTGCTGTCAAAGTG
->read2661_contig0_position3717_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTTCCTCAACGGAAACGTCTCAGACCCACCTTAGACGCGGGAATAAATTCGACACGGGGTACGAAGGGTAAGAACACCTAGCCTGGCAATTACCCCTTT
->read2662_contig0_position1618_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GACGCTTCGATAGGACATGCACCCGGTCCGTTGACTTACCAACTTGATCGCCAGTGAGTGAGCGGTGGTTTATCTGTTGAGTGGCCACTTTTCCCTATCT
->read2663_contig0_position2327_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGATACCTGCGGCTTCACTCCACAGTGTAAGAGTTGACGGGACTAAAACAGTATTGGGCGGTGAGGGGTACCCGACGCCTCGGCTGTCAAAGTGGGAAAT
->read2664_contig0_position6204_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGATTCTGCTACGTTTTAAAAAAGGGACGAGTGGGGTCAACAGTTCTTCTTCTTTCCTGTACGGTAATGCTTCCGCGCATCTAAGTGATATTCGCCGGA
->read2665_contig0_position9241_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCGAGGGCCTTTATACCCACACTGCCACTCCAGTACCTGGGCCGCGTGTTGTACGCTGTGTATCCTGAGAGCGTTTCTCCGTATCGAAATGTTCCGCTG
->read2666_contig0_position150_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCAGCGTCCGATGGTCCGGTGGCCTCCAGATAGTGTCCAGTCGCTCTAAGTGTATGGAGACCATAGGCATTTACCTTATTCTCATCGCCACGCCCCAAG
->read2667_contig0_position3320_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAATGGTCACGGCCTCTCTGGGAAAGCTGAACAACGGATGGGATTAAGCTCAGCAGTCCGCCTCCAATCTCTCCGACGTTCATTCTCAAGGGTGTAGTTT
->read2668_contig0_position9089_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCACGGGCATGCTGAAAGCGGCGGTTACATTAATCGCTTCTGTGATGACAGACCGAAGCCCACCTGTCCTGACCTCACCGCAGGCATCGAGTCTAACTCT
->read2669_contig0_position5240_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGCCGCGCAGGGTGCTATATATGATCCTTGATAGCTTTATGGCCATCATCATAGTAAATTTTTTCAGATTACCCTGCAGACGTCCGCCTAAGATCCTAG
->read2670_contig0_position3644_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTAGTAAACCAGAGATTCCATGGACTCTCTGTTTCGTCGATTGTCTGAATATCGTGCAGTAAGTTTCTCTTTGGTTCCTCAACGGAAACGTCTCAGACC
->read2671_contig0_position7643_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGAGGGCCGACGCCCGGGGACCGTGATATCCTTGCGAGTGGAATGCGAAAACGGCATAAGCGCAATGACCGAGGTAACACGCCATGAGGACTGGAGCGG
->read2672_contig0_position6607_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTAAGCAGCGACTCCACATGGAGCGATGGGTCCTCAAGGAAGTATAAAATGGACTGCTATCTAGGCGTTAAAGTAGTAGAACGAGGGTCGGGCGATTTG
->read2673_contig0_position502_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCGATTGGTTTCAGCTCACGTGGGACGCATGTACTTACCTAACATGAAGCGGTAATGGAGCTTGAACACTAGTCGGTGGCTCTTCTGTCTCTGGCGGGG
->read2674_contig0_position7216_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAAAAATTCTACCTGTCCACCTGTCCGCTAGAATCAGATTATACGGAATACATATCCCGACACCGGCAGCTGAAATGATGCAGAAGCCTTGCTTGCCACT
->read2675_contig0_position2414_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CAAAGTGGGAAATCCAGTCTCGACTATATCTACTATGTCATGCTTGTCGAATGAACAACTCAATTAGGTAGTGTGCGCGAGGTAGAGTATGCAGATTTCG
->read2676_contig0_position4909_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTACCGTCCATGACGTTGTGACATAAAGGTGCGGGACGCGGAAGCGCACCTCGTATAACGTTAGGGGTATCGTCACTGCATAGCAGAATGGGCGATCGGC
->read2677_contig0_position9114_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TACATTAATCGCTTCTGTGATGACAGACCGAAGCCCACCTGTCCTGACCTCACCGCAGGCATCGAGTCTAACTCTGATTCGAGAGACGGATGTAATTTAG
->read2678_contig0_position9430_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTGGTCGTGCAGACATTGTCGCTGCGTACCAAAGTAACTGGACGCTCATACCCCTTTGTCTACAGAAGCTCATGGATAAGAGTGTGCGAATAACATCAC
->read2679_contig0_position3055_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTAGCGGGTGTCGTCAATGAAAACTGATCGAGCACTGTCCGCGAAACATTATTCAGTACAGCGACTTTTACCCTCGTGGTCTGAATGTTATGCCGTCCGA
->read2680_contig0_position691_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTATACAGTAAGGTAGAATCGCGTAGAAGCACCCACGATCAATGTTATTAAACGCGACGGTGTATTCCACGACCTAATTTTTCCCGTCTCTGTGGTCAAC
->read2681_contig0_position4723_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTATCGGCGTTCAAAGTATTCGGCGGATGAATTAGAGCCAAAGCAGTAGGTTACCGTCGGCGCATAACCGGCGAGTGCTCTGAAACGTTACATTCGTCT
->read2682_contig0_position4211_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTATCGATATTCAGACTCTAACAAGTGGTCAGTACAGGTTCGACCATACGCGACGGCAAACAGAATCGCACGTCAACTATCCCCTTTATTAATGATCCGT
->read2683_contig0_position1606_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CATTCACCTTCGGACGCTTCGATAGGACATGCACCCGGTCCGTTGACTTACCAACTTGATCGCCAGTGAGTGAGCGGTGGTTTATCTGTTGAGTGGCCAC
->read2684_contig0_position8120_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGATCAAGCTAAGGACAGGGATTATGCACTAGCACGACCGCCGCAGGAAAGATCCGAGGCCTTTTCCAGGCTAAAATCATGGACTCATTGACCAACCCC
->read2685_contig0_position4846_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGTCCCACAGTGTTTTATACGGGACGGTGGCCACGGGGTGAGCACATGAATGGGGTACGGTTTTACCGTCCATGACGTTGTGACATAATGGTGCGGGAC
->read2686_contig0_position7721_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CAAGCCATGAGGACTGGAGCGGTAATGTGGTAGTGTAGTTGCCGGCCCCTGTGCTGACCTTATGTCCATATCGATACACGAAGGCCAGTGCGGAAGCGGA
->read2687_contig0_position6759_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACACCGCCTTATCGGCTATACTAGTTAGAGCCTCGCTTGGGGCTCTACATCCGCTGATACGCGCGAGCTCTCACCCACGACTGTACCCCGGTTAAGATTT
->read2688_contig0_position1550_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCTCACAACTGCACACTCCGATGCTCTGCCGAGCCTTCTAACCATCGGGTATGTACATTCACCTTTGGACGCTTCGATAGGACATGCACCCGGTCCGTT
->read2689_contig0_position4025_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCCTGAGATGGTTTTAGTGAGAGCAGCAGATGCACTCTTATCTCCGCTGATAACGATTACTATAAATCAGCGAATCTAACATCAATCTGCACCACGAAT
->read2690_contig0_position2626_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGCCTTAAAATCTAACCCTGAATTGGCTTTATCCACCCCCCCGACTGGCCACCACTGGGGCGCGAGTCTTGAGCCTCTCGACTCCAAAGGGTCTGCCCG
->read2691_contig0_position2552_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAAATGCGGGAGTCAGGACGATAGAGCGAAGTAGTTACGGTGATTACCCGTCCATTGATGCCCCTCCTGTCCCGAAGCCTTAAAATCTAACCCTGAATTG
->read2692_contig0_position7170_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTCCGCGTCCCATCGGTTAATTCAATGTCCGTCAATCGGGTTGGCCAAAAATTCTACCTGTCCACCTGTCCGCTAGAAGCAGATTATACGGAATACATA
->read2693_contig0_position1805_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTATGAGCAAGCATACAAGTTAGCCGACCCACAAATCGACGTGTGTATTTGTTCAATGGCAGGAGGTTAACTTTGCGGAGCTCAACCTATAACGATAAT
->read2694_contig0_position8302_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGTCTCCGTGGTCATTTCGATAACTCTGCGACCTGAATGCCCTTGGGCTCGTCGACATTCCTGGTAGTAATCCGATCTCAATTCCTGCGGTACCGAGCA
->read2695_contig0_position2128_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TACAGGTATTACGGAGTGAAACGGCTGCGAGCATCTCATATTCGGGCCACCCGAATTCAGCTTGGCCACAACAGAGACTAGCCACCAAGAGATGGGTTGA
->read2696_contig0_position9341_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAAAGAACCTGGCGTATCCTGACCATGGAGCTGCAACACTTTCACACAGGTAGCCGAACAGGTATTACTCAGACTGGAGAGGAATCTTCATTGGTCGTGC
->read2697_contig0_position1540_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGACATCTTGTTCTCACAACTGCACACTCCGATGCTCTGCCGAGCCTTCTAACCATCGGGTATGTACATTCACCTTTGGACGCTTCGATAGGACATGCAC
->read2698_contig0_position9796_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AATCTCTAACACGATTTTAGTAGGTTTACTACTAGGCCGCTTGCTCAGACATCGGAACACAAGTACGCGATCTCTTTTCTAGTCACCAGCCTCAGGCATT
->read2699_contig0_position7620_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GATCACAGCCCACTTGGAGTGTGCTGAGGGCCGACGCCCGGGGACCGTGATATCCTTGCGAGTGGAATGCGAAAACGGAATAAGCGCAATGACCGAGGTA
->read2700_contig0_position5523_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTTTAGAACCACGACCCAGAAATCTTTAGCTAGGTAATCGACTGCCTTCGTCGGGCCGCTTATTGGTTCACCCAATCTGGCCATTGCAAGTTTGGCAGA
->read2701_contig0_position8397_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGCAGCTTTAAGTTTTTGTAAGTCCCACGGTTAATGGGCCACTTATTTCGACATTCATGGCGCCGATATCCTGCTTAGGCAGTACGGCCCATGCACGAC
->read2702_contig0_position5410_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGACCGTACCCGGACACCTGGCAGCGGGAACCGCTTTGACTCTGGAGTGCCAGCGATAGTATCTCAGAGGCGAAAGCGCTTGTCACCTCATCTAAAATC
->read2703_contig0_position3978_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCTATTGAATGATATATGCTCTTGGACAACACGAGGTCGTAATTATTTCCTGAGATGGTTTTACTGAGAGCAGCAGATGCACTCTTAGCTCCGCTGATA
->read2704_contig0_position1329_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCCATGGGTCGCGCTGTATTTTTGTACGGCTTGATGTCAGGGTCAGTTTGGGCGCCGGTATGTCTGTGTAAGGTTGGGCCAATCGAGAGGACATTTCGC
->read2705_contig0_position221_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTACCTTATTCTCATCGCCACGCCCCAAGATCTTTAGGACCCAGCATTCCTTTAACCACTAACATAACGCGTGTCATCAAGTTCTAGCATACTCCGCCTT
->read2706_contig0_position5171_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCAATTCGTTGTATTGATCGCTGTGCACTTTAAAATTCGGAACATCTTAACCAAAGCATATTAATATGCCAGCCGCGCAGGGTGGTATATATGATCCTTG
->read2707_contig0_position4427_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCTATATGGAACCGAGGGGCGGGATGATAATTGTTCTTAGTATAGTGACCGTTATGGACGACGGACATAACTACTGAGTGTCCGCCCTCGGAGAATCAT
->read2708_contig0_position6517_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AACGGGGTGCCCGCGCCTGCGTCCGGTAGACGAGCGATGGATTTAGACCGTTCACTGAACTCTCTAATAGGACCTCTTGCCCATCCCAGGCTTAAGCAGC
->read2709_contig0_position1635_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCACCCGGTCCGTTGACTTACCAACTTGATCGCCAGTGAGTGAGCGGTGGTTTATCTGTTGAGTGGCCACTTTTCCCTATCTGCTGGGACGGCACTGGA
->read2710_contig0_position3920_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCATGCACTAAGCATAGAATGCACGCCTACTTGGTACTGAAGTCGGCATGACTATCAAACCTATTTAATGATATATGCTCTTGGACAACACGAGGTCGTA
->read2711_contig0_position7551_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACAGCCCTACTGCCCGCCGTGAACGAGAACAAGCGTGTGGAGAGTGACTGACTATCACGAGGAATTACGGATAACAGCCCACTTGGAGTGTGCTGAGGGC
->read2712_contig0_position1483_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCCAATTATTGACCACAAGTAGGGGCGAGGTATAAATTAGTGGATTCACTTCCCTTTGACATCTTGTTCTCACAACTGCACACTCCGATGCCCTGCCGT
->read2713_contig0_position2768_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TATTGTAAGAAATGCAATGCGTGGCCAGTTTGTTCCGGCAGGACACCACTCTTTGAAGGTGCCCATTGCATTGTAGCCTGAACTATTAGCAATCCTAAGC
->read2714_contig0_position7386_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTCTGGTGCCACTCGAGACCGCCCTCCCCTACCCATATGCAGTTTCTGCATACACCGGGTAGACAACATTCTCAGCCCTTCGTTGAAAGGAGAATACAA
->read2715_contig0_position6414_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCGGGGGTTCTACTGTACCACAGTGGCCTGGATAGCTAAGCAGGTCCTGGATTGGCATGTCATCCGGAGTGATAGGCGCTGCTCACGACCAGCTTGCGG
->read2716_contig0_position5655_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCTTAGGGTACCGAGTATATTAACTTTATGAAATTAGCGCGTTAACTACTTAAAGTTCAGAAGATTACTGTCCGCCTCGAACCACTCCAATAAGATTAC
->read2717_contig0_position4065_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCTCCGCTGATAACGATTACTATAAATCAGCGATTCTAACATCAATCTGCACCACGAATATCGTCCAAGACGTTTTGAGCCGGTGACTAATTCGGTTGT
->read2718_contig0_position870_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCACTAGGTAATTACTGTTGGCGCCTTTCTTCATGATCGTCGGAGTTCTTTCAGGCCGATCAAGTGGTTAGAGACCTAGGTCTATGCCAGACGATCGCA
->read2719_contig0_position6809_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGCTGATACGCGCGAGCTCTCACCCACGACTGTACCCCGGTTAAGATCTATAAACCATACATTTAACCCTTAGTCATAAGATGATACTTCATCTGCATG
->read2720_contig0_position7431_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTGCATACACCGGGTAGACAACATTCTCAGCCCTTCGTTGAAAGGAGAATACAAATGATGGGAACTCTGACGAGAGGGTGCTTCAACGAGAGAAGCTAA
->read2721_contig0_position7097_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGCTAATATATCGCGGCGTCGAGTTACCGTTGCACCACCTCCAAGTGTCCATCGGAGTCCGCTTCCCGGGCTTGTCCGCGTCCCATCGGTTAATTCAAT
->read2722_contig0_position6975_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GATGGTCCTTTCCTAGGCTACGGCCTTATACCAAAGACTTCTAGACCGGAGAGACTACTTCCAGCCACGAATTCGTGTGATAACCGCCTAAACAGTCTAA
->read2723_contig0_position2872_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGCCCTGCCCCACGGGGGCTACAATCCAGCAGTGAAGGCGTTTACCTTAAGACGAAAGCGTCAGTAGAGTTGGGGTTCGTGCTTTAATGACCCGTAGCC
->read2724_contig0_position4613_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGACGTAAACGCCAATTCCGCTTAATAGCGGAATCTGCTGGCTTGTGCATTCGTCGGCCTATTAGATACGGTACGGAATATTGGGTAACCTCCTCTTCA
->read2725_contig0_position3812_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTTTGTTATTCTAGTCAAGTGAAGAACCCGTGCCCAAAATTGGAACCCGTAATCTTCAAGTGAATAATCCGATCATGCAAACCTGATTATCTGCACGAC
->read2726_contig0_position6321_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTGTGCAAGCTACTTCTAGACCTTATTAAGTTCCCAGGAATTCCTAGGAAGGCGCGCAGCTCAAGCAATCATACATGGGGGAATGCCTGTCCACCGGGG
->read2727_contig0_position6124_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTACAGCGTTATCCGTCCCGAACTGGCTTGAGCCACTCATAAGGCACGCGCGGGCCATAACAGTCGACTAAAAGGCGTAACCGATTCTGCTACGTTATAA
->read2728_contig0_position1326_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGAACCCATGGGTCGCGCTGTATTTTTGTACGGCTTGATGTCAGGGTCAGTTTGGGCGCCGGTATGTCTGTGTAAGGTTGGGCCAATCGAGAGGACATTT
->read2729_contig0_position4578_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGTGCATAGAGTCCCGCAGTATCGGAGCGATAGGGAGGACGTAAACGCCAATTCCGCTTAATAGCGGAATCTGCTGGCTTGTGCATTCGTCGGCCTATTA
->read2730_contig0_position5565_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGCCTTCGTCGGGCCGCTTATTGGTTCACCCAATCTGGCCATTGCAAGTTTGGGAGACGCGAGGTTGCGTGGTCAACCGAACGTTGCTTTCCTTAGGGT
->read2731_contig0_position2020_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGCAGCGTGCATTGGTCTTTCAGTCCCCAGTCACCGGAGACGTCCGAGCTCGAACCCGTCCGGCTAAGAGGCAGGCAGTCGCTGCATGTGTACGCAGCG
->read2732_contig0_position650_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGCTAAAACTGAACAACGAGTGGGACACCGGCTTACTACATTATACAGTAAGGTAGAATCGCGTAGAAGCACCCACGATCAATGTTATTAACCGCGACG
->read2733_contig0_position605_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTATGTGAGTTCATAAATCTCAATGTCGAAACTCCGATGGGCAGAAGCTAAAACTGAACAACGAGTGGGACACCGGCCTACTACATTATACAGTAGGGT
->read2734_contig0_position4532_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGGTCAGGCATGCTTACCTCCTCCGACGGCATTGGCGATTATGGGCGTGCATAGAGTCCCGCAGTGTCGGAGCGATAGGGAGGACGAAAACGCCAATTC
->read2735_contig0_position3852_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGGAACCCGTAATCTTCAAGTGAATCATCCGATCATGCAAACCTGATTATCTGAACGACTCTTAAAATCATGCACTAAGCATAGAATGCACGACTACTT
->read2736_contig0_position99_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCGGTGTCGCTAGCGCAATGCGCAAGATTTTGACATTTACAAGGCAACATTGCAGCGTCCGATGGTCCGGTGGCCTCCAGATAGTGTCCAGTCGCTCTA
->read2737_contig0_position1629_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGACATGCACCCGGTCCGTTGACTTACCATCTTGATCGCCAGTGAGTGAGCGGTGGTTTATCTTTTGAGTGGCCACTTTTCCCTATCTGCTGGGACGGC
->read2738_contig0_position6925_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTATGGTCTGAATTGAGTGTTCAGAGTTGGGGGTCACAGATGAGCGTTCCGATTGTCCTTTCCCGGGCTACGGCCTTATACCAAAGACTTCTAGACCGGA
->read2739_contig0_position3767_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGACACGGGGTACGAAGGGTAAGAACACCTAGCCTGGCAATTACCCCTTTGTTATTCTAGTCAAGTGAAGAACCCGGGCCCAAAATTGGAACCCGTAATC
->read2740_contig0_position2688_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGAGTCTCGAGCCTCTCGACTCCAAAGGGTCTGCCCGAGACAGGTTCACCGAGTCGTTACTCCCGGGATCCACTGCGTCTATTGTAAGAAATGCAATGC
->read2741_contig0_position6077_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTCACACTATTGTTCGGTGCGTGCGCTGCTCAGGCTGGTGCGACCCTTACAGCGTTAACCGTCCCGAACTGGCTTGAGCCACTCATAAGGCACGCGCGG
->read2742_contig0_position2714_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGGTCTGCCCGAGACAGGTTCACCGAGTCGTTACTCCCGGGATCCACTGCGTCTATTGTAAGAAATGCAATGCGTGGCCAGTTTGTTCCGGCAGGACAC
->read2743_contig0_position4400_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCTTGACTCGGCTGATAAAGAAAACAATCTATATGGAACCGAGGGGCGGGATGATAATTGTTCTTAGTATAGTGACCGTTATGGACGACGGACATAACT
->read2744_contig0_position1730_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGGAGATCTGGAACATTAGATAGGATATAAAAGTACTACGGTTGATGTTATTACCAACTCCACTTCTGCAAATTGTTATGAGCAAGCATACTAGTTAGC
->read2745_contig0_position1882_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAGCTCAACCTATAACGATAATCAAATTGAGACAGACGAGTTGGAGTGTTTTGATGAGCGGTGTTATATTTGTCCTAACTTAGCACTATCGCACCACAA
->read2746_contig0_position5774_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTTTTCTGAATTGTGGCGATCTCAAATTGGGACCTAGTGTTGGCCAATAAGCTTCATATCGCCTTCTCAGATAGACTAATAGAACGAAGTCCATATAAC
->read2747_contig0_position6391_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CATACATGGCGGAAGGCCTGTCCACCGGGGGTTCTACTGTACCACAGTGGCCTGGATAGCTAAGCAGGTCCTGGATTGGCATGTCATCAGGAGTGATAGG
->read2748_contig0_position6393_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TACATGGCGGAATGCCTGTCCACCGGGGGTTCTACTGTACCACAGTGGCCTGGATAGCTAAGCAGGTCCTGGATTGGCATGTCATCCGGAGTGATAGGCA
->read2749_contig0_position1010_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGGGGGCATGGGGGTTCCGCATTGGCGCAAAGGTACCGCAAAGGGCCTGTATGACCCTGGTTACGCGTTATTACCGGTCAGCTCCAGTTACGTCACGGA
->read2750_contig0_position8837_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-ACAGCAGCATATTGTTAACACGCGATACAAGAGGGTTAGGAGCTAAGAAACCGGTGCGTCACCGTACGAAAAGGATGGTTGAAATAGAACGAGTTGTAAA
->read2751_contig0_position6160_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCATAAGGCACGCGCGGGCCATAACAGTCGACTAAAAGGCGTAACCGATTCTTCTACGTTATAAAAAAGGGACGAGTGGGGTCAACAGTTCTTCTTCTTT
->read2752_contig0_position7413_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCGACCCATATGCAGTTTCTGCATACACCGGGTAGACAACATTCTCAGCCCTTCGTTGAAAGGAGAATACAAATGACGGGAACTCTGACGAGAGGGTGC
->read2753_contig0_position8630_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGCCTAAAGGGAACATATGTGTCCAGAATAGGGTTCAACGGTGTATGAGCAAACGATGCGGTAAGACGAGCGCTCCGGCCCCCGTTGGCTCTGCTACAT
->read2754_contig0_position2497_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGAGTATGCAGATTTCGTGCCTTGCCACTGCTACCTCCGGCATATGGGCGAGCTATAAATGCGGGAGTCAGGACGATAGAGCGAAGTAGTTACGGTGATT
->read2755_contig0_position5589_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTCACCCAATCTGGCCATTGCAAGTTTGGCAGACGCGAGGTTGCGTGGTCAACCGAACGTTGCTTTCCTTAGGGTACCGAGTATATTAACTTTATGAAA
->read2756_contig0_position7583_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGTGTGGAGAGTGACTGACTATAACGAGGAATTACGGATAACAGCCCACTTGGAGTGTGCTGAGGGCCGACGCCCGGGGACCGTGATATCCTTGCGAGT
->read2757_contig0_position1352_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTACGGCTTGATGTCAGGGTCAGTTTGGGCGCCGGTATGTCTGTGTAAGGTTGGGCCAATCGAGAGGACATTTCGCAGCGCCCTTTCATCTCTATTGCA
->read2758_contig0_position3844_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCCAAAATTGGAACCCGTAATCTTCAAGTGAATCATCCGATCATGCATACCTGATTATCTGCACGACTCTTAAAATCATGCACTAAGCATAGAATGCAC
->read2759_contig0_position8512_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGAGAAGTTATAGTCTAATAATGAATGGTGAACAGCACATCTTTTCGTCCTGAGGCCATATTAATTCTACTCAGATTGTCTGTAACCGGAGCTTCGGGC
->read2760_contig0_position5989_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CATCTAACGTTTGGACGGGTCTTGTGTTCCCTCAACACGTACGTTGACAGAGCTAACAATCCGTCGACTGAATGTGATTCCTTTGTTATTTCACACTAGT
->read2761_contig0_position2728_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ACAGGTTCACCGAGTCTTTACTCCCGGGATCCACTGCGTCTATTGTAAGAAATGCAATGCGTGGCCAGTTAGTTCCGGCAGGACACCACTCTTTGAAGGT
->read2762_contig0_position9299_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGTATCTTGAGAGCGTTTCTCCGTATCGAAATGTTCCGCTGTAAAGAACCTGGCGTATCCTGACCATGGAGCTGCAACACTTTCACACAGGTAGCCGAA
->read2763_contig0_position1392_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTGTGTAAGGTTGGGCCAATCGAGAGGACATTTCGCAGCGCCCTTTCATCTCTATTGCTAGGTCTCTTAAGCCTAATCAGGATCATAGATGGCCAATTA
->read2764_contig0_position3912_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTTAAAATCATGCACTAAGCATAGAATGCACGACTACTTGTTACTGAAGTCGGCATGACTATCAAACCTATTTAATGATATATGCTCTTGGACAACACG
->read2765_contig0_position3256_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CACACCCTTAAGTACCGAACGATAGAGCACCCGTCTAGGAGGGCGTGCAGGGTCTCCCGCTAGCTAATGGTCACGGCCTCTCTGGGAAAGCTGAACAACG
->read2766_contig0_position2861_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTAAGCCGATAAGCCCTGCCCCACGGGGGCTACAATCCAGCAGTGAACGCGTTTACCTTAAGACGAAAGAGTCAGTAGAGTTGGGGTTCGTGCTTTAAT
->read2767_contig0_position5295_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAAATTTTTTCAGATTACCCTGCAGACGTCCGCCTAAGATCCTAGTTGAATTGATCAATTGAGTCCAGTACACCATATCAACAGCTTGATCGTTCCACTT
->read2768_contig0_position947_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGGTCTATGCCAGACGATCGCAGCGGAGTCGATATAATTGCAGTATCATGTATCGCTGATTGTGGGGGGCATGGGGGTTCCGCATTGGCGCAAAGGTAC
->read2769_contig0_position9538_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCACGGAACGCTTCTTGATCCTGAGCTCCCCCGCGATTAACCTATGTCGGGACAAACACTCGATTGAGCAGTGGTCATGTCATTATTGTACATCAGTACC
->read2770_contig0_position3255_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCACACCCTTAAGTACCGAACGATAGAGCACCCGTCTAGGAGGGCGTGCAGGGTCTCCCGCTAGCTAATGGTCACGGCCTCTCTGGGAAAGCTGAACAAC
->read2771_contig0_position4897_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGGGTACGGTTTTACCGTCCATGACGTTGTGACATAAAGGTGCGGGACGCGGAAGCGCACCTCGTATAACGTTAGGGGTATCGTCACTGCATAGCAGAA
->read2772_contig0_position5023_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TACTAACGGTCTGGCCTTATACAGCGCCACATCCGCCAATTCGCTAGGTTGTAGCCAGGAAGTCTGTAGTACAGGTGCCCATAACCCGATGAGGCCAAGG
->read2773_contig0_position4661_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CATTCGTCGGCCTATTAGATACGGTACGGAATATTGGGTAACCTCCTCTTCACTGATATCATCCTATCGGCGTTCAAAGTATTCGGCGGATGAATTAGAG
->read2774_contig0_position9473_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCCCATACCCCTTTGTCTACAGAAGCTCATGGATAAGAGTGCGCGAATAACATCACTTGTTACTTCCCGGAACGCTTCTTGATCCTGAGCTCCCCCGCG
->read2775_contig0_position552_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGTAATGGAGGTCGAACACTAGTCGGTGGCTCTTCTGTCTCCGGCGGGGACGGCTATGTGAGTTCATAAATCTCAATGTCGAAACTCCGATGGTCAGAA
->read2776_contig0_position5655_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCTTAGGGTACCGAGTATATTAACTTTATGAAATTAGCGCGTTAACTACTTAAAGTTCAGAAGATCACTGTCCGCCTCGAACCACTACAATAAGATTAC
->read2777_contig0_position2278_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GATAGTACGTTCCTTTTGTACTGAGTCTTAACATCGGCAAATGCGCCCTAGATACCTGCGGCTTCACTCCACAGTGTAAGAGTTGACGGGACTAAAACAG
->read2778_contig0_position3271_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGAACGATAGAGCACCCGTCTAGGAGGGCGTGCAGGGTCTCCCGCTAGCTAATGGTCACGGCCTCTCTGGGAAAGCTGAACAACGGATGGGATTAAGCTC
->read2779_contig0_position7604_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCACGAGGAATTACGGATAACAGCCCACTTGGAGTGTGCTGAGGGCCGACGCCCGGGGACCGTGATATCCTTGCGAGTGGAATGCGAAAACGGCATAAG
->read2780_contig0_position275_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCACTAACATAACGCGTGTCATCTAGTTCTAGCATACTCCGCCTTGGGCCACACAATTAATATAAGACGGGATAATGGCTTCATGCTCATGTTCTATAC
->read2781_contig0_position315_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCCTTGGGCCACACAATTAATATAAGACGGGATAATGGCTTCATGCTCATGTTCTATACCGGGCAGAGAGGTTGGGTCTACCTAGTAGTGTCGCGGTTA
->read2782_contig0_position8444_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCGACATTCATGGCGCCGATATCCTGCTTAGGCAGTACGGCCAATGCACGACCCTATATGACCCCTAGCGAGAAGTTATAGTCTAATAATGAATGGTGA
->read2783_contig0_position9571_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGATTAACCTATGTCGGGACAAACACTCGATTGAGCAGTGGTTATGTCATTATTGTACATCAGTACCATAGCTTGGCCACATGAGATGCTCGTACTCGAA
->read2784_contig0_position1971_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGCACCACAAAATTTCAGCATAAAGCATCCGGTTGAAAGCTGCGCATCGAGCAGCGTGCATCTGTCTTTCAGTCCCCAGTCACCGGATACGTCCGAGCT
->read2785_contig0_position9569_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCGATTAACCTATGTCGGGACAAACACTCGATTGAGCAGTCGTCATGTCATTATTGTACATCAGTACCATAGCTTGGCCACATGTGATGCTCGTACTCG
->read2786_contig0_position6429_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTACCACAGTGGCCTGGATAGCTAAGCAGGTCCTGGATTGGCATGTCATCCGGCGTGATAGGCACTGCTCACGACCAGCTTGCGGACAAACGGGGTGCCC
->read2787_contig0_position4188_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAACTTCCCGCTGATATGATTGTGATCGATATTCAGACTCTAACAAGTGGTCAGTACAGGTTCGACCATACGCGACGGCAAACAGAATCGCACGTCAAT
->read2788_contig0_position5263_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GATCCTTGATAGCTTTATGGCCATCATCATAGTAAATTTTTTCAGATTACCCTGCAGACGTCCGCCTAAGATCCTAGTTGAATTGATCAATTGAGTCCAG
->read2789_contig0_position2919_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTAAGACGAAAGAGTCAGTAGAGTTGGGGTTCGTGCTTTAATGACCCGTAGCCCAATTGCGCTCCCGAACAACGCGTGAGTTTAAAATTGACTTGAAACC
->read2790_contig0_position52_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCTTTAACCTGCCAGACGGTGACCAGGGCCGTTCGCCGTTGCATCGAGCGGTGTCGCTAGCGCAATGCGCAAGATTTTGACATTTACAAGGCAACATTG
->read2791_contig0_position9782_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTAAATGTCCTTAAATCTCTAACACGATTTTAGTAGGTCTACTACTAGGCCGCTTGCTCAGAAATCGGAACACAAGTACGCGATCTCTTTTCGAGTCAC
->read2792_contig0_position4846_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGTCCCTCAGTGTTTTATACGGGACGGTGGCCACGGGGTGAGCACATGAATGGGGTACGGTTTTACCGTCCATGACGTTGTGACATAAAGGTGCGGGAC
->read2793_contig0_position1278_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTATGGACTCTTATATTCTGTCCTGCGTAGTGCTCTCCCATAATAAGTGAACCCATGGGTCGCGCTGTATTTTTGTACGGCTTGATGTCAGGGTCAGTT
->read2794_contig0_position2855_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCAATCCTAAGCCCATAAGCCCTGCCCCACGGGGGCTACAATCCAGCAGTGAACGCGATTACCTTAAGACGAAAGAGTAAGTAGAGTTGGGGTTCGTGC
->read2795_contig0_position2812_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCACTCTTTGAAGGTGCCCATTGCATTGTAGCCTGAACTATTAGCAATCCTAAGCCCATAAGCCCTGCCCCACGGGGGCTACAATCCAGCAGTGAACGC
->read2796_contig0_position4159_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTTGTCGCACATAGTGTACGTTGAGGCGGGAACTTCCCGCTGATATGATTGTGATCGATATTCAGACTCTAACAAGTGGTCAGTACAGGTTCGACCATA
->read2797_contig0_position2330_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TACCTGCGGCTTCACTCCACAGTGTAAGAGTTGACGGGACTAAAACAGTATTGGGCGGTGAGGGGTACCCGACGCCTCTGCTGTCAAAGTGGGAAATCCA
->read2798_contig0_position7025_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGACTACTTCCAGCCACGAATTCGTGTGATAACCGCCTAAACAGTCTAATCTGGCCAATATACCCTGGGGGGAGCTAATATATCGCGGCGTCGAGTTAC
->read2799_contig0_position984_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTGCAGTATCATGTATCGCTGATTGTGGGGGGCATGGGGGTTCCGCATTGGCGCAAAGGTACCGCAAAGGGCCGGTATGACCCTGGTTACGCGTTATTA
->read2800_contig0_position6221_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAAAAAAGGGACGAGTGGGGTCAACAGTTCTTCTTCTTTCCTGTACGGTAATGCTTCCGCGCATCTAAGTGATATTCGCCGGAATTTACCCTTCTAATAT
->read2801_contig0_position5191_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGTGCACTTTAACATTCGGAACATCTTAACCAAAGCATATTAATATGCCAGCCGCGCAGGGTGGTGTATATGATCCTTGATAGCTTTATGGCCATCATC
->read2802_contig0_position8691_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTAAGACGAGCGCTCCGACCCCCCTTGGCTCTGCTACATCGAATTCAGCGTGTAAGAGCCCGCTTATCCGGTGGTGATACCTACTATTGACTGGGGGCAT
->read2803_contig0_position9495_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAAGCTCATGGATAAGAGTGTGCGAATAACATCACTTGTTACTTCACGGAACGCTTCTTGATCCTGAGCTCCCCCGCGATTAACCTATGTCGGGACAAAC
->read2804_contig0_position5562_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGACTGCCTTCGTCGGGCCGCTTATTGGTTCACCCAATCTGGCCATTGCAAGTTTGGCAGACGCGAGGTTCCGTGGTCAACCGAACGTTGCTTTCCTTAG
->read2805_contig0_position3232_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTCGTATGGTTGGAGGGCGGTTACACACCCTTAAGTACCGAACGATAGAGCACCCGTCTAGGAGGGCGTGCAGGGTCTCCCGCTAGCTAATGGTCACGG
->read2806_contig0_position9530_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGTTACTTCACGGAACGCTTCTTGATCCTGAGCTCCCCCGCGATTAACCTATGTCGGGACAAACACTCGATTGAGCAGTGGTCATGTCATTATTGTACA
->read2807_contig0_position2923_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GACGAAAGAGTCAGTAGAGTTGGGGTTCGTGCTTTAATGACCCGTAGCCCAATTGCGCTCCCGAACAACGCGTGAGTTTAAAATTGACTTGAAACCGCCT
->read2808_contig0_position2975_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGCGCTCCCGAACAACGCGTGAGTTTAAAATTGACTTGAAACCGCCTAGCTCGGACCACCAAAGAGCAAGACTCTATGACTAGCGGGTGTCGTCAATGA
->read2809_contig0_position57_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAACCTGCCAGACGGTGACCAGGGCCGTTCGGCGTTGCATCGAGCGGTGTCGCTAGCGCAATGCGCAAGATTTTGACATTTACAAGGCAACATTGCAGCG
->read2810_contig0_position3222_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGCCCTAAAGGTCGTATGGTTGGAGGGCGGTTACACACCCTCAAGTACCGAACGATAGAGCACCCGTCTAGGAGGGCGTGCAGGGTCTCCCGCTAGCTA
->read2811_contig0_position2076_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGTCCGGCTAAGAGGCAGGCAGTCGCTGCATGTGTACGCAGCGGTCTATGCTACAGGTATTACGGAGTGAAACGGCTGCGAGCATCTCATAATCGGGCC
->read2812_contig0_position3707_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTTCTCTTAGGTTCCTCAACGGAAACGTCTCAGACCCACCTTAGACGCGGGAATAAATTCGACACGGGGTACGAAGGGTAAGAACACCTAGCCTGGCAA
->read2813_contig0_position1341_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCTGTATTTTTGTACGGCCTGATGTCAGGGTCAGTTTGGGCGCCGGTATGTCTGTGTAAGGTTGGGCCAATCGAGAGGACATTTCGCAGCGCCCTTTCA
->read2814_contig0_position5065_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTAGGTTGTAGCCAGGAAGTCTGTAGTACAGGTGCCCATAACCCGATGAGGCCAAGGTGTTACGTGAAGTCGCGTTGTCGGTAGTAACAGATTGGGAGG
->read2815_contig0_position2415_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AAAGTGGGAAATCTAGTCTCGACTATATCTACTATGTCATGCTTGTCGAATGAACAACTCAATTAGGTAGTGTGCGCGAGGTAGTGTATGCAGATTTCGT
->read2816_contig0_position448_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGGTAGCGTAGTTAGTAACTTCAATCCGCGTTACGCTCTGTCCTCTGCTACGCCTCGATTGGTTTCAGCTCACGTGGGACGCATGTACTTACCTAACAT
->read2817_contig0_position6174_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGGCCATAACAGTGGACTAAAAGGCGTAACCGATTCCGCTACGTTATAAAAAAGGGACGAGTGGGGTCAACAGTTCTTCTTCTTTCCTGTACGGTAATG
->read2818_contig0_position2178_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGATTTCAGCTTGGCCACAACAGAGACTAGCCACCAAGAGATGGGTTGATGGTAGCATCCCGGCTTCTGGGGCAATTTCTGACGATTCGAGTGACCAGC
->read2819_contig0_position2305_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTAACATCGGCAAATGCGCCCTAGATACCTGCGGCTTCACTCCACAGTGTAAGAGTTGACGGGACTAAAACAGTATTGGGCGGTGAGGGGTACCCGACGC
->read2820_contig0_position3724_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CAACGGAAACGTCTCAGACCCACCTTAGACGCGGGAATAAATTCGACACGGGGTACGAAGGGTAAGAACACCTAGCCTGGCAATTACCCCTTTGTTATTC
->read2821_contig0_position3807_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTACCCCTTTGTTATTCTAGTCAAGTGAAGAACCCGGGCCCAAAATTGGAACCCGTAATCTTCAAGTGAATCATCCGATCATGCAAACCTGATTATCTGC
->read2822_contig0_position8138_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGATTATGCACTAGCACGACCGCCGTAGGAAAGATCCGAGGCCTTTTCCAGGGTGAAATGATGGACTCATTGACCCACCCCTATTATTATGAGAGGGCT
->read2823_contig0_position250_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCTTTTGGACCCAGCATTCCTTTAACCACTAACATAACGCGTGTCATCTAGTTCTAGCATACTCCGCCTTGGGCCACACAATTAATATAAGACGGGATA
->read2824_contig0_position6327_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAAGCTACTTCTAGACCTTATTAAGTGCCCAGGAATTCCTAGGAAGGCCCGCAGCTCAAGCAATCATACATGGCGGAATGCCTGTCCACCGGGGGTTCTA
->read2825_contig0_position8677_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGCAAACGATGCGGTAAGACGAGCGCTCCGACCCCCCTTGGCTCTGCTACAACGAATTCAGCGTGTAAGAGCCCGCTTATCCGGTGGTGATACCTACTA
->read2826_contig0_position3423_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGACTGAGAACTCACCCTATTGGTAGTACTGCCTGCCGTCGCCTCGCGCCCATAATGTTTGGAACTCGCAAACCTTTACACTCATCACATAGCAGGTTCC
->read2827_contig0_position7321_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GATGGCTACAAGCGCCAGATCGACTTGACTCTACGTCCTGCAATGGAGAACCGCGGAAGGAACACTTTCTGGTGCCACTCGAGACCGCCCTCCCCGACCC
->read2828_contig0_position7429_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTCTGCATACACCTGGTAGACAACATTCTCAGCCCTTCGTTGAAAGGAGAATACAAATGACGGGAACTCTGACGAGAGGGTGCTTGAACGAGAGAAGCT
->read2829_contig0_position33_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGCTAACGAGCTACCGTTTCCTTTAACCTGCCAGACGGTGACCAGGGCCGTTCGGCGTTGCATCGAGCGGTGTCGCTAGCGCAATGCGCAAGATTTTGA
->read2830_contig0_position440_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGAAGACCGGGTAGCGTAGTTAGTAACTTCAATCCGCGTTACGCTTTGTCCTCTGCTACGCCTCGATTGGTTTCAGCTCACGTGGGACGCATGTACTTA
->read2831_contig0_position4156_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCGGTTGTCGCACATAGTGTACGTTGAGGCGGGAGCTTCCCGCTGATATGATTGTGATCGATATTCAGACTCTAACAAGTGGTCAGTACAGGTTCGACC
->read2832_contig0_position1057_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGTATGACCTTGGTTACGCGTTATTACCGGTCAGCTCCAGTTACGTCACGGACGTAGAGAGCCTTTGAATGTGTACGGCAATAGGAGAAACTCGGCCAC
->read2833_contig0_position72_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGACCAGGGCCGTTCGGCGTTGCATCGAGCGGTGTCGCTAGCGCAATGCGCAAGATTTTGACATTTACAAGGCAACATTGCAGCGTCCGATGGTCCGGTG
->read2834_contig0_position1651_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTTACCAACTTTATCCCCAGTGAGTGAGCGGTGGTTTATCTGTTGAGTGGCCACTTTTGCCTATCTGCTGGGACGGCACTGGAGATCTGGAACATTAGA
->read2835_contig0_position1123_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGAATGTGTACGGCAATAGGAGAAACTCGGCCACGTACGTGTCAACATGGCGCGGCTCTCTATACCTCGCAAAGAATCACTCTATGGGTCATCTTGAGAG
->read2836_contig0_position6421_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTCTACTGTACCACAGTGGACTGGATAGCTAAGCTGGTCCTGGATTGGCATATCATCCGGAGTGATACGCACTGCTCACGACCAGCTTGCGGACAAACG
->read2837_contig0_position5117_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCAAGGTGTTACGCGAAGTCGCGTTGTCGCTAGTAACAGATTGGGAGGTCTCGGCCAATTCGTTGTATTGATCGCTGTGCACTTTAAAATTCGGAACATC
->read2838_contig0_position3626_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGTCCGCCACCTCCGGGTCTAGTAAACCAGAGATTCCGTGGACTCTCTGTTTCGTCGATTATCTGAATATCGTGCAGTAAGTTTCTCTTAGGTTCCTCA
->read2839_contig0_position7993_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGGCGACACGAAGATTGTCATACTAGCTTTCAGTCATTCCCCCTCAGTTTTGTCCATGTGGAGAATATGCATTCGACCAAATGAAAATGTCAATAATCT
->read2840_contig0_position641_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GATGGGCAGAAGCTAAAACTGAACAACGAGCGGGACACCGGCCTACTACATTATACAGTCAGGTAGAATCGCGTAGAAGCACCCACGATCAATGTTATTA
->read2841_contig0_position3536_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GTATTCTACGACAGCGTGAATCGTGTAACACTGCTCGGTTATACGCCCTCGGGAGAAGACCCATGTAAGATGTATCCATCCCTACCACACGCGTCCGCCA
->read2842_contig0_position5434_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGGGAACCGCTTTGACTCTGGAGTGCCAGCGATAGTATCTCAGAGGCGAAAGCGCTTATCACCTCATCTAAAATCGCGACTATAGATCTGTTTAGAACC
->read2843_contig0_position7376_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAAGGAACACTTTCTGGTGCCACTCGAGACCGCCCTCCCCGACCCATATGCAGTTTCTGCATACACCGGGTAGACAACATTCTCAGCCCTTCGTTGAAAG
->read2844_contig0_position1930_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTTTGATGAGCGGTGTTATATTTGTCCTAACTTACCACTATCGCACGACAAAATTTCAGCATGAAGCATCCGGTTGAAGGCTGCGCATCGAGCAGAGTG
->read2845_contig0_position6074_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTATTTCACACTATTGTTCGGTGCGTGCGCTGCTCAGGCTGGTGCGACCCTTACAGCGTTATCCGTCCCGAACTGGCTTGAGCCACTCATAAGGCACGCG
->read2846_contig0_position491_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCTGCTACGCCTCGATTGTTTTCAGCTCACGTGGGACGCATGTACTTACCTAACATGAAGCGGTAATGGAGCTCGAACACTAGTCGGTGGCTCTTCTGT
->read2847_contig0_position4100_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTAACATCAATCTGCACCACGAATACCGTCTAAGACGTTTTGAGCCGGTGACCAATTCGGTTGTCGCACATAGTGTACGTTGAGGCGGGAACTTCCCGC
->read2848_contig0_position6788_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCTCGCTTTGGTCTCTACATCCGCTGATACGCGCGAACTCTCACCCACGACTGTACCCCGGTTAAGATTTATAAACCATACATTTAACCCTTAGCCATA
->read2849_contig0_position3217_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTAAGCGCCCTAAAGGTCGTATGGTTGGAGGGCGGTTACACACCCTTATGTACCGAACGATAGAGCACCCGTCTAGGAGGGCGTGCAGGGTCTCCCGCT
->read2850_contig0_position6631_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CGATGGGTCCTCAAGGCAGTATAAAATGGACTGCTATCTAGGCGTAAAAGTAGTAGAACGAGGCTCGGGCGGTTTGTTTTGGTAGTGGTTATCGCATTGC
->read2851_contig0_position6978_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTCCTTTCCCAGGCTACGGCCTTATACCAAAGACTTCTAGACCGGAGAGACTACTTCCAGCCACGAATTCGTGTGATAACCGCCTAAACAGTCTAATCT
->read2852_contig0_position6209_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTGCTACGTTATAAAAAAGGGACGAGTGGGGTCAACAGTTCTTCTTCTTTCCTGTACGGTAATGCTTCCGCGCATCTAAGTGATATTCGCCGGAATTTA
->read2853_contig0_position3193_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTATGTTCCGGTAATCTCTCATCTACTAAGCGCCCTAAAGGTCGTATGGTTGGAGGGCGGTTACACACCCTTAAGTACCGAACGATAGAGCACCCGTCTA
->read2854_contig0_position8750_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGCTTATCCGGTGGTGATACCTACTATTGACTGGGGGCTTACTGAGAACACTTCATCTGTATGGCAAAGTTGCGACACCGCGCCACACAGCATTTTATT
->read2855_contig0_position1940_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGGTGTTATATTTGTCCTAACTTAGCACTATCGGACCACAAAATTTCAGCATAAAGCATCCGGTTGAAGGCTGCGCATCGAGCAGCGTGCATTGGTCTT
->read2856_contig0_position138_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACAAGGCAACATTGCAGCGTCCGATGGTCCGGTGGCATCCAGATAGTGTCCAGTCGCTCTAACTGTATGGAGACCATAGGCATTTACCTTATTCTCATCG
->read2857_contig0_position6927_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGGACTTAATTGAGTGTTCAGAGTTGGGCATCACAGATGAGGGTTCCGATTGTCCTTTCCCAGGCTACGGCCTTATACCAAAGACTTCTAGACCGGAGA
->read2858_contig0_position8399_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCAGCTTTGAGTTTTTGTAAGTCCCACGGTTAATGGGCCACTTATTTCGACATTCATGGCGCCGATATCCTGCTTAGGCAGTACGGCCAATGCACGACCC
->read2859_contig0_position7313_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTCCGCCGATGTCTAAAAGCGCCAGATCGACTTGACTCTACGTGCTGCAATGGAGAACCGCGGAAGGAACACTTTCTGGTGCCACTCGAGACCGCCCTC
->read2860_contig0_position1061_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGACCCTGGTTACGCGTTATTACCGGTCAGCGCCCGTTACGTCACGGACGTAGAGAGCCTTTGAATGTGTACGGCAATAGGAGAAACTCGGCCACGTAC
->read2861_contig0_position9640_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCTTGGCCAGATGTGATGCTCGGACTCGAAGGGGGAATCACCTTACTTAATCGGCTGAGGTAACGGCTGGTTTTGTACAACGGTATGGGAACCCGTTTG
->read2862_contig0_position5291_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATAGTAAATTTTTTCAGATTACCCTGCAGACGTCCGCCTAAGATACTAGTTGAATTGATTAATTGAGTCCAGTACACCATATCAACAGCTTGATCGTTCC
->read2863_contig0_position4738_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTATTCGGCGGATGAATTAGAGCCAAAGCGGTAGGTTACCGTCGGCGCATAACCGGCGAGTGCTCTGAAACGTTACATTCGTCTATCGGCACACACCGC
->read2864_contig0_position2779_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGCAATGCGTGGCCAGTTTGTTCCGGAAGGACACCACTCTTTGAAGGTGCCCATTGCATTGTAGCCTGAACTATTAGCAATCCTAAGCCCATAAGCCCT
->read2865_contig0_position7620_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GATAACAGCCCACTTGGAGTGTGCTGAGGGCCGACGCCCGGGGACCGTGATATCCTTGCGAGTGGAATGCGAAAACGGCATAAGCGCAATGACCGAGGTA
->read2866_contig0_position6145_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTGGCTTGAGCCACTCATAAGGCACGCGCGGGCCATAACAGTCGACTAAAAGGCGTAACAGATTCTGCTACGTTATAAAAAAGGGACGAGTGGGGTCAA
->read2867_contig0_position5590_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCACCCAATCTGGCCATTGCAAGTTTGGCAGACGCGAGGTTGCGTGGTCAACCGAACGTGGCTTTCCTTAGGGTACCGAGTATATTAACTTTATGAAAT
->read2868_contig0_position7704_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCAATGACCGAGGTAACCAGCCATGAGGACTGGAGCGGTAATGTGGTAGTGTAGTTGCCGGCCCCTGTGCTGACCTTATGTCCATATCGATACACGAAG
->read2869_contig0_position2018_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGAGCAGCGTGCATTGGTCTTTCAGTCCCCAGTCACCGGAGACGTCCGAGCTCGAACCCGTCCGGCTAAGAGGCAGGCAGTCGCTGCATGTGTACGCAG
->read2870_contig0_position7730_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGACTGGAGCGGTAATGTGGTAGTGTAGTTGCCGGCCCCTGTGCTGACCTTATGTCCATATCGATACACGAAGGCCAGTGCGGAAGCGGAGCCACACTC
->read2871_contig0_position5298_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTTTTTCAGATTACCCTGCAGACGTACGCCTAAGATCCTAGTTGAATTGATCAATTGAGTCCAGTACACCACATCAACAGCTTGATCGTTCCACTTCAA
->read2872_contig0_position7567_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGTGAACGAGAACAAGCGTGTGGAGAGTGACTGACTATCACGAGGAATTACGGATAACAGCCCACTTGGAGTGTGCTGAGGGCCGACGCCCGGGGACCG
->read2873_contig0_position6530_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCCTGCGTCCGGTAGACGAGCGATGGATTTAGACCGTTCACTGAACCCTCTAATAGGACCTCTTGCCCATCCGAGGCTTAAGCAGCGACTCCACATGGA
->read2874_contig0_position4370_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTCCCGCACTACTGAGACGAAGTCTAGCTAGCTTGACTCGGCTGATAAAGAAAACAATCTATATGGAACCGAGGGGCGGGATGATAATTGTTCTTAGTA
->read2875_contig0_position3023_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCTCGGACCACCAAAGAGCAAGACTCTATGACTAGCGGGTGTCGTCAATGAAAACTGATCGAGCACTGTCCGCGAAACATTATTCAGTACAGCGACTTT
->read2876_contig0_position8127_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCTAAAGGCAGGGATAATGCACTAGCACGACCGCCGCAGGAAAGATCCGAGGCCTTTTCCACGGTAAAATGATGGACTCATTGACGAACCCCTATTATT
->read2877_contig0_position4455_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAATTGTTCTTAGTATAGTGACCGTTACGGACGACGGACATAACTACTGAGTGTCCGCCCTCGGCTAATCATGAACACCGGTCAGGCATGCTTACCTCCT
->read2878_contig0_position9827_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTAGGCCGCTTCCTCAGAAATCGGAACACAAGTACGCGATCTCTTTTCTAGTCACCAGCCTCAGGCATTCGCAAATTTCGTTCATGCACGCAACGGGTCG
->read2879_contig0_position944_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCTAGGTCTATGCCAGACGATCGCAGCGGAGTCGATATAATTGCAGTATCATGTATCGCTGAGTGTGGGGGGCAGGGAGGTTCCGCATTGGCGCAAAGG
->read2880_contig0_position4013_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTCGTAATTATTTCCTGAGATGGTTTTAGTGAGAGCAGCAGATGCACTCTTAGCTCCGCTGATAACGATTACTATAAATCAGCGAATCTAACATCAATC
->read2881_contig0_position2376_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTATTAGGCGGTGAGGGGTACCCGACGCCTCTGCTGTCAAAGTGGGAAATCCATTCTCGACTATATCTACTATGTCATGCTTGTCGGATGAACAACTGA
->read2882_contig0_position561_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCTCGAACACTAGACGGTGGCTCTTCTGTCTCTGGCGGGGACGGCTATGTGAGTTCATAAATCTCAATGTCGAAACTCCGATGGGCAGAAGCTAAAACT
->read2883_contig0_position4008_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CACGAGGTCGTAATTATTTCCTGAGATGGTTTTAGTGAGAGCAGCAGATGCACTCTTAGCTCCGCTGATAACGATTACTATAAATCAGCGAATCTAACAT
->read2884_contig0_position14_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTGGGGCGGACCACGCTCTGGCTAACGAGCTACCGTCTCCTTTAACCTGCCAGACGGTGACCAGGGCCGTTCGGCGTTGCATCGAGCGGTGTCGCTAGC
->read2885_contig0_position8244_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTTGCAGCTCCGACCGCTTTCCAATCGTTGCACATGACTTGAGGCTCGGACTCGTATCTGTCTCCGTGTTCCTTTCGATAACTCTGGGACCTGAATGAC
->read2886_contig0_position5540_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGAAATCTTTAGCTAAGTAATCGACTGCCTTCGTCGGGCCGCTTATTGGTTCACCCAATCTGGCCATTGCAAGTTTGGCAGACGCGAGGTTGCGTGGTC
->read2887_contig0_position6071_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGTTATTTCACACTATTGTTCGGTGCGTGCGCTGCTCAGGCTGGTACGACCCTTACAGCGTTATCCGTCCCGAACTGGCTTGAGCCACTCATAAGGCAC
->read2888_contig0_position9084_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCTGTCACGGGCAAGCTGAAAGCGGCGGTTACATTAATCGCTTCTGTGATGACAGACCGAAGCCCACCTGTCCTGACCTCACCGCAGGCATCGAGTCTA
->read2889_contig0_position295_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CATCTAGTTCTAGCATACTCCGCCTTGGGCCACACAATTAATATAAGACGGGATAATGGCTTCATGCTCATGTTCTATACCGAGCAGAGAGGTTGGGTCT
->read2890_contig0_position8685_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GATGCGGTAAGACGAGCGCTCCGACCCCCCTTGGCTCTGCTACATCGAATTCAGCGTGTAAGAGCCCGCTTATCCGGTGGTGATGCCTACTATTGACTGG
->read2891_contig0_position5213_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CATCTTAACCAAAGCATATTAATATGCCAGCCGCGCAGGGTGGTATATATGATCCTTGATAGCTTTATGGCCATCATCCTAGTAAATTTTTTCAGACTAC
->read2892_contig0_position609_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTGAGTTCATAAATCTCAATGTCGAAACTCCGATGGGCAGAAGCTAAAACTGAACAACGAGTGGGACACCGGCCTACTACATTATACAGTAAGGTAGAA
->read2893_contig0_position8187_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGGGTAAAATGATGGACTCATTGACCAACCCCTATTTTTAGGAGAGGGCTGCGACTGCTTGCAGCTCCGACCGCTTTCCAATCGTTGCACATGACTTGA
->read2894_contig0_position9389_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTAGCCGAACAGGTATTACTCAGACTGGAGAGGAATCTTGATTGGTCGTGCAGACATTGTCGCTGCGTACCAAAGGAACTGGACGCCCATACCCCTTTG
->read2895_contig0_position360_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTCATGTTCTATACCGAGCAGAGATGTTGGGTCTACCTAGTAGTGTCGCGGTTATCGGACAGAGGATTATGTAAGGTTACCGAAGACCGGGTAGCGTAG
->read2896_contig0_position2407_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGCTGTCAAAGTGGGAAATCCATTCTCGACTATATCTACTATGTCATGCTTGTCGAATGAACAACTCAATTAGGTAGTGTGCGCAAGGTAGAGTATGCA
->read2897_contig0_position8450_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTCATGGCGCCGTTATCCTGCTTAGGCAGTACGGCCAATGCACGACCCTATATGACCCCTAGCGAGAAGTTATAGTCTAATAATGAATGGTGAACAGCA
->read2898_contig0_position5343_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AATTGATCAATTGAGTCCAGTACACCATATCAACAGCTTGATCGTTCCACTTCAATCAGCAAGACGGGCGACCGTACCCGGACACCTGGCAGCGGGAACC
->read2899_contig0_position292_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTCATCTAGTTCTAGCATACTCCGCCTTGGGCCACACAATTAATATAAGACGGGATAATGGCTTCATGCTCATGTTCTATACCGAGCAGAGAGGTTGGG
->read2900_contig0_position4583_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATAGAGTCCCGCAGTGTCGGAGCGATAGGGAGGACGTAAACGCCAATTCCGCTTAATAGCGGAATCTGCTGGCTTGTGCATTCGTCGGCCTATTAGATAC
->read2901_contig0_position3041_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GCAAGAATCTATGACTAGCGGGTGTCGTCAATGAAAACTGATCGAGCACTGTCCGCGAAAGATTATTTAGTACAGCGACTTTTACCCTCGTGGTCTGAAT
->read2902_contig0_position1901_M5_I0_D0_NG0______er0.01__indel0__rgeom0
-TAATCAAATTGAGACAGACGAGTTGGAGTGTTTTGATTAGCCGTGTTATATTTGTCCTAACTTAGCACTCTCGCAGCACAAAATTACAGCATAAAGCATC
->read2903_contig0_position5673_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TATTAACTTAATGAAATTAGCGCGTTAACTACTTAAAGTTCAGAAGATCACTGTCCGCCTCGAACCACTACAATAAGATTACGGATAGCCCGTGGCTTGG
->read2904_contig0_position4573_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGGGCGTGCATAGAGTCCCGCAGTGTCGGAGCGATAGGGAGGACGTAAACGCCAATTCCGCTTAATAGCGGAATCTGCTGGCTTGTGCATTCGTCGGCC
->read2905_contig0_position2918_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTAAGACGAAAGAGTCAGTAGAGTTGGGGTTCGTGCTTTAATGACCCGTAGCCCAATTGCGCTCCCGAACAACGCGTGAGTTTAAAATTGACTTGAAAC
->read2906_contig0_position8670_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTGTATGAGCAAACGATGCGGTAAGACGAGCGCTCCGACCCCACTTGGCTCTGCTACATCGAATTCAGCGTGCAAGAGCCCGCTTATCCGGTGGTGATA
->read2907_contig0_position365_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTTCTATACCGAGCAGAGAGGTTGGGTCTACCTAGTAGTGTCGCGGTTATCGGACAGAGGATTATGTAAGGTTACCGAAGACCGGGTAGCGTAGTTAGT
->read2908_contig0_position658_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTGAACAACGAGTGGGACACCGGTCTACTACATTATACAGTAAGGTAGAATCGCGTAGAAGCACCCACGATCAATGTTAATAACCGCGACGGTGTATTC
->read2909_contig0_position1776_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTTATTACCAACTCCACTTCTGCAAATTGTTATGAGCAAGCATACAAGTTAGCCGGCCCACAAATCGACGTGTGTATTTGTTCAATGGCAGGAGGTTAA
->read2910_contig0_position8614_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTTTTGCGTAAGACACTGCCTAAAGGGAACATATGTGTCCAGAATAGGGTTCAACGGTGTATGAGCAAACGATGCGGTAAGACGAGCGCTCCGACCCCC
->read2911_contig0_position7022_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAAAGACTACATCCAGCCACGAATTCGTGTGATAACCGCCTAAACAGTCTAATCTGGCCAATATTCCCTGGGGGGAGCTAATATATCGCGGGGTCGAGT
->read2912_contig0_position580_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCTCTTCTGTCTCTGGCGGGGACGGCTATGTGAGTTCATAAACCTCAATGTCGAAACTCCGATGGGCAGAAGCTAAAACTGAACAACGAGTCGGACACC
->read2913_contig0_position6298_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCGGAATTTACCCTTCTAATATTGTGTGCAAGCTACTTCTAGACCTTATTAAGTGCCCAGGAATTCCTAGGAAGGCGCGCAGCTCAAGCAATCATACAT
->read2914_contig0_position8860_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GATACAAGAGGGTTAGGTGCTAAGAAACCGGTGCATCACCGTACGAAAAGGATGGTTGAAATAGAACGAGTTGTAAAACATTAGCTCACGCGCCACCGTC
->read2915_contig0_position5797_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAAATTGGGACCTAGTGTTGGCCAATAAGCTTCATATCGCCTTCTCAGATAGACTAATAGAACGAAGTCCATATAACAGCTGGTTTAAGAGGAAAAATTG
->read2916_contig0_position8584_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGATTGTCTGTAACCGGAGCTTCGGGCGTATTTTTGCGTAAGACACTGCCTAAAGGGAACATATGTGTCAAGAATAGGGTTCAACGGTGTATGAGCAAA
->read2917_contig0_position5398_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCAGCAAGACGGGCGACCGTACCCGGACACCTGGCAGCGGGAACCGCTTTGACTCTGGAGTGCCAGCGATAGTATCTCAGAGGCGAAAGCGCTTGTCACC
->read2918_contig0_position6337_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTAGACCTTATTAAGTGCCCACGAATTCCTAGGAAGGCGCGCAGCTCAAGCAATCATACATGGCGGAATGCCCGTCCACCGGGGGTTCTACTGTACCACA
->read2919_contig0_position1004_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGATTGTGGGGGGCATGGGGGTTCCGTATTGGCGCAAAGGTACCGCAAAGGGCCTGTATGACCCTGGTTACGCGTTATTACCGGTCAGCTCCAGTTACGT
->read2920_contig0_position7605_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCACGAGGAATTACGGATAACAGCCCACTTGGAGTGTGCTGAGGGCCGACGCCCGGGGACCGTGATATCCTTGCGAGTGGAATGCGAAAACGGCATAAGC
->read2921_contig0_position4166_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCACATAGTGTACGTTGAGGCGGGAACTTCCCGCTGATATGATTGTGATCGATATTCAGACTCTAACAAGTGGTCAGTACAGGTTCGACCATACGCGACG
->read2922_contig0_position4604_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTATAGGGCGGACGTAAACGCCAATTCCGCTTAATAGCGGAATCTGCTGGCTTGTGCATTCGTCGGCCTATTAGATACGGTACGGAATATTGGGTAACC
->read2923_contig0_position5085_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTGGAGTACAGGTGCCCATAACCCGATGAGGCCAAGGTGTTACGTGAAGTCGCGCTGTCGCTAGTAACAGATTGGGAGGTCTCGGCCAATTCGTTGTAT
->read2924_contig0_position2553_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAATGCGGGAGTCAGGACGATAGAGCGAAGTAGTTACGGTGATTACCCGTCCATCGATGCCCCTCCTGTCCCGAAGCCTTAAAATCTAACCCTGAATTGG
->read2925_contig0_position2603_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCATCGATGCCCCTCCTGTCCCGAAGCCTTAAAATCTAACCCTGAATTGGCTTTATCCACCCCCCCTACTGGCCACCACTGGGGCGCGAGTCTCGAGCCT
->read2926_contig0_position5404_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGACGGGCGACCGTACCCGGACACCTGGCAGCGGGAACCGCTTTGACTCTGGAGTGCCAGCGATAGTATCTCAGAGGCGAAAGCGCTTGTCACCTCATCT
->read2927_contig0_position1950_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTTGTCCTAACTTAGCACTATCGCACCACAAAATTTCAGCATAACGCATCCGGTTGAAGGCTGCGCATCGAGCAGCTTTCATTGGTCTTTCAGTCCCCA
->read2928_contig0_position1048_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCAAAGGGCCTGTAGGACCCTGGTTACGCGTTATTACCGGTCAGCTCCAGTTACGTCACGGACGTAGAGAGCCTTTGAATGTGTACGGCAATAGGAGAAA
->read2929_contig0_position1863_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCAGGAGGTTAACTTTGCGGAGCTCAACCTATAACGATAATCAAATTGAGACAGACGAGCTGGAGTGTTTTGATGAGCGGTGTTATATTTGTCCTAACT
->read2930_contig0_position7037_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCCACGAATTCGTGTGAGAACCGCCTAAACAGTTTAATCTGGCCAATATACCCTGGGGGGAGCTAATATATCGCGGCGTCGAGTTACCGTTCCACCACT
->read2931_contig0_position296_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AACTAGTTCTAGCATACTCCGCCTTGGGCCACACAATTAATATAAGACGGGATAATGGCTTCATGCTCATGTTCTATACCGAGCAGAGAGGTTGGGTCTA
->read2932_contig0_position7476_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGAATACAAATGACGGGAACTCTGACGAGAGGGTGCTTGAACGAGAGAAGCTAACAGTCATTGCGATGACGAGAGCAGCCCTACTGCCCGTCGTGAACG
->read2933_contig0_position169_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGGCCTCGAGATAGTGTCCAGGCGCTCTAACTGTATGGAGACCATAGGCATTTACCTTATTCTCATCGCCACGCCCCAAGATCTTTAGGACCCAGCATT
->read2934_contig0_position9712_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTGTACTACGGTATGGGAACACGTTTGCCGAACGTCTGGAAATCTGTCGAGTCATATCGATGAACAGAGACTAAATGTCCTTAAATCTCTAACACGATT
->read2935_contig0_position7490_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGGAACTCTGAAGAGAGGGTGCTTGAACGAGAGAAGCTAACAGTCATTGCGATGACGAGAACAGCCATACTGCCCGCCGTGAACGAGAACAAGCGTGTG
->read2936_contig0_position9145_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCCCACCTGTCCTGACCTCGCCGCAGGCATCGAGTCTAACTCTGATTCGAGAGACGGATGTAATTTAGTAAGGTCGGAACCGCTGGCAGAGCAGCTCCG
->read2937_contig0_position8059_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TATGCATTCGACCAAATGAAAATGTCAATAATCTCGACCCTGTAGTCCGCGGCCAATCAGCACGATCAAGCTAAAGACAGGGATTATGCACTAGCACGAC
->read2938_contig0_position6592_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTGCCCATCCGAGGCTTAAGCAGCGACTCCACATGGAGCGATGGGTCCTCAAGGCAGTATAAAATGGACTGCTATCTAGGCGTTAAAGTAGTAGAACGA
->read2939_contig0_position3641_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGTCTAGTAAACCAGAGATTCCATGGGCTCTCTGTTTCGTCGATTGTCTGAATATCGTGCAGTAAGTTTCTCTTAGGTTCCTCAACGGAAACGTCTCAG
->read2940_contig0_position5720_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCACTGTCCGCCTCGAACCACTACAATAAGATTACGGATAGCCCGTGGCTTGGTTGTTTTCTGAATTGTGGCTATCACAAATTGGGACCTAGTGTTGGCC
->read2941_contig0_position6133_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TATCCGTCCCGAACTGGCTTGAGCCACTCATAAGGCACGCGCGGGCCATAACAGTCGACTAAAAGGCGTAACCGATTCTGCTACGTTATAAAAAAGGGAC
->read2942_contig0_position2876_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTGCCCCACGGGGGCTACAATCCAGCAGTGAACGCGTTTACCTTAAGACGAAAGAGTCAGTAGAGTTGGGGTTCGTGCTTTAATCACCCGTAGCCCAAT
->read2943_contig0_position2058_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGACGTCCGAGCTCGAACCCGTCCGGCTAAGAGGCAGGCAGTCGCTGCATGTGTACGCAGCGGTCTATGCTACAGGTATTACGGAGTGAAACGGCTGCGA
->read2944_contig0_position8340_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGACCTTGGGCTCGTCAACATTCCTGGTAGTAATCCGATCTCAATTCCTGCGGTACCGAGCAGCTTTGAGTTTTTGTAAGTCCCACGGTTAATGGGCCAC
->read2945_contig0_position9669_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGGGGGAATCACCTTACTTAATCGGCTGGGGTAACGGCTGGTTTTGTACTACGGTATGGGAACCCGTTTGCCGAACGTCTGGAAATCTGTCGAGTCATA
->read2946_contig0_position2253_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTTCTGACGATTCGCGTGACCAGCGATAGTACGTTCCTTTTGTACTGAGTCTTAACATCGGCAAATGCGCCCTAGATACCTGCGGCTTCACTCCACAGT
->read2947_contig0_position4622_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGCGAATTCCGCTTAATAGCGGAATCTGCTGGCTTGTGCATTCGTCGGCCTATTAGATACGGTACGGAATATTGGGTAACCTCCTCTTCACTGATATCA
->read2948_contig0_position8676_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGAGCAAACGATGCGGTAAGACGAGCGCTCCGACCCCCCTTGGCTCTGCTACATTGAATTCAGCGTGTAAGGGCCCGCTTATCCGGTGGTGATACCTACT
->read2949_contig0_position4212_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GATCGATATTCAGACTCTAACAAGTGGTCAGTACAGGTTCGACCATACGCGACGGCAAACAGAATCGCACGTCAACTATCCCCTTTATTAATGATCCGTG
->read2950_contig0_position8556_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCGTCCTGAGGCCATATTAATTCTACTCAGATTGTCTGTAACCGGAGCTTCGGGCGTATTTTTGCGTAAGACACTGCCTAAAGGGAACATATGTGTCCA
->read2951_contig0_position3932_M5_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTAGGATGCACGACTACTTGTTAATGAAGTCGGCATGACTATCAAACCCATTTAATGATATGTGCTCTTGGACAACACGAGGTCGTAATTATTTCCTGA
->read2952_contig0_position7634_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGAGTGTGCTGAGGGCCGACGCCCGGGGACCGTGATATCCTTGCGAGTGGAATGCGAAAACGGCATAAGCGCAATGACCGAGGTAACAAGCCATGAGGA
->read2953_contig0_position4579_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGCATAGAGTCCCGCAGTGTCGGAGCGATAGGGAGGACGTAAACGCCAATTCCGCTTAATAGCGGAATCTGCTGGCTTGTGCATTCGTCGGCCTATTAG
->read2954_contig0_position4887_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCACATGAATGGGGTACGGTTTTACCGTCCATGACGTTGTGACATAAAGGTGCGGGACGCGGAAGCGCACCTCGTATAACGTTAGGGGTATCGTCACTG
->read2955_contig0_position2575_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGCGAAGTAGTTACGGTGATTACCCGTCCATCGATGCCCCTCCTGTCCCGAAGCCTTAAAATCTAACCCTGAATTGGCTTTATCCACCACCCCTACGGG
->read2956_contig0_position5244_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCGCAGGGTGGTATATATGATCCTTGATTGCTTTATGGCCATCATCATAGTAAATTTTTTCAGATTACCGTGCAGTCGTCCGCCTAAGATCCTAGTTGA
->read2957_contig0_position8653_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCAGAATAGGGTTCAACGGTGTATGAGCAAACGATGCGGTAAGACGAACGCTCCGACCCCCCTTGGCTCTGCTACATCGAATTCAGCGTGTAAGAGCCCG
->read2958_contig0_position2682_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGGGCGCGAGCCTCGAGCCTCTCGACTCCAAAGGGTCTGCCCGAGACAGGTTCACTGAGTCGTTACTCCCGGGATCCACTGCGTCTATTGTAAGAAATG
->read2959_contig0_position9779_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGACTAAATGTCCTTAAATCTCTAACACGATTTTCGTAGGTCTACTACTAGGCCGCTTGCTCAGAAATCGGAACACAAGTACGCGATCTCTTTTCTAGT
->read2960_contig0_position5179_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGTATTGATCGCTGTGCACTTTAAAATTCGGAACATCTTAACCAAAGCATATTAATATGCCAGCCGCGCAGGGTGGTATATATGATCCTTGATAGCTTT
->read2961_contig0_position7903_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCGTGTCACTCTGTAGCTCTAATACCAATTGAAATGAAGCTTACGCAAACTACTCGACGAACAACAGCAAGATTCGACGATCAAACTCGCCGGCGACAC
->read2962_contig0_position3809_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCCCTTTGTTATTCTAGTCAAGTGAAGAACCCGGGCCCAAAATTGGAACCCGTAATCTTCAAGTGAATCATCCGATCATGCAAACCTGATTATCTGCAC
->read2963_contig0_position7318_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCGACGTCTAAAAGCGCCAGATCGACTTGACTCTACGTGCTGCAATGGAGAACCGCGGAAGGAACTCTTTCTGGTGCCACTCGAGACCGCCCTCCCCGA
->read2964_contig0_position8967_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCATATTGAGACAGGGTTGAAAACCTGTCTGAAGTCCGTGCTTCCCTAACCAGCCTATGCGCCTTAACTTTATGCATACTCGTTTAGTACAGGGCCGCGC
->read2965_contig0_position1103_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCACGGACGTAGAGAGCCTTTGAACGTGTACGGCAATAGGAGAAACTCGGCCACGTACGTGTCAACATGGCGCGGCTCTCTATACCTCGCAAAGAATCAC
->read2966_contig0_position8461_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGATATCCTGCTTAGGCAGTACGGCCAATGCACGACCCTATATGACCCCTAGCGAGAAGTTATAGTCTAATAATGAATGGTGAACAGCACATCTTTTCGT
->read2967_contig0_position6078_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCACACTATTGTTCGGTGCGTGCGCTGCTTAGGCGGGTGCGACCCTTACAGCGTTATCCGTCCCGAACTGGCTTGAGCCACTCATAAGGCACGCGCGGG
->read2968_contig0_position4572_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TATGGGCGTGCATAGAGTCCCGCAGTGTCGGAGCGATAGGGAGGACGTAAACGCCAATTCCGCTTAATATCGGAATCTGCTGGCTTGTGCATTCGTCGGC
->read2969_contig0_position8162_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCAGGAAAGATCCGAGGCCTTTTCCAGGGTAAAATGATGGACTCATTGACCAACCCCTATTATTAGGAGAGGGCTGCGACTGCTTGCAGCTCCGACCGC
->read2970_contig0_position5254_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTATATATGATCCTTGATAGCTTTATGGCCATCATCATAGTAAATTTTTTCAGATTACCCTGCAGACGTCCGCCTAAGATCCTAGTTGAATTGATCAAT
->read2971_contig0_position8732_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AATTCAGCGTGTAAGAGCCCGCTTATCTGGTGGTGATACCTACTATTGACTGGGGGCTTACTGAGAACACTTCATCTGTATGGCAAAGTTGCGACACCGC
->read2972_contig0_position6315_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TAATATTGCGTGCAAGCTACTTCTAGACCTTATTAAGTGCCCAGGAATTCCTAGGAAGGCGCGCAGCTCAAGCAATCATACATGGCGGAATCCCTGTCCA
->read2973_contig0_position120_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCAAGATTTTGACATTTACAAGGCAACATTGAAGCGTCCGATGGTCCGGTGGCATCCAGATAGTGTCCAGTCGCTCTAACCGTATGGAGACCATAGGCA
->read2974_contig0_position4456_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AATTGTTCTTAGTATAGTGACCGTTATGGACGACGGACATAACTACTGAGTGTCCACCCTCGGCTAATCATGAACACCGGTCAGGCATGCTTACCTCCTG
->read2975_contig0_position5817_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCAATAAGCTTCATATCGCCTTCTCAGATAGACTAATAGAACGAAGTCCATATAACAGCTGATTTAAGAGGAAAAATTGAACATGAACGGAAGTACTAT
->read2976_contig0_position8861_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATACAAGAGGGTTAGGAGCTAAGAAACCGGTGCATCACCGTACGAAAAGGATGGTTGAAATAGAACGAGTTGTAAAACATTAGCTCACGCGCCACCGTCA
->read2977_contig0_position6099_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCGCTGCTCAGGCTGGTGCGACCCTTACAGCGTTATCCGTCCCGAACTGGCTTGAGCCACTCATAAGGCACGCGCGGGCCATAACAGTCGACTAAAAGG
->read2978_contig0_position6413_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CACCGGGGGTTCTACTGTACCACAGTGGCCTGGATAGCTAAGCAGGTCCTGGATTGGCATGTCATCCAGAGTGATAGGCACTGCTCACGACCAGCTTGCG
->read2979_contig0_position5552_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTAAGTAATCGACGGCCTTCGTCGGGCCGCTTATTGGTTCACCCAATCTGGCCATTGCCAGTTTGGCAGACGCGAGGTTGCGTTGTCAACCGAACGTTG
->read2980_contig0_position6782_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTAGAGCCTCGCTTGGGTCTCTACATCCGCTGATACGCGCGAGCTCTCACCCACGACTGTACCCCGGTTTAGATTTATAAACCATACATTTAACCCTTA
->read2981_contig0_position7812_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAAGCGGAGCCACACTCTCCGTTACTGACTGATTGACAATCCAGCCCGTTTGGGGTGATTTGTGCCGGCGCGTCCAGGTGCGAACGTTGTGCCGTGTCA
->read2982_contig0_position578_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGGCTCTTCTGTCTCTGGCGGGGACGGCTATGTCAGTTCATAAATCTCAATGTAGAAACTCCGATGGGCAGAAGCTAAAACTGAACAACGAGTGGGACA
->read2983_contig0_position3090_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTCCGCGAAACATTATTCAGTACAGCGACTTTTACCCTCGTGGTCTGAATGTTATGCCGTCCGACTCTTGCGCTCGGATGTCCGCAATGGGTTATCAAA
->read2984_contig0_position2666_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCTACTGGCCACCACTGGGGCGCGAGTCCCGAGCCTCTCCACTCCAAAGGGTCTGCCCGAGACAGGTTCACCGAGTCGTTACTCCCGGGATCCACTGCG
->read2985_contig0_position300_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTTCTAGCATACTCCGCCTTGGGCCACACAATTAATATAAGACGGGATAATGGCTTCATGCTCATGTTCTATACCGAGCAGAGAGGTTGGGTCTACCTA
->read2986_contig0_position5693_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCGTTAACTACTTAAAGTTCATAAGATCACTGTCCGCCTCGAACCACGACAATAAGATTACGGATAGCCCGTGGCTTGGTTGTTTTCTGAATTGTGGCT
->read2987_contig0_position5215_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTTAACCAAAGCATATTAATATGCCAGCCGCGCAGGGTGGTATATATGATTCTTGATAGTTTTATGGCCATCATCATAGTAAATTTTTTCAGATTACCC
->read2988_contig0_position9114_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TACATTAATCGCTTCTGTGATGACAGACCTAAGCCCACCTGTCCTGACCTCACCGCAGGCATCGAGTCTAACTCTGATTCGAGAGACGGATGTAATTTAG
->read2989_contig0_position5350_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAATTGAGTCCAGTACACCATATCAACAGCTTGATCGTTCCACTTCAATCAGCAAGACGGGCGACCGTACACGGACACCTGGCAGCGGGAACCGCTTTGA
->read2990_contig0_position6414_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCGGGGGTTCTACTGTACCACAGTGGCCTGGATAGCTAAGCAGGTCCTGGATTGGCATGTCATCCGGAGTGATAGGCACTGCTCACGACCAGCTTGAGG
->read2991_contig0_position7377_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGGAACACTTTCTGGTGCCACTCGAGACCGCCCTCCCCGACCCATATGCAGTTTCTGCATACACCGGGTAGACAACATTCTCAGCCCTTCGTTGAAAGG
->read2992_contig0_position4903_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGGTTTTACCGTCCATGACGTTGTGACATAAAGGTGCGGGACGCGGAAGCGCACCTCGTACAACGTTAGGGGTATCGTCACTGCATAGCAGAATGGGCG
->read2993_contig0_position7926_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TACCAATTGAAAAGATGCTTACGCAAACTACTCGACGAGCAACAGCAAGATTCGACGATCAAACTCGCCGGCGACACGAAGATTGTCATACTAGCTTTCA
->read2994_contig0_position551_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGGTAATGGAGCTCGAACACTACTCGGTGGCTCTTCTGTCTCTGGCGGGGACGGCTATGTGAGTTCATAAATCTCAATGTCGAAACTCCGATGGGCAGA
->read2995_contig0_position8721_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGCTACATCGAATTCAGCGTGTAAGAGCCCGCTTATCCGGTGGTGATACCTACTATTGACTGGGGGCTTACTGAGAACACTTCATCTGTATGGCAAAGT
->read2996_contig0_position4491_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCATAACTACTGAGTGTCCGCCCTCGGCTAATCATGAACACCGGTCAGGCATGCTTACCTCCTGCGACGGCATTGGCGATTATGGGCGTGCATAGAGTC
->read2997_contig0_position9125_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTCTGTGATGACAGACCGAAGCCCACCTGTCCTGACCTCACCGCAGGCATCGAGTCTAACTCTGATTCGAGAGACGGATGTAATTTAGTCAGGTCGGAA
->read2998_contig0_position4391_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTCTAGCTAGCTTGACTCGGCTGATAAAGAAAACAATCTATATGGAACCGAGGGGCGGGATGATAATTGTTCTTAGTATAGTGACCGTTATGGACGACG
->read2999_contig0_position2486_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGCGCGAGGTAGAGTATGCAGATTTCGTACCTTGCCACTGCTACCTCCGGCATATGGGCGTGCTATATATGCGGGAGTCAGGACGATAGAGCGAAGTAG
->read3000_contig0_position8408_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTTTTTGTAAGTCCCACGGTTAATGGGCCACTTATTTCGACATTCATGGCGCCGATATCCTGCTTAGGCAGTACGGCCAATGCACGACCCTATATGACC
->read3001_contig0_position2135_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTACGGAGTGAAACGGCTGCGAGCATCTCATAATCGGGCCACCCGATTTCAGCTTGGCCACAACAGAGACTAGCCACCAAGAGATGGGTTGATGGTAGC
->read3002_contig0_position4117_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCACGAATATCGTCCAAGACGTTTTGAGCCGGTGACTAATTCGGTTGTCGCACATAGTGTACGTTGAGGCGGGAACTTCCCGCTGATGTGATTGTGATCG
->read3003_contig0_position5725_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCCGCCTCGAACCACTACAATAAGATTACGGATAGCCCGTGGCTTGGTTGTTTTCTGAATTGTGGCTATTTCAAATTGGGACCTAGTGTTGGCCAATAA
->read3004_contig0_position5708_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGTTCAGAAGATCACTGTCCGCCTCGAACCACTACAATAAGATTACGGATAGCCCGTGGCTTGGTTGTTTTCTGAATTGCGGCTATCTCAAATTGGGAC
->read3005_contig0_position1213_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCTTGAGAGAATAGTCGACTAGTAGCGAATATATGTTCTGCTCCGAGACTTCGGCATAAATCTAAGTATGGACTCTTATATTCCCTCCTGCGTAGTGCT
->read3006_contig0_position1994_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGCATCCGGTTGAAGGCTGCGCATCGAGCAGCGTGCATTGGTCTTTCAGTCCTCAGTCACCGGAGACGTCCGAGCTCGAACCCGTCCGGCTAAGAGGCA
->read3007_contig0_position7723_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCCATGAGGACTGGAGCGGTAATGTGGTAGTGTAGTTGCCGGCCCCTGTGCTGACCTTATGTCCATATCGATACACGAAGGCCTGTGCGGAAGCGGAGC
->read3008_contig0_position9604_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCAGTGGTCATGTCATTATTGTACATCAGTACCATAGCTTGGCCACATGTGATGCTCGTACTCGAAGGGGGAATCACCTTACTTAATCGGCTGGGGTAA
->read3009_contig0_position3568_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTCGGTTATACGCCCTCGGGAGAAGACCCATGTAAGATGTATCCATCCCTACCACACGCGTCCGCCACCTCCGGGTCTAGTAAACCAGAGATTCCATGG
->read3010_contig0_position8632_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCTAAAGGGAACATATGTGTCCAGAATAGGGTTCAACGGTGTATGAGCAAACGATGCGGTAAGACGAGCGCTCCGACCCCCCTTGGCTCTGCTACATCG
->read3011_contig0_position1511_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGTATAAATTAGTGGGTTCACTTCCCTTTGACATCTTGTTCTCACAACTGCACACTCCGATGCTCTGCCGAGCCTTCTAACCATCGGGTATGTACATTC
->read3012_contig0_position2653_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTTATCCACCCCCCCTACTGGCCACCACTGGGGCGCGAGTCTCGAGCCTCTCGACTCCAAAGGGTCTGCCCGAGACAGGTTCACCGAGTCGTTACTCCC
->read3013_contig0_position2742_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGTTACTCCCGGGATCCACTGCGTCTATTGTAAGAAATGCAATGCGTGGCCAGTTTGTTCCGGCAGGACACCACTCTTTGAAGGTGCCCATTGCATTGT
->read3014_contig0_position676_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CACCGGCCTACTACATTATACAGTAGGGTAGAATCGCGTAGAAGCACCCACGATCAATGTTATTAACCGCGACGGTGTATTCCACGACCTAATTTTTCCC
->read3015_contig0_position8424_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGGTTAATGGGCCACTTATTTCGACATTCATGGCTCCGATATCCTGCTTAGGCAGTACGGCCAATGCACGACCCTATATGACCCCTAGCGAGAAGTTAT
->read3016_contig0_position2089_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGCAGGCAGTCGCTGCATGTGTACGCAGCGGTCTATGCTACAGGTATTACGGAGGGAAACGGCTGCGAGCAGCTCATAATCGGGCCACTCGATTTCAGC
->read3017_contig0_position1558_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTGCACACTCCGATGCTCTGCCGAGCCTTCTAACCATCGGGTATGTACATTCACCTTTGGACGCTTCGATAGGACATGCACCCGGTCCGTTGACTTACC
->read3018_contig0_position4176_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TACGTTGAGGCGGGAACTTCCCGCTGATATGATTGTGATCGATATTCAGACTCTAACAAGTGGTCAGTACAGGTTCGACCATACGCGACGGCAGACAGAA
->read3019_contig0_position9302_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TATCTTGAGAGCGTTTCTCCGTATCGAAATGTTCCGCTGTAAAGAACCTGGCGTATGCTGACCATGGAGCTGCAACACTTTCACACAGGTAGCCGAACAG
->read3020_contig0_position5275_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTTATGGCCATCATCATAGTAAATTTTTTCAGATTACCCTGCAGACGTCCGCCTAAGATCCTAGTTGAATTGTTCAATTGAGTCCAGTACACCATATCA
->read3021_contig0_position2067_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCTCGAACCCGTCCGGCTAAGAGGCAGGCAGTCGCTGCATGTGTACGCAGCGGTCTATGCTACAGGTGTTACGGAGTGGAACGGCTGCGAGCATCTCAT
->read3022_contig0_position60_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTGCCAGACGGTGACCAGGGCCGTTCGGCGTTGCATCGAGCGGTGTCGCTAGCCCAATGCGCAAGATTGTGACATTTACAAGGCTACATTGCAGCGTCC
->read3023_contig0_position2311_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGGCAAATGCGCCCTAGATACCTGCGGCTTCACTCCACAGTGTAAGAGTTGACGGGACTAAAACAGTATTGGGCGGTGAGGGGTACTCGACGCCTCTGC
->read3024_contig0_position840_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTGGACGTCGTTTGTGGATGGCTTTGGGAATCACTAGGTAATTACTGTTGGCTCCTTTCTTCATGATCGTCGGAGTTCTTTCAGGCCGATCAAGTGGTT
->read3025_contig0_position7150_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGAGTCCGCTTCCCGGGCTCGTCCGCGTCCCATCGGTTAATTCAATGTCCGTCAATAGGGTTGGCCAAAGATTCTACCTGTCCACCTGTCCGCTAGAAG
->read3026_contig0_position2254_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTCTGACGATTCGAGTGACCAGCGATAGTACGTTCCTTTTGTACTGAGTCTTAACATCGGCAAATGCGCCCTAGATACCTGCTGCTTCACTCCACAGTG
->read3027_contig0_position131_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GACATTTACAAGGCAACATTGCAGCGTCCGATGGTCCGGTGGCCTCCAGATAGTGTCCAGTCGCTCTAACTGTATGGAGACCATAGGCATTTACCTTATT
->read3028_contig0_position5724_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTCCGCCTCGAACCACTACAATAAGATTACGGATAGCCCGTGGCTTGGTTGTTTTCTGAATTGTGGCTATCTCAAATTGGGACCTAGTGTTGGCCAATA
->read3029_contig0_position5587_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGTTCACCCAATCTGGCCATTGCAAGTTTGGCAGACGCGAGGTTGCGTGGTCAACCGAACGTTGCTTTCCTTAGGGTACCCAGTATATTAACTTTATGA
->read3030_contig0_position1099_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TACGTCACGGACGTAGAGAGCCTTTGAATGTGTACGGCAATAGGAGAAACTCGGCCACGTACGTGTCAACATGGCGCGGCTCTCTATACCTCGCAAAGAA
->read3031_contig0_position8571_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TATTAATTCTACTCAGATTGTCTGTAACCGGAGCTTCGGGCGTATTTTTGCGTAAGACACTGCCTAAAGGGAACATATGTGTCCAGAATAGGGTTCAACG
->read3032_contig0_position6008_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTTGTGTTCCCTCAACACGTACGTTGACAGAGCTAACAATCCGTCGACTGAATGTGATTCCTTTGTTATTTCACACTATTGTTCGGTGCGTGCGCTGCT
->read3033_contig0_position7797_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CACGAAGGCCAGTGCGGAAGCGGAGCCACACTCGCCGTTACTGACTGATTGACAATCCAGCCCGTTTGGGGTGATTTGTGCCGGCACGTCCAGGTGCGAA
->read3034_contig0_position5837_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTATCAGATAGACTAATAGAACGAAGTCCATATAACAGCTGATTTAAGAGGAAAAATTGAACATCAACGGAAGTACTATAGCAGGCTCACCAGCATGAA
->read3035_contig0_position6952_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGGGGTCACAGATGAGCGTTCCGATTATCCTTTCCCAGGCTACGGCCTTATACCAAAGACTTCTAGACCGGAGAGACTACTTCCAGCCACGAATTCGTG
->read3036_contig0_position2453_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGCTTGTCGAATGAACAACTCAATTAGGGAGTGTGCGCGAGGTAGAGTATGCAGATTTCGAACCTTGCCACTGCTACCTCCGGCATATGGGCGTGCTAT
->read3037_contig0_position9597_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGATTGAGCAGTGGTCATGTCATTATTGTACATCAGTACCATAGCTTGGCCACATGTGATGCTCGTACTCAAAGGGGGAATCACCTTACTTAATCGGCT
->read3038_contig0_position1339_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCGCTGTATTTTTGTACGGCTTGATGTCAGGGTCAGTTTGGGCGCCGATATGTCTGTGTAAGGTTGGGCCAATCGAGAGGACATTTCGCAGCGCCCTTT
->read3039_contig0_position2410_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGTCAAAGTGGGAAATCCAGTCTCGACTATATCTACTATGTCATGCTTGTCGAATGAACAACTCAATTAGGTAGTGTGCGCGAGGTAGAGTATGCAGAT
->read3040_contig0_position1530_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CACTTCCCTTTGACATCTTGTTCTCACAACTGCACACTCCGATGCTCTGCCGAGCCTTCTAACCATCGGGTATGTACATTCACCTTTGGACGCTTCGATA
->read3041_contig0_position4372_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCCGCACTACTGAGACGAAGTCTAGCTAGCTGGACTCGGCTGATAAAGAAAACAATCTATATGGAACCGAGGGGCGGGATGATAATTGTTCTTACTATA
->read3042_contig0_position7689_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGAAAACGGCATAAGCGCAATGACCGAGGTAACAAGCCATGAGGACTGGAGCGGTAATGTGGTAGTGTAGTTGCCGGCCCCTGTGCTGACCTTATGTCCA
->read3043_contig0_position9039_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCATACTCGTTTAGTACAGGGCCGCGCCCCATGAGGCCATATGCGCCTGTCACGTGCATGCAGAAAGCGGCGCTTACATTAATCGCTTCTGTGATGACA
->read3044_contig0_position3833_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GAAGGACCCGGGCCCAAAATTGGAACGCGTAATCTTCAAGTGAATCATCCGATCATGCAAACCTGATTATCTGCACGACTCTTAAAATCATGCACTAAGC
->read3045_contig0_position4721_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCCTATCGGCGTTCAAAGTATTCGGCGGATGAATTAGTGCCAAAGCAGTAGGTTACCGTCGGCGCATAACCGGCGAGTGCTCTGAAACGTTACATTCGT
->read3046_contig0_position8064_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTCGACCAAATGAAAATGTCAATAATCTCGACCCTGTAGTCCGCGGCCAATCAGCACGATCAAGCTAAAGACAGGGATTATGCACTAGCACGACCGCCG
->read3047_contig0_position1527_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTCACTTCCCTTTGACATCTTGTTCTCACAACTGCACACTCCGATGCTCTGCCGAGCCTTCTAACCATCGGGTATGTACATTCACCTTTGGACGCTTCG
->read3048_contig0_position6769_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCGGCTATACTAGTTAGAGCCTCGCTTGGGTCTCTACATCCGCTGATACGCGCGAGCTCTCACCCACGAATGTACCCCGGTTAAGATTTATAAACCATA
->read3049_contig0_position5402_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CAAGACGGGCGACCGTACCCGGACACCTGGCAGTGGGAACCGATTTGACTCTGGAGTGCCAGCGATAGTATCTCAGAGGCGAAAGCGCTTGTCACCTCAT
->read3050_contig0_position6731_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGAACGTACGGACGGACAAAATGTCGGACACCGCCTTATCGGCTATACTAGTTAGAGCCTCGCTTGGGTCTCTACATCCGCTGATACGCGCGAGCTCTC
->read3051_contig0_position9361_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GACCATGGAGCTGCAACACTTTCACACAGGTAGCCGAACATGTATTACTCAGACTGGAGAGGAATCTTCATTGGTCGTGCAGACATTGTCGCTGCGTACC
->read3052_contig0_position9804_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACACGATTTTCGTAGGTCTACTACTAGGCCGCTTGCTCAGAAATCGGAACACAAGTACGCGATCTCTTTTCTAGTCACCAGCCTCAGGCATTCGCAAATT
->read3053_contig0_position641_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GATGGGCAGAAGCTAAAACTGAACAACGAGTGGGACACCGGCCTACTACATTATACAGTAAGGTAGAATCGCGTAGAAGCACCCACGATCAATGTTATTA
->read3054_contig0_position6543_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGACGAGCGATGGATTTAAACCGTTCACTGAACCCTCTAATAGGACCTCTTGCCCATCCGAGGCTTAAGCAGCGACTCCACAAGCAGAGATGGGTCCTC
->read3055_contig0_position3051_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGACTAGCGGGTGTCGTCAATGAAAACTGATCGAGCACTGTCCGCGAAACATTATTCAGTACAGCGACTTTTACCCTCGTGGTCTGAATGTTATGCCGT
->read3056_contig0_position7600_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GACTATCACGAGGAATTACGGATAACAGCCCACTTGGAGTGTGCTGAGGGCCGACGCCCGGGGACCGTGATATCCTTGCGAGTGGAATGCTAAAACGGCA
->read3057_contig0_position1337_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCGCGCTGTATTTTTGTACGGCTTGATGTCAGGGTCAGTTTGGGCGCCGGTATCTCTGTGTAAGGCTGGGCCAATCGAGAGGACATTTCGCAGCGCCCT
->read3058_contig0_position7576_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGAACAAGCGTGTGGAGAGTGACTGACTATCACGAGGAATTACGGATAACAGCCCACTTGGAGTGTGCTGAGGGCCGACGCCCGGGGACCGTGATATCCT
->read3059_contig0_position3498_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTACACTCATCACATAGCAGGTTCCACCCGAACCGCGCGTATTCTGCGACAGCATGAATCGTGTAACTCTGCTCGGTTATACGCCCTCGGGAGAAGACCC
->read3060_contig0_position2029_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCATTGGTCTTTCAGTCCCCAGTCACCGGAGACGTCCGAGCTCGAACCCGTCCGGCTAAGAGGCAGGCAGTCGCTGCATGTGTACGCAGCGGTCTATGCT
->read3061_contig0_position7836_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTGACTGATTGACAATCCAGCCCTTTTGGGGTGATTTGTGCCGGCGCGTCCAGGTACGAACGTTGTGCCGTGTCACTCTGTAGCTCTAATACCAATTGA
->read3062_contig0_position369_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTATACCGAGCAGAGAGGTTGGGTCTACCTAGTAGTGTCGCGGTTATCGGACAGAGGATTATGTAAGGGTACCGAAGACCGGGTAGCGTAGTTAGTAACT
->read3063_contig0_position2005_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGAAGGCTGCGCATCGAGCAGCGTGCCTTGGTCTTTCAGTCCCCAGTCACCGGAGACGTCCGAGCTCGAACCCGTCCGGCTAAGAGGCAGGCAGTCGCTG
->read3064_contig0_position8249_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGCTCCGACCGCTTTCCAATCGTTGCACATGACTTGAGTCTCGGGCTCGTATCTGTCTCCGTGTTCCTTTCGATAACTCTGCGACCTGAATGACCTTGG
->read3065_contig0_position542_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TAACATGAAGCGGTAAGGGTGCTCGAACACTAGTCGGTGGCTCTTCTGTCTCTGGCGGGGACGGCTATGTGAGTTCATAAATCTCAATGTCGAAACTCCG
->read3066_contig0_position6394_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACATGGCGGAATGCCTGTCCACCGGGGGTTCTACTGTACCACAGTGGCCTGGATAGCTAAGCAGGTCCTGGATTGGCATGTCATCCGGAGTGATAGGCAC
->read3067_contig0_position1249_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCTGCTCCGAGACTTCGGCATAATTCTAAGTATGGACTCTTATATTCCCTCCTGCGTAGTGCTCTCCCATAATAGGTGAACCCATGGGTCGCGCTGTAT
->read3068_contig0_position1765_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AATACGGTTGAAGTTATTACCAACTCCACTTCTGCAAATTGTTATGAGCAAGCATACAAGTTAGCCGGCCCACAAATCGACGTGTGTAATTGTTCAATGG
->read3069_contig0_position3757_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAATAAATTCGACACGGGGTACGAAGGGTAAGAACACCTAGCCTGGCAATTACCCCTTTGTTATTCTAGTCAAGTGAAGAACCCGGGCCCAAAATTGGA
->read3070_contig0_position5153_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGATTGGGAGGTCTCGGCCAATTCGTTGTATTGATCGCTGTGCACTTTAAAATTCGGAACATCTTAACCAAAGCATATTAATATGCCAGCCGCGCAGGG
->read3071_contig0_position3285_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCGTCTAGGAGGGCGTGCAGGGTCTCCCGCTAGCTAATGGTCACGGCCTCTCTGGGAAAGCTGAACAACGGATGGGATTAAGCTCAGCAGTCCGCCTCC
->read3072_contig0_position835_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTGGCCGGGACGTCGTTTGTGGATGGCTTTGGGAATCACTAGGTAATTACTGTTGGCTCCTTTCTTCATGATCGTCGGAGTTGTTTCAGGCCGATCAAG
->read3073_contig0_position390_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTCTACCTAGTAGTGTCGCGGTTATCGGACAGAGGATTATGTAAGGTTACCGAAGACCGGGTAGCGTAGTTAGTAACTTCAATCCGCGTTACGCTTTGT
->read3074_contig0_position3823_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTAGTCAAGTGAAGAACCCGGGCCCAAAATTGGAAACCGTAATCTTCAAGTGAATCATCCGATCATGCAAACCTGATTATCTGCACGACTCTTAAAATCA
->read3075_contig0_position5216_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTAACCAAAGCATATTAATATGCCAGCCGCGCAGGGTGGTATATATGATCCTTGATAGCTTTATGGCCATCATCATAGTAAATTTTTTCATCTTACCCT
->read3076_contig0_position1623_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCGATAGGACATGCACCCGGTCCGTTGACTTACCAACTTGATCGCCAGTGCGTGAGCGGTGGTTTATCTGTTGAGTGGCCACTTTTCCCTATCTGCTGG
->read3077_contig0_position6634_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGGTCCTCAAGGCAGTATAAAATGGACTGCTATCTAGGCGTTAAAGTAGTAGAACGAGGGTCGGGCGATTTCTTTTGGTAGTGGTTATCGCATTGCAAG
->read3078_contig0_position8_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGAATTGTGGGGCGGACCACGCTCTGGCTAACGAGCTGCCGTTTCCTTTAACCTGCCAGACGGTGACCAGGGCCGTTCGGCGTTACATCGAGCGGGGTC
->read3079_contig0_position7702_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCGCAATGACCGACGTAACAAGCCAAGAGGACTGGAGCGGTAATGTGGTAGTGTAGTTGCCGGCCCCTGTGCTGACCTTAGGTCCATATCGATACACGA
->read3080_contig0_position1125_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AATGTGTACGGCAATAGGAGAAACTCGGCCACGTACGTGTCAACATGGCGCGGCTCTCTATACCTCGCAAAGAATCACTCTATGGGTCATCTTGAGAGAA
->read3081_contig0_position303_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTAGCATACTCCGCCTTGGGCCACACAATTAATATAAGACGGGATAATGGCTTCATGCTCATGTTCTATACCGAGCAGAGAGGTTGGGTCTACCTAGTA
->read3082_contig0_position8907_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGGATGGTTGAAATAGAACGAGTTGTAAAACATTAGCTCACGCGCCACCGTCATAGGCTGCATATTGAGACAGGGTTGAAAACCCGTCTGAAGTCCGTG
->read3083_contig0_position61_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGCCAGACGGTGACCAGGGCCGTTCGGCGTTGCATCGAGCGGTGTCGCTAGCGCAATGCGCAAGATTTTGACATTTACAAGGCAACATTGCAGCGTCCG
->read3084_contig0_position8401_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCTTTGAGTTTTTGTAAGTCCCACGGTTAATGGGCCACTTATTACGACATTCATGGCTCCGATATCCTGCTTAGGCAGTACGGCCAATGCACGACCCTA
->read3085_contig0_position9704_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGCTGGTTTTGTACTACGGTATGGGAACCCGTTTGCCGAACGTCTGGAAATCGGTCGAGTCATATCGATGAACAGAGACTAAATGTTCTTAAATCTCTA
->read3086_contig0_position3649_M5_I0_D0_NG0______er0.01__indel0__rgeom0
-TAAACCAGAGATTGCATGGACTCTCTGTTTCGTCGATTGTTTGAACATTGTGCAGTAAGATTCTCTTAGGTTCCTCAACGGAAACGTCTCAGACCCACCT
->read3087_contig0_position5266_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTTGATAGCTTTATGGCCATCATCATAGTAAATTTTTTCAGATTACCCTGCAGACGTCCGCCTAAGATCCTAGTTGAATTGATCAATTGAGCCCAGTAC
->read3088_contig0_position9186_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTGATTCGAGAGACGGATGTAATTTAGTCAGGTCGGAACCGCTGGCAGAGCAGCTCCGAGGGCCTTTATACCCATACTGCCACTCCAGTAGCTGGGCCG
->read3089_contig0_position9416_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAGAGGAATCTTCATTGGTCGTGCAGACATTGTCGCTGCGTACCAAAGTAACTGGACGCCCATACCCGTTTGTCTATAGAAGCTCATGGATAAGAGTGT
->read3090_contig0_position130_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGACATTTACAAGGCAACATTGCAGCGTCCGATGGTCCGGTGGCCTCCAGATAGTGTCCAGTCGCTCTAACTGTATGGAGACCATAGGCATTTACCTTAT
->read3091_contig0_position5488_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTTGTCACCTCATCTAAAATCGCGACTATAGATCTGTTTAGAACCACGACCCAGAAATCTTTAGCTAAGTAATCGACTGCCTTCGTCGGGCCGCTTATT
->read3092_contig0_position695_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ACAGTAAGGTAGAATCGCGTAGAAGCACCCACGATCAATGTTATTAACCGCGACGGTGTATTCCACGACCTAATTTTTCCGGTCTCTGTTGTCAACCTGG
->read3093_contig0_position8062_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCATTCGACCAAATGAAAATGTCAATAATCTCGACGCTGTAGTCCGCGGCCAATCAGCACGATCAAGCTAAAGACAGGGATTATGCACTAGCACGACCGC
->read3094_contig0_position8005_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGATTGTCATACTAGCTTTCAGTCATTCCCCGTCAGTTTTTTCCATGTGGAGAATATGCATTCGACCAAATGAAAATGTCAATAATCTCGACCCTGTAGT
->read3095_contig0_position346_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GATAATGGCTTCATGCTCATGTTGTATACCGAGCAGAGAGGTTGGGTCTACCTAGTAGTGTCGCGGTTATCGGACAGAGGATTATGTAAGGTTACCGAAG
->read3096_contig0_position8632_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCTGAAGGGAACATATGTGTCCAGAATAGGGTTCAACCGTGTATGAGCAAACGATGCGGTAAGACGAGCGCTCCGACCCCCCTTGGCTCTGCTACATCG
->read3097_contig0_position4271_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGAATCGCACGTCAACTATCCCCTTTATTAATGATCCGTGTCCCCCGACCGTGTGCTGAGGAGACCCGTAATGCATGGAAAGTGCCAATATCCCCGGGA
->read3098_contig0_position3962_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGGCATGACTATCAAACCTATTTAATGATATTTGCTCTTGGACAACACGAGGTCGTAATTATTTCCTGAGATGGTTTTAGTGAGAGCAGCAGATGCACT
->read3099_contig0_position7123_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCGTTGCACCACCTCCAAGTGTCCATCGGCGTCCGCTTCCCGGGCTTGTCCGCGTCGCATCGGGTAATTCAATGTCCGTCAATCGGGTTGGCCAAAAAT
->read3100_contig0_position8127_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCTAAAGACAGGGATTATGCACTAGCACGACCGCCGCAGGAAAGATCCGAGGCCTTTTTCAGGGTAAAATGATGGACTCATTGACCAACCCCTATTATT
->read3101_contig0_position5841_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCAGATAGACTAATAGAACGAAGTCCATATAACAGCTGATTTAATAGCAAAAATTGAACATCAACGGAAGTACTATAGCAGGCTCACCAGCATGAAAGAC
->read3102_contig0_position9099_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTGAAAGCGGCGGTTACATTAATCGCTTCTGTGATGACAGACCGAAGCCCACCTGTCCTGACCTCACCGCAGGCATCGATTCTAACTCTGATTCGAGAG
->read3103_contig0_position5153_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGATTGGGAGGTCTCGGCCAATTCGTTGTATTGATCGCTGTGCACTTTAAAATTCGGAACATCTTAACCAAAGCATATTAATATGCCAGCCGCGCAGGG
->read3104_contig0_position5853_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATAGAACGAAGTCCATATAACAGCTGATTTAAGAGGAAAAATTGAACATCAACGGAAGTACTATAGCAGGCTCACCAGCATGAAAGACATCCTCATTGTG
->read3105_contig0_position3428_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGAACTCACGCTATTGGTAGTACCGCCTGCCGTCGCCTCGCGCCCATAATGTTTGGAACTCGCAAACCTTTACACTCATCACATAGCAGGGTCCACCCG
->read3106_contig0_position6652_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TAAAATGGACTGCTATCTAGGCGCTAAAGTAGTAGAACGAGGGTCGGGCGATTTGTTTTGGTAGTGGTTATCGCATTGCAAGAGCGTACGGACGGACAAA
->read3107_contig0_position9182_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAACTCTGATTCGAGAGACGGATGTAATTTAGTCAGGTCGGAACCGCTGGCAGAGCAGTTCCGAGGGCCTTTATACCCATACTGCCACTCCAGTACCTGG
->read3108_contig0_position2983_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGACCAACGCGTGAGTTTAAAATTGACTTGAAACCGCCTAGCTCGGACCACCAAAGAGCAAGACTCTATGACTAGCGGGTGTCGTCAATGAAAACTGAT
->read3109_contig0_position3162_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTCGGATGTCCGCAATGGGTTATCAAATGCCTATGTTCCGGTAATCTCTCATCTACTAAGCGCTCTAAAGGTCGTATGGTTGGAGGGCGGTTACACACC
->read3110_contig0_position945_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTAGGCCTATGCCAGACGATCGCAGCGGAGTCGATATAATTGCAGTATCATGTATCGCTGATTGTGGGGGGCATGGGGGTTCCGCATTGGCGCAAAGGT
->read3111_contig0_position3869_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CAAGTGAATCAGCCGATCATGCAAACCTGATTATCTGCACGACTCTTAAAATCATGCACTAAGCATAGAATGCACGACTACTTGTTAGTGAAGTCGGCAT
->read3112_contig0_position2229_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTAGCATCCCGGCTTCTGGGGCAATTTTTGACGATTCGAGTGACCAGCGATAGTACGTTCCTTTTGTACTGAGTCTTAACATCGGCAAATGCGCCCTAG
->read3113_contig0_position674_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GACACCGGCCTACTACAATATACAGTAAGGTAGAATCGCGTAGAAGCACCCACGATCAATGTTATTAACCGCGACGGTGTATTCGACGACCTAATTTTTC
->read3114_contig0_position2575_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGCGAAGTATTTACGGTGATTACCCGTCCATCGATGCCCCTCCTGTCCCGAAGCCTTAAAATCTAACCCTGAATTGGCTTTATCCACCCCCCCTACTGG
->read3115_contig0_position1011_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGGGGCATGGGGGTTCCGCATTGGCGCAAAGGTACCGCAAAGGGCCTGTATGACCCTGGTTACGCGTTTTTACCGGTCAGCTCCAGTTACGTCACGGAC
->read3116_contig0_position7993_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGGCGACACGAAGATTGTCATACTAGCTTTCAGTCATTCCCCCTCAGTTTTGTCCATGTGGAGAATATGCATTCGACCAAATGAAAATGTCAATAATCT
->read3117_contig0_position7009_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGACTTCTAGACCGGAGAGACTACTTCCAGCCACGAATTCGTGTGATAACCGCCTAAACAGTCTAATCTGGCCAATATACCCTGGGGGGAGCTAATATAT
->read3118_contig0_position7914_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGTAGCTCTAATACCAATTGAAATGAAACTTACGCAAACTACTCGACGAACAACAGCAAGATTCGACGATCAAACTCGCCGGCGACACGAAGATTGTCA
->read3119_contig0_position4754_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTAGAGCCAAAGCAGTAGGTTACCGTCGGCGCATAACCGGCGAGTGCTCTGAAACGTTACATTCGTCTATCCGCACACACCGCCGTTGGATGTGTCCCA
->read3120_contig0_position9223_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AACCGCTGGCAGAGCAGCTCCGAGGGCCTTTATACCAATACGGCCACTCCAGTACCTGGGCCGCGTGTTGTACGCTGTGTATCTTGAGAGCGTTTCTCCG
->read3121_contig0_position6783_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTAGAGCCACGCTTGGGTCTCTACATCCGCTGATACGCGCGAGCTCTCACCCACGACTGTACCCCGGTTAAGATTTATAAACCATACATTTAACCCTTAG
->read3122_contig0_position8039_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTTTTGTCCATGTGGAGAATATGCATTCGACCAAATGAAAATGTCAATAATCTCAACCGTGTAGTCCGCGGCCAATCAGCGCGATCAAGCTAAAGACAG
->read3123_contig0_position445_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AACCGGGTAGCGTAGTTAGTAACTTCAATCCGCGTTACGCTTTGTCCTCTGCTACGCCTCGATTGGTTTCAGCTCACGTGGGACGCATGTACTTACCTAA
->read3124_contig0_position8204_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCATTGACCACCCCCTATTATTAGGAGAGGGCTGCGACTGCTTGCAGCACCGACCGCTTTCCAATCGTTGCACATGACTTGAGGCTCGGACTCGTATCT
->read3125_contig0_position2734_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCACCGAGTCGTTACTCCCGGGATCCACTGCGTCTATTGTAAGAAATGCAATGCGTGGCCAGTTTGTTCCGGCAGGACACCACTCTTTGAAGGTGCCCAT
->read3126_contig0_position1741_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAACATTAGATAGGATATAAAAATAATACGGTTGATGTTATTACCAACTCCACTTCTGCAAATTGTTATGAGCAAGCATACAAGTTAGCCGGCCCACAAA
->read3127_contig0_position6132_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTATCCGTCCCGAACTGGCTTGAGCCACTCATAAGGCACGCGCGGGCCATAACAGTCGACTAAAAGGCGTAACCGATTCTGCTACGTTATAAAAAAGGGA
->read3128_contig0_position6134_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCCGTCCCGAACTGGCTTGAGCCACTCATAAGGCACGCGCGGGCCATAACAGTCGACTAAAAGGCGTAACCGATTCTGCTACGTTATAAAAAAGGGACG
->read3129_contig0_position3449_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TACTGCCTGCCGTCGCCTCGCGCCCATAATGTTTGGAACTCGCAAACCTTTACACTCATCACATAGCAGGTTCCCCCCGAACCGCGCGTATTCTGCGACA
->read3130_contig0_position9668_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAAGGGGGAATCACCTTACTTAATCGGCTGGGGTAACGGCTGGTTTTGTACTACGGTATGGGAACCCGTTTGCCGAACGTCTGGAAATCTGTCGAGTCAT
->read3131_contig0_position4475_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCGTTATGGACGACGGACATAACTACTGAGTGTCCGCCCTCGGCTAATCATGAACACCGGACAGGCATGCTTTCCTCCTGCGACGGCATTGGCGATTAT
->read3132_contig0_position9397_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-AACAGGTATTACTCAGACTGGAGAGGAATCTTCATTGGTCGTCCAGACCTTGTCGCTGCGTACCAAAGTAACTAGACGCCCATACCCCTTTGTCTACAGA
->read3133_contig0_position3475_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAATGTTTGGAACTCGCAAACCTTTACACTCATCACATAGCAGGTTCCACCCGAACCGCGCGTATTCTGCGACAGCATGAATCGTGTAACTCTGCTCGGT
->read3134_contig0_position9079_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TATGCGCCTGTCACGGGCATGCTGAAAGCGGCGGTTACATTAATCGCTTCTGTGATGACAGACCGAAGCCCACCTGTCCTGACCTCACCGCAGGCATCGA
->read3135_contig0_position6921_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TATTTTATGGTCTTAATTGAGTGTTCAGAGTTGGGGGTCACAGATGAGCGTTCCGATTGTCCTTTCCCAGGCTACGGCCTTATACCAAAGACTTCTAGAC
->read3136_contig0_position4363_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCCGGGAGTCCCGCACTACTGAGACGAAGTCTAGCTAGCTTGACTCGGCTGATAAAGAAAACAATCTATATGGAACCGAGGGGCGGGATGATAATTGTT
->read3137_contig0_position1109_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGTAGAGAGCCTTTGAATGTGTACGGCAATAGGAGAAACTCGGCCACGTACGTGTCAACATGGCGCGGCTCTCTATACCTCGCAAAGAATCACTCTATG
->read3138_contig0_position6920_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTATTTTATGGTCTTAATTGAGTGTTCAGAGTTGGGGGTCACAGATGAGCGTTCCGATTGTCCATTCCCAGGCTACGGCCTTATACCAAAGAATTCTAGA
->read3139_contig0_position8542_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GAACAGCACATCTTTTCGTCATGAGGCCATATTAATTCTACTCAGATTGTCTGTAACCGGAGCTTCGCGCGTATTTTTGCGTAAGACACTGCCTAAAGGG
->read3140_contig0_position9646_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCACATGTGATGCTCGTACTCGAAGGGGGAATCACCTTACTTAATCGGCTGGGGTAACGGCTGGTTTTGTACTACGGTATGAGAACCCGTTTGCCGAAC
->read3141_contig0_position5418_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCCGGACACCTGGCAGCGGGAACCGCTTTGACTCTGGAGTGCCAGCGATAGTATCTCAGAGGCGAAAGCGCTTGTCACCTCATCTAAAATCGCGACTAT
->read3142_contig0_position8741_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTAAGAGCCAGCTTATCCGGTGGTGATACCTACTATTGACTGGGGGCTTACTGAGAACACTTCATCTGTATGGCAAAGTTGCGACACCGCGCCACACAG
->read3143_contig0_position8403_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTTGAGTTTTTGTAAGTCCCACGGTTAATGGGCCACTTATTTCGACATTCATGGCGCAGATATCCTGCTTAGGCAGTACGGCCAATGCACGACCCTATC
->read3144_contig0_position9608_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGGTCATGTCATTATTGTACATCAGTACCATAGCTTGGCCACATGTGATACTCGTACTCGAAGGGGGAATCACCTTACTTAATCGGCTGGGGTAACGGC
->read3145_contig0_position2966_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTAGCCCAATTGCGCTCCCGAACAACGCGTGAGTTTAAAATTGACTTGAAACCGCCTAGCTCGGACCACCAAAGAGCAAGACTCTATGACTAGCGGGTGT
->read3146_contig0_position7811_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGAAGCGGAGCCACACTCGCCGTTACTGACTGATTGACAATCCAGCCCGTTTGAGGTGATTTGTGCCGGCGCGTCCAGGTGCGAACGATGTGCCGTGTC
->read3147_contig0_position1124_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAATGTGTACGGCAATAGGAGAAACTCGGCCACGTACGTGTCAACATGGCGCGGCTCTCTATACCTCGCAAAGACTCACTCTATGGGTCATCTTGAGAGA
->read3148_contig0_position4763_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAAGCAGTAGGTTACCGTCGGCGCATAACCGGCGAGTGCTCTGAAACGTTACATTCGTCTATCCGCACACACCGCCGTTGTATGTGTCCCACAGTGTTTT
->read3149_contig0_position9479_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TACCCCTTTGTCTACAGAAGCTCATGGATAAGAGTGTGCGAATAACATCACTTGTTACTTCACGGAACGCTTCTTGATCCTGAGCTCCCCCGCGATTAAC
->read3150_contig0_position8048_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CATGTGGAGAATATGCATTCGACCAAATGAAAATGTCAATAAGCTCGACCCTGTAGTCCGCGGCCAATCAGCACGATCAAGCTAAAGACAGGGATTATGC
->read3151_contig0_position8237_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCGACTGCTTGCAGCTCCGACCGCCTTCCAATCGCTGCACATGACTTGAGGCTCGGACTCGTATCTGTCTCCGTGTTCCTTTCGATAACTCTGCGACCT
->read3152_contig0_position3783_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGTAAGAACACCTAGCCTGGCAATTACCCCTTTGTTATTCTAGTCAAGTGAAGAACCCGGGCCCAAAATTGGAACCCGTAATCTTCAAGTTAATCATCC
->read3153_contig0_position1458_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTAAGCCTAATCAGGATCATAGATGGCCAATTATTGACCACAGGTAGGGGCGAGGTATAAATTAGTGGATTCACTTCCCTTTGACAGCTTGTTCTCACA
->read3154_contig0_position5675_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TTAACTTTTTGTAATTAGCGCGTTAACTCCTTAAAGTTCAGAAGATCACTGTCCGCCTCGAACCACTACAATAAGATTACGGATAGCCCGTGGCTTGGTT
->read3155_contig0_position2924_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGAAAGAGTCAGTAGGGTTGGGGTTCGTGCTTTAATAATCCGTAGCCCAATCGCGCTCCCGAACAACGCGTGAGTTTAAAATTGACTTGAAACCGCCTA
->read3156_contig0_position2134_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TATTACGGAGTGAAACGGCTGCGAGCATCTCATAATCGGGCCACCCGATTTCAGCTTGGCCACAACAGAGACTAGCCACCAAGAGATGGGTTGATGGTAG
->read3157_contig0_position2457_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGTCGAAAGAACAACTCAATTAGGTAGTGTGCGCGAGGTAGAGTATGCAGATTTCGTACCTTGCCACTGCTACCTCCGGCATATGGGCGTGCCATAAAT
->read3158_contig0_position4651_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGGCTTGTGCATTCGTCGGCCTATTAGATACGGTACGGAATATTGGGTAACCTCCTCTTCACTGATATCATCCTATCGGCGTTCAAAGTATTCGGCGGA
->read3159_contig0_position5339_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTGAATTGATCAATTGAGTCCAGTACACCATATCAACAGCTTGATCGTTCCACTTCAATCAGCAAGACGGGCGACCGTACCCGGACACCTGGCAGCGGG
->read3160_contig0_position6159_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCATAAGGCACGCGCGGGCCATAACAGTCGACTAAAAGGCGTAACCGATTCTGCTACGTTATAAAAAAGGGACGAGTGGGGTCAACAGTTCTTCTTCTT
->read3161_contig0_position2525_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCTACCTCCGGCATATGGGCGTGCTATAAATACGCGAGTCAGGACGATAGAGCAAAGTAGTTACGGTGATTACCCGTCCATCGATGCCCCTCCTGTCCC
->read3162_contig0_position1129_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTACGGCAATAGGAGAAACTCGGCCACGTACGTGTCAACATGGCGCGGCTCTCTATACCTCGCAAAGAATCACTCTATGGGTCATCTTGAGAGAATAGT
->read3163_contig0_position4453_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GATAATTGTTCTTAGTATAGTGACCGTTATGGACGACGGACATAACTACTGAGTGTCCGCCCTCGGCTAATCATGAACACCGGTCAGGCATGCTTACCTC
->read3164_contig0_position7008_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGACTTCTAGATCGGAGAGACTACTTCCAGCCACGAATTCGTGTGATAACCGCCTAAACAGTCTAATCTGGCCAATATACCCTGGGGGGAGCTAATATA
->read3165_contig0_position9489_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTACAGAAGCTCATGGATAAGAGTGTGCGAATAACATCACTTGTTACTTCACGGAACGCTTCTTGATCCTGAGCTCCCCCGCGATTAACCTATGTCGGG
->read3166_contig0_position1511_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGTATAAGTTAGTGGATTCACTTCCCTTTGACATCTTGTTCTCACATCTGCACACTCCGATGCTCTGCCGAGCCTTCTAACCATCGGGTATGTACATTC
->read3167_contig0_position1531_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTTCCCTTTGACATCTTGTTCTCACAACTGCACACTCCGATGCTCTGCCGAGCCTTCTAACCATCGGGTATGTACATTCACCTTTGGACGCTTCGATAG
->read3168_contig0_position5376_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGCTTGATCGTTCCACTTCAATCAGCAAGACGGGCGACCGTACCCGGACACCTGGCAGCGGGAACCGCCTTGACTCTGGAGTGCCAGCGATAGTATCTC
->read3169_contig0_position8703_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTACGACCCCCCTTGGCTCTGCTACATCGAATTCAGCGTGTAAGAGCCCGCTTATCCGGTGGTGATACCTACTATTGACTGGGGGCTTACTGAGAACACT
->read3170_contig0_position7124_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGTTGCACCACCTCCAAGTGTCCATCGGAGTCCGCTTCCCGGGCTTGTCCGCGTCCCATCGGTTAATTCAATGTCCGTCAATCGGGTTGGCCAAAAATT
->read3171_contig0_position1189_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGCAAAGAATCACTCTATGGGTCATCTTGAGAGAATAGTCGACTAGTAGCGAATATATGTTCAGCTCCGAGACTTCGGCATAAATCTAAGTATGGACTC
->read3172_contig0_position7161_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCCAGGCTTGTCCGCGTCCCATCGGTTAATTCAATGTCCGTCGATCGGGTTGGCCAAAAATTCTACCTGTCCACCTGTCCGCTAGAAGCAGATTATACG
->read3173_contig0_position3614_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCCTACCACACGCGTCCGCCACCTCCGGGTCTAGTAAACCAGAGATTCCATGGACTCTCTGTTTCGTCGATTGTCTGAATATCGTGCAGTAAGTTTCTC
->read3174_contig0_position3517_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTTCCACCCGAACCGCGCGTATTCTGCGACAGCATGAATCGTGTAACTCTGCTCGGTTATACGCCCTCGGGAGAAGACCCATGTAAGATGTATCCATCC
->read3175_contig0_position7267_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATATCCCGACACCGGCAGCTGAAATGATGCAGAAGCATTGCTTGCCACTCCGCCGATGTCTAAAAGCGCCAGAGCGACTTGACTCTACGTGCTGCAATGG
->read3176_contig0_position3151_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGACTCTTGCGCTCGGATGTCCGCATTGGGTTATCAAATGCCTATGTTCCGCTAATCTCTCGTCTACTAAGCGCCCTAAAGGTCGTATGGTTGGAGGGC
->read3177_contig0_position6743_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGGACAAAATGTCGGACACCGCCTTATCGGCTATACTAGTTAGAGCCTCGCTTGGGTCTCTACATCCGCTGATACGCGCGAGCTCTCACCCACGACTGT
->read3178_contig0_position5681_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTATGAAATTAGCGCGTTAACTACTTAAAGTTCAGAAGATCACTGTCCGCCACGAACCACTACAATAAGATTACGGATAGCCCGTGGCTTGGTTGTTTTC
->read3179_contig0_position7020_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGGAGAGACTACTTCCAGCCACGAATTCGTGTGATAACCGCCTAAACAGTCTAATCTGGCCAATATACCCTGGGGGGAGCTAATATATCGCGGCGTCGA
->read3180_contig0_position9174_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCTAGTCTAACTCTGATTCGAGAGACGGATGTAATTTAGTCAGGTCGGAACCGCTGGCAGAGCAGCTCCGAGGGCCTTTATACCCATACTGCTACTCCA
->read3181_contig0_position1466_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAATCAGGATCATAGATGGCCAATTATTGACCACAGGTAGGGGCGAGGTATAAATTAGTGGATTCACTTCCCTTTGACATCTTGTTCTCACAACTGCACA
->read3182_contig0_position6530_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCCTGCGTCCGGTAGACGAGCGATGGATTTAGACCGTTCACTGAAGCCTATACTAGGACCTCTTGCCCATCCGAGGCTTAAGCAGCGACTCCACATGGA
->read3183_contig0_position8307_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCGTGTTCCTTTCGATAACTCTGCGACCTGAATGACCTTGGGCTCGTCGACATTCCTGGTAGTAATCCGATCTCAATTCCTGCGGTACCGAGCAGCTTT
->read3184_contig0_position5879_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTTAAGAGGAAAAATTGAACATCAACGGAAGTACTATAGCAGGCTCACCAGCATGAAAGACATCCTCATTGTGAACCCGGCATCTCGTGATTCGAGCCT
->read3185_contig0_position8609_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCGTATTTTTGCGTAAGACACTGCCTAAAGGGAAGATATGTGTCCAGAATAGGGTTCAACGGTGTATGAGCAAACGATGCGGTAAGACGAGCGCTCCGA
->read3186_contig0_position4942_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGACGCGGAAGCGCACCTCGTATAACGTTAGGGGTATCGTCACTGCATAGCAGAATGGGCGATCGGCCTACAAGAGTACAGTACGAACGGTCTGGCCTTA
->read3187_contig0_position6798_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTCTCTACATCCGCTGATACGCGCGAGCTCTCACCCACGACTGTACCCCGGTTAAGATTTATAAACCATACATTTAAGCCTTAGTCATAAGATGATACT
->read3188_contig0_position2434_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGACTATATCTACTATGTCATGCTTGTCGAATGAACAACTCAATTAGGTAGTGTGCGCGAGGTAGAGTATGCAGATTTCGTACCTTGCCACTGCTACCTC
->read3189_contig0_position5019_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACAGTACTAACGGTCTGGCCTTATACAGCGCCACATCCGCCAATTCGCTAGGTTGTAGCCAGGAAGTCTTTAGTACAGGTGCCCATAACCCGATGAGGCC
->read3190_contig0_position3093_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGCGAAACATTATTCAGTACAGCGACTTTTACCCTCGTGGTCTGAATGTTATGCCGTCGGACTCTTGCGCTCGGATGTCCGCAATGGGTTATCAAATGC
->read3191_contig0_position4993_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGAATGGGCGATCGGCCTACAAGAGTACAGTACTAACGGTCTGGCCTTATACAGCGCCACATCCGCCAATTCGCTAGGTTGTACCCAGGAAGTCTGTAGT
->read3192_contig0_position8379_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCAATTCCTGCGGTACCGAGCAGCTTTGAGTTTTTGTAAGTCACACGGTTAATGGGCCACTTATTTCGACATTCATGGCGCCGATATCCTGCTTAGGCA
->read3193_contig0_position1572_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCTCTGCCGACCCTTCTAACCATCGGGTATGTACATTCACCTTTGGACGCTTCGATAGGACATGCACCCGGTCCGTTGACTTACCAACTTGATCGCCAG
->read3194_contig0_position8721_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGCTACATCGGATTCAGCGTGTAAGAGCCCGCTTATCCGGTGGTGATAACTACTATTGACTGGGGGCTTACTGAGAACACTTCATCTGTATGGCAAAGT
->read3195_contig0_position867_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAATCACTAGGTAATTACTGTTGGCTCCTTTCTTCATGATCGTCGGAGTTCTTTCAGGCCGATCAAGTGGTTAGAGACCTAGGTCTATGCCAGACGATC
->read3196_contig0_position3252_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTACACACCCTTAAGTACCGAACGATAGAGCACCCGTCTAGGAGGGCGTGCAGGGTCTCCCGCTAGCTAATGGTCAGGGCCTCTCTGGGAAAGCTGAAC
->read3197_contig0_position193_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTCTAACTGTATGGAGACCATAGGCATTTACCTTATTCTCATCGCCACGCCCCAAGATCTTTAGGACCCAGCATTCCTTTAACCACTAACATAACGCGT
->read3198_contig0_position3635_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCTCCGGGTCTAGTAAACCAGAGATTCCATGGACTCTCTGTTCCGTCGATTGTCTGAATATCTTGCAGTAAGTTTCTCTTAGGTTCCTCAACGGAAACG
->read3199_contig0_position9661_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGTACTCGAAGGGGGAATCACCTTACTTAATCGGCTGGGGTAACGGCTGGTTTTGTACTACGGTATGGGAACCCGTTTGCCGAACGTCTGGAAATCTGTC
->read3200_contig0_position2685_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCGCGAGTCTCGAGCCTCTCGACTCCAAAGGGGCTGCCCGAGACAGGTTCACCGAGTCGTTACTCCCGGGATCCACTGCGTCTATTGTAAGAAATGCAA
->read3201_contig0_position6197_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCGTAACCGATTCTGCTACGTTATAAAAAAGGGACAAGTGGGGTCAACAGTTCTTCTTCTTTGCTGTACGGTAATGCTTCCGCGCATCTAAGTGATATT
->read3202_contig0_position7725_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCATGAGGACTGGAGCGGTAATGTGGTAGTGTAGTTGCCGGCCCCTGTGCTGACCTTATGTCCATATCGATACACGAAGGCCAGTGCGGAAGCGGACCCA
->read3203_contig0_position3160_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGCTCGGATGTCCGCAATGGGTTATCAAATGCCTATGTTCCGGTAATCTGTCATCTACTAAGCGCCATAAAGATCGTATGGTTGGAGGGCGGTTACACA
->read3204_contig0_position8684_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGATGCGGTAAGACGAGCGCTCCGACCCCCCTTGGCTCTGCTACATCGAATTCAGCGTGTAAGAGCCCGCTTATCCGGTGCTGATACCTACTATTGACTG
->read3205_contig0_position4654_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTTGTGCATTCGTCGGCCTATTAGATACGGTACGGAATATTGGGTAACCTCCTATTCACTGATATCATCCTATCGGCGTTCAAAGTATTCGGCGGATGA
->read3206_contig0_position4635_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTAATAGCGGAATCTGCTGGCTTGTGCATTCGTCGGCCTATTAGATACGGTACGGAATATTGGGTAACCTCCTCTTCATTGATATCATCCTATCGGCGTT
->read3207_contig0_position889_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGCTCCTTTCTTCATGATCGTCGGAGTTCTTTCAGGCCGATCAAGTGGTTAGAGACCTAGGTCTATGCCAGACGATCGCAGCGGAGTCGATATAATTGC
->read3208_contig0_position4286_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTATCCCCTTTATTAATGATCCGTGTCCCCCGACCGTGTGCTGAGGAGACCCGTATTGCATGGAAAGTGCCAATATCCCCGGGAGTCCCGCACTACTGA
->read3209_contig0_position3793_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCTAGCCTGGCAATTACCCCCTTGTTATTCTAGTCAAGTGAAGAACCCGGGCCCAAAATTGGAACCCGTCATCTTCAAGTGAATCATCCGATCATGCAA
->read3210_contig0_position9552_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGATCCTGAGCTCCCCCGCGATTAACCTATGTCGGGACAAACACTCGATTGAGCAGTGGTCATGTCATTATTGTACATCAGTACCATAGCTTGGCCACA
->read3211_contig0_position1679_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGGTGGTTTATCTGTTGAGTGGCCACTTTTCCCTATCTGCTGGGAAGGCACTGGAGATCTGGAACATTAGATAGGATATAAAAGTAATACGGTTGATGT
->read3212_contig0_position8795_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGAACACTTCATCTGTATGGCAAAGTTGCGACACCGCGCCACACAGCAGTTTATTGTTAACACGCGATACAAGAGGGTTAGGAGCTAAGAAACCGGTGCA
->read3213_contig0_position7275_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACACCGGCAGCTGAAATGATGCAGAAGCCTTGCTTGCCACTCCGCCGATATCTAAAAGCGCCAGATCGACTTGACTCTACGTGCTGCAATGGAGAACCGC
->read3214_contig0_position9606_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGTGGTCATGTCCTTAGTGTACATCAGTACCATAGCTTGGCCACATGTGATGCTCGTACTCGAAGGGGGAATCACCTTACTTAATCGGCTGGGGTAACG
->read3215_contig0_position8762_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGCGATACCTACTATTGACTGGGGGCTTACTGAGAGCACTTCATCTGTATGGCAAAGTTGCGACACCGCGCCACACAGCAGATTATTGTTAACACGCGA
->read3216_contig0_position9128_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGTGATGACAGACCGAAGACCACCTGTCCTGACCTCACCGCAGGCATCGAGTCTAACTCTGATTCGAGAGACGGATGTAATTTAGTCAGGTCGGAACCG
->read3217_contig0_position3400_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CATTCACAAGGGTGTAGTTTTAGAGACTGAGAACTCACCCTATTGGTAGTACTGCCTGCCGTCGCCTCGCGCCCATAATGTTTGGAACTCGCAAACCTTT
->read3218_contig0_position3772_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGGGTACGAAGGGTAAGAACACCTAGCCTGGCAATTACCCCTTTGTTATTCTAGTCAAGTGAAGAACCCGGGCCCAAAATTGGAAGCCGTACTCTTCAA
->read3219_contig0_position1536_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTTTGACATCTTGTTCTCACAACTGAACACTCCGATGCTCTGCCGAGCCGTCTAACCATCGGGTATGTACATTCACCTTTGGACGCTTCGATAGGACAT
->read3220_contig0_position6812_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGATACGCGCGAGCTATCACCCACGACTGTACCCCGGTTAAGATTTATAGACCATACATTTAACCATTAGTCATAAGATGATACTTCATCTGCATGCGC
->read3221_contig0_position1602_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTACATTCACCTTTGGACGCTTCGATAGGACATGCACCCGGTCCGTTGACTTACCAACTTGATCGCCAGTGAGTGAGCGGTGGTTTATCTGTTGAGTGG
->read3222_contig0_position6672_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGTTAAAGTAGTAGAACGAGGGTCGGGCGATTTGTTTTGGTAGTGGTTATCGCATTGCAAGAACGTACGGACGGACAAAATGTCGGACACCGCCTTATC
->read3223_contig0_position2953_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTTTAATGACCCGTAGCCCAATTGCGCTCCCGAACAACGCGTGAGTTTAAAATTGACTTGAAACCGCCTAGCTCGGACCACCAAAGAGCAAGACTCTAT
->read3224_contig0_position2261_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGATTCGAGTGACCAGCGATAGTACGTTCCTTTTGTACTGAGTCTTAACATCGGCAAATGCGCCCTAGATACCTGCGGCTTCACTCCACAGTGTAAGAGT
->read3225_contig0_position49_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTTCCTTTAACCTGCCAGACGGTGACCAGGGCCGTTCGGCGTTGCATCGAGCGGTGTCGCTAGCGCAATGCGCAAGATTTTGACATTTACAAGGCAACA
->read3226_contig0_position2134_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TATTACGGAGTGAAACGGCTGCGAGCATCTCATAATCGGGCCACCCGATTTCAGCTTCGCCACAACAGAGACTAGCCACCAAGAGATGGGTTGATGGTAG
->read3227_contig0_position3752_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGCGGGAATAAATTCGGCACGGGGTACGAAGGGTAAGAACACCTAGCCTGGCAATTACCCCTTTGTTATTCTAGTCAAGTGAAGAACCAGGGCCCAAAA
->read3228_contig0_position6480_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAGTGATAGGCACTGCTCACGACCAGCTTGCGGACAAACGGGGTGCCCGCGCCTGCGTCCGGTAGACGAGCGATGGATTTAGACCGTTCACTGAACCCT
->read3229_contig0_position7637_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTGTGCTGAGGGCCGACGCCCGGGGACCGTGATATCCTTGCGAGTGGAATGCGAAAACGGCATAAGCGCAATGACCGAGGTAACAAGCCATGAGGACTG
->read3230_contig0_position4410_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCTGATGAGGAAAACAATCTATATGTAACCGAGGGGCGGGATGATAATTGTTCTTAGTATAGTGACCGTTATGGACGACGGACATAACTACTGAGTGTC
->read3231_contig0_position7224_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTACCTGTCCACCTGTCCGCTAGAAGCAGATTATACGGAATACATATCCCGACACCGGCAGCTGAAATGATGCAGAAGCCTTGCTTGCCACTCCGCCGAT
->read3232_contig0_position3662_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GCATGGACTATCTGTTTCGTCGATTGTCTGAATATCGTGCAGTAAGTTTCTCTTAGGTTCCTCAACGGAAACGTCTCAGACCCACCTTAGACGCGGGAAT
->read3233_contig0_position9622_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTGTACATCAGTACCATAGCTTGGCCACATGTGATGCTCGTACTCGAAGGGGGAATCACCTTACTTAATCGGCTGGGGTAACGGCTGGTTTTGTACTAC
->read3234_contig0_position8378_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTCAATTCCTGCGGTACCGAGCAGCTTTGAGTCTTTGTAAGTCCCACGGTTAATGGGCCACTTATTTCGACATTCATGGCGCCGATATCCTGCTTAGGC
->read3235_contig0_position3490_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GCAAAGCTTTACACTCATCACATAGCAGGTTCCACCCGAACCGCGCGTATTCTGCGACAGCATGAATCGTGTAACTCTGCTCGGTTATAGGCCCTCGGGA
->read3236_contig0_position2982_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCGAACAACGCGTGAGTTTAAAATTGACTTGAAACCGCCTAGCTCGGACCACCAAAGAGCAAGACTCTATGACTAGCGGGTGTCGTCAATGAAAACTGA
->read3237_contig0_position4041_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTGAGAGCAGCAGATGCACTCTTAGCTCCGCTGATAACGATTGCTATAAATCAGGGAATCTAACATCAATCTGCACCACGAATATCGTCCAAGACGTTT
->read3238_contig0_position3081_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCGAGCACTGTCCGCGAAACATTATTCAGTACAGCGACTTTTACCCTCGTGGTCTGAATGTTATGCCGTCCGACTCTGGCGCTCGGATGTCCGCAATGG
->read3239_contig0_position5040_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TATACAGCGCCACATCCGCCAATTCGCTAGGTTGTAGCCAGGAAGTCTGTAGTACAGGTGCCCATAACCCGATGAGGCCAAGGTGTTACGTGAAGTCGCG
->read3240_contig0_position3578_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGCCCTCGGGAGAAGACCCATGTAAGATGTATCCATCCCTACCACACGCCTCCGCCACCTCCAGGTCTAGTAAACCAGAGATTCCATGGACTCTCTGTT
->read3241_contig0_position5118_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAAGGTGTTACGTGAAGTCGCGTTGTCGCTAGTAACAGATTGGGAGGTCTCGTCCAATTCGTTGTATTGATCGCTGTGCACTTTAAAATTCGGAACATCT
->read3242_contig0_position186_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCAGTCGCTCTAACTGTATGGAGACCATAGGCATTTACCTTATTCTCATCGCCACGCCCCAAGATCTTTAGGACCCAGCATTCCTTTAACCACTAACAT
->read3243_contig0_position7475_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAGAATACTAATGACGGGAACTCTGACGAGAGGGTGCCTGAACGAGAGAAGCTAACAGTCATTGCGATGACGAGAACAGCCCTACTGCCCGCCGTGAAC
->read3244_contig0_position9584_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGGGACAAACACTCGATTGAGCAGTGGTCACGTCATTATTGTACATCAGTACCATAGCTTGGCCACATGTGATGCTCGTACTCGAAGGGGGAATCACCT
->read3245_contig0_position3802_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCAATTACCCCTTTGTTATTCTAGTCAAGTGAAGAACCCGGGCCCAAAATTGGAACCCGTAATCTTCAAGTGAACCATCCGATCATGCAAACCTGATTA
->read3246_contig0_position1252_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCTCCGAGACTTCGGCATAAATCTAAGTATGGACTCTTATATTCCCTCCTGCGTAGTGCTCTCCCATAATAAGTGAACCCAGGGGTCGCGCTGTATTTT
->read3247_contig0_position2118_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGTCTATGCTACAGGTATTACGGAGTGAAACGGCTGCGAGCATCTCATAATCGGGCCACCCGATTTCAGCTTGGCCACAACAGAGACTAGCCACCAAGA
->read3248_contig0_position2195_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACAACAGAGACTAGCCACCAAGAGATGGGTTGATGGTAGCATCCCGGCTTCTGGGGCAATTTCTGACGATTCGAGTGACCAGCGATAGTACGTTCCTTTT
->read3249_contig0_position1474_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCATAGATGGCCAATTATTGACCACAGGTAGGGGCGAGGTATAAATTAATGGATTCACTTCCCTTTGACATCTTGTTCTCACAACTGTACACTCCGATG
->read3250_contig0_position3742_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCACCTTAGACGCGGGAATAAATTCGACACGGGGTACGAAGGGTAAGAACACCTAGCCTGGAAATTACCCCTTTGATATTCTAGTCAAGTGAAGAACCC
->read3251_contig0_position2629_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTTAAAATCTAACCCTGGATTGGCTTTATCCACCCCCCCTACTGGCCACCACTGGGGCGCGAGTCTCGAGCCTCTCGACTCCAAAGGGTCTGCCCGAGA
->read3252_contig0_position6620_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCACATGGAGCGATGGGTCCTCACGGCAGTATAAAATGGACTGCTATCTAGGCGTTAAAGTAGTAGAACGAGGGTCGGGCGATTTGTTTTGGTAGTGGT
->read3253_contig0_position8148_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTAGCACGACCGCCGCAGGAAAGATCCGAGGCCTTTTCCAGGGTAAAATGATGGACTCATTGACCAACCCCTATTATTAGGAGAGGGCTGCGACTGCTT
->read3254_contig0_position5288_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCATAGTAAATTTTTTCAGATTACCCTGCAGACGTCCGCCTAAGATCCTAGTTGTATTGATCAATTGAGTCCAGTACACCATATCAACAGCTTGATCGT
->read3255_contig0_position8396_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGAGCAGCTTTGAGTTTTTGTAAGTCCCACGGTTAATGGGCCACTTATTTCGACATTCATGGCGTCGATATCCTGCTTAGGCAGTACCGCCAATGCACGA
->read3256_contig0_position6424_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTACTGTACCACAGTGGCCTGGATAGCTAGGCAGGTCCTGGATTGGCATGTCATCCGGAGTGATAGGCACTGCTCACGACCAGCTTGCGGACAAACGGGG
->read3257_contig0_position1910_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGAGACAGACGAGTTGGAGTGTTTTGATGAGCGGTGTTATATTTGTCCTAACTTTGCACTATCGCACCACAAAATTTCAGCATAAAGCATCCGGTTGAAG
->read3258_contig0_position6387_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CAATCATACATGGCGGAATGCCTGTCCACCGGGGGTTCTACTGTACCACAGTGGCCTGGATAGCTAAGCAGGTCCTGGATTGGCATGTCATCCGGAGTGA
->read3259_contig0_position2571_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GATAGAGCGAAGTAGTTACGGTGATTACCCGTCCATCGATGCCCCTCCTGTCCCGAAGCCTTAAAATCTAACCCTGAATTGGCTTTATCCACCCCCCCTA
->read3260_contig0_position1404_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGGCCAATCGAGAGGACATTTCGCAGCGCCCTTTCATCTCTATTGCTAGGTCTCTTAAGCCTAATCAGGATCATAGATGGCCAATTATTGACCACAGGT
->read3261_contig0_position5624_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGAGGTTGCGTGGTCAACCGAACGTTGCTTTCCTTAGGGTACCGAGTATATTAACTTTATGAAATTAGCGCGTTAACTACTTAAAGTTCAGAAGATCAC
->read3262_contig0_position3140_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTTATGCCGTCCGACTCTTGCGCTCGGATGTCCGCAATGGGTTTTCAAATGCCTATGTTCCGGTAATCTCTCATCTACTAAGCGCCCTAAAGGTCGTAT
->read3263_contig0_position5876_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGATTTAAGAGGAAAAATTGAACATCAACGGAAGTACTATAGCAGGCTCACCAGCATGAAAGACATCCTCATTGTGGACCCGGCATCTCGTGATTCGAG
->read3264_contig0_position9205_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTAATATAGTCAGGTCGGAACCGCTGGCAGAGCAGCTCCGAGGGCCTTTATACCCATACTGCCACTCCAGTACCTGGGCCGCGTGTTGTACGCTGTGTAT
->read3265_contig0_position3942_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGACTACTTGTTACTGAAGTCGGCATGACTATCAAACCTATTTAATGATATATGCTCTTGGACAACACGAGGTCGTAATTATTTCCTGAGATGGTTTTA
->read3266_contig0_position446_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCGGGTAGCGTAGTTAGTAACTTCAATCCGCGTTACGCTTTGTCCTCTGCTACGCCTCGATTGGTTTCAGCTCACGTGGGACGCATGTACTTACCTAAC
->read3267_contig0_position5194_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCACTTTAAAATTCGGAACATCTTAACCAAAGCATATTAATATGCCAGCCGCGCAGGGTGGTATATATGATCCTTGATAGCTTTATGGCCATCATCATA
->read3268_contig0_position4615_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GACGTAAACGCCAATTCCGCTTAATAGCGGAATCTGCTGGCTTGTGCATTCGTCGGCCTATTAGATACGGTACGGAATATTGGGTAACCTCCTCTTCACT
->read3269_contig0_position5571_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGTCGGGCCGCTTATTGGTTCACCCAATCTGGCCATTGCAAGTTTGGCAGACGCGAGCTTGCGTGGTCAACCGAACGTTGCTTTCCTTAGGGTACCGAG
->read3270_contig0_position4445_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCGGGATGATAATTGTTCTTAGTATAGTGACCGTTAGGGACGACGGACATAACTACTGAGTGACCGCCCTCGGCTAATCATGAACACCGGTCAGGCATG
->read3271_contig0_position5338_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTTGAATTGATCAATTGAGTCCAGTACACCATATCAACAGCTTGATCGTTCCACTTCAATCAGCAAGACGGGCGACCGTACCCGGACACCTGGCAGCGG
->read3272_contig0_position1084_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGGTCAGCTCCAGTTACGTCACGGACGTAGAGAGCCTTTGAATGTGTACGGCAATAGGAGAAACTCGGCCACGTACGTGTCAACATGGCGCGGCTCTCT
->read3273_contig0_position1510_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGGTATAAATTAGTGGATTCACTTCCCTTTGACATCTTGTTCTCACAACTGCACACTCCGATGCTCTGCCGAGCCTTCTAACTATCGGGTATGTACATT
->read3274_contig0_position400_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GTAGTGTCGCGGTTGTCGGACAGAGGATTATGTAAGGTTCCCGGAGACCGGGTAGCGTAGTTAGTAACTTCAATCCGCGTTACGCTTTGTCCTCTGCTAC
->read3275_contig0_position5039_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTATACAGCGCCACATCCGCCAATTCGCTAGGTTGTAGCCAGGAAGTCTGTAGTACAGGTGCCCATAACCCGCTGAGGCCAAGGTGTTACGTGAAGTCGC
->read3276_contig0_position7330_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGCGCCAGATCGACTTGAATCTACGTGCTGCAATGGTGAACCGCGGAAGGAACACTTTCTGGTGCCACTCGAGACCGCCCTCCCCGACCCATATACAGT
->read3277_contig0_position4701_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCTCCTCTTCACTGATACCATCCTATCGGCGTTCAAAGTATTCGGCGGATGAATTAGAGCCAAAGCAGTAGGTTACCGTCGGCGCATAACCGGCGAGTG
->read3278_contig0_position8033_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCCTCAGTTTTGTCCATGTGGAGAATATGCATTCGACCAAATGAAAATCTCAATAATCTCGACCCTGTAGTCCGCGGCCAATCAGCACGATCAAGCTAA
->read3279_contig0_position2664_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCCCTACTGGCCACCACTGGGGCGCGAGTCTCGAGCCTCTCGACTCCAAAGGGTCTGCCCGAGACAGGTTCACCGAGTCGTTACTCCCGGGATCCACTG
->read3280_contig0_position2865_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCCCAGAAACCCTGCCCCACGGGGGCTACAATCCAGCAGTGAACGCGTTTACCTTAAGACTAAAGAGTCAGTAGAGTTGGGGTTCGTGCTTTAATGACC
->read3281_contig0_position4980_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCACTGCATAGCAGAATGGGCGATCGGTCTACAAGAGTACAGTACTAACGGTCTGGCCTTATACAGCGCCACATCCGCCAATTCGCTAGGTTGAAGCCA
->read3282_contig0_position1534_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCCTTTGACATCTTGTTCTCACAACTGCACACTCCGATGCTCTGCCGAGCCTTCTAACCATCGGGTATGTACATTCACCTTTGGACGCTTCGATAGGAC
->read3283_contig0_position9020_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTATGCGCCTTAACTTTATGCATACTCGTTTAGTACAGGGCCGCGCCCCATGAGGCCATATGCGCCTGTCACGGGCATTCTGAAAGCGGCGGTTACATT
->read3284_contig0_position4977_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCGTCACTGCATAGCAGAATGGGCGATCGGCCTACAAGAGTACAGTAATAACGGTCTGGCCTTATACAGCGCCACATCCGCCAATTCGCTAGGTTGTAG
->read3285_contig0_position2037_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTTCAGTCCCCAGTCACCGGAGACGTCCGAGCTCGAACCCGTCCGGCTACGAGGCAGGCAGTCGCTGCATGTGTACGCAGCGGTCTATGCTACAGGTAT
->read3286_contig0_position421_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGAGGATTATGTAAGGTTACCGAAGACCGGGTAGCGTAGTTAGTAACTTCAATCCGCGTTACGCTTTGTCCTCTGCTACGCGTCGATTGGTTTCAGCTCA
->read3287_contig0_position9779_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGACTAAATGTCCTTAAATCTCTAACACGATTTTAGTAGGTCTACTACTAGGCCGCTTGCTCAGAAATCGGAACACAAGTACGCGATCTCTTTTCTAGT
->read3288_contig0_position9407_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTCAGACTGGAGAGGAATCTTCATTGGTCGTGCAGACATTGTCGCTGCGTACCAAAGTAACTGGACGCCCATACCCCTTTGTCTACAGAAGCTCATGGA
->read3289_contig0_position70_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTGACCAGGGCCGTTCGGCGTTGCATCGAGCGGTGTCGCTAGCGCAATGCGCAAGATTTCGACATTTACAAGGCAACATTGCAGCGTCCGATGGTCCGG
->read3290_contig0_position6876_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCTTAGTCATAAGATGATACTTCATCTGCATGCGCGCATCTTCCTATTTTATGGGCTCAATTGAGTGTTCAGAGTTGGGGGTCACAGATGAGCGTTCCG
->read3291_contig0_position3938_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGCACGACTACTTGTTACTGAAGTCGGCATGACTATCAAACCTATTTAATGATATATGCTCTTGGACAACACGAGGTCGTAATTATTTCCTGTGATGGT
->read3292_contig0_position1350_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTGTACGGCTTGATGTCATGGTCAGTTTGGGCGCCGGTATGTCTGTGTAAGGTTGGGCCAATCGAGAGGACATTTCGCAGCGCCCTTTCATCTCTATTG
->read3293_contig0_position7561_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCCCGCCGTGAACGAGAACAAGCGTGTGGAGTGTGACTGACTATCACGAGGAATTACGGATAACAGCCCACTTGGAGTGTGCTGAGGGCCGACGCCCGG
->read3294_contig0_position8835_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACACAGCAGTTTATTGTTAACACGCGATACAAGAGGGTTAGGAGCTAAGAAACCGGTGCATCACCGTACGAAAAGGATGGTTTAAATAGAACGAGTTGTA
->read3295_contig0_position5201_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAAAATTCGGAACATCTTAACCAAAGCATATTAATATGCCAGCCGCGCAGGGTGGTATATATGATCCTTGATAGCTTTATGGCCATCACCATAGTAAATT
->read3296_contig0_position3749_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGACGCGGGAATAAATTCGACACGGGGTACGAATGGTAAGAACACCTAGCCTGGCAATTACCCCTTTGTTATTCTAGTCAAGTGAAGAACCCGGGCCCA
->read3297_contig0_position5456_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTGCCAGCGATAGTATCTCAGAGGCGAAAGCGCTTGTCACCTCATCTAAAATCGCGACTATAGATCTGTTTAGAACCACGACCCAGAAATCTTTAGCTA
->read3298_contig0_position633_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAAACTCCGATGGGCAGAAGCTAAAACTGAACAACGAGTGGGACACCGGCCTACTACATTATACAGTAAGGTAGAATCGCGTAGAAGCACCCACGTTCAA
->read3299_contig0_position3712_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTTAGGTTCCTCAACGGAAACGTCTCAGACCCACCTTAGACGCGGGAATAAATTCGACACGGGGTACGAAGGGTAAGAACACCTAGCCTGGCAATTACC
->read3300_contig0_position2621_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCCGAAGCCTTAAAATCTAACCCTGAATTGGCTTTATCCACCCCCCCTACTGACCACCACTGGGGCGCGAGTCTCGAGCCTCTCGACTCCAAAGGGTCT
->read3301_contig0_position3912_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTTAAAATCATGCACTAAGCATAGAATGCACGACTACTTGTTACTGAAGTCGGCATGCCTATCAAACCTATTTAATGATATATGCCCTTGGACAACACG
->read3302_contig0_position6288_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTGATATTCGCCGGAATTTACCCTTCTAATATTGTGTGCAAGCTACTTCTAGACCTTATTAAGTGCCCAGGAATTCCTAGGAAGGCGCGCAGCTCAAGC
->read3303_contig0_position5718_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GATCACTGTCCGCCTCGAACCACTACAATAAGATTACGGATAGCCCGTGGCTTGGTTGTTTTCTGAATTGTGGCTATCTCAAATTGGGACCTAGTGTTGG
->read3304_contig0_position6948_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGTTGGGGGTCACAGATGAGCGTTCCCATTGTCCTTTCCCAGGCTACGGCCTTATACCAAAGACTTCTAGACCGGAGAGACTACTTCCAGCCACGAATT
->read3305_contig0_position4786_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CATAACCGGCGAGTGCTCTGAAACGTTACATTCGTCTATCCGCAGACACCGCCGTTGGATGTGTCCCACAGTGTTTTATACGGGACGGTGGCCACGGGGT
->read3306_contig0_position1067_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGGTTACGCGTTATTACCGGTCAGCTCCAGTTACGTCACGGACGTAGAGAGCCTTTGAATGTGTACGGCAATAGGAGAAACTCGGCCACGTACGTGTCA
->read3307_contig0_position2634_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAATCTAACCCTGAATTGGCTTTATCCACCCCCCCTACTGGCCACCACTGGGGCGCGAGTCTCGAGCCTCTCGACTCCAAAGGGTCTGCCCGAGACAGGT
->read3308_contig0_position6901_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTGCATGCGCGCATCTTCCTATTTTATGGTCTTAATTGAGTGTTCAGAGTTGGGGGTCACAGATGAGCGTTCCGATTGTCCTTTCCCAGGCTACGGCCT
->read3309_contig0_position2612_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCCTCCTGTCCCGAAGCCTTAAAATCTAACCCTGAATTGGCTTTATCCACCCCCCCTACTGGCCACCACTGGGGCGCGAGTCTCGAGCCTCTCGACTCC
->read3310_contig0_position899_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTCATGATCGTCGGAGTTCTTTCAGGCCGATCAAGTGGTTAGAGACCTAGGTCTGTGCCAGACGATCGCAGCGGAGTCGATATAATTGCAGTATCATGT
->read3311_contig0_position338_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TAAGACGGGATAATGGCTTCATGCCCATGTTCTATACCGAGCAGAGAGGTTGGGTCTACCTAGTAGTGTCGCGGTTATCGGACAGAGGATTATGTAAGGA
->read3312_contig0_position8153_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CACGACCGCCGCAGGAAAGATCCGAGGCCTTTTCCAGCGTAAAATGATGGACTCATTGACCAACCCCTATTATTAGGAGAGGGCTGCGACTGCTTGCAGC
->read3313_contig0_position8368_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTAATCCGATCTCAACTCCTGCGGTACCGAGCAGCTTTGAGTTTTTGTAAGTCCCACGGTTAATGGGCCACTTATTTCGACATTCATGGCGCCGATATC
->read3314_contig0_position3649_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAAACCAGAGATTCCATGGACTCTCTGTTTCGTCGATTGTCTGCATATCGTGCAGTAAGTTTCTCTTAGGTTCCTCAACGGAAACGTCTCAGACCCACCT
->read3315_contig0_position4957_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTCGTATAACGTTAGGGGTATCGTCACTGCATAGCAGAATGGGCGATCGGCCTACAAGAGTACAGTACGAACGGTCTGGCCTTATACAGCGCCACATCC
->read3316_contig0_position2039_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCAGTCCCCAGTCACCGGAGACGTCCGAGCTCGAACCCGTCCGGCTAAGAGGCAGGCAGTCGTTGCATGTGTACGCAGCGGTCTATGCTACAGGTATTA
->read3317_contig0_position9384_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACACAGGTAGCCGAACAGGTATTACTCAGACTGGAGAGGAATCTTCATTGGTCGTGCAGACATTGTCGCTGCGTACCAAAGTAACTGGACGCCCATACCC
->read3318_contig0_position343_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGGATAATGGCTTCATGCTCATGTTCTATACCGAGCAGAGAGGTTGGGTCTACCTAGTAGTGTCGCGGTTATCGGACAGAGGATTATGTAAGGTTACCG
->read3319_contig0_position2479_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGTAGTGTGCGCGAGGTAGAGTATGCAGATTTCGTACCTTGCCACTGCTACCTCCGGCATATGGGCGTGCTATAAATGCGGGAGTCAGGACGATAGAGC
->read3320_contig0_position5476_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGAGGCGAAAGCGCTTGTCACCTCATCTAAAATCGCGACTATAGATCTGTTTAGAACCACGACCCAGAAAGCTTTAGCTAAGTAATCGACTGCCTTCGTC
->read3321_contig0_position8744_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGAGCCCGCTTATCCGGTGGTGATACCTACTATTGACTGGGGGCTTACTGAGAACACTTCATCTGTATGGCAAAGTTGCGACACCGCGCCACACAGCAG
->read3322_contig0_position5207_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGGAACATCTTAAACAGAGCATATTAATATGCCAGCCGCGCAGGGTGGTATATATGATCCTTGATAGCTTTATGGCCATCATCATAGTAAATTTTTTCA
->read3323_contig0_position4891_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CATGAATGGGGTACGGTTTTTCCGTCCATGACGTTGCGACATAAAGGTGCGGGACGCGGAAGCGCACCTCGTATAACGTTCGGGGTATCGTCACTGCATA
->read3324_contig0_position5031_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCTGGCCTTATACAGCGCCACATCCGCCAATTCGCTAGGTTGTAGCCAGGAAGTCTGTAGTACAGGTGCCCATAACCCGAGGAGGCCAAGGTGTTACGT
->read3325_contig0_position7700_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAAGCGCAATGACCGAGGTAACAAGCCATGAGGACTGGAGCGGTAATGTGGTAGTGTAGTTGCCGGCCCCTGTGCTGACCTTATGTCCATATCGATACAC
->read3326_contig0_position6539_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGGTAGACGAGCGATGGATTTAGACCGTTCACTGAACCCTCTAATAGGACCTCTTGCCCATCCGAGGCTTAAGCAGCGACTCCACATGGAGCGATGGGT
->read3327_contig0_position6829_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCACCCACGACTGTACCCCGGTTAAGATTTATAAACCATACATTTAACCCTTAGTCATAAGATGATACTTGATCTGCATGCGCGCATCTTCCTATTTTAT
->read3328_contig0_position9135_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GACAGACCGAAGCCCACCTGTCCTGACCTCACCGCAGGCATCGAGACTAACTCTGATTCGAGAGACGGATGTAATTTAGTCAGGTCGGAACCGCTGGCAG
->read3329_contig0_position8035_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTCAGTTTTGTCCATGTGGAGAATATGCATTCGACCAAATGAAAATGTCACTAATCTCGACCCTGCAGTCCGCGGCCAATCAGCACGATCAAGCTAAAG
->read3330_contig0_position4426_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AATCTATATGGAACCGAGGGGCGGGATGATAATTGTTCTTAGTATAGTGACCGTTATGGACGACGGTCATAACTACTGAGTGTCCGCCCTCGGCTAATCA
->read3331_contig0_position8613_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TATTTTTGCGTAAGACACTGCCTAAAGGGAACATATGTGTCCAGAATAGGGTTCAACGGTGTATGAGCAAACGATGCGGTAAGACGAGCGCTCCGACCCC
->read3332_contig0_position9737_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGCCGAACGTCTGGAAATCTGTCGAGTCATATCGATGAACAGAGACTAAATGTCCTTAAATCTCTAACACGATTTTAGTAGGTCTACTACTAGGCCGCT
->read3333_contig0_position2347_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CACAGTGTAAGAGTTGACGGGACTAAAACAGTATTGGGCGGTGAGGGGTACCCGACGCCTCTGCTGTCAAAGTGGGAAATCCAGTCTCGACTTTATCTAC
->read3334_contig0_position5757_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATAGCCCGTGGCTTGGTTGTTTTCTGAATTGTGGCTATCTCAAATCGGGACCTAGTGTTGGCCAATAAGCTTCATATCGCCTTCTCAGATAGACTAATAG
->read3335_contig0_position7019_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCGGAGAGACTAATTCCAGACACGAATTCGTGTGATAACCGCCTAAACAGTCTAATCTGGCCAATATTCCCTGGGGGGAGCTAATATATCGCGGCGTCG
->read3336_contig0_position2764_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGTCTATTGTAAGAAATGCAATGCGTGGCCAGTTTGTTCCGGCAGGACACCACTCTTTGAAGGTGCCCATTGCATTGTAGCCTGAAATATTAGCAATCCT
->read3337_contig0_position3963_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGCATGACTATCAAACCTATTTAATGATATATGCTCTTGGACAACACGTGGTCGTAATTATTTCCTGAGATGGTTTTAGTGAGAGCAGCAGATGCACTC
->read3338_contig0_position3863_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AATCTTCAAGTGAATCCTCCGATCATGCAAACCTGATTATCTGCACGACTCTTAAAATCATGCACTAAGCATAGAATGCACGACTACTTGTTACTGAAGT
->read3339_contig0_position1852_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTTGTTCAATGGCAGGAGGTTAACTTTGCGGAGCTCAACCTATAACGATAATCAAATTGAGACAGACGAGTTGGAGTGTTTTGATGAGCGGTGTTATAT
->read3340_contig0_position2506_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGATTTCGTACCTTGCCACTGCTACCTCCGGCATATGGGCGTGCTATAAATGCGGGAGTCAGGTCGATAGAGCGAAGTAGTTACGGTGATTACCCGTCCA
->read3341_contig0_position776_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCTCTGTGGTCAACCTGGACGCACAAACCCTAGTCCCATATAAAGCTATTCCACGCCGGGTGGCCTGGACGTCGTTTGTTGATGGCTTTGGGAATCACT
->read3342_contig0_position59_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCTGCCAGACGGTGACCAGGGCCGTTCGGCGTTGCATCGAGCGGTGTCGCTAGCGCAATGCGCAAGATTTTGACATTTACAAGGCAACATTGCAGCGTC
->read3343_contig0_position7855_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCCCGTTTGGGGTGATTTGTGCCGGCGCGTCCAGGTGCGAACGTTGTGCCGTGTCACTCTGTAGCTCTAATACCAATTGAAATGAAGCTTACGCAAACT
->read3344_contig0_position8637_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGGGAACATATGTGTCCAGAATAGGGTTCAACGGTGTATGAGCAAACGATGCGGTAAGACGACCGCTCCGACCCCCCTTGGCTCTGCTACATCGAATTC
->read3345_contig0_position7958_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGACGAACAACAGCAAGATTCGACGATCAAACTCGCCGGCGACACGAAGATTGTCATACTAGCTTTCAGTCATTCCCCCTCAGTTTTGTCCATGTGGAGA
->read3346_contig0_position9801_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTAACACGATTTTAGTAGGTCTACTACTAGGCCGCTTGCTCAGAAATCGGAACACAAGTACGCGATCTCTTTTCTAGTCACCAGCCTCAGGCATTCGCAA
->read3347_contig0_position7562_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCCGCCGTGAACGAGAACAAGCGTGTGGAGAGTGACTGACTATCACGAGGAATTACGGATAACAGCCCACTTGGAGTGTGCTGAGGGCCGACGCCCGGG
->read3348_contig0_position4649_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCTGGCTTGTGCATTCGTCGGCCTATGAGATACGGTACGGAATATTGGGTAACCTCCTCTTCACTGATATCATCCTATCGTCGTTCAAACTATTCGGCG
->read3349_contig0_position7363_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGGAGAACCGCGGAAGGAACACTTTCTGGTGCCACTCGAGACCGCCCTCCCCGACCCATATGCAGTTTCTGCATACACCGGGTAGACAACATTCTCAGC
->read3350_contig0_position8042_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTGTCCATGTGGAGAATATGCATTCGACCAAAGGAAAATGTCAATAATCTCGACCCTGTAGTACGCGGCCAATCAGCACGATCAAGCTAAAGACAGGGA
->read3351_contig0_position8302_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGTCTCCGTGTTCCTTTCGATAACTCTGCGACCTGAATGACATTGGGCTCGTCGACATTCCTGGTAGTAATCCGATCTCAATTCCTGCGGTACCGAGCA
->read3352_contig0_position8635_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TAAAGGGAATATATGTGTTCAGAATAGGGTTCAACGGTGTATGAGCAAACGATGCGGTAAGACGAGCGCTCCGACCCCCCTTGGCTCTGCTACATCGAAT
->read3353_contig0_position7572_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AACGAGAACAAGCGTGTGGAGAGTGACTGACTATCACGAGGAATTACGGATAACAGCCCACTTGGAGTGTGCTGAGGGCCGACGCCCGGGGACCGTGATA
->read3354_contig0_position4955_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CACATCGTATAACGTTAGGGGTATCGTCACTGCATAGCAGAATGGGCGATCGGCCTACAAGAGTACAGTACTAACGGTCTGGCCTTATACAGCGCCACAT
->read3355_contig0_position4257_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TACGCGACGGCAAACAGAATCGCACGTCAACTATCCCCTTTATTAATGATCCGTGTCCCCCGACCGTGTGCTGAGGAGACCCGTAATGCATGGAAAGTGC
->read3356_contig0_position20_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGGACCACGCTCTGGCTAACGAGCTACCGTTTCCTTTAACCTGCCAGACGGTGACCAGGGCCGTTCGGAGTTGCATCGAGCGGTGTCGCTAGCGCAATG
->read3357_contig0_position6979_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCCTTTCCCAGGCTACGGCCTTATACCAAAGACTTCTAGACCGGAGAGACTACTTCCAGCCACGAATTCGTGTGATAACCGCCTAAACAGTCTAATCTG
->read3358_contig0_position2582_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTAGTTACGGTGATTACCCGTCCATCGATGCCCCTCCTGTCCCGAAGCCTTAAAATCTAACCCTGAATTGGCTTTATCCACCCCCCCTACTGGCCACCAC
->read3359_contig0_position8573_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTAATTCTACTCAGATTGTCTGTAACCGGAGCTTCGGGCGGATTTTTGCGTAAGACACTGCCTAAAGGGAACATATGTGTCCAGAATAGGGTTCAACGGT
->read3360_contig0_position5964_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGTGATTCGAGCCTAACAGCATGCCATCTAACGTTTGGACGGGTCTTGGGTTCCCTAAACACGTACGTTGACAGAGCTAACAATCCGTCGACTGAATGT
->read3361_contig0_position4082_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTACTATAAATCAGCGAATCTAACATCAATCTGCACCACGAATATCGTCCAAGACGTTTTGAGCCCGTGACTAATTCGGTTGTCGCACATAGTGTACGTT
->read3362_contig0_position5955_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCGGCATCTCGTGATTCGTGCCTAACAGCATGCCATCTAACGTTTGTACGGGTCTTGTGTTCCCTCAACACGTACGTTGACAGAGCTAACAATCCGTCG
->read3363_contig0_position7804_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCAGTGCGGAAGCGGAGCCACACTCGCCGTTACTGACTGATTGACAATCCAGCCCGTTTGGGGTGATTTGTGCCGGCGCGTCCAGGTGCGAACGTTGCG
->read3364_contig0_position1377_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGGGCGCCGGTATGTCTGTGTAAGGTTGGGCCAATCGAGAGGACATTTCGCAGCGCCCTTTCATCTCTATTGCTAGGTCTCTTAAGCCTAATCAGGATC
->read3365_contig0_position8618_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGCGTAAGACACTGCCTAAAGGGAACATATGTGTCCAGAATAGGGTTCAACGGTGTATGAGCAAACGATGCGGTAAGACGAGCGCTCCGACCCCCCTTG
->read3366_contig0_position2632_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAAAATCTAACCCTGAATTGGCTTTATCCACCCCCCCTACTGGCCACCACTGGGGCGCGAGTCTCGAGCCTCTCGACTCCAAAGGGTCTGCCCGAGACAG
->read3367_contig0_position7418_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCATATGCAGTTTCTGCATACACCGGGTAGACAACATTCTCAGCCCTTCGTTGAAAGGAGAATACAAATGACGGGAACTCTGACGAGAGGGTGCTTGAA
->read3368_contig0_position3857_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCCGTAATCTTCAAGTGAATCATCCGATCATGCAAACCTGATTATCTGCACGACTCTTAAAATCATGCACTAAGCATAGAATGCACGACTACTTGTTAC
->read3369_contig0_position8719_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCTGCTACATCGAATTCAGCGTGTAAGAGCCCGCTTATCCGTTGGTGATACCTACTATTGACTGGGGGCTTACTGAGAACACTTCATCTGTATGGCAAA
->read3370_contig0_position3184_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCAAATGCCTATGTTCCGGTACTCTCTCATCTACTAAGCGCCCTAACGGTCGTATGGTTGGAGGGCGGTTACACACCCATAAGTACCGAACGATAGAGC
->read3371_contig0_position4139_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTGAGCCGGTGACTAATTCGGTTGTCGCACATAGTGTACGTTGAGGCGGGAACTTCCCGCTGATATGATTGTGATCGATATTCAGACTCTAACAAGTGG
->read3372_contig0_position9007_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTCCCTAACCAGCCTATGCGCCTTAACTTTATGCATACTCGTTTAGTACAGGGCCGCGCCCCATGAGGCCATATGCGCCTGTCACGGGCATGCTGAAAG
->read3373_contig0_position1442_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCTATTGCTAGGTCTCTTAAGCCTAATCAGGATCATAGATGGCCCATTATTGACCACAGGTAGGGGCGAGGTATAAATTAGTGGATTCACTTCCCTTTG
->read3374_contig0_position6004_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGGTCTTGTGTTCCCTCAACACGTACGTTGACAGAGCTAACAATCCGTCGACTGAATGTGATTCCTTTGTTATTTCACACTATTGTTCGGTGCGTGCGC
->read3375_contig0_position8235_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTGCGACTGCTTGCAGCTCCGACCGCTTTCCAATCGTTGCACATGACTTGAGGCTCGGACTCGTATCTGTCTCAGTGTTCCTTTCGATAACTCTGCGAC
->read3376_contig0_position8913_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTTGAAATAGAACGAGTTGTAAAACATTAGCTCACGCGCCACCGTAATAGGCTGCATATTGAGACAGGGTTGAAAACCTGTCTGAAGTCCGTGCTTCCC
->read3377_contig0_position3622_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACACGCGTCCGCCACCTCCGGGTCTAGTAAACCAGAGATTCCATGGACTCTCTGTTTCGTCGATTGTCTGAATATCGTGCAGTAAGTTTCTCTTAGGTTC
->read3378_contig0_position1091_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTCCAGTTACGTCACGGCCGTAGAGAGCCTTTGAATGTGTACGGCAATAGGAGAAACTCGGCCACGTACGTGTCAACATGGCGCGGCTCTCTATACCTC
->read3379_contig0_position7856_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCCGTTTGGGGTGATTTGTGCCGGCGCGTCCAGGTGCGAACGTTGTGCCGTGTCACTCTGTAGCTCTAATACCAATTGAAATGAAGCTTACGCAAACTA
->read3380_contig0_position6549_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCGATGGATTTAGACCGTTCACTGAACCCTCTAATACGACCTCTTGCCCATCCGAGGCTTAAGCAGCGACTCCACATGGAGCGATGGGTCCTCAAGGCA
->read3381_contig0_position9044_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTCGTTTAGTACAGGGCCGCGCCCCATGAGGCCATATGCGCCTGTCACGGGCATGCTGAAAGCGGCGGTTACATTAATCGCTTCTGTGATGACAGACCG
->read3382_contig0_position9238_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCTCCGAGGGCCTTTATACCCATACTGCCACTCCAGAACCTGGGCCGCGTGTTGTACGCTGTGTATCTTGACAGCGATTCTCCGTATCGAAATGTTCCG
->read3383_contig0_position4459_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTTCTTAGTATAGTGACCGTTATGGACGACGGACATAACTACTGAGTGTCCGCCCTCGGCTAAGCATGAACACCTGTCAGGCATGCTTACCTCCGGCGA
->read3384_contig0_position641_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GATGGGCAGAAGCTAAAACTGAACAACGAGTGGGACACCGGCCTACTACATTATACAGTAAGGTAGAATCGCGTATAAGCACCCACGATCAATGTTATTA
->read3385_contig0_position1241_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-AATATATGTTCTGCTCCGAGAGTTCGGCATAAATCTAGGTATGGACTCTTATATTCCCTCCTGCGTAGTGCTCTCCCATAAGAAGTGAACCCATGGGTCG
->read3386_contig0_position3216_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TACTAAGCGCCCTAAAGGTCGTATGGTTGGAGGGCGGTTACACACCCTTAAGTACCGAACGATAGAGCACCCGTCTAGGAGAGCGTGCAGGGTCTCCCGC
->read3387_contig0_position4146_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGTGACTAATTCCGTTGTCGCACATATTGTACGTTGAGGCGGGAACTTCCCGCTGATATGATTGTGATCGATATTCAGTCTCTAACAAGTGGTCAGTAC
->read3388_contig0_position5413_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCGTACCCGGACACCTGGCAGCGGGAACCGCTTTGACTCTGGAGTGCCTGCGATAGTATCTCAGAGGCGAAAGCGCTTGTCACCTCATCTAAAATCGCG
->read3389_contig0_position564_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGAACACTAGTCGGTGGCTCTTCTGTCTCTGGCGGGGACGGCTATGTGAGTTCATAAATCTCAATGTCGAAACTCCGATGGGCAGAAGCTAAAACTGAA
->read3390_contig0_position9820_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTACTACTAGGCCGCTTGCTCAGAAATCGGAACACAAGTACGCGATCTCTTTTCTAGTCACCAGCCTCCGGCATTCGCAAATTTCGTTCATGCACGCAA
->read3391_contig0_position7015_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTAGACCGGAGAGACTACTTCCAGCCACGAATTCGTGTGATAACCGCCTAAACAGTCTAATCTGGCCAATATACCCTGGGGGGAGCTAAAATATCGCGGC
->read3392_contig0_position5669_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTATATTAACTTTATGAAATTAGCGCGTTAACTACTTAAAGTTCAGAAGATCACTGTCCGCCTCGAAGCACTACAATAAGATTACGGCTAGCCCGTGGC
->read3393_contig0_position8687_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCGGTAAGACGAGCGCTCTGACCCCCCTTGGCTCTGCTACATCCAATTCAGCGTGTAAGAGCCCGCTTATCCGGTGGTGATACCTACTATTGACTGGGG
->read3394_contig0_position2127_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTACAGGTATTACGGAGTGTAACGGCTGCGAGCATCTCATAATCGGGCCACCCGATTTCAGCTTGGCCACAACAGAGACTAGCCACCAAGAGATGGGTTG
->read3395_contig0_position1277_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGTATGGACTCTTATATTCCCTCCTGCGTAGTGCTCTCCCATAATAAGTGAACCCATGGGTCGCGCTGTATTTTTGTACGGCTTGATGTCAGGGTCAGT
->read3396_contig0_position7212_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGCCAAAAATTCTACCTGTCCACCTGTCCGCTAGAAGCAGATTATACGGAATACATATCACGACACCGGCAGCTGAAATGATGCAGAAGCCTTGCTTGC
->read3397_contig0_position8737_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCGTGTAAGAGCCCGCTTATCCGGTGGTGATACCTACTATTGACTGGGGGCTTACTGAGAACACTTCATCTTTATGGCAAAGTTGCGACACCGCGCCAC
->read3398_contig0_position6972_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCGATTGTCCTTTCCCAGGCTACGGCCTGATACCAAAGACTTCTAGACCGGAGAGACTACTTCCAGCCACGAATTCGCGTGATAACCGCCTAAACAGTC
->read3399_contig0_position4658_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGCATTCGTCGGCCTATTAGAGACGGTACGGAATATTGGGTAACCTCCTCTTCACTGATATCATCCTATCGGCGTTCAAAGTATTCGGCGGATGAATTA
->read3400_contig0_position4309_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGTCCCCCGACCGTGTGCTGAGGAGACCCGTAATGCATGGAAAGTGCCAATATCCCCGGGAGTCCCGCACTACTGAGACGAAGTCTAGCTAGCTTGACT
->read3401_contig0_position3483_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAACTCGCAAACCTTTACACTCATCACATAGCAGGTTCCACCCGAACCGCGCGTATTCTGCGACAGCATGAATCGTGTAACTCTGCTCGGTTATACGCC
->read3402_contig0_position4850_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCACAGTGTTTTATACCGGACGGTGGCCACGGGGTGAGCACATGAATGGGGTACGGTTTTACCGTCCATGACGGTGTGACATAAAGGTGCGGGACGCGG
->read3403_contig0_position9633_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTACCATAGCTTGGCCACATGTGATGCTCGTACTCGAAGGGGGAATCACCTTACTTAATCGGCTGGGGGAACGGCTGGTTTTGTACTACGGTATGGGAAC
->read3404_contig0_position3128_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGTGGTCTGAATGTTATGCCGTCCGACTCTTGCGCTCGGATGTCCGCTATGGGTTTTCAAATGCCTATGTTCCGGTAATCTCTCATCTACTAAGCGCCC
->read3405_contig0_position1475_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCATAGATGGCCAATTATTGACCACAGGTAGGGGCGAGGTATAAATTAGTGGATTCACTTCCCTTTGACATCTTGTTCTCACAACTGCACACTCCGATGC
->read3406_contig0_position141_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGCAACATTGCAGCGTCCGAGGGTCCGGTGGCCTCCAGATAGTGTCCAGTCGCTCTAACTGTATGGAGACCATAGGCATTTACCTTATTCTCATCGCCA
->read3407_contig0_position3303_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGGGTCTCCCGCTAGCTAATGGTCACGGCCGCTCTGGGAAAGCTGAACAACGGATGGGATTAAGCTCAGCAGTCCGCCTCCAATCTCTCCGACGTTCAT
->read3408_contig0_position4417_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AAAGAAAACAATCTATATGGAACCGAGGGGCGGGATGATAATTGTTCTTAGTATAGTGACCGTTATGGACGAGGGGCATAACTACTGAGTGTCCGCCCTC
->read3409_contig0_position6818_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCGCGAGCTCTCACCCACGACTGTACCCCGGTTAAGATTTATAAACCATACATTTAACCCTTAGTCATAAGATGATACTTCATCTGCATGCGCGCATCT
->read3410_contig0_position5486_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGCTTGTCACCTCATCTAAAATCGCGACTATAGATCTGTTTAGAACCACGACCCTGAAATCTTTTGCTAAGTAATCGACTGCCTTCGTCGGGCCGCTTA
->read3411_contig0_position3025_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCGGACCACCAAAGAGCAAGACTCTATGACTAGCGGGTGTCGTCAATGAAAACTGATCGAGCACTGTCCGCGAAACATTATTCAGTACAGCGACTTTTA
->read3412_contig0_position6949_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTTGGCGGTCACAGATGAGCGTTCCGATGGTCCTTTCCCAGGCTACGGCCTTATACCAAAGACTTCTAGACCGGAGAGACTACTTCCAGCCACGAATTC
->read3413_contig0_position1066_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTGGTTACGCGTTATTACCGGTCAGCTCCAGTTACGTCACGGACGTAGAGAGCCTTTGAATGTGTACGGCAATAGGAGAAACTCGGCCACGTACGTGTC
->read3414_contig0_position9532_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTACTTCACGGAACGCTTCTTGATCCTGAGCTCCCCCGCGACTAACCTATGTCGGGACAAACACTCGATTGAGCAGTGGTCATGTCATTATTGTACATC
->read3415_contig0_position7768_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTGTGCTGACCTTATGTCCATATCGATACACGAAGGCCAGTGCGGAAGCGGAGCCACACTCGCCGTTACTGACTGATTGATAATCCAGCCCGTTTGGGG
->read3416_contig0_position5557_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTAATCGACTGCCTTCGTCGGGCCGCTTATTGGTTCACCCAATCTGGCCATTGCAAGTTTGTCAGACGCGAGGTTGCGTGGTCAACCGAACGTTGCTTTC
->read3417_contig0_position8042_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTGTCCATGTGGAGAATATGCATTCGACCAAATGAAAATGTCAATAATCTCGACCCTGTAGTCCGCGGCCAATCAGCACGATCAAGCTAAAGACAGGGA
->read3418_contig0_position6489_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCACTGCTCACGACCAGCTTGCGGACAAACGGGGTGCCCGCGCCTGCGTCCGGTAGACGAGCGATGGATTTAGACCGTTCACTGAACCCTCTAATAGGA
->read3419_contig0_position2666_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCTACTGGCCACCACTGGGGCGCGAGTCTCGAGCCTCTCGACTCCAAAGGGTCTGCCCGAGACAGGTTCACCGAGTCGTTACTCCCGGGATCCACTGCG
->read3420_contig0_position668_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGTGGGACACCGGCCTACTACATTATACAGTAAGGTAGAATCGCGTAGAAGCACCCACGATCAATGTTATTAACCGCGACGGTGTATTCGACGACCTAA
->read3421_contig0_position7113_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGTCGAGTTACCGTTGCGCCACCTCCATGTGTCCATCGGAGTCCGCTTCCCGGGCTTGTCCGCGTCCCATCGGTTAATTCAATGTCCGTCAATCGGGTT
->read3422_contig0_position2493_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGTAGAGTATGCAGATTTCGTACCTTGCCACTGCTACCTCCGGCATATGGGCGTGCTATAAATGCGGGAGTCAGGACGATAGAGCGAAGTAGTTACGGT
->read3423_contig0_position6377_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCAGCTCAAGCAATCATACATGGCGGAATGCCTGTCCACCGGGGGTTCTACTGTACCACAGTGGCCTGGATAGCTAAGCAGGTCCTGGATTGGCATGTCA
->read3424_contig0_position1466_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAATCAGGATCATAGATGGCCAATTATTGACCACAGGTAGGGGCGAGGTATAAATTAGTGGATTCACTTCCCGTTGACATCTTGTTCTCACAACTGCACA
->read3425_contig0_position4576_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCGTGCATAGAGTCCCGCAGTGTCGGAGCGATAGGGAGGACGTAAACGCCAATTCCGCTTAATAGCGGAATCTGCTGGCTTGTGCATTCGTCGGCCTAT
->read3426_contig0_position8575_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AATTCTACTCAGATTGTCTGTAACCGGAGCTTCGGGCGTATTTTTGCGTAAGACACTGCCTAAAGGGAACATATGTGTCCAGAATAGGGTTCAACGGTGT
->read3427_contig0_position5514_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTATAGATCTGTTTAGAAGCACGACCCAGAAATCTTTAGCTAAGTAATCGACTGCCTTCGTCGGGCCGCTTATTGGTTCACCCAATCTGGCCATTGCAAG
->read3428_contig0_position3978_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCTATTTACTGATATATGCTCTTGGACAACACGAGGTCGTAATTATTTCCTGAGATGGTTTTAGTGAGAGCAGCAGATGCACTCTTAGCTCCGCTGATA
->read3429_contig0_position9683_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTACTTAATCGGCTGGGGTAACGGCTGGTTTTGTACTACGGTATGGGAACCCGTTTGCCGAACGTCTGGAAATCCGTCGAGTCATATCGATGAACAGAGA
->read3430_contig0_position5942_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCTCATTGTGAACCCGGCATCTCGTGATTCGAGCCTAACAGCATGCCATCTAACGTTTGGACGGGTCATGTGTTCCCTCAACACGTACGTTGACCGAGC
->read3431_contig0_position7921_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTAATACCAATTGAAATGAAGCTTACGCAAACTACTCGACGAACAAAAGCAAGATTCGACGATCAAACTCGCCGGCGACACGAAGATTGTCTTACTAGC
->read3432_contig0_position9461_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AAAGTAACTGGACGCCCATACCCCTTTGTCTACAGAAGCTCATGGATAAGAGTGTGCGAATAACATCACTTGTTACTTCACGGAACGCTTCTTGAACCCG
->read3433_contig0_position5256_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TATATATGATCCTTGATAGCTTTATGGCCATCATCATAGTAAATTTTTTCAGATTACCCTGCAGACGTCCGCCTAAGATCCTAGTTGAATTGATCAATTG
->read3434_contig0_position2158_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCATCTCATAATCGGGCCACCCGATTTCAGCTTGCCCACAACAGAGACTAGCCACCAAGAGATGGGTTGATGGTAGCATCCCGGCTTCTGGGGCAATTTC
->read3435_contig0_position3900_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TATCTGCACGACTCTTAAAATCATGCACTAAGCATAGAATGCACGACTACTTGTTACTGAAGTCGGCATGACTATCAAACCTATTTAATGGTATATGCTC
->read3436_contig0_position9573_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTAACCTATGCCGGGACAAACACTCGATTGAGCAGTGGTCATGTCATTATTGTACATCAGTACCATAGCTTGGCCACATGTGATGCTCGTACTCGAAGG
->read3437_contig0_position7040_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CACGAATTAGTGTGATAACCGCCTAAACAGTCTAATCTGGCCAATATACCCTGGGGGGAGCTAATATATCGCGGCGTCGAGTTACCGTTGCACCACCTCC
->read3438_contig0_position6260_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTGTACGGTAATGCTTCCGCGCATCTAAGTGATACTCGCCGGAATTTACCCTTCTAATATTGTGTGCAAGCTACTTCTAGACCTTATTAAGTGCCCGGG
->read3439_contig0_position6016_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCCTCAACACGTACGTTGACAGAGGTAACAATCCGTCGACTGAATGTGATTCCTTTGTTATTTCACACTATTGTTCGGTGCGTGCGCTGCTCAGGCAGG
->read3440_contig0_position8924_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AACGAGTTGTAAAACATTAGCTCACGCGCCACCGTCATAGGCTGCATATTGAGACAGGGTTGAAAACCTGTCTGAAGTCCGTGCTTCCCTAACCAGCCTA
->read3441_contig0_position9742_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-GAACGTGTGGAAATCTGTCGAGTCATATCGATGAACAGAGACTAATTGTCCTTAAATCTCTAACACGATTTTAGTAGGTCGACTACTAGGCCGCGTGCTC
->read3442_contig0_position6183_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACAGTCGACTAAAAGGCGTAACCGATTCTGCTACGTTGTAAAAAAGGGACGAGTGGGGTCAACAGTTCTTCTTCTTTCCTGTACGGTAATGCTTCCGCGC
->read3443_contig0_position8313_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCCTTTCGATAACTCTGCGACCTGAATGACCTTGGGCTCGTCGACATTCCTGGTAGTAATCCGATCTCAATTCCTGCGGTACCGAGCAGCTTTGAGTTT
->read3444_contig0_position5245_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGCAGGGTGGTATATATGATCCTTGATAGCTTTATGGCCATCATCATAGTAAATTTTTTCAGATTACCCGGCAGACGTCCGCCTAAGATCCTAGTTGAA
->read3445_contig0_position9080_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGCGCCTGTCACGGGCATGCTGAAAGCGGCGGTTACATTCATCGCTTCTGTGATGACAGACCGAAGCCCACCTGTCCTGACCTCACCGCAGGCATCGAG
->read3446_contig0_position1827_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCCGGCCCACAAATCGACGTGTGTATTTGTTCAATGGCAGGAGGTTAACTTTGCGGAGCTCAACCTATAACGATAATCAAATTGAGACAGACGAGTTGG
->read3447_contig0_position4199_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGATATGATTGTGATCGATATTCAGACTCTAACAATTGGTCAGTACAGGTTCGACCATACGCGACGGCAAACAGAATCGCACGTCAACTAGCCCCTTTA
->read3448_contig0_position3239_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGTTGGAGGGCGGTTACACACCCTTAAGTACCGAACGATAGAGCACCCGTCTAGGAGGGCGTGCAGGGTCTCCCGCTAGCTAATGGTCACGGCCTCTCT
->read3449_contig0_position2184_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCAGCTTGGCCACAACAGAGACTAGCCACCAAGAGATGGGTTGATGGTAGCATCCCGGCTTCTGGGGCAATTTCTGACGATTCGAGTGACCAGCGATAGT
->read3450_contig0_position6307_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TACCCTTCTAATATTGTGTGCAAGCTACTTCTAGACCTTATTAAGTGCCCAGGAATTCCTAGGAAGGCGCGCAGCTCAAGCAATCATACATGGCGGAATG
->read3451_contig0_position6466_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGGCATGTCATCCGGAGTGATAGGCACTGCTCACGACCAGCTTGCGGACAAACGGGGTGCCCGCGCCTGCGTCCGGTAGACGAGCGATGGATTTAGACC
->read3452_contig0_position9593_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACACTCGATTGAGCAGTGGTCATGTCATTATTGTACATCAGTACCATAGCTTGGCCACATGTGATGCTCGTACTCGAAGGGGGAATCACCTTACTTAATC
->read3453_contig0_position5553_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTAAGTAATCGACTGCCTTCGTCGGGCCGCTTATTGGTTCACCCAATCTGGCCATTGCAAGTTTGGCAGACGCGAGGTTGCGCGGTCAACCGAGCGTTGC
->read3454_contig0_position6446_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATAGCTAAGCAGGTCCTGGATTGGCATGTCATCCGGAGTGATAGGCACTGCTCACGACCAGCTTGCGGACAAACGGGGTGCCCGCGCCTGCGTCCGGTAG
->read3455_contig0_position3836_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAACCCGGGCCCAAAATTGGAACCCGTAATCTTCAAGTGAATCATCCGATCATGCAAACCTAATTATCTGCACGACTCTTAAAATCATGCACTAAGCATA
->read3456_contig0_position1897_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGACAATCAAATTGAGACAGACGAGTTGGAGTGTTTTGATGAGCGGTGTTATATTTGTCCTAACTTAGCACTATCGCACCACAAAATTTCAGCATAAAG
->read3457_contig0_position8392_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTACCGAGCAGCTTTGAGTTATTGTAAGTCCCACGGTTAATGGGCCACTTATTTCGACATTCATGGCGCCGATATCCTGCTTAGGCAGTACGGCCAATGC
->read3458_contig0_position3179_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGTTATCAAATCCCTATGTTCCGGTAATCTCTCATCTACTAAGCGCCCTAAAGGTCGTATGGTTGGAGGGCGGTTACACACCCTTAAGTACCGAACGAT
->read3459_contig0_position799_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ACAAACCCTAGTCTCATATAAAGCTATTCCACGCCGGGTGGCCTGGACGTCGTTTGGGGATGGCTTTGGGAATCACTAGGTAATTACTGTTGGCTCCTTT
->read3460_contig0_position6019_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCAACACGTACGTTGACAGAGCTAACAATCCGTCGACTGAATGTGATTCCTTTGTTATTTCACACTATTGTTCGGTGCGTGCGCTGCTCAGGCTGGTGC
->read3461_contig0_position3318_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTCAAGGTCACGGCCTCTCTGGGAAAGCTGAACAACGGATGGGATTAAGCTCAGCAGTCCGCCTCCAATCTCTCCGACGTTCATTCTCAAGGGTGTAGT
->read3462_contig0_position1951_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTGTCCTAACTTAGCACTATCGCACCACAAAATTTCAGCATAAAGCATCCGGTTGAAGGCTGTGCATCGAGCAGCGTGCATTGGTCTTTCAGTCCCCAG
->read3463_contig0_position2815_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTCTTTGAAGGTGCCCATTGCATTGTAGCCTGAACTATTAGCAATCCTAAGCCCATAAGCCCTGCCCCACGGGGGCTACAATCCAGCAGTGAACGCGTT
->read3464_contig0_position4392_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCTAGCTAGCTTGACTCGGCTGATAAAGAAAACAATCTATATGGAACCGAGGGGCGGGATGATAATTGTTCTTAGTATAGTGACCGTTATGGACGACGG
->read3465_contig0_position1065_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCTGGTTACGCGTTATTACCGGTCAGCTCCAGTTACGTCACGGACGTAGAGAGCCTTTGAATGTGTACGGCAATAGGAGAAACTTGGCCACGTACGTGT
->read3466_contig0_position907_M5_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGTCGGAGTTCCTTCAGGCCGATCAAGTGGTTAGAGACCTAGGTCTATGCCAGACGATAGCCGCGGAGTCGATATAATTGCTATATCATGTATCGCTGA
->read3467_contig0_position465_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AACTTCAATCCGCGTTACGCTTTGTCCTCTGCTACGCCTCGATTGGTTTCAGCTCACGTGGGACGCATGTACTTACCTAACATGAAGCGGTAATGGAGCT
->read3468_contig0_position8299_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TATTTGTCTCCGTGTTCCTTTCGATAACTCTGCGACCTCAATGACCTTGGGCTCGTCGACATTCCTGGTAGTAATCCGATCTCAATTCCTGCGGTACCGA
->read3469_contig0_position5154_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGATTGGGAGGTCTCGGCCAATTCGTTGTATTGATCGCTGTGCACTCTAAAATTCGGAACATCTTAACCAAAGCATATTAATATGCCAGCCGCGCAGGGT
->read3470_contig0_position6847_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGTTAAGATTTATAAACCATACATTTAACCCTTAGTCATAAGATGATACTTCATCTGCATGCGCGCATCTTCCTATTTTATGGTCTTAATTGAGTGTTC
->read3471_contig0_position2884_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGGGGGCTACAATCCAGCAGTGAACGTGTTTACCTTAAGACGAAAGAGTCAGTAGAGTTGGGGTTCGTGCTTTAATGACCCGTAGCCCAATTGCGCTCC
->read3472_contig0_position5579_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGCTTATTGGTTCACCCAATCTGGCCATTTCAAGTTTGGCAGACGCGAGGTTGCGTGGTCAACCGAACGTTGCTTTCCTTAGGGTACCGAGTATATTAA
->read3473_contig0_position3479_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTTGGAACTCGCAAACCTTTACACTCATCACATAGCAGGTTCCACCCGAACCGCGCGTATTCTGCGACAGCATGAATCGTGTAACTCTGCTCGGTTATA
->read3474_contig0_position9178_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTCTAACTCTGATTCGAGAGACGGATGTAATTTAGTCAGGTCTGAACCGCTGGCAGAGCAGCTCCGAGGGCCTTTATACCCATACTGCCACTCCAGTAC
->read3475_contig0_position5941_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCCTCATTGTGAACCCGGCATCTCGTGATTCGAGCCTAACAGCATGCCATCTAACGTTTGGACGGGTCATGTGTTCCCTCAACACGTACGTTGACAGAG
->read3476_contig0_position2815_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTCTTTGAAGGTGCCCATCGCATTGTAGCCTGAACTATTAGCAATCCTAAGCCCATAAGCCCTGCCCCACGGGGGCTACAATCCAGCAGTGAACGCGTT
->read3477_contig0_position51_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCCTTTAACCTGCCAGACGGTGACCAGGGCCGTTCGGCGTAGCATCGAGCGGTGTCGCTAGCGCAATGCGCAAGATTTTGACATTTACAAGGCAACATT
->read3478_contig0_position19_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCGGACCACGCTCTGGCTAACGAGCTACCGTTTCCTTTAACCTGCCAGACGGTGACCAGGGTCGTACGGCGTTGCATCGAGCGGGGTCGCTAGCGCAAT
->read3479_contig0_position7090_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGGGGGGAGCTAATATATCGCGGCGTCGAGTTACCGTTGCACCACCTCCAAGTGTCCATCGGAGTCCGCTTCCCGGGCTTGTCCGCGTCCCATCGGTTA
->read3480_contig0_position2497_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGAGTATGCAGATTTCGTACCTTGCCACTGCTACCTCCGGCATATGGGCGTGCTATAAATGCGGGAGTCAGGACGATAGAGCGAAGTAGTTACGGTGATT
->read3481_contig0_position6053_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGACTGAATATGATTCCTTTGTTATTTCACACTATTGGTCGGTGCGTGCGCTGCTCAGGCTGGTGCGACCCTTACAGCGTTATCCGTCCCGAACTGGCTT
->read3482_contig0_position2049_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTCACCGGAGACGTCCGAGCTCGAACCCGTCCGGCTAAGAGGCAGGCAGTCGCTGCATGTGTACGCAGCGCTCTATGCTACAGGTATTACGGAGTGAAA
->read3483_contig0_position9838_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTCAGAAATCGGAACCCAAGTACGCGATCTCTTTTCTAGTCACCAGCCTCAGGCATTCGCAAATGTCGTTCATGCACGCAACGGGTCGAATAATATGCC
->read3484_contig0_position700_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGGTAGAATCGCGTAGAAGCACCCACGATCAATGTTATTAACCGCGACGGTGTATTCCACGACCTAATTTTTCCCGTCTCTGGGGTCGACCTGGACTCA
->read3485_contig0_position4338_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGTAATGCATGGAAAGTGCCAATATCCCCGGGAGTCCCGCACTACTGAGACGAAGTCTAGCTAGCTTGACTCGGCTGATAAAGAAAACAATCTATATGGA
->read3486_contig0_position3918_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AATCATGCACTAAGCATAGAATGCACGACTACTTGTTACTGAAGTCGGCATGACTATCAAACCTATTTCATGATTTATGCTCTTGGACAACACGAGGTCG
->read3487_contig0_position471_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AATCCGCGTTACGCTTTGTCCTCTGCTACGCCTCGATTGGTTTCAGCTCACGTGGGACGCATGTACTTACCTAACATGAAGCGGTAATGGAGCTCGAACA
->read3488_contig0_position4833_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCGCCGTTGGATGTGTCCCACAGTGTTTTATACGGGACGGTGCCCACGGGGTGAGCACATGAATGGGGTACGGTTTTACCGTCCATGACGTTGTGACAT
->read3489_contig0_position2145_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAAACGGCTGCGAGCATCTCATAATCGGGCCACCCGATTTCAGCTTGGCCACAACAGAGACTAGCCACCAAGAGATGGGTTGATGGTAGCATCCCGGCTT
->read3490_contig0_position6358_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAATTCCTAGGAAGGCGCGCAGCTCAAGCAATCATACATGGCGGAATGCCTGTCCACCGGGGGTTCTACTGTACCACAGTGGCCTGGATAGCTAAGCAG
->read3491_contig0_position7158_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTTCCCGGGCTTGTCCGCGTCCCATCGGTTAATTCAATGTCCGTCAATCGGGTTGGCCAAAAATTCTACCTGTCCACCTGTCCGCTAGAAGCAGATTAT
->read3492_contig0_position6813_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGATACGCGCGAGCTCTCACCCACGACTGTACCCCGGTTAAGATTTATAAACCATACATTTCACCCTTAGTCATAAGATGATACTTCATCTGCATGCGCG
->read3493_contig0_position1428_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGCGCCCTTTCATCTCTATTGCTAGGTCTCTGAAGCCTAATCAGGATCATAGATGGCCAATTATTGACCACAGGTAGGGGCGAGGTATAAATTAGTGGA
->read3494_contig0_position9577_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCTATGTCGGGACAAACACTCGATTGAGCAGTCGTCATGTGATTATTGTATATCAGTACCATTGCTTGGCCACATGTGATGCTCGTACTCGAAGGGGGA
->read3495_contig0_position3034_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCAAAGAGCAAGACTCTATGACTAGCGGGTGTCGTCAATCAAAACTGATCGAGCACTGTCCGCGAAACATTATTCAGTACAGCGACTTTTACCCTCGTGG
->read3496_contig0_position7970_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCAAGATTCGACGATCAAACTCGCCGGCGACACGAAGATTGTCATACTAGCTTTCAGTCATTCCCCCTCAGTTTTGTCCATGTGGAGAATATGCATTCGA
->read3497_contig0_position7171_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCCGGGTCCCATCGGTTAATTCAATGTCCGTCAATCGGGTTGGCCAAAAATTCTACCTGTCCACCTGTCCGCTAGAAGCAGATTATACGGAATACATAT
->read3498_contig0_position4579_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGCATAGAGTCCCGCAGTGTCGGAGCGATAGGGAGGACGTAAACGCCAATTCCGCTTAATAGCGGAATCTGCTGGCTTGTGCATTCGTCGGCCTATTAG
->read3499_contig0_position2611_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCCCTCCTGTCCAGTAGCCTTAAAATCTAACCCTGAATTGGCTTTATCCACCCCCACTACTGGCCACCACTGGGGCGCGAGTCTCGAGCCTCTCGACTC
->read3500_contig0_position9159_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCCTCACCGCAGGCATCGAGTCTAACTCTGAATCGAGAGACGGATGTAATTTAGTCAGGTCGGAACCGCTGGCAGAGCAGCTCCGAGGGCCTTTATACC
->read3501_contig0_position907_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGTCGGAGTTCTTTCAGGCCGATCAAGTGGTTAGAGACCTAGGTCTATGCCAGACGATCGCAGCGGATTCGATATAATTGCAGTATCATGTATCGCTGA
->read3502_contig0_position5653_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTCCTTAGGGTACCGAGTATATTAACTTTATGAAATTAGCGCGTTAACTACTTAAAGTTCAGAAGATCACTGTCCGCCTCGAACCACTACAATAAGATT
->read3503_contig0_position9461_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAAGTAACTGGACGCCCATACCCCTTTGTCTACAGAAGCTCATGGATAAGAGTGTGCGAATAACATCACTTGTTACTTCACGGAACGCTTCTTGATCCTG
->read3504_contig0_position2951_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGCTTTAATGACCCGTAGCCCAATTGCGCTCCCGAACAACGCGTGAGTTTAAAATTGACTTGAAACCGCCTAGCTCGGACCACCAAAGAGCAAGACTCT
->read3505_contig0_position7764_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCCCCTGTGCTGACCTTATGTTCATATCGATACACGAAGGCCAGTGCGGAAGCGGAGCCACACTCGCCGTTACTGACTGATTGACAATCCAGCCCGTTT
->read3506_contig0_position3135_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGAATGTTATGCCGTCCGACTCTTGCGCTCGGATGTCCGCAATGGGTTATCAAATGCCTATGTTCCGGTAATCTCTCATCTACTAAGCGCCCTAAAGGT
->read3507_contig0_position3517_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTTCCACCCGAACCGCGCGTATTCTGCGACAGCATGAATCGTGTAACTCTGCTCGGTTATACGCCCTCGGGAGAAGACCCATGTAAGATGTATCCATCC
->read3508_contig0_position3966_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CATGACTATCAAACGTATTTAATGATATATGCTCTTGGACAACACGAGGTCGTAATTATTTCCTGAGATGGTTTTAGTGAGAGCAGCAGATGCACTCTTA
->read3509_contig0_position5480_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGAAAGCGCTTGTCACCTCATCTAAAATCGCGACTATAGATCTGTTTAGAACCACGACCCAGAAATCTTTAGCTAAGTAATCGACTGCCTTCGTCGGGC
->read3510_contig0_position8984_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGAAAACCTGTCTGAAGTCCGTGCTTCCCTAACCAGCCTATGCGCCTTAACTTTATGCATACTCGTTTAGTACAGGGCCGCGCCCCATGAGGCCATATAC
->read3511_contig0_position3028_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGACCACCAAAGAGCAAGACTCTAAGACTAGCGGGTGTCGTCAATGAAAACTGATCGAGCACTGTCCGCGAAACATTATTCAGTACAGCGACTTTTACCA
->read3512_contig0_position4858_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTTTATACGGGACGGTGGCCACGGGGTGAGCACATGAATTGGGTACGATTTTACCGTCCATGACGTTGTGACATAAAGGTGCGGGACGCGGAAGCGCAC
->read3513_contig0_position3646_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGTAGACCAGAGATTCCATGGACTCTCTGTTTCGTCGATTGTCTGAATATCGTGCAGTAAGTTTCTCTTAGGTTCCTCACCGGAAACGTCTCAGACCCA
->read3514_contig0_position6023_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACACGTACGTTGACAGAGCTAACAATCCGTCGACTGAATGTGATTCCTTTGTTATTTCACACTATTGTTCGGTGCGTGCGCTGCTCAGGCTGGTGCGACC
->read3515_contig0_position8013_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATACTAGCTTTCAGTCATTCCCCCTCAGTTTTGTCCATGTGGAGAATATGCATTCGACCAAATGAAAATGTCAATAATCTCGACCCTGTAGTCCGCGGCC
->read3516_contig0_position3722_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCAACGGAAACGTCTCAGACCCACCTTAGACGCGGGAATAAATTCGACACGGGGTCCGAAGGGTAAGAACACCTAGCCTGGCAATTACCCCTTTGTTAT
->read3517_contig0_position8882_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGAAACCGGTGCATCACCGTACGAAAAGGATGGTTGAAATAGAACGAGTTGTAAAACATTAGCTCACGCGCCACCGTCATAGGCTGCATATTGAGACAGG
->read3518_contig0_position6464_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GATTGGCATGTCATCCGGAGTGATAGGCACTGCTCACGACCAGCTTGCGGACAAACGGGGTGCCCGCGCCTGCGTCCGGTAGACGAGCGATGGATTTAGA
->read3519_contig0_position5108_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGATGAGGCCAAGGTGTTACGTGAAGTCGCGTTGTCGCTAGTAACAGATTGGGAGGTCTCGGCCAATTCGTTGTATTGATCGTTGTGCACTTTAAAATT
->read3520_contig0_position6036_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGAGCTAGCAATCCGTCGACTGAATGTGATTCCTTTGTTGTTTCACACTATTGTTCGGTGCGTGCGCTGCTCAGGGTGGTGCGACCCTTACAGCGTTAT
->read3521_contig0_position4856_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGTTTTATACGGGACGGTGGCCACGGGGTGAGCACATGAATGGGGTACGGTGTTACCGTCCATGACGTTGTGACATAAAGGTGCGGGACGCGGAAGCGC
->read3522_contig0_position4724_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTATCGGCGTTCAAAGTATTCGGCGGATGAATTAGAGCCAAAGCAGTAGGTTACCGTCGGCGCATAACCGGCGAGTGCTCTGAAACGTCACATTCGTCTA
->read3523_contig0_position3113_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGCGACTTTTACCCTCGTGGTCTGAATGTTATGCCGTCCGACTCTTGCGCTCGGATGTCCGCAATGGGTTATCTACTGCCTATGTTCCGGTAATCTCTC
->read3524_contig0_position8205_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCATTGACCAACCCCTATTATTAGGAGAGGGCTGCGACTGCTTGTAGCTCCGACCGCTTTCCAATCGTTGCACACGACTTGAGGCTCGGACTCGTATCTG
->read3525_contig0_position7908_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCACTCTGTAGCTCTAATATCAATTGAAATGAAGCTTACGCAAACTACTCGACGAACAACAGCAAGATTCGACGATCAAACTCGCCGGCGACACGAAGA
->read3526_contig0_position2924_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGAAAGAGTCAGTAGAGTTGGGGTTCGTGCTTTAATGACCCGTAGCCCAAATGCGCTCCCGAACAACGCGTGAGTTTAAAATTGACTTGAAACCGCCTA
->read3527_contig0_position7828_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGCCGTTACTGCCTGATTGACAATCCAGCCCGTTTGGGGTGATTTGTGCCGGCGCGTCCAGGTGCGAACGTTGTGCCGTGTCACTCTGTAGCTCTAATA
->read3528_contig0_position7848_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-ACAATCCAGCCCGATTGGGGTGAATTGTGCCGGCGCGTCCAGGTGCGAACGTTGTGCCGTGTCACTCTGTAGCTCTAATACCAATGGAAATGAAGCTTAC
->read3529_contig0_position405_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCGCGGTTATCGGACAGAGGATTATGTAAGGTTACCGAAGACCGGTTAGCCTAGTTAGTAACTTCAATCCGCGTTACGCTTTGTCCTCTGCTACGCCTC
->read3530_contig0_position4531_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCGGTCAGGCATGCTTACCTCCTGCGACGGCATTGGCGATTATGGGCGTGCATAGAGTCGCGCAGTGTCGGAGCGATAGGGAGGACGTAAACGCCAATT
->read3531_contig0_position5019_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ACAGTTCTAACGGTCTGGCCTTATACAGCGCCACATCCGCCAATTCGCTAGGTAGTAGCCAGGAAGTCTGTAGTACAGGTGCCCATAACCCGATGAGGCC
->read3532_contig0_position2664_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCCCTACTGGCCACCACTGGGGCGCGAGTCTCGAGCCTCTCGACTCCAAAGGGTCTGCCCGAGACAGGTTCACCGAGTCGTTACTCCCGGGATCCATTG
->read3533_contig0_position141_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGCAACATTGCAGCGTCCGATGGTCCGGTGGCCTCCAGATAGTGTCCAGTCGCTCTAACTGTATGGAGACCATAGGCATTTCCCTTATTCTCATCGCCA
->read3534_contig0_position6648_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTATAAAATGGACTGCTATCTAGGCGTTAAAGTAGTAGAACGAGGGTCGGGCGATTTGTTTTGGTAGTGGTTATCGCATTGCAAGAACGTACGGACGGA
->read3535_contig0_position2458_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTCGAATGAACAAATCAATTAGGTAGTGTGCGCGAGGTAGAGTATGCAGATTTCGTACCTTGCCACTGCTACCTCCGGCATATGGGCGTGCTATAAATG
->read3536_contig0_position9506_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATAAGAGTGTGCGAATAACATCACTTGTTACTTCACGGAACGCTTCTTGATCCTGAGCTCCCCCGCGATTAACCTATGTCGGGACAAACACTCGATTGAG
->read3537_contig0_position5702_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TACTTAAAGTTCAGAAGATCACTGTCCGCCTCGAATCACTACAATAAGATTACGGATAGCCCGTGGCTTGGTTGTTTTCTGAATTGTGGCTATCTCAAAT
->read3538_contig0_position2606_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGATGCCCCTCCTGTCCCGAAGCCTTAAAATCTAACCCTGAATTGGCTTTATCCACCCCCCCTACTGGCCACCACTGGGGCGCGAGTCTCGAGCCTCTC
->read3539_contig0_position9236_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCAGCTCCGAGGGCCTTTATACCCATACTGCCACTCCAGTACCTGGGCCGCGTGTTGTACGCTGTGTATCTTGAGAGCGTTTCTCCGTATCGAAATGTTC
->read3540_contig0_position6376_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCAGCTCAAGCAATCATACATGGCGGAATGCCTGTCCACCGGGGGTTCTACTGTACCACAGTGGCCTGGATAGCTAAGCAGGTCCTGGATTGGCATGTC
->read3541_contig0_position9791_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTTAAATCTCTAACACGATTTTAGTAGGTCTACTACTAGGCAGCTTGCTCAGAAATCGGAACACAAGTAAGCGATCTCTTTTCTAGTCACCAGCCTAAG
->read3542_contig0_position6260_M5_I0_D0_NG0______er0.01__indel0__rgeom0
-CGTGTACGGTAATTCTTCCGCGCATCTAAGTGATATTCGCCGGAATTTACCCATCTAATGTTGTGTGCAAGCTACTTCTAGACCTTATCAAGTGCCCAGG
->read3543_contig0_position6203_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCGATTCTGCTACGTTATAAAAAAGGGACGAGTGGGGTCAACAGTTCTTCTTCTTTCCTGTACGGTAATGCTTCCGCGCATCTAAGTGATATTAGCCGG
->read3544_contig0_position7864_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGGTGATTTGTGGCGGCGCGTCCAGGTGCGAACGTTGTGCCGTGTCACTCTGTAGCTCTAATACCAATTGTAATGAAGCTTACGCAAACTACTCGACGA
->read3545_contig0_position4344_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCATGGAAAGTGCCAATATCCCCGGGAGTCCCGCACTACTGAGACGAAGTCTAGCTAGCTTGACTCGGCTGATAAAGAAAACAATCTATATGGAACCGAG
->read3546_contig0_position7920_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCCAATATCAATTGAAATGAAGCTTACGCAAACTACTCGACGAACAAGAGCAAGATTCGACGATCAAACTCGCCAGCGACACGAAGATTGTCATACTAG
->read3547_contig0_position8053_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAGAATATGCATTCGACCAAATGAAAATGTCAATAATCTCGACCCTGTAGTCCGCTGCCAATCAGCACGATCAAGCTAAAGACAGGGATTATGCACTAG
->read3548_contig0_position4625_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCAATTCCGCTTAATAGCGGAATCTGCTGGCTTGTGCATTCGTCGGCCTATTAGATACGGTACGGAATATTGGGTAACCTCCTCTTCACTGATATCATCC
->read3549_contig0_position5681_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTATGAAATTAGCGCGTTAACTACTTAAAGTTCAGAAGATCACTGTCCGCCTCGAACCACTACAATAAGATTACGGATAGCCCGTGGCTTGGTTGTTTTC
->read3550_contig0_position8243_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCTTGCAGCTCCGACCGCTTTCCAATCGTTGCACATGACTTGAGGCTCGGACTCGTATCTGTCTCCGTGTTCCTTTCGATAACTCTGCGACCTGAATGA
->read3551_contig0_position4291_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCCTTTATTAATGATCCGTGTCCCCCGACCGTGCGCTGAGGAGACCCGTAATGCATGGAAAGTGCCAATATCCCCGGGAGTCCCGCACTACTGAGACGA
->read3552_contig0_position4978_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGTCACTGCATAGCAGAATGGGCGATCGGCCTACAAGAGTACAGTACTAACGGTCTGGCCTTATACAGCGCCACATCCGCCAATTCGCTAGGTTGTAGC
->read3553_contig0_position520_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGTGGGACGCATGTACTTACCTAACATGAAGCGGTAATGGAGCTCGAACAGTAGTCGGTGGCTCTTCTGTCTCTGTCGGGGACGGCTATGTGAGTTCAT
->read3554_contig0_position5112_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGAGGCCAAGCTGTTACGTGAAGTCGCGTTGTCGCTAGTAACAGATTGGGAGGTCTCGGCCAATTCGTTGTATTGATCGCTGTGCACTTTAAAATTCGGA
->read3555_contig0_position6185_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTCGACTAAAAGGCGTAACCGATTCTGCTACGTTATAAAAAGGGGACGAGTGGGGTCAACAGTTCTTCTTCTTTCCTGTACGGTAATGCTTCCGCGCAT
->read3556_contig0_position2451_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCATGCTTGTCGAATGAACAACTCAATTAGGTAGTGTGCGCGAGGTAGAGTATGCAGATTTCGTACCTTGCCACTGCTACCTCCGGCATATGGGCGTGCT
->read3557_contig0_position5052_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CATCCGCCAATTCGCTAGGTTGTAGCCAGGAAGTCTGTAGTACAGGTGCCCATAACCCGATGAGGCCAAGGTGTTACGTGAAGTCGCGTTGTCGCTAGTA
->read3558_contig0_position7317_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCCGATGTCTAAAAGCGCCAGATCGACTTGACTCTACGTGCTGCAATGGAGAACCGCGGAAGGAACACTTTCTGGTGCCACTCGAGACCGCCCTCCCCG
->read3559_contig0_position2862_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CTAAGCCCATAAGCCCTGCCCCAAGGGGGCTACAATCCAGCAGTGAACGCGTTTACCTTAGGACGAAAGAGTCAGTAGAGTTGGGGTTCGTGCTTTGATG
->read3560_contig0_position4867_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGACGGTGGCCACGGGGTGAGCACATGAATGGGGTACGGTTTTACCGTCCATGACGTTGTGACATAAAGGTGTGGGACGCGTAAGAGCACCTCGTATAA
->read3561_contig0_position3367_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTCAGCAGTCCGCCTCCAATCTCTCCGACGTTCATTGTCAAGGGTGTAGTTTTAGAGACTGAGAACTCACCCTATTGGTAGTACTGCCTGCCGTCGCCT
->read3562_contig0_position3877_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCATCCGATCATGCAAACCTGATTATCTGTACGACTCTTAAAATCATGCACTAAGCATAGAATGCACGACTACTAGTTACTGAAGTCGGCATGACTATCA
->read3563_contig0_position1719_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGGGACGGCACTGGAGATCTGGAACATTAGATAGGATATAAAAGTAATACGGTTGATGTTATTACCAACTCCACTTCTGCAAATTGTTATGAGCAAGCA
->read3564_contig0_position7932_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGAAATGAAGCTTACGCAAACTACTCGACGAACAACAGCAAGATTCGACGATCAAACTCGCCGGCGTCACGAAGATTGTCATAATAGCTTTCAGTCATT
->read3565_contig0_position9708_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGTTTTGTACTACGGTATGGGAACCCGTTTGCCGAACGTCTGGAAATCTGTCGAGTCATATCGATGAACAGAGACTAAATGTCCTTAAATCTCTAACAC
->read3566_contig0_position9258_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCATACTGCCACTCCAGTACCAGGGCCGCGTGTTGTACGCTGTGTATCTTGAGAGCGTTTCTCCGTATCGAAATGTTCCGCTGTAAAGAACCTGGCGTAT
->read3567_contig0_position2386_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTGAGGGGTACCCGACGCCTCTGCTGTCAAAGTGGGAAATCCAGTCTCGACTATTTCTACTATGTCATGCTTGTCGAATGAACAACTCAATTAGGTAGT
->read3568_contig0_position5461_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGCGATAGTATCTCAGAGTCGAAAGCGCTTGTCACCTCATCTAAAATCGCGACTATAGATCTGTTTAGAACCACGACCCAGAAATCTTTAGCTAAGTAA
->read3569_contig0_position1281_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGGACTCTTATATTCCCTCCTGCGGAGTGCTCTCCCATAATAAGTGAACCCATGGGTCGCACTGTATTTTTGTACGGCTTGATGTCAGGGTCAGTTTGG
->read3570_contig0_position6543_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGACGAGCGATGGATTTAGACCGTTCACTGAACCCTCTAATAGAACCTCTTGCCCATCCGAGGCTTAAGCAGCGACTCCACATGGAGCGATGGGTCCTC
->read3571_contig0_position138_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACAAGGCAACATTGCAGCGTCCGATGGTCCGGTGGCCTCCAGATAGTGTCCAGTCGCTCTAACTGTATGGAGACCATAGGCATTTACCTTATTCTCATCG
->read3572_contig0_position5417_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TACCCGGACACCTGGCAGCGGGAACCGCTTTGACTCTGGAGTGCCAGCGGTAGTATCTCAGAGGCGAAAGCGCTTGTCACCTCATCTAAAATCGCGACTA
->read3573_contig0_position715_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGAAGCACCCACGATCAATGTTATTAACCGCGACGGTGTATTCCACGACCTAATTTTTCCCGTCTCTGTGGTCAACCTGGACGCACAAACCCTAGTCCCA
->read3574_contig0_position5610_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CAAGTTTGGCAGACGCGAGGTTGCGTGGTCAACCGAACGTTGCTTTCCTTAGGGTACCGAGTATATTAACTTTATGAAATTAGCGCGTTAACTACTTAAA
->read3575_contig0_position5299_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTTTTCAGATTACCCTGCAGACGTCCGTATAAGATCCTAGTTGAATTGATCAATTGAGTCCAGTACACCATATCAACAGCTTGATCGTTCCACTTCAAT
->read3576_contig0_position5539_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCAGAAATCTTTAGCTAAGTAATCGACTGCCTTCGTCGGGCCGCTTATTGGTTCACCCAATCTGGCCATTGCAAGTTTGGCAGACGCGAGGTTGCGTGGT
->read3577_contig0_position4814_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CATTCGTCTATCCGCACACACCGCCGTTGGATGTGTCCCACAGTGTTTTATACGGGACGGTGGCCACGGGGTGAGCACATGAATGGGGTACGGTTTTACC
->read3578_contig0_position4824_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCGCACACACCGCCGTTGGATGTGTCCCACAGTGTTTTATACGGGACGGTGGCCACGGGGTGAGCACATGAATGGGGTACGGTTTTACCGTCCATGACG
->read3579_contig0_position2022_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GCAGCGTGCATTGATCTTTCAGTCCCCAGTCACCGGAGACGTCCGAGCTCGAACGCGTCCGGCTAAGAGGCAGGCAGTCGCTGCATGTGTACGCAGCGGT
->read3580_contig0_position3256_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CACACCCTTAAGTACCGAACGATAGAGCACCCGTCTAGGAGGGCGTGCAGGGTCTCCCGCTAGCTAATGGTCACGGCCTCTCTGGGAAAGCTGAACAACG
->read3581_contig0_position2582_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTAGTTACGGTGATTACCCGTCCATCGATGCCCCTCCTGTCCCGAAGCCTTAAAATCTAACCCTGAATTGGCTTTATCCACCCCCCCTACTGGCCACCAC
->read3582_contig0_position6509_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCGGACAAACGGGGTGCCCGCGCCTGCGTCCGGTAGACGAGCGATGGATTTAGACCGTTCACTGAACCCTCTAATAGGACCTCTTGCCCATCCTAGGCT
->read3583_contig0_position273_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAACCACTAACATAACGCGTGTCATCTAGTTCTAGCATACTCCGCCTTGGGCCACACAATTAATATAAGACGGGATAATGGCTCCATGCTCATGTTCTAT
->read3584_contig0_position9067_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCATGAGGCCATATGCGCCTGTCACGGGCATGCTGAAAGCGGCGGTTACATTAATCGCTTCTGTGATGACAGACCGAAGCCCACCTGTCCTGACCTCAC
->read3585_contig0_position9650_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CATGTGATGCTCGTACTCGAAGGGGGAATCACCTTACTTAATCGTCTGGGGTTACGGCTGGTTTTGTACTACGGTATGGGAACTCGTTTGCCGAACGTCT
->read3586_contig0_position2430_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCTCGACTATATCTACTATGTCATGCTTGTCGAATGAACAACTCAATTAGGTAGTGTGCGCGAGGTAGAGTATGCAGATTTCGTTCCTTGCCACTGCTA
->read3587_contig0_position6012_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGTTCCCTCAACACGTACGTTGACAGAGCTAAAAATCCGTCGAATGAATGTGATTCCTTTGTTATTTCACACTATTGTTCGGTGCGTGCGCTTCTCAGG
->read3588_contig0_position1913_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GACAGACGAGTTGGAGTGTTTTGATGAGCGGTGTTATATTTGTCCTAACTTAGCACTATCGCACCACAAAATTTCAGCATAAAGCATCCGGTTGAAGGCT
->read3589_contig0_position8458_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCCGATATCCTGCTTAGGCAGTACGGCCAATGCACGACCCTATATGACCCCTAGCGAGAATTTATAGTCTAATAATGAATGGTGAACAGCACATCTTTT
->read3590_contig0_position9128_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGTGATGACAGACCGAAGCCCACCTGTCCTGACCTCACCGCAGGCATCGAGTCTAACTCTGATTCGAGAGACGGATGTAATTTAGTCAGGTCGGAACCG
->read3591_contig0_position5793_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCTCAAATTGGGACCTAGTGTTGGCCAATAAGCTTCATATCGCCTTCTCAGATAGACTAATAGAACGAAGTCCATATAACAGCTGATTTAAGAGGAAAA
->read3592_contig0_position6085_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TATTGTTCGGTGCGTGCGCTGCTCAGGCTGGTGCGACGCTTACAGCGTTATCCGTCCCGAACTGGCTTGAGCCACTCATAAGGCACGCGCGGGCCATAAC
->read3593_contig0_position2803_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGCGGGACACCACTCTTTGAAGGTGCCCATTGCATTGTAGCCTGAACTATTAGCAATCCTAAGCCCATAAGCCCTGCCCCACGGGGGCTACAATCCAGC
->read3594_contig0_position9289_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTGTACGCTGCGTATCTTGAGAGCGTTTCTCCGTATCGAAATGTTCCGCTGTAAAGAACCTGGCGTATCCTGACCATGGAGCTGCAACACTTTCACACA
->read3595_contig0_position7676_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCGAGTGGAATGCGTAAACGGCATAAGCGCAATGACCGAGGTAACAAGCCAGGAGGATTGGAGCGGTAATGTGGTAGTGTAGTTGCCGGCCCCTGTGCT
->read3596_contig0_position1273_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCTAAGTATGGACTCTTATATTCCCTCCTGCGTAGTGCTCTCCCATAATAAGTGAACCCATGGGTCGAGCTGTATTTTTGTACGGCTTGATGTCAGGGT
->read3597_contig0_position6958_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCACAGATGAGCGTTCCGATTGTCCTTTCCCAGGCTACGGCCTTATACCAAAGACTTCTAGACCGGAGAGCCTACTTCCAGCCACGAATTCGTGTGATAA
->read3598_contig0_position9474_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCCATACCCCTTTGTCTACAGAAGCTCATGGATAAGAGTGTGCGAATAACATCACTGGTTACTTCACGGAACGCTTCTTGATCCTGAGCTCACCCGCGA
->read3599_contig0_position3557_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGTGTAACTCTGCTCGGTTATACGCCCTCGGGAGAAGACCCATGTAAGATGTATCCATCCCTACCACACGCGTCCGCCACCTCCGGGTCTAGTAAACCAG
->read3600_contig0_position2415_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAAGTGGGAAATCCAGTCTCGACTATATCTACTATGTCATGCTTGTCGAATGAACAACTCAATTAGGTAGTGTGCGCGAGGTAGAGTATGCAGATTTCGT
->read3601_contig0_position1254_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCCGAGACTTCGGCATAAATCTAAGTATGGACTCTTATATTCCCTCCTGCGTAGTGCTCTCCCATAATAAGTGAACCCATGGTTCGCGCTGTATTTTTG
->read3602_contig0_position1806_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTATGAGCAAGCATACAAGTTAGCCGGCCCACAAATCGACGTGTGTATTTGTTCAATGGCAGGAGGTTAACTTTGCGGAGCTCAACCTATAACGATAATC
->read3603_contig0_position9229_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGCAGAGCAGCTCCGAGGGCCTTTATACCCATACTGCCACTCCAGTACCTGGGCCGCGTGTTGTACGCTGTGTATCTTGAGAACGTTTCTCCGTATCGA
->read3604_contig0_position4752_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAATTAGAGCCAAAGCAGTAGGTTACCGTCGGCGCATAACCGGCGAGTGCTCTGAAACGTTACATTCGTCTATCCGCACACACCGCCGTTGGATGTGTCC
->read3605_contig0_position2924_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGAAAGAGTCAGTAGAGTTGGGGTTCGTGCTTTAATGACCCGTAGCCCAATTGCGCTCCCGAACAACGCGTGAGTTTAAAATTGACTTGAAACCGCCTA
->read3606_contig0_position2901_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCAGTGAACGCGTTTACCTTAAGACGAAAGAGTCAGTAGAGTTGGGGTTCGTGCTTTAATGACCCGTAGCCCAATTGCGCTCCCGAACAACGCGTGAGTT
->read3607_contig0_position4963_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATAACGTTAGGGGCATCGTCACTGCATAGCAGAATGGGCGATCGGCCTACAAGAGTACAGTACTAACGGTCTGGCCTTATACAGCGCCACATCCGCCAAT
->read3608_contig0_position2933_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCAGTAGAGTTGGGGTTCGTGCTTTAATGACCCGTAGCCCAATTGCGCTCCCGAACAACGCGTGAGTTTAAAATTGACTTGAAACCGCCTAGCTCGGACC
->read3609_contig0_position6173_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGGGCCATAACAGTCGACTAAAAGGCGTAACCGATTCTGCTACGTTATAAAAAAGGGACGAGTGGGGTCAACAGTTCTTCTTCTTTCCTGTACGGTAAT
->read3610_contig0_position1223_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AATAGTCGACTAGTAGCGAATATATGTTCTGCTCCGAGACTTCGGCATGAATCTAAGTATGGACTCTTATATTCCCTCCTGCGTAGTGCTCTCCCATAAT
->read3611_contig0_position1969_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TATCGCACCACAAAATTTCAGCATAAAGCATCAGGTTAAAGGCTGCGCATCGAGCAGCGTGCATTGGTCTTTCAGTCCCCAGTCACCGGAGACGTCCGAG
->read3612_contig0_position5777_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTCTGAATTCTGGCTATCTCAAATTGGGACCTAGTGTTGGCCAATAAGCTTCATATCGCCTTCTCAGATAGACTAATAGAACGAAGTCTATATAACAGC
->read3613_contig0_position7631_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTTGGAGTGTGCTGAGGGCCGACGCCCGGGGACCGTGATATCCTTGCGAGTGGAATGCGAACACGGCATAAGCGCAATGACCGAGGTAACAAGCCATGA
->read3614_contig0_position2569_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGATAGAGCGAAGTAGTTACGGTGATTACCCGTCCATCGATGCCCCTCCTGTCCCGAAGCCTTAAAATTTAACCCTGAATTGGCTTTATCCACCCCCCC
->read3615_contig0_position8601_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGCTCCGGGCGTATTTTTGCGTAAGACACTTCCTAAAGGGAACATATGTGTCCAGAATAGGGTTCAACGGTGTATGAGCAAACGATGCGGTAAGACGAG
->read3616_contig0_position2052_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CACCGGAGACGTCCGAGCTCGAACCCGTCCGGCTAAGACGCAGGCAGTCGCTGCATGTGTACGCAGCGGTCTATGCTACAGGTATTACGGAGTGAAGCGG
->read3617_contig0_position7954_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TACTCGACGAACAACAGCAAGATTCGACGATCAAACTCGCCGGCGACACGAAGATTGTCATACTAGCTTTCAGTCATTCCCCCTCAGTTTTGTCCATGTG
->read3618_contig0_position8478_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTACGGCCAATGCACGACCCTATATGACCCCTAGCGAGAAGTTATAGTCTAATAATGAATGGTGAACAGCACATCTTTTCGTCCTGAGGCCATATTAAT
->read3619_contig0_position9234_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGCAGCTCCGAGCGCCTTTATACCCATACTGCCACTCCAGTACCTGGGCCGCGTGTTGTACGCTGTGTATCTTGAGAGCGTTTCTCCGTATCGCAATGT
->read3620_contig0_position8754_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTATCCGGTGGTGATACCTACTATTGACTGGGGGCTTACTGAGAACACTTCATCTGTATGGCAAAGTTGCGACACCGCGCCACACAGCAGTTTATTGTTA
->read3621_contig0_position647_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGAAGCTAAAACTGAACAACGAGTGGGACACCGGCCTACTACATTATACAGTAAGGTAGAATCGCGTAGAAGCACCCACGAACAATGTAATTGACCGCG
->read3622_contig0_position3129_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGTGGTCTGAATGTTATGCCGTCCGACTCTTGCGCTCGGATGTCCGCAATGGGTTATCAAATGCCTATGTTCCGGTAATCTCTCATCTACTAAGCGCCCT
->read3623_contig0_position705_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGAATCGCGTAGAAGCACCCACGATCAATGTTATTAACCGCGACGGTGTATTCCACGACCTAATTTTTCCCGTCTCTGTGGTCAACCTGGACGCACAAAC
->read3624_contig0_position1106_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGACGTAGATAGCCTTTGAATGTGTACGGCAATAGGAGAAACTCGGCCACGTACGTGACAACATGGCGCGGCTCTCTATACCTCGCAAAGAATCACTCT
->read3625_contig0_position3546_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ACAGCATGAATCGTGTAACTCTGCTCGGTTATACGCCCTCGGGAGAAGACCCATGTAAGATGCATCCATCGCTACCACACGCGTCCGCCACCTCCGGGTC
->read3626_contig0_position855_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGATGGCTTTGGGAATCACTAGGTAATTACTGTTGGCTCCTTTCTTCATGATCGTCGGAGTTCTTTCAGTCCGATCAAGTGGTTAGAGACCTAGGTCTA
->read3627_contig0_position6219_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TATAAAAAAGGGACGAGTGGGGTCAACAGTTCTTCTTCTTTCCTGTACGGTAATGCTTCCGCGCATCTAAGTGATATTCGCCGGAATTTACCCTTCTAAT
->read3628_contig0_position8664_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCAACGGTGTATGAGCCAACGATGCGGTAAGACGAGCGCTCCGACCCCCCTTGGCTCTGCTACATCGAATTCAGCGTGTAAGAGCCCGCTTATCCGGTG
->read3629_contig0_position1462_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCCTAATCAGGATCATAGATGGCCAATTATTGACCACAGGTAGGGGCGAGGTATAAATTAGTGGATTCACTTCCCTTTGACATCTTGTTCTCACAACTG
->read3630_contig0_position7917_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGCTCTAATACCAATTGAAATGAAGCTTACGCAAACTACTCGACGAACAACAGCAAGATTCGACGATCAAACTCGCCGGCGACACGAAGATTGTCATAC
->read3631_contig0_position8166_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAAAGATCCGAGGCCTTTTCCAGGGTAAAATGATGGACTCATTGACCAACCCCTATTATTAGGAGCGGGCTGCGACTGCTTGCAGCTCCGACCGCTTTC
->read3632_contig0_position3147_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGTCCGACTCTTGCGCTCGGATGTCCGCAATGGGTTATCAAATGCCTATGTTCCGGTAATCTCTCATCTACTAAGCGCCCTAAAGGTCGTATGGTTGGA
->read3633_contig0_position4654_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTTGTGCATTCGTCGGCCTATTAGATACGGTACGGGATATTGGGTAACCTCCTCTTCACTGATATCATCCTATCGGCGTTCAAAGTATTCGGCGGATGA
->read3634_contig0_position1402_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTGGGCCAATCGAGAGGACATTTCTCAGCGCCCTTTCATCACTATTGCTAGGTCTCTTAAGCCTAATCAGGATCATAGATGGCCAATTATTGACCACAG
->read3635_contig0_position1760_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAAGTAATACGGTTGATGTTATTACCAACTCCACTTCTGCAAATTGTTATGAGCAAGCATACAAGTTAGCCGGCCCACAAATCGACGTGTGTATTTGTTC
->read3636_contig0_position835_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTGGCCTGGACGTCGTTTGTGGATGGCTTTGGGAAACACTAGGTAATTACTGTTGGCTCCTTTCTTCATGATCGGCGGAGTTCTTTGAGGCCGATCAAG
->read3637_contig0_position3251_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTTACACACCCTTAAGTACCGAACGATAGCGCACCCGTCTAGGAGGGCGTGCAGGGTCTCCCGCTAGCTAATGGTCACGGCCTCTCTGGGAAAGCTGAA
->read3638_contig0_position4740_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TATTCGGCGGATGAATTAGAGCCAAAGCAGTAGGTTACCGTCGGCGCATAACCGGCGAGTGCTCTGAAACGTTACATTCGTCTATCCGCACACACCGCCG
->read3639_contig0_position2845_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGAACTATTAGCAATCCTAAGCCCATAAGCCCTGCCCCACGGGGGCTACAATCCAGCAGTGAACGCGTTTACCTTAAGACGAAAGAGTCAGTAGAGTTG
->read3640_contig0_position2758_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCACTGCGTCTATTGTAAGAAATGCAATGCGTGGCCAGTTTGTTCCGACAGGACACCACTCTTTGAAGGTGCCCATTGCATTGTAGCCTGAACTATTAGC
->read3641_contig0_position4063_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTAGCTCCGCTGATAACGATTACTATAAATCAGCGAATCTAACATCAATCTGCACCACGAATATCGTCCAAGACGTTTTGAGCCGGTGACTAATTCGGTT
->read3642_contig0_position6255_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTTTCCTGTACGGTAATGCTTCCGCGCATCTAAGTGATATTCGCCGGAATTTACCCTTCTAATATTGTGTGCAAGCTACTTCTAGAACTTATTAAGTGC
->read3643_contig0_position1655_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCAACTTGATCGCCAGTGAGTGAGCGGTGGTTTATCTGTTGAGTGGCCACTTTTCCCTATCTGCTGGGACGGCACTGGAGATCTGGAACATTAGATAGG
->read3644_contig0_position6826_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCTCAACCACGTCTGTACCCCGGTTAAGATTTATAAACCATACATTTAACCCTTAGTCATATGATGATACTTCATCTGCATGCGCGCATCTTCCTATTT
->read3645_contig0_position5247_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCAGGGTGGTATATATGATCCTTGATAGCTTTATGGCCATCATCATAGTAAATTTTTTCAGATTACCCTGCAGACGTCCGCCTAAGATCCTAGTTGATTT
->read3646_contig0_position6666_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCTAGGCGTTAAAGTAGTAGAACAAGGGTCGGGCGATTTGTTTTGGTAGTGGTTATCGCATTGCAAGAACGTACGGACGGACAAAATGTCGGACACCGC
->read3647_contig0_position2522_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CACTGCTACCTCCGGCATATGGGCGTGCTAAAAATGCGGGAGTCAGGACGATAGAGCGAAGTAGTTACGGTGATTACCCGTCCATCGATGCCCCTCCTGT
->read3648_contig0_position9205_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTAATTTAGTCAGGTCGGAACCGCTGGCAGAGCAGCTCCGAGGGCCTTTATACCCATACTGCCACTCCAGTACCTGGGCCGCGTGTTGTACGCTGTGTAT
->read3649_contig0_position5574_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGGGCCGCTTATTGGTTCACCCTATCTGGCCATTGCAAGTTTGGCAGACGCGAGGTTGCGTGGTCAACCGAACGTTGCTTTCCTTAGGGTACCGAGTAT
->read3650_contig0_position3503_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCATCACATAGCAGGTACCACCCGAACCGCGCGTATTCTGCGACAGCATGAATCGTGTAACTCTGCTCGGTTATACGCCCTCGGGAGAAGACCCATGTA
->read3651_contig0_position5989_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CATCTAACGTTTGGACGGGTCTTGTGTTCCCTCAACACGTACGTTGACAGAGCTAACAATCCGTCGACTGAATGTGATTCCTTTGTTATTTCACACTATT
->read3652_contig0_position29_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTCTGGCTAACGAGCTACCGTTTCCTTTAACCTACCAGACGGTGACCAGGGCCGTTCGGCGTTGCATCGAGCGGTGTCGCCAGCGCAATGCGCAAGATT
->read3653_contig0_position2210_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCCAAGAGATGGGTTGATGGTAGCATCCCGGCTTCAGGGGCAATTTCTGACGCTTCGAGTGACCAGCGATAGTACGTTCCTTTTGTACTGAGTCTTAAC
->read3654_contig0_position2851_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TATTAGCAATCCTAAGACCATAAGCCCTGCCCCACGGGGGCTACAATCCAGCAGTGAACGCGTTTACCTTAAGACGAAAGAGTCAGTAGAGTTGGGGTTC
->read3655_contig0_position3269_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCGAACAATAGAGCACCCGTCTAGGAGGGCGTGCAGGGTCTCCCGCTAGCTAATGGTCACGGCCTCTCTGGGAAAGCTGAACAACGGATGGGATTAAGC
->read3656_contig0_position2031_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTGGTCTTTCAGTCCCCAGTTACCGGAGACGTCCGAGCTCGAACCCGTCCGGCTAAGAGGCAGGCAGTCGCTGCATGTGTACGCAGCGGTCTATGCTAC
->read3657_contig0_position8188_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGGTAAAATGATGGACTCATTGACCAACCCCTATTATTAGGAGAGGGCTGCGACTGCTTGCAGCTCCGACCGCTTTCCAATCGTTGCACATGACTTGAG
->read3658_contig0_position9773_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGAACAGAGACTAAATGTCCTTAAATCTCTAACACGATTTTAGTAGGTCTACTACTAGGCCGCTTGCTCAGAAATCGGAACACAAGTACGCGATCTCTTT
->read3659_contig0_position3121_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTACCCTCGTGGTCTGAATGTTATGCCGTCCGACTCTTGCGCTCGGATGTCCGCAATGGGTTATCAAATGCCTATGTTCCGGTAATCTCTCATCTACTA
->read3660_contig0_position3971_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTATCAAACCTATTTAATGATATATGCTCTTGGACAACACGAGGTCGTAATTATTTCCTGAGATGGTTTTAGTGAGAGCAGCAGATGCACTCTTAGCTCC
->read3661_contig0_position8667_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AACGGTGTATGAGCAAACGATGCGGTAAGACGAGCGCTCCGACCCCCCTTGGCTCTGCTACATCGAATTCAGCGTGTAAGAGCCCGCTTATCCGGTGGTG
->read3662_contig0_position9363_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CCATGGAGCTGCAACACTTTCACACAGGTAGCCGAACAGGTATTACTCAGACTGGAGAGGAATCTTCATTGGTCGTGGAGCCATTGTCGCTGCGTACCTA
->read3663_contig0_position1342_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTGTATTTTTGTACGGCTTGATGTCAGGGTCAGTTTGGGCGCCGGTATGTCTGTGTAAGGTTGGGCCAATCGAGAGGACATTTCGCAGCGCCATTTCAT
->read3664_contig0_position6241_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCAACAGTTCTTCTTCTTTCCTGTACGGTAATGCTTCCGCGCATCTAAGTGATATTCGCCGGAATTTACCCTTCTAATATTGTGTGCAAGCTACTTCTAG
->read3665_contig0_position367_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCTATACCGAGCAGAGAGGTTGGGTCTACCTAGTAGTGTCGCGGTTATCGGACAGAGGATTATGTAAGGTTACCGAAGACCGGGTAGCGTAGTTAGTAA
->read3666_contig0_position5757_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATACCCCGTGGCTTGGTTGTTTTCTGAATTGTGGCTATCTCAAATTGGGACCTAGTGTTGGCCAATAAGCTTCATATCGCTTTCTCAGATAGACTAATAG
->read3667_contig0_position2758_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCACTGCGTCTATTGTAAGAAATGCAATGCGTGGCCAGTTTGTTCCGGCAGGACACCACTCTTTGAAGGTGCCCGTTGCATTGTAGCCTGAACTATTAGC
->read3668_contig0_position3189_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGCCTATGTTCCGGTAATCTCTCATCTACTAAGCGCCCTAAAGGTCGTATGGTTGGAGGGCGGTTACACACCCTTAAGTACCGAACAATAGAGCACCCG
->read3669_contig0_position5785_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGTGGCTATCTCAAATTGGGACCTAGTGTTGGCCAATAAGCTTCATATCGCCTTCTCAGATAGACTAATAGAACGAAGTCCATATAACAGCTGATTTAA
->read3670_contig0_position8150_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGCACGACCGCCGCAGGAAAGATCCGAGGCCTTTTCCAGGGTAAAATGATGGACTCATTGACCAACCCCTATTATTAGGAGAGGGCTGCGACTGCTTGC
->read3671_contig0_position5059_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CAATTCGCTAGGTTGTAGCCAGGAAGTCTGTAGTACAGGTGCCCATAACCCGATGAGGCCAAGGTGTTACGTGAAGTCGCGTTGTCGCTAGTAACAGATT
->read3672_contig0_position7581_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGCGTGTGGAGAGTGACTGACTATCACGAGGAATTACGGATAACAGCCCACTTGGAGTGTGCTGAGGGCCGACGCCCGGGGACCGTGATATCCTTGCGA
->read3673_contig0_position9786_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AATGTCCTTAAATCTCTAACACGATTTTAGTAGGTCTACTACTAGGCCGCTTGCTCACAAATCGGAACACAAGTACGCGATCTCTTTTCTAGTCACCAGC
->read3674_contig0_position3166_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGATGTCCGCAATGGGTTATCAAATGCCTATGTTCCGGTAATCTCTCATCTACTAAGCGCCCTAAAGGTCGTATGGTTGGAGGGCGGTTACACACCCTTA
->read3675_contig0_position9539_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CACGGAACGCTTCTTGATCCTGAGCTACCCCGCGATTAACCTATGTCGGGACAAACACTCGATTGAGAAGTGGTCATGTCATTATTGTACATCAGTACCA
->read3676_contig0_position9553_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGATCCTGAGCTCCCCCGCGATTAACCTATGTCGGGACAAACACTCGATTGAGCAGTGGTCATGTCATTATTGTACATCAGTACCATAGCTTGGCCACAT
->read3677_contig0_position452_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGCGTAGTTAGTAACTTCAATCCGCGTTACGCTTTGTCCTCTGCTACGCCTCGATTGGATTCAGCTCACGTGGGACGCATGTACTTACCTAACATGAAG
->read3678_contig0_position3075_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-AAACTGATCGAGCACTGTCCGCGAAACATTATTCAGTACCGCGACTTTTAGCCTCGTGGTCTGAATGTTATGCCGTCCGACTCTTGCGCTCGGACGTCCG
->read3679_contig0_position4799_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCTCTGCAACGTTACATTCGTCTATCCGCACACACCGCCGTTGGATGTGTGCCACAGTGTTTTATACGGGACGGTGGCCACGGGGTGAGCACATGAATG
->read3680_contig0_position1282_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGACTCTTATATTCCCTCCTGCGTCGTGCTCTCCCATAATAATTGAACCCATGGGTCGCGCTGTATTTTTGTACGGCTTGATGTCAGGGTCAGTTTGGG
->read3681_contig0_position1893_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TATAACGATAATCAAAATGAGACAGACGAGTTGGAGTGTTTTGATGAGCGGTGTTATATTTGTCCTAACTTAGCACTATCGCACCACAAAATTTCAGCAT
->read3682_contig0_position6711_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTAGTGGTTATCGCATCGCAAGAACGTACGGACGGACAAAATGTCGGACACCGTCTTATCGGCTATACTAGTTAGAGCCTCGCTTGGGTCTCTACATCC
->read3683_contig0_position829_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGCCGGGTGGCTTGGACGTCGTTTGTGGATGGCTTTGGGAATCACTAGGTAATTACTGTTGGCTCCTTTCTTCATGATCGTCGGAGTTCTTTCAGGCCG
->read3684_contig0_position1504_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGGGCGAGTTAAAAATTAGTGGATTCACTTCCCTTTGACATCTTGTTCTCACAACTGCACACTCCGATGCTCTGCCGAGCCTTCTAACCATCGGGTATG
->read3685_contig0_position3022_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGCTCGGACCACCAAAGAGCAAGACTCTATGACTAGCGGGTGTCGTCAATGAAAACTGATCGAGCACTGTCCGCGAAACATTATTCAGTACAGCGACTT
->read3686_contig0_position9358_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTGACCATGGAGCTGCAACACTTTCACACAGGTAGCCGAACAGGTATTACTCAGACTGGAGAGGAATCTTCATTGGTCGTGCAGACATTGTCGCTGCGT
->read3687_contig0_position4670_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCGATTAGATACGGTACGGAATATTGGGTAACCTCCTCTTCACTGATATCATCCTATCGGCGTTCAAAGTATTCGGCGGATGAATTAGAGCCAAAGCAG
->read3688_contig0_position9399_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGGTATTACTCCGACTGGAGAGGAATCTTCATTGGTCGTGCAGACATTGTCGCTGCGTACCAAAGTAACTGGACGCCCATACCCCTTTGTCTACAGAAG
->read3689_contig0_position1414_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGAGGACATTTCGCAGCGCCCTTTCATCTCTATTGCTAGGTCTCTTAGGCCTAATCAGGATCATAGATGGCCAATTATTGACCACAGGTAGGGGCGAGG
->read3690_contig0_position5847_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGACTAATAGAACGAAGTCCATATAACAGCTGATTTAAGAGGAAAAATTGAACATCAACGGAAGAACTATAGCAGGCTCACCAGCATGAAAGACATCCTC
->read3691_contig0_position9682_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTACTTAATCGGCTGGGGTAACGGCTGGTTTTGTACTACGGTATGGGAACCCGTTTGCCGAACGTCTGGAAATCTGTCGAGTCATATCGATGAACAGAG
->read3692_contig0_position2821_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGAAGGTGCCCATTGCATTGTAGCCTGAACTATTAGCAATCCTAAGCCCATAAGCCCTGCCCCACGGGGGCTACAATCCAGCAGTGAACGCGTTTGCCTT
->read3693_contig0_position29_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTCTGGCTAACGAGCTACCGTTTCCTTTAACCTGCCAGACGGTGACCAGGGCCGTTCGGGGTTGCATCGAGCGGTGTCGCTAGCGCAATGCGCAAGATT
->read3694_contig0_position4123_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATATCGTCCAAGACGTTTTGAGCCGGTGACCAATTCGGTTGTCGCACATAGTGTACGTTGAGGCGGGAACTTCCCGCTGATATGATTGTGATCGATATTC
->read3695_contig0_position279_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTAACATAACGCGTGTCATCTAGTTCTAGCATCCTCCGCCTTGGGCCACACAATTAATATAAGACGGGATAATGGCTTCATGCTCATGTTCTATACCGAG
->read3696_contig0_position5400_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCAAGACGGGCGACCGTACCCGGACACCTGGCAGCGGGAACCGCTTTGACTCTGGAGTGCCAGCGATAGTATCTCAGATGCGAAAGCGCTTGTCACCTC
->read3697_contig0_position9835_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTGCTCAGAGATCGGAACACAAGTACGCGATCTCTTTTCTAGTCACCAGCCTCAGGCATTCGCAAATTTCGTTCATGCACGCAACGGGTCGAATAATAT
->read3698_contig0_position2960_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGACCCGTAGCCCAATTGCGCTCCCGAACAACGAGTGAGTTTAAAATTGACTTGAAACCGCCTAGCTCGGACCACCAAAGAGCAAGACTCTATGACTAGC
->read3699_contig0_position8867_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGGGTTAGGAGCTAAGAAACCGGTGCATCACCGTACGAAAAGGATGGTTGAAATAGAACGAGTTGTAAAACATTAGCTCACGCGCCACCGTCATAGGCT
->read3700_contig0_position2651_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCTTTATCCACCCCCCCTACTGGCCACCACTGGGGCGCGAGTCTCGAGCCTCTCGACTCCAAAGGGTCTGCCCGAGACAGGTTCACCGAGTCGTTACTC
->read3701_contig0_position8952_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCACCGTCATAGGCTGCATATTGAGACAGGGTTGAAAACCTGTCTGAAGTCCGTGCTTCACTAACCAGCCTATGCGCCTTAACTTTATGCATACTCGTTT
->read3702_contig0_position5343_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AATTGATCAATTGAGTCCAGTACACCATATCAACAGCTTGTTCGTTCCACTTCAATCAGCAAGACGGGCGACCGTACCCGGACACTTGGCAGCGGGAACC
->read3703_contig0_position4609_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGGAGGACGTAAACGCCAATTCCGCTTAATAGCGGAATCTGCTGGCTTGTGCATTCGTCGGCCTATTAGATACGGTACGGAATATTGGGTAACCTCCTC
->read3704_contig0_position9238_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCTCCGAGGGCCTTTATACCCATACTGCCACTCCAGTACCTGGGCCGCGTGTTGTACGCTGTGTATCTTGAGAGCGTTTCTCCGTATCGAAATGTTACG
->read3705_contig0_position6590_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCTTGCCCATCCGAGGCTTAAGCAGCGACTCCACATGGAGCGATGGGTCCTCAAGGCAGTATAAAATGGACTGCTATCTAGGCGTTAAAGTAGTAGAAC
->read3706_contig0_position4873_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGGCCACGGGGTGAGCACATGAATGGGGTACGGTTTTACCGTCCATGAAGTTGTGACATAAAGGTGCGGGACGCGGAAGCGCACCTCGAATAACGTTAG
->read3707_contig0_position6967_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCGTTCCGATTGTCCTTTCCCAGGCTACGGCCTTATACCAAAGACTTCTAGACCGGAGAGACTACTTCCAGCCACGAATTCGTGTGATAACCGCCTAAA
->read3708_contig0_position1053_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGCCTGTATGACCCTGGTTACGCGTTATTACCGGTCAGCTCCAGTTACGTCACGGACGTAGAGAGCCTTTGAATGTGTACGGCAATAGGAGAAACTCGG
->read3709_contig0_position5129_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGAAGTCGCGTGGTCGCTAGTAACAGATTGGGAGGTCTCGGCCATTTCGTTGTATTGATCGCTGTGCACTTCAAAATTCGGAACATCTTAACCAAAGCA
->read3710_contig0_position3686_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTCTGAATATCGTGCAGTAAGTTTCTCTTAGGTTCCTCAACGGAAACGTCTCAGACCCACCTTAGACGCGGGAATAAATTCGACACGGGGTACGAAGGG
->read3711_contig0_position3895_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGATTATCTGCACGACTCTTAAAATCATGCACTAAGCATAGAATGCACGACTACTTGTTACTGAAGTCGGCATGACTATCAAACCTATTTAATGATATA
->read3712_contig0_position667_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGAGTGGGACACCGGCCTACTACATTATACAGTAAGGTAGAATCGCGTAGAAGCACCCACGATCAAAGTTATTAACCGCGACGGTGTATTCCACGACCTA
->read3713_contig0_position664_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CAACGAGTGGGACACCGGCCTACTACATTATACAGTTAGGTAGAATCGCGTAGAACCACCCACGATCAATGTTATTAACCGCGACGGTGTATTCCACGAC
->read3714_contig0_position7302_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTTGCTTGCCACTCCGCCGATGTCTATAAGCGGCAGATCTACTTGACTCTACGTGCTGCAATGGAGAACCGCGGAAGGAACACTTTCTGGTGCCACTCG
->read3715_contig0_position6303_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTTTACCCTTCTAATATTGTGTGCAAGCTACTTCTAGACCTTATTAAGTGCCCAGGAATTCCTAGGAAGGCGCGCAGCTCAAGCAATCATGCATGCCGG
->read3716_contig0_position5769_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTAGTTGTTTTCTGAATTGTGGCTATCTCAAATTGGGACCTAGTGTTGGCCAATAAGCTTCATATCGCCTTCTCAGATAGACTAATATAACGAAGTCCAT
->read3717_contig0_position7265_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACATATCCCGACACCGGCAGCTGAAATGATGCAGAAGCCTTGCTTGCCACTCCGCCGATGTCTAAAAGCGCCAGATCGACTTGACTCTACGTGCTGCAAT
->read3718_contig0_position5390_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCTTCAATCAGCAAGACGGGCGACCGTACCCGGACACCTGGCAGCGGGAACCGCTTTGACTTTGGAGTGCCAGCGATAGTATCTCAGAGGCGAAGGCGC
->read3719_contig0_position7745_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGTGGTAGTGTAGTTGCCGGCCCCTGTGCTGACCTTATGTCCATATCGATACACGAAGGCCAGTGCGGAAGCGGAGCCACACTCGCCGTTACTGACTGA
->read3720_contig0_position1203_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTATGGGTCATCTTGAGAGAATAGTCGACTAGTAGCGAATATATGTTCTGCTCCGAGACTTCGGCATAAATCTAAGTATGGACTCTTTTATTCCCTCCT
->read3721_contig0_position1182_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTATACCTCGCAAAGAATCACTCTATGGGTCATCTTGAGAGAATAGTCGACTAGTAGCGAATATATGTTCTGCTCTGAGACTTCGGCATAAATCTTAGTA
->read3722_contig0_position8186_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCAGGGTAAAATGATGGACTCATTGACCAACCCCTATTATTAGGAGAGGGCTGCGACTGCTTGCAGCTCCGACCGCTTTCCAATCGTTGCACATGACTTG
->read3723_contig0_position1231_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTAGTAGCGAATATATGTTCTGCTCCGAGACTTCGGCATAAATCTAAGTATGGACTCTTATATTCCCTCCTGCGTAGTGCTCTCCCATAATAAGTGAAC
->read3724_contig0_position3706_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTTTCTCTTAGGTTCCTCATCGGAAACGTCTCAGACCCACCTTAGACGCGGGAATAAATTCGACACGGGGTACGAAGGGTAAGAACACCTAGCCTGGCA
->read3725_contig0_position5576_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTCCGCTTATTGGTTCACCCAATCTGGCCATTGCAAGTTTGGCAGACGCGAGGTTGCGTGGTCAACCGAACGTTGCTTTCCTTAGGGTACCGAGTATAT
->read3726_contig0_position3105_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTCAGTACAGCGACTTTTACCCTCGTGGTCTGAATGTTATGCCGTCCGACTCTTGCGCTCGGATGTCCGCAATGGGTTATCAAATGCCTATGTTCCGGT
->read3727_contig0_position5221_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCAAAGCATATTAATATGCCAGCCGCGCAGGGTGGTATATATGATACTTGATAGCTTTATGGCCATCATCATAGTAAATTTTTTCAGATTACCCTGCAGA
->read3728_contig0_position2380_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGGGCGGTGAGGGGTACCCGACGCCTCTGCTGTCAAAGTGGGAAATCCAGTCTCGACTATATCTACTATGTCATGCTTGTCGAATGAACAACTCAATTA
->read3729_contig0_position2058_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGACGTCCGAGCTCGAACCCGTCCGGCTAGGAGGCAGGCAGTCGCTGCATGTGTACGCAGCGGTCTATGCTACAGGTATTACGGAGTGAAACGGCTGCGA
->read3730_contig0_position2134_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AATTACGGAGTGAAACGGCTGCGAGCATCTCATAATCGGGCCGCCCGATTTCAGCTTGGCCACAACAGAGACTAGCCACCAAGAGATGGGTTGATGGTAG
->read3731_contig0_position582_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCTTCTGTCTCTGGCGGGGACGGCTATGTGCGTTCATAAATCTCAATGTCGAAACTGCGATGGGCAGAAGCTAAAACTGAACAACGAGTGGGGCACCGG
->read3732_contig0_position1632_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACATGCACCCGGTCCGTTGACTTACCAACTTGATCGCCAGTGAGTGAGCGGTGGTTTATCTGTTGAGTGGCCACTTTTCCCTATCTGCTGGGACGGCACT
->read3733_contig0_position6809_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGCTGATACGCGCGAGCTCTCACCCACGACTGTACCCCGGTTAAGATTTATAAACCATACATTTAACCCTTAGTCATAAGATGATACTTCATCTGCATG
->read3734_contig0_position2052_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CACCGGAGACGTCCGAGCTCGAACCCGTCCGGCTAAGAGGCAGGCAGTCGCTGCATGTGTACGCAGCGGTCTATGCTACAGGTATTACGGAGTGCAACGG
->read3735_contig0_position9580_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TATGTCGGGACAAACACTCGATTGAGCAGTGGTCATGTCATTATTGTACATCAGTACCATAGCTTGGCCACATGTTATGCTCGTACTCGAAGGGGGAATA
->read3736_contig0_position1109_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGTAGAGAGCCTTTGAATGTGTACGGCGATAGGAGAACCTCGGCCACGTACGTGTCAACATGGCGCGGCTCTCTATACCTCGCAAAGAATCACTCTATG
->read3737_contig0_position9584_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGGGACAAACACTCGATTGAGCAGTGGTCATGTCATTATTGTACATCAGTACCATAGCTTGGCCACATGTGATGCTCGTACTCGAAGGGGGATTCACCT
->read3738_contig0_position52_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCTTTCACCTGCCAGACGGTGACCAGGGCCGTTCGGCGTTGCATCGAGCGGTGTCGCTAGCGCAATGCGCAAGATTTTGACATTTACAAGGCAACATTG
->read3739_contig0_position907_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGTCGGAGTTCTTTCAGGCCGATCAAGTGGTTAGAGACCTAGGTCTATCCCAGACGATCGCAGCGGAGTCGATATAATTGCAGTATCATGTCTCGCTGA
->read3740_contig0_position2798_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTTCCGGCAGGACACCACTCTTTGAAGGTGCCCATCGCATTGTAGCCTGAACTATTAGCAATCCTAAGCCCATAAGCCCTGCCCCACGGGGGCTACAAT
->read3741_contig0_position2143_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGAAACGGCTGCGAGCATCTCATAATCGGGCCACCCGATTTCAGCTTGGCCACAACAGAGACTAGCCACCAAGAGATGGGTTGATGGTAGCATCCCGGC
->read3742_contig0_position8971_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTGAGACAGGGTTGAAAACCTGTCTGAAGTCCGTGCTTCCCTAACCAGCCTATGCGCCTTAACTTTATGCATACTCGTTTAGTACAGGGCCGCGCCCCA
->read3743_contig0_position2754_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGATCCACTGCGTCTATTATAAGAAATGCAATGCGTGGCCAGTTTGTTCCGGCAGGACACCACTCTTTGAAGGTGCCCATTGCATTGTAGCCTGAACTAT
->read3744_contig0_position3170_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCCGCCATGGGATATCAAATGCCTATGTTCCGGTAATCTCTCATCTACTAAGCGCCCTAAAGGTCGTATGGTTGGAGGGCGGTTACACACCCTTAAGTA
->read3745_contig0_position1315_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCATAATAAGTGAACCCATGGGTCGCGCTGTATTTTTGTACGGCTTGATGTCAGGGTCAGTTTGGGCGCCGGTATCTCTGTGTAAGGTTGGGCCAATCG
->read3746_contig0_position3709_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCTCTTAGGTTCCTCAACGGAAACGTCTCAGACCCACCTTAGACGCGGGAATAAATTCGACACGGGGTACGAAGGGTAAGAACACCTAGCCTGGCAATT
->read3747_contig0_position6207_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTCTGCTACGTTATAAAAAAGGGACGAGTGGGGTCAACAGTTCTTCTTCTTTCCTGTACGGTAATGCTTCCGCGCATCTAAGTGATATTCGCCGGAATT
->read3748_contig0_position2858_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AATCCTAAGACCATAAGCCCTGCCCCACGGGGGCTACAATCCAGCAGTGAACGCGTTTACCTTAAGACGAAAGAGTCAGTAGAGTTGGGGTTCGTGCTTT
->read3749_contig0_position7136_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCCAAGTGTCCATCGGAGTCCGCTTCCCGGGCTTGTCCGCGTCCCATCGGTTAATTCAATGTCCGTCAATCGGGTTGCCCAAAAATTCTACCTGTCCAC
->read3750_contig0_position5240_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CACCCGCGCAGGGTGGTATATATGATCCTTGATAGCTTTATGGCCATCATCATAGTAAATTTTTTCAGATTACCCTGCAGACGTCCGCCTAAGATCCTAG
->read3751_contig0_position2527_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTACCTCCGGCGTATGGGCGTGCTATAAATGCGGGAGTCAGGACGATAGAGCGAAGTAGTTACGGTGATTACCCTTCCATCGATGCCCCTCCTGTCCCGA
->read3752_contig0_position2722_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCGAGACAGGTTCACCGAGTCGTTACTCCCGGGATCCACTGCGTCTATTGTAAGAAATGCAATGCGTGGCCAGTTTGTTCCGGCAGAACACCACTCTTT
->read3753_contig0_position4582_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CATAGAGTCCCGCAGTGTCGGAGCGATAGGGAGGACGTAAACGCCAATTCCGCTTAAAAGCGGAATCTGCTGGCTTGTGCATTCGTCGGCCTATTAGATA
->read3754_contig0_position6954_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGGTCACTGATGAGCGTTCCGATTGTCCTTTCCCAGGCTACGGCCTTATACCAAAGACTTCTAGACCGGAGAGACTACTTCCAGCCACGAATTCGTGTG
->read3755_contig0_position8766_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GATACCTACTATTGACTGGGGGCTTACTGAGAACACTTCATCTGTATGGCAAAGTTGTGCCACCGCGCCACACAGCAGTTTATTGTTAACACGCGATACA
->read3756_contig0_position4729_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCGTTCAAAGTATTCGGCGGATGAATTAGAGCCAAAGCAGTAGGTTACCGTCGGCGCATAACCGGCGAGTGCTCTGAAACGTTACATTCGTCTATCCGC
->read3757_contig0_position4655_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTGTGCATTCGTCGGCCTATTAGATACGGTACGGAATATTGGGTAACCTCCTCTTCACTGATATCATCCTATCGGCGTTCAACGTATTCGGCGGATGAA
->read3758_contig0_position5866_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CATATAACAGCTGATTTAATAGGAAAAATTGAACATCAACGGAAGTACTATAGCAGGCCCACCAGCGTGAAAGACATCCTCATTGTGAACCCGGCATCTC
->read3759_contig0_position6884_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CATAAGAGGATACTTCATCTGCATGCGCGCATCTTCCTATTTTATGGTCTTAATTGAGTGTTCAGAGTTGGGGGTCACAGATGAGCGTTCCGATTGTCCT
->read3760_contig0_position1081_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTCCGGTCAGCTCCAGTTACGTCACGGACGTAGAGAGCCTTTGAATGTGTACGGCAATAGGAGAAATTCGGCCACGTACGTGTCAACATGGCGCGGCTC
->read3761_contig0_position3835_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGAACCCGGGCCCAAAATTGGAACCCGTAATCTTCAAGTGAATCATTCGATCATGCAAACCTGATTATCTGCACGACTCTTAAAATCATGCACTAAGCAT
->read3762_contig0_position5064_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCTAGGTTGTAGCCAGGAAGGCTGTAGTACAGGTCCCCATAACCCGATGAGGCCAAGGTGTTACGTGAAGTCGCGTTGTCGGTAGTAACAGATTGGGAG
->read3763_contig0_position5274_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCTTATGGCCATCATCATAGTAAATTTTTTCAGATTACCCTGCAGACGTCCGCCTAAGATCCTAGTTGAATTGATCAATTGAGTCCAGTACACCATATC
->read3764_contig0_position1865_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGGAGGTTAACTTTGCGGAGCTCAACCTATAACGATAATCAAATTGAGACAGACGAGTTGGAGTGTTTTGATGAGCGGTGTTATATTTGTCCTATCTTA
->read3765_contig0_position7454_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTCTCAGCCCTTCGTTGAAAGGAGAATACAAATGACGGGAACTCTGACGAGAGGGTGCTTGAACGAGAGAAGCTAACAGTCATTGCGATGACGAGAACA
->read3766_contig0_position6123_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTACAGCGTTATCCGTCCGGAACTGGCTTGAGCCACTCATAAGGCACGCGCGGGCCATAACAGTCGACTAAAAGGCGTAACCGATTCTGCTACGTTATA
->read3767_contig0_position8280_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GACTTGAGGCTCGGACTCGTATCTCTCTCCGTGTTCCTTTCGATAACTCTGCGACCTGAATGACCTTGGGCTCGTCGACATTCGTGGTAGTAATCCGAGC
->read3768_contig0_position3097_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAAACATTATTCAGTACAGCGACTTTTACCCTCGTGGTCTGAATGTTATGCCGTCCGACTCTTGCGCTCGGATGTCCGCAATGGGTTATCAAATGCCTAT
->read3769_contig0_position2489_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCGAGGTAGAGTATGCAGATTTCGTACCTTGCCACTGCTACCTCCGGCATATGGGCGTGCTATAAATGCGGGAGTCAGGACGATAGAGCGAAGTAGTTA
->read3770_contig0_position48_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGTTTCCTTTAACCTGCCAGACGGTGACCAGGGCCGTTCGGCGTTGCATCGAGCGGTGTCGCTAGCGCAATGCGCAAGATTTTGACATTTACAAGGCAAC
->read3771_contig0_position2448_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGTCATGCTTGTCGAATGAACAACTCAATTCGGTAGTGTGCGCGAGGTAGAGTATGCAGATTTCATGCCTTGCCACTGCTACCTCCGGCATATGGGCGT
->read3772_contig0_position9083_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCCTGTCACGGGCATGCTGAAAGCGGCGGTTACATTAATCGCTTCTGTGATGACAGACCGAAGCCCACCTTTCCTGACCTCACCGCAGGCATCGAGTCT
->read3773_contig0_position4706_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCTTCACTGATATCATCCTATCGGCGCTCAAAGTATTCGGCGGATGAATTAGAGCCAAAGCAGTAGGTTACCGTCGGCGCATAACCGGCGAGTGCTCTG
->read3774_contig0_position7141_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTGTCCATCGGAGTCCGCTTCCCGGGCTTGTCCGCGTCCCATCGGTTAATTCAATGTCCGTCAATCGGGTTGGCCAAAAATTCTACCTGTCCACCTGTC
->read3775_contig0_position7091_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGGGGGAGCTAATATATCGCGGCGTCGAGTTACCGTTGCACCACCTCCAAGTGTCCATCGGAGTCCGCTTCCCGGGCTTGTCCGCGTCCCATCGGTTAA
->read3776_contig0_position1382_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCCGGTATGTCTGTGTAAGGTTGGGCCAATCGAGAGGACATTTCGCAGCGCCCTTTCATCTCTATTGCTAGGTCTCGTAAGGCTAATCAGGATCATAGA
->read3777_contig0_position4395_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGCTAGCTTGACTCGGCTGAAAAAGAAAACAATCTTTATGGAACCGAGGGGCGGGATGATAATTGTTCTTAGTATAGTGACCGTCATGGACGACGGACA
->read3778_contig0_position1414_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGAGGACATTTCGCAGCGCCCTTTCATCTCTATGGCTAGGTCTCTTAAGCCTAATCAGGATCATAGATGGCCAATTATTGACCACAGGTAGGGGCGAGG
->read3779_contig0_position2301_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTCTTAACATCGGCAAATGCGCCCTAGATACCTGCGGCTTCACTCCACAGTGTAAGAGTTGACGGGACTAAAACAGTATTGGGCGGTGAGGGGTACCCG
->read3780_contig0_position7573_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGAGAACAAGCGTGTGGAGAGTGACTGACTATCACGAGGAATTACGGATAACAGCCCACTTGGAGTGTGCTGAGGGCCGACGCCCGGGCACCGTGATAT
->read3781_contig0_position6095_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCGTGCGCTGCTAAGGCTGGTGCGACCCTCACAGCGTTATCCGTCCCGAACTGGCTTGAGCCACTCATAAGGCACGCGCGTGCCATAACAGTCGACTAA
->read3782_contig0_position5531_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCACGACCCAGAAATCTTTAGCTAAGTAATCGACTGCCTTCGTCGGGCCGCTTATTGGTTCACCCAATCTGGTCATTGCAAGTTTGGCAGACGCGAGGT
->read3783_contig0_position77_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGGCCGTTCGGCGTTGCATCGAGCGGTGTCGCTAGCGCAATGCGCAAGATTTTGACATTTACAAGGCAACATTGCAGCGTCCGATGCTCCGGTGGCCTC
->read3784_contig0_position3362_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTAAGTTCAGCAGTCCGCCTCCAATCTCTCCGACGTTCATTCTCAAGGGTGCAGTTTTAGAGACTGAGAACTCACCCTAGTGGTAGTACTGCCTGCCGT
->read3785_contig0_position2574_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGAGCGAAGTAGTTACGTTGATTACCCGTCCCTCGATGCCCCTCCTGTCCCGAAGCCTTAAAATCTAACCCTGAATTGGCTTTATCCACCCCCCCTACTG
->read3786_contig0_position418_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGAGAGGATTATGTAAGGTTACCGAAGACCGGGTAGCGTAGTTAGTAACTTCAATCCGCGTTACGCTTAGTCCTCTGCTACGCCTCGAATGGTTTCAGC
->read3787_contig0_position7705_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCAATGACCGAGGTAACAAGCCATGAGGACTGGAGCGGTAATGTGGTAGTGTAGTTGCCGGCCCCTGTGCTGACCTTATGTCCATATCGATACACGAAGG
->read3788_contig0_position8603_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTTCGGGCGTATTTTTGCGTAAGACACTGCCTAAAGGGAACATATGTGTCCAGAATAGGGTTCAACGGTGTATGAGCAAACGATGCGGTAAGACGAGCG
->read3789_contig0_position4469_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATAGTGAACGTTATGGACGACGGACATAACTACTGAGTGTCCGCCCTCGGCTAATCATGAACACCGGTCAGGCATGCTTACCCCCTGCGACGGCATTGGC
->read3790_contig0_position8095_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCCTGTAGTCCGCGGCCAATCAGCACGATCAAGCTAAAGACAGGGATTATGCACTAGCACGACCGCCGCAGGAAAGATCCGAGGCCTTTTCCAGGGTAA
->read3791_contig0_position2343_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTCCACAGTGTAAGAGTTGACGGGACTAAAACAGTATTGGGCGGTGAGGGGTACCCGACGCCTCTGCTGTCAAAGTGGGAAATCCAGTCTCGACTATAT
->read3792_contig0_position5788_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGCTATCTCAAATTGGGACCTAGTGTTGGCCAATAAGCTTCATATCGCCTTCTGAGATAGACTAATAGAACGCAGTCCATATAACAGCTGATTTAAGAG
->read3793_contig0_position2580_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGTAGTTACGGTGATTACCCGTCCATCGATGCCCCTCCTGTCCCGAAGCCATAAAATCTAACCCTGAATTGGCTTTATCCACCCCCCCTACTGGCGACC
->read3794_contig0_position7303_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTGCTTGCCACTCCGCCGATGTCTAAAAGCGCCAGATCGACTTGACTCGACGTGCTGCAATGGAGAACCGCGGAAGGAACACTTTCTGGTGCCACTCGA
->read3795_contig0_position360_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTCATGTTCTATACCGAGCAGAGAGGTTGGGTCTACCTAGTAGTGTGGCGGTTATCGGACAGAGGATTATGTAAGGTTACCGAAGACCGGGTAGCGTAG
->read3796_contig0_position7943_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTACGCAAACTACTCGACGAACTACAGCAAGATTGGACGATCAAACTCGCCGGCGACACGAAAATTGTCATACTAGCTTTCAGTCATTCCCCCTCAGTT
->read3797_contig0_position7862_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGGGGTGATTTGTGCCGGCGCGTCCAGGTGCGAACGTTGTGCCGTGTCACTCTGTAGCTCTAATACCAATTGAAATGAAGCTTACGCAAACTACTCGAC
->read3798_contig0_position2255_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCTGACGATTCGAGTGGCCAGCGATAGTACGTTCCTTTTGTACTGAGTCTCAACATCGGCAAATGCGCCCTAGATACCTGCGGCTTCACTCCACAGTGT
->read3799_contig0_position5759_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCCCGTGGCTTGGTTGTTTTCTGAATTGTGGCTATCTCAAATTGGGACCTAGTGTTGGCCAATAAGCTTCATATCGCCTTCTCAGATCGACTAATAGAA
->read3800_contig0_position7696_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCATAAGCGCAATGACCGAGGTAACAAGCCATGAGGACTGGAGCGGTAATGTGGTAGTGTAGTTGCCGGCCCCTGTGCTGACCTTATGTCCATATCGAT
->read3801_contig0_position3142_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTATGCCGTCCGACTCTTGCGCTCGGATGTCCGCAATGGGTTATCAAATGCCTATGTCCCGGTAATCTCTCATCTACTAAGCGCCCTAAAGGTCGTATGG
->read3802_contig0_position5611_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGTTTGGCAGACGCGAGGTTGCGTGGTCAACCGAACGTTGCTTTCCTTAGGGTACCGAGTATATTAACTTTATGAAATTAGCGCGTTAACTACTTAAAG
->read3803_contig0_position1376_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTGGGCGCCGGTATGTCTGTGTAAGGTTGGGCCAATCGAGAGGACATTTCGCAGCGCCCTTTCATCTCTATTGCTAGGTCTCTTAAGCCTAATCAGGAT
->read3804_contig0_position89_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGTTGCATCGAGCGGTGTCGCGAGCGCAGTGCGCAAGATTTTGACATTTACAAGGCAACATTGCAGCGTCCGATGGTCCGGTGGCCTCCAGATAGTGTCC
->read3805_contig0_position9575_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TAACCTATGTCGGGACAAACACTTGATTGAGCAGTGGTCATGTCATTAGTGTACATCAGTACCATAGCTTGGCCACATGTGATGCTCGTACTCGAAGGGG
->read3806_contig0_position5084_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCTGTAGTACAGGTGCACATAACCCGATGAGGCCAAGGTGTTACGTGAAGTCGCGTTGTCGCTAGTAACAGATTGGGAGGTCTCGGCCAATTCGTTGTA
->read3807_contig0_position1376_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTGGGCGCCGGTATGTCTGTGTAAGGTTGGGCCAATCGAGAGGACATTTCGCAGCGCCCTTTCATCTCTATTGCTAGGTCTCTTAAGCCTAATCAGGAT
->read3808_contig0_position3023_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCTCGGACCACCAAAGAGCAAGACTCTATGACTAGCGGGTGTCGTCAATGAAAACTGATCGAGCACTGTCCGCGAAACATTATTCAGTACCGCGACTTT
->read3809_contig0_position6180_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATAACAGTCGACTAAAAGGCGTAACCGATTCTGCTACGTTATAAAAAAGGGACGAGTGGGCTCAACAGTTCTTCTTCTTTCCTGTACGGTAATGCTTCCG
->read3810_contig0_position169_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGGCCTCCAGATAGTGTCCAGTCGCTCTAACTGTATGGAGACCATAGGCATTTACCTTATTCTCATCGCCACGCCGCAAGATCTTTAGGACCCAGCATT
->read3811_contig0_position6611_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCAGCGACTCCACATGGAGCGATGGGTCCTCAAGGCAGTATAAAATGGACTGCTATCTAGGCGTTAAAATAGTAGAACGAGGGTCGGGCGATTTGTTTT
->read3812_contig0_position4367_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGAGTCCCGCACTACTGATACGAAGTCTAGCTAGCTTGACTCGTCTGATAAAGAAAACAATCTATATGGAACCGAGGGGCGGAATGATAATTGTTCTTA
->read3813_contig0_position5398_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCAGCAAGACGGGCGCCCGTACCCGGACACCTGGCAGCGGGAACCGCTTTGACTCTGGAGTGCCAGCGATAGTATCTCAGAGGCGAAAGCGCTTGTCACC
->read3814_contig0_position8268_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCGTTGCACATGACTTGAGGCTCGGACTCGTATCTGTCTCCGTGTTCCTTTCGATAACTCTGCGACATGAATGACCTTGGGCTCGTCGACATTCCTGGT
->read3815_contig0_position1240_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAATATATGTTCTGCTCCGAGACTTCGGCATAAATCTAAGTATGGACTCTTATATTCCCTCCTGCGTAGTGCTCTCCCATAATAAGTGAACCCATGGGTC
->read3816_contig0_position7343_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTTGACTCTACGTGCTGCAATGGAGAACCGCGGAAGGAACACTTTCTGGTGCCACTCGAGACCGCCCTCCCCGACCCATATGCAGTTTCTGCATACACC
->read3817_contig0_position1128_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGTACGGCAATAGGAGAAACTCGGCCACGTACGTGTCAACATGGCGCGGCTCTCTATACCTCGCAAAGAATCACTCTATGGGTCATCTTGAGAGAATAG
->read3818_contig0_position7862_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGGGGTGATTTGTGCCGGCGCGTCCAGGTGCTAACGTTGTGCCGTGTCACTCTGTAGCTCTAATACCAATTGAAATGAAGCTTACGCAAACTACTCGAC
->read3819_contig0_position613_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTTCATAAATCTCAATGTCGAAACTCCGATGGGCAGAAGCTAAAACTGAACAACGAGTGGGACACCGGCCTACTACATTATACAGTAAGGTAGAATCGC
->read3820_contig0_position6368_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAAGGCGCGCAGCTCAAGCAATCATACATGGCGGAATGCCTGTCCACCGGGGGTTCTAGTGTACCACAGTGGCATGGATAGCTAAGCAGGTCCTGGATT
->read3821_contig0_position6542_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTAGACGAGCGATGGATTTAGACCGTTCACTGAACCCTCTAAAAGGACCTCTTGCCCATCCGAGGCTTAAGCAGCGACTCCACATGGAGCGATGGGTCCA
->read3822_contig0_position5388_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCACTTCAATCAGCAAGACGGGCGACCGTACCCGGACACCTAGCAGCGGGAACCGCTTTGACTCTGGAGTGCCAGCGATAGTATCTCAGAGGCGAAAGC
->read3823_contig0_position5157_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGGGAGGCCTCGGCCAATTCGTTGTATTGATCGCTGTGCACTTTAAAATTCGGAACATCTTAACCAAAGCATATTAATATGCCAGCCGCGCAGGGTGGT
->read3824_contig0_position1083_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCGGTCAGCTCCAGTTACGTCACGGACGTAGAGAGCGTTTGAATGTGTACGGCAATAGGAGAAACTCGGCCACGTACGTGTCAACATGGCGCGGCTCTC
->read3825_contig0_position2140_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAGTGAAACGGCTGCGAGCATCTCATAATCGGGCCACCCGATTTCAGCTTGGTCACAACAGAGACTAGCCACCAAGAGATGGGTTGATGGTAGCATCGC
->read3826_contig0_position6149_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTTGAGCCACTTATAAGGCACGCGCGGGCCATAACAGTCGACTGAAAGGCGTAACCGATTCTGCTACGTTATAAAAGAGGGACGAGTGGGGTCAACAGT
->read3827_contig0_position1398_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAAGGTTGGGCCAATCGAGAGGACATTTCGCAGCGCCCTTTCATCTCTATTGCTAGGTCTCTTAAGCCTAATCAGGATCATAGATGGCCAATTATTGACC
->read3828_contig0_position5853_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATAGAACGAAGTCCATATAACAGCTGATTTAAGAGGAAAAATTGAACATCAACGGAAGTACTATAGCAGGCTCACCAGCATGAAAGACATCCTCATTGTG
->read3829_contig0_position809_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCCCATATAAAGCTATTCCACGCCGGGTGGCCTGGACGTCGTTTGTGGATGGCTTTGGGAATCACTAGGTAATTACGGTTGGCTCCTTTCTTCATGATC
->read3830_contig0_position7970_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCAGATTCGACGATCAAACTCGCCGGCGACACGAAGATTGTCATACTAGCTTTCAGTCATTCCCCCTCAGTTTTGTCCATGTGGAGAATATGCATTCGA
->read3831_contig0_position4962_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTAACGTTAGGGTTATCATCACTGCATAGCAGAATGGGCGATCGGCCTACAAGAGTACAGTACTAACGGTCTGGCCTTATACAGCGCCACATCCGCCCA
->read3832_contig0_position1187_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTCGCAAAGAATCACTCTATGGGTCATCTTGAGAGAATAATCGACTAGTAGCGAATATATGTTCTTCTCCGAGACTTCGGCATAAATCTAAGTATGGAC
->read3833_contig0_position24_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCACGCTCTGGCTAACGAGCTACCGTTTCCTTTAACCTGCCAGACGGTGACCAGGGCCGTTCGGCGTTGCATCGAGCGGTGTCGCTAGCGCAATGCGCA
->read3834_contig0_position745_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGACGGTGTATCCCACGACCTAATTTTTCCCGTCTCTGTGGTCAACCTGGACGCACAAACCCTAGTCCCATATAAAGCTATTCCACGCCGGGTGGCTTGG
->read3835_contig0_position1785_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAACTCCACTTCTGCAAATTGTTATGAGCAAGCATACAAGTTAGCCGGCGCACAAATCGACGTGTGTATTTGTTCAATGGCAGGAGGTTAACTTTGCGGA
->read3836_contig0_position8874_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGAGCTAAGAAACCGGTGCATCACCGTACGAAAAGGATGGTTGAAATAGAACGAGTTGTAAAACATTAGCTCACGCGCCACCGTCATAGGCTGCATATT
->read3837_contig0_position6510_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGGACAAACGGGGTGCCCGCGCCTGCGTCCGGTAGACGAGCGATGGATTTAGACCGTTCACTGAACCCTCTAATAGGACCTCTTGCCCATCCGAGGATT
->read3838_contig0_position7667_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGATATCCTTGCGATTGGAATGCGAAAACGGCATAAGCGCAATGACCGAGGTAACAAGCCATGAGGACTGGAGCGGTAATGTGGTAGTGTAGTTGCCGGC
->read3839_contig0_position8611_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGTATTTTTGCATAAGACACTGCCTAAAGGGAACATATGTGTCCAGAATAGGGTTCAACGGTGTATGAGCAAACGATGCGGTAAGACGAGCGCTCCGACC
->read3840_contig0_position8796_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAACACTTCATCTGTATGGCAAAGTTGCGACACCGCGCCACACAGCAGTTTATTGTTAACACGCGATACAAGAGGGTTAGGAGCTAAGAAACCGGTGCAT
->read3841_contig0_position5961_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCTCGTGATTCGAGCCTAACAGCATGCCATCTAACGTTTGGACGGGTCTTGTGTTCCCTCAACACGTACGTTGACAGAGCTAACAATCCGTCGACTGAA
->read3842_contig0_position2641_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCCTGAATTGGCTTTATCCACCCCCCCTACTGGCCACCACTGGGGCGCGAGTCTCGAGCCTCTCGACTCCAAAGGGTCTGCCCGAGACAGGTTCACCGA
->read3843_contig0_position3131_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGTCTGAATGTTATGCCGTCCGACTCTTGCGCTCGGATGTCCGCAATGGGTTATAAAATGCCTATGTTCCGGTAATCTCTCATCTACTAAGCGCCCTAA
->read3844_contig0_position3585_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGGAGAAGACCCATGTAAGATGTATCCATCCCTACCACACGCGTCCGCCACCTCCGGGTCTAGTAAACCAGAGATTCCATGGACTCTCTGTTTCGTCGA
->read3845_contig0_position3682_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGATTGTCTGAATATCGTGCAGTAAGTTTCTCTTAGGTTCCTCAACGGAAACGTCTCAGACCCACCTAAGACGCGGGAATAAATTCGACACGGGGTACGA
->read3846_contig0_position5293_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTAAATTTTTTCAGATTACCCTGCAGACGTCCGCCTAAGATCCTAGTTGAATTGATCAATTGAGTCCAGTACACCATATCAACAGCTTGATCGTTCCAT
->read3847_contig0_position1457_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTTAAACCTAATCAGGATCATAGATGACCAATTATTGACCACAGGTATGGGCGAGGTATAAATTAGTGGATTCACTTCCCTTTGACATCTTGTTCTCAC
->read3848_contig0_position1686_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTATCTGTTGAGTGGCCACTTTTCCCTATCTGCTGGGACGGCACTGCAGATCTGGAACATTAGATAGGATATAAAAGTAATACGGTTGATGTTATTACC
->read3849_contig0_position1585_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTCTAGCCATCGGGTATGTACATTCACCTTTGGACGCTTCGATAGGACATGCACCCGGTCCGTTGACTTACCAACTTGATCGCCAGTGAGTGAGCGGTG
->read3850_contig0_position8490_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCACGACCCTATATGACCCCTAGCGAGAAGTTATAGTCTAATAATGAATGGTGAACAGCACATCTTTTCGTCCTGAGGCCATATTAATTCTACTCAGATT
->read3851_contig0_position2208_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCACCAAGAGATGGGTTGATGGTAGCATCCCGGCTTCTGGGGCAATTTCTGACGACTCGAGTGACCAGCGATAGTACGTTCCTTTTGTACTGAGTCTTA
->read3852_contig0_position6026_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGTACGTTGACAGAGCTAACAATCCGTCGACTGAATGTGATTCCTTTGTTATTTCACACTATTTTTCGGTGCGTGCGCTGCTCAGGCTGGTGCGACCCTT
->read3853_contig0_position1387_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTATGTCTGTGTAAGGTTGGGCCAATCGAGAGGACATTTCGCAGCGCCCTTTCATCTCTATTTCTAGGTCTCTTAAGCCTAATCAGGATCATAGATGGCC
->read3854_contig0_position5437_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAACCGCTTTGACTCTGGAGTGCCAGCGATAGTATCTCAGAGGCGAAAGCGCTTGTCACCTCATCTAAACTCGCGACTATAGATCTGTTTAGAACCACG
->read3855_contig0_position1706_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTTCCCTATCTGCTGGGACGGCACTGGAGATCTGGAACATTAGATAGGATATAAAAGTAATACGGTTGATGTTATGACCAACTCCACTTCTGCAAATTG
->read3856_contig0_position6175_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGCCATAACAGTCGACTAAAAGGCGTAACCGATTCTGCTACGTTATAAAAAAGGGTCGAGTGGGGTCAACAGTTCTTCTTCTTTCCTGTACGGTAATGC
->read3857_contig0_position8069_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCAAATGAAAATGTCAATAATCTCGACCCTGTAGTCCGCGGCCAATCAGCACGATCAAGCTAAAGACAGGGATTATGCACTAGCACGACCGCCGCAGGA
->read3858_contig0_position8071_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CAAATGAAAATGTCAATAATCTCGACCCTGTAGTCCGCGGCCAATCACCACGATCAAGCTAAAGACAGGGATTATGCACTAGCACGACCGCCACAGGAAA
->read3859_contig0_position2713_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGGGTCTGCCCGAGACAGTTTCACCGAGTCGTTACTCCCGGGATCCACTGCGTCTATTGTAAGAAATGCAATGCGTGGCCAGTTTGTTCCGGCAGGTCA
->read3860_contig0_position8178_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCATTTTCCAGGGTAAAATGATGGACTCATTGACCAACCCCTATTATTAGGAGAGGGCTACGACTGCTTGCAGCTCCAACCGCTTTCCAATCGTTGCAC
->read3861_contig0_position9425_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTTCATTGGTCGTGCAGACATTGTCGCTGCGTACCAAAGTAACTGGACGCCCATACCCCTTTGTCTACAGAAGCTCATGGATAAGAGTGTGCGAATAAC
->read3862_contig0_position3014_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-AAACCGCCTAGCTCGGACCACCAAAGAGCAAGAATCTATGACTAGCGGCTGTCGTCAATGAAAACTCATCGAGCACTGTCCGCGAAACATTATTCAGTAC
->read3863_contig0_position9254_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATACCCATACTGCCACTCCAGTACCTGGGCCGCGTGTTGTACGCTGTGTATCTTGAGAGCGTTTCTCCGTATCGAAATGTTCCGCTGTCAAGAACCTGGC
->read3864_contig0_position6684_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGAACGAGGGTCGGGCGATTTGTTTTGGTAGTGGTTATCGCATTACAAGAACGTACGGACGGACAAAATGTCGGACACCGCCTTATCGGCTATACTAGT
->read3865_contig0_position3884_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCATGCAAACCTGATTATCTGCACGACTCTTAAAATCATGCACTAAGCATAGAATGCACGACTACGTGTTACTGAAGTCGGCATGACTATCAAACCTAT
->read3866_contig0_position5339_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTGAATTGATCAATTGAGTCCAGTACACCATATCAACAGCTTGATCGTTCCACTTCAATCAGCAAGACGGGCGACCGTACCCGGACACCTGGCAGCGGG
->read3867_contig0_position6217_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTATAAAAAAGGGACGAGTGGGGTCAACAGTTCTTCTTCTTTCCTGTACGGTAATGCTTCCGCGCATCTAAGTGATATTCGCCGGAATTTACCCTTCTA
->read3868_contig0_position612_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGTTCATAAATCTCAATGTCGAAACTCCGATGGGCAGAAGCTAAAACTGAACAACGAGTGGGACACCGGCCTACTACATTATACAGTAAGGTAGAATCG
->read3869_contig0_position9088_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCACGGGCATGCTGAAAGCGGCGGTTACATTAATCGCTTCTGTGACGACAGACCGAAGCCCACCTGTCCTGACCTCACCGCAGGCATCGAGTCTAACTC
->read3870_contig0_position8078_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AAATGTCAATAATGCCGACCCTGTAGTCCGCGGCCAATCAGCACGATCAAGCTAAAGACAGGGATTATGCACTAGCACGACCGCCGCAGGAAAGATCCGA
->read3871_contig0_position1240_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAATATCTGTTCTGCTCCGAGACTTCGGCATAAATCTAAGTATGGACTCTTATATTCCCTCCTGCGTAGTGCTCTCCCATAATAAGTGAACCCATGGGTC
->read3872_contig0_position9263_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGCCACTCCAGTACCGGGGCCGCGTGTTGTACGCTGTGTATCTTGAGAGCGTTTCTCCGTATCGAAATGTTCCACTGTAAAGAACCTGGCGTATCCTGA
->read3873_contig0_position9735_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTTGCCGAACGTCTGGAAATCTGTCGAGTCATATCGATGAACAGAGACTAAATGTCCTTAAATCTCTAACACGATTTTAGTAGGTCTACTACTAGGCCG
->read3874_contig0_position1543_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CATCTTGTTCGCACAACTGCACACTCCGATGCTCTGCCGAGCCTTCTAACCATCGGGTATGTACATTCACCTTTGGACGCTTCGATAGGACATGCACCCG
->read3875_contig0_position7596_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GACTGACTATCACGAGGAATTACGGATAACAGCCCACTTGGAGTGTGCTGAGGGCCGACGCCCGGGGACCGTGATATCCTTGCGAGTGGATTGCAAAAAC
->read3876_contig0_position2695_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGAGCCTCTCGACTCCAAAGGGTCTGCCCGAGGCAGGTTCACCGAGTCGTTACTCCCGGGATCCACTGCGTCTATTGTAAGAAATGCAATGCGTGGCCA
->read3877_contig0_position7376_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAAGGAACACTTTCTGGTGCCACTCGAGACCGCCCTCCCCGACCCATATGCAGTTTCTGCATACACCGGGTAGACAACATTCTCAGCCCTTCGTTGAAAG
->read3878_contig0_position6818_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCGCGAGCTCTCACCCACGACTGTACCCCGGTTAAGATTTATAAACCATACATTTAACCCTTAGTCATAAGATGATACTTCATCTGCATGCGCGCATCT
->read3879_contig0_position1307_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTGCTCTCCCATAATAAGTGAACCCATGGGTCGCGCTGTATTTGTGTACGGCTTGATGTCAGGGTCAGTTTGGGCGCCGGTATGTCTGTGTAAGGTTGG
->read3880_contig0_position7840_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTGATTGACAATCCAGCCCGTTTGGGGTGATTTGTGCCGGCGCGTCCAGGTGCGAACGTTGTGCCGTGTCACTCTGTAGCTCTAATACCAATTGAAATG
->read3881_contig0_position9760_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGAGTCATATCCATGAACAGAGACTAAATGTCCTTAAATCTCTAACACGATTTTAATAGGTCTACTACTAGGCCGCTTGCTCAGAAATCGGAACACAAGT
->read3882_contig0_position1278_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTATGGACTCTTATATTCCCTCCTGCGTAGTGCTCTCCCATAATAAGTGTACCCATGGGTCGCGCTGTATTTTTGTACGGCTTGATGTCAGGGTCAGTT
->read3883_contig0_position7035_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCAGCCACGAATTCGTGTGATAACCGCCTAAACAGTCTAATCTGGCCAATATACCCTGGGGGGAGCTAATATATCGCGGCGTCGAGTTACCGTTGCACCA
->read3884_contig0_position1510_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGGTATAAATTAGTGGATTCACTTCCCTCTGACATCTTGTTCTCACAACTGCACACTCCGATGCTCTGCCGAGCCTTCTAACCATCGGGTATGTACATT
->read3885_contig0_position2259_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GACGATTCGAGTGACCAGCGATAGTACGTTCCTTTTGTACTGAGTCTTAACATCGGAAAATGCGCCCTAGATACCTGCGGCTTCACTCCACAGTGTAAGA
->read3886_contig0_position6788_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCTCGCTTGGGTCTCTACATCCGCTAATACCCGCGAGCTCTCACCCACGACTGTACCCCGGTTAAGATTTATAAACCATACATTTAACCCTTAGTCATA
->read3887_contig0_position2421_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAAATCCAGTCTCGACTATATCTACTATGTCATGCTTGTCGAATGAACAACTCAATTAGGTAGTGTGCGCGAGGTAGAGTATGCAGATTTCGTACCTTG
->read3888_contig0_position9096_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CATGCTGAAAGCGGCGGTTACATTAATCGCTTCTGTGATGACAGACCGAAGCCCACCTGTCCTGACCTCACCGCAGGCATCGAGTCTAACTCTGATTCGA
->read3889_contig0_position392_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTACCTAGTAGTGTCGCGGTTATCGGACAGAGGATTATGTAAGGTTACCGAAGACCGGGTAGCGTAGTTAGTAACTTCAATCCGCGTTACGCTTTGTCC
->read3890_contig0_position8841_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGTTTATTGTTAACACGCGATACAAGAGGGTTAGGAGCTAAGAAACCGGTGCATCACCGTACGAAAAGGATGGTTGAAATAGAACGAGTTGTAAAACAT
->read3891_contig0_position5462_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCGATAGTATCTCAGAGGCGAAAGCGCTTGTCACCCCATCTAAAATCGCGACTATAGATCTGTTTAGAACCACGACCCAGAAATCTTTAGCTAAGTAAT
->read3892_contig0_position4096_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGAATCTAACATTAATCTGCACCACGAATATCGTCCAAGACGTTTTGAGCCGGTGACTAATTCGGTTGTCGCACATAGTGTACGTTGAGGCGGGAACTTC
->read3893_contig0_position991_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TATCATGTATCGCTGATTGTGGGGGGCATGGGGGTTCCGCATTGGCGCAAAGGTACCGCAAAGGGCCTGTATGACCCTGGTTACGCGTTATTACCGGTCA
->read3894_contig0_position8341_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GACCTTGGGCTCGTCGACATTCCTGGTAGTAATCCGATCTCAATGCCTGCGGTACCGAGCAGCTTTGAGTTTTTGTAAGTCCCACGGTTAAAGGGCCACT
->read3895_contig0_position308_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CATACTCCGCCTTGGGCCACACAATTAATATAAGACGGGATAATGGCTTCATGCTCATGTTCTATACCGAGCAGAGAGGTTGGGTCGACCTAGTAGTGTC
->read3896_contig0_position8033_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCCTCCGTTTTGTCCATGTGGAGAATATGCATTCGACCAAATGAAAATGTCAATAATCTCGACCCTGTAGCCCGCGGCCAATCAGCACGATCAAGCTAA
->read3897_contig0_position3706_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTTTCTCTTAGGTTCCTCAACGGAAACGTCTCAGACCCACCTTAGACGCGGGAATAAATTCGACACGGGGTACGAAGGGTAAGAACACCTAGCCTGGCA
->read3898_contig0_position6499_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGACCTGCTTGCGGACAAACGGGGTGCCCGCGCCTGCGTCCGGTAGACGAGCGATGGATTTAGACCGTTCACTGAACCCTCTAATAGGACCTCTTGCCC
->read3899_contig0_position4077_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AACGATTACTATAAATCAGCGAATCTATCATCAATCTGCACCACGAATATCGTCCAAGACGTTTTGAGCCGGTGACTAATTCGGTTGTCGCACATAGTGT
->read3900_contig0_position29_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTCTGGCTAACGAGCTACCGTTTCCTTTAACCTGCCAGACGGTGACCAGGGCCGTTCGGCGTTGCATCGAGCGGTGTCGCTAGCGCAATGCGCAAGATT
->read3901_contig0_position3983_M6_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTAACGAAATACGCTCTTGGACAAAACGAGGTCGTAATTATTTCCTGAGCTGGTTTTAGTGAGAGCAGCAGATGCACTCTTAGCTCCGCTGAAAACGAT
->read3902_contig0_position6397_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGCGGAATGCCTGTCCACCGGGGGTTCTACTGTACCACAGTGGCCTGGATAGCTAAGCAGGTCCTGGATTGGCATGTCATCCGGAGTGATAGGCACTGC
->read3903_contig0_position5165_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTCGGCCAATTCGTTGTATTGATCGCTGTGCACTTTAAAATTCGGAACATCTTAACCAAAGCATATTAATATGCTAGCCGCGCAGGGTGGTATATATGA
->read3904_contig0_position90_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTGCATCGAGCGGTGTCGCTAGCGCAACGCGCAAGATTTTGACATTTACAAGGCAACATTGCAGCGTCCGATGGTCCGGTGGCCTCCAGATAGTGTCCA
->read3905_contig0_position4565_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGCGATTATGGGCGTGCATAGAGTCCCGCAGTGTCGGAGCGATAGGGAGGACGTAAACGCCAATTCCGCTTAATAGCGGAATCTGCTGGCTTGTGCATT
->read3906_contig0_position6933_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTAATTGAGTGTTCAGAGTTGCGGGTCACAGATGAGCGTTCCGATTGTCCTTTCCCAGGCTACGGCCTTATACCAAAGACTTCTAGACCGGAGAGACTAC
->read3907_contig0_position1079_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TATTACCGGTCAGCTCCAGTTACGTCACGGACGTAGAGAGCCTTTGAATGTGTACGGCAATAGGACAAACTCGGCCACGTACGTGTCAACATGGCGCGGC
->read3908_contig0_position4700_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AACCTCCTCTTCACTGATATCATCCTATCGGCGTTCAAAGTATTCGGCGGATGAATTAGAGCCAAAGCAGTAGGTTACCGTCGGCGCATAACCGCCGAGT
->read3909_contig0_position6025_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGTACGTTGACAGAGCTAACAATCCGTCGAATGAATGTGATTCCTTTGTTTTTTCACACTATTGTTCGGTGCGTGCGCTGCTCAGGCTGGTGCGACCCT
->read3910_contig0_position478_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTACGCTTTGTCCTCTGCTACGCCTCGATTGGTTTCAGCTCACGTGGGACGCACGTACTTACCTAGCATGAAGCGGTAATGGAGCTCGAACACTAGTCG
->read3911_contig0_position7410_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCCCCGACCCATATGCAGTTTCTGCATACACCGGGTAGACAACATTCTCAGCCCTTCGTTGAAAGGAGAATACAAATGACGGGAACTCTGACGAGAGGG
->read3912_contig0_position5264_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCCTTGATAGCTTTATGGCCATCATCATAGTAAATTTTTTCAGATTACCCTGCAGACGTCCGCCTAAGATCCTAGTTGAATTGATCAATTGAGTCCAGT
->read3913_contig0_position2661_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCCCCCCTACTGGCCACCACTGGGGCGCGAGTCTCGAGCCTCTCGACTCCAAAGGGTCTGCCCGAGACAGGTTCACCGAGTCGTTACTCCCGGGATCCA
->read3914_contig0_position3866_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTCAAGTGAAGCATCCGATCATGCAAACCTGATTATCTGCACGACTCTTAAAATCATGCACTAAGCATAGAATGCACGACTACTTGTTACTGAAGTCGG
->read3915_contig0_position516_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTCACGTGGGACGCATGTACTTACCTAACATGAAGCGGTAAAGGAGCTCGAACAGTAGTCGGTGGCTCTTCTGTCTCTGGCGGGGACGGCTATGTGAGT
->read3916_contig0_position4223_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGACTCTAACAAGTGGTCAGTACAGGGTCGACCATACGCAACGGCAAACAGAATCGCACGTCAACTATCCCCTTTATTAATGATCCGTGTCCCCCGACCG
->read3917_contig0_position122_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAAGATTTTGACATTTACAAGGCAACATTGCAGCGTCCGATGGTCCGGTGGCCTCCAGATAGTGTCCAGTCGCTCTAACTGTATGGAGACAATAGGCATT
->read3918_contig0_position6937_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGAGTGTTCAGAGTTGGGGGTCACGGATGAGCGTTCCGATTGTCCTTTCCCAGGCGTCGGCCTTATACCAAAGACTTGTAGACCGGAGAGACTACTTCC
->read3919_contig0_position5488_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTTGTCACCTCATCTAAAATCGCGACTATAGATCTATTTAGAACCACGACCCAGAAATCTTTAGCTAAGTAATCGACTGCCTTCGTCGGGCCGCTTATT
->read3920_contig0_position8985_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAAAACCTGTCTGAAGTCCGTGCTTCCCTAACCAGCCTATGCGCCTTAACTTTATGCATACGCGTTTAGTACAGGGCCGCGCCCCATGAGGCCATATGCG
->read3921_contig0_position1956_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTAACTTAGCACTATCGCACCACAAAATTTCAGCATAAAGCATCCGGTTGAAGGCTGCGCATCGAGCAGCGTGCATTGGTCTTTCAGTCCCCAGTCACC
->read3922_contig0_position1065_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCTGGTTACGCGTTATTACCGGTCAGCTCCAGTTACGTCACGGACGTAGAGAGCCTTTGAATGTGTACGGCAATAGGCGAAACTCGGCCACGTACGTGT
->read3923_contig0_position4267_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAAACAGAATCGCACGTCAACTATCCCCTTTATTAATGATCCGTGTCCCCCGATCGTGTGCTGAGGAGACCCGTAATGCATGGAAAGTGCCAATATCCCC
->read3924_contig0_position343_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGGATAATGGCTTCATGCTCATGTTCTATATCGAGCAGAGAGGTTGGGTCTACCTAGTAGTGTCGCGGTTATCGGACAGAGGATTATGTAAGGTTACCG
->read3925_contig0_position1317_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CATAATAAGTGAACCCATGGGTCGCGCTGTATTTTTGTACGGCTTGATGTCAGGGTCAGTTTGGGCGCCGGTCTGTCTGTGTAAGGTTGGGCCAATCGAG
->read3926_contig0_position6551_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGATGGATTTAGACCGTTCACTGAACCCTCTAATAGGACCTCTTGCCCAGCCGAGGCTTAAGCAGCGACTCCACATGGAGCGATGGGTCCTCAAGGCAGT
->read3927_contig0_position5368_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CATATCAACAGCTTGATCGTTCCACTTCAATCAGCAAGACGGGCGACCGTCCCCGGACACCTGGCAGCGGGAACCGCTTGGACTCTGGAGTGCCAGCAAT
->read3928_contig0_position8679_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCAAACGATGCGGTAAGACGAGCGCTCCGACCCCCCTTGGCTCTGCTACATCGAATTCAGCGTGTAAGAGCCCGCTTATCCGGTGGTGATACCTACTATT
->read3929_contig0_position6816_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TACGCGCGAGCTCTCACCCACGACTGTACCCCGGTTAAGATTTATAAACCATACATTTAACCCTTAGTCATAAGATGATACTTCATCTGCATGCGCGCAT
->read3930_contig0_position4137_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTTTGAGCCGGTGACTAATTCGGTTGTCGCACATAGTGTACGTTGAGGCGGGAACTTCCCGCTGATATGATTGTGATCGATATTCAGACTCGAACAAGT
->read3931_contig0_position3909_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GACTCTTAAAATCATGCACTAAGCATAGAATGCACGACTACTTGTTACTGAAGTCGGCATGACTATCAAACCTATTTAATGATATATGCTCTTGAACAAC
->read3932_contig0_position3902_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTGCGCGACTCTTAAAATCATGCACTATGCATAGAATGCACGACTACTTGTTACTGAAGTCGGCATGACTATCAAACCTATTTAATGATATATGCTCGT
->read3933_contig0_position3271_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGAACGATAGAGCACCCGTCTAGGAGGGCGTGCAGGGTCTCCCGCTAGCTAATGGTCACGGCCTCTCTGGGAAAGCTGAACAACGGATGGGATTAAGCTC
->read3934_contig0_position5771_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTTGTTTTCTGAATTGTGGCTATCTCAAATTGGGACCTAGTGTTGGCCAATAAGCTTCATATCGCCTTCTCAGATAGACTAAAAGAACGAAGTCCATAT
->read3935_contig0_position1337_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCGCGCTGTATTTTTGTACGGCTTGATGTCAGGGTCAGTTTGGGCGCCGGTATGTCTGTTTAAGGTTGGGGCAATCGAGAGGACATTTCGCAGCGCCCT
->read3936_contig0_position4597_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTCGGAGCGACAGGGAGGACGTAAACGCCAATTCCGCTTAATAGCGGAATCTGCTGGCTTGTGCATTCGTCGGCCTATTAGATACGGTACGGAATATTG
->read3937_contig0_position1419_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GACATTTCGCAGCGCCCTTTCATCTCTATTGCTAGGTCTCTTAAGCCTAATCAGGATCATAGATGGCCAATTATTGACCACAGGTAGGGGCGAGATATAA
->read3938_contig0_position4321_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGTGTGCTGAGGAGACCCGTAATGCATGGAAAGTGCCAATATCCCCGGGAGTCCCGCACTACTGAGACGAAGTCTAGATAGCTCGACTCGGCTGATAAAG
->read3939_contig0_position7834_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTACTGACTGATTGACAATCCAGCCCGTTTCGGGTGATTTGTGCCGGCGCGTCCAGGTGCGAACGTTGTGCCGTGTCACTCTGTAGCTCTAATACCAATT
->read3940_contig0_position3001_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAAAATTGACTTGAAACCGCCTAGCTCGGACCACCAAAGAGCAAGACTCTATGACTAGCGGGTGTCGTCAATGAAAACTGATCGAGCACTGTCCGCGAAA
->read3941_contig0_position3672_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTGTTTCGTCGATTGTCTGAATATCGTGCAGTAAGTTTCTCTTAGGTTCCTCAACGGAAACGTCTCAGACCCACCTTAGACGCGGGAATAAATTCGACA
->read3942_contig0_position4738_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTATTCGGCGGATGAATTAGAGCCAAAGCAGTAGGTTACCGTCGGCGCATAACCGGCGAGTGCTCTGAAACGTTACATTCGTCTATCCGCACACACCGC
->read3943_contig0_position9449_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGCTGCGTACCAAAGTAACTGGACGCCCATACCCCTTTGTCTACAGAAGCTCATGGATAAGAGTGTGCGAATAACATCACTTGTTACTTCACGGAACGC
->read3944_contig0_position2807_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGACACCACTCTTTGAAGGTGCCCATTGCATTGTAGCGTGAACTATTAACAATCCTAAGCCCATAATCCCTGCCCCACGGGGGCTCCAATCCAGCAGTG
->read3945_contig0_position3565_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTGCTCGGTTATACGCCCTCGGGAGAAGACCCATGTAAGATGTATCCATCCCTACCACACGCGTCCGCCACCTCCGGGTCTAGTAAACCAGAGATTCTA
->read3946_contig0_position2627_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCCTTAAAATCTAACCCTGAATTGGCTTTATCCACCCCCCCTACTGGCCACCACTGGGGCGCGAGTCTCGAGCCTCTCGACTCCAAAGGGTCTGCCCGA
->read3947_contig0_position4283_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCAACTATCCCCTTTATTAATGATCCGTGTCCCTCGACCGTGTGCTGAGGAGACCCGAAATGCATGGAAAGTGCCAATATCCCCGGGAGTCCCGCACTAC
->read3948_contig0_position2007_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGGCTGCGCATCGAGCAGCGTGCATTGGTCTTTCAGTCCCCAGTCACCGGAGACGTCCGAGCTCTAACCCGTCCGGATAAGGGGAAGGCAGTCGCTGCA
->read3949_contig0_position6147_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGCTTGAGCCACTCATCAGGCACGCGCGGGCCATAACAGTCGACTAAAAGGAGTAACCGATTCTGCTACGTTATAAAAAAGGGACGAGTGGGGTCAACA
->read3950_contig0_position281_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AACATAACGCGTGTCATCTAGTTCTAGCATACTCCGCCTTGGGCCACACAATCAATATAAGACGGGATAATGGCTTCATGCTCATGTTCTATACCGAGCA
->read3951_contig0_position2099_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGCTGCATGTGTACGCAGCGGTCTATGCTACAGGTATTACGGAGTGAAACGGCTGCGAGCATCTCATAATCGGGCCACCCGATTTCAGCTTGGCCACAG
->read3952_contig0_position8101_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGTCCGCGGCCAATCAGCACGATCAAGCTAAAGACAGGGATTATGTACTAGCACGACCGCCGCAGGAAAGATCCGAGGCCTTTTCCAGGGTAAAATGAT
->read3953_contig0_position4304_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GATCCGTGTCCCCCGACCGTGTGCTGAGGAGACCCGTAATGCATGGAAAGTGCCAATATCCCCGGGAGTCCCGCACTACTGAGACGAAGTCTAGCTAGCT
->read3954_contig0_position2221_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGTTGATGGTAGCATCCCGGCTTCTGGGGCAATTTCTGACGATTCGAGTGACCAGCGATAGTGCGTTCCTTTTGTACTGAGTCTTAACTACGGCAAATG
->read3955_contig0_position6507_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTGCGGACAAACGGGGTGCCCGCGCCTGCGTCCGGTAGACGAGCGATGGATTTAGACCGTTCACTGAACCCTCTAATAGGACCTCTTGCCCATCCGAGG
->read3956_contig0_position5280_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGCCATCATCATAGCAAATTTTTTCAGATTACCCTGCAGACGTCCGCCTAAGATCCTAGTTGAATTGATCAATCGAGTCCAGTACACCATATCAACAGC
->read3957_contig0_position3343_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGCTGAACAACGGATGGGATTAAGCTCAGCAGTCCGCCTCCAATCTCTCCGACGTTCATTCTCAAGGGTGTAGTTTTAGAGACTGAGAACTCACCCTAT
->read3958_contig0_position6312_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCTAATATTGTGTGCAAGCTACTTCTAGACCTTATTAAGTGCCCACGAATTCCTAGGAAAGCGCGCAGCTCAAGCAATCATACATGGCGGTATGCCTGT
->read3959_contig0_position8121_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGATCAAGCTAAAGACAGGGATTATGCACTAGCACGACCGCCGCAGGAAAGATCCGAGGCCTTTTCCAGGGTAAAATGATGGACTCATTGACCAACCCCT
->read3960_contig0_position7438_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACACCGGGTAGACAACATTCTCAGCCCTTCGTTGAAAGGAGAATACAAATGACGGGAACTCTGACGAGAGGGTGCTTGAACGAGAGAAGCTAACAGTCAT
->read3961_contig0_position8524_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTCTAATAATGAATGGTGAACCGCACATCTTTTCGTCCTGAGGCCATAATAATTCTACTCAGATTGTCTGTAACCGGAGCTTCGGGCGTATTTTTGCGT
->read3962_contig0_position4427_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCTATATGGAACCGAGGGGCGGGATGATAATTGTTCTTAGTATAGTGACCGTTATGGACGACGGACATAACTACAGAGTGTCCGCCCTCGGCTAATCAT
->read3963_contig0_position2140_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAGTGAAACGGCTGCGAGCATCTCATAATCGGGCCACCCGATTTCAGCTTGGCCACAACAGAGACTAGCCACCAAGAGATGGGTTGATGGTAGCATCCC
->read3964_contig0_position1660_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTGATCGCCAGTGAGTGAGCGGTGGTTTATCTGTTGAGTGGCCACTTTTCCCTATCTGCTGGGACGGCACTGGAGATCTGGAACATTAGACAGGATATA
->read3965_contig0_position4415_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-ATAAAGAAAACAATCTATATGGAACCGAGGGGCGGGATGATAATTGTTCTTAGTATATTGACCGTTATGGACGACGGACATAATGACTGAGTGTCCGCCC
->read3966_contig0_position7865_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGTGATTTGTGCCGGCGCGTCCAGGTGCGAACGTTGTGCCGTGTCACTCTGTAGCTCTAATACCAATTGAAATGAAGCTTACGCAAACTACTCGACGAA
->read3967_contig0_position2178_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGTTTTCAGCTTGGCCACAACAGAGACTAGCCACCAAGAGATGGGTTGATGGTAGCATCCCGGCTTCTGGGGCAATTTCTGACGATTCGAGTGACCAGC
->read3968_contig0_position515_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCTCACGTGGGACGCATGTACTTACCTAACATGAAGCGGTAATGGAGCTCGAACACTAGTCGGTGGCTCTTCTGTCTCTGGCGGGGACGGCTATGTGAG
->read3969_contig0_position7409_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTCCCCGACCCATATGCAGTTTCTGCATACACCGGGTAGACAACATTCTCAGCCCTTCGTTGAAAGGAGAATACAAATGACGGGAACTCTGACGAGAGG
->read3970_contig0_position601_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GACGGCTATGTGAGTTCATAAATCTCAATGTCGAAACTCCGATGGGCAGAAGCTAAAACTGAACAACGAGTGGGACATCGGCCTACTACATTATACAGTA
->read3971_contig0_position9260_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATACTGCCACTCCAGTACCTGGGCCGCGTGTTGTACGCTGTGTATCTTGAGAGCGTTTCTCCGTATCGAAATGTTCCGCTGTAACGAACCTGGCGTATCA
->read3972_contig0_position1538_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTGACATCTTGTTCTCACAACTGCACACTCCGATGCTCTGCCGAGCCTTCTAACCATCGGGTATGTACATTCACCTTTGGACGCTTCGATAGGACATGC
->read3973_contig0_position7998_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GACACGAAGATTGTCATACTAGCTTTCAGTCATTCCCCCTCAGTTTTGTCCATGTGGAGAATATGCATTCGACCAAATGAAAATGTCAATAATCTCGACC
->read3974_contig0_position3268_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TACCGAACGATAGAGCACCCGTCTAGGAGGGCGTGCAGGGTCTCCCGCTAGCTAATGGTCACGGCCTCTCTGGGAAAGCTGAACAACGGATGGGATTAAG
->read3975_contig0_position9097_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGCTGAAAGCGGCGGTTACATTAATCGCTTCTGTGATGACAGACCGAAGCCCACCTGTCCTTACCTCACCGCAGGCATCGAGTCTAACTCTGATTCGAG
->read3976_contig0_position6976_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTGTCCTTTGCCAGGCTACGGCCTTATACCAAAGGTTTCTAGACCGGAGAGACTACTTCCAGCCACGAATTCGTGTGATAACCGCCTAAACAGTCTAAT
->read3977_contig0_position8047_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCATGTGGAGAATATGCATTCGACCAAATGAAAATGACAATAATCTCGACCCTGTAGTCCGCGGCCAATCAGCACGATCAAGCTAAAGACAGGGATTATG
->read3978_contig0_position4512_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCTCTGCTAATCATGAACACCGGTCAGGCATGCTTACCTCATGCGACGGCATTGGCGATTATGGGCGTGCATAGAGTCCCGCAGTGTCGGAGCGATAGG
->read3979_contig0_position97_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGAGCGGTGTCGCTAGCGCAATGCGCAAGATTTTGACATTTACAAGGCAACATTGCAGCGTCCGATGGTCCGCTGGCCTCCAGATAGTGTCCAGTCGCTC
->read3980_contig0_position2858_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AATCCTAAGCCCATAAGCCCTGCCCCACGGGGGCTACAATCCAGCAGTGAACGCGTTTACCTTAAGACGAAAGAGTCAGTAGAGTTGGGGTTCGTGCTTT
->read3981_contig0_position8591_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTGTAACCGGAGCTTCGGGCGTATTTTTGCGTAAGACACTGCCTAAAGGGAACATATGTGTCCAGAATAGGGTTCAACGGTGTATGAGCAAACGATGCG
->read3982_contig0_position1370_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTCAGTTTGGGCGCCGGTATGTCTGTGTAAGGTTGGGCCAATCGAGAGGACATTTCGCAGCGCCCTTTCATCTCTATTGCTAGGTCTCTTAAGCCTAAT
->read3983_contig0_position7418_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCATATGCAGTTTCTGCATACACCGGGTAGACAACATTCTCAGCCCTTCGTTGAAAGGAGAATACAAATGACGGGAACTCTGACGAGAGGGTGCTTGAA
->read3984_contig0_position8990_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTGTCTGAAGTCCGTGCTTCCCTAACCAGCCTATGCGCCTTAACTTTATGCATACTCGTTTAGTACAGGGCCGCGCCCCATGAGGCCATATGCGCCTGT
->read3985_contig0_position988_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGTATCATGTATCGCTGATTGTGGGGGGCACGGGGGTTCCGCATTGGCGCAAAGGTACCGCAAAGGGCCTGTATGACCCTGGTTACGCGTTATTACCGG
->read3986_contig0_position8151_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCACGACCGCCGCAGGAAAGATCCCAGGCCTTTTCCAGGGTAAAATGATGGAGTCATTGACCAACCCCTATTATTAGGAGAGGGCTGCGACTGCTTGCA
->read3987_contig0_position8435_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCACTTATTTCGACATTCATGGCGCCGATATCCTGCTTAGGCAGTACGGCCAATGCACGACCATATATGACCCCTAGCGAGAAGTTATAGTCTAATAAT
->read3988_contig0_position6017_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCTCAACACGTACGTTGACAGAGCTAACAATCCGTCGACTGAATGTGATTCCTTTGTTATTTCACACTATTGTTCGGTGCGTGCGCTGCTCAGGCTGGT
->read3989_contig0_position4782_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCGCATAACCGGCGAGTGCTCTGAAACGTTACATTCGTCTATCCGCACACACCGCCGTTGGATGTGTCCCACAGTGTTTTATACTGGACGGTGGCCACG
->read3990_contig0_position3588_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGAAGACCCATGTAAGATGTATCCATCCCTACCACACGCGTCCGCCACCTCCGGGTCTAGTAAACCAGAGATTCCATGGACTCTCTGTTTCGTCGATTG
->read3991_contig0_position7509_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGCTTGAACGAGAGAAGCTAACACTCATTGCGATGACGAGAACAGCCCTACCGCCCGCCGTGAACGAGCACAAGCGTCTGGAGAGTGACTGACTATCAC
->read3992_contig0_position6391_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CATACATGGCGGAATGCCTGTCCACCGGGGGTTCTACTGTACCACAGTGGCCTGGATATCTAAGCAGGTCCTGGATTGGCATGTCATCCGGAGTGATAGG
->read3993_contig0_position3096_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGAAACATTATTCAGTACAGCGACTTTTACCCTCGTGGTCTGAATGTTATGCCGTCCGACTCTTGCGCTCGGATGTCCGCAATGGGTTATCAAATGCCTA
->read3994_contig0_position398_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGTAGTGTCGCGGTTATCGGACAGATGATTATGTAAGGTTACCGAAGACCGGGTAGCGTAGTTAGTAACTTCAATCCGCGTTACGCTGTGTCCTCTGCT
->read3995_contig0_position8525_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCTAATAATGAATGGTGAACAGCACATCTTTTCGTCCTGTGGCCATATTAATTCTACTCAGATTGTCTGTACCCGGAGGTTCGGGCGTATTTTTGCGTA
->read3996_contig0_position2762_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCGTCTATTGTAAGAAATGCAATGCGTGGCCAGTTTGTTCCGGCACGACACCACTCTTTGAAGGTGCCCATTGCATTGTAGCCTGAACTATTAGCAATC
->read3997_contig0_position5155_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GATTGGGAGGTCTCGGCCAATTCGTTGTATTGATCGCTGTGCACTTTAAAATTCGGAACATCTTAACCAAAGCATATTAATATGAGAGCCGCGCAGGGTG
->read3998_contig0_position2709_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCAAAGGGTCTGCACGAGACAGGTTCACCAAGTCGTTATTCCCGGGATCCAATGCGTCTATTGTAAGAAATGCAATGCGTGGCCAGTTTGTTCCGGCAG
->read3999_contig0_position9257_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCATACTGCCACTCCAGTACCTGGGCCGCGTGTTGTACGCTGTGTATCTTGAGAGCGTTTCTCCGTATCGAAATGTTCCGCTGTAAAGAACCTGGCGTA
->read4000_contig0_position5419_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCGGACACCTGGCAGCGGGAACCGCTTTGTCTCTGGAGTGCCAGCGATAGTATCTCAGAGGCGAAAGCGCTTGTCACCTCATCTAAAATCGCGACTATA
->read4001_contig0_position6541_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTAGACGAGCGATGGATTTAGACCGTTCACTGAACCCTCTAATAGGACCTCTTGCCCATCCGAGGCTTAAGCAGCGACTCCACATGGAGCGATGGGTCC
->read4002_contig0_position171_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCCTCCAGATAGTGTCCAGTCGCTCTAACTGTATGGAGACCATAGGCATTTACCTTATTCTCATCGCCACGCCCCAAGATCTTTAGGACCCAGCATTCC
->read4003_contig0_position382_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCGGTTGGGTCTACCTAGTAGTGTCGCGGTTATCGGACAGAGGATTATGTAAGGTTACCGAAGACCGGGTAGCGTAGTTAGTAACTTCAATCCGCGTTA
->read4004_contig0_position4600_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGAGCGATAGGGAGGATGTAAACGCCAATTCCGCTAAATAGCGGAATCTGCTGGCTTGTGCATTCGTCGGCCTATTAGATACGGTACGGAATATTGGGT
->read4005_contig0_position1293_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTCCCTCCTGCGTAGTGCTCTCCCATAATAAGTGAACCCATGGGTCGCGCTGTATTTTTGTACGGCTTGATGTCAGGGTCAGTTTGGTCGCCGGTATGT
->read4006_contig0_position5381_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGATCGTTCCACTTCAATCAGCAAGACGGGCGACCGTACCCGGACACCTGGCAGCGGGAACCGCTTTGACTCTGGAGTGCCAGCGATAGTATCTCAGAGG
->read4007_contig0_position4643_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAATCTGCTGGCTTGTGCATTCGTCGGCCTATTAGATACGGTACGGAATATTGGGTAACCTCCTCTTCACTGATATCATCCTATCGGCGTTCAAAGTAT
->read4008_contig0_position2419_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGGAAAGCCAGTCTCGACTATATCTACTATGTCATGCTTGTCGAATGAACAACTCAATTAGGTAGTGTGCGCGAGGTAGAGTATGCAGATTTCGTACCT
->read4009_contig0_position3130_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGGTCTGACTGTTATGCCGTCCGACTCTTGCGCTCGGATGTCCGCAATGGGTTATCAAATGCCTATGTTCCGGTAATCTCTCATCTACTAAGCGCCCTA
->read4010_contig0_position8332_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GACCTGAATGACCTTGGGCTCGTCGACATTCCTGGTAGTAATCCGATCTCAATTCCTGCGGTACCGAGCAGCTTTGAGTTTTTGTAAGTCCCACGGTTAA
->read4011_contig0_position8368_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTAATCCGATCTCAATTCCTGCGGTACCGAGCAGCTTTGAGTTTTTGTAAGACCCACGGTTAATGGGCCACTTATTTCGACATTCATGGCGCCGATATC
->read4012_contig0_position8054_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGAATATGCATTCGACCAAATGAAAATGTCAATAATCTCGACCCTGTAGTCCGCGGCCAATCAGCACGATCAAGCTAAAGACAGGGATTATGCACTAGC
->read4013_contig0_position5575_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGGCCGCTTATTGGCTCACCCAATCTGGCCATTGCAAGTTTGGCAGACGCGAGGTTGCGTGGTCAACCGAACGTTGCTTTCCTTAGGGTACCGAGTCTA
->read4014_contig0_position8677_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGCAAACGATGCGGTAAGACGAGCGCTCCGACCCCCCTTGGCTCTGCTACATCGAATTCAGCGTGTAAGAGCCAGCTTATCCGGTGGTGATACCTACTA
->read4015_contig0_position6541_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTAGACGAGCGATGGATTTAGACCGTTCACTGAACGCTCTAATAGGACCTCTTGCCCATCCGAGGCTTAAGCAGCGACTCCACATGGAGCGATGGGTCC
->read4016_contig0_position6278_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCGCATCTAAGTGATATTCGCCAGAATTTACCCTTCTAATATTGTGTGCAAGTTACTTCTAGACCTTATTAAGTGCCCAGGAATTCCTAGGAAGGCGCG
->read4017_contig0_position47_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGTTTCCTTTAACCTCCCAGACGGTGACCAGGGCCGTTCGGCGTTGCATCGAGCGGTGTCGCTAGCGCAATGCGCAAGATTTTGACATTTACAAGGCAA
->read4018_contig0_position1091_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTCCAGTTACGTCACGGACGTAGAGAGCCTTTGAATGTGTACGGCAATAGGAGAAACTCGGCCACGTACGTGTCAACATGGCGCGGCTCTCTATACCTC
->read4019_contig0_position7854_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGCCCGTTTGGGGTGATTTGTGCCGGCCCGTCCAGGTGCGATCGTTGTGCCGTGTCACTCTGTAGCTCTAATACCAATTGAAATGAAGCTTACGCAAAC
->read4020_contig0_position6508_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGCGGACAAACGGGGTGCCCGCGCCTGCGTCCGGTAGACGAGCGATGGATTTAGACCGTTCACTGAACCCTCTAATAGGACCTCTTGCCCATCCGAGGC
->read4021_contig0_position5289_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCATAGTAAATTTTTTCAGATTACCCTGCAGACGTCCGACTAAGATCCTAGTTGAATTGATCAATTGAGTCCAGTACACCATATCAACAGCTTGATCCTT
->read4022_contig0_position8548_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CACATCTTTTGGTCCTGAGGCCATATTTATTCTACTCAGATTGTCTGTAACCGGAGCTTCGGGCGTATTTTTGCGTAAGACACTGCCTAAAGGGAACATA
->read4023_contig0_position3522_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CACCCGAACCGCGCGTATTCTGCGACAGCATGAATCGTGTAACTCTGCTCGGTTATACGCCCTCGGGAGAAGACCCATGTAAGAGGTATCCATCCCCACC
->read4024_contig0_position9352_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGTATCCTGACCATGGAGCTGCAACACTTTCACATAGGTAGCCGAACAGGTATTACTCAGACTGGAGAGGAATCTTCATTGGTCGTGCAGACATTGTCG
->read4025_contig0_position4220_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCAGACTCTAACAAGTGGTCAGTACAGGTTCGACCATGCGCGACGGCAAACAGAATCGCACCTCAACTATCCCCTTTATTAATGATCCGTGTCCCCCGA
->read4026_contig0_position2880_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCCACGGGGGCTACAATCCAGCAGTGAACTCGTTTACCTTAAGACGAAAGAGTCAGTAGAGTTGGGGTTCGTGCTTTAATGACCCGTAGCCCAATTGCG
->read4027_contig0_position9105_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCGGCGGTTACATTAATCGCTTCTGTGATGACAGACCGAAGCCCACCTGTCCTGACCTCACCGCAGGCATCGCGTCTAACTCTGATTCGAGAGACGGAT
->read4028_contig0_position5752_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TACGGATAGCCCGTGGCTTGACTGTTTTCTGAATTGTGGCTATCTCAAATTGGGACCTAGTGTTGGCCAATAAGCTTCATATCGCCTTCTCAGATAGACT
->read4029_contig0_position5309_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTACCCTGCAGACGTCCGCCTAAGATCCTAGTTGAATTGATCAATTGAGTCCAGTACACCATATCAACAGCTTGATCGTTCCACTTCAATCAGCAAGACG
->read4030_contig0_position9032_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AACTTTATGCATACTCGTTTAGTACAGGGCCGCGCCCCATGAGGCCATATGCGCCTGTCACGGGCATGCTGAAAGCGGCGGTTACATTAATCGCTTCTGT
->read4031_contig0_position9706_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTGGTTTTGTACTACGGTATGGGAACCCGTTTGCCGAACGTCTGGAAATATGTCGAGTCATATCGATGAACAGAGACTAAATGTCCTTAAATCTCTAAC
->read4032_contig0_position1382_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCCGGTATGTCTGTGTAAGGTTGGGCCAATCGAGAGGACATTTCGCAGCGCCCTTTCATCTCTATTGCTAGGTCTCTTAAGCCTAATCAGGATCATAGA
->read4033_contig0_position3986_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AATGATATATGCTCTTGGACAACACGAGGTCGTAATTATTTCCTGAGATGGTTTTAGTGAGAGCAGCAGATGCACTCTTAGCTCCGCTGATAACGATTAC
->read4034_contig0_position3311_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCGCTAGCTAATGGTCACGGCCTCTCTGGGAAAGCTGAACAACGGATGGGATTAAGCTCAGCAGTCCGCCTCCAATTTCTCCGACGTTCATTCTCAAGG
->read4035_contig0_position7818_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAGCCACACTCGCCGTTACTGACTGATTGACAATCCAGCCCGTTTGGGGTGATATGTGCAGGAGCGTCCAGGTGCGAACGTTGTGCCGTGTCACTCTGT
->read4036_contig0_position127_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTTGACATTTACAAGGCAACATTGCAGCGTCCGATGGTCCGTTGGCCTCCAGATAGTGTCCAGTCGCTCTAACTGTATGGAGACCATAGGCATTTACCT
->read4037_contig0_position7193_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CAATGTCCGTCAATCGGGTTGGCCAAAAATTCTACCTGTCCACCTGTCCGCTAGAAGCAGATTATACGGAATACATATCCCGACACCGGCAGCTGAAATG
->read4038_contig0_position9532_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTACTTCACGGAACGCTTCTTGATCCTAAGCTCCCCCGCGATTAACCTATGTCGGGACAAACACTCGATTGAGCAGTGGTCATGTCATTATTGTACATC
->read4039_contig0_position1069_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTTACGCGTTATTACCGGTCAGCTCCAGTTACGTCACGGACGTAGAGAGCCTTTGAATGTGTACGGCAATAGGAGAAACTAGGCCACGTACGTGTCAAC
->read4040_contig0_position544_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ACATGAAGCGGTAATGGAGCTCGAACACTAGTCGGTGGCTCTTCTGTCTCTGGCGGGGACGGCTATGTGAGTGCATACATCTCAATGTCGAAACTCCGAT
->read4041_contig0_position5872_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACAGCTGATTTAAGAGGAAAAATTGAACATCAACGGAAGTACTATAGCAGGCTCACCAGCATGAAAGACAACCTCATTGTGAACCCGGCATCTCGTGATT
->read4042_contig0_position9608_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGGTCATGTCATTATTGTACATCAGTACCATAGCTTGGCCACATGTGATGCTCGTACTCGAAGGGGGAATCACCTTAGTTAATCGGCTGGGGTAACGGC
->read4043_contig0_position9097_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGCTTAAAGCGGCGGTTACATTAATCGCTTCTGTGATGACAGACCGAAGCCCACCTGTCCTGACCTCACCGCAGGCATCGAGTCTAACTCTGGTTCGAG
->read4044_contig0_position7656_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCGGGGACCGTGATATCCTTGCGAGTGGAATGCGAAAACGGCATAAGCGCAATGACCGAGGTAACAAGCCATGAGGACTGGAGCGGTAATGTGGTAGTG
->read4045_contig0_position3084_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGCACTGTCCGCGAAACATTATTCAGTACAGCGACTTTTACCCTCGTGGTCTGAATGTTATGCCGTCCGACTCTTGCGCTCGGATGTCCGCAATGGGTT
->read4046_contig0_position8327_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTGCGACCTGAATGACCTTGGGCTCGTCGACATTCCTGGTAGTAATCCGATCTCAATTCCTGCGGTACCGAGCAGCTTTGAGTTTTTGTAAGTCCCACG
->read4047_contig0_position2187_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTTGGCCACAACAGAGACTAGCCACCAAGAGATGGGTTGATGGTAGCATCCCGGCTTCTGGGGCAATTTCTGACGATTCGAGTGACCAGCGATAGTACG
->read4048_contig0_position5921_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCTCACCAGCAAGAAAGACATCCTCATTGTGAACCCGGCATCTCGTGATTCGAGCCTAACAGCATGCCATCTAACGTTTGGACGGGTCTTGTGTTCCCT
->read4049_contig0_position207_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGACCATAGGCATTTACCTTATTCTCATCGCCACGCCCCAAGATCTTTAGGACCCAGCATTCCTTTAACCACTAACATAACGCGTGTCATCTAGTTCTA
->read4050_contig0_position7092_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGGGGAGCTAATATATCGCGGCGTCGAGTTACCGTTGCACCACCTCCAAGTGTCCATCGGAGTCCGCTTCCCGGGCTTGTCCGCGTCCCATCGGTTAAT
->read4051_contig0_position4820_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTATCCGCACACACCGCCGTTGGATGTGTCCCACAGTGTTTTATACGGGACGGTGGCCACGGGGTGAGCACATGAATGGGGTACGGTTTTACCGTCCAT
->read4052_contig0_position1353_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCACGGCTTGATGTCAGGGTCAGTTTGGGCGCCGGTATGTCTGTGTAAGGTTGGGCCAATCGAGAGGACATTTCGCAGCGCCCTTTCATCTCTATTGCTA
->read4053_contig0_position7510_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCTTGAACGAGAGAAGCTAACAGTCATTGCGATGACGAGAACAGCCCTACTGCCCGCCGTGAACGAGAACAAGCGTGTGGAGAGTGACTGACTATCACG
->read4054_contig0_position3905_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GCACGACTCTTAAAATCATGCGCTAAGCATAGAATGCACGACTACTTGTTATTGAAGTCGGCATGACTATCAAACCTATTTAATGATATATGCTCTTGGA
->read4055_contig0_position2742_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGTTACTCCCGGGATCCACTGCGTCTATTGTAAGAAATGCAATGCGTTGCCAGTTTGTTCCGGCAGGACACCACTCTTTGAAGGTGCCAATTGCATTGT
->read4056_contig0_position4499_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TACTGAGTGTCCGCCCTCGGCTAATCATGAACACCGGTCAGGCATGCTTACCTCCTGCGACGGCATTGGCGATTATGGGCGTGCATAGAGTCCCGCAGTG
->read4057_contig0_position317_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTTGGGCCACACAATTAATATAAGACGGGATAATGGCTTCATGCTCATGTTCTATACCGAGCAGAGAGGTTGGGTCTACCTAGTAGTGTCGCGGTTATC
->read4058_contig0_position3413_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTAGTTTTAGAGACTGAGAACTCACCCTATTGGTAGTACTGCCTGCCGTCGCCTCGCGCCCATAGTGTTTGGAACTCGCAAACCTTTACACTCATCACAT
->read4059_contig0_position8387_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGCGGTACCGAGCAGCTTTGAGTTTTTGTAAGACCCACGGTTAATGGGCCACTTATTTCGACATTCATGGCGCCGATATCCTGCTTAGGCAGTACGGCC
->read4060_contig0_position381_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGAGGTTGGGTCTACCTAGTAGTGTCGCGGTTATCGGACAGAGGATTATTTAAGGTTACCGAAGACCGGGTAGCGTAGTTAGTAACTTCAATCCGCGTT
->read4061_contig0_position2391_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGGTACCCGACGCCTCTGCTGTCAAAGTGGGAAATCCAGTCTCGACTATATCTACTATGTCATGCTTGTCGAATGAACAACTCAATTAGGTAGTGTGCG
->read4062_contig0_position442_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAAGACCGGGTAGCGTAGTTAGTAACTTCAATCCGCGTTACGCTTTGTCCTCTGCTAGGCCTCGATTGGTTTCAGCTCACGTGGGACGCATGTACTTACC
->read4063_contig0_position90_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTGCATCGAGAGGTGTCGCTAGCGCAATGCGCAAGATTTTGACATTTACAAGGCAACATTGCAGCGTCCGATGGTCCGGTGGCCTCCAGATAGTGTCCA
->read4064_contig0_position2362_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GACGGGACTAAAACAGTATTGGGCGGTGAGGGGTACCCGACGCCTCTGCTGTCAAAGTGGGAAATCCAGTCTCGACTATATCTACTATGTCATGCTTGTC
->read4065_contig0_position6183_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACAGTCGACTAAAAGGCGTAACCGATTCTGCTACGTTATAAAAAAGGGACGAGTGGGGTCAACAGTTCTTCTTCTTTCCTATACGGTAATGCTTCCGCGC
->read4066_contig0_position6135_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCGTTCCGAACTGGCTTGAGCCACTCATAAGGCACGCGCGGGCCATAACAGTCGACAAAAAGGCGTAACCGATTCTGCTACGTTATAAAAAAGGGACGA
->read4067_contig0_position5670_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GTATATTAACTTTTTGAAATTAGCGAGTTAACTACTTAAAGTTCAGAAGATCACTGTCCGCCTCGAACCACTACAATAAGATTACGGCTAGCCCGTGGCT
->read4068_contig0_position9729_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAACCCGTTTGCCGAACGTCTGGAAATCTGTCGAGTCATATCGATGAACAGAGACTAAATGTCCTTAAATCTCTAACACGATTTTAGTAGGTCTACTACT
->read4069_contig0_position3256_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CACACCCTTAAGTACCGAACGATAGAGCACCCCTCTAGGAGGGCGTGTAGGGTCTCCCGCTAGCTAATGGTCACGGCCTCTCTGGGAAAGCTGAACAACG
->read4070_contig0_position5612_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTTTGGCAGACGCGAGGTTGCGTGGTCAACCGAACGTTGCTTTCCTTAGGGTACCGAGTATAGTAACTTTATGAAATTAGCGCGTTAACTACTTAAAGT
->read4071_contig0_position2977_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGCTCCCGAACAACGCGTGAGTTTAAAATTGACTTGAAACCGCCTAGCTCGGACCACCAAAGAGCAAGACTCTATGACTAGCGGGTGTCGTCAATGAAA
->read4072_contig0_position2634_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAATCTAACCCTGAATTGGCTTTATCCACCCCCCCTACTGGCCACCACTGAGGCGCGAGTCTCGAGCCTCTCGACTCCAAAGGGTCTGCCCGAGACAGGT
->read4073_contig0_position8159_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCCGCAGGAAAGATCCGAGGCCTTTTCCAGTGTAAAATGTTGGACTCATTGACCAACCCCTATTATTAGGAGAGGGCTGCGACTGCTTGCAGCTCCGAC
->read4074_contig0_position1068_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGTTACGCGTTATTACCGGTCAGCTCCAGTTACGTCACGGACGTAGAGAGCCTTTGAATGTGTACGGCAATAGGAGAAACTCGGCCACGTACGTGTCAA
->read4075_contig0_position2238_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGGCTTCTGGGGCAATTTCTGACGATTCGAGTGACCAGCGATAGTACGTTCCTTTTGTACAGAGTCTTAACATCGGCAAATGCGCCTTAGATACCTGCG
->read4076_contig0_position2218_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GATGGGTTGATGGTAGCATCCCGGCTTCTGGGGCAATTTCTGACGATTCGAGTGACCAGCGATAGTACGTTCCTTTTGTACTGAGTCTTAACATCGGCAA
->read4077_contig0_position2104_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCATGTGTACGCAGCGGTCTATGCTACAGGTATTACGGAGTGAAACGGCTGCGAGCATCTCATAATCGGGCCACCCGATTTCAGCTTGGCCACAACAGAG
->read4078_contig0_position9468_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGGACGCCCATACCCCTTTGTCTACAGAAGCTCATGGATAAGAGTGTGCGAATAACATCACTTGTTACTTCACGGAACGCTTCTTGATCCTGAGCTCCC
->read4079_contig0_position575_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGGTGGCTCTTCTGTCTCTGGCGGGGACGGCTATGTGAGTTCATAAATCTCAATGTCGAAACTCCGATGGGCAGAAGCTAAAACTGAACAACGAGTGGG
->read4080_contig0_position5997_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTTGGACGGGTCTTGTGTTCCCTCAACACGTACGTTGACAGAGCTAACAATCCGTCGACTGAATGTGATTCCTTTGTTATTTCACACTATTGTTCGGTG
->read4081_contig0_position5699_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AACTACTTAAAGTTCAGAAGATCACTGTCCGCCTCGAACCACTACAATAAGATTACGGATAGCCCGTGGCTTGGTTGTTTTCTGAATTGTGGCTATCTCA
->read4082_contig0_position4181_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGAGGCGGGAACTTCCCGCTGATATGATTGTGGTCGATATTCAGACTCTAACAAGTGGTCAGTACAGGTTCGACCATACGCGACGGCAAACAGAATCGCA
->read4083_contig0_position9707_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGGTTTTGTACTACGGTATGGGAACCAGTTTGCCGAACGTCTGGAAATCTGTCGAGTCATATCGATGAACAGAGACTAAATGTCCTTAAATCTCTAACA
->read4084_contig0_position4626_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CAATTCCGTTTAATAGCGGAATCTGCTGGCTTGTGCATTCGTCGGCCTATTAGATACGGTACGGAATATTGGGGAACCTCCTCTTCACTGATATCATCCT
->read4085_contig0_position7834_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTACTGACTGATTGACAATCCAGCCCGTTTGGGGTGATTTGTGCCGGCGCGTCCAGGTGCGAACGTTGTGCCGTGTCACTCTGTAGCTCTAATACCAATT
->read4086_contig0_position9211_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGTCAGGTCGGAACCGCTGACAGAGCAGCTCCGAGGGCCTTTATACCCATACTGCCACTCCAGTACCTGGGCCGCGTGTTGTACGCTGTGTATCTTGAG
->read4087_contig0_position6612_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCAGCGACCCCACATGGAGCGATGGGTCCTCAAGGCAGTATAAAATGGACTGCTATCTAGGCGTTAAAGTAGTAGAACGAGGGTCGGGCGATTTGTTTTG
->read4088_contig0_position5398_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCAGCAAGACGGGCGACCGTACCCGGACACCTGGCAGCGGGAACAGCTTTGACTCTGGAGTGCCAGCGATAGTATCTCAGAGGCGAAAGCGCTTGTCACC
->read4089_contig0_position2113_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCAGCGGTCTATGCTACAGGTATTACGGAGTGAAACGGCTGCGAGCATCTCATAATCGGGCCACCCGATTTCAGCTTGGCCACAACAGAGACTTGCCAC
->read4090_contig0_position216_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCATTTACCTTAGTCTCATCGCCACGCCCCAAGATCTTTAGGACCCAGCATTCCTTTAACCACTAACATAACGCGTGTCATCTAGTTCTAGCATACTCC
->read4091_contig0_position7423_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGCAGTTTCTGCATACACCGGGTAGACAACATTCTCAGCCCTTCGTTGAAAGGAGAATACAAATGACGGGAACTCTGACGAGAGGGTGCTTGAACGAGA
->read4092_contig0_position1218_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGAGAATAGTCGACTAGTAGCGAGTATATGTTCTGCTACGAGACTTCGGCATAAATCTAAGTATGGACTCTTATATTCCCTCCTGCGTAGTGCTCTCCC
->read4093_contig0_position4978_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGGCACTGCATAGCAGAATGGGCGATCGGCCTACAAGAGTACAGTACTAACGGTCTGGCCTTATACAGCGCCACATCCGCCAATTCGCTAGGTTGTAGC
->read4094_contig0_position4613_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGACATAAACGCCAATTCCGCTTAATAGCGGAATCTGCTGGCTTGTGCATTCGTCGGCCTATTAGATACGGTACGGAATATTGGGTAAGCGCCTCTTCA
->read4095_contig0_position9627_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACATCAGTACCATAGCTTGGCCACATGTGATGCTCGTACTCGAAGGGGGAATCACCTTACTTAATCGGCTGGGGTAACGGCTGGTTTTGTACTACGGAAT
->read4096_contig0_position1513_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTATAAATTAGTGGATTCACTTCCCTTTGACATCTTGTTCTCACAACTGCACACTCCGATGCTCTGCCGAGCCTTCTAACCATCGGGTATGTACATTCAC
->read4097_contig0_position819_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGCTATTCCACGCCGGGTGGCCTGGACGTCGTTAGTGGATGGCTTTGGGAATCACTAGGTAATTACTGTTGGCTCCTTTCTTCATGATCGTCGGAGTTC
->read4098_contig0_position7996_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGACACGAAGATTGTTATACTAGCTTTCAGTCATTCCCCCTCAGTTTTGTCCATGTGGAGAATATGCATTCGACCAAATGAAAATGTCAATAATCTCGA
->read4099_contig0_position2957_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TAATGACCCGTAGCCCAATTGCGCTCCCGAACAACGCGTGAGTTTAAAATTGACTTGAAACCGCCTAGATCGGACAACCAAAGAGCAAGACTCTATGACT
->read4100_contig0_position1937_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGAGCGGTGTTATATTTGTCCTAACTTAGCACTATCGCACCACAAAATTTCAGCATAAAGCATCCGGTTGAAGGCTGCGCATCGAGCCGCGTGCATTGGT
->read4101_contig0_position6089_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTCGGTGCGTGCGCTGCTCAGGCTGGTGCGACCCTTACAGCGTTATCCGTCCCGAACTGGCTTGAGCCACTCATAAGGCACGCGCGGGCCATAACAGTC
->read4102_contig0_position3130_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGGTCTGAATGTTATGCCGTCCGACTCTTGCGCTCGGATGTCCGCAATGGGTTATCAAATGCCTATGTTCCGGTAATCTCTCATCTACTAAGCGCCCTA
->read4103_contig0_position6678_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGTAGTAGAACGAGGGTCGGGCGATTTGTTTTGGTAGTGGTTATCGCATTGCAAGAACGTACGGACGGACAAAATGTCGGACACCGCCTTATCGGCTAT
->read4104_contig0_position3711_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCTTAGGTTCCTCAACGGAAACGTCTCAGACCCACCTTGGACGCGGGAATAAATTCGACACGGGGTACGAAGGGTAAGAACACCTAGCCTGGCAATTAC
->read4105_contig0_position4616_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGTAAACGCCAATTCCGCTTAATAGCGGAATCTGCTGGCTTGTGCATTCGTCGGCCTATTAGATACGGTACGGAATATTGGGTAACCTCCTCTTCACTG
->read4106_contig0_position6968_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGTTCCGATTGTCGTTTCCCAGGCTACGGCCTTATACCAAAGACTTCTAGACCGGAGAGACTACTTCCAGCCACGAAGTCGTGTGATAACCGCCTAAAC
->read4107_contig0_position1241_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AATATATGTTCTGCTCCGAGACTTCGGCATAAATCTAAGAATGGACTCTTATATTCCCTCCTGCGTAGTGCTCTCCCATAATCAGTGAACCCATGGGTCG
->read4108_contig0_position9199_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGGATGTAATTTAGTCAGGTCGGAACCGCTGGCAGAGCAGCTCCGAGGGCCTTTATACCCATACTGCCACTCCAGTACCTGGGCCGCGTGTTGTACGCT
->read4109_contig0_position297_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTAGTTCTAGCATACTCCGCCTTGGGCCACACAATTAATATAAGACGGGATAATGGCTTCATGCTCATGTTCTATACCGAGCAGAGAGGTTGGGTCTAC
->read4110_contig0_position6633_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGGGTCCTCAAGGCAGTATAAAATGGACTGCTATCTAGGCGTTAAAGTAGTAGAACGAGGGTCGGGCGATGTGTTTTGGTAGTCGTTATCGCATTGCAA
->read4111_contig0_position4990_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCAGAATGGGCGATCGGCCTACCAGAGTACAGTACTAACGGTCTGGCCTTATACAGCGCCACATCCGCCAATTCGCTAGGTTGTAGCCAGGCAGTCTGT
->read4112_contig0_position5667_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGAGTATATTAACTTTATGAAATTAGCGCGTTAACTACTTAAAGTTCAGAAGATCACTGTCCGCCTCGAACCACTACAATAAGATTACGGATAGCCCGTG
->read4113_contig0_position433_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGGTTACCGAAGACCGGGTAGCGTAGTTAGTAACTTCAATCCGCGTTACGCTTTGTACTCTGCTACGCCTCGATTGGTTTCAGCTCACGTGGGACGCAT
->read4114_contig0_position9279_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGGCCGCGTGTTGTACGCTGTGTATCTTGAGAGCGTTTCTCCGTATCGAAATGTTCCGCTGGAAAGAACCTGGCGTATCCTGACCATGGAGCTGCAACA
->read4115_contig0_position9602_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGAGCAGTGGTCATGTCATTAATGTACATCAGTACCATAGCTTGGCCACATGTGATGCTCGTACTCGAAGGGGGAATCACCTTACTTAATCGGCTGGGGT
->read4116_contig0_position3044_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-AGACTCTATGACTAGCGGGTGTCGTCAATGAAAACTGATCGAGCACTGTCCGCGAAAGATTATTCAGTACGGCGACTTTTACCCTCGTGGTCTGAATGTG
->read4117_contig0_position8277_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CATGACTTGAGGCTCGGACTCGTATCTGTCTCCGTGTTCCTTTCGATAACTCTGCGACCTGAATGACCTTGGGCTCTTCGACATTCCTGGTAGTAATCCG
->read4118_contig0_position4426_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AATCTATATGGAACCGAGGGGCGGGATGATAATTGTTCTTAGTATAGTGACCGTTATGGACGACGGACATAACTACTGAGTGTCCGCCCTCGGCTAATCA
->read4119_contig0_position7565_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCCGTGAACGAGAACAAGCGTGTGGAGAGTGACTGACTATCACGAGGAATTACGGATAACAGCCCACTTGGAGTGTGCTGAGGGCCGACGCCCGGGGAC
->read4120_contig0_position6200_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTAACCGATTCTGCTACGTTATAAAAAAGGGACGAGTGGGGTCAACAGTTCTTCTTCTTTCCTGTACGGTAATGCTTCCGCGCATCTAAGTGATATTCGC
->read4121_contig0_position8272_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGCACATGACTTGAGGCTCGGACTCGTATCTGTCTCCGTGTTCCTTTCGATAACTCTGCGACCTGAATGACCTTGGGCTCGTCGACATTCCTGGTAGTA
->read4122_contig0_position3793_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCTAGCCTGGCAATTACCCCTTTGTTATTCTAGTCAAATGAAGAACCCGGGCCCAAAATTGGAACCCGTAATCTTCAAGTGAATCATCCGATCATGCAA
->read4123_contig0_position9844_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAATCGGAACACAAGTACGCGATCTCTTTTCTAGTCACCAGCCTCAGGCATTCGCAAATTTCGTTCATGCACGCAACGGGTCGAATAATATGCCGATGTC
->read4124_contig0_position5546_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTTTAGCTAAGTAATCGACTGCCTTCGTCGGGCCGCTTATTGATTCACCCAATCTGGCCATTGCAAGTTTGGCAGACGCGAGGTTGCGTGGTCAACCGA
->read4125_contig0_position5209_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAACATCTTAACCAAAGCATATTAATATGCCAGCCGCGCAGGGTGGTATATATGATCCTTGATAGCTTTATGGCCATCATCATAGTAAATTTTTTCAGA
->read4126_contig0_position4499_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TACTGAGTGTCCGCCCTCGGCTAATGATGAACACCGGTCAGGCATGCTTACCTCCTGCGACGGCATTGGCGATTATGGGCGTGCATAGAGTCCCGCAGTG
->read4127_contig0_position4694_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGGGTAACCTCCTCTTCACTGATATCATCCTATCGGCGTTCAAAGTATTTGGCGGATGAATTAGAGCCAAAGCAGTAGGTTACCGTCGGCGCATAACCG
->read4128_contig0_position5470_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TATCTCAGAGGCGAAAGCGCTTGTCACCTCATCTAAAATCGCGACTATAGATCTGTTTAGGACCACGAACCAGAAATCTTTAGCTAAGTAATCGACTGCC
->read4129_contig0_position3553_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GAATCGTGTAACTCTGCTCGGTTACACGCCCTCGGGAGAAGCCCCATGTAAGATGTATCCATCCCTACGACACGCGTCCGCCACCTCCGGGTCTAGTAAA
->read4130_contig0_position5433_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCGGGAACCGCTTTGACTCTGGAGTGCCAGCGATAGTATCTCAGAGGCGAAAGCGCTTGTCACCTCTTCTAAAATCGCGACTATAGATCTGTTTAGAAC
->read4131_contig0_position4036_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTTTAGTGAGAGCAGCAGGTGCACTCTTAGCTCCGCTGATAACGATTACTATAAATCAGCGAATCTAACATCAATCTGCACCACGAATATCGTCCAAGA
->read4132_contig0_position7654_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCCCGGGGACCGTGATATCCTTGCGAGTGGAATGCGAAAACGGCATAAGCGCAATGACCGAGGTAACAAGCCATGAGGACTGGAGCGGTAATGTGGTAG
->read4133_contig0_position3084_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGCACTGTCCGCGAAACATTATTCAGTACAGCGAATTTTACCCTCGTGGTCTGAATGTTATGCCGTCCGACTCTTGCGCTCGGATGTCCGCAATGGGTT
->read4134_contig0_position6991_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTACGGCCTTATACCAAAGACTTCTAGACCGGAGAGACTACTTCCAGCCACGAATTCGTGTGATAACCGCCTAAACAGTCTAATCTGGCCAATATACCC
->read4135_contig0_position3026_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGGACCACCAAAGAGCGAGACTCTATGACTAGCGGGTGTCGTCAATGAAAACTGATCGAGCACTGTCCGCGAAACATTATTCAGTACAGAGACTTTTAC
->read4136_contig0_position278_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTAACATAACGCGTGTCATCTAGTTCTAGCATACTCCGCCTTGGGCCACACAATTAATATAAGACGGGATAATGGCTTCATGCTCATGTTCTATACCGA
->read4137_contig0_position3933_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATAGAATGCACGACTACTTGTTACTGAAGTCGGCATGACTATCAAACCTATTTAATGATATATGCTCTTGGACAACACGAGGTCGTAATTATTTCCTGAG
->read4138_contig0_position9445_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTGTCGCTGCGTACCAAATTAACTGGACGCCCATACCCCTTTGTCTACAGAAGCTCATGGATAAGAGTGTGCGAATAACATCACTTGTTACTTCACGGA
->read4139_contig0_position1567_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCGATGCTCTGCCGAGCCTTCTAACCATCGGGTATCTACATTCACCTTTGGACGCTTCGATAGGACATGCACCCGGTCCGTTGACTTACCAACTAGATC
->read4140_contig0_position733_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTTATTAACCGCGACGGTGTATTCCACGACCTAATTTTTCCCGTCTCTGTGGTCAACCTGGACGCACAAACCCTAGTCCCATATAAAGCTATTCCACGC
->read4141_contig0_position5988_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCATCTAACGTTTGGACGGGTCTTGTGTTCCCTCAACACGTACGTTGACAGAGCTAACAATCCGTCGACTGAATGTGATTCCTTTGTTATTTCACACTAT
->read4142_contig0_position141_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGCAACATTGCAGCGTCCGATGGTCCGGTGGCCTCCAGATAGTGTCCAGTCGCTCTAACTGTATGGAGACCATAGGCATTTCCCTTATTCTCATCGCCA
->read4143_contig0_position2031_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTGGTGCTTCAGTCCCCAGTCACCGGAGGCGTCCGAGCTCGAGCCCGTCCGGCTAAGAGGCAGGCAGTCGCTGCATGTGTACGCAGCGGTCTATGCTAC
->read4144_contig0_position4075_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATAACGATTACTATAAAGCAGCGAATCTAACATCAATCTGCACCACGAATATCGTCCAAGACGTTTTGAGCCGGTGACTAATACGGTTGTCGCACATAGT
->read4145_contig0_position7197_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCCGTCAATCGGGTTGGACAAAAATTCTACCTGTCCACCTGTCCGCTAGAAGCAGATTATACGGAATACATATCCCGACACCGGCAGCTGAAATGATGC
->read4146_contig0_position8175_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CGAGGCCTTTTCCAGGGTAAAATGATGGACTCATTGACCAACCCCTTTTATTAGGAGAGGGCTGCGACTGCTTGCAGATCCGACCGCGTTCCAATCGTTG
->read4147_contig0_position9346_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AACCTGGCGTATCCTGACCATGGAGCTGCAACACTTTCACACAGGTAGCCGAACAGGTATTACTCAGACTGGAGAGGAATCTTCATTGGTCGTGCAGACA
->read4148_contig0_position7992_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCGGCGACACGAAGATTGTCATACTAGCTTTCAGTCATTCCCCCTCAGTTTTGTCCATGTGGAGAATATGCATTCGACCAAATGAAAATGTCAATAATC
->read4149_contig0_position5212_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACATCTTAACCAAAGCATATTAATATGCCAGCCGCGCAGGGTGGTATATATGATCCTTGATAGCTTTATGGCCATCATCATAGTAAATTTTTTCAGATTA
->read4150_contig0_position5716_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGATCACTGTCCGCTTCGAACCACTACAATAAGATTACTGATAGCCCGTGGCTTGGTCGTTTTCTGAATTGTGGCTATCTCAAATTGGGACCTAGTGTT
->read4151_contig0_position893_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCTTTCTTCATGATCGTCGGAGTTCTTTCAGGCCGATCAAGTGGTTAGAGACCTAGGTCTATGCCAGACGATCGCAGCGGAGTCGATATAATTGCAGTA
->read4152_contig0_position538_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TACCTAACATGAAGCGGTAATGGAGCTCGAACACTAGTCGGTGGCTCTTCTGTCTCTGGCGGGGACGGATATGTGAGTTCATAAATCTCAATGTCGAAAC
->read4153_contig0_position7309_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCCACTCCGCCGATGTCTAAAAGCGCCAGATCGACTTGACTCTACGTGCTGCAATGGAGAACCGCGGAAGGAACGCTTTCTGGTGCCACTCGAGACCGC
->read4154_contig0_position5458_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCCAGCGATAGTATCTCAGAGGCGAAAGCGCTTGTCACCTCATCTAAAATCGCGACTATAGATCTGTTTAGAACCACGACCCAGAAATCTTTAGCTAAG
->read4155_contig0_position5615_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGGCAGACGCGAGGTTGCGTGGTCAACCGAACGTTGCTTTCCTTAGGGTACCGAGTATATTAACTTTATGAAATTAGCGCCTTAACTACTTAAAGTTCA
->read4156_contig0_position2905_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGAACGCGTTTACCTTAAGACGAAAGAGTCAGTAGAGTTGGGGTTCGTGCTTTAATGACCCGTAGCCCAATTGCGCTCCCGAACAACGCGTGAGTTTAAA
->read4157_contig0_position385_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTTGGGTCTACCTAGTAGTGTCGCGGTTATCGGACAGAGGATTATGTAAGGTTACCGAAGACCGGGTAGCGTAGTTAGTAACTTCAATCCGCGTTACGC
->read4158_contig0_position2223_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTGATGGTAGCATCCCGGCTTCTGGGGCAATTTCTGACGATTCGAGTGACCAGCGATAGTACGTTCCTTTTTTACTGAGTCTTAACATCGGCAAATGCG
->read4159_contig0_position744_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGACGGTGTATTCCACGACCTAATTTTTCCCGTCTCTGTGGTCAACCTGGACGCACAAACCCTAGTCCCATATAAAGCTATTCCACGCCGGGTGGCCTG
->read4160_contig0_position5990_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCTAACGTTTGGACGGGTCTTGTGTTCCCTCAACACGTACGTTGACAGAGCTAACAATCCGTCGACTGAATGTGATTCCTTTGTTATTTCACACTATTG
->read4161_contig0_position8946_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CACGCGCCACCGTCATAGGCTGCATATTGAGACAGGGTTTAAAACCTGTCTGAAGTCCGTGCTTCCCTAACCAGCCTATGCGCCTTAACTTTATGCATAC
->read4162_contig0_position3462_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCCTCGCGCCCATAATGTTTGGAACTCGCAAACCTTTACACTCATCACATAGCAGGTTCCACCCGAACCGCGCGTATTCTGCGACAGCATGAATCGTGT
->read4163_contig0_position7483_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CAAATCACGGGAACTCTGACGAGAGGGCGCTTGAACGAGAGAAGCTAACAGTCATTGCGATGACGAGAACAGCCCTACTGCCCGCCGTGAACGAGAACTA
->read4164_contig0_position3682_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGATTGTCTGAATATCGTGCAGTAAGTTTCTCTTAGGTTCCTCAACGGAAACGTCTCAGACCCACCTTAGACGCGGGAATAAATTCGACACGGGGTACGA
->read4165_contig0_position7022_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAGAGACTACTTCCAGCCACGAATTCGTGTGCTAACCGCCTACACCGTCTAATCTGGCCAATATACCCTGGGGGGAGCTAATATATCGCGGCGTTGAGT
->read4166_contig0_position5751_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTACGGATAGCCCGTGGCTTGGTTGTTTTCTGAATTGTGGCTATCTCAAATTGGGACCTAGTGTTGGCCAATAAGCTTCATATCGCCTTCTCAGATAGAC
->read4167_contig0_position1537_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTTGACATCTTGTTCTCACAACTACACACTCCGATGCTCTGCCGAGCCTTCTAACCATCGGGTATGTACATTCACCTTTGGACGCTTCGATAGGACATG
->read4168_contig0_position1707_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTCCCTATCTGCTGGGACGGCACTGGGGATCTGGAACATTAGATAGGATAAAAAAGTAATACGGTTGATGTTATTACCAACTCCACTTCTGCAAATTGT
->read4169_contig0_position325_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CACACAATTAATATAAGACGGGATAATGGCTTCATGCTCATGTTCTATACCGAGCAGAGAGGTTGGGTCTACCTAGGAGTGTCGCGGTTATCGGACAGAG
->read4170_contig0_position6882_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCATAAGATGATACTTCATCTGCATGCGCGCATCTTCCTATTTTATGGTCTTAATTGAGTGTTCAGAGTTGGGGGTCACAGATGAGCGTTCCGATTGTC
->read4171_contig0_position1174_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGGCTCTCTATACCTCGCAAAGAATCACTCTATGGGTCATCTTGAGAGAATAGTCGACTAGTAGCGAATATATGTTCTGCTCCGAGACTTCGGCATAAA
->read4172_contig0_position7792_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGATACACGAAGGCCAGAGCGGAAGCGGAGCCACACTCGCCGTTACTGACTGATTGACAATCCAGGCCGTTTGGGGTGATTTGTGCCGGCGCGTCCAGGT
->read4173_contig0_position715_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGAAGCACCCACGATCAATGTTATTAACCGCGACGGTGTATTCCCCGACCTAATTTTTCCCGTCTCTGTGGTCAACCTGGACGCACAAACCCTAGTCCCA
->read4174_contig0_position8724_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTACATCGAATTCAGCGTGTAAGAGCCCGCTTATCCGGTGGTGATACCTACTATTGACTGGGGGCTTACTGAGAAGACTTCATCTGTATGGCAAAGTTGC
->read4175_contig0_position1826_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGCCGGCCCACAAATCGACGTGTGTATTTGTTCAATGGCAGGAGGTTAACTTTGCGGAGCTCAACCTATAACGATAATCAAATTGAGACAGACGAATTG
->read4176_contig0_position9737_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGCCGAACGTCTGGAAATCTGTCGAGTCATATCGATGAACAGAGACTAAATGTCCTTAAATCTCTAACACGATTTTAGTAGGTCTACTACTAGGCCGCT
->read4177_contig0_position1033_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGCGCAAAGGTACCGCAAAGAGCCTGTATGACCCTGGTTACGCGTTATTACCGGTCAGATCCAGTTACGACACGGACGTAGAGAGCCTTTGAATGTGTA
->read4178_contig0_position4628_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTCCGCTTAATAGCGGAATCTGCTGGCTTGTGCATTCGTCGGCCTATTAGATACGGTACGGAATATTGGGTAACCTCCTCTTCACTGATATCATCCTAT
->read4179_contig0_position4323_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTGCTGAGGAGACCCGTAATGCATGGAAAGTGCCAATATCCCCGGGAGTCCCGCACTAATGAGACGAAGTCTAGCTAGCTTGACTCGGCTGATAAAGAA
->read4180_contig0_position4153_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAATTCGGTTGTCGCACACAGTGTACGTTGAGGCGGGAACTTCCCGCTGATATGATTGTGATCGATATTCAGACTCTAACAAGTGGTCAGTACAGGTTCG
->read4181_contig0_position1142_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGAAACTCGGCCACGTATGTGTCAACATGGCGCGGCTCTCTATACCTCGCAAAGAATCACTCTATGGGTCATCTTGAGAGAATAGTCGACTAGTAGCGA
->read4182_contig0_position1803_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGTTATGAGCAAGCATACAAGTTAGCCGGCCCACAAATCGACGTTTGTATTTGTTCAATGGCAGTAGGTTAACTTTGCGGAGCTCAACCTATAACGATA
->read4183_contig0_position7868_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TGATTTGTTCCGGTGCGTCCAGGTGCGAACGTTGTGCCGTGTCACTCTGTAGCTCTAATACGAATTGAAATGAAGCTTACGCAAACTACTCGACGAACAA
->read4184_contig0_position1482_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGCCAATTATTGACCACAGGTAGGGGCGAGGTATAAATTAGTGGATTCACTTCCCTTTGACATCTTGTTCTCACAACTGCACACTCCGATGCTCTGCGG
->read4185_contig0_position3201_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGTAATCTCTCATCTACTAAGCGCCGTAAAGGTCGTATGGTTGGAGGGCGGTTACACACCCGTAAGTACCGAACGATAGAGCACCCGTCAAGGAGGGCG
->read4186_contig0_position325_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CACACAATTAATATAAGACGGGATAATGGCTTCATGCTCATGTTCTATACCGAGCAGAGAGGTTGGGTCTACCTAGTAGTGTCGCGGTTATCGGACAGAG
->read4187_contig0_position7714_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAAGTAACAAGCCATGAGGACTGGAGCGGTAATGTGGTAGTGTAGTTGCCGGCCCCTGTGCTGACCTTATGTCCATATCGATACACGAAGGCCAGTGCGG
->read4188_contig0_position7875_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCCGGCGCGTCCAGGTGCGAACGTTGTGCCGTGTCACTCTGTAGCTCTAATACCAATTGAAATGAAGCTTACGCAAACTACTCGACGAACAACAGCAAG
->read4189_contig0_position1557_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AACTGCACACTCCGATGCTCTGCCGAGCCTTCTAACCATCGGGTATGTACATTCACCTTTGGACGCTTCGATAGGACATGCACCCGGTCCGTTGACTTAC
->read4190_contig0_position9067_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCATGAGGCCATATGCGCCTGTCACGGGCATGCTGAAAGCGGCGGTTACATTAATCGCTTCTGTGATGACAGACCGAAGCCCACCTGTCCTGACCTCAC
->read4191_contig0_position882_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTACTGTTGGCTCCTTTCTTCATGATCGTCGGAGTTCTTTCAGGCCGATCAAGTGGTTAGAGACCTAGGTCTATGCCAGACGATCGCAGCGGAGGCGATA
->read4192_contig0_position6177_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCATAACAGTCGACTAAAAGGCGTAACCGATTCTGCTACGTTATAAAAAAGGGACGAGTGGGGTCAACAGTTCTTCTTATTTCCTGTACGGTAATGCTT
->read4193_contig0_position536_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTACCTAAGATGAAGCGGTAATGGAGCTCGAACACTAGTCGGTGGCTCTTCTGTCTCTGGCGGGGACGGCTATGTGAGTTCATAAATCTCAATGTCGAA
->read4194_contig0_position2647_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AATTGGCTTAATCCACCCCCCCTACTGGCCACCACTGGGGCGCGAGTCTCGAGCCTCTCGACTCCAAAGGGTCTGCCCGAGACAGGTTCACCGAGTCGTT
->read4195_contig0_position1246_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGTTCTGCTCCGAGACTTCGGCATAAATCTAAGTATGGACTCTTATATTCCCTCCTGCCTAGTGCTCTCCCATAATAAGAGAACCCATGGGTCGCGCTG
->read4196_contig0_position3190_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCCTAAGTACCGGTAATCTCTCATCTACTAAGCGCCCTAAAGGTCGTATGGTTGGAGGGCGGTTACACACCCTTAAGTACCGAACGATAGAGCACCCGT
->read4197_contig0_position5015_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGTACAGTACTAACGGTCTGGCCTTATACAGCGCCACATCCGCCAATTCGCTAGGTTGTAGCCAGGAAGTCTGTAGTACAGGTGCCCATAACCCGATGA
->read4198_contig0_position4769_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTAGGTTACCGTCGGCGCATAACCGGCGAGTGCTCTGAAACGTTACATTCGTCTATCCGCACACACCGCCGTTGGATGTGTCCCACAGTGTCTTATACGG
->read4199_contig0_position7202_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCAATCGGGTTGGCCAAAAATTCTACCTGGCCACCTGTCCGCTAGAAGCAGATTATACGGAATACATATCCCGACACCGGCAGCTGAAATGATGCAGAAG
->read4200_contig0_position8092_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGACCCTGTAGTCCGCGGCCAATCAGCACAATCAAGCTAAAGACAGGGATTATGCACTAGCACGACCGCCGCAGGAAAGATCCGAGGCCTTTTCCAGGG
->read4201_contig0_position1416_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGGACATTTCGCAGCGCCCTTTCAGCTCTATTGCTAGGTCTCTTAAGCCTAATCAGGATCATAGATGGCCAATTATTGACCACAGGTAGGGGCGAGGTA
->read4202_contig0_position5215_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTTAACCAAAGCATATTAATATGCCAGCCGCGCAGGGTGGTATATATGATCCTTGATAGCTTTATGGCCATCATCATAGTAAATTTTTTCAGATTACCC
->read4203_contig0_position4345_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CATGGAAAGTGCCAATATCCCCGGGAGTCCCGCACTACTGAGACGAAGTCTAGCTAGCTTGACTCGGCTGATAAAGAAAACAATCTATATGGAACCGAGG
->read4204_contig0_position9175_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGAGTCTAACTCTGATTCGAGAGACGGATGTAATTTAGTCAGGTCGGAACCGCTGGCAGAGCAGCTCCGAGGGCCTTTATACCCATACTGCCACTCCAG
->read4205_contig0_position4056_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCACTCTTAGCTCCGCTGATAACGATTACTATAAATCAGCGAATCTAACATCAATCTGCACCACGAATATCGTCCAAGACGTTTTGAGCCGGTGACTAA
->read4206_contig0_position4035_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTTTTAGTGAGAGCAGCAGATGCACTCTTAGCTCCGCTGATAACGATTACTATATATCAGCGAATCTAACATCAATCTGCACCACGAATATCGTCCAAG
->read4207_contig0_position2794_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTTTGTTCCGGCAGGACACCACTCTTTGAAGGTGCCCATTGCATTGTAGCCTGAACTATTAGCAATCCTAAGCCCATAAGCCCTGCCCCACGGGGGCTA
->read4208_contig0_position6130_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGTTATCCGTCCCGAACTGGCTTGAGCCACTCATAAGGCACGCGCGGGCCATAACAGTCGACTAAAAGGCGTAACCGATTCTGCTACGTTACAAAAAAGG
->read4209_contig0_position3799_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTGGCAATTACCCCTTTGTCATTCTAGTCAAGTGAAGAACCCGGGCCCAAAATTGGAACCCGTAATCTTCAAGTGAATCATCCGATCATGCAAACCTGA
->read4210_contig0_position3826_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCAAGTGAAGAACCCGGGCGCAAAATTGGAACCCGTAATCTTCAAGTGAATCATCCGATCATGCAAACCTGATTATCTGCACGACTCTTAAAATCATGC
->read4211_contig0_position3184_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCAAATGCCTATCTTCCGGTAATCTCTCATCTACTAAGCGCCCTAAAGGTCGTATGGTTGGAGGGCGGTTACACACCCTTAAGTACCGAACGATAGAGC
->read4212_contig0_position9746_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCTGGAAATCTGTCGAGTCATATCGATGAACAGAGACTAAATGTCCTTAAATCTCTAACACGATTTTAGTAGGTCTACTACTAGGCCGCTTGCTCAGAA
->read4213_contig0_position7492_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAACTCTGACGAGCGGGTGCTTGAACGAGAGAAGCTAACAGTCATTGCGATGACGAGAACAGCCCTACTGCCCGCCGTGAACGAGAACAAGCGTGTGGA
->read4214_contig0_position2446_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTATGTCATGCTTGTCGAATGAACAACTCAATTAGGTAGTGTGCGCGAGGTAGAGTATGCAGATTTCGTACCTTGCCACTGCTACCTCCGGCATATGGGC
->read4215_contig0_position779_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTGTGGTCAACCTGGACGCACAAACCCTAGTCCCATATAAAGCTATTCCACGCCGGGTGGCCTGGACGTCGTTTGTGGATGGCTTTGGGAATCACTAGG
->read4216_contig0_position5323_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCGCCTAAGATCCTAGTTGAATTGATCTATTGAGTCCAGTACACCATATCAACAGCTTGATCGTTCCACTTCAATCAGCAAGACGGGCGACCGTACCCG
->read4217_contig0_position3533_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCGTATTCTGCGACAGCATGAATCGTGTAACTCTGCTCGGTTATACGCCCTCGGGAGAAGACCCATGTAAGATGTATCCATCCCTACCACACGCGTCCG
->read4218_contig0_position6783_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-ATAGTGACTCGCTTGGGTCTCTACATCCGCTGATACGCACGAGCTCTCACCCACGACTGTACCCCGGTTAAGATTTATAAACCATACATTTAACCCTTAG
->read4219_contig0_position2507_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GATTTCGTACCTAGCCACTGCTACCTCCGGCATATGGGCGTGCTATAAATGCGGGAGTCAGGACGATAGAGCGAAGTAGTTACGGTGATTACCCGTCCAT
->read4220_contig0_position479_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTACGCTTTGTCCTCTGCTACGCCTCGATTGGTTTCAGCTCACGTGGGACGCATGTACTTACCTAACATGAAGCGGTAACGGAGCTCGAACACTAGTCGG
->read4221_contig0_position7195_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGTCCGTCAATCGGGTTGGCCAAAAATTCTACCTGTCCACCTGTCCGCTAGAAGCAGATTATACGGAATACATATCCCGACGCCGGCAGCTGAAATGAT
->read4222_contig0_position1665_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGCCAGTGAGTGAGCGGTGGTTTATCTGTTGAGTGGCCACTTTTCCCTATCTGCTGGGACGGCACTGGAGATCTGGAACATTAGATAGGATATAAAAGT
->read4223_contig0_position6784_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGAGCCTCGCTTGGGTCTCTACATCCGCTGACACGCGCGAGCTCTCACCCACGACTGTACCCCGGTTAAGATTTATAAACCATACATTTAACCCTTAGT
->read4224_contig0_position3016_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCGCCTAGCTCGGACCACCAAAGAGCAAGACTCTATGACTAGCGGGTGTCGTCAATGAAAACTGATCGAGCACTGTCCGCGAAACATTATTCAGTACAG
->read4225_contig0_position299_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGTTCTAGCATACTCCGCCTTGGGCCACACAATTAATATAAGACGGGATAATGGCTTCATGCTCATGTTCTATACCGAGCAGAGAGGTTGGGTCTACCT
->read4226_contig0_position7872_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGTGCCGGCGCGTCCAGGTGCGAACGTTGTGCCGTGTCACTCTGTAGCTCTAATACCAATTGAAATGAAGCTTACGCAAACTACTCGACGAACAACAGC
->read4227_contig0_position5151_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AACAGATTGGGAGGTCTCGGCCAATTCGTTGTATTGATCGCTGTGCACTTTAAAATTCGGAACATCTTAACCAAAGCATATTAATATGCCAGCCGCGCAG
->read4228_contig0_position9316_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCTCCGTATCCAAATGTTCCGCTGTAAAGAACCTGGCCTATCCTGACCATGGAGCTGCAACACTTTCACACAGGTAGCCGAACAGGTATTACTCAGACT
->read4229_contig0_position5204_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AATTCGGAACATCTTAACCAAAGCATATTAATATGCCAGCCGCGCAGGGTGGTATATATGATCCTTGATAGCTTTATGGCTATCATCATAGTAAATTTTT
->read4230_contig0_position7640_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGCTGAGGGCCGACGCCCGGGGACCGTGATATCCTTGCGAGTGGAATGCGAAAACGGCATAAGCGCAATGACCGAGGTAACAAGCCATGAGGACTGGAG
->read4231_contig0_position6854_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GATTTATAAACCATACATTTAACCCTTAGTCATAAGATGATACTTCATCTGCATGCGCGCATCTTCCTATTTTATGGTCCTAATTGAGTGTTCAGAGTTG
->read4232_contig0_position7192_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCAATGTCCGTCAATCGGGTTGGCCAAAAATTCTACCTGTCCACCTGTCCGCTAGAAGCAGATTATACGGAATACATATCCCGACACCGGCAGCTGAAAT
->read4233_contig0_position4941_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGACCCGGAAGCGCACCTCGTATAACGTTAGGGGTATCGTCACTGCATAGCAGAATGGGCGATCGGCCTACAAGAGTACAGTACTAACGGTCTGGCCTT
->read4234_contig0_position3250_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGTTACACACCCTTAAGTACCGAACGATAGAGCACCCGTCTAGGAGGGCGTGCAGGGTCTCCCGCTAGCTAATGGTCACGGCCTCTCTGGGAAAGCTGA
->read4235_contig0_position1834_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCACAAATCGACGTGTGTATTTGTTCAATGGCAGGAGGTTAACTTTGCGGAGCTCAACCTATAACGATAATCAAATTGAGACAGACGAGTTGGAGTGTTT
->read4236_contig0_position6450_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTAAGCAGGTCCTGGATTGGCATGTCATCCGGAGTGATAGGCACTGTTCACGACCAGCTTGCGGACAAACGGGGTGCCCGCGCCTGCGTCCGGTAGACGA
->read4237_contig0_position4814_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CATTCGTCTATCCGCACACACCGCCGTTGGATGTGTCCCACAGTGTTTTATACGGGACGGTGGCCACGGGGTGAGCACATGAATGGGGTACGGTTTTACC
->read4238_contig0_position2621_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCCGAAGCCTTAAAATCTAACCCTGAATTGGCTTTATCCACCCCCCCTACTGGCCACCACTGGGGCGCGAGTCTCGAGCCTCTCGACTCCAAAGGGTCT
->read4239_contig0_position2823_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGGTGCCCATTGCATTGTAGCCTGAACTATTAGCAATCCTAAGCCCATAAGCCCTGCCCCACGGGGGCTACAATCCAGCAGTGAACGCGTTTACCTTAA
->read4240_contig0_position8038_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGTTTTGTCCATGTGGAGAATATGCATTCGACCAAATGAAAATGTCAATAATCTCGACCCTGTAGTCCGCGGCAAATCAGCACGATCAAGCTAAAGACA
->read4241_contig0_position2419_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGGAAATCCAGTCTCGACTATATCTACTATGTCATGCTTGTCGAATGAACAACTCAATTAGGTAGTGTGCGCGAGGTAGAGTATGCAGATTTCGTACCT
->read4242_contig0_position6584_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGGACCTCTTGCCCATCCGAGGCTTAAGCAGCGACTCCACATGGAGCGATGGGTCCTCAAGGCAGTATAGAATGGACTGCTATCTAGGCGTTAAAGTAG
->read4243_contig0_position8507_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCTAGCGAGAAGTTATAGTCTAATAATGTATGGTGAACAGCACATCTTTTCGTCCTGAGGCCATATTAATTCTACTCAGATTGTCTGTAACCGGAGCTT
->read4244_contig0_position6761_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCGCCTTATCGGCTATACTAGTTAGAGCCTCGCTTGGGTCTCTACATCCGCTGATACGCGCGAGCTCTCACCCACGACTGTACCCCGGTTAAGATTTAT
->read4245_contig0_position1062_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGACCCTGGTTACGCGTTATTACCGGTCAGCTCCAGTTACGTCACGGACGTAGAGAGCCTTTGAATGTGTGCGGCAATAGGAGAAACTCGGCCACGTACG
->read4246_contig0_position5151_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AACAGATTGGGAGGTCTCGGCCAATTCGTTGTATTGACCGCTGTGCACTTTAAAATTCGGAACATCTTAACCAAAGCATATTAATATGCCAGCCGCGCAG
->read4247_contig0_position5818_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CAAATAAGCTTCATATCGCCTTCTCAGATAGAGTAATAGAACGAAGTCCATATAACAGCTGATTTAAGAGGAAAAATTGAACATCAACGGAAGTACTATA
->read4248_contig0_position3334_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTCTGGGAAAGCTGAACAACGGATGGGATTAAGCTCAGCAGTCCGCCTCCAATCTCTCCGACGTTCATTCTCAAGGGTGTAGTTTTAGAGACTGAGAAC
->read4249_contig0_position3600_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GTAAGATGTGTCCATCCCTAGCACACGCGTCCGCCACCTCCGGGTCTAGTAAACCAGAGATTCCATCGACTCTCTGTTTCGTCGATTGTCTGAATATCGT
->read4250_contig0_position2718_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTGCCCGAGACAGGTTCACCGAGTCGTTACTCCCGGGATCCACTGCGTCTATTGTCAGAAATGCAATGCGTGGCCAGTTTGTTCCGGCAGGACACCACT
->read4251_contig0_position8798_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACACTTCATCTGTATGGCAAAGTTGCGACACCGCGCCACACAGCAGTTTATTGTTAACACGCGATACAAGAGGGTTACGAGCTAAGAAACCGGTGCATCA
->read4252_contig0_position3912_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTTAAAATCATGCACTAAGCATAGAATGCACGACTACTTGTTACTGAAGTCGGCATGACTATCAAACCTATTTAATGATATATGCTCTTGGACAACACG
->read4253_contig0_position4961_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GTATAACGTTAGGGGTATCGTCACTGCATAGCAGAATGGGTGATCGGCCTACAAGAGTACAGTACTAACGGTCTGGCCCTTTACAGCGCCACATCCGCCA
->read4254_contig0_position874_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTAGGTAATTACTGTTGGCTCCTTTCTTCATGATCGTCGGAGTTCTTTCAGGCCGATCAAGTGGTTAGAGACCTAGGTCTATGCCAGACGATCGCAGCGG
->read4255_contig0_position4372_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCCGCACTACTGAGACGAAGTCTAGCTAGCTTGACTCGGCTGATAAAGAAAACAATCTATATGGAACCGAAGGGCGGGATGATAATTGTTCTTAGTATA
->read4256_contig0_position3050_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TATGACTAGCGGGTGTCGTCAATGAAAACTGATCGAGCACTGTCCGCGAAACATTATTCAGTACAGCGACTTTTACCCTCGTGGTCTGAATGTTATGCCG
->read4257_contig0_position5966_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGATTCGAGCCTAACAGCATGCCATCTAACGTTTGGACGGGTCTTGTGTTCCCTCAACACGTACGTTGACAGAGCTAACAATCCGTCGACTGAATGCGA
->read4258_contig0_position525_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGACGCATGTACTTACCTAACATGAAGCGGTAATGGAGCTCGAACACTAGTCGGTGGCTCTTCTGTCTCTGGCGGGGACGGCTATGTGAGTTCATAAATC
->read4259_contig0_position9189_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GATTCGAGAGACGAATGTAATTTAGTCAGGTCGGAACCGCTGGCAGAGCAGCTCCGAGGGCCTTTATACCCATACTGCCACTCCAGTACCTGGGCCGCGT
->read4260_contig0_position4414_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GATAAAGAAAACAATCTATATGGAACCGAGGGGCGGGATGATAATTGTTCTTAGTATAGTGACCGTTATGGACGACGGACATAACTACTGAGTGTCCGCC
->read4261_contig0_position8004_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGATTGTCATACTAGCTTTCAGTCATTCCCCCTCAGTTTTGTCCATGTGGAGAATATGCATTCGACCATATGAAAATGTCAATAATCTCGACCCTGTAG
->read4262_contig0_position5897_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AACTTCAACGGAAGTACTATAGCAGGTTCACCAGCATGAAAGACATCCTCATTGTGAACCCGGCATCTCGTGATTCGAGCCTAACAGCATGCCATCTAAC
->read4263_contig0_position1507_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCGAGGTATAAATTAGTGGATTCACTTCCCTTTGACATCTTGTTCTCACAACTGCACACTCCGATGCTCTGCCGAGCCTTCTAACCATCGAGTATGTAC
->read4264_contig0_position349_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AATGGCTTCATGCTCATGTTCTATACCGAGCAGAGAGGTTGGGTCTACCTAGTAGTGTCGCGGTTATCGGACAGAGGATTATGTAAGGTTACGGAAGACC
->read4265_contig0_position6877_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTTAGTCATAAGATGATACTTCATCTGCATGCGCGCATCTTCCTATTTTATGGTCTTAATTGAGTGTTCAGAGTTGGGGGTCACAGATGAGCGTTCCGA
->read4266_contig0_position9049_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTAGTACAGGGCCGCGCCCCATGAGGCCATATGCGCCTGTCACGGGCATGCTGAAAGCGGCGGTTACATTAATCGCTTCTGTGATGACAGACCGAAGCC
->read4267_contig0_position9188_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGATTCGAGATACGGATGTAATTTAGTCAGGTCGGAACCGCTGGCAGAGCAGCTCCGAGGGCCTTTATACCCATACTGCCACTCCAGTACCTGGGCCGCG
->read4268_contig0_position3899_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTATCTGCACGACTCTTAAAATCATGCACTAAGCATAGAATGCACGACTACTTGTTACTGAAGTCGGCATGACTATCAAACCTATTTAATGATATGTGCT
->read4269_contig0_position2382_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGCGGTGAGGGGTACCCGACGCCTCTGCTGTCAAAGTGGGAAATCCAGTCTCGACTATATCAACTATGTCATGCTTGTCGAATGAACAACTCAATTAGG
->read4270_contig0_position7001_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TATACCAAAGACTTCTAGACCGGAAAGACTACTTCCAGCCACGAATTCGTGTGATAACCGCCTAAACAGTCTAATCTGGCCAATATACCCTGGGGGGAGC
->read4271_contig0_position2554_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AATGCGGGAGTCAGGACGATAGAGCGAAGTAGTTACGGTGATTACCCGTCCATCGATGCCCCTCCTGTCCCGAAGCCTTAAAATCTAACCCTGAATTGGC
->read4272_contig0_position4300_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAATGATCCGTGTCCCCCGACCGTGTGCTGAGGAGACCCGTAATGCATGGAAAGTGCCAATATCCCCGGGAGTCCCGCACTACTGAGACGAAGTCTAGCT
->read4273_contig0_position4833_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCGCCGTTGGATGTGTCCCACAGTGTTTTATACGGGACGGTGGCCACGGGGTGAGCACATGAATGGGGTACGGTTTTACCGTCCATGACGTTGTGACAT
->read4274_contig0_position9044_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTCGTTTAGTACAGGGCCGCGCCCCATGAGGCCATATGCGCCTGTCACGGGCATGCTGAAAGCGGCGGTTACATTAATCGCTTCTGTGATGACAGACCG
->read4275_contig0_position2586_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTACGGTGATTACCCGTCCATCGATGCCCCTCCTGTCCCGAAGCCTTAAAATCTAACCCTGAATTGGCTTTATCCACCCCCCCTACTGGCCACCACTGGG
->read4276_contig0_position1609_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCACCTTTGGACGCTTCGATAGGACATGCACCCGGTCCGTTGACTTACCAACTTGATCGCCAGTGAGTGAGCGGTGGTTTATCTGTTGAGTGGCCACTTT
->read4277_contig0_position7056_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AACCGCCTAAACAGTCTAATCTGGCCAATATACCCTGGGGGGAGCTAATATATCGCGGCGTCGAGTTACCGTTGCACCACCTCCAAGTGTCCATCGGAGT
->read4278_contig0_position8171_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GATCCGCGGCCTTTTCCAGGGTAAAATGATGGACTAAATGACCAACCCCTATTATTAGGAGAGGGCTGCGACTGCTTGCAGCTCCGACCGCTTTCCAATC
->read4279_contig0_position7600_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GACTATCACGAGGAATTACGGATAACAGCCCACTTGGAGTGTGCTGAGGGCCGACGCCCGGGGACCGTGATATCCTTTCGAGTGGAATGCGAAAACGGCA
->read4280_contig0_position2471_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTCAATTAGGTAGTGTGCGCGAGGTAGAGTATGCAGATTTCGTACCTTGCCACTGCTACCTCCGGCATATGGGCGTGCTATAAATGCGGGAGTCAGGAC
->read4281_contig0_position8614_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTTTTGCGTAAGACACTGCCTAAAGGGAACATATGTGTCCAGAATAGGGTTCAACGGTGTATGAGCAAACGATGCGGTAAGACGAGCGCTCCGACCCCC
->read4282_contig0_position3754_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGGGAATAAATTCGACACGGGGTACGAAGGGTAAGAACACCTAGCCTGGCAATTACCCCTTTGTGATTCTAGTCAAGTGAAGAACCCGGGCCCAAAATT
->read4283_contig0_position8796_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAACACTTCATCTGTATGGCAAAGTTGCGACACCGCGCCACACAGCAGTTTATTGTTAACACGCGATACAAGAGGGTTAGGAGCTAAGAAACCGGTGCAT
->read4284_contig0_position3601_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TAAGATGTATCCATCCCTACCACATGCGTACGCCACCTCCGGGTCTAGTAAACCAGAGATTCCATGGACTCTCTGTTTCGTCGATTGTCTGAATATCGTG
->read4285_contig0_position8275_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CACAGGACTTGAGGCTCGGACTCGTATCTGTCTCCGTGTTCCTTTCGATAACACTGAGACCTGAATGACCTTGGGCTCGTCGACATTCCTGGTAGTAATC
->read4286_contig0_position8582_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCAGATTGTCTGTAACCGGAGCTTCGGGCGTATTTTTGCGTTAGACACTGCATAAAGGGAACATATGTGTCCAGAATAGGGTTCAACGGTGTATGAGCA
->read4287_contig0_position7474_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGAGAATACAAATGACTGGTACTCTGACGAGAGGGTGCTTGAACGAGAGAAGCTAACAGTCATTGCGATGAGGAGAACAGCCCTACTGCCCGCCGTGAA
->read4288_contig0_position8027_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCATTCCCCCTCATTTTTGTCCATGTGGAGAAGATGCATTCGACCAAATGAAAATGTCAATAATCTCGACCCTGTAGTCCGCGGCCAATCAGCACGATCA
->read4289_contig0_position104_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTCGCTAGCGCAATGCGCAAGATTTTGACATTTACAAGGCAACATTGCAGCGTCCGATGGTCCGGTGGCCTCCAGATAGTGTCCAGTCGCTCTAACTGT
->read4290_contig0_position4857_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTTTTATACGGGACGGTGGCCACGGGGTGAGCACATGAATGGGGTACGGTTTTACCGTCCATGACGTTGTGACATGAAGGTGCGGGACGCGGAAGCGCA
->read4291_contig0_position3243_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCAGGGCGGTTACACACCCTTAAGTACCTAACGATAGAGCACCCGTCTAGGAGGGCGTGCAGGGTCTCCCGCTAGCTAATGGTCACGGCCTCTCTGGGA
->read4292_contig0_position732_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGTTATTAACCGCGACGGTGTATTCCACGACCTAATTTTTCCCGTCCCTGTGGTCAACCTGGACGCACAAACCCTAGTCCCATATAAAGCTATTCCACG
->read4293_contig0_position2325_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTAGATACCTGCGGCTTCACCCCACAGTGTAAGAGTTGACGGGACTAAAACAGTATTGGGCGGTGAGGGGTACCCGACGCCTCTGCTGTCAAAGTGGGAA
->read4294_contig0_position6573_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GAACCCTCTAATACGACCTCTTGCCCATCCGAGGCTTAAGCAGCGACTCCACATGGAGCGATGGGTCCTCAAGGCAGTCTAAAATGGACTGCTATCTAGG
->read4295_contig0_position9084_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCTGTCACGGGCATGCTGAAAGCGGCGGTTACATTAATCGCTTCTGTGATGACAGACCGAAGCCCACCTGTCCTGACCTCACCGCAGGCATCGAGTCTA
->read4296_contig0_position8795_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGAACACTTCATCTGTATGGCAAAGTTGCGACACCGCGCCACACAGCAGTTTATTGTTAACACGCGATACAAGAGGGTTAGGAGCTAAGAAACCGGTGCA
->read4297_contig0_position1587_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTAACCATCGGGTATGTACATTCACCTTTGGACGCTTCGATAGGACATGCAGCCGGTCCGTTGACTTACCAACTTGATCGCCAGTGAGTGAGCGGTGGT
->read4298_contig0_position4442_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGGGTGGGATGATAATTGTTCTTAGTATAGTGACCGTTATGGACGACGGACATAACTACTGAGTGTCCGCCCTCGGCTAATCATGAACACCGGTCAGGC
->read4299_contig0_position1945_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTATATTTGTCCTAACTTAGCACTATCGCACCACAAAATTTCAGCATAAAGCATCCGGTTGAAGGCTGAGCATCGAGCAGCGTGCATTGGTCTTTCAGT
->read4300_contig0_position3569_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCGGTTATACGCCCTCGGGAGAAGACCCATGTAAGATGTATCCATCCCTACCACACGCGTCCGCCACCTCCGGGTCTAGTAAACCAGAGATTCGATGGA
->read4301_contig0_position3617_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTACCACACGCGTCCGCCACCTCCGGGTCTAGTAAACCAGAGATTCCATGGACTCTCTGTTTCGTCGATTGTCTGAATATCGTGCAGTAAGTTTCTCTTA
->read4302_contig0_position6861_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAACCATACATCTAACCCTTAGTCATAAGATGATACTTCATCTGCATGCGCGCATCTTCCTATTTTATGGTCTTAATTGAGTGTTCAGAGTTGGGGGTCA
->read4303_contig0_position6532_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTGCGTCCGGTAGACGAGCGATGGATTTAGACCGTTCACTGAACCCTCTAATAGGACCTCTTGCCCATTCGAGGCTTAAGCAGCGACTCCACATGGAGC
->read4304_contig0_position7951_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AACTACTCGACGAACAACAGCAAGATTCGACGATCAAACTCGCCGGCGACACGAAGATTGTCATACTAGCATTCAGTCATTCCCCCTCAGTTTTGTCCAT
->read4305_contig0_position2253_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTTCTGACGATTCGAGTGACCAGCGATAGTACGTACCTTTTGTACTGAGTCTTAACATCGGCAAATGCGCCCTAGATACCTGCGGCTTCACTCCACAGT
->read4306_contig0_position131_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GACATTTACGAGGCAACATTGCAGCGTCCGATGGTCCGGTGGCCTCCAGATAGTGTCCAGTCGCTCTAACTGTATGGAGACCATAGGCATTTACCTTATT
->read4307_contig0_position7450_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CAAAATTCTCAGCCCTTCGTTGAAAGGTGAATACAAATGACGGGAGCTCTGACGAGAGGGTGCTTGAACGAGAGAAGCTAACAGTCATTGCGATGACGAG
->read4308_contig0_position5849_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTAATAGAACGAAGTCCATATCACAGCTGATTTAAGAGGAAAACTTGAACATCAACGGAAGTACTATAGCAGGCTCACCAGCATGAAAGACATCCTCAA
->read4309_contig0_position152_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGCGTCCGATGGTCCGGTGGCCTCCAGATAGTGTCCAGTCGCTCTAACTGTATGGAGACCATAGGCATTTACCTTATTCTCATCGCCACGCCCCAAGAT
->read4310_contig0_position3910_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTCTTAAAATCATGCACTAAGCATAGAATGCACGACTACTTGTTACTGAAGTCGGCATGACTATCAAACCTATTTAATGATATATGCTCTTGGACAACA
->read4311_contig0_position2638_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CTAACCCTGAACTGGCTTTATCCACCCCCCCTAATGGCCACCACTGGGGCGCGAGTCTCGAGCCTCTCGACACCAAAGGGTCTGCCCGAGACAGGTTCAC
->read4312_contig0_position3205_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AATCTCTCATCTACTAAGCGCCCTAAAGGTCGTATGGTTGGAGGGCGGTTACACACCCTTAAGTACCGAACGATAGAGCACCCGTCTAGGAGGGCGTGCA
->read4313_contig0_position798_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CACAAACCCTAGTCCGATATAAAGCTATTCCACGCCGGGTGGCCTGGACGTCGTTTATGGATGGCTTTGGGAATCACTAGGTAATTATTGTTGGCTCCTT
->read4314_contig0_position2118_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGTCTATGCTACAGGTATTACGAAGTGAAACGGCTGCGAGCATCTCATAATCGGGCCACCCGATTTCAGCTTGGCCACAACAGAGACTAGCCACCAAGA
->read4315_contig0_position822_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTATTCCACGCCGGGTGGCCTGGACATCGTTTGTGGATGGCTTTGGGAATCACTAGGTAATTACTGTTGGCTCCTTTCTTCATGATCGTCGGAGTTCTTT
->read4316_contig0_position9756_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGTCGAGTCATATCGATGAACAGAGACTAAATGTCCTTAAATCTCTAACACGATTTTAGTAGGTCTACTACTAGGCCGCATGCTCAGAAATCGGAACAC
->read4317_contig0_position6985_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCCAGGCTACGGCCTTATACCAAAGGCTTCTAGACCGGAGAGACTACTTCCAGCCACGAATTCGTGTGATAACCGCCTAAACAGTCTAATCTGGCCAAT
->read4318_contig0_position7541_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GATGACGAGAACAGCCCTACTGCCCGCCGTGAACGAGAACAAGCGTGTGGAGAGTGACTGACTATCACGAGGAATTACGGATAACAGCCCACTTGGAGTG
->read4319_contig0_position1636_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCACCCGGTCCGTTGACTTACCAACTTGATCGCCAGTGAGTGAGCGGTGGTTTATCTGTTGAGTGGCCACTTTTCCCTATCTGCTGGGACGGCACTGGAG
->read4320_contig0_position4908_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTACCGTCCATGACGTTGTGACATAAAGGTGCGGGACGCGGTAGCGCACCTCGTATAACGTTAGGGGTATCGTCACTGCATAGCAGAATGGGCGATCGA
->read4321_contig0_position145_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AACATTGCAGCGTCCGATGGTCCGGTGGCCTCCAGATAGTGTCCAGTCGCTCTATCTGTATGGAGACCATAGGCATTTACCTTATCCTCATCGCCACGCC
->read4322_contig0_position7909_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCACTCTGTAGCTCTAATACCAATTGAAATGAAGCTTACGCAAACTACTCGACGAACAACAGCAAGATTCGACGATCAAACTCGCCGGCGACACGAAGAT
->read4323_contig0_position2123_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TATGCTACAGGTATTACGGAGTGAAACGGCTGCGAGCATCTCATAATCGGGCCACCCGATTTCAGCTTGGCCACTACAGAGACTAGCCACCAAGAGATGG
->read4324_contig0_position8587_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTGTCTGTAACCGGAGCTTCGGGCGTTTTTTTGCGTAAGACACTGCCTAAAGGGAACATATGTGTCCAGAATAGGGTTCAACGGTGTATGAGCAAACGA
->read4325_contig0_position8176_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGGCCTTTTCCAGGGTAAAATGATGGACTCATTGACCAACCCCTATTATTAGGAGAGGGCTGCGACTGCTTGCAGCTCCGACCGCTTTCCAATCGTTGC
->read4326_contig0_position9307_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TGAGAGCGTTTCTCCGTATCGTAATGTTCCGCTGTAAAGAACCTGGCGTATCCTGACCATGGAGCCGCAACACTTTCACACAGATAGCCGAACAGGTATT
->read4327_contig0_position6217_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTATAAAAAAGGGACGAGTGGGGTCAACAGTTCTTCTTCTTTCCTGTACGGTAATGCTTCCGCGCATCTAAGTGATATTCGCCGGAATTTACACTTCTA
->read4328_contig0_position5383_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCGTTCCACTTCAATCAGCAAGACGGGCGACCGTACCCGGACACTTGGCAGCGGGAACCGCTTTGACTTTGGAGTGCCAGCGATAGTATCTCAGAGGCG
->read4329_contig0_position945_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTAGGTCTATGCCAGACGATCGCAGCGGAGTCGATATAATTGCAGTATCATGTATCGCTGATTGTGGGGGGCATGGGGGTTCCGCATTGGCGCAAAGGT
->read4330_contig0_position9262_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTGCCACTTCAGTACCTGCGCCGCGTGTTGTACGCTGTGTATCTTGAGAGCGTTTCTCCGTATCGAAATGCTCCGCTGTAAAGAACCTGGCGTATCCTG
->read4331_contig0_position9132_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GATGACAGACCGAAGCCCACCTGTCCTGACCTCACCGCAGGCATCGAGTCTAACTCTGAATCGAGAGACGGATGTAATTTAGTCAGGTCGGGACCGCTGG
->read4332_contig0_position3559_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTAACTCTGCTCGGTTATACGCCCTCGGGAGAAGACCCATGTAAGATGTATCCATCCCTACCACACGCGTCCGCCACCTCCGGGTCTAGTAAACCAGAG
->read4333_contig0_position7682_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGAATGCGAAAACGGCATAAGCGCAATGACCGAGGTAACAAGCCATGAGGACTGGAGCGGTAATGTGGTAGTGTAGTTGCCGGCCCCTGTGCTGACCTT
->read4334_contig0_position4181_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TGAGGCGGGAACTTCCCGCTGATATGATTGTGATCGATATTCAGACTCTAAGAAGTGGTCAGTACAGGTTCGACCATACGCGAAGGCAAACAAAATCGCA
->read4335_contig0_position7894_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAACGTTGTGCCGTGTCACTCTGTAGCTCTAATACCAATTGAAATGAAGCTTACGCAAACTACTCGACGAACAACAGCAAGATTCGACGATCAAACTCAC
->read4336_contig0_position9347_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCTGGCGTATCCTGACCATGGAGCTGCAACACTTTCACACAGGTAGCCGAACAGGTATTACTCAGACTGGAGAGGAATCTTCATTGGTCGTGCAGACAT
->read4337_contig0_position9455_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGTACCAAAGTAACTGGACGCCCATACCCCTTTGTCTACAGAAGCTCATGGATAAGAGTGTGCGAATAACATCACTTGTTACTTCACGGAACGCTTCTTG
->read4338_contig0_position3521_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCACCCGAACCGCGCGTATTCTGCGACAGCATGAATCGTGTAACTCTGCTCGGTAATACGCCCTCGGGAGAAGACCCATGTAAGATGTATCCATCCCTAC
->read4339_contig0_position3443_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGTAGTACTGCCTGCCGTCGCCTCGCGCCCATAATGTTTGGAACTCGCAAACCTTTACACTCATCACATAGCAGGTTCCACCCGAACCGCGCGTATTCT
->read4340_contig0_position6313_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTAATATTGTGTGCAAGCTACTTCTAGACCTTATTAAGTGCCCAGGAATTCCTAGGAAGGCGCGCAGCTCAAGCAATCATACATGGCGGAATGCCTGTC
->read4341_contig0_position9320_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGTATCGAACTGTTCCGCTGTAAAGAACCTGGCGTATCCTGACCATGGAGCTGCAACACTTTCACACAGGTAGCCGAACAGGTATTACTCAGACTGGAG
->read4342_contig0_position9666_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGAAGGGGGAATCACCTTACTTAATCGGCTGGGGTAACGGCTGGTTTTGTACTACGGTATGGGAACCCGTTTGCCGAACGTCTGGAAATCTGTCGAGTC
->read4343_contig0_position3047_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCTATGACTAGCGGGTGTCGTCAATGAAAACTGATCGAGCACTGTCCGCGAAACATTATTCAGTACAGCGACTTTTACCCTCGTGGTCTGAGTGTTATG
->read4344_contig0_position4038_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGAGTGAGAGCAGCAGATGCACTCTTAGCTCCGCTGATAACGATTACTATAAACCAGCGAATCTAACATCAATCTGCACCACGAATATCGTCCAAGACG
->read4345_contig0_position4875_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCCACGGGGTGAGCACATGAATGGGGTACGGTTTTACCGTCCATGACGTTGTGACATAAAGGTGCGGGACGCGGAAGCGCACCTCGTATAACGTTTGGG
->read4346_contig0_position2186_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCTTGGCCACAACGGAGACTAGCCACCAAGAGATGGGTTGATGGTAGCATCCCGGCTTCTGGGGCAATTTCTGACGATTCGATTGACCAGCGATAGTAC
->read4347_contig0_position8184_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCCAGGGTAAAATGATGGACTCATTGACCAACCCCTATTATTAGGAGAGGGCTGCGACTGCTTGCAGCTCCGACCGCTTTCCAATCGTTGCACATGACT
->read4348_contig0_position8020_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTTCAGTCATTCCCCCTCAGTTTTGTCCATGTGGAGAATATGCATTCGACCAAATGAAAATGTCAATAATCTCGACCCTGTACTCCGCGGCCAATCAGC
->read4349_contig0_position1551_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTCACAACTGCACACTCCGATGCTCTGCCGAGCCTTCTAACCATCGGGTATGTACATTCACCTTTGGACGCTTCGATAGGACATGCACGCGGTCCGTTG
->read4350_contig0_position4287_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTATCCCCTTTATTAATGATCCGTGTCCCCCGACCGTGTGCTGAGGAGACCCGTAATGCATGGAAAGTGCCAATATCCCCGGGAGTCCCGCACTACTGAG
->read4351_contig0_position2751_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGGGATCCACGGCGTCTATTGTAAGAAATGCAATGCGTGGCCAGTTTGTTCCGGCAGGACACCACTCTTTGAAGGTGCCCATTGCATTGTAGCCTGAAC
->read4352_contig0_position9833_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCTTGCTCAGAAATCGGAACACAAGTACGCGATCTCTTTTCTAGTCACCAGCCTCTGGCATTCGCAAATTTCGTTCATGCACGCAACGGGTCGAATAAT
->read4353_contig0_position5357_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCCAGTACACCATATCAACAGCTTGATCGTTCCACTTCAATCAGCAAGACGGGCGACCGTACCCGGACACCTGGCAGCGGGAACCGCTTTGACTCTGGA
->read4354_contig0_position8848_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGTTAAGACGCGATACAAGAGGGTAAGGAGCTAAGAAACCGGTGCATCACCGTACGAAAAGGATGGTTGAAATAGAACGAGTTGTAAAACATTAGCTCA
->read4355_contig0_position6697_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGCGATTTGTTTTGGTAGTGGTTATCGCATTGCAAGAACGTACGGACGGACAAAATGTCGGACACCGCCTTATCGGCTATACTAGTTAGAGCCTCGCTT
->read4356_contig0_position7190_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTCAATGTCCGTCAATCGGGTTGGCCAAAAATTCTACCTGTCCACCTGTCCGTTAGAAGCAGATTATACGGAATACATATCCCGACACCGGCAGCTGAA
->read4357_contig0_position558_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGAGCTCGAACACTAGTCGGTGGCTCTTCTGTCTCTGGCGGGGACGGCTATGTGAGTTCATAAATCTCAATGTCGAAACTCCGATGGGCAGAAGCTAAA
->read4358_contig0_position1439_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CATCTCTATTGCTAGGTCTCTTAAGCCTAATCAGGATCATAGATGGCCAATTATTGACCACAGGTAGGGGCGAGGTATAAATTAGTGGATTCACGTCCCT
->read4359_contig0_position1474_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCATAGATGGCCAATTATTGACCACAGGTAGGGGCGAGGTATAAATTAGTGGATTCACTTCCCTTTGACATCTTGTTCTCACAACTGCACACTCCGATG
->read4360_contig0_position5308_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTACCCTGCAGACGTCCGCCTAAGATCCTAGTTGAATTGATCAATTGAGTCCAGTACACCATATCAACAGCTTGATCGTTCCACTTAAATCAGCAAGAC
->read4361_contig0_position2360_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGACGGGACTAAAACAGTATTGGGCGGTGAGGGGTACCCGACGCCTCTGCTGTCAAAGTGGGAAATCCAGTCTCGACTATATCTACTATGTCATGCTTG
->read4362_contig0_position3396_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGTTCATTCTCAAGGGTGTAGTTTTAGAGACTGAGAATTCACCCTATTGGTAGTACTGCCTGCCGTCGCCTCGCGCCCATAATGTTTGGAACTCGCAAAC
->read4363_contig0_position4060_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCTTAGCTCCGCTGATAACGATTACTATAAATCAGCGAATCTAACATCAATCTGCACCACGAATATCGTCCAAGACGTTTTGAGCCGGTGACTAATTCG
->read4364_contig0_position8282_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTGAGGCTCGGACTCGTATATGTCTCCGTGTTCCTTTCGATACCTCTGCGACCTGAATGACCTTGGGCTCGTCGACATTCCTGGTAGTAATCCGATCTC
->read4365_contig0_position9722_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTATGGGAACCCGTTTGCCGAACGTCTGTAAATCTGTCGAGTCATATCGATGAACAGAGACTAAATGTCCTTAAATCTCTAACACGATTTTAGTAGGTC
->read4366_contig0_position2414_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CAAAGTGGGAAATCCAGTCTCGACTATATCTACTATGTCATGCTTGTCGAATGAACAACTCAATTAGGTAGTGTGCGCGAGGTAGAGTATGCAGATTTCG
->read4367_contig0_position2812_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCACTCTTTGAAGGTGCCCATTGCATTGTAGCCTGAACTATTAGCAATCCTAAGCCCATAAGCCCTGCCCCACGGGGGCTACAATCCAGCAGTGAACGC
->read4368_contig0_position8092_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGACCCTGTAGTCCGCGGCCAATCAGCACGATCAAGCTAAAGACAGGGATTATGCACTAGCACGACCGCCGCAGGAAAGATCCGAGGCCTTTTCCTGGG
->read4369_contig0_position4056_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCACTCTTAGCTCCGCTGATAACGATTACTATAAATCAGCGAATCTAACATCAATCTGCACCACGAATATCGTCCAAGACGTTTTGAGCCGGTGACTAA
->read4370_contig0_position9305_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTGAGAGCGTTTCTCCGTATCGAAATGTTCCGCTGTAAAGAACCTGGCGTATCCTGACCATGGAGCTGCAACACTTTCACACAGTTAGCCGAACAGGTA
->read4371_contig0_position5991_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTAACGTTTGGACGGGTCTTGTGTTCCCTCAACACGTACGTTGACAGAGCTACCAATCCGTCGACTGAATGTGATTCCTTTGTTATTTCACACTATTGT
->read4372_contig0_position715_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-AGAAGCACCCACGATCAATGTTATTAACCGCGACGGTGTATTCCACGACCTAATATTTCCCGTCTCTATGGTCAACCTGGACGCACAAACCCTCTTCCCA
->read4373_contig0_position7202_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCAATCGGGTTGGCCAAAAATTCTACTTGTCCACCTGTCCGCTAGAAGCAGATTATACGGAATACATATCCCGACACCGGCAGCTGAAATGATGCAGAAG
->read4374_contig0_position7526_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTAACAGTCATTGCGATGACGAGAACAGCCCTACTGCCCGCCGTGAACGAGAATAAGCGTGTGGAGAGTGACTGACTATCACGAGGAATTACGGATAAC
->read4375_contig0_position3129_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGTGGTCTGAATGTTATGCCGTCCGACTCTTGCGCTCGGATGTCCGCAATGGGTTATCAAATGCCTATGTTCCGGTAATCTCTCATCTACTAAGCGCCCC
->read4376_contig0_position1442_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCTATTGCTAGGTCTCTTAAGCCTAATCAGGATCATAGATGGCCAATTATTGACGACAGGTAGGGGCGTGGTATAAATTAGTGGATTCACTTCCCTTTG
->read4377_contig0_position5243_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGCGCAGGGTGGTATATATGATCCTTGATAGCTTTATGGCCATCATCATAGTAAATTTTTTCAGATTACCCTGCAGACGTCCGCCTAAGATCCTAGTTG
->read4378_contig0_position7253_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTATACGGAATACATATCCCGACACCGGCAGCTGAAATGATGCAGAAGCCTTGCTTGCCACTCCGCCGATGTCTAAAAGCGCAAGATCGACTTGACTCT
->read4379_contig0_position7260_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAATACATATCCCGACACCGGCAGCTTAAATGATGCAGAAGCCTTGCTTGCCACTCCGCCGATGTCTAAAAGCGCCAGATCGACTTGACTCTTCGTGCT
->read4380_contig0_position1200_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CACTCTATGGGTCATCTTGAGCGAATAGTCGACTAGTAGCAAATATATGTTCTGCTCCGAGACTTCGGCATAAATCTAAGTATGGACTCTTATATTCCCT
->read4381_contig0_position2367_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GACGAAAACAGTATTGGGCGGTGAGGGGTACCCGACGCCTCTGCTGTCAAAGTGGGAAATCCAGTCTTGACTATATCTACTATATCATGCTTGTCGAATG
->read4382_contig0_position5467_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGTATCTCAGAGGCGAAAGCGCTTGTCACCTCATCTAAAATCGCGACTATAGATCTGTTTAGAACCACGACCCACAAATCTTTAGCTAAGTAATCGACT
->read4383_contig0_position5954_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCCGGCATCTCGTGATTCGAGCCTAATAGCATGCCATCTAACGTTTGGACGGGTCTTGTGTTCCCTCAACACGTACGTTGACAGAGCTAACAATCCGTC
->read4384_contig0_position4168_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ACATAGTGTACGTTGAGGCGGGAACTTCCCGCTGATATGATTGTGATCTAAATTCAGACTCTAACAAGTGGTCAGTACAGGTTCGACCATACGCGACGGC
->read4385_contig0_position8176_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGGCCTTTTCCAGGGTAAAATGATGGACTCATTGACCAACCCCTATTATTAGGAGAGGGCTGCGACTGCTTGCAGCTCCGACCGCTTTCCAATCGTTGC
->read4386_contig0_position3244_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAGGGCGGTTACACACCCTTAAGTACCGAACGATAGAGCACCCGTCTAGGAGGGCGTGCAGGTTCTCCCGCTAGCTAATGGTCACGGCCTCTCTGGGAA
->read4387_contig0_position6926_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TATGGTCTTAATTGAGTGTTCAGAGTTGGGGGTCACAGATGAGCGTTCCGATTGTCCTTTCCCAGGCTACGGCCTTATACCAAAGACTTCTAGACCGGAG
->read4388_contig0_position9436_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGTGCAGACATTGTCGCTGCGTACCAAAGTAACTGGACGCCCATACCCCTTTGTCTACAGAAGCTCATGGATAAGAGTGTGCGAGTAACATCACTTCTTA
->read4389_contig0_position5393_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCAATCAGCAAGACGGGCGACCGTACCCGGACACCTGGCAGCGGGAACCGCTTTGACTCTGGAGTGCCAGCGATAGTATCTCAGAGGCGAAAGCGCTTG
->read4390_contig0_position7064_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAACAGTCTAATCTGGCCAATATACCCTGGGGGGAGCTAATATATCGCGGCGTCGAGTTACCGTTGCACCACCTCCAAGTGTCCATCGGAGTCCGCTTCC
->read4391_contig0_position2149_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGCTGCGATCATCTCATAGTCGGGCCACCCGATTTCAGCTTGGCCACAACAGAGACTAGCCACCAAGAGATGGGTTGATGGTAGCATCCCGGCTTCTGG
->read4392_contig0_position3525_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGAACCGCGCGTATTCTGCGACAGCATGAATCGTGTAACTCTGCTCGGTCATACGCCCTCGGGAGAAGACCCATGTAAGATGTATCCATCCCTACCACA
->read4393_contig0_position5852_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AATAGAACGAAGTCCATATAACAGCTGATTTAAGAGGAAAAATTGAACATCAACGGAAGTACTATAGCAGGCTCACCAGCATGAAAGACATCCTCATTGT
->read4394_contig0_position909_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCGGAGTTCTTTCAGGCCGATCAAGTGGTTAGAGACCTAGGTCTATGCCAGACGATCGCAGCGGAGTCGATATAATTGCAGTATCATGTATCGCTGATT
->read4395_contig0_position2703_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCGACTCCAAAGGGTCTGCCCGAGACAGGTTCACCGAGTCGTTACTCCCGGGATCCACTGCGTCTATTGTAAGAAATGCAATGCGTGGCCAGTTTGTTC
->read4396_contig0_position6248_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCTTCTTCTTTCCTGTACGGTAATGCTTCCGCGCATCTAAGTGATATTCGCCGAAATTTACCCTTCTAATATTGTGTGCAAGCTACTTCTAGACCTTAT
->read4397_contig0_position4750_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGAATTAGAGCCAAAGCAGTAGGTTACCGTCGGCGCATAACCGGCGAGTGCTCTGAAACGTTACATTCGTCTATCCGCACACACCGCCGTTGGATGTGT
->read4398_contig0_position7767_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCTGTGCTGACCTTATGTCCATATCGATACACGAAGGCCAGTGCTGAAGCGGAGCCACACTCGCCGTTACTGACTGATTGACAATCCAGCCCGTTTGGG
->read4399_contig0_position4652_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGCTTGTGCATTCGTCGGCCTATTAGATACGGTACGGAATATTGGGTAACCTCCTCTTCACTGATATCATCCTATCGACGTTCAAAGTATTCGGCGGAT
->read4400_contig0_position220_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTACCTTATTCTCATCGCCACGCCCCAAGATCTTTAGGACCCAGCATTCCTTTAACCACTAACATAACGCGTGTCATCTAGTTCTAGCATACTCCGCCT
->read4401_contig0_position2439_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATATCTACTATGTCATGCTTGTCGAATGAACAACTAAATTAGGTAGTGTGCGCGAGGTAGAGTATGCAGATTTCGTACCTTGCCACTGCTACCTCCGGCA
->read4402_contig0_position3925_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CACTAAGCATAGAATGCACGACTACTTGTTACTGAAGTCGGCATGACTATCAAACCTATTTAATGATATATGCTCTTGGACAACACGAGGTCGTAATTAT
->read4403_contig0_position543_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AACATGAAGCGGTAATGGAGCTCGAACACTAGTCGGTGGCTCTTCTGTCTCTGGCGGGGACGGCTATGTGAGTTCATAAATCTCAATGTCGAAACTCCGA
->read4404_contig0_position7527_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTAACAGTCATTGCGATGACGAGAACAGCCCTACTGCCCGCCGTGAACGAGAACAAGCGTGTGGAGAGTGACTGACTATCACGAGGAATTACGGATAACA
->read4405_contig0_position8608_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGCGTATTTTTGCGTAAGACACTGCCTATAGGGAACATATGAGTCCAGAATAGGGTTCAACGGTGTATGAGCAAACGATGCGGTAAGACGAGCGCTCCG
->read4406_contig0_position4357_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CAATATCCCCGGGAGTCCCGCACTACTGAGACGAAGTCTAGCTAGCTTGACTCGGCTGATAAAGAAAACAATCTATATGGAACCGAGGGGCGGGATGATA
->read4407_contig0_position5370_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TATCAACAGCTTGATCGTTCCACTTCAATCAGCAAGACGGGCGACCGTACCCGGACACCTGGCAGCGGGAACCGCTTTGACTCTGGAGTGCCAGCGATAG
->read4408_contig0_position3928_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAAGCATAGAATGCACGACTACTTGTTACTGAAGTCGGCATGACTATAAAACCTATTTAATGATATATGCTCTTGGACAACACGAGGTCGTAATTATTTC
->read4409_contig0_position909_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCGGAGTTCTTTCAGGCCGATCAAGTGGTTAGAGACCTAGGTCTATGCCAGACGATCGCAGCGGAGTCGATATAATTGTAGTATCATGTATCGCTGATT
->read4410_contig0_position5163_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTCTCGGCCAATTCGTTGTATTGATCGCTGTGTACTTTAAAATTCGGAACATCTTAACCAAAGCATATTAATATGCCAGCCGCGCAGGGTGGTATATAT
->read4411_contig0_position2782_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAATGCGTGGCCAGTTTGTTCCGGCAGGACACCACTCTTTAAAGGTGCCCATTGCATTGTAGCCTGAACTATTAGCAATCCTAAGCCCATAAGCCCTGCC
->read4412_contig0_position2419_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGGAAATCCAGTCTCGACTATATCTACTATGTCATGCTTGTCGAATGAACAACTCAAATAGGTAGTGTGCGCGAGGTAGAGTATGCAGATTTCGTACCT
->read4413_contig0_position1418_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGACATTTCGCAGCGCCCTTTCATCTCTATTGCTAGGTCTCTTAAGCCTAATCAGGATCATAGATGGCCAATTATTGACCACAGGTAGGCGCGAGGTATA
->read4414_contig0_position8332_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GACCTGAATGACCTTGGGTTCGTCGACATTCCTGGTAGTAATCCGATCTCAATTCCTGCGGTACCGAGCAGCTTTGAGTTGTTGTAAGTCCCACGGTTAA
->read4415_contig0_position9592_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AACACTCGAATGAGCAGTGGTCATGTCATTATTGTACATCAGTACCATAGCTTGGCCACATGCGATGCTCGTACTCGAAGGGGGAATCACCTTACTTAAT
->read4416_contig0_position1607_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTCACCTTTGGACGCTTCGATAGGACATGCACCCGGTCCGTTGACTTACCAACTTGATCGCCAGTGAGTGAGCGGTGGTTTATCTCTTGAGTGGCCACT
->read4417_contig0_position1824_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTAGCCGGCCCACAAATCGACGTGTGTATTTGTTCAATGGCAGGAGGTTAACTTTGCGGAGCTCAACCTATAACGATAATCAAATTGAGACAGACGAGT
->read4418_contig0_position8574_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAATACTACTCAGATTGTCTGTAACCGGAGCTTCGGGCGTATTTTTGCGTAAGACACTGCCTAAAGGGAACATATGTGTCCAGAATAGGGTTCAACGGTG
->read4419_contig0_position6629_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCGAAGGGTCCTCAAGGCAGTATAAAATGGACTGCTATCTAGGCGTTAAATTAGTAGAACGAGGGTCGGGCGATTTGTTTTGGTAGTGGTTATCGCATT
->read4420_contig0_position8162_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CACAGGAAAGATCCGAGGCCTTTTCCAGGGTAAAATGATGGACTCATTGACCAACCCCTATTATTAGGAGAGGGCTGCGACTGCGTGCAGCTCCGACCGC
->read4421_contig0_position3323_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGTCACGGCCTCTCTGGGAAAGTTGAACAACGGATGGGATTAAGCTCAGCAGTCCGCCTCCAATCTCTCCGACGTTCATTCTCAAGGGTGTAGTTTTAG
->read4422_contig0_position8436_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CCACTTATTTCGACAGTCATGGCGCCGATATCCTGCTTAGGCAGTACGGCCAATGCACGACCCTATATGACCCCTAGCAAGAAGTTATAGTCTAATAATG
->read4423_contig0_position2102_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGCATGTGTACGCAGCGGTCTATGCTACAGGTGTTACGGAGTGAAACGGCTGCGAGCATCTCATAATCGGGCCACCCGATTTCAGCTTGGCAACAACAG
->read4424_contig0_position9843_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAAATCGGAACACAAGTACGCGATCTCTTTTCTAGTCACCAGCCTCAGGCATTCGCAAATTTCGTTCATGCACGCAACGGGTCGAATAATATGCCGATGT
->read4425_contig0_position8434_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCCACTTATTTCGACATTCATGGCGCCGATATCCTGCTTAGGCAGTACGGCCAATGCACGACCCTATATGACCCCTAGCGAGAAGTTATAGTCTAATAA
->read4426_contig0_position5339_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTGAATTGTTCAATTGAGACCAGTACACCATATCAACAGCTTGATCGTTCCACTTCAATCAGCAAGACGGGCGACCGTACCCGGACACCTGGCAGCGGG
->read4427_contig0_position8241_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTGCTTGCAGCTCCGACCGCTTTCCAATCGTTGCACATGACTTGAGGCTCGGACTCGTATCTGTCTCCGTGTTCCTTTCGATAACTCTGAGACCTGAAT
->read4428_contig0_position6159_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCATAAGGCACGCGCGGGCCATAACAGTCGACTAAAAGACGTAACCGATTCTGCTACGTTATAAAAAAGGGACAAGTGGGGTCTACAGTTCTTCTTCTT
->read4429_contig0_position1225_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGTGGACTAGTAGCGAATATATGTTCTGCTCCGAGACTTCGGCATAAATCTAAGTATGGACTCTTATATTCCCTCCTGCGTAGTGCTCTCCCATAATAA
->read4430_contig0_position490_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTCTGCTACGCCTCGATTGGTTTCAGCTCACGTGGGACGCATGTACTTACCTAACATGAAGCGGTAATGGAGCTCGAACACTAGTCGGTGGCTCTTCTG
->read4431_contig0_position446_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCGGGTAGCGTAGTTAGTAACTTCAATCCGCGTTACGCTTTGTCCTCTGCTACGCCTCGATTGGTTTCAGCTCACGTGGGACGCATGTACTTACCTAAC
->read4432_contig0_position8087_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAATCTCGACCCTGTAGTCCGCGGCCAATCAGCACGATCAAGCTAAAGACAGGGATTATGCACTAGCACGACCGCCGCAGGAAAGATCCGAGGCCTTTTC
->read4433_contig0_position8392_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTACCGAGCAGCTTTGAGTTTTTGTAAGTCCCACGGTTAATGGGCCACTAATTTCGACATTCATGGCGCCGATATCCTGCTTAGGCAGTACGGCCAATGC
->read4434_contig0_position7811_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGAAGCGGAGCCACACTCGCCGTTACTGACTGATTGACAATCCAGCCCGTTTGGGGTGATTTGTGCCGGCGCGTCCAGGTGCGAACGTTGTGCCGTGTC
->read4435_contig0_position2809_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GACACCACTCTTTGAAGGTGCCCATTGCATTGTAGCCTGAACTCTTAGCAATCCTAAGCCCATAAGCCCTGCCCCACGGGGGCTACAATCCAGCAGTGAA
->read4436_contig0_position6231_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGAGTGGGGTCAACAGATCTTCTTCTTTCCTGTACGGTAATGCTTCCGCGCATCTAAGTGATATTCGCCGGAATTTACCCTTCTAATATTGTGTGCAAG
->read4437_contig0_position8565_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGCCATATTAATTCTACTCAGATTGTCTGTAACCGGAGCTTCGGGCTTATTTTTGCGTAAGACACTACCTAAAGGGAACATATGTGTCCAGAATAGGGT
->read4438_contig0_position4909_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTACCGTCCATGACGTTGTGACATAAAGGTGCGGGACCCGGAAGCGCACCTCGTATAACGTTAGGGGTATCGTCCCTGCATAGCAGAATGGGCGATCGGC
->read4439_contig0_position6028_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TACGTTGACAGAGCTAACAATCCGTCGACTGAATGTGATTCCTTTGTTATTTCACACTATTGTTCGGTGCGTGCGCTGCTCAGGCTGGTGCGACCCTTAC
->read4440_contig0_position4431_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATATGGAACCGAGGGGCGGGATGATAATTGTTCTTAGTATAGTGACCGTTATGGACGACGGACATAACTACTGAGTGACCGCCCTCGGCTAATCATGAAC
->read4441_contig0_position7434_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCATACACCGGGTAGACAACATTCTCAGCCCTTCGTTGAAAGGAGAATACAAATGACGGGAACTCTGACGAGAGGGTGCTTGAACGAGAGAAGCTAACAG
->read4442_contig0_position2674_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCACCACTGGGGCGCGAGTCTCGAGCCTCTCGACTCCAAACGGTCTGCCCGAGACAGGTTCACCGAGTCGTTACTCCCGGGATCCACTGCGTCTATTGT
->read4443_contig0_position4742_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCGGCGGATGAATTAGAGCCAAAGCAGTAGGTTACCGTCGGCGCATAACCGGCGAGTGCTCTGAAACGTTACATTCGTCTATCCGCACACACCGCCGTT
->read4444_contig0_position9274_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTACCTGGGCCGCGTGTTGTACGCTGTGTATCTTGAGAGCGTTTCTCGGTATCGAAATGTTCCGCTGTAAAGAACCTGGCCTATCCTGACCATGGAGCTG
->read4445_contig0_position9491_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TACAGAAGCTCATGGATAAGAGTGTGCGAATAACATCACTTGTTACTTCACGGAACGCTTCTTGATCCTGAGCTCCCCCGCGATTAACCTATGTCGGGAC
->read4446_contig0_position3693_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATATCGTGCAGTAAGTTTCTCTTAGGTTCCTCAACGGAAACTTCTCAGACCCACCTTAGACGCGGGAATAAATTCGACACGGGGTACGAAGGGTAAGAAC
->read4447_contig0_position618_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATAAATCTCAATGTCGAAACTCCGGTGGGCAGAAGCTAAAACTGAACAACGAGTGGGACACCGGCCTACTACATTATACAGTAAGGTAGAATCGCGTAGA
->read4448_contig0_position1552_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCACAACTGCACACTCCGATGCTCTGCCGAGCCTTCTAACCATCGGGTATGTACATTCACCTTTGGACGCTTCGGTAGGACATGCACCCGGTCCGTTGA
->read4449_contig0_position8080_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGTCAATAATCTCGACCCTGTAGTCCGCGGCCAATCAGCACGATCAAGCTAAAGACAGGGATTATGCACTAGCACGACCGCCGCAGGAAAGATCCGAGG
->read4450_contig0_position9358_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTGACCATGGAGCTGCAACACTTTCACACAGGTAGCCGAACAGGTATTACTCAGACTGGAGAGGAATCTTCATTGGTCGTGCAGACATGGTCGCTGCGT
->read4451_contig0_position3713_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTAGGTTCCTCAACGGAAACGTCTCAGACCCACCTTAGACGCGGGAATAAAGTCGACACGGGGTACGAAGGGTAAGAACACCTAGCCTGGCAATTACCC
->read4452_contig0_position8711_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCCTTGGCTCTGCTACATCGAATTCAGCGTGTAAGAGCCCGCTTATCCGGTGGTGATACCTACTATTGACTGGGGGCTTACTGAGAACACTTCATCTTT
->read4453_contig0_position795_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGCACAAACCCTAGTCCCATATAAAGCTATTCCACGCCGGGTGGCCTGGACGTCGTTTGTGGATGGCTTTGGGAATCACTAGGTAATTACTGTTGGCTC
->read4454_contig0_position9063_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGCCCCATGAGGCCATATGCGCCTGTCACGGGCATGCTGAAAGCGGCGGTTACATTAATCGCTTCTGTGATGACAGACCGAAGCCCACCTGTCTTGACC
->read4455_contig0_position3544_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGACAGCATGAATCGTGTAACTCTGCTCGGTTATACGCCCTCGGGAGAAGACCCATGTAAGATGTATCCATCCCTACCACACGCGTCCGCCACCTCCGGG
->read4456_contig0_position6410_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGCACCGGGGGTTCTACTGTACCACAGTGGCCTGGATAGCTAAGCAGGTCCTGGATTGGCATGTCATCCGGAGTGATAGGCACTGCTCACGACCAGCTT
->read4457_contig0_position2858_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AATCCTAAGCCCATAAGCCCTGCCCCACGGGGGCTACAATCCAGCAGTGAACGCGTTTACCTTAAGACGAAAGAGTCAATAGAGTGGGGGTTCGTGCTTT
->read4458_contig0_position1323_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGTGAACCCATGGGTCGCGCTGTATTTTTGTACTGCTTGATGTCAGGGTCAGTTTGGGCGCCTGTATGTCTGTGTAAGGTTGGGCCAATCGAGAGGACA
->read4459_contig0_position4423_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AACAATCTATATGTAACCGAGGGGCGGGATGATAATTGTTCTTAGTATAGTGACCGTTATGGACGACGGACATAACTACTGACTGTCCGCCCTCGGCTAA
->read4460_contig0_position8035_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTCAGTTTTGTCCATGTGGAGAATATGCATTCGACCAAATGAAAATGTCAATAATCTCAACCCTGTAGTCCGCGGCCAATCAGCACGATCAAGCTAAAG
->read4461_contig0_position8476_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GCAGTACGGCCTATGCACGACCCTATAGGACCCCTAGCGAGAAGTTATAGTCTAATAATGAATGGTGAACAGCACATCTTTTCGTCCTGAGGCCATATTA
->read4462_contig0_position3704_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GAAGTTTCTCTTAGGTTCCTCAACGGAAACGTCTCAGACCCACCTTAGACGCGGGAATAAATTCGACACAGGGTACGAAGGGTAAGAACTCCTAGCCTGG
->read4463_contig0_position2422_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAAATCCAGTCTCGACTATATCTACTATGTCATGCTTGTCGAATGAACAACTCAATTAGGTAGTGTGCGCGAGGTAGAGTATGCAGATTTCGTACCTTGC
->read4464_contig0_position2712_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAAGGGTCTGCCCGAGACAGGTTCACCGAGTCGTTACTCCCGGGATCCACTGCGTCTATTGTAAGAAATGCAATGCGTGGCCAGTTTGTTCCGGCAGGAC
->read4465_contig0_position8753_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTATCCGGTGGTGATACCTACTATTGACTGGGGGCTTACTGAGAACACGTCATCTGTATGGCAAAGTTGCGACACCGCGCCACACAGCAGTTTATTGTT
->read4466_contig0_position9056_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGGGCCGCGCCCCATGAGACAATATGCGCCTGTCACGGGCATGCTGAAAGCGGCGGTTACATTAATCGCTTCTCTGATGACAGACCGAAGTCCACCTGT
->read4467_contig0_position9559_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGAGCTCCCCCGCGATTAACCTATGTCGGGACAAACACTCGATTGAGCAGTGGTCATGTCATTATTGTACATCAGTACCATAGCTTGGCCACATGTTATG
->read4468_contig0_position9727_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGAACCCGTTTGCCGAAGGTCTGGAAATCTGTCGAGTCATATCGATGAACAGAGACTAAATGTCCTTAAATCTCTAACACGATTTTAGTAGGTCTACTA
->read4469_contig0_position6741_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGACGGACAAAATGTCGGACACCGCCTTATCGGCTATAATAGTTAGAGCCTCGCTTTGGTCTCTACATCCGCTGATACGCGCGAGCTCTCACCCACGACT
->read4470_contig0_position8863_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ACAAGAGGGTTAGGAGCTAAGAAACCGGTGCATCACCGTACGAAAAGGATGGTTGAAATAGAACGAGTTGAAAAACATTAGCTCACGCGCCACCGCCATA
->read4471_contig0_position6913_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CATCTTCCTATTTTATGGTCTTAATTGAGTGTTCAGAGTTGGGGGTCACAGATGAGCGTTCCGATTGTCATTTCCCAGGCTACGGCCTTATACCAAATAC
->read4472_contig0_position5904_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGGAAGTACTATAGCAGGCTCACCAGCATGAAAGACATTCTCATTGTGAACCCGGCATCTCGTGATTCGAGCCTAACAGCATGCCATCTAACGTTTGGA
->read4473_contig0_position468_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCAATCCGGGTTACGCTTTGTCCTCTGCTACGCCTCGATTGGTTTCAGCTCACGTGGGACGCATGTACTTACCTAACATGAAGCGGTAATGGAGCTCGA
->read4474_contig0_position6510_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGGACAAACGGGGTGCCCGCGCCTGCGTCCGGTAGACGAGCGATGGATTTAGACCGTTCACTGAACCCTCTAATAGGACCTCTTGCCCATCCGAGGCTT
->read4475_contig0_position9521_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAACATCACTTGTTACTTCCCGGAACGCTTCTTGATCCTGAGCTCCCCCGCGATTAACCTATGTCGGGACAAACACTCGATTGAGCAGTGGTCATGTCAT
->read4476_contig0_position8021_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTCAGTCATTCCCCCTCAGATTTGTCCATGTGGAGTATATGCATTCGACCAAATGATAATGGCAATAATCTCGACCCTGTAGTCCGCGGCCAATCAGCA
->read4477_contig0_position6295_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCGCCGGAATTTACCCTTCTAATATTGTGTGCAAGCTACTTCAAGACCTTATTAAGTGCCCAGGAATTCCTAGGAAGGCGCGCAGCTCAAGCAATCATA
->read4478_contig0_position1602_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTACATTCACCTTTGGACGCTTCGATAGGACATGCACCCGGTCCGTTGACTTACCAACTTGATCGCCAGTGAGTGAGCGGTGGTTTATCTGTTGAGTGG
->read4479_contig0_position8431_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGGGCCACTTATTTCGACATTCATGGCGCCGATATCCTGCTTAGGCAGTACGGCCAATGCACGACCCTATATGACCCCTAGCGAGAAGTTATAGTCTAA
->read4480_contig0_position6452_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGCAGGTCCTGGATTGGCATGTCATCCGGAGTGAAAGGCACTGCTCACGACCAGCTTGCGGACAAACGGGGTGCCCGCGCCTGCGTCCGGTAGACGAGC
->read4481_contig0_position8353_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCGACATTCCTGGTAGTAATCCGATCTCAATTCCTGCGGTACCGAGCAGCTTTGAGTTTTTTTAAGTCCCACGGTTAATGGGCCACTTATTTCCACATT
->read4482_contig0_position3478_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTTTGGAACTCGCAAACCTTTACACTCATCACATAGCAGGTTCCACCCGAACCGCGCGTATTCTGCGACAGCATGAATCGTGTAACTCTGCTCGGTTAT
->read4483_contig0_position4553_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGCGACGGCATTGGCGATTATGGGCGTGCATAGAGTCCCGCAGTGTCGGAGCGATAGGGAGGACGTAAACGCCAATTCCGCTTAATAGCGGAATCTGCT
->read4484_contig0_position2482_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGTGTGCGCGAGGTAGAGTATGCATATTTCGTACCTTGCCACTGCTACCTCCGGCATATGGGCGTGCTATAAATGCGGGAGTCAGGACGATAGAGCGAA
->read4485_contig0_position4564_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGGCGATTATGGGCGTGCATAGAGTCCCGCAGTGTCGGAGCGATAGGGAGGACGTAAACGCCAATTCCGCTTAATAGCGGAATCTGCTGGCTTGTGCAT
->read4486_contig0_position958_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGACGATCGCAGCGGAGTCGATATGATTGCAGTATCATGTATCGCTGATTGTGGGGGGCATGGGGGTTCCGCATTGGCGCAAAGGCACCGCAAAGGGCC
->read4487_contig0_position3707_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTTCTCTTAGGTTCCTCAACGGAAACGTCTCAGACCCACCTTAGACGCGGGAATAAATTCGACACGGGGTACGAAGGGTAAGAACACCTAGCCTGGCAA
->read4488_contig0_position9546_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCTTCTTGATCCTGAGCTCCCCCGCGATTAACCTATGTCGGGACAAACACTCGATTGAGCAGTCGTCATGTCATTATTGTACATCAGTACCCTAGCTTG
->read4489_contig0_position5679_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTTATGAAATTAGCGCGTTAACTACTTAAAGTTCAGAAGATCACTGTCCGCATCGAACCACTACAATAAGATTACGGATAGCCCGTGGCTTGGTTGTTT
->read4490_contig0_position1073_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGCGTTATTACCGGTCAGCTCCAGTTACGTCACGGACATAGAGAGCCTTTGAATGTGTACGGCAATAGGAGAAACTCGGCCACGTACGTGTCAACATGG
->read4491_contig0_position4435_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAACCGAGGGGCGGGATGATAATTGTTCTTAGTATAGTGACCGTTATGGACGACGGACAGAACTACTGAGTGTCCGCCCTCGGCTAATCATGAACACCG
->read4492_contig0_position3618_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TACCACACGCGTCCGCCACCTCCGGGTCTAGTAAACCAGAGATTCCATGGACTCTCTGTTTCGTCGATAGTCTGAATAGCGTGCAGTAAGTTTCTCTTAG
->read4493_contig0_position4317_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGACCGTGTGCTTAGGAGACCCGTAATGCATGGAAAGTGCCAATATCCCCGGGAGTCCCGCACTACTGAGACGAAGTCTAGCTATCTTGACTCGGCTGAT
->read4494_contig0_position2468_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACAACTCAATTAGGTAGTGTGCGCGAGGTAGAGTATGCAGATTTCGTACCTTGCCAGTGCTACCTCCGGCATATGGGCGTGCTATAAATGCGGGAGTCAG
->read4495_contig0_position7683_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAATGCGAAAACGGCATAAGCGCAATGACCGAGGTAACAAGCCATGAGGACTGGAGCGGTAATGTGGGAGTGTAGTTGCCGGCCCCTGTGCTGACCTTA
->read4496_contig0_position9134_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTACAGACCGAAGCCCACCTGTCCTGACCTCACCGCAGGCATCGAGTCTAACTCTGATTCGAGAGACGGATGTAATTTAGTCAGGTCGGAACCGCTGGCA
->read4497_contig0_position3692_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AATATCGTGCAGTAAGTTTCTCTTAGGTTCCTCAATGGAAACGTCTCAGACCCACCTTAGACGCAGGAATAAATTCGACACGGGGTACGAAGGGTAAGAA
->read4498_contig0_position1225_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGTCGACTAGTAGGGAATATATGTTCTGCTCCGAGACTTCGGCATAAATCTAAGTATGGACTCTTATATTCCCTCCTGCGTAGTGCTCTCCCATAATAA
->read4499_contig0_position3422_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGACTGAGAACTCACCCTATTGGTAGTACTGCCTGCCGTCGCCTCGCGCCCATAATGTTTGGAACTCGCAAACCTTTACACTCATCACATAGCAGGTTC
->read4500_contig0_position8235_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTGCGACTGCTTGCATCTCCGACCGCTTTCCAATCGTTGCAGATGACTTGAGGCTCGGACTCGTATCTTTCTCCGTGTTCCTTTCGATAACTCTGCGAC
->read4501_contig0_position1287_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTTATATTCCCTCCTGCGTAGTGCTCTCCCATAATAAGTGAACGCATGGGTCGCGCTGTATTTTTGTACGACTTGATGTCAGAGTCAGTTTGGGCGCCG
->read4502_contig0_position6676_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-TAAAGTAGTAGAACGAGGGTCGGGCGATTTGCATTGGTAGTGGTTATCGCATTGCAAGAACGTATGTACGGACAAAATGTCGGACACCGCCTTATCGGCT
->read4503_contig0_position2375_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGTATTGGGCGGTGAGGGGTACCCGACGCCTCTGCTGTCAAAGTGGGAAATCCAGTCTCGACTATATCTACTATGTCATGCTTGTCGGATGAACAACTC
->read4504_contig0_position6644_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGCAGTATAAAATGGACTGCTATCTAGGCGTTAAAGTAGTAGAACGAGGGTCGGGCGATTTGTTTTGGAAGTGGTTATCGCATTGCAAGAACGTACGGA
->read4505_contig0_position3491_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CAAACCTTTACACTCATCACATAGCAGGTTCCACCCGAACCGCGCGTATTCTGCGACAGCATGAATCGTGTAACTCTGCTCGGTTATACGCCCTCGGGAG
->read4506_contig0_position6823_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGCTCTCACCCACGACTGTACCCCGGTTAAGATTTATAAACCATACATTTAACCCTTAGTCATAAGATGATACTTCATCTGCATGCGCGCATCTTCCTA
->read4507_contig0_position6216_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGTTATAAAAAAGGGACGAGTGGGGGCAACAGTTCTTCTTCTTTCCTGTACGGTAATGCTTCCGCGCATCTAAGTGATATTCGCCGGAATTTACCCTTCT
->read4508_contig0_position8792_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGAGAACACTTCATCTGTATGGCAAAGTTGCGACACCGCGCCACACAGCAGTTTATTGTTAACACGCGATACAAGAGGGTTAGGAGCTAAGAAACCGGT
->read4509_contig0_position2028_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCATTGGTCTTTCAGTCCCCAGTCACCGGAGACGTCCGAGCTCGAACCCGTCCGGCTAAGAGGCAGGCAGTCGCTGCATGTGTACGCAGCGGTCTATGC
->read4510_contig0_position3657_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGATTCCATGGACTCTCTGTTTCGTCGATTGTCTGAATATCGTGCAGTAAGTTTCTCTTAGGTTCCTCAACGGAAACGTCTCAGACCCACCTTAGACGCG
->read4511_contig0_position7026_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGACTACTTCCAGCCACGAATTCGTGTGATAACCGCCTAAACAGTCTAATCTGGCCAATATACCCTGGGGGGAGCTAATATATCGCGGCGTCGAGTTACC
->read4512_contig0_position5727_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGCCTCGAACCACTACAATAAGATTACGGATAGCCCGTGGCTTGGTTGTTTTCTGAATTGTGGCTATCTCAAATTGGGACCTAGTGTTGGCCAATAAGC
->read4513_contig0_position9226_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCTGGCAGAGCAGCTCCGAGGGCCTTTATACCCATACTGCCACTCCAGTACCTGGGCCGCGTGTTGTACGCTGTGTATCTTGAGAGCGTTTCTCCGTAT
->read4514_contig0_position5317_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGACGTCCGCCTAAGATCCTAGTTGAATTGATCAATTGAGTCCAGTACACCATATCAACAGCTTGATCGTTCCACTTCAATCCGCAAGACGGGCGACCG
->read4515_contig0_position2375_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGTATTGGGCGGTGAGGGGTACCCGACGCCTCTGCGGTCAAAGTGGGAAATCCAGTCTCGACTATATCTACTATGTCCTGCTTGTCGAATGAACAACTC
->read4516_contig0_position8579_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTACTCAGATTGTCTGTAACCGGAGCTTCGGGCGTATTTTTGCGTAAGACACTGACTAAAGGGAACATATGTGTCCAGAATAGGGTTCAACGGTGTATGA
->read4517_contig0_position2396_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCCGACGCCTATGCTGTCAAAGTGGGAAACCCAGTCTCGACAATATCTACTATGTCATGCTTGTCGAATGAACAACTCAATTAGGTAGTGTGCGCGAGG
->read4518_contig0_position491_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCTGCTACGCCTCGATTGGTTTCAGCTCACGTGGGACGCATGTACTTACCTAACATGAAGCGGTAATGGAGCTCGAACACTAGTCGGTGGCTCTTCTGT
->read4519_contig0_position1269_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATAAATCTAAGTATGGACTCTTATATTCCCTCCTACGTAGTGCTCTCCCATAATAGGTGAACCCATGGGTCGCGCTGTATTTTTGTACGGCTTGATGTCA
->read4520_contig0_position3783_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGTAAGAACACCTAGCCTGGCAATTACCCCTTTGTTATTCTAGTCAAGTGAAGAACCCGGGCCCAAAATTGGAACCCGTAATCTTCAAGTGAATCATTC
->read4521_contig0_position2621_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCCGAAGTCTTAAAATCTAACCCTGAATTGGCTTTATCCACCCCCCCTACTGGCCACCAATGGGGCGCGAGTCTCGAGCCTCTCGACTCCAAAGGGTCT
->read4522_contig0_position7776_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GACCTTATGTCCATATCGATACACGAAGGCCAGTGCGGAAGCAGAGCCACACTCGCCGTTACTGACTGATTGACAATCCAGCCCGTTTGGGGTGATTTGT
->read4523_contig0_position9192_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGAGAGACGGATGTAATTTAGTCAGGTCGGAACCGCTGGCAGAGCAGCTCCGAGGGCCTTTATAACCATACTGCCACTCCAGTACCTGGGCCGCGTGTT
->read4524_contig0_position5458_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCCAGCGATAGTATCTAAGAGGCGAAAGCGCTTGTCACCTCATCTAAAATCGCGACTATAGATCTGTTTAGGACCACGACCCAGAAATCTTTAGCTAAG
->read4525_contig0_position2564_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCAGGACGATAGAACGAAGTAGTTACGGTGATTACCCGTCCATCGATGCCCCTGCTGTCCCGAAGCCTTAAAATCTAACCCTGAATTGGCTTTATCCACC
->read4526_contig0_position418_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GACAGAGGATTATGTAAGGTTACCGAAGACCGGGTAGCGTAGTTAGTAACTTCAATCCGCGTTACGCTTTGTCCTCTGCTACGCCTCGATTGGTTTCAGC
->read4527_contig0_position1384_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGGTATGTCTGTGTAAGGTTGGGCCAATCGAGAGGACATTTCGCAGCGCCCTTTCATCTCTATTGCTAGGTCTCTTAAGCCTAATCAGGATCATAGATG
->read4528_contig0_position6612_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCAGCGACTCCACATGGAGCGATGGGTCCTCAAGGCAGTATAAAATGGACTGCTATCTAGGCGTTAAAGTAGTAGAACGAGGGTCGGGCGATTTGTTTTG
->read4529_contig0_position8828_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGCGCCACACAGCAGTTTATTGTTAACACGCGATACAAGAGGGTTAGGAGCTAAGAAACCGGTGCATCACCGTACGAAAAGGATGGTTGAAATAGAACG
->read4530_contig0_position5859_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGAAGTCCATATAACAGCTGATTTAAGAGGAAAAATTGAACATCAACGGAACTACTATAGCAGGCTCACCAGCATGAAAGACATCCTCATTGTGAACCCG
->read4531_contig0_position8509_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTAGCGAGAAGTTATAGTCTAATAACGAATGGTGAACAGCACATCTTTTCGTCCTGAGGCCATATTAATTCTACTCAGATTGTCTGTAACCGGAGCTTCG
->read4532_contig0_position7363_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGGAGAACCGCGGAAGTAACAATTTCTGGTGCCACTCGAGACCGCCCTCCCCGAGCCATATGCAGTTTCTGCATACACCGGGTAGACAACATTCTCAGC
->read4533_contig0_position3280_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGCACCCGTCTAGGAGGGCGTGCAGGGTCTCCCGCTAGCTAATGGTCACGGCCTCTCTGGGAAAGCTGAACAACGGATGGGATTAAGCTCAGCAGTCCG
->read4534_contig0_position5377_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCTTGATCGTTCCACTTCAATCAGCAAGACGGGCGACCGTACCCGGACACCTGGCAGCGGGAACCGCTTTGACTCTGGAGTGCCAGCGATAGTATCTCA
->read4535_contig0_position1356_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGCTTGATGTCAGGGTCAGTTTGGGCGCCGGTATGTCTGTGTAAGGTTGGGCCAATCGAGAGGACATTTCGCAGCGCCCTTTCATCTCTATTGCTAGGT
->read4536_contig0_position5468_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTATCTCAGAGGCGAAAGCGCTTGTCACCTCATCTAAAATCGCGACTATAGATCTGTTTAGAACCACGACCCAGAAATCTTTAGCTAAGTAATCGACTG
->read4537_contig0_position469_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCAATCCGCGTTACGCTTTGTCCTCTGCTACGCCTCGATTGGTTTCAGCTCACGTGGGACGCATGTACTTACCTAACATGAAGCGGTAATGGAGCTCGAA
->read4538_contig0_position5129_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGAAGTCGCGTTGTCGCTAGTAACAGATTGGGAGGTCTCGGCCAATTCGTTGTATTGATCGCTGTGCACTTTAAAATTCGGAACATCTTAACCAAAGCA
->read4539_contig0_position9757_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTCGAGTCATATCGATGAACAGAGACTAAATGTCCTTAAATCTCTAACACGATTTTAGTAGGTCTACTACTAGGCCGCGTGCTCAGAAATCGGAACACA
->read4540_contig0_position1038_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAAAGGTACCGCAAATGGCCTGTATGACCCTGGTTACGCGTTATTACCGGTCAGCTCCAGTTACGTCACGGACGTAGAGAGCCTTTGAATGTGTACGGCA
->read4541_contig0_position2582_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTAGTTACGCTGATTACCCGTCCATCGATGCCCCTCCTGTCCCGAAGCCTTAAAATCTAACCCTGAATTGGCTTTATCCACCCCCCCTACTGGCCACCAC
->read4542_contig0_position6836_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGACTGTACCCCGGTTAAGATTTATAAACCATACATTTAACCCTTAGTCATAAGATGATACTTCATCTGCATGCGCGCATCTTCCTATTTTATGGTCTTA
->read4543_contig0_position7373_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGGAAGGAACACTTTCTGGTGCCACTCGAGACCGCCCTCCCCGACCCATATGCAGTTTCTGCATCCACCGGGTAGACAACATTCTCATCCCTTCGTTGA
->read4544_contig0_position6757_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGACACCGCCTTATCGGCTATACTAGTTAGAGTCTCGCTTGGGTCTCTACATCCCCTGATACGCGCGAGCTCTCACCCACGACTGTACCCCGGTTAAGAT
->read4545_contig0_position5103_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATAACGCGATGAGGCCAAGGTGTTACGTGAAGTCGCGTTGTCGCTAGTAACAGATTGGGAGGTCTCGGCCAATTCGTTGTATTGATCGCTGTGCACTTTA
->read4546_contig0_position6968_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGTTCCGATTGTCCTTTCCCAGGCTACGGCCTTATACCAAAGACTTCTAGACCGGAGAGACTACTTCCACCCACGAATTCGTGTGATAACCGCCTATAC
->read4547_contig0_position7089_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTGGGGCGAGCTAATATATCGCGGCGTCGAGTTACCGTTGCACCACCTCCAAGTGTCCATCGGAGTCCGCTTCCCGGGCTTGTCCGCGTCCCATCGGTT
->read4548_contig0_position5138_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGTTGTCGCTAGTAACAGATTGGGAGGTCTCGGCCAATTCGTTGTATTGATCGCTGTGCACTATAAAATTCGGAACATCTTAACCAAAGCATATTAATAT
->read4549_contig0_position9803_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AACACGATTTTAGTAGGTCTACTACTAGGCCGCTTGCTCAGAAATCGGAACACAAGTACGCGATCTCTCTTCTAGTCACCAGCCTCAGGCATTCGCAAAT
->read4550_contig0_position1740_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAACATTAGATAGGATATAAAAGTAATACGGTTGATGTTATTACCAACTCCACTTCTGCAAATTGTTATGAGCAAGCATACAAGTTAGCCGGCCCACAA
->read4551_contig0_position5653_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTCCTTAGGGTACCGAGTATATTAACTTTATGAAATTAGCGCGTTGACTACTTAAAGTTCAGAAGATCACTGTCCGCCTCGAACCACTACAATAAGATT
->read4552_contig0_position6912_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCATCTTCCTATTTTATGGTCTTAATTGAGTGTTCAGAGTTGGGGGTCACAGATGAGCGTTCCGATTGTCCTTTCCCAGGCTACGGCCTTATACCAAAGA
->read4553_contig0_position5446_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGAGTCTGGAGTGCCAGCGATAGTATCTCAGAGGCGAAAGCGCTTGTCACCTCATCTAAAATCTCGACTATAGATCTGTTTAGAACCACGACCCAGAAA
->read4554_contig0_position2936_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTAGAGTTGGGGTTCGTGCTTCAATGACCCGTAGCCCAATTGCGCTCCCGAACAACGCGTGAGTTTAAAATTGACTTGAAACCGCCTAGCTCGGACCACC
->read4555_contig0_position9004_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGCTTCCCTAACCTGCCTATGCGCCTTAACTTTATGCATACTCGTCTAGTACAGGGCCGCGCCCCATGAGGCCATATGCGCCTGTCACGGGCATGCTGA
->read4556_contig0_position5673_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TATTAACTTTATGAAATTAGCGCGTTCACTACTTAAAGTTCAGATGATCACTGGCCGCCTCGAACCACTACAATAAGATTACGGATAGCCCGTGGCTTGG
->read4557_contig0_position8353_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCGACATTCCTGGTAGGAATCCGATCTCAATTCCTGCGGTACCGAGCAGCTTTGAGTTTTTGTAAGTCCCACGGTCAATGGGCCACTTATTTCGACATT
->read4558_contig0_position7185_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTTAATTCAATGTCCGTCAATCGGGTTGGCCAAAAATTCTACCTGTCCACCTGTCCGCTAGAAGCAGATTATACGGAATACATATCCCGACACCGGCAG
->read4559_contig0_position12_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTGTGGGGAGGACCACGCTCTGGCTAACGAGCTACCGTTTCCTTTAACCTGCCAGACGGTGACCAGGGCCGTTCGGCGTTGCATCGAGCGGTGTCGCTA
->read4560_contig0_position5059_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAATTCGCTAGGTTGTAGCCAGGAAGTCTGTAGTACAGGTGCCCATAACCCGATGAGGCCAAGGTGTTACGTGAAGTCGCGTTGTCGCTAGTAACAGCTT
->read4561_contig0_position6367_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGAAGGCGCGCAGCTCAAGCAATCATACATGGCGGAATGCCTGTCCACCGGGGGTTCTACTGTACCACAGTGGCCTGGATAGCTAAGCAGGTCCTGGAT
->read4562_contig0_position1074_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCGTTATTACCGGTCAGCTCCAGTTACGTCACGGACGTAGAGAGCCTTTGAATGTGTACGGCAATAGGTGAAACTCGGCCACGTACGTGTCAACATGGC
->read4563_contig0_position3567_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCTCGGTTATACGCCCTCGGGAGAAGACCCATGTAAGATGTATCCATCCCTACCACACGCGTCCGACACCTCCGGGTCTAGTAAACCAGAGATTCCATG
->read4564_contig0_position7151_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAGTCCGCTTCCCGGGCTTGTCCGCGTCCCATCGGTTAATTCAATGTCCGTCAATCGGGTTGGCCAAAAATTCTACCTGTCCACCTGTCCGCTAGAAGC
->read4565_contig0_position8328_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGCGACCTGAATGACCTTGGGCTCGTCGACATTCCTGGTAGTAATCCGATCTCAATTCCTGCGGTACCGAGCAGCTTTTAGTTTTTGTAAGTCCCACGG
->read4566_contig0_position4699_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAACCTCCTCTTCACTGATATCATCCTATCGGCGTTCGAAGTATTCGGCGGATGAATTAGAGCCAAAGCAGTAGGTTACCGTCGGCGCATAACCGGCGAG
->read4567_contig0_position4942_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGACGCGGAAGCGCACCTCGTATAACGTTAGGGGTATCGTCACTGCATAGCAGAATGGGCGATCGGCCTACAAGAGTACAGTACTAACGGTCTGGCCTTA
->read4568_contig0_position8296_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCTATCTGTCTCCGTGTTCCTTTCGATAACACTGCGACCTGAATGACCTTGGGCTCGTCGACATTCCTGGTAGTAATCCGATCTCAATTCCTGCGGTAC
->read4569_contig0_position6277_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGCGCATCTAAGTTATATTCGCCGGAATTTACCCTTCTAATATTGTGTGCAAGCTACTTCTAGACCTTATTAAGTGCCCAGGAATTCCTAGGAAGGCGC
->read4570_contig0_position7196_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTCCGTCAATCGGGTTGGCCAAAAATTCTACCTGTCCACCTGTCCGCTAGAAGCAGATTATACGGAATACATATCCCGACACCGGCAGCTGAAATGATG
->read4571_contig0_position1640_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGGTCCGTTGACTTACCAACTTGATCGCCAGTGAGTGAGCGGTGGTTTATCTGTTGAGTGGCCACTTTTCCCTATCTGCTGGGACGGCACTGGAGATCT
->read4572_contig0_position295_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CATCTAGTTCTAGCATACTCCGCCTTGGGCCACACAATTAATATAAGACGGGATAATGGCTTCATGCTCATGTTCTATACGGAGCAGAGAGGTTGGGTCT
->read4573_contig0_position4837_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGTTGGATGTGTCCCACAGTGTTTTATACGGGACGGTGGCCACGGGGTGAGCACATGAATGGGGTACGGTTTTACCGTCCATGACGTTGTGACATAAAG
->read4574_contig0_position2537_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CATATGGGCGTGCTATAAATGCGGGAGTCAGGACGATAGAGCGAAGTAGTTACGGTGATTACCCGTCCATCGATGCCCCTCCTGTCCCGAAGCCTTAAAA
->read4575_contig0_position9033_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTTTATGCATACTCGTTTAGTACAGGGCCCCGCCCCATGAGGCCATATGCGCCTGTCACGGGCATGCTGAAAGCGGCGGTTACATTAATCGCTTCTGTG
->read4576_contig0_position3650_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AAACCAGAGATTCCATGGACTCTCTGTTACGTCGATTGTCTGAATATCGTGCAGTAAGTTTCTCTTAGGTTCCGCAACGGAAACGTCTCAGACCCACCTT
->read4577_contig0_position6828_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCACCCACGACTGTACCCCGGTTAAGATTTATAAACCATACATTTAACCCTTAGTCATAAGATGATACTTCATCTGCATGAGCGCATCTTCCTATTTTA
->read4578_contig0_position5253_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGTATATATGATCCTTGATAGCTTTATGGCCATCATCATAGTAAATTTTTTCAGATTACCCTGCAGACGTCCGCCTAAGATCCTAGTTGAACTGATCAA
->read4579_contig0_position5217_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTAACCAAAGCATATTAATATGCCAGCCGCGCAGGGTGGTATATATGATCCTTGATAGCTTTTTGGCTATCATCATAGTAAATTTTTTCAGATTACCCTG
->read4580_contig0_position7556_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTACTGCCCGCCGTGAACGAGAACAAGCGTGTGGAGAGTGACTGACTATCACGAGGAATTACGGATAACAGCCCACTTGGAGTGTGCTGAGGGCCGACG
->read4581_contig0_position9419_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGGAATCTTCATTGGTCGTGCAGACATTGTCGCTGCGTACCAAAGTAACTGGACGCCCATACCCCTTTGTCTACACAAGCTCATGGATAAGAGTGTGCG
->read4582_contig0_position7644_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TGAGGGCCGACGCCCGGGGACCGTGATATCCTTGCGAGTTGAATGCGAAAACTGCATAAGCGCAATGACCGGGGTAACAAGCCATGAGGACTGGAGCGGT
->read4583_contig0_position4961_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTATAACGTTAGGGGTATCGTCACTGCATAGCAGAATGGGCGATCGGCCTACAAGAGTACAGTACTAACGGTCTGGCCTTATACAGCGCCACATCCGCCA
->read4584_contig0_position1177_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTCTCTAAACCTCGCAAAGAATCACTCTATGGGTCATCTTGAGAGAATAGTCGACTAGTAGCGAATATATGTTCTGCTCCGAGACTTCGGCATAAATCT
->read4585_contig0_position2392_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGTACCCGACGCCTCTGCTGTCAAAGTGGGAAATCCAGTCTCGACTATAACTACTATGTCATGCTTGTCGAATGAACAACTCAATTAGGTAGTGTGCGC
->read4586_contig0_position7321_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GATGTCTAGAAGCGCCAGATCGACTTGACTCTACGTGCTGCAATGGAGAACCGCGGAAGGAACACTTTCTGGTGCCACTCGAGACCGCCCTCCCCGACCC
->read4587_contig0_position6420_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTTCCACTGTACCACAGTGGCCTGGATAGCTACGCAGGTCCTGGATTGGCATGTCATCCGGAGTGATAGGCACTGCTCACGACCAGCTTGCGGACAAAC
->read4588_contig0_position1261_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTTCGGCATAAATCTAAGTATGGACTCTTATATTCCCTCCTGCGTAGTGCTCTCCCATAATAAGTGACCCCATGGGTCGCGCTGTATTTTTGTACGGCT
->read4589_contig0_position3783_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGTAAGAACACCTAGCCTGGCAATTACCCCTTTGTGATTCTAGTCAAGTGAAGAACCCGGGCCCAAAATTGGAACCCGTAATCTTCAAGTGAATCATCC
->read4590_contig0_position1694_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGAGTGGCCACTTTTCCCTATCTGCTGGGACGGCACTGGAGATCTGGAACATTAGATAGGATATAAAAGTAATACGTTTGATGTTATTACCAACTCCAC
->read4591_contig0_position2552_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAAATGCGGGAGTCAGGACGATAGAGCGAAGTAGTTACGGTGATTACCCGTCCATCGATGCCCCTCCTGTCCCTAAGCCTTAAAATCTAACCCTGAATTG
->read4592_contig0_position3897_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GATTATCTGCACGACTCTTAAAATCATGCACTAAGCATAGAATGCACGACTACTTGTTACTGAAGTGGGCATGACTATCAAACCTATTTAATGATATATG
->read4593_contig0_position9847_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGGAACACAAGTACGCGATCTCTTTTCTAGTCACCAGCCTCAGGCATTCGCAAATTTCGTTCATGCACGCAACGGGTCGAATAATATGCCGATGTCATG
->read4594_contig0_position7277_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCGGCAGCTGAAATGATGCAGAAGCCTTGCTTGCCACTCCGCCGATGTCTAAAAGCGCCAGATCGACTTGACTCTACGTGCTGCAATGGAGAACCGCGG
->read4595_contig0_position1700_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCCACTTTTCCCTATCTGCTGGGACGGCACTGGAGATCTGGAACATTAGATAGGATATAAAAGTAATACGGTTGATGTTATTACCAACTCCACTTCTGC
->read4596_contig0_position3489_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCAAACCTTTACACTCATCACATAGCAGGTTCCACCCGAACCGCGCGTATTCTGCGACAGCATGAATCGTGTAACTCTGCTCGGTTATACGCCCTCGGG
->read4597_contig0_position4547_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TACCTCCTGCGACGGCATTGGCGATTATGGGCGTGCATAGAGTCCCGCAGTGTCGGAGCGATAGGGAGGACGTAAACGCCAATTCCGCTTAATAGCGGAA
->read4598_contig0_position8652_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCAGAATAGGGTTCAACGGTGTATGAGCAAACGATGCGGTAAGACGAGCGCTCCGACCCCCCTTGGCTCTGCTACATCGAATTCAGCGTGTAAGAGCCC
->read4599_contig0_position3262_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTAAGTACCGAACGATAGAGCACCCGTCTAGGTGGGCGTGCAGGGTCTCCCGCTAGCTAATGGTCACGGCCTCTCTGGGAAAGCTGAACAACGGATGGG
->read4600_contig0_position2602_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCATCGATGCCCCTCCTGTCCCGAAGCCTTAAAATCTAACCCTGAATTGGCTTTATCCACCCCCCCTACTGGCCACCACTGGGGCGCGAGTCACGAGCC
->read4601_contig0_position8461_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGATATCCTGCTTAGGCAGTACGGCCAATGCACGACCCTATATGACCCCTAGCGAAAAGTTATAGTCTAATAATGAATGGTGAACAGCACATCTTTTCGT
->read4602_contig0_position5863_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCCATATAACAGCTGATTTAAGAGGAAAAATTGAACATCAACGGAAGTACTATAGCAGGCTCAACAGCATGAAAGACATCCTCATTGTGAACCCGGCAT
->read4603_contig0_position9559_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TGACCTCCCCCGCGATTAACCTATGTCGGGACAAACACTCGATTGAGCAGTGGACATGTCATTATTGTACATCAGTACCATAGCTTGGCCACCTGTGATG
->read4604_contig0_position1320_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AATAAGTGAACCCATGGGTCGCGCTGTATTTTTGTACGGCTTGATGTCAGGGTCAGTTTGGGCGCCGTTATGTCTGTGTAAGGTTGGGCCAATCGAGAGG
->read4605_contig0_position4619_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAAACGCCAATTCCGCTTAATAGCGGAATTTGCTGGCTTGTGCATTCGTCGGCCTATTAGATACGGTACGGAATATTGGGTAACCTCCTCTTCACTGATA
->read4606_contig0_position4724_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCTCGGCGTTCAAAGTATTCGGCGGATGAATTAGAGCCAAAGCAGTAGGTTACCGTCGGCGCATAACCGGCGAGTGCTCTGAAACGTTACATTCGTCTA
->read4607_contig0_position8898_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGTACGAAAAGGATGGTTGAAATAGAACGAGTTGTAGAACATTAGCTCACGCGCCACCGTCATAGGCTGCATATTGAGACAGGCTTGAAAACCTGTCTG
->read4608_contig0_position5373_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CAACAGCTTGATCGTTCCACTTCAATCAGCAAGACGGGCGACCGTACCCGAACACCTGGCAGCGGGAACCCCTTTGACTCTGGAGTGCCAGCGATAGTAT
->read4609_contig0_position2959_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGACCCGTAGCCCAATTGCGCTCCCGAACAACGCGTGAGTTTAAAATTGACTTGAAACCGCCTAGCTCGGACCACCAAAGAGCAAGACTCTATGACTAG
->read4610_contig0_position4049_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGCAGATGCACTCTTAGCTCCGCTGATAACGATTACTATAAATCAGCGAATCTAACATCAATCTGCACCACGAATATCGTCCAAGACGTTTTGAGCCGG
->read4611_contig0_position3489_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCAAACCTTTACACTCATCACATAGCAGGTTCCACCCGAACCGGGCGTATTCTGCGACAGCATGAATCGTGTAACTCTGCTCGGTTATACGCCCTCGGG
->read4612_contig0_position3573_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTATACGCCCTCGGGAGAAGACCCATGTAAGATGTATCCATCCCTACCACACGCGTCCGCCACCTCCGGGTCTAGTAAACCAGAGATTCCATGGACTCT
->read4613_contig0_position4772_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTTACCGTCGGCGCATAACCGGCGAGTGCTCTGAAACGTTCCATTCGTCTATCCGCCCACACCGCCGTTGGATGTGTCCCACAGTGTTTTATACGGGAC
->read4614_contig0_position5850_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTAATAGAACGAAGTCCATATAACAGCTGATTTAAGAGGAAAAATTGAACATCAACGGAAGTACTATAGCAGGCTCACCAGCAAGAAAGACATCCTCATT
->read4615_contig0_position6042_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAACAATCCGTCGACTGAATGTGATTCCTTTGTTATTTCACACTATTGTTCGGTGCGTGCGCTGCTCAGGTTGGTGCGACCCTTACAGCGTTATCCGTCC
->read4616_contig0_position1013_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGGCATGGGGGTTCCGCATTGGAGCAAAGGTACCGCAAAGAGCCTGTATGACCCTGGTTACGCGTTATTACCGGTCAGCTCCAGTTACGTCACGGACGT
->read4617_contig0_position7782_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGTCCATATCGATACACGAAGGCCAGTCCGCAAGCGGAGCCACACTCGCCGTTACTGACTGATTGACAATCCAGCCCGTTTGGGGTGATTTGTGCCGGC
->read4618_contig0_position4352_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTGCCAATATCCCCGGGAGTCCCGCACTACTGAGACGAAGTCTAGCTAGCTTGACTCGGCTGATAAAGAAAACAATCCATATGGAACCGAGGGGCGGGA
->read4619_contig0_position6181_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TAACAGTCGACTAAAAGGCGTAACCGATTCTGCTACGTTTTAAAAAAGGGACGAGTGGGGTCAACAGTTCTTCTTCTTTCTTGTAAGGTAATGCTTCCGC
->read4620_contig0_position1665_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGCCAGTGAGTGAGCGGTGGTTTATCTGTTGCGTGGCCACTTTTCCCTATCTGCTGGGACGGCACTGGAGATCTGGAACATTAGATAGGATATAAAAGT
->read4621_contig0_position1056_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTGTATGACCCTGGTTACGCGTTATTACCGGTCAGCTCCAGTTACGTCACGGACGTAGAGAGCCTTTGAATGTGTAGGGCAATAGGAGAAACTCGGCCA
->read4622_contig0_position2478_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGGTAGTGTGCGCGAGGTAGAGTATGCAGATTTCGTACCTTGCCACTGCCACCTCCGGCATATGGGCGTGCTATAAATGCGGGAGTCAGGACGATAGAG
->read4623_contig0_position1420_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACATTTCGCAGCGCCCTTTCATCTCTATTGCTAGGTCTCTTAAGCCTAATCAGGATCATAGATGGCCAATTATTGACCACAGGTAGGGGCGAGGTATAAA
->read4624_contig0_position3993_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TATGCTCTTGGACAACACGAGGTCGTAATTATTTCCTGAGATGGTTTTAGTGAGAGCAGCAGATGCACTCTTAGCTCCGCTGATAACGATTACTATAAAT
->read4625_contig0_position959_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGACGATCGCAGCGGAGTCGATATAATTGCAGTATCATGTATCGCTGATTGTGGGGGGCATGGGGGTTCCGCATTGGCGCAAAGGTACCGCAAAGGGCCT
->read4626_contig0_position4373_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCGCACTCCTGAGACGAAGTCTAGCTAGCTTGACTCGGCTGATAAAGAAAACAATCTATATGGAACCGAGGGGCGGGATGATAATTGTTCTTAGTATAG
->read4627_contig0_position7921_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTAATACCAATTGAAATGAAGCTTACGCAAACTACTCGACGAACAACAGCAAGGTTCGACGATCAAACTCGCCGGCGACACGAAGATTGTCATACTAGC
->read4628_contig0_position9352_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGTATCCTGACCATGGAGCTGCAACACTTTCACACAGGTAGCCGAACAGGTATTACTCAGACTGGAGAGGAATCTTCATTGGTCGTGCAGACATTGTCG
->read4629_contig0_position1629_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGACATGCACCCGGTCCGTTGACTTACCAACTTGATCGCCAGTGAGTGAGCGGTGGTTTATCTGTTGAGTGGCCACTTTTCCCTAACTGCTGGGACGGC
->read4630_contig0_position7411_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCCCGACCCATATGCAGTTTCTGCATACACCGGGTAGACAACATTCTCAGCCCTTCGTTGAAAGGAGAATACAAATGACGGGAACTCTGACGAGAGGGT
->read4631_contig0_position5681_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTATGAAATTAGCGCGTTAACTACTTAAAGTTCAGAAGATCACTGTCCGCCTCGAACCACTACAATAAGATTACGGATAGCCCGTGGCTTGGTTGTTTTC
->read4632_contig0_position6132_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTATCCGTCCCGAACTGGCTTGAGCCACTCATAAGGCACGCGCGGGCCATAACAGTCGACTAAAAGGCGTAACCGATTCTGCTACGTTATAAAAAAGGGA
->read4633_contig0_position7156_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGCTTCCCGGGCTTGTCCGCGTCCCATCGGTTAATTCAATGTCCGTCAATCGGGTTGGCCAAAAATTCTACCTGTCCACCTGTCCGCTAGAAGCAGATT
->read4634_contig0_position7858_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGTTTGGGGTGATTTGTGCCGGCGCGTCCAGGTGCGAACGTTGTGCCGTGTCACTCTTTAGCTCTAATACCAATTGAAATGAAGCTTACGCAAACTACT
->read4635_contig0_position6261_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGTACGGTAATGCTTCCGCGCATCTAAGTGATATTCGCCGGAATTTACCCTTCTAAAATTGTGTGCAAGCTACTTCTAGACTCTATTAAGTGCCCAGGA
->read4636_contig0_position2326_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGATACCTGCGGCTTCACTCCACAGTGTAAGAGTTGCCGGGACTAAAACAGTATTGGGCGGTGAGGGGTACCCGACGCCTCTGCTGTCAAAGTGGGAAA
->read4637_contig0_position8917_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GAAATAGAACGAGTTGTAAAACATTAGCTCACGCGCCACCGTCATAGGCTGCATATTGAGACAGGGTTGAAAACCTGTCTGAAGTCCGAGCTTCACTAAC
->read4638_contig0_position6599_M5_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCCGAGGATTATGCAGCGACTCCACATGGAGCGTTGGGGCCTCAAGGCAGTATAAAATGGACTGCTATCTAGGCGTTAAAGTAGTAGACCGAGGGTCGG
->read4639_contig0_position3735_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTCAGACCCACCTTAGACGCGGGAATAAATTCGACACGGGGTACGAAGGGTAAGAACACCTAGCCTGGCAATTACCCCTTTGTTATTCTAGTCAAGTGA
->read4640_contig0_position9688_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAATCGGCTGGGGTAACGGCTGGTTTTGTACTACGGTATGGGAACCCGTTTGCCGAACGTCTGGAAATCTGTCGAGTCATATCGATGAACAGAGACTAAA
->read4641_contig0_position6603_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGGCTTAAGCAGCGACTCCACATGGAGCGATGGGTCCTCAAGGCAGTATAAAATGGACTGCTATCTAGGCGTTAAAGTAGTAGAACGAGGGTCGGGCGA
->read4642_contig0_position7483_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CAAATGACGGGAACTCTGACGAGAGGGTGCTTGAACGAGAGAAGCTAACAGTCATTGCGAGGACGAGAACAGCCCTACTGCCCGCCGTGAACGACAACAA
->read4643_contig0_position5373_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAACAGCTTGATCGTTCCACTTCAAACAGCAAGACGGGCGACCGTACCCGGACACCTGGCAGCGGGAACCGCTTTGACTCTGGAGTGCCAGCGATAGTAT
->read4644_contig0_position7795_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TACACGAAGGCCAGTGCGGAAGCGGAGCCACACTCGCCGTTACTGACTGATTGACAATCCAGCCCGTTTGGGGTGATTTGTGCCGGCGCGTCCAGGTGCG
->read4645_contig0_position3641_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGTCTCGTAAACCAGAGATTCCATGGACTCTCTGTTTCGTCGATTGTCTGAATATCGTGCAGTAAGTTTCTCTTAGGTTCCTCAACAGAAACGTCTCAG
->read4646_contig0_position3876_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCATCCGATCATGCAAACCTGATTATCTGCACGACTCTTAAAATCATGCACTAAGCATAGAATGCACGACTACTTGTTACTGAAGTCGGCATGACTATC
->read4647_contig0_position9024_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCGCCTTAACTTTATGCATACTCGTTTAGTACAGCGCCGCGCCCCATGAGGCCATATGCGCCTGTCACGGGCATGCTGAAAGCGGCGGTTACATTAATC
->read4648_contig0_position7322_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGTCTAAAAGCGCCAGATCGACTTGACTCTACGTGCTGCAATGGAGAACCGCGGAAGGAACACTTTCTGGTGCCACTCGAGACCGCCCTCCCCGACCCA
->read4649_contig0_position4245_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGTTTCGACCATACGCGACGGCAAACAGAATCGCACGTCAACTATCCCCTTTATTAATGATCCGTGTCCCCCGACCGTGTGCTGAGGAGACCCGGAATG
->read4650_contig0_position6015_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCCCTCAACACGTACGTTGACAGAGCTAACAATCCGTCGACTGAATGTGATTCCTTTGTTATTTCACACTATTGTTCGGTGCGTGCGCTGCTCAGGCTG
->read4651_contig0_position6945_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCAGAGTTGGGGGTCACAGATGAGCGTTCCGATTGTCCTTTCCCAGGCTACGGCCTTATACCAAAGACTTCTAGACCGGAGAGACTACTTCCAGCCACGA
->read4652_contig0_position8473_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGGCAGTACGGCCAATGCACGACCCTACATGACCCCTAGCGAGAAGTTATAGTCTAATAATGAATGGTGAACAGCACATCTTTTCGTCCTGAGGCCATA
->read4653_contig0_position7677_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGAGTGGAATGCGAAAACGGCATAAGCGCAATGACCGAGGTAACAAGCCATGAGGACTGGAGCGGTAATGTGGTAGTGTAGTTGACGGCCCCTGTGCTG
->read4654_contig0_position983_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AATTGCAGTATCATGTATCGCTGATTGTGGGGGGCATGGGGGTTCCGCATTGGCGCAAAGGTACCGCAACGGGCCTGTATGACCCTGGTTACGCGTTATT
->read4655_contig0_position1071_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTACGCGTTATTACCGGTCAGCTCCAGTTACGTCACGGACGTAGAGAGCCTTTGAATGTGTACGGGGATAGGAGAAACTCGGCCACGTACGTGTCAACAT
->read4656_contig0_position2278_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GATAGTACGTTCCTTTTGTACTGAGTCTTAACATCGGCAAATGCGCCCTAGATACCAGCGGCTTCACTCCACAGTGTAAAAGTTGACGGGACTAAAACAG
->read4657_contig0_position8755_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TATCCGGTGGTGATACCTACTATTGACTGGGGGCTTACTGAGAACTCTTCATCTGTTTGGCAAAGTTGCGACACCGCGCCACACAGCAGTTTATTGTTAA
->read4658_contig0_position4647_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTGCTGGCTTGTGCATTCGTCGGCCTATTAGATACGGTACGGAATATTGGGTAACCTCCTCTTGACTGATATCATCCTATCGGCGTTCAAAGTATTCGG
->read4659_contig0_position9314_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTTCTCCTTATCGAATTGTTCCGCTGTAAAGAACCTGGCGTATCCTGACCATGGAGCTGCAACACTTTCACACAGGTAGCCGAACAGGTATTACTCTGA
->read4660_contig0_position524_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGACGCATGTACTTACCTAACATGAAGCGGTAATGGAGCTCGGACACTAGTCGGTGGCTCTTCTGTCTCTGGCGTGGACGGCTATGTGAGTTCATAAAT
->read4661_contig0_position1344_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTATTTTTGTACGGCTTGATGTCAGGGTCAGTTGGGGCGCCGGTATGTCTGTGTAAGGTTGGGCCAATCGAGAGGACATTTCGCAGCGCCCTTTCATTT
->read4662_contig0_position5323_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCGCCTAAGATCCTAGTTGAATTGATCAATTGAGTCCAGTACACCATATCAACAGCTTGATCGTTCCACTTCAATCAGCAAGACGGGCGACCGTACCCG
->read4663_contig0_position3230_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGGTCGTATGGTTGGAGGGCGGTTGCACACCCTTAAGTACCGAACGATAGAGCACCCGACTAGGAGGGCGTGCAGGGTCTCCCGCTAGCTAATGGTCAC
->read4664_contig0_position4890_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACATGAATGGGGTACGGTTTTAGCGTCCATGACGTTGTGACATAAAGGTGCGGGACGCGGAAGCGCACCTCGTATAACGTTAGGGGTATCGTCACTGCAT
->read4665_contig0_position7203_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CAATCGGGTTGGCCAAAAATTCTACCTGTCCACCTGTCCGCTAGAAGCAGATTATACGGAATACATATCCCGACACCGGCAGCTGAAATGATGCAGAAGC
->read4666_contig0_position982_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAATTGCAGTATCATGTATCGCTGATTGTGGGGGGCATGGGGGTTCCGCATTGGCGCAAAGGTACCGCAAAGGGCCTGTATGACCCTGGTTACGCGTTAT
->read4667_contig0_position3074_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAAACTGATCGAGCACTGTCCGCGAAACATTATTCAGTACAGCGACTTTTACCCTCGTGGTCTGAATGTTATGCCGTCCGACTCTTGCGCTCGGATGTCC
->read4668_contig0_position9777_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGAGACTAAATGTCCTTAAATCTCTAACACGATTTTAGTAGGTCTACTACTAGGCCGCTTGCTCAGAAATCGGAACACAAGTACGCGATCTCTTTTCTA
->read4669_contig0_position7821_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCACACTCGCCGTTACTGACTGATTGACAATCCAGCCCGTTTGGGGTGATTTGTGCCGGCGCGTCCAGGTGCGAACGTTGTGCCGTGTCACTCTGTAGC
->read4670_contig0_position3461_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGCCTCGCGCCCATAATGTTTGGTACTCGCAAACCTTTACACTCATCACATAGCAGGTTCCACCCGAACCGCGCGTATTCTGCGACAGCATGAATCGTG
->read4671_contig0_position1855_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTTCAATGGCAGGAGGTTAACTTTGCGGAGCTCAACCTATAACGATAATCAAATTGAGACAGACGAGTTGGAGTGTTTTGATGAGCGGTGTTATATTTG
->read4672_contig0_position3739_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-AGACCCACCTTAGACGCGGGACTAAATTCGACACGGGGAGCGAAGGGTAAGAACACCTAGCCTGGCAATTACCCCTTTGTTATTCTAGTCAAGTGAAGAA
->read4673_contig0_position4867_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGACGGTGACCACGGGGTGAGCACATGAATGGGGTACGGTTTTACCGTCCATTACGTTGTGACATAAAGGTGCGGGACGCGGAAGCGCACCTCGTATAA
->read4674_contig0_position3941_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CACGACTTCTTGTTACTGAAGTCGGCATGACTATCAAACCTATTTAATGATATATGATCTTGGACAACACGAGGTCGTAATTATTTCCTGAGATGGTTTT
->read4675_contig0_position2940_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTTGGGGTTCGTGCTTTAATGACCCGTAGCCCAATTGCGCTCCCGAACATCGCGTGAGTTTAAAATTGACTTGAAACCGCCTAGCTCGGACCACCAAAG
->read4676_contig0_position7855_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCCCGTTTGGGGTGATTTGTGCCGGCGCGTCCAGGTGCGAACGTTGTGCCGTGTCACTCTGTAGCTCTAATACCAATTGAAATGAAGCTTACGCAAACT
->read4677_contig0_position4682_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGTACGGAATATTGGGTAACCTCCTCTTCACTGATATCATCCTATCGGCGTTCAAAGTATTCGGCGGATGAATTAGAGCCAAAGCAGTAGGTTACCGTC
->read4678_contig0_position1942_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTGTTATATTTGTCCTAACTTAGCACTATCGCACCACAAAATTTCAGCATAAAGCATACGGTTGAAGGCTGCGCATCGAGCAGCGTGCATTGGTCTTTC
->read4679_contig0_position4388_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGAAGTCTAGCTAGCTTGACTCGGCTGATAAAGAAAACAATCTATATGGAACCGAGGGGCGGGATGATAATTGTTCTTAGTATAGTGACCGTTATGGACG
->read4680_contig0_position2742_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGTTACTCCCGGGATTCACTGCGTCTATTGTAAGAAATGCAATGCGTGGCCAGTTTGTTCCGGCACGACACCACTCTTTGAAGGTGCCCATTGCATTGT
->read4681_contig0_position1336_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTCGCGCTGTATTTTTGTAAGGCTTGATGTCAGGGTCAGTTTGGGCGCCGGTATGTCTGTGTAAGGTTTGGCCAATCGAGAGGACATTTCGCAGCGCCC
->read4682_contig0_position8798_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACACTTCATCTCTATGGCAAAGTTGCGACACCGCGCCACACAGCAGTTTATTGTTAACACGCGATACAAGAGGGTTAGGAGCTAAGAAACCGGTGCATCA
->read4683_contig0_position2978_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCTCCCGAACAACGCGTGAGTTTAAAATTGACTTGAAACCGCCTAGCTCGGACCCCCAAAGAGCAAGACTCTATGACTAGCGGGTGTCGTCAATGAAAA
->read4684_contig0_position2379_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTGGGCGGTGAGGGGTACCCGACGCCTCTGCTGTCAAAGTGGGAAATCCAGTCTCGACTATATCTACTATGTCATGCTTGTCGAATGAACAACTCAATT
->read4685_contig0_position4461_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCTTAGTATAGTGACCGTTATGGACGACGGACATAACTACTGAGTGTCCGCCCTCGGCTAATCATGAACACCGGTCAGGCATGCTTACCTCCTGCGACG
->read4686_contig0_position4457_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTGTTCTTAGTATAGTGACCGTTATGGACGACGTACATAACTACTGAGTGTCCGCCCTCGGCTAATCATGAACACCGGTCAGGCATGCTTACCTCCTGC
->read4687_contig0_position1013_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGGCATGGGGGTTCCGCATTGGCGCAAAGGTACCGCAAAGGGCCTGTATGACCCTGGTTACGCGTTATTACCGGTCAGCTCCAGTTACGTCACGGCCGT
->read4688_contig0_position3890_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAAACCTGATTATCAGCACGACTCTTAAAATCATGCACTAAGCATAGAATGCACGACTACTTGTTACTGAAGTCGGCATGACTATCAAACCTATTTAATG
->read4689_contig0_position2_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCGCGGGGAATTGTGGGGCGGACCACGCTCTGGCTAACGAGCTACCGTTTCCTTTAACCTGCCAGACGGTGACCAGGGCCGTTCGGCGTTGCATCGAGC
->read4690_contig0_position7915_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTAGCTCTAATACCAATTGAAATGAAGCTTACGCAAACTACTCGACGAACAACAGCAAGATTCGACGATCAAACTCGCCGGCGACACGAAGATTGTCAA
->read4691_contig0_position9707_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGTTTTTGGACTACGGTATGGGAACCCGTTTGCCGAACGTCTGGAAATCTGTCGAGTCATATCGATGAACAGAGACTAAATGTCCTTAAATCTCTAACA
->read4692_contig0_position3485_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-AACTCGCAAACCTTTACACTCATCACATAGCAGGTTCCACCCGAACCGCGCATATTCTGCGACAGCATCAATCGTGTAACTCTGCTCTGTTATACGCCCT
->read4693_contig0_position8878_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTAGGAAACCGGTGCATCACCGTACTAAAAGGATGGTTGCAATAGAACGAGTTGTAAAACATTAGCTCACGCGCCACCGTCATAGGCTGCATATTGAGA
->read4694_contig0_position1098_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTACGTCACGGACGTAGAGAGCCTTTGAATGTGTACGGCAATAGGAGAAACTCGGCCACGTACGTGTCAACATGGCGCGGCTCTCTATACCTCGCAAAGA
->read4695_contig0_position8872_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTAGGAGCTAAGAAACCGGTGCATCACCGTACGAAAAGGATGGTTGAAATAGAACGAGTTGTAAAACATTAGCTCACGCGCCACCGTCATAGGCTGTATA
->read4696_contig0_position2924_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGAAAGAGTCAGTAGAGTTGGGGTTCGTGCTTTAATGACCCGTAGCCCAATTGCGCTCCCGAACAACGCGTGAGTTTAAAATTGACTTGAAACCGCCTA
->read4697_contig0_position9239_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTCCGAGGGCCTTTATACCCATACTGCCACTCCAGTACCTGGGCCGCGTGTTGTACGCTGTGTATCTTGAGAGCGTTTCTCCGTATCGAAATGTTCCGC
->read4698_contig0_position4845_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTGTCCCACAGTGTTTTATACGGGACGGTGGCCACGGGGTGAGCACATGAATGGGGTACGATTTTACCGTCCATGACGTTGTGACATAAAGTTGCGGGA
->read4699_contig0_position8133_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGACAGGGATTATGCACTAGCACGACCGCCGCAGGAAAGATCCGAGGCCTTTTCCAGGGTAAAATGATGGACTCATTGACCAACCCCTATTATGAGGCGA
->read4700_contig0_position8758_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGGTGGTGATACCTACTATTGACTGGGGGCTTACTGAGAACACTTCATCTGTATGGCAAAGTTGCGACACCGCGCCACACAGCAGTTTATTGTTAACAC
->read4701_contig0_position5992_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTAACGTTTGGACGGGTCTTGTGTTCCCTCAACACGTACGTTGACAGAGCTAAGAATCCGTCGACTGAATGTGATTCCTTTGTTATTTCACACTATTGTT
->read4702_contig0_position3110_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTACAGCGACTTTTACCCTCGTGGTCTGAATGTTATACCGTCCGACTCTTGCGCTCGGATGTCCGCAATGGGTTATCAAATGCCTATTTTCCGGTAATCT
->read4703_contig0_position7145_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCATCGGAGTCCGCTTCCCGGGCTTGTCCGCGTCCCATCGGTTAATTTAATGTCCGTCAATCGGGTTGGCCAAAAATTCTACCTGTCCACCTGTCCGCT
->read4704_contig0_position6509_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCGGACAAACGGGGTGCCCGCGCCTGCGTCCGGTAGACGAGCGATGGATTTAGACCGTTCACTGAACCCTCTAATAGGACCTCTTGCCCATCCGAGGCT
->read4705_contig0_position8989_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCTGTCTGAAGTCCGTGCTTCCCTAACCAGCCTATGCGCCTTAACTTTATGCATACTCGTTTAGTACAGGGCCGCGCCCCATGAGGCCATATGCGCCTG
->read4706_contig0_position3723_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCAACGGAAACGTCTCAGACCCACCTTAGACGCGGGAATAAATTCGACACGGGGTACGAAGGGTAAGAACACCTAGCCTGGCAATTACCCCTTTGTTATT
->read4707_contig0_position5195_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCACTTTAAAATTCGGAACATCTTAACCAAAGCATATTAATATGCCAGCCGCGGAGGGTGGTATATATGATCCTTGATAGCTTTATGGCCATCATCATAG
->read4708_contig0_position5748_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-AGATTACGGATAGCCCGTGGCTTGGTTGTTTTCTGAATTGTGGCTATCTCAAATTGGGACCTAGTCTTGGCCAATAAGCTGCATATCACCTTCTCAGATA
->read4709_contig0_position1744_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CATTAGATAGGATATAAAAGTAATACGGTTGATGTTATTACCAACTCCACTTCTCCAAATTGTTATGAGCAAGCATACAAGTTAGCCGGCCCACAAATCG
->read4710_contig0_position7528_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAACAGTCATTGCGATGACGAGAACAGCCCTACTGCCCGCCGTGAACGAGAACAAGCGTGTGGAGAGTGACTGACTATCACGAGGAATTACGGATAACAG
->read4711_contig0_position6077_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTCACACTATTGTTCGGTGCGTGCGCTGCTCAGGCTGGTGCGACCCTTACAGCGTTATCCGTACCGAACTGGCTTGAGCCACTCATAAGGCACGCGCGG
->read4712_contig0_position9597_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGATTGAGCAGTGGTCATGTCATTATTGTACATCAGTACCATAGCTTCGCCACATGTGATGCTCGTACTCGAAGGGGGAATCACCTTACTTAATCGGCT
->read4713_contig0_position2401_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGCCTCTGCTGTCAAAGTGGGAAATCCAGTCTCGACTATATCTACTATGTAATGCTTGTCGAATGAACAACTCAATTAGGTAGTGTGCGCGAGGTAGAG
->read4714_contig0_position616_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCATAAATCTCAATGTCGAAACTCCGATGGGCAGAAGCTAAAACTGAACAACGAGTGGGACACCGGCCTACTACATTATACAGTAAGGTAGAATCGCGTA
->read4715_contig0_position3538_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTCTGCGACAGCATGAACCGTGTAACTCTGCTCGGTTATACGCCCTCGGGAGAAGACCCATGTCAGATGTATCCATCCCTACCACACGCGTCCGCCACC
->read4716_contig0_position1896_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AACGATAATCAAATTGAGACAGACGAGTTGGAGTGTTTTGATGAGCGGTGTTATATTTGTCCTAACTTAGCACTATCGCACCACAAAATTTCAGCATAAA
->read4717_contig0_position3089_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGTCCGCGAAACATTATTCAGTACAGCGACTTTTACCCTCGTGGTCTGAATGTTATGCCGTCCGACTCTTGCGCTCGGATGTCCGCAATGGGTTATCAA
->read4718_contig0_position7555_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCTACTGCCCGCCATGAACGAGAACAAGCGTGTGGAGAGTGACTGACTATCAAGAGGAATTACGGATAACAGCCCACATGGAGTGTGCTGAGGGCCGAC
->read4719_contig0_position8554_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTTCGTCCTGAGGCCATATTAATTCTACTCAGATTGTCTGTAACCGGAGCTTCGGGCGTATTTTTGCCTAAGACACTGCCTAAAGGGAACATATGTGTC
->read4720_contig0_position2955_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTAATGACCCGTAGCCCAATTGCGCTCCCGTACAACGCGTGAGTTTAAAATTGACTTGAAACCGCCTAGCTCGGACCACCAAAGAGCAAGACTCTATGA
->read4721_contig0_position3317_M5_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCTAATGGTCACGGCCCCTCTGGGAAAGCTGAACAACGGATGCTATTATGCTCAGCAGTCCGCTTCCAATCTCTCCGACGTTCATTCTCAAGGGTGTAG
->read4722_contig0_position5367_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCATATCAACAGCTTGATCGTTCCACTTCAATCAGCAAGACGGGCGACCGTACCCGGACACCTGGCAGCGGGAACCGCTTTGACTCTGGAGTGCCAGCGA
->read4723_contig0_position8361_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCTGGTAGTAATCCGATCTCGATTCCTGCGGTACCGAGCAGCTTTGAGTTTTTGTAAGTCCCACGATTAATGGGCCACTTATTTCGACATTCATGGCGC
->read4724_contig0_position8376_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GATCTCAAGTCCTGCGGTACCGAGCAGCTTTGAGTTTTTGTAAGTCCCACGGTTAATGGGCCACTTATTTCGACATTCATGGCGCCGATATCCTGCTTAG
->read4725_contig0_position4105_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CATCAATCTGCACCACGAATATCGTCCAAGACATTTTGAGCCGGTGACTAATTCGGTTGTCGCACATAGTGTACGTTGAGGCGGGAACTTCCCGCTGATA
->read4726_contig0_position1021_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGGTTCCGCATTGGCGCAAAGGTACCGCAAAGGGCCTGTATGACCCTGGTTACGCGTTATTACCGGTCAGCTCCAGTTACGTCACGGACGTAGAGAGCC
->read4727_contig0_position419_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACAGAGGATTATGTAAGGTTACCGAAGACCGGGTAGCGTAGTTAGTAACTTCAATCCGCGTTACGCTTTGTCCTCTGCTACGCCTCGATTGGTTTCAGCT
->read4728_contig0_position3453_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCTGCCGTCGCCTCGCGCCCATAATGTCTGGAACTCGCAAACCTTTACACTCATCACATAGCAGGTTCCACCCGAACCGCGCGTATTCTGCGACAGCAT
->read4729_contig0_position1431_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCCCTTTCATCTCTATTGCTAGGTCTCTTAAGCCTAATCAGGATCATAGATGGCCAATTATTGACCACAGGTAGGGGCGAGGTATAAATTAGTGGATTC
->read4730_contig0_position1471_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGATCATAGATGGCCAATTATTGACCACACGTAGGGGCGAGGTATAAATTAGTGGATTCACTTCCCTTTGACATCTTGTTCTCACAACTGCACACTCCG
->read4731_contig0_position2936_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTAGAGTTGGGGTTCGTGCTTTAATGACCCGTAGCCCAATTGCGCTCCCGAACAACGCGTGAGTTTAAAATTGACTTGAAACCGCCTGGCTCGGACCACC
->read4732_contig0_position5454_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAGTGCCAGCGATAGTATCTCAGAGGCGAAAGCGCTTGTCACCTCATCTAAAATCGCGACTATAGATCTGTTTAGAACCACGACCCAGAAATCTTTAGC
->read4733_contig0_position1343_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGTATTTTTGTACGGCTTGATGTCAGGGTCAGTTTGGGCGCCGGTATGTCTGTGTAAGGTTGGGCCAATCGAGAGGACATTTCGCAGCGCCCGTTCATC
->read4734_contig0_position1469_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GCAGGATCATCGATGGCCAATTATTGACCACAGGTAGGGGCGAGGTATAAATTAGTGGATTCACTTCCCTTTGACATCTTGTTCTCACAACTGCACACTC
->read4735_contig0_position1009_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGGGGGGCATGGGGGTTCCGCATTGGCGCAAAGGTACCGCAAACGGCCTGTATGACCCTGGTTACGCGTTATTACCGGTCAGCTCCAGTTACGTCACGG
->read4736_contig0_position4159_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTTGTCGCACATAGTGTACGTTGAGGCGGGAACTTCCCGCTGATATGATTGTGATCGATATTCAGACTCTAACAAGTGGTCAGTACAGGTTCGACCATA
->read4737_contig0_position4667_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGGCCTATTAGATACGGTACGGAATATTGGGTAACCTCCTCTTCACTGATATCATCCTATCGGCGTTCAAAGTATTCGGCGGATGAATTAGAGCCAAAG
->read4738_contig0_position2153_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCGAGCATCTCATAATCGGGCCACCCGATTTCAGCTTGGCCACAACAGAGACTAGCCACCAGGAGATGGGTTGATGGTAGCATCCCGGCTTCTGGGGCA
->read4739_contig0_position7174_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCGTCCCATCGGTTAATTCAATGTCCGTCAATCGGGTTGGCCAAAAATTCTACCTGTCCACCTGTCCGCTAGAAGCAGATTATACGGAATACATATCCC
->read4740_contig0_position6119_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GACCCTTACAGCGTTATCCGTCCCGAACTGGCTTGAGCCACTCATAAGGCACGCGCGGGCCATAACAGTCGACTAACAGGCGTAACCGATTCTGCTACGT
->read4741_contig0_position2324_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTAGATACCTGCGGGTTCACTCCACAGTGTAAGAGTTGACGGGACTAAAACAGTATTGGGCGGTGAGGGGTACCCGACGCCTCTGCTGTCAAAGTGGGA
->read4742_contig0_position6427_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGTACCACAGTGGCCTGGATAGCTAAGCAGGTCCTGGATTGGCATGTCATCCGGAGTGATAGGCACTGCTCACGACCAGCTTGCGGACAAACGGGGTGC
->read4743_contig0_position2859_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCCTAAGCCCATAAGCCCTGCCCCACGGGGGCTACAATCCAGCAGTGAACGCGTTTACCTTAAGACGAAAGAGTCAGTAGAGTTGGGGTTCGTGCTTTA
->read4744_contig0_position5295_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAAATTTTTTCAGATTACCCTGCAGACGTCCGCCTAAGATCCTAGTTGAATTGATCAATTGAGTCCAGTACACCATATCAACAGCTTGATCGTTCCACTT
->read4745_contig0_position8898_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGTACGAAAAGGATGGTTGAAATAGAACGAGTTGTAAAACATTAGCTCACGCGCCACCGTCATAGGCTGCATATTGAGACAGGGTTGAAAACCTGTCTG
->read4746_contig0_position5470_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TATCTCAGAGGCGAAAGCGCTTGTCACCTCATCTAAAATCGCGACTATAGAACTGTTTAGAACCACGACCCAGAAATCTTTAGCTAAGTAATCGACTGCC
->read4747_contig0_position5255_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTATATATGATCCTTGATAGCTTTATGGCCATCATCATAGTAAATTTTTTCAGATTACTCTGCAGACGTCCGCCTAAGATCCTAGTTGAATTGATCAATT
->read4748_contig0_position5960_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CATCTCGTGATTCGAGCCTAACAGCATGCCATCTAACGTTTGGACGGGTCTTGTGTTCCCTCAACACGTACGTTGACAGAGCTAACAATCCGTCGACTGA
->read4749_contig0_position8466_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCTGCTTAGGCAGTACGGCCAATGCACGACCCTATATTACCCCTAGCGAGAAGTTATAGTCTAATAATGAATGGTGAACAGCAAATCTTTTCGTCCTGA
->read4750_contig0_position1355_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGGCTTGATGTCAGGGTCAGTTTGAGCGCCGGTATGTCTGTGTAAGGTTGGGCAAATCGAGAGGACATTTCGCAGCGCCCTTTCATCTCTATTGCTAGG
->read4751_contig0_position4596_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGTCGGAGCGATAGGGAGGACGTAAACGCCAATTCCGCTTAATAGCGCAATCTGCTGACTTGTGCATTCGTCGGCCTATTAGATACGGTACGGAATATT
->read4752_contig0_position6068_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTTTGTTATTTCACACTATTGTTCGGTGCGTGCGCTGCTCAGGCTGGTGCGACCCTTACAGCGTTATCCGTCCCGAACTGGCTTGAGCCACTCATAAGG
->read4753_contig0_position1436_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTCATCTCTGTTGCTAGGTCTCTTAAGCCTAATCAGGATCATAGATGGCCAATTATTGACCACAGGTAGGGGCGAGGTATAAATTAGTGGATTCACTTC
->read4754_contig0_position4608_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGGGAGGACGTAAACGCCAATTCCGCTTAATCGCGGAATCTGCTGGCTTGTGCATTCGTCGGCCTATTAGATACGGTACGGAATATTGGGTAACCTCCT
->read4755_contig0_position6870_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTTAACCCTTAGTCATAAGATGATACTTCATCTGCATGCGCGCATCTTCCTATTTTATGGTCTTAATTGAGTGTTCAGAGTTGGGGGTCACAGATGAGC
->read4756_contig0_position4091_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCAGCGAATCTAACATCAATCTGCACCACGAATATCGTCCAAGACGTTTTGAGCCGGTGACTAATTCGGTTGTCGCACATAGTGTACGTTGAGGCGGGA
->read4757_contig0_position3417_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTTAGAGACTGAGAACTCACCATATTGGTTGTACTGCCTGCCGTCGCCTCGCGCCCATAATGTTTGGAACTCGCAAACCTTTACACTCATCACATAGCA
->read4758_contig0_position5785_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGTGGCTATCTCAAATTGGGACCTAGTGTTGGCCAATAAGCTTCATATCGCCTTCTCAGATAGACTAATAGAACGAAGTCCATATAACAGCTGATTTAA
->read4759_contig0_position2349_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGTGTAAGAGTTGACGGGACTAAAACAGTATTGGGTGGTGCGGGGTACCCGACGCCTCTGCTGTCAAAGTGGGAAATCCAGTCTCGACTATATCTACTA
->read4760_contig0_position7169_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGTCCGCGTTCCATCGGTTAATTCAATGTCCGTCAATCGGGATGGCCAAAAATTCTACCCGTCCACCTGTCCGCTAGCAGCAGATTATACGGAATACAT
->read4761_contig0_position2012_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCGCATCGAGCAGCGTGCATTGGTCTTTCAGTCCCCATTCACCGGAGACGTCCGAGCTCGAACCCGTCCGGCTAAGAGGCAGGCAGTCGCTGCATGTGT
->read4762_contig0_position5245_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGCAGGGTGGTATATATGATCCTTGATAGCTTTATGGACATCATCATAGTAAATTTTTTCAGATTACCCTGCAGACGTCCGCCTAAGATCCTAGTTGAA
->read4763_contig0_position2241_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTTCTGGGGCAATTTCGGACGATTCGAGTGACCAGCGATAGTACGTTCCTTTTGTACTGAGTCTTAACATCGGCAAATGCGCCCTAGATACCTGCGGCT
->read4764_contig0_position1639_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCGGTCCGTTGACTTACCAACTTGATCGCCAGTGAGTGAGCGGTGGTTTATCTGTTGAGTGGCCACTTTTCCCTATCTGCTGGGACGGCACTGAAGATC
->read4765_contig0_position9109_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGGTTACATTAATCGCTTCTGTGATGACAGACGGAAGCCCACCTGTCCTGACCTCACCGCAGGCATCGAGTCTAACTCTGATTCGAGAGACGGATGTAA
->read4766_contig0_position9300_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTATCTTGAGAGCGTTTCTCCGTATGGAAATGTTCCGCTGTAAAGAACCTGGCGTCTCCTGACCATGGAGCTGCAACACTTTCACACAGGTAGCCGAAC
->read4767_contig0_position4551_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCTGCGACGGCATTGGCGATTATGGGCGTGCATAGAGTCCCGCAGTGTCGGAGCGATAGGGAGGACGTAAACGCCAATTCCGCTTAATAGCGGAATCTG
->read4768_contig0_position9656_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGCTCGTACTCGAAGGGGGAATCACCTTACTTAATCGGCTGGGGTAACGGCTGGTTTTGTACTACGGTATGGGGACCCGTGTGCCGAACGTCTGGAAAT
->read4769_contig0_position7276_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CACCGGCAGCTGAAATGATGCAGAAGCCTTGCTTGCCACTCCGCCGATGTCTAAAAGCGCCAGATCGACTTGACTCTACGTGCTGCAATGGAGATCCGCG
->read4770_contig0_position3818_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTATTCTAGTCAAGTGAAGAACCCGGGCCCAAAATTGGAACCCGTAATCTTCAAGTGAATCATCCGATCATGCAAACCTGATTATCTGCACGACTCTTAA
->read4771_contig0_position5500_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCTAAAATCGCGACTATAGATCTGTTTAGAACCACGACCCAGAAATCTTTAGCTAAGTAATCGACTGCCTTCGTCGGGCCGCTTATTGGTTCACCCAAT
->read4772_contig0_position7051_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGATAACCGCCTAAACAGTCTAATCTGGCCAATATACCCTGGGGGGAGCTAATATATCGCGGCGTCGAGTTACCGTTGCACCACCTCCAAGTGTCCATC
->read4773_contig0_position7331_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCGCCAGATCGACTTGACTCTACGTGCTGCAATGGAGAACCGCGGAAGGAACACTTTCTGGTGCCACTCGAGACCGCCCTCCCCGACCCATATGCAGTT
->read4774_contig0_position4917_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CATGACGTTGTGACATAAAGGTGCGGGACGCGGAAGCGCACCTCGTATAACGTTAGGGGTATCGTCACTGCATAGCAGAATGGGCGATCGGCCTACAAGA
->read4775_contig0_position5406_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGGGCGACCGTACCCGGACACCTGGCAGCGGGAACCGCTTTGACTCTGGAGTGCCAGCGATAGTATCTCAGAGGCGAAACCGCTTGTCACCTCATCTAA
->read4776_contig0_position5790_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCTATCTCAAATTGGGACCTAGTGTTGGCCAATAAGCTTCATATCGCCTTCTCAGATAGTCTAATAGAACGAAGTCCATATAACAGCTGATTTAAGAGGA
->read4777_contig0_position5974_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCCTAACAGCATGCCATCTAACGTTTGGACGGGTCTTGTGTTCCCTCAACACGTACGTTGACAGAGCTAACAATCCGTCGTCTGAATGTGATTCCTTTG
->read4778_contig0_position3760_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATAAATTCGACACGGGGTACGAAGGGTAAGAACACCTAGCCTGGCAATTACCCCTTTGTTATTCTAGTCAAGTGAAGAACCCGGGCCCAAAATTGGAACC
->read4779_contig0_position4018_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAATTATTTCCTGAGATGGTTTTAGTGAGAGCAGCAGATGCACTCTTAGCTCCGCTGATAACTATTACTATAAATCAGCGAATCTAACATCAATCTGCAC
->read4780_contig0_position2339_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTCACTCCACAGTGTAAGAGTTGACGGGACTAAAACAGTATTGGGCGGTGAGGGGTACCCGACGCCTCTGCTGTCAAAGTGGGAAATCCAGTCTCGACT
->read4781_contig0_position3063_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTCGTCAATGAAAACTGATCGAGCACTGTCCGCGAATCATTATTCAGTACAGCGACTTTTACCCTCGTGGTCTGAATGTTATGCCGTCCGACTCTTGCG
->read4782_contig0_position6010_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGTGTTCCCTCAACACGTACGTTGACAGAGCTAACAATCCTTCGACTGAATGTGAATCCTTTGTTATTTCACACTAGTGTTCGGTGCGTGCGCTGCTCA
->read4783_contig0_position8104_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCGCGGCCAATCAGCACGATCAAGCTAAAGACAGGGATTATGCACTAGCACGACCGCCGCAGGAAAGATCCGAGGCCTTTTCCAGGGTAAAATGATGGA
->read4784_contig0_position9244_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGGGCCTTTATACCCATACTGCCACTCCAGTACCTGGGCCGCGTGTTGTGCGCTGTGTATCTTGAGAGCGTTTCTCCGTATCGAAATGTTCCGCTGTAT
->read4785_contig0_position1847_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTGTATTTGTTCAATGGCAGGAGGTTAACTTTGCGGAGCGCAACCTATAACGATAATCAAATTGAGACAGACGAGTTGGAGTGTTTTGATGAGCGGTGT
->read4786_contig0_position3067_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCAATGAAAACTGATCGAGCACTGTCCGCGAAAAATTATTCAGTACAGCGACTTTTACCCTCGTGGCCTGAATGTTATGCCGTCCGACTCTTGCGCTCG
->read4787_contig0_position8195_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AATGATGGACTCATTGACCAACCCCTATTATTAGGAGAGGGCTGCGACTGCTTGCAGCTCCGACCGCTTTCCAATCGTTGCACATGACTTGAGCCTCGGA
->read4788_contig0_position151_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCAGCGTCCGATGGTCCGGTGGCCTCCAGATAGTGTCCAGTCGCTCTAACTGTATGGAGACCATAGGCATTTACCTTATTCTCATCGCCACGCCCCAAGA
->read4789_contig0_position1353_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GTACGGCTTGATGTCCGCGTCAGTTTGGGCGCCGGTATGTCTGTGTAAGGTTGGGCCAATCGAGACGACATTTCGCAGCGCCCTTTCATCTCTATTGCTA
->read4790_contig0_position8216_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCCTATTATTAGGAGAGGGCTGCGACTGCTTGCAGCTCCGACCGCTTTCCAATCGTTGCACATGACTTGAGGCTCGGACTCGTATCTGTCTCCGTGTTC
->read4791_contig0_position3316_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGCTAATGGTCACGGCCTCTCTGGGAAAGCTGAACAACGGATGGGATTAAGCTCAGCAGTCCGCCTCCAATCTCTCCGACGTTCATTCTCAAGCGTGTA
->read4792_contig0_position5447_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGACTCTGGAGTGCCAGCGATAGTATCTCAGAGGCGAAAGCGCTTGTCACCTCATCTAAAATCGCGACTATAGATCTGTTTAGAACCACGACCCAGAAAT
->read4793_contig0_position7117_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGAGTTACCGTTGCACCACCTCCAAGTGTCCATCGGAGTCCGCTTCCCGGGCTTGTCCGCGTCCCATCGGTTAATTCAATGTCCGTCAATCGGGTTGGCC
->read4794_contig0_position5452_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGGAGTGCCAGCGATAGTATCTCAGAGGCGAAAGCGCTTGACACCTCATCTAAAATCGCGACTATAGATCTGTTTAGAACCACGACCCAGAAATCTTTA
->read4795_contig0_position2973_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AATTGCGCTCCCGAACAACGCGTGAGTTTAAAATTGACTTGAAACCGCCTAGCTCGGACCACCAAAGAGCAAGACTCTATGACTAGCGGGTGTCGTCAAT
->read4796_contig0_position9683_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TTACTTAATCGGCTGGGGTAACAGCTGCTTTTGTACTACGGTATGGGAACCCGTTTGCCGAACGTCTGGAAATCTGTCGAGTCATATCGATGAACAGAGG
->read4797_contig0_position300_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTTCTAGCGTACTCCGCCTTGGGCCAAACAATTAATATAAGACGGGATAATGGCTTCATGCTCATGTTCTATACCGAGCAGAGAGGTTGGGTCTACCTA
->read4798_contig0_position7403_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GACCGCCCTCCCCGACCCATATGCAGTTTCTGCATACACCGGGTAGACAACCTTCTCAGCCCTTCGTTGAAAGGAGAATACAAATGACGGGAACTCTGAC
->read4799_contig0_position3668_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTCTCTGTTTCGTCGATTGTCTGAATATCGTGCAGTAAGTTTCTCTTAGGTTCCTCAACGGAAACGTCTCAGACCCACCTTAGACGCGGGAATAAATTC
->read4800_contig0_position1539_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGACATCTTGTTCTCACAACTGCACACTCCGATGCTCTGCCGAGCCTTCTAACCATCGGGTATGTACATTCACCTTTGGACGCTTCGATAGGACATGCA
->read4801_contig0_position5474_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCAGAGGCGAAAGCGCTTGTCACCTCATCTAAAATCGCGACTATAGATCTGTTTAGAACCACGACCCAGAAATCTTTAGCTAAGTAATCGACTGCCTTCG
->read4802_contig0_position2264_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCGAGTGACCAGCGATAGTACGTTCCTTTTGTACTGAGTGTTAACATCGGCAAATGCGCCCTAGATACCTGCGGCTTCACTCCACAGTGTAAGAGTTGA
->read4803_contig0_position3712_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTTAGGTTCCTCAACGGAAACGTCTCAGACCCACCTTAGACGCGGGAATAAATTCGACACGGGGTACGAAGGGTAAGAACACCTAGCCTGGCAATTACC
->read4804_contig0_position8320_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGATAACTCTGCGACCTGAATGACCTTGGGCTAGTCGACATTCCTGGTAGTAATCCGATCTCAATTCCTGCGGTACCGAGCAGCTTTGAGTTTTTGTAAG
->read4805_contig0_position6788_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCTCGCTTGGGTCTCTACATCCGCTGATACGCGCGAGCTCTCACCCACGACTGTACCCCGGTTAAGATTTATAAAGCATACATTTAACCCTTAGTCATA
->read4806_contig0_position3348_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAACAACGGATGGGATTAAGCTCAGCAGTCCGCCTCCAATCTCTCCGACGTTCATTCTCAAGGGTGTAGTTTTAGAGACTGAGAACTCACCCTATTGGTA
->read4807_contig0_position9315_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTCTCCGTATCGAAATGTTCCGCTGTAAAGAACCTGGCGGATCCTGACCATGGAGCTGCAACACTTTCACACAGGTAGCCGAACAGGTATTACTCAGAC
->read4808_contig0_position4657_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTGCATTCGTCGGCCTATTAGATACGGTACGGAATATTGGGTAACCTCCTCTTCACTGATATCATCCTATCGGCGTTCAAAGTATTCGGCGGATGAATT
->read4809_contig0_position9266_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CCACTCCAGTACCTGGGCCGCGTGTTGTACGGTGTGTATCTTGAGAGCGTTTCTCCGTATCGAAATGTTCCGCTGTAAGGAACCTGGCGTATCCTGACCA
->read4810_contig0_position2584_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTTACGGTGATTACCCGTCCATCGATGCCCCTCCTGTCCCGAAGCCTTAAAATCTAACCCTGAATTGGCTTTATCCACCCCCCCTACTGGCCACCACTG
->read4811_contig0_position667_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGAGTGGGACACCGGCCTACTACATTATACAGTAAGGTAGAATCGCGTAGAAGCACCCACGATCAATGTTATTAACCGCGACGGTGTCTTACACGACCTA
->read4812_contig0_position2908_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGCGTTTACCTTAAGACGAAAGAGTCAGTAGAGTTGGGGTTCCTGCTTTAATGACCCGTAGCCCAATTGCGCTCCCGAACAACGCGTGAGTTTAAAATT
->read4813_contig0_position5566_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCCTTCGTCGGGCCGCTTATTGGTTCACCCAATCTGGACATTGCAAGTTTGGCAGACGCGAGGTTGCGTGGTCAACCGAACGTTGCTTTCCTTAGGGTA
->read4814_contig0_position2824_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGTGCCCATTGCATTGTAGCCTGAACTATTAGCAATCCTAAGCTCATAAGCCCTGCCCCACGGGGGCTACAATCCAGCAGTGAACGCGTTTACCTTAAG
->read4815_contig0_position5766_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCTTGGTTGTTTTCTGAATTGTGGCTATCTCAAATTGGGACCTAGTGTTGGCCAATAAGCTTCATATCGGCTTCTCAGATAGACTAATAGAACGAAGTC
->read4816_contig0_position1153_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCACGTACGTGTCAACATGGCGCGGCTCTCTATACCTCGCAAAGAATCACTCTATGGGTCATCTTGAGAGAATAGTCGACTAGTAGCGAATATATGTTCT
->read4817_contig0_position2997_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTTTAAAATTGACTTGAAACCGCCTAGCTCGGACCACCAAAGAGCAAGACTCTATGACTAGCGGGTGTCGTCAATGAAAACTGATCGAGCACTCTCCGC
->read4818_contig0_position6794_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTGGGTCTCTGCATCCGCTGATACGCGCGAGCTCTCACCCACGACTGTACCCCGGTTAAGATTTATAAACCATACATTTAACCCTTAGTCATAAGATGA
->read4819_contig0_position3287_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGTCTAGGAGGGCGTGCAGGGTCTCCCGCTAGCTAATGGTCACGGCCTCTCTGGGAAAGCTGAACAACGGATGGGATTAAGCTCAGCAGTCCGCCTCCAA
->read4820_contig0_position1760_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAAGTAATACGGTTGATGTTATTACCAACTCCACTTCTGCAAATTGTTATGAGCAAGCATACAAGTTAGCCGGCCCACAAATCGACGTGTGTATTTGTTC
->read4821_contig0_position1425_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGCAGCGCCCTTTCATCTCTATTGCTAGGTCTCTTAAGCCTAATCAGGATCATAGATGGCCAATTATTGACCACAGGTAGGGGCGAGGTATAAATTAGT
->read4822_contig0_position8618_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGCGTAAGACACTGCCTAAAGGGAACATATGTGTCCAGAATAGGGTTCAACGGTGTATGAGCAAACGATGCGGTAAGACGAGCGCTCCGACCCCCCTTG
->read4823_contig0_position8733_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTCAGCGTGTAAGAGCCCGCTTAGCCGGTGGTGATACCTACTATTGACTGGGGGCTTACTGAGTACACTTCATCTGTGTGGCAAAGTTGCGACACCGCG
->read4824_contig0_position2844_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTGAACTATTAGCAATCCTAAGCCCATAAGCCCTGCCCCACGGGAGCTACAATCCAGCAGTGAACGCGTTTACCTTAAGACGAAAGAGTCAGTAGAGTT
->read4825_contig0_position1531_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTTCCCTTTGACATCTTGTTCTCACAACTGCACACTCCGATGCTCTGCCGAGCCTTCTAACCATCGGGTATGTACATTCACCTTTGGACGCTTCGATGG
->read4826_contig0_position8565_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGGCCATATTAATTCTACTCAGATTGTCTGTAACCGGGGCTTCGGGCGTATTTTTGCGTAAGACACTGCCTAAAGGGAATATATGTGTCCAGAATAGGGT
->read4827_contig0_position7297_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGAAGCCTTGCTTGCCACTCCGCCGATGTCTAAAAGCGCCAGATCGACTTGACTCTACGTGCTGCAATGGAGAACCGCGGAAGGAACACTTTCTGGTGCC
->read4828_contig0_position2240_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCTTCTGGGGGAATTTCTGACGATTCGAGTGACCAGCGATAGTGCGTTCCTTTTGTACTGAGTCTTAACATCGGCAAATGCGCCCTAGATACCTGCGGC
->read4829_contig0_position4342_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGCATGGAAAGTGCCAATATCCCCGGGAGTCCCGCACTACTGAGACGAAGTCTAGCTAGCTTGACTCGGCTGATAAAGAAAACAATCTATATGTAACCG
->read4830_contig0_position7861_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTTGGGGTGATTTGTGCCGGCGCGTCCAGGTGCGGACGTTGTGCCGTGTCTCTCTGTAGCTCTAATACCAATTGAAATGAAGCTTACGCAAACTACTCGA
->read4831_contig0_position4221_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCAGACTCTAACAAGTGGTCAGTACAGGTTCGACCATACGCGACGGCAAACAGAATCGCACGTCAACTATCCCCTTTATTAATGATCCGTGTCACCCGAC
->read4832_contig0_position4781_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGCGCATAACCGGCGAGTGCTCTGAAACGTTACATTCGTCTATCCGCACACACCGCCGTTGGATGTGTCCCACAGTGTTTTATACGGGACGGTGGCCAC
->read4833_contig0_position2906_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAACGCGTTTACCTTAAGACGAAAGAGTCAGTAGAGTTGGGGTTCGTGCTTTAATGACCCGTAGCCCAATTGCGCTCCCGAACAACGCGTGAGTTTAAAA
->read4834_contig0_position2347_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CACAGTGTAACACTTGACGGGACTAAAACAGTATTGGGCGGTGAGGGGTACCCGACGCCTCTGCTGTCAAAGTGGGAAATCCAGTCTCGACTATATCTAC
->read4835_contig0_position514_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGCTCACGTGGGACGCATGTACTTACCTAACATGAAGCGGTAATGGAGCTCGAACACTAGTCGGTGGCTCTTCTGTCTCTGGCGGGGACGGCTATGTGA
->read4836_contig0_position7065_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-AACAGTCTAATCTGACCAATATACCCTGGGGGGAGCTAATATATCGCGGCGTCGAGTTACCGTTGCACCACCTCCAAGTCTCCATCGGAGTCAGCTTCCC
->read4837_contig0_position2862_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTAAGCCCATAAGCCCTGCCCCACGGGGGCTACAATCCAGCAGTGAACGCGTTTACCTTAAGACGAAAGAGTCAGTAGAGTTGGGGTCCGTGCTTTAATG
->read4838_contig0_position1973_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GCACCACACAATTTCAGCATAAAGCATCCGGTTGAAGGCTGCGCATCGAGCAGCGAGCATTGGTCTTTCAGTCCCCAGTCACCGGAGACGTCCGAGCTCG
->read4839_contig0_position5169_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCCAATTCGTTGTATTGATCGCTGTGCACTTTAATATTCGGAACATCTTAACCAAAGCATATTAATATGCCAGCCGCGCAGGGTGGTATATATGATCCT
->read4840_contig0_position8732_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-AATTCAGCGTGTAACAGCCCGCTTATCTGGTGGTGATACCTACTATTGACTGGGGGCTTACTGAGAACACTTCATCAGTATGGCAAAGTTGCGACACCGC
->read4841_contig0_position6114_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTGCGACCCTTACAGCGTTATCCGTCCCGAACTGGCTTGAGCCACTCATAAGGCACGCGCGGGCCATAACAGTCGACTAAAAGGCGTAACCGATTCTGC
->read4842_contig0_position2294_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTACTGAATCTTAACATCGGCAAATGCGCCCTTGATACCTGCGGCTTCACTCCACAGTGTAAGAGTTGATGGGACTAAAACAGTATTGGGGGGTGAGGG
->read4843_contig0_position6649_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTATAAAATGGACTGCTATCTAGGCGTTAAAGTAGTAGAACGAGGGTTGGGCGATTTGTTTTGGTAGTGGTCATCGCATTGCAAGAACGTACGGACGGAC
->read4844_contig0_position1428_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGCGCCCTTTCATCTCTATTGCTAGGTCTCTTAAGCCTAATCAGGATCATAGATGGCCAATTATTGACCACAGGTAGGGGCGAGGTATAAATTAGTGGA
->read4845_contig0_position958_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGACGATCGCAGCGGAGTCGATATAATTGCAGTATCATGTATTGCTGATTGTGGGGGGCATGGGGGTTCCGCATTGGCGCAAAGGTACCGCAAAGGGCC
->read4846_contig0_position522_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGGGACGCATGTACTTACCTAACATGAAGCGGTAATGGAGCTCGGACACTAGTCGGTGGCTCTTCTGTCTTAGGCGGGGACGGCTATGTGAGTTCATAA
->read4847_contig0_position8003_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAAGATTGTGATACTAGCTTTCAGTCATTCCCCCTCAGTTTTGTCCATGTGGAGAATATGCATTCGACCAAATGAAAATGTCAATAATCTCGACCCTGTA
->read4848_contig0_position5403_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGACGGGCGACCGTACCCGGACACCTGGCAGCGGGAACCGCTTTGACTCTGGAGTGCCAGCGATAGTATCTCAGAGGCGAAAGCGCTTGTCACCTCATC
->read4849_contig0_position2944_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGGTTCGTGCTTTAATGACCTGTAGCCCAATTGCGCTCCCGAACAACGCGTGAGTTTAAAATTGACTTGAAACCGCCTAGCTCGGACCACCAAAGAGCA
->read4850_contig0_position9273_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTACCTGGGCCGCGTGTTGTACGCTGTGTATCTTGAGAGCGTTTCTCCGTATCGAAATGTTCCGCTGTAAAGAACCTGGCGTATCCTGACCATGGAGCT
->read4851_contig0_position2023_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGCGTGCATTGGTCTTTCAGTCCCCAGTCACCGGAGACGTCCGAGCTCGAACCCGTCCGGCTAAGAGGCAGGCAGTCGCTGCATGTGTCCGCAGCGGTC
->read4852_contig0_position2634_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AAATCTAACTCTGAATTGGCTTTATCCACCCCCCCTAGTGGCCACCACTGGGGCGCGAGTCTCGAGCCTCTCGACTCCAAAGGGTCTGCCCGAGACAGGT
->read4853_contig0_position1401_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTTGGGCCAATCGAGAGGACATTTCGCAGCGCCCTTTCATCTCTATTGCTAGGTCTCTTAAGCCTAATCAGGATCATAGATGGCCAATTATTGACCACA
->read4854_contig0_position3328_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGGCCTCTCTGGGAAAGCTGAACAACGGATGGGATTAAGCTCAGCAGTCCGCCTCCAATCTCTCCGACGTTCATTCTCAAGGGTGTACTTTTAGAGACT
->read4855_contig0_position6311_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CTTCTTATATTGTGTGCAAGCTACTTCTAGACCTTATTAAGTGCCCAGGAACTCCTAGGAAGGCGCGCAGCTCAAGCAATCATACATGGCGGAATGCCTG
->read4856_contig0_position6790_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCGCTTGGGTCTCTACATCCGCTGATACGCGCGAGCTCTCACCCACGACTGTACCCCGGTTAAGATTTATAAACCATACATTTAACCCTTAGTCATAAG
->read4857_contig0_position5163_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTCTCGGCCAATTCGTTGTATTGATCGCTGTGCACTTTAAAATTCGGAACATCTTAACCAAAGCATATTAATATGCCAGCAGCGCAGGGTGGTATATAT
->read4858_contig0_position1528_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCACTTCCCTTTGACATCTTGTTCTCACAACTGCACACTCCGATGCTCTGCCGAGCCTTCTAACCATCGGGTATGTACATTCACCTTTGGACGCTTCGA
->read4859_contig0_position7636_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGTGTGCTGAGGGCCGACGCCCGGGGACCGTGATATCCTTGCGAGTGGAATGCGAAAACGGCATAAGCGCAATGACCGAGGTAACAAGCCATGAGGACT
->read4860_contig0_position3754_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGGGAATAAATTCGACACGGGGTACGAAGGGTAAGAACACCTAGCCTGGCAATTACCCCTTTGTTATTCTAGTCAAGTGAAGAACCCGGGACCAAAATT
->read4861_contig0_position1078_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTATTACCGGTCAGCTCCAGTTACGTAACGGACGTAGAGAGCCTTTGAATGTGTACGGCAATAGGAGAAACTCGGCCACGTACGTGTCAACATGGCGCGG
->read4862_contig0_position2501_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TATGCAGATTTCGTACCTTGCCACTGCTACCTCCGGCATATGGGCGTGCTATAAATGCGGGAGTCAGGACGATAGAGCGAAGTAGTTACGGTGATTACCC
->read4863_contig0_position1355_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGGCTTGATGTCAGGGTCAGTTTGGGCGCCGGTATGTCTGTGTAAGGTTGGGCCAATCGAGAGGACATTTCGCAGCGCCCTTTCATCTCTATTGTTAGG
->read4864_contig0_position3163_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCGGATGTCCGCAATGGGTTATCAAATGCCTATGTTCCGGTAATCTCTCATCTACTAAGCGCCCTAAAGGTCGTATGGTTGGAGGACGGTTACACACCC
->read4865_contig0_position7173_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCCGTCCCATCGGTTAATTCAATGTCCGTCAATCGGGTTGGCCAAAAATTCTACCTGTCCACCTGTCCGCTAGACGCAGATTATACGGAATACATATCC
->read4866_contig0_position2908_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGCGTTTACCTTAAGACGAAAGAATCAGTAGATTTGGGGTTCGTGCTTTAATGACCCGTAGCCCAATTGCGCTCCCGAACAACGCGTGAGTTTAAAATT
->read4867_contig0_position4327_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGAGGAGACCCGTAATGCATGGAAAGTGCCAATATCCCCCGGAGTCCCGCACTACTGAGACGAAGTCTAGCTAGCTTGACTCGGCTGATAAAGAAAACA
->read4868_contig0_position5820_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AATAAGCTTCATATCGCCTTCTCAGATAGACTAATAGAACGAAGTCCATATAACAGCTGATTTAAGAGGAAGAATTGAACATCAACGGAAGTACTATAGC
->read4869_contig0_position1544_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCTTGTTCTCACAACTGCACACTCCGATGCTCTGCCGAGCCTTCTAACCATCGGGTATGTACATTCACCTTTGGACGCTTCGATAGGACATGCACCCGG
->read4870_contig0_position3104_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TATTCAGTACAGCGACTTTTACCCTCGTGGTCTGAATGTTATGCCGTCCGACTCTTGCGCTCGGATGTCCGCAATGGGTTATCAAATGCCTATGTTCCGG
->read4871_contig0_position6954_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGGTCACAGATGAGCGTTCCGATTGTCCTTTCCCAGGCTACGGCCTTATACCAAAGACTTCTAGACCGGAGAGACTACTTCCAGCCACGAATTCGTGTG
->read4872_contig0_position4532_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGGTCAGGCATGCTTACCTCCTGCGACGGCATTGGCGATTATGGGCGTGCGTAGAGTCCCGCAGTGTCGGAGCGATAGGGAGGACGTAAACGCCAATTC
->read4873_contig0_position6401_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAATGCCTGTCCACCGGGGGTTCTACTGTACCGCAGTGGCCTGGATAGCTAAGCAGGTCCTGGCTTGGCATGTCATCCGGAGTGGTAGGCACTGCTCAC
->read4874_contig0_position739_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TAACCGCGACGGTGTATTCCACAACCTAATTTTTCCCGTCTCTGTGGTCAACCTGGACGCACAAACCCTAGTCCCATATAAAGCTATTCCATGCCGGGTG
->read4875_contig0_position5945_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCATTGTGAACCCGGCATCTCGTGATTCGAGCCTAACAGCATGCCATCTAACGTTTGGACGGGTCTTGTGTTCCCTCAACACGTACGTTGACAGAGCTAA
->read4876_contig0_position4857_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGTTTTATACGGGACGGTGGCCGCGGGGTGAGCACATGAATGGGGTACGGTTTTACCGTCCATGACGTTGTGACATAAAGGTGCGGGACGCGGAAGCGCA
->read4877_contig0_position9751_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAAATCTGTCGAGTCATATCGATGAACAGAGACTAAATGTCCTTAAATCTCTAACACGATTTTAGTAGGTCTACTACTAGGCCGCTTGCTCAGAAATCGG
->read4878_contig0_position8683_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGATGCGGTAAGACGAGCGCTCCGACCCCCCTTGGCTCTGCTACATCGAATTCAGCGTGTAAGAGCCCGCTTATCCGGTGGTGATACCTACTATTGACT
->read4879_contig0_position1226_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AGTCGACTAGTAGCGAATATATGTTCTGCTCCGAGACTTCGGCATAAATCTAAATATGGACTCTTATATTCCCTCCTGCGTAGTGCTCTCCCATAATAAG
->read4880_contig0_position8563_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-TGAGGCCATATTAATTATACTCAGATTGTCTATAACAGGAGCTTCGGGCGTATTTTTGCGTAAGACACTGCCTAAAGGGAACATATGTGTCCAGAATAGG
->read4881_contig0_position525_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGACGCATGTACTTACCTAACATGAAGCGGTAATGGAGCTCGAACACTAGTCGGTGGCTCTTCTGTCTCTGGCGGGGACGGCTATGTGAGTTCATAAATC
->read4882_contig0_position4485_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGACGGACATAACTACTGAGTGTCCGCCCTCGGCTAATCTTGAACACCGGTCAGGCATGCTTACCTCCTGCGACGGCATTGGCGATTATGGGCGTGCAT
->read4883_contig0_position8895_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCACCGTACGAAAAGGATGGTTGAAATAGAACGAGTTGTAAAACATTAGCTCACGCGCCACCGTCATAGGCTGCATATTGAGACAGGGTTGAAAACCTGT
->read4884_contig0_position2476_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATTAGGTAGTGTGCGCGAGGTGGAGAATGCAGATTTCGTACCTTGCCACTGCTACCTCCGGCATATGGGCGTGCTATAAATGCGGGAGTCAGGACGATAG
->read4885_contig0_position4573_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGGGCGTGCATAGAGTCCCGCAGTGTCGGAGCGATAGGGAGGACGTAAACGCCAATTCCGCTTAATAGCGGAATCTGCTGGCTTGTGCATTCGTCGGCC
->read4886_contig0_position8160_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCGCAGGAAAGATCCGAGGCCTTTTCCAGGGTAAAATGATGGACTCATTGACCAACCCCTATTATTAGGAGAGGGCTGCGACTGCTTGCAGCTCCGACC
->read4887_contig0_position7118_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGTTACCGTTGCACCACCTCCAAGTGTCCATCGGAGTCCGCTTCCCGGGCTTGTCCGCGTCCCATCGGTTAGTTCAATGTCCGTCAATCGGGTTGGCCA
->read4888_contig0_position750_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGTATTCCACGACCTAATTTTTCCCGTCTCTGTGGTCAACCTGGACGCACAAACCCTAGTCCCATATAAAGCTATTCCACGCCGGGTGGCCTGGACGTC
->read4889_contig0_position146_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACATTGCAGCGTCCGATGGTCCGGTGGCCTCCAGATAGTGTCCAGTCGCTCTAACCGTATGGAGACCATAGGCATTTACCTTATTCTCATCGCCACGCCC
->read4890_contig0_position6178_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CCATAACAGTCGACTAAAAGGCGTAACCGATTCTGCTACGTTATAACAAAGGGACGAGTGGTGTCAACAGTTCTTCTTCTTTCCTGTACGGTAATGCTTC
->read4891_contig0_position9068_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCATGAGGCCATATGCGCCTGTCACGGGCATGCTGAAAGCGGCGGTTACATTAATCGCTTCTGTGATGACAGACCGAAGCCCTCCTGTCCTGACCTCACC
->read4892_contig0_position5337_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TATTTGAATTGATCAATTGAGTCCAGTACACCATATCAACACCTTGATCGTTCCACTTCAATCAGCAAGACGGGCGACCGTACCCGGACACCTGGCAGCG
->read4893_contig0_position5241_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCCGCGCAGGGTCGTATATATGATCCTTGATAGCTTTATGGCCATCATCATAGTAAATTTTTTCAAATTACCCTGCAGACGTCCGCCTAAGATCCTAGT
->read4894_contig0_position6341_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACCTTATTAGGTGCCCAGGAATTCCTAGGAAGGCGCGCAGCTCAAGCAATCATACATGGCGGAATGCCTGTCCACCGGGGGTTCTACTGTACCACAGTGG
->read4895_contig0_position4688_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAATATTGGGTAACCTCCTCTTCACTGATATCATCCGATCGGCGTTCAAAGTATTCGGCGGATGAATTAGAGCCAAAGCAGTAGGTTACCGTCGGCGCA
->read4896_contig0_position334_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AATATAAGACGGGATAATGGCTTCATGCTCATGTTCTATACCGAGCAGAGAGGTTGGATCTACCCAGTAGTGTCGCGGTTATCGGACAGAGGATTATGTA
->read4897_contig0_position9768_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCGATGAACAGAGACTAAATGTCCTTAAATCTCTAACACGATTTTAGTAGGTCTACTACTAGGCCGCTTGCTCAGAAATCGGAACACAAGTACGCGATC
->read4898_contig0_position450_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTAGCGTAGTTAGTAACTTCAATCCGCGTTACGCTTTGTCCTCTGCTACGCCTCGATTGGTTTCAGCTCACGTGGGACGCATGTACTTACCTAACATGA
->read4899_contig0_position8881_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGAAACCGGTGCATCACCGTATGAAAAGGATGGTTGAAATAGAACGAGTTGTAAAACATTAGCTCACGCGCCACCGTCATAGGCTGCATATTGAGACAG
->read4900_contig0_position4374_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGCACTACTGAGACGAAGTCTAGCTAGCTTCACTCGGCTGATAAAGAAAACAATCTATATGGAACCGAGGGGCGGGATGATAATTGTTCTTAGTATAGT
->read4901_contig0_position2644_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGAATTGGCTTTATCCACCCCCCCTACTGGCCACCACTGGGGCGCGAGTCTCGAGCCTCTCGACTCCAAAGGGTCTGCCCGAGACAGGTTCACCGAGTC
->read4902_contig0_position2598_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCGTCCATCGATGCCCCTCCTGTCCCGAAGCCTTAAAATCTAACCCTGAATTGGCTTTATCCACCCCCCCTACTGGCCACCACTGGGGCGCGAGTCTCG
->read4903_contig0_position1598_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTATGTACATTCACCTTTGGATGCTTCGATAGGACATGCACCCGGTCCGTTGACTTACCAACTTGATCGCCAGTGAGTGAGCGGTGGTTTATCTGTTGC
->read4904_contig0_position4900_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTACGGTTTTACCGTCCTTGACGTTGTGACATAAAGGTGCGGGACGCGGAAGCGCACCTCGTAGAACGTTAGGGGTATCGTCACTGCATAGCAGAATGG
->read4905_contig0_position3872_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGAATCATCAGATCATGCAAACCTGATTATCTGCACGACTCTTAAAATCATGCACTAAGCATAGAATGCACGACTACTTGTTACTGAAGTCGGCATGAC
->read4906_contig0_position4510_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCCCTCGGCTAATCATGAACACCGGTCAGGCATGCTTACCTCCTGCGACGGCATGGGCGATTATGGGCGTGCATAGAGTCCCGCAGTGTCGGAGCGCTA
->read4907_contig0_position7768_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTGTGCTGACCTTATGTCCATATCGATACAAGATGGCCAGTGCGGAAGCGGAGCCACACTCGCCGTTACTGACTGATTGACAATCCAGCCCGTTTGGGG
->read4908_contig0_position9159_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GACCTCACCGCAGGCATCGAGTCTAACTCTGATTCGAGAGACGGATGTAATTGAGTCAGGTCGGAACCGCTGGCAGAGCACCTCCGAGGGCCTTTATACC
->read4909_contig0_position6015_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCCCTCAACACGTACGTTGACAGAGCTAACAATCCGTCGACTGAATGTGATTCCTTTGTTATTTCACACTATTGGTCGGTGCGTGCGCTGCTCAGGCTG
->read4910_contig0_position6526_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCGCGCCTGCGTCCGGTAGACCAGCGATGGATTTAGACCGTTCACTGAACCCTCTAATAGGACCTCTTGCCCATCCGAGGCTTAAGCAGCGACTCCACA
->read4911_contig0_position1574_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCTGCCGAGCCTTCTAACCATCGGGTATGTACATTCACCTTTGGACGCTTCGATAGGACATGCACCCGGTCCGTTGACTTACCAACTTGATCGCCAGTG
->read4912_contig0_position5739_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTACAATAAGATTACGGATAGCCCGTGGCTTGGTAGTTTTCTGAATTGTGGCTATCTCAAATTGGGACCTAGTGTTGGCCAATAAGCTTCATATCGCCT
->read4913_contig0_position8683_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGATGCGGTAAGACGAGCGCTCCGACCCCCCTTGGCTATGCTACATCGAATTCAGCGTGTAAGAGCCCGCTTATCCGGTGGTGATACCTACTATTGACT
->read4914_contig0_position4224_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GACTCTAACAAGTGGTCAGTACAGGTTCGACCATACTCGACGGCAAACAGAATCGTACGTCAACTATCCCCTTTATTAATGATCCGTGTCCCCCGACCGT
->read4915_contig0_position296_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCTAGTTCTAGCATACTCCGCCTTGGGCCACACAATTAATATAAGACGGGATAATGGCTTCATGCTCATGTTCTATACCGAGCAGAGAGGTTGGGTCTA
->read4916_contig0_position1913_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GACAGACGAGTTGGAGTGTTTTGATGAGCGGTGTGATATTAGTCCTAACTTAGCACTATCGCACCACAAAATTTCAGCATAAAGCATCCGGTTGAAGGCT
->read4917_contig0_position6667_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTAGGCGTTAAAGTAGTAGAACGAGGGTCGGGCGATTTGTTTTGGTAGTGGATATCGCATTGCAAGAACGTACGGACGGACAAAATGTCGGACACCGCC
->read4918_contig0_position6217_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTTATAAAAAAGGGACGAGTGGGGTCAACAGTTCTTCTTCTTTCCTGTACGGTAATGCTTCCGCGCATCTAAGTGATATTCGCCGGAATTTACCCTTCTA
->read4919_contig0_position529_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCATGTACTTACCTAACATGAAGCGGTAATGAAGCTCGAACACTAGTCGGTGGCTCTTCTGTCTCTGGCGGGGACGGCTATGTGAGTTCATAAATCTCAA
->read4920_contig0_position1343_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGTATTTTTGTACGGCTTGATGTCAGGGTCAGTTTGGGCGCCGGTATGTCTGTGTAAGGTTGGGCCAATCGAGAGGACATTTCGCAGCGCCCTTTCATC
->read4921_contig0_position9555_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATCCTGAGCTCCCCCGCGATTAACCTATGTCGGGACAAACACTCGATTGAGCAGTGGTCATGTCATTATTGTACATCAGTACCATAGCTTGGCCACATGT
->read4922_contig0_position5979_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-AACAGCATGCCATCTAACGTTTGGACGGGTCTAGTGTTCCCTCAACACGTACGTTGACAGAGCTCACAATCCGTCGACTGAATGTGATACCTTTGTTATT
->read4923_contig0_position6190_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ACGAAAAGGCGTAACCGATTCTGCTACGTTATGAAAAAGGGACGAGTGGGGTCAACAGTTCTTCTTCTTTCCTGTACGGTAATGCTTCCGCGCATCTAAG
->read4924_contig0_position5955_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCGGCATCTCGTGATCCGAGCCTAACAGCATGCCATCTAACGTTTGGACGGGTCTTGTGTTCCCTCAACACGTACGTTGACAGAGCTAACAATCCGTCG
->read4925_contig0_position91_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGCATCGAGCGGTGTCGCTAGCGCAATGCGCAAGATTTTGACATTTACAAGGCAACATTGCAGCGTCCGATGGTCCGGTGGCCTCCAGATAGTGTCCAG
->read4926_contig0_position2967_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGCCCAATTGCGCTCCCGAACAACGCGTGAGTTTAAAATTGACTTGAAACCGCCTAGCTCGGACCACCAAAGAGCAAGACTCTATGACTAGCGTGTGTC
->read4927_contig0_position1086_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGTCAGCTCCAGTTACGTTACGGACGTAGAGAGCCTTTGAATGTGTACGGCAATAGGAGAAACTCGGCCACGTACGTGTCAACATGGCGCGGCTCTCTAT
->read4928_contig0_position5999_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGGACGGGTCTGGTGTTCCCTCAACACGTACGTTGACAGAGCTAACAATCCGTCGACTGAATGTGATTCCTTTGTTCTTTCACACTATTGTTCGGTGCG
->read4929_contig0_position9575_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TAACCTATGTCGGGACAAACACTCGATTGAGCAGTGGTCATGTCATTATTGTACATCAGTACCATAGCTTGGCCACATGTGATGCTCGTACTCGATGGGG
->read4930_contig0_position4730_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGTTCAAAGTATTCGGCGGATGAATTAGAGCCAAAGCACTAGGTTACCGTCGGCGCATAACCGGCGAGTGCTCTGAAACGTTACATTCGTCTATCCGCA
->read4931_contig0_position1441_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTCTATTGCTAGGTCTCTTAAGCGTAGTCAGGATCATAGATGGCCAATTATTGACCACAGGTAGGGGCGAGGTATAAATTAGTGGATTCACTTCCCTTT
->read4932_contig0_position1312_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTCCCATAATAAGTGAACCCATGGGTCGCGCTGTATTTTTGTACGGCTTGATGTCAGGGTCAGTTTGGGCGCCGGTATGTCTGTGTAAGGTTGGGCCAA
->read4933_contig0_position7336_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGATCGACTTGACTCTACGTGCTGCAATGGAGAACCGCGGAAGGAACACTTTCTGGTGCCACTCGAGACCGCCCTCCCCGACCCATATGCAGTTTCTGC
->read4934_contig0_position4493_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CATAACTACTGAGTGTCCGCACGCGGCTAATCATGAACACCGGTCAGGCATGCTTACCTCCTGCGACGGCATTGGCGATTATGGGCGTGCATAGAGTCCC
->read4935_contig0_position3400_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CATTCTCAAGGGTATAGTTTTAGAGACTGAGAACTCACCCTATTGGTAGTACTGCCTGCCGTCGCCTCGCGCTCATAATGTTTGGAACTCGCAAACCTTT
->read4936_contig0_position6591_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TCTTGCCCATCCGAGGCTTAAGCAGCGACTCCACATGGAGCGATGGGTCCTCAAGGCAGTATAAAATGGACTGCTATCTAGGCGTTAAAGTAGTAGAACG
->read4937_contig0_position8220_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TATTATTAGGAGAGGGCTGCGACTGCTTGCAGCTCCGACCGCTTTCCAATCGTTGCACATGACTTGAGGCTCGGACTCGTATCTGTCTCCGTGTTCCTTT
->read4938_contig0_position1521_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TAGTGGATTCACTTCCCTTTGACATCTTGTTCTCACAACTGCACACTCCGATGCTCTGCCGAGCCTTCTAACCATCGGGTATGTACATTCACCTTTGGAC
->read4939_contig0_position4577_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCGTGCATAGAGTCCCGCAGTGTCGGAGCGAGAGGGAGGACGTAAACGCCAATTCCGCTTAATAGCGGAATCTGCTGGCTTGTGCATTCGTCGGCCTATT
->read4940_contig0_position2014_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCATCGAGCAGCGTGCATTGGTCTTTCAGTCCCCAGTCACCGGCGACGTCCGAGCTCGAACCCGTCCGGCTAAGAGGCAGGCAGTCGCTGCATGTGTAC
->read4941_contig0_position1937_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGAGCGGTGTTATATTTGTCCTAACTTAGCACTATCGCACCACAAAATTTCAGCATAAAGCATCCGGTTGAAGGCTGCGCATCGAGCAGCGTGCATTGGT
->read4942_contig0_position8998_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-AAGCCCGTGCTTCCCTACCCAGCCTAGGCGCCTTAACTTTATGCATACTCGTTTAGTACAGGGCCGCGCCCCATGAGGCCATATGCGCCTGTCACGGGCA
->read4943_contig0_position6581_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGTAGGACCTCTTGCCCATCCGAGGCTTAAGCAGCGACTCCACATGGAGCGATGGGTCCTCAAGGCAGTATAAAATGGACTGCTATCTAGGCGTTAAAG
->read4944_contig0_position858_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGGCTTTGGGAATCACTAGGTAATTACTGTTGGCTCCTTTCTTCATGATCGTCGGAGTTCCTTCAGGCCGATCAAGTGGTTAGAGACCTAGGTCTATGC
->read4945_contig0_position3967_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGACTATCAAACCTATTTAATGATATAAGCTCTTGGACAACACGAGGTCGTAATTATTTCCTGAGATGGTTTTAGTGAGAGCAGCAGATGCACTCTTAG
->read4946_contig0_position5923_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTCACCAGCATGAAAGACATCCTCATTGTGAACCCGGCATCTCGTGATTCGAGCCTAACAGCATGCCATCTAACGTTTGGACGGGTCTTGTGCTCCCTCA
->read4947_contig0_position269_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTTTAACCACTAACATAACGCGTGTCATCTAGTTCTAGCATACTCCGCCTTGGGCCACACAATTAATATGAGACGGGATAATGGCTTCTTGCTCATGTT
->read4948_contig0_position5169_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCCAATTCGTTGTATTGATCGCTGTGCACTTTAAAATTCGGAACATCTTAACCAAAGCATATTAATATGCCAGCCGCGCAGGGTGGTATATATGATCCT
->read4949_contig0_position727_M4_I0_D0_NG0______er0.01__indel0__rgeom0
-GATCGATGTTATTAACCGCGACGGTGTATTCCACGACCTAATTTTTCCCGTCTCTGTGGTCAGCCTGGACGCTCAAACCCTATTCCCATATAAAGCTATT
->read4950_contig0_position4163_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCGCACATAGTGTACGTTGAGGCGGGAACTTCCCGCTGATATGATTGTGATCGATATTCAGACTCTAACAAGTGGTCAGTACAGGTTCGACCATACGCG
->read4951_contig0_position2471_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ACTCAATTAGGTAGTGTGCGCGAGGTAGAGTATGCAGATTTCGTACCTTGCCACTGCTACCTCCGGCATATGGGCGTGCTATAAATGCGGGAGTCAGGAC
->read4952_contig0_position5327_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCTAAGATCCTAGTTGAATTGATCAATTGAGTCCAGTACACCATATCAACAGCTTGATCGTTCCACTTCAATCAGCAAGACGGGCGACCGTACCCGGACA
->read4953_contig0_position3918_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-AATCATGCACTAAGCATAGCATGCACGACTACTTGTTACTGAAGTCGGCATGACTATCAAACCTATTTAATGATATATGCTCTTGGACAACACGAGGTCG
->read4954_contig0_position2209_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CCACCAAGAGATGGGTTGATGGTAGCATCCCGGCTTCTGGGGCAATTTCTGACGATTAGAGTGACCAGCGATAGTACGTTCCTTTTTTACTGAGTCTTAA
->read4955_contig0_position7818_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GGAGCCACACTCGCCGTTACTGACTGATTAACAATCCAGCCCGTTTGGGGTGATTTGTGCCGGCGCGTCCAGGTGCGAACGTTGTGCCGTGTCACTCTGT
->read4956_contig0_position8740_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GTGTAAGAGCCCGCTTATCCGGTGGTGATACCTACTATTGACTGGGGGCTTACTGAGAACACTTCATCTGTATGGCAAAGTTGCGACACCGCGCCACACA
->read4957_contig0_position8570_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATATTAATTCTACTCAGATTGTCTGTAACCGGAGCTTCGGGCGTATTTTTGCGTAAGACACTGCCTAAAGGGAACATATGTGTCCAGAATAGGGTTCAAC
->read4958_contig0_position7682_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGAATGCGAAAACGGCATAAGCGCAATGACCGAGGTAACAAGCCATGAGGACTGCAGCGGTAATGTGGTAGTGTAGTTGCCGGCCCCTGTGCTGACCTT
->read4959_contig0_position8304_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GTCTCCGTGTTCCTTTCGATAACTCTGCGTCCTGAATGACCTTGGGCTCGTCGACATTCCTGTTAGTAATCCGATCTCAATTCCTGCGGTACCGAGCAGC
->read4960_contig0_position5952_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAACCCGGCATCTCGTGATTCGAGCCTAACAGCATGCCATCTAACGTTTGGACGGGTCTTGTGTTCCCTCAACACGTACGTTGACAGAGCTAACAATCCG
->read4961_contig0_position8258_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGCTTTCCAATCGTTGCACATGACTTGAGGCTCGGACTCGTATCTGTCTCCGTGTTCCATTCGATAACTCTGCGACCTGAATGACCTTGGGCTCGTCGA
->read4962_contig0_position2203_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GACTAGCCACCAAGAGATGGGTTGATGGTAGCATCCCGGCTTCTGGGGCAATTTCTGACGATTCGAGTGACCAGCGATAGTACGTTCCTTTTGTACTGAG
->read4963_contig0_position7058_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGCCTAAACAGTCTAATCTGGCCAATATACCCTGGGCGGAGTTAATATATCGCGGCGTCGAGTTACCGGTGCACCACCTCCAAGTGTCCATCGGAGTCC
->read4964_contig0_position7542_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGACGATAACAGCCCTACTGCCCGCCGTGAACGAGAACAAGCGTGTGGAGAGTGACTGACTATCACGAGGAATTACGGATAACAGCCCACTTGGAGTGT
->read4965_contig0_position3860_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CGTAGTCTTCAAGTGAATCATCCGATCATGCAAACCTGATTATCTGCACGACTCTTAAAATCTTGCACTAAGCATAGAATGCACGACTACTTGTTACTGA
->read4966_contig0_position9008_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCCCTCACCAGCCTATGCGCCTTAACTTTATGCATACTCGTTTAGTACAGGGCCGCGCCCCATGAGGCCATATGCGCCTGTCACGGGCATGCTGAAAGC
->read4967_contig0_position8046_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TCCATGTGGAGAATATGCATTCGACCAAATGAAAATGTCAATAATCTCGACCCTCTAGTCCGCGGCCAATCAGCACGATCAAGCTAAAGACAGGGATTAT
->read4968_contig0_position9030_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTAACTTTATGCATACTCGTTTAGTACAGGGCCGCGCCCCATGAGGCCATATGCGCCTGTCACGGGCATGCTGAAAGCGGCGGTTACATTAAGCGCTTCT
->read4969_contig0_position7602_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTATCACGAGGAATTACGGATAACAGCCCACTTGGAGTGTGCTGAGGGCCGACGCCCGGGGACTGTGATATCCTTGCGAGTGGAATGCGAAAACGGCATA
->read4970_contig0_position5171_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCAATTCGTTGTATTGATCGCTGTGCACTTTAAAATTCGGAACATCTTAACCAAAGCATATTAATATGCCAGCCGCGCAGGGTGGTATATATGATCCTTG
->read4971_contig0_position9738_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TGCCGAACGTCTGGAAATCTGTCGGGTCATATCGATGAACAGAGACTAAATGTCCTTAAAACTCTAACACGATTTTAGTAGGTCTACTACTAGGCCGCTT
->read4972_contig0_position9247_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-GGCCTTTATACCCATACTGCCACTCCAGTACCTGGGCCGCGTGTTGTACGCTGTGTATCTTGAGAGCGTTTCTCCGTATCGAAATCTTCCGCTGTAGAGA
->read4973_contig0_position2464_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGAACAACTCAATTAGGTAGTGTGCGCGAGGTAGAGTATGCAGATTTCGTACCTTGCCACTGCTACCTCCGGCATATGGGCGTGCTATAAATGCGGCAG
->read4974_contig0_position3344_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-AGCTGAACAACGGATGGGATTAAGCTCAGCAGTCCGCCTCCAATCTCTCCGACGATCATTCTCAAAGGTGTAGTTTTAGAGACTGAGAACTCACCCTATT
->read4975_contig0_position985_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGCAGTATCATGTATCGCTGATTGTGGGGGGCATGGGGGTTCCGCATTGGCGCAAAGGTACCGCAAAGGGCCTGTATGACCCTGGTTACGCGTTATTAC
->read4976_contig0_position2315_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CATATGCGCCCTAGATACCTGCGGCTTCACTCCACAGTGTAAGAGTTGACGGGACTAAAACAGTATTGGGCGGTGAGGGGTACCCGACGCCTCTGCTGTC
->read4977_contig0_position7465_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TTCGTTGAAAGGAGAATACAAATGACGGGAACTCTGACGAGAGGGTGCTTGAACGAGAGAAGCTAACAGTCATTGCGATGACGAGAACAGCCCTACTGCC
->read4978_contig0_position8674_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TATGAGCAAACGATGCGGTAAGACGAGCGCTCCGACCCCCCTTGGCTCTGCTACATCGAATTCAGCGTGTAAGAGCCCGCTTATCCGGTGGTGATACCTA
->read4979_contig0_position935_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGGTTAGAGACCTAGGTCTATGCCAGACGATCGCAGCGGAGTCGATATAATTGCAGTATCATGTATCGCTGATTGTGGGGGGCATGGGGGTTCCGCATTG
->read4980_contig0_position409_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGGTTATCGGACAGAGGATTATGTAAGGTTACCGAAGACCGGGTAGCGTAGTTAGTAACTTCAATCCGCGTTACGCTTTGTCCTCTGCTACGCCTGGATT
->read4981_contig0_position7200_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CGTCAATCGGGTTGGCCAAAAATTCTACCTGTCCACCTGTCCGCTAGAAGCAGATTATACGGAATACATATCCCGACACCGGCAGCTGAAATGATTCAGA
->read4982_contig0_position2739_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGTCGTTACTCCCGGGATCCACTGCGTCTATTGTAAGAAATGCAATGCGTGGCCAGTTTGTTCCGGCAGGACACCACTCTTTGAAGGTGCCCATTGCAT
->read4983_contig0_position4165_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CGCACATAGTGTACGTTGAGGCGGGAACTTCCCGCTGATATGATTGTGATCGATATTCAGACTCTAACAAGTGGTCAGTACAGGTTCGACCATACGCGAC
->read4984_contig0_position2945_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-GGGTTCGTGCTTTAATGACCCGTAGCCCAATTGCGCTCCCGAACAACGCGTGAGTTTAAAATTGACTTGAAACCGCCTAGCTCGGACCACCAAAGAGCAA
->read4985_contig0_position2874_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GCCCTGCCCCACGGGGGCTACTATCCAGCAGTGAACGCGTTTACCTTAAGACGAAAGAGTCAGTAGAGTTGGGGTTCGTGCTTTAATGACCCGTAGCCCA
->read4986_contig0_position1095_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGTTACGTCACGGACGTAGAGAGCCTTTGAATGTGTACGGCAATAGGAGAAACTCGGCCACGTACGTGTCAACATGGCGCGGCTCTCTATACCTCGCAA
->read4987_contig0_position4383_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-TGAGACGAAGTCTAGCTAGCTTGACTCGGCTGATAAAGAAAACAATCTATATGGAACCGAGGGGCGGGATGATAATTGTTCTTAGTATAGTGACCGTTAT
->read4988_contig0_position7036_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-CAGCCACGAATTCGTGTGATAACCGCCTAAACAGTCTAATCTGGCCAATATACCCTTGGGGGAGCTAATATATCGCGGCGTCGAGTTACCGTTGCGCCAC
->read4989_contig0_position1184_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-ATACCTCGCAAAGAATCACTCTATGGGTCATCTTGAGAGAATAGTCGACTAGTAGCGAATATATGTTCTGCTCCGAGACTTCGGCATAAATCTAAGTATG
->read4990_contig0_position8216_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CCCCTATTATTAGGAGAGGGCTGCGACTGCTTGCAGCTCCGACCGCTTTCCAATTGTTGCACATGACTTGAGGCTCGGACTCGTATCTGTCTCCGTGTTC
->read4991_contig0_position1057_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-CTGTATGACCCTGGTTACGCGTTATTAGCGGTCAGCTCCAGTTACGTCACGGACGTAGAGAGCCTTTGAATGTGTACGGCAATAGGAGAAACTCGGCCAC
->read4992_contig0_position8407_M3_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGTTTTTTTAAGTCCCACGGTTAATGGGCCACTTATTTCGACAATCATGGCGCCGATATCCTGCCTAGGCAGTACGGCCAATGCACGACCCTATATGAC
->read4993_contig0_position1873_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TAACTTTGCGGAGCTCAACCTATAACGATAATCAACTTGAGACAGGCGAGTTGGAGTGTTTTGATGAGCGGTGTTATATTTGTCCTAACTTAGCACTATC
->read4994_contig0_position4972_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-GAGGTATCGTCACTGCATAGCAGAATGGGCGATCGGCCTACAAGAGTACAGTACTAACGGTCTGGCCTTATACAGCGCCACATCCGCCAATTCGCTAGGT
->read4995_contig0_position2599_M0_I0_D0_NG0______er0.01__indel0__rgeom0
-CCGTCCATCGATGCCCCTCCTGTCCCGAAGCCTTAAAATCTAACCCTGAATTGGCTTTATCCACCCCCCCTACTGGCCACCACTGGGGCGCGAGTCTCGA
->read4996_contig0_position1007_M1_I0_D0_NG0______er0.01__indel0__rgeom0
-TTGTGGGGGGCATGGGGGTTCCGCATTGGCGCAAAGGTACCGCAAAGGGCCTGTATGACCCTGGTTACGCGTTATTACCGGTCATCTCCAGTTACGTCAC
->read4997_contig0_position6553_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-ATGGATTTAGACCGTTCACTGAACCCTGTAATAGGACCTCTTGCCCATCCGAGCCTTAAGCAGCGACTCCACATGGAGCGATGGGTCCTCAAGGCAGTAT
->read4998_contig0_position3466_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TCGCGCCCATAATGTTTGGAACTCGCAAACCTTTACACTCATCACATAGCAGGTTCCACCCGAACCGCGCGTATTCTGCGACAGCATAAATCGTGTTACT
->read4999_contig0_position8772_M2_I0_D0_NG0______er0.01__indel0__rgeom0
-TACTATTGACTGGGGGCTTACGGAGAACACTTCGTCTGTATGGCAAAGTTGCGACACCGCGCCACACAGCAGTTTATTGTTAACACGCGATACAAGAGGG
diff --git a/test/result10K.fasta b/test/result10K.fasta
deleted file mode 100644
index 364ab2e..0000000
--- a/test/result10K.fasta
+++ /dev/null
@@ -1,2 +0,0 @@
->0__len__9935
-GGGAATTGTGGGGCGGACCACGCTCTGGCTAACGAGCTACCGTTTCCTTTAACCTGCCAGACGGTGACCAGGGCCGTTCGGCGTTGCATCGAGCGGTGTCGCTAGCGCAATGCGCAAGATTTTGACATTTACAAGGCAACATTGCAGCGTCCGATGGTCCGGTGGCCTCCAGATAGTGTCCAGTCGCTCTAACTGTATGGAGACCATAGGCATTTACCTTATTCTCATCGCCACGCCCCAAGATCTTTAGGACCCAGCATTCCTTTAACCACTAACATAACGCGTGTCATCTAGTTCTAGCATACTCCGCCTTGGGCCACACAATTAATATAAGACGGGATAATGGCTTCATGCTCATGTTCTATACCGAGCAGAGAGGTTGGGTCTACCTAGTAGTGTCGCGGTTATCGGACAGAGGATTATGTAAGGTTACCGAAGACCGGGTAGCGTAGTTAGTAACTTCAATCCGCGTTACGCTTTGTCCTCTGCTAC [...]
diff --git a/ttmath/ttmath.h b/ttmath/ttmath.h
deleted file mode 100644
index 37c971f..0000000
--- a/ttmath/ttmath.h
+++ /dev/null
@@ -1,2849 +0,0 @@
-/*
- * This file is a part of TTMath Bignum Library
- * and is distributed under the (new) BSD licence.
- * Author: Tomasz Sowa <t.sowa at ttmath.org>
- */
-
-/*
- * Copyright (c) 2006-2010, Tomasz Sowa
- * All rights reserved.
- *
- * Redistribution and use in source and binary forms, with or without
- * modification, are permitted provided that the following conditions are met:
- *
- * * Redistributions of source code must retain the above copyright notice,
- * this list of conditions and the following disclaimer.
- *
- * * Redistributions in binary form must reproduce the above copyright
- * notice, this list of conditions and the following disclaimer in the
- * documentation and/or other materials provided with the distribution.
- *
- * * Neither the name Tomasz Sowa nor the names of contributors to this
- * project may be used to endorse or promote products derived
- * from this software without specific prior written permission.
- *
- * THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS"
- * AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
- * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- * ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE
- * LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR
- * CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF
- * SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS
- * INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN
- * CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
- * ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF
- * THE POSSIBILITY OF SUCH DAMAGE.
- */
-
-
-
-#ifndef headerfilettmathmathtt
-#define headerfilettmathmathtt
-
-/*!
- \file ttmath.h
- \brief Mathematics functions.
-*/
-
-#ifdef _MSC_VER
-//warning C4127: conditional expression is constant
-#pragma warning( disable: 4127 )
-//warning C4702: unreachable code
-#pragma warning( disable: 4702 )
-//warning C4800: forcing value to bool 'true' or 'false' (performance warning)
-#pragma warning( disable: 4800 )
-#endif
-
-
-#include "ttmathbig.h"
-#include "ttmathobjects.h"
-
-
-namespace ttmath
-{
- /*
- *
- * functions defined here are used only with Big<> types
- *
- *
- */
-
-
- /*
- *
- * functions for rounding
- *
- *
- */
-
-
- /*!
- this function skips the fraction from x
- e.g 2.2 = 2
- 2.7 = 2
- -2.2 = 2
- -2.7 = 2
- */
- template<class ValueType>
- ValueType SkipFraction(const ValueType & x)
- {
- ValueType result( x );
- result.SkipFraction();
-
- return result;
- }
-
-
- /*!
- this function rounds to the nearest integer value
- e.g 2.2 = 2
- 2.7 = 3
- -2.2 = -2
- -2.7 = -3
- */
- template<class ValueType>
- ValueType Round(const ValueType & x, ErrorCode * err = 0)
- {
- if( x.IsNan() )
- {
- if( err )
- *err = err_improper_argument;
-
- return x; // NaN
- }
-
- ValueType result( x );
- uint c = result.Round();
-
- if( err )
- *err = c ? err_overflow : err_ok;
-
- return result;
- }
-
-
-
- /*!
- this function returns a value representing the smallest integer
- that is greater than or equal to x
-
- Ceil(-3.7) = -3
- Ceil(-3.1) = -3
- Ceil(-3.0) = -3
- Ceil(4.0) = 4
- Ceil(4.2) = 5
- Ceil(4.8) = 5
- */
- template<class ValueType>
- ValueType Ceil(const ValueType & x, ErrorCode * err = 0)
- {
- if( x.IsNan() )
- {
- if( err )
- *err = err_improper_argument;
-
- return x; // NaN
- }
-
- ValueType result(x);
- uint c = 0;
-
- result.SkipFraction();
-
- if( result != x )
- {
- // x is with fraction
- // if x is negative we don't have to do anything
- if( !x.IsSign() )
- {
- ValueType one;
- one.SetOne();
-
- c += result.Add(one);
- }
- }
-
- if( err )
- *err = c ? err_overflow : err_ok;
-
- return result;
- }
-
-
- /*!
- this function returns a value representing the largest integer
- that is less than or equal to x
-
- Floor(-3.6) = -4
- Floor(-3.1) = -4
- Floor(-3) = -3
- Floor(2) = 2
- Floor(2.3) = 2
- Floor(2.8) = 2
- */
- template<class ValueType>
- ValueType Floor(const ValueType & x, ErrorCode * err = 0)
- {
- if( x.IsNan() )
- {
- if( err )
- *err = err_improper_argument;
-
- return x; // NaN
- }
-
- ValueType result(x);
- uint c = 0;
-
- result.SkipFraction();
-
- if( result != x )
- {
- // x is with fraction
- // if x is positive we don't have to do anything
- if( x.IsSign() )
- {
- ValueType one;
- one.SetOne();
-
- c += result.Sub(one);
- }
- }
-
- if( err )
- *err = c ? err_overflow : err_ok;
-
- return result;
- }
-
-
-
- /*
- *
- * logarithms and the exponent
- *
- *
- */
-
-
- /*!
- this function calculates the natural logarithm (logarithm with the base 'e')
- */
- template<class ValueType>
- ValueType Ln(const ValueType & x, ErrorCode * err = 0)
- {
- if( x.IsNan() )
- {
- if( err )
- *err = err_improper_argument;
-
- return x; // NaN
- }
-
- ValueType result;
- uint state = result.Ln(x);
-
- if( err )
- {
- switch( state )
- {
- case 0:
- *err = err_ok;
- break;
- case 1:
- *err = err_overflow;
- break;
- case 2:
- *err = err_improper_argument;
- break;
- default:
- *err = err_internal_error;
- break;
- }
- }
-
-
- return result;
- }
-
-
- /*!
- this function calculates the logarithm
- */
- template<class ValueType>
- ValueType Log(const ValueType & x, const ValueType & base, ErrorCode * err = 0)
- {
- if( x.IsNan() )
- {
- if( err ) *err = err_improper_argument;
- return x;
- }
-
- if( base.IsNan() )
- {
- if( err ) *err = err_improper_argument;
- return base;
- }
-
- ValueType result;
- uint state = result.Log(x, base);
-
- if( err )
- {
- switch( state )
- {
- case 0:
- *err = err_ok;
- break;
- case 1:
- *err = err_overflow;
- break;
- case 2:
- case 3:
- *err = err_improper_argument;
- break;
- default:
- *err = err_internal_error;
- break;
- }
- }
-
- return result;
- }
-
-
- /*!
- this function calculates the expression e^x
- */
- template<class ValueType>
- ValueType Exp(const ValueType & x, ErrorCode * err = 0)
- {
- if( x.IsNan() )
- {
- if( err )
- *err = err_improper_argument;
-
- return x; // NaN
- }
-
- ValueType result;
- uint c = result.Exp(x);
-
- if( err )
- *err = c ? err_overflow : err_ok;
-
- return result;
- }
-
-
- /*!
- *
- * trigonometric functions
- *
- */
-
-
- /*
- this namespace consists of auxiliary functions
- (something like 'private' in a class)
- */
- namespace auxiliaryfunctions
- {
-
- /*!
- an auxiliary function for calculating the Sine
- (you don't have to call this function)
- */
- template<class ValueType>
- uint PrepareSin(ValueType & x, bool & change_sign)
- {
- ValueType temp;
-
- change_sign = false;
-
- if( x.IsSign() )
- {
- // we're using the formula 'sin(-x) = -sin(x)'
- change_sign = !change_sign;
- x.ChangeSign();
- }
-
- // we're reducing the period 2*PI
- // (for big values there'll always be zero)
- temp.Set2Pi();
-
- if( x.Mod(temp) )
- return 1;
-
-
- // we're setting 'x' as being in the range of <0, 0.5PI>
-
- temp.SetPi();
-
- if( x > temp )
- {
- // x is in (pi, 2*pi>
- x.Sub( temp );
- change_sign = !change_sign;
- }
-
- temp.Set05Pi();
-
- if( x > temp )
- {
- // x is in (0.5pi, pi>
- x.Sub( temp );
- x = temp - x;
- }
-
- return 0;
- }
-
-
- /*!
- an auxiliary function for calculating the Sine
- (you don't have to call this function)
-
- it returns Sin(x) where 'x' is from <0, PI/2>
- we're calculating the Sin with using Taylor series in zero or PI/2
- (depending on which point of these two points is nearer to the 'x')
-
- Taylor series:
- sin(x) = sin(a) + cos(a)*(x-a)/(1!)
- - sin(a)*((x-a)^2)/(2!) - cos(a)*((x-a)^3)/(3!)
- + sin(a)*((x-a)^4)/(4!) + ...
-
- when a=0 it'll be:
- sin(x) = (x)/(1!) - (x^3)/(3!) + (x^5)/(5!) - (x^7)/(7!) + (x^9)/(9!) ...
-
- and when a=PI/2:
- sin(x) = 1 - ((x-PI/2)^2)/(2!) + ((x-PI/2)^4)/(4!) - ((x-PI/2)^6)/(6!) ...
- */
- template<class ValueType>
- ValueType Sin0pi05(const ValueType & x)
- {
- ValueType result;
- ValueType numerator, denominator;
- ValueType d_numerator, d_denominator;
- ValueType one, temp, old_result;
-
- // temp = pi/4
- temp.Set05Pi();
- temp.exponent.SubOne();
-
- one.SetOne();
-
- if( x < temp )
- {
- // we're using the Taylor series with a=0
- result = x;
- numerator = x;
- denominator = one;
-
- // d_numerator = x^2
- d_numerator = x;
- d_numerator.Mul(x);
-
- d_denominator = 2;
- }
- else
- {
- // we're using the Taylor series with a=PI/2
- result = one;
- numerator = one;
- denominator = one;
-
- // d_numerator = (x-pi/2)^2
- ValueType pi05;
- pi05.Set05Pi();
-
- temp = x;
- temp.Sub( pi05 );
- d_numerator = temp;
- d_numerator.Mul( temp );
-
- d_denominator = one;
- }
-
- uint c = 0;
- bool addition = false;
-
- old_result = result;
- for(uint i=1 ; i<=TTMATH_ARITHMETIC_MAX_LOOP ; ++i)
- {
- // we're starting from a second part of the formula
- c += numerator. Mul( d_numerator );
- c += denominator. Mul( d_denominator );
- c += d_denominator.Add( one );
- c += denominator. Mul( d_denominator );
- c += d_denominator.Add( one );
- temp = numerator;
- c += temp.Div(denominator);
-
- if( c )
- // Sin is from <-1,1> and cannot make an overflow
- // but the carry can be from the Taylor series
- // (then we only break our calculations)
- break;
-
- if( addition )
- result.Add( temp );
- else
- result.Sub( temp );
-
-
- addition = !addition;
-
- // we're testing whether the result has changed after adding
- // the next part of the Taylor formula, if not we end the loop
- // (it means 'x' is zero or 'x' is PI/2 or this part of the formula
- // is too small)
- if( result == old_result )
- break;
-
- old_result = result;
- }
-
- return result;
- }
-
- } // namespace auxiliaryfunctions
-
-
-
- /*!
- this function calculates the Sine
- */
- template<class ValueType>
- ValueType Sin(ValueType x, ErrorCode * err = 0)
- {
- using namespace auxiliaryfunctions;
-
- ValueType one, result;
- bool change_sign;
-
- if( x.IsNan() )
- {
- if( err )
- *err = err_improper_argument;
-
- return x;
- }
-
- if( err )
- *err = err_ok;
-
- if( PrepareSin( x, change_sign ) )
- {
- // x is too big, we cannnot reduce the 2*PI period
- // prior to version 0.8.5 the result was zero
-
- // result has NaN flag set by default
-
- if( err )
- *err = err_overflow; // maybe another error code? err_improper_argument?
-
- return result; // NaN is set by default
- }
-
- result = Sin0pi05( x );
-
- one.SetOne();
-
- // after calculations there can be small distortions in the result
- if( result > one )
- result = one;
- else
- if( result.IsSign() )
- // we've calculated the sin from <0, pi/2> and the result
- // should be positive
- result.SetZero();
-
- if( change_sign )
- result.ChangeSign();
-
- return result;
- }
-
-
- /*!
- this function calulates the Cosine
- we're using the formula cos(x) = sin(x + PI/2)
- */
- template<class ValueType>
- ValueType Cos(ValueType x, ErrorCode * err = 0)
- {
- if( x.IsNan() )
- {
- if( err )
- *err = err_improper_argument;
-
- return x; // NaN
- }
-
- ValueType pi05;
- pi05.Set05Pi();
-
- uint c = x.Add( pi05 );
-
- if( c )
- {
- if( err )
- *err = err_overflow;
-
- return ValueType(); // result is undefined (NaN is set by default)
- }
-
- return Sin(x, err);
- }
-
-
- /*!
- this function calulates the Tangent
- we're using the formula tan(x) = sin(x) / cos(x)
-
- it takes more time than calculating the Tan directly
- from for example Taylor series but should be a bit preciser
- because Tan receives its values from -infinity to +infinity
- and when we calculate it from any series then we can make
- a greater mistake than calculating 'sin/cos'
- */
- template<class ValueType>
- ValueType Tan(const ValueType & x, ErrorCode * err = 0)
- {
- ValueType result = Cos(x, err);
-
- if( err && *err != err_ok )
- return result;
-
- if( result.IsZero() )
- {
- if( err )
- *err = err_improper_argument;
-
- result.SetNan();
-
- return result;
- }
-
- return Sin(x, err) / result;
- }
-
-
- /*!
- this function calulates the Tangent
- look at the description of Tan(...)
-
- (the abbreviation of Tangent can be 'tg' as well)
- */
- template<class ValueType>
- ValueType Tg(const ValueType & x, ErrorCode * err = 0)
- {
- return Tan(x, err);
- }
-
-
- /*!
- this function calulates the Cotangent
- we're using the formula tan(x) = cos(x) / sin(x)
-
- (why do we make it in this way?
- look at information in Tan() function)
- */
- template<class ValueType>
- ValueType Cot(const ValueType & x, ErrorCode * err = 0)
- {
- ValueType result = Sin(x, err);
-
- if( err && *err != err_ok )
- return result;
-
- if( result.IsZero() )
- {
- if( err )
- *err = err_improper_argument;
-
- result.SetNan();
-
- return result;
- }
-
- return Cos(x, err) / result;
- }
-
-
- /*!
- this function calulates the Cotangent
- look at the description of Cot(...)
-
- (the abbreviation of Cotangent can be 'ctg' as well)
- */
- template<class ValueType>
- ValueType Ctg(const ValueType & x, ErrorCode * err = 0)
- {
- return Cot(x, err);
- }
-
-
- /*
- *
- * inverse trigonometric functions
- *
- *
- */
-
- namespace auxiliaryfunctions
- {
-
- /*!
- an auxiliary function for calculating the Arc Sine
-
- we're calculating asin from the following formula:
- asin(x) = x + (1*x^3)/(2*3) + (1*3*x^5)/(2*4*5) + (1*3*5*x^7)/(2*4*6*7) + ...
- where abs(x) <= 1
-
- we're using this formula when x is from <0, 1/2>
- */
- template<class ValueType>
- ValueType ASin_0(const ValueType & x)
- {
- ValueType nominator, denominator, nominator_add, nominator_x, denominator_add, denominator_x;
- ValueType two, result(x), x2(x);
- ValueType nominator_temp, denominator_temp, old_result = result;
- uint c = 0;
-
- x2.Mul(x);
- two = 2;
-
- nominator.SetOne();
- denominator = two;
- nominator_add = nominator;
- denominator_add = denominator;
- nominator_x = x;
- denominator_x = 3;
-
- for(uint i=1 ; i<=TTMATH_ARITHMETIC_MAX_LOOP ; ++i)
- {
- c += nominator_x.Mul(x2);
- nominator_temp = nominator_x;
- c += nominator_temp.Mul(nominator);
- denominator_temp = denominator;
- c += denominator_temp.Mul(denominator_x);
- c += nominator_temp.Div(denominator_temp);
-
- // if there is a carry somewhere we only break the calculating
- // the result should be ok -- it's from <-pi/2, pi/2>
- if( c )
- break;
-
- result.Add(nominator_temp);
-
- if( result == old_result )
- // there's no sense to calculate more
- break;
-
- old_result = result;
-
-
- c += nominator_add.Add(two);
- c += denominator_add.Add(two);
- c += nominator.Mul(nominator_add);
- c += denominator.Mul(denominator_add);
- c += denominator_x.Add(two);
- }
-
- return result;
- }
-
-
-
- /*!
- an auxiliary function for calculating the Arc Sine
-
- we're calculating asin from the following formula:
- asin(x) = pi/2 - sqrt(2)*sqrt(1-x) * asin_temp
- asin_temp = 1 + (1*(1-x))/((2*3)*(2)) + (1*3*(1-x)^2)/((2*4*5)*(4)) + (1*3*5*(1-x)^3)/((2*4*6*7)*(8)) + ...
-
- where abs(x) <= 1
-
- we're using this formula when x is from (1/2, 1>
- */
- template<class ValueType>
- ValueType ASin_1(const ValueType & x)
- {
- ValueType nominator, denominator, nominator_add, nominator_x, nominator_x_add, denominator_add, denominator_x;
- ValueType denominator2;
- ValueType one, two, result;
- ValueType nominator_temp, denominator_temp, old_result;
- uint c = 0;
-
- two = 2;
-
- one.SetOne();
- nominator = one;
- result = one;
- old_result = result;
- denominator = two;
- nominator_add = nominator;
- denominator_add = denominator;
- nominator_x = one;
- nominator_x.Sub(x);
- nominator_x_add = nominator_x;
- denominator_x = 3;
- denominator2 = two;
-
-
- for(uint i=1 ; i<=TTMATH_ARITHMETIC_MAX_LOOP ; ++i)
- {
- nominator_temp = nominator_x;
- c += nominator_temp.Mul(nominator);
- denominator_temp = denominator;
- c += denominator_temp.Mul(denominator_x);
- c += denominator_temp.Mul(denominator2);
- c += nominator_temp.Div(denominator_temp);
-
- // if there is a carry somewhere we only break the calculating
- // the result should be ok -- it's from <-pi/2, pi/2>
- if( c )
- break;
-
- result.Add(nominator_temp);
-
- if( result == old_result )
- // there's no sense to calculate more
- break;
-
- old_result = result;
-
- c += nominator_x.Mul(nominator_x_add);
- c += nominator_add.Add(two);
- c += denominator_add.Add(two);
- c += nominator.Mul(nominator_add);
- c += denominator.Mul(denominator_add);
- c += denominator_x.Add(two);
- c += denominator2.Mul(two);
- }
-
-
- nominator_x_add.exponent.AddOne(); // *2
- one.exponent.SubOne(); // =0.5
- nominator_x_add.Pow(one); // =sqrt(nominator_x_add)
- result.Mul(nominator_x_add);
-
- one.Set05Pi();
- one.Sub(result);
-
- return one;
- }
-
-
- } // namespace auxiliaryfunctions
-
-
- /*!
- this function calculates the Arc Sine
- x is from <-1,1>
- */
- template<class ValueType>
- ValueType ASin(ValueType x, ErrorCode * err = 0)
- {
- using namespace auxiliaryfunctions;
-
- ValueType result, one;
- one.SetOne();
- bool change_sign = false;
-
- if( x.IsNan() )
- {
- if( err )
- *err = err_improper_argument;
-
- return x;
- }
-
- if( x.GreaterWithoutSignThan(one) )
- {
- if( err )
- *err = err_improper_argument;
-
- return result; // NaN is set by default
- }
-
- if( x.IsSign() )
- {
- change_sign = true;
- x.Abs();
- }
-
- one.exponent.SubOne(); // =0.5
-
- // asin(-x) = -asin(x)
- if( x.GreaterWithoutSignThan(one) )
- result = ASin_1(x);
- else
- result = ASin_0(x);
-
- if( change_sign )
- result.ChangeSign();
-
- if( err )
- *err = err_ok;
-
- return result;
- }
-
-
- /*!
- this function calculates the Arc Cosine
-
- we're using the formula:
- acos(x) = pi/2 - asin(x)
- */
- template<class ValueType>
- ValueType ACos(const ValueType & x, ErrorCode * err = 0)
- {
- ValueType temp;
-
- temp.Set05Pi();
- temp.Sub(ASin(x, err));
-
- return temp;
- }
-
-
-
- namespace auxiliaryfunctions
- {
-
- /*!
- an auxiliary function for calculating the Arc Tangent
-
- arc tan (x) where x is in <0; 0.5)
- (x can be in (-0.5 ; 0.5) too)
-
- we're using the Taylor series expanded in zero:
- atan(x) = x - (x^3)/3 + (x^5)/5 - (x^7)/7 + ...
- */
- template<class ValueType>
- ValueType ATan0(const ValueType & x)
- {
- ValueType nominator, denominator, nominator_add, denominator_add, temp;
- ValueType result, old_result;
- bool adding = false;
- uint c = 0;
-
- result = x;
- old_result = result;
- nominator = x;
- nominator_add = x;
- nominator_add.Mul(x);
-
- denominator.SetOne();
- denominator_add = 2;
-
- for(uint i=1 ; i<=TTMATH_ARITHMETIC_MAX_LOOP ; ++i)
- {
- c += nominator.Mul(nominator_add);
- c += denominator.Add(denominator_add);
-
- temp = nominator;
- c += temp.Div(denominator);
-
- if( c )
- // the result should be ok
- break;
-
- if( adding )
- result.Add(temp);
- else
- result.Sub(temp);
-
- if( result == old_result )
- // there's no sense to calculate more
- break;
-
- old_result = result;
- adding = !adding;
- }
-
- return result;
- }
-
-
- /*!
- an auxiliary function for calculating the Arc Tangent
-
- where x is in <0 ; 1>
- */
- template<class ValueType>
- ValueType ATan01(const ValueType & x)
- {
- ValueType half;
- half.Set05();
-
- /*
- it would be better if we chose about sqrt(2)-1=0.41... instead of 0.5 here
-
- because as you can see below:
- when x = sqrt(2)-1
- abs(x) = abs( (x-1)/(1+x) )
- so when we're calculating values around x
- then they will be better converged to each other
-
- for example if we have x=0.4999 then during calculating ATan0(0.4999)
- we have to make about 141 iterations but when we have x=0.5
- then during calculating ATan0( (x-1)/(1+x) ) we have to make
- only about 89 iterations (both for Big<3,9>)
-
- in the future this 0.5 can be changed
- */
- if( x.SmallerWithoutSignThan(half) )
- return ATan0(x);
-
-
- /*
- x>=0.5 and x<=1
- (x can be even smaller than 0.5)
-
- y = atac(x)
- x = tan(y)
-
- tan(y-b) = (tan(y)-tab(b)) / (1+tan(y)*tan(b))
- y-b = atan( (tan(y)-tab(b)) / (1+tan(y)*tan(b)) )
- y = b + atan( (x-tab(b)) / (1+x*tan(b)) )
-
- let b = pi/4
- tan(b) = tan(pi/4) = 1
- y = pi/4 + atan( (x-1)/(1+x) )
-
- so
- atac(x) = pi/4 + atan( (x-1)/(1+x) )
- when x->1 (x converges to 1) the (x-1)/(1+x) -> 0
- and we can use ATan0() function here
- */
-
- ValueType n(x),d(x),one,result;
-
- one.SetOne();
- n.Sub(one);
- d.Add(one);
- n.Div(d);
-
- result = ATan0(n);
-
- n.Set05Pi();
- n.exponent.SubOne(); // =pi/4
- result.Add(n);
-
- return result;
- }
-
-
- /*!
- an auxiliary function for calculating the Arc Tangent
- where x > 1
-
- we're using the formula:
- atan(x) = pi/2 - atan(1/x) for x>0
- */
- template<class ValueType>
- ValueType ATanGreaterThanPlusOne(const ValueType & x)
- {
- ValueType temp, atan;
-
- temp.SetOne();
-
- if( temp.Div(x) )
- {
- // if there was a carry here that means x is very big
- // and atan(1/x) fast converged to 0
- atan.SetZero();
- }
- else
- atan = ATan01(temp);
-
- temp.Set05Pi();
- temp.Sub(atan);
-
- return temp;
- }
-
- } // namespace auxiliaryfunctions
-
-
- /*!
- this function calculates the Arc Tangent
- */
- template<class ValueType>
- ValueType ATan(ValueType x)
- {
- using namespace auxiliaryfunctions;
-
- ValueType one, result;
- one.SetOne();
- bool change_sign = false;
-
- if( x.IsNan() )
- return x;
-
- // if x is negative we're using the formula:
- // atan(-x) = -atan(x)
- if( x.IsSign() )
- {
- change_sign = true;
- x.Abs();
- }
-
- if( x.GreaterWithoutSignThan(one) )
- result = ATanGreaterThanPlusOne(x);
- else
- result = ATan01(x);
-
- if( change_sign )
- result.ChangeSign();
-
- return result;
- }
-
-
- /*!
- this function calculates the Arc Tangent
- look at the description of ATan(...)
-
- (the abbreviation of Arc Tangent can be 'atg' as well)
- */
- template<class ValueType>
- ValueType ATg(const ValueType & x)
- {
- return ATan(x);
- }
-
-
- /*!
- this function calculates the Arc Cotangent
-
- we're using the formula:
- actan(x) = pi/2 - atan(x)
- */
- template<class ValueType>
- ValueType ACot(const ValueType & x)
- {
- ValueType result;
-
- result.Set05Pi();
- result.Sub(ATan(x));
-
- return result;
- }
-
-
- /*!
- this function calculates the Arc Cotangent
- look at the description of ACot(...)
-
- (the abbreviation of Arc Cotangent can be 'actg' as well)
- */
- template<class ValueType>
- ValueType ACtg(const ValueType & x)
- {
- return ACot(x);
- }
-
-
- /*
- *
- * hyperbolic functions
- *
- *
- */
-
-
- /*!
- this function calculates the Hyperbolic Sine
-
- we're using the formula sinh(x)= ( e^x - e^(-x) ) / 2
- */
- template<class ValueType>
- ValueType Sinh(const ValueType & x, ErrorCode * err = 0)
- {
- if( x.IsNan() )
- {
- if( err )
- *err = err_improper_argument;
-
- return x; // NaN
- }
-
- ValueType ex, emx;
- uint c = 0;
-
- c += ex.Exp(x);
- c += emx.Exp(-x);
-
- c += ex.Sub(emx);
- c += ex.exponent.SubOne();
-
- if( err )
- *err = c ? err_overflow : err_ok;
-
- return ex;
- }
-
-
- /*!
- this function calculates the Hyperbolic Cosine
-
- we're using the formula cosh(x)= ( e^x + e^(-x) ) / 2
- */
- template<class ValueType>
- ValueType Cosh(const ValueType & x, ErrorCode * err = 0)
- {
- if( x.IsNan() )
- {
- if( err )
- *err = err_improper_argument;
-
- return x; // NaN
- }
-
- ValueType ex, emx;
- uint c = 0;
-
- c += ex.Exp(x);
- c += emx.Exp(-x);
-
- c += ex.Add(emx);
- c += ex.exponent.SubOne();
-
- if( err )
- *err = c ? err_overflow : err_ok;
-
- return ex;
- }
-
-
- /*!
- this function calculates the Hyperbolic Tangent
-
- we're using the formula tanh(x)= ( e^x - e^(-x) ) / ( e^x + e^(-x) )
- */
- template<class ValueType>
- ValueType Tanh(const ValueType & x, ErrorCode * err = 0)
- {
- if( x.IsNan() )
- {
- if( err )
- *err = err_improper_argument;
-
- return x; // NaN
- }
-
- ValueType ex, emx, nominator, denominator;
- uint c = 0;
-
- c += ex.Exp(x);
- c += emx.Exp(-x);
-
- nominator = ex;
- c += nominator.Sub(emx);
- denominator = ex;
- c += denominator.Add(emx);
-
- c += nominator.Div(denominator);
-
- if( err )
- *err = c ? err_overflow : err_ok;
-
- return nominator;
- }
-
-
- /*!
- this function calculates the Hyperbolic Tangent
- look at the description of Tanh(...)
-
- (the abbreviation of Hyperbolic Tangent can be 'tgh' as well)
- */
- template<class ValueType>
- ValueType Tgh(const ValueType & x, ErrorCode * err = 0)
- {
- return Tanh(x, err);
- }
-
- /*!
- this function calculates the Hyperbolic Cotangent
-
- we're using the formula coth(x)= ( e^x + e^(-x) ) / ( e^x - e^(-x) )
- */
- template<class ValueType>
- ValueType Coth(const ValueType & x, ErrorCode * err = 0)
- {
- if( x.IsNan() )
- {
- if( err )
- *err = err_improper_argument;
-
- return x; // NaN
- }
-
- if( x.IsZero() )
- {
- if( err )
- *err = err_improper_argument;
-
- return ValueType(); // NaN is set by default
- }
-
- ValueType ex, emx, nominator, denominator;
- uint c = 0;
-
- c += ex.Exp(x);
- c += emx.Exp(-x);
-
- nominator = ex;
- c += nominator.Add(emx);
- denominator = ex;
- c += denominator.Sub(emx);
-
- c += nominator.Div(denominator);
-
- if( err )
- *err = c ? err_overflow : err_ok;
-
- return nominator;
- }
-
-
- /*!
- this function calculates the Hyperbolic Cotangent
- look at the description of Coth(...)
-
- (the abbreviation of Hyperbolic Cotangent can be 'ctgh' as well)
- */
- template<class ValueType>
- ValueType Ctgh(const ValueType & x, ErrorCode * err = 0)
- {
- return Coth(x, err);
- }
-
-
- /*
- *
- * inverse hyperbolic functions
- *
- *
- */
-
-
- /*!
- inverse hyperbolic sine
-
- asinh(x) = ln( x + sqrt(x^2 + 1) )
- */
- template<class ValueType>
- ValueType ASinh(const ValueType & x, ErrorCode * err = 0)
- {
- if( x.IsNan() )
- {
- if( err )
- *err = err_improper_argument;
-
- return x; // NaN
- }
-
- ValueType xx(x), one, result;
- uint c = 0;
- one.SetOne();
-
- c += xx.Mul(x);
- c += xx.Add(one);
- one.exponent.SubOne(); // one=0.5
- // xx is >= 1
- c += xx.PowFrac(one); // xx=sqrt(xx)
- c += xx.Add(x);
- c += result.Ln(xx); // xx > 0
-
- // here can only be a carry
- if( err )
- *err = c ? err_overflow : err_ok;
-
- return result;
- }
-
-
- /*!
- inverse hyperbolic cosine
-
- acosh(x) = ln( x + sqrt(x^2 - 1) ) x in <1, infinity)
- */
- template<class ValueType>
- ValueType ACosh(const ValueType & x, ErrorCode * err = 0)
- {
- if( x.IsNan() )
- {
- if( err )
- *err = err_improper_argument;
-
- return x; // NaN
- }
-
- ValueType xx(x), one, result;
- uint c = 0;
- one.SetOne();
-
- if( x < one )
- {
- if( err )
- *err = err_improper_argument;
-
- return result; // NaN is set by default
- }
-
- c += xx.Mul(x);
- c += xx.Sub(one);
- // xx is >= 0
- // we can't call a PowFrac when the 'x' is zero
- // if x is 0 the sqrt(0) is 0
- if( !xx.IsZero() )
- {
- one.exponent.SubOne(); // one=0.5
- c += xx.PowFrac(one); // xx=sqrt(xx)
- }
- c += xx.Add(x);
- c += result.Ln(xx); // xx >= 1
-
- // here can only be a carry
- if( err )
- *err = c ? err_overflow : err_ok;
-
- return result;
- }
-
-
- /*!
- inverse hyperbolic tangent
-
- atanh(x) = 0.5 * ln( (1+x) / (1-x) ) x in (-1, 1)
- */
- template<class ValueType>
- ValueType ATanh(const ValueType & x, ErrorCode * err = 0)
- {
- if( x.IsNan() )
- {
- if( err )
- *err = err_improper_argument;
-
- return x; // NaN
- }
-
- ValueType nominator(x), denominator, one, result;
- uint c = 0;
- one.SetOne();
-
- if( !x.SmallerWithoutSignThan(one) )
- {
- if( err )
- *err = err_improper_argument;
-
- return result; // NaN is set by default
- }
-
- c += nominator.Add(one);
- denominator = one;
- c += denominator.Sub(x);
- c += nominator.Div(denominator);
- c += result.Ln(nominator);
- c += result.exponent.SubOne();
-
- // here can only be a carry
- if( err )
- *err = c ? err_overflow : err_ok;
-
- return result;
- }
-
-
- /*!
- inverse hyperbolic tantent
- */
- template<class ValueType>
- ValueType ATgh(const ValueType & x, ErrorCode * err = 0)
- {
- return ATanh(x, err);
- }
-
-
- /*!
- inverse hyperbolic cotangent
-
- acoth(x) = 0.5 * ln( (x+1) / (x-1) ) x in (-infinity, -1) or (1, infinity)
- */
- template<class ValueType>
- ValueType ACoth(const ValueType & x, ErrorCode * err = 0)
- {
- if( x.IsNan() )
- {
- if( err )
- *err = err_improper_argument;
-
- return x; // NaN
- }
-
- ValueType nominator(x), denominator(x), one, result;
- uint c = 0;
- one.SetOne();
-
- if( !x.GreaterWithoutSignThan(one) )
- {
- if( err )
- *err = err_improper_argument;
-
- return result; // NaN is set by default
- }
-
- c += nominator.Add(one);
- c += denominator.Sub(one);
- c += nominator.Div(denominator);
- c += result.Ln(nominator);
- c += result.exponent.SubOne();
-
- // here can only be a carry
- if( err )
- *err = c ? err_overflow : err_ok;
-
- return result;
- }
-
-
- /*!
- inverse hyperbolic cotantent
- */
- template<class ValueType>
- ValueType ACtgh(const ValueType & x, ErrorCode * err = 0)
- {
- return ACoth(x, err);
- }
-
-
-
-
-
- /*
- *
- * functions for converting between degrees, radians and gradians
- *
- *
- */
-
-
- /*!
- this function converts degrees to radians
-
- it returns: x * pi / 180
- */
- template<class ValueType>
- ValueType DegToRad(const ValueType & x, ErrorCode * err = 0)
- {
- ValueType result, temp;
- uint c = 0;
-
- if( x.IsNan() )
- {
- if( err )
- *err = err_improper_argument;
-
- return x;
- }
-
- result = x;
-
- // it is better to make division first and then multiplication
- // the result is more accurate especially when x is: 90,180,270 or 360
- temp = 180;
- c += result.Div(temp);
-
- temp.SetPi();
- c += result.Mul(temp);
-
- if( err )
- *err = c ? err_overflow : err_ok;
-
- return result;
- }
-
-
- /*!
- this function converts radians to degrees
-
- it returns: x * 180 / pi
- */
- template<class ValueType>
- ValueType RadToDeg(const ValueType & x, ErrorCode * err = 0)
- {
- ValueType result, delimiter;
- uint c = 0;
-
- if( x.IsNan() )
- {
- if( err )
- *err = err_improper_argument;
-
- return x;
- }
-
- result = 180;
- c += result.Mul(x);
-
- delimiter.SetPi();
- c += result.Div(delimiter);
-
- if( err )
- *err = c ? err_overflow : err_ok;
-
- return result;
- }
-
-
- /*!
- this function converts degrees in the long format into one value
-
- long format: (degrees, minutes, seconds)
- minutes and seconds must be greater than or equal zero
-
- result:
- if d>=0 : result= d + ((s/60)+m)/60
- if d<0 : result= d - ((s/60)+m)/60
-
- ((s/60)+m)/60 = (s+60*m)/3600 (second version is faster because
- there's only one division)
-
- for example:
- DegToDeg(10, 30, 0) = 10.5
- DegToDeg(10, 24, 35.6)=10.4098(8)
- */
- template<class ValueType>
- ValueType DegToDeg( const ValueType & d, const ValueType & m, const ValueType & s,
- ErrorCode * err = 0)
- {
- ValueType delimiter, multipler;
- uint c = 0;
-
- if( d.IsNan() || m.IsNan() || s.IsNan() || m.IsSign() || s.IsSign() )
- {
- if( err )
- *err = err_improper_argument;
-
- delimiter.SetZeroNan(); // not needed, only to get rid of GCC warning about an uninitialized variable
-
- return delimiter;
- }
-
- multipler = 60;
- delimiter = 3600;
-
- c += multipler.Mul(m);
- c += multipler.Add(s);
- c += multipler.Div(delimiter);
-
- if( d.IsSign() )
- multipler.ChangeSign();
-
- c += multipler.Add(d);
-
- if( err )
- *err = c ? err_overflow : err_ok;
-
- return multipler;
- }
-
-
- /*!
- this function converts degrees in the long format to radians
- */
- template<class ValueType>
- ValueType DegToRad( const ValueType & d, const ValueType & m, const ValueType & s,
- ErrorCode * err = 0)
- {
- ValueType temp_deg = DegToDeg(d,m,s,err);
-
- if( err && *err!=err_ok )
- return temp_deg;
-
- return DegToRad(temp_deg, err);
- }
-
-
- /*!
- this function converts gradians to radians
-
- it returns: x * pi / 200
- */
- template<class ValueType>
- ValueType GradToRad(const ValueType & x, ErrorCode * err = 0)
- {
- ValueType result, temp;
- uint c = 0;
-
- if( x.IsNan() )
- {
- if( err )
- *err = err_improper_argument;
-
- return x;
- }
-
- result = x;
-
- // it is better to make division first and then multiplication
- // the result is more accurate especially when x is: 100,200,300 or 400
- temp = 200;
- c += result.Div(temp);
-
- temp.SetPi();
- c += result.Mul(temp);
-
- if( err )
- *err = c ? err_overflow : err_ok;
-
- return result;
- }
-
-
- /*!
- this function converts radians to gradians
-
- it returns: x * 200 / pi
- */
- template<class ValueType>
- ValueType RadToGrad(const ValueType & x, ErrorCode * err = 0)
- {
- ValueType result, delimiter;
- uint c = 0;
-
- if( x.IsNan() )
- {
- if( err )
- *err = err_improper_argument;
-
- return x;
- }
-
- result = 200;
- c += result.Mul(x);
-
- delimiter.SetPi();
- c += result.Div(delimiter);
-
- if( err )
- *err = c ? err_overflow : err_ok;
-
- return result;
- }
-
-
- /*!
- this function converts degrees to gradians
-
- it returns: x * 200 / 180
- */
- template<class ValueType>
- ValueType DegToGrad(const ValueType & x, ErrorCode * err = 0)
- {
- ValueType result, temp;
- uint c = 0;
-
- if( x.IsNan() )
- {
- if( err )
- *err = err_improper_argument;
-
- return x;
- }
-
- result = x;
-
- temp = 200;
- c += result.Mul(temp);
-
- temp = 180;
- c += result.Div(temp);
-
- if( err )
- *err = c ? err_overflow : err_ok;
-
- return result;
- }
-
-
- /*!
- this function converts degrees in the long format to gradians
- */
- template<class ValueType>
- ValueType DegToGrad( const ValueType & d, const ValueType & m, const ValueType & s,
- ErrorCode * err = 0)
- {
- ValueType temp_deg = DegToDeg(d,m,s,err);
-
- if( err && *err!=err_ok )
- return temp_deg;
-
- return DegToGrad(temp_deg, err);
- }
-
-
- /*!
- this function converts degrees to gradians
-
- it returns: x * 180 / 200
- */
- template<class ValueType>
- ValueType GradToDeg(const ValueType & x, ErrorCode * err = 0)
- {
- ValueType result, temp;
- uint c = 0;
-
- if( x.IsNan() )
- {
- if( err )
- *err = err_improper_argument;
-
- return x;
- }
-
- result = x;
-
- temp = 180;
- c += result.Mul(temp);
-
- temp = 200;
- c += result.Div(temp);
-
- if( err )
- *err = c ? err_overflow : err_ok;
-
- return result;
- }
-
-
-
-
- /*
- *
- * another functions
- *
- *
- */
-
-
- /*!
- this function calculates the square root
-
- Sqrt(9) = 3
- */
- template<class ValueType>
- ValueType Sqrt(ValueType x, ErrorCode * err = 0)
- {
- if( x.IsNan() || x.IsSign() )
- {
- if( err )
- *err = err_improper_argument;
-
- x.SetNan();
-
- return x;
- }
-
- uint c = x.Sqrt();
-
- if( err )
- *err = c ? err_overflow : err_ok;
-
- return x;
- }
-
-
-
- namespace auxiliaryfunctions
- {
-
- template<class ValueType>
- bool RootCheckIndexSign(ValueType & x, const ValueType & index, ErrorCode * err)
- {
- if( index.IsSign() )
- {
- // index cannot be negative
- if( err )
- *err = err_improper_argument;
-
- x.SetNan();
-
- return true;
- }
-
- return false;
- }
-
-
- template<class ValueType>
- bool RootCheckIndexZero(ValueType & x, const ValueType & index, ErrorCode * err)
- {
- if( index.IsZero() )
- {
- if( x.IsZero() )
- {
- // there isn't root(0;0) - we assume it's not defined
- if( err )
- *err = err_improper_argument;
-
- x.SetNan();
-
- return true;
- }
-
- // root(x;0) is 1 (if x!=0)
- x.SetOne();
-
- if( err )
- *err = err_ok;
-
- return true;
- }
-
- return false;
- }
-
-
- template<class ValueType>
- bool RootCheckIndexOne(const ValueType & index, ErrorCode * err)
- {
- ValueType one;
- one.SetOne();
-
- if( index == one )
- {
- //root(x;1) is x
- // we do it because if we used the PowFrac function
- // we would lose the precision
- if( err )
- *err = err_ok;
-
- return true;
- }
-
- return false;
- }
-
-
- template<class ValueType>
- bool RootCheckIndexTwo(ValueType & x, const ValueType & index, ErrorCode * err)
- {
- if( index == 2 )
- {
- x = Sqrt(x, err);
-
- return true;
- }
-
- return false;
- }
-
-
- template<class ValueType>
- bool RootCheckIndexFrac(ValueType & x, const ValueType & index, ErrorCode * err)
- {
- if( !index.IsInteger() )
- {
- // index must be integer
- if( err )
- *err = err_improper_argument;
-
- x.SetNan();
-
- return true;
- }
-
- return false;
- }
-
-
- template<class ValueType>
- bool RootCheckXZero(ValueType & x, ErrorCode * err)
- {
- if( x.IsZero() )
- {
- // root(0;index) is zero (if index!=0)
- // RootCheckIndexZero() must be called beforehand
- x.SetZero();
-
- if( err )
- *err = err_ok;
-
- return true;
- }
-
- return false;
- }
-
-
- template<class ValueType>
- bool RootCheckIndex(ValueType & x, const ValueType & index, ErrorCode * err, bool * change_sign)
- {
- *change_sign = false;
-
- if( index.Mod2() )
- {
- // index is odd (1,3,5...)
- if( x.IsSign() )
- {
- *change_sign = true;
- x.Abs();
- }
- }
- else
- {
- // index is even
- // x cannot be negative
- if( x.IsSign() )
- {
- if( err )
- *err = err_improper_argument;
-
- x.SetNan();
-
- return true;
- }
- }
-
- return false;
- }
-
-
- template<class ValueType>
- uint RootCorrectInteger(ValueType & old_x, ValueType & x, const ValueType & index)
- {
- if( !old_x.IsInteger() || x.IsInteger() || !index.exponent.IsSign() )
- return 0;
-
- // old_x is integer,
- // x is not integer,
- // index is relatively small (index.exponent<0 or index.exponent<=0)
- // (because we're using a special powering algorithm Big::PowUInt())
-
- uint c = 0;
-
- ValueType temp(x);
- c += temp.Round();
-
- ValueType temp_round(temp);
- c += temp.PowUInt(index);
-
- if( temp == old_x )
- x = temp_round;
-
- return (c==0)? 0 : 1;
- }
-
-
-
- } // namespace auxiliaryfunctions
-
-
-
- /*!
- indexth Root of x
- index must be integer and not negative <0;1;2;3....)
-
- if index==0 the result is one
- if x==0 the result is zero and we assume root(0;0) is not defined
-
- if index is even (2;4;6...) the result is x^(1/index) and x>0
- if index is odd (1;2;3;...) the result is either
- -(abs(x)^(1/index)) if x<0 or
- x^(1/index)) if x>0
-
- (for index==1 the result is equal x)
- */
- template<class ValueType>
- ValueType Root(ValueType x, const ValueType & index, ErrorCode * err = 0)
- {
- using namespace auxiliaryfunctions;
-
- if( x.IsNan() || index.IsNan() )
- {
- if( err )
- *err = err_improper_argument;
-
- x.SetNan();
-
- return x;
- }
-
- if( RootCheckIndexSign(x, index, err) ) return x;
- if( RootCheckIndexZero(x, index, err) ) return x;
- if( RootCheckIndexOne ( index, err) ) return x;
- if( RootCheckIndexTwo (x, index, err) ) return x;
- if( RootCheckIndexFrac(x, index, err) ) return x;
- if( RootCheckXZero (x, err) ) return x;
-
- // index integer and index!=0
- // x!=0
-
- ValueType old_x(x);
- bool change_sign;
-
- if( RootCheckIndex(x, index, err, &change_sign ) ) return x;
-
- ValueType temp;
- uint c = 0;
-
- // we're using the formula: root(x ; n) = exp( ln(x) / n )
- c += temp.Ln(x);
- c += temp.Div(index);
- c += x.Exp(temp);
-
- if( change_sign )
- {
- // x is different from zero
- x.SetSign();
- }
-
- c += RootCorrectInteger(old_x, x, index);
-
- if( err )
- *err = c ? err_overflow : err_ok;
-
- return x;
- }
-
-
-
- /*!
- absolute value of x
- e.g. -2 = 2
- 2 = 2
- */
- template<class ValueType>
- ValueType Abs(const ValueType & x)
- {
- ValueType result( x );
- result.Abs();
-
- return result;
- }
-
-
- /*!
- it returns the sign of the value
- e.g. -2 = -1
- 0 = 0
- 10 = 1
- */
- template<class ValueType>
- ValueType Sgn(ValueType x)
- {
- x.Sgn();
-
- return x;
- }
-
-
- /*!
- the remainder from a division
-
- e.g.
- mod( 12.6 ; 3) = 0.6 because 12.6 = 3*4 + 0.6
- mod(-12.6 ; 3) = -0.6 bacause -12.6 = 3*(-4) + (-0.6)
- mod( 12.6 ; -3) = 0.6
- mod(-12.6 ; -3) = -0.6
- */
- template<class ValueType>
- ValueType Mod(ValueType a, const ValueType & b, ErrorCode * err = 0)
- {
- if( a.IsNan() || b.IsNan() )
- {
- if( err )
- *err = err_improper_argument;
-
- a.SetNan();
-
- return a;
- }
-
- uint c = a.Mod(b);
-
- if( err )
- *err = c ? err_overflow : err_ok;
-
- return a;
- }
-
-
-
- namespace auxiliaryfunctions
- {
-
- /*!
- this function is used to store factorials in a given container
- 'more' means how many values should be added at the end
-
- e.g.
- std::vector<ValueType> fact;
- SetFactorialSequence(fact, 3);
- // now the container has three values: 1 1 2
-
- SetFactorialSequence(fact, 2);
- // now the container has five values: 1 1 2 6 24
- */
- template<class ValueType>
- void SetFactorialSequence(std::vector<ValueType> & fact, uint more = 20)
- {
- if( more == 0 )
- more = 1;
-
- uint start = static_cast<uint>(fact.size());
- fact.resize(fact.size() + more);
-
- if( start == 0 )
- {
- fact[0] = 1;
- ++start;
- }
-
- for(uint i=start ; i<fact.size() ; ++i)
- {
- fact[i] = fact[i-1];
- fact[i].MulInt(i);
- }
- }
-
-
- /*!
- an auxiliary function used to calculate Bernoulli numbers
-
- this function returns a sum:
- sum(m) = sum_{k=0}^{m-1} {2^k * (m k) * B(k)} k in [0, m-1] (m k) means binomial coefficient = (m! / (k! * (m-k)!))
-
- you should have sufficient factorials in cgamma.fact
- (cgamma.fact should have at least m items)
-
- n_ should be equal 2
- */
- template<class ValueType>
- ValueType SetBernoulliNumbersSum(CGamma<ValueType> & cgamma, const ValueType & n_, uint m,
- const volatile StopCalculating * stop = 0)
- {
- ValueType k_, temp, temp2, temp3, sum;
-
- sum.SetZero();
-
- for(uint k=0 ; k<m ; ++k) // k<m means k<=m-1
- {
- if( stop && (k & 15)==0 ) // means: k % 16 == 0
- if( stop->WasStopSignal() )
- return ValueType(); // NaN
-
- if( k>1 && (k & 1) == 1 ) // for that k the Bernoulli number is zero
- continue;
-
- k_ = k;
-
- temp = n_; // n_ is equal 2
- temp.Pow(k_);
- // temp = 2^k
-
- temp2 = cgamma.fact[m];
- temp3 = cgamma.fact[k];
- temp3.Mul(cgamma.fact[m-k]);
- temp2.Div(temp3);
- // temp2 = (m k) = m! / ( k! * (m-k)! )
-
- temp.Mul(temp2);
- temp.Mul(cgamma.bern[k]);
-
- sum.Add(temp);
- // sum += 2^k * (m k) * B(k)
-
- if( sum.IsNan() )
- break;
- }
-
- return sum;
- }
-
-
- /*!
- an auxiliary function used to calculate Bernoulli numbers
- start is >= 2
-
- we use the recurrence formula:
- B(m) = 1 / (2*(1 - 2^m)) * sum(m)
- where sum(m) is calculated by SetBernoulliNumbersSum()
- */
- template<class ValueType>
- bool SetBernoulliNumbersMore(CGamma<ValueType> & cgamma, uint start, const volatile StopCalculating * stop = 0)
- {
- ValueType denominator, temp, temp2, temp3, m_, sum, sum2, n_, k_;
-
- const uint n = 2;
- n_ = n;
-
- // start is >= 2
- for(uint m=start ; m<cgamma.bern.size() ; ++m)
- {
- if( (m & 1) == 1 )
- {
- cgamma.bern[m].SetZero();
- }
- else
- {
- m_ = m;
-
- temp = n_; // n_ = 2
- temp.Pow(m_);
- // temp = 2^m
-
- denominator.SetOne();
- denominator.Sub(temp);
- if( denominator.exponent.AddOne() ) // it means: denominator.MulInt(2)
- denominator.SetNan();
-
- // denominator = 2 * (1 - 2^m)
-
- cgamma.bern[m] = SetBernoulliNumbersSum(cgamma, n_, m, stop);
-
- if( stop && stop->WasStopSignal() )
- {
- cgamma.bern.resize(m); // valid numbers are in [0, m-1]
- return false;
- }
-
- cgamma.bern[m].Div(denominator);
- }
- }
-
- return true;
- }
-
-
- /*!
- this function is used to calculate Bernoulli numbers,
- returns false if there was a stop signal,
- 'more' means how many values should be added at the end
-
- e.g.
- typedef Big<1,2> MyBig;
- CGamma<MyBig> cgamma;
- SetBernoulliNumbers(cgamma, 3);
- // now we have three first Bernoulli numbers: 1 -0.5 0.16667
-
- SetBernoulliNumbers(cgamma, 4);
- // now we have 7 Bernoulli numbers: 1 -0.5 0.16667 0 -0.0333 0 0.0238
- */
- template<class ValueType>
- bool SetBernoulliNumbers(CGamma<ValueType> & cgamma, uint more = 20, const volatile StopCalculating * stop = 0)
- {
- if( more == 0 )
- more = 1;
-
- uint start = static_cast<uint>(cgamma.bern.size());
- cgamma.bern.resize(cgamma.bern.size() + more);
-
- if( start == 0 )
- {
- cgamma.bern[0].SetOne();
- ++start;
- }
-
- if( cgamma.bern.size() == 1 )
- return true;
-
- if( start == 1 )
- {
- cgamma.bern[1].Set05();
- cgamma.bern[1].ChangeSign();
- ++start;
- }
-
- // we should have sufficient factorials in cgamma.fact
- if( cgamma.fact.size() < cgamma.bern.size() )
- SetFactorialSequence(cgamma.fact, static_cast<uint>(cgamma.bern.size() - cgamma.fact.size()));
-
-
- return SetBernoulliNumbersMore(cgamma, start, stop);
- }
-
-
- /*!
- an auxiliary function used to calculate the Gamma() function
-
- we calculate a sum:
- sum(n) = sum_{m=2} { B(m) / ( (m^2 - m) * n^(m-1) ) } = 1/(12*n) - 1/(360*n^3) + 1/(1260*n^5) + ...
- B(m) means a mth Bernoulli number
- the sum starts from m=2, we calculate as long as the value will not change after adding a next part
- */
- template<class ValueType>
- ValueType GammaFactorialHighSum(const ValueType & n, CGamma<ValueType> & cgamma, ErrorCode & err,
- const volatile StopCalculating * stop)
- {
- ValueType temp, temp2, denominator, sum, oldsum;
-
- sum.SetZero();
-
- for(uint m=2 ; m<TTMATH_ARITHMETIC_MAX_LOOP ; m+=2)
- {
- if( stop && (m & 3)==0 ) // (m & 3)==0 means: (m % 4)==0
- if( stop->WasStopSignal() )
- {
- err = err_interrupt;
- return ValueType(); // NaN
- }
-
- temp = (m-1);
- denominator = n;
- denominator.Pow(temp);
- // denominator = n ^ (m-1)
-
- temp = m;
- temp2 = temp;
- temp.Mul(temp2);
- temp.Sub(temp2);
- // temp = m^2 - m
-
- denominator.Mul(temp);
- // denominator = (m^2 - m) * n ^ (m-1)
-
- if( m >= cgamma.bern.size() )
- {
- if( !SetBernoulliNumbers(cgamma, m - cgamma.bern.size() + 1 + 3, stop) ) // 3 more than needed
- {
- // there was the stop signal
- err = err_interrupt;
- return ValueType(); // NaN
- }
- }
-
- temp = cgamma.bern[m];
- temp.Div(denominator);
-
- oldsum = sum;
- sum.Add(temp);
-
- if( sum.IsNan() || oldsum==sum )
- break;
- }
-
- return sum;
- }
-
-
- /*!
- an auxiliary function used to calculate the Gamma() function
-
- we calculate a helper function GammaFactorialHigh() by using Stirling's series:
- n! = (n/e)^n * sqrt(2*pi*n) * exp( sum(n) )
- where n is a real number (not only an integer) and is sufficient large (greater than TTMATH_GAMMA_BOUNDARY)
- and sum(n) is calculated by GammaFactorialHighSum()
- */
- template<class ValueType>
- ValueType GammaFactorialHigh(const ValueType & n, CGamma<ValueType> & cgamma, ErrorCode & err,
- const volatile StopCalculating * stop)
- {
- ValueType temp, temp2, temp3, denominator, sum;
-
- temp.Set2Pi();
- temp.Mul(n);
- temp2 = Sqrt(temp);
- // temp2 = sqrt(2*pi*n)
-
- temp = n;
- temp3.SetE();
- temp.Div(temp3);
- temp.Pow(n);
- // temp = (n/e)^n
-
- sum = GammaFactorialHighSum(n, cgamma, err, stop);
- temp3.Exp(sum);
- // temp3 = exp(sum)
-
- temp.Mul(temp2);
- temp.Mul(temp3);
-
- return temp;
- }
-
-
- /*!
- an auxiliary function used to calculate the Gamma() function
-
- Gamma(x) = GammaFactorialHigh(x-1)
- */
- template<class ValueType>
- ValueType GammaPlusHigh(ValueType n, CGamma<ValueType> & cgamma, ErrorCode & err, const volatile StopCalculating * stop)
- {
- ValueType one;
-
- one.SetOne();
- n.Sub(one);
-
- return GammaFactorialHigh(n, cgamma, err, stop);
- }
-
-
- /*!
- an auxiliary function used to calculate the Gamma() function
-
- we use this function when n is integer and a small value (from 0 to TTMATH_GAMMA_BOUNDARY]
- we use the formula:
- gamma(n) = (n-1)! = 1 * 2 * 3 * ... * (n-1)
- */
- template<class ValueType>
- ValueType GammaPlusLowIntegerInt(uint n, CGamma<ValueType> & cgamma)
- {
- TTMATH_ASSERT( n > 0 )
-
- if( n - 1 < static_cast<uint>(cgamma.fact.size()) )
- return cgamma.fact[n - 1];
-
- ValueType res;
- uint start = 2;
-
- if( cgamma.fact.size() < 2 )
- {
- res.SetOne();
- }
- else
- {
- start = static_cast<uint>(cgamma.fact.size());
- res = cgamma.fact[start-1];
- }
-
- for(uint i=start ; i<n ; ++i)
- res.MulInt(i);
-
- return res;
- }
-
-
- /*!
- an auxiliary function used to calculate the Gamma() function
-
- we use this function when n is integer and a small value (from 0 to TTMATH_GAMMA_BOUNDARY]
- */
- template<class ValueType>
- ValueType GammaPlusLowInteger(const ValueType & n, CGamma<ValueType> & cgamma)
- {
- sint n_;
-
- n.ToInt(n_);
-
- return GammaPlusLowIntegerInt(n_, cgamma);
- }
-
-
- /*!
- an auxiliary function used to calculate the Gamma() function
-
- we use this function when n is a small value (from 0 to TTMATH_GAMMA_BOUNDARY]
- we use a recurrence formula:
- gamma(z+1) = z * gamma(z)
- then: gamma(z) = gamma(z+1) / z
-
- e.g.
- gamma(3.89) = gamma(2001.89) / ( 3.89 * 4.89 * 5.89 * ... * 1999.89 * 2000.89 )
- */
- template<class ValueType>
- ValueType GammaPlusLow(ValueType n, CGamma<ValueType> & cgamma, ErrorCode & err, const volatile StopCalculating * stop)
- {
- ValueType one, denominator, temp, boundary;
-
- if( n.IsInteger() )
- return GammaPlusLowInteger(n, cgamma);
-
- one.SetOne();
- denominator = n;
- boundary = TTMATH_GAMMA_BOUNDARY;
-
- while( n < boundary )
- {
- n.Add(one);
- denominator.Mul(n);
- }
-
- n.Add(one);
-
- // now n is sufficient big
- temp = GammaPlusHigh(n, cgamma, err, stop);
- temp.Div(denominator);
-
- return temp;
- }
-
-
- /*!
- an auxiliary function used to calculate the Gamma() function
- */
- template<class ValueType>
- ValueType GammaPlus(const ValueType & n, CGamma<ValueType> & cgamma, ErrorCode & err, const volatile StopCalculating * stop)
- {
- if( n > TTMATH_GAMMA_BOUNDARY )
- return GammaPlusHigh(n, cgamma, err, stop);
-
- return GammaPlusLow(n, cgamma, err, stop);
- }
-
-
- /*!
- an auxiliary function used to calculate the Gamma() function
-
- this function is used when n is negative
- we use the reflection formula:
- gamma(1-z) * gamma(z) = pi / sin(pi*z)
- then: gamma(z) = pi / (sin(pi*z) * gamma(1-z))
-
- */
- template<class ValueType>
- ValueType GammaMinus(const ValueType & n, CGamma<ValueType> & cgamma, ErrorCode & err, const volatile StopCalculating * stop)
- {
- ValueType pi, denominator, temp, temp2;
-
- if( n.IsInteger() )
- {
- // gamma function is not defined when n is negative and integer
- err = err_improper_argument;
- return temp; // NaN
- }
-
- pi.SetPi();
-
- temp = pi;
- temp.Mul(n);
- temp2 = Sin(temp);
- // temp2 = sin(pi * n)
-
- temp.SetOne();
- temp.Sub(n);
- temp = GammaPlus(temp, cgamma, err, stop);
- // temp = gamma(1 - n)
-
- temp.Mul(temp2);
- pi.Div(temp);
-
- return pi;
- }
-
- } // namespace auxiliaryfunctions
-
-
-
- /*!
- this function calculates the Gamma function
-
- it's multithread safe, you should create a CGamma<> object and use it whenever you call the Gamma()
- e.g.
- typedef Big<1,2> MyBig;
- MyBig x=234, y=345.53;
- CGamma<MyBig> cgamma;
- std::cout << Gamma(x, cgamma) << std::endl;
- std::cout << Gamma(y, cgamma) << std::endl;
- in the CGamma<> object the function stores some coefficients (factorials, Bernoulli numbers),
- and they will be reused in next calls to the function
-
- each thread should have its own CGamma<> object, and you can use these objects with Factorial() function too
- */
- template<class ValueType>
- ValueType Gamma(const ValueType & n, CGamma<ValueType> & cgamma, ErrorCode * err = 0,
- const volatile StopCalculating * stop = 0)
- {
- using namespace auxiliaryfunctions;
-
- ValueType result;
- ErrorCode err_tmp;
-
- if( n.IsNan() )
- {
- if( err )
- *err = err_improper_argument;
-
- return n;
- }
-
- if( cgamma.history.Get(n, result, err_tmp) )
- {
- if( err )
- *err = err_tmp;
-
- return result;
- }
-
- err_tmp = err_ok;
-
- if( n.IsSign() )
- {
- result = GammaMinus(n, cgamma, err_tmp, stop);
- }
- else
- if( n.IsZero() )
- {
- err_tmp = err_improper_argument;
- result.SetNan();
- }
- else
- {
- result = GammaPlus(n, cgamma, err_tmp, stop);
- }
-
- if( result.IsNan() && err_tmp==err_ok )
- err_tmp = err_overflow;
-
- if( err )
- *err = err_tmp;
-
- if( stop && !stop->WasStopSignal() )
- cgamma.history.Add(n, result, err_tmp);
-
- return result;
- }
-
-
- /*!
- this function calculates the Gamma function
-
- note: this function should be used only in a single-thread environment
- */
- template<class ValueType>
- ValueType Gamma(const ValueType & n, ErrorCode * err = 0)
- {
- // warning: this static object is not thread safe
- static CGamma<ValueType> cgamma;
-
- return Gamma(n, cgamma, err);
- }
-
-
-
- namespace auxiliaryfunctions
- {
-
- /*!
- an auxiliary function for calculating the factorial function
-
- we use the formula:
- x! = gamma(x+1)
- */
- template<class ValueType>
- ValueType Factorial2(ValueType x,
- CGamma<ValueType> * cgamma = 0,
- ErrorCode * err = 0,
- const volatile StopCalculating * stop = 0)
- {
- ValueType result, one;
-
- if( x.IsNan() || x.IsSign() || !x.IsInteger() )
- {
- if( err )
- *err = err_improper_argument;
-
- x.SetNan();
-
- return x;
- }
-
- one.SetOne();
- x.Add(one);
-
- if( cgamma )
- return Gamma(x, *cgamma, err, stop);
-
- return Gamma(x, err);
- }
-
- } // namespace auxiliaryfunctions
-
-
-
- /*!
- the factorial from given 'x'
- e.g.
- Factorial(4) = 4! = 1*2*3*4
-
- it's multithread safe, you should create a CGamma<> object and use it whenever you call the Factorial()
- e.g.
- typedef Big<1,2> MyBig;
- MyBig x=234, y=54345;
- CGamma<MyBig> cgamma;
- std::cout << Factorial(x, cgamma) << std::endl;
- std::cout << Factorial(y, cgamma) << std::endl;
- in the CGamma<> object the function stores some coefficients (factorials, Bernoulli numbers),
- and they will be reused in next calls to the function
-
- each thread should have its own CGamma<> object, and you can use these objects with Gamma() function too
- */
- template<class ValueType>
- ValueType Factorial(const ValueType & x, CGamma<ValueType> & cgamma, ErrorCode * err = 0,
- const volatile StopCalculating * stop = 0)
- {
- return auxiliaryfunctions::Factorial2(x, &cgamma, err, stop);
- }
-
-
- /*!
- the factorial from given 'x'
- e.g.
- Factorial(4) = 4! = 1*2*3*4
-
- note: this function should be used only in a single-thread environment
- */
- template<class ValueType>
- ValueType Factorial(const ValueType & x, ErrorCode * err = 0)
- {
- return auxiliaryfunctions::Factorial2(x, (CGamma<ValueType>*)0, err, 0);
- }
-
-
- /*!
- this method prepares some coefficients: factorials and Bernoulli numbers
- stored in 'fact' and 'bern' objects
-
- we're defining the method here because we're using Gamma() function which
- is not available in ttmathobjects.h
-
- read the doc info in ttmathobjects.h file where CGamma<> struct is declared
- */
- template<class ValueType>
- void CGamma<ValueType>::InitAll()
- {
- ValueType x = TTMATH_GAMMA_BOUNDARY + 1;
-
- // history.Remove(x) removes only one object
- // we must be sure that there are not others objects with the key 'x'
- while( history.Remove(x) )
- {
- }
-
- // the simplest way to initialize is to call the Gamma function with (TTMATH_GAMMA_BOUNDARY + 1)
- // when x is larger then fewer coefficients we need
- Gamma(x, *this);
- }
-
-
-
-} // namespace
-
-
-/*!
- this is for convenience for the user
- he can only use '#include <ttmath/ttmath.h>' even if he uses the parser
-*/
-#include "ttmathparser.h"
-
-
-#ifdef _MSC_VER
-//warning C4127: conditional expression is constant
-#pragma warning( default: 4127 )
-//warning C4702: unreachable code
-#pragma warning( default: 4702 )
-//warning C4800: forcing value to bool 'true' or 'false' (performance warning)
-#pragma warning( default: 4800 )
-#endif
-
-#endif
diff --git a/ttmath/ttmathbig.h b/ttmath/ttmathbig.h
deleted file mode 100644
index 6be5d9b..0000000
--- a/ttmath/ttmathbig.h
+++ /dev/null
@@ -1,6061 +0,0 @@
-/*
- * This file is a part of TTMath Bignum Library
- * and is distributed under the (new) BSD licence.
- * Author: Tomasz Sowa <t.sowa at ttmath.org>
- */
-
-/*
- * Copyright (c) 2006-2010, Tomasz Sowa
- * All rights reserved.
- *
- * Redistribution and use in source and binary forms, with or without
- * modification, are permitted provided that the following conditions are met:
- *
- * * Redistributions of source code must retain the above copyright notice,
- * this list of conditions and the following disclaimer.
- *
- * * Redistributions in binary form must reproduce the above copyright
- * notice, this list of conditions and the following disclaimer in the
- * documentation and/or other materials provided with the distribution.
- *
- * * Neither the name Tomasz Sowa nor the names of contributors to this
- * project may be used to endorse or promote products derived
- * from this software without specific prior written permission.
- *
- * THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS"
- * AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
- * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- * ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE
- * LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR
- * CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF
- * SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS
- * INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN
- * CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
- * ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF
- * THE POSSIBILITY OF SUCH DAMAGE.
- */
-
-#ifndef headerfilettmathbig
-#define headerfilettmathbig
-
-/*!
- \file ttmathbig.h
- \brief A Class for representing floating point numbers
-*/
-
-#include "ttmathint.h"
-#include "ttmaththreads.h"
-
-#include <iostream>
-
-#ifdef TTMATH_MULTITHREADS
-#include <signal.h>
-#endif
-
-namespace ttmath
-{
-
-
-/*!
- \brief Big implements the floating point numbers
-*/
-template <uint exp, uint man>
-class Big
-{
-
-/*
- value = mantissa * 2^exponent
-
- exponent - an integer value with a sign
- mantissa - an integer value without a sing
-
- mantissa must be pushed into the left side that is the highest bit from
- mantissa must be one (of course if there's another value than zero) -- this job
- (pushing bits into the left side) making Standardizing() method
-
- for example:
- if we want to store value one (1) into our Big object we must:
- set mantissa to 1
- set exponent to 0
- set info to 0
- and call method Standardizing()
-*/
-
-
-public:
-
-Int<exp> exponent;
-UInt<man> mantissa;
-unsigned char info;
-
-
-/*!
- Sign
- the mask of a bit from 'info' which means that there is a sign
- (when the bit is set)
-*/
-#define TTMATH_BIG_SIGN 128
-
-
-/*!
- Not a number
- if this bit is set that there is not a valid number
-*/
-#define TTMATH_BIG_NAN 64
-
-
-/*!
- Zero
- if this bit is set that there is value zero
- mantissa should be zero and exponent should be zero too
- (the Standardizing() method does this)
-*/
-#define TTMATH_BIG_ZERO 32
-
-
- /*!
- this method sets NaN if there was a carry (and returns 1 in such a case)
-
- c can be 0, 1 or other value different from zero
- */
- uint CheckCarry(uint c)
- {
- if( c != 0 )
- {
- SetNan();
- return 1;
- }
-
- return 0;
- }
-
-public:
-
-
- /*!
- returning the string represents the currect type of the library
- we have following types:
- asm_vc_32 - with asm code designed for Microsoft Visual C++ (32 bits)
- asm_gcc_32 - with asm code designed for GCC (32 bits)
- asm_vc_64 - with asm for VC (64 bit)
- asm_gcc_64 - with asm for GCC (64 bit)
- no_asm_32 - pure C++ version (32 bit) - without any asm code
- no_asm_64 - pure C++ version (64 bit) - without any asm code
- */
- static const char * LibTypeStr()
- {
- return UInt<man>::LibTypeStr();
- }
-
-
- /*!
- returning the currect type of the library
- */
- static LibTypeCode LibType()
- {
- return UInt<man>::LibType();
- }
-
-
-
- /*!
- this method moves all bits from mantissa into its left side
- (suitably changes the exponent) or if the mantissa is zero
- it sets the exponent to zero as well
- (and clears the sign bit and sets the zero bit)
-
- it can return a carry
- the carry will be when we don't have enough space in the exponent
-
- you don't have to use this method if you don't change the mantissa
- and exponent directly
- */
- uint Standardizing()
- {
- if( mantissa.IsTheHighestBitSet() )
- {
- ClearInfoBit(TTMATH_BIG_ZERO);
- return 0;
- }
-
- if( CorrectZero() )
- return 0;
-
- uint comp = mantissa.CompensationToLeft();
-
- return exponent.Sub( comp );
- }
-
-
-private:
-
- /*!
- if the mantissa is equal zero this method sets exponent to zero and
- info without the sign
-
- it returns true if there was the correction
- */
- bool CorrectZero()
- {
- if( mantissa.IsZero() )
- {
- SetInfoBit(TTMATH_BIG_ZERO);
- ClearInfoBit(TTMATH_BIG_SIGN);
- exponent.SetZero();
-
- return true;
- }
- else
- {
- ClearInfoBit(TTMATH_BIG_ZERO);
- }
-
- return false;
- }
-
-
-public:
-
- /*!
- this method clears a specific bit in the 'info' variable
-
- bit is one of: TTMATH_BIG_SIGN, TTMATH_BIG_NAN etc.
- */
- void ClearInfoBit(unsigned char bit)
- {
- info = info & (~bit);
- }
-
-
- /*!
- this method sets a specific bit in the 'info' variable
-
- bit is one of: TTMATH_BIG_SIGN, TTMATH_BIG_NAN etc.
-
- */
- void SetInfoBit(unsigned char bit)
- {
- info = info | bit;
- }
-
-
- /*!
- this method returns true if a specific bit in the 'info' variable is set
-
- bit is one of: TTMATH_BIG_SIGN, TTMATH_BIG_NAN etc.
- */
- bool IsInfoBit(unsigned char bit) const
- {
- return (info & bit) != 0;
- }
-
-
- /*!
- this method sets zero
- */
- void SetZero()
- {
- info = TTMATH_BIG_ZERO;
- exponent.SetZero();
- mantissa.SetZero();
-
- /*
- we don't have to compensate zero
- */
- }
-
-
- /*!
- this method sets one
- */
- void SetOne()
- {
- info = 0;
- mantissa.SetZero();
- mantissa.table[man-1] = TTMATH_UINT_HIGHEST_BIT;
- exponent = -sint(man * TTMATH_BITS_PER_UINT - 1);
-
- // don't have to Standardize() - the last bit from mantissa is set
- }
-
-
- /*!
- this method sets value 0.5
- */
- void Set05()
- {
- SetOne();
- exponent.SubOne();
- }
-
-
- /*!
- this method sets NaN flag (Not a Number)
- when this flag is set that means there is no a valid number
- */
- void SetNan()
- {
- SetInfoBit(TTMATH_BIG_NAN);
- }
-
-
- /*!
- this method sets NaN flag (Not a Number)
- also clears the mantissa and exponent (similarly as it would be a zero value)
- */
- void SetZeroNan()
- {
- SetZero();
- SetNan();
- }
-
-
- /*!
- this method swappes this for an argument
- */
- void Swap(Big<exp, man> & ss2)
- {
- unsigned char info_temp = info;
- info = ss2.info;
- ss2.info = info_temp;
-
- exponent.Swap(ss2.exponent);
- mantissa.Swap(ss2.mantissa);
- }
-
-
-private:
-
- /*!
- this method sets the mantissa of the value of pi
- */
- void SetMantissaPi()
- {
- // this is a static table which represents the value of Pi (mantissa of it)
- // (first is the highest word)
- // we must define this table as 'unsigned int' because
- // both on 32bit and 64bit platforms this table is 32bit
- static const unsigned int temp_table[] = {
- 0xc90fdaa2, 0x2168c234, 0xc4c6628b, 0x80dc1cd1, 0x29024e08, 0x8a67cc74, 0x020bbea6, 0x3b139b22,
- 0x514a0879, 0x8e3404dd, 0xef9519b3, 0xcd3a431b, 0x302b0a6d, 0xf25f1437, 0x4fe1356d, 0x6d51c245,
- 0xe485b576, 0x625e7ec6, 0xf44c42e9, 0xa637ed6b, 0x0bff5cb6, 0xf406b7ed, 0xee386bfb, 0x5a899fa5,
- 0xae9f2411, 0x7c4b1fe6, 0x49286651, 0xece45b3d, 0xc2007cb8, 0xa163bf05, 0x98da4836, 0x1c55d39a,
- 0x69163fa8, 0xfd24cf5f, 0x83655d23, 0xdca3ad96, 0x1c62f356, 0x208552bb, 0x9ed52907, 0x7096966d,
- 0x670c354e, 0x4abc9804, 0xf1746c08, 0xca18217c, 0x32905e46, 0x2e36ce3b, 0xe39e772c, 0x180e8603,
- 0x9b2783a2, 0xec07a28f, 0xb5c55df0, 0x6f4c52c9, 0xde2bcbf6, 0x95581718, 0x3995497c, 0xea956ae5,
- 0x15d22618, 0x98fa0510, 0x15728e5a, 0x8aaac42d, 0xad33170d, 0x04507a33, 0xa85521ab, 0xdf1cba64,
- 0xecfb8504, 0x58dbef0a, 0x8aea7157, 0x5d060c7d, 0xb3970f85, 0xa6e1e4c7, 0xabf5ae8c, 0xdb0933d7,
- 0x1e8c94e0, 0x4a25619d, 0xcee3d226, 0x1ad2ee6b, 0xf12ffa06, 0xd98a0864, 0xd8760273, 0x3ec86a64,
- 0x521f2b18, 0x177b200c, 0xbbe11757, 0x7a615d6c, 0x770988c0, 0xbad946e2, 0x08e24fa0, 0x74e5ab31,
- 0x43db5bfc, 0xe0fd108e, 0x4b82d120, 0xa9210801, 0x1a723c12, 0xa787e6d7, 0x88719a10, 0xbdba5b26,
- 0x99c32718, 0x6af4e23c, 0x1a946834, 0xb6150bda, 0x2583e9ca, 0x2ad44ce8, 0xdbbbc2db, 0x04de8ef9,
- 0x2e8efc14, 0x1fbecaa6, 0x287c5947, 0x4e6bc05d, 0x99b2964f, 0xa090c3a2, 0x233ba186, 0x515be7ed,
- 0x1f612970, 0xcee2d7af, 0xb81bdd76, 0x2170481c, 0xd0069127, 0xd5b05aa9, 0x93b4ea98, 0x8d8fddc1,
- 0x86ffb7dc, 0x90a6c08f, 0x4df435c9, 0x34028492, 0x36c3fab4, 0xd27c7026, 0xc1d4dcb2, 0x602646de,
- 0xc9751e76, 0x3dba37bd, 0xf8ff9406, 0xad9e530e, 0xe5db382f, 0x413001ae, 0xb06a53ed, 0x9027d831,
- 0x179727b0, 0x865a8918, 0xda3edbeb, 0xcf9b14ed, 0x44ce6cba, 0xced4bb1b, 0xdb7f1447, 0xe6cc254b,
- 0x33205151, 0x2bd7af42, 0x6fb8f401, 0x378cd2bf, 0x5983ca01, 0xc64b92ec, 0xf032ea15, 0xd1721d03,
- 0xf482d7ce, 0x6e74fef6, 0xd55e702f, 0x46980c82, 0xb5a84031, 0x900b1c9e, 0x59e7c97f, 0xbec7e8f3,
- 0x23a97a7e, 0x36cc88be, 0x0f1d45b7, 0xff585ac5, 0x4bd407b2, 0x2b4154aa, 0xcc8f6d7e, 0xbf48e1d8,
- 0x14cc5ed2, 0x0f8037e0, 0xa79715ee, 0xf29be328, 0x06a1d58b, 0xb7c5da76, 0xf550aa3d, 0x8a1fbff0,
- 0xeb19ccb1, 0xa313d55c, 0xda56c9ec, 0x2ef29632, 0x387fe8d7, 0x6e3c0468, 0x043e8f66, 0x3f4860ee,
- 0x12bf2d5b, 0x0b7474d6, 0xe694f91e, 0x6dbe1159, 0x74a3926f, 0x12fee5e4, 0x38777cb6, 0xa932df8c,
- 0xd8bec4d0, 0x73b931ba, 0x3bc832b6, 0x8d9dd300, 0x741fa7bf, 0x8afc47ed, 0x2576f693, 0x6ba42466,
- 0x3aab639c, 0x5ae4f568, 0x3423b474, 0x2bf1c978, 0x238f16cb, 0xe39d652d, 0xe3fdb8be, 0xfc848ad9,
- 0x22222e04, 0xa4037c07, 0x13eb57a8, 0x1a23f0c7, 0x3473fc64, 0x6cea306b, 0x4bcbc886, 0x2f8385dd,
- 0xfa9d4b7f, 0xa2c087e8, 0x79683303, 0xed5bdd3a, 0x062b3cf5, 0xb3a278a6, 0x6d2a13f8, 0x3f44f82d,
- 0xdf310ee0, 0x74ab6a36, 0x4597e899, 0xa0255dc1, 0x64f31cc5, 0x0846851d, 0xf9ab4819, 0x5ded7ea1,
- 0xb1d510bd, 0x7ee74d73, 0xfaf36bc3, 0x1ecfa268, 0x359046f4, 0xeb879f92, 0x4009438b, 0x481c6cd7,
- 0x889a002e, 0xd5ee382b, 0xc9190da6, 0xfc026e47, 0x9558e447, 0x5677e9aa, 0x9e3050e2, 0x765694df,
- 0xc81f56e8, 0x80b96e71, 0x60c980dd, 0x98a573ea, 0x4472065a, 0x139cd290, 0x6cd1cb72, 0x9ec52a53 // last one was: 0x9ec52a52
- //0x86d44014, ...
- // (the last word 0x9ec52a52 was rounded up because the next one is 0x86d44014 -- first bit is one 0x8..)
- // 256 32bit words for the mantissa -- about 2464 valid decimal digits
- };
- // the value of PI is comming from the website http://zenwerx.com/pi.php
- // 3101 digits were taken from this website
- // (later the digits were compared with:
- // http://www.eveandersson.com/pi/digits/1000000 and http://www.geom.uiuc.edu/~huberty/math5337/groupe/digits.html )
- // and they were set into Big<1,400> type (using operator=(const char*) on a 32bit platform)
- // and then the first 256 words were taken into this table
- // (TTMATH_BUILTIN_VARIABLES_SIZE on 32bit platform should have the value 256,
- // and on 64bit platform value 128 (256/2=128))
-
- mantissa.SetFromTable(temp_table, sizeof(temp_table) / sizeof(int));
- }
-
-public:
-
-
- /*!
- this method sets the value of pi
- */
- void SetPi()
- {
- SetMantissaPi();
- info = 0;
- exponent = -sint(man)*sint(TTMATH_BITS_PER_UINT) + 2;
- }
-
-
- /*!
- this method sets the value of 0.5 * pi
- */
- void Set05Pi()
- {
- SetMantissaPi();
- info = 0;
- exponent = -sint(man)*sint(TTMATH_BITS_PER_UINT) + 1;
- }
-
-
- /*!
- this method sets the value of 2 * pi
- */
- void Set2Pi()
- {
- SetMantissaPi();
- info = 0;
- exponent = -sint(man)*sint(TTMATH_BITS_PER_UINT) + 3;
- }
-
-
- /*!
- this method sets the value of e
- (the base of the natural logarithm)
- */
- void SetE()
- {
- static const unsigned int temp_table[] = {
- 0xadf85458, 0xa2bb4a9a, 0xafdc5620, 0x273d3cf1, 0xd8b9c583, 0xce2d3695, 0xa9e13641, 0x146433fb,
- 0xcc939dce, 0x249b3ef9, 0x7d2fe363, 0x630c75d8, 0xf681b202, 0xaec4617a, 0xd3df1ed5, 0xd5fd6561,
- 0x2433f51f, 0x5f066ed0, 0x85636555, 0x3ded1af3, 0xb557135e, 0x7f57c935, 0x984f0c70, 0xe0e68b77,
- 0xe2a689da, 0xf3efe872, 0x1df158a1, 0x36ade735, 0x30acca4f, 0x483a797a, 0xbc0ab182, 0xb324fb61,
- 0xd108a94b, 0xb2c8e3fb, 0xb96adab7, 0x60d7f468, 0x1d4f42a3, 0xde394df4, 0xae56ede7, 0x6372bb19,
- 0x0b07a7c8, 0xee0a6d70, 0x9e02fce1, 0xcdf7e2ec, 0xc03404cd, 0x28342f61, 0x9172fe9c, 0xe98583ff,
- 0x8e4f1232, 0xeef28183, 0xc3fe3b1b, 0x4c6fad73, 0x3bb5fcbc, 0x2ec22005, 0xc58ef183, 0x7d1683b2,
- 0xc6f34a26, 0xc1b2effa, 0x886b4238, 0x611fcfdc, 0xde355b3b, 0x6519035b, 0xbc34f4de, 0xf99c0238,
- 0x61b46fc9, 0xd6e6c907, 0x7ad91d26, 0x91f7f7ee, 0x598cb0fa, 0xc186d91c, 0xaefe1309, 0x85139270,
- 0xb4130c93, 0xbc437944, 0xf4fd4452, 0xe2d74dd3, 0x64f2e21e, 0x71f54bff, 0x5cae82ab, 0x9c9df69e,
- 0xe86d2bc5, 0x22363a0d, 0xabc52197, 0x9b0deada, 0x1dbf9a42, 0xd5c4484e, 0x0abcd06b, 0xfa53ddef,
- 0x3c1b20ee, 0x3fd59d7c, 0x25e41d2b, 0x669e1ef1, 0x6e6f52c3, 0x164df4fb, 0x7930e9e4, 0xe58857b6,
- 0xac7d5f42, 0xd69f6d18, 0x7763cf1d, 0x55034004, 0x87f55ba5, 0x7e31cc7a, 0x7135c886, 0xefb4318a,
- 0xed6a1e01, 0x2d9e6832, 0xa907600a, 0x918130c4, 0x6dc778f9, 0x71ad0038, 0x092999a3, 0x33cb8b7a,
- 0x1a1db93d, 0x7140003c, 0x2a4ecea9, 0xf98d0acc, 0x0a8291cd, 0xcec97dcf, 0x8ec9b55a, 0x7f88a46b,
- 0x4db5a851, 0xf44182e1, 0xc68a007e, 0x5e0dd902, 0x0bfd64b6, 0x45036c7a, 0x4e677d2c, 0x38532a3a,
- 0x23ba4442, 0xcaf53ea6, 0x3bb45432, 0x9b7624c8, 0x917bdd64, 0xb1c0fd4c, 0xb38e8c33, 0x4c701c3a,
- 0xcdad0657, 0xfccfec71, 0x9b1f5c3e, 0x4e46041f, 0x388147fb, 0x4cfdb477, 0xa52471f7, 0xa9a96910,
- 0xb855322e, 0xdb6340d8, 0xa00ef092, 0x350511e3, 0x0abec1ff, 0xf9e3a26e, 0x7fb29f8c, 0x183023c3,
- 0x587e38da, 0x0077d9b4, 0x763e4e4b, 0x94b2bbc1, 0x94c6651e, 0x77caf992, 0xeeaac023, 0x2a281bf6,
- 0xb3a739c1, 0x22611682, 0x0ae8db58, 0x47a67cbe, 0xf9c9091b, 0x462d538c, 0xd72b0374, 0x6ae77f5e,
- 0x62292c31, 0x1562a846, 0x505dc82d, 0xb854338a, 0xe49f5235, 0xc95b9117, 0x8ccf2dd5, 0xcacef403,
- 0xec9d1810, 0xc6272b04, 0x5b3b71f9, 0xdc6b80d6, 0x3fdd4a8e, 0x9adb1e69, 0x62a69526, 0xd43161c1,
- 0xa41d570d, 0x7938dad4, 0xa40e329c, 0xcff46aaa, 0x36ad004c, 0xf600c838, 0x1e425a31, 0xd951ae64,
- 0xfdb23fce, 0xc9509d43, 0x687feb69, 0xedd1cc5e, 0x0b8cc3bd, 0xf64b10ef, 0x86b63142, 0xa3ab8829,
- 0x555b2f74, 0x7c932665, 0xcb2c0f1c, 0xc01bd702, 0x29388839, 0xd2af05e4, 0x54504ac7, 0x8b758282,
- 0x2846c0ba, 0x35c35f5c, 0x59160cc0, 0x46fd8251, 0x541fc68c, 0x9c86b022, 0xbb709987, 0x6a460e74,
- 0x51a8a931, 0x09703fee, 0x1c217e6c, 0x3826e52c, 0x51aa691e, 0x0e423cfc, 0x99e9e316, 0x50c1217b,
- 0x624816cd, 0xad9a95f9, 0xd5b80194, 0x88d9c0a0, 0xa1fe3075, 0xa577e231, 0x83f81d4a, 0x3f2fa457,
- 0x1efc8ce0, 0xba8a4fe8, 0xb6855dfe, 0x72b0a66e, 0xded2fbab, 0xfbe58a30, 0xfafabe1c, 0x5d71a87e,
- 0x2f741ef8, 0xc1fe86fe, 0xa6bbfde5, 0x30677f0d, 0x97d11d49, 0xf7a8443d, 0x0822e506, 0xa9f4614e,
- 0x011e2a94, 0x838ff88c, 0xd68c8bb7, 0xc51eef6d, 0x49ea8ab4, 0xf2c3df5b, 0xb4e0735a, 0xb0d68749
- // 0x2fe26dd4, ...
- // 256 32bit words for the mantissa -- about 2464 valid decimal digits
- };
-
- // above value was calculated using Big<1,400> type on a 32bit platform
- // and then the first 256 words were taken,
- // the calculating was made by using ExpSurrounding0(1) method
- // which took 1420 iterations
- // (the result was compared with e taken from http://antwrp.gsfc.nasa.gov/htmltest/gifcity/e.2mil)
- // (TTMATH_BUILTIN_VARIABLES_SIZE on 32bit platform should have the value 256,
- // and on 64bit platform value 128 (256/2=128))
-
- mantissa.SetFromTable(temp_table, sizeof(temp_table) / sizeof(int));
- exponent = -sint(man)*sint(TTMATH_BITS_PER_UINT) + 2;
- info = 0;
- }
-
-
- /*!
- this method sets the value of ln(2)
- the natural logarithm from 2
- */
- void SetLn2()
- {
- static const unsigned int temp_table[] = {
- 0xb17217f7, 0xd1cf79ab, 0xc9e3b398, 0x03f2f6af, 0x40f34326, 0x7298b62d, 0x8a0d175b, 0x8baafa2b,
- 0xe7b87620, 0x6debac98, 0x559552fb, 0x4afa1b10, 0xed2eae35, 0xc1382144, 0x27573b29, 0x1169b825,
- 0x3e96ca16, 0x224ae8c5, 0x1acbda11, 0x317c387e, 0xb9ea9bc3, 0xb136603b, 0x256fa0ec, 0x7657f74b,
- 0x72ce87b1, 0x9d6548ca, 0xf5dfa6bd, 0x38303248, 0x655fa187, 0x2f20e3a2, 0xda2d97c5, 0x0f3fd5c6,
- 0x07f4ca11, 0xfb5bfb90, 0x610d30f8, 0x8fe551a2, 0xee569d6d, 0xfc1efa15, 0x7d2e23de, 0x1400b396,
- 0x17460775, 0xdb8990e5, 0xc943e732, 0xb479cd33, 0xcccc4e65, 0x9393514c, 0x4c1a1e0b, 0xd1d6095d,
- 0x25669b33, 0x3564a337, 0x6a9c7f8a, 0x5e148e82, 0x074db601, 0x5cfe7aa3, 0x0c480a54, 0x17350d2c,
- 0x955d5179, 0xb1e17b9d, 0xae313cdb, 0x6c606cb1, 0x078f735d, 0x1b2db31b, 0x5f50b518, 0x5064c18b,
- 0x4d162db3, 0xb365853d, 0x7598a195, 0x1ae273ee, 0x5570b6c6, 0x8f969834, 0x96d4e6d3, 0x30af889b,
- 0x44a02554, 0x731cdc8e, 0xa17293d1, 0x228a4ef9, 0x8d6f5177, 0xfbcf0755, 0x268a5c1f, 0x9538b982,
- 0x61affd44, 0x6b1ca3cf, 0x5e9222b8, 0x8c66d3c5, 0x422183ed, 0xc9942109, 0x0bbb16fa, 0xf3d949f2,
- 0x36e02b20, 0xcee886b9, 0x05c128d5, 0x3d0bd2f9, 0x62136319, 0x6af50302, 0x0060e499, 0x08391a0c,
- 0x57339ba2, 0xbeba7d05, 0x2ac5b61c, 0xc4e9207c, 0xef2f0ce2, 0xd7373958, 0xd7622658, 0x901e646a,
- 0x95184460, 0xdc4e7487, 0x156e0c29, 0x2413d5e3, 0x61c1696d, 0xd24aaebd, 0x473826fd, 0xa0c238b9,
- 0x0ab111bb, 0xbd67c724, 0x972cd18b, 0xfbbd9d42, 0x6c472096, 0xe76115c0, 0x5f6f7ceb, 0xac9f45ae,
- 0xcecb72f1, 0x9c38339d, 0x8f682625, 0x0dea891e, 0xf07afff3, 0xa892374e, 0x175eb4af, 0xc8daadd8,
- 0x85db6ab0, 0x3a49bd0d, 0xc0b1b31d, 0x8a0e23fa, 0xc5e5767d, 0xf95884e0, 0x6425a415, 0x26fac51c,
- 0x3ea8449f, 0xe8f70edd, 0x062b1a63, 0xa6c4c60c, 0x52ab3316, 0x1e238438, 0x897a39ce, 0x78b63c9f,
- 0x364f5b8a, 0xef22ec2f, 0xee6e0850, 0xeca42d06, 0xfb0c75df, 0x5497e00c, 0x554b03d7, 0xd2874a00,
- 0x0ca8f58d, 0x94f0341c, 0xbe2ec921, 0x56c9f949, 0xdb4a9316, 0xf281501e, 0x53daec3f, 0x64f1b783,
- 0x154c6032, 0x0e2ff793, 0x33ce3573, 0xfacc5fdc, 0xf1178590, 0x3155bbd9, 0x0f023b22, 0x0224fcd8,
- 0x471bf4f4, 0x45f0a88a, 0x14f0cd97, 0x6ea354bb, 0x20cdb5cc, 0xb3db2392, 0x88d58655, 0x4e2a0e8a,
- 0x6fe51a8c, 0xfaa72ef2, 0xad8a43dc, 0x4212b210, 0xb779dfe4, 0x9d7307cc, 0x846532e4, 0xb9694eda,
- 0xd162af05, 0x3b1751f3, 0xa3d091f6, 0x56658154, 0x12b5e8c2, 0x02461069, 0xac14b958, 0x784934b8,
- 0xd6cce1da, 0xa5053701, 0x1aa4fb42, 0xb9a3def4, 0x1bda1f85, 0xef6fdbf2, 0xf2d89d2a, 0x4b183527,
- 0x8fd94057, 0x89f45681, 0x2b552879, 0xa6168695, 0xc12963b0, 0xff01eaab, 0x73e5b5c1, 0x585318e7,
- 0x624f14a5, 0x1a4a026b, 0x68082920, 0x57fd99b6, 0x6dc085a9, 0x8ac8d8ca, 0xf9eeeea9, 0x8a2400ca,
- 0xc95f260f, 0xd10036f9, 0xf91096ac, 0x3195220a, 0x1a356b2a, 0x73b7eaad, 0xaf6d6058, 0x71ef7afb,
- 0x80bc4234, 0x33562e94, 0xb12dfab4, 0x14451579, 0xdf59eae0, 0x51707062, 0x4012a829, 0x62c59cab,
- 0x347f8304, 0xd889659e, 0x5a9139db, 0x14efcc30, 0x852be3e8, 0xfc99f14d, 0x1d822dd6, 0xe2f76797,
- 0xe30219c8, 0xaa9ce884, 0x8a886eb3, 0xc87b7295, 0x988012e8, 0x314186ed, 0xbaf86856, 0xccd3c3b6,
- 0xee94e62f, 0x110a6783, 0xd2aae89c, 0xcc3b76fc, 0x435a0ce1, 0x34c2838f, 0xd571ec6c, 0x1366a993 // last one was: 0x1366a992
- //0xcbb9ac40, ...
- // (the last word 0x1366a992 was rounded up because the next one is 0xcbb9ac40 -- first bit is one 0xc..)
- // 256 32bit words for the mantissa -- about 2464 valid decimal digits
- };
-
- // above value was calculated using Big<1,400> type on a 32bit platform
- // and then the first 256 words were taken,
- // the calculating was made by using LnSurrounding1(2) method
- // which took 4035 iterations
- // (the result was compared with ln(2) taken from http://ja0hxv.calico.jp/pai/estart.html)
- // (TTMATH_BUILTIN_VARIABLES_SIZE on 32bit platform should have the value 256,
- // and on 64bit platform value 128 (256/2=128))
-
- mantissa.SetFromTable(temp_table, sizeof(temp_table) / sizeof(int));
- exponent = -sint(man)*sint(TTMATH_BITS_PER_UINT);
- info = 0;
- }
-
-
- /*!
- this method sets the value of ln(10)
- the natural logarithm from 10
-
- I introduced this constant especially to make the conversion ToString()
- being faster. In fact the method ToString() is keeping values of logarithms
- it has calculated but it must calculate the logarithm at least once.
- If a program, which uses this library, is running for a long time this
- would be ok, but for programs which are running shorter, for example for
- CGI applications which only once are printing values, this would be much
- inconvenience. Then if we're printing with base (radix) 10 and the mantissa
- of our value is smaller than or equal to TTMATH_BUILTIN_VARIABLES_SIZE
- we don't calculate the logarithm but take it from this constant.
- */
- void SetLn10()
- {
- static const unsigned int temp_table[] = {
- 0x935d8ddd, 0xaaa8ac16, 0xea56d62b, 0x82d30a28, 0xe28fecf9, 0xda5df90e, 0x83c61e82, 0x01f02d72,
- 0x962f02d7, 0xb1a8105c, 0xcc70cbc0, 0x2c5f0d68, 0x2c622418, 0x410be2da, 0xfb8f7884, 0x02e516d6,
- 0x782cf8a2, 0x8a8c911e, 0x765aa6c3, 0xb0d831fb, 0xef66ceb0, 0x4ab3c6fa, 0x5161bb49, 0xd219c7bb,
- 0xca67b35b, 0x23605085, 0x8e93368d, 0x44789c4f, 0x5b08b057, 0xd5ede20f, 0x469ea58e, 0x9305e981,
- 0xe2478fca, 0xad3aee98, 0x9cd5b42e, 0x6a271619, 0xa47ecb26, 0x978c5d4f, 0xdb1d28ea, 0x57d4fdc0,
- 0xe40bf3cc, 0x1e14126a, 0x45765cde, 0x268339db, 0xf47fa96d, 0xeb271060, 0xaf88486e, 0xa9b7401e,
- 0x3dfd3c51, 0x748e6d6e, 0x3848c8d2, 0x5faf1bca, 0xe88047f1, 0x7b0d9b50, 0xa949eaaa, 0xdf69e8a5,
- 0xf77e3760, 0x4e943960, 0xe38a5700, 0xffde2db1, 0xad6bfbff, 0xd821ba0a, 0x4cb0466d, 0x61ba648e,
- 0xef99c8e5, 0xf6974f36, 0x3982a78c, 0xa45ddfc8, 0x09426178, 0x19127a6e, 0x3b70fcda, 0x2d732d47,
- 0xb5e4b1c8, 0xc0e5a10a, 0xaa6604a5, 0x324ec3dc, 0xbc64ea80, 0x6e198566, 0x1f1d366c, 0x20663834,
- 0x4d5e843f, 0x20642b97, 0x0a62d18e, 0x478f7bd5, 0x8fcd0832, 0x4a7b32a6, 0xdef85a05, 0xeb56323a,
- 0x421ef5e0, 0xb00410a0, 0xa0d9c260, 0x794a976f, 0xf6ff363d, 0xb00b6b33, 0xf42c58de, 0xf8a3c52d,
- 0xed69b13d, 0xc1a03730, 0xb6524dc1, 0x8c167e86, 0x99d6d20e, 0xa2defd2b, 0xd006f8b4, 0xbe145a2a,
- 0xdf3ccbb3, 0x189da49d, 0xbc1261c8, 0xb3e4daad, 0x6a36cecc, 0xb2d5ae5b, 0x89bf752f, 0xb5dfb353,
- 0xff3065c4, 0x0cfceec8, 0x1be5a9a9, 0x67fddc57, 0xc4b83301, 0x006bf062, 0x4b40ed7a, 0x56c6cdcd,
- 0xa2d6fe91, 0x388e9e3e, 0x48a93f5f, 0x5e3b6eb4, 0xb81c4a5b, 0x53d49ea6, 0x8e668aea, 0xba83c7f8,
- 0xfb5f06c3, 0x58ac8f70, 0xfa9d8c59, 0x8c574502, 0xbaf54c96, 0xc84911f0, 0x0482d095, 0x1a0af022,
- 0xabbab080, 0xec97efd3, 0x671e4e0e, 0x52f166b6, 0xcd5cd226, 0x0dc67795, 0x2e1e34a3, 0xf799677f,
- 0x2c1d48f1, 0x2944b6c5, 0x2ba1307e, 0x704d67f9, 0x1c1035e4, 0x4e927c63, 0x03cf12bf, 0xe2cd2e31,
- 0xf8ee4843, 0x344d51b0, 0xf37da42b, 0x9f0b0fd9, 0x134fb2d9, 0xf815e490, 0xd966283f, 0x23962766,
- 0xeceab1e4, 0xf3b5fc86, 0x468127e2, 0xb606d10d, 0x3a45f4b6, 0xb776102d, 0x2fdbb420, 0x80c8fa84,
- 0xd0ff9f45, 0xc58aef38, 0xdb2410fd, 0x1f1cebad, 0x733b2281, 0x52ca5f36, 0xddf29daa, 0x544334b8,
- 0xdeeaf659, 0x4e462713, 0x1ed485b4, 0x6a0822e1, 0x28db471c, 0xa53938a8, 0x44c3bef7, 0xf35215c8,
- 0xb382bc4e, 0x3e4c6f15, 0x6285f54c, 0x17ab408e, 0xccbf7f5e, 0xd16ab3f6, 0xced2846d, 0xf457e14f,
- 0xbb45d9c5, 0x646ad497, 0xac697494, 0x145de32e, 0x93907128, 0xd263d521, 0x79efb424, 0xd64651d6,
- 0xebc0c9f0, 0xbb583a44, 0xc6412c84, 0x85bb29a6, 0x4d31a2cd, 0x92954469, 0xa32b1abd, 0xf7f5202c,
- 0xa4aa6c93, 0x2e9b53cf, 0x385ab136, 0x2741f356, 0x5de9c065, 0x6009901c, 0x88abbdd8, 0x74efcf73,
- 0x3f761ad4, 0x35f3c083, 0xfd6b8ee0, 0x0bef11c7, 0xc552a89d, 0x58ce4a21, 0xd71e54f2, 0x4157f6c7,
- 0xd4622316, 0xe98956d7, 0x450027de, 0xcbd398d8, 0x4b98b36a, 0x0724c25c, 0xdb237760, 0xe9324b68,
- 0x7523e506, 0x8edad933, 0x92197f00, 0xb853a326, 0xb330c444, 0x65129296, 0x34bc0670, 0xe177806d,
- 0xe338dac4, 0x5537492a, 0xe19add83, 0xcf45000f, 0x5b423bce, 0x6497d209, 0xe30e18a1, 0x3cbf0687,
- 0x67973103, 0xd9485366, 0x81506bba, 0x2e93a9a4, 0x7dd59d3f, 0xf17cd746, 0x8c2075be, 0x552a4348 // last one was: 0x552a4347
- // 0xb4a638ef, ...
- //(the last word 0x552a4347 was rounded up because the next one is 0xb4a638ef -- first bit is one 0xb..)
- // 256 32bit words for the mantissa -- about 2464 valid digits (decimal)
- };
-
- // above value was calculated using Big<1,400> type on a 32bit platform
- // and then the first 256 32bit words were taken,
- // the calculating was made by using LnSurrounding1(10) method
- // which took 22080 iterations
- // (the result was compared with ln(10) taken from http://ja0hxv.calico.jp/pai/estart.html)
- // (the formula used in LnSurrounding1(x) converges badly when
- // the x is greater than one but in fact we can use it, only the
- // number of iterations will be greater)
- // (TTMATH_BUILTIN_VARIABLES_SIZE on 32bit platform should have the value 256,
- // and on 64bit platform value 128 (256/2=128))
-
- mantissa.SetFromTable(temp_table, sizeof(temp_table) / sizeof(int));
- exponent = -sint(man)*sint(TTMATH_BITS_PER_UINT) + 2;
- info = 0;
- }
-
-
- /*!
- this method sets the maximum value which can be held in this type
- */
- void SetMax()
- {
- info = 0;
- mantissa.SetMax();
- exponent.SetMax();
-
- // we don't have to use 'Standardizing()' because the last bit from
- // the mantissa is set
- }
-
-
- /*!
- this method sets the minimum value which can be held in this type
- */
- void SetMin()
- {
- info = 0;
-
- mantissa.SetMax();
- exponent.SetMax();
- SetSign();
-
- // we don't have to use 'Standardizing()' because the last bit from
- // the mantissa is set
- }
-
-
- /*!
- testing whether there is a value zero or not
- */
- bool IsZero() const
- {
- return IsInfoBit(TTMATH_BIG_ZERO);
- }
-
-
- /*!
- this method returns true when there's the sign set
- also we don't check the NaN flag
- */
- bool IsSign() const
- {
- return IsInfoBit(TTMATH_BIG_SIGN);
- }
-
-
- /*!
- this method returns true when there is not a valid number
- */
- bool IsNan() const
- {
- return IsInfoBit(TTMATH_BIG_NAN);
- }
-
-
-
- /*!
- this method clears the sign
- (there'll be an absolute value)
-
- e.g.
- -1 -> 1
- 2 -> 2
- */
- void Abs()
- {
- ClearInfoBit(TTMATH_BIG_SIGN);
- }
-
-
- /*!
- this method remains the 'sign' of the value
- e.g. -2 = -1
- 0 = 0
- 10 = 1
- */
- void Sgn()
- {
- // we have to check the NaN flag, because the next SetOne() method would clear it
- if( IsNan() )
- return;
-
- if( IsSign() )
- {
- SetOne();
- SetSign();
- }
- else
- if( IsZero() )
- SetZero(); // !! is nedeed here?
- else
- SetOne();
- }
-
-
-
- /*!
- this method sets the sign
-
- e.g.
- -1 -> -1
- 2 -> -2
-
- we do not check whether there is a zero or not, if you're using this method
- you must be sure that the value is (or will be afterwards) different from zero
- */
- void SetSign()
- {
- SetInfoBit(TTMATH_BIG_SIGN);
- }
-
-
- /*!
- this method changes the sign
- when there is a value of zero then the sign is not changed
-
- e.g.
- -1 -> 1
- 2 -> -2
- */
- void ChangeSign()
- {
- // we don't have to check the NaN flag here
-
- if( IsZero() )
- return;
-
- if( IsSign() )
- ClearInfoBit(TTMATH_BIG_SIGN);
- else
- SetInfoBit(TTMATH_BIG_SIGN);
- }
-
-
-
-private:
-
- /*!
- this method does the half-to-even rounding (banker's rounding)
-
- if is_half is:
- true - that means the rest was equal the half (0.5 decimal)
- false - that means the rest was greater than a half (greater than 0.5 decimal)
-
- if the rest was less than a half then don't call this method
- (the rounding should does nothing then)
- */
- uint RoundHalfToEven(bool is_half, bool rounding_up = true)
- {
- uint c = 0;
-
- if( !is_half || mantissa.IsTheLowestBitSet() )
- {
- if( rounding_up )
- {
- if( mantissa.AddOne() )
- {
- mantissa.Rcr(1, 1);
- c = exponent.AddOne();
- }
- }
- else
- {
- #ifdef TTMATH_DEBUG
- uint c_from_zero =
- #endif
- mantissa.SubOne();
-
- // we're using rounding_up=false in Add() when the mantissas have different signs
- // mantissa can be zero only when previous mantissa was equal to ss2.mantissa
- // but in such a case 'last_bit_set' will not be set and consequently 'do_rounding' will be false
- TTMATH_ASSERT( c_from_zero == 0 )
- }
- }
-
- return c;
- }
-
-
-
-
-
- /*!
- *
- * basic mathematic functions
- *
- */
-
-
- /*!
- this method adds one to the existing value
- */
- uint AddOne()
- {
- Big<exp, man> one;
-
- one.SetOne();
-
- return Add(one);
- }
-
-
- /*!
- this method subtracts one from the existing value
- */
- uint SubOne()
- {
- Big<exp, man> one;
-
- one.SetOne();
-
- return Sub(one);
- }
-
-
-private:
-
-
- /*!
- an auxiliary method for adding
- */
- void AddCheckExponents( Big<exp, man> & ss2,
- Int<exp> & exp_offset,
- bool & last_bit_set,
- bool & rest_zero,
- bool & do_adding,
- bool & do_rounding)
- {
- Int<exp> mantissa_size_in_bits( man * TTMATH_BITS_PER_UINT );
-
- if( exp_offset == mantissa_size_in_bits )
- {
- last_bit_set = ss2.mantissa.IsTheHighestBitSet();
- rest_zero = ss2.mantissa.AreFirstBitsZero(man*TTMATH_BITS_PER_UINT - 1);
- do_rounding = true; // we'are only rounding
- }
- else
- if( exp_offset < mantissa_size_in_bits )
- {
- uint moved = exp_offset.ToInt(); // how many times we must move ss2.mantissa
- rest_zero = true;
-
- if( moved > 0 )
- {
- last_bit_set = static_cast<bool>( ss2.mantissa.GetBit(moved-1) );
-
- if( moved > 1 )
- rest_zero = ss2.mantissa.AreFirstBitsZero(moved - 1);
-
- // (2) moving 'exp_offset' times
- ss2.mantissa.Rcr(moved, 0);
- }
-
- do_adding = true;
- do_rounding = true;
- }
-
- // if exp_offset is greater than mantissa_size_in_bits then we do nothing
- // ss2 is too small for taking into consideration in the sum
- }
-
-
- /*!
- an auxiliary method for adding
- */
- uint AddMantissas( Big<exp, man> & ss2,
- bool & last_bit_set,
- bool & rest_zero)
- {
- uint c = 0;
-
- if( IsSign() == ss2.IsSign() )
- {
- // values have the same signs
- if( mantissa.Add(ss2.mantissa) )
- {
- // we have one bit more from addition (carry)
- // now rest_zero means the old rest_zero with the old last_bit_set
- rest_zero = (!last_bit_set && rest_zero);
- last_bit_set = mantissa.Rcr(1,1);
- c += exponent.AddOne();
- }
- }
- else
- {
- // values have different signs
- // there shouldn't be a carry here because
- // (1) (2) guarantee that the mantissa of this
- // is greater than or equal to the mantissa of the ss2
-
- #ifdef TTMATH_DEBUG
- uint c_temp =
- #endif
- mantissa.Sub(ss2.mantissa);
-
- TTMATH_ASSERT( c_temp == 0 )
- }
-
- return c;
- }
-
-
-public:
-
-
- /*!
- Addition this = this + ss2
-
- it returns carry if the sum is too big
- */
- uint Add(Big<exp, man> ss2, bool round = true, bool adding = true)
- {
- bool last_bit_set, rest_zero, do_adding, do_rounding, rounding_up;
- Int<exp> exp_offset( exponent );
- uint c = 0;
-
- if( IsNan() || ss2.IsNan() )
- return CheckCarry(1);
-
- if( !adding )
- ss2.ChangeSign(); // subtracting
-
- exp_offset.Sub( ss2.exponent );
- exp_offset.Abs();
-
- // (1) abs(this) will be >= abs(ss2)
- if( SmallerWithoutSignThan(ss2) )
- Swap(ss2);
-
- if( ss2.IsZero() )
- return 0;
-
- last_bit_set = rest_zero = do_adding = do_rounding = false;
- rounding_up = (IsSign() == ss2.IsSign());
-
- AddCheckExponents(ss2, exp_offset, last_bit_set, rest_zero, do_adding, do_rounding);
-
- if( do_adding )
- c += AddMantissas(ss2, last_bit_set, rest_zero);
-
- if( !round || !last_bit_set )
- do_rounding = false;
-
- if( do_rounding )
- c += RoundHalfToEven(rest_zero, rounding_up);
-
- if( do_adding || do_rounding )
- c += Standardizing();
-
- return CheckCarry(c);
- }
-
-
- /*!
- Subtraction this = this - ss2
-
- it returns carry if the result is too big
- */
- uint Sub(const Big<exp, man> & ss2, bool round = true)
- {
- return Add(ss2, round, false);
- }
-
-
- /*!
- bitwise AND
-
- this and ss2 must be >= 0
- return values:
- 0 - ok
- 1 - carry
- 2 - this or ss2 was negative
- */
- uint BitAnd(Big<exp, man> ss2)
- {
- if( IsNan() || ss2.IsNan() )
- return CheckCarry(1);
-
- if( IsSign() || ss2.IsSign() )
- {
- SetNan();
- return 2;
- }
-
- if( IsZero() )
- return 0;
-
- if( ss2.IsZero() )
- {
- SetZero();
- return 0;
- }
-
- Int<exp> exp_offset( exponent );
- Int<exp> mantissa_size_in_bits( man * TTMATH_BITS_PER_UINT );
-
- uint c = 0;
-
- exp_offset.Sub( ss2.exponent );
- exp_offset.Abs();
-
- // abs(this) will be >= abs(ss2)
- if( SmallerWithoutSignThan(ss2) )
- Swap(ss2);
-
- if( exp_offset >= mantissa_size_in_bits )
- {
- // the second value is too small
- SetZero();
- return 0;
- }
-
- // exp_offset < mantissa_size_in_bits, moving 'exp_offset' times
- ss2.mantissa.Rcr( exp_offset.ToInt(), 0 );
- mantissa.BitAnd(ss2.mantissa);
-
- c += Standardizing();
-
- return CheckCarry(c);
- }
-
-
- /*!
- bitwise OR
-
- this and ss2 must be >= 0
- return values:
- 0 - ok
- 1 - carry
- 2 - this or ss2 was negative
- */
- uint BitOr(Big<exp, man> ss2)
- {
- if( IsNan() || ss2.IsNan() )
- return CheckCarry(1);
-
- if( IsSign() || ss2.IsSign() )
- {
- SetNan();
- return 2;
- }
-
- if( IsZero() )
- {
- *this = ss2;
- return 0;
- }
-
- if( ss2.IsZero() )
- return 0;
-
- Int<exp> exp_offset( exponent );
- Int<exp> mantissa_size_in_bits( man * TTMATH_BITS_PER_UINT );
-
- uint c = 0;
-
- exp_offset.Sub( ss2.exponent );
- exp_offset.Abs();
-
- // abs(this) will be >= abs(ss2)
- if( SmallerWithoutSignThan(ss2) )
- Swap(ss2);
-
- if( exp_offset >= mantissa_size_in_bits )
- // the second value is too small
- return 0;
-
- // exp_offset < mantissa_size_in_bits, moving 'exp_offset' times
- ss2.mantissa.Rcr( exp_offset.ToInt(), 0 );
- mantissa.BitOr(ss2.mantissa);
-
- c += Standardizing();
-
- return CheckCarry(c);
- }
-
-
- /*!
- bitwise XOR
-
- this and ss2 must be >= 0
- return values:
- 0 - ok
- 1 - carry
- 2 - this or ss2 was negative
- */
- uint BitXor(Big<exp, man> ss2)
- {
- if( IsNan() || ss2.IsNan() )
- return CheckCarry(1);
-
- if( IsSign() || ss2.IsSign() )
- {
- SetNan();
- return 2;
- }
-
- if( ss2.IsZero() )
- return 0;
-
- if( IsZero() )
- {
- *this = ss2;
- return 0;
- }
-
- Int<exp> exp_offset( exponent );
- Int<exp> mantissa_size_in_bits( man * TTMATH_BITS_PER_UINT );
-
- uint c = 0;
-
- exp_offset.Sub( ss2.exponent );
- exp_offset.Abs();
-
- // abs(this) will be >= abs(ss2)
- if( SmallerWithoutSignThan(ss2) )
- Swap(ss2);
-
- if( exp_offset >= mantissa_size_in_bits )
- // the second value is too small
- return 0;
-
- // exp_offset < mantissa_size_in_bits, moving 'exp_offset' times
- ss2.mantissa.Rcr( exp_offset.ToInt(), 0 );
- mantissa.BitXor(ss2.mantissa);
-
- c += Standardizing();
-
- return CheckCarry(c);
- }
-
-
-
- /*!
- Multiplication this = this * ss2 (ss2 is uint)
-
- ss2 without a sign
- */
- uint MulUInt(uint ss2)
- {
- UInt<man+1> man_result;
- uint i,c = 0;
-
- if( IsNan() )
- return 1;
-
- if( IsZero() )
- return 0;
-
- if( ss2 == 0 )
- {
- SetZero();
- return 0;
- }
-
- // man_result = mantissa * ss2.mantissa
- mantissa.MulInt(ss2, man_result);
-
- sint bit = UInt<man>::FindLeadingBitInWord(man_result.table[man]); // man - last word
-
- if( bit!=-1 && uint(bit) > (TTMATH_BITS_PER_UINT/2) )
- {
- // 'i' will be from 0 to TTMATH_BITS_PER_UINT
- i = man_result.CompensationToLeft();
- c = exponent.Add( TTMATH_BITS_PER_UINT - i );
-
- for(i=0 ; i<man ; ++i)
- mantissa.table[i] = man_result.table[i+1];
- }
- else
- {
- if( bit != -1 )
- {
- man_result.Rcr(bit+1, 0);
- c += exponent.Add(bit+1);
- }
-
- for(i=0 ; i<man ; ++i)
- mantissa.table[i] = man_result.table[i];
- }
-
- c += Standardizing();
-
- return CheckCarry(c);
- }
-
-
- /*!
- Multiplication this = this * ss2 (ss2 is sint)
-
- ss2 with a sign
- */
- uint MulInt(sint ss2)
- {
- if( IsNan() )
- return 1;
-
- if( ss2 == 0 )
- {
- SetZero();
- return 0;
- }
-
- if( IsZero() )
- return 0;
-
- if( IsSign() == (ss2<0) )
- {
- // the signs are the same (both are either - or +), the result is positive
- Abs();
- }
- else
- {
- // the signs are different, the result is negative
- SetSign();
- }
-
- if( ss2<0 )
- ss2 = -ss2;
-
-
- return MulUInt( uint(ss2) );
- }
-
-
-private:
-
-
- /*!
- this method checks whether a table pointed by 'tab' and 'len'
- has the value 0.5 decimal
- (it is treated as the comma operator would be before the highest bit)
- call this method only if the highest bit is set - you have to test it beforehand
-
- return:
- true - tab was equal the half (0.5 decimal)
- false - tab was greater than a half (greater than 0.5 decimal)
-
- */
- bool CheckGreaterOrEqualHalf(uint * tab, uint len)
- {
- uint i;
-
- TTMATH_ASSERT( len>0 && (tab[len-1] & TTMATH_UINT_HIGHEST_BIT)!=0 )
-
- for(i=0 ; i<len-1 ; ++i)
- if( tab[i] != 0 )
- return false;
-
- if( tab[i] != TTMATH_UINT_HIGHEST_BIT )
- return false;
-
- return true;
- }
-
-
-private:
-
- /*!
- multiplication this = this * ss2
- this method returns a carry
- */
- uint MulRef(const Big<exp, man> & ss2, bool round = true)
- {
- TTMATH_REFERENCE_ASSERT( ss2 )
-
- UInt<man*2> man_result;
- uint c = 0;
- uint i;
-
- if( IsNan() || ss2.IsNan() )
- return CheckCarry(1);
-
- if( IsZero() )
- return 0;
-
- if( ss2.IsZero() )
- {
- SetZero();
- return 0;
- }
-
- // man_result = mantissa * ss2.mantissa
- mantissa.MulBig(ss2.mantissa, man_result);
-
- // 'i' will be from 0 to man*TTMATH_BITS_PER_UINT
- // because mantissa and ss2.mantissa are standardized
- // (the highest bit in man_result is set to 1 or
- // if there is a zero value in man_result the method CompensationToLeft()
- // returns 0 but we'll correct this at the end in Standardizing() method)
- i = man_result.CompensationToLeft();
- uint exp_add = man * TTMATH_BITS_PER_UINT - i;
-
- if( exp_add )
- c += exponent.Add( exp_add );
-
- c += exponent.Add( ss2.exponent );
-
- for(i=0 ; i<man ; ++i)
- mantissa.table[i] = man_result.table[i+man];
-
- if( round && (man_result.table[man-1] & TTMATH_UINT_HIGHEST_BIT) != 0 )
- {
- bool is_half = CheckGreaterOrEqualHalf(man_result.table, man);
- c += RoundHalfToEven(is_half);
- }
-
- if( IsSign() == ss2.IsSign() )
- {
- // the signs are the same, the result is positive
- Abs();
- }
- else
- {
- // the signs are different, the result is negative
- // if the value is zero it will be corrected later in Standardizing method
- SetSign();
- }
-
- c += Standardizing();
-
- return CheckCarry(c);
- }
-
-
-public:
-
-
- /*!
- multiplication this = this * ss2
- this method returns a carry
- */
- uint Mul(const Big<exp, man> & ss2, bool round = true)
- {
- if( this == &ss2 )
- {
- Big<exp, man> copy_ss2(ss2);
- return MulRef(copy_ss2, round);
- }
- else
- {
- return MulRef(ss2, round);
- }
- }
-
-
-private:
-
- /*!
- division this = this / ss2
-
- return value:
- 0 - ok
- 1 - carry (in a division carry can be as well)
- 2 - improper argument (ss2 is zero)
- */
- uint DivRef(const Big<exp, man> & ss2, bool round = true)
- {
- TTMATH_REFERENCE_ASSERT( ss2 )
-
- UInt<man*2> man1;
- UInt<man*2> man2;
- uint i,c = 0;
-
- if( IsNan() || ss2.IsNan() )
- return CheckCarry(1);
-
- if( ss2.IsZero() )
- {
- SetNan();
- return 2;
- }
-
- if( IsZero() )
- return 0;
-
- // !! this two loops can be joined together
-
- for(i=0 ; i<man ; ++i)
- {
- man1.table[i+man] = mantissa.table[i];
- man2.table[i] = ss2.mantissa.table[i];
- }
-
- for(i=0 ; i<man ; ++i)
- {
- man1.table[i] = 0;
- man2.table[i+man] = 0;
- }
-
- man1.Div(man2);
-
- i = man1.CompensationToLeft();
-
- if( i )
- c += exponent.Sub(i);
-
- c += exponent.Sub(ss2.exponent);
-
- for(i=0 ; i<man ; ++i)
- mantissa.table[i] = man1.table[i+man];
-
- if( round && (man1.table[man-1] & TTMATH_UINT_HIGHEST_BIT) != 0 )
- {
- bool is_half = CheckGreaterOrEqualHalf(man1.table, man);
- c += RoundHalfToEven(is_half);
- }
-
- if( IsSign() == ss2.IsSign() )
- Abs();
- else
- SetSign(); // if there is a zero it will be corrected in Standardizing()
-
- c += Standardizing();
-
- return CheckCarry(c);
- }
-
-
-public:
-
- /*!
- division this = this / ss2
-
- return value:
- 0 - ok
- 1 - carry (in a division carry can be as well)
- 2 - improper argument (ss2 is zero)
- */
- uint Div(const Big<exp, man> & ss2, bool round = true)
- {
- if( this == &ss2 )
- {
- Big<exp, man> copy_ss2(ss2);
- return DivRef(copy_ss2, round);
- }
- else
- {
- return DivRef(ss2, round);
- }
- }
-
-
-private:
-
- /*!
- the remainder from a division
- */
- uint ModRef(const Big<exp, man> & ss2)
- {
- TTMATH_REFERENCE_ASSERT( ss2 )
-
- uint c = 0;
-
- if( IsNan() || ss2.IsNan() )
- return CheckCarry(1);
-
- if( ss2.IsZero() )
- {
- SetNan();
- return 2;
- }
-
- if( !SmallerWithoutSignThan(ss2) )
- {
- Big<exp, man> temp(*this);
-
- c = temp.Div(ss2);
- temp.SkipFraction();
- c += temp.Mul(ss2);
- c += Sub(temp);
-
- if( !SmallerWithoutSignThan( ss2 ) )
- c += 1;
- }
-
- return CheckCarry(c);
- }
-
-
-public:
-
- /*!
- the remainder from a division
-
- e.g.
- 12.6 mod 3 = 0.6 because 12.6 = 3*4 + 0.6
- -12.6 mod 3 = -0.6 bacause -12.6 = 3*(-4) + (-0.6)
- 12.6 mod -3 = 0.6
- -12.6 mod -3 = -0.6
-
- it means:
- in other words: this(old) = ss2 * q + this(new)
-
- return value:
- 0 - ok
- 1 - carry
- 2 - improper argument (ss2 is zero)
- */
- uint Mod(const Big<exp, man> & ss2)
- {
- if( this == &ss2 )
- {
- Big<exp, man> copy_ss2(ss2);
- return ModRef(copy_ss2);
- }
- else
- {
- return ModRef(ss2);
- }
- }
-
-
- /*!
- this method returns: 'this' mod 2
- (either zero or one)
-
- this method is much faster than using Mod( object_with_value_two )
- */
- uint Mod2() const
- {
- if( exponent>sint(0) || exponent<=-sint(man*TTMATH_BITS_PER_UINT) )
- return 0;
-
- sint exp_int = exponent.ToInt();
- // 'exp_int' is negative (or zero), we set it as positive
- exp_int = -exp_int;
-
- return mantissa.GetBit(exp_int);
- }
-
-
- /*!
- power this = this ^ pow
- (pow without a sign)
-
- binary algorithm (r-to-l)
-
- return values:
- 0 - ok
- 1 - carry
- 2 - incorrect arguments (0^0)
- */
- template<uint pow_size>
- uint Pow(UInt<pow_size> pow)
- {
- if( IsNan() )
- return 1;
-
- if( IsZero() )
- {
- if( pow.IsZero() )
- {
- // we don't define zero^zero
- SetNan();
- return 2;
- }
-
- // 0^(+something) is zero
- return 0;
- }
-
- Big<exp, man> start(*this), start_temp;
- Big<exp, man> result;
- result.SetOne();
- uint c = 0;
-
- while( !c )
- {
- if( pow.table[0] & 1 )
- c += result.Mul(start);
-
- pow.Rcr(1);
-
- if( pow.IsZero() )
- break;
-
- start_temp = start;
- c += start.Mul(start_temp);
- }
-
- *this = result;
-
- return CheckCarry(c);
- }
-
-
- /*!
- power this = this ^ pow
- p can be negative
-
- return values:
- 0 - ok
- 1 - carry
- 2 - incorrect arguments 0^0 or 0^(-something)
- */
- template<uint pow_size>
- uint Pow(Int<pow_size> pow)
- {
- if( IsNan() )
- return 1;
-
- if( !pow.IsSign() )
- return Pow( UInt<pow_size>(pow) );
-
- if( IsZero() )
- {
- // if 'p' is negative then
- // 'this' must be different from zero
- SetNan();
- return 2;
- }
-
- uint c = pow.ChangeSign();
-
- Big<exp, man> t(*this);
- c += t.Pow( UInt<pow_size>(pow) ); // here can only be a carry (return:1)
-
- SetOne();
- c += Div(t);
-
- return CheckCarry(c);
- }
-
-
- /*!
- power this = this ^ abs([pow])
- pow is treated as a value without a sign and without a fraction
- if pow has a sign then the method pow.Abs() is used
- if pow has a fraction the fraction is skipped (not used in calculation)
-
- return values:
- 0 - ok
- 1 - carry
- 2 - incorrect arguments (0^0)
- */
- uint PowUInt(Big<exp, man> pow)
- {
- if( IsNan() || pow.IsNan() )
- return CheckCarry(1);
-
- if( IsZero() )
- {
- if( pow.IsZero() )
- {
- SetNan();
- return 2;
- }
-
- // 0^(+something) is zero
- return 0;
- }
-
- if( pow.IsSign() )
- pow.Abs();
-
- Big<exp, man> start(*this), start_temp;
- Big<exp, man> result;
- Big<exp, man> one;
- Int<exp> e_one;
- uint c = 0;
-
- e_one.SetOne();
- one.SetOne();
- result = one;
-
- while( !c )
- {
- if( pow.Mod2() )
- c += result.Mul(start);
-
- c += pow.exponent.Sub( e_one ); // !! may use SubOne() here?
-
- if( pow < one )
- break;
-
- start_temp = start;
- c += start.Mul(start_temp);
- }
-
- *this = result;
-
- return CheckCarry(c);
- }
-
-
- /*!
- power this = this ^ [pow]
- pow is treated as a value without a fraction
- pow can be negative
-
- return values:
- 0 - ok
- 1 - carry
- 2 - incorrect arguments 0^0 or 0^(-something)
- */
- uint PowInt(const Big<exp, man> & pow)
- {
- if( IsNan() || pow.IsNan() )
- return CheckCarry(1);
-
- if( !pow.IsSign() )
- return PowUInt(pow);
-
- if( IsZero() )
- {
- // if 'pow' is negative then
- // 'this' must be different from zero
- SetNan();
- return 2;
- }
-
- Big<exp, man> temp(*this);
- uint c = temp.PowUInt(pow); // here can only be a carry (result:1)
-
- SetOne();
- c += Div(temp);
-
- return CheckCarry(c);
- }
-
-
- /*!
- power this = this ^ pow
- this must be greater than zero (this > 0)
- pow can be negative and with fraction
-
- return values:
- 0 - ok
- 1 - carry
- 2 - incorrect argument ('this' <= 0)
- */
- uint PowFrac(const Big<exp, man> & pow)
- {
- if( IsNan() || pow.IsNan() )
- return CheckCarry(1);
-
- Big<exp, man> temp;
- uint c = temp.Ln(*this);
-
- if( c != 0 ) // can be 2 from Ln()
- {
- SetNan();
- return c;
- }
-
- c += temp.Mul(pow);
- c += Exp(temp);
-
- return CheckCarry(c);
- }
-
-
- /*!
- power this = this ^ pow
- pow can be negative and with fraction
-
- return values:
- 0 - ok
- 1 - carry
- 2 - incorrect argument ('this' or 'pow')
- */
- uint Pow(const Big<exp, man> & pow)
- {
- if( IsNan() || pow.IsNan() )
- return CheckCarry(1);
-
- if( IsZero() )
- {
- // 0^pow will be 0 only for pow>0
- if( pow.IsSign() || pow.IsZero() )
- {
- SetNan();
- return 2;
- }
-
- SetZero();
-
- return 0;
- }
-
- if( pow.exponent>-sint(man*TTMATH_BITS_PER_UINT) && pow.exponent<=0 )
- {
- if( pow.IsInteger() )
- return PowInt( pow );
- }
-
- return PowFrac(pow);
- }
-
-
- /*!
- this function calculates the square root
- e.g. let this=9 then this.Sqrt() gives 3
-
- return: 0 - ok
- 1 - carry
- 2 - improper argument (this<0 or NaN)
- */
- uint Sqrt()
- {
- if( IsNan() || IsSign() )
- {
- SetNan();
- return 2;
- }
-
- if( IsZero() )
- return 0;
-
- Big<exp, man> old(*this);
- Big<exp, man> ln;
- uint c = 0;
-
- // we're using the formula: sqrt(x) = e ^ (ln(x) / 2)
- c += ln.Ln(*this);
- c += ln.exponent.SubOne(); // ln = ln / 2
- c += Exp(ln);
-
- // above formula doesn't give accurate results for some integers
- // e.g. Sqrt(81) would not be 9 but a value very closed to 9
- // we're rounding the result, calculating result*result and comparing
- // with the old value, if they are equal then the result is an integer too
-
- if( !c && old.IsInteger() && !IsInteger() )
- {
- Big<exp, man> temp(*this);
- c += temp.Round();
-
- Big<exp, man> temp2(temp);
- c += temp.Mul(temp2);
-
- if( temp == old )
- *this = temp2;
- }
-
- return CheckCarry(c);
- }
-
-
-private:
-
-#ifdef TTMATH_CONSTANTSGENERATOR
-public:
-#endif
-
- /*!
- Exponent this = exp(x) = e^x where x is in (-1,1)
-
- we're using the formula exp(x) = 1 + (x)/(1!) + (x^2)/(2!) + (x^3)/(3!) + ...
- */
- void ExpSurrounding0(const Big<exp,man> & x, uint * steps = 0)
- {
- TTMATH_REFERENCE_ASSERT( x )
-
- Big<exp,man> denominator, denominator_i;
- Big<exp,man> one, old_value, next_part;
- Big<exp,man> numerator = x;
-
- SetOne();
- one.SetOne();
- denominator.SetOne();
- denominator_i.SetOne();
-
- uint i;
- old_value = *this;
-
- // we begin from 1 in order to not test at the beginning
- #ifdef TTMATH_CONSTANTSGENERATOR
- for(i=1 ; true ; ++i)
- #else
- for(i=1 ; i<=TTMATH_ARITHMETIC_MAX_LOOP ; ++i)
- #endif
- {
- bool testing = ((i & 3) == 0); // it means '(i % 4) == 0'
-
- next_part = numerator;
-
- if( next_part.Div( denominator ) )
- // if there is a carry here we only break the loop
- // however the result we return as good
- // it means there are too many parts of the formula
- break;
-
- // there shouldn't be a carry here
- Add( next_part );
-
- if( testing )
- {
- if( old_value == *this )
- // we've added next few parts of the formula but the result
- // is still the same then we break the loop
- break;
- else
- old_value = *this;
- }
-
- // we set the denominator and the numerator for a next part of the formula
- if( denominator_i.Add(one) )
- // if there is a carry here the result we return as good
- break;
-
- if( denominator.Mul(denominator_i) )
- break;
-
- if( numerator.Mul(x) )
- break;
- }
-
- if( steps )
- *steps = i;
- }
-
-public:
-
-
- /*!
- Exponent this = exp(x) = e^x
-
- we're using the fact that our value is stored in form of:
- x = mantissa * 2^exponent
- then
- e^x = e^(mantissa* 2^exponent) or
- e^x = (e^mantissa)^(2^exponent)
-
- 'Exp' returns a carry if we can't count the result ('x' is too big)
- */
- uint Exp(const Big<exp,man> & x)
- {
- uint c = 0;
-
- if( x.IsNan() )
- return CheckCarry(1);
-
- if( x.IsZero() )
- {
- SetOne();
- return 0;
- }
-
- // m will be the value of the mantissa in range (-1,1)
- Big<exp,man> m(x);
- m.exponent = -sint(man*TTMATH_BITS_PER_UINT);
-
- // 'e_' will be the value of '2^exponent'
- // e_.mantissa.table[man-1] = TTMATH_UINT_HIGHEST_BIT; and
- // e_.exponent.Add(1) mean:
- // e_.mantissa.table[0] = 1;
- // e_.Standardizing();
- // e_.exponent.Add(man*TTMATH_BITS_PER_UINT)
- // (we must add 'man*TTMATH_BITS_PER_UINT' because we've taken it from the mantissa)
- Big<exp,man> e_(x);
- e_.mantissa.SetZero();
- e_.mantissa.table[man-1] = TTMATH_UINT_HIGHEST_BIT;
- c += e_.exponent.Add(1);
- e_.Abs();
-
- /*
- now we've got:
- m - the value of the mantissa in range (-1,1)
- e_ - 2^exponent
-
- e_ can be as:
- ...2^-2, 2^-1, 2^0, 2^1, 2^2 ...
- ...1/4 , 1/2 , 1 , 2 , 4 ...
-
- above one e_ is integer
-
- if e_ is greater than 1 we calculate the exponent as:
- e^(m * e_) = ExpSurrounding0(m) ^ e_
- and if e_ is smaller or equal one we calculate the exponent in this way:
- e^(m * e_) = ExpSurrounding0(m* e_)
- because if e_ is smaller or equal 1 then the product of m*e_ is smaller or equal m
- */
-
- if( e_ <= 1 )
- {
- m.Mul(e_);
- ExpSurrounding0(m);
- }
- else
- {
- ExpSurrounding0(m);
- c += PowUInt(e_);
- }
-
- return CheckCarry(c);
- }
-
-
-
-
-private:
-
-#ifdef TTMATH_CONSTANTSGENERATOR
-public:
-#endif
-
- /*!
- Natural logarithm this = ln(x) where x in range <1,2)
-
- we're using the formula:
- ln x = 2 * [ (x-1)/(x+1) + (1/3)((x-1)/(x+1))^3 + (1/5)((x-1)/(x+1))^5 + ... ]
- */
- void LnSurrounding1(const Big<exp,man> & x, uint * steps = 0)
- {
- Big<exp,man> old_value, next_part, denominator, one, two, x1(x), x2(x);
-
- one.SetOne();
-
- if( x == one )
- {
- // LnSurrounding1(1) is 0
- SetZero();
- return;
- }
-
- two = 2;
-
- x1.Sub(one);
- x2.Add(one);
-
- x1.Div(x2);
- x2 = x1;
- x2.Mul(x1);
-
- denominator.SetOne();
- SetZero();
-
- old_value = *this;
- uint i;
-
-
- #ifdef TTMATH_CONSTANTSGENERATOR
- for(i=1 ; true ; ++i)
- #else
- // we begin from 1 in order to not test at the beginning
- for(i=1 ; i<=TTMATH_ARITHMETIC_MAX_LOOP ; ++i)
- #endif
- {
- bool testing = ((i & 3) == 0); // it means '(i % 4) == 0'
-
- next_part = x1;
-
- if( next_part.Div(denominator) )
- // if there is a carry here we only break the loop
- // however the result we return as good
- // it means there are too many parts of the formula
- break;
-
- // there shouldn't be a carry here
- Add(next_part);
-
- if( testing )
- {
- if( old_value == *this )
- // we've added next (step_test) parts of the formula but the result
- // is still the same then we break the loop
- break;
- else
- old_value = *this;
- }
-
- if( x1.Mul(x2) )
- // if there is a carry here the result we return as good
- break;
-
- if( denominator.Add(two) )
- break;
- }
-
- // this = this * 2
- // ( there can't be a carry here because we calculate the logarithm between <1,2) )
- exponent.AddOne();
-
- if( steps )
- *steps = i;
- }
-
-
-
-
-public:
-
-
- /*!
- Natural logarithm this = ln(x)
- (a logarithm with the base equal 'e')
-
- we're using the fact that our value is stored in form of:
- x = mantissa * 2^exponent
- then
- ln(x) = ln (mantissa * 2^exponent) = ln (mantissa) + (exponent * ln (2))
-
- the mantissa we'll show as a value from range <1,2) because the logarithm
- is decreasing too fast when 'x' is going to 0
-
- return values:
- 0 - ok
- 1 - overflow (carry)
- 2 - incorrect argument (x<=0)
- */
- uint Ln(const Big<exp,man> & x)
- {
- if( x.IsNan() )
- return CheckCarry(1);
-
- if( x.IsSign() || x.IsZero() )
- {
- SetNan();
- return 2;
- }
-
- Big<exp,man> exponent_temp;
- exponent_temp.FromInt( x.exponent );
-
- // m will be the value of the mantissa in range <1,2)
- Big<exp,man> m(x);
- m.exponent = -sint(man*TTMATH_BITS_PER_UINT - 1);
-
- // we must add 'man*TTMATH_BITS_PER_UINT-1' because we've taken it from the mantissa
- uint c = exponent_temp.Add(man*TTMATH_BITS_PER_UINT-1);
-
- LnSurrounding1(m);
-
- Big<exp,man> ln2;
- ln2.SetLn2();
- c += exponent_temp.Mul(ln2);
- c += Add(exponent_temp);
-
- return CheckCarry(c);
- }
-
-
- /*!
- Logarithm from 'x' with a 'base'
-
- we're using the formula:
- Log(x) with 'base' = ln(x) / ln(base)
-
- return values:
- 0 - ok
- 1 - overflow
- 2 - incorrect argument (x<=0)
- 3 - incorrect base (a<=0 lub a=1)
- */
- uint Log(const Big<exp,man> & x, const Big<exp,man> & base)
- {
- if( x.IsNan() || base.IsNan() )
- return CheckCarry(1);
-
- if( x.IsSign() || x.IsZero() )
- {
- SetNan();
- return 2;
- }
-
- Big<exp,man> denominator;;
- denominator.SetOne();
-
- if( base.IsSign() || base.IsZero() || base==denominator )
- {
- SetNan();
- return 3;
- }
-
- if( x == denominator ) // (this is: if x == 1)
- {
- // log(1) is 0
- SetZero();
- return 0;
- }
-
- // another error values we've tested at the beginning
- // there can only be a carry
- uint c = Ln(x);
-
- c += denominator.Ln(base);
- c += Div(denominator);
-
- return CheckCarry(c);
- }
-
-
-
-
- /*!
- *
- * converting methods
- *
- */
-
-
- /*!
- converting from another type of a Big object
- */
- template<uint another_exp, uint another_man>
- uint FromBig(const Big<another_exp, another_man> & another)
- {
- info = another.info;
-
- if( IsNan() )
- return 1;
-
- if( exponent.FromInt(another.exponent) )
- {
- SetNan();
- return 1;
- }
-
- uint man_len_min = (man < another_man)? man : another_man;
- uint i;
- uint c = 0;
-
- for( i = 0 ; i<man_len_min ; ++i )
- mantissa.table[man-1-i] = another.mantissa.table[another_man-1-i];
-
- for( ; i<man ; ++i )
- mantissa.table[man-1-i] = 0;
-
-
- // MS Visual Express 2005 reports a warning (in the lines with 'uint man_diff = ...'):
- // warning C4307: '*' : integral constant overflow
- // but we're using 'if( man > another_man )' and 'if( man < another_man )' and there'll be no such situation here
- #ifdef _MSC_VER
- #pragma warning( disable: 4307 )
- #endif
-
- if( man > another_man )
- {
- uint man_diff = (man - another_man) * TTMATH_BITS_PER_UINT;
- c += exponent.SubInt(man_diff, 0);
- }
- else
- if( man < another_man )
- {
- uint man_diff = (another_man - man) * TTMATH_BITS_PER_UINT;
- c += exponent.AddInt(man_diff, 0);
- }
-
- #ifdef _MSC_VER
- #pragma warning( default: 4307 )
- #endif
-
- // mantissa doesn't have to be standardized (either the highest bit is set or all bits are equal zero)
- CorrectZero();
-
- return CheckCarry(c);
- }
-
-
-private:
-
- /*!
- an auxiliary method for converting 'this' into 'result'
- if the value is too big this method returns a carry (1)
- */
- uint ToUIntOrInt(uint & result) const
- {
- result = 0;
-
- if( IsZero() )
- return 0;
-
- sint maxbit = -sint(man*TTMATH_BITS_PER_UINT);
-
- if( exponent > maxbit + sint(TTMATH_BITS_PER_UINT) )
- // if exponent > (maxbit + sint(TTMATH_BITS_PER_UINT)) the value can't be passed
- // into the 'sint' type (it's too big)
- return 1;
-
- if( exponent <= maxbit )
- // our value is from the range of (-1,1) and we return zero
- return 0;
-
- // exponent is from a range of (maxbit, maxbit + sint(TTMATH_BITS_PER_UINT) >
- // and [maxbit + sint(TTMATH_BITS_PER_UINT] <= 0
- sint how_many_bits = exponent.ToInt();
-
- // how_many_bits is negative, we'll make it positive
- how_many_bits = -how_many_bits;
-
- result = (mantissa.table[man-1] >> (how_many_bits % TTMATH_BITS_PER_UINT));
-
- return 0;
- }
-
-
-public:
-
- /*!
- this method converts 'this' into uint
- */
- uint ToUInt() const
- {
- uint result;
-
- ToUInt(result);
-
- return result;
- }
-
-
- /*!
- this method converts 'this' into 'result'
-
- if the value is too big this method returns a carry (1)
- */
- uint ToUInt(uint & result) const
- {
- if( ToUIntOrInt(result) )
- return 1;
-
- if( IsSign() )
- return 1;
-
- return 0;
- }
-
-
- /*!
- this method converts 'this' into sint
- */
- sint ToInt() const
- {
- sint result;
-
- ToInt(result);
-
- return result;
- }
-
-
- /*!
- this method converts 'this' into 'result'
-
- if the value is too big this method returns a carry (1)
- */
- uint ToInt(uint & result) const
- {
- return ToUInt(result);
- }
-
-
- /*!
- this method converts 'this' into 'result'
-
- if the value is too big this method returns a carry (1)
- */
- uint ToInt(sint & result) const
- {
- uint result_uint;
-
- uint c = ToUIntOrInt(result_uint);
- result = sint(result_uint);
-
- if( c )
- return 1;
-
- uint mask = 0;
-
- if( IsSign() )
- {
- mask = TTMATH_UINT_MAX_VALUE;
- result = -result;
- }
-
- return ((result & TTMATH_UINT_HIGHEST_BIT) == (mask & TTMATH_UINT_HIGHEST_BIT)) ? 0 : 1;
- }
-
-
-private:
-
- /*!
- an auxiliary method for converting 'this' into 'result'
-
- if the value is too big this method returns a carry (1)
- */
- template<uint int_size>
- uint ToUIntOrInt(UInt<int_size> & result) const
- {
- result.SetZero();
-
- if( IsZero() )
- return 0;
-
- sint maxbit = -sint(man*TTMATH_BITS_PER_UINT);
-
- if( exponent > maxbit + sint(int_size*TTMATH_BITS_PER_UINT) )
- // if exponent > (maxbit + sint(int_size*TTMATH_BITS_PER_UINT)) the value can't be passed
- // into the 'UInt<int_size>' type (it's too big)
- return 1;
-
- if( exponent <= maxbit )
- // our value is from range (-1,1) and we return zero
- return 0;
-
- sint how_many_bits = exponent.ToInt();
-
- if( how_many_bits < 0 )
- {
- how_many_bits = -how_many_bits;
- uint index = how_many_bits / TTMATH_BITS_PER_UINT;
-
- UInt<man> mantissa_temp(mantissa);
- mantissa_temp.Rcr( how_many_bits % TTMATH_BITS_PER_UINT, 0 );
-
- for(uint i=index, a=0 ; i<man ; ++i,++a)
- result.table[a] = mantissa_temp.table[i];
- }
- else
- {
- uint index = how_many_bits / TTMATH_BITS_PER_UINT;
-
- if( index + (man-1) < int_size )
- {
- // above 'if' is always true
- // this is only to get rid of a warning "warning: array subscript is above array bounds"
- // (from gcc)
- // we checked the condition there: "if( exponent > maxbit + sint(int_size*TTMATH_BITS_PER_UINT) )"
- // but gcc doesn't understand our types - exponent is Int<>
-
- for(uint i=0 ; i<man ; ++i)
- result.table[index+i] = mantissa.table[i];
- }
-
- result.Rcl( how_many_bits % TTMATH_BITS_PER_UINT, 0 );
- }
-
- return 0;
- }
-
-
-public:
-
- /*!
- this method converts 'this' into 'result'
-
- if the value is too big this method returns a carry (1)
- */
- template<uint int_size>
- uint ToUInt(UInt<int_size> & result) const
- {
- uint c = ToUIntOrInt(result);
-
- if( c )
- return 1;
-
- if( IsSign() )
- return 1;
-
- return 0;
- }
-
-
- /*!
- this method converts 'this' into 'result'
-
- if the value is too big this method returns a carry (1)
- */
- template<uint int_size>
- uint ToInt(UInt<int_size> & result) const
- {
- return ToUInt(result);
- }
-
-
- /*!
- this method converts 'this' into 'result'
-
- if the value is too big this method returns a carry (1)
- */
- template<uint int_size>
- uint ToInt(Int<int_size> & result) const
- {
- uint c = ToUIntOrInt(result);
-
- if( c )
- return 1;
-
- uint mask = 0;
-
- if( IsSign() )
- {
- result.ChangeSign();
- mask = TTMATH_UINT_MAX_VALUE;
- }
-
- return ((result.table[int_size-1] & TTMATH_UINT_HIGHEST_BIT) == (mask & TTMATH_UINT_HIGHEST_BIT))? 0 : 1;
- }
-
-
- /*!
- a method for converting 'uint' to this class
- */
- uint FromUInt(uint value)
- {
- if( value == 0 )
- {
- SetZero();
- return 0;
- }
-
- info = 0;
-
- for(uint i=0 ; i<man-1 ; ++i)
- mantissa.table[i] = 0;
-
- mantissa.table[man-1] = value;
- exponent = -sint(man-1) * sint(TTMATH_BITS_PER_UINT);
-
- // there shouldn't be a carry because 'value' has the 'uint' type
- Standardizing();
-
- return 0;
- }
-
-
- /*!
- a method for converting 'uint' to this class
- */
- uint FromInt(uint value)
- {
- return FromUInt(value);
- }
-
-
- /*!
- a method for converting 'sint' to this class
- */
- uint FromInt(sint value)
- {
- bool is_sign = false;
-
- if( value < 0 )
- {
- value = -value;
- is_sign = true;
- }
-
- FromUInt(uint(value));
-
- if( is_sign )
- SetSign();
-
- return 0;
- }
-
-
-
- /*!
- this method converts from standard double into this class
-
- standard double means IEEE-754 floating point value with 64 bits
- it is as follows (from http://www.psc.edu/general/software/packages/ieee/ieee.html):
-
- The IEEE double precision floating point standard representation requires
- a 64 bit word, which may be represented as numbered from 0 to 63, left to
- right. The first bit is the sign bit, S, the next eleven bits are the
- exponent bits, 'E', and the final 52 bits are the fraction 'F':
-
- S EEEEEEEEEEE FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
- 0 1 11 12 63
-
- The value V represented by the word may be determined as follows:
-
- * If E=2047 and F is nonzero, then V=NaN ("Not a number")
- * If E=2047 and F is zero and S is 1, then V=-Infinity
- * If E=2047 and F is zero and S is 0, then V=Infinity
- * If 0<E<2047 then V=(-1)**S * 2 ** (E-1023) * (1.F) where "1.F" is intended
- to represent the binary number created by prefixing F with an implicit
- leading 1 and a binary point.
- * If E=0 and F is nonzero, then V=(-1)**S * 2 ** (-1022) * (0.F) These are
- "unnormalized" values.
- * If E=0 and F is zero and S is 1, then V=-0
- * If E=0 and F is zero and S is 0, then V=0
- */
-
-#ifdef TTMATH_PLATFORM32
-
- uint FromDouble(double value)
- {
- // I am not sure what will be on a platform which has
- // a different endianness... but we use this library only
- // on x86 and amd (intel) 64 bits (as there's a lot of assembler code)
- union
- {
- double d;
- uint u[2]; // two 32bit words
- } temp;
-
- temp.d = value;
-
- sint e = ( temp.u[1] & 0x7FF00000u) >> 20;
- uint m1 = ((temp.u[1] & 0xFFFFFu) << 11) | (temp.u[0] >> 21);
- uint m2 = temp.u[0] << 11;
-
- if( e == 2047 )
- {
- // If E=2047 and F is nonzero, then V=NaN ("Not a number")
- // If E=2047 and F is zero and S is 1, then V=-Infinity
- // If E=2047 and F is zero and S is 0, then V=Infinity
-
- // we do not support -Infinity and +Infinity
- // we assume that there is always NaN
-
- SetNan();
- }
- else
- if( e > 0 )
- {
- // If 0<E<2047 then
- // V=(-1)**S * 2 ** (E-1023) * (1.F)
- // where "1.F" is intended to represent the binary number
- // created by prefixing F with an implicit leading 1 and a binary point.
-
- FromDouble_SetExpAndMan((temp.u[1] & 0x80000000u) != 0,
- e - 1023 - man*TTMATH_BITS_PER_UINT + 1, 0x80000000u,
- m1, m2);
-
- // we do not have to call Standardizing() here
- // because the mantissa will have the highest bit set
- }
- else
- {
- // e == 0
-
- if( m1 != 0 || m2 != 0 )
- {
- // If E=0 and F is nonzero,
- // then V=(-1)**S * 2 ** (-1022) * (0.F)
- // These are "unnormalized" values.
-
- UInt<2> m;
- m.table[1] = m1;
- m.table[0] = m2;
- uint moved = m.CompensationToLeft();
-
- FromDouble_SetExpAndMan((temp.u[1] & 0x80000000u) != 0,
- e - 1022 - man*TTMATH_BITS_PER_UINT + 1 - moved, 0,
- m.table[1], m.table[2]);
- }
- else
- {
- // If E=0 and F is zero and S is 1, then V=-0
- // If E=0 and F is zero and S is 0, then V=0
-
- // we do not support -0 or 0, only is one 0
- SetZero();
- }
- }
-
- return 0; // never be a carry
- }
-
-
-private:
-
- void FromDouble_SetExpAndMan(bool is_sign, int e, uint mhighest, uint m1, uint m2)
- {
- exponent = e;
-
- if( man > 1 )
- {
- mantissa.table[man-1] = m1 | mhighest;
- mantissa.table[sint(man-2)] = m2;
- // although man>1 we're using casting into sint
- // to get rid from a warning which generates Microsoft Visual:
- // warning C4307: '*' : integral constant overflow
-
- for(uint i=0 ; i<man-2 ; ++i)
- mantissa.table[i] = 0;
- }
- else
- {
- mantissa.table[0] = m1 | mhighest;
- }
-
- info = 0;
-
- // the value should be different from zero
- TTMATH_ASSERT( mantissa.IsZero() == false )
-
- if( is_sign )
- SetSign();
- }
-
-
-#else
-
-public:
-
- // 64bit platforms
- uint FromDouble(double value)
- {
- // I am not sure what will be on a plaltform which has
- // a different endianness... but we use this library only
- // on x86 and amd (intel) 64 bits (as there's a lot of assembler code)
- union
- {
- double d;
- uint u; // one 64bit word
- } temp;
-
- temp.d = value;
-
- sint e = (temp.u & 0x7FF0000000000000ul) >> 52;
- uint m = (temp.u & 0xFFFFFFFFFFFFFul) << 11;
-
- if( e == 2047 )
- {
- // If E=2047 and F is nonzero, then V=NaN ("Not a number")
- // If E=2047 and F is zero and S is 1, then V=-Infinity
- // If E=2047 and F is zero and S is 0, then V=Infinity
-
- // we do not support -Infinity and +Infinity
- // we assume that there is always NaN
-
- SetNan();
- }
- else
- if( e > 0 )
- {
- // If 0<E<2047 then
- // V=(-1)**S * 2 ** (E-1023) * (1.F)
- // where "1.F" is intended to represent the binary number
- // created by prefixing F with an implicit leading 1 and a binary point.
-
- FromDouble_SetExpAndMan((temp.u & 0x8000000000000000ul) != 0,
- e - 1023 - man*TTMATH_BITS_PER_UINT + 1,
- 0x8000000000000000ul, m);
-
- // we do not have to call Standardizing() here
- // because the mantissa will have the highest bit set
- }
- else
- {
- // e == 0
-
- if( m != 0 )
- {
- // If E=0 and F is nonzero,
- // then V=(-1)**S * 2 ** (-1022) * (0.F)
- // These are "unnormalized" values.
-
- FromDouble_SetExpAndMan(bool(temp.u & 0x8000000000000000ul),
- e - 1022 - man*TTMATH_BITS_PER_UINT + 1, 0, m);
- Standardizing();
- }
- else
- {
- // If E=0 and F is zero and S is 1, then V=-0
- // If E=0 and F is zero and S is 0, then V=0
-
- // we do not support -0 or 0, only is one 0
- SetZero();
- }
- }
-
- return 0; // never be a carry
- }
-
-private:
-
- void FromDouble_SetExpAndMan(bool is_sign, sint e, uint mhighest, uint m)
- {
- exponent = e;
- mantissa.table[man-1] = m | mhighest;
-
- for(uint i=0 ; i<man-1 ; ++i)
- mantissa.table[i] = 0;
-
- info = 0;
-
- // the value should be different from zero
- TTMATH_ASSERT( mantissa.IsZero() == false )
-
- if( is_sign )
- SetSign();
- }
-
-#endif
-
-
-public:
-
-
- /*!
- this method converts from float to this class
- */
- uint FromFloat(float value)
- {
- return FromDouble(double(value));
- }
-
-
- /*!
- this method converts from this class into the 'double'
-
- if the value is too big:
- 'result' will be +/-infinity (depending on the sign)
- if the value is too small:
- 'result' will be 0
- */
- double ToDouble() const
- {
- double result;
-
- ToDouble(result);
-
- return result;
- }
-
-
-private:
-
-
- /*!
- an auxiliary method to check if the float value is +/-infinity
- we provide this method because isinf(float) in only in C99 language
-
- description taken from: http://www.psc.edu/general/software/packages/ieee/ieee.php
-
- The IEEE single precision floating point standard representation requires a 32 bit word,
- which may be represented as numbered from 0 to 31, left to right.
- The first bit is the sign bit, S, the next eight bits are the exponent bits, 'E',
- and the final 23 bits are the fraction 'F':
-
- S EEEEEEEE FFFFFFFFFFFFFFFFFFFFFFF
- 0 1 8 9 31
-
- The value V represented by the word may be determined as follows:
-
- * If E=255 and F is nonzero, then V=NaN ("Not a number")
- * If E=255 and F is zero and S is 1, then V=-Infinity
- * If E=255 and F is zero and S is 0, then V=Infinity
- * If 0<E<255 then V=(-1)**S * 2 ** (E-127) * (1.F) where "1.F" is intended to represent
- the binary number created by prefixing F with an implicit leading 1 and a binary point.
- * If E=0 and F is nonzero, then V=(-1)**S * 2 ** (-126) * (0.F) These are "unnormalized" values.
- * If E=0 and F is zero and S is 1, then V=-0
- * If E=0 and F is zero and S is 0, then V=0
- */
- bool IsInf(float value) const
- {
- // need testing on a 64 bit machine
-
- union
- {
- float d;
- uint u;
- } temp;
-
- temp.d = value;
-
- if( ((temp.u >> 23) & 0xff) == 0xff )
- {
- if( (temp.u & 0x7FFFFF) == 0 )
- return true; // +/- infinity
- }
-
- return false;
- }
-
-
-public:
-
- /*!
- this method converts from this class into the 'float'
-
- if the value is too big:
- 'result' will be +/-infinity (depending on the sign)
- if the value is too small:
- 'result' will be 0
- */
- float ToFloat() const
- {
- float result;
-
- ToFloat(result);
-
- return result;
- }
-
-
- /*!
- this method converts from this class into the 'float'
-
- if the value is too big:
- 'result' will be +/-infinity (depending on the sign)
- and the method returns 1
- if the value is too small:
- 'result' will be 0
- and the method returns 1
- */
- uint ToFloat(float & result) const
- {
- double result_double;
-
- uint c = ToDouble(result_double);
- result = float(result_double);
-
- if( result == -0.0f )
- result = 0.0f;
-
- if( c )
- return 1;
-
- // although the result_double can have a correct value
- // but after converting to float there can be infinity
-
- if( IsInf(result) )
- return 1;
-
- if( result == 0.0f && result_double != 0.0 )
- // result_double was too small for float
- return 1;
-
- return 0;
- }
-
-
- /*!
- this method converts from this class into the 'double'
-
- if the value is too big:
- 'result' will be +/-infinity (depending on the sign)
- and the method returns 1
- if the value is too small:
- 'result' will be 0
- and the method returns 1
- */
- uint ToDouble(double & result) const
- {
- if( IsZero() )
- {
- result = 0.0;
- return 0;
- }
-
- if( IsNan() )
- {
- result = ToDouble_SetDouble( false, 2047, 0, false, true);
-
- return 0;
- }
-
- sint e_correction = sint(man*TTMATH_BITS_PER_UINT) - 1;
-
- if( exponent >= 1024 - e_correction )
- {
- // +/- infinity
- result = ToDouble_SetDouble( IsSign(), 2047, 0, true);
-
- return 1;
- }
- else
- if( exponent <= -1023 - 52 - e_correction )
- {
- // too small value - we assume that there'll be a zero
- result = 0;
-
- // and return a carry
- return 1;
- }
-
- sint e = exponent.ToInt() + e_correction;
-
- if( e <= -1023 )
- {
- // -1023-52 < e <= -1023 (unnormalized value)
- result = ToDouble_SetDouble( IsSign(), 0, -(e + 1023));
- }
- else
- {
- // -1023 < e < 1024
- result = ToDouble_SetDouble( IsSign(), e + 1023, -1);
- }
-
- return 0;
- }
-
-private:
-
-#ifdef TTMATH_PLATFORM32
-
- // 32bit platforms
- double ToDouble_SetDouble(bool is_sign, uint e, sint move, bool infinity = false, bool nan = false) const
- {
- union
- {
- double d;
- uint u[2]; // two 32bit words
- } temp;
-
- temp.u[0] = temp.u[1] = 0;
-
- if( is_sign )
- temp.u[1] |= 0x80000000u;
-
- temp.u[1] |= (e << 20) & 0x7FF00000u;
-
- if( nan )
- {
- temp.u[0] |= 1;
- return temp.d;
- }
-
- if( infinity )
- return temp.d;
-
- UInt<2> m;
- m.table[1] = mantissa.table[man-1];
- m.table[0] = ( man > 1 ) ? mantissa.table[sint(man-2)] : 0;
- // although man>1 we're using casting into sint
- // to get rid from a warning which generates Microsoft Visual:
- // warning C4307: '*' : integral constant overflow
-
- m.Rcr( 12 + move );
- m.table[1] &= 0xFFFFFu; // cutting the 20 bit (when 'move' was -1)
-
- temp.u[1] |= m.table[1];
- temp.u[0] |= m.table[0];
-
- return temp.d;
- }
-
-#else
-
- // 64bit platforms
- double ToDouble_SetDouble(bool is_sign, uint e, sint move, bool infinity = false, bool nan = false) const
- {
- union
- {
- double d;
- uint u; // 64bit word
- } temp;
-
- temp.u = 0;
-
- if( is_sign )
- temp.u |= 0x8000000000000000ul;
-
- temp.u |= (e << 52) & 0x7FF0000000000000ul;
-
- if( nan )
- {
- temp.u |= 1;
- return temp.d;
- }
-
- if( infinity )
- return temp.d;
-
- uint m = mantissa.table[man-1];
-
- m >>= ( 12 + move );
- m &= 0xFFFFFFFFFFFFFul; // cutting the 20 bit (when 'move' was -1)
- temp.u |= m;
-
- return temp.d;
- }
-
-#endif
-
-
-public:
-
-
- /*!
- an operator= for converting 'sint' to this class
- */
- Big<exp, man> & operator=(sint value)
- {
- FromInt(value);
-
- return *this;
- }
-
-
- /*!
- an operator= for converting 'uint' to this class
- */
- Big<exp, man> & operator=(uint value)
- {
- FromUInt(value);
-
- return *this;
- }
-
-
- /*!
- an operator= for converting 'float' to this class
- */
- Big<exp, man> & operator=(float value)
- {
- FromFloat(value);
-
- return *this;
- }
-
-
- /*!
- an operator= for converting 'double' to this class
- */
- Big<exp, man> & operator=(double value)
- {
- FromDouble(value);
-
- return *this;
- }
-
-
- /*!
- a constructor for converting 'sint' to this class
- */
- Big(sint value)
- {
- FromInt(value);
- }
-
- /*!
- a constructor for converting 'uint' to this class
- */
- Big(uint value)
- {
- FromUInt(value);
- }
-
-
- /*!
- a constructor for converting 'double' to this class
- */
- Big(double value)
- {
- FromDouble(value);
- }
-
-
- /*!
- a constructor for converting 'float' to this class
- */
- Big(float value)
- {
- FromFloat(value);
- }
-
-
-#ifdef TTMATH_PLATFORM32
-
- /*!
- this method converts 'this' into 'result' (64 bit unsigned integer)
- if the value is too big this method returns a carry (1)
- */
- uint ToUInt(ulint & result) const
- {
- UInt<2> temp; // 64 bits container
-
- uint c = ToUInt(temp);
- temp.ToUInt(result);
-
- return c;
- }
-
-
- /*!
- this method converts 'this' into 'result' (64 bit unsigned integer)
- if the value is too big this method returns a carry (1)
- */
- uint ToInt(ulint & result) const
- {
- return ToUInt(result);
- }
-
-
- /*!
- this method converts 'this' into 'result' (64 bit unsigned integer)
- if the value is too big this method returns a carry (1)
- */
- uint ToInt(slint & result) const
- {
- Int<2> temp; // 64 bits container
-
- uint c = ToInt(temp);
- temp.ToInt(result);
-
- return c;
- }
-
-
- /*!
- a method for converting 'ulint' (64bit unsigned integer) to this class
- */
- uint FromUInt(ulint value)
- {
- if( value == 0 )
- {
- SetZero();
- return 0;
- }
-
- info = 0;
-
- if( man == 1 )
- {
- sint bit = mantissa.FindLeadingBitInWord(uint(value >> TTMATH_BITS_PER_UINT));
-
- if( bit != -1 )
- {
- // the highest word from value is different from zero
- bit += 1;
- value >>= bit;
- exponent = bit;
- }
- else
- {
- exponent.SetZero();
- }
-
- mantissa.table[0] = uint(value);
- }
- else
- {
- #ifdef _MSC_VER
- //warning C4307: '*' : integral constant overflow
- #pragma warning( disable: 4307 )
- #endif
-
- // man >= 2
- mantissa.table[man-1] = uint(value >> TTMATH_BITS_PER_UINT);
- mantissa.table[man-2] = uint(value);
-
- #ifdef _MSC_VER
- //warning C4307: '*' : integral constant overflow
- #pragma warning( default: 4307 )
- #endif
-
- exponent = -sint(man-2) * sint(TTMATH_BITS_PER_UINT);
-
- for(uint i=0 ; i<man-2 ; ++i)
- mantissa.table[i] = 0;
- }
-
- // there shouldn't be a carry because 'value' has the 'ulint' type
- // (we have sufficient exponent)
- Standardizing();
-
- return 0;
- }
-
-
- /*!
- a method for converting 'ulint' (64bit unsigned integer) to this class
- */
- uint FromInt(ulint value)
- {
- return FromUInt(value);
- }
-
-
- /*!
- a method for converting 'slint' (64bit signed integer) to this class
- */
- uint FromInt(slint value)
- {
- bool is_sign = false;
-
- if( value < 0 )
- {
- value = -value;
- is_sign = true;
- }
-
- FromUInt(ulint(value));
-
- if( is_sign )
- SetSign();
-
- return 0;
- }
-
-
- /*!
- a constructor for converting 'ulint' (64bit unsigned integer) to this class
- */
- Big(ulint value)
- {
- FromUInt(value);
- }
-
-
- /*!
- an operator for converting 'ulint' (64bit unsigned integer) to this class
- */
- Big<exp, man> & operator=(ulint value)
- {
- FromUInt(value);
-
- return *this;
- }
-
-
- /*!
- a constructor for converting 'slint' (64bit signed integer) to this class
- */
- Big(slint value)
- {
- FromInt(value);
- }
-
-
- /*!
- an operator for converting 'slint' (64bit signed integer) to this class
- */
- Big<exp, man> & operator=(slint value)
- {
- FromInt(value);
-
- return *this;
- }
-
-#endif
-
-
-
-#ifdef TTMATH_PLATFORM64
-
-
- /*!
- this method converts 'this' into 'result' (32 bit unsigned integer)
- ***this method is created only on a 64bit platform***
- if the value is too big this method returns a carry (1)
- */
- uint ToUInt(unsigned int & result) const
- {
- uint result_uint;
-
- uint c = ToUInt(result_uint);
- result = (unsigned int)result_uint;
-
- if( c || result_uint != uint(result) )
- return 1;
-
- return 0;
- }
-
-
- /*!
- this method converts 'this' into 'result' (32 bit unsigned integer)
- ***this method is created only on a 64bit platform***
- if the value is too big this method returns a carry (1)
- */
- uint ToInt(unsigned int & result) const
- {
- return ToUInt(result);
- }
-
-
- /*!
- this method converts 'this' into 'result' (32 bit signed integer)
- ***this method is created only on a 64bit platform***
- if the value is too big this method returns a carry (1)
- */
- uint ToInt(signed int & result) const
- {
- sint result_sint;
-
- uint c = ToInt(result_sint);
- result = (signed int)result_sint;
-
- if( c || result_sint != sint(result) )
- return 1;
-
- return 0;
- }
-
-
- /*
- this method converts 32 bit unsigned int to this class
- ***this method is created only on a 64bit platform***
- */
- uint FromUInt(unsigned int value)
- {
- return FromUInt(uint(value));
- }
-
-
- /*
- this method converts 32 bit unsigned int to this class
- ***this method is created only on a 64bit platform***
- */
- uint FromInt(unsigned int value)
- {
- return FromUInt(uint(value));
- }
-
-
- /*
- this method converts 32 bit signed int to this class
- ***this method is created only on a 64bit platform***
- */
- uint FromInt(signed int value)
- {
- return FromInt(sint(value));
- }
-
-
- /*!
- an operator= for converting 32 bit unsigned int to this class
- ***this operator is created only on a 64bit platform***
- */
- Big<exp, man> & operator=(unsigned int value)
- {
- FromUInt(value);
-
- return *this;
- }
-
-
- /*!
- a constructor for converting 32 bit unsigned int to this class
- ***this constructor is created only on a 64bit platform***
- */
- Big(unsigned int value)
- {
- FromUInt(value);
- }
-
-
- /*!
- an operator for converting 32 bit signed int to this class
- ***this operator is created only on a 64bit platform***
- */
- Big<exp, man> & operator=(signed int value)
- {
- FromInt(value);
-
- return *this;
- }
-
-
- /*!
- a constructor for converting 32 bit signed int to this class
- ***this constructor is created only on a 64bit platform***
- */
- Big(signed int value)
- {
- FromInt(value);
- }
-
-#endif
-
-
-private:
-
- /*!
- an auxiliary method for converting from UInt and Int
-
- we assume that there'll never be a carry here
- (we have an exponent and the value in Big can be bigger than
- that one from the UInt)
- */
- template<uint int_size>
- uint FromUIntOrInt(const UInt<int_size> & value, sint compensation)
- {
- uint minimum_size = (int_size < man)? int_size : man;
- exponent = (sint(int_size)-sint(man)) * sint(TTMATH_BITS_PER_UINT) - compensation;
-
- // copying the highest words
- uint i;
- for(i=1 ; i<=minimum_size ; ++i)
- mantissa.table[man-i] = value.table[int_size-i];
-
- // setting the rest of mantissa.table into zero (if some has left)
- for( ; i<=man ; ++i)
- mantissa.table[man-i] = 0;
-
- // the highest bit is either one or zero (when the whole mantissa is zero)
- // we can only call CorrectZero()
- CorrectZero();
-
- return 0;
- }
-
-
-public:
-
- /*!
- a method for converting from 'UInt<int_size>' to this class
- */
- template<uint int_size>
- uint FromUInt(UInt<int_size> value)
- {
- info = 0;
- sint compensation = (sint)value.CompensationToLeft();
-
- return FromUIntOrInt(value, compensation);
- }
-
-
- /*!
- a method for converting from 'UInt<int_size>' to this class
- */
- template<uint int_size>
- uint FromInt(const UInt<int_size> & value)
- {
- return FromUInt(value);
- }
-
-
- /*!
- a method for converting from 'Int<int_size>' to this class
- */
- template<uint int_size>
- uint FromInt(Int<int_size> value)
- {
- info = 0;
- bool is_sign = false;
-
- if( value.IsSign() )
- {
- value.ChangeSign();
- is_sign = true;
- }
-
- sint compensation = (sint)value.CompensationToLeft();
- FromUIntOrInt(value, compensation);
-
- if( is_sign )
- SetSign();
-
- return 0;
- }
-
-
- /*!
- an operator= for converting from 'Int<int_size>' to this class
- */
- template<uint int_size>
- Big<exp,man> & operator=(const Int<int_size> & value)
- {
- FromInt(value);
-
- return *this;
- }
-
-
- /*!
- a constructor for converting from 'Int<int_size>' to this class
- */
- template<uint int_size>
- Big(const Int<int_size> & value)
- {
- FromInt(value);
- }
-
-
- /*!
- an operator= for converting from 'UInt<int_size>' to this class
- */
- template<uint int_size>
- Big<exp,man> & operator=(const UInt<int_size> & value)
- {
- FromUInt(value);
-
- return *this;
- }
-
-
- /*!
- a constructor for converting from 'UInt<int_size>' to this class
- */
- template<uint int_size>
- Big(const UInt<int_size> & value)
- {
- FromUInt(value);
- }
-
-
- /*!
- an operator= for converting from 'Big<another_exp, another_man>' to this class
- */
- template<uint another_exp, uint another_man>
- Big<exp,man> & operator=(const Big<another_exp, another_man> & value)
- {
- FromBig(value);
-
- return *this;
- }
-
-
- /*!
- a constructor for converting from 'Big<another_exp, another_man>' to this class
- */
- template<uint another_exp, uint another_man>
- Big(const Big<another_exp, another_man> & value)
- {
- FromBig(value);
- }
-
-
- /*!
- a default constructor
-
- by default we don't set any of the members to zero
- only NaN flag is set
-
- if you want the mantissa and exponent to be set to zero
- define TTMATH_BIG_DEFAULT_CLEAR macro
- (useful for debug purposes)
- */
- Big()
- {
- #ifdef TTMATH_BIG_DEFAULT_CLEAR
-
- SetZeroNan();
-
- #else
-
- info = TTMATH_BIG_NAN;
- // we're directly setting 'info' (instead of calling SetNan())
- // in order to get rid of a warning saying that 'info' is uninitialized
-
- #endif
- }
-
-
- /*!
- a destructor
- */
- ~Big()
- {
- }
-
-
- /*!
- the default assignment operator
- */
- Big<exp,man> & operator=(const Big<exp,man> & value)
- {
- info = value.info;
- exponent = value.exponent;
- mantissa = value.mantissa;
-
- return *this;
- }
-
-
- /*!
- a constructor for copying from another object of this class
- */
-
- Big(const Big<exp,man> & value)
- {
- operator=(value);
- }
-
-
-
- /*!
- a method for converting into a string
- struct Conv is defined in ttmathtypes.h, look there for more information about parameters
-
- output:
- return value:
- 0 - ok and 'result' will be an object of type std::string (or std::wstring) which holds the value
- 1 - if there is a carry (it shoudn't be in a normal situation - if it is that means there
- is somewhere an error in the library)
- */
- uint ToString( std::string & result,
- uint base = 10,
- bool scient = false,
- sint scient_from = 15,
- sint round = -1,
- bool trim_zeroes = true,
- char comma = '.' ) const
- {
- Conv conv;
-
- conv.base = base;
- conv.scient = scient;
- conv.scient_from = scient_from;
- conv.round = round;
- conv.trim_zeroes = trim_zeroes;
- conv.comma = static_cast<uint>(comma);
-
- return ToStringBase<std::string, char>(result, conv);
- }
-
-
- /*!
- a method for converting into a string
- struct Conv is defined in ttmathtypes.h, look there for more information about parameters
- */
- uint ToString(std::string & result, const Conv & conv) const
- {
- return ToStringBase<std::string, char>(result, conv);
- }
-
-
- /*!
- a method for converting into a string
- struct Conv is defined in ttmathtypes.h, look there for more information about parameters
- */
- std::string ToString(const Conv & conv) const
- {
- std::string result;
- ToStringBase<std::string, char>(result, conv);
-
- return result;
- }
-
-
- /*!
- a method for converting into a string
- struct Conv is defined in ttmathtypes.h, look there for more information about parameters
- */
- std::string ToString(uint base = 10) const
- {
- Conv conv;
- conv.base = base;
-
- return ToString(conv);
- }
-
-
-
-#ifndef TTMATH_DONT_USE_WCHAR
-
-
- /*!
- a method for converting into a string
- struct Conv is defined in ttmathtypes.h, look there for more information about parameters
- */
- uint ToString( std::wstring & result,
- uint base = 10,
- bool scient = false,
- sint scient_from = 15,
- sint round = -1,
- bool trim_zeroes = true,
- wchar_t comma = '.' ) const
- {
- Conv conv;
-
- conv.base = base;
- conv.scient = scient;
- conv.scient_from = scient_from;
- conv.round = round;
- conv.trim_zeroes = trim_zeroes;
- conv.comma = static_cast<uint>(comma);
-
- return ToStringBase<std::wstring, wchar_t>(result, conv);
- }
-
-
- /*!
- a method for converting into a string
- struct Conv is defined in ttmathtypes.h, look there for more information about parameters
- */
- uint ToString(std::wstring & result, const Conv & conv) const
- {
- return ToStringBase<std::wstring, wchar_t>(result, conv);
- }
-
-
- /*!
- a method for converting into a string
- struct Conv is defined in ttmathtypes.h, look there for more information about parameters
- */
- std::wstring ToWString(const Conv & conv) const
- {
- std::wstring result;
- ToStringBase<std::wstring, wchar_t>(result, conv);
-
- return result;
- }
-
-
- /*!
- a method for converting into a string
- struct Conv is defined in ttmathtypes.h, look there for more information about parameters
- */
- std::wstring ToWString(uint base = 10) const
- {
- Conv conv;
- conv.base = base;
-
- return ToWString(conv);
- }
-
-#endif
-
-
-
-private:
-
-
- /*!
- an auxiliary method for converting into the string
- */
- template<class string_type, class char_type>
- uint ToStringBase(string_type & result, const Conv & conv) const
- {
- static char error_overflow_msg[] = "overflow";
- static char error_nan_msg[] = "NaN";
- result.erase();
-
- if( IsNan() )
- {
- Misc::AssignString(result, error_nan_msg);
- return 0;
- }
-
- if( conv.base<2 || conv.base>16 )
- {
- Misc::AssignString(result, error_overflow_msg);
- return 1;
- }
-
- if( IsZero() )
- {
- result = '0';
-
- return 0;
- }
-
- /*
- since 'base' is greater or equal 2 that 'new_exp' of type 'Int<exp>' should
- hold the new value of exponent but we're using 'Int<exp+1>' because
- if the value for example would be 'max()' then we couldn't show it
-
- max() -> 11111111 * 2 ^ 11111111111 (bin)(the mantissa and exponent have all bits set)
- if we were using 'Int<exp>' we couldn't show it in this format:
- 1,1111111 * 2 ^ 11111111111 (bin)
- because we have to add something to the mantissa and because
- mantissa is full we can't do it and it'll be a carry
- (look at ToString_SetCommaAndExponent(...))
-
- when the base would be greater than two (for example 10)
- we could use 'Int<exp>' here
- */
- Int<exp+1> new_exp;
-
- if( ToString_CreateNewMantissaAndExponent<string_type, char_type>(result, conv, new_exp) )
- {
- Misc::AssignString(result, error_overflow_msg);
- return 1;
- }
-
-
- if( ToString_SetCommaAndExponent<string_type, char_type>(result, conv, new_exp) )
- {
- Misc::AssignString(result, error_overflow_msg);
- return 1;
- }
-
- if( IsSign() )
- result.insert(result.begin(), '-');
-
-
- // converted successfully
- return 0;
- }
-
-
-
- /*!
- in the method 'ToString_CreateNewMantissaAndExponent()' we're using
- type 'Big<exp+1,man>' and we should have the ability to use some
- necessary methods from that class (methods which are private here)
- */
- friend class Big<exp-1,man>;
-
-
- /*!
- an auxiliary method for converting into the string
-
- input:
- base - the base in range <2,16>
-
- output:
- return values:
- 0 - ok
- 1 - if there was a carry
- new_man - the new mantissa for 'base'
- new_exp - the new exponent for 'base'
-
- mathematic part:
-
- the value is stored as:
- value = mantissa * 2^exponent
- we want to show 'value' as:
- value = new_man * base^new_exp
-
- then 'new_man' we'll print using the standard method from UInt<> type for printing
- and 'new_exp' is the offset of the comma operator in a system of a base 'base'
-
- value = mantissa * 2^exponent
- value = mantissa * 2^exponent * (base^new_exp / base^new_exp)
- value = mantissa * (2^exponent / base^new_exp) * base^new_exp
-
- look at the part (2^exponent / base^new_exp), there'll be good if we take
- a 'new_exp' equal that value when the (2^exponent / base^new_exp) will be equal one
-
- on account of the 'base' is not as power of 2 (can be from 2 to 16),
- this formula will not be true for integer 'new_exp' then in our case we take
- 'base^new_exp' _greater_ than '2^exponent'
-
- if 'base^new_exp' were smaller than '2^exponent' the new mantissa could be
- greater than the max value of the container UInt<man>
-
- value = mantissa * (2^exponent / base^new_exp) * base^new_exp
- let M = mantissa * (2^exponent / base^new_exp) then
- value = M * base^new_exp
-
- in our calculation we treat M as floating value showing it as:
- M = mm * 2^ee where ee will be <= 0
-
- next we'll move all bits of mm into the right when ee is equal zero
- abs(ee) must not be too big that only few bits from mm we can leave
-
- then we'll have:
- M = mmm * 2^0
- 'mmm' is the new_man which we're looking for
-
-
- new_exp we calculate in this way:
- 2^exponent <= base^new_exp
- new_exp >= log base (2^exponent) <- logarithm with the base 'base' from (2^exponent)
-
- but we need new_exp as integer then we test:
- if new_exp is greater than zero and with fraction we add one to new_exp
- new_exp = new_exp + 1 (if new_exp>0 and with fraction)
- and at the end we take the integer part:
- new_exp = int(new_exp)
- */
- template<class string_type, class char_type>
- uint ToString_CreateNewMantissaAndExponent( string_type & new_man, const Conv & conv,
- Int<exp+1> & new_exp) const
- {
- uint c = 0;
-
- if( conv.base<2 || conv.base>16 )
- return 1;
-
- // special method for base equal 2
- if( conv.base == 2 )
- return ToString_CreateNewMantissaAndExponent_Base2(new_man, new_exp);
-
- // special method for base equal 4
- if( conv.base == 4 )
- return ToString_CreateNewMantissaAndExponent_BasePow2(new_man, new_exp, 2);
-
- // special method for base equal 8
- if( conv.base == 8 )
- return ToString_CreateNewMantissaAndExponent_BasePow2(new_man, new_exp, 3);
-
- // special method for base equal 16
- if( conv.base == 16 )
- return ToString_CreateNewMantissaAndExponent_BasePow2(new_man, new_exp, 4);
-
-
- // this = mantissa * 2^exponent
-
- // temp = +1 * 2^exponent
- // we're using a bigger type than 'big<exp,man>' (look below)
- Big<exp+1,man> temp;
- temp.info = 0;
- temp.exponent = exponent;
- temp.mantissa.SetOne();
- c += temp.Standardizing();
-
- // new_exp_ = log base (2^exponent)
- // if new_exp_ is positive and with fraction then we add one
- Big<exp+1,man> new_exp_;
- c += new_exp_.ToString_Log(temp, conv.base); // this logarithm isn't very complicated
-
- // rounding up to the nearest integer
- if( !new_exp_.IsInteger() )
- {
- if( !new_exp_.IsSign() )
- c += new_exp_.AddOne(); // new_exp_ > 0 and with fraction
-
- new_exp_.SkipFraction();
- }
-
- if( ToString_CreateNewMantissaTryExponent<string_type, char_type>(new_man, conv, new_exp_, new_exp) )
- {
- // in very rare cases there can be an overflow from ToString_CreateNewMantissaTryExponent
- // it means that new_exp_ was too small (the problem comes from floating point numbers precision)
- // so we increse new_exp_ and try again
- new_exp_.AddOne();
- c += ToString_CreateNewMantissaTryExponent<string_type, char_type>(new_man, conv, new_exp_, new_exp);
- }
-
- return (c==0)? 0 : 1;
- }
-
-
-
- /*!
- an auxiliary method for converting into the string
-
- trying to calculate new_man for given exponent (new_exp_)
- if there is a carry it can mean that new_exp_ is too small
- */
- template<class string_type, class char_type>
- uint ToString_CreateNewMantissaTryExponent( string_type & new_man, const Conv & conv,
- const Big<exp+1,man> & new_exp_, Int<exp+1> & new_exp) const
- {
- uint c = 0;
-
- // because 'base^new_exp' is >= '2^exponent' then
- // because base is >= 2 then we've got:
- // 'new_exp_' must be smaller or equal 'new_exp'
- // and we can pass it into the Int<exp> type
- // (in fact we're using a greater type then it'll be ok)
- c += new_exp_.ToInt(new_exp);
-
- // base_ = base
- Big<exp+1,man> base_(conv.base);
-
- // base_ = base_ ^ new_exp_
- c += base_.Pow( new_exp_ ); // use new_exp_ so Pow(Big<> &) version will be used
- // if we hadn't used a bigger type than 'Big<exp,man>' then the result
- // of this formula 'Pow(...)' would have been with an overflow
-
- // temp = mantissa * 2^exponent / base_^new_exp_
- Big<exp+1,man> temp;
- temp.info = 0;
- temp.mantissa = mantissa;
- temp.exponent = exponent;
- c += temp.Div(base_);
-
- // moving all bits of the mantissa into the right
- // (how many times to move depend on the exponent)
- c += temp.ToString_MoveMantissaIntoRight();
-
- // because we took 'new_exp' as small as it was
- // possible ([log base (2^exponent)] + 1) that after the division
- // (temp.Div( base_ )) the value of exponent should be equal zero or
- // minimum smaller than zero then we've got the mantissa which has
- // maximum valid bits
- temp.mantissa.ToString(new_man, conv.base);
-
- if( IsInteger() )
- {
- // making sure the new mantissa will be without fraction (integer)
- ToString_CheckMantissaInteger<string_type, char_type>(new_man, new_exp);
- }
- else
- if( conv.base_round )
- {
- c += ToString_BaseRound<string_type, char_type>(new_man, conv, new_exp);
- }
-
- return (c==0)? 0 : 1;
- }
-
-
- /*!
- this method calculates the logarithm
- it is used by ToString_CreateNewMantissaAndExponent() method
-
- it's not too complicated
- because x=+1*2^exponent (mantissa is one) then during the calculation
- the Ln(x) will not be making the long formula from LnSurrounding1()
- and only we have to calculate 'Ln(base)' but it'll be calculated
- only once, the next time we will get it from the 'history'
-
- x is greater than 0
- base is in <2,16> range
- */
- uint ToString_Log(const Big<exp,man> & x, uint base)
- {
- TTMATH_REFERENCE_ASSERT( x )
- TTMATH_ASSERT( base>=2 && base<=16 )
-
- Big<exp,man> temp;
- temp.SetOne();
-
- if( x == temp )
- {
- // log(1) is 0
- SetZero();
-
- return 0;
- }
-
- // there can be only a carry
- // because the 'x' is in '1+2*exponent' form then
- // the long formula from LnSurrounding1() will not be calculated
- // (LnSurrounding1() will return one immediately)
- uint c = Ln(x);
-
- if( base==10 && man<=TTMATH_BUILTIN_VARIABLES_SIZE )
- {
- // for the base equal 10 we're using SetLn10() instead of calculating it
- // (only if we have the constant sufficient big)
- temp.SetLn10();
- }
- else
- {
- c += ToString_LogBase(base, temp);
- }
-
- c += Div( temp );
-
- return (c==0)? 0 : 1;
- }
-
-
-#ifndef TTMATH_MULTITHREADS
-
- /*!
- this method calculates the logarithm of 'base'
- it's used in single thread environment
- */
- uint ToString_LogBase(uint base, Big<exp,man> & result)
- {
- TTMATH_ASSERT( base>=2 && base<=16 )
-
- // this guardians are initialized before the program runs (static POD types)
- static int guardians[15] = {0,0,0,0,0,0,0,0,0,0,0,0,0,0,0};
- static Big<exp,man> log_history[15];
- uint index = base - 2;
- uint c = 0;
-
- if( guardians[index] == 0 )
- {
- Big<exp,man> base_(base);
- c += log_history[index].Ln(base_);
- guardians[index] = 1;
- }
-
- result = log_history[index];
-
- return (c==0)? 0 : 1;
- }
-
-#else
-
- /*!
- this method calculates the logarithm of 'base'
- it's used in multi-thread environment
- */
- uint ToString_LogBase(uint base, Big<exp,man> & result)
- {
- TTMATH_ASSERT( base>=2 && base<=16 )
-
- // this guardians are initialized before the program runs (static POD types)
- volatile static sig_atomic_t guardians[15] = {0,0,0,0,0,0,0,0,0,0,0,0,0,0,0};
- static Big<exp,man> * plog_history;
- uint index = base - 2;
- uint c = 0;
-
- // double-checked locking
- if( guardians[index] == 0 )
- {
- ThreadLock thread_lock;
-
- // locking
- if( thread_lock.Lock() )
- {
- static Big<exp,man> log_history[15];
-
- if( guardians[index] == 0 )
- {
- plog_history = log_history;
-
- Big<exp,man> base_(base);
- c += log_history[index].Ln(base_);
- guardians[index] = 1;
- }
- }
- else
- {
- // there was a problem with locking, we store the result directly in 'result' object
- Big<exp,man> base_(base);
- c += result.Ln(base_);
-
- return (c==0)? 0 : 1;
- }
-
- // automatically unlocking
- }
-
- result = plog_history[index];
-
- return (c==0)? 0 : 1;
- }
-
-#endif
-
- /*!
- an auxiliary method for converting into the string (private)
-
- this method moving all bits from mantissa into the right side
- the exponent tell us how many times moving (the exponent is <=0)
- */
- uint ToString_MoveMantissaIntoRight()
- {
- if( exponent.IsZero() )
- return 0;
-
- // exponent can't be greater than zero
- // because we would cat the highest bits of the mantissa
- if( !exponent.IsSign() )
- return 1;
-
-
- if( exponent <= -sint(man*TTMATH_BITS_PER_UINT) )
- // if 'exponent' is <= than '-sint(man*TTMATH_BITS_PER_UINT)'
- // it means that we must cut the whole mantissa
- // (there'll not be any of the valid bits)
- return 1;
-
- // e will be from (-man*TTMATH_BITS_PER_UINT, 0>
- sint e = -( exponent.ToInt() );
- mantissa.Rcr(e,0);
-
- return 0;
- }
-
-
- /*!
- a special method similar to the 'ToString_CreateNewMantissaAndExponent'
- when the 'base' is equal 2
-
- we use it because if base is equal 2 we don't have to make those
- complicated calculations and the output is directly from the source
- (there will not be any small distortions)
- */
- template<class string_type>
- uint ToString_CreateNewMantissaAndExponent_Base2( string_type & new_man,
- Int<exp+1> & new_exp ) const
- {
- for( sint i=man-1 ; i>=0 ; --i )
- {
- uint value = mantissa.table[i];
-
- for( uint bit=0 ; bit<TTMATH_BITS_PER_UINT ; ++bit )
- {
- if( (value & TTMATH_UINT_HIGHEST_BIT) != 0 )
- new_man += '1';
- else
- new_man += '0';
-
- value <<= 1;
- }
- }
-
- new_exp = exponent;
-
- return 0;
- }
-
-
- /*!
- a special method used to calculate the new mantissa and exponent
- when the 'base' is equal 4, 8 or 16
-
- when base is 4 then bits is 2
- when base is 8 then bits is 3
- when base is 16 then bits is 4
- (and the algorithm can be used with a base greater than 16)
- */
- template<class string_type>
- uint ToString_CreateNewMantissaAndExponent_BasePow2( string_type & new_man,
- Int<exp+1> & new_exp,
- uint bits) const
- {
- sint move; // how many times move the mantissa
- UInt<man+1> man_temp(mantissa); // man+1 for moving
- new_exp = exponent;
- new_exp.DivInt((sint)bits, move);
-
- if( move != 0 )
- {
- // we're moving the man_temp to left-hand side
- if( move < 0 )
- {
- move = sint(bits) + move;
- new_exp.SubOne(); // when move is < than 0 then new_exp is < 0 too
- }
-
- man_temp.Rcl(move);
- }
-
-
- if( bits == 3 )
- {
- // base 8
- // now 'move' is greater than or equal 0
- uint len = man*TTMATH_BITS_PER_UINT + move;
- return ToString_CreateNewMantissaAndExponent_Base8(new_man, man_temp, len, bits);
- }
- else
- {
- // base 4 or 16
- return ToString_CreateNewMantissaAndExponent_Base4or16(new_man, man_temp, bits);
- }
- }
-
-
- /*!
- a special method used to calculate the new mantissa
- when the 'base' is equal 8
-
- bits is always 3
-
- we can use this algorithm when the base is 4 or 16 too
- but we have a faster method ToString_CreateNewMantissaAndExponent_Base4or16()
- */
- template<class string_type>
- uint ToString_CreateNewMantissaAndExponent_Base8( string_type & new_man,
- UInt<man+1> & man_temp,
- uint len,
- uint bits) const
- {
- uint shift = TTMATH_BITS_PER_UINT - bits;
- uint mask = TTMATH_UINT_MAX_VALUE >> shift;
- uint i;
-
- for( i=0 ; i<len ; i+=bits )
- {
- uint digit = man_temp.table[0] & mask;
- new_man.insert(new_man.begin(), static_cast<char>(Misc::DigitToChar(digit)));
-
- man_temp.Rcr(bits);
- }
-
- TTMATH_ASSERT( man_temp.IsZero() )
-
- return 0;
- }
-
-
- /*!
- a special method used to calculate the new mantissa
- when the 'base' is equal 4 or 16
-
- when the base is equal 4 or 16 the bits is 2 or 4
- and because TTMATH_BITS_PER_UINT (32 or 64) is divisible by 2 (or 4)
- then we can get digits from the end of our mantissa
- */
- template<class string_type>
- uint ToString_CreateNewMantissaAndExponent_Base4or16( string_type & new_man,
- UInt<man+1> & man_temp,
- uint bits) const
- {
- TTMATH_ASSERT( TTMATH_BITS_PER_UINT % 2 == 0 )
- TTMATH_ASSERT( TTMATH_BITS_PER_UINT % 4 == 0 )
-
- uint shift = TTMATH_BITS_PER_UINT - bits;
- uint mask = TTMATH_UINT_MAX_VALUE << shift;
- uint digit;
-
- // table[man] - last word - is different from zero if we moved man_temp
- digit = man_temp.table[man];
-
- if( digit != 0 )
- new_man += static_cast<char>(Misc::DigitToChar(digit));
-
-
- for( int i=man-1 ; i>=0 ; --i )
- {
- uint shift_local = shift;
- uint mask_local = mask;
-
- while( mask_local != 0 )
- {
- digit = man_temp.table[i] & mask_local;
-
- if( shift_local != 0 )
- digit = digit >> shift_local;
-
- new_man += static_cast<char>(Misc::DigitToChar(digit));
- mask_local = mask_local >> bits;
- shift_local = shift_local - bits;
- }
- }
-
- return 0;
- }
-
-
- /*!
- an auxiliary method for converting into the string
- */
- template<class string_type, class char_type>
- bool ToString_RoundMantissaWouldBeInteger(string_type & new_man, const Conv & conv, Int<exp+1> & new_exp) const
- {
- // if new_exp is greater or equal to zero then we have an integer value,
- // if new_exp is equal -1 then we have only one digit after the comma
- // and after rounding it would be an integer value
- if( !new_exp.IsSign() || new_exp == -1 )
- return true;
-
- if( new_man.size() >= TTMATH_UINT_HIGHEST_BIT || new_man.size() < 2 )
- return true; // oops, the mantissa is too large for calculating (or too small) - we are not doing the base rounding
-
- uint i = 0;
- char_type digit;
-
- if( new_exp >= -sint(new_man.size()) )
- {
- uint new_exp_abs = -new_exp.ToInt();
- i = new_man.size() - new_exp_abs; // start from the first digit after the comma operator
- }
-
- if( Misc::CharToDigit(new_man[new_man.size()-1]) >= conv.base/2 )
- {
- if( new_exp < -sint(new_man.size()) )
- {
- // there are some zeroes after the comma operator
- // (between the comma and the first digit from the mantissa)
- // and the result value will never be an integer
- return false;
- }
-
- digit = static_cast<char_type>( Misc::DigitToChar(conv.base-1) );
- }
- else
- {
- digit = '0';
- }
-
- for( ; i < new_man.size()-1 ; ++i)
- if( new_man[i] != digit )
- return false; // it will not be an integer
-
- return true; // it will be integer after rounding
- }
-
-
- /*!
- an auxiliary method for converting into the string
- (when this is integer)
-
- after floating point calculating the new mantissa can consist of some fraction
- so if our value is integer we should check the new mantissa
- (after the decimal point there should be only zeroes)
-
- often this is a last digit different from zero
- ToString_BaseRound would not get rid of it because the method make a test against
- an integer value (ToString_RoundMantissaWouldBeInteger) and returns immediately
- */
- template<class string_type, class char_type>
- void ToString_CheckMantissaInteger(string_type & new_man, const Int<exp+1> & new_exp) const
- {
- if( !new_exp.IsSign() )
- return; // return if new_exp >= 0
-
- uint i = 0;
- uint man_size = new_man.size();
-
- if( man_size >= TTMATH_UINT_HIGHEST_BIT )
- return; // ops, the mantissa is too long
-
- sint sman_size = -sint(man_size);
-
- if( new_exp >= sman_size )
- {
- sint e = new_exp.ToInt();
- e = -e;
- // now e means how many last digits from the mantissa should be equal zero
-
- i = man_size - uint(e);
- }
-
- for( ; i<man_size ; ++i)
- new_man[i] = '0';
- }
-
-
- /*!
- an auxiliary method for converting into the string
-
- this method is used for base!=2, base!=4, base!=8 and base!=16
- we do the rounding when the value has fraction (is not an integer)
- */
- template<class string_type, class char_type>
- uint ToString_BaseRound(string_type & new_man, const Conv & conv, Int<exp+1> & new_exp) const
- {
- // we must have minimum two characters
- if( new_man.size() < 2 )
- return 0;
-
- // assert that there will not be an integer after rounding
- if( ToString_RoundMantissaWouldBeInteger<string_type, char_type>(new_man, conv, new_exp) )
- return 0;
-
- typename string_type::size_type i = new_man.length() - 1;
-
- // we're erasing the last character
- uint digit = Misc::CharToDigit( new_man[i] );
- new_man.erase(i, 1);
- uint c = new_exp.AddOne();
-
- // if the last character is greater or equal 'base/2'
- // we are adding one into the new mantissa
- if( digit >= conv.base / 2 )
- ToString_RoundMantissa_AddOneIntoMantissa<string_type, char_type>(new_man, conv);
-
- return c;
- }
-
-
- /*!
- an auxiliary method for converting into the string
-
- this method addes one into the new mantissa
- */
- template<class string_type, class char_type>
- void ToString_RoundMantissa_AddOneIntoMantissa(string_type & new_man, const Conv & conv) const
- {
- if( new_man.empty() )
- return;
-
- sint i = sint( new_man.length() ) - 1;
- bool was_carry = true;
-
- for( ; i>=0 && was_carry ; --i )
- {
- // we can have the comma as well because
- // we're using this method later in ToString_CorrectDigitsAfterComma_Round()
- // (we're only ignoring it)
- if( new_man[i] == static_cast<char_type>(conv.comma) )
- continue;
-
- // we're adding one
- uint digit = Misc::CharToDigit( new_man[i] ) + 1;
-
- if( digit == conv.base )
- digit = 0;
- else
- was_carry = false;
-
- new_man[i] = static_cast<char_type>( Misc::DigitToChar(digit) );
- }
-
- if( i<0 && was_carry )
- new_man.insert( new_man.begin() , '1' );
- }
-
-
-
- /*!
- an auxiliary method for converting into the string
-
- this method sets the comma operator and/or puts the exponent
- into the string
- */
- template<class string_type, class char_type>
- uint ToString_SetCommaAndExponent(string_type & new_man, const Conv & conv, Int<exp+1> & new_exp) const
- {
- uint carry = 0;
-
- if( new_man.empty() )
- return carry;
-
- Int<exp+1> scientific_exp( new_exp );
-
- // 'new_exp' depends on the 'new_man' which is stored like this e.g:
- // 32342343234 (the comma is at the end)
- // we'd like to show it in this way:
- // 3.2342343234 (the 'scientific_exp' is connected with this example)
-
- sint offset = sint( new_man.length() ) - 1;
- carry += scientific_exp.Add( offset );
- // there shouldn't have been a carry because we're using
- // a greater type -- 'Int<exp+1>' instead of 'Int<exp>'
-
- bool print_scientific = conv.scient;
-
- if( !print_scientific )
- {
- if( scientific_exp > conv.scient_from || scientific_exp < -sint(conv.scient_from) )
- print_scientific = true;
- }
-
- if( !print_scientific )
- ToString_SetCommaAndExponent_Normal<string_type, char_type>(new_man, conv, new_exp);
- else
- // we're passing the 'scientific_exp' instead of 'new_exp' here
- ToString_SetCommaAndExponent_Scientific<string_type, char_type>(new_man, conv, scientific_exp);
-
- return (carry==0)? 0 : 1;
- }
-
-
- /*!
- an auxiliary method for converting into the string
- */
- template<class string_type, class char_type>
- void ToString_SetCommaAndExponent_Normal(string_type & new_man, const Conv & conv, Int<exp+1> & new_exp ) const
- {
- if( !new_exp.IsSign() ) // it means: if( new_exp >= 0 )
- ToString_SetCommaAndExponent_Normal_AddingZero<string_type, char_type>(new_man, new_exp);
- else
- ToString_SetCommaAndExponent_Normal_SetCommaInside<string_type, char_type>(new_man, conv, new_exp);
-
-
- ToString_Group_man<string_type, char_type>(new_man, conv);
- }
-
-
- /*!
- an auxiliary method for converting into the string
- */
- template<class string_type, class char_type>
- void ToString_SetCommaAndExponent_Normal_AddingZero(string_type & new_man,
- Int<exp+1> & new_exp) const
- {
- // we're adding zero characters at the end
- // 'i' will be smaller than 'when_scientific' (or equal)
- uint i = new_exp.ToInt();
-
- if( new_man.length() + i > new_man.capacity() )
- // about 6 characters more (we'll need it for the comma or something)
- new_man.reserve( new_man.length() + i + 6 );
-
- for( ; i>0 ; --i)
- new_man += '0';
- }
-
-
- /*!
- an auxiliary method for converting into the string
- */
- template<class string_type, class char_type>
- void ToString_SetCommaAndExponent_Normal_SetCommaInside(
- string_type & new_man,
- const Conv & conv,
- Int<exp+1> & new_exp ) const
- {
- // new_exp is < 0
-
- sint new_man_len = sint(new_man.length()); // 'new_man_len' with a sign
- sint e = -( new_exp.ToInt() ); // 'e' will be positive
-
- if( new_exp > -new_man_len )
- {
- // we're setting the comma within the mantissa
-
- sint index = new_man_len - e;
- new_man.insert( new_man.begin() + index, static_cast<char_type>(conv.comma));
- }
- else
- {
- // we're adding zero characters before the mantissa
-
- uint how_many = e - new_man_len;
- string_type man_temp(how_many+1, '0');
-
- man_temp.insert( man_temp.begin()+1, static_cast<char_type>(conv.comma));
- new_man.insert(0, man_temp);
- }
-
- ToString_CorrectDigitsAfterComma<string_type, char_type>(new_man, conv);
- }
-
-
- /*!
- an auxiliary method for converting into the string
- */
- template<class string_type, class char_type>
- void ToString_SetCommaAndExponent_Scientific( string_type & new_man,
- const Conv & conv,
- Int<exp+1> & scientific_exp ) const
- {
- if( new_man.empty() )
- return;
-
- if( new_man.size() > 1 )
- {
- new_man.insert( new_man.begin()+1, static_cast<char_type>(conv.comma) );
- ToString_CorrectDigitsAfterComma<string_type, char_type>(new_man, conv);
- }
-
- ToString_Group_man<string_type, char_type>(new_man, conv);
-
- if( conv.base == 10 )
- {
- new_man += 'e';
-
- if( !scientific_exp.IsSign() )
- new_man += '+';
- }
- else
- {
- // the 10 here is meant as the base 'base'
- // (no matter which 'base' we're using there'll always be 10 here)
- Misc::AddString(new_man, "*10^");
- }
-
- string_type temp_exp;
- scientific_exp.ToString( temp_exp, conv.base );
-
- new_man += temp_exp;
- }
-
-
- /*!
- an auxiliary method for converting into the string
- */
- template<class string_type, class char_type>
- void ToString_Group_man(string_type & new_man, const Conv & conv) const
- {
- typedef typename string_type::size_type StrSize;
-
- if( conv.group == 0 )
- return;
-
- // first we're looking for the comma operator
- StrSize index = new_man.find(static_cast<char_type>(conv.comma), 0);
-
- if( index == string_type::npos )
- index = new_man.size();
-
- ToString_Group_man_before_comma<string_type, char_type>(new_man, conv, index);
- ToString_Group_man_after_comma<string_type, char_type>(new_man, conv, index+1);
- }
-
-
-
- /*!
- an auxiliary method for converting into the string
- */
- template<class string_type, class char_type>
- void ToString_Group_man_before_comma( string_type & new_man, const Conv & conv,
- typename string_type::size_type & index) const
- {
- typedef typename string_type::size_type StrSize;
- uint group = 0;
-
- StrSize i = index;
-
- // adding group characters before the comma operator
- // i>0 because on the first position we don't put any additional grouping characters
- for( ; i>0 ; --i, ++group)
- {
- if( group >= 3 )
- {
- group = 0;
- new_man.insert(i, 1, static_cast<char_type>(conv.group));
- ++index;
- }
- }
- }
-
-
- /*!
- an auxiliary method for converting into the string
- */
- template<class string_type, class char_type>
- void ToString_Group_man_after_comma(string_type & new_man, const Conv & conv,
- typename string_type::size_type index) const
- {
- uint group = 0;
-
- for( ; index<new_man.size() ; ++index, ++group)
- {
- if( group >= 3 )
- {
- group = 0;
- new_man.insert(index, 1, static_cast<char_type>(conv.group));
- ++index;
- }
- }
- }
-
-
- /*!
- an auxiliary method for converting into the string
- */
- template<class string_type, class char_type>
- void ToString_CorrectDigitsAfterComma( string_type & new_man,
- const Conv & conv ) const
- {
- if( conv.round >= 0 )
- ToString_CorrectDigitsAfterComma_Round<string_type, char_type>(new_man, conv);
-
- if( conv.trim_zeroes )
- ToString_CorrectDigitsAfterComma_CutOffZeroCharacters<string_type, char_type>(new_man, conv);
- }
-
-
- /*!
- an auxiliary method for converting into the string
- */
- template<class string_type, class char_type>
- void ToString_CorrectDigitsAfterComma_CutOffZeroCharacters(
- string_type & new_man,
- const Conv & conv) const
- {
- // minimum two characters
- if( new_man.length() < 2 )
- return;
-
- // we're looking for the index of the last character which is not zero
- uint i = uint( new_man.length() ) - 1;
- for( ; i>0 && new_man[i]=='0' ; --i );
-
- // if there is another character than zero at the end
- // we're finishing
- if( i == new_man.length() - 1 )
- return;
-
- // we must have a comma
- // (the comma can be removed by ToString_CorrectDigitsAfterComma_Round
- // which is called before)
- if( new_man.find_last_of(static_cast<char_type>(conv.comma), i) == string_type::npos )
- return;
-
- // if directly before the first zero is the comma operator
- // we're cutting it as well
- if( i>0 && new_man[i]==static_cast<char_type>(conv.comma) )
- --i;
-
- new_man.erase(i+1, new_man.length()-i-1);
- }
-
-
- /*!
- an auxiliary method for converting into the string
- */
- template<class string_type, class char_type>
- void ToString_CorrectDigitsAfterComma_Round(
- string_type & new_man,
- const Conv & conv ) const
- {
- typedef typename string_type::size_type StrSize;
-
- // first we're looking for the comma operator
- StrSize index = new_man.find(static_cast<char_type>(conv.comma), 0);
-
- if( index == string_type::npos )
- // nothing was found (actually there can't be this situation)
- return;
-
- // we're calculating how many digits there are at the end (after the comma)
- // 'after_comma' will be greater than zero because at the end
- // we have at least one digit
- StrSize after_comma = new_man.length() - index - 1;
-
- // if 'max_digit_after_comma' is greater than 'after_comma' (or equal)
- // we don't have anything for cutting
- if( static_cast<StrSize>(conv.round) >= after_comma )
- return;
-
- uint last_digit = Misc::CharToDigit( new_man[ index + conv.round + 1 ], conv.base );
-
- // we're cutting the rest of the string
- new_man.erase(index + conv.round + 1, after_comma - conv.round);
-
- if( conv.round == 0 )
- {
- // we're cutting the comma operator as well
- // (it's not needed now because we've cut the whole rest after the comma)
- new_man.erase(index, 1);
- }
-
- if( last_digit >= conv.base / 2 )
- // we must round here
- ToString_RoundMantissa_AddOneIntoMantissa<string_type, char_type>(new_man, conv);
- }
-
-
-
-public:
-
- /*!
- a method for converting a string into its value
-
- it returns 1 if the value is too big -- we cannot pass it into the range
- of our class Big<exp,man> (or if the base is incorrect)
-
- that means only digits before the comma operator can make this value too big,
- all digits after the comma we can ignore
-
- 'source' - pointer to the string for parsing
-
- if 'after_source' is set that when this method finishes
- it sets the pointer to the new first character after parsed value
-
- 'value_read' - if the pointer is provided that means the value_read will be true
- only when a value has been actually read, there can be situation where only such
- a string '-' or '+' will be parsed -- 'after_source' will be different from 'source' but
- no value has been read (there are no digits)
- on other words if 'value_read' is true -- there is at least one digit in the string
- */
- uint FromString(const char * source, uint base = 10, const char ** after_source = 0, bool * value_read = 0)
- {
- Conv conv;
- conv.base = base;
-
- return FromStringBase(source, conv, after_source, value_read);
- }
-
-
- /*!
- a method for converting a string into its value
- */
- uint FromString(const char * source, const Conv & conv, const char ** after_source = 0, bool * value_read = 0)
- {
- return FromStringBase(source, conv, after_source, value_read);
- }
-
-
- /*!
- a method for converting a string into its value
- */
- uint FromString(const std::string & string, uint base = 10, const char ** after_source = 0, bool * value_read = 0)
- {
- return FromString(string.c_str(), base, after_source, value_read);
- }
-
-
- /*!
- a method for converting a string into its value
- */
- uint FromString(const std::string & string, const Conv & conv, const char ** after_source = 0, bool * value_read = 0)
- {
- return FromString(string.c_str(), conv, after_source, value_read);
- }
-
-
-#ifndef TTMATH_DONT_USE_WCHAR
-
- /*!
- a method for converting a string into its value
- */
- uint FromString(const wchar_t * source, uint base = 10, const wchar_t ** after_source = 0, bool * value_read = 0)
- {
- Conv conv;
- conv.base = base;
-
- return FromStringBase(source, conv, after_source, value_read);
- }
-
-
- /*!
- a method for converting a string into its value
- */
- uint FromString(const wchar_t * source, const Conv & conv, const wchar_t ** after_source = 0, bool * value_read = 0)
- {
- return FromStringBase(source, conv, after_source, value_read);
- }
-
-
- /*!
- a method for converting a string into its value
- */
- uint FromString(const std::wstring & string, uint base = 10, const wchar_t ** after_source = 0, bool * value_read = 0)
- {
- return FromString(string.c_str(), base, after_source, value_read);
- }
-
-
- /*!
- a method for converting a string into its value
- */
- uint FromString(const std::wstring & string, const Conv & conv, const wchar_t ** after_source = 0, bool * value_read = 0)
- {
- return FromString(string.c_str(), conv, after_source, value_read);
- }
-
-#endif
-
-
-private:
-
-
- /*!
- an auxiliary method for converting from a string
- */
- template<class char_type>
- uint FromStringBase(const char_type * source, const Conv & conv, const char_type ** after_source = 0, bool * value_read = 0)
- {
- bool is_sign;
- bool value_read_temp = false;
-
- if( conv.base<2 || conv.base>16 )
- {
- SetNan();
-
- if( after_source )
- *after_source = source;
-
- if( value_read )
- *value_read = value_read_temp;
-
- return 1;
- }
-
- SetZero();
- FromString_TestSign( source, is_sign );
-
- uint c = FromString_ReadPartBeforeComma( source, conv, value_read_temp );
-
- if( FromString_TestCommaOperator(source, conv) )
- c += FromString_ReadPartAfterComma( source, conv, value_read_temp );
-
- if( value_read_temp && conv.base == 10 )
- c += FromString_ReadScientificIfExists( source );
-
- if( is_sign && !IsZero() )
- ChangeSign();
-
- if( after_source )
- *after_source = source;
-
- if( value_read )
- *value_read = value_read_temp;
-
- return CheckCarry(c);
- }
-
-
- /*!
- we're testing whether the value is with the sign
-
- (this method is used from 'FromString_ReadPartScientific' too)
- */
- template<class char_type>
- void FromString_TestSign( const char_type * & source, bool & is_sign )
- {
- Misc::SkipWhiteCharacters(source);
-
- is_sign = false;
-
- if( *source == '-' )
- {
- is_sign = true;
- ++source;
- }
- else
- if( *source == '+' )
- {
- ++source;
- }
- }
-
-
- /*!
- we're testing whether there's a comma operator
- */
- template<class char_type>
- bool FromString_TestCommaOperator(const char_type * & source, const Conv & conv)
- {
- if( (*source == static_cast<char_type>(conv.comma)) ||
- (*source == static_cast<char_type>(conv.comma2) && conv.comma2 != 0 ) )
- {
- ++source;
-
- return true;
- }
-
- return false;
- }
-
-
- /*!
- this method reads the first part of a string
- (before the comma operator)
- */
- template<class char_type>
- uint FromString_ReadPartBeforeComma( const char_type * & source, const Conv & conv, bool & value_read )
- {
- sint character;
- Big<exp, man> temp;
- Big<exp, man> base_( conv.base );
-
- Misc::SkipWhiteCharacters( source );
-
- for( ; true ; ++source )
- {
- if( conv.group!=0 && *source==static_cast<char>(conv.group) )
- continue;
-
- character = Misc::CharToDigit(*source, conv.base);
-
- if( character == -1 )
- break;
-
- value_read = true;
- temp = character;
-
- if( Mul(base_) )
- return 1;
-
- if( Add(temp) )
- return 1;
- }
-
- return 0;
- }
-
-
- /*!
- this method reads the second part of a string
- (after the comma operator)
- */
- template<class char_type>
- uint FromString_ReadPartAfterComma( const char_type * & source, const Conv & conv, bool & value_read )
- {
- sint character;
- uint c = 0, index = 1;
- Big<exp, man> sum, part, power, old_value, base_( conv.base );
-
- // we don't remove any white characters here
-
- // this is only to avoid getting a warning about an uninitialized object 'old_value' which GCC reports
- // (in fact we will initialize it later when the condition 'testing' is fulfilled)
- old_value.SetZero();
-
- power.SetOne();
- sum.SetZero();
-
- for( ; true ; ++source, ++index )
- {
- if( conv.group!=0 && *source==static_cast<char>(conv.group) )
- continue;
-
- character = Misc::CharToDigit(*source, conv.base);
-
- if( character == -1 )
- break;
-
- value_read = true;
-
- part = character;
-
- if( power.Mul( base_ ) )
- // there's no sens to add the next parts, but we can't report this
- // as an error (this is only inaccuracy)
- break;
-
- if( part.Div( power ) )
- break;
-
- // every 5 iteration we make a test whether the value will be changed or not
- // (character must be different from zero to this test)
- bool testing = (character != 0 && (index % 5) == 0);
-
- if( testing )
- old_value = sum;
-
- // there actually shouldn't be a carry here
- c += sum.Add( part );
-
- if( testing && old_value == sum )
- // after adding 'part' the value has not been changed
- // there's no sense to add any next parts
- break;
- }
-
- // we could break the parsing somewhere in the middle of the string,
- // but the result (value) still can be good
- // we should set a correct value of 'source' now
- for( ; Misc::CharToDigit(*source, conv.base) != -1 ; ++source );
-
- c += Add(sum);
-
- return (c==0)? 0 : 1;
- }
-
-
- /*!
- this method checks whether there is a scientific part: [e|E][-|+]value
-
- it is called when the base is 10 and some digits were read before
- */
- template<class char_type>
- uint FromString_ReadScientificIfExists(const char_type * & source)
- {
- uint c = 0;
-
- bool scientific_read = false;
- const char_type * before_scientific = source;
-
- if( FromString_TestScientific(source) )
- c += FromString_ReadPartScientific( source, scientific_read );
-
- if( !scientific_read )
- source = before_scientific;
-
- return (c==0)? 0 : 1;
- }
-
-
-
- /*!
- we're testing whether is there the character 'e'
-
- this character is only allowed when we're using the base equals 10
- */
- template<class char_type>
- bool FromString_TestScientific(const char_type * & source)
- {
- Misc::SkipWhiteCharacters(source);
-
- if( *source=='e' || *source=='E' )
- {
- ++source;
-
- return true;
- }
-
- return false;
- }
-
-
- /*!
- this method reads the exponent (after 'e' character) when there's a scientific
- format of value and only when we're using the base equals 10
- */
- template<class char_type>
- uint FromString_ReadPartScientific( const char_type * & source, bool & scientific_read )
- {
- uint c = 0;
- Big<exp, man> new_exponent, temp;
- bool was_sign = false;
-
- FromString_TestSign( source, was_sign );
- c += FromString_ReadPartScientific_ReadExponent( source, new_exponent, scientific_read );
-
- if( scientific_read )
- {
- if( was_sign )
- new_exponent.ChangeSign();
-
- temp = 10;
- c += temp.Pow( new_exponent );
- c += Mul(temp);
- }
-
- return (c==0)? 0 : 1;
- }
-
-
- /*!
- this method reads the value of the extra exponent when scientific format is used
- (only when base == 10)
- */
- template<class char_type>
- uint FromString_ReadPartScientific_ReadExponent( const char_type * & source, Big<exp, man> & new_exponent, bool & scientific_read )
- {
- sint character;
- Big<exp, man> base, temp;
-
- Misc::SkipWhiteCharacters(source);
-
- new_exponent.SetZero();
- base = 10;
-
- for( ; (character=Misc::CharToDigit(*source, 10)) != -1 ; ++source )
- {
- scientific_read = true;
-
- temp = character;
-
- if( new_exponent.Mul(base) )
- return 1;
-
- if( new_exponent.Add(temp) )
- return 1;
- }
-
- return 0;
- }
-
-
-public:
-
-
- /*!
- a constructor for converting a string into this class
- */
- Big(const char * string)
- {
- FromString( string );
- }
-
-
- /*!
- a constructor for converting a string into this class
- */
- Big(const std::string & string)
- {
- FromString( string.c_str() );
- }
-
-
- /*!
- an operator= for converting a string into its value
- */
- Big<exp, man> & operator=(const char * string)
- {
- FromString( string );
-
- return *this;
- }
-
-
- /*!
- an operator= for converting a string into its value
- */
- Big<exp, man> & operator=(const std::string & string)
- {
- FromString( string.c_str() );
-
- return *this;
- }
-
-
-
-#ifndef TTMATH_DONT_USE_WCHAR
-
- /*!
- a constructor for converting a string into this class
- */
- Big(const wchar_t * string)
- {
- FromString( string );
- }
-
-
- /*!
- a constructor for converting a string into this class
- */
- Big(const std::wstring & string)
- {
- FromString( string.c_str() );
- }
-
-
- /*!
- an operator= for converting a string into its value
- */
- Big<exp, man> & operator=(const wchar_t * string)
- {
- FromString( string );
-
- return *this;
- }
-
-
- /*!
- an operator= for converting a string into its value
- */
- Big<exp, man> & operator=(const std::wstring & string)
- {
- FromString( string.c_str() );
-
- return *this;
- }
-
-
-#endif
-
-
-
- /*!
- *
- * methods for comparing
- *
- */
-
-
- /*!
- this method performs the formula 'abs(this) < abs(ss2)'
- and returns the result
-
- (in other words it treats 'this' and 'ss2' as values without a sign)
- we don't check the NaN flag
- */
- bool SmallerWithoutSignThan(const Big<exp,man> & ss2) const
- {
- if( IsZero() )
- {
- if( ss2.IsZero() )
- // we've got two zeroes
- return false;
- else
- // this==0 and ss2!=0
- return true;
- }
-
- if( ss2.IsZero() )
- // this!=0 and ss2==0
- return false;
-
- // we're using the fact that all bits in mantissa are pushed
- // into the left side -- Standardizing()
- if( exponent == ss2.exponent )
- return mantissa < ss2.mantissa;
-
- return exponent < ss2.exponent;
- }
-
-
- /*!
- this method performs the formula 'abs(this) > abs(ss2)'
- and returns the result
-
- (in other words it treats 'this' and 'ss2' as values without a sign)
- we don't check the NaN flag
- */
- bool GreaterWithoutSignThan(const Big<exp,man> & ss2) const
- {
- if( IsZero() )
- {
- if( ss2.IsZero() )
- // we've got two zeroes
- return false;
- else
- // this==0 and ss2!=0
- return false;
- }
-
- if( ss2.IsZero() )
- // this!=0 and ss2==0
- return true;
-
- // we're using the fact that all bits in mantissa are pushed
- // into the left side -- Standardizing()
- if( exponent == ss2.exponent )
- return mantissa > ss2.mantissa;
-
- return exponent > ss2.exponent;
- }
-
-
- /*!
- this method performs the formula 'abs(this) == abs(ss2)'
- and returns the result
-
- (in other words it treats 'this' and 'ss2' as values without a sign)
- we don't check the NaN flag
- */
- bool EqualWithoutSign(const Big<exp,man> & ss2) const
- {
- if( IsZero() )
- {
- if( ss2.IsZero() )
- // we've got two zeroes
- return true;
- else
- // this==0 and ss2!=0
- return false;
- }
-
- if( ss2.IsZero() )
- // this!=0 and ss2==0
- return false;
-
- if( exponent==ss2.exponent && mantissa==ss2.mantissa )
- return true;
-
- return false;
- }
-
-
- bool operator<(const Big<exp,man> & ss2) const
- {
- if( IsSign() && !ss2.IsSign() )
- // this<0 and ss2>=0
- return true;
-
- if( !IsSign() && ss2.IsSign() )
- // this>=0 and ss2<0
- return false;
-
- // both signs are the same
-
- if( IsSign() )
- return ss2.SmallerWithoutSignThan( *this );
-
- return SmallerWithoutSignThan( ss2 );
- }
-
-
- bool operator==(const Big<exp,man> & ss2) const
- {
- if( IsSign() != ss2.IsSign() )
- return false;
-
- return EqualWithoutSign( ss2 );
- }
-
-
- bool operator>(const Big<exp,man> & ss2) const
- {
- if( IsSign() && !ss2.IsSign() )
- // this<0 and ss2>=0
- return false;
-
- if( !IsSign() && ss2.IsSign() )
- // this>=0 and ss2<0
- return true;
-
- // both signs are the same
-
- if( IsSign() )
- return ss2.GreaterWithoutSignThan( *this );
-
- return GreaterWithoutSignThan( ss2 );
- }
-
-
- bool operator>=(const Big<exp,man> & ss2) const
- {
- return !operator<( ss2 );
- }
-
-
- bool operator<=(const Big<exp,man> & ss2) const
- {
- return !operator>( ss2 );
- }
-
-
- bool operator!=(const Big<exp,man> & ss2) const
- {
- return !operator==(ss2);
- }
-
-
-
-
-
- /*!
- *
- * standard mathematical operators
- *
- */
-
-
- /*!
- an operator for changing the sign
-
- this method is not changing 'this' but the changed value is returned
- */
- Big<exp,man> operator-() const
- {
- Big<exp,man> temp(*this);
-
- temp.ChangeSign();
-
- return temp;
- }
-
-
- Big<exp,man> operator-(const Big<exp,man> & ss2) const
- {
- Big<exp,man> temp(*this);
-
- temp.Sub(ss2);
-
- return temp;
- }
-
- Big<exp,man> & operator-=(const Big<exp,man> & ss2)
- {
- Sub(ss2);
-
- return *this;
- }
-
-
- Big<exp,man> operator+(const Big<exp,man> & ss2) const
- {
- Big<exp,man> temp(*this);
-
- temp.Add(ss2);
-
- return temp;
- }
-
-
- Big<exp,man> & operator+=(const Big<exp,man> & ss2)
- {
- Add(ss2);
-
- return *this;
- }
-
-
- Big<exp,man> operator*(const Big<exp,man> & ss2) const
- {
- Big<exp,man> temp(*this);
-
- temp.Mul(ss2);
-
- return temp;
- }
-
-
- Big<exp,man> & operator*=(const Big<exp,man> & ss2)
- {
- Mul(ss2);
-
- return *this;
- }
-
-
- Big<exp,man> operator/(const Big<exp,man> & ss2) const
- {
- Big<exp,man> temp(*this);
-
- temp.Div(ss2);
-
- return temp;
- }
-
-
- Big<exp,man> & operator/=(const Big<exp,man> & ss2)
- {
- Div(ss2);
-
- return *this;
- }
-
-
- /*!
- Prefix operator e.g ++variable
- */
- Big<exp,man> & operator++()
- {
- AddOne();
-
- return *this;
- }
-
-
- /*!
- Postfix operator e.g variable++
- */
- Big<exp,man> operator++(int)
- {
- Big<exp,man> temp( *this );
-
- AddOne();
-
- return temp;
- }
-
-
- Big<exp,man> & operator--()
- {
- SubOne();
-
- return *this;
- }
-
-
- Big<exp,man> operator--(int)
- {
- Big<exp,man> temp( *this );
-
- SubOne();
-
- return temp;
- }
-
-
-
- /*!
- *
- * bitwise operators
- * (we do not define bitwise not)
- */
-
-
- Big<exp,man> operator&(const Big<exp,man> & p2) const
- {
- Big<exp,man> temp( *this );
-
- temp.BitAnd(p2);
-
- return temp;
- }
-
-
- Big<exp,man> & operator&=(const Big<exp,man> & p2)
- {
- BitAnd(p2);
-
- return *this;
- }
-
-
- Big<exp,man> operator|(const Big<exp,man> & p2) const
- {
- Big<exp,man> temp( *this );
-
- temp.BitOr(p2);
-
- return temp;
- }
-
-
- Big<exp,man> & operator|=(const Big<exp,man> & p2)
- {
- BitOr(p2);
-
- return *this;
- }
-
-
- Big<exp,man> operator^(const Big<exp,man> & p2) const
- {
- Big<exp,man> temp( *this );
-
- temp.BitXor(p2);
-
- return temp;
- }
-
-
- Big<exp,man> & operator^=(const Big<exp,man> & p2)
- {
- BitXor(p2);
-
- return *this;
- }
-
-
-
-
-
-
- /*!
- this method makes an integer value by skipping any fractions
-
- for example:
- 10.7 will be 10
- 12.1 -- 12
- -20.2 -- 20
- -20.9 -- 20
- -0.7 -- 0
- 0.8 -- 0
- */
- void SkipFraction()
- {
- if( IsNan() || IsZero() )
- return;
-
- if( !exponent.IsSign() )
- // exponent >=0 -- the value don't have any fractions
- return;
-
- if( exponent <= -sint(man*TTMATH_BITS_PER_UINT) )
- {
- // the value is from (-1,1), we return zero
- SetZero();
- return;
- }
-
- // exponent is in range (-man*TTMATH_BITS_PER_UINT, 0)
- sint e = exponent.ToInt();
-
- mantissa.ClearFirstBits( -e );
-
- // we don't have to standardize 'Standardizing()' the value because
- // there's at least one bit in the mantissa
- // (the highest bit which we didn't touch)
- }
-
-
- /*!
- this method remains only a fraction from the value
-
- for example:
- 30.56 will be 0.56
- -12.67 -- -0.67
- */
- void RemainFraction()
- {
- if( IsNan() || IsZero() )
- return;
-
- if( !exponent.IsSign() )
- {
- // exponent >= 0 -- the value doesn't have any fractions
- // we return zero
- SetZero();
- return;
- }
-
- if( exponent <= -sint(man*TTMATH_BITS_PER_UINT) )
- {
- // the value is from (-1,1)
- // we don't make anything with the value
- return;
- }
-
- // e will be from (-man*TTMATH_BITS_PER_UINT, 0)
- sint e = exponent.ToInt();
-
- sint how_many_bits_leave = sint(man*TTMATH_BITS_PER_UINT) + e; // there'll be a subtraction -- e is negative
- mantissa.Rcl( how_many_bits_leave, 0);
-
- // there'll not be a carry because the exponent is too small
- exponent.Sub( how_many_bits_leave );
-
- // we must call Standardizing() here
- Standardizing();
- }
-
-
-
- /*!
- this method returns true if the value is integer
- (there is no a fraction)
-
- (we don't check nan)
- */
- bool IsInteger() const
- {
- if( IsZero() )
- return true;
-
- if( !exponent.IsSign() )
- // exponent >=0 -- the value don't have any fractions
- return true;
-
- if( exponent <= -sint(man*TTMATH_BITS_PER_UINT) )
- // the value is from (-1,1)
- return false;
-
- // exponent is in range (-man*TTMATH_BITS_PER_UINT, 0)
- sint e = exponent.ToInt();
- e = -e; // e means how many bits we must check
-
- uint len = e / TTMATH_BITS_PER_UINT;
- uint rest = e % TTMATH_BITS_PER_UINT;
- uint i = 0;
-
- for( ; i<len ; ++i )
- if( mantissa.table[i] != 0 )
- return false;
-
- if( rest > 0 )
- {
- uint rest_mask = TTMATH_UINT_MAX_VALUE >> (TTMATH_BITS_PER_UINT - rest);
- if( (mantissa.table[i] & rest_mask) != 0 )
- return false;
- }
-
- return true;
- }
-
-
- /*!
- this method rounds to the nearest integer value
- (it returns a carry if it was)
-
- for example:
- 2.3 = 2
- 2.8 = 3
-
- -2.3 = -2
- -2.8 = 3
- */
- uint Round()
- {
- Big<exp,man> half;
- uint c;
-
- if( IsNan() )
- return 1;
-
- if( IsZero() )
- return 0;
-
- half.Set05();
-
- if( IsSign() )
- {
- // 'this' is < 0
- c = Sub( half );
- }
- else
- {
- // 'this' is > 0
- c = Add( half );
- }
-
- SkipFraction();
-
- return CheckCarry(c);
- }
-
-
-
- /*!
- *
- * input/output operators for standard streams
- *
- */
-
-private:
-
- /*!
- an auxiliary method for outputing to standard streams
- */
- template<class ostream_type, class string_type>
- static ostream_type & OutputToStream(ostream_type & s, const Big<exp,man> & l)
- {
- string_type ss;
-
- l.ToString(ss);
- s << ss;
-
- return s;
- }
-
-
-public:
-
-
- /*!
- output to standard streams
- */
- friend std::ostream & operator<<(std::ostream & s, const Big<exp,man> & l)
- {
- return OutputToStream<std::ostream, std::string>(s, l);
- }
-
-
-#ifndef TTMATH_DONT_USE_WCHAR
-
- /*!
- output to standard streams
- */
- friend std::wostream & operator<<(std::wostream & s, const Big<exp,man> & l)
- {
- return OutputToStream<std::wostream, std::wstring>(s, l);
- }
-
-#endif
-
-
-
-private:
-
- /*!
- an auxiliary method for converting from a string
- */
- template<class istream_type, class string_type, class char_type>
- static istream_type & InputFromStream(istream_type & s, Big<exp,man> & l)
- {
- string_type ss;
-
- // char or wchar_t for operator>>
- char_type z, old_z;
- bool was_comma = false;
- bool was_e = false;
-
-
- // operator>> omits white characters if they're set for ommiting
- s >> z;
-
- if( z=='-' || z=='+' )
- {
- ss += z;
- s >> z; // we're reading a next character (white characters can be ommited)
- }
-
- old_z = 0;
-
- // we're reading only digits (base=10) and only one comma operator
- for( ; s.good() ; z=static_cast<char_type>(s.get()) )
- {
- if( z=='.' || z==',' )
- {
- if( was_comma || was_e )
- // second comma operator or comma operator after 'e' character
- break;
-
- was_comma = true;
- }
- else
- if( z == 'e' || z == 'E' )
- {
- if( was_e )
- // second 'e' character
- break;
-
- was_e = true;
- }
- else
- if( z == '+' || z == '-' )
- {
- if( old_z != 'e' && old_z != 'E' )
- // '+' or '-' is allowed only after 'e' character
- break;
- }
- else
- if( Misc::CharToDigit(z, 10) < 0 )
- break;
-
-
- ss += z;
- old_z = z;
- }
-
- // we're leaving the last read character
- // (it's not belonging to the value)
- s.unget();
-
- l.FromString( ss );
-
- return s;
- }
-
-
-
-public:
-
- /*!
- input from standard streams
- */
- friend std::istream & operator>>(std::istream & s, Big<exp,man> & l)
- {
- return InputFromStream<std::istream, std::string, char>(s, l);
- }
-
-
-#ifndef TTMATH_DONT_USE_WCHAR
-
- /*!
- input from standard streams
- */
- friend std::wistream & operator>>(std::wistream & s, Big<exp,man> & l)
- {
- return InputFromStream<std::wistream, std::wstring, wchar_t>(s, l);
- }
-
-#endif
-
-};
-
-
-} // namespace
-
-#endif
diff --git a/ttmath/ttmathint.h b/ttmath/ttmathint.h
deleted file mode 100644
index abc9c28..0000000
--- a/ttmath/ttmathint.h
+++ /dev/null
@@ -1,1924 +0,0 @@
-/*
- * This file is a part of TTMath Bignum Library
- * and is distributed under the (new) BSD licence.
- * Author: Tomasz Sowa <t.sowa at ttmath.org>
- */
-
-/*
- * Copyright (c) 2006-2010, Tomasz Sowa
- * All rights reserved.
- *
- * Redistribution and use in source and binary forms, with or without
- * modification, are permitted provided that the following conditions are met:
- *
- * * Redistributions of source code must retain the above copyright notice,
- * this list of conditions and the following disclaimer.
- *
- * * Redistributions in binary form must reproduce the above copyright
- * notice, this list of conditions and the following disclaimer in the
- * documentation and/or other materials provided with the distribution.
- *
- * * Neither the name Tomasz Sowa nor the names of contributors to this
- * project may be used to endorse or promote products derived
- * from this software without specific prior written permission.
- *
- * THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS"
- * AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
- * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- * ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE
- * LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR
- * CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF
- * SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS
- * INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN
- * CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
- * ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF
- * THE POSSIBILITY OF SUCH DAMAGE.
- */
-
-
-
-#ifndef headerfilettmathint
-#define headerfilettmathint
-
-/*!
- \file ttmathint.h
- \brief template class Int<uint>
-*/
-
-#include "ttmathuint.h"
-
-namespace ttmath
-{
-
-
-/*!
- \brief Int implements a big integer value with a sign
-
- value_size - how many bytes specify our value
- on 32bit platforms: value_size=1 -> 4 bytes -> 32 bits
- on 64bit platforms: value_size=1 -> 8 bytes -> 64 bits
- value_size = 1,2,3,4,5,6....
-*/
-template<uint value_size>
-class Int : public UInt<value_size>
-{
-public:
-
- /*!
- this method sets the max value which this class can hold
- (all bits will be one besides the last one)
- */
- void SetMax()
- {
- UInt<value_size>::SetMax();
- UInt<value_size>::table[value_size-1] = ~ TTMATH_UINT_HIGHEST_BIT;
- }
-
-
- /*!
- this method sets the min value which this class can hold
- (all bits will be zero besides the last one which is one)
- */
- void SetMin()
- {
- UInt<value_size>::SetZero();
- UInt<value_size>::table[value_size-1] = TTMATH_UINT_HIGHEST_BIT;
- }
-
-
- /*!
- this method sets -1 as the value
- (-1 is equal the max value in an unsigned type)
- */
- void SetSignOne()
- {
- UInt<value_size>::SetMax();
- }
-
-
- /*!
- we change the sign of the value
-
- if it isn't possible to change the sign this method returns 1
- else return 0 and changing the sign
- */
- uint ChangeSign()
- {
- /*
- if the value is equal that one which has been returned from SetMin
- (only the highest bit is set) that means we can't change sign
- because the value is too big (bigger about one)
-
- e.g. when value_size = 1 and value is -2147483648 we can't change it to the
- 2147483648 because the max value which can be held is 2147483647
-
- we don't change the value and we're using this fact somewhere in some methods
- (if we look on our value without the sign we get the correct value
- eg. -2147483648 in Int<1> will be 2147483648 on the UInt<1> type)
- */
- if( UInt<value_size>::IsOnlyTheHighestBitSet() )
- return 1;
-
- UInt<value_size> temp(*this);
- UInt<value_size>::SetZero();
- UInt<value_size>::Sub(temp);
-
- return 0;
- }
-
-
-
- /*!
- this method sets the sign
-
- e.g. 1 -> -1
- -2 -> -2
-
- from a positive value we make a negative value,
- if the value is negative we do nothing
- */
- void SetSign()
- {
- if( IsSign() )
- return;
-
- ChangeSign();
- }
-
-
-
- /*!
- this method returns true if there's the sign
-
- (the highest bit will be converted to the bool)
- */
- bool IsSign() const
- {
- return UInt<value_size>::IsTheHighestBitSet();
- }
-
-
-
- /*!
- it sets an absolute value
-
- it can return carry (1) (look on ChangeSign() for details)
- */
- uint Abs()
- {
- if( !IsSign() )
- return 0;
-
- return ChangeSign();
- }
-
-
-
-
- /*!
- *
- * basic mathematic functions
- *
- */
-
-private:
-
- uint CorrectCarryAfterAdding(bool p1_is_sign, bool p2_is_sign)
- {
- if( !p1_is_sign && !p2_is_sign )
- {
- if( UInt<value_size>::IsTheHighestBitSet() )
- return 1;
- }
-
- if( p1_is_sign && p2_is_sign )
- {
- if( ! UInt<value_size>::IsTheHighestBitSet() )
- return 1;
- }
-
- return 0;
- }
-
-
-public:
-
- /*!
- this method adds two value with a sign and returns a carry
-
- we're using methods from the base class because values are stored with U2
- we must only make the carry correction
-
- this = p1(=this) + p2
-
- when p1>=0 i p2>=0 carry is set when the highest bit of value is set
- when p1<0 i p2<0 carry is set when the highest bit of value is clear
- when p1>=0 i p2<0 carry will never be set
- when p1<0 i p2>=0 carry will never be set
- */
- uint Add(const Int<value_size> & ss2)
- {
- bool p1_is_sign = IsSign();
- bool p2_is_sign = ss2.IsSign();
-
- UInt<value_size>::Add(ss2);
-
- return CorrectCarryAfterAdding(p1_is_sign, p2_is_sign);
- }
-
-
- /*!
- this method adds one *unsigned* word (at a specific position)
- and returns a carry (if it was)
-
- look at a description in UInt<>::AddInt(...)
- */
- uint AddInt(uint value, uint index = 0)
- {
- bool p1_is_sign = IsSign();
-
- UInt<value_size>::AddInt(value, index);
-
- return CorrectCarryAfterAdding(p1_is_sign, false);
- }
-
-
- /*!
- this method adds two *unsigned* words to the existing value
- and these words begin on the 'index' position
-
- index should be equal or smaller than value_size-2 (index <= value_size-2)
- x1 - lower word, x2 - higher word
-
- look at a description in UInt<>::AddTwoInts(...)
- */
- uint AddTwoInts(uint x2, uint x1, uint index)
- {
- bool p1_is_sign = IsSign();
-
- UInt<value_size>::AddTwoInts(x2, x1, index);
-
- return CorrectCarryAfterAdding(p1_is_sign, false);
- }
-
-private:
-
- uint CorrectCarryAfterSubtracting(bool p1_is_sign, bool p2_is_sign)
- {
- if( !p1_is_sign && p2_is_sign )
- {
- if( UInt<value_size>::IsTheHighestBitSet() )
- return 1;
- }
-
- if( p1_is_sign && !p2_is_sign )
- {
- if( ! UInt<value_size>::IsTheHighestBitSet() )
- return 1;
- }
-
- return 0;
- }
-
-public:
-
- /*!
- this method subtracts two values with a sign
-
- we don't use the previous Add because the method ChangeSign can
- sometimes return carry
-
- this = p1(=this) - p2
-
- when p1>=0 i p2>=0 carry will never be set
- when p1<0 i p2<0 carry will never be set
- when p1>=0 i p2<0 carry is set when the highest bit of value is set
- when p1<0 i p2>=0 carry is set when the highest bit of value is clear
- */
- uint Sub(const Int<value_size> & ss2)
- {
- bool p1_is_sign = IsSign();
- bool p2_is_sign = ss2.IsSign();
-
- UInt<value_size>::Sub(ss2);
-
- return CorrectCarryAfterSubtracting(p1_is_sign, p2_is_sign);
- }
-
-
- /*!
- this method subtracts one *unsigned* word (at a specific position)
- and returns a carry (if it was)
- */
- uint SubInt(uint value, uint index = 0)
- {
- bool p1_is_sign = IsSign();
-
- UInt<value_size>::SubInt(value, index);
-
- return CorrectCarryAfterSubtracting(p1_is_sign, false);
- }
-
-
- /*!
- this method adds one to the value and returns carry
- */
- uint AddOne()
- {
- bool p1_is_sign = IsSign();
-
- UInt<value_size>::AddOne();
-
- return CorrectCarryAfterAdding(p1_is_sign, false);
- }
-
-
- /*!
- this method subtracts one from the value and returns carry
- */
- uint SubOne()
- {
- bool p1_is_sign = IsSign();
-
- UInt<value_size>::SubOne();
-
- return CorrectCarryAfterSubtracting(p1_is_sign, false);
- }
-
-
-private:
-
-
- uint CheckMinCarry(bool ss1_is_sign, bool ss2_is_sign)
- {
- /*
- we have to examine the sign of the result now
- but if the result is with the sign then:
- 1. if the signs were the same that means the result is too big
- (the result must be without a sign)
- 2. if the signs were different that means if the result
- is different from that one which has been returned from SetMin()
- that is carry (result too big) but if the result is equal SetMin()
- there'll be ok (and the next SetSign will has no effect because
- the value is actually negative -- look at description of that case
- in ChangeSign())
- */
- if( IsSign() )
- {
- if( ss1_is_sign != ss2_is_sign )
- {
- /*
- there can be one case where signs are different and
- the result will be equal the value from SetMin() (only the highest bit is set)
- (this situation is ok)
- */
- if( !UInt<value_size>::IsOnlyTheHighestBitSet() )
- return 1;
- }
- else
- {
- // signs were the same
- return 1;
- }
- }
-
- return 0;
- }
-
-
-public:
-
-
- /*!
- multiplication: this = this * ss2
-
- it can return a carry
- */
- uint MulInt(sint ss2)
- {
- bool ss1_is_sign, ss2_is_sign;
- uint c;
-
- ss1_is_sign = IsSign();
-
- /*
- we don't have to check the carry from Abs (values will be correct
- because next we're using the method MulInt from the base class UInt
- which is without a sign)
- */
- Abs();
-
- if( ss2 < 0 )
- {
- ss2 = -ss2;
- ss2_is_sign = true;
- }
- else
- {
- ss2_is_sign = false;
- }
-
- c = UInt<value_size>::MulInt((uint)ss2);
- c += CheckMinCarry(ss1_is_sign, ss2_is_sign);
-
- if( ss1_is_sign != ss2_is_sign )
- SetSign();
-
- return c;
- }
-
-
-
- /*!
- multiplication this = this * ss2
-
- it returns carry if the result is too big
- (we're using the method from the base class but we have to make
- one correction in account of signs)
- */
- uint Mul(Int<value_size> ss2)
- {
- bool ss1_is_sign, ss2_is_sign;
- uint c;
-
- ss1_is_sign = IsSign();
- ss2_is_sign = ss2.IsSign();
-
- /*
- we don't have to check the carry from Abs (values will be correct
- because next we're using the method Mul from the base class UInt
- which is without a sign)
- */
- Abs();
- ss2.Abs();
-
- c = UInt<value_size>::Mul(ss2);
- c += CheckMinCarry(ss1_is_sign, ss2_is_sign);
-
- if( ss1_is_sign != ss2_is_sign )
- SetSign();
-
- return c;
- }
-
-
- /*!
- division this = this / ss2
- returned values:
- 0 - ok
- 1 - division by zero
-
- for example: (result means 'this')
- 20 / 3 --> result: 6 remainder: 2
- -20 / 3 --> result: -6 remainder: -2
- 20 / -3 --> result: -6 remainder: 2
- -20 / -3 --> result: 6 remainder: -2
-
- in other words: this(old) = ss2 * this(new)(result) + remainder
- */
- uint Div(Int<value_size> ss2, Int<value_size> * remainder = 0)
- {
- bool ss1_is_sign, ss2_is_sign;
-
- ss1_is_sign = IsSign();
- ss2_is_sign = ss2.IsSign();
-
- /*
- we don't have to test the carry from Abs as well as in Mul
- */
- Abs();
- ss2.Abs();
-
- uint c = UInt<value_size>::Div(ss2, remainder);
-
- if( ss1_is_sign != ss2_is_sign )
- SetSign();
-
- if( ss1_is_sign && remainder )
- remainder->SetSign();
-
- return c;
- }
-
- uint Div(const Int<value_size> & ss2, Int<value_size> & remainder)
- {
- return Div(ss2, &remainder);
- }
-
-
- /*!
- division this = this / ss2 (ss2 is int)
- returned values:
- 0 - ok
- 1 - division by zero
-
- for example: (result means 'this')
- 20 / 3 --> result: 6 remainder: 2
- -20 / 3 --> result: -6 remainder: -2
- 20 / -3 --> result: -6 remainder: 2
- -20 / -3 --> result: 6 remainder: -2
-
- in other words: this(old) = ss2 * this(new)(result) + remainder
- */
- uint DivInt(sint ss2, sint * remainder = 0)
- {
- bool ss1_is_sign, ss2_is_sign;
-
- ss1_is_sign = IsSign();
-
- /*
- we don't have to test the carry from Abs as well as in Mul
- */
- Abs();
-
- if( ss2 < 0 )
- {
- ss2 = -ss2;
- ss2_is_sign = true;
- }
- else
- {
- ss2_is_sign = false;
- }
-
- uint rem;
- uint c = UInt<value_size>::DivInt((uint)ss2, &rem);
-
- if( ss1_is_sign != ss2_is_sign )
- SetSign();
-
- if( remainder )
- {
- if( ss1_is_sign )
- *remainder = -sint(rem);
- else
- *remainder = sint(rem);
- }
-
- return c;
- }
-
-
- uint DivInt(sint ss2, sint & remainder)
- {
- return DivInt(ss2, &remainder);
- }
-
-
-private:
-
-
- /*!
- power this = this ^ pow
- this can be negative
- pow is >= 0
- */
- uint Pow2(const Int<value_size> & pow)
- {
- bool was_sign = IsSign();
- uint c = 0;
-
- if( was_sign )
- c += Abs();
-
- uint c_temp = UInt<value_size>::Pow(pow);
- if( c_temp > 0 )
- return c_temp; // c_temp can be: 0, 1 or 2
-
- if( was_sign && (pow.table[0] & 1) == 1 )
- // negative value to the power of odd number is negative
- c += ChangeSign();
-
- return (c==0)? 0 : 1;
- }
-
-
-public:
-
-
- /*!
- power this = this ^ pow
-
- return values:
- 0 - ok
- 1 - carry
- 2 - incorrect arguments 0^0 or 0^(-something)
- */
- uint Pow(Int<value_size> pow)
- {
- if( !pow.IsSign() )
- return Pow2(pow);
-
- if( UInt<value_size>::IsZero() )
- // if 'pow' is negative then
- // 'this' must be different from zero
- return 2;
-
- if( pow.ChangeSign() )
- return 1;
-
- Int<value_size> t(*this);
- uint c_temp = t.Pow2(pow);
- if( c_temp > 0 )
- return c_temp;
-
- UInt<value_size>::SetOne();
- if( Div(t) )
- return 1;
-
- return 0;
- }
-
-
-
- /*!
- *
- * convertion methods
- *
- */
-private:
-
-
- /*!
- an auxiliary method for converting both from UInt and Int
- */
- template<uint argument_size>
- uint FromUIntOrInt(const UInt<argument_size> & p, bool UInt_type)
- {
- uint min_size = (value_size < argument_size)? value_size : argument_size;
- uint i;
-
- for(i=0 ; i<min_size ; ++i)
- UInt<value_size>::table[i] = p.table[i];
-
-
- if( value_size > argument_size )
- {
- uint fill;
-
- if( UInt_type )
- fill = 0;
- else
- fill = (p.table[argument_size-1] & TTMATH_UINT_HIGHEST_BIT)?
- TTMATH_UINT_MAX_VALUE : 0;
-
- // 'this' is longer than 'p'
- for( ; i<value_size ; ++i)
- UInt<value_size>::table[i] = fill;
- }
- else
- {
- uint test = (UInt<value_size>::table[value_size-1] & TTMATH_UINT_HIGHEST_BIT)?
- TTMATH_UINT_MAX_VALUE : 0;
-
- if( UInt_type && test!=0 )
- return 1;
-
- for( ; i<argument_size ; ++i)
- if( p.table[i] != test )
- return 1;
- }
-
- return 0;
- }
-
-public:
-
- /*!
- this method converts an Int<another_size> type into this class
-
- this operation has mainly sense if the value from p
- can be held in this type
-
- it returns a carry if the value 'p' is too big
- */
- template<uint argument_size>
- uint FromInt(const Int<argument_size> & p)
- {
- return FromUIntOrInt(p, false);
- }
-
-
- /*!
- this method converts the sint type into this class
- */
- uint FromInt(sint value)
- {
- uint fill = ( value<0 ) ? TTMATH_UINT_MAX_VALUE : 0;
-
- for(uint i=1 ; i<value_size ; ++i)
- UInt<value_size>::table[i] = fill;
-
- UInt<value_size>::table[0] = uint(value);
-
- // there'll never be a carry here
- return 0;
- }
-
-
- /*!
- this method converts UInt<another_size> into this class
- */
- template<uint argument_size>
- uint FromUInt(const UInt<argument_size> & p)
- {
- return FromUIntOrInt(p, true);
- }
-
-
- /*!
- this method converts UInt<another_size> into this class
- */
- template<uint argument_size>
- uint FromInt(const UInt<argument_size> & p)
- {
- return FromUIntOrInt(p, true);
- }
-
-
- /*!
- this method converts the uint type into this class
- */
- uint FromUInt(uint value)
- {
- for(uint i=1 ; i<value_size ; ++i)
- UInt<value_size>::table[i] = 0;
-
- UInt<value_size>::table[0] = value;
-
- // there can be a carry here when the size of this value is equal one word
- // and the 'value' has the highest bit set
- if( value_size==1 && (value & TTMATH_UINT_HIGHEST_BIT)!=0 )
- return 1;
-
- return 0;
- }
-
-
- /*!
- this method converts the uint type into this class
- */
- uint FromInt(uint value)
- {
- return FromUInt(value);
- }
-
-
- /*!
- the default assignment operator
- */
- Int<value_size> & operator=(const Int<value_size> & p)
- {
- FromInt(p);
-
- return *this;
- }
-
-
- /*!
- this operator converts an Int<another_size> type to this class
-
- it doesn't return a carry
- */
- template<uint argument_size>
- Int<value_size> & operator=(const Int<argument_size> & p)
- {
- FromInt(p);
-
- return *this;
- }
-
-
- /*!
- this method converts the sint type to this class
- */
- Int<value_size> & operator=(sint i)
- {
- FromInt(i);
-
- return *this;
- }
-
-
- /*!
- a constructor for converting the uint to this class
- */
- Int(sint i)
- {
- FromInt(i);
- }
-
-
- /*!
- a copy constructor
- */
- Int(const Int<value_size> & u)
- {
- FromInt(u);
- }
-
-
- /*!
- a constructor for copying from another types
- */
- template<uint argument_size>
- Int(const Int<argument_size> & u)
- {
- // look that 'size' we still set as 'value_size' and not as u.value_size
- FromInt(u);
- }
-
-
-
- /*!
- this operator converts an UInt<another_size> type to this class
-
- it doesn't return a carry
- */
- template<uint argument_size>
- Int<value_size> & operator=(const UInt<argument_size> & p)
- {
- FromUInt(p);
-
- return *this;
- }
-
-
- /*!
- this method converts the Uint type to this class
- */
- Int<value_size> & operator=(uint i)
- {
- FromUInt(i);
-
- return *this;
- }
-
-
- /*!
- a constructor for converting the uint to this class
- */
- Int(uint i)
- {
- FromUInt(i);
- }
-
-
- /*!
- a constructor for copying from another types
- */
- template<uint argument_size>
- Int(const UInt<argument_size> & u)
- {
- // look that 'size' we still set as 'value_size' and not as u.value_size
- FromUInt(u);
- }
-
-
-
-#ifdef TTMATH_PLATFORM32
-
-
- /*!
- this method converts unsigned 64 bit int type to this class
- ***this method is created only on a 32bit platform***
- */
- uint FromUInt(ulint n)
- {
- uint c = UInt<value_size>::FromUInt(n);
-
- if( c )
- return 1;
-
- if( value_size == 1 )
- return ((UInt<value_size>::table[0] & TTMATH_UINT_HIGHEST_BIT) == 0) ? 0 : 1;
-
- if( value_size == 2 )
- return ((UInt<value_size>::table[1] & TTMATH_UINT_HIGHEST_BIT) == 0) ? 0 : 1;
-
- return 0;
- }
-
-
- /*!
- this method converts unsigned 64 bit int type to this class
- ***this method is created only on a 32bit platform***
- */
- uint FromInt(ulint n)
- {
- return FromUInt(n);
- }
-
-
- /*!
- this method converts signed 64 bit int type to this class
- ***this method is created only on a 32bit platform***
- */
- uint FromInt(slint n)
- {
- uint mask = (n < 0) ? TTMATH_UINT_MAX_VALUE : 0;
-
- UInt<value_size>::table[0] = (uint)(ulint)n;
-
- if( value_size == 1 )
- {
- if( uint(ulint(n) >> 32) != mask )
- return 1;
-
- return ((UInt<value_size>::table[0] & TTMATH_UINT_HIGHEST_BIT) == (mask & TTMATH_UINT_HIGHEST_BIT)) ? 0 : 1;
- }
-
- UInt<value_size>::table[1] = (uint)(ulint(n) >> 32);
-
- for(uint i=2 ; i<value_size ; ++i)
- UInt<value_size>::table[i] = mask;
-
- return 0;
- }
-
-
- /*!
- this operator converts unsigned 64 bit int type to this class
- ***this operator is created only on a 32bit platform***
- */
- Int<value_size> & operator=(ulint n)
- {
- FromUInt(n);
-
- return *this;
- }
-
-
- /*!
- a constructor for converting unsigned 64 bit int to this class
- ***this constructor is created only on a 32bit platform***
- */
- Int(ulint n)
- {
- FromUInt(n);
- }
-
-
- /*!
- this operator converts signed 64 bit int type to this class
- ***this operator is created only on a 32bit platform***
- */
- Int<value_size> & operator=(slint n)
- {
- FromInt(n);
-
- return *this;
- }
-
-
- /*!
- a constructor for converting signed 64 bit int to this class
- ***this constructor is created only on a 32bit platform***
- */
- Int(slint n)
- {
- FromInt(n);
- }
-
-#endif
-
-
-
-
-#ifdef TTMATH_PLATFORM64
-
- /*!
- this method converts 32 bit unsigned int type to this class
- ***this operator is created only on a 64bit platform***
- */
- uint FromUInt(unsigned int i)
- {
- return FromUInt(uint(i));
- }
-
-
- /*!
- this method converts 32 bit unsigned int type to this class
- ***this operator is created only on a 64bit platform***
- */
- uint FromInt(unsigned int i)
- {
- return FromUInt(i);
- }
-
-
- /*!
- this method converts 32 bit signed int type to this class
- ***this operator is created only on a 64bit platform***
- */
- uint FromInt(signed int i)
- {
- return FromInt(sint(i));
- }
-
-
- /*!
- this method converts 32 bit unsigned int type to this class
- ***this operator is created only on a 64bit platform***
- */
- Int<value_size> & operator=(unsigned int i)
- {
- FromUInt(i);
-
- return *this;
- }
-
-
- /*!
- a constructor for converting 32 bit unsigned int to this class
- ***this constructor is created only on a 64bit platform***
- */
- Int(unsigned int i)
- {
- FromUInt(i);
- }
-
-
- /*!
- this operator converts 32 bit signed int type to this class
- ***this operator is created only on a 64bit platform***
- */
- Int<value_size> & operator=(signed int i)
- {
- FromInt(i);
-
- return *this;
- }
-
-
- /*!
- a constructor for converting 32 bit signed int to this class
- ***this constructor is created only on a 64bit platform***
- */
- Int(signed int i)
- {
- FromInt(i);
- }
-
-#endif
-
-
-
- /*!
- a constructor for converting string to this class (with the base=10)
- */
- Int(const char * s)
- {
- FromString(s);
- }
-
-
- /*!
- a constructor for converting a string to this class (with the base=10)
- */
- Int(const std::string & s)
- {
- FromString( s.c_str() );
- }
-
-
-#ifndef TTMATH_DONT_USE_WCHAR
-
- /*!
- a constructor for converting string to this class (with the base=10)
- */
- Int(const wchar_t * s)
- {
- FromString(s);
- }
-
-
- /*!
- a constructor for converting a string to this class (with the base=10)
- */
- Int(const std::wstring & s)
- {
- FromString( s.c_str() );
- }
-
-#endif
-
-
- /*!
- a default constructor
-
- we don't clear table etc.
- */
- Int()
- {
- }
-
-
- /*!
- the destructor
- */
- ~Int()
- {
- }
-
-
- /*!
- this method returns the lowest value from table with a sign
-
- we must be sure when we using this method whether the value
- will hold in an sint type or not (the rest value from table must be zero or -1)
- */
- sint ToInt() const
- {
- return sint( UInt<value_size>::table[0] );
- }
-
-
- /*!
- this method converts the value to uint type
- can return a carry if the value is too long to store it in uint type
- */
- uint ToUInt(uint & result) const
- {
- uint c = UInt<value_size>::ToUInt(result);
-
- if( value_size == 1 )
- return (result & TTMATH_UINT_HIGHEST_BIT) == 0 ? 0 : 1;
-
- return c;
- }
-
-
- /*!
- this method converts the value to uint type
- can return a carry if the value is too long to store it in uint type
- */
- uint ToInt(uint & result) const
- {
- return ToUInt(result);
- }
-
-
- /*!
- this method converts the value to sint type
- can return a carry if the value is too long to store it in sint type
- */
- uint ToInt(sint & result) const
- {
- result = sint( UInt<value_size>::table[0] );
- uint mask = IsSign() ? TTMATH_UINT_MAX_VALUE : 0;
-
- if( (result & TTMATH_UINT_HIGHEST_BIT) != (mask & TTMATH_UINT_HIGHEST_BIT) )
- return 1;
-
- for(uint i=1 ; i<value_size ; ++i)
- if( UInt<value_size>::table[i] != mask )
- return 1;
-
- return 0;
- }
-
-
-#ifdef TTMATH_PLATFORM32
-
- /*!
- this method converts the value to ulint type (64 bit unsigned integer)
- can return a carry if the value is too long to store it in ulint type
- *** this method is created only on a 32 bit platform ***
- */
- uint ToUInt(ulint & result) const
- {
- uint c = UInt<value_size>::ToUInt(result);
-
- if( value_size == 1 )
- return (UInt<value_size>::table[0] & TTMATH_UINT_HIGHEST_BIT) == 0 ? 0 : 1;
-
- if( value_size == 2 )
- return (UInt<value_size>::table[1] & TTMATH_UINT_HIGHEST_BIT) == 0 ? 0 : 1;
-
- return c;
- }
-
-
- /*!
- this method converts the value to ulint type (64 bit unsigned integer)
- can return a carry if the value is too long to store it in ulint type
- *** this method is created only on a 32 bit platform ***
- */
- uint ToInt(ulint & result) const
- {
- return ToUInt(result);
- }
-
-
- /*!
- this method converts the value to slint type (64 bit signed integer)
- can return a carry if the value is too long to store it in slint type
- *** this method is created only on a 32 bit platform ***
- */
- uint ToInt(slint & result) const
- {
- if( value_size == 1 )
- {
- result = slint(sint(UInt<value_size>::table[0]));
- }
- else
- {
- uint low = UInt<value_size>::table[0];
- uint high = UInt<value_size>::table[1];
-
- result = low;
- result |= (ulint(high) << TTMATH_BITS_PER_UINT);
-
- uint mask = IsSign() ? TTMATH_UINT_MAX_VALUE : 0;
-
- if( (high & TTMATH_UINT_HIGHEST_BIT) != (mask & TTMATH_UINT_HIGHEST_BIT) )
- return 1;
-
- for(uint i=2 ; i<value_size ; ++i)
- if( UInt<value_size>::table[i] != mask )
- return 1;
- }
-
- return 0;
- }
-
-#endif
-
-
-
-#ifdef TTMATH_PLATFORM64
-
- /*!
- this method converts the value to a 32 bit unsigned integer
- can return a carry if the value is too long to store it in this type
- *** this method is created only on a 64 bit platform ***
- */
- uint ToUInt(unsigned int & result) const
- {
- uint c = UInt<value_size>::ToUInt(result);
-
- if( c || IsSign() )
- return 1;
-
- return 0;
- }
-
-
- /*!
- this method converts the value to a 32 bit unsigned integer
- can return a carry if the value is too long to store it in this type
- *** this method is created only on a 64 bit platform ***
- */
- uint ToInt(unsigned int & result) const
- {
- return ToUInt(result);
- }
-
-
- /*!
- this method converts the value to a 32 bit signed integer
- can return a carry if the value is too long to store it in this type
- *** this method is created only on a 64 bit platform ***
- */
- uint ToInt(int & result) const
- {
- uint first = UInt<value_size>::table[0];
-
- result = int(first);
- uint mask = IsSign() ? TTMATH_UINT_MAX_VALUE : 0;
-
- if( (first >> 31) != (mask >> 31) )
- return 1;
-
- for(uint i=1 ; i<value_size ; ++i)
- if( UInt<value_size>::table[i] != mask )
- return 1;
-
- return 0;
- }
-
-#endif
-
-
-
-
-private:
-
- /*!
- an auxiliary method for converting to a string
- */
- template<class string_type>
- void ToStringBase(string_type & result, uint b = 10) const
- {
- if( IsSign() )
- {
- Int<value_size> temp(*this);
- temp.Abs();
-
- temp.UInt<value_size>::ToString(result, b);
- result.insert(result.begin(), '-');
- }
- else
- {
- UInt<value_size>::ToString(result, b);
- }
- }
-
-public:
-
- /*!
- this method converts the value to a string with a base equal 'b'
- */
- void ToString(std::string & result, uint b = 10) const
- {
- return ToStringBase(result, b);
- }
-
-
- /*!
- this method converts the value to a string with a base equal 'b'
- */
- std::string ToString(uint b = 10) const
- {
- std::string result;
- ToStringBase(result, b);
-
- return result;
- }
-
-
-#ifndef TTMATH_DONT_USE_WCHAR
-
- /*!
- this method converts the value to a string with a base equal 'b'
- */
- void ToString(std::wstring & result, uint b = 10) const
- {
- return ToStringBase(result, b);
- }
-
-
- /*!
- this method converts the value to a string with a base equal 'b'
- */
- std::wstring ToWString(uint b = 10) const
- {
- std::wstring result;
- ToStringBase(result, b);
-
- return result;
- }
-
-#endif
-
-
-
-private:
-
- /*!
- an auxiliary method for converting from a string
- */
- template<class char_type>
- uint FromStringBase(const char_type * s, uint b = 10, const char_type ** after_source = 0, bool * value_read = 0)
- {
- bool is_sign = false;
-
- Misc::SkipWhiteCharacters(s);
-
- if( *s == '-' )
- {
- is_sign = true;
- Misc::SkipWhiteCharacters(++s);
- }
- else
- if( *s == '+' )
- {
- Misc::SkipWhiteCharacters(++s);
- }
-
- if( UInt<value_size>::FromString(s,b,after_source,value_read) )
- return 1;
-
- if( is_sign )
- {
- Int<value_size> mmin;
-
- mmin.SetMin();
-
- /*
- the reference to mmin will be automatically converted to the reference
- to UInt type
- (this value can be equal mmin -- look at a description in ChangeSign())
- */
- if( UInt<value_size>::operator>( mmin ) )
- return 1;
-
- /*
- if the value is equal mmin the method ChangeSign() does nothing (only returns 1 but we ignore it)
- */
- ChangeSign();
- }
- else
- {
- Int<value_size> mmax;
-
- mmax.SetMax();
-
- if( UInt<value_size>::operator>( mmax ) )
- return 1;
- }
-
- return 0;
- }
-
-
-public:
-
- /*!
- this method converts a string into its value
- it returns carry=1 if the value will be too big or an incorrect base 'b' is given
-
- string is ended with a non-digit value, for example:
- "-12" will be translated to -12
- as well as:
- "- 12foo" will be translated to -12 too
-
- existing first white characters will be ommited
- (between '-' and a first digit can be white characters too)
-
- after_source (if exists) is pointing at the end of the parsed string
-
- value_read (if exists) tells whether something has actually been read (at least one digit)
- */
- uint FromString(const char * s, uint b = 10, const char ** after_source = 0, bool * value_read = 0)
- {
- return FromStringBase(s, b, after_source, value_read);
- }
-
-
- /*!
- this method converts a string into its value
- */
- uint FromString(const wchar_t * s, uint b = 10, const wchar_t ** after_source = 0, bool * value_read = 0)
- {
- return FromStringBase(s, b, after_source, value_read);
- }
-
-
- /*!
- this method converts a string into its value
- it returns carry=1 if the value will be too big or an incorrect base 'b' is given
- */
- uint FromString(const std::string & s, uint b = 10)
- {
- return FromString( s.c_str(), b );
- }
-
-
- /*!
- this operator converts a string into its value (with base = 10)
- */
- Int<value_size> & operator=(const char * s)
- {
- FromString(s);
-
- return *this;
- }
-
-
-#ifndef TTMATH_DONT_USE_WCHAR
-
-
- /*!
- this method converts a string into its value
- it returns carry=1 if the value will be too big or an incorrect base 'b' is given
- */
- uint FromString(const std::wstring & s, uint b = 10)
- {
- return FromString( s.c_str(), b );
- }
-
-
- /*!
- this operator converts a string into its value (with base = 10)
- */
- Int<value_size> & operator=(const wchar_t * s)
- {
- FromString(s);
-
- return *this;
- }
-
-
- /*!
- this operator converts a string into its value (with base = 10)
- */
- Int<value_size> & operator=(const std::wstring & s)
- {
- FromString( s.c_str() );
-
- return *this;
- }
-
-#endif
-
-
- /*!
- this operator converts a string into its value (with base = 10)
- */
- Int<value_size> & operator=(const std::string & s)
- {
- FromString( s.c_str() );
-
- return *this;
- }
-
-
-
- /*!
- *
- * methods for comparing
- *
- *
- */
-
- bool operator==(const Int<value_size> & l) const
- {
- return UInt<value_size>::operator==(l);
- }
-
- bool operator!=(const Int<value_size> & l) const
- {
- return UInt<value_size>::operator!=(l);
- }
-
- bool operator<(const Int<value_size> & l) const
- {
- sint i=value_size-1;
-
- sint a1 = sint(UInt<value_size>::table[i]);
- sint a2 = sint(l.table[i]);
-
- if( a1 != a2 )
- return a1 < a2;
-
-
- for(--i ; i>=0 ; --i)
- {
- if( UInt<value_size>::table[i] != l.table[i] )
- // comparison as unsigned int
- return UInt<value_size>::table[i] < l.table[i];
- }
-
- // they're equal
- return false;
- }
-
-
- bool operator>(const Int<value_size> & l) const
- {
- sint i=value_size-1;
-
- sint a1 = sint(UInt<value_size>::table[i]);
- sint a2 = sint(l.table[i]);
-
- if( a1 != a2 )
- return a1 > a2;
-
-
- for(--i ; i>=0 ; --i)
- {
- if( UInt<value_size>::table[i] != l.table[i] )
- // comparison as unsigned int
- return UInt<value_size>::table[i] > l.table[i];
- }
-
- // they're equal
- return false;
- }
-
-
- bool operator<=(const Int<value_size> & l) const
- {
- sint i=value_size-1;
-
- sint a1 = sint(UInt<value_size>::table[i]);
- sint a2 = sint(l.table[i]);
-
- if( a1 != a2 )
- return a1 < a2;
-
-
- for(--i ; i>=0 ; --i)
- {
- if( UInt<value_size>::table[i] != l.table[i] )
- // comparison as unsigned int
- return UInt<value_size>::table[i] < l.table[i];
- }
-
- // they're equal
- return true;
- }
-
-
- bool operator>=(const Int<value_size> & l) const
- {
- sint i=value_size-1;
-
- sint a1 = sint(UInt<value_size>::table[i]);
- sint a2 = sint(l.table[i]);
-
- if( a1 != a2 )
- return a1 > a2;
-
-
- for(--i ; i>=0 ; --i)
- {
- if( UInt<value_size>::table[i] != l.table[i] )
- // comparison as unsigned int
- return UInt<value_size>::table[i] > l.table[i];
- }
-
- // they're equal
- return true;
- }
-
-
-
- /*!
- *
- * standard mathematical operators
- *
- */
-
-
- /*!
- an operator for changing the sign
-
- it's not changing 'this' but the changed value will be returned
- */
- Int<value_size> operator-() const
- {
- Int<value_size> temp(*this);
-
- temp.ChangeSign();
-
- return temp;
- }
-
-
- Int<value_size> operator-(const Int<value_size> & p2) const
- {
- Int<value_size> temp(*this);
-
- temp.Sub(p2);
-
- return temp;
- }
-
-
- Int<value_size> & operator-=(const Int<value_size> & p2)
- {
- Sub(p2);
-
- return *this;
- }
-
-
- Int<value_size> operator+(const Int<value_size> & p2) const
- {
- Int<value_size> temp(*this);
-
- temp.Add(p2);
-
- return temp;
- }
-
-
- Int<value_size> & operator+=(const Int<value_size> & p2)
- {
- Add(p2);
-
- return *this;
- }
-
-
- Int<value_size> operator*(const Int<value_size> & p2) const
- {
- Int<value_size> temp(*this);
-
- temp.Mul(p2);
-
- return temp;
- }
-
-
- Int<value_size> & operator*=(const Int<value_size> & p2)
- {
- Mul(p2);
-
- return *this;
- }
-
-
- Int<value_size> operator/(const Int<value_size> & p2) const
- {
- Int<value_size> temp(*this);
-
- temp.Div(p2);
-
- return temp;
- }
-
-
- Int<value_size> & operator/=(const Int<value_size> & p2)
- {
- Div(p2);
-
- return *this;
- }
-
-
- Int<value_size> operator%(const Int<value_size> & p2) const
- {
- Int<value_size> temp(*this);
- Int<value_size> remainder;
-
- temp.Div(p2, remainder);
-
- return remainder;
- }
-
-
- Int<value_size> & operator%=(const Int<value_size> & p2)
- {
- Int<value_size> remainder;
-
- Div(p2, remainder);
- operator=(remainder);
-
- return *this;
- }
-
-
- /*!
- Prefix operator e.g. ++variable
- */
- UInt<value_size> & operator++()
- {
- AddOne();
-
- return *this;
- }
-
-
- /*!
- Postfix operator e.g. variable++
- */
- UInt<value_size> operator++(int)
- {
- UInt<value_size> temp( *this );
-
- AddOne();
-
- return temp;
- }
-
-
- UInt<value_size> & operator--()
- {
- SubOne();
-
- return *this;
- }
-
-
- UInt<value_size> operator--(int)
- {
- UInt<value_size> temp( *this );
-
- SubOne();
-
- return temp;
- }
-
-
-
- /*!
- *
- * input/output operators for standard streams
- *
- */
-
-private:
-
- /*!
- an auxiliary method for outputing to standard streams
- */
- template<class ostream_type, class string_type>
- static ostream_type & OutputToStream(ostream_type & s, const Int<value_size> & l)
- {
- string_type ss;
-
- l.ToString(ss);
- s << ss;
-
- return s;
- }
-
-
-
-public:
-
-
- /*!
- output to standard streams
- */
- friend std::ostream & operator<<(std::ostream & s, const Int<value_size> & l)
- {
- return OutputToStream<std::ostream, std::string>(s, l);
- }
-
-
-#ifndef TTMATH_DONT_USE_WCHAR
-
- /*!
- output to standard streams
- */
- friend std::wostream & operator<<(std::wostream & s, const Int<value_size> & l)
- {
- return OutputToStream<std::wostream, std::wstring>(s, l);
- }
-
-#endif
-
-
-
-private:
-
- /*!
- an auxiliary method for converting from a string
- */
- template<class istream_type, class string_type, class char_type>
- static istream_type & InputFromStream(istream_type & s, Int<value_size> & l)
- {
- string_type ss;
-
- // char or wchar_t for operator>>
- char_type z;
-
- // operator>> omits white characters if they're set for ommiting
- s >> z;
-
- if( z=='-' || z=='+' )
- {
- ss += z;
- s >> z; // we're reading a next character (white characters can be ommited)
- }
-
- // we're reading only digits (base=10)
- while( s.good() && Misc::CharToDigit(z, 10)>=0 )
- {
- ss += z;
- z = static_cast<char_type>(s.get());
- }
-
- // we're leaving the last readed character
- // (it's not belonging to the value)
- s.unget();
-
- l.FromString(ss);
-
- return s;
- }
-
-
-public:
-
- /*!
- input from standard streams
- */
- friend std::istream & operator>>(std::istream & s, Int<value_size> & l)
- {
- return InputFromStream<std::istream, std::string, char>(s, l);
- }
-
-
-#ifndef TTMATH_DONT_USE_WCHAR
-
- /*!
- input from standard streams
- */
- friend std::wistream & operator>>(std::wistream & s, Int<value_size> & l)
- {
- return InputFromStream<std::wistream, std::wstring, wchar_t>(s, l);
- }
-#endif
-
-
-};
-
-} // namespace
-
-#endif
diff --git a/ttmath/ttmathmisc.h b/ttmath/ttmathmisc.h
deleted file mode 100644
index 330a43a..0000000
--- a/ttmath/ttmathmisc.h
+++ /dev/null
@@ -1,250 +0,0 @@
-/*
- * This file is a part of TTMath Bignum Library
- * and is distributed under the (new) BSD licence.
- * Author: Tomasz Sowa <t.sowa at ttmath.org>
- */
-
-/*
- * Copyright (c) 2006-2010, Tomasz Sowa
- * All rights reserved.
- *
- * Redistribution and use in source and binary forms, with or without
- * modification, are permitted provided that the following conditions are met:
- *
- * * Redistributions of source code must retain the above copyright notice,
- * this list of conditions and the following disclaimer.
- *
- * * Redistributions in binary form must reproduce the above copyright
- * notice, this list of conditions and the following disclaimer in the
- * documentation and/or other materials provided with the distribution.
- *
- * * Neither the name Tomasz Sowa nor the names of contributors to this
- * project may be used to endorse or promote products derived
- * from this software without specific prior written permission.
- *
- * THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS"
- * AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
- * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- * ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE
- * LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR
- * CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF
- * SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS
- * INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN
- * CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
- * ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF
- * THE POSSIBILITY OF SUCH DAMAGE.
- */
-
-#ifndef headerfilettmathmisc
-#define headerfilettmathmisc
-
-
-/*!
- \file ttmathmisc.h
- \brief some helpful functions
-*/
-
-
-#include <string>
-
-
-namespace ttmath
-{
-
-/*!
- some helpful functions
-*/
-class Misc
-{
-public:
-
-
-/*
- *
- * AssignString(result, str)
- * result = str
- *
- */
-
-/*!
- result = str
-*/
-static void AssignString(std::string & result, const char * str)
-{
- result = str;
-}
-
-
-#ifndef TTMATH_DONT_USE_WCHAR
-
-/*!
- result = str
-*/
-static void AssignString(std::wstring & result, const char * str)
-{
- result.clear();
-
- for( ; *str ; ++str )
- result += *str;
-}
-
-
-/*!
- result = str
-*/
-static void AssignString(std::wstring & result, const std::string & str)
-{
- return AssignString(result, str.c_str());
-}
-
-
-/*!
- result = str
-*/
-static void AssignString(std::string & result, const wchar_t * str)
-{
- result.clear();
-
- for( ; *str ; ++str )
- result += static_cast<char>(*str);
-}
-
-
-/*!
- result = str
-*/
-static void AssignString(std::string & result, const std::wstring & str)
-{
- return AssignString(result, str.c_str());
-}
-
-#endif
-
-
-/*
- *
- * AddString(result, str)
- * result += str
- *
- */
-
-
-/*!
- result += str
-*/
-static void AddString(std::string & result, const char * str)
-{
- result += str;
-}
-
-
-#ifndef TTMATH_DONT_USE_WCHAR
-
-/*!
- result += str
-*/
-static void AddString(std::wstring & result, const char * str)
-{
- for( ; *str ; ++str )
- result += *str;
-}
-
-#endif
-
-
-/*
- this method omits any white characters from the string
- char_type is char or wchar_t
-*/
-template<class char_type>
-static void SkipWhiteCharacters(const char_type * & c)
-{
- // 13 is at the end in a DOS text file (\r\n)
- while( (*c==' ' ) || (*c=='\t') || (*c==13 ) || (*c=='\n') )
- ++c;
-}
-
-
-
-
-/*!
- this static method converts one character into its value
-
- for example:
- 1 -> 1
- 8 -> 8
- A -> 10
- f -> 15
-
- this method don't check whether c is correct or not
-*/
-static uint CharToDigit(uint c)
-{
- if(c>='0' && c<='9')
- return c-'0';
-
- if(c>='a' && c<='z')
- return c-'a'+10;
-
-return c-'A'+10;
-}
-
-
-/*!
- this method changes a character 'c' into its value
- (if there can't be a correct value it returns -1)
-
- for example:
- c=2, base=10 -> function returns 2
- c=A, base=10 -> function returns -1
- c=A, base=16 -> function returns 10
-*/
-static sint CharToDigit(uint c, uint base)
-{
- if( c>='0' && c<='9' )
- c=c-'0';
- else
- if( c>='a' && c<='z' )
- c=c-'a'+10;
- else
- if( c>='A' && c<='Z' )
- c=c-'A'+10;
- else
- return -1;
-
-
- if( c >= base )
- return -1;
-
-
-return sint(c);
-}
-
-
-
-/*!
- this method converts a digit into a char
- digit should be from <0,F>
- (we don't have to get a base)
-
- for example:
- 1 -> 1
- 8 -> 8
- 10 -> A
- 15 -> F
-*/
-static uint DigitToChar(uint digit)
-{
- if( digit < 10 )
- return digit + '0';
-
-return digit - 10 + 'A';
-}
-
-
-}; // struct Misc
-
-}
-
-
-#endif
diff --git a/ttmath/ttmathobjects.h b/ttmath/ttmathobjects.h
deleted file mode 100644
index c35026b..0000000
--- a/ttmath/ttmathobjects.h
+++ /dev/null
@@ -1,809 +0,0 @@
-/*
- * This file is a part of TTMath Mathematical Library
- * and is distributed under the (new) BSD licence.
- * Author: Tomasz Sowa <t.sowa at ttmath.org>
- */
-
-/*
- * Copyright (c) 2006-2010, Tomasz Sowa
- * All rights reserved.
- *
- * Redistribution and use in source and binary forms, with or without
- * modification, are permitted provided that the following conditions are met:
- *
- * * Redistributions of source code must retain the above copyright notice,
- * this list of conditions and the following disclaimer.
- *
- * * Redistributions in binary form must reproduce the above copyright
- * notice, this list of conditions and the following disclaimer in the
- * documentation and/or other materials provided with the distribution.
- *
- * * Neither the name Tomasz Sowa nor the names of contributors to this
- * project may be used to endorse or promote products derived
- * from this software without specific prior written permission.
- *
- * THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS"
- * AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
- * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- * ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE
- * LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR
- * CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF
- * SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS
- * INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN
- * CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
- * ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF
- * THE POSSIBILITY OF SUCH DAMAGE.
- */
-
-
-#ifndef headerfilettmathobject
-#define headerfilettmathobject
-
-/*!
- \file ttmathobjects.h
- \brief Mathematic functions.
-*/
-
-#include <string>
-#include <vector>
-#include <list>
-#include <map>
-
-#include "ttmathtypes.h"
-#include "ttmathmisc.h"
-
-
-namespace ttmath
-{
-
-/*!
- objects of this class are used with the mathematical parser
- they hold variables or functions defined by a user
-
- each object has its own table in which we're keeping variables or functions
-*/
-class Objects
-{
-public:
-
-
- /*!
- one item (variable or function)
- 'items' will be on the table
- */
- struct Item
- {
- // name of a variable of a function
- // internally we store variables and funcions as std::string (not std::wstring even when wide characters are used)
- std::string value;
-
- // number of parameters required by the function
- // (if there's a variable this 'param' is ignored)
- int param;
-
- Item() {}
- Item(const std::string & v, int p) : value(v), param(p) {}
- };
-
- // 'Table' is the type of our table
- typedef std::map<std::string, Item> Table;
- typedef Table::iterator Iterator;
- typedef Table::const_iterator CIterator;
-
-
-
- /*!
- this method returns true if a character 'c' is a character
- which can be in a name
-
- if 'can_be_digit' is true that means when the 'c' is a digit this
- method returns true otherwise it returns false
- */
- static bool CorrectCharacter(int c, bool can_be_digit)
- {
- if( (c>='a' && c<='z') || (c>='A' && c<='Z') )
- return true;
-
- if( can_be_digit && ((c>='0' && c<='9') || c=='_') )
- return true;
-
- return false;
- }
-
-
- /*!
- this method returns true if the name can be as a name of an object
- */
- template<class string_type>
- static bool IsNameCorrect(const string_type & name)
- {
- if( name.empty() )
- return false;
-
- if( !CorrectCharacter(name[0], false) )
- return false;
-
- typename string_type::const_iterator i = name.begin();
-
- for(++i ; i!=name.end() ; ++i)
- if( !CorrectCharacter(*i, true) )
- return false;
-
- return true;
- }
-
-
- /*!
- this method returns true if such an object is defined (name exists)
- */
- bool IsDefined(const std::string & name)
- {
- Iterator i = table.find(name);
-
- if( i != table.end() )
- // we have this object in our table
- return true;
-
- return false;
- }
-
-
-
-#ifndef TTMATH_DONT_USE_WCHAR
-
- /*!
- this method returns true if such an object is defined (name exists)
- */
- bool IsDefined(const std::wstring & name)
- {
- // we should check whether the name (in wide characters) are correct
- // before calling AssignString() function
- if( !IsNameCorrect(name) )
- return false;
-
- Misc::AssignString(str_tmp1, name);
-
- return IsDefined(str_tmp1);
- }
-
-#endif
-
-
- /*!
- this method adds one object (variable of function) into the table
- */
- ErrorCode Add(const std::string & name, const std::string & value, int param = 0)
- {
- if( !IsNameCorrect(name) )
- return err_incorrect_name;
-
- Iterator i = table.find(name);
-
- if( i != table.end() )
- // we have this object in our table
- return err_object_exists;
-
- table.insert( std::make_pair(name, Item(value, param)) );
-
- return err_ok;
- }
-
-
-#ifndef TTMATH_DONT_USE_WCHAR
-
- /*!
- this method adds one object (variable of function) into the table
- */
- ErrorCode Add(const std::wstring & name, const std::wstring & value, int param = 0)
- {
- // we should check whether the name (in wide characters) are correct
- // before calling AssignString() function
- if( !IsNameCorrect(name) )
- return err_incorrect_name;
-
- Misc::AssignString(str_tmp1, name);
- Misc::AssignString(str_tmp2, value);
-
- return Add(str_tmp1, str_tmp2, param);
- }
-
-#endif
-
-
- /*!
- this method returns 'true' if the table is empty
- */
- bool Empty() const
- {
- return table.empty();
- }
-
-
- /*!
- this method clears the table
- */
- void Clear()
- {
- return table.clear();
- }
-
-
- /*!
- this method returns 'const_iterator' on the first item on the table
- */
- CIterator Begin() const
- {
- return table.begin();
- }
-
-
- /*!
- this method returns 'const_iterator' pointing at the space after last item
- (returns table.end())
- */
- CIterator End() const
- {
- return table.end();
- }
-
-
- /*!
- this method changes the value and the number of parameters for a specific object
- */
- ErrorCode EditValue(const std::string & name, const std::string & value, int param = 0)
- {
- if( !IsNameCorrect(name) )
- return err_incorrect_name;
-
- Iterator i = table.find(name);
-
- if( i == table.end() )
- return err_unknown_object;
-
- i->second.value = value;
- i->second.param = param;
-
- return err_ok;
- }
-
-
-#ifndef TTMATH_DONT_USE_WCHAR
-
-
- /*!
- this method changes the value and the number of parameters for a specific object
- */
- ErrorCode EditValue(const std::wstring & name, const std::wstring & value, int param = 0)
- {
- // we should check whether the name (in wide characters) are correct
- // before calling AssignString() function
- if( !IsNameCorrect(name) )
- return err_incorrect_name;
-
- Misc::AssignString(str_tmp1, name);
- Misc::AssignString(str_tmp2, value);
-
- return EditValue(str_tmp1, str_tmp2, param);
- }
-
-#endif
-
-
- /*!
- this method changes the name of a specific object
- */
- ErrorCode EditName(const std::string & old_name, const std::string & new_name)
- {
- if( !IsNameCorrect(old_name) || !IsNameCorrect(new_name) )
- return err_incorrect_name;
-
- Iterator old_i = table.find(old_name);
- if( old_i == table.end() )
- return err_unknown_object;
-
- if( old_name == new_name )
- // the new name is the same as the old one
- // we treat it as a normal situation
- return err_ok;
-
- ErrorCode err = Add(new_name, old_i->second.value, old_i->second.param);
-
- if( err == err_ok )
- {
- old_i = table.find(old_name);
- TTMATH_ASSERT( old_i != table.end() )
-
- table.erase(old_i);
- }
-
- return err;
- }
-
-
-
-#ifndef TTMATH_DONT_USE_WCHAR
-
-
- /*!
- this method changes the name of a specific object
- */
- ErrorCode EditName(const std::wstring & old_name, const std::wstring & new_name)
- {
- // we should check whether the name (in wide characters) are correct
- // before calling AssignString() function
- if( !IsNameCorrect(old_name) || !IsNameCorrect(new_name) )
- return err_incorrect_name;
-
- Misc::AssignString(str_tmp1, old_name);
- Misc::AssignString(str_tmp2, new_name);
-
- return EditName(str_tmp1, str_tmp2);
- }
-
-#endif
-
-
- /*!
- this method deletes an object
- */
- ErrorCode Delete(const std::string & name)
- {
- if( !IsNameCorrect(name) )
- return err_incorrect_name;
-
- Iterator i = table.find(name);
-
- if( i == table.end() )
- return err_unknown_object;
-
- table.erase( i );
-
- return err_ok;
- }
-
-
-#ifndef TTMATH_DONT_USE_WCHAR
-
-
- /*!
- this method deletes an object
- */
- ErrorCode Delete(const std::wstring & name)
- {
- // we should check whether the name (in wide characters) are correct
- // before calling AssignString() function
- if( !IsNameCorrect(name) )
- return err_incorrect_name;
-
- Misc::AssignString(str_tmp1, name);
-
- return Delete(str_tmp1);
- }
-
-#endif
-
-
- /*!
- this method gets the value of a specific object
- */
- ErrorCode GetValue(const std::string & name, std::string & value) const
- {
- if( !IsNameCorrect(name) )
- return err_incorrect_name;
-
- CIterator i = table.find(name);
-
- if( i == table.end() )
- {
- value.clear();
- return err_unknown_object;
- }
-
- value = i->second.value;
-
- return err_ok;
- }
-
-
-#ifndef TTMATH_DONT_USE_WCHAR
-
- /*!
- this method gets the value of a specific object
- */
- ErrorCode GetValue(const std::wstring & name, std::wstring & value)
- {
- // we should check whether the name (in wide characters) are correct
- // before calling AssignString() function
- if( !IsNameCorrect(name) )
- return err_incorrect_name;
-
- Misc::AssignString(str_tmp1, name);
- ErrorCode err = GetValue(str_tmp1, str_tmp2);
- Misc::AssignString(value, str_tmp2);
-
- return err;
- }
-
-#endif
-
-
- /*!
- this method gets the value of a specific object
- (this version is used for not copying the whole string)
- */
- ErrorCode GetValue(const std::string & name, const char ** value) const
- {
- if( !IsNameCorrect(name) )
- return err_incorrect_name;
-
- CIterator i = table.find(name);
-
- if( i == table.end() )
- {
- *value = 0;
- return err_unknown_object;
- }
-
- *value = i->second.value.c_str();
-
- return err_ok;
- }
-
-
-#ifndef TTMATH_DONT_USE_WCHAR
-
- /*!
- this method gets the value of a specific object
- (this version is used for not copying the whole string)
- */
- ErrorCode GetValue(const std::wstring & name, const char ** value)
- {
- // we should check whether the name (in wide characters) are correct
- // before calling AssignString() function
- if( !IsNameCorrect(name) )
- return err_incorrect_name;
-
- Misc::AssignString(str_tmp1, name);
-
- return GetValue(str_tmp1, value);
- }
-
-#endif
-
-
- /*!
- this method gets the value and the number of parameters
- of a specific object
- */
- ErrorCode GetValueAndParam(const std::string & name, std::string & value, int * param) const
- {
- if( !IsNameCorrect(name) )
- return err_incorrect_name;
-
- CIterator i = table.find(name);
-
- if( i == table.end() )
- {
- value.empty();
- *param = 0;
- return err_unknown_object;
- }
-
- value = i->second.value;
- *param = i->second.param;
-
- return err_ok;
- }
-
-
-#ifndef TTMATH_DONT_USE_WCHAR
-
- /*!
- this method gets the value and the number of parameters
- of a specific object
- */
- ErrorCode GetValueAndParam(const std::wstring & name, std::wstring & value, int * param)
- {
- // we should check whether the name (in wide characters) are correct
- // before calling AssignString() function
- if( !IsNameCorrect(name) )
- return err_incorrect_name;
-
- Misc::AssignString(str_tmp1, name);
- ErrorCode err = GetValueAndParam(str_tmp1, str_tmp2, param);
- Misc::AssignString(value, str_tmp2);
-
- return err;
- }
-
-#endif
-
-
- /*!
- this method sets the value and the number of parameters
- of a specific object
- (this version is used for not copying the whole string)
- */
- ErrorCode GetValueAndParam(const std::string & name, const char ** value, int * param) const
- {
- if( !IsNameCorrect(name) )
- return err_incorrect_name;
-
- CIterator i = table.find(name);
-
- if( i == table.end() )
- {
- *value = 0;
- *param = 0;
- return err_unknown_object;
- }
-
- *value = i->second.value.c_str();
- *param = i->second.param;
-
- return err_ok;
- }
-
-
-#ifndef TTMATH_DONT_USE_WCHAR
-
-
- /*!
- this method sets the value and the number of parameters
- of a specific object
- (this version is used for not copying the whole string
- but in fact we make one copying during AssignString())
- */
- ErrorCode GetValueAndParam(const std::wstring & name, const char ** value, int * param)
- {
- // we should check whether the name (in wide characters) are correct
- // before calling AssignString() function
- if( !IsNameCorrect(name) )
- return err_incorrect_name;
-
- Misc::AssignString(str_tmp1, name);
-
- return GetValueAndParam(str_tmp1, value, param);
- }
-
-
-#endif
-
-
- /*!
- this method returns a pointer into the table
- */
- Table * GetTable()
- {
- return &table;
- }
-
-
-private:
-
- Table table;
- std::string str_tmp1, str_tmp2;
-
-}; // end of class Objects
-
-
-
-
-
-
-
-/*!
- objects of the class History are used to keep values in functions
- which take a lot of time during calculating, for instance in the
- function Factorial(x)
-
- it means that when we're calculating e.g. Factorial(1000) and the
- Factorial finds that we have calculated it before, the value (result)
- is taken from the history
-*/
-template<class ValueType>
-class History
-{
- /*!
- one item in the History's object holds a key, a value for the key
- and a corresponding error code
- */
- struct Item
- {
- ValueType key, value;
- ErrorCode err;
- };
-
-
- /*!
- we use std::list for simply deleting the first item
- but because we're searching through the whole container
- (in the method Get) the container should not be too big
- (linear time of searching)
- */
- typedef std::list<Item> buffer_type;
- buffer_type buffer;
- typename buffer_type::size_type buffer_max_size;
-
-public:
-
- /*!
- default constructor
- default max size of the History's container is 15 items
- */
- History()
- {
- buffer_max_size = 15;
- }
-
-
- /*!
- a constructor which takes another value of the max size
- of the History's container
- */
- History(typename buffer_type::size_type new_size)
- {
- buffer_max_size = new_size;
- }
-
-
- /*!
- this method adds one item into the History
- if the size of the container is greater than buffer_max_size
- the first item will be removed
- */
- void Add(const ValueType & key, const ValueType & value, ErrorCode err)
- {
- Item item;
- item.key = key;
- item.value = value;
- item.err = err;
-
- buffer.insert( buffer.end(), item );
-
- if( buffer.size() > buffer_max_size )
- buffer.erase(buffer.begin());
- }
-
-
- /*!
- this method checks whether we have an item which has the key equal 'key'
-
- if there's such item the method sets the 'value' and the 'err'
- and returns true otherwise it returns false and 'value' and 'err'
- remain unchanged
- */
- bool Get(const ValueType & key, ValueType & value, ErrorCode & err)
- {
- typename buffer_type::iterator i = buffer.begin();
-
- for( ; i != buffer.end() ; ++i )
- {
- if( i->key == key )
- {
- value = i->value;
- err = i->err;
- return true;
- }
- }
-
- return false;
- }
-
-
- /*!
- this methods deletes an item
-
- we assume that there is only one item with the 'key'
- (this methods removes the first one)
- */
- bool Remove(const ValueType & key)
- {
- typename buffer_type::iterator i = buffer.begin();
-
- for( ; i != buffer.end() ; ++i )
- {
- if( i->key == key )
- {
- buffer.erase(i);
- return true;
- }
- }
-
- return false;
- }
-
-
-}; // end of class History
-
-
-
-/*!
- this is an auxiliary class used when calculating Gamma() or Factorial()
-
- in multithreaded environment you can provide an object of this class to
- the Gamma() or Factorial() function, e.g;
- typedef Big<1, 3> MyBig;
- MyBig x = 123456;
- CGamma<MyBig> cgamma;
- std::cout << Gamma(x, cgamma);
- each thread should have its own CGamma<> object
-
- in a single-thread environment a CGamma<> object is a static variable
- in a second version of Gamma() and you don't have to explicitly use it, e.g.
- typedef Big<1, 3> MyBig;
- MyBig x = 123456;
- std::cout << Gamma(x);
-*/
-template<class ValueType>
-struct CGamma
-{
- /*!
- this table holds factorials
- 1
- 1
- 2
- 6
- 24
- 120
- 720
- .......
- */
- std::vector<ValueType> fact;
-
-
- /*!
- this table holds Bernoulli numbers
- 1
- -0.5
- 0.166666666666666666666666667
- 0
- -0.0333333333333333333333333333
- 0
- 0.0238095238095238095238095238
- 0
- -0.0333333333333333333333333333
- 0
- 0.075757575757575757575757576
- .....
- */
- std::vector<ValueType> bern;
-
-
- /*!
- here we store some calculated values
- (this is for speeding up, if the next argument of Gamma() or Factorial()
- is in the 'history' then the result we are not calculating but simply
- return from the 'history' object)
- */
- History<ValueType> history;
-
-
- /*!
- this method prepares some coefficients: factorials and Bernoulli numbers
- stored in 'fact' and 'bern' objects
-
- how many values should be depends on the size of the mantissa - if
- the mantissa is larger then we must calculate more values
- for a mantissa which consists of 256 bits (8 words on a 32bit platform)
- we have to calculate about 30 values (the size of fact and bern will be 30),
- and for a 2048 bits mantissa we have to calculate 306 coefficients
-
- you don't have to call this method, these coefficients will be automatically calculated
- when they are needed
-
- you must note that calculating these coefficients is a little time-consuming operation,
- (especially when the mantissa is large) and first call to Gamma() or Factorial()
- can take more time than next calls, and in the end this is the point when InitAll()
- comes in handy: you can call this method somewhere at the beginning of your program
- */
- void InitAll();
- // definition is in ttmath.h
-};
-
-
-
-
-} // namespace
-
-#endif
diff --git a/ttmath/ttmathparser.h b/ttmath/ttmathparser.h
deleted file mode 100644
index 1b3ed91..0000000
--- a/ttmath/ttmathparser.h
+++ /dev/null
@@ -1,2765 +0,0 @@
-/*
- * This file is a part of TTMath Bignum Library
- * and is distributed under the (new) BSD licence.
- * Author: Tomasz Sowa <t.sowa at ttmath.org>
- */
-
-/*
- * Copyright (c) 2006-2010, Tomasz Sowa
- * All rights reserved.
- *
- * Redistribution and use in source and binary forms, with or without
- * modification, are permitted provided that the following conditions are met:
- *
- * * Redistributions of source code must retain the above copyright notice,
- * this list of conditions and the following disclaimer.
- *
- * * Redistributions in binary form must reproduce the above copyright
- * notice, this list of conditions and the following disclaimer in the
- * documentation and/or other materials provided with the distribution.
- *
- * * Neither the name Tomasz Sowa nor the names of contributors to this
- * project may be used to endorse or promote products derived
- * from this software without specific prior written permission.
- *
- * THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS"
- * AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
- * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- * ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE
- * LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR
- * CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF
- * SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS
- * INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN
- * CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
- * ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF
- * THE POSSIBILITY OF SUCH DAMAGE.
- */
-
-
-
-#ifndef headerfilettmathparser
-#define headerfilettmathparser
-
-/*!
- \file ttmathparser.h
- \brief A mathematical parser
-*/
-
-#include <cstdio>
-#include <vector>
-#include <map>
-#include <set>
-
-#include "ttmath.h"
-#include "ttmathobjects.h"
-#include "ttmathmisc.h"
-
-
-
-namespace ttmath
-{
-
-/*!
- \brief Mathematical parser
-
- let x will be an input string meaning an expression for converting:
-
- x = [+|-]Value[operator[+|-]Value][operator[+|-]Value]...
- where:
- an operator can be:
- ^ (pow) (the heighest priority)
-
- * (mul) (or multiplication without an operator -- short mul)
- / (div) (* and / have the same priority)
-
- + (add)
- - (sub) (+ and - have the same priority)
-
- < (lower than)
- > (greater than)
- <= (lower or equal than)
- >= (greater or equal than)
- == (equal)
- != (not equal) (all above logical operators have the same priority)
-
- && (logical and)
-
- || (logical or) (the lowest priority)
-
- short mul:
- if the second Value (Var below) is either a variable or function there might not be
- an operator between them, e.g.
- "[+|-]Value Var" is treated as "[+|-]Value * Var" and the multiplication
- has the same priority as a normal multiplication:
- 4x = 4 * x
- 2^3m = (2^3)* m
- 6h^3 = 6 * (h^3)
- 2sin(pi) = 2 * sin(pi)
- etc.
-
- Value can be:
- constant e.g. 100, can be preceded by operators for changing the base (radix): [#|&]
- # - hex
- & - bin
- sample: #10 = 16
- &10 = 2
- variable e.g. pi
- another expression between brackets e.g (x)
- function e.g. sin(x)
-
- for example a correct input string can be:
- "1"
- "2.1234"
- "2,1234" (they are the same, by default we can either use a comma or a dot)
- "1 + 2"
- "(1 + 2) * 3"
- "pi"
- "sin(pi)"
- "(1+2)*(2+3)"
- "log(2;1234)" there's a semicolon here (not a comma), we use it in functions
- for separating parameters
- "1 < 2" (the result will be: 1)
- "4 < 3" (the result will be: 0)
- "2+x" (of course if the variable 'x' is defined)
- "4x+10"
- "#20+10" = 32 + 10 = 42
- "10 ^ -&101" = 10 ^ -5 = 0.00001
- "8 * -&10" = 8 * -2 = -16
- etc.
-
- we can also use a semicolon for separating any 'x' input strings
- for example:
- "1+2;4+5"
- the result will be on the stack as follows:
- stack[0].value=3
- stack[1].value=9
-*/
-template<class ValueType>
-class Parser
-{
-private:
-
-/*!
- there are 5 mathematical operators as follows (with their standard priorities):
- add (+)
- sub (-)
- mul (*)
- div (/)
- pow (^)
- and 'shortmul' used when there is no any operators between
- a first parameter and a variable or function
- (the 'shortmul' has the same priority as the normal multiplication )
-*/
- class MatOperator
- {
- public:
-
- enum Type
- {
- none,add,sub,mul,div,pow,lt,gt,let,get,eq,neq,lor,land,shortmul
- };
-
- enum Assoc
- {
- right, // right-associative
- non_right // associative or left-associative
- };
-
- Type GetType() const { return type; }
- int GetPriority() const { return priority; }
- Assoc GetAssoc() const { return assoc; }
-
- void SetType(Type t)
- {
- type = t;
- assoc = non_right;
-
- switch( type )
- {
- case lor:
- priority = 4;
- break;
-
- case land:
- priority = 5;
- break;
-
- case eq:
- case neq:
- case lt:
- case gt:
- case let:
- case get:
- priority = 7;
- break;
-
- case add:
- case sub:
- priority = 10;
- break;
-
- case mul:
- case shortmul:
- case div:
- priority = 12;
- break;
-
- case pow:
- priority = 14;
- assoc = right;
- break;
-
- default:
- Error( err_internal_error );
- break;
- }
- }
-
- MatOperator(): type(none), priority(0), assoc(non_right)
- {
- }
-
- private:
-
- Type type;
- int priority;
- Assoc assoc;
- }; // end of MatOperator class
-
-
-
-public:
-
-
-
- /*!
- Objects of type 'Item' we are keeping on our stack
- */
- struct Item
- {
- enum Type
- {
- none, numerical_value, mat_operator, first_bracket,
- last_bracket, variable, semicolon
- };
-
- // The kind of type which we're keeping
- Type type;
-
- // if type == numerical_value
- ValueType value;
-
- // if type == mat_operator
- MatOperator moperator;
-
- /*
- if type == first_bracket
-
- if 'function' is set to true it means that the first recognized bracket
- was the bracket from function in other words we must call a function when
- we'll find the 'last' bracket
- */
- bool function;
-
- // if function is true
- std::string function_name;
-
- /*
- the sign of value
-
- it can be for type==numerical_value or type==first_bracket
- when it's true it means e.g. that value is equal -value
- */
- bool sign;
-
- Item(): type(none), function(false), sign(false)
- {
- }
-
- }; // end of Item struct
-
-
-/*!
- stack on which we're keeping the Items
-
- at the end of parsing we'll have the result here
- the result don't have to be one value, it can be
- more than one if we have used a semicolon in the global space
- e.g. such input string "1+2;3+4" will generate a result:
- stack[0].value=3
- stack[1].value=7
-
- you should check if the stack is not empty, because if there was
- a syntax error in the input string then we do not have any results
- on the stack
-*/
-std::vector<Item> stack;
-
-
-private:
-
-
-/*!
- size of the stack when we're starting parsing of the string
-
- if it's to small while parsing the stack will be automatically resized
-*/
-const int default_stack_size;
-
-
-
-/*!
- index of an object in our stack
- it's pointing on the place behind the last element
- for example at the beginning of parsing its value is zero
-*/
-unsigned int stack_index;
-
-
-/*!
- code of the last error
-*/
-ErrorCode error;
-
-
-/*!
- pointer to the currently reading char
- when an error has occured it may be used to count the index of the wrong character
-*/
-const char * pstring;
-
-
-/*!
- the base (radix) of the mathematic system (for example it may be '10')
-*/
-int base;
-
-
-/*!
- the unit of angles used in: sin,cos,tan,cot,asin,acos,atan,acot
- 0 - deg
- 1 - rad (default)
- 2 - grad
-*/
-int deg_rad_grad;
-
-
-
-/*!
- a pointer to an object which tell us whether we should stop calculating or not
-*/
-const volatile StopCalculating * pstop_calculating;
-
-
-
-/*!
- a pointer to the user-defined variables' table
-*/
-const Objects * puser_variables;
-
-/*!
- a pointer to the user-defined functions' table
-*/
-const Objects * puser_functions;
-
-
-typedef std::map<std::string, ValueType> FunctionLocalVariables;
-
-/*!
- a pointer to the local variables of a function
-*/
-const FunctionLocalVariables * pfunction_local_variables;
-
-
-/*!
- a temporary set using during parsing user defined variables
-*/
-std::set<std::string> visited_variables;
-
-
-/*!
- a temporary set using during parsing user defined functions
-*/
-std::set<std::string> visited_functions;
-
-
-
-
-/*!
- pfunction is the type of pointer to a mathematic function
-
- these mathematic functions are private members of this class,
- they are the wrappers for standard mathematics function
-
- 'pstack' is the pointer to the first argument on our stack
- 'amount_of_arg' tell us how many argument there are in our stack
- 'result' is the reference for result of function
-*/
-typedef void (Parser<ValueType>::*pfunction)(int pstack, int amount_of_arg, ValueType & result);
-
-
-/*!
- pfunction is the type of pointer to a method which returns value of variable
-*/
-typedef void (ValueType::*pfunction_var)();
-
-
-/*!
- table of mathematic functions
-
- this map consists of:
- std::string - function's name
- pfunction - pointer to specific function
-*/
-typedef std::map<std::string, pfunction> FunctionsTable;
-FunctionsTable functions_table;
-
-
-/*!
- table of mathematic operators
-
- this map consists of:
- std::string - operators's name
- MatOperator::Type - type of the operator
-*/
-typedef std::map<std::string, typename MatOperator::Type> OperatorsTable;
-OperatorsTable operators_table;
-
-
-/*!
- table of mathematic variables
-
- this map consists of:
- std::string - variable's name
- pfunction_var - pointer to specific function which returns value of variable
-*/
-typedef std::map<std::string, pfunction_var> VariablesTable;
-VariablesTable variables_table;
-
-
-/*!
- some coefficients used when calculating the gamma (or factorial) function
-*/
-CGamma<ValueType> cgamma;
-
-
-/*!
- temporary object for a whole string when Parse(std::wstring) is used
-*/
-std::string wide_to_ansi;
-
-
-/*!
- group character (used when parsing)
- default zero (not used)
-*/
-int group;
-
-
-/*!
- characters used as a comma
- default: '.' and ','
- comma2 can be zero (it means it is not used)
-*/
-int comma, comma2;
-
-
-/*!
- an additional character used as a separator between function parameters
- (semicolon is used always)
-*/
-int param_sep;
-
-
-/*!
- true if something was calculated (at least one mathematical operator was used or a function or a variable)
-*/
-bool calculated;
-
-
-
-/*!
- we're using this method for reporting an error
-*/
-static void Error(ErrorCode code)
-{
- throw code;
-}
-
-
-/*!
- this method skips the white character from the string
-
- it's moving the 'pstring' to the first no-white character
-*/
-void SkipWhiteCharacters()
-{
- while( (*pstring==' ' ) || (*pstring=='\t') )
- ++pstring;
-}
-
-
-/*!
- an auxiliary method for RecurrenceParsingVariablesOrFunction(...)
-*/
-void RecurrenceParsingVariablesOrFunction_CheckStopCondition(bool variable, const std::string & name)
-{
- if( variable )
- {
- if( visited_variables.find(name) != visited_variables.end() )
- Error( err_variable_loop );
- }
- else
- {
- if( visited_functions.find(name) != visited_functions.end() )
- Error( err_functions_loop );
- }
-}
-
-
-/*!
- an auxiliary method for RecurrenceParsingVariablesOrFunction(...)
-*/
-void RecurrenceParsingVariablesOrFunction_AddName(bool variable, const std::string & name)
-{
- if( variable )
- visited_variables.insert( name );
- else
- visited_functions.insert( name );
-}
-
-
-/*!
- an auxiliary method for RecurrenceParsingVariablesOrFunction(...)
-*/
-void RecurrenceParsingVariablesOrFunction_DeleteName(bool variable, const std::string & name)
-{
- if( variable )
- visited_variables.erase( name );
- else
- visited_functions.erase( name );
-}
-
-
-/*!
- this method returns the value of a variable or function
- by creating a new instance of the mathematical parser
- and making the standard parsing algorithm on the given string
-
- this method is used only during parsing user defined variables or functions
-
- (there can be a recurrence here therefore we're using 'visited_variables'
- and 'visited_functions' sets to make a stop condition)
-*/
-ValueType RecurrenceParsingVariablesOrFunction(bool variable, const std::string & name, const char * new_string,
- FunctionLocalVariables * local_variables = 0)
-{
- RecurrenceParsingVariablesOrFunction_CheckStopCondition(variable, name);
- RecurrenceParsingVariablesOrFunction_AddName(variable, name);
-
- Parser<ValueType> NewParser(*this);
- ErrorCode err;
-
- NewParser.pfunction_local_variables = local_variables;
-
- try
- {
- err = NewParser.Parse(new_string);
- }
- catch(...)
- {
- RecurrenceParsingVariablesOrFunction_DeleteName(variable, name);
-
- throw;
- }
-
- RecurrenceParsingVariablesOrFunction_DeleteName(variable, name);
-
- if( err != err_ok )
- Error( err );
-
- if( NewParser.stack.size() != 1 )
- Error( err_must_be_only_one_value );
-
- if( NewParser.stack[0].type != Item::numerical_value )
- // I think there shouldn't be this error here
- Error( err_incorrect_value );
-
-return NewParser.stack[0].value;
-}
-
-
-public:
-
-
-/*!
- this method returns the user-defined value of a variable
-*/
-bool GetValueOfUserDefinedVariable(const std::string & variable_name,ValueType & result)
-{
- if( !puser_variables )
- return false;
-
- const char * string_value;
-
- if( puser_variables->GetValue(variable_name, &string_value) != err_ok )
- return false;
-
- result = RecurrenceParsingVariablesOrFunction(true, variable_name, string_value);
- calculated = true;
-
-return true;
-}
-
-
-/*!
- this method returns the value of a local variable of a function
-*/
-bool GetValueOfFunctionLocalVariable(const std::string & variable_name, ValueType & result)
-{
- if( !pfunction_local_variables )
- return false;
-
- typename FunctionLocalVariables::const_iterator i = pfunction_local_variables->find(variable_name);
-
- if( i == pfunction_local_variables->end() )
- return false;
-
- result = i->second;
-
-return true;
-}
-
-
-/*!
- this method returns the value of a variable from variables' table
-
- we make an object of type ValueType then call a method which
- sets the correct value in it and finally we'll return the object
-*/
-ValueType GetValueOfVariable(const std::string & variable_name)
-{
-ValueType result;
-
- if( GetValueOfFunctionLocalVariable(variable_name, result) )
- return result;
-
- if( GetValueOfUserDefinedVariable(variable_name, result) )
- return result;
-
-
- typename std::map<std::string, pfunction_var>::iterator i =
- variables_table.find(variable_name);
-
- if( i == variables_table.end() )
- Error( err_unknown_variable );
-
- (result.*(i->second))();
- calculated = true;
-
-return result;
-}
-
-
-private:
-
-/*!
- wrappers for mathematic functions
-
- 'sindex' is pointing on the first argument on our stack
- (the second argument has 'sindex+2'
- because 'sindex+1' is guaranted for the 'semicolon' operator)
- the third artument has of course 'sindex+4' etc.
-
- 'result' will be the result of the function
-
- (we're using exceptions here for example when function gets an improper argument)
-*/
-
-
-/*!
- used by: sin,cos,tan,cot
-*/
-ValueType ConvertAngleToRad(const ValueType & input)
-{
- if( deg_rad_grad == 1 ) // rad
- return input;
-
- ValueType result;
- ErrorCode err;
-
- if( deg_rad_grad == 0 ) // deg
- result = ttmath::DegToRad(input, &err);
- else // grad
- result = ttmath::GradToRad(input, &err);
-
- if( err != err_ok )
- Error( err );
-
-return result;
-}
-
-
-/*!
- used by: asin,acos,atan,acot
-*/
-ValueType ConvertRadToAngle(const ValueType & input)
-{
- if( deg_rad_grad == 1 ) // rad
- return input;
-
- ValueType result;
- ErrorCode err;
-
- if( deg_rad_grad == 0 ) // deg
- result = ttmath::RadToDeg(input, &err);
- else // grad
- result = ttmath::RadToGrad(input, &err);
-
- if( err != err_ok )
- Error( err );
-
-return result;
-}
-
-
-void Gamma(int sindex, int amount_of_args, ValueType & result)
-{
- if( amount_of_args != 1 )
- Error( err_improper_amount_of_arguments );
-
- ErrorCode err;
-
- result = ttmath::Gamma(stack[sindex].value, cgamma, &err, pstop_calculating);
-
- if(err != err_ok)
- Error( err );
-}
-
-
-/*!
- factorial
- result = 1 * 2 * 3 * 4 * .... * x
-*/
-void Factorial(int sindex, int amount_of_args, ValueType & result)
-{
- if( amount_of_args != 1 )
- Error( err_improper_amount_of_arguments );
-
- ErrorCode err;
-
- result = ttmath::Factorial(stack[sindex].value, cgamma, &err, pstop_calculating);
-
- if(err != err_ok)
- Error( err );
-}
-
-
-void Abs(int sindex, int amount_of_args, ValueType & result)
-{
- if( amount_of_args != 1 )
- Error( err_improper_amount_of_arguments );
-
- result = ttmath::Abs(stack[sindex].value);
-}
-
-void Sin(int sindex, int amount_of_args, ValueType & result)
-{
- if( amount_of_args != 1 )
- Error( err_improper_amount_of_arguments );
-
- ErrorCode err;
- result = ttmath::Sin( ConvertAngleToRad(stack[sindex].value), &err );
-
- if(err != err_ok)
- Error( err );
-}
-
-void Cos(int sindex, int amount_of_args, ValueType & result)
-{
- if( amount_of_args != 1 )
- Error( err_improper_amount_of_arguments );
-
- ErrorCode err;
- result = ttmath::Cos( ConvertAngleToRad(stack[sindex].value), &err );
-
- if(err != err_ok)
- Error( err );
-}
-
-void Tan(int sindex, int amount_of_args, ValueType & result)
-{
- if( amount_of_args != 1 )
- Error( err_improper_amount_of_arguments );
-
- ErrorCode err;
- result = ttmath::Tan(ConvertAngleToRad(stack[sindex].value), &err);
-
- if(err != err_ok)
- Error( err );
-}
-
-void Cot(int sindex, int amount_of_args, ValueType & result)
-{
- if( amount_of_args != 1 )
- Error( err_improper_amount_of_arguments );
-
- ErrorCode err;
- result = ttmath::Cot(ConvertAngleToRad(stack[sindex].value), &err);
-
- if(err != err_ok)
- Error( err );
-}
-
-void Int(int sindex, int amount_of_args, ValueType & result)
-{
- if( amount_of_args != 1 )
- Error( err_improper_amount_of_arguments );
-
- result = ttmath::SkipFraction(stack[sindex].value);
-}
-
-
-void Round(int sindex, int amount_of_args, ValueType & result)
-{
- if( amount_of_args != 1 )
- Error( err_improper_amount_of_arguments );
-
- result = stack[sindex].value;
-
- if( result.Round() )
- Error( err_overflow );
-}
-
-
-void Ln(int sindex, int amount_of_args, ValueType & result)
-{
- if( amount_of_args != 1 )
- Error( err_improper_amount_of_arguments );
-
- ErrorCode err;
- result = ttmath::Ln(stack[sindex].value, &err);
-
- if(err != err_ok)
- Error( err );
-}
-
-void Log(int sindex, int amount_of_args, ValueType & result)
-{
- if( amount_of_args != 2 )
- Error( err_improper_amount_of_arguments );
-
- ErrorCode err;
- result = ttmath::Log(stack[sindex].value, stack[sindex+2].value, &err);
-
- if(err != err_ok)
- Error( err );
-}
-
-void Exp(int sindex, int amount_of_args, ValueType & result)
-{
- if( amount_of_args != 1 )
- Error( err_improper_amount_of_arguments );
-
- ErrorCode err;
- result = ttmath::Exp(stack[sindex].value, &err);
-
- if(err != err_ok)
- Error( err );
-}
-
-
-void Max(int sindex, int amount_of_args, ValueType & result)
-{
- if( amount_of_args == 0 )
- {
- result.SetMax();
-
- return;
- }
-
- result = stack[sindex].value;
-
- for(int i=1 ; i<amount_of_args ; ++i)
- {
- if( result < stack[sindex + i*2].value )
- result = stack[sindex + i*2].value;
- }
-}
-
-
-void Min(int sindex, int amount_of_args, ValueType & result)
-{
- if( amount_of_args == 0 )
- {
- result.SetMin();
-
- return;
- }
-
- result = stack[sindex].value;
-
- for(int i=1 ; i<amount_of_args ; ++i)
- {
- if( result > stack[sindex + i*2].value )
- result = stack[sindex + i*2].value;
- }
-}
-
-
-void ASin(int sindex, int amount_of_args, ValueType & result)
-{
- if( amount_of_args != 1 )
- Error( err_improper_amount_of_arguments );
-
- ErrorCode err;
- ValueType temp = ttmath::ASin(stack[sindex].value, &err);
-
- if(err != err_ok)
- Error( err );
-
- result = ConvertRadToAngle(temp);
-}
-
-
-void ACos(int sindex, int amount_of_args, ValueType & result)
-{
- if( amount_of_args != 1 )
- Error( err_improper_amount_of_arguments );
-
- ErrorCode err;
- ValueType temp = ttmath::ACos(stack[sindex].value, &err);
-
- if(err != err_ok)
- Error( err );
-
- result = ConvertRadToAngle(temp);
-}
-
-
-void ATan(int sindex, int amount_of_args, ValueType & result)
-{
- if( amount_of_args != 1 )
- Error( err_improper_amount_of_arguments );
-
- result = ConvertRadToAngle(ttmath::ATan(stack[sindex].value));
-}
-
-
-void ACot(int sindex, int amount_of_args, ValueType & result)
-{
- if( amount_of_args != 1 )
- Error( err_improper_amount_of_arguments );
-
- result = ConvertRadToAngle(ttmath::ACot(stack[sindex].value));
-}
-
-
-void Sgn(int sindex, int amount_of_args, ValueType & result)
-{
- if( amount_of_args != 1 )
- Error( err_improper_amount_of_arguments );
-
- result = ttmath::Sgn(stack[sindex].value);
-}
-
-
-void Mod(int sindex, int amount_of_args, ValueType & result)
-{
- if( amount_of_args != 2 )
- Error( err_improper_amount_of_arguments );
-
- if( stack[sindex+2].value.IsZero() )
- Error( err_improper_argument );
-
- result = stack[sindex].value;
- uint c = result.Mod(stack[sindex+2].value);
-
- if( c )
- Error( err_overflow );
-}
-
-
-void If(int sindex, int amount_of_args, ValueType & result)
-{
- if( amount_of_args != 3 )
- Error( err_improper_amount_of_arguments );
-
-
- if( !stack[sindex].value.IsZero() )
- result = stack[sindex+2].value;
- else
- result = stack[sindex+4].value;
-}
-
-
-void Or(int sindex, int amount_of_args, ValueType & result)
-{
- if( amount_of_args < 2 )
- Error( err_improper_amount_of_arguments );
-
- for(int i=0 ; i<amount_of_args ; ++i)
- {
- if( !stack[sindex+i*2].value.IsZero() )
- {
- result.SetOne();
- return;
- }
- }
-
- result.SetZero();
-}
-
-
-void And(int sindex, int amount_of_args, ValueType & result)
-{
- if( amount_of_args < 2 )
- Error( err_improper_amount_of_arguments );
-
- for(int i=0 ; i<amount_of_args ; ++i)
- {
- if( stack[sindex+i*2].value.IsZero() )
- {
- result.SetZero();
- return;
- }
- }
-
- result.SetOne();
-}
-
-
-void Not(int sindex, int amount_of_args, ValueType & result)
-{
- if( amount_of_args != 1 )
- Error( err_improper_amount_of_arguments );
-
-
- if( stack[sindex].value.IsZero() )
- result.SetOne();
- else
- result.SetZero();
-}
-
-
-void DegToRad(int sindex, int amount_of_args, ValueType & result)
-{
- ErrorCode err = err_ok;
-
- if( amount_of_args == 1 )
- {
- result = ttmath::DegToRad(stack[sindex].value, &err);
- }
- else
- if( amount_of_args == 3 )
- {
- result = ttmath::DegToRad( stack[sindex].value, stack[sindex+2].value,
- stack[sindex+4].value, &err);
- }
- else
- Error( err_improper_amount_of_arguments );
-
-
- if( err != err_ok )
- Error( err );
-}
-
-
-void RadToDeg(int sindex, int amount_of_args, ValueType & result)
-{
- ErrorCode err;
-
- if( amount_of_args != 1 )
- Error( err_improper_amount_of_arguments );
-
- result = ttmath::RadToDeg(stack[sindex].value, &err);
-
- if( err != err_ok )
- Error( err );
-}
-
-
-void DegToDeg(int sindex, int amount_of_args, ValueType & result)
-{
- if( amount_of_args != 3 )
- Error( err_improper_amount_of_arguments );
-
- ErrorCode err;
- result = ttmath::DegToDeg( stack[sindex].value, stack[sindex+2].value,
- stack[sindex+4].value, &err);
-
- if( err != err_ok )
- Error( err );
-}
-
-
-void GradToRad(int sindex, int amount_of_args, ValueType & result)
-{
- ErrorCode err;
-
- if( amount_of_args != 1 )
- Error( err_improper_amount_of_arguments );
-
- result = ttmath::GradToRad(stack[sindex].value, &err);
-
- if( err != err_ok )
- Error( err );
-}
-
-
-void RadToGrad(int sindex, int amount_of_args, ValueType & result)
-{
- ErrorCode err;
-
- if( amount_of_args != 1 )
- Error( err_improper_amount_of_arguments );
-
- result = ttmath::RadToGrad(stack[sindex].value, &err);
-
- if( err != err_ok )
- Error( err );
-}
-
-
-void DegToGrad(int sindex, int amount_of_args, ValueType & result)
-{
- ErrorCode err = err_ok;
-
- if( amount_of_args == 1 )
- {
- result = ttmath::DegToGrad(stack[sindex].value, &err);
- }
- else
- if( amount_of_args == 3 )
- {
- result = ttmath::DegToGrad( stack[sindex].value, stack[sindex+2].value,
- stack[sindex+4].value, &err);
- }
- else
- Error( err_improper_amount_of_arguments );
-
-
- if( err != err_ok )
- Error( err );
-}
-
-
-void GradToDeg(int sindex, int amount_of_args, ValueType & result)
-{
- ErrorCode err;
-
- if( amount_of_args != 1 )
- Error( err_improper_amount_of_arguments );
-
- result = ttmath::GradToDeg(stack[sindex].value, &err);
-
- if( err != err_ok )
- Error( err );
-}
-
-
-void Ceil(int sindex, int amount_of_args, ValueType & result)
-{
- if( amount_of_args != 1 )
- Error( err_improper_amount_of_arguments );
-
- ErrorCode err;
- result = ttmath::Ceil(stack[sindex].value, &err);
-
- if( err != err_ok )
- Error( err );
-}
-
-
-void Floor(int sindex, int amount_of_args, ValueType & result)
-{
- if( amount_of_args != 1 )
- Error( err_improper_amount_of_arguments );
-
- ErrorCode err;
- result = ttmath::Floor(stack[sindex].value, &err);
-
- if( err != err_ok )
- Error( err );
-}
-
-void Sqrt(int sindex, int amount_of_args, ValueType & result)
-{
- if( amount_of_args != 1 )
- Error( err_improper_amount_of_arguments );
-
- ErrorCode err;
- result = ttmath::Sqrt(stack[sindex].value, &err);
-
- if( err != err_ok )
- Error( err );
-}
-
-
-void Sinh(int sindex, int amount_of_args, ValueType & result)
-{
- if( amount_of_args != 1 )
- Error( err_improper_amount_of_arguments );
-
- ErrorCode err;
- result = ttmath::Sinh(stack[sindex].value, &err);
-
- if( err != err_ok )
- Error( err );
-}
-
-
-void Cosh(int sindex, int amount_of_args, ValueType & result)
-{
- if( amount_of_args != 1 )
- Error( err_improper_amount_of_arguments );
-
- ErrorCode err;
- result = ttmath::Cosh(stack[sindex].value, &err);
-
- if( err != err_ok )
- Error( err );
-}
-
-
-void Tanh(int sindex, int amount_of_args, ValueType & result)
-{
- if( amount_of_args != 1 )
- Error( err_improper_amount_of_arguments );
-
- ErrorCode err;
- result = ttmath::Tanh(stack[sindex].value, &err);
-
- if( err != err_ok )
- Error( err );
-}
-
-
-void Coth(int sindex, int amount_of_args, ValueType & result)
-{
- if( amount_of_args != 1 )
- Error( err_improper_amount_of_arguments );
-
- ErrorCode err;
- result = ttmath::Coth(stack[sindex].value, &err);
-
- if( err != err_ok )
- Error( err );
-}
-
-
-void Root(int sindex, int amount_of_args, ValueType & result)
-{
- if( amount_of_args != 2 )
- Error( err_improper_amount_of_arguments );
-
- ErrorCode err;
- result = ttmath::Root(stack[sindex].value, stack[sindex+2].value, &err);
-
- if( err != err_ok )
- Error( err );
-}
-
-
-
-void ASinh(int sindex, int amount_of_args, ValueType & result)
-{
- if( amount_of_args != 1 )
- Error( err_improper_amount_of_arguments );
-
- ErrorCode err;
- result = ttmath::ASinh(stack[sindex].value, &err);
-
- if( err != err_ok )
- Error( err );
-}
-
-
-void ACosh(int sindex, int amount_of_args, ValueType & result)
-{
- if( amount_of_args != 1 )
- Error( err_improper_amount_of_arguments );
-
- ErrorCode err;
- result = ttmath::ACosh(stack[sindex].value, &err);
-
- if( err != err_ok )
- Error( err );
-}
-
-
-void ATanh(int sindex, int amount_of_args, ValueType & result)
-{
- if( amount_of_args != 1 )
- Error( err_improper_amount_of_arguments );
-
- ErrorCode err;
- result = ttmath::ATanh(stack[sindex].value, &err);
-
- if( err != err_ok )
- Error( err );
-}
-
-
-void ACoth(int sindex, int amount_of_args, ValueType & result)
-{
- if( amount_of_args != 1 )
- Error( err_improper_amount_of_arguments );
-
- ErrorCode err;
- result = ttmath::ACoth(stack[sindex].value, &err);
-
- if( err != err_ok )
- Error( err );
-}
-
-
-void BitAnd(int sindex, int amount_of_args, ValueType & result)
-{
- if( amount_of_args != 2 )
- Error( err_improper_amount_of_arguments );
-
- uint err;
- result = stack[sindex].value;
- err = result.BitAnd(stack[sindex+2].value);
-
- switch(err)
- {
- case 1:
- Error( err_overflow );
- break;
- case 2:
- Error( err_improper_argument );
- break;
- }
-}
-
-void BitOr(int sindex, int amount_of_args, ValueType & result)
-{
- if( amount_of_args != 2 )
- Error( err_improper_amount_of_arguments );
-
- uint err;
- result = stack[sindex].value;
- err = result.BitOr(stack[sindex+2].value);
-
- switch(err)
- {
- case 1:
- Error( err_overflow );
- break;
- case 2:
- Error( err_improper_argument );
- break;
- }
-}
-
-
-void BitXor(int sindex, int amount_of_args, ValueType & result)
-{
- if( amount_of_args != 2 )
- Error( err_improper_amount_of_arguments );
-
- uint err;
- result = stack[sindex].value;
- err = result.BitXor(stack[sindex+2].value);
-
- switch(err)
- {
- case 1:
- Error( err_overflow );
- break;
- case 2:
- Error( err_improper_argument );
- break;
- }
-}
-
-
-void Sum(int sindex, int amount_of_args, ValueType & result)
-{
- if( amount_of_args == 0 )
- Error( err_improper_amount_of_arguments );
-
- result = stack[sindex].value;
-
- for(int i=1 ; i<amount_of_args ; ++i )
- if( result.Add( stack[ sindex + i*2 ].value ) )
- Error( err_overflow );
-}
-
-void Avg(int sindex, int amount_of_args, ValueType & result)
-{
- if( amount_of_args == 0 )
- Error( err_improper_amount_of_arguments );
-
- result = stack[sindex].value;
-
- for(int i=1 ; i<amount_of_args ; ++i )
- if( result.Add( stack[ sindex + i*2 ].value ) )
- Error( err_overflow );
-
- if( result.Div( amount_of_args ) )
- Error( err_overflow );
-}
-
-
-void Frac(int sindex, int amount_of_args, ValueType & result)
-{
- if( amount_of_args != 1 )
- Error( err_improper_amount_of_arguments );
-
- result = stack[sindex].value;
- result.RemainFraction();
-}
-
-
-
-
-/*!
- we use such a method because 'wvsprintf' is not everywhere defined
-*/
-void Sprintf(char * buffer, int par)
-{
-char buf[30]; // char, not wchar_t
-int i;
-
- #ifdef _MSC_VER
- #pragma warning( disable: 4996 )
- //warning C4996: 'sprintf': This function or variable may be unsafe.
- #endif
-
- sprintf(buf, "%d", par);
- for(i=0 ; buf[i] != 0 ; ++i)
- buffer[i] = buf[i];
-
- buffer[i] = 0;
-
- #ifdef _MSC_VER
- #pragma warning( default: 4996 )
- #endif
-}
-
-
-
-
-/*!
- this method returns the value from a user-defined function
-
- (look at the description in 'CallFunction(...)')
-*/
-bool GetValueOfUserDefinedFunction(const std::string & function_name, int amount_of_args, int sindex)
-{
- if( !puser_functions )
- return false;
-
- const char * string_value;
- int param;
-
- if( puser_functions->GetValueAndParam(function_name, &string_value, ¶m) != err_ok )
- return false;
-
- if( param != amount_of_args )
- Error( err_improper_amount_of_arguments );
-
-
- FunctionLocalVariables local_variables;
-
- if( amount_of_args > 0 )
- {
- char buffer[30];
-
- // x = x1
- buffer[0] = 'x';
- buffer[1] = 0;
- local_variables.insert( std::make_pair(buffer, stack[sindex].value) );
-
- for(int i=0 ; i<amount_of_args ; ++i)
- {
- buffer[0] = 'x';
- Sprintf(buffer+1, i+1);
- local_variables.insert( std::make_pair(buffer, stack[sindex + i*2].value) );
- }
- }
-
- stack[sindex-1].value = RecurrenceParsingVariablesOrFunction(false, function_name, string_value, &local_variables);
- calculated = true;
-
-return true;
-}
-
-
-/*
- we're calling a specific function
-
- function_name - name of the function
- amount_of_args - how many arguments there are on our stack
- (function must check whether this is a correct value or not)
- sindex - index of the first argument on the stack (sindex is greater than zero)
- if there aren't any arguments on the stack 'sindex' pointing on
- a non existend element (after the first bracket)
-
- result will be stored in 'stack[sindex-1].value'
- (we don't have to set the correct type of this element, it'll be set later)
-*/
-void CallFunction(const std::string & function_name, int amount_of_args, int sindex)
-{
- if( GetValueOfUserDefinedFunction(function_name, amount_of_args, sindex) )
- return;
-
- typename FunctionsTable::iterator i = functions_table.find( function_name );
-
- if( i == functions_table.end() )
- Error( err_unknown_function );
-
- /*
- calling the specify function
- */
- (this->*(i->second))(sindex, amount_of_args, stack[sindex-1].value);
- calculated = true;
-}
-
-
-
-
-
-/*!
- inserting a function to the functions' table
-
- function_name - name of the function
- pf - pointer to the function (to the wrapper)
-*/
-void InsertFunctionToTable(const char * function_name, pfunction pf)
-{
- std::string str;
- Misc::AssignString(str, function_name);
-
- functions_table.insert( std::make_pair(str, pf) );
-}
-
-
-
-/*!
- inserting a function to the variables' table
- (this function returns value of variable)
-
- variable_name - name of the function
- pf - pointer to the function
-*/
-void InsertVariableToTable(const char * variable_name, pfunction_var pf)
-{
- std::string str;
- Misc::AssignString(str, variable_name);
-
- variables_table.insert( std::make_pair(str, pf) );
-}
-
-
-/*!
- this method creates the table of functions
-*/
-void CreateFunctionsTable()
-{
- InsertFunctionToTable("gamma", &Parser<ValueType>::Gamma);
- InsertFunctionToTable("factorial", &Parser<ValueType>::Factorial);
- InsertFunctionToTable("abs", &Parser<ValueType>::Abs);
- InsertFunctionToTable("sin", &Parser<ValueType>::Sin);
- InsertFunctionToTable("cos", &Parser<ValueType>::Cos);
- InsertFunctionToTable("tan", &Parser<ValueType>::Tan);
- InsertFunctionToTable("tg", &Parser<ValueType>::Tan);
- InsertFunctionToTable("cot", &Parser<ValueType>::Cot);
- InsertFunctionToTable("ctg", &Parser<ValueType>::Cot);
- InsertFunctionToTable("int", &Parser<ValueType>::Int);
- InsertFunctionToTable("round", &Parser<ValueType>::Round);
- InsertFunctionToTable("ln", &Parser<ValueType>::Ln);
- InsertFunctionToTable("log", &Parser<ValueType>::Log);
- InsertFunctionToTable("exp", &Parser<ValueType>::Exp);
- InsertFunctionToTable("max", &Parser<ValueType>::Max);
- InsertFunctionToTable("min", &Parser<ValueType>::Min);
- InsertFunctionToTable("asin", &Parser<ValueType>::ASin);
- InsertFunctionToTable("acos", &Parser<ValueType>::ACos);
- InsertFunctionToTable("atan", &Parser<ValueType>::ATan);
- InsertFunctionToTable("atg", &Parser<ValueType>::ATan);
- InsertFunctionToTable("acot", &Parser<ValueType>::ACot);
- InsertFunctionToTable("actg", &Parser<ValueType>::ACot);
- InsertFunctionToTable("sgn", &Parser<ValueType>::Sgn);
- InsertFunctionToTable("mod", &Parser<ValueType>::Mod);
- InsertFunctionToTable("if", &Parser<ValueType>::If);
- InsertFunctionToTable("or", &Parser<ValueType>::Or);
- InsertFunctionToTable("and", &Parser<ValueType>::And);
- InsertFunctionToTable("not", &Parser<ValueType>::Not);
- InsertFunctionToTable("degtorad", &Parser<ValueType>::DegToRad);
- InsertFunctionToTable("radtodeg", &Parser<ValueType>::RadToDeg);
- InsertFunctionToTable("degtodeg", &Parser<ValueType>::DegToDeg);
- InsertFunctionToTable("gradtorad", &Parser<ValueType>::GradToRad);
- InsertFunctionToTable("radtograd", &Parser<ValueType>::RadToGrad);
- InsertFunctionToTable("degtograd", &Parser<ValueType>::DegToGrad);
- InsertFunctionToTable("gradtodeg", &Parser<ValueType>::GradToDeg);
- InsertFunctionToTable("ceil", &Parser<ValueType>::Ceil);
- InsertFunctionToTable("floor", &Parser<ValueType>::Floor);
- InsertFunctionToTable("sqrt", &Parser<ValueType>::Sqrt);
- InsertFunctionToTable("sinh", &Parser<ValueType>::Sinh);
- InsertFunctionToTable("cosh", &Parser<ValueType>::Cosh);
- InsertFunctionToTable("tanh", &Parser<ValueType>::Tanh);
- InsertFunctionToTable("tgh", &Parser<ValueType>::Tanh);
- InsertFunctionToTable("coth", &Parser<ValueType>::Coth);
- InsertFunctionToTable("ctgh", &Parser<ValueType>::Coth);
- InsertFunctionToTable("root", &Parser<ValueType>::Root);
- InsertFunctionToTable("asinh", &Parser<ValueType>::ASinh);
- InsertFunctionToTable("acosh", &Parser<ValueType>::ACosh);
- InsertFunctionToTable("atanh", &Parser<ValueType>::ATanh);
- InsertFunctionToTable("atgh", &Parser<ValueType>::ATanh);
- InsertFunctionToTable("acoth", &Parser<ValueType>::ACoth);
- InsertFunctionToTable("actgh", &Parser<ValueType>::ACoth);
- InsertFunctionToTable("bitand", &Parser<ValueType>::BitAnd);
- InsertFunctionToTable("bitor", &Parser<ValueType>::BitOr);
- InsertFunctionToTable("bitxor", &Parser<ValueType>::BitXor);
- InsertFunctionToTable("band", &Parser<ValueType>::BitAnd);
- InsertFunctionToTable("bor", &Parser<ValueType>::BitOr);
- InsertFunctionToTable("bxor", &Parser<ValueType>::BitXor);
- InsertFunctionToTable("sum", &Parser<ValueType>::Sum);
- InsertFunctionToTable("avg", &Parser<ValueType>::Avg);
- InsertFunctionToTable("frac", &Parser<ValueType>::Frac);
-}
-
-
-/*!
- this method creates the table of variables
-*/
-void CreateVariablesTable()
-{
- InsertVariableToTable("pi", &ValueType::SetPi);
- InsertVariableToTable("e", &ValueType::SetE);
-}
-
-
-/*!
- converting from a big letter to a small one
-*/
-int ToLowerCase(int c)
-{
- if( c>='A' && c<='Z' )
- return c - 'A' + 'a';
-
-return c;
-}
-
-
-/*!
- this method read the name of a variable or a function
-
- 'result' will be the name of a variable or a function
- function return 'false' if this name is the name of a variable
- or function return 'true' if this name is the name of a function
-
- what should be returned is tested just by a '(' character that means if there's
- a '(' character after a name that function returns 'true'
-*/
-bool ReadName(std::string & result)
-{
-int character;
-
-
- result.erase();
- character = *pstring;
-
- /*
- the first letter must be from range 'a' - 'z' or 'A' - 'Z'
- */
- if( ! (( character>='a' && character<='z' ) || ( character>='A' && character<='Z' )) )
- Error( err_unknown_character );
-
-
- do
- {
- result += static_cast<char>( character );
- character = * ++pstring;
- }
- while( (character>='a' && character<='z') ||
- (character>='A' && character<='Z') ||
- (character>='0' && character<='9') ||
- character=='_' );
-
-
- SkipWhiteCharacters();
-
-
- /*
- if there's a character '(' that means this name is a name of a function
- */
- if( *pstring == '(' )
- {
- ++pstring;
- return true;
- }
-
-
-return false;
-}
-
-
-/*!
- we're checking whether the first character is '-' or '+'
- if it is we'll return 'true' and if it is equally '-' we'll set the 'sign' member of 'result'
-*/
-bool TestSign(Item & result)
-{
- SkipWhiteCharacters();
- result.sign = false;
-
- if( *pstring == '-' || *pstring == '+' )
- {
- if( *pstring == '-' )
- result.sign = true;
-
- ++pstring;
-
- return true;
- }
-
-return false;
-}
-
-
-/*!
- we're reading the name of a variable or a function
- if is there a function we'll return 'true'
-*/
-bool ReadVariableOrFunction(Item & result)
-{
-std::string name;
-bool is_it_name_of_function = ReadName(name);
-
- if( is_it_name_of_function )
- {
- /*
- we've read the name of a function
- */
- result.function_name = name;
- result.type = Item::first_bracket;
- result.function = true;
- }
- else
- {
- /*
- we've read the name of a variable and we're getting its value now
- */
- result.value = GetValueOfVariable( name );
- }
-
-return is_it_name_of_function;
-}
-
-
-
-
-/*!
- we're reading a numerical value directly from the string
-*/
-void ReadValue(Item & result, int reading_base)
-{
-const char * new_stack_pointer;
-bool value_read;
-Conv conv;
-
- conv.base = reading_base;
- conv.comma = comma;
- conv.comma2 = comma2;
- conv.group = group;
-
- uint carry = result.value.FromString(pstring, conv, &new_stack_pointer, &value_read);
- pstring = new_stack_pointer;
-
- if( carry )
- Error( err_overflow );
-
- if( !value_read )
- Error( err_unknown_character );
-}
-
-
-/*!
- this method returns true if 'character' is a proper first digit for the value (or a comma -- can be first too)
-*/
-bool ValueStarts(int character, int base)
-{
- if( character == comma )
- return true;
-
- if( comma2!=0 && character==comma2 )
- return true;
-
- if( Misc::CharToDigit(character, base) != -1 )
- return true;
-
-return false;
-}
-
-
-/*!
- we're reading the item
-
- return values:
- 0 - all ok, the item is successfully read
- 1 - the end of the string (the item is not read)
- 2 - the final bracket ')'
-*/
-int ReadValueVariableOrFunction(Item & result)
-{
-bool it_was_sign = false;
-int character;
-
-
- if( TestSign(result) )
- // 'result.sign' was set as well
- it_was_sign = true;
-
- SkipWhiteCharacters();
- character = ToLowerCase( *pstring );
-
-
- if( character == 0 )
- {
- if( it_was_sign )
- // at the end of the string a character like '-' or '+' has left
- Error( err_unexpected_end );
-
- // there's the end of the string here
- return 1;
- }
- else
- if( character == '(' )
- {
- // we've got a normal bracket (not a function)
- result.type = Item::first_bracket;
- result.function = false;
- ++pstring;
-
- return 0;
- }
- else
- if( character == ')' )
- {
- // we've got a final bracket
- // (in this place we can find a final bracket only when there are empty brackets
- // without any values inside or with a sign '-' or '+' inside)
-
- if( it_was_sign )
- Error( err_unexpected_final_bracket );
-
- result.type = Item::last_bracket;
-
- // we don't increment 'pstring', this final bracket will be read next by the
- // 'ReadOperatorAndCheckFinalBracket(...)' method
-
- return 2;
- }
- else
- if( character == '#' )
- {
- ++pstring;
- SkipWhiteCharacters();
-
- // after '#' character we do not allow '-' or '+' (can be white characters)
- if( ValueStarts(*pstring, 16) )
- ReadValue( result, 16 );
- else
- Error( err_unknown_character );
- }
- else
- if( character == '&' )
- {
- ++pstring;
- SkipWhiteCharacters();
-
- // after '&' character we do not allow '-' or '+' (can be white characters)
- if( ValueStarts(*pstring, 2) )
- ReadValue( result, 2 );
- else
- Error( err_unknown_character );
- }
- else
- if( ValueStarts(character, base) )
- {
- ReadValue( result, base );
- }
- else
- if( character>='a' && character<='z' )
- {
- if( ReadVariableOrFunction(result) )
- // we've read the name of a function
- return 0;
- }
- else
- Error( err_unknown_character );
-
-
-
- /*
- we've got a value in the 'result'
- this value is from a variable or directly from the string
- */
- result.type = Item::numerical_value;
-
- if( result.sign )
- {
- result.value.ChangeSign();
- result.sign = false;
- }
-
-
-return 0;
-}
-
-
-void InsertOperatorToTable(const char * name, typename MatOperator::Type type)
-{
- operators_table.insert( std::make_pair(std::string(name), type) );
-}
-
-
-/*!
- this method creates the table of operators
-*/
-void CreateMathematicalOperatorsTable()
-{
- InsertOperatorToTable("||", MatOperator::lor);
- InsertOperatorToTable("&&", MatOperator::land);
- InsertOperatorToTable("!=", MatOperator::neq);
- InsertOperatorToTable("==", MatOperator::eq);
- InsertOperatorToTable(">=", MatOperator::get);
- InsertOperatorToTable("<=", MatOperator::let);
- InsertOperatorToTable(">", MatOperator::gt);
- InsertOperatorToTable("<", MatOperator::lt);
- InsertOperatorToTable("-", MatOperator::sub);
- InsertOperatorToTable("+", MatOperator::add);
- InsertOperatorToTable("/", MatOperator::div);
- InsertOperatorToTable("*", MatOperator::mul);
- InsertOperatorToTable("^", MatOperator::pow);
-}
-
-
-/*!
- returns true if 'str2' is the substring of str1
-
- e.g.
- true when str1="test" and str2="te"
-*/
-bool IsSubstring(const std::string & str1, const std::string & str2)
-{
- if( str2.length() > str1.length() )
- return false;
-
- for(typename std::string::size_type i=0 ; i<str2.length() ; ++i)
- if( str1[i] != str2[i] )
- return false;
-
-return true;
-}
-
-
-/*!
- this method reads a mathematical (or logical) operator
-*/
-void ReadMathematicalOperator(Item & result)
-{
-std::string oper;
-typename OperatorsTable::iterator iter_old, iter_new;
-
- iter_old = operators_table.end();
-
- for( ; true ; ++pstring )
- {
- oper += *pstring;
- iter_new = operators_table.lower_bound(oper);
-
- if( iter_new == operators_table.end() || !IsSubstring(iter_new->first, oper) )
- {
- oper.erase( --oper.end() ); // we've got mininum one element
-
- if( iter_old != operators_table.end() && iter_old->first == oper )
- {
- result.type = Item::mat_operator;
- result.moperator.SetType( iter_old->second );
- break;
- }
-
- Error( err_unknown_operator );
- }
-
- iter_old = iter_new;
- }
-}
-
-
-/*!
- this method makes a calculation for the percentage operator
- e.g.
- 1000-50% = 1000-(1000*0,5) = 500
-*/
-void OperatorPercentage()
-{
- if( stack_index < 3 ||
- stack[stack_index-1].type != Item::numerical_value ||
- stack[stack_index-2].type != Item::mat_operator ||
- stack[stack_index-3].type != Item::numerical_value )
- Error(err_percent_from);
-
- ++pstring;
- SkipWhiteCharacters();
-
- uint c = 0;
- c += stack[stack_index-1].value.Div(100);
- c += stack[stack_index-1].value.Mul(stack[stack_index-3].value);
-
- if( c )
- Error(err_overflow);
-}
-
-
-/*!
- this method reads a mathematic operators
- or the final bracket or the semicolon operator
-
- return values:
- 0 - ok
- 1 - the string is finished
-*/
-int ReadOperator(Item & result)
-{
- SkipWhiteCharacters();
-
- if( *pstring == '%' )
- OperatorPercentage();
-
-
- if( *pstring == 0 )
- return 1;
- else
- if( *pstring == ')' )
- {
- result.type = Item::last_bracket;
- ++pstring;
- }
- else
- if( *pstring == ';' || (param_sep!=0 && *pstring==param_sep) )
- {
- result.type = Item::semicolon;
- ++pstring;
- }
- else
- if( (*pstring>='a' && *pstring<='z') || (*pstring>='A' && *pstring<='Z') )
- {
- // short mul (without any operators)
-
- result.type = Item::mat_operator;
- result.moperator.SetType( MatOperator::shortmul );
- }
- else
- ReadMathematicalOperator(result);
-
-return 0;
-}
-
-
-
-/*!
- this method is making the standard mathematic operation like '-' '+' '*' '/' and '^'
-
- the operation is made between 'value1' and 'value2'
- the result of this operation is stored in the 'value1'
-*/
-void MakeStandardMathematicOperation(ValueType & value1, typename MatOperator::Type mat_operator,
- const ValueType & value2)
-{
-uint res;
-
- calculated = true;
-
- switch( mat_operator )
- {
- case MatOperator::land:
- (!value1.IsZero() && !value2.IsZero()) ? value1.SetOne() : value1.SetZero();
- break;
-
- case MatOperator::lor:
- (!value1.IsZero() || !value2.IsZero()) ? value1.SetOne() : value1.SetZero();
- break;
-
- case MatOperator::eq:
- (value1 == value2) ? value1.SetOne() : value1.SetZero();
- break;
-
- case MatOperator::neq:
- (value1 != value2) ? value1.SetOne() : value1.SetZero();
- break;
-
- case MatOperator::lt:
- (value1 < value2) ? value1.SetOne() : value1.SetZero();
- break;
-
- case MatOperator::gt:
- (value1 > value2) ? value1.SetOne() : value1.SetZero();
- break;
-
- case MatOperator::let:
- (value1 <= value2) ? value1.SetOne() : value1.SetZero();
- break;
-
- case MatOperator::get:
- (value1 >= value2) ? value1.SetOne() : value1.SetZero();
- break;
-
- case MatOperator::sub:
- if( value1.Sub(value2) ) Error( err_overflow );
- break;
-
- case MatOperator::add:
- if( value1.Add(value2) ) Error( err_overflow );
- break;
-
- case MatOperator::mul:
- case MatOperator::shortmul:
- if( value1.Mul(value2) ) Error( err_overflow );
- break;
-
- case MatOperator::div:
- if( value2.IsZero() ) Error( err_division_by_zero );
- if( value1.Div(value2) ) Error( err_overflow );
- break;
-
- case MatOperator::pow:
- res = value1.Pow( value2 );
-
- if( res == 1 ) Error( err_overflow );
- else
- if( res == 2 ) Error( err_improper_argument );
-
- break;
-
- default:
- /*
- on the stack left an unknown operator but we had to recognize its before
- that means there's an error in our algorithm
- */
- Error( err_internal_error );
- }
-}
-
-
-
-
-/*!
- this method is trying to roll the stack up with the operator's priority
-
- for example if there are:
- "1 - 2 +"
- we can subtract "1-2" and the result store on the place where is '1' and copy the last
- operator '+', that means there'll be '-1+' on our stack
-
- but if there are:
- "1 - 2 *"
- we can't roll the stack up because the operator '*' has greater priority than '-'
-*/
-void TryRollingUpStackWithOperatorPriority()
-{
- while( stack_index>=4 &&
- stack[stack_index-4].type == Item::numerical_value &&
- stack[stack_index-3].type == Item::mat_operator &&
- stack[stack_index-2].type == Item::numerical_value &&
- stack[stack_index-1].type == Item::mat_operator &&
- (
- (
- // the first operator has greater priority
- stack[stack_index-3].moperator.GetPriority() > stack[stack_index-1].moperator.GetPriority()
- ) ||
- (
- // or both operators have the same priority and the first operator is not right associative
- stack[stack_index-3].moperator.GetPriority() == stack[stack_index-1].moperator.GetPriority() &&
- stack[stack_index-3].moperator.GetAssoc() == MatOperator::non_right
- )
- )
- )
- {
- MakeStandardMathematicOperation(stack[stack_index-4].value,
- stack[stack_index-3].moperator.GetType(),
- stack[stack_index-2].value);
-
-
- /*
- copying the last operator and setting the stack pointer to the correct value
- */
- stack[stack_index-3] = stack[stack_index-1];
- stack_index -= 2;
- }
-}
-
-
-/*!
- this method is trying to roll the stack up without testing any operators
-
- for example if there are:
- "1 - 2"
- there'll be "-1" on our stack
-*/
-void TryRollingUpStack()
-{
- while( stack_index >= 3 &&
- stack[stack_index-3].type == Item::numerical_value &&
- stack[stack_index-2].type == Item::mat_operator &&
- stack[stack_index-1].type == Item::numerical_value )
- {
- MakeStandardMathematicOperation( stack[stack_index-3].value,
- stack[stack_index-2].moperator.GetType(),
- stack[stack_index-1].value );
-
- stack_index -= 2;
- }
-}
-
-
-/*!
- this method is reading a value or a variable or a function
- (the normal first bracket as well) and push it into the stack
-*/
-int ReadValueVariableOrFunctionAndPushItIntoStack(Item & temp)
-{
-int code = ReadValueVariableOrFunction( temp );
-
- if( code == 0 )
- {
- if( stack_index < stack.size() )
- stack[stack_index] = temp;
- else
- stack.push_back( temp );
-
- ++stack_index;
- }
-
- if( code == 2 )
- // there was a final bracket, we didn't push it into the stack
- // (it'll be read by the 'ReadOperatorAndCheckFinalBracket' method next)
- code = 0;
-
-
-return code;
-}
-
-
-
-/*!
- this method calculate how many parameters there are on the stack
- and the index of the first parameter
-
- if there aren't any parameters on the stack this method returns
- 'size' equals zero and 'index' pointing after the first bracket
- (on non-existend element)
-*/
-void HowManyParameters(int & size, int & index)
-{
- size = 0;
- index = stack_index;
-
- if( index == 0 )
- // we haven't put a first bracket on the stack
- Error( err_unexpected_final_bracket );
-
-
- if( stack[index-1].type == Item::first_bracket )
- // empty brackets
- return;
-
- for( --index ; index>=1 ; index-=2 )
- {
- if( stack[index].type != Item::numerical_value )
- {
- /*
- this element must be 'numerical_value', if not that means
- there's an error in our algorithm
- */
- Error( err_internal_error );
- }
-
- ++size;
-
- if( stack[index-1].type != Item::semicolon )
- break;
- }
-
- if( index<1 || stack[index-1].type != Item::first_bracket )
- {
- /*
- we haven't put a first bracket on the stack
- */
- Error( err_unexpected_final_bracket );
- }
-}
-
-
-/*!
- this method is being called when the final bracket ')' is being found
-
- this method's rolling the stack up, counting how many parameters there are
- on the stack and if there was a function it's calling the function
-*/
-void RollingUpFinalBracket()
-{
-int amount_of_parameters;
-int index;
-
-
- if( stack_index<1 ||
- (stack[stack_index-1].type != Item::numerical_value &&
- stack[stack_index-1].type != Item::first_bracket)
- )
- Error( err_unexpected_final_bracket );
-
-
- TryRollingUpStack();
- HowManyParameters(amount_of_parameters, index);
-
- // 'index' will be greater than zero
- // 'amount_of_parameters' can be zero
-
-
- if( amount_of_parameters==0 && !stack[index-1].function )
- Error( err_unexpected_final_bracket );
-
-
- bool was_sign = stack[index-1].sign;
-
-
- if( stack[index-1].function )
- {
- // the result of a function will be on 'stack[index-1]'
- // and then at the end we'll set the correct type (numerical value) of this element
- CallFunction(stack[index-1].function_name, amount_of_parameters, index);
- }
- else
- {
- /*
- there was a normal bracket (not a funcion)
- */
- if( amount_of_parameters != 1 )
- Error( err_unexpected_semicolon_operator );
-
-
- /*
- in the place where is the bracket we put the result
- */
- stack[index-1] = stack[index];
- }
-
-
- /*
- if there was a '-' character before the first bracket
- we change the sign of the expression
- */
- stack[index-1].sign = false;
-
- if( was_sign )
- stack[index-1].value.ChangeSign();
-
- stack[index-1].type = Item::numerical_value;
-
-
- /*
- the pointer of the stack will be pointing on the next (non-existing now) element
- */
- stack_index = index;
-}
-
-
-/*!
- this method is putting the operator on the stack
-*/
-
-void PushOperatorIntoStack(Item & temp)
-{
- if( stack_index < stack.size() )
- stack[stack_index] = temp;
- else
- stack.push_back( temp );
-
- ++stack_index;
-}
-
-
-
-/*!
- this method is reading a operator and if it's a final bracket
- it's calling RollingUpFinalBracket() and reading a operator again
-*/
-int ReadOperatorAndCheckFinalBracket(Item & temp)
-{
- do
- {
- if( ReadOperator(temp) == 1 )
- {
- /*
- the string is finished
- */
- return 1;
- }
-
- if( temp.type == Item::last_bracket )
- RollingUpFinalBracket();
-
- }
- while( temp.type == Item::last_bracket );
-
-return 0;
-}
-
-
-/*!
- we check wheter there are only numerical value's or 'semicolon' operators on the stack
-*/
-void CheckIntegrityOfStack()
-{
- for(unsigned int i=0 ; i<stack_index; ++i)
- {
- if( stack[i].type != Item::numerical_value &&
- stack[i].type != Item::semicolon)
- {
- /*
- on the stack we must only have 'numerical_value' or 'semicolon' operator
- if there is something another that means
- we probably didn't close any of the 'first' bracket
- */
- Error( err_stack_not_clear );
- }
- }
-}
-
-
-
-/*!
- the main loop of parsing
-*/
-void Parse()
-{
-Item item;
-int result_code;
-
-
- while( true )
- {
- if( pstop_calculating && pstop_calculating->WasStopSignal() )
- Error( err_interrupt );
-
- result_code = ReadValueVariableOrFunctionAndPushItIntoStack( item );
-
- if( result_code == 0 )
- {
- if( item.type == Item::first_bracket )
- continue;
-
- result_code = ReadOperatorAndCheckFinalBracket( item );
- }
-
-
- if( result_code==1 || item.type==Item::semicolon )
- {
- /*
- the string is finished or the 'semicolon' operator has appeared
- */
-
- if( stack_index == 0 )
- Error( err_nothing_has_read );
-
- TryRollingUpStack();
-
- if( result_code == 1 )
- {
- CheckIntegrityOfStack();
-
- return;
- }
- }
-
-
- PushOperatorIntoStack( item );
- TryRollingUpStackWithOperatorPriority();
- }
-}
-
-/*!
- this method is called at the end of the parsing process
-
- on our stack we can have another value than 'numerical_values' for example
- when someone use the operator ';' in the global scope or there was an error during
- parsing and the parser hasn't finished its job
-
- if there was an error the stack is cleaned up now
- otherwise we resize stack and leave on it only 'numerical_value' items
-*/
-void NormalizeStack()
-{
- if( error!=err_ok || stack_index==0 )
- {
- stack.clear();
- return;
- }
-
-
- /*
- 'stack_index' tell us how many elements there are on the stack,
- we must resize the stack now because 'stack_index' is using only for parsing
- and stack has more (or equal) elements than value of 'stack_index'
- */
- stack.resize( stack_index );
-
- for(uint i=stack_index-1 ; i!=uint(-1) ; --i)
- {
- if( stack[i].type != Item::numerical_value )
- stack.erase( stack.begin() + i );
- }
-}
-
-
-public:
-
-
-/*!
- the default constructor
-*/
-Parser(): default_stack_size(100)
-{
- pstop_calculating = 0;
- puser_variables = 0;
- puser_functions = 0;
- pfunction_local_variables = 0;
- base = 10;
- deg_rad_grad = 1;
- error = err_ok;
- group = 0;
- comma = '.';
- comma2 = ',';
- param_sep = 0;
-
- CreateFunctionsTable();
- CreateVariablesTable();
- CreateMathematicalOperatorsTable();
-}
-
-
-/*!
- the assignment operator
-*/
-Parser<ValueType> & operator=(const Parser<ValueType> & p)
-{
- pstop_calculating = p.pstop_calculating;
- puser_variables = p.puser_variables;
- puser_functions = p.puser_functions;
- pfunction_local_variables = 0;
- base = p.base;
- deg_rad_grad = p.deg_rad_grad;
- error = p.error;
- group = p.group;
- comma = p.comma;
- comma2 = p.comma2;
- param_sep = p.param_sep;
-
- /*
- we don't have to call 'CreateFunctionsTable()' etc.
- we can only copy these tables
- */
- functions_table = p.functions_table;
- variables_table = p.variables_table;
- operators_table = p.operators_table;
-
- visited_variables = p.visited_variables;
- visited_functions = p.visited_functions;
-
-return *this;
-}
-
-
-/*!
- the copying constructor
-*/
-Parser(const Parser<ValueType> & p): default_stack_size(p.default_stack_size)
-{
- operator=(p);
-}
-
-
-/*!
- the new base of mathematic system
- default is 10
-*/
-void SetBase(int b)
-{
- if( b>=2 && b<=16 )
- base = b;
-}
-
-
-/*!
- the unit of angles used in: sin,cos,tan,cot,asin,acos,atan,acot
- 0 - deg
- 1 - rad (default)
- 2 - grad
-*/
-void SetDegRadGrad(int angle)
-{
- if( angle >= 0 || angle <= 2 )
- deg_rad_grad = angle;
-}
-
-/*!
- this method sets a pointer to the object which tell us whether we should stop
- calculations
-*/
-void SetStopObject(const volatile StopCalculating * ps)
-{
- pstop_calculating = ps;
-}
-
-
-/*!
- this method sets the new table of user-defined variables
- if you don't want any other variables just put zero value into the 'puser_variables' variable
-
- (you can have only one table at the same time)
-*/
-void SetVariables(const Objects * pv)
-{
- puser_variables = pv;
-}
-
-
-/*!
- this method sets the new table of user-defined functions
- if you don't want any other functions just put zero value into the 'puser_functions' variable
-
- (you can have only one table at the same time)
-*/
-void SetFunctions(const Objects * pf)
-{
- puser_functions = pf;
-}
-
-
-/*!
- setting the group character
- default zero (not used)
-*/
-void SetGroup(int g)
-{
- group = g;
-}
-
-
-/*!
- setting the main comma operator and the additional comma operator
- the additional operator can be zero (which means it is not used)
- default are: '.' and ','
-*/
-void SetComma(int c, int c2 = 0)
-{
- comma = c;
- comma2 = c2;
-}
-
-
-/*!
- setting an additional character which is used as a parameters separator
- the main parameters separator is a semicolon (is used always)
-
- this character is used also as a global separator
-*/
-void SetParamSep(int s)
-{
- param_sep = s;
-}
-
-
-/*!
- the main method using for parsing string
-*/
-ErrorCode Parse(const char * str)
-{
- stack_index = 0;
- pstring = str;
- error = err_ok;
- calculated = false;
-
- stack.resize( default_stack_size );
-
- try
- {
- Parse();
- }
- catch(ErrorCode c)
- {
- error = c;
- calculated = false;
- }
-
- NormalizeStack();
-
-return error;
-}
-
-
-/*!
- the main method using for parsing string
-*/
-ErrorCode Parse(const std::string & str)
-{
- return Parse(str.c_str());
-}
-
-
-#ifndef TTMATH_DONT_USE_WCHAR
-
-/*!
- the main method using for parsing string
-*/
-ErrorCode Parse(const wchar_t * str)
-{
- Misc::AssignString(wide_to_ansi, str);
-
-return Parse(wide_to_ansi.c_str());
-
- // !! wide_to_ansi clearing can be added here
-}
-
-
-/*!
- the main method using for parsing string
-*/
-ErrorCode Parse(const std::wstring & str)
-{
- return Parse(str.c_str());
-}
-
-#endif
-
-
-/*!
- this method returns true is something was calculated
- (at least one mathematical operator was used or a function or variable)
- e.g. true if the string to Parse() looked like this:
- "1+1"
- "2*3"
- "sin(5)"
-
- if the string was e.g. "678" the result is false
-*/
-bool Calculated()
-{
- return calculated;
-}
-
-
-};
-
-
-
-} // namespace
-
-
-#endif
diff --git a/ttmath/ttmaththreads.h b/ttmath/ttmaththreads.h
deleted file mode 100644
index 586227f..0000000
--- a/ttmath/ttmaththreads.h
+++ /dev/null
@@ -1,250 +0,0 @@
-/*
- * This file is a part of TTMath Bignum Library
- * and is distributed under the (new) BSD licence.
- * Author: Tomasz Sowa <t.sowa at ttmath.org>
- */
-
-/*
- * Copyright (c) 2006-2009, Tomasz Sowa
- * All rights reserved.
- *
- * Redistribution and use in source and binary forms, with or without
- * modification, are permitted provided that the following conditions are met:
- *
- * * Redistributions of source code must retain the above copyright notice,
- * this list of conditions and the following disclaimer.
- *
- * * Redistributions in binary form must reproduce the above copyright
- * notice, this list of conditions and the following disclaimer in the
- * documentation and/or other materials provided with the distribution.
- *
- * * Neither the name Tomasz Sowa nor the names of contributors to this
- * project may be used to endorse or promote products derived
- * from this software without specific prior written permission.
- *
- * THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS"
- * AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
- * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- * ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE
- * LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR
- * CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF
- * SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS
- * INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN
- * CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
- * ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF
- * THE POSSIBILITY OF SUCH DAMAGE.
- */
-
-
-
-#ifndef headerfilettmaththreads
-#define headerfilettmaththreads
-
-#include "ttmathtypes.h"
-
-#ifdef TTMATH_WIN32_THREADS
-#include <windows.h>
-#include <cstdio>
-#endif
-
-#ifdef TTMATH_POSIX_THREADS
-#include <pthread.h>
-#endif
-
-
-
-/*!
- \file ttmaththreads.h
- \brief Some objects used in multithreads environment
-*/
-
-
-/*
- this is a simple skeleton of a program in multithreads environment:
-
- #define TTMATH_MULTITHREADS
- #include<ttmath/ttmath.h>
-
- TTMATH_MULTITHREADS_HELPER
-
- int main()
- {
- [...]
- }
-
- make sure that macro TTMATH_MULTITHREADS is defined and (somewhere in *.cpp file)
- use TTMATH_MULTITHREADS_HELPER macro (outside of any classes/functions/namespaces scope)
-*/
-
-
-namespace ttmath
-{
-
-
-#ifdef TTMATH_WIN32_THREADS
-
- /*
- we use win32 threads
- */
-
-
- /*!
- in multithreads environment you should use TTMATH_MULTITHREADS_HELPER macro
- somewhere in *.cpp file
-
- (at the moment in win32 this macro does nothing)
- */
- #define TTMATH_MULTITHREADS_HELPER
-
-
- /*!
- objects of this class are used to synchronize
- */
- class ThreadLock
- {
- HANDLE mutex_handle;
-
-
- void CreateName(char * buffer) const
- {
- #ifdef _MSC_VER
- #pragma warning (disable : 4996)
- // warning C4996: 'sprintf': This function or variable may be unsafe. Consider using sprintf_s instead.
- #endif
-
- sprintf(buffer, "TTMATH_LOCK_%ul", (unsigned long)GetCurrentProcessId());
-
- #ifdef _MSC_VER
- #pragma warning (default : 4996)
- #endif
- }
-
-
- public:
-
- bool Lock()
- {
- char buffer[50];
-
- CreateName(buffer);
- mutex_handle = CreateMutexA(0, false, buffer);
-
- if( mutex_handle == 0 )
- return false;
-
- WaitForSingleObject(mutex_handle, INFINITE);
-
- return true;
- }
-
-
- ThreadLock()
- {
- mutex_handle = 0;
- }
-
-
- ~ThreadLock()
- {
- if( mutex_handle != 0 )
- {
- ReleaseMutex(mutex_handle);
- CloseHandle(mutex_handle);
- }
- }
- };
-
-#endif // #ifdef TTMATH_WIN32_THREADS
-
-
-
-
-
-#ifdef TTMATH_POSIX_THREADS
-
- /*
- we use posix threads
- */
-
-
- /*!
- in multithreads environment you should use TTMATH_MULTITHREADS_HELPER macro
- somewhere in *.cpp file
- (this macro defines a pthread_mutex_t object used by TTMath library)
- */
- #define TTMATH_MULTITHREADS_HELPER \
- namespace ttmath \
- { \
- pthread_mutex_t ttmath_mutex = PTHREAD_MUTEX_INITIALIZER; \
- }
-
-
- /*!
- ttmath_mutex will be defined by TTMATH_MULTITHREADS_HELPER macro
- */
- extern pthread_mutex_t ttmath_mutex;
-
-
- /*!
- objects of this class are used to synchronize
- */
- class ThreadLock
- {
- public:
-
- bool Lock()
- {
- if( pthread_mutex_lock(&ttmath_mutex) != 0 )
- return false;
-
- return true;
- }
-
-
- ~ThreadLock()
- {
- pthread_mutex_unlock(&ttmath_mutex);
- }
- };
-
-#endif // #ifdef TTMATH_POSIX_THREADS
-
-
-
-
-#if !defined(TTMATH_POSIX_THREADS) && !defined(TTMATH_WIN32_THREADS)
-
- /*!
- we don't use win32 and pthreads
- */
-
- /*!
- */
- #define TTMATH_MULTITHREADS_HELPER
-
-
- /*!
- objects of this class are used to synchronize
- actually we don't synchronize, the method Lock() returns always 'false'
- */
- class ThreadLock
- {
- public:
-
- bool Lock()
- {
- return false;
- }
- };
-
-
-#endif // #if !defined(TTMATH_POSIX_THREADS) && !defined(TTMATH_WIN32_THREADS)
-
-
-
-
-
-} // namespace
-
-#endif
-
diff --git a/ttmath/ttmathtypes.h b/ttmath/ttmathtypes.h
deleted file mode 100644
index 0590d2f..0000000
--- a/ttmath/ttmathtypes.h
+++ /dev/null
@@ -1,667 +0,0 @@
-/*
- * This file is a part of TTMath Bignum Library
- * and is distributed under the (new) BSD licence.
- * Author: Tomasz Sowa <t.sowa at ttmath.org>
- */
-
-/*
- * Copyright (c) 2006-2010, Tomasz Sowa
- * All rights reserved.
- *
- * Redistribution and use in source and binary forms, with or without
- * modification, are permitted provided that the following conditions are met:
- *
- * * Redistributions of source code must retain the above copyright notice,
- * this list of conditions and the following disclaimer.
- *
- * * Redistributions in binary form must reproduce the above copyright
- * notice, this list of conditions and the following disclaimer in the
- * documentation and/or other materials provided with the distribution.
- *
- * * Neither the name Tomasz Sowa nor the names of contributors to this
- * project may be used to endorse or promote products derived
- * from this software without specific prior written permission.
- *
- * THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS"
- * AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
- * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- * ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE
- * LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR
- * CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF
- * SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS
- * INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN
- * CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
- * ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF
- * THE POSSIBILITY OF SUCH DAMAGE.
- */
-
-
-#ifndef headerfilettmathtypes
-#define headerfilettmathtypes
-
-/*!
- \file ttmathtypes.h
- \brief constants used in the library
-
- As our library is written in header files (templates) we cannot use
- constants like 'const int' etc. because we should have some source files
- *.cpp to define this variables. Only what we can have are constants
- defined by #define preprocessor macros.
-
- All macros are preceded by TTMATH_ prefix
-*/
-
-
-#include <stdexcept>
-#include <sstream>
-#include <vector>
-
-#ifndef _MSC_VER
-#include <stdint.h>
-// for uint64_t and int64_t on a 32 bit platform
-#endif
-
-
-
-/*!
- the version of the library
-
- TTMATH_PRERELEASE_VER is either zero or one
- zero means that this is the release version of the library
- (one means something like beta)
-*/
-#define TTMATH_MAJOR_VER 0
-#define TTMATH_MINOR_VER 9
-#define TTMATH_REVISION_VER 2
-
-#define TTMATH_PRERELEASE_VER 0
-
-
-
-/*!
- you can define a platform explicitly by defining either
- TTMATH_PLATFORM32 or TTMATH_PLATFORM64 macro
-*/
-#if !defined TTMATH_PLATFORM32 && !defined TTMATH_PLATFORM64
-
- #if !defined _M_X64 && !defined __x86_64__
-
- /*
- other platforms than x86 and amd64 are not recognized at the moment
- so you should set TTMATH_PLATFORMxx manually
- */
-
- // we're using a 32bit platform
- #define TTMATH_PLATFORM32
-
- #else
-
- // we're using a 64bit platform
- #define TTMATH_PLATFORM64
-
- #endif
-
-#endif
-
-
-/*!
- asm version of the library is available by default only for:
- x86 and amd64 platforms and for Microsoft Visual and GCC compilers
-
- but you can force using asm version (the same asm as for Microsoft Visual)
- by defining TTMATH_FORCEASM macro
- you have to be sure that your compiler accept such an asm format
-*/
-#ifndef TTMATH_FORCEASM
-
- #if !defined __i386__ && !defined _X86_ && !defined _M_IX86 && !defined __x86_64__ && !defined _M_X64
- /*!
- x86 architecture:
- __i386__ defined by GNU C
- _X86_ defined by MinGW32
- _M_IX86 defined by Visual Studio, Intel C/C++, Digital Mars and Watcom C/C++
-
- amd64 architecture:
- __x86_64__ defined by GNU C and Sun Studio
- _M_X64 defined by Visual Studio
-
- asm version is available only for x86 or amd64 platforms
- */
- #define TTMATH_NOASM
- #endif
-
-
-
- #if !defined _MSC_VER && !defined __GNUC__
- /*!
- another compilers than MS VC or GCC by default use no asm version
- */
- #define TTMATH_NOASM
- #endif
-
-#endif
-
-
-namespace ttmath
-{
-
-
-#ifdef TTMATH_PLATFORM32
-
- /*!
- on 32bit platforms one word (uint, sint) will be equal 32bits
- */
- typedef unsigned int uint;
- typedef signed int sint;
-
- /*!
- on 32 bit platform ulint and slint will be equal 64 bits
- */
- #ifdef _MSC_VER
- // long long on MS Windows (Visual and GCC mingw compilers) have 64 bits
- // stdint.h is not available on Visual Studio prior to VS 2010 version
- typedef unsigned long long int ulint;
- typedef signed long long int slint;
- #else
- // we do not use 'long' here because there is a difference in unix and windows
- // environments: in unix 'long' has 64 bits but in windows it has only 32 bits
- typedef uint64_t ulint;
- typedef int64_t slint;
- #endif
-
- /*!
- how many bits there are in the uint type
- */
- #define TTMATH_BITS_PER_UINT 32u
-
- /*!
- the mask for the highest bit in the unsigned 32bit word (2^31)
- */
- #define TTMATH_UINT_HIGHEST_BIT 2147483648u
-
- /*!
- the max value of the unsigned 32bit word (2^32 - 1)
- (all bits equal one)
- */
- #define TTMATH_UINT_MAX_VALUE 4294967295u
-
- /*!
- the number of words (32bit words on 32bit platform)
- which are kept in built-in variables for a Big<> type
- (these variables are defined in ttmathbig.h)
- */
- #define TTMATH_BUILTIN_VARIABLES_SIZE 256u
-
- /*!
- this macro returns the number of machine words
- capable to hold min_bits bits
- e.g. TTMATH_BITS(128) returns 4
- */
- #define TTMATH_BITS(min_bits) ((min_bits-1)/32 + 1)
-
-#else
-
- /*!
- on 64bit platforms one word (uint, sint) will be equal 64bits
- */
- #ifdef _MSC_VER
- /* in VC 'long' type has 32 bits, __int64 is VC extension */
- typedef unsigned __int64 uint;
- typedef signed __int64 sint;
- #else
- typedef unsigned long uint;
- typedef signed long sint;
- #endif
-
- /*!
- on 64bit platforms we do not define ulint and slint
- */
-
- /*!
- how many bits there are in the uint type
- */
- #define TTMATH_BITS_PER_UINT 64ul
-
- /*!
- the mask for the highest bit in the unsigned 64bit word (2^63)
- */
- #define TTMATH_UINT_HIGHEST_BIT 9223372036854775808ul
-
- /*!
- the max value of the unsigned 64bit word (2^64 - 1)
- (all bits equal one)
- */
- #define TTMATH_UINT_MAX_VALUE 18446744073709551615ul
-
- /*!
- the number of words (64bit words on 64bit platforms)
- which are kept in built-in variables for a Big<> type
- (these variables are defined in ttmathbig.h)
- */
- #define TTMATH_BUILTIN_VARIABLES_SIZE 128ul
-
- /*!
- this macro returns the number of machine words
- capable to hold min_bits bits
- e.g. TTMATH_BITS(128) returns 2
- */
- #define TTMATH_BITS(min_bits) ((min_bits-1)/64 + 1)
-
-#endif
-}
-
-
-#if defined(TTMATH_MULTITHREADS) && !defined(TTMATH_MULTITHREADS_NOSYNC)
- #if !defined(TTMATH_POSIX_THREADS) && !defined(TTMATH_WIN32_THREADS)
-
- #if defined(_WIN32)
- #define TTMATH_WIN32_THREADS
- #elif defined(unix) || defined(__unix__) || defined(__unix)
- #define TTMATH_POSIX_THREADS
- #endif
-
- #endif
-#endif
-
-
-
-/*!
- this variable defines how many iterations are performed
- during some kind of calculating when we're making any long formulas
- (for example Taylor series)
-
- it's used in ExpSurrounding0(...), LnSurrounding1(...), Sin0pi05(...), etc.
-
- note! there'll not be so many iterations, iterations are stopped when
- there is no sense to continue calculating (for example when the result
- still remains unchanged after adding next series and we know that the next
- series are smaller than previous ones)
-*/
-#define TTMATH_ARITHMETIC_MAX_LOOP 10000
-
-
-
-/*!
- this is a limit when calculating Karatsuba multiplication
- if the size of a vector is smaller than TTMATH_USE_KARATSUBA_MULTIPLICATION_FROM_SIZE
- the Karatsuba algorithm will use standard schoolbook multiplication
-*/
-#ifdef TTMATH_DEBUG_LOG
- // if TTMATH_DEBUG_LOG is defined then we should use the same size regardless of the compiler
- #define TTMATH_USE_KARATSUBA_MULTIPLICATION_FROM_SIZE 3
-#else
- #ifdef __GNUC__
- #define TTMATH_USE_KARATSUBA_MULTIPLICATION_FROM_SIZE 3
- #else
- #define TTMATH_USE_KARATSUBA_MULTIPLICATION_FROM_SIZE 5
- #endif
-#endif
-
-
-/*!
- this is a special value used when calculating the Gamma(x) function
- if x is greater than this value then the Gamma(x) will be calculated using
- some kind of series
-
- don't use smaller values than about 100
-*/
-#define TTMATH_GAMMA_BOUNDARY 2000
-
-
-
-
-
-namespace ttmath
-{
-
- /*!
- lib type codes:
- asm_vc_32 - with asm code designed for Microsoft Visual C++ (32 bits)
- asm_gcc_32 - with asm code designed for GCC (32 bits)
- asm_vc_64 - with asm for VC (64 bit)
- asm_gcc_64 - with asm for GCC (64 bit)
- no_asm_32 - pure C++ version (32 bit) - without any asm code
- no_asm_64 - pure C++ version (64 bit) - without any asm code
- */
- enum LibTypeCode
- {
- asm_vc_32 = 0,
- asm_gcc_32,
- asm_vc_64,
- asm_gcc_64,
- no_asm_32,
- no_asm_64
- };
-
-
- /*!
- error codes
- */
- enum ErrorCode
- {
- err_ok = 0,
- err_nothing_has_read,
- err_unknown_character,
- err_unexpected_final_bracket,
- err_stack_not_clear,
- err_unknown_variable,
- err_division_by_zero,
- err_interrupt,
- err_overflow,
- err_unknown_function,
- err_unknown_operator,
- err_unexpected_semicolon_operator,
- err_improper_amount_of_arguments,
- err_improper_argument,
- err_unexpected_end,
- err_internal_error,
- err_incorrect_name,
- err_incorrect_value,
- err_variable_exists,
- err_variable_loop,
- err_functions_loop,
- err_must_be_only_one_value,
- err_object_exists,
- err_unknown_object,
- err_still_calculating,
- err_in_short_form_used_function,
- err_percent_from
- };
-
-
- /*!
- this struct is used when converting to/from a string
- /temporarily only in Big::ToString() and Big::FromString()/
- */
- struct Conv
- {
- /*!
- base (radix) on which the value will be shown (or read)
- default: 10
- */
- uint base;
-
-
- /*!
- used only in Big::ToString()
- if true the value will be always shown in the scientific mode, e.g: 123e+30
- default: false
- */
- bool scient;
-
-
- /*!
- used only in Big::ToString()
- if scient is false then the value will be printed in the scientific mode
- only if the exponent is greater than scien_from
- default: 15
- */
- sint scient_from;
-
-
- /*!
- if 'base_round' is true and 'base' is different from 2, 4, 8, or 16
- and the result value is not an integer then we make an additional rounding
- (after converting the last digit from the result is skipped)
- default: true
-
- e.g.
- Conv c;
- c.base_round = false;
- Big<1, 1> a = "0.1"; // decimal input
- std::cout << a.ToString(c) << std::endl; // the result is: 0.099999999
- */
- bool base_round;
-
-
- /*!
- used only in Big::ToString()
- tells how many digits after comma are possible
- default: -1 which means all digits are printed
-
- set it to zero if you want integer value only
-
- for example when the value is:
- 12.345678 and 'round' is 4
- then the result will be
- 12.3457 (the last digit was rounded)
- */
- sint round;
-
-
- /*!
- if true that not mattered digits in the mantissa will be cut off
- (zero characters at the end -- after the comma operator)
- e.g. 1234,78000 will be: 1234,78
- default: true
- */
- bool trim_zeroes;
-
-
- /*!
- the main comma operator (used when reading and writing)
- default is a dot '.'
- */
- uint comma;
-
-
- /*!
- additional comma operator (used only when reading)
- if you don't want it just set it to zero
- default is a comma ','
-
- this allowes you to convert from a value:
- 123.45 as well as from 123,45
- */
- uint comma2;
-
-
- /*!
- it sets the character which is used for grouping
- if group=' ' then: 1234,56789 will be printed as: 1 234,567 89
-
- if you don't want grouping just set it to zero (which is default)
- */
- uint group;
-
-
- /*!
- */
- uint group_exp; // not implemented yet
-
-
-
-
- Conv()
- {
- // default values
- base = 10;
- scient = false;
- scient_from = 15;
- base_round = true;
- round = -1;
- trim_zeroes = true;
- comma = '.';
- comma2 = ',';
- group = 0;
- group_exp = 0;
- }
- };
-
-
-
- /*!
- this simple class can be used in multithreading model
- (you can write your own class derived from this one)
-
- for example: in some functions like Factorial()
- /at the moment only Factorial/ you can give a pointer to
- the 'stop object', if the method WasStopSignal() of this
- object returns true that means we should break the calculating
- and return
- */
- class StopCalculating
- {
- public:
- virtual bool WasStopSignal() const volatile { return false; }
- virtual ~StopCalculating(){}
- };
-
-
- /*!
- a small class which is useful when compiling with gcc
-
- object of this type holds the name and the line of a file
- in which the macro TTMATH_ASSERT or TTMATH_REFERENCE_ASSERT was used
- */
- class ExceptionInfo
- {
- const char * file;
- int line;
-
- public:
- ExceptionInfo() : file(0), line(0) {}
- ExceptionInfo(const char * f, int l) : file(f), line(l) {}
-
- std::string Where() const
- {
- if( !file )
- return "unknown";
-
- std::ostringstream result;
- result << file << ":" << line;
-
- return result.str();
- }
- };
-
-
- /*!
- A small class used for reporting 'reference' errors
-
- In the library is used macro TTMATH_REFERENCE_ASSERT which
- can throw an exception of this type
-
- ** from version 0.9.2 this macro is removed from all methods
- in public interface so you don't have to worry about it **
-
- If you compile with gcc you can get a small benefit
- from using method Where() (it returns std::string) with
- the name and the line of a file where the macro TTMATH_REFERENCE_ASSERT
- was used)
- */
- class ReferenceError : public std::logic_error, public ExceptionInfo
- {
- public:
-
- ReferenceError() : std::logic_error("reference error")
- {
- }
-
- ReferenceError(const char * f, int l) :
- std::logic_error("reference error"), ExceptionInfo(f,l)
- {
- }
-
- std::string Where() const
- {
- return ExceptionInfo::Where();
- }
- };
-
-
- /*!
- a small class used for reporting errors
-
- in the library is used macro TTMATH_ASSERT which
- (if the condition in it is false) throw an exception
- of this type
-
- if you compile with gcc you can get a small benefit
- from using method Where() (it returns std::string) with
- the name and the line of a file where the macro TTMATH_ASSERT
- was used)
- */
- class RuntimeError : public std::runtime_error, public ExceptionInfo
- {
- public:
-
- RuntimeError() : std::runtime_error("internal error")
- {
- }
-
- RuntimeError(const char * f, int l) :
- std::runtime_error("internal error"), ExceptionInfo(f,l)
- {
- }
-
- std::string Where() const
- {
- return ExceptionInfo::Where();
- }
- };
-
-
-
- /*!
- TTMATH_DEBUG
- this macro enables further testing during writing your code
- you don't have to define it in a release mode
-
- if this macro is set then macros TTMATH_ASSERT and TTMATH_REFERENCE_ASSERT
- are set as well and these macros can throw an exception if a condition in it
- is not fulfilled (look at the definition of TTMATH_ASSERT and TTMATH_REFERENCE_ASSERT)
-
- TTMATH_DEBUG is set automatically if DEBUG or _DEBUG are defined
- */
- #if defined DEBUG || defined _DEBUG
- #define TTMATH_DEBUG
- #endif
-
-
- #ifdef TTMATH_DEBUG
-
- #if defined(__FILE__) && defined(__LINE__)
-
- #define TTMATH_REFERENCE_ASSERT(expression) \
- if( &(expression) == this ) throw ttmath::ReferenceError(__FILE__, __LINE__);
-
- #define TTMATH_ASSERT(expression) \
- if( !(expression) ) throw ttmath::RuntimeError(__FILE__, __LINE__);
-
- #else
-
- #define TTMATH_REFERENCE_ASSERT(expression) \
- if( &(expression) == this ) throw ReferenceError();
-
- #define TTMATH_ASSERT(expression) \
- if( !(expression) ) throw RuntimeError();
- #endif
-
- #else
- #define TTMATH_REFERENCE_ASSERT(expression)
- #define TTMATH_ASSERT(expression)
- #endif
-
-
-
- #ifdef TTMATH_DEBUG_LOG
- #define TTMATH_LOG(msg) PrintLog(msg, std::cout);
- #define TTMATH_LOGC(msg, carry) PrintLog(msg, carry, std::cout);
- #define TTMATH_VECTOR_LOG(msg, vector, len) PrintVectorLog(msg, std::cout, vector, len);
- #define TTMATH_VECTOR_LOGC(msg, carry, vector, len) PrintVectorLog(msg, carry, std::cout, vector, len);
- #else
- #define TTMATH_LOG(msg)
- #define TTMATH_LOGC(msg, carry)
- #define TTMATH_VECTOR_LOG(msg, vector, len)
- #define TTMATH_VECTOR_LOGC(msg, carry, vector, len)
- #endif
-
-
-
-
-} // namespace
-
-
-#endif
-
diff --git a/ttmath/ttmathuint.h b/ttmath/ttmathuint.h
deleted file mode 100644
index 25ffbb8..0000000
--- a/ttmath/ttmathuint.h
+++ /dev/null
@@ -1,4062 +0,0 @@
-/*
- * This file is a part of TTMath Bignum Library
- * and is distributed under the (new) BSD licence.
- * Author: Tomasz Sowa <t.sowa at ttmath.org>
- */
-
-/*
- * Copyright (c) 2006-2010, Tomasz Sowa
- * All rights reserved.
- *
- * Redistribution and use in source and binary forms, with or without
- * modification, are permitted provided that the following conditions are met:
- *
- * * Redistributions of source code must retain the above copyright notice,
- * this list of conditions and the following disclaimer.
- *
- * * Redistributions in binary form must reproduce the above copyright
- * notice, this list of conditions and the following disclaimer in the
- * documentation and/or other materials provided with the distribution.
- *
- * * Neither the name Tomasz Sowa nor the names of contributors to this
- * project may be used to endorse or promote products derived
- * from this software without specific prior written permission.
- *
- * THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS"
- * AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
- * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- * ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE
- * LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR
- * CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF
- * SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS
- * INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN
- * CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
- * ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF
- * THE POSSIBILITY OF SUCH DAMAGE.
- */
-
-
-
-#ifndef headerfilettmathuint
-#define headerfilettmathuint
-
-
-/*!
- \file ttmathuint.h
- \brief template class UInt<uint>
-*/
-
-#include <iostream>
-#include <iomanip>
-
-
-#include "ttmathtypes.h"
-#include "ttmathmisc.h"
-
-
-
-/*!
- \brief a namespace for the TTMath library
-*/
-namespace ttmath
-{
-
-/*!
- \brief UInt implements a big integer value without a sign
-
- value_size - how many bytes specify our value
- on 32bit platforms: value_size=1 -> 4 bytes -> 32 bits
- on 64bit platforms: value_size=1 -> 8 bytes -> 64 bits
- value_size = 1,2,3,4,5,6....
-*/
-template<uint value_size>
-class UInt
-{
-public:
-
- /*!
- buffer for the integer value
- table[0] - the lowest word of the value
- */
- uint table[value_size];
-
-
-
- /*!
- some methods used for debugging purposes
- */
-
-
- /*!
- this method is only for debugging purposes or when we want to make
- a table of a variable (constant) in ttmathbig.h
-
- it prints the table in a nice form of several columns
- */
- template<class ostream_type>
- void PrintTable(ostream_type & output) const
- {
- // how many columns there'll be
- const int columns = 8;
-
- int c = 1;
- for(int i=value_size-1 ; i>=0 ; --i)
- {
- output << "0x" << std::setfill('0');
-
- #ifdef TTMATH_PLATFORM32
- output << std::setw(8);
- #else
- output << std::setw(16);
- #endif
-
- output << std::hex << table[i];
-
- if( i>0 )
- {
- output << ", ";
-
- if( ++c > columns )
- {
- output << std::endl;
- c = 1;
- }
- }
- }
-
- output << std::dec << std::endl;
- }
-
-
- /*!
- this method is used when macro TTMATH_DEBUG_LOG is defined
- */
- template<class char_type, class ostream_type>
- static void PrintVectorLog(const char_type * msg, ostream_type & output, const uint * vector, uint vector_len)
- {
- output << msg << std::endl;
-
- for(uint i=0 ; i<vector_len ; ++i)
- output << " table[" << i << "]: " << vector[i] << std::endl;
- }
-
-
- /*!
- this method is used when macro TTMATH_DEBUG_LOG is defined
- */
- template<class char_type, class ostream_type>
- static void PrintVectorLog(const char_type * msg, uint carry, ostream_type & output, const uint * vector, uint vector_len)
- {
- PrintVectorLog(msg, output, vector, vector_len);
- output << " carry: " << carry << std::endl;
- }
-
-
- /*!
- this method is used when macro TTMATH_DEBUG_LOG is defined
- */
- template<class char_type, class ostream_type>
- void PrintLog(const char_type * msg, ostream_type & output) const
- {
- PrintVectorLog(msg, output, table, value_size);
- }
-
-
- /*!
- this method is used when macro TTMATH_DEBUG_LOG is defined
- */
- template<class char_type, class ostream_type>
- void PrintLog(const char_type * msg, uint carry, ostream_type & output) const
- {
- PrintVectorLog(msg, output, table, value_size);
- output << " carry: " << carry << std::endl;
- }
-
-
- /*!
- this method returns the size of the table
- */
- uint Size() const
- {
- return value_size;
- }
-
-
- /*!
- this method sets zero
- */
- void SetZero()
- {
- // in the future here can be 'memset'
-
- for(uint i=0 ; i<value_size ; ++i)
- table[i] = 0;
-
- TTMATH_LOG("UInt::SetZero")
- }
-
-
- /*!
- this method sets one
- */
- void SetOne()
- {
- SetZero();
- table[0] = 1;
-
- TTMATH_LOG("UInt::SetOne")
- }
-
-
- /*!
- this method sets the max value which this class can hold
- (all bits will be one)
- */
- void SetMax()
- {
- for(uint i=0 ; i<value_size ; ++i)
- table[i] = TTMATH_UINT_MAX_VALUE;
-
- TTMATH_LOG("UInt::SetMax")
- }
-
-
- /*!
- this method sets the min value which this class can hold
- (for an unsigned integer value the zero is the smallest value)
- */
- void SetMin()
- {
- SetZero();
-
- TTMATH_LOG("UInt::SetMin")
- }
-
-
- /*!
- this method swappes this for an argument
- */
- void Swap(UInt<value_size> & ss2)
- {
- for(uint i=0 ; i<value_size ; ++i)
- {
- uint temp = table[i];
- table[i] = ss2.table[i];
- ss2.table[i] = temp;
- }
- }
-
-
-#ifdef TTMATH_PLATFORM32
-
- /*!
- this method copies the value stored in an another table
- (warning: first values in temp_table are the highest words -- it's different
- from our table)
-
- we copy as many words as it is possible
-
- if temp_table_len is bigger than value_size we'll try to round
- the lowest word from table depending on the last not used bit in temp_table
- (this rounding isn't a perfect rounding -- look at the description below)
-
- and if temp_table_len is smaller than value_size we'll clear the rest words
- in the table
- */
- void SetFromTable(const uint * temp_table, uint temp_table_len)
- {
- uint temp_table_index = 0;
- sint i; // 'i' with a sign
-
- for(i=value_size-1 ; i>=0 && temp_table_index<temp_table_len; --i, ++temp_table_index)
- table[i] = temp_table[ temp_table_index ];
-
-
- // rounding mantissa
- if( temp_table_index < temp_table_len )
- {
- if( (temp_table[temp_table_index] & TTMATH_UINT_HIGHEST_BIT) != 0 )
- {
- /*
- very simply rounding
- if the bit from not used last word from temp_table is set to one
- we're rouding the lowest word in the table
-
- in fact there should be a normal addition but
- we don't use Add() or AddTwoInts() because these methods
- can set a carry and then there'll be a small problem
- for optimization
- */
- if( table[0] != TTMATH_UINT_MAX_VALUE )
- ++table[0];
- }
- }
-
- // cleaning the rest of the mantissa
- for( ; i>=0 ; --i)
- table[i] = 0;
-
-
- TTMATH_LOG("UInt::SetFromTable")
- }
-
-#endif
-
-
-#ifdef TTMATH_PLATFORM64
- /*!
- this method copies the value stored in an another table
- (warning: first values in temp_table are the highest words -- it's different
- from our table)
-
- ***this method is created only on a 64bit platform***
-
- we copy as many words as it is possible
-
- if temp_table_len is bigger than value_size we'll try to round
- the lowest word from table depending on the last not used bit in temp_table
- (this rounding isn't a perfect rounding -- look at the description below)
-
- and if temp_table_len is smaller than value_size we'll clear the rest words
- in the table
-
- warning: we're using 'temp_table' as a pointer at 32bit words
- */
- void SetFromTable(const unsigned int * temp_table, uint temp_table_len)
- {
- uint temp_table_index = 0;
- sint i; // 'i' with a sign
-
- for(i=value_size-1 ; i>=0 && temp_table_index<temp_table_len; --i, ++temp_table_index)
- {
- table[i] = uint(temp_table[ temp_table_index ]) << 32;
-
- ++temp_table_index;
-
- if( temp_table_index<temp_table_len )
- table[i] |= temp_table[ temp_table_index ];
- }
-
-
- // rounding mantissa
- if( temp_table_index < temp_table_len )
- {
- if( (temp_table[temp_table_index] & TTMATH_UINT_HIGHEST_BIT) != 0 )
- {
- /*
- very simply rounding
- if the bit from not used last word from temp_table is set to one
- we're rouding the lowest word in the table
-
- in fact there should be a normal addition but
- we don't use Add() or AddTwoInts() because these methods
- can set a carry and then there'll be a small problem
- for optimization
- */
- if( table[0] != TTMATH_UINT_MAX_VALUE )
- ++table[0];
- }
- }
-
- // cleaning the rest of the mantissa
- for( ; i >= 0 ; --i)
- table[i] = 0;
-
- TTMATH_LOG("UInt::SetFromTable")
- }
-
-#endif
-
-
-
-
-
- /*!
- *
- * basic mathematic functions
- *
- */
-
-
-
-
- /*!
- this method adds one to the existing value
- */
- uint AddOne()
- {
- return AddInt(1);
- }
-
-
- /*!
- this method subtracts one from the existing value
- */
- uint SubOne()
- {
- return SubInt(1);
- }
-
-
-private:
-
-
- /*!
- an auxiliary method for moving bits into the left hand side
-
- this method moves only words
- */
- void RclMoveAllWords(uint & rest_bits, uint & last_c, uint bits, uint c)
- {
- rest_bits = bits % TTMATH_BITS_PER_UINT;
- uint all_words = bits / TTMATH_BITS_PER_UINT;
- uint mask = ( c ) ? TTMATH_UINT_MAX_VALUE : 0;
-
-
- if( all_words >= value_size )
- {
- if( all_words == value_size && rest_bits == 0 )
- last_c = table[0] & 1;
- // else: last_c is default set to 0
-
- // clearing
- for(uint i = 0 ; i<value_size ; ++i)
- table[i] = mask;
-
- rest_bits = 0;
- }
- else
- if( all_words > 0 )
- {
- // 0 < all_words < value_size
-
- sint first, second;
- last_c = table[value_size - all_words] & 1; // all_words is greater than 0
-
- // copying the first part of the value
- for(first = value_size-1, second=first-all_words ; second>=0 ; --first, --second)
- table[first] = table[second];
-
- // setting the rest to 'c'
- for( ; first>=0 ; --first )
- table[first] = mask;
- }
-
- TTMATH_LOG("UInt::RclMoveAllWords")
- }
-
-public:
-
- /*!
- moving all bits into the left side 'bits' times
- return value <- this <- C
-
- bits is from a range of <0, man * TTMATH_BITS_PER_UINT>
- or it can be even bigger then all bits will be set to 'c'
-
- the value c will be set into the lowest bits
- and the method returns state of the last moved bit
- */
- uint Rcl(uint bits, uint c=0)
- {
- uint last_c = 0;
- uint rest_bits = bits;
-
- if( bits == 0 )
- return 0;
-
- if( bits >= TTMATH_BITS_PER_UINT )
- RclMoveAllWords(rest_bits, last_c, bits, c);
-
- if( rest_bits == 0 )
- {
- TTMATH_LOG("UInt::Rcl")
- return last_c;
- }
-
- // rest_bits is from 1 to TTMATH_BITS_PER_UINT-1 now
- if( rest_bits == 1 )
- {
- last_c = Rcl2_one(c);
- }
- else if( rest_bits == 2 )
- {
- // performance tests showed that for rest_bits==2 it's better to use Rcl2_one twice instead of Rcl2(2,c)
- Rcl2_one(c);
- last_c = Rcl2_one(c);
- }
- else
- {
- last_c = Rcl2(rest_bits, c);
- }
-
- TTMATH_LOGC("UInt::Rcl", last_c)
-
- return last_c;
- }
-
-private:
-
- /*!
- an auxiliary method for moving bits into the right hand side
-
- this method moves only words
- */
- void RcrMoveAllWords(uint & rest_bits, uint & last_c, uint bits, uint c)
- {
- rest_bits = bits % TTMATH_BITS_PER_UINT;
- uint all_words = bits / TTMATH_BITS_PER_UINT;
- uint mask = ( c ) ? TTMATH_UINT_MAX_VALUE : 0;
-
-
- if( all_words >= value_size )
- {
- if( all_words == value_size && rest_bits == 0 )
- last_c = (table[value_size-1] & TTMATH_UINT_HIGHEST_BIT) ? 1 : 0;
- // else: last_c is default set to 0
-
- // clearing
- for(uint i = 0 ; i<value_size ; ++i)
- table[i] = mask;
-
- rest_bits = 0;
- }
- else if( all_words > 0 )
- {
- // 0 < all_words < value_size
-
- uint first, second;
- last_c = (table[all_words - 1] & TTMATH_UINT_HIGHEST_BIT) ? 1 : 0; // all_words is > 0
-
- // copying the first part of the value
- for(first=0, second=all_words ; second<value_size ; ++first, ++second)
- table[first] = table[second];
-
- // setting the rest to 'c'
- for( ; first<value_size ; ++first )
- table[first] = mask;
- }
-
- TTMATH_LOG("UInt::RcrMoveAllWords")
- }
-
-public:
-
- /*!
- moving all bits into the right side 'bits' times
- c -> this -> return value
-
- bits is from a range of <0, man * TTMATH_BITS_PER_UINT>
- or it can be even bigger then all bits will be set to 'c'
-
- the value c will be set into the highest bits
- and the method returns state of the last moved bit
- */
- uint Rcr(uint bits, uint c=0)
- {
- uint last_c = 0;
- uint rest_bits = bits;
-
- if( bits == 0 )
- return 0;
-
- if( bits >= TTMATH_BITS_PER_UINT )
- RcrMoveAllWords(rest_bits, last_c, bits, c);
-
- if( rest_bits == 0 )
- {
- TTMATH_LOG("UInt::Rcr")
- return last_c;
- }
-
- // rest_bits is from 1 to TTMATH_BITS_PER_UINT-1 now
- if( rest_bits == 1 )
- {
- last_c = Rcr2_one(c);
- }
- else if( rest_bits == 2 )
- {
- // performance tests showed that for rest_bits==2 it's better to use Rcr2_one twice instead of Rcr2(2,c)
- Rcr2_one(c);
- last_c = Rcr2_one(c);
- }
- else
- {
- last_c = Rcr2(rest_bits, c);
- }
-
- TTMATH_LOGC("UInt::Rcr", last_c)
-
- return last_c;
- }
-
-
- /*!
- this method moves all bits into the left side
- (it returns value how many bits have been moved)
- */
- uint CompensationToLeft()
- {
- uint moving = 0;
-
- // a - index a last word which is different from zero
- sint a;
- for(a=value_size-1 ; a>=0 && table[a]==0 ; --a);
-
- if( a < 0 )
- return moving; // all words in table have zero
-
- if( a != value_size-1 )
- {
- moving += ( value_size-1 - a ) * TTMATH_BITS_PER_UINT;
-
- // moving all words
- sint i;
- for(i=value_size-1 ; a>=0 ; --i, --a)
- table[i] = table[a];
-
- // setting the rest word to zero
- for(; i>=0 ; --i)
- table[i] = 0;
- }
-
- uint moving2 = FindLeadingBitInWord( table[value_size-1] );
- // moving2 is different from -1 because the value table[value_size-1]
- // is not zero
-
- moving2 = TTMATH_BITS_PER_UINT - moving2 - 1;
- Rcl(moving2);
-
- TTMATH_LOG("UInt::CompensationToLeft")
-
- return moving + moving2;
- }
-
-
- /*!
- this method looks for the highest set bit
-
- result:
- if 'this' is not zero:
- return value - true
- 'table_id' - the index of a word <0..value_size-1>
- 'index' - the index of this set bit in the word <0..TTMATH_BITS_PER_UINT)
-
- if 'this' is zero:
- return value - false
- both 'table_id' and 'index' are zero
- */
- bool FindLeadingBit(uint & table_id, uint & index) const
- {
- for(table_id=value_size-1 ; table_id!=0 && table[table_id]==0 ; --table_id);
-
- if( table_id==0 && table[table_id]==0 )
- {
- // is zero
- index = 0;
-
- return false;
- }
-
- // table[table_id] is different from 0
- index = FindLeadingBitInWord( table[table_id] );
-
- return true;
- }
-
-
- /*!
- this method looks for the smallest set bit
-
- result:
- if 'this' is not zero:
- return value - true
- 'table_id' - the index of a word <0..value_size-1>
- 'index' - the index of this set bit in the word <0..TTMATH_BITS_PER_UINT)
-
- if 'this' is zero:
- return value - false
- both 'table_id' and 'index' are zero
- */
- bool FindLowestBit(uint & table_id, uint & index) const
- {
- for(table_id=0 ; table_id<value_size && table[table_id]==0 ; ++table_id);
-
- if( table_id >= value_size )
- {
- // is zero
- index = 0;
- table_id = 0;
-
- return false;
- }
-
- // table[table_id] is different from 0
- index = FindLowestBitInWord( table[table_id] );
-
- return true;
- }
-
-
- /*!
- getting the 'bit_index' bit
-
- bit_index bigger or equal zero
- */
- uint GetBit(uint bit_index) const
- {
- TTMATH_ASSERT( bit_index < value_size * TTMATH_BITS_PER_UINT )
-
- uint index = bit_index / TTMATH_BITS_PER_UINT;
- uint bit = bit_index % TTMATH_BITS_PER_UINT;
-
- uint temp = table[index];
- uint res = SetBitInWord(temp, bit);
-
- return res;
- }
-
-
- /*!
- setting the 'bit_index' bit
- and returning the last state of the bit
-
- bit_index bigger or equal zero
- */
- uint SetBit(uint bit_index)
- {
- TTMATH_ASSERT( bit_index < value_size * TTMATH_BITS_PER_UINT )
-
- uint index = bit_index / TTMATH_BITS_PER_UINT;
- uint bit = bit_index % TTMATH_BITS_PER_UINT;
- uint res = SetBitInWord(table[index], bit);
-
- TTMATH_LOG("UInt::SetBit")
-
- return res;
- }
-
-
- /*!
- this method performs a bitwise operation AND
- */
- void BitAnd(const UInt<value_size> & ss2)
- {
- for(uint x=0 ; x<value_size ; ++x)
- table[x] &= ss2.table[x];
-
- TTMATH_LOG("UInt::BitAnd")
- }
-
-
- /*!
- this method performs a bitwise operation OR
- */
- void BitOr(const UInt<value_size> & ss2)
- {
- for(uint x=0 ; x<value_size ; ++x)
- table[x] |= ss2.table[x];
-
- TTMATH_LOG("UInt::BitOr")
- }
-
-
- /*!
- this method performs a bitwise operation XOR
- */
- void BitXor(const UInt<value_size> & ss2)
- {
- for(uint x=0 ; x<value_size ; ++x)
- table[x] ^= ss2.table[x];
-
- TTMATH_LOG("UInt::BitXor")
- }
-
-
- /*!
- this method performs a bitwise operation NOT
- */
- void BitNot()
- {
- for(uint x=0 ; x<value_size ; ++x)
- table[x] = ~table[x];
-
- TTMATH_LOG("UInt::BitNot")
- }
-
-
- /*!
- this method performs a bitwise operation NOT but only
- on the range of <0, leading_bit>
-
- for example:
- BitNot2(8) = BitNot2( 1000(bin) ) = 111(bin) = 7
- */
- void BitNot2()
- {
- uint table_id, index;
-
- if( FindLeadingBit(table_id, index) )
- {
- for(uint x=0 ; x<table_id ; ++x)
- table[x] = ~table[x];
-
- uint mask = TTMATH_UINT_MAX_VALUE;
- uint shift = TTMATH_BITS_PER_UINT - index - 1;
-
- if(shift)
- mask >>= shift;
-
- table[table_id] ^= mask;
- }
- else
- table[0] = 1;
-
-
- TTMATH_LOG("UInt::BitNot2")
- }
-
-
-
- /*!
- *
- * Multiplication
- *
- *
- */
-
-public:
-
- /*!
- multiplication: this = this * ss2
-
- it can return a carry
- */
- uint MulInt(uint ss2)
- {
- uint r1, r2, x1;
- uint c = 0;
-
- UInt<value_size> u(*this);
- SetZero();
-
- if( ss2 == 0 )
- {
- TTMATH_LOGC("UInt::MulInt(uint)", 0)
- return 0;
- }
-
- for(x1=0 ; x1<value_size-1 ; ++x1)
- {
- MulTwoWords(u.table[x1], ss2, &r2, &r1);
- c += AddTwoInts(r2,r1,x1);
- }
-
- // x1 = value_size-1 (last word)
- MulTwoWords(u.table[x1], ss2, &r2, &r1);
- c += (r2!=0) ? 1 : 0;
- c += AddInt(r1, x1);
-
- TTMATH_LOGC("UInt::MulInt(uint)", c)
-
- return (c==0)? 0 : 1;
- }
-
-
- /*!
- multiplication: result = this * ss2
-
- we're using this method only when result_size is greater than value_size
- if so there will not be a carry
- */
- template<uint result_size>
- void MulInt(uint ss2, UInt<result_size> & result) const
- {
- TTMATH_ASSERT( result_size > value_size )
-
- uint r2,r1;
- uint x1size=value_size;
- uint x1start=0;
-
- result.SetZero();
-
- if( ss2 == 0 )
- {
- TTMATH_VECTOR_LOG("UInt::MulInt(uint, UInt<>)", result.table, result_size)
- return;
- }
-
- if( value_size > 2 )
- {
- // if the value_size is smaller than or equal to 2
- // there is no sense to set x1size and x1start to another values
-
- for(x1size=value_size ; x1size>0 && table[x1size-1]==0 ; --x1size);
-
- if( x1size == 0 )
- {
- TTMATH_VECTOR_LOG("UInt::MulInt(uint, UInt<>)", result.table, result_size)
- return;
- }
-
- for(x1start=0 ; x1start<x1size && table[x1start]==0 ; ++x1start);
- }
-
- for(uint x1=x1start ; x1<x1size ; ++x1)
- {
- MulTwoWords(table[x1], ss2, &r2, &r1 );
- result.AddTwoInts(r2,r1,x1);
- }
-
- TTMATH_VECTOR_LOG("UInt::MulInt(uint, UInt<>)", result.table, result_size)
-
- return;
- }
-
-
-
- /*!
- the multiplication 'this' = 'this' * ss2
-
- algorithm: 100 - means automatically choose the fastest algorithm
- */
- uint Mul(const UInt<value_size> & ss2, uint algorithm = 100)
- {
- switch( algorithm )
- {
- case 1:
- return Mul1(ss2);
-
- case 2:
- return Mul2(ss2);
-
- case 3:
- return Mul3(ss2);
-
- case 100:
- default:
- return MulFastest(ss2);
- }
- }
-
-
- /*!
- the multiplication 'result' = 'this' * ss2
-
- since the 'result' is twice bigger than 'this' and 'ss2'
- this method never returns a carry
-
- algorithm: 100 - means automatically choose the fastest algorithm
- */
- void MulBig(const UInt<value_size> & ss2,
- UInt<value_size*2> & result,
- uint algorithm = 100)
- {
- switch( algorithm )
- {
- case 1:
- return Mul1Big(ss2, result);
-
- case 2:
- return Mul2Big(ss2, result);
-
- case 3:
- return Mul3Big(ss2, result);
-
- case 100:
- default:
- return MulFastestBig(ss2, result);
- }
- }
-
-
-
- /*!
- the first version of the multiplication algorithm
- */
-
-private:
-
- /*!
- multiplication: this = this * ss2
-
- it returns carry if it has been
- */
- uint Mul1Ref(const UInt<value_size> & ss2)
- {
- TTMATH_REFERENCE_ASSERT( ss2 )
-
- UInt<value_size> ss1( *this );
- SetZero();
-
- for(uint i=0; i < value_size*TTMATH_BITS_PER_UINT ; ++i)
- {
- if( Add(*this) )
- {
- TTMATH_LOGC("UInt::Mul1", 1)
- return 1;
- }
-
- if( ss1.Rcl(1) )
- if( Add(ss2) )
- {
- TTMATH_LOGC("UInt::Mul1", 1)
- return 1;
- }
- }
-
- TTMATH_LOGC("UInt::Mul1", 0)
-
- return 0;
- }
-
-
-public:
-
- /*!
- multiplication: this = this * ss2
- can return carry
- */
- uint Mul1(const UInt<value_size> & ss2)
- {
- if( this == &ss2 )
- {
- UInt<value_size> copy_ss2(ss2);
- return Mul1Ref(copy_ss2);
- }
- else
- {
- return Mul1Ref(ss2);
- }
- }
-
-
- /*!
- multiplication: result = this * ss2
-
- result is twice bigger than 'this' and 'ss2'
- this method never returns carry
- */
- void Mul1Big(const UInt<value_size> & ss2_, UInt<value_size*2> & result)
- {
- UInt<value_size*2> ss2;
- uint i;
-
- // copying *this into result and ss2_ into ss2
- for(i=0 ; i<value_size ; ++i)
- {
- result.table[i] = table[i];
- ss2.table[i] = ss2_.table[i];
- }
-
- // cleaning the highest bytes in result and ss2
- for( ; i < value_size*2 ; ++i)
- {
- result.table[i] = 0;
- ss2.table[i] = 0;
- }
-
- // multiply
- // (there will not be a carry)
- result.Mul1( ss2 );
-
- TTMATH_LOG("UInt::Mul1Big")
- }
-
-
-
- /*!
- the second version of the multiplication algorithm
-
- this algorithm is similar to the 'schoolbook method' which is done by hand
- */
-
- /*!
- multiplication: this = this * ss2
-
- it returns carry if it has been
- */
- uint Mul2(const UInt<value_size> & ss2)
- {
- UInt<value_size*2> result;
- uint i, c = 0;
-
- Mul2Big(ss2, result);
-
- // copying result
- for(i=0 ; i<value_size ; ++i)
- table[i] = result.table[i];
-
- // testing carry
- for( ; i<value_size*2 ; ++i)
- if( result.table[i] != 0 )
- {
- c = 1;
- break;
- }
-
- TTMATH_LOGC("UInt::Mul2", c)
-
- return c;
- }
-
-
- /*!
- multiplication: result = this * ss2
-
- result is twice bigger than this and ss2
- this method never returns carry
- */
- void Mul2Big(const UInt<value_size> & ss2, UInt<value_size*2> & result)
- {
- Mul2Big2<value_size>(table, ss2.table, result);
-
- TTMATH_LOG("UInt::Mul2Big")
- }
-
-
-private:
-
- /*!
- an auxiliary method for calculating the multiplication
-
- arguments we're taking as pointers (this is to improve the Mul3Big2()- avoiding
- unnecessary copying objects), the result should be taken as a pointer too,
- but at the moment there is no method AddTwoInts() which can operate on pointers
- */
- template<uint ss_size>
- void Mul2Big2(const uint * ss1, const uint * ss2, UInt<ss_size*2> & result)
- {
- uint x1size = ss_size, x2size = ss_size;
- uint x1start = 0, x2start = 0;
-
- if( ss_size > 2 )
- {
- // if the ss_size is smaller than or equal to 2
- // there is no sense to set x1size (and others) to another values
-
- for(x1size=ss_size ; x1size>0 && ss1[x1size-1]==0 ; --x1size);
- for(x2size=ss_size ; x2size>0 && ss2[x2size-1]==0 ; --x2size);
-
- for(x1start=0 ; x1start<x1size && ss1[x1start]==0 ; ++x1start);
- for(x2start=0 ; x2start<x2size && ss2[x2start]==0 ; ++x2start);
- }
-
- Mul2Big3<ss_size>(ss1, ss2, result, x1start, x1size, x2start, x2size);
- }
-
-
-
- /*!
- an auxiliary method for calculating the multiplication
- */
- template<uint ss_size>
- void Mul2Big3(const uint * ss1, const uint * ss2, UInt<ss_size*2> & result, uint x1start, uint x1size, uint x2start, uint x2size)
- {
- uint r2, r1;
-
- result.SetZero();
-
- if( x1size==0 || x2size==0 )
- return;
-
- for(uint x1=x1start ; x1<x1size ; ++x1)
- {
- for(uint x2=x2start ; x2<x2size ; ++x2)
- {
- MulTwoWords(ss1[x1], ss2[x2], &r2, &r1);
- result.AddTwoInts(r2, r1, x2+x1);
- // here will never be a carry
- }
- }
- }
-
-
-public:
-
-
- /*!
- multiplication: this = this * ss2
-
- This is Karatsuba Multiplication algorithm, we're using it when value_size is greater than
- or equal to TTMATH_USE_KARATSUBA_MULTIPLICATION_FROM_SIZE macro (defined in ttmathuint.h).
- If value_size is smaller then we're using Mul2Big() instead.
-
- Karatsuba multiplication:
- Assume we have:
- this = x = x1*B^m + x0
- ss2 = y = y1*B^m + y0
- where x0 and y0 are less than B^m
- the product from multiplication we can show as:
- x*y = (x1*B^m + x0)(y1*B^m + y0) = z2*B^(2m) + z1*B^m + z0
- where
- z2 = x1*y1
- z1 = x1*y0 + x0*y1
- z0 = x0*y0
- this is standard schoolbook algorithm with O(n^2), Karatsuba observed that z1 can be given in other form:
- z1 = (x1 + x0)*(y1 + y0) - z2 - z0 / z1 = (x1*y1 + x1*y0 + x0*y1 + x0*y0) - x1*y1 - x0*y0 = x1*y0 + x0*y1 /
- and to calculate the multiplication we need only three multiplications (with some additions and subtractions)
-
- Our objects 'this' and 'ss2' we divide into two parts and by using recurrence we calculate the multiplication.
- Karatsuba multiplication has O( n^(ln(3)/ln(2)) )
- */
- uint Mul3(const UInt<value_size> & ss2)
- {
- UInt<value_size*2> result;
- uint i, c = 0;
-
- Mul3Big(ss2, result);
-
- // copying result
- for(i=0 ; i<value_size ; ++i)
- table[i] = result.table[i];
-
- // testing carry
- for( ; i<value_size*2 ; ++i)
- if( result.table[i] != 0 )
- {
- c = 1;
- break;
- }
-
- TTMATH_LOGC("UInt::Mul3", c)
-
- return c;
- }
-
-
-
- /*!
- multiplication: result = this * ss2
-
- result is twice bigger than this and ss2,
- this method never returns carry,
- (Karatsuba multiplication)
- */
- void Mul3Big(const UInt<value_size> & ss2, UInt<value_size*2> & result)
- {
- Mul3Big2<value_size>(table, ss2.table, result.table);
-
- TTMATH_LOG("UInt::Mul3Big")
- }
-
-
-
-private:
-
- /*!
- an auxiliary method for calculating the Karatsuba multiplication
-
- result_size is equal ss_size*2
- */
- template<uint ss_size>
- void Mul3Big2(const uint * ss1, const uint * ss2, uint * result)
- {
- const uint * x1, * x0, * y1, * y0;
-
-
- if( ss_size>1 && ss_size<TTMATH_USE_KARATSUBA_MULTIPLICATION_FROM_SIZE )
- {
- UInt<ss_size*2> res;
- Mul2Big2<ss_size>(ss1, ss2, res);
-
- for(uint i=0 ; i<ss_size*2 ; ++i)
- result[i] = res.table[i];
-
- return;
- }
- else
- if( ss_size == 1 )
- {
- return MulTwoWords(*ss1, *ss2, &result[1], &result[0]);
- }
-
-
- if( (ss_size & 1) == 1 )
- {
- // ss_size is odd
- x0 = ss1;
- y0 = ss2;
- x1 = ss1 + ss_size / 2 + 1;
- y1 = ss2 + ss_size / 2 + 1;
-
- // the second vectors (x1 and y1) are smaller about one from the first ones (x0 and y0)
- Mul3Big3<ss_size/2 + 1, ss_size/2, ss_size*2>(x1, x0, y1, y0, result);
- }
- else
- {
- // ss_size is even
- x0 = ss1;
- y0 = ss2;
- x1 = ss1 + ss_size / 2;
- y1 = ss2 + ss_size / 2;
-
- // all four vectors (x0 x1 y0 y1) are equal in size
- Mul3Big3<ss_size/2, ss_size/2, ss_size*2>(x1, x0, y1, y0, result);
- }
- }
-
-
-
-#ifdef _MSC_VER
-#pragma warning (disable : 4717)
-//warning C4717: recursive on all control paths, function will cause runtime stack overflow
-//we have the stop point in Mul3Big2() method
-#endif
-
-
- /*!
- an auxiliary method for calculating the Karatsuba multiplication
-
- x = x1*B^m + x0
- y = y1*B^m + y0
-
- first_size - is the size of vectors: x0 and y0
- second_size - is the size of vectors: x1 and y1 (can be either equal first_size or smaller about one from first_size)
-
- x*y = (x1*B^m + x0)(y1*B^m + y0) = z2*B^(2m) + z1*B^m + z0
- where
- z0 = x0*y0
- z2 = x1*y1
- z1 = (x1 + x0)*(y1 + y0) - z2 - z0
- */
- template<uint first_size, uint second_size, uint result_size>
- void Mul3Big3(const uint * x1, const uint * x0, const uint * y1, const uint * y0, uint * result)
- {
- uint i, c, xc, yc;
-
- UInt<first_size> temp, temp2;
- UInt<first_size*3> z1;
-
- // z0 and z2 we store directly in the result (we don't use any temporary variables)
- Mul3Big2<first_size>(x0, y0, result); // z0
- Mul3Big2<second_size>(x1, y1, result+first_size*2); // z2
-
- // now we calculate z1
- // temp = (x0 + x1)
- // temp2 = (y0 + y1)
- // we're using temp and temp2 with UInt<first_size>, although there can be a carry but
- // we simple remember it in xc and yc (xc and yc can be either 0 or 1),
- // and (x0 + x1)*(y0 + y1) we calculate in this way (schoolbook algorithm):
- //
- // xc | temp
- // yc | temp2
- // --------------------
- // (temp * temp2)
- // xc*temp2 |
- // yc*temp |
- // xc*yc |
- // ---------- z1 --------
- //
- // and the result is never larger in size than 3*first_size
-
- xc = AddVector(x0, x1, first_size, second_size, temp.table);
- yc = AddVector(y0, y1, first_size, second_size, temp2.table);
-
- Mul3Big2<first_size>(temp.table, temp2.table, z1.table);
-
- // clearing the rest of z1
- for(i=first_size*2 ; i<first_size*3 ; ++i)
- z1.table[i] = 0;
-
-
- if( xc )
- {
- c = AddVector(z1.table+first_size, temp2.table, first_size*3-first_size, first_size, z1.table+first_size);
- TTMATH_ASSERT( c==0 )
- }
-
- if( yc )
- {
- c = AddVector(z1.table+first_size, temp.table, first_size*3-first_size, first_size, z1.table+first_size);
- TTMATH_ASSERT( c==0 )
- }
-
-
- if( xc && yc )
- {
- for( i=first_size*2 ; i<first_size*3 ; ++i )
- if( ++z1.table[i] != 0 )
- break; // break if there was no carry
- }
-
- // z1 = z1 - z2
- c = SubVector(z1.table, result+first_size*2, first_size*3, second_size*2, z1.table);
- TTMATH_ASSERT(c==0)
-
- // z1 = z1 - z0
- c = SubVector(z1.table, result, first_size*3, first_size*2, z1.table);
- TTMATH_ASSERT(c==0)
-
- // here we've calculated the z1
- // now we're adding it to the result
-
- if( first_size > second_size )
- {
- uint z1_size = result_size - first_size;
- TTMATH_ASSERT( z1_size <= first_size*3 )
-
- for(i=z1_size ; i<first_size*3 ; ++i)
- {
- TTMATH_ASSERT( z1.table[i] == 0 )
- }
-
- c = AddVector(result+first_size, z1.table, result_size-first_size, z1_size, result+first_size);
- TTMATH_ASSERT(c==0)
- }
- else
- {
- c = AddVector(result+first_size, z1.table, result_size-first_size, first_size*3, result+first_size);
- TTMATH_ASSERT(c==0)
- }
- }
-
-
-
-#ifdef _MSC_VER
-#pragma warning (default : 4717)
-#endif
-
-
-public:
-
-
- /*!
- multiplication this = this * ss2
- */
- uint MulFastest(const UInt<value_size> & ss2)
- {
- UInt<value_size*2> result;
- uint i, c = 0;
-
- MulFastestBig(ss2, result);
-
- // copying result
- for(i=0 ; i<value_size ; ++i)
- table[i] = result.table[i];
-
- // testing carry
- for( ; i<value_size*2 ; ++i)
- if( result.table[i] != 0 )
- {
- c = 1;
- break;
- }
-
- TTMATH_LOGC("UInt::MulFastest", c)
-
- return c;
- }
-
-
- /*!
- multiplication result = this * ss2
-
- this method is trying to select the fastest algorithm
- (in the future this method can be improved)
- */
- void MulFastestBig(const UInt<value_size> & ss2, UInt<value_size*2> & result)
- {
- if( value_size < TTMATH_USE_KARATSUBA_MULTIPLICATION_FROM_SIZE )
- return Mul2Big(ss2, result);
-
- uint x1size = value_size, x2size = value_size;
- uint x1start = 0, x2start = 0;
-
- for(x1size=value_size ; x1size>0 && table[x1size-1]==0 ; --x1size);
- for(x2size=value_size ; x2size>0 && ss2.table[x2size-1]==0 ; --x2size);
-
- if( x1size==0 || x2size==0 )
- {
- // either 'this' or 'ss2' is equal zero - the result is zero too
- result.SetZero();
- return;
- }
-
- for(x1start=0 ; x1start<x1size && table[x1start]==0 ; ++x1start);
- for(x2start=0 ; x2start<x2size && ss2.table[x2start]==0 ; ++x2start);
-
- uint distancex1 = x1size - x1start;
- uint distancex2 = x2size - x2start;
-
- if( distancex1 < 3 || distancex2 < 3 )
- // either 'this' or 'ss2' have only 2 (or 1) items different from zero (side by side)
- // (this condition in the future can be improved)
- return Mul2Big3<value_size>(table, ss2.table, result, x1start, x1size, x2start, x2size);
-
-
- // Karatsuba multiplication
- Mul3Big(ss2, result);
-
- TTMATH_LOG("UInt::MulFastestBig")
- }
-
-
- /*!
- *
- * Division
- *
- *
- */
-
-public:
-
-
- /*!
- division by one unsigned word
-
- returns 1 when divisor is zero
- */
- uint DivInt(uint divisor, uint * remainder = 0)
- {
- if( divisor == 0 )
- {
- if( remainder )
- *remainder = 0; // this is for convenience, without it the compiler can report that 'remainder' is uninitialized
-
- TTMATH_LOG("UInt::DivInt")
-
- return 1;
- }
-
- if( divisor == 1 )
- {
- if( remainder )
- *remainder = 0;
-
- TTMATH_LOG("UInt::DivInt")
-
- return 0;
- }
-
- UInt<value_size> dividend(*this);
- SetZero();
-
- sint i; // i must be with a sign
- uint r = 0;
-
- // we're looking for the last word in ss1
- for(i=value_size-1 ; i>0 && dividend.table[i]==0 ; --i);
-
- for( ; i>=0 ; --i)
- DivTwoWords(r, dividend.table[i], divisor, &table[i], &r);
-
- if( remainder )
- *remainder = r;
-
- TTMATH_LOG("UInt::DivInt")
-
- return 0;
- }
-
- uint DivInt(uint divisor, uint & remainder)
- {
- return DivInt(divisor, &remainder);
- }
-
-
-
- /*!
- division this = this / ss2
-
- return values:
- 0 - ok
- 1 - division by zero
- 'this' will be the quotient
- 'remainder' - remainder
- */
- uint Div( const UInt<value_size> & divisor,
- UInt<value_size> * remainder = 0,
- uint algorithm = 3)
- {
- switch( algorithm )
- {
- case 1:
- return Div1(divisor, remainder);
-
- case 2:
- return Div2(divisor, remainder);
-
- case 3:
- default:
- return Div3(divisor, remainder);
- }
- }
-
- uint Div(const UInt<value_size> & divisor, UInt<value_size> & remainder, uint algorithm = 3)
- {
- return Div(divisor, &remainder, algorithm);
- }
-
-
-
-private:
-
- /*!
- return values:
- 0 - none has to be done
- 1 - division by zero
- 2 - division should be made
- */
- uint Div_StandardTest( const UInt<value_size> & v,
- uint & m, uint & n,
- UInt<value_size> * remainder = 0)
- {
- switch( Div_CalculatingSize(v, m, n) )
- {
- case 4: // 'this' is equal v
- if( remainder )
- remainder->SetZero();
-
- SetOne();
- TTMATH_LOG("UInt::Div_StandardTest")
- return 0;
-
- case 3: // 'this' is smaller than v
- if( remainder )
- *remainder = *this;
-
- SetZero();
- TTMATH_LOG("UInt::Div_StandardTest")
- return 0;
-
- case 2: // 'this' is zero
- if( remainder )
- remainder->SetZero();
-
- SetZero();
- TTMATH_LOG("UInt::Div_StandardTest")
- return 0;
-
- case 1: // v is zero
- TTMATH_LOG("UInt::Div_StandardTest")
- return 1;
- }
-
- TTMATH_LOG("UInt::Div_StandardTest")
-
- return 2;
- }
-
-
-
- /*!
- return values:
- 0 - ok
- 'm' - is the index (from 0) of last non-zero word in table ('this')
- 'n' - is the index (from 0) of last non-zero word in v.table
- 1 - v is zero
- 2 - 'this' is zero
- 3 - 'this' is smaller than v
- 4 - 'this' is equal v
-
- if the return value is different than zero the 'm' and 'n' are undefined
- */
- uint Div_CalculatingSize(const UInt<value_size> & v, uint & m, uint & n)
- {
- m = n = value_size-1;
-
- for( ; n!=0 && v.table[n]==0 ; --n);
-
- if( n==0 && v.table[n]==0 )
- return 1;
-
- for( ; m!=0 && table[m]==0 ; --m);
-
- if( m==0 && table[m]==0 )
- return 2;
-
- if( m < n )
- return 3;
- else
- if( m == n )
- {
- uint i;
- for(i = n ; i!=0 && table[i]==v.table[i] ; --i);
-
- if( table[i] < v.table[i] )
- return 3;
- else
- if (table[i] == v.table[i] )
- return 4;
- }
-
- return 0;
- }
-
-
-public:
-
- /*!
- the first division algorithm
- radix 2
- */
- uint Div1(const UInt<value_size> & divisor, UInt<value_size> * remainder = 0)
- {
- uint m,n, test;
-
- test = Div_StandardTest(divisor, m, n, remainder);
- if( test < 2 )
- return test;
-
- if( !remainder )
- {
- UInt<value_size> rem;
-
- return Div1_Calculate(divisor, rem);
- }
-
- return Div1_Calculate(divisor, *remainder);
- }
-
-
- /*!
- the first division algorithm
- radix 2
- */
- uint Div1(const UInt<value_size> & divisor, UInt<value_size> & remainder)
- {
- return Div1(divisor, &remainder);
- }
-
-
-private:
-
- uint Div1_Calculate(const UInt<value_size> & divisor, UInt<value_size> & rest)
- {
- if( this == &divisor )
- {
- UInt<value_size> divisor_copy(divisor);
- return Div1_CalculateRef(divisor_copy, rest);
- }
- else
- {
- return Div1_CalculateRef(divisor, rest);
- }
- }
-
-
- uint Div1_CalculateRef(const UInt<value_size> & divisor, UInt<value_size> & rest)
- {
- TTMATH_REFERENCE_ASSERT( divisor )
-
- sint loop;
- sint c;
-
- rest.SetZero();
- loop = value_size * TTMATH_BITS_PER_UINT;
- c = 0;
-
-
- div_a:
- c = Rcl(1, c);
- c = rest.Add(rest,c);
- c = rest.Sub(divisor,c);
-
- c = !c;
-
- if(!c)
- goto div_d;
-
-
- div_b:
- --loop;
- if(loop)
- goto div_a;
-
- c = Rcl(1, c);
- TTMATH_LOG("UInt::Div1_Calculate")
- return 0;
-
-
- div_c:
- c = Rcl(1, c);
- c = rest.Add(rest,c);
- c = rest.Add(divisor);
-
- if(c)
- goto div_b;
-
-
- div_d:
- --loop;
- if(loop)
- goto div_c;
-
- c = Rcl(1, c);
- c = rest.Add(divisor);
-
- TTMATH_LOG("UInt::Div1_Calculate")
-
- return 0;
- }
-
-
-public:
-
- /*!
- the second division algorithm
-
- return values:
- 0 - ok
- 1 - division by zero
- */
- uint Div2(const UInt<value_size> & divisor, UInt<value_size> * remainder = 0)
- {
- if( this == &divisor )
- {
- UInt<value_size> divisor_copy(divisor);
- return Div2Ref(divisor_copy, remainder);
- }
- else
- {
- return Div2Ref(divisor, remainder);
- }
- }
-
-
- /*!
- the second division algorithm
-
- return values:
- 0 - ok
- 1 - division by zero
- */
- uint Div2(const UInt<value_size> & divisor, UInt<value_size> & remainder)
- {
- return Div2(divisor, &remainder);
- }
-
-
-private:
-
- /*!
- the second division algorithm
-
- return values:
- 0 - ok
- 1 - division by zero
- */
- uint Div2Ref(const UInt<value_size> & divisor, UInt<value_size> * remainder = 0)
- {
- uint bits_diff;
- uint status = Div2_Calculate(divisor, remainder, bits_diff);
- if( status < 2 )
- return status;
-
- if( CmpBiggerEqual(divisor) )
- {
- Div2(divisor, remainder);
- SetBit(bits_diff);
- }
- else
- {
- if( remainder )
- *remainder = *this;
-
- SetZero();
- SetBit(bits_diff);
- }
-
- TTMATH_LOG("UInt::Div2")
-
- return 0;
- }
-
-
- /*!
- return values:
- 0 - we've calculated the division
- 1 - division by zero
- 2 - we have to still calculate
-
- */
- uint Div2_Calculate(const UInt<value_size> & divisor, UInt<value_size> * remainder,
- uint & bits_diff)
- {
- uint table_id, index;
- uint divisor_table_id, divisor_index;
-
- uint status = Div2_FindLeadingBitsAndCheck( divisor, remainder,
- table_id, index,
- divisor_table_id, divisor_index);
-
- if( status < 2 )
- {
- TTMATH_LOG("UInt::Div2_Calculate")
- return status;
- }
-
- // here we know that 'this' is greater than divisor
- // then 'index' is greater or equal 'divisor_index'
- bits_diff = index - divisor_index;
-
- UInt<value_size> divisor_copy(divisor);
- divisor_copy.Rcl(bits_diff, 0);
-
- if( CmpSmaller(divisor_copy, table_id) )
- {
- divisor_copy.Rcr(1);
- --bits_diff;
- }
-
- Sub(divisor_copy, 0);
-
- TTMATH_LOG("UInt::Div2_Calculate")
-
- return 2;
- }
-
-
- /*!
- return values:
- 0 - we've calculated the division
- 1 - division by zero
- 2 - we have to still calculate
- */
- uint Div2_FindLeadingBitsAndCheck( const UInt<value_size> & divisor,
- UInt<value_size> * remainder,
- uint & table_id, uint & index,
- uint & divisor_table_id, uint & divisor_index)
- {
- if( !divisor.FindLeadingBit(divisor_table_id, divisor_index) )
- {
- // division by zero
- TTMATH_LOG("UInt::Div2_FindLeadingBitsAndCheck")
- return 1;
- }
-
- if( !FindLeadingBit(table_id, index) )
- {
- // zero is divided by something
-
- SetZero();
-
- if( remainder )
- remainder->SetZero();
-
- TTMATH_LOG("UInt::Div2_FindLeadingBitsAndCheck")
-
- return 0;
- }
-
- divisor_index += divisor_table_id * TTMATH_BITS_PER_UINT;
- index += table_id * TTMATH_BITS_PER_UINT;
-
- if( divisor_table_id == 0 )
- {
- // dividor has only one 32-bit word
-
- uint r;
- DivInt(divisor.table[0], &r);
-
- if( remainder )
- {
- remainder->SetZero();
- remainder->table[0] = r;
- }
-
- TTMATH_LOG("UInt::Div2_FindLeadingBitsAndCheck")
-
- return 0;
- }
-
-
- if( Div2_DivisorGreaterOrEqual( divisor, remainder,
- table_id, index,
- divisor_index) )
- {
- TTMATH_LOG("UInt::Div2_FindLeadingBitsAndCheck")
- return 0;
- }
-
-
- TTMATH_LOG("UInt::Div2_FindLeadingBitsAndCheck")
-
- return 2;
- }
-
-
- /*!
- return values:
- true if divisor is equal or greater than 'this'
- */
- bool Div2_DivisorGreaterOrEqual( const UInt<value_size> & divisor,
- UInt<value_size> * remainder,
- uint table_id, uint index,
- uint divisor_index )
- {
- if( divisor_index > index )
- {
- // divisor is greater than this
-
- if( remainder )
- *remainder = *this;
-
- SetZero();
-
- TTMATH_LOG("UInt::Div2_DivisorGreaterOrEqual")
-
- return true;
- }
-
- if( divisor_index == index )
- {
- // table_id == divisor_table_id as well
-
- uint i;
- for(i = table_id ; i!=0 && table[i]==divisor.table[i] ; --i);
-
- if( table[i] < divisor.table[i] )
- {
- // divisor is greater than 'this'
-
- if( remainder )
- *remainder = *this;
-
- SetZero();
-
- TTMATH_LOG("UInt::Div2_DivisorGreaterOrEqual")
-
- return true;
- }
- else
- if( table[i] == divisor.table[i] )
- {
- // divisor is equal 'this'
-
- if( remainder )
- remainder->SetZero();
-
- SetOne();
-
- TTMATH_LOG("UInt::Div2_DivisorGreaterOrEqual")
-
- return true;
- }
- }
-
- TTMATH_LOG("UInt::Div2_DivisorGreaterOrEqual")
-
- return false;
- }
-
-
-public:
-
- /*!
- the third division algorithm
- */
- uint Div3(const UInt<value_size> & ss2, UInt<value_size> * remainder = 0)
- {
- if( this == &ss2 )
- {
- UInt<value_size> copy_ss2(ss2);
- return Div3Ref(copy_ss2, remainder);
- }
- else
- {
- return Div3Ref(ss2, remainder);
- }
- }
-
-
- /*!
- the third division algorithm
- */
- uint Div3(const UInt<value_size> & ss2, UInt<value_size> & remainder)
- {
- return Div3(ss2, &remainder);
- }
-
-
-private:
-
- /*!
- the third division algorithm
-
- this algorithm is described in the following book:
- "The art of computer programming 2" (4.3.1 page 272)
- Donald E. Knuth
- !! give the description here (from the book)
- */
- uint Div3Ref(const UInt<value_size> & v, UInt<value_size> * remainder = 0)
- {
- uint m,n, test;
-
- test = Div_StandardTest(v, m, n, remainder);
- if( test < 2 )
- return test;
-
- if( n == 0 )
- {
- uint r;
- DivInt( v.table[0], &r );
-
- if( remainder )
- {
- remainder->SetZero();
- remainder->table[0] = r;
- }
-
- TTMATH_LOG("UInt::Div3")
-
- return 0;
- }
-
-
- // we can only use the third division algorithm when
- // the divisor is greater or equal 2^32 (has more than one 32-bit word)
- ++m;
- ++n;
- m = m - n;
- Div3_Division(v, remainder, m, n);
-
- TTMATH_LOG("UInt::Div3")
-
- return 0;
- }
-
-
-
-private:
-
-
- void Div3_Division(UInt<value_size> v, UInt<value_size> * remainder, uint m, uint n)
- {
- TTMATH_ASSERT( n>=2 )
-
- UInt<value_size+1> uu, vv;
- UInt<value_size> q;
- uint d, u_value_size, u0, u1, u2, v1, v0, j=m;
-
- u_value_size = Div3_Normalize(v, n, d);
-
- if( j+n == value_size )
- u2 = u_value_size;
- else
- u2 = table[j+n];
-
- Div3_MakeBiggerV(v, vv);
-
- for(uint i = j+1 ; i<value_size ; ++i)
- q.table[i] = 0;
-
- while( true )
- {
- u1 = table[j+n-1];
- u0 = table[j+n-2];
- v1 = v.table[n-1];
- v0 = v.table[n-2];
-
- uint qp = Div3_Calculate(u2,u1,u0, v1,v0);
-
- Div3_MakeNewU(uu, j, n, u2);
- Div3_MultiplySubtract(uu, vv, qp);
- Div3_CopyNewU(uu, j, n);
-
- q.table[j] = qp;
-
- // the next loop
- if( j-- == 0 )
- break;
-
- u2 = table[j+n];
- }
-
- if( remainder )
- Div3_Unnormalize(remainder, n, d);
-
- *this = q;
-
- TTMATH_LOG("UInt::Div3_Division")
- }
-
-
- void Div3_MakeNewU(UInt<value_size+1> & uu, uint j, uint n, uint u_max)
- {
- uint i;
-
- for(i=0 ; i<n ; ++i, ++j)
- uu.table[i] = table[j];
-
- // 'n' is from <1..value_size> so and 'i' is from <0..value_size>
- // then table[i] is always correct (look at the declaration of 'uu')
- uu.table[i] = u_max;
-
- for( ++i ; i<value_size+1 ; ++i)
- uu.table[i] = 0;
-
- TTMATH_LOG("UInt::Div3_MakeNewU")
- }
-
-
- void Div3_CopyNewU(const UInt<value_size+1> & uu, uint j, uint n)
- {
- uint i;
-
- for(i=0 ; i<n ; ++i)
- table[i+j] = uu.table[i];
-
- if( i+j < value_size )
- table[i+j] = uu.table[i];
-
- TTMATH_LOG("UInt::Div3_CopyNewU")
- }
-
-
- /*!
- we're making the new 'vv'
- the value is actually the same but the 'table' is bigger (value_size+1)
- */
- void Div3_MakeBiggerV(const UInt<value_size> & v, UInt<value_size+1> & vv)
- {
- for(uint i=0 ; i<value_size ; ++i)
- vv.table[i] = v.table[i];
-
- vv.table[value_size] = 0;
-
- TTMATH_LOG("UInt::Div3_MakeBiggerV")
- }
-
-
- /*!
- we're moving all bits from 'v' into the left side of the n-1 word
- (the highest bit at v.table[n-1] will be equal one,
- the bits from 'this' we're moving the same times as 'v')
-
- return values:
- d - how many times we've moved
- return - the next-left value from 'this' (that after table[value_size-1])
- */
- uint Div3_Normalize(UInt<value_size> & v, uint n, uint & d)
- {
- // v.table[n-1] is != 0
-
- uint bit = (uint)FindLeadingBitInWord(v.table[n-1]);
- uint move = (TTMATH_BITS_PER_UINT - bit - 1);
- uint res = table[value_size-1];
- d = move;
-
- if( move > 0 )
- {
- v.Rcl(move, 0);
- Rcl(move, 0);
- res = res >> (bit + 1);
- }
- else
- {
- res = 0;
- }
-
- TTMATH_LOG("UInt::Div3_Normalize")
-
- return res;
- }
-
-
- void Div3_Unnormalize(UInt<value_size> * remainder, uint n, uint d)
- {
- for(uint i=n ; i<value_size ; ++i)
- table[i] = 0;
-
- Rcr(d,0);
-
- *remainder = *this;
-
- TTMATH_LOG("UInt::Div3_Unnormalize")
- }
-
-
- uint Div3_Calculate(uint u2, uint u1, uint u0, uint v1, uint v0)
- {
- UInt<2> u_temp;
- uint rp;
- bool next_test;
-
- TTMATH_ASSERT( v1 != 0 )
-
- u_temp.table[1] = u2;
- u_temp.table[0] = u1;
- u_temp.DivInt(v1, &rp);
-
- TTMATH_ASSERT( u_temp.table[1]==0 || u_temp.table[1]==1 )
-
- do
- {
- bool decrease = false;
-
- if( u_temp.table[1] == 1 )
- decrease = true;
- else
- {
- UInt<2> temp1, temp2;
-
- UInt<2>::MulTwoWords(u_temp.table[0], v0, temp1.table+1, temp1.table);
- temp2.table[1] = rp;
- temp2.table[0] = u0;
-
- if( temp1 > temp2 )
- decrease = true;
- }
-
- next_test = false;
-
- if( decrease )
- {
- u_temp.SubOne();
-
- rp += v1;
-
- if( rp >= v1 ) // it means that there wasn't a carry (r<b from the book)
- next_test = true;
- }
- }
- while( next_test );
-
- TTMATH_LOG("UInt::Div3_Calculate")
-
- return u_temp.table[0];
- }
-
-
-
- void Div3_MultiplySubtract( UInt<value_size+1> & uu,
- const UInt<value_size+1> & vv, uint & qp)
- {
- // D4 (in the book)
-
- UInt<value_size+1> vv_temp(vv);
- vv_temp.MulInt(qp);
-
- if( uu.Sub(vv_temp) )
- {
- // there was a carry
-
- //
- // !!! this part of code was not tested
- //
-
- --qp;
- uu.Add(vv);
-
- // can be a carry from this additions but it should be ignored
- // because it cancels with the borrow from uu.Sub(vv_temp)
- }
-
- TTMATH_LOG("UInt::Div3_MultiplySubtract")
- }
-
-
-
-
-
-
-public:
-
-
- /*!
- power this = this ^ pow
- binary algorithm (r-to-l)
-
- return values:
- 0 - ok
- 1 - carry
- 2 - incorrect argument (0^0)
- */
- uint Pow(UInt<value_size> pow)
- {
- if(pow.IsZero() && IsZero())
- // we don't define zero^zero
- return 2;
-
- UInt<value_size> start(*this), start_temp;
- UInt<value_size> result;
- result.SetOne();
- uint c = 0;
-
- while( !c )
- {
- if( pow.table[0] & 1 )
- c += result.Mul(start);
-
- pow.Rcr2_one(0);
- if( pow.IsZero() )
- break;
-
- start_temp = start;
- // in the second Mul algorithm we can use start.Mul(start) directly (there is no TTMATH_ASSERT_REFERENCE there)
- c += start.Mul(start_temp);
- }
-
- *this = result;
-
- TTMATH_LOGC("UInt::Pow(UInt<>)", c)
-
- return (c==0)? 0 : 1;
- }
-
-
- /*!
- square root
- e.g. Sqrt(9) = 3
- ('digit-by-digit' algorithm)
- */
- void Sqrt()
- {
- UInt<value_size> bit, temp;
-
- if( IsZero() )
- return;
-
- UInt<value_size> value(*this);
-
- SetZero();
- bit.SetZero();
- bit.table[value_size-1] = (TTMATH_UINT_HIGHEST_BIT >> 1);
-
- while( bit > value )
- bit.Rcr(2);
-
- while( !bit.IsZero() )
- {
- temp = *this;
- temp.Add(bit);
-
- if( value >= temp )
- {
- value.Sub(temp);
- Rcr(1);
- Add(bit);
- }
- else
- {
- Rcr(1);
- }
-
- bit.Rcr(2);
- }
-
- TTMATH_LOG("UInt::Sqrt")
- }
-
-
-
- /*!
- this method sets n first bits to value zero
-
- For example:
- let n=2 then if there's a value 111 (bin) there'll be '100' (bin)
- */
- void ClearFirstBits(uint n)
- {
- if( n >= value_size*TTMATH_BITS_PER_UINT )
- {
- SetZero();
- TTMATH_LOG("UInt::ClearFirstBits")
- return;
- }
-
- uint * p = table;
-
- // first we're clearing the whole words
- while( n >= TTMATH_BITS_PER_UINT )
- {
- *p++ = 0;
- n -= TTMATH_BITS_PER_UINT;
- }
-
- if( n == 0 )
- {
- TTMATH_LOG("UInt::ClearFirstBits")
- return;
- }
-
- // and then we're clearing one word which has left
- // mask -- all bits are set to one
- uint mask = TTMATH_UINT_MAX_VALUE;
-
- mask = mask << n;
-
- (*p) &= mask;
-
- TTMATH_LOG("UInt::ClearFirstBits")
- }
-
-
- /*!
- this method returns true if the highest bit of the value is set
- */
- bool IsTheHighestBitSet() const
- {
- return (table[value_size-1] & TTMATH_UINT_HIGHEST_BIT) != 0;
- }
-
-
- /*!
- this method returns true if the lowest bit of the value is set
- */
- bool IsTheLowestBitSet() const
- {
- return (*table & 1) != 0;
- }
-
-
- /*!
- returning true if only the highest bit is set
- */
- bool IsOnlyTheHighestBitSet() const
- {
- for(uint i=0 ; i<value_size-1 ; ++i)
- if( table[i] != 0 )
- return false;
-
- if( table[value_size-1] != TTMATH_UINT_HIGHEST_BIT )
- return false;
-
- return true;
- }
-
-
- /*!
- returning true if only the lowest bit is set
- */
- bool IsOnlyTheLowestBitSet() const
- {
- if( table[0] != 1 )
- return false;
-
- for(uint i=1 ; i<value_size ; ++i)
- if( table[i] != 0 )
- return false;
-
- return true;
- }
-
-
- /*!
- this method returns true if the value is equal zero
- */
- bool IsZero() const
- {
- for(uint i=0 ; i<value_size ; ++i)
- if(table[i] != 0)
- return false;
-
- return true;
- }
-
-
- /*!
- returning true if first 'bits' bits are equal zero
- */
- bool AreFirstBitsZero(uint bits) const
- {
- TTMATH_ASSERT( bits <= value_size * TTMATH_BITS_PER_UINT )
-
- uint index = bits / TTMATH_BITS_PER_UINT;
- uint rest = bits % TTMATH_BITS_PER_UINT;
- uint i;
-
- for(i=0 ; i<index ; ++i)
- if(table[i] != 0 )
- return false;
-
- if( rest == 0 )
- return true;
-
- uint mask = TTMATH_UINT_MAX_VALUE >> (TTMATH_BITS_PER_UINT - rest);
-
- return (table[i] & mask) == 0;
- }
-
-
-
- /*!
- *
- * conversion methods
- *
- */
-
-
-
- /*!
- this method converts an UInt<another_size> type to this class
-
- this operation has mainly sense if the value from p is
- equal or smaller than that one which is returned from UInt<value_size>::SetMax()
-
- it returns a carry if the value 'p' is too big
- */
- template<uint argument_size>
- uint FromUInt(const UInt<argument_size> & p)
- {
- uint min_size = (value_size < argument_size)? value_size : argument_size;
- uint i;
-
- for(i=0 ; i<min_size ; ++i)
- table[i] = p.table[i];
-
-
- if( value_size > argument_size )
- {
- // 'this' is longer than 'p'
-
- for( ; i<value_size ; ++i)
- table[i] = 0;
- }
- else
- {
- for( ; i<argument_size ; ++i)
- if( p.table[i] != 0 )
- {
- TTMATH_LOGC("UInt::FromUInt(UInt<>)", 1)
- return 1;
- }
- }
-
- TTMATH_LOGC("UInt::FromUInt(UInt<>)", 0)
-
- return 0;
- }
-
-
- /*!
- this method converts an UInt<another_size> type to this class
-
- this operation has mainly sense if the value from p is
- equal or smaller than that one which is returned from UInt<value_size>::SetMax()
-
- it returns a carry if the value 'p' is too big
- */
- template<uint argument_size>
- uint FromInt(const UInt<argument_size> & p)
- {
- return FromUInt(p);
- }
-
-
- /*!
- this method converts the uint type to this class
- */
- uint FromUInt(uint value)
- {
- for(uint i=1 ; i<value_size ; ++i)
- table[i] = 0;
-
- table[0] = value;
-
- TTMATH_LOG("UInt::FromUInt(uint)")
-
- // there'll never be a carry here
- return 0;
- }
-
-
- /*!
- this method converts the uint type to this class
- */
- uint FromInt(uint value)
- {
- return FromUInt(value);
- }
-
-
- /*!
- this method converts the sint type to this class
- */
- uint FromInt(sint value)
- {
- uint c = FromUInt(uint(value));
-
- if( c || value < 0 )
- return 1;
-
- return 0;
- }
-
-
- /*!
- this operator converts an UInt<another_size> type to this class
-
- it doesn't return a carry
- */
- template<uint argument_size>
- UInt<value_size> & operator=(const UInt<argument_size> & p)
- {
- FromUInt(p);
-
- return *this;
- }
-
-
- /*!
- the assignment operator
- */
- UInt<value_size> & operator=(const UInt<value_size> & p)
- {
- for(uint i=0 ; i<value_size ; ++i)
- table[i] = p.table[i];
-
- TTMATH_LOG("UInt::operator=(UInt<>)")
-
- return *this;
- }
-
-
- /*!
- this method converts the uint type to this class
- */
- UInt<value_size> & operator=(uint i)
- {
- FromUInt(i);
-
- return *this;
- }
-
-
- /*!
- a constructor for converting the uint to this class
- */
- UInt(uint i)
- {
- FromUInt(i);
- }
-
-
- /*!
- this method converts the sint type to this class
- */
- UInt<value_size> & operator=(sint i)
- {
- FromInt(i);
-
- return *this;
- }
-
-
- /*!
- a constructor for converting the sint to this class
-
- look at the description of UInt::operator=(sint)
- */
- UInt(sint i)
- {
- FromInt(i);
- }
-
-
-#ifdef TTMATH_PLATFORM32
-
-
- /*!
- this method converts unsigned 64 bit int type to this class
- ***this method is created only on a 32bit platform***
- */
- uint FromUInt(ulint n)
- {
- table[0] = (uint)n;
-
- if( value_size == 1 )
- {
- uint c = ((n >> TTMATH_BITS_PER_UINT) == 0) ? 0 : 1;
-
- TTMATH_LOGC("UInt::FromUInt(ulint)", c)
- return c;
- }
-
- table[1] = (uint)(n >> TTMATH_BITS_PER_UINT);
-
- for(uint i=2 ; i<value_size ; ++i)
- table[i] = 0;
-
- TTMATH_LOG("UInt::FromUInt(ulint)")
-
- return 0;
- }
-
-
- /*!
- this method converts unsigned 64 bit int type to this class
- ***this method is created only on a 32bit platform***
- */
- uint FromInt(ulint n)
- {
- return FromUInt(n);
- }
-
-
- /*!
- this method converts signed 64 bit int type to this class
- ***this method is created only on a 32bit platform***
- */
- uint FromInt(slint n)
- {
- uint c = FromUInt(ulint(n));
-
- if( c || n < 0 )
- return 1;
-
- return 0;
- }
-
-
- /*!
- this operator converts unsigned 64 bit int type to this class
- ***this operator is created only on a 32bit platform***
- */
- UInt<value_size> & operator=(ulint n)
- {
- FromUInt(n);
-
- return *this;
- }
-
-
- /*!
- a constructor for converting unsigned 64 bit int to this class
- ***this constructor is created only on a 32bit platform***
- */
- UInt(ulint n)
- {
- FromUInt(n);
- }
-
-
- /*!
- this operator converts signed 64 bit int type to this class
- ***this operator is created only on a 32bit platform***
- */
- UInt<value_size> & operator=(slint n)
- {
- FromInt(n);
-
- return *this;
- }
-
-
- /*!
- a constructor for converting signed 64 bit int to this class
- ***this constructor is created only on a 32bit platform***
- */
- UInt(slint n)
- {
- FromInt(n);
- }
-
-#endif
-
-
-
-#ifdef TTMATH_PLATFORM64
-
-
- /*!
- this method converts 32 bit unsigned int type to this class
- ***this operator is created only on a 64bit platform***
- */
- uint FromUInt(unsigned int i)
- {
- return FromUInt(uint(i));
- }
-
- /*!
- this method converts 32 bit unsigned int type to this class
- ***this operator is created only on a 64bit platform***
- */
- uint FromInt(unsigned int i)
- {
- return FromUInt(uint(i));
- }
-
-
- /*!
- this method converts 32 bit signed int type to this class
- ***this operator is created only on a 64bit platform***
- */
- uint FromInt(signed int i)
- {
- return FromInt(sint(i));
- }
-
-
- /*!
- this operator converts 32 bit unsigned int type to this class
- ***this operator is created only on a 64bit platform***
- */
- UInt<value_size> & operator=(unsigned int i)
- {
- FromUInt(i);
-
- return *this;
- }
-
-
- /*!
- a constructor for converting 32 bit unsigned int to this class
- ***this constructor is created only on a 64bit platform***
- */
- UInt(unsigned int i)
- {
- FromUInt(i);
- }
-
-
- /*!
- an operator for converting 32 bit signed int to this class
- ***this constructor is created only on a 64bit platform***
- */
- UInt<value_size> & operator=(signed int i)
- {
- FromInt(i);
-
- return *this;
- }
-
-
- /*!
- a constructor for converting 32 bit signed int to this class
- ***this constructor is created only on a 64bit platform***
- */
- UInt(signed int i)
- {
- FromInt(i);
- }
-
-
-#endif
-
-
-
-
-
- /*!
- a constructor for converting a string to this class (with the base=10)
- */
- UInt(const char * s)
- {
- FromString(s);
- }
-
-
- /*!
- a constructor for converting a string to this class (with the base=10)
- */
- UInt(const std::string & s)
- {
- FromString( s.c_str() );
- }
-
-
-#ifndef TTMATH_DONT_USE_WCHAR
-
- /*!
- a constructor for converting a string to this class (with the base=10)
- */
- UInt(const wchar_t * s)
- {
- FromString(s);
- }
-
-
- /*!
- a constructor for converting a string to this class (with the base=10)
- */
- UInt(const std::wstring & s)
- {
- FromString( s.c_str() );
- }
-
-#endif
-
-
-
-
- /*!
- a default constructor
-
- we don't clear the table
- */
- UInt()
- {
- // when macro TTMATH_DEBUG_LOG is defined
- // we set special values to the table
- // in order to be everywhere the same value of the UInt object
- // without this it would be difficult to analyse the log file
- #ifdef TTMATH_DEBUG_LOG
- #ifdef TTMATH_PLATFORM32
- for(uint i=0 ; i<value_size ; ++i)
- table[i] = 0xc1c1c1c1;
- #else
- for(uint i=0 ; i<value_size ; ++i)
- table[i] = 0xc1c1c1c1c1c1c1c1;
- #endif
- #endif
- }
-
-
- /*!
- a copy constructor
- */
- UInt(const UInt<value_size> & u)
- {
- for(uint i=0 ; i<value_size ; ++i)
- table[i] = u.table[i];
-
- TTMATH_LOG("UInt::UInt(UInt<>)")
- }
-
-
-
- /*!
- a template for producting constructors for copying from another types
- */
- template<uint argument_size>
- UInt(const UInt<argument_size> & u)
- {
- // look that 'size' we still set as 'value_size' and not as u.value_size
- FromUInt(u);
- }
-
-
-
-
- /*!
- a destructor
- */
- ~UInt()
- {
- }
-
-
- /*!
- this method returns the lowest value from table
-
- we must be sure when we using this method whether the value
- will hold in an uint type or not (the rest value from the table must be zero)
- */
- uint ToUInt() const
- {
- return table[0];
- }
-
-
- /*!
- this method converts the value to uint type
- can return a carry if the value is too long to store it in uint type
- */
- uint ToUInt(uint & result) const
- {
- result = table[0];
-
- for(uint i=1 ; i<value_size ; ++i)
- if( table[i] != 0 )
- return 1;
-
- return 0;
- }
-
-
- /*!
- this method converts the value to uint type
- can return a carry if the value is too long to store it in uint type
- */
- uint ToInt(uint & result) const
- {
- return ToUInt(result);
- }
-
-
- /*!
- this method converts the value to sint type (signed integer)
- can return a carry if the value is too long to store it in sint type
- */
- uint ToInt(sint & result) const
- {
- result = sint(table[0]);
-
- if( (result & TTMATH_UINT_HIGHEST_BIT) != 0 )
- return 1;
-
- for(uint i=1 ; i<value_size ; ++i)
- if( table[i] != 0 )
- return 1;
-
- return 0;
- }
-
-
-#ifdef TTMATH_PLATFORM32
-
- /*!
- this method converts the value to ulint type (64 bit unsigned integer)
- can return a carry if the value is too long to store it in ulint type
- *** this method is created only on a 32 bit platform ***
- */
- uint ToUInt(ulint & result) const
- {
- if( value_size == 1 )
- {
- result = table[0];
- }
- else
- {
- uint low = table[0];
- uint high = table[1];
-
- result = low;
- result |= (ulint(high) << TTMATH_BITS_PER_UINT);
-
- for(uint i=2 ; i<value_size ; ++i)
- if( table[i] != 0 )
- return 1;
- }
-
- return 0;
- }
-
-
- /*!
- this method converts the value to ulint type (64 bit unsigned integer)
- can return a carry if the value is too long to store it in ulint type
- *** this method is created only on a 32 bit platform ***
- */
- uint ToInt(ulint & result) const
- {
- return ToUInt(result);
- }
-
-
- /*!
- this method converts the value to slint type (64 bit signed integer)
- can return a carry if the value is too long to store it in slint type
- *** this method is created only on a 32 bit platform ***
- */
- uint ToInt(slint & result) const
- {
- ulint temp;
-
- uint c = ToUInt(temp);
- result = slint(temp);
-
- if( c || result < 0 )
- return 1;
-
- return 0;
- }
-
-#endif
-
-
-
-#ifdef TTMATH_PLATFORM64
-
- /*!
- this method converts the value to a 32 unsigned integer
- can return a carry if the value is too long to store it in this type
- *** this method is created only on a 64 bit platform ***
- */
- uint ToUInt(unsigned int & result) const
- {
- result = (unsigned int)table[0];
-
- if( (table[0] >> 32) != 0 )
- return 1;
-
- for(uint i=1 ; i<value_size ; ++i)
- if( table[i] != 0 )
- return 1;
-
- return 0;
- }
-
-
- /*!
- this method converts the value to a 32 unsigned integer
- can return a carry if the value is too long to store it in this type
- *** this method is created only on a 64 bit platform ***
- */
- uint ToInt(unsigned int & result) const
- {
- return ToUInt(result);
- }
-
-
- /*!
- this method converts the value to a 32 signed integer
- can return a carry if the value is too long to store it in this type
- *** this method is created only on a 64 bit platform ***
- */
- uint ToInt(int & result) const
- {
- unsigned int temp;
-
- uint c = ToUInt(temp);
- result = int(temp);
-
- if( c || result < 0 )
- return 1;
-
- return 0;
- }
-
-
-#endif
-
-
-
-
-private:
-
- /*!
- an auxiliary method for converting to a string
- */
- template<class string_type>
- void ToStringBase(string_type & result, uint b = 10) const
- {
- UInt<value_size> temp( *this );
- char character;
- uint rem;
-
- result.clear();
-
- if( b<2 || b>16 )
- return;
-
- do
- {
- temp.DivInt(b, &rem);
- character = static_cast<char>( Misc::DigitToChar(rem) );
- result.insert(result.begin(), character);
- }
- while( !temp.IsZero() );
-
- return;
- }
-
-
-public:
-
- /*!
- this method converts the value to a string with a base equal 'b'
- */
- void ToString(std::string & result, uint b = 10) const
- {
- return ToStringBase(result, b);
- }
-
-
- std::string ToString(uint b = 10) const
- {
- std::string result;
- ToStringBase(result, b);
-
- return result;
- }
-
-
-#ifndef TTMATH_DONT_USE_WCHAR
-
- void ToString(std::wstring & result, uint b = 10) const
- {
- return ToStringBase(result, b);
- }
-
- std::wstring ToWString(uint b = 10) const
- {
- std::wstring result;
- ToStringBase(result, b);
-
- return result;
- }
-
-#endif
-
-
-
-private:
-
- /*!
- an auxiliary method for converting from a string
- */
- template<class char_type>
- uint FromStringBase(const char_type * s, uint b = 10, const char_type ** after_source = 0, bool * value_read = 0)
- {
- UInt<value_size> base( b );
- UInt<value_size> temp;
- sint z;
- uint c = 0;
-
- SetZero();
- temp.SetZero();
- Misc::SkipWhiteCharacters(s);
-
- if( after_source )
- *after_source = s;
-
- if( value_read )
- *value_read = false;
-
- if( b<2 || b>16 )
- return 1;
-
-
- for( ; (z=Misc::CharToDigit(*s, b)) != -1 ; ++s)
- {
- if( value_read )
- *value_read = true;
-
- if( c == 0 )
- {
- temp.table[0] = z;
-
- c += Mul(base);
- c += Add(temp);
- }
- }
-
- if( after_source )
- *after_source = s;
-
- TTMATH_LOGC("UInt::FromString", c)
-
- return (c==0)? 0 : 1;
- }
-
-
-public:
-
-
- /*!
- this method converts a string into its value
- it returns carry=1 if the value will be too big or an incorrect base 'b' is given
-
- string is ended with a non-digit value, for example:
- "12" will be translated to 12
- as well as:
- "12foo" will be translated to 12 too
-
- existing first white characters will be ommited
-
- if the value from s is too large the rest digits will be skipped
-
- after_source (if exists) is pointing at the end of the parsed string
-
- value_read (if exists) tells whether something has actually been read (at least one digit)
- */
- uint FromString(const char * s, uint b = 10, const char ** after_source = 0, bool * value_read = 0)
- {
- return FromStringBase(s, b, after_source, value_read);
- }
-
-
- /*!
- this method converts a string into its value
-
- (it returns carry=1 if the value will be too big or an incorrect base 'b' is given)
- */
- uint FromString(const std::string & s, uint b = 10)
- {
- return FromString( s.c_str(), b );
- }
-
-
- /*!
- this operator converts a string into its value (with base = 10)
- */
- UInt<value_size> & operator=(const char * s)
- {
- FromString(s);
-
- return *this;
- }
-
-
- /*!
- this operator converts a string into its value (with base = 10)
- */
- UInt<value_size> & operator=(const std::string & s)
- {
- FromString( s.c_str() );
-
- return *this;
- }
-
-
-
-#ifndef TTMATH_DONT_USE_WCHAR
-
- /*!
- this method converts a string into its value
- */
- uint FromString(const wchar_t * s, uint b = 10, const wchar_t ** after_source = 0, bool * value_read = 0)
- {
- return FromStringBase(s, b, after_source, value_read);
- }
-
-
- /*!
- this method converts a string into its value
-
- (it returns carry=1 if the value will be too big or an incorrect base 'b' is given)
- */
- uint FromString(const std::wstring & s, uint b = 10)
- {
- return FromString( s.c_str(), b );
- }
-
-
- /*!
- this operator converts a string into its value (with base = 10)
- */
- UInt<value_size> & operator=(const wchar_t * s)
- {
- FromString(s);
-
- return *this;
- }
-
-
- /*!
- this operator converts a string into its value (with base = 10)
- */
- UInt<value_size> & operator=(const std::wstring & s)
- {
- FromString( s.c_str() );
-
- return *this;
- }
-
-#endif
-
-
- /*!
- *
- * methods for comparing
- *
- */
-
-
- /*!
- this method returns true if 'this' is smaller than 'l'
-
- 'index' is an index of the first word from will be the comparison performed
- (note: we start the comparison from back - from the last word, when index is -1 /default/
- it is automatically set into the last word)
- I introduced it for some kind of optimization made in the second division algorithm (Div2)
- */
- bool CmpSmaller(const UInt<value_size> & l, sint index = -1) const
- {
- sint i;
-
- if( index==-1 || index>=sint(value_size) )
- i = value_size - 1;
- else
- i = index;
-
-
- for( ; i>=0 ; --i)
- {
- if( table[i] != l.table[i] )
- return table[i] < l.table[i];
- }
-
- // they're equal
- return false;
- }
-
-
-
- /*!
- this method returns true if 'this' is bigger than 'l'
-
- 'index' is an index of the first word from will be the comparison performed
- (note: we start the comparison from back - from the last word, when index is -1 /default/
- it is automatically set into the last word)
-
- I introduced it for some kind of optimization made in the second division algorithm (Div2)
- */
- bool CmpBigger(const UInt<value_size> & l, sint index = -1) const
- {
- sint i;
-
- if( index==-1 || index>=sint(value_size) )
- i = value_size - 1;
- else
- i = index;
-
-
- for( ; i>=0 ; --i)
- {
- if( table[i] != l.table[i] )
- return table[i] > l.table[i];
- }
-
- // they're equal
- return false;
- }
-
-
- /*!
- this method returns true if 'this' is equal 'l'
-
- 'index' is an index of the first word from will be the comparison performed
- (note: we start the comparison from back - from the last word, when index is -1 /default/
- it is automatically set into the last word)
- */
- bool CmpEqual(const UInt<value_size> & l, sint index = -1) const
- {
- sint i;
-
- if( index==-1 || index>=sint(value_size) )
- i = value_size - 1;
- else
- i = index;
-
-
- for( ; i>=0 ; --i)
- if( table[i] != l.table[i] )
- return false;
-
- return true;
- }
-
-
-
- /*!
- this method returns true if 'this' is smaller than or equal 'l'
-
- 'index' is an index of the first word from will be the comparison performed
- (note: we start the comparison from back - from the last word, when index is -1 /default/
- it is automatically set into the last word)
- */
- bool CmpSmallerEqual(const UInt<value_size> & l, sint index=-1) const
- {
- sint i;
-
- if( index==-1 || index>=sint(value_size) )
- i = value_size - 1;
- else
- i = index;
-
-
- for( ; i>=0 ; --i)
- {
- if( table[i] != l.table[i] )
- return table[i] < l.table[i];
- }
-
- // they're equal
- return true;
- }
-
-
-
- /*!
- this method returns true if 'this' is bigger than or equal 'l'
-
- 'index' is an index of the first word from will be the comparison performed
- (note: we start the comparison from back - from the last word, when index is -1 /default/
- it is automatically set into the last word)
- */
- bool CmpBiggerEqual(const UInt<value_size> & l, sint index=-1) const
- {
- sint i;
-
- if( index==-1 || index>=sint(value_size) )
- i = value_size - 1;
- else
- i = index;
-
-
- for( ; i>=0 ; --i)
- {
- if( table[i] != l.table[i] )
- return table[i] > l.table[i];
- }
-
- // they're equal
- return true;
- }
-
-
- /*
- operators for comparising
- */
-
- bool operator<(const UInt<value_size> & l) const
- {
- return CmpSmaller(l);
- }
-
-
- bool operator>(const UInt<value_size> & l) const
- {
- return CmpBigger(l);
- }
-
-
- bool operator==(const UInt<value_size> & l) const
- {
- return CmpEqual(l);
- }
-
-
- bool operator!=(const UInt<value_size> & l) const
- {
- return !operator==(l);
- }
-
-
- bool operator<=(const UInt<value_size> & l) const
- {
- return CmpSmallerEqual(l);
- }
-
- bool operator>=(const UInt<value_size> & l) const
- {
- return CmpBiggerEqual(l);
- }
-
-
- /*!
- *
- * standard mathematical operators
- *
- */
-
- UInt<value_size> operator-(const UInt<value_size> & p2) const
- {
- UInt<value_size> temp(*this);
-
- temp.Sub(p2);
-
- return temp;
- }
-
- UInt<value_size> & operator-=(const UInt<value_size> & p2)
- {
- Sub(p2);
-
- return *this;
- }
-
- UInt<value_size> operator+(const UInt<value_size> & p2) const
- {
- UInt<value_size> temp(*this);
-
- temp.Add(p2);
-
- return temp;
- }
-
- UInt<value_size> & operator+=(const UInt<value_size> & p2)
- {
- Add(p2);
-
- return *this;
- }
-
-
- UInt<value_size> operator*(const UInt<value_size> & p2) const
- {
- UInt<value_size> temp(*this);
-
- temp.Mul(p2);
-
- return temp;
- }
-
-
- UInt<value_size> & operator*=(const UInt<value_size> & p2)
- {
- Mul(p2);
-
- return *this;
- }
-
-
- UInt<value_size> operator/(const UInt<value_size> & p2) const
- {
- UInt<value_size> temp(*this);
-
- temp.Div(p2);
-
- return temp;
- }
-
-
- UInt<value_size> & operator/=(const UInt<value_size> & p2)
- {
- Div(p2);
-
- return *this;
- }
-
-
- UInt<value_size> operator%(const UInt<value_size> & p2) const
- {
- UInt<value_size> temp(*this);
- UInt<value_size> remainder;
-
- temp.Div( p2, remainder );
-
- return remainder;
- }
-
-
- UInt<value_size> & operator%=(const UInt<value_size> & p2)
- {
- UInt<value_size> remainder;
-
- Div( p2, remainder );
- operator=(remainder);
-
- return *this;
- }
-
-
- /*!
- Prefix operator e.g ++variable
- */
- UInt<value_size> & operator++()
- {
- AddOne();
-
- return *this;
- }
-
-
- /*!
- Postfix operator e.g variable++
- */
- UInt<value_size> operator++(int)
- {
- UInt<value_size> temp( *this );
-
- AddOne();
-
- return temp;
- }
-
-
- UInt<value_size> & operator--()
- {
- SubOne();
-
- return *this;
- }
-
-
- UInt<value_size> operator--(int)
- {
- UInt<value_size> temp( *this );
-
- SubOne();
-
- return temp;
- }
-
-
-
- /*!
- *
- * bitwise operators
- *
- */
-
- UInt<value_size> operator~() const
- {
- UInt<value_size> temp( *this );
-
- temp.BitNot();
-
- return temp;
- }
-
-
- UInt<value_size> operator&(const UInt<value_size> & p2) const
- {
- UInt<value_size> temp( *this );
-
- temp.BitAnd(p2);
-
- return temp;
- }
-
-
- UInt<value_size> & operator&=(const UInt<value_size> & p2)
- {
- BitAnd(p2);
-
- return *this;
- }
-
-
- UInt<value_size> operator|(const UInt<value_size> & p2) const
- {
- UInt<value_size> temp( *this );
-
- temp.BitOr(p2);
-
- return temp;
- }
-
-
- UInt<value_size> & operator|=(const UInt<value_size> & p2)
- {
- BitOr(p2);
-
- return *this;
- }
-
-
- UInt<value_size> operator^(const UInt<value_size> & p2) const
- {
- UInt<value_size> temp( *this );
-
- temp.BitXor(p2);
-
- return temp;
- }
-
-
- UInt<value_size> & operator^=(const UInt<value_size> & p2)
- {
- BitXor(p2);
-
- return *this;
- }
-
-
- UInt<value_size> operator>>(int move) const
- {
- UInt<value_size> temp( *this );
-
- temp.Rcr(move);
-
- return temp;
- }
-
-
- UInt<value_size> & operator>>=(int move)
- {
- Rcr(move);
-
- return *this;
- }
-
-
- UInt<value_size> operator<<(int move) const
- {
- UInt<value_size> temp( *this );
-
- temp.Rcl(move);
-
- return temp;
- }
-
-
- UInt<value_size> & operator<<=(int move)
- {
- Rcl(move);
-
- return *this;
- }
-
-
- /*!
- *
- * input/output operators for standard streams
- *
- * (they are very simple, in the future they should be changed)
- *
- */
-
-
-private:
-
-
- /*!
- an auxiliary method for outputing to standard streams
- */
- template<class ostream_type, class string_type>
- static ostream_type & OutputToStream(ostream_type & s, const UInt<value_size> & l)
- {
- string_type ss;
-
- l.ToString(ss);
- s << ss;
-
- return s;
- }
-
-
-public:
-
-
- /*!
- output to standard streams
- */
- friend std::ostream & operator<<(std::ostream & s, const UInt<value_size> & l)
- {
- return OutputToStream<std::ostream, std::string>(s, l);
- }
-
-
-#ifndef TTMATH_DONT_USE_WCHAR
-
- /*!
- output to standard streams
- */
- friend std::wostream & operator<<(std::wostream & s, const UInt<value_size> & l)
- {
- return OutputToStream<std::wostream, std::wstring>(s, l);
- }
-
-#endif
-
-
-
-private:
-
- /*!
- an auxiliary method for reading from standard streams
- */
- template<class istream_type, class string_type, class char_type>
- static istream_type & InputFromStream(istream_type & s, UInt<value_size> & l)
- {
- string_type ss;
-
- // char or wchar_t for operator>>
- char_type z;
-
- // operator>> omits white characters if they're set for ommiting
- s >> z;
-
- // we're reading only digits (base=10)
- while( s.good() && Misc::CharToDigit(z, 10)>=0 )
- {
- ss += z;
- z = static_cast<char_type>(s.get());
- }
-
- // we're leaving the last read character
- // (it's not belonging to the value)
- s.unget();
-
- l.FromString(ss);
-
- return s;
- }
-
-public:
-
-
- /*!
- input from standard streams
- */
- friend std::istream & operator>>(std::istream & s, UInt<value_size> & l)
- {
- return InputFromStream<std::istream, std::string, char>(s, l);
- }
-
-
-#ifndef TTMATH_DONT_USE_WCHAR
-
- /*!
- input from standard streams
- */
- friend std::wistream & operator>>(std::wistream & s, UInt<value_size> & l)
- {
- return InputFromStream<std::wistream, std::wstring, wchar_t>(s, l);
- }
-
-#endif
-
-
- /*
- following methods are defined in:
- ttmathuint_x86.h
- ttmathuint_x86_64.h
- ttmathuint_noasm.h
- */
-
-#ifdef TTMATH_NOASM
- static uint AddTwoWords(uint a, uint b, uint carry, uint * result);
- static uint SubTwoWords(uint a, uint b, uint carry, uint * result);
-
-#ifdef TTMATH_PLATFORM64
-
- union uint_
- {
- struct
- {
- unsigned int low; // 32 bit
- unsigned int high; // 32 bit
- } u_;
-
- uint u; // 64 bit
- };
-
-
- static void DivTwoWords2(uint a,uint b, uint c, uint * r, uint * rest);
- static uint DivTwoWordsNormalize(uint_ & a_, uint_ & b_, uint_ & c_);
- static uint DivTwoWordsUnnormalize(uint u, uint d);
- static unsigned int DivTwoWordsCalculate(uint_ u_, unsigned int u3, uint_ v_);
- static void MultiplySubtract(uint_ & u_, unsigned int & u3, unsigned int & q, uint_ v_);
-
-#endif // TTMATH_PLATFORM64
-#endif // TTMATH_NOASM
-
-
-private:
- uint Rcl2_one(uint c);
- uint Rcr2_one(uint c);
- uint Rcl2(uint bits, uint c);
- uint Rcr2(uint bits, uint c);
-
-public:
- static const char * LibTypeStr();
- static LibTypeCode LibType();
- uint Add(const UInt<value_size> & ss2, uint c=0);
- uint AddInt(uint value, uint index = 0);
- uint AddTwoInts(uint x2, uint x1, uint index);
- static uint AddVector(const uint * ss1, const uint * ss2, uint ss1_size, uint ss2_size, uint * result);
- uint Sub(const UInt<value_size> & ss2, uint c=0);
- uint SubInt(uint value, uint index = 0);
- static uint SubVector(const uint * ss1, const uint * ss2, uint ss1_size, uint ss2_size, uint * result);
- static sint FindLeadingBitInWord(uint x);
- static sint FindLowestBitInWord(uint x);
- static uint SetBitInWord(uint & value, uint bit);
- static void MulTwoWords(uint a, uint b, uint * result_high, uint * result_low);
- static void DivTwoWords(uint a,uint b, uint c, uint * r, uint * rest);
-
-};
-
-
-
-/*!
- this specialization is needed in order to not confused the compiler "error: ISO C++ forbids zero-size array"
- when compiling Mul3Big2() method
-*/
-template<>
-class UInt<0>
-{
-public:
- uint table[1];
-
- void Mul2Big(const UInt<0> &, UInt<0> &) { TTMATH_ASSERT(false) };
- void SetZero() { TTMATH_ASSERT(false) };
- uint AddTwoInts(uint, uint, uint) { TTMATH_ASSERT(false) return 0; };
-};
-
-
-} //namespace
-
-
-#include "ttmathuint_x86.h"
-#include "ttmathuint_x86_64.h"
-#include "ttmathuint_noasm.h"
-
-#endif
diff --git a/ttmath/ttmathuint_noasm.h b/ttmath/ttmathuint_noasm.h
deleted file mode 100644
index 07c73fc..0000000
--- a/ttmath/ttmathuint_noasm.h
+++ /dev/null
@@ -1,1017 +0,0 @@
-/*
- * This file is a part of TTMath Bignum Library
- * and is distributed under the (new) BSD licence.
- * Author: Tomasz Sowa <t.sowa at ttmath.org>
- */
-
-/*
- * Copyright (c) 2006-2010, Tomasz Sowa
- * All rights reserved.
- *
- * Redistribution and use in source and binary forms, with or without
- * modification, are permitted provided that the following conditions are met:
- *
- * * Redistributions of source code must retain the above copyright notice,
- * this list of conditions and the following disclaimer.
- *
- * * Redistributions in binary form must reproduce the above copyright
- * notice, this list of conditions and the following disclaimer in the
- * documentation and/or other materials provided with the distribution.
- *
- * * Neither the name Tomasz Sowa nor the names of contributors to this
- * project may be used to endorse or promote products derived
- * from this software without specific prior written permission.
- *
- * THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS"
- * AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
- * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- * ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE
- * LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR
- * CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF
- * SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS
- * INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN
- * CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
- * ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF
- * THE POSSIBILITY OF SUCH DAMAGE.
- */
-
-#ifndef headerfilettmathuint_noasm
-#define headerfilettmathuint_noasm
-
-
-#ifdef TTMATH_NOASM
-
-/*!
- \file ttmathuint_noasm.h
- \brief template class UInt<uint> with methods without any assembler code
-
- this file is included at the end of ttmathuint.h
-*/
-
-
-namespace ttmath
-{
-
- /*!
- returning the string represents the currect type of the library
- we have following types:
- asm_vc_32 - with asm code designed for Microsoft Visual C++ (32 bits)
- asm_gcc_32 - with asm code designed for GCC (32 bits)
- asm_vc_64 - with asm for VC (64 bit)
- asm_gcc_64 - with asm for GCC (64 bit)
- no_asm_32 - pure C++ version (32 bit) - without any asm code
- no_asm_64 - pure C++ version (64 bit) - without any asm code
- */
- template<uint value_size>
- const char * UInt<value_size>::LibTypeStr()
- {
- #ifdef TTMATH_PLATFORM32
- static const char info[] = "no_asm_32";
- #endif
-
- #ifdef TTMATH_PLATFORM64
- static const char info[] = "no_asm_64";
- #endif
-
- return info;
- }
-
-
- /*!
- returning the currect type of the library
- */
- template<uint value_size>
- LibTypeCode UInt<value_size>::LibType()
- {
- #ifdef TTMATH_PLATFORM32
- LibTypeCode info = no_asm_32;
- #endif
-
- #ifdef TTMATH_PLATFORM64
- LibTypeCode info = no_asm_64;
- #endif
-
- return info;
- }
-
-
- /*!
- this method adds two words together
- returns carry
-
- this method is created only when TTMATH_NOASM macro is defined
- */
- template<uint value_size>
- uint UInt<value_size>::AddTwoWords(uint a, uint b, uint carry, uint * result)
- {
- uint temp;
-
- if( carry == 0 )
- {
- temp = a + b;
-
- if( temp < a )
- carry = 1;
- }
- else
- {
- carry = 1;
- temp = a + b + carry;
-
- if( temp > a ) // !(temp<=a)
- carry = 0;
- }
-
- *result = temp;
-
- return carry;
- }
-
-
-
- /*!
- this method adding ss2 to the this and adding carry if it's defined
- (this = this + ss2 + c)
-
- c must be zero or one (might be a bigger value than 1)
- function returns carry (1) (if it was)
- */
-
- template<uint value_size>
- uint UInt<value_size>::Add(const UInt<value_size> & ss2, uint c)
- {
- uint i;
-
- for(i=0 ; i<value_size ; ++i)
- c = AddTwoWords(table[i], ss2.table[i], c, &table[i]);
-
- TTMATH_LOGC("UInt::Add", c)
-
- return c;
- }
-
-
- /*!
- this method adds one word (at a specific position)
- and returns a carry (if it was)
-
- if we've got (value_size=3):
- table[0] = 10;
- table[1] = 30;
- table[2] = 5;
- and we call:
- AddInt(2,1)
- then it'll be:
- table[0] = 10;
- table[1] = 30 + 2;
- table[2] = 5;
-
- of course if there was a carry from table[2] it would be returned
- */
- template<uint value_size>
- uint UInt<value_size>::AddInt(uint value, uint index)
- {
- uint i, c;
-
- TTMATH_ASSERT( index < value_size )
-
-
- c = AddTwoWords(table[index], value, 0, &table[index]);
-
- for(i=index+1 ; i<value_size && c ; ++i)
- c = AddTwoWords(table[i], 0, c, &table[i]);
-
- TTMATH_LOGC("UInt::AddInt", c)
-
- return c;
- }
-
-
-
-
-
- /*!
- this method adds only two unsigned words to the existing value
- and these words begin on the 'index' position
- (it's used in the multiplication algorithm 2)
-
- index should be equal or smaller than value_size-2 (index <= value_size-2)
- x1 - lower word, x2 - higher word
-
- for example if we've got value_size equal 4 and:
- table[0] = 3
- table[1] = 4
- table[2] = 5
- table[3] = 6
- then let
- x1 = 10
- x2 = 20
- and
- index = 1
-
- the result of this method will be:
- table[0] = 3
- table[1] = 4 + x1 = 14
- table[2] = 5 + x2 = 25
- table[3] = 6
-
- and no carry at the end of table[3]
-
- (of course if there was a carry in table[2](5+20) then
- this carry would be passed to the table[3] etc.)
- */
- template<uint value_size>
- uint UInt<value_size>::AddTwoInts(uint x2, uint x1, uint index)
- {
- uint i, c;
-
- TTMATH_ASSERT( index < value_size - 1 )
-
-
- c = AddTwoWords(table[index], x1, 0, &table[index]);
- c = AddTwoWords(table[index+1], x2, c, &table[index+1]);
-
- for(i=index+2 ; i<value_size && c ; ++i)
- c = AddTwoWords(table[i], 0, c, &table[i]);
-
- TTMATH_LOGC("UInt::AddTwoInts", c)
-
- return c;
- }
-
-
-
- /*!
- this static method addes one vector to the other
- 'ss1' is larger in size or equal to 'ss2'
-
- ss1 points to the first (larger) vector
- ss2 points to the second vector
- ss1_size - size of the ss1 (and size of the result too)
- ss2_size - size of the ss2
- result - is the result vector (which has size the same as ss1: ss1_size)
-
- Example: ss1_size is 5, ss2_size is 3
- ss1: ss2: result (output):
- 5 1 5+1
- 4 3 4+3
- 2 7 2+7
- 6 6
- 9 9
- of course the carry is propagated and will be returned from the last item
- (this method is used by the Karatsuba multiplication algorithm)
- */
- template<uint value_size>
- uint UInt<value_size>::AddVector(const uint * ss1, const uint * ss2, uint ss1_size, uint ss2_size, uint * result)
- {
- uint i, c = 0;
-
- TTMATH_ASSERT( ss1_size >= ss2_size )
-
- for(i=0 ; i<ss2_size ; ++i)
- c = AddTwoWords(ss1[i], ss2[i], c, &result[i]);
-
- for( ; i<ss1_size ; ++i)
- c = AddTwoWords(ss1[i], 0, c, &result[i]);
-
- TTMATH_VECTOR_LOGC("UInt::AddVector", c, result, ss1_size)
-
- return c;
- }
-
-
-
-
- /*!
- this method subtractes one word from the other
- returns carry
-
- this method is created only when TTMATH_NOASM macro is defined
- */
- template<uint value_size>
- uint UInt<value_size>::SubTwoWords(uint a, uint b, uint carry, uint * result)
- {
- if( carry == 0 )
- {
- *result = a - b;
-
- if( a < b )
- carry = 1;
- }
- else
- {
- carry = 1;
- *result = a - b - carry;
-
- if( a > b ) // !(a <= b )
- carry = 0;
- }
-
- return carry;
- }
-
-
-
-
- /*!
- this method's subtracting ss2 from the 'this' and subtracting
- carry if it has been defined
- (this = this - ss2 - c)
-
- c must be zero or one (might be a bigger value than 1)
- function returns carry (1) (if it was)
- */
- template<uint value_size>
- uint UInt<value_size>::Sub(const UInt<value_size> & ss2, uint c)
- {
- uint i;
-
- for(i=0 ; i<value_size ; ++i)
- c = SubTwoWords(table[i], ss2.table[i], c, &table[i]);
-
- TTMATH_LOGC("UInt::Sub", c)
-
- return c;
- }
-
-
-
-
- /*!
- this method subtracts one word (at a specific position)
- and returns a carry (if it was)
-
- if we've got (value_size=3):
- table[0] = 10;
- table[1] = 30;
- table[2] = 5;
- and we call:
- SubInt(2,1)
- then it'll be:
- table[0] = 10;
- table[1] = 30 - 2;
- table[2] = 5;
-
- of course if there was a carry from table[2] it would be returned
- */
- template<uint value_size>
- uint UInt<value_size>::SubInt(uint value, uint index)
- {
- uint i, c;
-
- TTMATH_ASSERT( index < value_size )
-
-
- c = SubTwoWords(table[index], value, 0, &table[index]);
-
- for(i=index+1 ; i<value_size && c ; ++i)
- c = SubTwoWords(table[i], 0, c, &table[i]);
-
- TTMATH_LOGC("UInt::SubInt", c)
-
- return c;
- }
-
-
- /*!
- this static method subtractes one vector from the other
- 'ss1' is larger in size or equal to 'ss2'
-
- ss1 points to the first (larger) vector
- ss2 points to the second vector
- ss1_size - size of the ss1 (and size of the result too)
- ss2_size - size of the ss2
- result - is the result vector (which has size the same as ss1: ss1_size)
-
- Example: ss1_size is 5, ss2_size is 3
- ss1: ss2: result (output):
- 5 1 5-1
- 4 3 4-3
- 2 7 2-7
- 6 6-1 (the borrow from previous item)
- 9 9
- return (carry): 0
- of course the carry (borrow) is propagated and will be returned from the last item
- (this method is used by the Karatsuba multiplication algorithm)
- */
- template<uint value_size>
- uint UInt<value_size>::SubVector(const uint * ss1, const uint * ss2, uint ss1_size, uint ss2_size, uint * result)
- {
- uint i, c = 0;
-
- TTMATH_ASSERT( ss1_size >= ss2_size )
-
- for(i=0 ; i<ss2_size ; ++i)
- c = SubTwoWords(ss1[i], ss2[i], c, &result[i]);
-
- for( ; i<ss1_size ; ++i)
- c = SubTwoWords(ss1[i], 0, c, &result[i]);
-
- TTMATH_VECTOR_LOGC("UInt::SubVector", c, result, ss1_size)
-
- return c;
- }
-
-
-
- /*!
- this method moves all bits into the left hand side
- return value <- this <- c
-
- the lowest *bit* will be held the 'c' and
- the state of one additional bit (on the left hand side)
- will be returned
-
- for example:
- let this is 001010000
- after Rcl2_one(1) there'll be 010100001 and Rcl2_one returns 0
- */
- template<uint value_size>
- uint UInt<value_size>::Rcl2_one(uint c)
- {
- uint i, new_c;
-
- if( c != 0 )
- c = 1;
-
- for(i=0 ; i<value_size ; ++i)
- {
- new_c = (table[i] & TTMATH_UINT_HIGHEST_BIT) ? 1 : 0;
- table[i] = (table[i] << 1) | c;
- c = new_c;
- }
-
- TTMATH_LOGC("UInt::Rcl2_one", c)
-
- return c;
- }
-
-
-
-
-
-
-
- /*!
- this method moves all bits into the right hand side
- c -> this -> return value
-
- the highest *bit* will be held the 'c' and
- the state of one additional bit (on the right hand side)
- will be returned
-
- for example:
- let this is 000000010
- after Rcr2_one(1) there'll be 100000001 and Rcr2_one returns 0
- */
- template<uint value_size>
- uint UInt<value_size>::Rcr2_one(uint c)
- {
- sint i; // signed i
- uint new_c;
-
- if( c != 0 )
- c = TTMATH_UINT_HIGHEST_BIT;
-
- for(i=sint(value_size)-1 ; i>=0 ; --i)
- {
- new_c = (table[i] & 1) ? TTMATH_UINT_HIGHEST_BIT : 0;
- table[i] = (table[i] >> 1) | c;
- c = new_c;
- }
-
- c = (c != 0)? 1 : 0;
-
- TTMATH_LOGC("UInt::Rcr2_one", c)
-
- return c;
- }
-
-
-
-
- /*!
- this method moves all bits into the left hand side
- return value <- this <- c
-
- the lowest *bits* will be held the 'c' and
- the state of one additional bit (on the left hand side)
- will be returned
-
- for example:
- let this is 001010000
- after Rcl2(3, 1) there'll be 010000111 and Rcl2 returns 1
- */
- template<uint value_size>
- uint UInt<value_size>::Rcl2(uint bits, uint c)
- {
- TTMATH_ASSERT( bits>0 && bits<TTMATH_BITS_PER_UINT )
-
- uint move = TTMATH_BITS_PER_UINT - bits;
- uint i, new_c;
-
- if( c != 0 )
- c = TTMATH_UINT_MAX_VALUE >> move;
-
- for(i=0 ; i<value_size ; ++i)
- {
- new_c = table[i] >> move;
- table[i] = (table[i] << bits) | c;
- c = new_c;
- }
-
- TTMATH_LOGC("UInt::Rcl2", (c & 1))
-
- return (c & 1);
- }
-
-
-
-
- /*!
- this method moves all bits into the right hand side
- C -> this -> return value
-
- the highest *bits* will be held the 'c' and
- the state of one additional bit (on the right hand side)
- will be returned
-
- for example:
- let this is 000000010
- after Rcr2(2, 1) there'll be 110000000 and Rcr2 returns 1
- */
- template<uint value_size>
- uint UInt<value_size>::Rcr2(uint bits, uint c)
- {
- TTMATH_ASSERT( bits>0 && bits<TTMATH_BITS_PER_UINT )
-
- uint move = TTMATH_BITS_PER_UINT - bits;
- sint i; // signed
- uint new_c;
-
- if( c != 0 )
- c = TTMATH_UINT_MAX_VALUE << move;
-
- for(i=value_size-1 ; i>=0 ; --i)
- {
- new_c = table[i] << move;
- table[i] = (table[i] >> bits) | c;
- c = new_c;
- }
-
- c = (c & TTMATH_UINT_HIGHEST_BIT) ? 1 : 0;
-
- TTMATH_LOGC("UInt::Rcr2", c)
-
- return c;
- }
-
-
-
-
- /*!
- this method returns the number of the highest set bit in x
- if the 'x' is zero this method returns '-1'
- */
- template<uint value_size>
- sint UInt<value_size>::FindLeadingBitInWord(uint x)
- {
- if( x == 0 )
- return -1;
-
- uint bit = TTMATH_BITS_PER_UINT - 1;
-
- while( (x & TTMATH_UINT_HIGHEST_BIT) == 0 )
- {
- x = x << 1;
- --bit;
- }
-
- return bit;
- }
-
-
-
- /*!
- this method returns the number of the highest set bit in x
- if the 'x' is zero this method returns '-1'
- */
- template<uint value_size>
- sint UInt<value_size>::FindLowestBitInWord(uint x)
- {
- if( x == 0 )
- return -1;
-
- uint bit = 0;
-
- while( (x & 1) == 0 )
- {
- x = x >> 1;
- ++bit;
- }
-
- return bit;
- }
-
-
-
- /*!
- this method sets a special bit in the 'value'
- and returns the last state of the bit (zero or one)
-
- bit is from <0,TTMATH_BITS_PER_UINT-1>
-
- e.g.
- uint x = 100;
- uint bit = SetBitInWord(x, 3);
- now: x = 108 and bit = 0
- */
- template<uint value_size>
- uint UInt<value_size>::SetBitInWord(uint & value, uint bit)
- {
- TTMATH_ASSERT( bit < TTMATH_BITS_PER_UINT )
-
- uint mask = 1;
-
- if( bit > 0 )
- mask = mask << bit;
-
- uint last = value & mask;
- value = value | mask;
-
- return (last != 0) ? 1 : 0;
- }
-
-
-
-
-
-
- /*!
- *
- * Multiplication
- *
- *
- */
-
-
- /*!
- multiplication: result_high:result_low = a * b
- result_high - higher word of the result
- result_low - lower word of the result
-
- this methos never returns a carry
- this method is used in the second version of the multiplication algorithms
- */
- template<uint value_size>
- void UInt<value_size>::MulTwoWords(uint a, uint b, uint * result_high, uint * result_low)
- {
- #ifdef TTMATH_PLATFORM32
-
- /*
- on 32bit platforms we have defined 'unsigned long long int' type known as 'ulint' in ttmath namespace
- this type has 64 bits, then we're using only one multiplication: 32bit * 32bit = 64bit
- */
-
- union uint_
- {
- struct
- {
- uint low; // 32 bits
- uint high; // 32 bits
- } u_;
-
- ulint u; // 64 bits
- } res;
-
- res.u = ulint(a) * ulint(b); // multiply two 32bit words, the result has 64 bits
-
- *result_high = res.u_.high;
- *result_low = res.u_.low;
-
- #else
-
- /*
- 64 bits platforms
-
- we don't have a native type which has 128 bits
- then we're splitting 'a' and 'b' to 4 parts (high and low halves)
- and using 4 multiplications (with additions and carry correctness)
- */
-
- uint_ a_;
- uint_ b_;
- uint_ res_high1, res_high2;
- uint_ res_low1, res_low2;
-
- a_.u = a;
- b_.u = b;
-
- /*
- the multiplication is as follows (schoolbook algorithm with O(n^2) ):
-
- 32 bits 32 bits
-
- +--------------------------------+
- | a_.u_.high | a_.u_.low |
- +--------------------------------+
- | b_.u_.high | b_.u_.low |
- +--------------------------------+--------------------------------+
- | res_high1.u | res_low1.u |
- +--------------------------------+--------------------------------+
- | res_high2.u | res_low2.u |
- +--------------------------------+--------------------------------+
-
- 64 bits 64 bits
- */
-
-
- uint_ temp;
-
- res_low1.u = uint(b_.u_.low) * uint(a_.u_.low);
-
- temp.u = uint(res_low1.u_.high) + uint(b_.u_.low) * uint(a_.u_.high);
- res_low1.u_.high = temp.u_.low;
- res_high1.u_.low = temp.u_.high;
- res_high1.u_.high = 0;
-
- res_low2.u_.low = 0;
- temp.u = uint(b_.u_.high) * uint(a_.u_.low);
- res_low2.u_.high = temp.u_.low;
-
- res_high2.u = uint(b_.u_.high) * uint(a_.u_.high) + uint(temp.u_.high);
-
- uint c = AddTwoWords(res_low1.u, res_low2.u, 0, &res_low2.u);
- AddTwoWords(res_high1.u, res_high2.u, c, &res_high2.u); // there is no carry from here
-
- *result_high = res_high2.u;
- *result_low = res_low2.u;
-
- #endif
- }
-
-
-
-
- /*!
- *
- * Division
- *
- *
- */
-
-
- /*!
- this method calculates 64bits word a:b / 32bits c (a higher, b lower word)
- r = a:b / c and rest - remainder
-
- *
- * WARNING:
- * the c has to be suitably large for the result being keeped in one word,
- * if c is equal zero there'll be a hardware interruption (0)
- * and probably the end of your program
- *
- */
- template<uint value_size>
- void UInt<value_size>::DivTwoWords(uint a, uint b, uint c, uint * r, uint * rest)
- {
- // (a < c ) for the result to be one word
- TTMATH_ASSERT( c != 0 && a < c )
-
- #ifdef TTMATH_PLATFORM32
-
- union
- {
- struct
- {
- uint low; // 32 bits
- uint high; // 32 bits
- } u_;
-
- ulint u; // 64 bits
- } ab;
-
- ab.u_.high = a;
- ab.u_.low = b;
-
- *r = uint(ab.u / c);
- *rest = uint(ab.u % c);
-
- #else
-
- uint_ c_;
- c_.u = c;
-
-
- if( a == 0 )
- {
- *r = b / c;
- *rest = b % c;
- }
- else
- if( c_.u_.high == 0 )
- {
- // higher half of 'c' is zero
- // then higher half of 'a' is zero too (look at the asserts at the beginning - 'a' is smaller than 'c')
- uint_ a_, b_, res_, temp1, temp2;
-
- a_.u = a;
- b_.u = b;
-
- temp1.u_.high = a_.u_.low;
- temp1.u_.low = b_.u_.high;
-
- res_.u_.high = (unsigned int)(temp1.u / c);
- temp2.u_.high = (unsigned int)(temp1.u % c);
- temp2.u_.low = b_.u_.low;
-
- res_.u_.low = (unsigned int)(temp2.u / c);
- *rest = temp2.u % c;
-
- *r = res_.u;
- }
- else
- {
- return DivTwoWords2(a, b, c, r, rest);
- }
-
- #endif
- }
-
-
-#ifdef TTMATH_PLATFORM64
-
-
- /*!
- this method is available only on 64bit platforms
-
- the same algorithm like the third division algorithm in ttmathuint.h
- but now with the radix=2^32
- */
- template<uint value_size>
- void UInt<value_size>::DivTwoWords2(uint a, uint b, uint c, uint * r, uint * rest)
- {
- // a is not zero
- // c_.u_.high is not zero
-
- uint_ a_, b_, c_, u_, q_;
- unsigned int u3; // 32 bit
-
- a_.u = a;
- b_.u = b;
- c_.u = c;
-
- // normalizing
- uint d = DivTwoWordsNormalize(a_, b_, c_);
-
- // loop from j=1 to j=0
- // the first step (for j=2) is skipped because our result is only in one word,
- // (first 'q' were 0 and nothing would be changed)
- u_.u_.high = a_.u_.high;
- u_.u_.low = a_.u_.low;
- u3 = b_.u_.high;
- q_.u_.high = DivTwoWordsCalculate(u_, u3, c_);
- MultiplySubtract(u_, u3, q_.u_.high, c_);
-
- u_.u_.high = u_.u_.low;
- u_.u_.low = u3;
- u3 = b_.u_.low;
- q_.u_.low = DivTwoWordsCalculate(u_, u3, c_);
- MultiplySubtract(u_, u3, q_.u_.low, c_);
-
- *r = q_.u;
-
- // unnormalizing for the remainder
- u_.u_.high = u_.u_.low;
- u_.u_.low = u3;
- *rest = DivTwoWordsUnnormalize(u_.u, d);
- }
-
-
-
-
- template<uint value_size>
- uint UInt<value_size>::DivTwoWordsNormalize(uint_ & a_, uint_ & b_, uint_ & c_)
- {
- uint d = 0;
-
- for( ; (c_.u & TTMATH_UINT_HIGHEST_BIT) == 0 ; ++d )
- {
- c_.u = c_.u << 1;
-
- uint bc = b_.u & TTMATH_UINT_HIGHEST_BIT; // carry from 'b'
-
- b_.u = b_.u << 1;
- a_.u = a_.u << 1; // carry bits from 'a' are simply skipped
-
- if( bc )
- a_.u = a_.u | 1;
- }
-
- return d;
- }
-
-
- template<uint value_size>
- uint UInt<value_size>::DivTwoWordsUnnormalize(uint u, uint d)
- {
- if( d == 0 )
- return u;
-
- u = u >> d;
-
- return u;
- }
-
-
- template<uint value_size>
- unsigned int UInt<value_size>::DivTwoWordsCalculate(uint_ u_, unsigned int u3, uint_ v_)
- {
- bool next_test;
- uint_ qp_, rp_, temp_;
-
- qp_.u = u_.u / uint(v_.u_.high);
- rp_.u = u_.u % uint(v_.u_.high);
-
- TTMATH_ASSERT( qp_.u_.high==0 || qp_.u_.high==1 )
-
- do
- {
- bool decrease = false;
-
- if( qp_.u_.high == 1 )
- decrease = true;
- else
- {
- temp_.u_.high = rp_.u_.low;
- temp_.u_.low = u3;
-
- if( qp_.u * uint(v_.u_.low) > temp_.u )
- decrease = true;
- }
-
- next_test = false;
-
- if( decrease )
- {
- --qp_.u;
- rp_.u += v_.u_.high;
-
- if( rp_.u_.high == 0 )
- next_test = true;
- }
- }
- while( next_test );
-
- return qp_.u_.low;
- }
-
-
- template<uint value_size>
- void UInt<value_size>::MultiplySubtract(uint_ & u_, unsigned int & u3, unsigned int & q, uint_ v_)
- {
- uint_ temp_;
-
- uint res_high;
- uint res_low;
-
- MulTwoWords(v_.u, q, &res_high, &res_low);
-
- uint_ sub_res_high_;
- uint_ sub_res_low_;
-
- temp_.u_.high = u_.u_.low;
- temp_.u_.low = u3;
-
- uint c = SubTwoWords(temp_.u, res_low, 0, &sub_res_low_.u);
-
- temp_.u_.high = 0;
- temp_.u_.low = u_.u_.high;
- c = SubTwoWords(temp_.u, res_high, c, &sub_res_high_.u);
-
- if( c )
- {
- --q;
-
- c = AddTwoWords(sub_res_low_.u, v_.u, 0, &sub_res_low_.u);
- AddTwoWords(sub_res_high_.u, 0, c, &sub_res_high_.u);
- }
-
- u_.u_.high = sub_res_high_.u_.low;
- u_.u_.low = sub_res_low_.u_.high;
- u3 = sub_res_low_.u_.low;
- }
-
-#endif // #ifdef TTMATH_PLATFORM64
-
-
-
-} //namespace
-
-
-#endif //ifdef TTMATH_NOASM
-#endif
-
-
-
-
diff --git a/ttmath/ttmathuint_x86.h b/ttmath/ttmathuint_x86.h
deleted file mode 100644
index 1dd087f..0000000
--- a/ttmath/ttmathuint_x86.h
+++ /dev/null
@@ -1,1602 +0,0 @@
-/*
- * This file is a part of TTMath Bignum Library
- * and is distributed under the (new) BSD licence.
- * Author: Tomasz Sowa <t.sowa at ttmath.org>
- */
-
-/*
- * Copyright (c) 2006-2009, Tomasz Sowa
- * All rights reserved.
- *
- * Redistribution and use in source and binary forms, with or without
- * modification, are permitted provided that the following conditions are met:
- *
- * * Redistributions of source code must retain the above copyright notice,
- * this list of conditions and the following disclaimer.
- *
- * * Redistributions in binary form must reproduce the above copyright
- * notice, this list of conditions and the following disclaimer in the
- * documentation and/or other materials provided with the distribution.
- *
- * * Neither the name Tomasz Sowa nor the names of contributors to this
- * project may be used to endorse or promote products derived
- * from this software without specific prior written permission.
- *
- * THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS"
- * AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
- * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- * ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE
- * LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR
- * CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF
- * SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS
- * INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN
- * CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
- * ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF
- * THE POSSIBILITY OF SUCH DAMAGE.
- */
-
-
-
-#ifndef headerfilettmathuint_x86
-#define headerfilettmathuint_x86
-
-
-#ifndef TTMATH_NOASM
-#ifdef TTMATH_PLATFORM32
-
-
-/*!
- \file ttmathuint_x86.h
- \brief template class UInt<uint> with assembler code for 32bit x86 processors
-
- this file is included at the end of ttmathuint.h
-*/
-
-
-
-/*!
- \brief a namespace for the TTMath library
-*/
-namespace ttmath
-{
-
- /*!
- returning the string represents the currect type of the library
- we have following types:
- asm_vc_32 - with asm code designed for Microsoft Visual C++ (32 bits)
- asm_gcc_32 - with asm code designed for GCC (32 bits)
- asm_vc_64 - with asm for VC (64 bit)
- asm_gcc_64 - with asm for GCC (64 bit)
- no_asm_32 - pure C++ version (32 bit) - without any asm code
- no_asm_64 - pure C++ version (64 bit) - without any asm code
- */
- template<uint value_size>
- const char * UInt<value_size>::LibTypeStr()
- {
- #ifndef __GNUC__
- static const char info[] = "asm_vc_32";
- #endif
-
- #ifdef __GNUC__
- static const char info[] = "asm_gcc_32";
- #endif
-
- return info;
- }
-
-
- /*!
- returning the currect type of the library
- */
- template<uint value_size>
- LibTypeCode UInt<value_size>::LibType()
- {
- #ifndef __GNUC__
- LibTypeCode info = asm_vc_32;
- #endif
-
- #ifdef __GNUC__
- LibTypeCode info = asm_gcc_32;
- #endif
-
- return info;
- }
-
-
-
- /*!
- *
- * basic mathematic functions
- *
- */
-
-
- /*!
- adding ss2 to the this and adding carry if it's defined
- (this = this + ss2 + c)
-
- c must be zero or one (might be a bigger value than 1)
- function returns carry (1) (if it has been)
- */
- template<uint value_size>
- uint UInt<value_size>::Add(const UInt<value_size> & ss2, uint c)
- {
- uint b = value_size;
- uint * p1 = table;
- uint * p2 = const_cast<uint*>(ss2.table);
-
- // we don't have to use TTMATH_REFERENCE_ASSERT here
- // this algorithm doesn't require it
-
- #ifndef __GNUC__
-
- // this part might be compiled with for example visual c
-
- __asm
- {
- push eax
- push ebx
- push ecx
- push edx
- push esi
-
- mov ecx,[b]
-
- mov ebx,[p1]
- mov esi,[p2]
-
- xor edx,edx // edx=0
- mov eax,[c]
- neg eax // CF=1 if rax!=0 , CF=0 if rax==0
-
- ttmath_loop:
- mov eax,[esi+edx*4]
- adc [ebx+edx*4],eax
-
- inc edx
- dec ecx
- jnz ttmath_loop
-
- adc ecx, ecx
- mov [c], ecx
-
- pop esi
- pop edx
- pop ecx
- pop ebx
- pop eax
- }
-
-
-
- #endif
-
-
- #ifdef __GNUC__
- uint dummy, dummy2;
- // this part should be compiled with gcc
-
- __asm__ __volatile__(
-
- "xorl %%edx, %%edx \n"
- "negl %%eax \n" // CF=1 if rax!=0 , CF=0 if rax==0
-
- "1: \n"
- "movl (%%esi,%%edx,4), %%eax \n"
- "adcl %%eax, (%%ebx,%%edx,4) \n"
-
- "incl %%edx \n"
- "decl %%ecx \n"
- "jnz 1b \n"
-
- "adc %%ecx, %%ecx \n"
-
- : "=c" (c), "=a" (dummy), "=d" (dummy2)
- : "0" (b), "1" (c), "b" (p1), "S" (p2)
- : "cc", "memory" );
- #endif
-
- TTMATH_LOGC("UInt::Add", c)
-
- return c;
- }
-
-
-
- /*!
- adding one word (at a specific position)
- and returning a carry (if it has been)
-
- e.g.
-
- if we've got (value_size=3):
- table[0] = 10;
- table[1] = 30;
- table[2] = 5;
- and we call:
- AddInt(2,1)
- then it'll be:
- table[0] = 10;
- table[1] = 30 + 2;
- table[2] = 5;
-
- of course if there was a carry from table[2] it would be returned
- */
- template<uint value_size>
- uint UInt<value_size>::AddInt(uint value, uint index)
- {
- uint b = value_size;
- uint * p1 = table;
- uint c;
-
- TTMATH_ASSERT( index < value_size )
-
- #ifndef __GNUC__
-
- __asm
- {
- push eax
- push ebx
- push ecx
- push edx
-
- mov ecx, [b]
- sub ecx, [index]
-
- mov edx, [index]
- mov ebx, [p1]
-
- mov eax, [value]
-
- ttmath_loop:
- add [ebx+edx*4], eax
- jnc ttmath_end
-
- mov eax, 1
- inc edx
- dec ecx
- jnz ttmath_loop
-
- ttmath_end:
- setc al
- movzx edx, al
- mov [c], edx
-
- pop edx
- pop ecx
- pop ebx
- pop eax
- }
-
- #endif
-
-
- #ifdef __GNUC__
- uint dummy, dummy2;
-
- __asm__ __volatile__(
-
- "subl %%edx, %%ecx \n"
-
- "1: \n"
- "addl %%eax, (%%ebx,%%edx,4) \n"
- "jnc 2f \n"
-
- "movl $1, %%eax \n"
- "incl %%edx \n"
- "decl %%ecx \n"
- "jnz 1b \n"
-
- "2: \n"
- "setc %%al \n"
- "movzx %%al, %%edx \n"
-
- : "=d" (c), "=a" (dummy), "=c" (dummy2)
- : "0" (index), "1" (value), "2" (b), "b" (p1)
- : "cc", "memory" );
-
- #endif
-
- TTMATH_LOGC("UInt::AddInt", c)
-
- return c;
- }
-
-
-
-
- /*!
- adding only two unsigned words to the existing value
- and these words begin on the 'index' position
- (it's used in the multiplication algorithm 2)
-
- index should be equal or smaller than value_size-2 (index <= value_size-2)
- x1 - lower word, x2 - higher word
-
- for example if we've got value_size equal 4 and:
- table[0] = 3
- table[1] = 4
- table[2] = 5
- table[3] = 6
- then let
- x1 = 10
- x2 = 20
- and
- index = 1
-
- the result of this method will be:
- table[0] = 3
- table[1] = 4 + x1 = 14
- table[2] = 5 + x2 = 25
- table[3] = 6
-
- and no carry at the end of table[3]
-
- (of course if there was a carry in table[2](5+20) then
- this carry would be passed to the table[3] etc.)
- */
- template<uint value_size>
- uint UInt<value_size>::AddTwoInts(uint x2, uint x1, uint index)
- {
- uint b = value_size;
- uint * p1 = table;
- uint c;
-
- TTMATH_ASSERT( index < value_size - 1 )
-
- #ifndef __GNUC__
- __asm
- {
- push eax
- push ebx
- push ecx
- push edx
-
- mov ecx, [b]
- sub ecx, [index]
-
- mov ebx, [p1]
- mov edx, [index]
-
- mov eax, [x1]
- add [ebx+edx*4], eax
- inc edx
- dec ecx
-
- mov eax, [x2]
-
- ttmath_loop:
- adc [ebx+edx*4], eax
- jnc ttmath_end
-
- mov eax, 0
- inc edx
- dec ecx
- jnz ttmath_loop
-
- ttmath_end:
- setc al
- movzx edx, al
- mov [c], edx
-
- pop edx
- pop ecx
- pop ebx
- pop eax
-
- }
- #endif
-
-
- #ifdef __GNUC__
- uint dummy, dummy2;
-
- __asm__ __volatile__(
-
- "subl %%edx, %%ecx \n"
-
- "addl %%esi, (%%ebx,%%edx,4) \n"
- "incl %%edx \n"
- "decl %%ecx \n"
-
- "1: \n"
- "adcl %%eax, (%%ebx,%%edx,4) \n"
- "jnc 2f \n"
-
- "mov $0, %%eax \n"
- "incl %%edx \n"
- "decl %%ecx \n"
- "jnz 1b \n"
-
- "2: \n"
- "setc %%al \n"
- "movzx %%al, %%eax \n"
-
- : "=a" (c), "=c" (dummy), "=d" (dummy2)
- : "0" (x2), "1" (b), "2" (index), "b" (p1), "S" (x1)
- : "cc", "memory" );
-
- #endif
-
- TTMATH_LOGC("UInt::AddTwoInts", c)
-
- return c;
- }
-
-
-
- /*!
- this static method addes one vector to the other
- 'ss1' is larger in size or equal to 'ss2'
-
- ss1 points to the first (larger) vector
- ss2 points to the second vector
- ss1_size - size of the ss1 (and size of the result too)
- ss2_size - size of the ss2
- result - is the result vector (which has size the same as ss1: ss1_size)
-
- Example: ss1_size is 5, ss2_size is 3
- ss1: ss2: result (output):
- 5 1 5+1
- 4 3 4+3
- 2 7 2+7
- 6 6
- 9 9
- of course the carry is propagated and will be returned from the last item
- (this method is used by the Karatsuba multiplication algorithm)
- */
- template<uint value_size>
- uint UInt<value_size>::AddVector(const uint * ss1, const uint * ss2, uint ss1_size, uint ss2_size, uint * result)
- {
- TTMATH_ASSERT( ss1_size >= ss2_size )
-
- uint rest = ss1_size - ss2_size;
- uint c;
-
- #ifndef __GNUC__
-
- // this part might be compiled with for example visual c
- __asm
- {
- pushad
-
- mov ecx, [ss2_size]
- xor edx, edx // edx = 0, cf = 0
-
- mov esi, [ss1]
- mov ebx, [ss2]
- mov edi, [result]
-
- ttmath_loop:
- mov eax, [esi+edx*4]
- adc eax, [ebx+edx*4]
- mov [edi+edx*4], eax
-
- inc edx
- dec ecx
- jnz ttmath_loop
-
- adc ecx, ecx // ecx has the cf state
-
- mov ebx, [rest]
- or ebx, ebx
- jz ttmath_end
-
- xor ebx, ebx // ebx = 0
- neg ecx // setting cf from ecx
- mov ecx, [rest] // ecx is != 0
-
- ttmath_loop2:
- mov eax, [esi+edx*4]
- adc eax, ebx
- mov [edi+edx*4], eax
-
- inc edx
- dec ecx
- jnz ttmath_loop2
-
- adc ecx, ecx
-
- ttmath_end:
- mov [c], ecx
-
- popad
- }
-
- #endif
-
-
- #ifdef __GNUC__
-
- // this part should be compiled with gcc
- uint dummy1, dummy2, dummy3;
-
- __asm__ __volatile__(
- "push %%edx \n"
- "xor %%edx, %%edx \n" // edx = 0, cf = 0
- "1: \n"
- "mov (%%esi,%%edx,4), %%eax \n"
- "adc (%%ebx,%%edx,4), %%eax \n"
- "mov %%eax, (%%edi,%%edx,4) \n"
-
- "inc %%edx \n"
- "dec %%ecx \n"
- "jnz 1b \n"
-
- "adc %%ecx, %%ecx \n" // ecx has the cf state
- "pop %%eax \n" // eax = rest
-
- "or %%eax, %%eax \n"
- "jz 3f \n"
-
- "xor %%ebx, %%ebx \n" // ebx = 0
- "neg %%ecx \n" // setting cf from ecx
- "mov %%eax, %%ecx \n" // ecx=rest and is != 0
- "2: \n"
- "mov (%%esi, %%edx, 4), %%eax \n"
- "adc %%ebx, %%eax \n"
- "mov %%eax, (%%edi, %%edx, 4) \n"
-
- "inc %%edx \n"
- "dec %%ecx \n"
- "jnz 2b \n"
-
- "adc %%ecx, %%ecx \n"
- "3: \n"
-
- : "=a" (dummy1), "=b" (dummy2), "=c" (c), "=d" (dummy3)
- : "1" (ss2), "2" (ss2_size), "3" (rest), "S" (ss1), "D" (result)
- : "cc", "memory" );
-
- #endif
-
- TTMATH_VECTOR_LOGC("UInt::AddVector", c, result, ss1_size)
-
- return c;
- }
-
-
- /*!
- subtracting ss2 from the 'this' and subtracting
- carry if it has been defined
- (this = this - ss2 - c)
-
- c must be zero or one (might be a bigger value than 1)
- function returns carry (1) (if it has been)
- */
- template<uint value_size>
- uint UInt<value_size>::Sub(const UInt<value_size> & ss2, uint c)
- {
- uint b = value_size;
- uint * p1 = table;
- uint * p2 = const_cast<uint*>(ss2.table);
-
- // we don't have to use TTMATH_REFERENCE_ASSERT here
- // this algorithm doesn't require it
-
- #ifndef __GNUC__
-
- __asm
- {
- push eax
- push ebx
- push ecx
- push edx
- push esi
-
- mov ecx,[b]
-
- mov ebx,[p1]
- mov esi,[p2]
-
- xor edx,edx // edx=0
- mov eax,[c]
- neg eax // CF=1 if rax!=0 , CF=0 if rax==0
-
- ttmath_loop:
- mov eax,[esi+edx*4]
- sbb [ebx+edx*4],eax
-
- inc edx
- dec ecx
- jnz ttmath_loop
-
- adc ecx, ecx
- mov [c], ecx
-
- pop esi
- pop edx
- pop ecx
- pop ebx
- pop eax
- }
-
- #endif
-
-
- #ifdef __GNUC__
- uint dummy, dummy2;
-
- __asm__ __volatile__(
-
- "xorl %%edx, %%edx \n"
- "negl %%eax \n" // CF=1 if rax!=0 , CF=0 if rax==0
-
- "1: \n"
- "movl (%%esi,%%edx,4), %%eax \n"
- "sbbl %%eax, (%%ebx,%%edx,4) \n"
-
- "incl %%edx \n"
- "decl %%ecx \n"
- "jnz 1b \n"
-
- "adc %%ecx, %%ecx \n"
-
- : "=c" (c), "=a" (dummy), "=d" (dummy2)
- : "0" (b), "1" (c), "b" (p1), "S" (p2)
- : "cc", "memory" );
-
- #endif
-
- TTMATH_LOGC("UInt::Sub", c)
-
- return c;
- }
-
-
-
-
- /*!
- this method subtracts one word (at a specific position)
- and returns a carry (if it was)
-
- e.g.
-
- if we've got (value_size=3):
- table[0] = 10;
- table[1] = 30;
- table[2] = 5;
- and we call:
- SubInt(2,1)
- then it'll be:
- table[0] = 10;
- table[1] = 30 - 2;
- table[2] = 5;
-
- of course if there was a carry from table[2] it would be returned
- */
- template<uint value_size>
- uint UInt<value_size>::SubInt(uint value, uint index)
- {
- uint b = value_size;
- uint * p1 = table;
- uint c;
-
- TTMATH_ASSERT( index < value_size )
-
- #ifndef __GNUC__
-
- __asm
- {
- push eax
- push ebx
- push ecx
- push edx
-
- mov ecx, [b]
- sub ecx, [index]
-
- mov edx, [index]
- mov ebx, [p1]
-
- mov eax, [value]
-
- ttmath_loop:
- sub [ebx+edx*4], eax
- jnc ttmath_end
-
- mov eax, 1
- inc edx
- dec ecx
- jnz ttmath_loop
-
- ttmath_end:
- setc al
- movzx edx, al
- mov [c], edx
-
- pop edx
- pop ecx
- pop ebx
- pop eax
- }
-
- #endif
-
-
- #ifdef __GNUC__
- uint dummy, dummy2;
-
- __asm__ __volatile__(
-
- "subl %%edx, %%ecx \n"
-
- "1: \n"
- "subl %%eax, (%%ebx,%%edx,4) \n"
- "jnc 2f \n"
-
- "movl $1, %%eax \n"
- "incl %%edx \n"
- "decl %%ecx \n"
- "jnz 1b \n"
-
- "2: \n"
- "setc %%al \n"
- "movzx %%al, %%edx \n"
-
- : "=d" (c), "=a" (dummy), "=c" (dummy2)
- : "0" (index), "1" (value), "2" (b), "b" (p1)
- : "cc", "memory" );
-
- #endif
-
- TTMATH_LOGC("UInt::SubInt", c)
-
- return c;
- }
-
-
-
- /*!
- this static method subtractes one vector from the other
- 'ss1' is larger in size or equal to 'ss2'
-
- ss1 points to the first (larger) vector
- ss2 points to the second vector
- ss1_size - size of the ss1 (and size of the result too)
- ss2_size - size of the ss2
- result - is the result vector (which has size the same as ss1: ss1_size)
-
- Example: ss1_size is 5, ss2_size is 3
- ss1: ss2: result (output):
- 5 1 5-1
- 4 3 4-3
- 2 7 2-7
- 6 6-1 (the borrow from previous item)
- 9 9
- return (carry): 0
- of course the carry (borrow) is propagated and will be returned from the last item
- (this method is used by the Karatsuba multiplication algorithm)
- */
- template<uint value_size>
- uint UInt<value_size>::SubVector(const uint * ss1, const uint * ss2, uint ss1_size, uint ss2_size, uint * result)
- {
- TTMATH_ASSERT( ss1_size >= ss2_size )
-
- uint rest = ss1_size - ss2_size;
- uint c;
-
- #ifndef __GNUC__
-
- // this part might be compiled with for example visual c
-
- /*
- the asm code is nearly the same as in AddVector
- only two instructions 'adc' are changed to 'sbb'
- */
- __asm
- {
- pushad
-
- mov ecx, [ss2_size]
- xor edx, edx // edx = 0, cf = 0
-
- mov esi, [ss1]
- mov ebx, [ss2]
- mov edi, [result]
-
- ttmath_loop:
- mov eax, [esi+edx*4]
- sbb eax, [ebx+edx*4]
- mov [edi+edx*4], eax
-
- inc edx
- dec ecx
- jnz ttmath_loop
-
- adc ecx, ecx // ecx has the cf state
-
- mov ebx, [rest]
- or ebx, ebx
- jz ttmath_end
-
- xor ebx, ebx // ebx = 0
- neg ecx // setting cf from ecx
- mov ecx, [rest] // ecx is != 0
-
- ttmath_loop2:
- mov eax, [esi+edx*4]
- sbb eax, ebx
- mov [edi+edx*4], eax
-
- inc edx
- dec ecx
- jnz ttmath_loop2
-
- adc ecx, ecx
-
- ttmath_end:
- mov [c], ecx
-
- popad
- }
-
- #endif
-
-
- #ifdef __GNUC__
-
- // this part should be compiled with gcc
- uint dummy1, dummy2, dummy3;
-
- __asm__ __volatile__(
- "push %%edx \n"
- "xor %%edx, %%edx \n" // edx = 0, cf = 0
- "1: \n"
- "mov (%%esi,%%edx,4), %%eax \n"
- "sbb (%%ebx,%%edx,4), %%eax \n"
- "mov %%eax, (%%edi,%%edx,4) \n"
-
- "inc %%edx \n"
- "dec %%ecx \n"
- "jnz 1b \n"
-
- "adc %%ecx, %%ecx \n" // ecx has the cf state
- "pop %%eax \n" // eax = rest
-
- "or %%eax, %%eax \n"
- "jz 3f \n"
-
- "xor %%ebx, %%ebx \n" // ebx = 0
- "neg %%ecx \n" // setting cf from ecx
- "mov %%eax, %%ecx \n" // ecx=rest and is != 0
- "2: \n"
- "mov (%%esi, %%edx, 4), %%eax \n"
- "sbb %%ebx, %%eax \n"
- "mov %%eax, (%%edi, %%edx, 4) \n"
-
- "inc %%edx \n"
- "dec %%ecx \n"
- "jnz 2b \n"
-
- "adc %%ecx, %%ecx \n"
- "3: \n"
-
- : "=a" (dummy1), "=b" (dummy2), "=c" (c), "=d" (dummy3)
- : "1" (ss2), "2" (ss2_size), "3" (rest), "S" (ss1), "D" (result)
- : "cc", "memory" );
-
- #endif
-
- TTMATH_VECTOR_LOGC("UInt::SubVector", c, result, ss1_size)
-
- return c;
- }
-
-
-
- /*!
- this method moves all bits into the left hand side
- return value <- this <- c
-
- the lowest *bit* will be held the 'c' and
- the state of one additional bit (on the left hand side)
- will be returned
-
- for example:
- let this is 001010000
- after Rcl2_one(1) there'll be 010100001 and Rcl2_one returns 0
- */
- template<uint value_size>
- uint UInt<value_size>::Rcl2_one(uint c)
- {
- uint b = value_size;
- uint * p1 = table;
-
- #ifndef __GNUC__
- __asm
- {
- push ebx
- push ecx
- push edx
-
- mov ebx, [p1]
- xor edx, edx
- mov ecx, [c]
- neg ecx
- mov ecx, [b]
-
- ttmath_loop:
- rcl dword ptr [ebx+edx*4], 1
-
- inc edx
- dec ecx
- jnz ttmath_loop
-
- adc ecx, ecx
- mov [c], ecx
-
- pop edx
- pop ecx
- pop ebx
- }
- #endif
-
-
- #ifdef __GNUC__
- uint dummy, dummy2;
-
- __asm__ __volatile__(
-
- "xorl %%edx, %%edx \n" // edx=0
- "negl %%eax \n" // CF=1 if eax!=0 , CF=0 if eax==0
-
- "1: \n"
- "rcll $1, (%%ebx, %%edx, 4) \n"
-
- "incl %%edx \n"
- "decl %%ecx \n"
- "jnz 1b \n"
-
- "adcl %%ecx, %%ecx \n"
-
- : "=c" (c), "=a" (dummy), "=d" (dummy2)
- : "0" (b), "1" (c), "b" (p1)
- : "cc", "memory" );
-
- #endif
-
- TTMATH_LOGC("UInt::Rcl2_one", c)
-
- return c;
- }
-
-
-
- /*!
- this method moves all bits into the right hand side
- c -> this -> return value
-
- the highest *bit* will be held the 'c' and
- the state of one additional bit (on the right hand side)
- will be returned
-
- for example:
- let this is 000000010
- after Rcr2_one(1) there'll be 100000001 and Rcr2_one returns 0
- */
- template<uint value_size>
- uint UInt<value_size>::Rcr2_one(uint c)
- {
- uint b = value_size;
- uint * p1 = table;
-
- #ifndef __GNUC__
- __asm
- {
- push ebx
- push ecx
-
- mov ebx, [p1]
- mov ecx, [c]
- neg ecx
- mov ecx, [b]
-
- ttmath_loop:
- rcr dword ptr [ebx+ecx*4-4], 1
-
- dec ecx
- jnz ttmath_loop
-
- adc ecx, ecx
- mov [c], ecx
-
- pop ecx
- pop ebx
- }
- #endif
-
-
- #ifdef __GNUC__
- uint dummy;
-
- __asm__ __volatile__(
-
- "negl %%eax \n" // CF=1 if eax!=0 , CF=0 if eax==0
-
- "1: \n"
- "rcrl $1, -4(%%ebx, %%ecx, 4) \n"
-
- "decl %%ecx \n"
- "jnz 1b \n"
-
- "adcl %%ecx, %%ecx \n"
-
- : "=c" (c), "=a" (dummy)
- : "0" (b), "1" (c), "b" (p1)
- : "cc", "memory" );
-
- #endif
-
- TTMATH_LOGC("UInt::Rcr2_one", c)
-
- return c;
- }
-
-
-
-#ifdef _MSC_VER
-#pragma warning (disable : 4731)
-//warning C4731: frame pointer register 'ebp' modified by inline assembly code
-#endif
-
-
-
- /*!
- this method moves all bits into the left hand side
- return value <- this <- c
-
- the lowest *bits* will be held the 'c' and
- the state of one additional bit (on the left hand side)
- will be returned
-
- for example:
- let this is 001010000
- after Rcl2(3, 1) there'll be 010000111 and Rcl2 returns 1
- */
- template<uint value_size>
- uint UInt<value_size>::Rcl2(uint bits, uint c)
- {
- TTMATH_ASSERT( bits>0 && bits<TTMATH_BITS_PER_UINT )
-
- uint b = value_size;
- uint * p1 = table;
-
- #ifndef __GNUC__
- __asm
- {
- push eax
- push ebx
- push ecx
- push edx
- push esi
- push edi
- push ebp
-
- mov edi, [b]
-
- mov ecx, 32
- sub ecx, [bits]
- mov edx, -1
- shr edx, cl
-
- mov ecx, [bits]
- mov ebx, [p1]
- mov eax, [c]
-
- mov ebp, edx // ebp = mask (modified ebp - don't read/write to variables)
-
- xor edx, edx // edx = 0
- mov esi, edx
- or eax, eax
- cmovnz esi, ebp // if(c) esi=mask else esi=0
-
- ttmath_loop:
- rol dword ptr [ebx+edx*4], cl
-
- mov eax, [ebx+edx*4]
- and eax, ebp
- xor [ebx+edx*4], eax // clearing bits
- or [ebx+edx*4], esi // saving old value
- mov esi, eax
-
- inc edx
- dec edi
- jnz ttmath_loop
-
- pop ebp // restoring ebp
-
- and eax, 1
- mov [c], eax
-
- pop edi
- pop esi
- pop edx
- pop ecx
- pop ebx
- pop eax
- }
- #endif
-
-
- #ifdef __GNUC__
- uint dummy, dummy2, dummy3;
-
- __asm__ __volatile__(
-
- "push %%ebp \n"
-
- "movl %%ecx, %%esi \n"
- "movl $32, %%ecx \n"
- "subl %%esi, %%ecx \n" // ecx = 32 - bits
- "movl $-1, %%edx \n" // edx = -1 (all bits set to one)
- "shrl %%cl, %%edx \n" // shifting (0 -> edx -> cf) (cl times)
- "movl %%edx, %%ebp \n" // ebp = edx = mask
- "movl %%esi, %%ecx \n"
-
- "xorl %%edx, %%edx \n"
- "movl %%edx, %%esi \n"
- "orl %%eax, %%eax \n"
- "cmovnz %%ebp, %%esi \n" // if(c) esi=mask else esi=0
-
- "1: \n"
- "roll %%cl, (%%ebx,%%edx,4) \n"
-
- "movl (%%ebx,%%edx,4), %%eax \n"
- "andl %%ebp, %%eax \n"
- "xorl %%eax, (%%ebx,%%edx,4) \n"
- "orl %%esi, (%%ebx,%%edx,4) \n"
- "movl %%eax, %%esi \n"
-
- "incl %%edx \n"
- "decl %%edi \n"
- "jnz 1b \n"
-
- "and $1, %%eax \n"
-
- "pop %%ebp \n"
-
- : "=a" (c), "=D" (dummy), "=S" (dummy2), "=d" (dummy3)
- : "0" (c), "1" (b), "b" (p1), "c" (bits)
- : "cc", "memory" );
-
- #endif
-
- TTMATH_LOGC("UInt::Rcl2", c)
-
- return c;
- }
-
-
-
-
- /*!
- this method moves all bits into the right hand side
- C -> this -> return value
-
- the highest *bits* will be held the 'c' and
- the state of one additional bit (on the right hand side)
- will be returned
-
- for example:
- let this is 000000010
- after Rcr2(2, 1) there'll be 110000000 and Rcr2 returns 1
- */
- template<uint value_size>
- uint UInt<value_size>::Rcr2(uint bits, uint c)
- {
- TTMATH_ASSERT( bits>0 && bits<TTMATH_BITS_PER_UINT )
-
- uint b = value_size;
- uint * p1 = table;
-
- #ifndef __GNUC__
- __asm
- {
- push eax
- push ebx
- push ecx
- push edx
- push esi
- push edi
- push ebp
-
- mov edi, [b]
-
- mov ecx, 32
- sub ecx, [bits]
- mov edx, -1
- shl edx, cl
-
- mov ecx, [bits]
- mov ebx, [p1]
- mov eax, [c]
-
- mov ebp, edx // ebp = mask (modified ebp - don't read/write to variables)
-
- xor edx, edx // edx = 0
- mov esi, edx
- add edx, edi
- dec edx // edx is pointing at the end of the table (on last word)
- or eax, eax
- cmovnz esi, ebp // if(c) esi=mask else esi=0
-
- ttmath_loop:
- ror dword ptr [ebx+edx*4], cl
-
- mov eax, [ebx+edx*4]
- and eax, ebp
- xor [ebx+edx*4], eax // clearing bits
- or [ebx+edx*4], esi // saving old value
- mov esi, eax
-
- dec edx
- dec edi
- jnz ttmath_loop
-
- pop ebp // restoring ebp
-
- rol eax, 1 // 31bit will be first
- and eax, 1
- mov [c], eax
-
- pop edi
- pop esi
- pop edx
- pop ecx
- pop ebx
- pop eax
- }
- #endif
-
-
- #ifdef __GNUC__
- uint dummy, dummy2, dummy3;
-
- __asm__ __volatile__(
-
- "push %%ebp \n"
-
- "movl %%ecx, %%esi \n"
- "movl $32, %%ecx \n"
- "subl %%esi, %%ecx \n" // ecx = 32 - bits
- "movl $-1, %%edx \n" // edx = -1 (all bits set to one)
- "shll %%cl, %%edx \n" // shifting (cf <- edx <- 0) (cl times)
- "movl %%edx, %%ebp \n" // ebp = edx = mask
- "movl %%esi, %%ecx \n"
-
- "xorl %%edx, %%edx \n"
- "movl %%edx, %%esi \n"
- "addl %%edi, %%edx \n"
- "decl %%edx \n" // edx is pointing at the end of the table (on last word)
- "orl %%eax, %%eax \n"
- "cmovnz %%ebp, %%esi \n" // if(c) esi=mask else esi=0
-
- "1: \n"
- "rorl %%cl, (%%ebx,%%edx,4) \n"
-
- "movl (%%ebx,%%edx,4), %%eax \n"
- "andl %%ebp, %%eax \n"
- "xorl %%eax, (%%ebx,%%edx,4) \n"
- "orl %%esi, (%%ebx,%%edx,4) \n"
- "movl %%eax, %%esi \n"
-
- "decl %%edx \n"
- "decl %%edi \n"
- "jnz 1b \n"
-
- "roll $1, %%eax \n"
- "andl $1, %%eax \n"
-
- "pop %%ebp \n"
-
- : "=a" (c), "=D" (dummy), "=S" (dummy2), "=d" (dummy3)
- : "0" (c), "1" (b), "b" (p1), "c" (bits)
- : "cc", "memory" );
-
- #endif
-
- TTMATH_LOGC("UInt::Rcr2", c)
-
- return c;
- }
-
-
-#ifdef _MSC_VER
-#pragma warning (default : 4731)
-#endif
-
-
- /*
- this method returns the number of the highest set bit in one 32-bit word
- if the 'x' is zero this method returns '-1'
- */
- template<uint value_size>
- sint UInt<value_size>::FindLeadingBitInWord(uint x)
- {
- sint result;
-
- #ifndef __GNUC__
- __asm
- {
- push eax
- push edx
-
- mov edx,-1
- bsr eax,[x]
- cmovz eax,edx
- mov [result], eax
-
- pop edx
- pop eax
- }
- #endif
-
-
- #ifdef __GNUC__
- uint dummy;
-
- __asm__ (
-
- "movl $-1, %1 \n"
- "bsrl %2, %0 \n"
- "cmovz %1, %0 \n"
-
- : "=r" (result), "=&r" (dummy)
- : "r" (x)
- : "cc" );
-
- #endif
-
- return result;
- }
-
-
-
- /*
- this method returns the number of the smallest set bit in one 32-bit word
- if the 'x' is zero this method returns '-1'
- */
- template<uint value_size>
- sint UInt<value_size>::FindLowestBitInWord(uint x)
- {
- sint result;
-
- #ifndef __GNUC__
- __asm
- {
- push eax
- push edx
-
- mov edx,-1
- bsf eax,[x]
- cmovz eax,edx
- mov [result], eax
-
- pop edx
- pop eax
- }
- #endif
-
-
- #ifdef __GNUC__
- uint dummy;
-
- __asm__ (
-
- "movl $-1, %1 \n"
- "bsfl %2, %0 \n"
- "cmovz %1, %0 \n"
-
- : "=r" (result), "=&r" (dummy)
- : "r" (x)
- : "cc" );
-
- #endif
-
- return result;
- }
-
-
-
- /*!
- this method sets a special bit in the 'value'
- and returns the last state of the bit (zero or one)
-
- bit is from <0,31>
- e.g.
- uint x = 100;
- uint bit = SetBitInWord(x, 3);
- now: x = 108 and bit = 0
- */
- template<uint value_size>
- uint UInt<value_size>::SetBitInWord(uint & value, uint bit)
- {
- TTMATH_ASSERT( bit < TTMATH_BITS_PER_UINT )
-
- uint old_bit;
- uint v = value;
-
- #ifndef __GNUC__
- __asm
- {
- push ebx
- push eax
-
- mov eax, [v]
- mov ebx, [bit]
- bts eax, ebx
- mov [v], eax
-
- setc bl
- movzx ebx, bl
- mov [old_bit], ebx
-
- pop eax
- pop ebx
- }
- #endif
-
-
- #ifdef __GNUC__
- __asm__ (
-
- "btsl %%ebx, %%eax \n"
- "setc %%bl \n"
- "movzx %%bl, %%ebx \n"
-
- : "=a" (v), "=b" (old_bit)
- : "0" (v), "1" (bit)
- : "cc" );
-
- #endif
-
- value = v;
-
- return old_bit;
- }
-
-
-
-
- /*!
- multiplication: result_high:result_low = a * b
- result_high - higher word of the result
- result_low - lower word of the result
-
- this methos never returns a carry
- this method is used in the second version of the multiplication algorithms
- */
- template<uint value_size>
- void UInt<value_size>::MulTwoWords(uint a, uint b, uint * result_high, uint * result_low)
- {
- /*
- we must use these temporary variables in order to inform the compilator
- that value pointed with result1 and result2 has changed
-
- this has no effect in visual studio but it's useful when
- using gcc and options like -Ox
- */
- uint result1_;
- uint result2_;
-
- #ifndef __GNUC__
-
- __asm
- {
- push eax
- push edx
-
- mov eax, [a]
- mul dword ptr [b]
-
- mov [result2_], edx
- mov [result1_], eax
-
- pop edx
- pop eax
- }
-
- #endif
-
-
- #ifdef __GNUC__
-
- __asm__ (
-
- "mull %%edx \n"
-
- : "=a" (result1_), "=d" (result2_)
- : "0" (a), "1" (b)
- : "cc" );
-
- #endif
-
-
- *result_low = result1_;
- *result_high = result2_;
- }
-
-
-
-
-
- /*!
- *
- * Division
- *
- *
- */
-
-
-
-
- /*!
- this method calculates 64bits word a:b / 32bits c (a higher, b lower word)
- r = a:b / c and rest - remainder
-
- *
- * WARNING:
- * if r (one word) is too small for the result or c is equal zero
- * there'll be a hardware interruption (0)
- * and probably the end of your program
- *
- */
- template<uint value_size>
- void UInt<value_size>::DivTwoWords(uint a, uint b, uint c, uint * r, uint * rest)
- {
- uint r_;
- uint rest_;
- /*
- these variables have similar meaning like those in
- the multiplication algorithm MulTwoWords
- */
-
- TTMATH_ASSERT( c != 0 )
-
- #ifndef __GNUC__
- __asm
- {
- push eax
- push edx
-
- mov edx, [a]
- mov eax, [b]
- div dword ptr [c]
-
- mov [r_], eax
- mov [rest_], edx
-
- pop edx
- pop eax
- }
- #endif
-
-
- #ifdef __GNUC__
-
- __asm__ (
-
- "divl %%ecx \n"
-
- : "=a" (r_), "=d" (rest_)
- : "0" (b), "1" (a), "c" (c)
- : "cc" );
-
- #endif
-
-
- *r = r_;
- *rest = rest_;
-
- }
-
-
-
-} //namespace
-
-
-
-#endif //ifdef TTMATH_PLATFORM32
-#endif //ifndef TTMATH_NOASM
-#endif
diff --git a/ttmath/ttmathuint_x86_64.h b/ttmath/ttmathuint_x86_64.h
deleted file mode 100644
index 188fc5e..0000000
--- a/ttmath/ttmathuint_x86_64.h
+++ /dev/null
@@ -1,1146 +0,0 @@
-/*
- * This file is a part of TTMath Bignum Library
- * and is distributed under the (new) BSD licence.
- * Author: Tomasz Sowa <t.sowa at ttmath.org>
- */
-
-/*
- * Copyright (c) 2006-2010, Tomasz Sowa
- * All rights reserved.
- *
- * Redistribution and use in source and binary forms, with or without
- * modification, are permitted provided that the following conditions are met:
- *
- * * Redistributions of source code must retain the above copyright notice,
- * this list of conditions and the following disclaimer.
- *
- * * Redistributions in binary form must reproduce the above copyright
- * notice, this list of conditions and the following disclaimer in the
- * documentation and/or other materials provided with the distribution.
- *
- * * Neither the name Tomasz Sowa nor the names of contributors to this
- * project may be used to endorse or promote products derived
- * from this software without specific prior written permission.
- *
- * THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS"
- * AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
- * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- * ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE
- * LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR
- * CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF
- * SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS
- * INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN
- * CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
- * ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF
- * THE POSSIBILITY OF SUCH DAMAGE.
- */
-
-
-#ifndef headerfilettmathuint_x86_64
-#define headerfilettmathuint_x86_64
-
-
-#ifndef TTMATH_NOASM
-#ifdef TTMATH_PLATFORM64
-
-
-/*!
- \file ttmathuint_x86_64.h
- \brief template class UInt<uint> with assembler code for 64bit x86_64 processors
-
- this file is included at the end of ttmathuint.h
-*/
-
-#ifndef __GNUC__
-#include <intrin.h>
-#endif
-
-
-namespace ttmath
-{
-
- #ifndef __GNUC__
-
- extern "C"
- {
- uint __fastcall ttmath_adc_x64(uint* p1, const uint* p2, uint nSize, uint c);
- uint __fastcall ttmath_addindexed_x64(uint* p1, uint nSize, uint nPos, uint nValue);
- uint __fastcall ttmath_addindexed2_x64(uint* p1, uint nSize, uint nPos, uint nValue1, uint nValue2);
- uint __fastcall ttmath_addvector_x64(const uint * ss1, const uint * ss2, uint ss1_size, uint ss2_size, uint * result);
- uint __fastcall ttmath_sbb_x64(uint* p1, const uint* p2, uint nSize, uint c);
- uint __fastcall ttmath_subindexed_x64(uint* p1, uint nSize, uint nPos, uint nValue);
- uint __fastcall ttmath_subvector_x64(const uint * ss1, const uint * ss2, uint ss1_size, uint ss2_size, uint * result);
- uint __fastcall ttmath_rcl_x64(uint* p1, uint nSize, uint nLowestBit);
- uint __fastcall ttmath_rcr_x64(uint* p1, uint nSize, uint nLowestBit);
- uint __fastcall ttmath_div_x64(uint* pnValHi, uint* pnValLo, uint nDiv);
- uint __fastcall ttmath_rcl2_x64(uint* p1, uint nSize, uint nBits, uint c);
- uint __fastcall ttmath_rcr2_x64(uint* p1, uint nSize, uint nBits, uint c);
- };
- #endif
-
-
- /*!
- returning the string represents the currect type of the library
- we have following types:
- asm_vc_32 - with asm code designed for Microsoft Visual C++ (32 bits)
- asm_gcc_32 - with asm code designed for GCC (32 bits)
- asm_vc_64 - with asm for VC (64 bit)
- asm_gcc_64 - with asm for GCC (64 bit)
- no_asm_32 - pure C++ version (32 bit) - without any asm code
- no_asm_64 - pure C++ version (64 bit) - without any asm code
- */
- template<uint value_size>
- const char * UInt<value_size>::LibTypeStr()
- {
- #ifndef __GNUC__
- static const char info[] = "asm_vc_64";
- #endif
-
- #ifdef __GNUC__
- static const char info[] = "asm_gcc_64";
- #endif
-
- return info;
- }
-
-
- /*!
- returning the currect type of the library
- */
- template<uint value_size>
- LibTypeCode UInt<value_size>::LibType()
- {
- #ifndef __GNUC__
- LibTypeCode info = asm_vc_64;
- #endif
-
- #ifdef __GNUC__
- LibTypeCode info = asm_gcc_64;
- #endif
-
- return info;
- }
-
-
- /*!
- *
- * basic mathematic functions
- *
- */
-
-
-
- /*!
- this method adding ss2 to the this and adding carry if it's defined
- (this = this + ss2 + c)
-
- ***this method is created only on a 64bit platform***
-
- c must be zero or one (might be a bigger value than 1)
- function returns carry (1) (if it was)
- */
- template<uint value_size>
- uint UInt<value_size>::Add(const UInt<value_size> & ss2, uint c)
- {
- uint b = value_size;
- uint * p1 = table;
- const uint * p2 = ss2.table;
-
- // we don't have to use TTMATH_REFERENCE_ASSERT here
- // this algorithm doesn't require it
-
- #ifndef __GNUC__
- c = ttmath_adc_x64(p1,p2,b,c);
- #endif
-
- #ifdef __GNUC__
- uint dummy, dummy2;
-
- /*
- this part should be compiled with gcc
- */
- __asm__ __volatile__(
-
- "xorq %%rdx, %%rdx \n"
- "negq %%rax \n" // CF=1 if rax!=0 , CF=0 if rax==0
-
- "1: \n"
- "movq (%%rsi,%%rdx,8), %%rax \n"
- "adcq %%rax, (%%rbx,%%rdx,8) \n"
-
- "incq %%rdx \n"
- "decq %%rcx \n"
- "jnz 1b \n"
-
- "adcq %%rcx, %%rcx \n"
-
- : "=c" (c), "=a" (dummy), "=d" (dummy2)
- : "0" (b), "1" (c), "b" (p1), "S" (p2)
- : "cc", "memory" );
-
- #endif
-
- TTMATH_LOGC("UInt::Add", c)
-
- return c;
- }
-
-
-
- /*!
- this method adds one word (at a specific position)
- and returns a carry (if it was)
-
- ***this method is created only on a 64bit platform***
-
-
- if we've got (value_size=3):
- table[0] = 10;
- table[1] = 30;
- table[2] = 5;
- and we call:
- AddInt(2,1)
- then it'll be:
- table[0] = 10;
- table[1] = 30 + 2;
- table[2] = 5;
-
- of course if there was a carry from table[2] it would be returned
- */
- template<uint value_size>
- uint UInt<value_size>::AddInt(uint value, uint index)
- {
- uint b = value_size;
- uint * p1 = table;
- uint c;
-
- TTMATH_ASSERT( index < value_size )
-
- #ifndef __GNUC__
- c = ttmath_addindexed_x64(p1,b,index,value);
- #endif
-
-
- #ifdef __GNUC__
- uint dummy, dummy2;
-
- __asm__ __volatile__(
-
- "subq %%rdx, %%rcx \n"
-
- "1: \n"
- "addq %%rax, (%%rbx,%%rdx,8) \n"
- "jnc 2f \n"
-
- "movq $1, %%rax \n"
- "incq %%rdx \n"
- "decq %%rcx \n"
- "jnz 1b \n"
-
- "2: \n"
- "setc %%al \n"
- "movzx %%al, %%rdx \n"
-
- : "=d" (c), "=a" (dummy), "=c" (dummy2)
- : "0" (index), "1" (value), "2" (b), "b" (p1)
- : "cc", "memory" );
-
- #endif
-
- TTMATH_LOGC("UInt::AddInt", c)
-
- return c;
- }
-
-
-
- /*!
- this method adds only two unsigned words to the existing value
- and these words begin on the 'index' position
- (it's used in the multiplication algorithm 2)
-
- ***this method is created only on a 64bit platform***
-
- index should be equal or smaller than value_size-2 (index <= value_size-2)
- x1 - lower word, x2 - higher word
-
- for example if we've got value_size equal 4 and:
- table[0] = 3
- table[1] = 4
- table[2] = 5
- table[3] = 6
- then let
- x1 = 10
- x2 = 20
- and
- index = 1
-
- the result of this method will be:
- table[0] = 3
- table[1] = 4 + x1 = 14
- table[2] = 5 + x2 = 25
- table[3] = 6
-
- and no carry at the end of table[3]
-
- (of course if there was a carry in table[2](5+20) then
- this carry would be passed to the table[3] etc.)
- */
- template<uint value_size>
- uint UInt<value_size>::AddTwoInts(uint x2, uint x1, uint index)
- {
- uint b = value_size;
- uint * p1 = table;
- uint c;
-
- TTMATH_ASSERT( index < value_size - 1 )
-
- #ifndef __GNUC__
- c = ttmath_addindexed2_x64(p1,b,index,x1,x2);
- #endif
-
-
- #ifdef __GNUC__
- uint dummy, dummy2;
-
- __asm__ __volatile__(
-
- "subq %%rdx, %%rcx \n"
-
- "addq %%rsi, (%%rbx,%%rdx,8) \n"
- "incq %%rdx \n"
- "decq %%rcx \n"
-
- "1: \n"
- "adcq %%rax, (%%rbx,%%rdx,8) \n"
- "jnc 2f \n"
-
- "mov $0, %%rax \n"
- "incq %%rdx \n"
- "decq %%rcx \n"
- "jnz 1b \n"
-
- "2: \n"
- "setc %%al \n"
- "movzx %%al, %%rax \n"
-
- : "=a" (c), "=c" (dummy), "=d" (dummy2)
- : "0" (x2), "1" (b), "2" (index), "b" (p1), "S" (x1)
- : "cc", "memory" );
-
- #endif
-
- TTMATH_LOGC("UInt::AddTwoInts", c)
-
- return c;
- }
-
-
-
- /*!
- this static method addes one vector to the other
- 'ss1' is larger in size or equal to 'ss2'
-
- ss1 points to the first (larger) vector
- ss2 points to the second vector
- ss1_size - size of the ss1 (and size of the result too)
- ss2_size - size of the ss2
- result - is the result vector (which has size the same as ss1: ss1_size)
-
- Example: ss1_size is 5, ss2_size is 3
- ss1: ss2: result (output):
- 5 1 5+1
- 4 3 4+3
- 2 7 2+7
- 6 6
- 9 9
- of course the carry is propagated and will be returned from the last item
- (this method is used by the Karatsuba multiplication algorithm)
- */
- template<uint value_size>
- uint UInt<value_size>::AddVector(const uint * ss1, const uint * ss2, uint ss1_size, uint ss2_size, uint * result)
- {
- TTMATH_ASSERT( ss1_size >= ss2_size )
-
- uint c;
-
- #ifndef __GNUC__
- c = ttmath_addvector_x64(ss1, ss2, ss1_size, ss2_size, result);
- #endif
-
-
- #ifdef __GNUC__
- uint dummy1, dummy2, dummy3;
- uint rest = ss1_size - ss2_size;
-
- // this part should be compiled with gcc
-
- __asm__ __volatile__(
- "mov %%rdx, %%r8 \n"
- "xor %%rdx, %%rdx \n" // rdx = 0, cf = 0
- "1: \n"
- "mov (%%rsi,%%rdx,8), %%rax \n"
- "adc (%%rbx,%%rdx,8), %%rax \n"
- "mov %%rax, (%%rdi,%%rdx,8) \n"
-
- "inc %%rdx \n"
- "dec %%rcx \n"
- "jnz 1b \n"
-
- "adc %%rcx, %%rcx \n" // rcx has the cf state
-
- "or %%r8, %%r8 \n"
- "jz 3f \n"
-
- "xor %%rbx, %%rbx \n" // ebx = 0
- "neg %%rcx \n" // setting cf from rcx
- "mov %%r8, %%rcx \n" // rcx=rest and is != 0
- "2: \n"
- "mov (%%rsi, %%rdx, 8), %%rax \n"
- "adc %%rbx, %%rax \n"
- "mov %%rax, (%%rdi, %%rdx, 8) \n"
-
- "inc %%rdx \n"
- "dec %%rcx \n"
- "jnz 2b \n"
-
- "adc %%rcx, %%rcx \n"
- "3: \n"
-
- : "=a" (dummy1), "=b" (dummy2), "=c" (c), "=d" (dummy3)
- : "1" (ss2), "2" (ss2_size), "3" (rest), "S" (ss1), "D" (result)
- : "%r8", "cc", "memory" );
-
- #endif
-
- TTMATH_VECTOR_LOGC("UInt::AddVector", c, result, ss1_size)
-
- return c;
- }
-
-
-
- /*!
- this method's subtracting ss2 from the 'this' and subtracting
- carry if it has been defined
- (this = this - ss2 - c)
-
- ***this method is created only on a 64bit platform***
-
- c must be zero or one (might be a bigger value than 1)
- function returns carry (1) (if it was)
- */
- template<uint value_size>
- uint UInt<value_size>::Sub(const UInt<value_size> & ss2, uint c)
- {
- uint b = value_size;
- uint * p1 = table;
- const uint * p2 = ss2.table;
-
- // we don't have to use TTMATH_REFERENCE_ASSERT here
- // this algorithm doesn't require it
-
- #ifndef __GNUC__
- c = ttmath_sbb_x64(p1,p2,b,c);
- #endif
-
-
- #ifdef __GNUC__
- uint dummy, dummy2;
-
- __asm__ __volatile__(
-
- "xorq %%rdx, %%rdx \n"
- "negq %%rax \n" // CF=1 if rax!=0 , CF=0 if rax==0
-
- "1: \n"
- "movq (%%rsi,%%rdx,8), %%rax \n"
- "sbbq %%rax, (%%rbx,%%rdx,8) \n"
-
- "incq %%rdx \n"
- "decq %%rcx \n"
- "jnz 1b \n"
-
- "adcq %%rcx, %%rcx \n"
-
- : "=c" (c), "=a" (dummy), "=d" (dummy2)
- : "0" (b), "1" (c), "b" (p1), "S" (p2)
- : "cc", "memory" );
-
- #endif
-
- TTMATH_LOGC("UInt::Sub", c)
-
- return c;
- }
-
-
-
- /*!
- this method subtracts one word (at a specific position)
- and returns a carry (if it was)
-
- ***this method is created only on a 64bit platform***
-
- if we've got (value_size=3):
- table[0] = 10;
- table[1] = 30;
- table[2] = 5;
- and we call:
- SubInt(2,1)
- then it'll be:
- table[0] = 10;
- table[1] = 30 - 2;
- table[2] = 5;
-
- of course if there was a carry from table[2] it would be returned
- */
- template<uint value_size>
- uint UInt<value_size>::SubInt(uint value, uint index)
- {
- uint b = value_size;
- uint * p1 = table;
- uint c;
-
- TTMATH_ASSERT( index < value_size )
-
- #ifndef __GNUC__
- c = ttmath_subindexed_x64(p1,b,index,value);
- #endif
-
-
- #ifdef __GNUC__
- uint dummy, dummy2;
-
- __asm__ __volatile__(
-
- "subq %%rdx, %%rcx \n"
-
- "1: \n"
- "subq %%rax, (%%rbx,%%rdx,8) \n"
- "jnc 2f \n"
-
- "movq $1, %%rax \n"
- "incq %%rdx \n"
- "decq %%rcx \n"
- "jnz 1b \n"
-
- "2: \n"
- "setc %%al \n"
- "movzx %%al, %%rdx \n"
-
- : "=d" (c), "=a" (dummy), "=c" (dummy2)
- : "0" (index), "1" (value), "2" (b), "b" (p1)
- : "cc", "memory" );
-
- #endif
-
- TTMATH_LOGC("UInt::SubInt", c)
-
- return c;
- }
-
-
- /*!
- this static method subtractes one vector from the other
- 'ss1' is larger in size or equal to 'ss2'
-
- ss1 points to the first (larger) vector
- ss2 points to the second vector
- ss1_size - size of the ss1 (and size of the result too)
- ss2_size - size of the ss2
- result - is the result vector (which has size the same as ss1: ss1_size)
-
- Example: ss1_size is 5, ss2_size is 3
- ss1: ss2: result (output):
- 5 1 5-1
- 4 3 4-3
- 2 7 2-7
- 6 6-1 (the borrow from previous item)
- 9 9
- return (carry): 0
- of course the carry (borrow) is propagated and will be returned from the last item
- (this method is used by the Karatsuba multiplication algorithm)
- */
- template<uint value_size>
- uint UInt<value_size>::SubVector(const uint * ss1, const uint * ss2, uint ss1_size, uint ss2_size, uint * result)
- {
- TTMATH_ASSERT( ss1_size >= ss2_size )
-
- uint c;
-
- #ifndef __GNUC__
- c = ttmath_subvector_x64(ss1, ss2, ss1_size, ss2_size, result);
- #endif
-
-
- #ifdef __GNUC__
-
- // the asm code is nearly the same as in AddVector
- // only two instructions 'adc' are changed to 'sbb'
-
- uint dummy1, dummy2, dummy3;
- uint rest = ss1_size - ss2_size;
-
- __asm__ __volatile__(
- "mov %%rdx, %%r8 \n"
- "xor %%rdx, %%rdx \n" // rdx = 0, cf = 0
- "1: \n"
- "mov (%%rsi,%%rdx,8), %%rax \n"
- "sbb (%%rbx,%%rdx,8), %%rax \n"
- "mov %%rax, (%%rdi,%%rdx,8) \n"
-
- "inc %%rdx \n"
- "dec %%rcx \n"
- "jnz 1b \n"
-
- "adc %%rcx, %%rcx \n" // rcx has the cf state
-
- "or %%r8, %%r8 \n"
- "jz 3f \n"
-
- "xor %%rbx, %%rbx \n" // ebx = 0
- "neg %%rcx \n" // setting cf from rcx
- "mov %%r8, %%rcx \n" // rcx=rest and is != 0
- "2: \n"
- "mov (%%rsi, %%rdx, 8), %%rax \n"
- "sbb %%rbx, %%rax \n"
- "mov %%rax, (%%rdi, %%rdx, 8) \n"
-
- "inc %%rdx \n"
- "dec %%rcx \n"
- "jnz 2b \n"
-
- "adc %%rcx, %%rcx \n"
- "3: \n"
-
- : "=a" (dummy1), "=b" (dummy2), "=c" (c), "=d" (dummy3)
- : "1" (ss2), "2" (ss2_size), "3" (rest), "S" (ss1), "D" (result)
- : "%r8", "cc", "memory" );
-
- #endif
-
- TTMATH_VECTOR_LOGC("UInt::SubVector", c, result, ss1_size)
-
- return c;
- }
-
-
- /*!
- this method moves all bits into the left hand side
- return value <- this <- c
-
- the lowest *bit* will be held the 'c' and
- the state of one additional bit (on the left hand side)
- will be returned
-
- for example:
- let this is 001010000
- after Rcl2_one(1) there'll be 010100001 and Rcl2_one returns 0
-
- ***this method is created only on a 64bit platform***
- */
- template<uint value_size>
- uint UInt<value_size>::Rcl2_one(uint c)
- {
- sint b = value_size;
- uint * p1 = table;
-
-
- #ifndef __GNUC__
- c = ttmath_rcl_x64(p1,b,c);
- #endif
-
-
- #ifdef __GNUC__
- uint dummy, dummy2;
-
- __asm__ __volatile__(
-
- "xorq %%rdx, %%rdx \n" // rdx=0
- "negq %%rax \n" // CF=1 if rax!=0 , CF=0 if rax==0
-
- "1: \n"
- "rclq $1, (%%rbx, %%rdx, 8) \n"
-
- "incq %%rdx \n"
- "decq %%rcx \n"
- "jnz 1b \n"
-
- "adcq %%rcx, %%rcx \n"
-
- : "=c" (c), "=a" (dummy), "=d" (dummy2)
- : "0" (b), "1" (c), "b" (p1)
- : "cc", "memory" );
-
- #endif
-
- TTMATH_LOGC("UInt::Rcl2_one", c)
-
- return c;
- }
-
-
- /*!
- this method moves all bits into the right hand side
- c -> this -> return value
-
- the highest *bit* will be held the 'c' and
- the state of one additional bit (on the right hand side)
- will be returned
-
- for example:
- let this is 000000010
- after Rcr2_one(1) there'll be 100000001 and Rcr2_one returns 0
-
- ***this method is created only on a 64bit platform***
- */
- template<uint value_size>
- uint UInt<value_size>::Rcr2_one(uint c)
- {
- sint b = value_size;
- uint * p1 = table;
-
-
- #ifndef __GNUC__
- c = ttmath_rcr_x64(p1,b,c);
- #endif
-
-
- #ifdef __GNUC__
- uint dummy;
-
- __asm__ __volatile__(
-
- "negq %%rax \n" // CF=1 if rax!=0 , CF=0 if rax==0
-
- "1: \n"
- "rcrq $1, -8(%%rbx, %%rcx, 8) \n"
-
- "decq %%rcx \n"
- "jnz 1b \n"
-
- "adcq %%rcx, %%rcx \n"
-
- : "=c" (c), "=a" (dummy)
- : "0" (b), "1" (c), "b" (p1)
- : "cc", "memory" );
-
- #endif
-
- TTMATH_LOGC("UInt::Rcr2_one", c)
-
- return c;
- }
-
-
-
- /*!
- this method moves all bits into the left hand side
- return value <- this <- c
-
- the lowest *bits* will be held the 'c' and
- the state of one additional bit (on the left hand side)
- will be returned
-
- for example:
- let this is 001010000
- after Rcl2(3, 1) there'll be 010000111 and Rcl2 returns 1
-
- ***this method is created only on a 64bit platform***
- */
- template<uint value_size>
- uint UInt<value_size>::Rcl2(uint bits, uint c)
- {
- TTMATH_ASSERT( bits>0 && bits<TTMATH_BITS_PER_UINT )
-
- uint b = value_size;
- uint * p1 = table;
-
-
- #ifndef __GNUC__
- c = ttmath_rcl2_x64(p1,b,bits,c);
- #endif
-
-
- #ifdef __GNUC__
- uint dummy, dummy2, dummy3;
-
- __asm__ __volatile__(
-
- "movq %%rcx, %%rsi \n"
- "movq $64, %%rcx \n"
- "subq %%rsi, %%rcx \n"
- "movq $-1, %%rdx \n"
- "shrq %%cl, %%rdx \n"
- "movq %%rdx, %%r8 \n"
- "movq %%rsi, %%rcx \n"
-
- "xorq %%rdx, %%rdx \n"
- "movq %%rdx, %%rsi \n"
- "orq %%rax, %%rax \n"
- "cmovnz %%r8, %%rsi \n"
-
- "1: \n"
- "rolq %%cl, (%%rbx,%%rdx,8) \n"
-
- "movq (%%rbx,%%rdx,8), %%rax \n"
- "andq %%r8, %%rax \n"
- "xorq %%rax, (%%rbx,%%rdx,8) \n"
- "orq %%rsi, (%%rbx,%%rdx,8) \n"
- "movq %%rax, %%rsi \n"
-
- "incq %%rdx \n"
- "decq %%rdi \n"
- "jnz 1b \n"
-
- "and $1, %%rax \n"
-
- : "=a" (c), "=D" (dummy), "=S" (dummy2), "=d" (dummy3)
- : "0" (c), "1" (b), "b" (p1), "c" (bits)
- : "%r8", "cc", "memory" );
-
- #endif
-
- TTMATH_LOGC("UInt::Rcl2", c)
-
- return c;
- }
-
-
- /*!
- this method moves all bits into the right hand side
- C -> this -> return value
-
- the highest *bits* will be held the 'c' and
- the state of one additional bit (on the right hand side)
- will be returned
-
- for example:
- let this is 000000010
- after Rcr2(2, 1) there'll be 110000000 and Rcr2 returns 1
-
- ***this method is created only on a 64bit platform***
- */
- template<uint value_size>
- uint UInt<value_size>::Rcr2(uint bits, uint c)
- {
- TTMATH_ASSERT( bits>0 && bits<TTMATH_BITS_PER_UINT )
-
- sint b = value_size;
- uint * p1 = table;
-
-
- #ifndef __GNUC__
- c = ttmath_rcr2_x64(p1,b,bits,c);
- #endif
-
-
- #ifdef __GNUC__
- uint dummy, dummy2, dummy3;
-
- __asm__ __volatile__(
-
- "movq %%rcx, %%rsi \n"
- "movq $64, %%rcx \n"
- "subq %%rsi, %%rcx \n"
- "movq $-1, %%rdx \n"
- "shlq %%cl, %%rdx \n"
- "movq %%rdx, %%R8 \n"
- "movq %%rsi, %%rcx \n"
-
- "xorq %%rdx, %%rdx \n"
- "movq %%rdx, %%rsi \n"
- "addq %%rdi, %%rdx \n"
- "decq %%rdx \n"
- "orq %%rax, %%rax \n"
- "cmovnz %%R8, %%rsi \n"
-
- "1: \n"
- "rorq %%cl, (%%rbx,%%rdx,8) \n"
-
- "movq (%%rbx,%%rdx,8), %%rax \n"
- "andq %%R8, %%rax \n"
- "xorq %%rax, (%%rbx,%%rdx,8) \n"
- "orq %%rsi, (%%rbx,%%rdx,8) \n"
- "movq %%rax, %%rsi \n"
-
- "decq %%rdx \n"
- "decq %%rdi \n"
- "jnz 1b \n"
-
- "rolq $1, %%rax \n"
- "andq $1, %%rax \n"
-
- : "=a" (c), "=D" (dummy), "=S" (dummy2), "=d" (dummy3)
- : "0" (c), "1" (b), "b" (p1), "c" (bits)
- : "%r8", "cc", "memory" );
-
- #endif
-
- TTMATH_LOGC("UInt::Rcr2", c)
-
- return c;
- }
-
-
- /*
- this method returns the number of the highest set bit in one 64-bit word
- if the 'x' is zero this method returns '-1'
-
- ***this method is created only on a 64bit platform***
- */
- template<uint value_size>
- sint UInt<value_size>::FindLeadingBitInWord(uint x)
- {
- sint result;
-
-
- #ifndef __GNUC__
-
- unsigned long nIndex = 0;
-
- if( _BitScanReverse64(&nIndex,x) == 0 )
- result = -1;
- else
- result = nIndex;
-
- #endif
-
-
- #ifdef __GNUC__
- uint dummy;
-
- __asm__ (
-
- "movq $-1, %1 \n"
- "bsrq %2, %0 \n"
- "cmovz %1, %0 \n"
-
- : "=r" (result), "=&r" (dummy)
- : "r" (x)
- : "cc" );
-
- #endif
-
-
- return result;
- }
-
-
- /*
- this method returns the number of the highest set bit in one 64-bit word
- if the 'x' is zero this method returns '-1'
-
- ***this method is created only on a 64bit platform***
- */
- template<uint value_size>
- sint UInt<value_size>::FindLowestBitInWord(uint x)
- {
- sint result;
-
-
- #ifndef __GNUC__
-
- unsigned long nIndex = 0;
-
- if( _BitScanForward64(&nIndex,x) == 0 )
- result = -1;
- else
- result = nIndex;
-
- #endif
-
-
- #ifdef __GNUC__
- uint dummy;
-
- __asm__ (
-
- "movq $-1, %1 \n"
- "bsfq %2, %0 \n"
- "cmovz %1, %0 \n"
-
- : "=r" (result), "=&r" (dummy)
- : "r" (x)
- : "cc" );
-
- #endif
-
-
- return result;
- }
-
-
- /*!
- this method sets a special bit in the 'value'
- and returns the last state of the bit (zero or one)
-
- ***this method is created only on a 64bit platform***
-
- bit is from <0,63>
-
- e.g.
- uint x = 100;
- uint bit = SetBitInWord(x, 3);
- now: x = 108 and bit = 0
- */
- template<uint value_size>
- uint UInt<value_size>::SetBitInWord(uint & value, uint bit)
- {
- TTMATH_ASSERT( bit < TTMATH_BITS_PER_UINT )
-
- uint old_bit;
- uint v = value;
-
-
- #ifndef __GNUC__
- old_bit = _bittestandset64((__int64*)&value,bit) != 0;
- #endif
-
-
- #ifdef __GNUC__
-
- __asm__ (
-
- "btsq %%rbx, %%rax \n"
- "setc %%bl \n"
- "movzx %%bl, %%rbx \n"
-
- : "=a" (v), "=b" (old_bit)
- : "0" (v), "1" (bit)
- : "cc" );
-
- #endif
-
- value = v;
-
- return old_bit;
- }
-
-
- /*!
- *
- * Multiplication
- *
- *
- */
-
-
- /*!
- multiplication: result_high:result_low = a * b
- result_high - higher word of the result
- result_low - lower word of the result
-
- this methos never returns a carry
- this method is used in the second version of the multiplication algorithms
-
- ***this method is created only on a 64bit platform***
- */
- template<uint value_size>
- void UInt<value_size>::MulTwoWords(uint a, uint b, uint * result_high, uint * result_low)
- {
- /*
- we must use these temporary variables in order to inform the compilator
- that value pointed with result1 and result2 has changed
-
- this has no effect in visual studio but it's usefull when
- using gcc and options like -O
- */
- uint result1_;
- uint result2_;
-
-
- #ifndef __GNUC__
- result1_ = _umul128(a,b,&result2_);
- #endif
-
-
- #ifdef __GNUC__
-
- __asm__ (
-
- "mulq %%rdx \n"
-
- : "=a" (result1_), "=d" (result2_)
- : "0" (a), "1" (b)
- : "cc" );
-
- #endif
-
-
- *result_low = result1_;
- *result_high = result2_;
- }
-
-
-
-
- /*!
- *
- * Division
- *
- *
- */
-
-
- /*!
- this method calculates 64bits word a:b / 32bits c (a higher, b lower word)
- r = a:b / c and rest - remainder
-
- ***this method is created only on a 64bit platform***
-
- *
- * WARNING:
- * if r (one word) is too small for the result or c is equal zero
- * there'll be a hardware interruption (0)
- * and probably the end of your program
- *
- */
- template<uint value_size>
- void UInt<value_size>::DivTwoWords(uint a,uint b, uint c, uint * r, uint * rest)
- {
- uint r_;
- uint rest_;
- /*
- these variables have similar meaning like those in
- the multiplication algorithm MulTwoWords
- */
-
- TTMATH_ASSERT( c != 0 )
-
-
- #ifndef __GNUC__
-
- ttmath_div_x64(&a,&b,c);
- r_ = a;
- rest_ = b;
-
- #endif
-
-
- #ifdef __GNUC__
-
- __asm__ (
-
- "divq %%rcx \n"
-
- : "=a" (r_), "=d" (rest_)
- : "d" (a), "a" (b), "c" (c)
- : "cc" );
-
- #endif
-
-
- *r = r_;
- *rest = rest_;
- }
-
-} //namespace
-
-
-#endif //ifdef TTMATH_PLATFORM64
-#endif //ifndef TTMATH_NOASM
-#endif
-
-
--
Alioth's /usr/local/bin/git-commit-notice on /srv/git.debian.org/git/debian-med/minia.git
More information about the debian-med-commit
mailing list