[med-svn] [jellyfish1] 02/03: New upstream version 1.1.11
    Andreas Tille 
    tille at debian.org
       
    Thu Jul 20 07:44:26 UTC 2017
    
    
  
This is an automated email from the git hooks/post-receive script.
tille pushed a commit to branch master
in repository jellyfish1.
commit 379377eab0b88bccca8beb3a1a740a5c4f93cca7
Author: Andreas Tille <tille at debian.org>
Date:   Thu Jul 20 09:40:27 2017 +0200
    New upstream version 1.1.11
---
 Makefile.am                                        |   144 +-
 Makefile.in                                        |  1259 +-
 aclocal.m4                                         |   106 +-
 config.guess                                       |   449 +-
 config.h.in                                        |     9 +
 config.sub                                         |   227 +-
 configure                                          | 16036 +++++++++----------
 configure.ac                                       |    30 +-
 depcomp                                            |   190 +-
 gtest.mk                                           |    13 +-
 install-sh                                         |    29 +-
 jellyfish-1.1.pc.in                                |     2 +-
 jellyfish/allocators_malloc.hpp                    |     2 +-
 jellyfish/allocators_mmap.hpp                      |     2 +-
 jellyfish/allocators_shm.hpp                       |     2 +-
 jellyfish/capped_integer.hpp                       |     6 +-
 jellyfish/circular_buffer.hpp                      |     2 +-
 jellyfish/cite.cc                                  |     3 +-
 jellyfish/compacted_hash.hpp                       |    88 +-
 jellyfish/concurrent_queues.hpp                    |   203 +-
 jellyfish/count_main_cmdline.hpp                   |   363 +-
 jellyfish/dbg.cc                                   |     7 +
 jellyfish/dbg.hpp                                  |     2 +-
 jellyfish/direct_indexing_array.hpp                |     6 +-
 jellyfish/direct_sorted_dumper.hpp                 |    22 +-
 jellyfish/divisor.hpp                              |   144 +-
 jellyfish/dna_codes.hpp                            |    20 +-
 jellyfish/double_fifo_input.hpp                    |     2 +-
 jellyfish/dump_main.cc                             |    53 +-
 jellyfish/dumper.hpp                               |    25 +-
 jellyfish/err.hpp                                  |    41 +-
 jellyfish/fastq_dumper.hpp                         |     2 +-
 jellyfish/file_parser.cc                           |     4 +-
 jellyfish/floats.hpp                               |    13 +-
 jellyfish/generate_sequence.cc                     |     2 +-
 jellyfish/half.h                                   |     2 +-
 jellyfish/hash.hpp                                 |    13 +-
 jellyfish/hash_fastq_merge.cc                      |     2 +-
 jellyfish/hash_merge.cc                            |     2 +-
 jellyfish/heap.hpp                                 |     4 +-
 jellyfish/invertible_hash_array.hpp                |   167 +-
 jellyfish/locking_hash_counters.hpp                |     4 +-
 jellyfish/locks_pthread.hpp                        |     6 +-
 jellyfish/mapped_file.hpp                          |     6 +-
 jellyfish/mer_counter.cc                           |    58 +-
 jellyfish/misc.cc                                  |    13 +
 jellyfish/misc.hpp                                 |     2 +
 jellyfish/offsets_key_value.hpp                    |    68 +-
 jellyfish/parse_dna.hpp                            |     2 +-
 jellyfish/parse_qual_dna.hpp                       |     4 +-
 jellyfish/parse_read.hpp                           |     8 +-
 jellyfish/randomc.h                                |     4 +-
 jellyfish/raw_dumper.hpp                           |    26 +-
 jellyfish/simple_circular_buffer.hpp               |   134 +
 jellyfish/simple_growing_array.hpp                 |     2 +-
 jellyfish/sorted_dumper.hpp                        |    43 +-
 jellyfish/square_binary_matrix.cc                  |    18 +-
 jellyfish/square_binary_matrix.hpp                 |    15 +-
 jellyfish/test_double_fifo_input.cc                |     2 +-
 jellyfish/time.hpp                                 |     6 +-
 jellyfish/yaggo.hpp                                |     4 +-
 ltmain.sh                                          |  4017 +++--
 m4/gnulib-cache.m4                                 |    35 -
 m4/libtool.m4                                      |  2248 ++-
 m4/ltoptions.m4                                    |    32 +-
 m4/ltversion.m4                                    |    12 +-
 m4/lt~obsolete.m4                                  |    12 +-
 missing                                            |    53 +-
 tests/compat.sh.in                                 |     2 +-
 tests/parallel_direct_indexing.sh                  |    23 +-
 tests/parallel_fastq_direct_indexing.sh            |    28 +
 tests/parallel_fastq_hashing.sh                    |    16 +-
 tests/parallel_hashing.sh                          |    37 +-
 .../gtest/include/gtest/internal/gtest-internal.h  |    10 +
 .../gtest/include/gtest/internal/gtest-port.h      |    10 +
 .../gtest/include/gtest/internal/gtest-string.h    |    10 +
 unit_tests/gtest/src/gtest-port.cc                 |     6 +
 unit_tests/test_offsets_key_value.cc               |   288 +-
 unit_tests/test_simple_circular_buffer.cc          |    71 +
 unit_tests/test_square_binary_matrix.cc            |   133 +
 unit_tests/unit_tests.sh                           |     2 +-
 81 files changed, 14813 insertions(+), 12355 deletions(-)
diff --git a/Makefile.am b/Makefile.am
index 315a092..e25a30b 100644
--- a/Makefile.am
+++ b/Makefile.am
@@ -1,45 +1,41 @@
 ACLOCAL_AMFLAGS = -I m4
-EXTRA_DIST = m4/gnulib-cache.m4 doc/jellyfish.pdf doc/jellyfish.man README LICENSE HalfLICENSE
+EXTRA_DIST = doc/jellyfish.pdf doc/jellyfish.man README LICENSE HalfLICENSE
 man1_MANS = doc/jellyfish.man
 
 pkgconfigdir = $(libdir)/pkgconfig
 pkgconfig_DATA = jellyfish-1.1.pc
 
 AM_LDFLAGS = -lpthread
-AM_CPPFLAGS = -Wall -Werror -Wnon-virtual-dtor -I$(top_srcdir)
+AM_CPPFLAGS = -Wall -Wnon-virtual-dtor -I$(top_srcdir)
 AM_CXXFLAGS = -g -O3
+LDADD = libjellyfish-1.1.la
 
 # What to build
+lib_LTLIBRARIES = libjellyfish-1.1.la
+
 bin_PROGRAMS = bin/jellyfish
-lib_LTLIBRARIES = libjellyfish.la
 check_PROGRAMS = bin/generate_sequence bin/test_double_fifo_input	\
                  bin/test_read_parser
 
+
 ########################################
 # Build Jellyfish the exec
 ########################################
-bin_jellyfish_SOURCES = jellyfish/jellyfish.cc jellyfish/stats_main.cc	\
-                        jellyfish/hash_merge.cc jellyfish/storage.cc	\
-                        jellyfish/misc.cc jellyfish/err.cc		\
-                        jellyfish/mer_counter.cc			\
-                        jellyfish/histo_main.cc jellyfish/dump_main.cc	\
-                        jellyfish/time.cc jellyfish/thread_exec.cc	\
-                        jellyfish/query_main.cc				\
-                        jellyfish/square_binary_matrix.cc		\
-                        jellyfish/dump_fastq_main.cc			\
-                        jellyfish/histo_fastq_main.cc			\
-                        jellyfish/cite.cc jellyfish/parse_dna.cc	\
-                        jellyfish/file_parser.cc			\
-                        jellyfish/parse_quake.cc			\
-                        jellyfish/parse_qual_dna.cc			\
-                        jellyfish/sequence_parser.cc			\
-                        jellyfish/seq_qual_parser.cc			\
-                        jellyfish/half.cpp				\
-                        jellyfish/hash_fastq_merge.cc jellyfish/dbg.cc	\
-                        jellyfish/mapped_file.cc			\
-                        jellyfish/backtrace.cc jellyfish/floats.cc	\
-                        jellyfish/allocators_mmap.cc			\
-                        jellyfish/yaggo.cpp jellyfish/dna_codes.cc
+bin_jellyfish_SOURCES = jellyfish/jellyfish.cc			\
+                        jellyfish/stats_main.cc			\
+                        jellyfish/hash_merge.cc			\
+                        jellyfish/mer_counter.cc		\
+                        jellyfish/histo_main.cc			\
+                        jellyfish/dump_main.cc			\
+                        jellyfish/query_main.cc			\
+                        jellyfish/dump_fastq_main.cc		\
+                        jellyfish/histo_fastq_main.cc		\
+                        jellyfish/cite.cc			\
+                        jellyfish/hash_fastq_merge.cc		\
+                        jellyfish/yaggo.cpp
+# bin_jellyfish_LDADD = libjellyfish-1.1.la
+
+bin_jellyfish_LDFLAGS = $(AM_LDFLAGS) $(STATIC_FLAGS)
 
 EXTRA_DIST += jellyfish/cite_cmdline.hpp jellyfish/query_cmdline.hpp	\
               jellyfish/hash_merge_cmdline.hpp				\
@@ -54,28 +50,29 @@ EXTRA_DIST += jellyfish/cite_cmdline.hpp jellyfish/query_cmdline.hpp	\
               jellyfish/simple_growing_array.hpp			\
               jellyfish/backtrace.hpp jellyfish/noop_dumper.hpp		\
               jellyfish/yaggo.hpp jellyfish/fstream_default.hpp
+
 ########################################
 # Build Jellyfish the shared library
 ########################################
-libjellyfish_la_LDFLAGS = -version-info 2:0:1
-libjellyfish_la_SOURCES = jellyfish/square_binary_matrix.cc		\
-                          jellyfish/err.cc jellyfish/misc.cc		\
-                          jellyfish/storage.cc				\
-                          jellyfish/thread_exec.cc jellyfish/time.cc	\
-                          jellyfish/file_parser.cc			\
-                          jellyfish/read_parser.cc			\
-                          jellyfish/parse_read.cc jellyfish/half.cpp	\
-                          jellyfish/mapped_file.cc			\
-                          jellyfish/parse_dna.cc			\
-                          jellyfish/parse_quake.cc			\
-                          jellyfish/parse_qual_dna.cc			\
-                          jellyfish/sequence_parser.cc			\
-                          jellyfish/seq_qual_parser.cc			\
-                          jellyfish/backtrace.cc jellyfish/floats.cc	\
-                          jellyfish/dbg.cc				\
-                          jellyfish/allocators_mmap.cc			\
-                          jellyfish/dna_codes.cc
-libjellyfish_la_CPPFLAGS = $(AM_CPPFLAGS)
+libjellyfish_srcs = jellyfish/square_binary_matrix.cc		\
+                       jellyfish/err.cc jellyfish/misc.cc		\
+                       jellyfish/storage.cc jellyfish/thread_exec.cc	\
+                       jellyfish/time.cc jellyfish/file_parser.cc	\
+                       jellyfish/read_parser.cc				\
+                       jellyfish/parse_read.cc jellyfish/half.cpp	\
+                       jellyfish/mapped_file.cc				\
+                       jellyfish/parse_dna.cc				\
+                       jellyfish/parse_quake.cc				\
+                       jellyfish/parse_qual_dna.cc			\
+                       jellyfish/sequence_parser.cc			\
+                       jellyfish/seq_qual_parser.cc			\
+                       jellyfish/backtrace.cc jellyfish/floats.cc	\
+                       jellyfish/dbg.cc jellyfish/allocators_mmap.cc	\
+                       jellyfish/dna_codes.cc
+
+libjellyfish_1_1_la_SOURCES = $(libjellyfish_srcs)
+libjellyfish_1_1_la_LDFLAGS = -version-info 1:1:0
+
 library_includedir=$(includedir)/jellyfish- at PACKAGE_VERSION@/jellyfish
 library_include_HEADERS = jellyfish/allocators_malloc.hpp		\
                           jellyfish/allocators_mmap.hpp			\
@@ -93,15 +90,15 @@ library_include_HEADERS = jellyfish/allocators_malloc.hpp		\
                           jellyfish/locking_hash_counters.hpp		\
                           jellyfish/locks_pthread.hpp			\
                           jellyfish/mapped_file.hpp			\
-                          jellyfish/mer_counting.hpp jellyfish/err.hpp	\
-                          jellyfish/misc.hpp				\
+                          jellyfish/mer_counting.hpp			\
+                          jellyfish/err.hpp jellyfish/misc.hpp		\
                           jellyfish/offsets_key_value.hpp		\
                           jellyfish/reversible_hash_function.hpp	\
                           jellyfish/sorted_dumper.hpp			\
                           jellyfish/square_binary_matrix.hpp		\
                           jellyfish/storage.hpp				\
-                          jellyfish/thread_exec.hpp jellyfish/time.hpp	\
-                          jellyfish/token_ring.hpp			\
+                          jellyfish/thread_exec.hpp			\
+                          jellyfish/time.hpp jellyfish/token_ring.hpp	\
                           jellyfish/raw_dumper.hpp			\
                           jellyfish/capped_integer.hpp			\
                           jellyfish/aligned_values_array.hpp		\
@@ -122,35 +119,17 @@ library_include_HEADERS = jellyfish/allocators_malloc.hpp		\
                           jellyfish/toFloat.h jellyfish/eLut.h		\
                           jellyfish/dbg.hpp jellyfish/half.h		\
                           jellyfish/backtrace.hpp			\
-                          jellyfish/dna_codes.hpp
+                          jellyfish/dna_codes.hpp			\
+                          jellyfish/simple_circular_buffer.hpp
 
 
 ########################################
 # Build tests
 ########################################
 bin_generate_sequence_SOURCES = jellyfish/generate_sequence.cc		\
-                                jellyfish/misc.cc			\
-                                jellyfish/mersenne.cpp			\
-                                jellyfish/square_binary_matrix.cc	\
-                                jellyfish/backtrace.cc			\
-                                jellyfish/dbg.cc jellyfish/time.cc
-bin_test_double_fifo_input_SOURCES =						\
-                                     jellyfish/test_double_fifo_input.cc	\
-                                     jellyfish/parse_dna.cc			\
-                                     jellyfish/file_parser.cc			\
-                                     jellyfish/sequence_parser.cc		\
-                                     jellyfish/backtrace.cc			\
-                                     jellyfish/thread_exec.cc			\
-                                     jellyfish/dbg.cc				\
-                                     jellyfish/time.cc				\
-                                     jellyfish/allocators_mmap.cc		\
-                                     jellyfish/dna_codes.cc
-bin_test_read_parser_SOURCES = jellyfish/test_read_parser.cc		\
-                               jellyfish/file_parser.cc			\
-                               jellyfish/read_parser.cc			\
-                               jellyfish/parse_read.cc			\
-                               jellyfish/dbg.cc jellyfish/backtrace.cc	\
-                               jellyfish/time.cc
+                                jellyfish/mersenne.cpp
+bin_test_double_fifo_input_SOURCES = jellyfish/test_double_fifo_input.cc
+bin_test_read_parser_SOURCES = jellyfish/test_read_parser.cc
 EXTRA_DIST += jellyfish/randomc.h jellyfish/generate_sequence_cmdline.hpp
 
 ########################################
@@ -168,18 +147,20 @@ TESTS = tests/generate_sequence.sh tests/serial_hashing.sh		\
         tests/multi_file_fastq.sh tests/from_stream.sh			\
         tests/parallel_fastq_sequence_hashing.sh			\
         tests/from_stream_fastq.sh tests/merge.sh tests/min_qual.sh	\
-        tests/big.sh tests/parsers.sh tests/small.sh
+        tests/big.sh tests/parsers.sh tests/small.sh			\
+        tests/parallel_fastq_direct_indexing.sh
 
 EXTRA_DIST += $(TESTS)
 clean-local: clean-local-check
 .PHONY: clean-local-check
 clean-local-check:
-	-cd tests; rm -f seq10m* seq1m* *_0 *_1 *_2 *.md5sum *.histo *.stats *.timing *.query *.dump *.fa
+	-cd tests; rm -f seq10m* seq1m* *_0 *_1 *_2 *_S *.md5sum *.histo *.stats *.timing *.query *.dump *.fa
 
 tests/serial_hashing.log: tests/generate_sequence.log
 tests/parallel_hashing.log: tests/generate_sequence.log
 tests/serial_direct_indexing.log: tests/generate_sequence.log
 tests/parallel_direct_indexing.log: tests/generate_sequence.log
+tests/parallel_fastq_direct_indexing.log: tests/generate_fastq_sequence.log
 tests/multi_file.log: tests/generate_sequence.log
 tests/raw_hash.log: tests/generate_sequence.log
 tests/from_stream.log: tests/generate_sequence.log
@@ -195,10 +176,19 @@ tests/parsers.log: tests/generate_sequence.log
 # Unit tests
 ########################################
 TESTS += unit_tests/unit_tests.sh
-check_PROGRAMS += bin/test_offsets_key_value
+check_PROGRAMS += bin/test_all
 
-bin_test_offsets_key_value_SOURCES = unit_tests/test_offsets_key_value.cc
-bin_test_offsets_key_value_CXXFLAGS = -I$(top_srcdir)/unit_tests/gtest/include -I$(top_srcdir)/unit_tests/gtest
-bin_test_offsets_key_value_LDADD = libgtest_main.la
+bin_test_all_SOURCES = unit_tests/test_offsets_key_value.cc		\
+                       unit_tests/test_simple_circular_buffer.cc	\
+                       unit_tests/test_square_binary_matrix.cc
+bin_test_all_CXXFLAGS = -I$(top_srcdir)/unit_tests/gtest/include -I$(top_srcdir)/unit_tests/gtest
+bin_test_all_LDADD = libgtest_main.a libgtest.a $(LDADD)
 
 include gtest.mk
+-include $(top_srcdir)/development.mk
+
+########
+# info #
+########
+print-%:
+	@echo -n $($*)
diff --git a/Makefile.in b/Makefile.in
index 11e03b1..455ac70 100644
--- a/Makefile.in
+++ b/Makefile.in
@@ -1,9 +1,9 @@
-# Makefile.in generated by automake 1.11 from Makefile.am.
+# Makefile.in generated by automake 1.11.6 from Makefile.am.
 # @configure_input@
 
 # Copyright (C) 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002,
-# 2003, 2004, 2005, 2006, 2007, 2008, 2009  Free Software Foundation,
-# Inc.
+# 2003, 2004, 2005, 2006, 2007, 2008, 2009, 2010, 2011 Free Software
+# Foundation, Inc.
 # This Makefile.in is free software; the Free Software Foundation
 # gives unlimited permission to copy and/or distribute it,
 # with or without modifications, as long as this notice is preserved.
@@ -19,6 +19,23 @@
 
 
 VPATH = @srcdir@
+am__make_dryrun = \
+  { \
+    am__dry=no; \
+    case $$MAKEFLAGS in \
+      *\\[\ \	]*) \
+        echo 'am--echo: ; @echo "AM"  OK' | $(MAKE) -f - 2>/dev/null \
+          | grep '^AM OK$$' >/dev/null || am__dry=yes;; \
+      *) \
+        for am__flg in $$MAKEFLAGS; do \
+          case $$am__flg in \
+            *=*|--*) ;; \
+            *n*) am__dry=yes; break;; \
+          esac; \
+        done;; \
+    esac; \
+    test $$am__dry = yes; \
+  }
 pkgdatadir = $(datadir)/@PACKAGE@
 pkgincludedir = $(includedir)/@PACKAGE@
 pkglibdir = $(libdir)/@PACKAGE@
@@ -40,8 +57,7 @@ host_triplet = @host@
 bin_PROGRAMS = bin/jellyfish$(EXEEXT)
 check_PROGRAMS = bin/generate_sequence$(EXEEXT) \
 	bin/test_double_fifo_input$(EXEEXT) \
-	bin/test_read_parser$(EXEEXT) \
-	bin/test_offsets_key_value$(EXEEXT)
+	bin/test_read_parser$(EXEEXT) bin/test_all$(EXEEXT)
 DIST_COMMON = README $(am__configure_deps) $(library_include_HEADERS) \
 	$(noinst_HEADERS) $(srcdir)/Makefile.am $(srcdir)/Makefile.in \
 	$(srcdir)/config.h.in $(srcdir)/gtest.mk \
@@ -62,6 +78,24 @@ mkinstalldirs = $(install_sh) -d
 CONFIG_HEADER = config.h
 CONFIG_CLEAN_FILES = tests/compat.sh jellyfish-1.1.pc
 CONFIG_CLEAN_VPATH_FILES =
+ARFLAGS = cru
+AM_V_AR = $(am__v_AR_ at AM_V@)
+am__v_AR_ = $(am__v_AR_ at AM_DEFAULT_V@)
+am__v_AR_0 = @echo "  AR    " $@;
+AM_V_at = $(am__v_at_ at AM_V@)
+am__v_at_ = $(am__v_at_ at AM_DEFAULT_V@)
+am__v_at_0 = @
+libgtest_a_AR = $(AR) $(ARFLAGS)
+libgtest_a_LIBADD =
+am__dirstamp = $(am__leading_dot)dirstamp
+am_libgtest_a_OBJECTS =  \
+	unit_tests/gtest/src/libgtest_a-gtest-all.$(OBJEXT)
+libgtest_a_OBJECTS = $(am_libgtest_a_OBJECTS)
+libgtest_main_a_AR = $(AR) $(ARFLAGS)
+libgtest_main_a_DEPENDENCIES = libgtest.a
+am_libgtest_main_a_OBJECTS =  \
+	unit_tests/gtest/src/libgtest_main_a-gtest_main.$(OBJEXT)
+libgtest_main_a_OBJECTS = $(am_libgtest_main_a_OBJECTS)
 am__vpath_adj_setup = srcdirstrip=`echo "$(srcdir)" | sed 's|.|.|g'`;
 am__vpath_adj = case $$p in \
     $(srcdir)/*) f=`echo "$$p" | sed "s|^$$srcdirstrip/||"`;; \
@@ -83,114 +117,77 @@ am__nobase_list = $(am__nobase_strip_setup); \
 am__base_list = \
   sed '$$!N;$$!N;$$!N;$$!N;$$!N;$$!N;$$!N;s/\n/ /g' | \
   sed '$$!N;$$!N;$$!N;$$!N;s/\n/ /g'
+am__uninstall_files_from_dir = { \
+  test -z "$$files" \
+    || { test ! -d "$$dir" && test ! -f "$$dir" && test ! -r "$$dir"; } \
+    || { echo " ( cd '$$dir' && rm -f" $$files ")"; \
+         $(am__cd) "$$dir" && rm -f $$files; }; \
+  }
 am__installdirs = "$(DESTDIR)$(libdir)" "$(DESTDIR)$(bindir)" \
 	"$(DESTDIR)$(man1dir)" "$(DESTDIR)$(pkgconfigdir)" \
 	"$(DESTDIR)$(library_includedir)"
 LTLIBRARIES = $(lib_LTLIBRARIES)
-libgtest_la_LIBADD =
-am__dirstamp = $(am__leading_dot)dirstamp
-am_libgtest_la_OBJECTS =  \
-	unit_tests/gtest/src/libgtest_la-gtest-all.lo
-libgtest_la_OBJECTS = $(am_libgtest_la_OBJECTS)
-AM_V_lt = $(am__v_lt_$(V))
-am__v_lt_ = $(am__v_lt_$(AM_DEFAULT_VERBOSITY))
+libjellyfish_1_1_la_LIBADD =
+am__objects_1 = jellyfish/square_binary_matrix.lo jellyfish/err.lo \
+	jellyfish/misc.lo jellyfish/storage.lo \
+	jellyfish/thread_exec.lo jellyfish/time.lo \
+	jellyfish/file_parser.lo jellyfish/read_parser.lo \
+	jellyfish/parse_read.lo jellyfish/half.lo \
+	jellyfish/mapped_file.lo jellyfish/parse_dna.lo \
+	jellyfish/parse_quake.lo jellyfish/parse_qual_dna.lo \
+	jellyfish/sequence_parser.lo jellyfish/seq_qual_parser.lo \
+	jellyfish/backtrace.lo jellyfish/floats.lo jellyfish/dbg.lo \
+	jellyfish/allocators_mmap.lo jellyfish/dna_codes.lo
+am_libjellyfish_1_1_la_OBJECTS = $(am__objects_1)
+libjellyfish_1_1_la_OBJECTS = $(am_libjellyfish_1_1_la_OBJECTS)
+AM_V_lt = $(am__v_lt_ at AM_V@)
+am__v_lt_ = $(am__v_lt_ at AM_DEFAULT_V@)
 am__v_lt_0 = --silent
-libgtest_la_LINK = $(LIBTOOL) $(AM_V_lt) --tag=CXX $(AM_LIBTOOLFLAGS) \
-	$(LIBTOOLFLAGS) --mode=link $(CXXLD) $(libgtest_la_CXXFLAGS) \
-	$(CXXFLAGS) $(AM_LDFLAGS) $(LDFLAGS) -o $@
-libgtest_main_la_DEPENDENCIES = libgtest.la
-am_libgtest_main_la_OBJECTS =  \
-	unit_tests/gtest/src/libgtest_main_la-gtest_main.lo
-libgtest_main_la_OBJECTS = $(am_libgtest_main_la_OBJECTS)
-libgtest_main_la_LINK = $(LIBTOOL) $(AM_V_lt) --tag=CXX \
-	$(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=link $(CXXLD) \
-	$(libgtest_main_la_CXXFLAGS) $(CXXFLAGS) $(AM_LDFLAGS) \
-	$(LDFLAGS) -o $@
-libjellyfish_la_LIBADD =
-am_libjellyfish_la_OBJECTS =  \
-	jellyfish/libjellyfish_la-square_binary_matrix.lo \
-	jellyfish/libjellyfish_la-err.lo \
-	jellyfish/libjellyfish_la-misc.lo \
-	jellyfish/libjellyfish_la-storage.lo \
-	jellyfish/libjellyfish_la-thread_exec.lo \
-	jellyfish/libjellyfish_la-time.lo \
-	jellyfish/libjellyfish_la-file_parser.lo \
-	jellyfish/libjellyfish_la-read_parser.lo \
-	jellyfish/libjellyfish_la-parse_read.lo \
-	jellyfish/libjellyfish_la-half.lo \
-	jellyfish/libjellyfish_la-mapped_file.lo \
-	jellyfish/libjellyfish_la-parse_dna.lo \
-	jellyfish/libjellyfish_la-parse_quake.lo \
-	jellyfish/libjellyfish_la-parse_qual_dna.lo \
-	jellyfish/libjellyfish_la-sequence_parser.lo \
-	jellyfish/libjellyfish_la-seq_qual_parser.lo \
-	jellyfish/libjellyfish_la-backtrace.lo \
-	jellyfish/libjellyfish_la-floats.lo \
-	jellyfish/libjellyfish_la-dbg.lo \
-	jellyfish/libjellyfish_la-allocators_mmap.lo \
-	jellyfish/libjellyfish_la-dna_codes.lo
-libjellyfish_la_OBJECTS = $(am_libjellyfish_la_OBJECTS)
-libjellyfish_la_LINK = $(LIBTOOL) $(AM_V_lt) --tag=CXX \
+libjellyfish_1_1_la_LINK = $(LIBTOOL) $(AM_V_lt) --tag=CXX \
 	$(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=link $(CXXLD) \
-	$(AM_CXXFLAGS) $(CXXFLAGS) $(libjellyfish_la_LDFLAGS) \
+	$(AM_CXXFLAGS) $(CXXFLAGS) $(libjellyfish_1_1_la_LDFLAGS) \
 	$(LDFLAGS) -o $@
 PROGRAMS = $(bin_PROGRAMS)
 am_bin_generate_sequence_OBJECTS =  \
-	jellyfish/generate_sequence.$(OBJEXT) jellyfish/misc.$(OBJEXT) \
-	jellyfish/mersenne.$(OBJEXT) \
-	jellyfish/square_binary_matrix.$(OBJEXT) \
-	jellyfish/backtrace.$(OBJEXT) jellyfish/dbg.$(OBJEXT) \
-	jellyfish/time.$(OBJEXT)
+	jellyfish/generate_sequence.$(OBJEXT) \
+	jellyfish/mersenne.$(OBJEXT)
 bin_generate_sequence_OBJECTS = $(am_bin_generate_sequence_OBJECTS)
 bin_generate_sequence_LDADD = $(LDADD)
+bin_generate_sequence_DEPENDENCIES = libjellyfish-1.1.la
 am_bin_jellyfish_OBJECTS = jellyfish/jellyfish.$(OBJEXT) \
 	jellyfish/stats_main.$(OBJEXT) jellyfish/hash_merge.$(OBJEXT) \
-	jellyfish/storage.$(OBJEXT) jellyfish/misc.$(OBJEXT) \
-	jellyfish/err.$(OBJEXT) jellyfish/mer_counter.$(OBJEXT) \
-	jellyfish/histo_main.$(OBJEXT) jellyfish/dump_main.$(OBJEXT) \
-	jellyfish/time.$(OBJEXT) jellyfish/thread_exec.$(OBJEXT) \
-	jellyfish/query_main.$(OBJEXT) \
-	jellyfish/square_binary_matrix.$(OBJEXT) \
+	jellyfish/mer_counter.$(OBJEXT) jellyfish/histo_main.$(OBJEXT) \
+	jellyfish/dump_main.$(OBJEXT) jellyfish/query_main.$(OBJEXT) \
 	jellyfish/dump_fastq_main.$(OBJEXT) \
 	jellyfish/histo_fastq_main.$(OBJEXT) jellyfish/cite.$(OBJEXT) \
-	jellyfish/parse_dna.$(OBJEXT) jellyfish/file_parser.$(OBJEXT) \
-	jellyfish/parse_quake.$(OBJEXT) \
-	jellyfish/parse_qual_dna.$(OBJEXT) \
-	jellyfish/sequence_parser.$(OBJEXT) \
-	jellyfish/seq_qual_parser.$(OBJEXT) jellyfish/half.$(OBJEXT) \
-	jellyfish/hash_fastq_merge.$(OBJEXT) jellyfish/dbg.$(OBJEXT) \
-	jellyfish/mapped_file.$(OBJEXT) jellyfish/backtrace.$(OBJEXT) \
-	jellyfish/floats.$(OBJEXT) jellyfish/allocators_mmap.$(OBJEXT) \
-	jellyfish/yaggo.$(OBJEXT) jellyfish/dna_codes.$(OBJEXT)
+	jellyfish/hash_fastq_merge.$(OBJEXT) jellyfish/yaggo.$(OBJEXT)
 bin_jellyfish_OBJECTS = $(am_bin_jellyfish_OBJECTS)
 bin_jellyfish_LDADD = $(LDADD)
+bin_jellyfish_DEPENDENCIES = libjellyfish-1.1.la
+bin_jellyfish_LINK = $(LIBTOOL) $(AM_V_lt) --tag=CXX \
+	$(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=link $(CXXLD) \
+	$(AM_CXXFLAGS) $(CXXFLAGS) $(bin_jellyfish_LDFLAGS) $(LDFLAGS) \
+	-o $@
+am_bin_test_all_OBJECTS =  \
+	unit_tests/bin_test_all-test_offsets_key_value.$(OBJEXT) \
+	unit_tests/bin_test_all-test_simple_circular_buffer.$(OBJEXT) \
+	unit_tests/bin_test_all-test_square_binary_matrix.$(OBJEXT)
+bin_test_all_OBJECTS = $(am_bin_test_all_OBJECTS)
+bin_test_all_DEPENDENCIES = libgtest_main.a libgtest.a $(LDADD)
+bin_test_all_LINK = $(LIBTOOL) $(AM_V_lt) --tag=CXX $(AM_LIBTOOLFLAGS) \
+	$(LIBTOOLFLAGS) --mode=link $(CXXLD) $(bin_test_all_CXXFLAGS) \
+	$(CXXFLAGS) $(AM_LDFLAGS) $(LDFLAGS) -o $@
 am_bin_test_double_fifo_input_OBJECTS =  \
-	jellyfish/test_double_fifo_input.$(OBJEXT) \
-	jellyfish/parse_dna.$(OBJEXT) jellyfish/file_parser.$(OBJEXT) \
-	jellyfish/sequence_parser.$(OBJEXT) \
-	jellyfish/backtrace.$(OBJEXT) jellyfish/thread_exec.$(OBJEXT) \
-	jellyfish/dbg.$(OBJEXT) jellyfish/time.$(OBJEXT) \
-	jellyfish/allocators_mmap.$(OBJEXT) \
-	jellyfish/dna_codes.$(OBJEXT)
+	jellyfish/test_double_fifo_input.$(OBJEXT)
 bin_test_double_fifo_input_OBJECTS =  \
 	$(am_bin_test_double_fifo_input_OBJECTS)
 bin_test_double_fifo_input_LDADD = $(LDADD)
-am_bin_test_offsets_key_value_OBJECTS = unit_tests/bin_test_offsets_key_value-test_offsets_key_value.$(OBJEXT)
-bin_test_offsets_key_value_OBJECTS =  \
-	$(am_bin_test_offsets_key_value_OBJECTS)
-bin_test_offsets_key_value_DEPENDENCIES = libgtest_main.la
-bin_test_offsets_key_value_LINK = $(LIBTOOL) $(AM_V_lt) --tag=CXX \
-	$(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=link $(CXXLD) \
-	$(bin_test_offsets_key_value_CXXFLAGS) $(CXXFLAGS) \
-	$(AM_LDFLAGS) $(LDFLAGS) -o $@
+bin_test_double_fifo_input_DEPENDENCIES = libjellyfish-1.1.la
 am_bin_test_read_parser_OBJECTS =  \
-	jellyfish/test_read_parser.$(OBJEXT) \
-	jellyfish/file_parser.$(OBJEXT) \
-	jellyfish/read_parser.$(OBJEXT) jellyfish/parse_read.$(OBJEXT) \
-	jellyfish/dbg.$(OBJEXT) jellyfish/backtrace.$(OBJEXT) \
-	jellyfish/time.$(OBJEXT)
+	jellyfish/test_read_parser.$(OBJEXT)
 bin_test_read_parser_OBJECTS = $(am_bin_test_read_parser_OBJECTS)
 bin_test_read_parser_LDADD = $(LDADD)
+bin_test_read_parser_DEPENDENCIES = libjellyfish-1.1.la
 DEFAULT_INCLUDES = -I. at am__isrc@
 depcomp = $(SHELL) $(top_srcdir)/depcomp
 am__depfiles_maybe = depfiles
@@ -201,32 +198,34 @@ LTCXXCOMPILE = $(LIBTOOL) $(AM_V_lt) --tag=CXX $(AM_LIBTOOLFLAGS) \
 	$(LIBTOOLFLAGS) --mode=compile $(CXX) $(DEFS) \
 	$(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) $(CPPFLAGS) \
 	$(AM_CXXFLAGS) $(CXXFLAGS)
-AM_V_CXX = $(am__v_CXX_$(V))
-am__v_CXX_ = $(am__v_CXX_$(AM_DEFAULT_VERBOSITY))
+AM_V_CXX = $(am__v_CXX_ at AM_V@)
+am__v_CXX_ = $(am__v_CXX_ at AM_DEFAULT_V@)
 am__v_CXX_0 = @echo "  CXX   " $@;
-AM_V_at = $(am__v_at_$(V))
-am__v_at_ = $(am__v_at_$(AM_DEFAULT_VERBOSITY))
-am__v_at_0 = @
 CXXLD = $(CXX)
 CXXLINK = $(LIBTOOL) $(AM_V_lt) --tag=CXX $(AM_LIBTOOLFLAGS) \
 	$(LIBTOOLFLAGS) --mode=link $(CXXLD) $(AM_CXXFLAGS) \
 	$(CXXFLAGS) $(AM_LDFLAGS) $(LDFLAGS) -o $@
-AM_V_CXXLD = $(am__v_CXXLD_$(V))
-am__v_CXXLD_ = $(am__v_CXXLD_$(AM_DEFAULT_VERBOSITY))
+AM_V_CXXLD = $(am__v_CXXLD_ at AM_V@)
+am__v_CXXLD_ = $(am__v_CXXLD_ at AM_DEFAULT_V@)
 am__v_CXXLD_0 = @echo "  CXXLD " $@;
-AM_V_GEN = $(am__v_GEN_$(V))
-am__v_GEN_ = $(am__v_GEN_$(AM_DEFAULT_VERBOSITY))
+AM_V_GEN = $(am__v_GEN_ at AM_V@)
+am__v_GEN_ = $(am__v_GEN_ at AM_DEFAULT_V@)
 am__v_GEN_0 = @echo "  GEN   " $@;
-SOURCES = $(libgtest_la_SOURCES) $(libgtest_main_la_SOURCES) \
-	$(libjellyfish_la_SOURCES) $(bin_generate_sequence_SOURCES) \
-	$(bin_jellyfish_SOURCES) $(bin_test_double_fifo_input_SOURCES) \
-	$(bin_test_offsets_key_value_SOURCES) \
+SOURCES = $(libgtest_a_SOURCES) $(libgtest_main_a_SOURCES) \
+	$(libjellyfish_1_1_la_SOURCES) \
+	$(bin_generate_sequence_SOURCES) $(bin_jellyfish_SOURCES) \
+	$(bin_test_all_SOURCES) $(bin_test_double_fifo_input_SOURCES) \
 	$(bin_test_read_parser_SOURCES)
-DIST_SOURCES = $(libgtest_la_SOURCES) $(libgtest_main_la_SOURCES) \
-	$(libjellyfish_la_SOURCES) $(bin_generate_sequence_SOURCES) \
-	$(bin_jellyfish_SOURCES) $(bin_test_double_fifo_input_SOURCES) \
-	$(bin_test_offsets_key_value_SOURCES) \
+DIST_SOURCES = $(libgtest_a_SOURCES) $(libgtest_main_a_SOURCES) \
+	$(libjellyfish_1_1_la_SOURCES) \
+	$(bin_generate_sequence_SOURCES) $(bin_jellyfish_SOURCES) \
+	$(bin_test_all_SOURCES) $(bin_test_double_fifo_input_SOURCES) \
 	$(bin_test_read_parser_SOURCES)
+am__can_run_installinfo = \
+  case $$AM_UPDATE_INFO_DIR in \
+    n|no|NO) false;; \
+    *) (install-info --version) >/dev/null 2>&1;; \
+  esac
 man1dir = $(mandir)/man1
 NROFF = nroff
 MANS = $(man1_MANS)
@@ -253,18 +252,24 @@ test "X$(AM_COLOR_TESTS)" != Xno \
 am__rst_title = sed 's/.*/   &   /;h;s/./=/g;p;x;p;g;p;s/.*//'
 am__rst_section = sed 'p;s/./=/g;p;g'
 # Put stdin (possibly several lines separated by ".  ") in a box.
-am__text_box = $(AWK) '{				\
-  n = split($$0, lines, "\\.  "); max = 0;		\
-  for (i = 1; i <= n; ++i)				\
-    if (max < length(lines[i]))				\
-      max = length(lines[i]);				\
-  for (i = 0; i < max; ++i) line = line "=";		\
-  print line;						\
-  for (i = 1; i <= n; ++i) if (lines[i]) print lines[i];\
-  print line;						\
+# Prefix each line by 'col' and terminate each with 'std', for coloring.
+# Multi line coloring is problematic with "less -R", so we really need
+# to color each line individually.
+am__text_box = $(AWK) '{			\
+  n = split($$0, lines, "\\.  "); max = 0;	\
+  for (i = 1; i <= n; ++i)			\
+    if (max < length(lines[i]))			\
+      max = length(lines[i]);			\
+  for (i = 0; i < max; ++i)			\
+    line = line "=";				\
+  print col line std;				\
+  for (i = 1; i <= n; ++i)			\
+    if (lines[i])				\
+      print col lines[i] std;			\
+  print col line std;				\
 }'
 # Solaris 10 'make', and several other traditional 'make' implementations,
-# pass "-e" to $(SHELL).  This contradicts POSIX.  Work around the problem
+# pass "-e" to $(SHELL), and POSIX 2008 even requires this.  Work around it
 # by disabling -e (using the XSI extension "set +e") if it's set.
 am__sh_e_setup = case $$- in *e*) set +e;; esac
 # To be inserted before the command running the test.  Creates the
@@ -277,8 +282,9 @@ $(am__sh_e_setup);					\
 $(am__vpath_adj_setup) $(am__vpath_adj)			\
 srcdir=$(srcdir); export srcdir;			\
 rm -f $@-t;						\
-trap 'st=$$?; rm -f '\''$(abs_builddir)/$@-t'\''; (exit $$st); exit $$st' \
-  1 2 13 15;						\
+am__trap='rm -f '\''$(abs_builddir)/$@-t'\''; (exit $$st); exit $$st'; \
+trap "st=129; $$am__trap" 1; trap "st=130; $$am__trap" 2;	\
+trap "st=141; $$am__trap" 13; trap "st=143; $$am__trap" 15; \
 am__odir=`echo "./$@" | sed 's|/[^/]*$$||'`;		\
 test "x$$am__odir" = x. || $(MKDIR_P) "$$am__odir" || exit $$?;	\
 if test -f "./$$f"; then dir=./;			\
@@ -286,10 +292,39 @@ elif test -f "$$f"; then dir=;				\
 else dir="$(srcdir)/"; fi;				\
 tst=$$dir$$f; log='$@'; __SAVED_TERM=$$TERM;		\
 $(TESTS_ENVIRONMENT)
+# To be appended to the command running the test.  Handle the stdout
+# and stderr redirection, and catch the exit status.
+am__check_post = \
+>$@-t 2>&1;						\
+estatus=$$?;						\
+if test -n '$(DISABLE_HARD_ERRORS)'			\
+   && test $$estatus -eq 99; then			\
+  estatus=1;						\
+fi;							\
+TERM=$$__SAVED_TERM; export TERM;			\
+$(am__tty_colors);					\
+xfailed=PASS;						\
+case " $(XFAIL_TESTS) " in				\
+  *[\ \	]$$f[\ \	]* | *[\ \	]$$dir$$f[\ \	]*) \
+    xfailed=XFAIL;;					\
+esac;							\
+case $$estatus.$$xfailed in				\
+    0.XFAIL) col=$$red; res=XPASS;;			\
+    0.*)     col=$$grn; res=PASS ;;			\
+    77.*)    col=$$blu; res=SKIP ;;			\
+    99.*)    col=$$red; res=FAIL ;;			\
+    *.XFAIL) col=$$lgn; res=XFAIL;;			\
+    *.*)     col=$$red; res=FAIL ;;			\
+esac;							\
+echo "$${col}$$res$${std}: $$f";			\
+echo "$$res: $$f (exit: $$estatus)" |			\
+  $(am__rst_section) >$@;				\
+cat $@-t >>$@;						\
+rm -f $@-t
 RECHECK_LOGS = $(TEST_LOGS)
-AM_RECURSIVE_TARGETS = check check-html recheck recheck-html
-TEST_SUITE_LOG = test-suite.log
+AM_RECURSIVE_TARGETS = check recheck check-html recheck-html
 TEST_SUITE_HTML = $(TEST_SUITE_LOG:.log=.html)
+TEST_SUITE_LOG = test-suite.log
 am__test_logs1 = $(TESTS:=.log)
 am__test_logs2 = $(am__test_logs1:@EXEEXT at .log=.log)
 TEST_LOGS = $(am__test_logs2:.sh.log=.log)
@@ -299,12 +334,16 @@ DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)
 distdir = $(PACKAGE)-$(VERSION)
 top_distdir = $(distdir)
 am__remove_distdir = \
-  { test ! -d "$(distdir)" \
-    || { find "$(distdir)" -type d ! -perm -200 -exec chmod u+w {} ';' \
-         && rm -fr "$(distdir)"; }; }
+  if test -d "$(distdir)"; then \
+    find "$(distdir)" -type d ! -perm -200 -exec chmod u+w {} ';' \
+      && rm -rf "$(distdir)" \
+      || { sleep 5 && rm -rf "$(distdir)"; }; \
+  else :; fi
 DIST_ARCHIVES = $(distdir).tar.gz
 GZIP_ENV = --best
 distuninstallcheck_listfiles = find . -type f -print
+am__distuninstallcheck_listfiles = $(distuninstallcheck_listfiles) \
+  | sed 's|^\./|$(prefix)/|' | grep -v '$(infodir)/dir$$'
 distcleancheck_listfiles = find . -type f -print
 ACLOCAL = @ACLOCAL@
 AMTAR = @AMTAR@
@@ -326,6 +365,7 @@ CXXFLAGS = @CXXFLAGS@
 CYGPATH_W = @CYGPATH_W@
 DEFS = @DEFS@
 DEPDIR = @DEPDIR@
+DLLTOOL = @DLLTOOL@
 DSYMUTIL = @DSYMUTIL@
 DUMPBIN = @DUMPBIN@
 ECHO_C = @ECHO_C@
@@ -349,6 +389,7 @@ LIPO = @LIPO@
 LN_S = @LN_S@
 LTLIBOBJS = @LTLIBOBJS@
 MAKEINFO = @MAKEINFO@
+MANIFEST_TOOL = @MANIFEST_TOOL@
 MD5 = @MD5@
 MKDIR_P = @MKDIR_P@
 NM = @NM@
@@ -362,18 +403,21 @@ PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@
 PACKAGE_NAME = @PACKAGE_NAME@
 PACKAGE_STRING = @PACKAGE_STRING@
 PACKAGE_TARNAME = @PACKAGE_TARNAME@
+PACKAGE_URL = @PACKAGE_URL@
 PACKAGE_VERSION = @PACKAGE_VERSION@
 PATH_SEPARATOR = @PATH_SEPARATOR@
 RANLIB = @RANLIB@
 SED = @SED@
 SET_MAKE = @SET_MAKE@
 SHELL = @SHELL@
+STATIC_FLAGS = @STATIC_FLAGS@
 STRIP = @STRIP@
 VERSION = @VERSION@
 abs_builddir = @abs_builddir@
 abs_srcdir = @abs_srcdir@
 abs_top_builddir = @abs_top_builddir@
 abs_top_srcdir = @abs_top_srcdir@
+ac_ct_AR = @ac_ct_AR@
 ac_ct_CC = @ac_ct_CC@
 ac_ct_CXX = @ac_ct_CXX@
 ac_ct_DUMPBIN = @ac_ct_DUMPBIN@
@@ -407,7 +451,6 @@ libdir = @libdir@
 libexecdir = @libexecdir@
 localedir = @localedir@
 localstatedir = @localstatedir@
-lt_ECHO = @lt_ECHO@
 mandir = @mandir@
 mkdir_p = @mkdir_p@
 oldincludedir = @oldincludedir@
@@ -424,8 +467,8 @@ top_build_prefix = @top_build_prefix@
 top_builddir = @top_builddir@
 top_srcdir = @top_srcdir@
 ACLOCAL_AMFLAGS = -I m4
-EXTRA_DIST = m4/gnulib-cache.m4 doc/jellyfish.pdf doc/jellyfish.man \
-	README LICENSE HalfLICENSE jellyfish/cite_cmdline.hpp \
+EXTRA_DIST = doc/jellyfish.pdf doc/jellyfish.man README LICENSE \
+	HalfLICENSE jellyfish/cite_cmdline.hpp \
 	jellyfish/query_cmdline.hpp jellyfish/hash_merge_cmdline.hpp \
 	jellyfish/histo_main_cmdline.hpp \
 	jellyfish/stats_main_cmdline.hpp \
@@ -443,59 +486,53 @@ man1_MANS = doc/jellyfish.man
 pkgconfigdir = $(libdir)/pkgconfig
 pkgconfig_DATA = jellyfish-1.1.pc
 AM_LDFLAGS = -lpthread
-AM_CPPFLAGS = -Wall -Werror -Wnon-virtual-dtor -I$(top_srcdir)
+AM_CPPFLAGS = -Wall -Wnon-virtual-dtor -I$(top_srcdir)
 AM_CXXFLAGS = -g -O3
-lib_LTLIBRARIES = libjellyfish.la
+LDADD = libjellyfish-1.1.la
+
+# What to build
+lib_LTLIBRARIES = libjellyfish-1.1.la
 
 ########################################
 # Build Jellyfish the exec
 ########################################
-bin_jellyfish_SOURCES = jellyfish/jellyfish.cc jellyfish/stats_main.cc	\
-                        jellyfish/hash_merge.cc jellyfish/storage.cc	\
-                        jellyfish/misc.cc jellyfish/err.cc		\
-                        jellyfish/mer_counter.cc			\
-                        jellyfish/histo_main.cc jellyfish/dump_main.cc	\
-                        jellyfish/time.cc jellyfish/thread_exec.cc	\
-                        jellyfish/query_main.cc				\
-                        jellyfish/square_binary_matrix.cc		\
-                        jellyfish/dump_fastq_main.cc			\
-                        jellyfish/histo_fastq_main.cc			\
-                        jellyfish/cite.cc jellyfish/parse_dna.cc	\
-                        jellyfish/file_parser.cc			\
-                        jellyfish/parse_quake.cc			\
-                        jellyfish/parse_qual_dna.cc			\
-                        jellyfish/sequence_parser.cc			\
-                        jellyfish/seq_qual_parser.cc			\
-                        jellyfish/half.cpp				\
-                        jellyfish/hash_fastq_merge.cc jellyfish/dbg.cc	\
-                        jellyfish/mapped_file.cc			\
-                        jellyfish/backtrace.cc jellyfish/floats.cc	\
-                        jellyfish/allocators_mmap.cc			\
-                        jellyfish/yaggo.cpp jellyfish/dna_codes.cc
+bin_jellyfish_SOURCES = jellyfish/jellyfish.cc			\
+                        jellyfish/stats_main.cc			\
+                        jellyfish/hash_merge.cc			\
+                        jellyfish/mer_counter.cc		\
+                        jellyfish/histo_main.cc			\
+                        jellyfish/dump_main.cc			\
+                        jellyfish/query_main.cc			\
+                        jellyfish/dump_fastq_main.cc		\
+                        jellyfish/histo_fastq_main.cc		\
+                        jellyfish/cite.cc			\
+                        jellyfish/hash_fastq_merge.cc		\
+                        jellyfish/yaggo.cpp
+
+# bin_jellyfish_LDADD = libjellyfish-1.1.la
+bin_jellyfish_LDFLAGS = $(AM_LDFLAGS) $(STATIC_FLAGS)
 
 ########################################
 # Build Jellyfish the shared library
 ########################################
-libjellyfish_la_LDFLAGS = -version-info 2:0:1
-libjellyfish_la_SOURCES = jellyfish/square_binary_matrix.cc		\
-                          jellyfish/err.cc jellyfish/misc.cc		\
-                          jellyfish/storage.cc				\
-                          jellyfish/thread_exec.cc jellyfish/time.cc	\
-                          jellyfish/file_parser.cc			\
-                          jellyfish/read_parser.cc			\
-                          jellyfish/parse_read.cc jellyfish/half.cpp	\
-                          jellyfish/mapped_file.cc			\
-                          jellyfish/parse_dna.cc			\
-                          jellyfish/parse_quake.cc			\
-                          jellyfish/parse_qual_dna.cc			\
-                          jellyfish/sequence_parser.cc			\
-                          jellyfish/seq_qual_parser.cc			\
-                          jellyfish/backtrace.cc jellyfish/floats.cc	\
-                          jellyfish/dbg.cc				\
-                          jellyfish/allocators_mmap.cc			\
-                          jellyfish/dna_codes.cc
-
-libjellyfish_la_CPPFLAGS = $(AM_CPPFLAGS)
+libjellyfish_srcs = jellyfish/square_binary_matrix.cc		\
+                       jellyfish/err.cc jellyfish/misc.cc		\
+                       jellyfish/storage.cc jellyfish/thread_exec.cc	\
+                       jellyfish/time.cc jellyfish/file_parser.cc	\
+                       jellyfish/read_parser.cc				\
+                       jellyfish/parse_read.cc jellyfish/half.cpp	\
+                       jellyfish/mapped_file.cc				\
+                       jellyfish/parse_dna.cc				\
+                       jellyfish/parse_quake.cc				\
+                       jellyfish/parse_qual_dna.cc			\
+                       jellyfish/sequence_parser.cc			\
+                       jellyfish/seq_qual_parser.cc			\
+                       jellyfish/backtrace.cc jellyfish/floats.cc	\
+                       jellyfish/dbg.cc jellyfish/allocators_mmap.cc	\
+                       jellyfish/dna_codes.cc
+
+libjellyfish_1_1_la_SOURCES = $(libjellyfish_srcs)
+libjellyfish_1_1_la_LDFLAGS = -version-info 1:1:0
 library_includedir = $(includedir)/jellyfish- at PACKAGE_VERSION@/jellyfish
 library_include_HEADERS = jellyfish/allocators_malloc.hpp		\
                           jellyfish/allocators_mmap.hpp			\
@@ -513,15 +550,15 @@ library_include_HEADERS = jellyfish/allocators_malloc.hpp		\
                           jellyfish/locking_hash_counters.hpp		\
                           jellyfish/locks_pthread.hpp			\
                           jellyfish/mapped_file.hpp			\
-                          jellyfish/mer_counting.hpp jellyfish/err.hpp	\
-                          jellyfish/misc.hpp				\
+                          jellyfish/mer_counting.hpp			\
+                          jellyfish/err.hpp jellyfish/misc.hpp		\
                           jellyfish/offsets_key_value.hpp		\
                           jellyfish/reversible_hash_function.hpp	\
                           jellyfish/sorted_dumper.hpp			\
                           jellyfish/square_binary_matrix.hpp		\
                           jellyfish/storage.hpp				\
-                          jellyfish/thread_exec.hpp jellyfish/time.hpp	\
-                          jellyfish/token_ring.hpp			\
+                          jellyfish/thread_exec.hpp			\
+                          jellyfish/time.hpp jellyfish/token_ring.hpp	\
                           jellyfish/raw_dumper.hpp			\
                           jellyfish/capped_integer.hpp			\
                           jellyfish/aligned_values_array.hpp		\
@@ -542,38 +579,18 @@ library_include_HEADERS = jellyfish/allocators_malloc.hpp		\
                           jellyfish/toFloat.h jellyfish/eLut.h		\
                           jellyfish/dbg.hpp jellyfish/half.h		\
                           jellyfish/backtrace.hpp			\
-                          jellyfish/dna_codes.hpp
+                          jellyfish/dna_codes.hpp			\
+                          jellyfish/simple_circular_buffer.hpp
 
 
 ########################################
 # Build tests
 ########################################
 bin_generate_sequence_SOURCES = jellyfish/generate_sequence.cc		\
-                                jellyfish/misc.cc			\
-                                jellyfish/mersenne.cpp			\
-                                jellyfish/square_binary_matrix.cc	\
-                                jellyfish/backtrace.cc			\
-                                jellyfish/dbg.cc jellyfish/time.cc
-
-bin_test_double_fifo_input_SOURCES = \
-                                     jellyfish/test_double_fifo_input.cc	\
-                                     jellyfish/parse_dna.cc			\
-                                     jellyfish/file_parser.cc			\
-                                     jellyfish/sequence_parser.cc		\
-                                     jellyfish/backtrace.cc			\
-                                     jellyfish/thread_exec.cc			\
-                                     jellyfish/dbg.cc				\
-                                     jellyfish/time.cc				\
-                                     jellyfish/allocators_mmap.cc		\
-                                     jellyfish/dna_codes.cc
-
-bin_test_read_parser_SOURCES = jellyfish/test_read_parser.cc		\
-                               jellyfish/file_parser.cc			\
-                               jellyfish/read_parser.cc			\
-                               jellyfish/parse_read.cc			\
-                               jellyfish/dbg.cc jellyfish/backtrace.cc	\
-                               jellyfish/time.cc
+                                jellyfish/mersenne.cpp
 
+bin_test_double_fifo_input_SOURCES = jellyfish/test_double_fifo_input.cc
+bin_test_read_parser_SOURCES = jellyfish/test_read_parser.cc
 
 ########################################
 # Tests
@@ -594,23 +611,28 @@ TESTS = tests/generate_sequence.sh tests/serial_hashing.sh \
 	tests/parallel_fastq_sequence_hashing.sh \
 	tests/from_stream_fastq.sh tests/merge.sh tests/min_qual.sh \
 	tests/big.sh tests/parsers.sh tests/small.sh \
+	tests/parallel_fastq_direct_indexing.sh \
 	unit_tests/unit_tests.sh
-bin_test_offsets_key_value_SOURCES = unit_tests/test_offsets_key_value.cc
-bin_test_offsets_key_value_CXXFLAGS = -I$(top_srcdir)/unit_tests/gtest/include -I$(top_srcdir)/unit_tests/gtest
-bin_test_offsets_key_value_LDADD = libgtest_main.la
+bin_test_all_SOURCES = unit_tests/test_offsets_key_value.cc		\
+                       unit_tests/test_simple_circular_buffer.cc	\
+                       unit_tests/test_square_binary_matrix.cc
+
+bin_test_all_CXXFLAGS = -I$(top_srcdir)/unit_tests/gtest/include -I$(top_srcdir)/unit_tests/gtest
+bin_test_all_LDADD = libgtest_main.a libgtest.a $(LDADD)
 
 ##############################
 # Gtest build.
 ##############################
 # Build rules for libraries.
-check_LTLIBRARIES = libgtest.la libgtest_main.la
-libgtest_la_SOURCES = unit_tests/gtest/src/gtest-all.cc
-libgtest_main_la_SOURCES = unit_tests/gtest/src/gtest_main.cc
-libgtest_main_la_LIBADD = libgtest.la
-libgtest_la_CXXFLAGS = -I$(top_srcdir)/unit_tests/gtest	\
+# check_LTLIBRARIES = libgtest.la libgtest_main.la
+check_LIBRARIES = libgtest.a libgtest_main.a
+libgtest_a_SOURCES = unit_tests/gtest/src/gtest-all.cc
+libgtest_main_a_SOURCES = unit_tests/gtest/src/gtest_main.cc
+libgtest_main_a_LIBADD = libgtest.a
+libgtest_a_CXXFLAGS = -I$(top_srcdir)/unit_tests/gtest	\
 -I$(top_srcdir)/unit_tests/gtest/include
 
-libgtest_main_la_CXXFLAGS = -I$(top_srcdir)/unit_tests/gtest	\
+libgtest_main_a_CXXFLAGS = -I$(top_srcdir)/unit_tests/gtest	\
 -I$(top_srcdir)/unit_tests/gtest/include
 
 
@@ -651,7 +673,7 @@ all: config.h
 
 .SUFFIXES:
 .SUFFIXES: .cc .cpp .html .lo .log .o .obj .sh .sh$(EXEEXT)
-am--refresh:
+am--refresh: Makefile
 	@:
 $(srcdir)/Makefile.in:  $(srcdir)/Makefile.am $(srcdir)/gtest.mk $(am__configure_deps)
 	@for dep in $?; do \
@@ -676,6 +698,7 @@ Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status
 	    echo ' cd $(top_builddir) && $(SHELL) ./config.status $@ $(am__depfiles_maybe)'; \
 	    cd $(top_builddir) && $(SHELL) ./config.status $@ $(am__depfiles_maybe);; \
 	esac;
+$(srcdir)/gtest.mk:
 
 $(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES)
 	$(SHELL) ./config.status --recheck
@@ -687,10 +710,8 @@ $(ACLOCAL_M4):  $(am__aclocal_m4_deps)
 $(am__aclocal_m4_deps):
 
 config.h: stamp-h1
-	@if test ! -f $@; then \
-	  rm -f stamp-h1; \
-	  $(MAKE) $(AM_MAKEFLAGS) stamp-h1; \
-	else :; fi
+	@if test ! -f $@; then rm -f stamp-h1; else :; fi
+	@if test ! -f $@; then $(MAKE) $(AM_MAKEFLAGS) stamp-h1; else :; fi
 
 stamp-h1: $(srcdir)/config.h.in $(top_builddir)/config.status
 	@rm -f stamp-h1
@@ -707,17 +728,30 @@ tests/compat.sh: $(top_builddir)/config.status $(top_srcdir)/tests/compat.sh.in
 jellyfish-1.1.pc: $(top_builddir)/config.status $(srcdir)/jellyfish-1.1.pc.in
 	cd $(top_builddir) && $(SHELL) ./config.status $@
 
-clean-checkLTLIBRARIES:
-	-test -z "$(check_LTLIBRARIES)" || rm -f $(check_LTLIBRARIES)
-	@list='$(check_LTLIBRARIES)'; for p in $$list; do \
-	  dir="`echo $$p | sed -e 's|/[^/]*$$||'`"; \
-	  test "$$dir" != "$$p" || dir=.; \
-	  echo "rm -f \"$${dir}/so_locations\""; \
-	  rm -f "$${dir}/so_locations"; \
-	done
+clean-checkLIBRARIES:
+	-test -z "$(check_LIBRARIES)" || rm -f $(check_LIBRARIES)
+unit_tests/gtest/src/$(am__dirstamp):
+	@$(MKDIR_P) unit_tests/gtest/src
+	@: > unit_tests/gtest/src/$(am__dirstamp)
+unit_tests/gtest/src/$(DEPDIR)/$(am__dirstamp):
+	@$(MKDIR_P) unit_tests/gtest/src/$(DEPDIR)
+	@: > unit_tests/gtest/src/$(DEPDIR)/$(am__dirstamp)
+unit_tests/gtest/src/libgtest_a-gtest-all.$(OBJEXT):  \
+	unit_tests/gtest/src/$(am__dirstamp) \
+	unit_tests/gtest/src/$(DEPDIR)/$(am__dirstamp)
+libgtest.a: $(libgtest_a_OBJECTS) $(libgtest_a_DEPENDENCIES) $(EXTRA_libgtest_a_DEPENDENCIES) 
+	$(AM_V_at)-rm -f libgtest.a
+	$(AM_V_AR)$(libgtest_a_AR) libgtest.a $(libgtest_a_OBJECTS) $(libgtest_a_LIBADD)
+	$(AM_V_at)$(RANLIB) libgtest.a
+unit_tests/gtest/src/libgtest_main_a-gtest_main.$(OBJEXT):  \
+	unit_tests/gtest/src/$(am__dirstamp) \
+	unit_tests/gtest/src/$(DEPDIR)/$(am__dirstamp)
+libgtest_main.a: $(libgtest_main_a_OBJECTS) $(libgtest_main_a_DEPENDENCIES) $(EXTRA_libgtest_main_a_DEPENDENCIES) 
+	$(AM_V_at)-rm -f libgtest_main.a
+	$(AM_V_AR)$(libgtest_main_a_AR) libgtest_main.a $(libgtest_main_a_OBJECTS) $(libgtest_main_a_LIBADD)
+	$(AM_V_at)$(RANLIB) libgtest_main.a
 install-libLTLIBRARIES: $(lib_LTLIBRARIES)
 	@$(NORMAL_INSTALL)
-	test -z "$(libdir)" || $(MKDIR_P) "$(DESTDIR)$(libdir)"
 	@list='$(lib_LTLIBRARIES)'; test -n "$(libdir)" || list=; \
 	list2=; for p in $$list; do \
 	  if test -f $$p; then \
@@ -725,6 +759,8 @@ install-libLTLIBRARIES: $(lib_LTLIBRARIES)
 	  else :; fi; \
 	done; \
 	test -z "$$list2" || { \
+	  echo " $(MKDIR_P) '$(DESTDIR)$(libdir)'"; \
+	  $(MKDIR_P) "$(DESTDIR)$(libdir)" || exit 1; \
 	  echo " $(LIBTOOL) $(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=install $(INSTALL) $(INSTALL_STRIP_FLAG) $$list2 '$(DESTDIR)$(libdir)'"; \
 	  $(LIBTOOL) $(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=install $(INSTALL) $(INSTALL_STRIP_FLAG) $$list2 "$(DESTDIR)$(libdir)"; \
 	}
@@ -746,76 +782,63 @@ clean-libLTLIBRARIES:
 	  echo "rm -f \"$${dir}/so_locations\""; \
 	  rm -f "$${dir}/so_locations"; \
 	done
-unit_tests/gtest/src/$(am__dirstamp):
-	@$(MKDIR_P) unit_tests/gtest/src
-	@: > unit_tests/gtest/src/$(am__dirstamp)
-unit_tests/gtest/src/$(DEPDIR)/$(am__dirstamp):
-	@$(MKDIR_P) unit_tests/gtest/src/$(DEPDIR)
-	@: > unit_tests/gtest/src/$(DEPDIR)/$(am__dirstamp)
-unit_tests/gtest/src/libgtest_la-gtest-all.lo:  \
-	unit_tests/gtest/src/$(am__dirstamp) \
-	unit_tests/gtest/src/$(DEPDIR)/$(am__dirstamp)
-libgtest.la: $(libgtest_la_OBJECTS) $(libgtest_la_DEPENDENCIES) 
-	$(AM_V_CXXLD)$(libgtest_la_LINK)  $(libgtest_la_OBJECTS) $(libgtest_la_LIBADD) $(LIBS)
-unit_tests/gtest/src/libgtest_main_la-gtest_main.lo:  \
-	unit_tests/gtest/src/$(am__dirstamp) \
-	unit_tests/gtest/src/$(DEPDIR)/$(am__dirstamp)
-libgtest_main.la: $(libgtest_main_la_OBJECTS) $(libgtest_main_la_DEPENDENCIES) 
-	$(AM_V_CXXLD)$(libgtest_main_la_LINK)  $(libgtest_main_la_OBJECTS) $(libgtest_main_la_LIBADD) $(LIBS)
 jellyfish/$(am__dirstamp):
 	@$(MKDIR_P) jellyfish
 	@: > jellyfish/$(am__dirstamp)
 jellyfish/$(DEPDIR)/$(am__dirstamp):
 	@$(MKDIR_P) jellyfish/$(DEPDIR)
 	@: > jellyfish/$(DEPDIR)/$(am__dirstamp)
-jellyfish/libjellyfish_la-square_binary_matrix.lo:  \
-	jellyfish/$(am__dirstamp) jellyfish/$(DEPDIR)/$(am__dirstamp)
-jellyfish/libjellyfish_la-err.lo: jellyfish/$(am__dirstamp) \
+jellyfish/square_binary_matrix.lo: jellyfish/$(am__dirstamp) \
+	jellyfish/$(DEPDIR)/$(am__dirstamp)
+jellyfish/err.lo: jellyfish/$(am__dirstamp) \
 	jellyfish/$(DEPDIR)/$(am__dirstamp)
-jellyfish/libjellyfish_la-misc.lo: jellyfish/$(am__dirstamp) \
+jellyfish/misc.lo: jellyfish/$(am__dirstamp) \
 	jellyfish/$(DEPDIR)/$(am__dirstamp)
-jellyfish/libjellyfish_la-storage.lo: jellyfish/$(am__dirstamp) \
+jellyfish/storage.lo: jellyfish/$(am__dirstamp) \
 	jellyfish/$(DEPDIR)/$(am__dirstamp)
-jellyfish/libjellyfish_la-thread_exec.lo: jellyfish/$(am__dirstamp) \
+jellyfish/thread_exec.lo: jellyfish/$(am__dirstamp) \
 	jellyfish/$(DEPDIR)/$(am__dirstamp)
-jellyfish/libjellyfish_la-time.lo: jellyfish/$(am__dirstamp) \
+jellyfish/time.lo: jellyfish/$(am__dirstamp) \
 	jellyfish/$(DEPDIR)/$(am__dirstamp)
-jellyfish/libjellyfish_la-file_parser.lo: jellyfish/$(am__dirstamp) \
+jellyfish/file_parser.lo: jellyfish/$(am__dirstamp) \
 	jellyfish/$(DEPDIR)/$(am__dirstamp)
-jellyfish/libjellyfish_la-read_parser.lo: jellyfish/$(am__dirstamp) \
+jellyfish/read_parser.lo: jellyfish/$(am__dirstamp) \
 	jellyfish/$(DEPDIR)/$(am__dirstamp)
-jellyfish/libjellyfish_la-parse_read.lo: jellyfish/$(am__dirstamp) \
+jellyfish/parse_read.lo: jellyfish/$(am__dirstamp) \
 	jellyfish/$(DEPDIR)/$(am__dirstamp)
-jellyfish/libjellyfish_la-half.lo: jellyfish/$(am__dirstamp) \
+jellyfish/half.lo: jellyfish/$(am__dirstamp) \
 	jellyfish/$(DEPDIR)/$(am__dirstamp)
-jellyfish/libjellyfish_la-mapped_file.lo: jellyfish/$(am__dirstamp) \
+jellyfish/mapped_file.lo: jellyfish/$(am__dirstamp) \
 	jellyfish/$(DEPDIR)/$(am__dirstamp)
-jellyfish/libjellyfish_la-parse_dna.lo: jellyfish/$(am__dirstamp) \
+jellyfish/parse_dna.lo: jellyfish/$(am__dirstamp) \
 	jellyfish/$(DEPDIR)/$(am__dirstamp)
-jellyfish/libjellyfish_la-parse_quake.lo: jellyfish/$(am__dirstamp) \
+jellyfish/parse_quake.lo: jellyfish/$(am__dirstamp) \
 	jellyfish/$(DEPDIR)/$(am__dirstamp)
-jellyfish/libjellyfish_la-parse_qual_dna.lo:  \
-	jellyfish/$(am__dirstamp) jellyfish/$(DEPDIR)/$(am__dirstamp)
-jellyfish/libjellyfish_la-sequence_parser.lo:  \
-	jellyfish/$(am__dirstamp) jellyfish/$(DEPDIR)/$(am__dirstamp)
-jellyfish/libjellyfish_la-seq_qual_parser.lo:  \
-	jellyfish/$(am__dirstamp) jellyfish/$(DEPDIR)/$(am__dirstamp)
-jellyfish/libjellyfish_la-backtrace.lo: jellyfish/$(am__dirstamp) \
+jellyfish/parse_qual_dna.lo: jellyfish/$(am__dirstamp) \
 	jellyfish/$(DEPDIR)/$(am__dirstamp)
-jellyfish/libjellyfish_la-floats.lo: jellyfish/$(am__dirstamp) \
+jellyfish/sequence_parser.lo: jellyfish/$(am__dirstamp) \
 	jellyfish/$(DEPDIR)/$(am__dirstamp)
-jellyfish/libjellyfish_la-dbg.lo: jellyfish/$(am__dirstamp) \
+jellyfish/seq_qual_parser.lo: jellyfish/$(am__dirstamp) \
 	jellyfish/$(DEPDIR)/$(am__dirstamp)
-jellyfish/libjellyfish_la-allocators_mmap.lo:  \
-	jellyfish/$(am__dirstamp) jellyfish/$(DEPDIR)/$(am__dirstamp)
-jellyfish/libjellyfish_la-dna_codes.lo: jellyfish/$(am__dirstamp) \
+jellyfish/backtrace.lo: jellyfish/$(am__dirstamp) \
 	jellyfish/$(DEPDIR)/$(am__dirstamp)
-libjellyfish.la: $(libjellyfish_la_OBJECTS) $(libjellyfish_la_DEPENDENCIES) 
-	$(AM_V_CXXLD)$(libjellyfish_la_LINK) -rpath $(libdir) $(libjellyfish_la_OBJECTS) $(libjellyfish_la_LIBADD) $(LIBS)
+jellyfish/floats.lo: jellyfish/$(am__dirstamp) \
+	jellyfish/$(DEPDIR)/$(am__dirstamp)
+jellyfish/dbg.lo: jellyfish/$(am__dirstamp) \
+	jellyfish/$(DEPDIR)/$(am__dirstamp)
+jellyfish/allocators_mmap.lo: jellyfish/$(am__dirstamp) \
+	jellyfish/$(DEPDIR)/$(am__dirstamp)
+jellyfish/dna_codes.lo: jellyfish/$(am__dirstamp) \
+	jellyfish/$(DEPDIR)/$(am__dirstamp)
+libjellyfish-1.1.la: $(libjellyfish_1_1_la_OBJECTS) $(libjellyfish_1_1_la_DEPENDENCIES) $(EXTRA_libjellyfish_1_1_la_DEPENDENCIES) 
+	$(AM_V_CXXLD)$(libjellyfish_1_1_la_LINK) -rpath $(libdir) $(libjellyfish_1_1_la_OBJECTS) $(libjellyfish_1_1_la_LIBADD) $(LIBS)
 install-binPROGRAMS: $(bin_PROGRAMS)
 	@$(NORMAL_INSTALL)
-	test -z "$(bindir)" || $(MKDIR_P) "$(DESTDIR)$(bindir)"
 	@list='$(bin_PROGRAMS)'; test -n "$(bindir)" || list=; \
+	if test -n "$$list"; then \
+	  echo " $(MKDIR_P) '$(DESTDIR)$(bindir)'"; \
+	  $(MKDIR_P) "$(DESTDIR)$(bindir)" || exit 1; \
+	fi; \
 	for p in $$list; do echo "$$p $$p"; done | \
 	sed 's/$(EXEEXT)$$//' | \
 	while read p p1; do if test -f $$p || test -f $$p1; \
@@ -866,22 +889,12 @@ clean-checkPROGRAMS:
 	rm -f $$list
 jellyfish/generate_sequence.$(OBJEXT): jellyfish/$(am__dirstamp) \
 	jellyfish/$(DEPDIR)/$(am__dirstamp)
-jellyfish/misc.$(OBJEXT): jellyfish/$(am__dirstamp) \
-	jellyfish/$(DEPDIR)/$(am__dirstamp)
 jellyfish/mersenne.$(OBJEXT): jellyfish/$(am__dirstamp) \
 	jellyfish/$(DEPDIR)/$(am__dirstamp)
-jellyfish/square_binary_matrix.$(OBJEXT): jellyfish/$(am__dirstamp) \
-	jellyfish/$(DEPDIR)/$(am__dirstamp)
-jellyfish/backtrace.$(OBJEXT): jellyfish/$(am__dirstamp) \
-	jellyfish/$(DEPDIR)/$(am__dirstamp)
-jellyfish/dbg.$(OBJEXT): jellyfish/$(am__dirstamp) \
-	jellyfish/$(DEPDIR)/$(am__dirstamp)
-jellyfish/time.$(OBJEXT): jellyfish/$(am__dirstamp) \
-	jellyfish/$(DEPDIR)/$(am__dirstamp)
 bin/$(am__dirstamp):
 	@$(MKDIR_P) bin
 	@: > bin/$(am__dirstamp)
-bin/generate_sequence$(EXEEXT): $(bin_generate_sequence_OBJECTS) $(bin_generate_sequence_DEPENDENCIES) bin/$(am__dirstamp)
+bin/generate_sequence$(EXEEXT): $(bin_generate_sequence_OBJECTS) $(bin_generate_sequence_DEPENDENCIES) $(EXTRA_bin_generate_sequence_DEPENDENCIES) bin/$(am__dirstamp)
 	@rm -f bin/generate_sequence$(EXEEXT)
 	$(AM_V_CXXLD)$(CXXLINK) $(bin_generate_sequence_OBJECTS) $(bin_generate_sequence_LDADD) $(LIBS)
 jellyfish/jellyfish.$(OBJEXT): jellyfish/$(am__dirstamp) \
@@ -890,18 +903,12 @@ jellyfish/stats_main.$(OBJEXT): jellyfish/$(am__dirstamp) \
 	jellyfish/$(DEPDIR)/$(am__dirstamp)
 jellyfish/hash_merge.$(OBJEXT): jellyfish/$(am__dirstamp) \
 	jellyfish/$(DEPDIR)/$(am__dirstamp)
-jellyfish/storage.$(OBJEXT): jellyfish/$(am__dirstamp) \
-	jellyfish/$(DEPDIR)/$(am__dirstamp)
-jellyfish/err.$(OBJEXT): jellyfish/$(am__dirstamp) \
-	jellyfish/$(DEPDIR)/$(am__dirstamp)
 jellyfish/mer_counter.$(OBJEXT): jellyfish/$(am__dirstamp) \
 	jellyfish/$(DEPDIR)/$(am__dirstamp)
 jellyfish/histo_main.$(OBJEXT): jellyfish/$(am__dirstamp) \
 	jellyfish/$(DEPDIR)/$(am__dirstamp)
 jellyfish/dump_main.$(OBJEXT): jellyfish/$(am__dirstamp) \
 	jellyfish/$(DEPDIR)/$(am__dirstamp)
-jellyfish/thread_exec.$(OBJEXT): jellyfish/$(am__dirstamp) \
-	jellyfish/$(DEPDIR)/$(am__dirstamp)
 jellyfish/query_main.$(OBJEXT): jellyfish/$(am__dirstamp) \
 	jellyfish/$(DEPDIR)/$(am__dirstamp)
 jellyfish/dump_fastq_main.$(OBJEXT): jellyfish/$(am__dirstamp) \
@@ -910,467 +917,271 @@ jellyfish/histo_fastq_main.$(OBJEXT): jellyfish/$(am__dirstamp) \
 	jellyfish/$(DEPDIR)/$(am__dirstamp)
 jellyfish/cite.$(OBJEXT): jellyfish/$(am__dirstamp) \
 	jellyfish/$(DEPDIR)/$(am__dirstamp)
-jellyfish/parse_dna.$(OBJEXT): jellyfish/$(am__dirstamp) \
-	jellyfish/$(DEPDIR)/$(am__dirstamp)
-jellyfish/file_parser.$(OBJEXT): jellyfish/$(am__dirstamp) \
-	jellyfish/$(DEPDIR)/$(am__dirstamp)
-jellyfish/parse_quake.$(OBJEXT): jellyfish/$(am__dirstamp) \
-	jellyfish/$(DEPDIR)/$(am__dirstamp)
-jellyfish/parse_qual_dna.$(OBJEXT): jellyfish/$(am__dirstamp) \
-	jellyfish/$(DEPDIR)/$(am__dirstamp)
-jellyfish/sequence_parser.$(OBJEXT): jellyfish/$(am__dirstamp) \
-	jellyfish/$(DEPDIR)/$(am__dirstamp)
-jellyfish/seq_qual_parser.$(OBJEXT): jellyfish/$(am__dirstamp) \
-	jellyfish/$(DEPDIR)/$(am__dirstamp)
-jellyfish/half.$(OBJEXT): jellyfish/$(am__dirstamp) \
-	jellyfish/$(DEPDIR)/$(am__dirstamp)
 jellyfish/hash_fastq_merge.$(OBJEXT): jellyfish/$(am__dirstamp) \
 	jellyfish/$(DEPDIR)/$(am__dirstamp)
-jellyfish/mapped_file.$(OBJEXT): jellyfish/$(am__dirstamp) \
-	jellyfish/$(DEPDIR)/$(am__dirstamp)
-jellyfish/floats.$(OBJEXT): jellyfish/$(am__dirstamp) \
-	jellyfish/$(DEPDIR)/$(am__dirstamp)
-jellyfish/allocators_mmap.$(OBJEXT): jellyfish/$(am__dirstamp) \
-	jellyfish/$(DEPDIR)/$(am__dirstamp)
 jellyfish/yaggo.$(OBJEXT): jellyfish/$(am__dirstamp) \
 	jellyfish/$(DEPDIR)/$(am__dirstamp)
-jellyfish/dna_codes.$(OBJEXT): jellyfish/$(am__dirstamp) \
-	jellyfish/$(DEPDIR)/$(am__dirstamp)
-bin/jellyfish$(EXEEXT): $(bin_jellyfish_OBJECTS) $(bin_jellyfish_DEPENDENCIES) bin/$(am__dirstamp)
+bin/jellyfish$(EXEEXT): $(bin_jellyfish_OBJECTS) $(bin_jellyfish_DEPENDENCIES) $(EXTRA_bin_jellyfish_DEPENDENCIES) bin/$(am__dirstamp)
 	@rm -f bin/jellyfish$(EXEEXT)
-	$(AM_V_CXXLD)$(CXXLINK) $(bin_jellyfish_OBJECTS) $(bin_jellyfish_LDADD) $(LIBS)
-jellyfish/test_double_fifo_input.$(OBJEXT): jellyfish/$(am__dirstamp) \
-	jellyfish/$(DEPDIR)/$(am__dirstamp)
-bin/test_double_fifo_input$(EXEEXT): $(bin_test_double_fifo_input_OBJECTS) $(bin_test_double_fifo_input_DEPENDENCIES) bin/$(am__dirstamp)
-	@rm -f bin/test_double_fifo_input$(EXEEXT)
-	$(AM_V_CXXLD)$(CXXLINK) $(bin_test_double_fifo_input_OBJECTS) $(bin_test_double_fifo_input_LDADD) $(LIBS)
+	$(AM_V_CXXLD)$(bin_jellyfish_LINK) $(bin_jellyfish_OBJECTS) $(bin_jellyfish_LDADD) $(LIBS)
 unit_tests/$(am__dirstamp):
 	@$(MKDIR_P) unit_tests
 	@: > unit_tests/$(am__dirstamp)
 unit_tests/$(DEPDIR)/$(am__dirstamp):
 	@$(MKDIR_P) unit_tests/$(DEPDIR)
 	@: > unit_tests/$(DEPDIR)/$(am__dirstamp)
-unit_tests/bin_test_offsets_key_value-test_offsets_key_value.$(OBJEXT):  \
+unit_tests/bin_test_all-test_offsets_key_value.$(OBJEXT):  \
 	unit_tests/$(am__dirstamp) \
 	unit_tests/$(DEPDIR)/$(am__dirstamp)
-bin/test_offsets_key_value$(EXEEXT): $(bin_test_offsets_key_value_OBJECTS) $(bin_test_offsets_key_value_DEPENDENCIES) bin/$(am__dirstamp)
-	@rm -f bin/test_offsets_key_value$(EXEEXT)
-	$(AM_V_CXXLD)$(bin_test_offsets_key_value_LINK) $(bin_test_offsets_key_value_OBJECTS) $(bin_test_offsets_key_value_LDADD) $(LIBS)
-jellyfish/test_read_parser.$(OBJEXT): jellyfish/$(am__dirstamp) \
-	jellyfish/$(DEPDIR)/$(am__dirstamp)
-jellyfish/read_parser.$(OBJEXT): jellyfish/$(am__dirstamp) \
+unit_tests/bin_test_all-test_simple_circular_buffer.$(OBJEXT):  \
+	unit_tests/$(am__dirstamp) \
+	unit_tests/$(DEPDIR)/$(am__dirstamp)
+unit_tests/bin_test_all-test_square_binary_matrix.$(OBJEXT):  \
+	unit_tests/$(am__dirstamp) \
+	unit_tests/$(DEPDIR)/$(am__dirstamp)
+bin/test_all$(EXEEXT): $(bin_test_all_OBJECTS) $(bin_test_all_DEPENDENCIES) $(EXTRA_bin_test_all_DEPENDENCIES) bin/$(am__dirstamp)
+	@rm -f bin/test_all$(EXEEXT)
+	$(AM_V_CXXLD)$(bin_test_all_LINK) $(bin_test_all_OBJECTS) $(bin_test_all_LDADD) $(LIBS)
+jellyfish/test_double_fifo_input.$(OBJEXT): jellyfish/$(am__dirstamp) \
 	jellyfish/$(DEPDIR)/$(am__dirstamp)
-jellyfish/parse_read.$(OBJEXT): jellyfish/$(am__dirstamp) \
+bin/test_double_fifo_input$(EXEEXT): $(bin_test_double_fifo_input_OBJECTS) $(bin_test_double_fifo_input_DEPENDENCIES) $(EXTRA_bin_test_double_fifo_input_DEPENDENCIES) bin/$(am__dirstamp)
+	@rm -f bin/test_double_fifo_input$(EXEEXT)
+	$(AM_V_CXXLD)$(CXXLINK) $(bin_test_double_fifo_input_OBJECTS) $(bin_test_double_fifo_input_LDADD) $(LIBS)
+jellyfish/test_read_parser.$(OBJEXT): jellyfish/$(am__dirstamp) \
 	jellyfish/$(DEPDIR)/$(am__dirstamp)
-bin/test_read_parser$(EXEEXT): $(bin_test_read_parser_OBJECTS) $(bin_test_read_parser_DEPENDENCIES) bin/$(am__dirstamp)
+bin/test_read_parser$(EXEEXT): $(bin_test_read_parser_OBJECTS) $(bin_test_read_parser_DEPENDENCIES) $(EXTRA_bin_test_read_parser_DEPENDENCIES) bin/$(am__dirstamp)
 	@rm -f bin/test_read_parser$(EXEEXT)
 	$(AM_V_CXXLD)$(CXXLINK) $(bin_test_read_parser_OBJECTS) $(bin_test_read_parser_LDADD) $(LIBS)
 
 mostlyclean-compile:
 	-rm -f *.$(OBJEXT)
 	-rm -f jellyfish/allocators_mmap.$(OBJEXT)
+	-rm -f jellyfish/allocators_mmap.lo
 	-rm -f jellyfish/backtrace.$(OBJEXT)
+	-rm -f jellyfish/backtrace.lo
 	-rm -f jellyfish/cite.$(OBJEXT)
 	-rm -f jellyfish/dbg.$(OBJEXT)
+	-rm -f jellyfish/dbg.lo
 	-rm -f jellyfish/dna_codes.$(OBJEXT)
+	-rm -f jellyfish/dna_codes.lo
 	-rm -f jellyfish/dump_fastq_main.$(OBJEXT)
 	-rm -f jellyfish/dump_main.$(OBJEXT)
 	-rm -f jellyfish/err.$(OBJEXT)
+	-rm -f jellyfish/err.lo
 	-rm -f jellyfish/file_parser.$(OBJEXT)
+	-rm -f jellyfish/file_parser.lo
 	-rm -f jellyfish/floats.$(OBJEXT)
+	-rm -f jellyfish/floats.lo
 	-rm -f jellyfish/generate_sequence.$(OBJEXT)
 	-rm -f jellyfish/half.$(OBJEXT)
+	-rm -f jellyfish/half.lo
 	-rm -f jellyfish/hash_fastq_merge.$(OBJEXT)
 	-rm -f jellyfish/hash_merge.$(OBJEXT)
 	-rm -f jellyfish/histo_fastq_main.$(OBJEXT)
 	-rm -f jellyfish/histo_main.$(OBJEXT)
 	-rm -f jellyfish/jellyfish.$(OBJEXT)
-	-rm -f jellyfish/libjellyfish_la-allocators_mmap.$(OBJEXT)
-	-rm -f jellyfish/libjellyfish_la-allocators_mmap.lo
-	-rm -f jellyfish/libjellyfish_la-backtrace.$(OBJEXT)
-	-rm -f jellyfish/libjellyfish_la-backtrace.lo
-	-rm -f jellyfish/libjellyfish_la-dbg.$(OBJEXT)
-	-rm -f jellyfish/libjellyfish_la-dbg.lo
-	-rm -f jellyfish/libjellyfish_la-dna_codes.$(OBJEXT)
-	-rm -f jellyfish/libjellyfish_la-dna_codes.lo
-	-rm -f jellyfish/libjellyfish_la-err.$(OBJEXT)
-	-rm -f jellyfish/libjellyfish_la-err.lo
-	-rm -f jellyfish/libjellyfish_la-file_parser.$(OBJEXT)
-	-rm -f jellyfish/libjellyfish_la-file_parser.lo
-	-rm -f jellyfish/libjellyfish_la-floats.$(OBJEXT)
-	-rm -f jellyfish/libjellyfish_la-floats.lo
-	-rm -f jellyfish/libjellyfish_la-half.$(OBJEXT)
-	-rm -f jellyfish/libjellyfish_la-half.lo
-	-rm -f jellyfish/libjellyfish_la-mapped_file.$(OBJEXT)
-	-rm -f jellyfish/libjellyfish_la-mapped_file.lo
-	-rm -f jellyfish/libjellyfish_la-misc.$(OBJEXT)
-	-rm -f jellyfish/libjellyfish_la-misc.lo
-	-rm -f jellyfish/libjellyfish_la-parse_dna.$(OBJEXT)
-	-rm -f jellyfish/libjellyfish_la-parse_dna.lo
-	-rm -f jellyfish/libjellyfish_la-parse_quake.$(OBJEXT)
-	-rm -f jellyfish/libjellyfish_la-parse_quake.lo
-	-rm -f jellyfish/libjellyfish_la-parse_qual_dna.$(OBJEXT)
-	-rm -f jellyfish/libjellyfish_la-parse_qual_dna.lo
-	-rm -f jellyfish/libjellyfish_la-parse_read.$(OBJEXT)
-	-rm -f jellyfish/libjellyfish_la-parse_read.lo
-	-rm -f jellyfish/libjellyfish_la-read_parser.$(OBJEXT)
-	-rm -f jellyfish/libjellyfish_la-read_parser.lo
-	-rm -f jellyfish/libjellyfish_la-seq_qual_parser.$(OBJEXT)
-	-rm -f jellyfish/libjellyfish_la-seq_qual_parser.lo
-	-rm -f jellyfish/libjellyfish_la-sequence_parser.$(OBJEXT)
-	-rm -f jellyfish/libjellyfish_la-sequence_parser.lo
-	-rm -f jellyfish/libjellyfish_la-square_binary_matrix.$(OBJEXT)
-	-rm -f jellyfish/libjellyfish_la-square_binary_matrix.lo
-	-rm -f jellyfish/libjellyfish_la-storage.$(OBJEXT)
-	-rm -f jellyfish/libjellyfish_la-storage.lo
-	-rm -f jellyfish/libjellyfish_la-thread_exec.$(OBJEXT)
-	-rm -f jellyfish/libjellyfish_la-thread_exec.lo
-	-rm -f jellyfish/libjellyfish_la-time.$(OBJEXT)
-	-rm -f jellyfish/libjellyfish_la-time.lo
 	-rm -f jellyfish/mapped_file.$(OBJEXT)
+	-rm -f jellyfish/mapped_file.lo
 	-rm -f jellyfish/mer_counter.$(OBJEXT)
 	-rm -f jellyfish/mersenne.$(OBJEXT)
 	-rm -f jellyfish/misc.$(OBJEXT)
+	-rm -f jellyfish/misc.lo
 	-rm -f jellyfish/parse_dna.$(OBJEXT)
+	-rm -f jellyfish/parse_dna.lo
 	-rm -f jellyfish/parse_quake.$(OBJEXT)
+	-rm -f jellyfish/parse_quake.lo
 	-rm -f jellyfish/parse_qual_dna.$(OBJEXT)
+	-rm -f jellyfish/parse_qual_dna.lo
 	-rm -f jellyfish/parse_read.$(OBJEXT)
+	-rm -f jellyfish/parse_read.lo
 	-rm -f jellyfish/query_main.$(OBJEXT)
 	-rm -f jellyfish/read_parser.$(OBJEXT)
+	-rm -f jellyfish/read_parser.lo
 	-rm -f jellyfish/seq_qual_parser.$(OBJEXT)
+	-rm -f jellyfish/seq_qual_parser.lo
 	-rm -f jellyfish/sequence_parser.$(OBJEXT)
+	-rm -f jellyfish/sequence_parser.lo
 	-rm -f jellyfish/square_binary_matrix.$(OBJEXT)
+	-rm -f jellyfish/square_binary_matrix.lo
 	-rm -f jellyfish/stats_main.$(OBJEXT)
 	-rm -f jellyfish/storage.$(OBJEXT)
+	-rm -f jellyfish/storage.lo
 	-rm -f jellyfish/test_double_fifo_input.$(OBJEXT)
 	-rm -f jellyfish/test_read_parser.$(OBJEXT)
 	-rm -f jellyfish/thread_exec.$(OBJEXT)
+	-rm -f jellyfish/thread_exec.lo
 	-rm -f jellyfish/time.$(OBJEXT)
+	-rm -f jellyfish/time.lo
 	-rm -f jellyfish/yaggo.$(OBJEXT)
-	-rm -f unit_tests/bin_test_offsets_key_value-test_offsets_key_value.$(OBJEXT)
-	-rm -f unit_tests/gtest/src/libgtest_la-gtest-all.$(OBJEXT)
-	-rm -f unit_tests/gtest/src/libgtest_la-gtest-all.lo
-	-rm -f unit_tests/gtest/src/libgtest_main_la-gtest_main.$(OBJEXT)
-	-rm -f unit_tests/gtest/src/libgtest_main_la-gtest_main.lo
+	-rm -f unit_tests/bin_test_all-test_offsets_key_value.$(OBJEXT)
+	-rm -f unit_tests/bin_test_all-test_simple_circular_buffer.$(OBJEXT)
+	-rm -f unit_tests/bin_test_all-test_square_binary_matrix.$(OBJEXT)
+	-rm -f unit_tests/gtest/src/libgtest_a-gtest-all.$(OBJEXT)
+	-rm -f unit_tests/gtest/src/libgtest_main_a-gtest_main.$(OBJEXT)
 
 distclean-compile:
 	-rm -f *.tab.c
 
- at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/allocators_mmap.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/backtrace.Po at am__quote@
+ at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/allocators_mmap.Plo at am__quote@
+ at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/backtrace.Plo at am__quote@
 @AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/cite.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/dbg.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/dna_codes.Po at am__quote@
+ at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/dbg.Plo at am__quote@
+ at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/dna_codes.Plo at am__quote@
 @AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/dump_fastq_main.Po at am__quote@
 @AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/dump_main.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/err.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/file_parser.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/floats.Po at am__quote@
+ at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/err.Plo at am__quote@
+ at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/file_parser.Plo at am__quote@
+ at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/floats.Plo at am__quote@
 @AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/generate_sequence.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/half.Po at am__quote@
+ at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/half.Plo at am__quote@
 @AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/hash_fastq_merge.Po at am__quote@
 @AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/hash_merge.Po at am__quote@
 @AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/histo_fastq_main.Po at am__quote@
 @AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/histo_main.Po at am__quote@
 @AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/jellyfish.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/libjellyfish_la-allocators_mmap.Plo at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/libjellyfish_la-backtrace.Plo at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/libjellyfish_la-dbg.Plo at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/libjellyfish_la-dna_codes.Plo at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/libjellyfish_la-err.Plo at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/libjellyfish_la-file_parser.Plo at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/libjellyfish_la-floats.Plo at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/libjellyfish_la-half.Plo at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/libjellyfish_la-mapped_file.Plo at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/libjellyfish_la-misc.Plo at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/libjellyfish_la-parse_dna.Plo at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/libjellyfish_la-parse_quake.Plo at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/libjellyfish_la-parse_qual_dna.Plo at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/libjellyfish_la-parse_read.Plo at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/libjellyfish_la-read_parser.Plo at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/libjellyfish_la-seq_qual_parser.Plo at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/libjellyfish_la-sequence_parser.Plo at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/libjellyfish_la-square_binary_matrix.Plo at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/libjellyfish_la-storage.Plo at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/libjellyfish_la-thread_exec.Plo at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/libjellyfish_la-time.Plo at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/mapped_file.Po at am__quote@
+ at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/mapped_file.Plo at am__quote@
 @AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/mer_counter.Po at am__quote@
 @AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/mersenne.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/misc.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/parse_dna.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/parse_quake.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/parse_qual_dna.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/parse_read.Po at am__quote@
+ at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/misc.Plo at am__quote@
+ at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/parse_dna.Plo at am__quote@
+ at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/parse_quake.Plo at am__quote@
+ at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/parse_qual_dna.Plo at am__quote@
+ at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/parse_read.Plo at am__quote@
 @AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/query_main.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/read_parser.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/seq_qual_parser.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/sequence_parser.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/square_binary_matrix.Po at am__quote@
+ at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/read_parser.Plo at am__quote@
+ at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/seq_qual_parser.Plo at am__quote@
+ at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/sequence_parser.Plo at am__quote@
+ at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/square_binary_matrix.Plo at am__quote@
 @AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/stats_main.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/storage.Po at am__quote@
+ at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/storage.Plo at am__quote@
 @AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/test_double_fifo_input.Po at am__quote@
 @AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/test_read_parser.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/thread_exec.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/time.Po at am__quote@
+ at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/thread_exec.Plo at am__quote@
+ at AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/time.Plo at am__quote@
 @AMDEP_TRUE@@am__include@ @am__quote at jellyfish/$(DEPDIR)/yaggo.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at unit_tests/$(DEPDIR)/bin_test_offsets_key_value-test_offsets_key_value.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at unit_tests/gtest/src/$(DEPDIR)/libgtest_la-gtest-all.Plo at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at unit_tests/gtest/src/$(DEPDIR)/libgtest_main_la-gtest_main.Plo at am__quote@
+ at AMDEP_TRUE@@am__include@ @am__quote at unit_tests/$(DEPDIR)/bin_test_all-test_offsets_key_value.Po at am__quote@
+ at AMDEP_TRUE@@am__include@ @am__quote at unit_tests/$(DEPDIR)/bin_test_all-test_simple_circular_buffer.Po at am__quote@
+ at AMDEP_TRUE@@am__include@ @am__quote at unit_tests/$(DEPDIR)/bin_test_all-test_square_binary_matrix.Po at am__quote@
+ at AMDEP_TRUE@@am__include@ @am__quote at unit_tests/gtest/src/$(DEPDIR)/libgtest_a-gtest-all.Po at am__quote@
+ at AMDEP_TRUE@@am__include@ @am__quote at unit_tests/gtest/src/$(DEPDIR)/libgtest_main_a-gtest_main.Po at am__quote@
 
 .cc.o:
 @am__fastdepCXX_TRUE@	$(AM_V_CXX)depbase=`echo $@ | sed 's|[^/]*$$|$(DEPDIR)/&|;s|\.o$$||'`;\
 @am__fastdepCXX_TRUE@	$(CXXCOMPILE) -MT $@ -MD -MP -MF $$depbase.Tpo -c -o $@ $< &&\
 @am__fastdepCXX_TRUE@	$(am__mv) $$depbase.Tpo $$depbase.Po
- at am__fastdepCXX_FALSE@	$(AM_V_CXX) @AM_BACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@	source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCXX_FALSE@	$(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
 @AMDEP_TRUE@@am__fastdepCXX_FALSE@	DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@	$(CXXCOMPILE) -c -o $@ $<
+ at am__fastdepCXX_FALSE@	$(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ $<
 
 .cc.obj:
 @am__fastdepCXX_TRUE@	$(AM_V_CXX)depbase=`echo $@ | sed 's|[^/]*$$|$(DEPDIR)/&|;s|\.obj$$||'`;\
 @am__fastdepCXX_TRUE@	$(CXXCOMPILE) -MT $@ -MD -MP -MF $$depbase.Tpo -c -o $@ `$(CYGPATH_W) '$<'` &&\
 @am__fastdepCXX_TRUE@	$(am__mv) $$depbase.Tpo $$depbase.Po
- at am__fastdepCXX_FALSE@	$(AM_V_CXX) @AM_BACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@	source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCXX_FALSE@	$(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
 @AMDEP_TRUE@@am__fastdepCXX_FALSE@	DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@	$(CXXCOMPILE) -c -o $@ `$(CYGPATH_W) '$<'`
+ at am__fastdepCXX_FALSE@	$(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ `$(CYGPATH_W) '$<'`
 
 .cc.lo:
 @am__fastdepCXX_TRUE@	$(AM_V_CXX)depbase=`echo $@ | sed 's|[^/]*$$|$(DEPDIR)/&|;s|\.lo$$||'`;\
 @am__fastdepCXX_TRUE@	$(LTCXXCOMPILE) -MT $@ -MD -MP -MF $$depbase.Tpo -c -o $@ $< &&\
 @am__fastdepCXX_TRUE@	$(am__mv) $$depbase.Tpo $$depbase.Plo
- at am__fastdepCXX_FALSE@	$(AM_V_CXX) @AM_BACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@	source='$<' object='$@' libtool=yes @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@	DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@	$(LTCXXCOMPILE) -c -o $@ $<
-
-unit_tests/gtest/src/libgtest_la-gtest-all.lo: unit_tests/gtest/src/gtest-all.cc
- at am__fastdepCXX_TRUE@	$(AM_V_CXX)$(LIBTOOL) $(AM_V_lt) --tag=CXX $(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=compile $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) $(CPPFLAGS) $(libgtest_la_CXXFLAGS) $(CXXFLAGS) -MT unit_tests/gtest/src/libgtest_la-gtest-all.lo -MD -MP -MF unit_tests/gtest/src/$(DEPDIR)/libgtest_la-gtest-all.Tpo -c -o unit_tests/gtest/src/libgtest_la-gtest-all.lo `test -f 'unit_tests/gtest/src/gtest-all.cc' || echo '$(srcdir)/'`unit_tests/gtest/src/gtest-all.cc
- at am__fastdepCXX_TRUE@	$(AM_V_at)$(am__mv) unit_tests/gtest/src/$(DEPDIR)/libgtest_la-gtest-all.Tpo unit_tests/gtest/src/$(DEPDIR)/libgtest_la-gtest-all.Plo
- at am__fastdepCXX_FALSE@	$(AM_V_CXX) @AM_BACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@	source='unit_tests/gtest/src/gtest-all.cc' object='unit_tests/gtest/src/libgtest_la-gtest-all.lo' libtool=yes @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@	DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@	$(LIBTOOL) $(AM_V_lt) --tag=CXX $(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=compile $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) $(CPPFLAGS) $(libgtest_la_CXXFLAGS) $(CXXFLAGS) -c -o unit_tests/gtest/src/libgtest_la-gtest-all.lo `test -f 'unit_tests/gtest/src/gtest-all.cc' || echo '$(srcdir)/'`unit_tests/gtest/src/gtest-all.cc
-
-unit_tests/gtest/src/libgtest_main_la-gtest_main.lo: unit_tests/gtest/src/gtest_main.cc
- at am__fastdepCXX_TRUE@	$(AM_V_CXX)$(LIBTOOL) $(AM_V_lt) --tag=CXX $(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=compile $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) $(CPPFLAGS) $(libgtest_main_la_CXXFLAGS) $(CXXFLAGS) -MT unit_tests/gtest/src/libgtest_main_la-gtest_main.lo -MD -MP -MF unit_tests/gtest/src/$(DEPDIR)/libgtest_main_la-gtest_main.Tpo -c -o unit_tests/gtest/src/libgtest_main_la-gtest_main.lo `test -f 'unit_tests/gtest/src/gtest_main.cc' || echo '$(srcdir)/'`unit_t [...]
- at am__fastdepCXX_TRUE@	$(AM_V_at)$(am__mv) unit_tests/gtest/src/$(DEPDIR)/libgtest_main_la-gtest_main.Tpo unit_tests/gtest/src/$(DEPDIR)/libgtest_main_la-gtest_main.Plo
- at am__fastdepCXX_FALSE@	$(AM_V_CXX) @AM_BACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@	source='unit_tests/gtest/src/gtest_main.cc' object='unit_tests/gtest/src/libgtest_main_la-gtest_main.lo' libtool=yes @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@	DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@	$(LIBTOOL) $(AM_V_lt) --tag=CXX $(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=compile $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) $(CPPFLAGS) $(libgtest_main_la_CXXFLAGS) $(CXXFLAGS) -c -o unit_tests/gtest/src/libgtest_main_la-gtest_main.lo `test -f 'unit_tests/gtest/src/gtest_main.cc' || echo '$(srcdir)/'`unit_tests/gtest/src/gtest_main.cc
-
-jellyfish/libjellyfish_la-square_binary_matrix.lo: jellyfish/square_binary_matrix.cc
- at am__fastdepCXX_TRUE@	$(AM_V_CXX)$(LIBTOOL) $(AM_V_lt) --tag=CXX $(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=compile $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libjellyfish_la_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT jellyfish/libjellyfish_la-square_binary_matrix.lo -MD -MP -MF jellyfish/$(DEPDIR)/libjellyfish_la-square_binary_matrix.Tpo -c -o jellyfish/libjellyfish_la-square_binary_matrix.lo `test -f 'jellyfish/square_binary_matrix.cc' || echo '$(srcdir)/'`jellyfish/squa [...]
- at am__fastdepCXX_TRUE@	$(AM_V_at)$(am__mv) jellyfish/$(DEPDIR)/libjellyfish_la-square_binary_matrix.Tpo jellyfish/$(DEPDIR)/libjellyfish_la-square_binary_matrix.Plo
- at am__fastdepCXX_FALSE@	$(AM_V_CXX) @AM_BACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@	source='jellyfish/square_binary_matrix.cc' object='jellyfish/libjellyfish_la-square_binary_matrix.lo' libtool=yes @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@	DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@	$(LIBTOOL) $(AM_V_lt) --tag=CXX $(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=compile $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libjellyfish_la_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o jellyfish/libjellyfish_la-square_binary_matrix.lo `test -f 'jellyfish/square_binary_matrix.cc' || echo '$(srcdir)/'`jellyfish/square_binary_matrix.cc
-
-jellyfish/libjellyfish_la-err.lo: jellyfish/err.cc
- at am__fastdepCXX_TRUE@	$(AM_V_CXX)$(LIBTOOL) $(AM_V_lt) --tag=CXX $(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=compile $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libjellyfish_la_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT jellyfish/libjellyfish_la-err.lo -MD -MP -MF jellyfish/$(DEPDIR)/libjellyfish_la-err.Tpo -c -o jellyfish/libjellyfish_la-err.lo `test -f 'jellyfish/err.cc' || echo '$(srcdir)/'`jellyfish/err.cc
- at am__fastdepCXX_TRUE@	$(AM_V_at)$(am__mv) jellyfish/$(DEPDIR)/libjellyfish_la-err.Tpo jellyfish/$(DEPDIR)/libjellyfish_la-err.Plo
- at am__fastdepCXX_FALSE@	$(AM_V_CXX) @AM_BACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@	source='jellyfish/err.cc' object='jellyfish/libjellyfish_la-err.lo' libtool=yes @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@	DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@	$(LIBTOOL) $(AM_V_lt) --tag=CXX $(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=compile $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libjellyfish_la_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o jellyfish/libjellyfish_la-err.lo `test -f 'jellyfish/err.cc' || echo '$(srcdir)/'`jellyfish/err.cc
-
-jellyfish/libjellyfish_la-misc.lo: jellyfish/misc.cc
- at am__fastdepCXX_TRUE@	$(AM_V_CXX)$(LIBTOOL) $(AM_V_lt) --tag=CXX $(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=compile $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libjellyfish_la_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT jellyfish/libjellyfish_la-misc.lo -MD -MP -MF jellyfish/$(DEPDIR)/libjellyfish_la-misc.Tpo -c -o jellyfish/libjellyfish_la-misc.lo `test -f 'jellyfish/misc.cc' || echo '$(srcdir)/'`jellyfish/misc.cc
- at am__fastdepCXX_TRUE@	$(AM_V_at)$(am__mv) jellyfish/$(DEPDIR)/libjellyfish_la-misc.Tpo jellyfish/$(DEPDIR)/libjellyfish_la-misc.Plo
- at am__fastdepCXX_FALSE@	$(AM_V_CXX) @AM_BACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@	source='jellyfish/misc.cc' object='jellyfish/libjellyfish_la-misc.lo' libtool=yes @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@	DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@	$(LIBTOOL) $(AM_V_lt) --tag=CXX $(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=compile $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libjellyfish_la_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o jellyfish/libjellyfish_la-misc.lo `test -f 'jellyfish/misc.cc' || echo '$(srcdir)/'`jellyfish/misc.cc
-
-jellyfish/libjellyfish_la-storage.lo: jellyfish/storage.cc
- at am__fastdepCXX_TRUE@	$(AM_V_CXX)$(LIBTOOL) $(AM_V_lt) --tag=CXX $(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=compile $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libjellyfish_la_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT jellyfish/libjellyfish_la-storage.lo -MD -MP -MF jellyfish/$(DEPDIR)/libjellyfish_la-storage.Tpo -c -o jellyfish/libjellyfish_la-storage.lo `test -f 'jellyfish/storage.cc' || echo '$(srcdir)/'`jellyfish/storage.cc
- at am__fastdepCXX_TRUE@	$(AM_V_at)$(am__mv) jellyfish/$(DEPDIR)/libjellyfish_la-storage.Tpo jellyfish/$(DEPDIR)/libjellyfish_la-storage.Plo
- at am__fastdepCXX_FALSE@	$(AM_V_CXX) @AM_BACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@	source='jellyfish/storage.cc' object='jellyfish/libjellyfish_la-storage.lo' libtool=yes @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@	DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@	$(LIBTOOL) $(AM_V_lt) --tag=CXX $(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=compile $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libjellyfish_la_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o jellyfish/libjellyfish_la-storage.lo `test -f 'jellyfish/storage.cc' || echo '$(srcdir)/'`jellyfish/storage.cc
-
-jellyfish/libjellyfish_la-thread_exec.lo: jellyfish/thread_exec.cc
- at am__fastdepCXX_TRUE@	$(AM_V_CXX)$(LIBTOOL) $(AM_V_lt) --tag=CXX $(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=compile $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libjellyfish_la_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT jellyfish/libjellyfish_la-thread_exec.lo -MD -MP -MF jellyfish/$(DEPDIR)/libjellyfish_la-thread_exec.Tpo -c -o jellyfish/libjellyfish_la-thread_exec.lo `test -f 'jellyfish/thread_exec.cc' || echo '$(srcdir)/'`jellyfish/thread_exec.cc
- at am__fastdepCXX_TRUE@	$(AM_V_at)$(am__mv) jellyfish/$(DEPDIR)/libjellyfish_la-thread_exec.Tpo jellyfish/$(DEPDIR)/libjellyfish_la-thread_exec.Plo
- at am__fastdepCXX_FALSE@	$(AM_V_CXX) @AM_BACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@	source='jellyfish/thread_exec.cc' object='jellyfish/libjellyfish_la-thread_exec.lo' libtool=yes @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@	DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@	$(LIBTOOL) $(AM_V_lt) --tag=CXX $(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=compile $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libjellyfish_la_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o jellyfish/libjellyfish_la-thread_exec.lo `test -f 'jellyfish/thread_exec.cc' || echo '$(srcdir)/'`jellyfish/thread_exec.cc
-
-jellyfish/libjellyfish_la-time.lo: jellyfish/time.cc
- at am__fastdepCXX_TRUE@	$(AM_V_CXX)$(LIBTOOL) $(AM_V_lt) --tag=CXX $(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=compile $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libjellyfish_la_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT jellyfish/libjellyfish_la-time.lo -MD -MP -MF jellyfish/$(DEPDIR)/libjellyfish_la-time.Tpo -c -o jellyfish/libjellyfish_la-time.lo `test -f 'jellyfish/time.cc' || echo '$(srcdir)/'`jellyfish/time.cc
- at am__fastdepCXX_TRUE@	$(AM_V_at)$(am__mv) jellyfish/$(DEPDIR)/libjellyfish_la-time.Tpo jellyfish/$(DEPDIR)/libjellyfish_la-time.Plo
- at am__fastdepCXX_FALSE@	$(AM_V_CXX) @AM_BACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@	source='jellyfish/time.cc' object='jellyfish/libjellyfish_la-time.lo' libtool=yes @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@	DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@	$(LIBTOOL) $(AM_V_lt) --tag=CXX $(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=compile $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libjellyfish_la_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o jellyfish/libjellyfish_la-time.lo `test -f 'jellyfish/time.cc' || echo '$(srcdir)/'`jellyfish/time.cc
-
-jellyfish/libjellyfish_la-file_parser.lo: jellyfish/file_parser.cc
- at am__fastdepCXX_TRUE@	$(AM_V_CXX)$(LIBTOOL) $(AM_V_lt) --tag=CXX $(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=compile $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libjellyfish_la_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT jellyfish/libjellyfish_la-file_parser.lo -MD -MP -MF jellyfish/$(DEPDIR)/libjellyfish_la-file_parser.Tpo -c -o jellyfish/libjellyfish_la-file_parser.lo `test -f 'jellyfish/file_parser.cc' || echo '$(srcdir)/'`jellyfish/file_parser.cc
- at am__fastdepCXX_TRUE@	$(AM_V_at)$(am__mv) jellyfish/$(DEPDIR)/libjellyfish_la-file_parser.Tpo jellyfish/$(DEPDIR)/libjellyfish_la-file_parser.Plo
- at am__fastdepCXX_FALSE@	$(AM_V_CXX) @AM_BACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@	source='jellyfish/file_parser.cc' object='jellyfish/libjellyfish_la-file_parser.lo' libtool=yes @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@	DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@	$(LIBTOOL) $(AM_V_lt) --tag=CXX $(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=compile $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libjellyfish_la_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o jellyfish/libjellyfish_la-file_parser.lo `test -f 'jellyfish/file_parser.cc' || echo '$(srcdir)/'`jellyfish/file_parser.cc
-
-jellyfish/libjellyfish_la-read_parser.lo: jellyfish/read_parser.cc
- at am__fastdepCXX_TRUE@	$(AM_V_CXX)$(LIBTOOL) $(AM_V_lt) --tag=CXX $(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=compile $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libjellyfish_la_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT jellyfish/libjellyfish_la-read_parser.lo -MD -MP -MF jellyfish/$(DEPDIR)/libjellyfish_la-read_parser.Tpo -c -o jellyfish/libjellyfish_la-read_parser.lo `test -f 'jellyfish/read_parser.cc' || echo '$(srcdir)/'`jellyfish/read_parser.cc
- at am__fastdepCXX_TRUE@	$(AM_V_at)$(am__mv) jellyfish/$(DEPDIR)/libjellyfish_la-read_parser.Tpo jellyfish/$(DEPDIR)/libjellyfish_la-read_parser.Plo
- at am__fastdepCXX_FALSE@	$(AM_V_CXX) @AM_BACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@	source='jellyfish/read_parser.cc' object='jellyfish/libjellyfish_la-read_parser.lo' libtool=yes @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@	DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@	$(LIBTOOL) $(AM_V_lt) --tag=CXX $(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=compile $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libjellyfish_la_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o jellyfish/libjellyfish_la-read_parser.lo `test -f 'jellyfish/read_parser.cc' || echo '$(srcdir)/'`jellyfish/read_parser.cc
-
-jellyfish/libjellyfish_la-parse_read.lo: jellyfish/parse_read.cc
- at am__fastdepCXX_TRUE@	$(AM_V_CXX)$(LIBTOOL) $(AM_V_lt) --tag=CXX $(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=compile $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libjellyfish_la_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT jellyfish/libjellyfish_la-parse_read.lo -MD -MP -MF jellyfish/$(DEPDIR)/libjellyfish_la-parse_read.Tpo -c -o jellyfish/libjellyfish_la-parse_read.lo `test -f 'jellyfish/parse_read.cc' || echo '$(srcdir)/'`jellyfish/parse_read.cc
- at am__fastdepCXX_TRUE@	$(AM_V_at)$(am__mv) jellyfish/$(DEPDIR)/libjellyfish_la-parse_read.Tpo jellyfish/$(DEPDIR)/libjellyfish_la-parse_read.Plo
- at am__fastdepCXX_FALSE@	$(AM_V_CXX) @AM_BACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@	source='jellyfish/parse_read.cc' object='jellyfish/libjellyfish_la-parse_read.lo' libtool=yes @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@	DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@	$(LIBTOOL) $(AM_V_lt) --tag=CXX $(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=compile $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libjellyfish_la_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o jellyfish/libjellyfish_la-parse_read.lo `test -f 'jellyfish/parse_read.cc' || echo '$(srcdir)/'`jellyfish/parse_read.cc
-
-jellyfish/libjellyfish_la-half.lo: jellyfish/half.cpp
- at am__fastdepCXX_TRUE@	$(AM_V_CXX)$(LIBTOOL) $(AM_V_lt) --tag=CXX $(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=compile $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libjellyfish_la_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT jellyfish/libjellyfish_la-half.lo -MD -MP -MF jellyfish/$(DEPDIR)/libjellyfish_la-half.Tpo -c -o jellyfish/libjellyfish_la-half.lo `test -f 'jellyfish/half.cpp' || echo '$(srcdir)/'`jellyfish/half.cpp
- at am__fastdepCXX_TRUE@	$(AM_V_at)$(am__mv) jellyfish/$(DEPDIR)/libjellyfish_la-half.Tpo jellyfish/$(DEPDIR)/libjellyfish_la-half.Plo
- at am__fastdepCXX_FALSE@	$(AM_V_CXX) @AM_BACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@	source='jellyfish/half.cpp' object='jellyfish/libjellyfish_la-half.lo' libtool=yes @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCXX_FALSE@	$(AM_V_CXX)source='$<' object='$@' libtool=yes @AMDEPBACKSLASH@
 @AMDEP_TRUE@@am__fastdepCXX_FALSE@	DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@	$(LIBTOOL) $(AM_V_lt) --tag=CXX $(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=compile $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libjellyfish_la_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o jellyfish/libjellyfish_la-half.lo `test -f 'jellyfish/half.cpp' || echo '$(srcdir)/'`jellyfish/half.cpp
+ at am__fastdepCXX_FALSE@	$(AM_V_CXX at am__nodep@)$(LTCXXCOMPILE) -c -o $@ $<
 
-jellyfish/libjellyfish_la-mapped_file.lo: jellyfish/mapped_file.cc
- at am__fastdepCXX_TRUE@	$(AM_V_CXX)$(LIBTOOL) $(AM_V_lt) --tag=CXX $(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=compile $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libjellyfish_la_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT jellyfish/libjellyfish_la-mapped_file.lo -MD -MP -MF jellyfish/$(DEPDIR)/libjellyfish_la-mapped_file.Tpo -c -o jellyfish/libjellyfish_la-mapped_file.lo `test -f 'jellyfish/mapped_file.cc' || echo '$(srcdir)/'`jellyfish/mapped_file.cc
- at am__fastdepCXX_TRUE@	$(AM_V_at)$(am__mv) jellyfish/$(DEPDIR)/libjellyfish_la-mapped_file.Tpo jellyfish/$(DEPDIR)/libjellyfish_la-mapped_file.Plo
- at am__fastdepCXX_FALSE@	$(AM_V_CXX) @AM_BACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@	source='jellyfish/mapped_file.cc' object='jellyfish/libjellyfish_la-mapped_file.lo' libtool=yes @AMDEPBACKSLASH@
+unit_tests/gtest/src/libgtest_a-gtest-all.o: unit_tests/gtest/src/gtest-all.cc
+ at am__fastdepCXX_TRUE@	$(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) $(CPPFLAGS) $(libgtest_a_CXXFLAGS) $(CXXFLAGS) -MT unit_tests/gtest/src/libgtest_a-gtest-all.o -MD -MP -MF unit_tests/gtest/src/$(DEPDIR)/libgtest_a-gtest-all.Tpo -c -o unit_tests/gtest/src/libgtest_a-gtest-all.o `test -f 'unit_tests/gtest/src/gtest-all.cc' || echo '$(srcdir)/'`unit_tests/gtest/src/gtest-all.cc
+ at am__fastdepCXX_TRUE@	$(AM_V_at)$(am__mv) unit_tests/gtest/src/$(DEPDIR)/libgtest_a-gtest-all.Tpo unit_tests/gtest/src/$(DEPDIR)/libgtest_a-gtest-all.Po
+ at AMDEP_TRUE@@am__fastdepCXX_FALSE@	$(AM_V_CXX)source='unit_tests/gtest/src/gtest-all.cc' object='unit_tests/gtest/src/libgtest_a-gtest-all.o' libtool=no @AMDEPBACKSLASH@
 @AMDEP_TRUE@@am__fastdepCXX_FALSE@	DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@	$(LIBTOOL) $(AM_V_lt) --tag=CXX $(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=compile $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libjellyfish_la_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o jellyfish/libjellyfish_la-mapped_file.lo `test -f 'jellyfish/mapped_file.cc' || echo '$(srcdir)/'`jellyfish/mapped_file.cc
+ at am__fastdepCXX_FALSE@	$(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) $(CPPFLAGS) $(libgtest_a_CXXFLAGS) $(CXXFLAGS) -c -o unit_tests/gtest/src/libgtest_a-gtest-all.o `test -f 'unit_tests/gtest/src/gtest-all.cc' || echo '$(srcdir)/'`unit_tests/gtest/src/gtest-all.cc
 
-jellyfish/libjellyfish_la-parse_dna.lo: jellyfish/parse_dna.cc
- at am__fastdepCXX_TRUE@	$(AM_V_CXX)$(LIBTOOL) $(AM_V_lt) --tag=CXX $(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=compile $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libjellyfish_la_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT jellyfish/libjellyfish_la-parse_dna.lo -MD -MP -MF jellyfish/$(DEPDIR)/libjellyfish_la-parse_dna.Tpo -c -o jellyfish/libjellyfish_la-parse_dna.lo `test -f 'jellyfish/parse_dna.cc' || echo '$(srcdir)/'`jellyfish/parse_dna.cc
- at am__fastdepCXX_TRUE@	$(AM_V_at)$(am__mv) jellyfish/$(DEPDIR)/libjellyfish_la-parse_dna.Tpo jellyfish/$(DEPDIR)/libjellyfish_la-parse_dna.Plo
- at am__fastdepCXX_FALSE@	$(AM_V_CXX) @AM_BACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@	source='jellyfish/parse_dna.cc' object='jellyfish/libjellyfish_la-parse_dna.lo' libtool=yes @AMDEPBACKSLASH@
+unit_tests/gtest/src/libgtest_a-gtest-all.obj: unit_tests/gtest/src/gtest-all.cc
+ at am__fastdepCXX_TRUE@	$(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) $(CPPFLAGS) $(libgtest_a_CXXFLAGS) $(CXXFLAGS) -MT unit_tests/gtest/src/libgtest_a-gtest-all.obj -MD -MP -MF unit_tests/gtest/src/$(DEPDIR)/libgtest_a-gtest-all.Tpo -c -o unit_tests/gtest/src/libgtest_a-gtest-all.obj `if test -f 'unit_tests/gtest/src/gtest-all.cc'; then $(CYGPATH_W) 'unit_tests/gtest/src/gtest-all.cc'; else $(CYGPATH_W) '$(srcdir)/unit_tests/gtest/src/gtest-all.cc'; fi`
+ at am__fastdepCXX_TRUE@	$(AM_V_at)$(am__mv) unit_tests/gtest/src/$(DEPDIR)/libgtest_a-gtest-all.Tpo unit_tests/gtest/src/$(DEPDIR)/libgtest_a-gtest-all.Po
+ at AMDEP_TRUE@@am__fastdepCXX_FALSE@	$(AM_V_CXX)source='unit_tests/gtest/src/gtest-all.cc' object='unit_tests/gtest/src/libgtest_a-gtest-all.obj' libtool=no @AMDEPBACKSLASH@
 @AMDEP_TRUE@@am__fastdepCXX_FALSE@	DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@	$(LIBTOOL) $(AM_V_lt) --tag=CXX $(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=compile $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libjellyfish_la_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o jellyfish/libjellyfish_la-parse_dna.lo `test -f 'jellyfish/parse_dna.cc' || echo '$(srcdir)/'`jellyfish/parse_dna.cc
+ at am__fastdepCXX_FALSE@	$(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) $(CPPFLAGS) $(libgtest_a_CXXFLAGS) $(CXXFLAGS) -c -o unit_tests/gtest/src/libgtest_a-gtest-all.obj `if test -f 'unit_tests/gtest/src/gtest-all.cc'; then $(CYGPATH_W) 'unit_tests/gtest/src/gtest-all.cc'; else $(CYGPATH_W) '$(srcdir)/unit_tests/gtest/src/gtest-all.cc'; fi`
 
-jellyfish/libjellyfish_la-parse_quake.lo: jellyfish/parse_quake.cc
- at am__fastdepCXX_TRUE@	$(AM_V_CXX)$(LIBTOOL) $(AM_V_lt) --tag=CXX $(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=compile $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libjellyfish_la_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT jellyfish/libjellyfish_la-parse_quake.lo -MD -MP -MF jellyfish/$(DEPDIR)/libjellyfish_la-parse_quake.Tpo -c -o jellyfish/libjellyfish_la-parse_quake.lo `test -f 'jellyfish/parse_quake.cc' || echo '$(srcdir)/'`jellyfish/parse_quake.cc
- at am__fastdepCXX_TRUE@	$(AM_V_at)$(am__mv) jellyfish/$(DEPDIR)/libjellyfish_la-parse_quake.Tpo jellyfish/$(DEPDIR)/libjellyfish_la-parse_quake.Plo
- at am__fastdepCXX_FALSE@	$(AM_V_CXX) @AM_BACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@	source='jellyfish/parse_quake.cc' object='jellyfish/libjellyfish_la-parse_quake.lo' libtool=yes @AMDEPBACKSLASH@
+unit_tests/gtest/src/libgtest_main_a-gtest_main.o: unit_tests/gtest/src/gtest_main.cc
+ at am__fastdepCXX_TRUE@	$(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) $(CPPFLAGS) $(libgtest_main_a_CXXFLAGS) $(CXXFLAGS) -MT unit_tests/gtest/src/libgtest_main_a-gtest_main.o -MD -MP -MF unit_tests/gtest/src/$(DEPDIR)/libgtest_main_a-gtest_main.Tpo -c -o unit_tests/gtest/src/libgtest_main_a-gtest_main.o `test -f 'unit_tests/gtest/src/gtest_main.cc' || echo '$(srcdir)/'`unit_tests/gtest/src/gtest_main.cc
+ at am__fastdepCXX_TRUE@	$(AM_V_at)$(am__mv) unit_tests/gtest/src/$(DEPDIR)/libgtest_main_a-gtest_main.Tpo unit_tests/gtest/src/$(DEPDIR)/libgtest_main_a-gtest_main.Po
+ at AMDEP_TRUE@@am__fastdepCXX_FALSE@	$(AM_V_CXX)source='unit_tests/gtest/src/gtest_main.cc' object='unit_tests/gtest/src/libgtest_main_a-gtest_main.o' libtool=no @AMDEPBACKSLASH@
 @AMDEP_TRUE@@am__fastdepCXX_FALSE@	DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@	$(LIBTOOL) $(AM_V_lt) --tag=CXX $(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=compile $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libjellyfish_la_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o jellyfish/libjellyfish_la-parse_quake.lo `test -f 'jellyfish/parse_quake.cc' || echo '$(srcdir)/'`jellyfish/parse_quake.cc
+ at am__fastdepCXX_FALSE@	$(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) $(CPPFLAGS) $(libgtest_main_a_CXXFLAGS) $(CXXFLAGS) -c -o unit_tests/gtest/src/libgtest_main_a-gtest_main.o `test -f 'unit_tests/gtest/src/gtest_main.cc' || echo '$(srcdir)/'`unit_tests/gtest/src/gtest_main.cc
 
-jellyfish/libjellyfish_la-parse_qual_dna.lo: jellyfish/parse_qual_dna.cc
- at am__fastdepCXX_TRUE@	$(AM_V_CXX)$(LIBTOOL) $(AM_V_lt) --tag=CXX $(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=compile $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libjellyfish_la_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT jellyfish/libjellyfish_la-parse_qual_dna.lo -MD -MP -MF jellyfish/$(DEPDIR)/libjellyfish_la-parse_qual_dna.Tpo -c -o jellyfish/libjellyfish_la-parse_qual_dna.lo `test -f 'jellyfish/parse_qual_dna.cc' || echo '$(srcdir)/'`jellyfish/parse_qual_dna.cc
- at am__fastdepCXX_TRUE@	$(AM_V_at)$(am__mv) jellyfish/$(DEPDIR)/libjellyfish_la-parse_qual_dna.Tpo jellyfish/$(DEPDIR)/libjellyfish_la-parse_qual_dna.Plo
- at am__fastdepCXX_FALSE@	$(AM_V_CXX) @AM_BACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@	source='jellyfish/parse_qual_dna.cc' object='jellyfish/libjellyfish_la-parse_qual_dna.lo' libtool=yes @AMDEPBACKSLASH@
+unit_tests/gtest/src/libgtest_main_a-gtest_main.obj: unit_tests/gtest/src/gtest_main.cc
+ at am__fastdepCXX_TRUE@	$(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) $(CPPFLAGS) $(libgtest_main_a_CXXFLAGS) $(CXXFLAGS) -MT unit_tests/gtest/src/libgtest_main_a-gtest_main.obj -MD -MP -MF unit_tests/gtest/src/$(DEPDIR)/libgtest_main_a-gtest_main.Tpo -c -o unit_tests/gtest/src/libgtest_main_a-gtest_main.obj `if test -f 'unit_tests/gtest/src/gtest_main.cc'; then $(CYGPATH_W) 'unit_tests/gtest/src/gtest_main.cc'; else $(CYGPATH_W) '$(srcdir)/unit_tests/gtest/src/g [...]
+ at am__fastdepCXX_TRUE@	$(AM_V_at)$(am__mv) unit_tests/gtest/src/$(DEPDIR)/libgtest_main_a-gtest_main.Tpo unit_tests/gtest/src/$(DEPDIR)/libgtest_main_a-gtest_main.Po
+ at AMDEP_TRUE@@am__fastdepCXX_FALSE@	$(AM_V_CXX)source='unit_tests/gtest/src/gtest_main.cc' object='unit_tests/gtest/src/libgtest_main_a-gtest_main.obj' libtool=no @AMDEPBACKSLASH@
 @AMDEP_TRUE@@am__fastdepCXX_FALSE@	DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@	$(LIBTOOL) $(AM_V_lt) --tag=CXX $(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=compile $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libjellyfish_la_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o jellyfish/libjellyfish_la-parse_qual_dna.lo `test -f 'jellyfish/parse_qual_dna.cc' || echo '$(srcdir)/'`jellyfish/parse_qual_dna.cc
+ at am__fastdepCXX_FALSE@	$(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) $(CPPFLAGS) $(libgtest_main_a_CXXFLAGS) $(CXXFLAGS) -c -o unit_tests/gtest/src/libgtest_main_a-gtest_main.obj `if test -f 'unit_tests/gtest/src/gtest_main.cc'; then $(CYGPATH_W) 'unit_tests/gtest/src/gtest_main.cc'; else $(CYGPATH_W) '$(srcdir)/unit_tests/gtest/src/gtest_main.cc'; fi`
 
-jellyfish/libjellyfish_la-sequence_parser.lo: jellyfish/sequence_parser.cc
- at am__fastdepCXX_TRUE@	$(AM_V_CXX)$(LIBTOOL) $(AM_V_lt) --tag=CXX $(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=compile $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libjellyfish_la_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT jellyfish/libjellyfish_la-sequence_parser.lo -MD -MP -MF jellyfish/$(DEPDIR)/libjellyfish_la-sequence_parser.Tpo -c -o jellyfish/libjellyfish_la-sequence_parser.lo `test -f 'jellyfish/sequence_parser.cc' || echo '$(srcdir)/'`jellyfish/sequence_parser.cc
- at am__fastdepCXX_TRUE@	$(AM_V_at)$(am__mv) jellyfish/$(DEPDIR)/libjellyfish_la-sequence_parser.Tpo jellyfish/$(DEPDIR)/libjellyfish_la-sequence_parser.Plo
- at am__fastdepCXX_FALSE@	$(AM_V_CXX) @AM_BACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@	source='jellyfish/sequence_parser.cc' object='jellyfish/libjellyfish_la-sequence_parser.lo' libtool=yes @AMDEPBACKSLASH@
+unit_tests/bin_test_all-test_offsets_key_value.o: unit_tests/test_offsets_key_value.cc
+ at am__fastdepCXX_TRUE@	$(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) $(CPPFLAGS) $(bin_test_all_CXXFLAGS) $(CXXFLAGS) -MT unit_tests/bin_test_all-test_offsets_key_value.o -MD -MP -MF unit_tests/$(DEPDIR)/bin_test_all-test_offsets_key_value.Tpo -c -o unit_tests/bin_test_all-test_offsets_key_value.o `test -f 'unit_tests/test_offsets_key_value.cc' || echo '$(srcdir)/'`unit_tests/test_offsets_key_value.cc
+ at am__fastdepCXX_TRUE@	$(AM_V_at)$(am__mv) unit_tests/$(DEPDIR)/bin_test_all-test_offsets_key_value.Tpo unit_tests/$(DEPDIR)/bin_test_all-test_offsets_key_value.Po
+ at AMDEP_TRUE@@am__fastdepCXX_FALSE@	$(AM_V_CXX)source='unit_tests/test_offsets_key_value.cc' object='unit_tests/bin_test_all-test_offsets_key_value.o' libtool=no @AMDEPBACKSLASH@
 @AMDEP_TRUE@@am__fastdepCXX_FALSE@	DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@	$(LIBTOOL) $(AM_V_lt) --tag=CXX $(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=compile $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libjellyfish_la_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o jellyfish/libjellyfish_la-sequence_parser.lo `test -f 'jellyfish/sequence_parser.cc' || echo '$(srcdir)/'`jellyfish/sequence_parser.cc
+ at am__fastdepCXX_FALSE@	$(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) $(CPPFLAGS) $(bin_test_all_CXXFLAGS) $(CXXFLAGS) -c -o unit_tests/bin_test_all-test_offsets_key_value.o `test -f 'unit_tests/test_offsets_key_value.cc' || echo '$(srcdir)/'`unit_tests/test_offsets_key_value.cc
 
-jellyfish/libjellyfish_la-seq_qual_parser.lo: jellyfish/seq_qual_parser.cc
- at am__fastdepCXX_TRUE@	$(AM_V_CXX)$(LIBTOOL) $(AM_V_lt) --tag=CXX $(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=compile $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libjellyfish_la_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT jellyfish/libjellyfish_la-seq_qual_parser.lo -MD -MP -MF jellyfish/$(DEPDIR)/libjellyfish_la-seq_qual_parser.Tpo -c -o jellyfish/libjellyfish_la-seq_qual_parser.lo `test -f 'jellyfish/seq_qual_parser.cc' || echo '$(srcdir)/'`jellyfish/seq_qual_parser.cc
- at am__fastdepCXX_TRUE@	$(AM_V_at)$(am__mv) jellyfish/$(DEPDIR)/libjellyfish_la-seq_qual_parser.Tpo jellyfish/$(DEPDIR)/libjellyfish_la-seq_qual_parser.Plo
- at am__fastdepCXX_FALSE@	$(AM_V_CXX) @AM_BACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@	source='jellyfish/seq_qual_parser.cc' object='jellyfish/libjellyfish_la-seq_qual_parser.lo' libtool=yes @AMDEPBACKSLASH@
+unit_tests/bin_test_all-test_offsets_key_value.obj: unit_tests/test_offsets_key_value.cc
+ at am__fastdepCXX_TRUE@	$(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) $(CPPFLAGS) $(bin_test_all_CXXFLAGS) $(CXXFLAGS) -MT unit_tests/bin_test_all-test_offsets_key_value.obj -MD -MP -MF unit_tests/$(DEPDIR)/bin_test_all-test_offsets_key_value.Tpo -c -o unit_tests/bin_test_all-test_offsets_key_value.obj `if test -f 'unit_tests/test_offsets_key_value.cc'; then $(CYGPATH_W) 'unit_tests/test_offsets_key_value.cc'; else $(CYGPATH_W) '$(srcdir)/unit_tests/test_offsets_ [...]
+ at am__fastdepCXX_TRUE@	$(AM_V_at)$(am__mv) unit_tests/$(DEPDIR)/bin_test_all-test_offsets_key_value.Tpo unit_tests/$(DEPDIR)/bin_test_all-test_offsets_key_value.Po
+ at AMDEP_TRUE@@am__fastdepCXX_FALSE@	$(AM_V_CXX)source='unit_tests/test_offsets_key_value.cc' object='unit_tests/bin_test_all-test_offsets_key_value.obj' libtool=no @AMDEPBACKSLASH@
 @AMDEP_TRUE@@am__fastdepCXX_FALSE@	DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@	$(LIBTOOL) $(AM_V_lt) --tag=CXX $(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=compile $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libjellyfish_la_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o jellyfish/libjellyfish_la-seq_qual_parser.lo `test -f 'jellyfish/seq_qual_parser.cc' || echo '$(srcdir)/'`jellyfish/seq_qual_parser.cc
+ at am__fastdepCXX_FALSE@	$(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) $(CPPFLAGS) $(bin_test_all_CXXFLAGS) $(CXXFLAGS) -c -o unit_tests/bin_test_all-test_offsets_key_value.obj `if test -f 'unit_tests/test_offsets_key_value.cc'; then $(CYGPATH_W) 'unit_tests/test_offsets_key_value.cc'; else $(CYGPATH_W) '$(srcdir)/unit_tests/test_offsets_key_value.cc'; fi`
 
-jellyfish/libjellyfish_la-backtrace.lo: jellyfish/backtrace.cc
- at am__fastdepCXX_TRUE@	$(AM_V_CXX)$(LIBTOOL) $(AM_V_lt) --tag=CXX $(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=compile $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libjellyfish_la_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT jellyfish/libjellyfish_la-backtrace.lo -MD -MP -MF jellyfish/$(DEPDIR)/libjellyfish_la-backtrace.Tpo -c -o jellyfish/libjellyfish_la-backtrace.lo `test -f 'jellyfish/backtrace.cc' || echo '$(srcdir)/'`jellyfish/backtrace.cc
- at am__fastdepCXX_TRUE@	$(AM_V_at)$(am__mv) jellyfish/$(DEPDIR)/libjellyfish_la-backtrace.Tpo jellyfish/$(DEPDIR)/libjellyfish_la-backtrace.Plo
- at am__fastdepCXX_FALSE@	$(AM_V_CXX) @AM_BACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@	source='jellyfish/backtrace.cc' object='jellyfish/libjellyfish_la-backtrace.lo' libtool=yes @AMDEPBACKSLASH@
+unit_tests/bin_test_all-test_simple_circular_buffer.o: unit_tests/test_simple_circular_buffer.cc
+ at am__fastdepCXX_TRUE@	$(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) $(CPPFLAGS) $(bin_test_all_CXXFLAGS) $(CXXFLAGS) -MT unit_tests/bin_test_all-test_simple_circular_buffer.o -MD -MP -MF unit_tests/$(DEPDIR)/bin_test_all-test_simple_circular_buffer.Tpo -c -o unit_tests/bin_test_all-test_simple_circular_buffer.o `test -f 'unit_tests/test_simple_circular_buffer.cc' || echo '$(srcdir)/'`unit_tests/test_simple_circular_buffer.cc
+ at am__fastdepCXX_TRUE@	$(AM_V_at)$(am__mv) unit_tests/$(DEPDIR)/bin_test_all-test_simple_circular_buffer.Tpo unit_tests/$(DEPDIR)/bin_test_all-test_simple_circular_buffer.Po
+ at AMDEP_TRUE@@am__fastdepCXX_FALSE@	$(AM_V_CXX)source='unit_tests/test_simple_circular_buffer.cc' object='unit_tests/bin_test_all-test_simple_circular_buffer.o' libtool=no @AMDEPBACKSLASH@
 @AMDEP_TRUE@@am__fastdepCXX_FALSE@	DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@	$(LIBTOOL) $(AM_V_lt) --tag=CXX $(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=compile $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libjellyfish_la_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o jellyfish/libjellyfish_la-backtrace.lo `test -f 'jellyfish/backtrace.cc' || echo '$(srcdir)/'`jellyfish/backtrace.cc
+ at am__fastdepCXX_FALSE@	$(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) $(CPPFLAGS) $(bin_test_all_CXXFLAGS) $(CXXFLAGS) -c -o unit_tests/bin_test_all-test_simple_circular_buffer.o `test -f 'unit_tests/test_simple_circular_buffer.cc' || echo '$(srcdir)/'`unit_tests/test_simple_circular_buffer.cc
 
-jellyfish/libjellyfish_la-floats.lo: jellyfish/floats.cc
- at am__fastdepCXX_TRUE@	$(AM_V_CXX)$(LIBTOOL) $(AM_V_lt) --tag=CXX $(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=compile $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libjellyfish_la_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT jellyfish/libjellyfish_la-floats.lo -MD -MP -MF jellyfish/$(DEPDIR)/libjellyfish_la-floats.Tpo -c -o jellyfish/libjellyfish_la-floats.lo `test -f 'jellyfish/floats.cc' || echo '$(srcdir)/'`jellyfish/floats.cc
- at am__fastdepCXX_TRUE@	$(AM_V_at)$(am__mv) jellyfish/$(DEPDIR)/libjellyfish_la-floats.Tpo jellyfish/$(DEPDIR)/libjellyfish_la-floats.Plo
- at am__fastdepCXX_FALSE@	$(AM_V_CXX) @AM_BACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@	source='jellyfish/floats.cc' object='jellyfish/libjellyfish_la-floats.lo' libtool=yes @AMDEPBACKSLASH@
+unit_tests/bin_test_all-test_simple_circular_buffer.obj: unit_tests/test_simple_circular_buffer.cc
+ at am__fastdepCXX_TRUE@	$(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) $(CPPFLAGS) $(bin_test_all_CXXFLAGS) $(CXXFLAGS) -MT unit_tests/bin_test_all-test_simple_circular_buffer.obj -MD -MP -MF unit_tests/$(DEPDIR)/bin_test_all-test_simple_circular_buffer.Tpo -c -o unit_tests/bin_test_all-test_simple_circular_buffer.obj `if test -f 'unit_tests/test_simple_circular_buffer.cc'; then $(CYGPATH_W) 'unit_tests/test_simple_circular_buffer.cc'; else $(CYGPATH_W) '$(srcdir) [...]
+ at am__fastdepCXX_TRUE@	$(AM_V_at)$(am__mv) unit_tests/$(DEPDIR)/bin_test_all-test_simple_circular_buffer.Tpo unit_tests/$(DEPDIR)/bin_test_all-test_simple_circular_buffer.Po
+ at AMDEP_TRUE@@am__fastdepCXX_FALSE@	$(AM_V_CXX)source='unit_tests/test_simple_circular_buffer.cc' object='unit_tests/bin_test_all-test_simple_circular_buffer.obj' libtool=no @AMDEPBACKSLASH@
 @AMDEP_TRUE@@am__fastdepCXX_FALSE@	DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@	$(LIBTOOL) $(AM_V_lt) --tag=CXX $(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=compile $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libjellyfish_la_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o jellyfish/libjellyfish_la-floats.lo `test -f 'jellyfish/floats.cc' || echo '$(srcdir)/'`jellyfish/floats.cc
+ at am__fastdepCXX_FALSE@	$(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) $(CPPFLAGS) $(bin_test_all_CXXFLAGS) $(CXXFLAGS) -c -o unit_tests/bin_test_all-test_simple_circular_buffer.obj `if test -f 'unit_tests/test_simple_circular_buffer.cc'; then $(CYGPATH_W) 'unit_tests/test_simple_circular_buffer.cc'; else $(CYGPATH_W) '$(srcdir)/unit_tests/test_simple_circular_buffer.cc'; fi`
 
-jellyfish/libjellyfish_la-dbg.lo: jellyfish/dbg.cc
- at am__fastdepCXX_TRUE@	$(AM_V_CXX)$(LIBTOOL) $(AM_V_lt) --tag=CXX $(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=compile $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libjellyfish_la_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT jellyfish/libjellyfish_la-dbg.lo -MD -MP -MF jellyfish/$(DEPDIR)/libjellyfish_la-dbg.Tpo -c -o jellyfish/libjellyfish_la-dbg.lo `test -f 'jellyfish/dbg.cc' || echo '$(srcdir)/'`jellyfish/dbg.cc
- at am__fastdepCXX_TRUE@	$(AM_V_at)$(am__mv) jellyfish/$(DEPDIR)/libjellyfish_la-dbg.Tpo jellyfish/$(DEPDIR)/libjellyfish_la-dbg.Plo
- at am__fastdepCXX_FALSE@	$(AM_V_CXX) @AM_BACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@	source='jellyfish/dbg.cc' object='jellyfish/libjellyfish_la-dbg.lo' libtool=yes @AMDEPBACKSLASH@
+unit_tests/bin_test_all-test_square_binary_matrix.o: unit_tests/test_square_binary_matrix.cc
+ at am__fastdepCXX_TRUE@	$(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) $(CPPFLAGS) $(bin_test_all_CXXFLAGS) $(CXXFLAGS) -MT unit_tests/bin_test_all-test_square_binary_matrix.o -MD -MP -MF unit_tests/$(DEPDIR)/bin_test_all-test_square_binary_matrix.Tpo -c -o unit_tests/bin_test_all-test_square_binary_matrix.o `test -f 'unit_tests/test_square_binary_matrix.cc' || echo '$(srcdir)/'`unit_tests/test_square_binary_matrix.cc
+ at am__fastdepCXX_TRUE@	$(AM_V_at)$(am__mv) unit_tests/$(DEPDIR)/bin_test_all-test_square_binary_matrix.Tpo unit_tests/$(DEPDIR)/bin_test_all-test_square_binary_matrix.Po
+ at AMDEP_TRUE@@am__fastdepCXX_FALSE@	$(AM_V_CXX)source='unit_tests/test_square_binary_matrix.cc' object='unit_tests/bin_test_all-test_square_binary_matrix.o' libtool=no @AMDEPBACKSLASH@
 @AMDEP_TRUE@@am__fastdepCXX_FALSE@	DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@	$(LIBTOOL) $(AM_V_lt) --tag=CXX $(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=compile $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libjellyfish_la_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o jellyfish/libjellyfish_la-dbg.lo `test -f 'jellyfish/dbg.cc' || echo '$(srcdir)/'`jellyfish/dbg.cc
+ at am__fastdepCXX_FALSE@	$(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) $(CPPFLAGS) $(bin_test_all_CXXFLAGS) $(CXXFLAGS) -c -o unit_tests/bin_test_all-test_square_binary_matrix.o `test -f 'unit_tests/test_square_binary_matrix.cc' || echo '$(srcdir)/'`unit_tests/test_square_binary_matrix.cc
 
-jellyfish/libjellyfish_la-allocators_mmap.lo: jellyfish/allocators_mmap.cc
- at am__fastdepCXX_TRUE@	$(AM_V_CXX)$(LIBTOOL) $(AM_V_lt) --tag=CXX $(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=compile $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libjellyfish_la_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT jellyfish/libjellyfish_la-allocators_mmap.lo -MD -MP -MF jellyfish/$(DEPDIR)/libjellyfish_la-allocators_mmap.Tpo -c -o jellyfish/libjellyfish_la-allocators_mmap.lo `test -f 'jellyfish/allocators_mmap.cc' || echo '$(srcdir)/'`jellyfish/allocators_mmap.cc
- at am__fastdepCXX_TRUE@	$(AM_V_at)$(am__mv) jellyfish/$(DEPDIR)/libjellyfish_la-allocators_mmap.Tpo jellyfish/$(DEPDIR)/libjellyfish_la-allocators_mmap.Plo
- at am__fastdepCXX_FALSE@	$(AM_V_CXX) @AM_BACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@	source='jellyfish/allocators_mmap.cc' object='jellyfish/libjellyfish_la-allocators_mmap.lo' libtool=yes @AMDEPBACKSLASH@
+unit_tests/bin_test_all-test_square_binary_matrix.obj: unit_tests/test_square_binary_matrix.cc
+ at am__fastdepCXX_TRUE@	$(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) $(CPPFLAGS) $(bin_test_all_CXXFLAGS) $(CXXFLAGS) -MT unit_tests/bin_test_all-test_square_binary_matrix.obj -MD -MP -MF unit_tests/$(DEPDIR)/bin_test_all-test_square_binary_matrix.Tpo -c -o unit_tests/bin_test_all-test_square_binary_matrix.obj `if test -f 'unit_tests/test_square_binary_matrix.cc'; then $(CYGPATH_W) 'unit_tests/test_square_binary_matrix.cc'; else $(CYGPATH_W) '$(srcdir)/unit_test [...]
+ at am__fastdepCXX_TRUE@	$(AM_V_at)$(am__mv) unit_tests/$(DEPDIR)/bin_test_all-test_square_binary_matrix.Tpo unit_tests/$(DEPDIR)/bin_test_all-test_square_binary_matrix.Po
+ at AMDEP_TRUE@@am__fastdepCXX_FALSE@	$(AM_V_CXX)source='unit_tests/test_square_binary_matrix.cc' object='unit_tests/bin_test_all-test_square_binary_matrix.obj' libtool=no @AMDEPBACKSLASH@
 @AMDEP_TRUE@@am__fastdepCXX_FALSE@	DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@	$(LIBTOOL) $(AM_V_lt) --tag=CXX $(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=compile $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libjellyfish_la_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o jellyfish/libjellyfish_la-allocators_mmap.lo `test -f 'jellyfish/allocators_mmap.cc' || echo '$(srcdir)/'`jellyfish/allocators_mmap.cc
-
-jellyfish/libjellyfish_la-dna_codes.lo: jellyfish/dna_codes.cc
- at am__fastdepCXX_TRUE@	$(AM_V_CXX)$(LIBTOOL) $(AM_V_lt) --tag=CXX $(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=compile $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libjellyfish_la_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT jellyfish/libjellyfish_la-dna_codes.lo -MD -MP -MF jellyfish/$(DEPDIR)/libjellyfish_la-dna_codes.Tpo -c -o jellyfish/libjellyfish_la-dna_codes.lo `test -f 'jellyfish/dna_codes.cc' || echo '$(srcdir)/'`jellyfish/dna_codes.cc
- at am__fastdepCXX_TRUE@	$(AM_V_at)$(am__mv) jellyfish/$(DEPDIR)/libjellyfish_la-dna_codes.Tpo jellyfish/$(DEPDIR)/libjellyfish_la-dna_codes.Plo
- at am__fastdepCXX_FALSE@	$(AM_V_CXX) @AM_BACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@	source='jellyfish/dna_codes.cc' object='jellyfish/libjellyfish_la-dna_codes.lo' libtool=yes @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@	DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@	$(LIBTOOL) $(AM_V_lt) --tag=CXX $(AM_LIBTOOLFLAGS) $(LIBTOOLFLAGS) --mode=compile $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libjellyfish_la_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o jellyfish/libjellyfish_la-dna_codes.lo `test -f 'jellyfish/dna_codes.cc' || echo '$(srcdir)/'`jellyfish/dna_codes.cc
-
-unit_tests/bin_test_offsets_key_value-test_offsets_key_value.o: unit_tests/test_offsets_key_value.cc
- at am__fastdepCXX_TRUE@	$(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) $(CPPFLAGS) $(bin_test_offsets_key_value_CXXFLAGS) $(CXXFLAGS) -MT unit_tests/bin_test_offsets_key_value-test_offsets_key_value.o -MD -MP -MF unit_tests/$(DEPDIR)/bin_test_offsets_key_value-test_offsets_key_value.Tpo -c -o unit_tests/bin_test_offsets_key_value-test_offsets_key_value.o `test -f 'unit_tests/test_offsets_key_value.cc' || echo '$(srcdir)/'`unit_tests/test_offsets_key_value.cc
- at am__fastdepCXX_TRUE@	$(AM_V_at)$(am__mv) unit_tests/$(DEPDIR)/bin_test_offsets_key_value-test_offsets_key_value.Tpo unit_tests/$(DEPDIR)/bin_test_offsets_key_value-test_offsets_key_value.Po
- at am__fastdepCXX_FALSE@	$(AM_V_CXX) @AM_BACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@	source='unit_tests/test_offsets_key_value.cc' object='unit_tests/bin_test_offsets_key_value-test_offsets_key_value.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@	DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@	$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) $(CPPFLAGS) $(bin_test_offsets_key_value_CXXFLAGS) $(CXXFLAGS) -c -o unit_tests/bin_test_offsets_key_value-test_offsets_key_value.o `test -f 'unit_tests/test_offsets_key_value.cc' || echo '$(srcdir)/'`unit_tests/test_offsets_key_value.cc
-
-unit_tests/bin_test_offsets_key_value-test_offsets_key_value.obj: unit_tests/test_offsets_key_value.cc
- at am__fastdepCXX_TRUE@	$(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) $(CPPFLAGS) $(bin_test_offsets_key_value_CXXFLAGS) $(CXXFLAGS) -MT unit_tests/bin_test_offsets_key_value-test_offsets_key_value.obj -MD -MP -MF unit_tests/$(DEPDIR)/bin_test_offsets_key_value-test_offsets_key_value.Tpo -c -o unit_tests/bin_test_offsets_key_value-test_offsets_key_value.obj `if test -f 'unit_tests/test_offsets_key_value.cc'; then $(CYGPATH_W) 'unit_tests/test_offsets_key_value.cc [...]
- at am__fastdepCXX_TRUE@	$(AM_V_at)$(am__mv) unit_tests/$(DEPDIR)/bin_test_offsets_key_value-test_offsets_key_value.Tpo unit_tests/$(DEPDIR)/bin_test_offsets_key_value-test_offsets_key_value.Po
- at am__fastdepCXX_FALSE@	$(AM_V_CXX) @AM_BACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@	source='unit_tests/test_offsets_key_value.cc' object='unit_tests/bin_test_offsets_key_value-test_offsets_key_value.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@	DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@	$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) $(CPPFLAGS) $(bin_test_offsets_key_value_CXXFLAGS) $(CXXFLAGS) -c -o unit_tests/bin_test_offsets_key_value-test_offsets_key_value.obj `if test -f 'unit_tests/test_offsets_key_value.cc'; then $(CYGPATH_W) 'unit_tests/test_offsets_key_value.cc'; else $(CYGPATH_W) '$(srcdir)/unit_tests/test_offsets_key_value.cc'; fi`
+ at am__fastdepCXX_FALSE@	$(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) $(CPPFLAGS) $(bin_test_all_CXXFLAGS) $(CXXFLAGS) -c -o unit_tests/bin_test_all-test_square_binary_matrix.obj `if test -f 'unit_tests/test_square_binary_matrix.cc'; then $(CYGPATH_W) 'unit_tests/test_square_binary_matrix.cc'; else $(CYGPATH_W) '$(srcdir)/unit_tests/test_square_binary_matrix.cc'; fi`
 
 .cpp.o:
 @am__fastdepCXX_TRUE@	$(AM_V_CXX)depbase=`echo $@ | sed 's|[^/]*$$|$(DEPDIR)/&|;s|\.o$$||'`;\
 @am__fastdepCXX_TRUE@	$(CXXCOMPILE) -MT $@ -MD -MP -MF $$depbase.Tpo -c -o $@ $< &&\
 @am__fastdepCXX_TRUE@	$(am__mv) $$depbase.Tpo $$depbase.Po
- at am__fastdepCXX_FALSE@	$(AM_V_CXX) @AM_BACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@	source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCXX_FALSE@	$(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
 @AMDEP_TRUE@@am__fastdepCXX_FALSE@	DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@	$(CXXCOMPILE) -c -o $@ $<
+ at am__fastdepCXX_FALSE@	$(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ $<
 
 .cpp.obj:
 @am__fastdepCXX_TRUE@	$(AM_V_CXX)depbase=`echo $@ | sed 's|[^/]*$$|$(DEPDIR)/&|;s|\.obj$$||'`;\
 @am__fastdepCXX_TRUE@	$(CXXCOMPILE) -MT $@ -MD -MP -MF $$depbase.Tpo -c -o $@ `$(CYGPATH_W) '$<'` &&\
 @am__fastdepCXX_TRUE@	$(am__mv) $$depbase.Tpo $$depbase.Po
- at am__fastdepCXX_FALSE@	$(AM_V_CXX) @AM_BACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@	source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCXX_FALSE@	$(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
 @AMDEP_TRUE@@am__fastdepCXX_FALSE@	DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@	$(CXXCOMPILE) -c -o $@ `$(CYGPATH_W) '$<'`
+ at am__fastdepCXX_FALSE@	$(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ `$(CYGPATH_W) '$<'`
 
 .cpp.lo:
 @am__fastdepCXX_TRUE@	$(AM_V_CXX)depbase=`echo $@ | sed 's|[^/]*$$|$(DEPDIR)/&|;s|\.lo$$||'`;\
 @am__fastdepCXX_TRUE@	$(LTCXXCOMPILE) -MT $@ -MD -MP -MF $$depbase.Tpo -c -o $@ $< &&\
 @am__fastdepCXX_TRUE@	$(am__mv) $$depbase.Tpo $$depbase.Plo
- at am__fastdepCXX_FALSE@	$(AM_V_CXX) @AM_BACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@	source='$<' object='$@' libtool=yes @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCXX_FALSE@	$(AM_V_CXX)source='$<' object='$@' libtool=yes @AMDEPBACKSLASH@
 @AMDEP_TRUE@@am__fastdepCXX_FALSE@	DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@	$(LTCXXCOMPILE) -c -o $@ $<
+ at am__fastdepCXX_FALSE@	$(AM_V_CXX at am__nodep@)$(LTCXXCOMPILE) -c -o $@ $<
 
 mostlyclean-libtool:
 	-rm -f *.lo
@@ -1379,15 +1190,23 @@ clean-libtool:
 	-rm -rf .libs _libs
 	-rm -rf bin/.libs bin/_libs
 	-rm -rf jellyfish/.libs jellyfish/_libs
-	-rm -rf unit_tests/gtest/src/.libs unit_tests/gtest/src/_libs
 
 distclean-libtool:
 	-rm -f libtool config.lt
 install-man1: $(man1_MANS)
 	@$(NORMAL_INSTALL)
-	test -z "$(man1dir)" || $(MKDIR_P) "$(DESTDIR)$(man1dir)"
-	@list='$(man1_MANS)'; test -n "$(man1dir)" || exit 0; \
-	{ for i in $$list; do echo "$$i"; done; \
+	@list1='$(man1_MANS)'; \
+	list2=''; \
+	test -n "$(man1dir)" \
+	  && test -n "`echo $$list1$$list2`" \
+	  || exit 0; \
+	echo " $(MKDIR_P) '$(DESTDIR)$(man1dir)'"; \
+	$(MKDIR_P) "$(DESTDIR)$(man1dir)" || exit 1; \
+	{ for i in $$list1; do echo "$$i"; done;  \
+	if test -n "$$list2"; then \
+	  for i in $$list2; do echo "$$i"; done \
+	    | sed -n '/\.1[a-z]*$$/p'; \
+	fi; \
 	} | while read p; do \
 	  if test -f $$p; then d=; else d="$(srcdir)/"; fi; \
 	  echo "$$d$$p"; echo "$$p"; \
@@ -1414,13 +1233,14 @@ uninstall-man1:
 	files=`{ for i in $$list; do echo "$$i"; done; \
 	} | sed -e 's,.*/,,;h;s,.*\.,,;s,^[^1][0-9a-z]*$$,1,;x' \
 	      -e 's,\.[0-9a-z]*$$,,;$(transform);G;s,\n,.,'`; \
-	test -z "$$files" || { \
-	  echo " ( cd '$(DESTDIR)$(man1dir)' && rm -f" $$files ")"; \
-	  cd "$(DESTDIR)$(man1dir)" && rm -f $$files; }
+	dir='$(DESTDIR)$(man1dir)'; $(am__uninstall_files_from_dir)
 install-pkgconfigDATA: $(pkgconfig_DATA)
 	@$(NORMAL_INSTALL)
-	test -z "$(pkgconfigdir)" || $(MKDIR_P) "$(DESTDIR)$(pkgconfigdir)"
 	@list='$(pkgconfig_DATA)'; test -n "$(pkgconfigdir)" || list=; \
+	if test -n "$$list"; then \
+	  echo " $(MKDIR_P) '$(DESTDIR)$(pkgconfigdir)'"; \
+	  $(MKDIR_P) "$(DESTDIR)$(pkgconfigdir)" || exit 1; \
+	fi; \
 	for p in $$list; do \
 	  if test -f "$$p"; then d=; else d="$(srcdir)/"; fi; \
 	  echo "$$d$$p"; \
@@ -1434,13 +1254,14 @@ uninstall-pkgconfigDATA:
 	@$(NORMAL_UNINSTALL)
 	@list='$(pkgconfig_DATA)'; test -n "$(pkgconfigdir)" || list=; \
 	files=`for p in $$list; do echo $$p; done | sed -e 's|^.*/||'`; \
-	test -n "$$files" || exit 0; \
-	echo " ( cd '$(DESTDIR)$(pkgconfigdir)' && rm -f" $$files ")"; \
-	cd "$(DESTDIR)$(pkgconfigdir)" && rm -f $$files
+	dir='$(DESTDIR)$(pkgconfigdir)'; $(am__uninstall_files_from_dir)
 install-library_includeHEADERS: $(library_include_HEADERS)
 	@$(NORMAL_INSTALL)
-	test -z "$(library_includedir)" || $(MKDIR_P) "$(DESTDIR)$(library_includedir)"
 	@list='$(library_include_HEADERS)'; test -n "$(library_includedir)" || list=; \
+	if test -n "$$list"; then \
+	  echo " $(MKDIR_P) '$(DESTDIR)$(library_includedir)'"; \
+	  $(MKDIR_P) "$(DESTDIR)$(library_includedir)" || exit 1; \
+	fi; \
 	for p in $$list; do \
 	  if test -f "$$p"; then d=; else d="$(srcdir)/"; fi; \
 	  echo "$$d$$p"; \
@@ -1454,9 +1275,7 @@ uninstall-library_includeHEADERS:
 	@$(NORMAL_UNINSTALL)
 	@list='$(library_include_HEADERS)'; test -n "$(library_includedir)" || list=; \
 	files=`for p in $$list; do echo $$p; done | sed -e 's|^.*/||'`; \
-	test -n "$$files" || exit 0; \
-	echo " ( cd '$(DESTDIR)$(library_includedir)' && rm -f" $$files ")"; \
-	cd "$(DESTDIR)$(library_includedir)" && rm -f $$files
+	dir='$(DESTDIR)$(library_includedir)'; $(am__uninstall_files_from_dir)
 
 ID: $(HEADERS) $(SOURCES) $(LISP) $(TAGS_FILES)
 	list='$(SOURCES) $(HEADERS) $(LISP) $(TAGS_FILES)'; \
@@ -1510,41 +1329,12 @@ GTAGS:
 distclean-tags:
 	-rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags
 
-# To be appended to the command running the test.  Handle the stdout
-# and stderr redirection, and catch the exit status.
-am__check_post =					\
->$@-t 2>&1;						\
-estatus=$$?;						\
-if test -n '$(DISABLE_HARD_ERRORS)'			\
-   && test $$estatus -eq 99; then			\
-  estatus=1;						\
-fi;							\
-TERM=$$__SAVED_TERM; export TERM;			\
-$(am__tty_colors);					\
-xfailed=PASS;						\
-case " $(XFAIL_TESTS) " in				\
-  *[\ \	]$$f[\ \	]* | *[\ \	]$$dir$$f[\ \	]*) \
-    xfailed=XFAIL;;					\
-esac;							\
-case $$estatus:$$xfailed in				\
-    0:XFAIL) col=$$red; res=XPASS;;			\
-    0:*)     col=$$grn; res=PASS ;;			\
-    77:*)    col=$$blu; res=SKIP ;;			\
-    99:*)    col=$$red; res=FAIL ;;			\
-    *:XFAIL) col=$$lgn; res=XFAIL;;			\
-    *:*)     col=$$red; res=FAIL ;;			\
-esac;							\
-echo "$${col}$$res$${std}: $$f";			\
-echo "$$res: $$f (exit: $$estatus)" |			\
-  $(am__rst_section) >$@;				\
-cat $@-t >>$@;						\
-rm -f $@-t
-
 $(TEST_SUITE_LOG): $(TEST_LOGS)
 	@$(am__sh_e_setup);						\
 	list='$(TEST_LOGS)';						\
 	results=`for f in $$list; do					\
-		   read line < $$f && echo "$$line" || echo FAIL;	\
+		   test -r $$f && read line < $$f && echo "$$line"	\
+		     || echo FAIL;					\
 		 done`;							\
 	all=`echo "$$results" | sed '/^$$/d' | wc -l | sed -e 's/^[	 ]*//'`; \
 	fail=`echo "$$results" | grep -c '^FAIL'`;			\
@@ -1593,7 +1383,7 @@ $(TEST_SUITE_LOG): $(TEST_LOGS)
 	  echo ".. contents:: :depth: 2";				\
 	  echo;								\
 	  for f in $$list; do						\
-	    read line < $$f;						\
+	    test -r $$f && read line < $$f || line=;			\
 	    case $$line in						\
 	      PASS:*|XFAIL:*);;						\
 	      *) echo; cat $$f;;					\
@@ -1610,22 +1400,37 @@ $(TEST_SUITE_LOG): $(TEST_LOGS)
 	test x"$$VERBOSE" = x || $$exit || cat $(TEST_SUITE_LOG);	\
 	$(am__tty_colors);						\
 	if $$exit; then							\
-	  echo $(ECHO_N) "$$grn$(ECHO_C)";				\
+	  col="$$grn";							\
 	 else								\
-	  echo $(ECHO_N) "$$red$(ECHO_C)";				\
+	  col="$$red";							\
 	fi;								\
-	echo "$$msg" | $(am__text_box);					\
-	echo $(ECHO_N) "$$std$(ECHO_C)";				\
-	$$exit
+	echo "$$msg" | $(am__text_box) "col=$$col" "std=$$std";		\
+	$$exit || exit 1
 
-# Run all the tests.
-check-TESTS:
-	@list='$(RECHECK_LOGS)'; test -z "$$list" || rm -f $$list
+check-TESTS recheck:
+	@if test $@ != recheck; then \
+	   list='$(RECHECK_LOGS)'; test -z "$$list" || rm -f $$list; \
+	 fi
 	@test -z "$(TEST_SUITE_LOG)" || rm -f $(TEST_SUITE_LOG)
-	@set_logs=; if test "X$(TEST_LOGS)" = X.log; then		\
-	  set_logs=TEST_LOGS=;						\
-	fi;								\
-	$(MAKE) $(AM_MAKEFLAGS) $(TEST_SUITE_LOG) $$set_logs
+	@list='' list2='$(TEST_LOGS)'; for f in $$list2; do \
+	  test .log = $$f && continue; \
+	  if test $@ = recheck; then \
+	    test -f $$f || continue; \
+	    if test -r $$f && read line < $$f; then \
+	      case $$line in FAIL*|XPASS*) : ;; *) continue;; esac; \
+	    fi; \
+	  fi; \
+	  if test -z "$$list"; then list=$$f; else list="$$list $$f"; fi; \
+	done; \
+	if test $@ = recheck && test -n "$$list"; then \
+	  $(am__make_dryrun) || rm -f $$list || exit 1; \
+	fi; \
+	$(MAKE) $(AM_MAKEFLAGS) $(TEST_SUITE_LOG) TEST_LOGS="$$list"
+recheck: $(check_LIBRARIES) $(check_PROGRAMS)
+
+am--mostlyclean-test-html:
+	list='$(TEST_LOGS:.log=.html)'; test -z "$$list" || rm -f $$list
+	rm -f $(TEST_SUITE_HTML)
 
 .log.html:
 	@list='$(RST2HTML) $$RST2HTML rst2html rst2html.py';		\
@@ -1645,22 +1450,11 @@ check-TESTS:
 # Beware of concurrent executions.  Run "check" not "check-TESTS", as
 # check-SCRIPTS and other dependencies are rebuilt by the former only.
 # And expect check to fail.
-check-html:
-	@if $(MAKE) $(AM_MAKEFLAGS) check; then			\
-	  rv=0; else rv=$$?;					\
-	fi;							\
-	$(MAKE) $(AM_MAKEFLAGS) $(TEST_SUITE_HTML) || exit 4;	\
+check-html recheck-html:
+	@target=`echo $@ | sed 's/-html$$//'`; \
+	rv=0; $(MAKE) $(AM_MAKEFLAGS) $$target || rv=$$?; \
+	$(MAKE) $(AM_MAKEFLAGS) $(TEST_SUITE_HTML) TEST_LOGS= || exit 4; \
 	exit $$rv
-recheck recheck-html:
-	@target=`echo $@ | sed 's,^re,,'`;				\
-	list='$(TEST_LOGS)';						\
-	list=`for f in $$list; do					\
-	        test -f $$f || continue;				\
-	        if read line < $$f; then				\
-	          case $$line in FAIL*|XPASS*) echo $$f;; esac;		\
-	        else echo $$f; fi;					\
-	      done | tr '\012\015' '  '`;				\
-	$(MAKE) $(AM_MAKEFLAGS) $$target AM_MAKEFLAGS='$(AM_MAKEFLAGS) TEST_LOGS="'"$$list"'"'
 .sh.log:
 	@p='$<'; $(am__check_pre) $(SH_LOG_COMPILE) "$$tst" $(am__check_post)
 @am__EXEEXT_TRUE at .sh$(EXEEXT).log:
@@ -1712,7 +1506,8 @@ distdir: $(DISTFILES)
 	  fi; \
 	done
 	-test -n "$(am__skip_mode_fix)" \
-	|| find "$(distdir)" -type d ! -perm -777 -exec chmod a+rwx {} \; -o \
+	|| find "$(distdir)" -type d ! -perm -755 \
+		-exec chmod u+rwx,go+rx {} \; -o \
 	  ! -type d ! -perm -444 -links 1 -exec chmod a+r {} \; -o \
 	  ! -type d ! -perm -400 -exec chmod a+r {} \; -o \
 	  ! -type d ! -perm -444 -exec $(install_sh) -c -m a+r {} {} \; \
@@ -1722,7 +1517,11 @@ dist-gzip: distdir
 	$(am__remove_distdir)
 
 dist-bzip2: distdir
-	tardir=$(distdir) && $(am__tar) | bzip2 -9 -c >$(distdir).tar.bz2
+	tardir=$(distdir) && $(am__tar) | BZIP2=$${BZIP2--9} bzip2 -c >$(distdir).tar.bz2
+	$(am__remove_distdir)
+
+dist-lzip: distdir
+	tardir=$(distdir) && $(am__tar) | lzip -c $${LZIP_OPT--9} >$(distdir).tar.lz
 	$(am__remove_distdir)
 
 dist-lzma: distdir
@@ -1730,7 +1529,7 @@ dist-lzma: distdir
 	$(am__remove_distdir)
 
 dist-xz: distdir
-	tardir=$(distdir) && $(am__tar) | xz -c >$(distdir).tar.xz
+	tardir=$(distdir) && $(am__tar) | XZ_OPT=$${XZ_OPT--e} xz -c >$(distdir).tar.xz
 	$(am__remove_distdir)
 
 dist-tarZ: distdir
@@ -1756,21 +1555,23 @@ dist dist-all: distdir
 distcheck: dist
 	case '$(DIST_ARCHIVES)' in \
 	*.tar.gz*) \
-	  GZIP=$(GZIP_ENV) gunzip -c $(distdir).tar.gz | $(am__untar) ;;\
+	  GZIP=$(GZIP_ENV) gzip -dc $(distdir).tar.gz | $(am__untar) ;;\
 	*.tar.bz2*) \
-	  bunzip2 -c $(distdir).tar.bz2 | $(am__untar) ;;\
+	  bzip2 -dc $(distdir).tar.bz2 | $(am__untar) ;;\
 	*.tar.lzma*) \
-	  unlzma -c $(distdir).tar.lzma | $(am__untar) ;;\
+	  lzma -dc $(distdir).tar.lzma | $(am__untar) ;;\
+	*.tar.lz*) \
+	  lzip -dc $(distdir).tar.lz | $(am__untar) ;;\
 	*.tar.xz*) \
 	  xz -dc $(distdir).tar.xz | $(am__untar) ;;\
 	*.tar.Z*) \
 	  uncompress -c $(distdir).tar.Z | $(am__untar) ;;\
 	*.shar.gz*) \
-	  GZIP=$(GZIP_ENV) gunzip -c $(distdir).shar.gz | unshar ;;\
+	  GZIP=$(GZIP_ENV) gzip -dc $(distdir).shar.gz | unshar ;;\
 	*.zip*) \
 	  unzip $(distdir).zip ;;\
 	esac
-	chmod -R a-w $(distdir); chmod a+w $(distdir)
+	chmod -R a-w $(distdir); chmod u+w $(distdir)
 	mkdir $(distdir)/_build
 	mkdir $(distdir)/_inst
 	chmod a-w $(distdir)
@@ -1780,6 +1581,7 @@ distcheck: dist
 	  && am__cwd=`pwd` \
 	  && $(am__cd) $(distdir)/_build \
 	  && ../configure --srcdir=.. --prefix="$$dc_install_base" \
+	    $(AM_DISTCHECK_CONFIGURE_FLAGS) \
 	    $(DISTCHECK_CONFIGURE_FLAGS) \
 	  && $(MAKE) $(AM_MAKEFLAGS) \
 	  && $(MAKE) $(AM_MAKEFLAGS) dvi \
@@ -1808,8 +1610,16 @@ distcheck: dist
 	  list='$(DIST_ARCHIVES)'; for i in $$list; do echo $$i; done) | \
 	  sed -e 1h -e 1s/./=/g -e 1p -e 1x -e '$$p' -e '$$x'
 distuninstallcheck:
-	@$(am__cd) '$(distuninstallcheck_dir)' \
-	&& test `$(distuninstallcheck_listfiles) | wc -l` -le 1 \
+	@test -n '$(distuninstallcheck_dir)' || { \
+	  echo 'ERROR: trying to run $@ with an empty' \
+	       '$$(distuninstallcheck_dir)' >&2; \
+	  exit 1; \
+	}; \
+	$(am__cd) '$(distuninstallcheck_dir)' || { \
+	  echo 'ERROR: cannot chdir into $(distuninstallcheck_dir)' >&2; \
+	  exit 1; \
+	}; \
+	test `$(am__distuninstallcheck_listfiles) | wc -l` -eq 0 \
 	   || { echo "ERROR: files left after uninstall:" ; \
 	        if test -n "$(DESTDIR)"; then \
 	          echo "  (check DESTDIR support)"; \
@@ -1826,7 +1636,7 @@ distcleancheck: distclean
 	       $(distcleancheck_listfiles) ; \
 	       exit 1; } >&2
 check-am: all-am
-	$(MAKE) $(AM_MAKEFLAGS) $(check_LTLIBRARIES) $(check_PROGRAMS)
+	$(MAKE) $(AM_MAKEFLAGS) $(check_LIBRARIES) $(check_PROGRAMS)
 	$(MAKE) $(AM_MAKEFLAGS) check-TESTS
 check: check-am
 all-am: Makefile $(LTLIBRARIES) $(PROGRAMS) $(MANS) $(DATA) $(HEADERS) \
@@ -1847,14 +1657,18 @@ install-am: all-am
 
 installcheck: installcheck-am
 install-strip:
-	$(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
-	  install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
-	  `test -z '$(STRIP)' || \
-	    echo "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'"` install
+	if test -z '$(STRIP)'; then \
+	  $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
+	    install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
+	      install; \
+	else \
+	  $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
+	    install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
+	    "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'" install; \
+	fi
 mostlyclean-generic:
 	-test -z "$(TEST_LOGS)" || rm -f $(TEST_LOGS)
 	-test -z "$(TEST_LOGS_TMP)" || rm -f $(TEST_LOGS_TMP)
-	-test -z "$(TEST_SUITE_HTML)" || rm -f $(TEST_SUITE_HTML)
 	-test -z "$(TEST_SUITE_LOG)" || rm -f $(TEST_SUITE_LOG)
 
 clean-generic:
@@ -1875,7 +1689,7 @@ maintainer-clean-generic:
 	@echo "it deletes files that may require special tools to rebuild."
 clean: clean-am
 
-clean-am: clean-binPROGRAMS clean-checkLTLIBRARIES clean-checkPROGRAMS \
+clean-am: clean-binPROGRAMS clean-checkLIBRARIES clean-checkPROGRAMS \
 	clean-generic clean-libLTLIBRARIES clean-libtool clean-local \
 	mostlyclean-am
 
@@ -1936,8 +1750,8 @@ maintainer-clean-am: distclean-am maintainer-clean-generic
 
 mostlyclean: mostlyclean-am
 
-mostlyclean-am: mostlyclean-compile mostlyclean-generic \
-	mostlyclean-libtool
+mostlyclean-am: am--mostlyclean-test-html mostlyclean-compile \
+	mostlyclean-generic mostlyclean-libtool
 
 pdf: pdf-am
 
@@ -1953,18 +1767,18 @@ uninstall-am: uninstall-binPROGRAMS uninstall-libLTLIBRARIES \
 
 uninstall-man: uninstall-man1
 
-.MAKE: all check-am check-html install-am install-strip recheck \
-	recheck-html
-
-.PHONY: CTAGS GTAGS all all-am am--refresh check check-TESTS check-am \
-	check-html clean clean-binPROGRAMS clean-checkLTLIBRARIES \
-	clean-checkPROGRAMS clean-generic clean-libLTLIBRARIES \
-	clean-libtool clean-local ctags dist dist-all dist-bzip2 \
-	dist-gzip dist-lzma dist-shar dist-tarZ dist-xz dist-zip \
-	distcheck distclean distclean-compile distclean-generic \
-	distclean-hdr distclean-libtool distclean-tags distcleancheck \
-	distdir distuninstallcheck dvi dvi-am html html-am info \
-	info-am install install-am install-binPROGRAMS install-data \
+.MAKE: all check-am check-html install-am install-strip recheck-html
+
+.PHONY: CTAGS GTAGS all all-am am--mostlyclean-test-html am--refresh \
+	check check-TESTS check-am check-html clean clean-binPROGRAMS \
+	clean-checkLIBRARIES clean-checkPROGRAMS clean-generic \
+	clean-libLTLIBRARIES clean-libtool clean-local ctags dist \
+	dist-all dist-bzip2 dist-gzip dist-lzip dist-lzma dist-shar \
+	dist-tarZ dist-xz dist-zip distcheck distclean \
+	distclean-compile distclean-generic distclean-hdr \
+	distclean-libtool distclean-tags distcleancheck distdir \
+	distuninstallcheck dvi dvi-am html html-am info info-am \
+	install install-am install-binPROGRAMS install-data \
 	install-data-am install-dvi install-dvi-am install-exec \
 	install-exec-am install-html install-html-am install-info \
 	install-info-am install-libLTLIBRARIES \
@@ -1981,12 +1795,13 @@ uninstall-man: uninstall-man1
 clean-local: clean-local-check
 .PHONY: clean-local-check
 clean-local-check:
-	-cd tests; rm -f seq10m* seq1m* *_0 *_1 *_2 *.md5sum *.histo *.stats *.timing *.query *.dump *.fa
+	-cd tests; rm -f seq10m* seq1m* *_0 *_1 *_2 *_S *.md5sum *.histo *.stats *.timing *.query *.dump *.fa
 
 tests/serial_hashing.log: tests/generate_sequence.log
 tests/parallel_hashing.log: tests/generate_sequence.log
 tests/serial_direct_indexing.log: tests/generate_sequence.log
 tests/parallel_direct_indexing.log: tests/generate_sequence.log
+tests/parallel_fastq_direct_indexing.log: tests/generate_fastq_sequence.log
 tests/multi_file.log: tests/generate_sequence.log
 tests/raw_hash.log: tests/generate_sequence.log
 tests/from_stream.log: tests/generate_sequence.log
@@ -1998,6 +1813,14 @@ tests/merge.log: tests/generate_fastq_sequence.log
 tests/min_qual.log: tests/generate_fastq_sequence.log
 tests/parsers.log: tests/generate_sequence.log
 
+-include $(top_srcdir)/development.mk
+
+########
+# info #
+########
+print-%:
+	@echo -n $($*)
+
 # Tell versions [3.59,3.63) of GNU make to not export all variables.
 # Otherwise a system limit (for SysV at least) may be exceeded.
 .NOEXPORT:
diff --git a/aclocal.m4 b/aclocal.m4
index f3ebea5..20ca7c9 100644
--- a/aclocal.m4
+++ b/aclocal.m4
@@ -1,7 +1,8 @@
-# generated automatically by aclocal 1.11 -*- Autoconf -*-
+# generated automatically by aclocal 1.11.6 -*- Autoconf -*-
 
 # Copyright (C) 1996, 1997, 1998, 1999, 2000, 2001, 2002, 2003, 2004,
-# 2005, 2006, 2007, 2008, 2009  Free Software Foundation, Inc.
+# 2005, 2006, 2007, 2008, 2009, 2010, 2011 Free Software Foundation,
+# Inc.
 # This file is free software; the Free Software Foundation
 # gives unlimited permission to copy and/or distribute it,
 # with or without modifications, as long as this notice is preserved.
@@ -13,18 +14,21 @@
 
 m4_ifndef([AC_AUTOCONF_VERSION],
   [m4_copy([m4_PACKAGE_VERSION], [AC_AUTOCONF_VERSION])])dnl
-m4_if(m4_defn([AC_AUTOCONF_VERSION]), [2.63],,
-[m4_warning([this file was generated for autoconf 2.63.
+m4_if(m4_defn([AC_AUTOCONF_VERSION]), [2.68],,
+[m4_warning([this file was generated for autoconf 2.68.
 You have another version of autoconf.  It may work, but is not guaranteed to.
 If you have problems, you may need to regenerate the build system entirely.
 To do so, use the procedure documented by the package, typically `autoreconf'.])])
 
-# Copyright (C) 2002, 2003, 2005, 2006, 2007, 2008  Free Software Foundation, Inc.
+# Copyright (C) 2002, 2003, 2005, 2006, 2007, 2008, 2011 Free Software
+# Foundation, Inc.
 #
 # This file is free software; the Free Software Foundation
 # gives unlimited permission to copy and/or distribute it,
 # with or without modifications, as long as this notice is preserved.
 
+# serial 1
+
 # AM_AUTOMAKE_VERSION(VERSION)
 # ----------------------------
 # Automake X.Y traces this macro to ensure aclocal.m4 has been
@@ -34,7 +38,7 @@ AC_DEFUN([AM_AUTOMAKE_VERSION],
 [am__api_version='1.11'
 dnl Some users find AM_AUTOMAKE_VERSION and mistake it for a way to
 dnl require some minimum version.  Point them to the right macro.
-m4_if([$1], [1.11], [],
+m4_if([$1], [1.11.6], [],
       [AC_FATAL([Do not call $0, use AM_INIT_AUTOMAKE([$1]).])])dnl
 ])
 
@@ -50,19 +54,21 @@ m4_define([_AM_AUTOCONF_VERSION], [])
 # Call AM_AUTOMAKE_VERSION and AM_AUTOMAKE_VERSION so they can be traced.
 # This function is AC_REQUIREd by AM_INIT_AUTOMAKE.
 AC_DEFUN([AM_SET_CURRENT_AUTOMAKE_VERSION],
-[AM_AUTOMAKE_VERSION([1.11])dnl
+[AM_AUTOMAKE_VERSION([1.11.6])dnl
 m4_ifndef([AC_AUTOCONF_VERSION],
   [m4_copy([m4_PACKAGE_VERSION], [AC_AUTOCONF_VERSION])])dnl
 _AM_AUTOCONF_VERSION(m4_defn([AC_AUTOCONF_VERSION]))])
 
 # AM_AUX_DIR_EXPAND                                         -*- Autoconf -*-
 
-# Copyright (C) 2001, 2003, 2005  Free Software Foundation, Inc.
+# Copyright (C) 2001, 2003, 2005, 2011 Free Software Foundation, Inc.
 #
 # This file is free software; the Free Software Foundation
 # gives unlimited permission to copy and/or distribute it,
 # with or without modifications, as long as this notice is preserved.
 
+# serial 1
+
 # For projects using AC_CONFIG_AUX_DIR([foo]), Autoconf sets
 # $ac_aux_dir to `$srcdir/foo'.  In other projects, it is set to
 # `$srcdir', `$srcdir/..', or `$srcdir/../..'.
@@ -144,14 +150,14 @@ AC_CONFIG_COMMANDS_PRE(
 Usually this means the macro was only invoked conditionally.]])
 fi])])
 
-# Copyright (C) 1999, 2000, 2001, 2002, 2003, 2004, 2005, 2006, 2009
-# Free Software Foundation, Inc.
+# Copyright (C) 1999, 2000, 2001, 2002, 2003, 2004, 2005, 2006, 2009,
+# 2010, 2011 Free Software Foundation, Inc.
 #
 # This file is free software; the Free Software Foundation
 # gives unlimited permission to copy and/or distribute it,
 # with or without modifications, as long as this notice is preserved.
 
-# serial 10
+# serial 12
 
 # There are a few dirty hacks below to avoid letting `AC_PROG_CC' be
 # written in clear, in which case automake, when reading aclocal.m4,
@@ -191,6 +197,7 @@ AC_CACHE_CHECK([dependency style of $depcc],
   # instance it was reported that on HP-UX the gcc test will end up
   # making a dummy file named `D' -- because `-MD' means `put the output
   # in D'.
+  rm -rf conftest.dir
   mkdir conftest.dir
   # Copy depcomp to subdir because otherwise we won't find it if we're
   # using a relative directory.
@@ -255,7 +262,7 @@ AC_CACHE_CHECK([dependency style of $depcc],
 	break
       fi
       ;;
-    msvisualcpp | msvcmsys)
+    msvc7 | msvc7msys | msvisualcpp | msvcmsys)
       # This compiler won't grok `-c -o', but also, the minuso test has
       # not run yet.  These depmodes are late enough in the game, and
       # so weak that their functioning should not be impacted.
@@ -320,10 +327,13 @@ AC_DEFUN([AM_DEP_TRACK],
 if test "x$enable_dependency_tracking" != xno; then
   am_depcomp="$ac_aux_dir/depcomp"
   AMDEPBACKSLASH='\'
+  am__nodep='_no'
 fi
 AM_CONDITIONAL([AMDEP], [test "x$enable_dependency_tracking" != xno])
 AC_SUBST([AMDEPBACKSLASH])dnl
 _AM_SUBST_NOTMAKE([AMDEPBACKSLASH])dnl
+AC_SUBST([am__nodep])dnl
+_AM_SUBST_NOTMAKE([am__nodep])dnl
 ])
 
 # Generate code to set up dependency tracking.              -*- Autoconf -*-
@@ -545,12 +555,15 @@ for _am_header in $config_headers :; do
 done
 echo "timestamp for $_am_arg" >`AS_DIRNAME(["$_am_arg"])`/stamp-h[]$_am_stamp_count])
 
-# Copyright (C) 2001, 2003, 2005, 2008  Free Software Foundation, Inc.
+# Copyright (C) 2001, 2003, 2005, 2008, 2011 Free Software Foundation,
+# Inc.
 #
 # This file is free software; the Free Software Foundation
 # gives unlimited permission to copy and/or distribute it,
 # with or without modifications, as long as this notice is preserved.
 
+# serial 1
+
 # AM_PROG_INSTALL_SH
 # ------------------
 # Define $install_sh.
@@ -682,12 +695,15 @@ else
 fi
 ])
 
-# Copyright (C) 2003, 2004, 2005, 2006  Free Software Foundation, Inc.
+# Copyright (C) 2003, 2004, 2005, 2006, 2011 Free Software Foundation,
+# Inc.
 #
 # This file is free software; the Free Software Foundation
 # gives unlimited permission to copy and/or distribute it,
 # with or without modifications, as long as this notice is preserved.
 
+# serial 1
+
 # AM_PROG_MKDIR_P
 # ---------------
 # Check for `mkdir -p'.
@@ -710,13 +726,14 @@ esac
 
 # Helper functions for option handling.                     -*- Autoconf -*-
 
-# Copyright (C) 2001, 2002, 2003, 2005, 2008  Free Software Foundation, Inc.
+# Copyright (C) 2001, 2002, 2003, 2005, 2008, 2010 Free Software
+# Foundation, Inc.
 #
 # This file is free software; the Free Software Foundation
 # gives unlimited permission to copy and/or distribute it,
 # with or without modifications, as long as this notice is preserved.
 
-# serial 4
+# serial 5
 
 # _AM_MANGLE_OPTION(NAME)
 # -----------------------
@@ -724,13 +741,13 @@ AC_DEFUN([_AM_MANGLE_OPTION],
 [[_AM_OPTION_]m4_bpatsubst($1, [[^a-zA-Z0-9_]], [_])])
 
 # _AM_SET_OPTION(NAME)
-# ------------------------------
+# --------------------
 # Set option NAME.  Presently that only means defining a flag for this option.
 AC_DEFUN([_AM_SET_OPTION],
 [m4_define(_AM_MANGLE_OPTION([$1]), 1)])
 
 # _AM_SET_OPTIONS(OPTIONS)
-# ----------------------------------
+# ------------------------
 # OPTIONS is a space-separated list of Automake options.
 AC_DEFUN([_AM_SET_OPTIONS],
 [m4_foreach_w([_AM_Option], [$1], [_AM_SET_OPTION(_AM_Option)])])
@@ -806,13 +823,13 @@ Check your system clock])
 fi
 AC_MSG_RESULT(yes)])
 
-# Copyright (C) 2009  Free Software Foundation, Inc.
+# Copyright (C) 2009, 2011  Free Software Foundation, Inc.
 #
 # This file is free software; the Free Software Foundation
 # gives unlimited permission to copy and/or distribute it,
 # with or without modifications, as long as this notice is preserved.
 
-# serial 1
+# serial 2
 
 # AM_SILENT_RULES([DEFAULT])
 # --------------------------
@@ -827,18 +844,50 @@ yes) AM_DEFAULT_VERBOSITY=0;;
 no)  AM_DEFAULT_VERBOSITY=1;;
 *)   AM_DEFAULT_VERBOSITY=m4_if([$1], [yes], [0], [1]);;
 esac
+dnl
+dnl A few `make' implementations (e.g., NonStop OS and NextStep)
+dnl do not support nested variable expansions.
+dnl See automake bug#9928 and bug#10237.
+am_make=${MAKE-make}
+AC_CACHE_CHECK([whether $am_make supports nested variables],
+   [am_cv_make_support_nested_variables],
+   [if AS_ECHO([['TRUE=$(BAR$(V))
+BAR0=false
+BAR1=true
+V=1
+am__doit:
+	@$(TRUE)
+.PHONY: am__doit']]) | $am_make -f - >/dev/null 2>&1; then
+  am_cv_make_support_nested_variables=yes
+else
+  am_cv_make_support_nested_variables=no
+fi])
+if test $am_cv_make_support_nested_variables = yes; then
+  dnl Using `$V' instead of `$(V)' breaks IRIX make.
+  AM_V='$(V)'
+  AM_DEFAULT_V='$(AM_DEFAULT_VERBOSITY)'
+else
+  AM_V=$AM_DEFAULT_VERBOSITY
+  AM_DEFAULT_V=$AM_DEFAULT_VERBOSITY
+fi
+AC_SUBST([AM_V])dnl
+AM_SUBST_NOTMAKE([AM_V])dnl
+AC_SUBST([AM_DEFAULT_V])dnl
+AM_SUBST_NOTMAKE([AM_DEFAULT_V])dnl
 AC_SUBST([AM_DEFAULT_VERBOSITY])dnl
 AM_BACKSLASH='\'
 AC_SUBST([AM_BACKSLASH])dnl
 _AM_SUBST_NOTMAKE([AM_BACKSLASH])dnl
 ])
 
-# Copyright (C) 2001, 2003, 2005  Free Software Foundation, Inc.
+# Copyright (C) 2001, 2003, 2005, 2011 Free Software Foundation, Inc.
 #
 # This file is free software; the Free Software Foundation
 # gives unlimited permission to copy and/or distribute it,
 # with or without modifications, as long as this notice is preserved.
 
+# serial 1
+
 # AM_PROG_INSTALL_STRIP
 # ---------------------
 # One issue with vendor `install' (even GNU) is that you can't
@@ -861,13 +910,13 @@ fi
 INSTALL_STRIP_PROGRAM="\$(install_sh) -c -s"
 AC_SUBST([INSTALL_STRIP_PROGRAM])])
 
-# Copyright (C) 2006, 2008  Free Software Foundation, Inc.
+# Copyright (C) 2006, 2008, 2010 Free Software Foundation, Inc.
 #
 # This file is free software; the Free Software Foundation
 # gives unlimited permission to copy and/or distribute it,
 # with or without modifications, as long as this notice is preserved.
 
-# serial 2
+# serial 3
 
 # _AM_SUBST_NOTMAKE(VARIABLE)
 # ---------------------------
@@ -876,13 +925,13 @@ AC_SUBST([INSTALL_STRIP_PROGRAM])])
 AC_DEFUN([_AM_SUBST_NOTMAKE])
 
 # AM_SUBST_NOTMAKE(VARIABLE)
-# ---------------------------
+# --------------------------
 # Public sister of _AM_SUBST_NOTMAKE.
 AC_DEFUN([AM_SUBST_NOTMAKE], [_AM_SUBST_NOTMAKE($@)])
 
 # Check how to create a tarball.                            -*- Autoconf -*-
 
-# Copyright (C) 2004, 2005  Free Software Foundation, Inc.
+# Copyright (C) 2004, 2005, 2012 Free Software Foundation, Inc.
 #
 # This file is free software; the Free Software Foundation
 # gives unlimited permission to copy and/or distribute it,
@@ -904,10 +953,11 @@ AC_DEFUN([AM_SUBST_NOTMAKE], [_AM_SUBST_NOTMAKE($@)])
 # a tarball read from stdin.
 #     $(am__untar) < result.tar
 AC_DEFUN([_AM_PROG_TAR],
-[# Always define AMTAR for backward compatibility.
-AM_MISSING_PROG([AMTAR], [tar])
+[# Always define AMTAR for backward compatibility.  Yes, it's still used
+# in the wild :-(  We should find a proper way to deprecate it ...
+AC_SUBST([AMTAR], ['$${TAR-tar}'])
 m4_if([$1], [v7],
-     [am__tar='${AMTAR} chof - "$$tardir"'; am__untar='${AMTAR} xf -'],
+     [am__tar='$${TAR-tar} chof - "$$tardir"' am__untar='$${TAR-tar} xf -'],
      [m4_case([$1], [ustar],, [pax],,
               [m4_fatal([Unknown tar format])])
 AC_MSG_CHECKING([how to create a $1 tar archive])
diff --git a/config.guess b/config.guess
index da83314..d622a44 100755
--- a/config.guess
+++ b/config.guess
@@ -1,10 +1,10 @@
 #! /bin/sh
 # Attempt to guess a canonical system name.
 #   Copyright (C) 1992, 1993, 1994, 1995, 1996, 1997, 1998, 1999,
-#   2000, 2001, 2002, 2003, 2004, 2005, 2006, 2007, 2008
-#   Free Software Foundation, Inc.
+#   2000, 2001, 2002, 2003, 2004, 2005, 2006, 2007, 2008, 2009, 2010,
+#   2011, 2012 Free Software Foundation, Inc.
 
-timestamp='2009-04-27'
+timestamp='2012-02-10'
 
 # This file is free software; you can redistribute it and/or modify it
 # under the terms of the GNU General Public License as published by
@@ -17,9 +17,7 @@ timestamp='2009-04-27'
 # General Public License for more details.
 #
 # You should have received a copy of the GNU General Public License
-# along with this program; if not, write to the Free Software
-# Foundation, Inc., 51 Franklin Street - Fifth Floor, Boston, MA
-# 02110-1301, USA.
+# along with this program; if not, see <http://www.gnu.org/licenses/>.
 #
 # As a special exception to the GNU General Public License, if you
 # distribute this file as part of a program that contains a
@@ -27,16 +25,16 @@ timestamp='2009-04-27'
 # the same distribution terms that you use for the rest of that program.
 
 
-# Originally written by Per Bothner <per at bothner.com>.
-# Please send patches to <config-patches at gnu.org>.  Submit a context
-# diff and a properly formatted ChangeLog entry.
+# Originally written by Per Bothner.  Please send patches (context
+# diff format) to <config-patches at gnu.org> and include a ChangeLog
+# entry.
 #
 # This script attempts to guess a canonical system name similar to
 # config.sub.  If it succeeds, it prints the system name on stdout, and
 # exits with 0.  Otherwise, it exits with 1.
 #
-# The plan is that this can be called by configure scripts if you
-# don't specify an explicit build system type.
+# You can get the latest version of this script from:
+# http://git.savannah.gnu.org/gitweb/?p=config.git;a=blob_plain;f=config.guess;hb=HEAD
 
 me=`echo "$0" | sed -e 's,.*/,,'`
 
@@ -56,8 +54,9 @@ version="\
 GNU config.guess ($timestamp)
 
 Originally written by Per Bothner.
-Copyright (C) 1992, 1993, 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001,
-2002, 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc.
+Copyright (C) 1992, 1993, 1994, 1995, 1996, 1997, 1998, 1999, 2000,
+2001, 2002, 2003, 2004, 2005, 2006, 2007, 2008, 2009, 2010, 2011, 2012
+Free Software Foundation, Inc.
 
 This is free software; see the source for copying conditions.  There is NO
 warranty; not even for MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE."
@@ -144,7 +143,7 @@ UNAME_VERSION=`(uname -v) 2>/dev/null` || UNAME_VERSION=unknown
 case "${UNAME_MACHINE}:${UNAME_SYSTEM}:${UNAME_RELEASE}:${UNAME_VERSION}" in
     *:NetBSD:*:*)
 	# NetBSD (nbsd) targets should (where applicable) match one or
-	# more of the tupples: *-*-netbsdelf*, *-*-netbsdaout*,
+	# more of the tuples: *-*-netbsdelf*, *-*-netbsdaout*,
 	# *-*-netbsdecoff* and *-*-netbsd*.  For targets that recently
 	# switched to ELF, *-*-netbsd* would select the old
 	# object file format.  This provides both forward
@@ -170,7 +169,7 @@ case "${UNAME_MACHINE}:${UNAME_SYSTEM}:${UNAME_RELEASE}:${UNAME_VERSION}" in
 	    arm*|i386|m68k|ns32k|sh3*|sparc|vax)
 		eval $set_cc_for_build
 		if echo __ELF__ | $CC_FOR_BUILD -E - 2>/dev/null \
-			| grep __ELF__ >/dev/null
+			| grep -q __ELF__
 		then
 		    # Once all utilities can be ECOFF (netbsdecoff) or a.out (netbsdaout).
 		    # Return netbsd for either.  FIX?
@@ -180,7 +179,7 @@ case "${UNAME_MACHINE}:${UNAME_SYSTEM}:${UNAME_RELEASE}:${UNAME_VERSION}" in
 		fi
 		;;
 	    *)
-	        os=netbsd
+		os=netbsd
 		;;
 	esac
 	# The OS release
@@ -223,7 +222,7 @@ case "${UNAME_MACHINE}:${UNAME_SYSTEM}:${UNAME_RELEASE}:${UNAME_VERSION}" in
 		UNAME_RELEASE=`/usr/sbin/sizer -v | awk '{print $3}'`
 		;;
 	*5.*)
-	        UNAME_RELEASE=`/usr/sbin/sizer -v | awk '{print $4}'`
+		UNAME_RELEASE=`/usr/sbin/sizer -v | awk '{print $4}'`
 		;;
 	esac
 	# According to Compaq, /usr/sbin/psrinfo has been available on
@@ -269,7 +268,10 @@ case "${UNAME_MACHINE}:${UNAME_SYSTEM}:${UNAME_RELEASE}:${UNAME_VERSION}" in
 	# A Xn.n version is an unreleased experimental baselevel.
 	# 1.2 uses "1.2" for uname -r.
 	echo ${UNAME_MACHINE}-dec-osf`echo ${UNAME_RELEASE} | sed -e 's/^[PVTX]//' | tr 'ABCDEFGHIJKLMNOPQRSTUVWXYZ' 'abcdefghijklmnopqrstuvwxyz'`
-	exit ;;
+	# Reset EXIT trap before exiting to avoid spurious non-zero exit code.
+	exitcode=$?
+	trap '' 0
+	exit $exitcode ;;
     Alpha\ *:Windows_NT*:*)
 	# How do we know it's Interix rather than the generic POSIX subsystem?
 	# Should we change UNAME_MACHINE based on the output of uname instead
@@ -295,7 +297,7 @@ case "${UNAME_MACHINE}:${UNAME_SYSTEM}:${UNAME_RELEASE}:${UNAME_VERSION}" in
 	echo s390-ibm-zvmoe
 	exit ;;
     *:OS400:*:*)
-        echo powerpc-ibm-os400
+	echo powerpc-ibm-os400
 	exit ;;
     arm:RISC*:1.[012]*:*|arm:riscix:1.[012]*:*)
 	echo arm-acorn-riscix${UNAME_RELEASE}
@@ -333,6 +335,9 @@ case "${UNAME_MACHINE}:${UNAME_SYSTEM}:${UNAME_RELEASE}:${UNAME_VERSION}" in
     sun4*:SunOS:5.*:* | tadpole*:SunOS:5.*:*)
 	echo sparc-sun-solaris2`echo ${UNAME_RELEASE}|sed -e 's/[^.]*//'`
 	exit ;;
+    i86pc:AuroraUX:5.*:* | i86xen:AuroraUX:5.*:*)
+	echo i386-pc-auroraux${UNAME_RELEASE}
+	exit ;;
     i86pc:SunOS:5.*:* | i86xen:SunOS:5.*:*)
 	eval $set_cc_for_build
 	SUN_ARCH="i386"
@@ -391,23 +396,23 @@ case "${UNAME_MACHINE}:${UNAME_SYSTEM}:${UNAME_RELEASE}:${UNAME_VERSION}" in
     # MiNT.  But MiNT is downward compatible to TOS, so this should
     # be no problem.
     atarist[e]:*MiNT:*:* | atarist[e]:*mint:*:* | atarist[e]:*TOS:*:*)
-        echo m68k-atari-mint${UNAME_RELEASE}
+	echo m68k-atari-mint${UNAME_RELEASE}
 	exit ;;
     atari*:*MiNT:*:* | atari*:*mint:*:* | atarist[e]:*TOS:*:*)
 	echo m68k-atari-mint${UNAME_RELEASE}
-        exit ;;
+	exit ;;
     *falcon*:*MiNT:*:* | *falcon*:*mint:*:* | *falcon*:*TOS:*:*)
-        echo m68k-atari-mint${UNAME_RELEASE}
+	echo m68k-atari-mint${UNAME_RELEASE}
 	exit ;;
     milan*:*MiNT:*:* | milan*:*mint:*:* | *milan*:*TOS:*:*)
-        echo m68k-milan-mint${UNAME_RELEASE}
-        exit ;;
+	echo m68k-milan-mint${UNAME_RELEASE}
+	exit ;;
     hades*:*MiNT:*:* | hades*:*mint:*:* | *hades*:*TOS:*:*)
-        echo m68k-hades-mint${UNAME_RELEASE}
-        exit ;;
+	echo m68k-hades-mint${UNAME_RELEASE}
+	exit ;;
     *:*MiNT:*:* | *:*mint:*:* | *:*TOS:*:*)
-        echo m68k-unknown-mint${UNAME_RELEASE}
-        exit ;;
+	echo m68k-unknown-mint${UNAME_RELEASE}
+	exit ;;
     m68k:machten:*:*)
 	echo m68k-apple-machten${UNAME_RELEASE}
 	exit ;;
@@ -477,8 +482,8 @@ EOF
 	echo m88k-motorola-sysv3
 	exit ;;
     AViiON:dgux:*:*)
-        # DG/UX returns AViiON for all architectures
-        UNAME_PROCESSOR=`/usr/bin/uname -p`
+	# DG/UX returns AViiON for all architectures
+	UNAME_PROCESSOR=`/usr/bin/uname -p`
 	if [ $UNAME_PROCESSOR = mc88100 ] || [ $UNAME_PROCESSOR = mc88110 ]
 	then
 	    if [ ${TARGET_BINARY_INTERFACE}x = m88kdguxelfx ] || \
@@ -491,7 +496,7 @@ EOF
 	else
 	    echo i586-dg-dgux${UNAME_RELEASE}
 	fi
- 	exit ;;
+	exit ;;
     M88*:DolphinOS:*:*)	# DolphinOS (SVR3)
 	echo m88k-dolphin-sysv3
 	exit ;;
@@ -548,7 +553,7 @@ EOF
 		echo rs6000-ibm-aix3.2
 	fi
 	exit ;;
-    *:AIX:*:[456])
+    *:AIX:*:[4567])
 	IBM_CPU_ID=`/usr/sbin/lsdev -C -c processor -S available | sed 1q | awk '{ print $1 }'`
 	if /usr/sbin/lsattr -El ${IBM_CPU_ID} | grep ' POWER' >/dev/null 2>&1; then
 		IBM_ARCH=rs6000
@@ -591,52 +596,52 @@ EOF
 	    9000/[678][0-9][0-9])
 		if [ -x /usr/bin/getconf ]; then
 		    sc_cpu_version=`/usr/bin/getconf SC_CPU_VERSION 2>/dev/null`
-                    sc_kernel_bits=`/usr/bin/getconf SC_KERNEL_BITS 2>/dev/null`
-                    case "${sc_cpu_version}" in
-                      523) HP_ARCH="hppa1.0" ;; # CPU_PA_RISC1_0
-                      528) HP_ARCH="hppa1.1" ;; # CPU_PA_RISC1_1
-                      532)                      # CPU_PA_RISC2_0
-                        case "${sc_kernel_bits}" in
-                          32) HP_ARCH="hppa2.0n" ;;
-                          64) HP_ARCH="hppa2.0w" ;;
+		    sc_kernel_bits=`/usr/bin/getconf SC_KERNEL_BITS 2>/dev/null`
+		    case "${sc_cpu_version}" in
+		      523) HP_ARCH="hppa1.0" ;; # CPU_PA_RISC1_0
+		      528) HP_ARCH="hppa1.1" ;; # CPU_PA_RISC1_1
+		      532)                      # CPU_PA_RISC2_0
+			case "${sc_kernel_bits}" in
+			  32) HP_ARCH="hppa2.0n" ;;
+			  64) HP_ARCH="hppa2.0w" ;;
 			  '') HP_ARCH="hppa2.0" ;;   # HP-UX 10.20
-                        esac ;;
-                    esac
+			esac ;;
+		    esac
 		fi
 		if [ "${HP_ARCH}" = "" ]; then
 		    eval $set_cc_for_build
-		    sed 's/^              //' << EOF >$dummy.c
+		    sed 's/^		//' << EOF >$dummy.c
 
-              #define _HPUX_SOURCE
-              #include <stdlib.h>
-              #include <unistd.h>
+		#define _HPUX_SOURCE
+		#include <stdlib.h>
+		#include <unistd.h>
 
-              int main ()
-              {
-              #if defined(_SC_KERNEL_BITS)
-                  long bits = sysconf(_SC_KERNEL_BITS);
-              #endif
-                  long cpu  = sysconf (_SC_CPU_VERSION);
+		int main ()
+		{
+		#if defined(_SC_KERNEL_BITS)
+		    long bits = sysconf(_SC_KERNEL_BITS);
+		#endif
+		    long cpu  = sysconf (_SC_CPU_VERSION);
 
-                  switch (cpu)
-              	{
-              	case CPU_PA_RISC1_0: puts ("hppa1.0"); break;
-              	case CPU_PA_RISC1_1: puts ("hppa1.1"); break;
-              	case CPU_PA_RISC2_0:
-              #if defined(_SC_KERNEL_BITS)
-              	    switch (bits)
-              		{
-              		case 64: puts ("hppa2.0w"); break;
-              		case 32: puts ("hppa2.0n"); break;
-              		default: puts ("hppa2.0"); break;
-              		} break;
-              #else  /* !defined(_SC_KERNEL_BITS) */
-              	    puts ("hppa2.0"); break;
-              #endif
-              	default: puts ("hppa1.0"); break;
-              	}
-                  exit (0);
-              }
+		    switch (cpu)
+			{
+			case CPU_PA_RISC1_0: puts ("hppa1.0"); break;
+			case CPU_PA_RISC1_1: puts ("hppa1.1"); break;
+			case CPU_PA_RISC2_0:
+		#if defined(_SC_KERNEL_BITS)
+			    switch (bits)
+				{
+				case 64: puts ("hppa2.0w"); break;
+				case 32: puts ("hppa2.0n"); break;
+				default: puts ("hppa2.0"); break;
+				} break;
+		#else  /* !defined(_SC_KERNEL_BITS) */
+			    puts ("hppa2.0"); break;
+		#endif
+			default: puts ("hppa1.0"); break;
+			}
+		    exit (0);
+		}
 EOF
 		    (CCOPTS= $CC_FOR_BUILD -o $dummy $dummy.c 2>/dev/null) && HP_ARCH=`$dummy`
 		    test -z "$HP_ARCH" && HP_ARCH=hppa
@@ -656,7 +661,7 @@ EOF
 	    # => hppa64-hp-hpux11.23
 
 	    if echo __LP64__ | (CCOPTS= $CC_FOR_BUILD -E - 2>/dev/null) |
-		grep __LP64__ >/dev/null
+		grep -q __LP64__
 	    then
 		HP_ARCH="hppa2.0w"
 	    else
@@ -727,22 +732,22 @@ EOF
 	exit ;;
     C1*:ConvexOS:*:* | convex:ConvexOS:C1*:*)
 	echo c1-convex-bsd
-        exit ;;
+	exit ;;
     C2*:ConvexOS:*:* | convex:ConvexOS:C2*:*)
 	if getsysinfo -f scalar_acc
 	then echo c32-convex-bsd
 	else echo c2-convex-bsd
 	fi
-        exit ;;
+	exit ;;
     C34*:ConvexOS:*:* | convex:ConvexOS:C34*:*)
 	echo c34-convex-bsd
-        exit ;;
+	exit ;;
     C38*:ConvexOS:*:* | convex:ConvexOS:C38*:*)
 	echo c38-convex-bsd
-        exit ;;
+	exit ;;
     C4*:ConvexOS:*:* | convex:ConvexOS:C4*:*)
 	echo c4-convex-bsd
-        exit ;;
+	exit ;;
     CRAY*Y-MP:*:*:*)
 	echo ymp-cray-unicos${UNAME_RELEASE} | sed -e 's/\.[^.]*$/.X/'
 	exit ;;
@@ -766,14 +771,14 @@ EOF
 	exit ;;
     F30[01]:UNIX_System_V:*:* | F700:UNIX_System_V:*:*)
 	FUJITSU_PROC=`uname -m | tr 'ABCDEFGHIJKLMNOPQRSTUVWXYZ' 'abcdefghijklmnopqrstuvwxyz'`
-        FUJITSU_SYS=`uname -p | tr 'ABCDEFGHIJKLMNOPQRSTUVWXYZ' 'abcdefghijklmnopqrstuvwxyz' | sed -e 's/\///'`
-        FUJITSU_REL=`echo ${UNAME_RELEASE} | sed -e 's/ /_/'`
-        echo "${FUJITSU_PROC}-fujitsu-${FUJITSU_SYS}${FUJITSU_REL}"
-        exit ;;
+	FUJITSU_SYS=`uname -p | tr 'ABCDEFGHIJKLMNOPQRSTUVWXYZ' 'abcdefghijklmnopqrstuvwxyz' | sed -e 's/\///'`
+	FUJITSU_REL=`echo ${UNAME_RELEASE} | sed -e 's/ /_/'`
+	echo "${FUJITSU_PROC}-fujitsu-${FUJITSU_SYS}${FUJITSU_REL}"
+	exit ;;
     5000:UNIX_System_V:4.*:*)
-        FUJITSU_SYS=`uname -p | tr 'ABCDEFGHIJKLMNOPQRSTUVWXYZ' 'abcdefghijklmnopqrstuvwxyz' | sed -e 's/\///'`
-        FUJITSU_REL=`echo ${UNAME_RELEASE} | tr 'ABCDEFGHIJKLMNOPQRSTUVWXYZ' 'abcdefghijklmnopqrstuvwxyz' | sed -e 's/ /_/'`
-        echo "sparc-fujitsu-${FUJITSU_SYS}${FUJITSU_REL}"
+	FUJITSU_SYS=`uname -p | tr 'ABCDEFGHIJKLMNOPQRSTUVWXYZ' 'abcdefghijklmnopqrstuvwxyz' | sed -e 's/\///'`
+	FUJITSU_REL=`echo ${UNAME_RELEASE} | tr 'ABCDEFGHIJKLMNOPQRSTUVWXYZ' 'abcdefghijklmnopqrstuvwxyz' | sed -e 's/ /_/'`
+	echo "sparc-fujitsu-${FUJITSU_SYS}${FUJITSU_REL}"
 	exit ;;
     i*86:BSD/386:*:* | i*86:BSD/OS:*:* | *:Ascend\ Embedded/OS:*:*)
 	echo ${UNAME_MACHINE}-pc-bsdi${UNAME_RELEASE}
@@ -785,13 +790,12 @@ EOF
 	echo ${UNAME_MACHINE}-unknown-bsdi${UNAME_RELEASE}
 	exit ;;
     *:FreeBSD:*:*)
-	case ${UNAME_MACHINE} in
-	    pc98)
-		echo i386-unknown-freebsd`echo ${UNAME_RELEASE}|sed -e 's/[-(].*//'` ;;
+	UNAME_PROCESSOR=`/usr/bin/uname -p`
+	case ${UNAME_PROCESSOR} in
 	    amd64)
 		echo x86_64-unknown-freebsd`echo ${UNAME_RELEASE}|sed -e 's/[-(].*//'` ;;
 	    *)
-		echo ${UNAME_MACHINE}-unknown-freebsd`echo ${UNAME_RELEASE}|sed -e 's/[-(].*//'` ;;
+		echo ${UNAME_PROCESSOR}-unknown-freebsd`echo ${UNAME_RELEASE}|sed -e 's/[-(].*//'` ;;
 	esac
 	exit ;;
     i*:CYGWIN*:*)
@@ -800,19 +804,22 @@ EOF
     *:MINGW*:*)
 	echo ${UNAME_MACHINE}-pc-mingw32
 	exit ;;
+    i*:MSYS*:*)
+	echo ${UNAME_MACHINE}-pc-msys
+	exit ;;
     i*:windows32*:*)
-    	# uname -m includes "-pc" on this system.
-    	echo ${UNAME_MACHINE}-mingw32
+	# uname -m includes "-pc" on this system.
+	echo ${UNAME_MACHINE}-mingw32
 	exit ;;
     i*:PW*:*)
 	echo ${UNAME_MACHINE}-pc-pw32
 	exit ;;
-    *:Interix*:[3456]*)
-    	case ${UNAME_MACHINE} in
+    *:Interix*:*)
+	case ${UNAME_MACHINE} in
 	    x86)
 		echo i586-pc-interix${UNAME_RELEASE}
 		exit ;;
-	    EM64T | authenticamd | genuineintel)
+	    authenticamd | genuineintel | EM64T)
 		echo x86_64-unknown-interix${UNAME_RELEASE}
 		exit ;;
 	    IA64)
@@ -822,6 +829,9 @@ EOF
     [345]86:Windows_95:* | [345]86:Windows_98:* | [345]86:Windows_NT:*)
 	echo i${UNAME_MACHINE}-pc-mks
 	exit ;;
+    8664:Windows_NT:*)
+	echo x86_64-pc-mks
+	exit ;;
     i*:Windows_NT*:* | Pentium*:Windows_NT*:*)
 	# How do we know it's Interix rather than the generic POSIX subsystem?
 	# It also conflicts with pre-2.0 versions of AT&T UWIN. Should we
@@ -851,6 +861,27 @@ EOF
     i*86:Minix:*:*)
 	echo ${UNAME_MACHINE}-pc-minix
 	exit ;;
+    aarch64:Linux:*:*)
+	echo ${UNAME_MACHINE}-unknown-linux-gnu
+	exit ;;
+    aarch64_be:Linux:*:*)
+	UNAME_MACHINE=aarch64_be
+	echo ${UNAME_MACHINE}-unknown-linux-gnu
+	exit ;;
+    alpha:Linux:*:*)
+	case `sed -n '/^cpu model/s/^.*: \(.*\)/\1/p' < /proc/cpuinfo` in
+	  EV5)   UNAME_MACHINE=alphaev5 ;;
+	  EV56)  UNAME_MACHINE=alphaev56 ;;
+	  PCA56) UNAME_MACHINE=alphapca56 ;;
+	  PCA57) UNAME_MACHINE=alphapca56 ;;
+	  EV6)   UNAME_MACHINE=alphaev6 ;;
+	  EV67)  UNAME_MACHINE=alphaev67 ;;
+	  EV68*) UNAME_MACHINE=alphaev68 ;;
+	esac
+	objdump --private-headers /bin/sh | grep -q ld.so.1
+	if test "$?" = 0 ; then LIBC="libc1" ; else LIBC="" ; fi
+	echo ${UNAME_MACHINE}-unknown-linux-gnu${LIBC}
+	exit ;;
     arm*:Linux:*:*)
 	eval $set_cc_for_build
 	if echo __ARM_EABI__ | $CC_FOR_BUILD -E - 2>/dev/null \
@@ -858,20 +889,40 @@ EOF
 	then
 	    echo ${UNAME_MACHINE}-unknown-linux-gnu
 	else
-	    echo ${UNAME_MACHINE}-unknown-linux-gnueabi
+	    if echo __ARM_PCS_VFP | $CC_FOR_BUILD -E - 2>/dev/null \
+		| grep -q __ARM_PCS_VFP
+	    then
+		echo ${UNAME_MACHINE}-unknown-linux-gnueabi
+	    else
+		echo ${UNAME_MACHINE}-unknown-linux-gnueabihf
+	    fi
 	fi
 	exit ;;
     avr32*:Linux:*:*)
 	echo ${UNAME_MACHINE}-unknown-linux-gnu
 	exit ;;
     cris:Linux:*:*)
-	echo cris-axis-linux-gnu
+	echo ${UNAME_MACHINE}-axis-linux-gnu
 	exit ;;
     crisv32:Linux:*:*)
-	echo crisv32-axis-linux-gnu
+	echo ${UNAME_MACHINE}-axis-linux-gnu
 	exit ;;
     frv:Linux:*:*)
-    	echo frv-unknown-linux-gnu
+	echo ${UNAME_MACHINE}-unknown-linux-gnu
+	exit ;;
+    hexagon:Linux:*:*)
+	echo ${UNAME_MACHINE}-unknown-linux-gnu
+	exit ;;
+    i*86:Linux:*:*)
+	LIBC=gnu
+	eval $set_cc_for_build
+	sed 's/^	//' << EOF >$dummy.c
+	#ifdef __dietlibc__
+	LIBC=dietlibc
+	#endif
+EOF
+	eval `$CC_FOR_BUILD -E $dummy.c 2>/dev/null | grep '^LIBC'`
+	echo "${UNAME_MACHINE}-pc-linux-${LIBC}"
 	exit ;;
     ia64:Linux:*:*)
 	echo ${UNAME_MACHINE}-unknown-linux-gnu
@@ -882,78 +933,34 @@ EOF
     m68*:Linux:*:*)
 	echo ${UNAME_MACHINE}-unknown-linux-gnu
 	exit ;;
-    mips:Linux:*:*)
+    mips:Linux:*:* | mips64:Linux:*:*)
 	eval $set_cc_for_build
 	sed 's/^	//' << EOF >$dummy.c
 	#undef CPU
-	#undef mips
-	#undef mipsel
+	#undef ${UNAME_MACHINE}
+	#undef ${UNAME_MACHINE}el
 	#if defined(__MIPSEL__) || defined(__MIPSEL) || defined(_MIPSEL) || defined(MIPSEL)
-	CPU=mipsel
+	CPU=${UNAME_MACHINE}el
 	#else
 	#if defined(__MIPSEB__) || defined(__MIPSEB) || defined(_MIPSEB) || defined(MIPSEB)
-	CPU=mips
+	CPU=${UNAME_MACHINE}
 	#else
 	CPU=
 	#endif
 	#endif
 EOF
-	eval "`$CC_FOR_BUILD -E $dummy.c 2>/dev/null | sed -n '
-	    /^CPU/{
-		s: ::g
-		p
-	    }'`"
-	test x"${CPU}" != x && { echo "${CPU}-unknown-linux-gnu"; exit; }
-	;;
-    mips64:Linux:*:*)
-	eval $set_cc_for_build
-	sed 's/^	//' << EOF >$dummy.c
-	#undef CPU
-	#undef mips64
-	#undef mips64el
-	#if defined(__MIPSEL__) || defined(__MIPSEL) || defined(_MIPSEL) || defined(MIPSEL)
-	CPU=mips64el
-	#else
-	#if defined(__MIPSEB__) || defined(__MIPSEB) || defined(_MIPSEB) || defined(MIPSEB)
-	CPU=mips64
-	#else
-	CPU=
-	#endif
-	#endif
-EOF
-	eval "`$CC_FOR_BUILD -E $dummy.c 2>/dev/null | sed -n '
-	    /^CPU/{
-		s: ::g
-		p
-	    }'`"
+	eval `$CC_FOR_BUILD -E $dummy.c 2>/dev/null | grep '^CPU'`
 	test x"${CPU}" != x && { echo "${CPU}-unknown-linux-gnu"; exit; }
 	;;
     or32:Linux:*:*)
-	echo or32-unknown-linux-gnu
-	exit ;;
-    ppc:Linux:*:*)
-	echo powerpc-unknown-linux-gnu
-	exit ;;
-    ppc64:Linux:*:*)
-	echo powerpc64-unknown-linux-gnu
-	exit ;;
-    alpha:Linux:*:*)
-	case `sed -n '/^cpu model/s/^.*: \(.*\)/\1/p' < /proc/cpuinfo` in
-	  EV5)   UNAME_MACHINE=alphaev5 ;;
-	  EV56)  UNAME_MACHINE=alphaev56 ;;
-	  PCA56) UNAME_MACHINE=alphapca56 ;;
-	  PCA57) UNAME_MACHINE=alphapca56 ;;
-	  EV6)   UNAME_MACHINE=alphaev6 ;;
-	  EV67)  UNAME_MACHINE=alphaev67 ;;
-	  EV68*) UNAME_MACHINE=alphaev68 ;;
-        esac
-	objdump --private-headers /bin/sh | grep ld.so.1 >/dev/null
-	if test "$?" = 0 ; then LIBC="libc1" ; else LIBC="" ; fi
-	echo ${UNAME_MACHINE}-unknown-linux-gnu${LIBC}
+	echo ${UNAME_MACHINE}-unknown-linux-gnu
 	exit ;;
     padre:Linux:*:*)
 	echo sparc-unknown-linux-gnu
 	exit ;;
+    parisc64:Linux:*:* | hppa64:Linux:*:*)
+	echo hppa64-unknown-linux-gnu
+	exit ;;
     parisc:Linux:*:* | hppa:Linux:*:*)
 	# Look for CPU level
 	case `grep '^cpu[^a-z]*:' /proc/cpuinfo 2>/dev/null | cut -d' ' -f2` in
@@ -962,14 +969,17 @@ EOF
 	  *)    echo hppa-unknown-linux-gnu ;;
 	esac
 	exit ;;
-    parisc64:Linux:*:* | hppa64:Linux:*:*)
-	echo hppa64-unknown-linux-gnu
+    ppc64:Linux:*:*)
+	echo powerpc64-unknown-linux-gnu
+	exit ;;
+    ppc:Linux:*:*)
+	echo powerpc-unknown-linux-gnu
 	exit ;;
     s390:Linux:*:* | s390x:Linux:*:*)
 	echo ${UNAME_MACHINE}-ibm-linux
 	exit ;;
     sh64*:Linux:*:*)
-    	echo ${UNAME_MACHINE}-unknown-linux-gnu
+	echo ${UNAME_MACHINE}-unknown-linux-gnu
 	exit ;;
     sh*:Linux:*:*)
 	echo ${UNAME_MACHINE}-unknown-linux-gnu
@@ -977,75 +987,18 @@ EOF
     sparc:Linux:*:* | sparc64:Linux:*:*)
 	echo ${UNAME_MACHINE}-unknown-linux-gnu
 	exit ;;
+    tile*:Linux:*:*)
+	echo ${UNAME_MACHINE}-unknown-linux-gnu
+	exit ;;
     vax:Linux:*:*)
 	echo ${UNAME_MACHINE}-dec-linux-gnu
 	exit ;;
     x86_64:Linux:*:*)
-	echo x86_64-unknown-linux-gnu
+	echo ${UNAME_MACHINE}-unknown-linux-gnu
 	exit ;;
     xtensa*:Linux:*:*)
-    	echo ${UNAME_MACHINE}-unknown-linux-gnu
+	echo ${UNAME_MACHINE}-unknown-linux-gnu
 	exit ;;
-    i*86:Linux:*:*)
-	# The BFD linker knows what the default object file format is, so
-	# first see if it will tell us. cd to the root directory to prevent
-	# problems with other programs or directories called `ld' in the path.
-	# Set LC_ALL=C to ensure ld outputs messages in English.
-	ld_supported_targets=`cd /; LC_ALL=C ld --help 2>&1 \
-			 | sed -ne '/supported targets:/!d
-				    s/[ 	][ 	]*/ /g
-				    s/.*supported targets: *//
-				    s/ .*//
-				    p'`
-        case "$ld_supported_targets" in
-	  elf32-i386)
-		TENTATIVE="${UNAME_MACHINE}-pc-linux-gnu"
-		;;
-	  a.out-i386-linux)
-		echo "${UNAME_MACHINE}-pc-linux-gnuaout"
-		exit ;;
-	  "")
-		# Either a pre-BFD a.out linker (linux-gnuoldld) or
-		# one that does not give us useful --help.
-		echo "${UNAME_MACHINE}-pc-linux-gnuoldld"
-		exit ;;
-	esac
-	# Determine whether the default compiler is a.out or elf
-	eval $set_cc_for_build
-	sed 's/^	//' << EOF >$dummy.c
-	#include <features.h>
-	#ifdef __ELF__
-	# ifdef __GLIBC__
-	#  if __GLIBC__ >= 2
-	LIBC=gnu
-	#  else
-	LIBC=gnulibc1
-	#  endif
-	# else
-	LIBC=gnulibc1
-	# endif
-	#else
-	#if defined(__INTEL_COMPILER) || defined(__PGI) || defined(__SUNPRO_C) || defined(__SUNPRO_CC)
-	LIBC=gnu
-	#else
-	LIBC=gnuaout
-	#endif
-	#endif
-	#ifdef __dietlibc__
-	LIBC=dietlibc
-	#endif
-EOF
-	eval "`$CC_FOR_BUILD -E $dummy.c 2>/dev/null | sed -n '
-	    /^LIBC/{
-		s: ::g
-		p
-	    }'`"
-	test x"${LIBC}" != x && {
-		echo "${UNAME_MACHINE}-pc-linux-${LIBC}"
-		exit
-	}
-	test x"${TENTATIVE}" != x && { echo "${TENTATIVE}"; exit; }
-	;;
     i*86:DYNIX/ptx:4*:*)
 	# ptx 4.0 does uname -s correctly, with DYNIX/ptx in there.
 	# earlier versions are messed up and put the nodename in both
@@ -1053,11 +1006,11 @@ EOF
 	echo i386-sequent-sysv4
 	exit ;;
     i*86:UNIX_SV:4.2MP:2.*)
-        # Unixware is an offshoot of SVR4, but it has its own version
-        # number series starting with 2...
-        # I am not positive that other SVR4 systems won't match this,
+	# Unixware is an offshoot of SVR4, but it has its own version
+	# number series starting with 2...
+	# I am not positive that other SVR4 systems won't match this,
 	# I just have to hope.  -- rms.
-        # Use sysv4.2uw... so that sysv4* matches it.
+	# Use sysv4.2uw... so that sysv4* matches it.
 	echo ${UNAME_MACHINE}-pc-sysv4.2uw${UNAME_VERSION}
 	exit ;;
     i*86:OS/2:*:*)
@@ -1074,7 +1027,7 @@ EOF
     i*86:syllable:*:*)
 	echo ${UNAME_MACHINE}-pc-syllable
 	exit ;;
-    i*86:LynxOS:2.*:* | i*86:LynxOS:3.[01]*:* | i*86:LynxOS:4.0*:*)
+    i*86:LynxOS:2.*:* | i*86:LynxOS:3.[01]*:* | i*86:LynxOS:4.[02]*:*)
 	echo i386-unknown-lynxos${UNAME_RELEASE}
 	exit ;;
     i*86:*DOS:*:*)
@@ -1089,7 +1042,7 @@ EOF
 	fi
 	exit ;;
     i*86:*:5:[678]*)
-    	# UnixWare 7.x, OpenUNIX and OpenServer 6.
+	# UnixWare 7.x, OpenUNIX and OpenServer 6.
 	case `/bin/uname -X | grep "^Machine"` in
 	    *486*)	     UNAME_MACHINE=i486 ;;
 	    *Pentium)	     UNAME_MACHINE=i586 ;;
@@ -1117,13 +1070,13 @@ EOF
 	exit ;;
     pc:*:*:*)
 	# Left here for compatibility:
-        # uname -m prints for DJGPP always 'pc', but it prints nothing about
-        # the processor, so we play safe by assuming i586.
+	# uname -m prints for DJGPP always 'pc', but it prints nothing about
+	# the processor, so we play safe by assuming i586.
 	# Note: whatever this is, it MUST be the same as what config.sub
 	# prints for the "djgpp" host, or else GDB configury will decide that
 	# this is a cross-build.
 	echo i586-pc-msdosdjgpp
-        exit ;;
+	exit ;;
     Intel:Mach:3*:*)
 	echo i386-pc-mach3
 	exit ;;
@@ -1158,8 +1111,8 @@ EOF
 	/bin/uname -p 2>/dev/null | /bin/grep entium >/dev/null \
 	  && { echo i586-ncr-sysv4.3${OS_REL}; exit; } ;;
     3[34]??:*:4.0:* | 3[34]??,*:*:4.0:*)
-        /bin/uname -p 2>/dev/null | grep 86 >/dev/null \
-          && { echo i486-ncr-sysv4; exit; } ;;
+	/bin/uname -p 2>/dev/null | grep 86 >/dev/null \
+	  && { echo i486-ncr-sysv4; exit; } ;;
     NCR*:*:4.2:* | MPRAS*:*:4.2:*)
 	OS_REL='.3'
 	test -r /etc/.relid \
@@ -1182,7 +1135,7 @@ EOF
     rs6000:LynxOS:2.*:*)
 	echo rs6000-unknown-lynxos${UNAME_RELEASE}
 	exit ;;
-    PowerPC:LynxOS:2.*:* | PowerPC:LynxOS:3.[01]*:* | PowerPC:LynxOS:4.0*:*)
+    PowerPC:LynxOS:2.*:* | PowerPC:LynxOS:3.[01]*:* | PowerPC:LynxOS:4.[02]*:*)
 	echo powerpc-unknown-lynxos${UNAME_RELEASE}
 	exit ;;
     SM[BE]S:UNIX_SV:*:*)
@@ -1202,10 +1155,10 @@ EOF
 		echo ns32k-sni-sysv
 	fi
 	exit ;;
-    PENTIUM:*:4.0*:*) # Unisys `ClearPath HMP IX 4000' SVR4/MP effort
-                      # says <Richard.M.Bartel at ccMail.Census.GOV>
-        echo i586-unisys-sysv4
-        exit ;;
+    PENTIUM:*:4.0*:*)	# Unisys `ClearPath HMP IX 4000' SVR4/MP effort
+			# says <Richard.M.Bartel at ccMail.Census.GOV>
+	echo i586-unisys-sysv4
+	exit ;;
     *:UNIX_System_V:4*:FTX*)
 	# From Gerald Hewes <hewes at openmarket.com>.
 	# How about differentiating between stratus architectures? -djm
@@ -1231,11 +1184,11 @@ EOF
 	exit ;;
     R[34]000:*System_V*:*:* | R4000:UNIX_SYSV:*:* | R*000:UNIX_SV:*:*)
 	if [ -d /usr/nec ]; then
-	        echo mips-nec-sysv${UNAME_RELEASE}
+		echo mips-nec-sysv${UNAME_RELEASE}
 	else
-	        echo mips-unknown-sysv${UNAME_RELEASE}
+		echo mips-unknown-sysv${UNAME_RELEASE}
 	fi
-        exit ;;
+	exit ;;
     BeBox:BeOS:*:*)	# BeOS running on hardware made by Be, PPC only.
 	echo powerpc-be-beos
 	exit ;;
@@ -1275,6 +1228,16 @@ EOF
     *:Darwin:*:*)
 	UNAME_PROCESSOR=`uname -p` || UNAME_PROCESSOR=unknown
 	case $UNAME_PROCESSOR in
+	    i386)
+		eval $set_cc_for_build
+		if [ "$CC_FOR_BUILD" != 'no_compiler_found' ]; then
+		  if (echo '#ifdef __LP64__'; echo IS_64BIT_ARCH; echo '#endif') | \
+		      (CCOPTS= $CC_FOR_BUILD -E - 2>/dev/null) | \
+		      grep IS_64BIT_ARCH >/dev/null
+		  then
+		      UNAME_PROCESSOR="x86_64"
+		  fi
+		fi ;;
 	    unknown) UNAME_PROCESSOR=powerpc ;;
 	esac
 	echo ${UNAME_PROCESSOR}-apple-darwin${UNAME_RELEASE}
@@ -1290,6 +1253,9 @@ EOF
     *:QNX:*:4*)
 	echo i386-pc-qnx
 	exit ;;
+    NEO-?:NONSTOP_KERNEL:*:*)
+	echo neo-tandem-nsk${UNAME_RELEASE}
+	exit ;;
     NSE-?:NONSTOP_KERNEL:*:*)
 	echo nse-tandem-nsk${UNAME_RELEASE}
 	exit ;;
@@ -1335,13 +1301,13 @@ EOF
 	echo pdp10-unknown-its
 	exit ;;
     SEI:*:*:SEIUX)
-        echo mips-sei-seiux${UNAME_RELEASE}
+	echo mips-sei-seiux${UNAME_RELEASE}
 	exit ;;
     *:DragonFly:*:*)
 	echo ${UNAME_MACHINE}-unknown-dragonfly`echo ${UNAME_RELEASE}|sed -e 's/[-(].*//'`
 	exit ;;
     *:*VMS:*:*)
-    	UNAME_MACHINE=`(uname -p) 2>/dev/null`
+	UNAME_MACHINE=`(uname -p) 2>/dev/null`
 	case "${UNAME_MACHINE}" in
 	    A*) echo alpha-dec-vms ; exit ;;
 	    I*) echo ia64-dec-vms ; exit ;;
@@ -1359,6 +1325,9 @@ EOF
     i*86:AROS:*:*)
 	echo ${UNAME_MACHINE}-pc-aros
 	exit ;;
+    x86_64:VMkernel:*:*)
+	echo ${UNAME_MACHINE}-unknown-esx
+	exit ;;
 esac
 
 #echo '(No uname command or uname output not recognized.)' 1>&2
@@ -1381,11 +1350,11 @@ main ()
 #include <sys/param.h>
   printf ("m68k-sony-newsos%s\n",
 #ifdef NEWSOS4
-          "4"
+	"4"
 #else
-	  ""
+	""
 #endif
-         ); exit (0);
+	); exit (0);
 #endif
 #endif
 
diff --git a/config.h.in b/config.h.in
index ea47b5e..7801220 100644
--- a/config.h.in
+++ b/config.h.in
@@ -13,6 +13,9 @@
 /* Define to 1 if you have the <execinfo.h> header file. */
 #undef HAVE_EXECINFO_H
 
+/* Define if type __int128 is supported */
+#undef HAVE_INT128
+
 /* Define to 1 if you have the <inttypes.h> header file. */
 #undef HAVE_INTTYPES_H
 
@@ -43,6 +46,9 @@
 /* Define to 1 if you have the <sys/stat.h> header file. */
 #undef HAVE_SYS_STAT_H
 
+/* Define to 1 if you have the <sys/syscall.h> header file. */
+#undef HAVE_SYS_SYSCALL_H
+
 /* Define to 1 if you have the <sys/types.h> header file. */
 #undef HAVE_SYS_TYPES_H
 
@@ -68,6 +74,9 @@
 /* Define to the one symbol short name of this package. */
 #undef PACKAGE_TARNAME
 
+/* Define to the home page for this package. */
+#undef PACKAGE_URL
+
 /* Define to the version of this package. */
 #undef PACKAGE_VERSION
 
diff --git a/config.sub b/config.sub
index a39437d..c894da4 100755
--- a/config.sub
+++ b/config.sub
@@ -1,10 +1,10 @@
 #! /bin/sh
 # Configuration validation subroutine script.
 #   Copyright (C) 1992, 1993, 1994, 1995, 1996, 1997, 1998, 1999,
-#   2000, 2001, 2002, 2003, 2004, 2005, 2006, 2007, 2008
-#   Free Software Foundation, Inc.
+#   2000, 2001, 2002, 2003, 2004, 2005, 2006, 2007, 2008, 2009, 2010,
+#   2011, 2012 Free Software Foundation, Inc.
 
-timestamp='2009-04-17'
+timestamp='2012-02-10'
 
 # This file is (in principle) common to ALL GNU software.
 # The presence of a machine in this file suggests that SOME GNU software
@@ -21,9 +21,7 @@ timestamp='2009-04-17'
 # GNU General Public License for more details.
 #
 # You should have received a copy of the GNU General Public License
-# along with this program; if not, write to the Free Software
-# Foundation, Inc., 51 Franklin Street - Fifth Floor, Boston, MA
-# 02110-1301, USA.
+# along with this program; if not, see <http://www.gnu.org/licenses/>.
 #
 # As a special exception to the GNU General Public License, if you
 # distribute this file as part of a program that contains a
@@ -32,13 +30,16 @@ timestamp='2009-04-17'
 
 
 # Please send patches to <config-patches at gnu.org>.  Submit a context
-# diff and a properly formatted ChangeLog entry.
+# diff and a properly formatted GNU ChangeLog entry.
 #
 # Configuration subroutine to validate and canonicalize a configuration type.
 # Supply the specified configuration type as an argument.
 # If it is invalid, we print an error message on stderr and exit with code 1.
 # Otherwise, we print the canonical config type on stdout and succeed.
 
+# You can get the latest version of this script from:
+# http://git.savannah.gnu.org/gitweb/?p=config.git;a=blob_plain;f=config.sub;hb=HEAD
+
 # This file is supposed to be the same for all GNU packages
 # and recognize all the CPU types, system types and aliases
 # that are meaningful with *any* GNU software.
@@ -72,8 +73,9 @@ Report bugs and patches to <config-patches at gnu.org>."
 version="\
 GNU config.sub ($timestamp)
 
-Copyright (C) 1992, 1993, 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001,
-2002, 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc.
+Copyright (C) 1992, 1993, 1994, 1995, 1996, 1997, 1998, 1999, 2000,
+2001, 2002, 2003, 2004, 2005, 2006, 2007, 2008, 2009, 2010, 2011, 2012
+Free Software Foundation, Inc.
 
 This is free software; see the source for copying conditions.  There is NO
 warranty; not even for MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE."
@@ -120,13 +122,18 @@ esac
 # Here we must recognize all the valid KERNEL-OS combinations.
 maybe_os=`echo $1 | sed 's/^\(.*\)-\([^-]*-[^-]*\)$/\2/'`
 case $maybe_os in
-  nto-qnx* | linux-gnu* | linux-dietlibc | linux-newlib* | linux-uclibc* | \
-  uclinux-uclibc* | uclinux-gnu* | kfreebsd*-gnu* | knetbsd*-gnu* | netbsd*-gnu* | \
+  nto-qnx* | linux-gnu* | linux-android* | linux-dietlibc | linux-newlib* | \
+  linux-uclibc* | uclinux-uclibc* | uclinux-gnu* | kfreebsd*-gnu* | \
+  knetbsd*-gnu* | netbsd*-gnu* | \
   kopensolaris*-gnu* | \
   storm-chaos* | os2-emx* | rtmk-nova*)
     os=-$maybe_os
     basic_machine=`echo $1 | sed 's/^\(.*\)-\([^-]*-[^-]*\)$/\1/'`
     ;;
+  android-linux)
+    os=-linux-android
+    basic_machine=`echo $1 | sed 's/^\(.*\)-\([^-]*-[^-]*\)$/\1/'`-unknown
+    ;;
   *)
     basic_machine=`echo $1 | sed 's/-[^-]*$//'`
     if [ $basic_machine != $1 ]
@@ -149,10 +156,13 @@ case $os in
 	-convergent* | -ncr* | -news | -32* | -3600* | -3100* | -hitachi* |\
 	-c[123]* | -convex* | -sun | -crds | -omron* | -dg | -ultra | -tti* | \
 	-harris | -dolphin | -highlevel | -gould | -cbm | -ns | -masscomp | \
-	-apple | -axis | -knuth | -cray)
+	-apple | -axis | -knuth | -cray | -microblaze)
 		os=
 		basic_machine=$1
 		;;
+	-bluegene*)
+		os=-cnk
+		;;
 	-sim | -cisco | -oki | -wec | -winbond)
 		os=
 		basic_machine=$1
@@ -167,10 +177,10 @@ case $os in
 		os=-chorusos
 		basic_machine=$1
 		;;
- 	-chorusrdb)
- 		os=-chorusrdb
+	-chorusrdb)
+		os=-chorusrdb
 		basic_machine=$1
- 		;;
+		;;
 	-hiux*)
 		os=-hiuxwe2
 		;;
@@ -239,17 +249,22 @@ case $basic_machine in
 	# Some are omitted here because they have special meanings below.
 	1750a | 580 \
 	| a29k \
+	| aarch64 | aarch64_be \
 	| alpha | alphaev[4-8] | alphaev56 | alphaev6[78] | alphapca5[67] \
 	| alpha64 | alpha64ev[4-8] | alpha64ev56 | alpha64ev6[78] | alpha64pca5[67] \
 	| am33_2.0 \
 	| arc | arm | arm[bl]e | arme[lb] | armv[2345] | armv[345][lb] | avr | avr32 \
+        | be32 | be64 \
 	| bfin \
 	| c4x | clipper \
 	| d10v | d30v | dlx | dsp16xx \
+	| epiphany \
 	| fido | fr30 | frv \
 	| h8300 | h8500 | hppa | hppa1.[01] | hppa2.0 | hppa2.0[nw] | hppa64 \
+	| hexagon \
 	| i370 | i860 | i960 | ia64 \
 	| ip2k | iq2000 \
+	| le32 | le64 \
 	| lm32 \
 	| m32c | m32r | m32rle | m68000 | m68k | m88k \
 	| maxq | mb | microblaze | mcore | mep | metag \
@@ -275,27 +290,39 @@ case $basic_machine in
 	| moxie \
 	| mt \
 	| msp430 \
+	| nds32 | nds32le | nds32be \
 	| nios | nios2 \
 	| ns16k | ns32k \
+	| open8 \
 	| or32 \
 	| pdp10 | pdp11 | pj | pjl \
-	| powerpc | powerpc64 | powerpc64le | powerpcle | ppcbe \
+	| powerpc | powerpc64 | powerpc64le | powerpcle \
 	| pyramid \
+	| rl78 | rx \
 	| score \
 	| sh | sh[1234] | sh[24]a | sh[24]aeb | sh[23]e | sh[34]eb | sheb | shbe | shle | sh[1234]le | sh3ele \
 	| sh64 | sh64le \
 	| sparc | sparc64 | sparc64b | sparc64v | sparc86x | sparclet | sparclite \
 	| sparcv8 | sparcv9 | sparcv9b | sparcv9v \
-	| spu | strongarm \
-	| tahoe | thumb | tic4x | tic80 | tron \
-	| v850 | v850e \
+	| spu \
+	| tahoe | tic4x | tic54x | tic55x | tic6x | tic80 | tron \
+	| ubicom32 \
+	| v850 | v850e | v850e1 | v850e2 | v850es | v850e2v3 \
 	| we32k \
-	| x86 | xc16x | xscale | xscalee[bl] | xstormy16 | xtensa \
+	| x86 | xc16x | xstormy16 | xtensa \
 	| z8k | z80)
 		basic_machine=$basic_machine-unknown
 		;;
-	m6811 | m68hc11 | m6812 | m68hc12)
-		# Motorola 68HC11/12.
+	c54x)
+		basic_machine=tic54x-unknown
+		;;
+	c55x)
+		basic_machine=tic55x-unknown
+		;;
+	c6x)
+		basic_machine=tic6x-unknown
+		;;
+	m6811 | m68hc11 | m6812 | m68hc12 | m68hcs12x | picochip)
 		basic_machine=$basic_machine-unknown
 		os=-none
 		;;
@@ -305,6 +332,21 @@ case $basic_machine in
 		basic_machine=mt-unknown
 		;;
 
+	strongarm | thumb | xscale)
+		basic_machine=arm-unknown
+		;;
+	xgate)
+		basic_machine=$basic_machine-unknown
+		os=-none
+		;;
+	xscaleeb)
+		basic_machine=armeb-unknown
+		;;
+
+	xscaleel)
+		basic_machine=armel-unknown
+		;;
+
 	# We use `pc' rather than `unknown'
 	# because (1) that's what they normally are, and
 	# (2) the word "unknown" tends to confuse beginning users.
@@ -319,25 +361,29 @@ case $basic_machine in
 	# Recognize the basic CPU types with company name.
 	580-* \
 	| a29k-* \
+	| aarch64-* | aarch64_be-* \
 	| alpha-* | alphaev[4-8]-* | alphaev56-* | alphaev6[78]-* \
 	| alpha64-* | alpha64ev[4-8]-* | alpha64ev56-* | alpha64ev6[78]-* \
 	| alphapca5[67]-* | alpha64pca5[67]-* | arc-* \
 	| arm-*  | armbe-* | armle-* | armeb-* | armv*-* \
 	| avr-* | avr32-* \
+	| be32-* | be64-* \
 	| bfin-* | bs2000-* \
-	| c[123]* | c30-* | [cjt]90-* | c4x-* | c54x-* | c55x-* | c6x-* \
+	| c[123]* | c30-* | [cjt]90-* | c4x-* \
 	| clipper-* | craynv-* | cydra-* \
 	| d10v-* | d30v-* | dlx-* \
 	| elxsi-* \
 	| f30[01]-* | f700-* | fido-* | fr30-* | frv-* | fx80-* \
 	| h8300-* | h8500-* \
 	| hppa-* | hppa1.[01]-* | hppa2.0-* | hppa2.0[nw]-* | hppa64-* \
+	| hexagon-* \
 	| i*86-* | i860-* | i960-* | ia64-* \
 	| ip2k-* | iq2000-* \
+	| le32-* | le64-* \
 	| lm32-* \
 	| m32c-* | m32r-* | m32rle-* \
 	| m68000-* | m680[012346]0-* | m68360-* | m683?2-* | m68k-* \
-	| m88110-* | m88k-* | maxq-* | mcore-* | metag-* \
+	| m88110-* | m88k-* | maxq-* | mcore-* | metag-* | microblaze-* \
 	| mips-* | mipsbe-* | mipseb-* | mipsel-* | mipsle-* \
 	| mips16-* \
 	| mips64-* | mips64el-* \
@@ -359,24 +405,29 @@ case $basic_machine in
 	| mmix-* \
 	| mt-* \
 	| msp430-* \
+	| nds32-* | nds32le-* | nds32be-* \
 	| nios-* | nios2-* \
 	| none-* | np1-* | ns16k-* | ns32k-* \
+	| open8-* \
 	| orion-* \
 	| pdp10-* | pdp11-* | pj-* | pjl-* | pn-* | power-* \
-	| powerpc-* | powerpc64-* | powerpc64le-* | powerpcle-* | ppcbe-* \
+	| powerpc-* | powerpc64-* | powerpc64le-* | powerpcle-* \
 	| pyramid-* \
-	| romp-* | rs6000-* \
+	| rl78-* | romp-* | rs6000-* | rx-* \
 	| sh-* | sh[1234]-* | sh[24]a-* | sh[24]aeb-* | sh[23]e-* | sh[34]eb-* | sheb-* | shbe-* \
 	| shle-* | sh[1234]le-* | sh3ele-* | sh64-* | sh64le-* \
 	| sparc-* | sparc64-* | sparc64b-* | sparc64v-* | sparc86x-* | sparclet-* \
 	| sparclite-* \
-	| sparcv8-* | sparcv9-* | sparcv9b-* | sparcv9v-* | strongarm-* | sv1-* | sx?-* \
-	| tahoe-* | thumb-* \
-	| tic30-* | tic4x-* | tic54x-* | tic55x-* | tic6x-* | tic80-* | tile-* \
+	| sparcv8-* | sparcv9-* | sparcv9b-* | sparcv9v-* | sv1-* | sx?-* \
+	| tahoe-* \
+	| tic30-* | tic4x-* | tic54x-* | tic55x-* | tic6x-* | tic80-* \
+	| tile*-* \
 	| tron-* \
-	| v850-* | v850e-* | vax-* \
+	| ubicom32-* \
+	| v850-* | v850e-* | v850e1-* | v850es-* | v850e2-* | v850e2v3-* \
+	| vax-* \
 	| we32k-* \
-	| x86-* | x86_64-* | xc16x-* | xps100-* | xscale-* | xscalee[bl]-* \
+	| x86-* | x86_64-* | xc16x-* | xps100-* \
 	| xstormy16-* | xtensa*-* \
 	| ymp-* \
 	| z8k-* | z80-*)
@@ -401,7 +452,7 @@ case $basic_machine in
 		basic_machine=a29k-amd
 		os=-udi
 		;;
-    	abacus)
+	abacus)
 		basic_machine=abacus-unknown
 		;;
 	adobe68k)
@@ -467,11 +518,24 @@ case $basic_machine in
 		basic_machine=bfin-`echo $basic_machine | sed 's/^[^-]*-//'`
 		os=-linux
 		;;
+	bluegene*)
+		basic_machine=powerpc-ibm
+		os=-cnk
+		;;
+	c54x-*)
+		basic_machine=tic54x-`echo $basic_machine | sed 's/^[^-]*-//'`
+		;;
+	c55x-*)
+		basic_machine=tic55x-`echo $basic_machine | sed 's/^[^-]*-//'`
+		;;
+	c6x-*)
+		basic_machine=tic6x-`echo $basic_machine | sed 's/^[^-]*-//'`
+		;;
 	c90)
 		basic_machine=c90-cray
 		os=-unicos
 		;;
-        cegcc)
+	cegcc)
 		basic_machine=arm-unknown
 		os=-cegcc
 		;;
@@ -503,7 +567,7 @@ case $basic_machine in
 		basic_machine=craynv-cray
 		os=-unicosmp
 		;;
-	cr16)
+	cr16 | cr16-*)
 		basic_machine=cr16-unknown
 		os=-elf
 		;;
@@ -661,7 +725,6 @@ case $basic_machine in
 	i370-ibm* | ibm*)
 		basic_machine=i370-ibm
 		;;
-# I'm not sure what "Sysv32" means.  Should this be sysv3.2?
 	i*86v32)
 		basic_machine=`echo $1 | sed -e 's/86.*/86-pc/'`
 		os=-sysv32
@@ -719,6 +782,9 @@ case $basic_machine in
 		basic_machine=ns32k-utek
 		os=-sysv
 		;;
+	microblaze)
+		basic_machine=microblaze-xilinx
+		;;
 	mingw32)
 		basic_machine=i386-pc
 		os=-mingw32
@@ -755,10 +821,18 @@ case $basic_machine in
 	ms1-*)
 		basic_machine=`echo $basic_machine | sed -e 's/ms1-/mt-/'`
 		;;
+	msys)
+		basic_machine=i386-pc
+		os=-msys
+		;;
 	mvs)
 		basic_machine=i370-ibm
 		os=-mvs
 		;;
+	nacl)
+		basic_machine=le32-unknown
+		os=-nacl
+		;;
 	ncr3000)
 		basic_machine=i486-ncr
 		os=-sysv4
@@ -823,6 +897,12 @@ case $basic_machine in
 	np1)
 		basic_machine=np1-gould
 		;;
+	neo-tandem)
+		basic_machine=neo-tandem
+		;;
+	nse-tandem)
+		basic_machine=nse-tandem
+		;;
 	nsr-tandem)
 		basic_machine=nsr-tandem
 		;;
@@ -905,9 +985,10 @@ case $basic_machine in
 		;;
 	power)	basic_machine=power-ibm
 		;;
-	ppc)	basic_machine=powerpc-unknown
+	ppc | ppcbe)	basic_machine=powerpc-unknown
 		;;
-	ppc-*)	basic_machine=powerpc-`echo $basic_machine | sed 's/^[^-]*-//'`
+	ppc-* | ppcbe-*)
+		basic_machine=powerpc-`echo $basic_machine | sed 's/^[^-]*-//'`
 		;;
 	ppcle | powerpclittle | ppc-le | powerpc-little)
 		basic_machine=powerpcle-unknown
@@ -1001,6 +1082,9 @@ case $basic_machine in
 		basic_machine=i860-stratus
 		os=-sysv4
 		;;
+	strongarm-* | thumb-*)
+		basic_machine=arm-`echo $basic_machine | sed 's/^[^-]*-//'`
+		;;
 	sun2)
 		basic_machine=m68000-sun
 		;;
@@ -1057,20 +1141,8 @@ case $basic_machine in
 		basic_machine=t90-cray
 		os=-unicos
 		;;
-	tic54x | c54x*)
-		basic_machine=tic54x-unknown
-		os=-coff
-		;;
-	tic55x | c55x*)
-		basic_machine=tic55x-unknown
-		os=-coff
-		;;
-	tic6x | c6x*)
-		basic_machine=tic6x-unknown
-		os=-coff
-		;;
 	tile*)
-		basic_machine=tile-unknown
+		basic_machine=$basic_machine-unknown
 		os=-linux-gnu
 		;;
 	tx39)
@@ -1140,6 +1212,9 @@ case $basic_machine in
 	xps | xps100)
 		basic_machine=xps100-honeywell
 		;;
+	xscale-* | xscalee[bl]-*)
+		basic_machine=`echo $basic_machine | sed 's/^xscale/arm/'`
+		;;
 	ymp)
 		basic_machine=ymp-cray
 		os=-unicos
@@ -1237,9 +1312,12 @@ esac
 if [ x"$os" != x"" ]
 then
 case $os in
-        # First match some system type aliases
-        # that might get confused with valid system types.
+	# First match some system type aliases
+	# that might get confused with valid system types.
 	# -solaris* is a basic system type, with this one exception.
+	-auroraux)
+		os=-auroraux
+		;;
 	-solaris1 | -solaris1.*)
 		os=`echo $os | sed -e 's|solaris1|sunos4|'`
 		;;
@@ -1260,9 +1338,9 @@ case $os in
 	# Each alternative MUST END IN A *, to match a version number.
 	# -sysv* is not here because it comes later, after sysvr4.
 	-gnu* | -bsd* | -mach* | -minix* | -genix* | -ultrix* | -irix* \
-	      | -*vms* | -sco* | -esix* | -isc* | -aix* | -sunos | -sunos[34]*\
-	      | -hpux* | -unos* | -osf* | -luna* | -dgux* | -solaris* | -sym* \
-	      | -kopensolaris* \
+	      | -*vms* | -sco* | -esix* | -isc* | -aix* | -cnk* | -sunos | -sunos[34]*\
+	      | -hpux* | -unos* | -osf* | -luna* | -dgux* | -auroraux* | -solaris* \
+	      | -sym* | -kopensolaris* \
 	      | -amigaos* | -amigados* | -msdos* | -newsos* | -unicos* | -aof* \
 	      | -aos* | -aros* \
 	      | -nindy* | -vxsim* | -vxworks* | -ebmon* | -hms* | -mvs* \
@@ -1274,8 +1352,9 @@ case $os in
 	      | -ptx* | -coff* | -ecoff* | -winnt* | -domain* | -vsta* \
 	      | -udi* | -eabi* | -lites* | -ieee* | -go32* | -aux* \
 	      | -chorusos* | -chorusrdb* | -cegcc* \
-	      | -cygwin* | -pe* | -psos* | -moss* | -proelf* | -rtems* \
-	      | -mingw32* | -linux-gnu* | -linux-newlib* | -linux-uclibc* \
+	      | -cygwin* | -msys* | -pe* | -psos* | -moss* | -proelf* | -rtems* \
+	      | -mingw32* | -linux-gnu* | -linux-android* \
+	      | -linux-newlib* | -linux-uclibc* \
 	      | -uxpv* | -beos* | -mpeix* | -udk* \
 	      | -interix* | -uwin* | -mks* | -rhapsody* | -darwin* | -opened* \
 	      | -openstep* | -oskit* | -conix* | -pw32* | -nonstopux* \
@@ -1283,7 +1362,7 @@ case $os in
 	      | -os2* | -vos* | -palmos* | -uclinux* | -nucleus* \
 	      | -morphos* | -superux* | -rtmk* | -rtmk-nova* | -windiss* \
 	      | -powermax* | -dnix* | -nx6 | -nx7 | -sei* | -dragonfly* \
-	      | -skyos* | -haiku* | -rdos* | -toppers* | -drops*)
+	      | -skyos* | -haiku* | -rdos* | -toppers* | -drops* | -es*)
 	# Remember, each alternative MUST END IN *, to match a version number.
 		;;
 	-qnx*)
@@ -1322,7 +1401,7 @@ case $os in
 	-opened*)
 		os=-openedition
 		;;
-        -os400*)
+	-os400*)
 		os=-os400
 		;;
 	-wince*)
@@ -1371,7 +1450,7 @@ case $os in
 	-sinix*)
 		os=-sysv4
 		;;
-        -tpf*)
+	-tpf*)
 		os=-tpf
 		;;
 	-triton*)
@@ -1416,6 +1495,8 @@ case $os in
 	-dicos*)
 		os=-dicos
 		;;
+	-nacl*)
+		;;
 	-none)
 		;;
 	*)
@@ -1438,10 +1519,10 @@ else
 # system, and we'll never get to this point.
 
 case $basic_machine in
-        score-*)
+	score-*)
 		os=-elf
 		;;
-        spu-*)
+	spu-*)
 		os=-elf
 		;;
 	*-acorn)
@@ -1453,8 +1534,17 @@ case $basic_machine in
 	arm*-semi)
 		os=-aout
 		;;
-        c4x-* | tic4x-*)
-        	os=-coff
+	c4x-* | tic4x-*)
+		os=-coff
+		;;
+	tic54x-*)
+		os=-coff
+		;;
+	tic55x-*)
+		os=-coff
+		;;
+	tic6x-*)
+		os=-coff
 		;;
 	# This must come before the *-dec entry.
 	pdp10-*)
@@ -1474,14 +1564,11 @@ case $basic_machine in
 		;;
 	m68000-sun)
 		os=-sunos3
-		# This also exists in the configure program, but was not the
-		# default.
-		# os=-sunos4
 		;;
 	m68*-cisco)
 		os=-aout
 		;;
-        mep-*)
+	mep-*)
 		os=-elf
 		;;
 	mips*-cisco)
@@ -1508,7 +1595,7 @@ case $basic_machine in
 	*-ibm)
 		os=-aix
 		;;
-    	*-knuth)
+	*-knuth)
 		os=-mmixware
 		;;
 	*-wec)
@@ -1613,7 +1700,7 @@ case $basic_machine in
 			-sunos*)
 				vendor=sun
 				;;
-			-aix*)
+			-cnk*|-aix*)
 				vendor=ibm
 				;;
 			-beos*)
diff --git a/configure b/configure
index edc9046..dc385a3 100755
--- a/configure
+++ b/configure
@@ -1,20 +1,24 @@
 #! /bin/sh
 # Guess values for system-dependent variables and create Makefiles.
-# Generated by GNU Autoconf 2.63 for jellyfish 1.1.5.
+# Generated by GNU Autoconf 2.68 for jellyfish 1.1.11.
 #
 # Report bugs to <gmarcais at umd.edu>.
 #
+#
 # Copyright (C) 1992, 1993, 1994, 1995, 1996, 1998, 1999, 2000, 2001,
-# 2002, 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc.
+# 2002, 2003, 2004, 2005, 2006, 2007, 2008, 2009, 2010 Free Software
+# Foundation, Inc.
+#
+#
 # This configure script is free software; the Free Software Foundation
 # gives unlimited permission to copy, distribute and modify it.
-## --------------------- ##
-## M4sh Initialization.  ##
-## --------------------- ##
+## -------------------- ##
+## M4sh Initialization. ##
+## -------------------- ##
 
 # Be more Bourne compatible
 DUALCASE=1; export DUALCASE # for MKS sh
-if test -n "${ZSH_VERSION+set}" && (emulate sh) >/dev/null 2>&1; then
+if test -n "${ZSH_VERSION+set}" && (emulate sh) >/dev/null 2>&1; then :
   emulate sh
   NULLCMD=:
   # Pre-4.2 versions of Zsh do word splitting on ${1+"$@"}, which
@@ -22,23 +26,15 @@ if test -n "${ZSH_VERSION+set}" && (emulate sh) >/dev/null 2>&1; then
   alias -g '${1+"$@"}'='"$@"'
   setopt NO_GLOB_SUBST
 else
-  case `(set -o) 2>/dev/null` in
-  *posix*) set -o posix ;;
+  case `(set -o) 2>/dev/null` in #(
+  *posix*) :
+    set -o posix ;; #(
+  *) :
+     ;;
 esac
-
 fi
 
 
-
-
-# PATH needs CR
-# Avoid depending upon Character Ranges.
-as_cr_letters='abcdefghijklmnopqrstuvwxyz'
-as_cr_LETTERS='ABCDEFGHIJKLMNOPQRSTUVWXYZ'
-as_cr_Letters=$as_cr_letters$as_cr_LETTERS
-as_cr_digits='0123456789'
-as_cr_alnum=$as_cr_Letters$as_cr_digits
-
 as_nl='
 '
 export as_nl
@@ -46,7 +42,13 @@ export as_nl
 as_echo='\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\'
 as_echo=$as_echo$as_echo$as_echo$as_echo$as_echo
 as_echo=$as_echo$as_echo$as_echo$as_echo$as_echo$as_echo
-if (test "X`printf %s $as_echo`" = "X$as_echo") 2>/dev/null; then
+# Prefer a ksh shell builtin over an external printf program on Solaris,
+# but without wasting forks for bash or zsh.
+if test -z "$BASH_VERSION$ZSH_VERSION" \
+    && (test "X`print -r -- $as_echo`" = "X$as_echo") 2>/dev/null; then
+  as_echo='print -r --'
+  as_echo_n='print -rn --'
+elif (test "X`printf %s $as_echo`" = "X$as_echo") 2>/dev/null; then
   as_echo='printf %s\n'
   as_echo_n='printf %s'
 else
@@ -57,7 +59,7 @@ else
     as_echo_body='eval expr "X$1" : "X\\(.*\\)"'
     as_echo_n_body='eval
       arg=$1;
-      case $arg in
+      case $arg in #(
       *"$as_nl"*)
 	expr "X$arg" : "X\\(.*\\)$as_nl";
 	arg=`expr "X$arg" : ".*$as_nl\\(.*\\)"`;;
@@ -80,13 +82,6 @@ if test "${PATH_SEPARATOR+set}" != set; then
   }
 fi
 
-# Support unset when possible.
-if ( (MAIL=60; unset MAIL) || exit) >/dev/null 2>&1; then
-  as_unset=unset
-else
-  as_unset=false
-fi
-
 
 # IFS
 # We need space, tab and new line, in precisely that order.  Quoting is
@@ -96,15 +91,16 @@ fi
 IFS=" ""	$as_nl"
 
 # Find who we are.  Look in the path if we contain no directory separator.
-case $0 in
+as_myself=
+case $0 in #((
   *[\\/]* ) as_myself=$0 ;;
   *) as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
 for as_dir in $PATH
 do
   IFS=$as_save_IFS
   test -z "$as_dir" && as_dir=.
-  test -r "$as_dir/$0" && as_myself=$as_dir/$0 && break
-done
+    test -r "$as_dir/$0" && as_myself=$as_dir/$0 && break
+  done
 IFS=$as_save_IFS
 
      ;;
@@ -116,12 +112,16 @@ if test "x$as_myself" = x; then
 fi
 if test ! -f "$as_myself"; then
   $as_echo "$as_myself: error: cannot find myself; rerun with an absolute file name" >&2
-  { (exit 1); exit 1; }
+  exit 1
 fi
 
-# Work around bugs in pre-3.0 UWIN ksh.
-for as_var in ENV MAIL MAILPATH
-do ($as_unset $as_var) >/dev/null 2>&1 && $as_unset $as_var
+# Unset variables that we do not need and which cause bugs (e.g. in
+# pre-3.0 UWIN ksh).  But do not cause bugs in bash 2.01; the "|| exit 1"
+# suppresses any "Segmentation fault" message there.  '((' could
+# trigger a bug in pdksh 5.2.14.
+for as_var in BASH_ENV ENV MAIL MAILPATH
+do eval test x\${$as_var+set} = xset \
+  && ( (unset $as_var) || exit 1) >/dev/null 2>&1 && unset $as_var || :
 done
 PS1='$ '
 PS2='> '
@@ -133,7 +133,264 @@ export LC_ALL
 LANGUAGE=C
 export LANGUAGE
 
-# Required to use basename.
+# CDPATH.
+(unset CDPATH) >/dev/null 2>&1 && unset CDPATH
+
+if test "x$CONFIG_SHELL" = x; then
+  as_bourne_compatible="if test -n \"\${ZSH_VERSION+set}\" && (emulate sh) >/dev/null 2>&1; then :
+  emulate sh
+  NULLCMD=:
+  # Pre-4.2 versions of Zsh do word splitting on \${1+\"\$@\"}, which
+  # is contrary to our usage.  Disable this feature.
+  alias -g '\${1+\"\$@\"}'='\"\$@\"'
+  setopt NO_GLOB_SUBST
+else
+  case \`(set -o) 2>/dev/null\` in #(
+  *posix*) :
+    set -o posix ;; #(
+  *) :
+     ;;
+esac
+fi
+"
+  as_required="as_fn_return () { (exit \$1); }
+as_fn_success () { as_fn_return 0; }
+as_fn_failure () { as_fn_return 1; }
+as_fn_ret_success () { return 0; }
+as_fn_ret_failure () { return 1; }
+
+exitcode=0
+as_fn_success || { exitcode=1; echo as_fn_success failed.; }
+as_fn_failure && { exitcode=1; echo as_fn_failure succeeded.; }
+as_fn_ret_success || { exitcode=1; echo as_fn_ret_success failed.; }
+as_fn_ret_failure && { exitcode=1; echo as_fn_ret_failure succeeded.; }
+if ( set x; as_fn_ret_success y && test x = \"\$1\" ); then :
+
+else
+  exitcode=1; echo positional parameters were not saved.
+fi
+test x\$exitcode = x0 || exit 1"
+  as_suggested="  as_lineno_1=";as_suggested=$as_suggested$LINENO;as_suggested=$as_suggested" as_lineno_1a=\$LINENO
+  as_lineno_2=";as_suggested=$as_suggested$LINENO;as_suggested=$as_suggested" as_lineno_2a=\$LINENO
+  eval 'test \"x\$as_lineno_1'\$as_run'\" != \"x\$as_lineno_2'\$as_run'\" &&
+  test \"x\`expr \$as_lineno_1'\$as_run' + 1\`\" = \"x\$as_lineno_2'\$as_run'\"' || exit 1
+
+  test -n \"\${ZSH_VERSION+set}\${BASH_VERSION+set}\" || (
+    ECHO='\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\'
+    ECHO=\$ECHO\$ECHO\$ECHO\$ECHO\$ECHO
+    ECHO=\$ECHO\$ECHO\$ECHO\$ECHO\$ECHO\$ECHO
+    PATH=/empty FPATH=/empty; export PATH FPATH
+    test \"X\`printf %s \$ECHO\`\" = \"X\$ECHO\" \\
+      || test \"X\`print -r -- \$ECHO\`\" = \"X\$ECHO\" ) || exit 1
+test \$(( 1 + 1 )) = 2 || exit 1"
+  if (eval "$as_required") 2>/dev/null; then :
+  as_have_required=yes
+else
+  as_have_required=no
+fi
+  if test x$as_have_required = xyes && (eval "$as_suggested") 2>/dev/null; then :
+
+else
+  as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+as_found=false
+for as_dir in /bin$PATH_SEPARATOR/usr/bin$PATH_SEPARATOR$PATH
+do
+  IFS=$as_save_IFS
+  test -z "$as_dir" && as_dir=.
+  as_found=:
+  case $as_dir in #(
+	 /*)
+	   for as_base in sh bash ksh sh5; do
+	     # Try only shells that exist, to save several forks.
+	     as_shell=$as_dir/$as_base
+	     if { test -f "$as_shell" || test -f "$as_shell.exe"; } &&
+		    { $as_echo "$as_bourne_compatible""$as_required" | as_run=a "$as_shell"; } 2>/dev/null; then :
+  CONFIG_SHELL=$as_shell as_have_required=yes
+		   if { $as_echo "$as_bourne_compatible""$as_suggested" | as_run=a "$as_shell"; } 2>/dev/null; then :
+  break 2
+fi
+fi
+	   done;;
+       esac
+  as_found=false
+done
+$as_found || { if { test -f "$SHELL" || test -f "$SHELL.exe"; } &&
+	      { $as_echo "$as_bourne_compatible""$as_required" | as_run=a "$SHELL"; } 2>/dev/null; then :
+  CONFIG_SHELL=$SHELL as_have_required=yes
+fi; }
+IFS=$as_save_IFS
+
+
+      if test "x$CONFIG_SHELL" != x; then :
+  # We cannot yet assume a decent shell, so we have to provide a
+	# neutralization value for shells without unset; and this also
+	# works around shells that cannot unset nonexistent variables.
+	# Preserve -v and -x to the replacement shell.
+	BASH_ENV=/dev/null
+	ENV=/dev/null
+	(unset BASH_ENV) >/dev/null 2>&1 && unset BASH_ENV ENV
+	export CONFIG_SHELL
+	case $- in # ((((
+	  *v*x* | *x*v* ) as_opts=-vx ;;
+	  *v* ) as_opts=-v ;;
+	  *x* ) as_opts=-x ;;
+	  * ) as_opts= ;;
+	esac
+	exec "$CONFIG_SHELL" $as_opts "$as_myself" ${1+"$@"}
+fi
+
+    if test x$as_have_required = xno; then :
+  $as_echo "$0: This script requires a shell more modern than all"
+  $as_echo "$0: the shells that I found on your system."
+  if test x${ZSH_VERSION+set} = xset ; then
+    $as_echo "$0: In particular, zsh $ZSH_VERSION has bugs and should"
+    $as_echo "$0: be upgraded to zsh 4.3.4 or later."
+  else
+    $as_echo "$0: Please tell bug-autoconf at gnu.org and gmarcais at umd.edu
+$0: about your system, including any error possibly output
+$0: before this message. Then install a modern shell, or
+$0: manually run the script under such a shell if you do
+$0: have one."
+  fi
+  exit 1
+fi
+fi
+fi
+SHELL=${CONFIG_SHELL-/bin/sh}
+export SHELL
+# Unset more variables known to interfere with behavior of common tools.
+CLICOLOR_FORCE= GREP_OPTIONS=
+unset CLICOLOR_FORCE GREP_OPTIONS
+
+## --------------------- ##
+## M4sh Shell Functions. ##
+## --------------------- ##
+# as_fn_unset VAR
+# ---------------
+# Portably unset VAR.
+as_fn_unset ()
+{
+  { eval $1=; unset $1;}
+}
+as_unset=as_fn_unset
+
+# as_fn_set_status STATUS
+# -----------------------
+# Set $? to STATUS, without forking.
+as_fn_set_status ()
+{
+  return $1
+} # as_fn_set_status
+
+# as_fn_exit STATUS
+# -----------------
+# Exit the shell with STATUS, even in a "trap 0" or "set -e" context.
+as_fn_exit ()
+{
+  set +e
+  as_fn_set_status $1
+  exit $1
+} # as_fn_exit
+
+# as_fn_mkdir_p
+# -------------
+# Create "$as_dir" as a directory, including parents if necessary.
+as_fn_mkdir_p ()
+{
+
+  case $as_dir in #(
+  -*) as_dir=./$as_dir;;
+  esac
+  test -d "$as_dir" || eval $as_mkdir_p || {
+    as_dirs=
+    while :; do
+      case $as_dir in #(
+      *\'*) as_qdir=`$as_echo "$as_dir" | sed "s/'/'\\\\\\\\''/g"`;; #'(
+      *) as_qdir=$as_dir;;
+      esac
+      as_dirs="'$as_qdir' $as_dirs"
+      as_dir=`$as_dirname -- "$as_dir" ||
+$as_expr X"$as_dir" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \
+	 X"$as_dir" : 'X\(//\)[^/]' \| \
+	 X"$as_dir" : 'X\(//\)$' \| \
+	 X"$as_dir" : 'X\(/\)' \| . 2>/dev/null ||
+$as_echo X"$as_dir" |
+    sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{
+	    s//\1/
+	    q
+	  }
+	  /^X\(\/\/\)[^/].*/{
+	    s//\1/
+	    q
+	  }
+	  /^X\(\/\/\)$/{
+	    s//\1/
+	    q
+	  }
+	  /^X\(\/\).*/{
+	    s//\1/
+	    q
+	  }
+	  s/.*/./; q'`
+      test -d "$as_dir" && break
+    done
+    test -z "$as_dirs" || eval "mkdir $as_dirs"
+  } || test -d "$as_dir" || as_fn_error $? "cannot create directory $as_dir"
+
+
+} # as_fn_mkdir_p
+# as_fn_append VAR VALUE
+# ----------------------
+# Append the text in VALUE to the end of the definition contained in VAR. Take
+# advantage of any shell optimizations that allow amortized linear growth over
+# repeated appends, instead of the typical quadratic growth present in naive
+# implementations.
+if (eval "as_var=1; as_var+=2; test x\$as_var = x12") 2>/dev/null; then :
+  eval 'as_fn_append ()
+  {
+    eval $1+=\$2
+  }'
+else
+  as_fn_append ()
+  {
+    eval $1=\$$1\$2
+  }
+fi # as_fn_append
+
+# as_fn_arith ARG...
+# ------------------
+# Perform arithmetic evaluation on the ARGs, and store the result in the
+# global $as_val. Take advantage of shells that can avoid forks. The arguments
+# must be portable across $(()) and expr.
+if (eval "test \$(( 1 + 1 )) = 2") 2>/dev/null; then :
+  eval 'as_fn_arith ()
+  {
+    as_val=$(( $* ))
+  }'
+else
+  as_fn_arith ()
+  {
+    as_val=`expr "$@" || test $? -eq 1`
+  }
+fi # as_fn_arith
+
+
+# as_fn_error STATUS ERROR [LINENO LOG_FD]
+# ----------------------------------------
+# Output "`basename $0`: error: ERROR" to stderr. If LINENO and LOG_FD are
+# provided, also output the error to LOG_FD, referencing LINENO. Then exit the
+# script with STATUS, using 1 if that was 0.
+as_fn_error ()
+{
+  as_status=$1; test $as_status -eq 0 && as_status=1
+  if test "$4"; then
+    as_lineno=${as_lineno-"$3"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
+    $as_echo "$as_me:${as_lineno-$LINENO}: error: $2" >&$4
+  fi
+  $as_echo "$as_me: error: $2" >&2
+  as_fn_exit $as_status
+} # as_fn_error
+
 if expr a : '\(a\)' >/dev/null 2>&1 &&
    test "X`expr 00001 : '.*\(...\)'`" = X001; then
   as_expr=expr
@@ -147,8 +404,12 @@ else
   as_basename=false
 fi
 
+if (as_dir=`dirname -- /` && test "X$as_dir" = X/) >/dev/null 2>&1; then
+  as_dirname=dirname
+else
+  as_dirname=false
+fi
 
-# Name of the executable.
 as_me=`$as_basename -- "$0" ||
 $as_expr X/"$0" : '.*/\([^/][^/]*\)/*$' \| \
 	 X"$0" : 'X\(//\)$' \| \
@@ -168,4639 +429,3279 @@ $as_echo X/"$0" |
 	  }
 	  s/.*/./; q'`
 
-# CDPATH.
-$as_unset CDPATH
+# Avoid depending upon Character Ranges.
+as_cr_letters='abcdefghijklmnopqrstuvwxyz'
+as_cr_LETTERS='ABCDEFGHIJKLMNOPQRSTUVWXYZ'
+as_cr_Letters=$as_cr_letters$as_cr_LETTERS
+as_cr_digits='0123456789'
+as_cr_alnum=$as_cr_Letters$as_cr_digits
 
 
-if test "x$CONFIG_SHELL" = x; then
-  if (eval ":") 2>/dev/null; then
-  as_have_required=yes
-else
-  as_have_required=no
-fi
+  as_lineno_1=$LINENO as_lineno_1a=$LINENO
+  as_lineno_2=$LINENO as_lineno_2a=$LINENO
+  eval 'test "x$as_lineno_1'$as_run'" != "x$as_lineno_2'$as_run'" &&
+  test "x`expr $as_lineno_1'$as_run' + 1`" = "x$as_lineno_2'$as_run'"' || {
+  # Blame Lee E. McMahon (1931-1989) for sed's syntax.  :-)
+  sed -n '
+    p
+    /[$]LINENO/=
+  ' <$as_myself |
+    sed '
+      s/[$]LINENO.*/&-/
+      t lineno
+      b
+      :lineno
+      N
+      :loop
+      s/[$]LINENO\([^'$as_cr_alnum'_].*\n\)\(.*\)/\2\1\2/
+      t loop
+      s/-\n.*//
+    ' >$as_me.lineno &&
+  chmod +x "$as_me.lineno" ||
+    { $as_echo "$as_me: error: cannot create $as_me.lineno; rerun with a POSIX shell" >&2; as_fn_exit 1; }
 
-  if test $as_have_required = yes &&	 (eval ":
-(as_func_return () {
-  (exit \$1)
-}
-as_func_success () {
-  as_func_return 0
-}
-as_func_failure () {
-  as_func_return 1
-}
-as_func_ret_success () {
-  return 0
-}
-as_func_ret_failure () {
-  return 1
+  # Don't try to exec as it changes $[0], causing all sort of problems
+  # (the dirname of $[0] is not the place where we might find the
+  # original and so on.  Autoconf is especially sensitive to this).
+  . "./$as_me.lineno"
+  # Exit status is that of the last command.
+  exit
 }
 
-exitcode=0
-if as_func_success; then
-  :
-else
-  exitcode=1
-  echo as_func_success failed.
-fi
+ECHO_C= ECHO_N= ECHO_T=
+case `echo -n x` in #(((((
+-n*)
+  case `echo 'xy\c'` in
+  *c*) ECHO_T='	';;	# ECHO_T is single tab character.
+  xy)  ECHO_C='\c';;
+  *)   echo `echo ksh88 bug on AIX 6.1` > /dev/null
+       ECHO_T='	';;
+  esac;;
+*)
+  ECHO_N='-n';;
+esac
 
-if as_func_failure; then
-  exitcode=1
-  echo as_func_failure succeeded.
+rm -f conf$$ conf$$.exe conf$$.file
+if test -d conf$$.dir; then
+  rm -f conf$$.dir/conf$$.file
+else
+  rm -f conf$$.dir
+  mkdir conf$$.dir 2>/dev/null
 fi
-
-if as_func_ret_success; then
-  :
+if (echo >conf$$.file) 2>/dev/null; then
+  if ln -s conf$$.file conf$$ 2>/dev/null; then
+    as_ln_s='ln -s'
+    # ... but there are two gotchas:
+    # 1) On MSYS, both `ln -s file dir' and `ln file dir' fail.
+    # 2) DJGPP < 2.04 has no symlinks; `ln -s' creates a wrapper executable.
+    # In both cases, we have to default to `cp -p'.
+    ln -s conf$$.file conf$$.dir 2>/dev/null && test ! -f conf$$.exe ||
+      as_ln_s='cp -p'
+  elif ln conf$$.file conf$$ 2>/dev/null; then
+    as_ln_s=ln
+  else
+    as_ln_s='cp -p'
+  fi
 else
-  exitcode=1
-  echo as_func_ret_success failed.
+  as_ln_s='cp -p'
 fi
+rm -f conf$$ conf$$.exe conf$$.dir/conf$$.file conf$$.file
+rmdir conf$$.dir 2>/dev/null
 
-if as_func_ret_failure; then
-  exitcode=1
-  echo as_func_ret_failure succeeded.
+if mkdir -p . 2>/dev/null; then
+  as_mkdir_p='mkdir -p "$as_dir"'
+else
+  test -d ./-p && rmdir ./-p
+  as_mkdir_p=false
 fi
 
-if ( set x; as_func_ret_success y && test x = \"\$1\" ); then
-  :
+if test -x / >/dev/null 2>&1; then
+  as_test_x='test -x'
 else
-  exitcode=1
-  echo positional parameters were not saved.
+  if ls -dL / >/dev/null 2>&1; then
+    as_ls_L_option=L
+  else
+    as_ls_L_option=
+  fi
+  as_test_x='
+    eval sh -c '\''
+      if test -d "$1"; then
+	test -d "$1/.";
+      else
+	case $1 in #(
+	-*)set "./$1";;
+	esac;
+	case `ls -ld'$as_ls_L_option' "$1" 2>/dev/null` in #((
+	???[sx]*):;;*)false;;esac;fi
+    '\'' sh
+  '
 fi
+as_executable_p=$as_test_x
 
-test \$exitcode = 0) || { (exit 1); exit 1; }
+# Sed expression to map a string onto a valid CPP name.
+as_tr_cpp="eval sed 'y%*$as_cr_letters%P$as_cr_LETTERS%;s%[^_$as_cr_alnum]%_%g'"
 
-(
-  as_lineno_1=\$LINENO
-  as_lineno_2=\$LINENO
-  test \"x\$as_lineno_1\" != \"x\$as_lineno_2\" &&
-  test \"x\`expr \$as_lineno_1 + 1\`\" = \"x\$as_lineno_2\") || { (exit 1); exit 1; }
-") 2> /dev/null; then
-  :
-else
-  as_candidate_shells=
-    as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in /bin$PATH_SEPARATOR/usr/bin$PATH_SEPARATOR$PATH
-do
-  IFS=$as_save_IFS
-  test -z "$as_dir" && as_dir=.
-  case $as_dir in
-	 /*)
-	   for as_base in sh bash ksh sh5; do
-	     as_candidate_shells="$as_candidate_shells $as_dir/$as_base"
-	   done;;
-       esac
-done
-IFS=$as_save_IFS
+# Sed expression to map a string onto a valid variable name.
+as_tr_sh="eval sed 'y%*+%pp%;s%[^_$as_cr_alnum]%_%g'"
 
+SHELL=${CONFIG_SHELL-/bin/sh}
 
-      for as_shell in $as_candidate_shells $SHELL; do
-	 # Try only shells that exist, to save several forks.
-	 if { test -f "$as_shell" || test -f "$as_shell.exe"; } &&
-		{ ("$as_shell") 2> /dev/null <<\_ASEOF
-if test -n "${ZSH_VERSION+set}" && (emulate sh) >/dev/null 2>&1; then
-  emulate sh
-  NULLCMD=:
-  # Pre-4.2 versions of Zsh do word splitting on ${1+"$@"}, which
-  # is contrary to our usage.  Disable this feature.
-  alias -g '${1+"$@"}'='"$@"'
-  setopt NO_GLOB_SUBST
-else
-  case `(set -o) 2>/dev/null` in
-  *posix*) set -o posix ;;
-esac
-
-fi
-
-
-:
-_ASEOF
-}; then
-  CONFIG_SHELL=$as_shell
-	       as_have_required=yes
-	       if { "$as_shell" 2> /dev/null <<\_ASEOF
-if test -n "${ZSH_VERSION+set}" && (emulate sh) >/dev/null 2>&1; then
-  emulate sh
-  NULLCMD=:
-  # Pre-4.2 versions of Zsh do word splitting on ${1+"$@"}, which
-  # is contrary to our usage.  Disable this feature.
-  alias -g '${1+"$@"}'='"$@"'
-  setopt NO_GLOB_SUBST
-else
-  case `(set -o) 2>/dev/null` in
-  *posix*) set -o posix ;;
-esac
-
-fi
-
-
-:
-(as_func_return () {
-  (exit $1)
-}
-as_func_success () {
-  as_func_return 0
-}
-as_func_failure () {
-  as_func_return 1
-}
-as_func_ret_success () {
-  return 0
-}
-as_func_ret_failure () {
-  return 1
-}
-
-exitcode=0
-if as_func_success; then
-  :
-else
-  exitcode=1
-  echo as_func_success failed.
-fi
-
-if as_func_failure; then
-  exitcode=1
-  echo as_func_failure succeeded.
-fi
-
-if as_func_ret_success; then
-  :
-else
-  exitcode=1
-  echo as_func_ret_success failed.
-fi
-
-if as_func_ret_failure; then
-  exitcode=1
-  echo as_func_ret_failure succeeded.
-fi
-
-if ( set x; as_func_ret_success y && test x = "$1" ); then
-  :
-else
-  exitcode=1
-  echo positional parameters were not saved.
-fi
-
-test $exitcode = 0) || { (exit 1); exit 1; }
-
-(
-  as_lineno_1=$LINENO
-  as_lineno_2=$LINENO
-  test "x$as_lineno_1" != "x$as_lineno_2" &&
-  test "x`expr $as_lineno_1 + 1`" = "x$as_lineno_2") || { (exit 1); exit 1; }
-
-_ASEOF
-}; then
-  break
-fi
-
-fi
-
-      done
-
-      if test "x$CONFIG_SHELL" != x; then
-  for as_var in BASH_ENV ENV
-	do ($as_unset $as_var) >/dev/null 2>&1 && $as_unset $as_var
-	done
-	export CONFIG_SHELL
-	exec "$CONFIG_SHELL" "$as_myself" ${1+"$@"}
-fi
-
-
-    if test $as_have_required = no; then
-  echo This script requires a shell more modern than all the
-      echo shells that I found on your system.  Please install a
-      echo modern shell, or manually run the script under such a
-      echo shell if you do have one.
-      { (exit 1); exit 1; }
-fi
-
-
-fi
-
-fi
-
-
-
-(eval "as_func_return () {
-  (exit \$1)
-}
-as_func_success () {
-  as_func_return 0
-}
-as_func_failure () {
-  as_func_return 1
-}
-as_func_ret_success () {
-  return 0
-}
-as_func_ret_failure () {
-  return 1
-}
-
-exitcode=0
-if as_func_success; then
-  :
-else
-  exitcode=1
-  echo as_func_success failed.
-fi
-
-if as_func_failure; then
-  exitcode=1
-  echo as_func_failure succeeded.
-fi
-
-if as_func_ret_success; then
-  :
-else
-  exitcode=1
-  echo as_func_ret_success failed.
-fi
-
-if as_func_ret_failure; then
-  exitcode=1
-  echo as_func_ret_failure succeeded.
-fi
-
-if ( set x; as_func_ret_success y && test x = \"\$1\" ); then
-  :
-else
-  exitcode=1
-  echo positional parameters were not saved.
-fi
-
-test \$exitcode = 0") || {
-  echo No shell found that supports shell functions.
-  echo Please tell bug-autoconf at gnu.org about your system,
-  echo including any error possibly output before this message.
-  echo This can help us improve future autoconf versions.
-  echo Configuration will now proceed without shell functions.
-}
-
-
-
-  as_lineno_1=$LINENO
-  as_lineno_2=$LINENO
-  test "x$as_lineno_1" != "x$as_lineno_2" &&
-  test "x`expr $as_lineno_1 + 1`" = "x$as_lineno_2" || {
-
-  # Create $as_me.lineno as a copy of $as_myself, but with $LINENO
-  # uniformly replaced by the line number.  The first 'sed' inserts a
-  # line-number line after each line using $LINENO; the second 'sed'
-  # does the real work.  The second script uses 'N' to pair each
-  # line-number line with the line containing $LINENO, and appends
-  # trailing '-' during substitution so that $LINENO is not a special
-  # case at line end.
-  # (Raja R Harinath suggested sed '=', and Paul Eggert wrote the
-  # scripts with optimization help from Paolo Bonzini.  Blame Lee
-  # E. McMahon (1931-1989) for sed's syntax.  :-)
-  sed -n '
-    p
-    /[$]LINENO/=
-  ' <$as_myself |
-    sed '
-      s/[$]LINENO.*/&-/
-      t lineno
-      b
-      :lineno
-      N
-      :loop
-      s/[$]LINENO\([^'$as_cr_alnum'_].*\n\)\(.*\)/\2\1\2/
-      t loop
-      s/-\n.*//
-    ' >$as_me.lineno &&
-  chmod +x "$as_me.lineno" ||
-    { $as_echo "$as_me: error: cannot create $as_me.lineno; rerun with a POSIX shell" >&2
-   { (exit 1); exit 1; }; }
-
-  # Don't try to exec as it changes $[0], causing all sort of problems
-  # (the dirname of $[0] is not the place where we might find the
-  # original and so on.  Autoconf is especially sensitive to this).
-  . "./$as_me.lineno"
-  # Exit status is that of the last command.
-  exit
-}
-
-
-if (as_dir=`dirname -- /` && test "X$as_dir" = X/) >/dev/null 2>&1; then
-  as_dirname=dirname
-else
-  as_dirname=false
-fi
-
-ECHO_C= ECHO_N= ECHO_T=
-case `echo -n x` in
--n*)
-  case `echo 'x\c'` in
-  *c*) ECHO_T='	';;	# ECHO_T is single tab character.
-  *)   ECHO_C='\c';;
-  esac;;
-*)
-  ECHO_N='-n';;
-esac
-if expr a : '\(a\)' >/dev/null 2>&1 &&
-   test "X`expr 00001 : '.*\(...\)'`" = X001; then
-  as_expr=expr
-else
-  as_expr=false
-fi
-
-rm -f conf$$ conf$$.exe conf$$.file
-if test -d conf$$.dir; then
-  rm -f conf$$.dir/conf$$.file
-else
-  rm -f conf$$.dir
-  mkdir conf$$.dir 2>/dev/null
-fi
-if (echo >conf$$.file) 2>/dev/null; then
-  if ln -s conf$$.file conf$$ 2>/dev/null; then
-    as_ln_s='ln -s'
-    # ... but there are two gotchas:
-    # 1) On MSYS, both `ln -s file dir' and `ln file dir' fail.
-    # 2) DJGPP < 2.04 has no symlinks; `ln -s' creates a wrapper executable.
-    # In both cases, we have to default to `cp -p'.
-    ln -s conf$$.file conf$$.dir 2>/dev/null && test ! -f conf$$.exe ||
-      as_ln_s='cp -p'
-  elif ln conf$$.file conf$$ 2>/dev/null; then
-    as_ln_s=ln
-  else
-    as_ln_s='cp -p'
-  fi
-else
-  as_ln_s='cp -p'
-fi
-rm -f conf$$ conf$$.exe conf$$.dir/conf$$.file conf$$.file
-rmdir conf$$.dir 2>/dev/null
-
-if mkdir -p . 2>/dev/null; then
-  as_mkdir_p=:
-else
-  test -d ./-p && rmdir ./-p
-  as_mkdir_p=false
-fi
-
-if test -x / >/dev/null 2>&1; then
-  as_test_x='test -x'
-else
-  if ls -dL / >/dev/null 2>&1; then
-    as_ls_L_option=L
-  else
-    as_ls_L_option=
-  fi
-  as_test_x='
-    eval sh -c '\''
-      if test -d "$1"; then
-	test -d "$1/.";
-      else
-	case $1 in
-	-*)set "./$1";;
-	esac;
-	case `ls -ld'$as_ls_L_option' "$1" 2>/dev/null` in
-	???[sx]*):;;*)false;;esac;fi
-    '\'' sh
-  '
-fi
-as_executable_p=$as_test_x
-
-# Sed expression to map a string onto a valid CPP name.
-as_tr_cpp="eval sed 'y%*$as_cr_letters%P$as_cr_LETTERS%;s%[^_$as_cr_alnum]%_%g'"
-
-# Sed expression to map a string onto a valid variable name.
-as_tr_sh="eval sed 'y%*+%pp%;s%[^_$as_cr_alnum]%_%g'"
-
-
-
-
-# Check that we are running under the correct shell.
-SHELL=${CONFIG_SHELL-/bin/sh}
-
-case X$lt_ECHO in
-X*--fallback-echo)
-  # Remove one level of quotation (which was required for Make).
-  ECHO=`echo "$lt_ECHO" | sed 's,\\\\\$\\$0,'$0','`
-  ;;
-esac
-
-ECHO=${lt_ECHO-echo}
-if test "X$1" = X--no-reexec; then
-  # Discard the --no-reexec flag, and continue.
-  shift
-elif test "X$1" = X--fallback-echo; then
-  # Avoid inline document here, it may be left over
-  :
-elif test "X`{ $ECHO '\t'; } 2>/dev/null`" = 'X\t' ; then
-  # Yippee, $ECHO works!
-  :
-else
-  # Restart under the correct shell.
-  exec $SHELL "$0" --no-reexec ${1+"$@"}
-fi
-
-if test "X$1" = X--fallback-echo; then
-  # used as fallback echo
-  shift
-  cat <<_LT_EOF
-$*
-_LT_EOF
-  exit 0
-fi
-
-# The HP-UX ksh and POSIX shell print the target directory to stdout
-# if CDPATH is set.
-(unset CDPATH) >/dev/null 2>&1 && unset CDPATH
-
-if test -z "$lt_ECHO"; then
-  if test "X${echo_test_string+set}" != Xset; then
-    # find a string as large as possible, as long as the shell can cope with it
-    for cmd in 'sed 50q "$0"' 'sed 20q "$0"' 'sed 10q "$0"' 'sed 2q "$0"' 'echo test'; do
-      # expected sizes: less than 2Kb, 1Kb, 512 bytes, 16 bytes, ...
-      if { echo_test_string=`eval $cmd`; } 2>/dev/null &&
-	 { test "X$echo_test_string" = "X$echo_test_string"; } 2>/dev/null
-      then
-        break
-      fi
-    done
-  fi
-
-  if test "X`{ $ECHO '\t'; } 2>/dev/null`" = 'X\t' &&
-     echo_testing_string=`{ $ECHO "$echo_test_string"; } 2>/dev/null` &&
-     test "X$echo_testing_string" = "X$echo_test_string"; then
-    :
-  else
-    # The Solaris, AIX, and Digital Unix default echo programs unquote
-    # backslashes.  This makes it impossible to quote backslashes using
-    #   echo "$something" | sed 's/\\/\\\\/g'
-    #
-    # So, first we look for a working echo in the user's PATH.
-
-    lt_save_ifs="$IFS"; IFS=$PATH_SEPARATOR
-    for dir in $PATH /usr/ucb; do
-      IFS="$lt_save_ifs"
-      if (test -f $dir/echo || test -f $dir/echo$ac_exeext) &&
-         test "X`($dir/echo '\t') 2>/dev/null`" = 'X\t' &&
-         echo_testing_string=`($dir/echo "$echo_test_string") 2>/dev/null` &&
-         test "X$echo_testing_string" = "X$echo_test_string"; then
-        ECHO="$dir/echo"
-        break
-      fi
-    done
-    IFS="$lt_save_ifs"
-
-    if test "X$ECHO" = Xecho; then
-      # We didn't find a better echo, so look for alternatives.
-      if test "X`{ print -r '\t'; } 2>/dev/null`" = 'X\t' &&
-         echo_testing_string=`{ print -r "$echo_test_string"; } 2>/dev/null` &&
-         test "X$echo_testing_string" = "X$echo_test_string"; then
-        # This shell has a builtin print -r that does the trick.
-        ECHO='print -r'
-      elif { test -f /bin/ksh || test -f /bin/ksh$ac_exeext; } &&
-	   test "X$CONFIG_SHELL" != X/bin/ksh; then
-        # If we have ksh, try running configure again with it.
-        ORIGINAL_CONFIG_SHELL=${CONFIG_SHELL-/bin/sh}
-        export ORIGINAL_CONFIG_SHELL
-        CONFIG_SHELL=/bin/ksh
-        export CONFIG_SHELL
-        exec $CONFIG_SHELL "$0" --no-reexec ${1+"$@"}
-      else
-        # Try using printf.
-        ECHO='printf %s\n'
-        if test "X`{ $ECHO '\t'; } 2>/dev/null`" = 'X\t' &&
-	   echo_testing_string=`{ $ECHO "$echo_test_string"; } 2>/dev/null` &&
-	   test "X$echo_testing_string" = "X$echo_test_string"; then
-	  # Cool, printf works
-	  :
-        elif echo_testing_string=`($ORIGINAL_CONFIG_SHELL "$0" --fallback-echo '\t') 2>/dev/null` &&
-	     test "X$echo_testing_string" = 'X\t' &&
-	     echo_testing_string=`($ORIGINAL_CONFIG_SHELL "$0" --fallback-echo "$echo_test_string") 2>/dev/null` &&
-	     test "X$echo_testing_string" = "X$echo_test_string"; then
-	  CONFIG_SHELL=$ORIGINAL_CONFIG_SHELL
-	  export CONFIG_SHELL
-	  SHELL="$CONFIG_SHELL"
-	  export SHELL
-	  ECHO="$CONFIG_SHELL $0 --fallback-echo"
-        elif echo_testing_string=`($CONFIG_SHELL "$0" --fallback-echo '\t') 2>/dev/null` &&
-	     test "X$echo_testing_string" = 'X\t' &&
-	     echo_testing_string=`($CONFIG_SHELL "$0" --fallback-echo "$echo_test_string") 2>/dev/null` &&
-	     test "X$echo_testing_string" = "X$echo_test_string"; then
-	  ECHO="$CONFIG_SHELL $0 --fallback-echo"
-        else
-	  # maybe with a smaller string...
-	  prev=:
-
-	  for cmd in 'echo test' 'sed 2q "$0"' 'sed 10q "$0"' 'sed 20q "$0"' 'sed 50q "$0"'; do
-	    if { test "X$echo_test_string" = "X`eval $cmd`"; } 2>/dev/null
-	    then
-	      break
-	    fi
-	    prev="$cmd"
-	  done
-
-	  if test "$prev" != 'sed 50q "$0"'; then
-	    echo_test_string=`eval $prev`
-	    export echo_test_string
-	    exec ${ORIGINAL_CONFIG_SHELL-${CONFIG_SHELL-/bin/sh}} "$0" ${1+"$@"}
-	  else
-	    # Oops.  We lost completely, so just stick with echo.
-	    ECHO=echo
-	  fi
-        fi
-      fi
-    fi
-  fi
-fi
-
-# Copy echo and quote the copy suitably for passing to libtool from
-# the Makefile, instead of quoting the original, which is used later.
-lt_ECHO=$ECHO
-if test "X$lt_ECHO" = "X$CONFIG_SHELL $0 --fallback-echo"; then
-   lt_ECHO="$CONFIG_SHELL \\\$\$0 --fallback-echo"
-fi
-
-
-
-
-exec 7<&0 </dev/null 6>&1
-
-# Name of the host.
-# hostname on some systems (SVR3.2, Linux) returns a bogus exit status,
-# so uname gets run too.
-ac_hostname=`(hostname || uname -n) 2>/dev/null | sed 1q`
-
-#
-# Initializations.
-#
-ac_default_prefix=/usr/local
-ac_clean_files=
-ac_config_libobj_dir=.
-LIBOBJS=
-cross_compiling=no
-subdirs=
-MFLAGS=
-MAKEFLAGS=
-SHELL=${CONFIG_SHELL-/bin/sh}
-
-# Identity of this package.
-PACKAGE_NAME='jellyfish'
-PACKAGE_TARNAME='jellyfish'
-PACKAGE_VERSION='1.1.5'
-PACKAGE_STRING='jellyfish 1.1.5'
-PACKAGE_BUGREPORT='gmarcais at umd.edu'
-
-# Factoring default headers for most tests.
-ac_includes_default="\
-#include <stdio.h>
-#ifdef HAVE_SYS_TYPES_H
-# include <sys/types.h>
-#endif
-#ifdef HAVE_SYS_STAT_H
-# include <sys/stat.h>
-#endif
-#ifdef STDC_HEADERS
-# include <stdlib.h>
-# include <stddef.h>
-#else
-# ifdef HAVE_STDLIB_H
-#  include <stdlib.h>
-# endif
-#endif
-#ifdef HAVE_STRING_H
-# if !defined STDC_HEADERS && defined HAVE_MEMORY_H
-#  include <memory.h>
-# endif
-# include <string.h>
-#endif
-#ifdef HAVE_STRINGS_H
-# include <strings.h>
-#endif
-#ifdef HAVE_INTTYPES_H
-# include <inttypes.h>
-#endif
-#ifdef HAVE_STDINT_H
-# include <stdint.h>
-#endif
-#ifdef HAVE_UNISTD_H
-# include <unistd.h>
-#endif"
-
-ac_subst_vars='am__EXEEXT_FALSE
-am__EXEEXT_TRUE
-LTLIBOBJS
-LIBOBJS
-CXXCPP
-OTOOL64
-OTOOL
-LIPO
-NMEDIT
-DSYMUTIL
-lt_ECHO
-RANLIB
-AR
-OBJDUMP
-LN_S
-NM
-ac_ct_DUMPBIN
-DUMPBIN
-LD
-FGREP
-SED
-LIBTOOL
-EGREP
-GREP
-CPP
-am__fastdepCC_FALSE
-am__fastdepCC_TRUE
-CCDEPMODE
-ac_ct_CC
-CFLAGS
-CC
-MD5
-am__fastdepCXX_FALSE
-am__fastdepCXX_TRUE
-CXXDEPMODE
-AMDEPBACKSLASH
-AMDEP_FALSE
-AMDEP_TRUE
-am__quote
-am__include
-DEPDIR
-OBJEXT
-EXEEXT
-ac_ct_CXX
-CPPFLAGS
-LDFLAGS
-CXXFLAGS
-CXX
-AM_BACKSLASH
-AM_DEFAULT_VERBOSITY
-am__untar
-am__tar
-AMTAR
-am__leading_dot
-SET_MAKE
-AWK
-mkdir_p
-MKDIR_P
-INSTALL_STRIP_PROGRAM
-STRIP
-install_sh
-MAKEINFO
-AUTOHEADER
-AUTOMAKE
-AUTOCONF
-ACLOCAL
-VERSION
-PACKAGE
-CYGPATH_W
-am__isrc
-INSTALL_DATA
-INSTALL_SCRIPT
-INSTALL_PROGRAM
-host_os
-host_vendor
-host_cpu
-host
-build_os
-build_vendor
-build_cpu
-build
-target_alias
-host_alias
-build_alias
-LIBS
-ECHO_T
-ECHO_N
-ECHO_C
-DEFS
-mandir
-localedir
-libdir
-psdir
-pdfdir
-dvidir
-htmldir
-infodir
-docdir
-oldincludedir
-includedir
-localstatedir
-sharedstatedir
-sysconfdir
-datadir
-datarootdir
-libexecdir
-sbindir
-bindir
-program_transform_name
-prefix
-exec_prefix
-PACKAGE_BUGREPORT
-PACKAGE_STRING
-PACKAGE_VERSION
-PACKAGE_TARNAME
-PACKAGE_NAME
-PATH_SEPARATOR
-SHELL'
-ac_subst_files=''
-ac_user_opts='
-enable_option_checking
-enable_silent_rules
-enable_dependency_tracking
-with_sse
-with_half
-enable_shared
-enable_static
-with_pic
-enable_fast_install
-with_gnu_ld
-enable_libtool_lock
-'
-      ac_precious_vars='build_alias
-host_alias
-target_alias
-CXX
-CXXFLAGS
-LDFLAGS
-LIBS
-CPPFLAGS
-CCC
-MD5
-CC
-CFLAGS
-CPP
-CXXCPP'
-
-
-# Initialize some variables set by options.
-ac_init_help=
-ac_init_version=false
-ac_unrecognized_opts=
-ac_unrecognized_sep=
-# The variables have the same names as the options, with
-# dashes changed to underlines.
-cache_file=/dev/null
-exec_prefix=NONE
-no_create=
-no_recursion=
-prefix=NONE
-program_prefix=NONE
-program_suffix=NONE
-program_transform_name=s,x,x,
-silent=
-site=
-srcdir=
-verbose=
-x_includes=NONE
-x_libraries=NONE
-
-# Installation directory options.
-# These are left unexpanded so users can "make install exec_prefix=/foo"
-# and all the variables that are supposed to be based on exec_prefix
-# by default will actually change.
-# Use braces instead of parens because sh, perl, etc. also accept them.
-# (The list follows the same order as the GNU Coding Standards.)
-bindir='${exec_prefix}/bin'
-sbindir='${exec_prefix}/sbin'
-libexecdir='${exec_prefix}/libexec'
-datarootdir='${prefix}/share'
-datadir='${datarootdir}'
-sysconfdir='${prefix}/etc'
-sharedstatedir='${prefix}/com'
-localstatedir='${prefix}/var'
-includedir='${prefix}/include'
-oldincludedir='/usr/include'
-docdir='${datarootdir}/doc/${PACKAGE_TARNAME}'
-infodir='${datarootdir}/info'
-htmldir='${docdir}'
-dvidir='${docdir}'
-pdfdir='${docdir}'
-psdir='${docdir}'
-libdir='${exec_prefix}/lib'
-localedir='${datarootdir}/locale'
-mandir='${datarootdir}/man'
-
-ac_prev=
-ac_dashdash=
-for ac_option
-do
-  # If the previous option needs an argument, assign it.
-  if test -n "$ac_prev"; then
-    eval $ac_prev=\$ac_option
-    ac_prev=
-    continue
-  fi
-
-  case $ac_option in
-  *=*)	ac_optarg=`expr "X$ac_option" : '[^=]*=\(.*\)'` ;;
-  *)	ac_optarg=yes ;;
-  esac
-
-  # Accept the important Cygnus configure options, so we can diagnose typos.
-
-  case $ac_dashdash$ac_option in
-  --)
-    ac_dashdash=yes ;;
-
-  -bindir | --bindir | --bindi | --bind | --bin | --bi)
-    ac_prev=bindir ;;
-  -bindir=* | --bindir=* | --bindi=* | --bind=* | --bin=* | --bi=*)
-    bindir=$ac_optarg ;;
-
-  -build | --build | --buil | --bui | --bu)
-    ac_prev=build_alias ;;
-  -build=* | --build=* | --buil=* | --bui=* | --bu=*)
-    build_alias=$ac_optarg ;;
-
-  -cache-file | --cache-file | --cache-fil | --cache-fi \
-  | --cache-f | --cache- | --cache | --cach | --cac | --ca | --c)
-    ac_prev=cache_file ;;
-  -cache-file=* | --cache-file=* | --cache-fil=* | --cache-fi=* \
-  | --cache-f=* | --cache-=* | --cache=* | --cach=* | --cac=* | --ca=* | --c=*)
-    cache_file=$ac_optarg ;;
-
-  --config-cache | -C)
-    cache_file=config.cache ;;
-
-  -datadir | --datadir | --datadi | --datad)
-    ac_prev=datadir ;;
-  -datadir=* | --datadir=* | --datadi=* | --datad=*)
-    datadir=$ac_optarg ;;
-
-  -datarootdir | --datarootdir | --datarootdi | --datarootd | --dataroot \
-  | --dataroo | --dataro | --datar)
-    ac_prev=datarootdir ;;
-  -datarootdir=* | --datarootdir=* | --datarootdi=* | --datarootd=* \
-  | --dataroot=* | --dataroo=* | --dataro=* | --datar=*)
-    datarootdir=$ac_optarg ;;
-
-  -disable-* | --disable-*)
-    ac_useropt=`expr "x$ac_option" : 'x-*disable-\(.*\)'`
-    # Reject names that are not valid shell variable names.
-    expr "x$ac_useropt" : ".*[^-+._$as_cr_alnum]" >/dev/null &&
-      { $as_echo "$as_me: error: invalid feature name: $ac_useropt" >&2
-   { (exit 1); exit 1; }; }
-    ac_useropt_orig=$ac_useropt
-    ac_useropt=`$as_echo "$ac_useropt" | sed 's/[-+.]/_/g'`
-    case $ac_user_opts in
-      *"
-"enable_$ac_useropt"
-"*) ;;
-      *) ac_unrecognized_opts="$ac_unrecognized_opts$ac_unrecognized_sep--disable-$ac_useropt_orig"
-	 ac_unrecognized_sep=', ';;
-    esac
-    eval enable_$ac_useropt=no ;;
-
-  -docdir | --docdir | --docdi | --doc | --do)
-    ac_prev=docdir ;;
-  -docdir=* | --docdir=* | --docdi=* | --doc=* | --do=*)
-    docdir=$ac_optarg ;;
-
-  -dvidir | --dvidir | --dvidi | --dvid | --dvi | --dv)
-    ac_prev=dvidir ;;
-  -dvidir=* | --dvidir=* | --dvidi=* | --dvid=* | --dvi=* | --dv=*)
-    dvidir=$ac_optarg ;;
-
-  -enable-* | --enable-*)
-    ac_useropt=`expr "x$ac_option" : 'x-*enable-\([^=]*\)'`
-    # Reject names that are not valid shell variable names.
-    expr "x$ac_useropt" : ".*[^-+._$as_cr_alnum]" >/dev/null &&
-      { $as_echo "$as_me: error: invalid feature name: $ac_useropt" >&2
-   { (exit 1); exit 1; }; }
-    ac_useropt_orig=$ac_useropt
-    ac_useropt=`$as_echo "$ac_useropt" | sed 's/[-+.]/_/g'`
-    case $ac_user_opts in
-      *"
-"enable_$ac_useropt"
-"*) ;;
-      *) ac_unrecognized_opts="$ac_unrecognized_opts$ac_unrecognized_sep--enable-$ac_useropt_orig"
-	 ac_unrecognized_sep=', ';;
-    esac
-    eval enable_$ac_useropt=\$ac_optarg ;;
-
-  -exec-prefix | --exec_prefix | --exec-prefix | --exec-prefi \
-  | --exec-pref | --exec-pre | --exec-pr | --exec-p | --exec- \
-  | --exec | --exe | --ex)
-    ac_prev=exec_prefix ;;
-  -exec-prefix=* | --exec_prefix=* | --exec-prefix=* | --exec-prefi=* \
-  | --exec-pref=* | --exec-pre=* | --exec-pr=* | --exec-p=* | --exec-=* \
-  | --exec=* | --exe=* | --ex=*)
-    exec_prefix=$ac_optarg ;;
-
-  -gas | --gas | --ga | --g)
-    # Obsolete; use --with-gas.
-    with_gas=yes ;;
-
-  -help | --help | --hel | --he | -h)
-    ac_init_help=long ;;
-  -help=r* | --help=r* | --hel=r* | --he=r* | -hr*)
-    ac_init_help=recursive ;;
-  -help=s* | --help=s* | --hel=s* | --he=s* | -hs*)
-    ac_init_help=short ;;
-
-  -host | --host | --hos | --ho)
-    ac_prev=host_alias ;;
-  -host=* | --host=* | --hos=* | --ho=*)
-    host_alias=$ac_optarg ;;
-
-  -htmldir | --htmldir | --htmldi | --htmld | --html | --htm | --ht)
-    ac_prev=htmldir ;;
-  -htmldir=* | --htmldir=* | --htmldi=* | --htmld=* | --html=* | --htm=* \
-  | --ht=*)
-    htmldir=$ac_optarg ;;
-
-  -includedir | --includedir | --includedi | --included | --include \
-  | --includ | --inclu | --incl | --inc)
-    ac_prev=includedir ;;
-  -includedir=* | --includedir=* | --includedi=* | --included=* | --include=* \
-  | --includ=* | --inclu=* | --incl=* | --inc=*)
-    includedir=$ac_optarg ;;
-
-  -infodir | --infodir | --infodi | --infod | --info | --inf)
-    ac_prev=infodir ;;
-  -infodir=* | --infodir=* | --infodi=* | --infod=* | --info=* | --inf=*)
-    infodir=$ac_optarg ;;
-
-  -libdir | --libdir | --libdi | --libd)
-    ac_prev=libdir ;;
-  -libdir=* | --libdir=* | --libdi=* | --libd=*)
-    libdir=$ac_optarg ;;
-
-  -libexecdir | --libexecdir | --libexecdi | --libexecd | --libexec \
-  | --libexe | --libex | --libe)
-    ac_prev=libexecdir ;;
-  -libexecdir=* | --libexecdir=* | --libexecdi=* | --libexecd=* | --libexec=* \
-  | --libexe=* | --libex=* | --libe=*)
-    libexecdir=$ac_optarg ;;
-
-  -localedir | --localedir | --localedi | --localed | --locale)
-    ac_prev=localedir ;;
-  -localedir=* | --localedir=* | --localedi=* | --localed=* | --locale=*)
-    localedir=$ac_optarg ;;
-
-  -localstatedir | --localstatedir | --localstatedi | --localstated \
-  | --localstate | --localstat | --localsta | --localst | --locals)
-    ac_prev=localstatedir ;;
-  -localstatedir=* | --localstatedir=* | --localstatedi=* | --localstated=* \
-  | --localstate=* | --localstat=* | --localsta=* | --localst=* | --locals=*)
-    localstatedir=$ac_optarg ;;
-
-  -mandir | --mandir | --mandi | --mand | --man | --ma | --m)
-    ac_prev=mandir ;;
-  -mandir=* | --mandir=* | --mandi=* | --mand=* | --man=* | --ma=* | --m=*)
-    mandir=$ac_optarg ;;
-
-  -nfp | --nfp | --nf)
-    # Obsolete; use --without-fp.
-    with_fp=no ;;
-
-  -no-create | --no-create | --no-creat | --no-crea | --no-cre \
-  | --no-cr | --no-c | -n)
-    no_create=yes ;;
-
-  -no-recursion | --no-recursion | --no-recursio | --no-recursi \
-  | --no-recurs | --no-recur | --no-recu | --no-rec | --no-re | --no-r)
-    no_recursion=yes ;;
-
-  -oldincludedir | --oldincludedir | --oldincludedi | --oldincluded \
-  | --oldinclude | --oldinclud | --oldinclu | --oldincl | --oldinc \
-  | --oldin | --oldi | --old | --ol | --o)
-    ac_prev=oldincludedir ;;
-  -oldincludedir=* | --oldincludedir=* | --oldincludedi=* | --oldincluded=* \
-  | --oldinclude=* | --oldinclud=* | --oldinclu=* | --oldincl=* | --oldinc=* \
-  | --oldin=* | --oldi=* | --old=* | --ol=* | --o=*)
-    oldincludedir=$ac_optarg ;;
-
-  -prefix | --prefix | --prefi | --pref | --pre | --pr | --p)
-    ac_prev=prefix ;;
-  -prefix=* | --prefix=* | --prefi=* | --pref=* | --pre=* | --pr=* | --p=*)
-    prefix=$ac_optarg ;;
-
-  -program-prefix | --program-prefix | --program-prefi | --program-pref \
-  | --program-pre | --program-pr | --program-p)
-    ac_prev=program_prefix ;;
-  -program-prefix=* | --program-prefix=* | --program-prefi=* \
-  | --program-pref=* | --program-pre=* | --program-pr=* | --program-p=*)
-    program_prefix=$ac_optarg ;;
-
-  -program-suffix | --program-suffix | --program-suffi | --program-suff \
-  | --program-suf | --program-su | --program-s)
-    ac_prev=program_suffix ;;
-  -program-suffix=* | --program-suffix=* | --program-suffi=* \
-  | --program-suff=* | --program-suf=* | --program-su=* | --program-s=*)
-    program_suffix=$ac_optarg ;;
-
-  -program-transform-name | --program-transform-name \
-  | --program-transform-nam | --program-transform-na \
-  | --program-transform-n | --program-transform- \
-  | --program-transform | --program-transfor \
-  | --program-transfo | --program-transf \
-  | --program-trans | --program-tran \
-  | --progr-tra | --program-tr | --program-t)
-    ac_prev=program_transform_name ;;
-  -program-transform-name=* | --program-transform-name=* \
-  | --program-transform-nam=* | --program-transform-na=* \
-  | --program-transform-n=* | --program-transform-=* \
-  | --program-transform=* | --program-transfor=* \
-  | --program-transfo=* | --program-transf=* \
-  | --program-trans=* | --program-tran=* \
-  | --progr-tra=* | --program-tr=* | --program-t=*)
-    program_transform_name=$ac_optarg ;;
-
-  -pdfdir | --pdfdir | --pdfdi | --pdfd | --pdf | --pd)
-    ac_prev=pdfdir ;;
-  -pdfdir=* | --pdfdir=* | --pdfdi=* | --pdfd=* | --pdf=* | --pd=*)
-    pdfdir=$ac_optarg ;;
-
-  -psdir | --psdir | --psdi | --psd | --ps)
-    ac_prev=psdir ;;
-  -psdir=* | --psdir=* | --psdi=* | --psd=* | --ps=*)
-    psdir=$ac_optarg ;;
-
-  -q | -quiet | --quiet | --quie | --qui | --qu | --q \
-  | -silent | --silent | --silen | --sile | --sil)
-    silent=yes ;;
-
-  -sbindir | --sbindir | --sbindi | --sbind | --sbin | --sbi | --sb)
-    ac_prev=sbindir ;;
-  -sbindir=* | --sbindir=* | --sbindi=* | --sbind=* | --sbin=* \
-  | --sbi=* | --sb=*)
-    sbindir=$ac_optarg ;;
-
-  -sharedstatedir | --sharedstatedir | --sharedstatedi \
-  | --sharedstated | --sharedstate | --sharedstat | --sharedsta \
-  | --sharedst | --shareds | --shared | --share | --shar \
-  | --sha | --sh)
-    ac_prev=sharedstatedir ;;
-  -sharedstatedir=* | --sharedstatedir=* | --sharedstatedi=* \
-  | --sharedstated=* | --sharedstate=* | --sharedstat=* | --sharedsta=* \
-  | --sharedst=* | --shareds=* | --shared=* | --share=* | --shar=* \
-  | --sha=* | --sh=*)
-    sharedstatedir=$ac_optarg ;;
-
-  -site | --site | --sit)
-    ac_prev=site ;;
-  -site=* | --site=* | --sit=*)
-    site=$ac_optarg ;;
-
-  -srcdir | --srcdir | --srcdi | --srcd | --src | --sr)
-    ac_prev=srcdir ;;
-  -srcdir=* | --srcdir=* | --srcdi=* | --srcd=* | --src=* | --sr=*)
-    srcdir=$ac_optarg ;;
-
-  -sysconfdir | --sysconfdir | --sysconfdi | --sysconfd | --sysconf \
-  | --syscon | --sysco | --sysc | --sys | --sy)
-    ac_prev=sysconfdir ;;
-  -sysconfdir=* | --sysconfdir=* | --sysconfdi=* | --sysconfd=* | --sysconf=* \
-  | --syscon=* | --sysco=* | --sysc=* | --sys=* | --sy=*)
-    sysconfdir=$ac_optarg ;;
-
-  -target | --target | --targe | --targ | --tar | --ta | --t)
-    ac_prev=target_alias ;;
-  -target=* | --target=* | --targe=* | --targ=* | --tar=* | --ta=* | --t=*)
-    target_alias=$ac_optarg ;;
-
-  -v | -verbose | --verbose | --verbos | --verbo | --verb)
-    verbose=yes ;;
-
-  -version | --version | --versio | --versi | --vers | -V)
-    ac_init_version=: ;;
-
-  -with-* | --with-*)
-    ac_useropt=`expr "x$ac_option" : 'x-*with-\([^=]*\)'`
-    # Reject names that are not valid shell variable names.
-    expr "x$ac_useropt" : ".*[^-+._$as_cr_alnum]" >/dev/null &&
-      { $as_echo "$as_me: error: invalid package name: $ac_useropt" >&2
-   { (exit 1); exit 1; }; }
-    ac_useropt_orig=$ac_useropt
-    ac_useropt=`$as_echo "$ac_useropt" | sed 's/[-+.]/_/g'`
-    case $ac_user_opts in
-      *"
-"with_$ac_useropt"
-"*) ;;
-      *) ac_unrecognized_opts="$ac_unrecognized_opts$ac_unrecognized_sep--with-$ac_useropt_orig"
-	 ac_unrecognized_sep=', ';;
-    esac
-    eval with_$ac_useropt=\$ac_optarg ;;
-
-  -without-* | --without-*)
-    ac_useropt=`expr "x$ac_option" : 'x-*without-\(.*\)'`
-    # Reject names that are not valid shell variable names.
-    expr "x$ac_useropt" : ".*[^-+._$as_cr_alnum]" >/dev/null &&
-      { $as_echo "$as_me: error: invalid package name: $ac_useropt" >&2
-   { (exit 1); exit 1; }; }
-    ac_useropt_orig=$ac_useropt
-    ac_useropt=`$as_echo "$ac_useropt" | sed 's/[-+.]/_/g'`
-    case $ac_user_opts in
-      *"
-"with_$ac_useropt"
-"*) ;;
-      *) ac_unrecognized_opts="$ac_unrecognized_opts$ac_unrecognized_sep--without-$ac_useropt_orig"
-	 ac_unrecognized_sep=', ';;
-    esac
-    eval with_$ac_useropt=no ;;
-
-  --x)
-    # Obsolete; use --with-x.
-    with_x=yes ;;
-
-  -x-includes | --x-includes | --x-include | --x-includ | --x-inclu \
-  | --x-incl | --x-inc | --x-in | --x-i)
-    ac_prev=x_includes ;;
-  -x-includes=* | --x-includes=* | --x-include=* | --x-includ=* | --x-inclu=* \
-  | --x-incl=* | --x-inc=* | --x-in=* | --x-i=*)
-    x_includes=$ac_optarg ;;
-
-  -x-libraries | --x-libraries | --x-librarie | --x-librari \
-  | --x-librar | --x-libra | --x-libr | --x-lib | --x-li | --x-l)
-    ac_prev=x_libraries ;;
-  -x-libraries=* | --x-libraries=* | --x-librarie=* | --x-librari=* \
-  | --x-librar=* | --x-libra=* | --x-libr=* | --x-lib=* | --x-li=* | --x-l=*)
-    x_libraries=$ac_optarg ;;
-
-  -*) { $as_echo "$as_me: error: unrecognized option: $ac_option
-Try \`$0 --help' for more information." >&2
-   { (exit 1); exit 1; }; }
-    ;;
-
-  *=*)
-    ac_envvar=`expr "x$ac_option" : 'x\([^=]*\)='`
-    # Reject names that are not valid shell variable names.
-    expr "x$ac_envvar" : ".*[^_$as_cr_alnum]" >/dev/null &&
-      { $as_echo "$as_me: error: invalid variable name: $ac_envvar" >&2
-   { (exit 1); exit 1; }; }
-    eval $ac_envvar=\$ac_optarg
-    export $ac_envvar ;;
-
-  *)
-    # FIXME: should be removed in autoconf 3.0.
-    $as_echo "$as_me: WARNING: you should use --build, --host, --target" >&2
-    expr "x$ac_option" : ".*[^-._$as_cr_alnum]" >/dev/null &&
-      $as_echo "$as_me: WARNING: invalid host type: $ac_option" >&2
-    : ${build_alias=$ac_option} ${host_alias=$ac_option} ${target_alias=$ac_option}
-    ;;
-
-  esac
-done
-
-if test -n "$ac_prev"; then
-  ac_option=--`echo $ac_prev | sed 's/_/-/g'`
-  { $as_echo "$as_me: error: missing argument to $ac_option" >&2
-   { (exit 1); exit 1; }; }
-fi
-
-if test -n "$ac_unrecognized_opts"; then
-  case $enable_option_checking in
-    no) ;;
-    fatal) { $as_echo "$as_me: error: unrecognized options: $ac_unrecognized_opts" >&2
-   { (exit 1); exit 1; }; } ;;
-    *)     $as_echo "$as_me: WARNING: unrecognized options: $ac_unrecognized_opts" >&2 ;;
-  esac
-fi
-
-# Check all directory arguments for consistency.
-for ac_var in	exec_prefix prefix bindir sbindir libexecdir datarootdir \
-		datadir sysconfdir sharedstatedir localstatedir includedir \
-		oldincludedir docdir infodir htmldir dvidir pdfdir psdir \
-		libdir localedir mandir
-do
-  eval ac_val=\$$ac_var
-  # Remove trailing slashes.
-  case $ac_val in
-    */ )
-      ac_val=`expr "X$ac_val" : 'X\(.*[^/]\)' \| "X$ac_val" : 'X\(.*\)'`
-      eval $ac_var=\$ac_val;;
-  esac
-  # Be sure to have absolute directory names.
-  case $ac_val in
-    [\\/$]* | ?:[\\/]* )  continue;;
-    NONE | '' ) case $ac_var in *prefix ) continue;; esac;;
-  esac
-  { $as_echo "$as_me: error: expected an absolute directory name for --$ac_var: $ac_val" >&2
-   { (exit 1); exit 1; }; }
-done
-
-# There might be people who depend on the old broken behavior: `$host'
-# used to hold the argument of --host etc.
-# FIXME: To remove some day.
-build=$build_alias
-host=$host_alias
-target=$target_alias
-
-# FIXME: To remove some day.
-if test "x$host_alias" != x; then
-  if test "x$build_alias" = x; then
-    cross_compiling=maybe
-    $as_echo "$as_me: WARNING: If you wanted to set the --build type, don't use --host.
-    If a cross compiler is detected then cross compile mode will be used." >&2
-  elif test "x$build_alias" != "x$host_alias"; then
-    cross_compiling=yes
-  fi
-fi
-
-ac_tool_prefix=
-test -n "$host_alias" && ac_tool_prefix=$host_alias-
-
-test "$silent" = yes && exec 6>/dev/null
-
-
-ac_pwd=`pwd` && test -n "$ac_pwd" &&
-ac_ls_di=`ls -di .` &&
-ac_pwd_ls_di=`cd "$ac_pwd" && ls -di .` ||
-  { $as_echo "$as_me: error: working directory cannot be determined" >&2
-   { (exit 1); exit 1; }; }
-test "X$ac_ls_di" = "X$ac_pwd_ls_di" ||
-  { $as_echo "$as_me: error: pwd does not report name of working directory" >&2
-   { (exit 1); exit 1; }; }
-
-
-# Find the source files, if location was not specified.
-if test -z "$srcdir"; then
-  ac_srcdir_defaulted=yes
-  # Try the directory containing this script, then the parent directory.
-  ac_confdir=`$as_dirname -- "$as_myself" ||
-$as_expr X"$as_myself" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \
-	 X"$as_myself" : 'X\(//\)[^/]' \| \
-	 X"$as_myself" : 'X\(//\)$' \| \
-	 X"$as_myself" : 'X\(/\)' \| . 2>/dev/null ||
-$as_echo X"$as_myself" |
-    sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{
-	    s//\1/
-	    q
-	  }
-	  /^X\(\/\/\)[^/].*/{
-	    s//\1/
-	    q
-	  }
-	  /^X\(\/\/\)$/{
-	    s//\1/
-	    q
-	  }
-	  /^X\(\/\).*/{
-	    s//\1/
-	    q
-	  }
-	  s/.*/./; q'`
-  srcdir=$ac_confdir
-  if test ! -r "$srcdir/$ac_unique_file"; then
-    srcdir=..
-  fi
-else
-  ac_srcdir_defaulted=no
-fi
-if test ! -r "$srcdir/$ac_unique_file"; then
-  test "$ac_srcdir_defaulted" = yes && srcdir="$ac_confdir or .."
-  { $as_echo "$as_me: error: cannot find sources ($ac_unique_file) in $srcdir" >&2
-   { (exit 1); exit 1; }; }
-fi
-ac_msg="sources are in $srcdir, but \`cd $srcdir' does not work"
-ac_abs_confdir=`(
-	cd "$srcdir" && test -r "./$ac_unique_file" || { $as_echo "$as_me: error: $ac_msg" >&2
-   { (exit 1); exit 1; }; }
-	pwd)`
-# When building in place, set srcdir=.
-if test "$ac_abs_confdir" = "$ac_pwd"; then
-  srcdir=.
-fi
-# Remove unnecessary trailing slashes from srcdir.
-# Double slashes in file names in object file debugging info
-# mess up M-x gdb in Emacs.
-case $srcdir in
-*/) srcdir=`expr "X$srcdir" : 'X\(.*[^/]\)' \| "X$srcdir" : 'X\(.*\)'`;;
-esac
-for ac_var in $ac_precious_vars; do
-  eval ac_env_${ac_var}_set=\${${ac_var}+set}
-  eval ac_env_${ac_var}_value=\$${ac_var}
-  eval ac_cv_env_${ac_var}_set=\${${ac_var}+set}
-  eval ac_cv_env_${ac_var}_value=\$${ac_var}
-done
-
-#
-# Report the --help message.
-#
-if test "$ac_init_help" = "long"; then
-  # Omit some internal or obsolete options to make the list less imposing.
-  # This message is too long to be a string in the A/UX 3.1 sh.
-  cat <<_ACEOF
-\`configure' configures jellyfish 1.1.5 to adapt to many kinds of systems.
-
-Usage: $0 [OPTION]... [VAR=VALUE]...
-
-To assign environment variables (e.g., CC, CFLAGS...), specify them as
-VAR=VALUE.  See below for descriptions of some of the useful variables.
-
-Defaults for the options are specified in brackets.
-
-Configuration:
-  -h, --help              display this help and exit
-      --help=short        display options specific to this package
-      --help=recursive    display the short help of all the included packages
-  -V, --version           display version information and exit
-  -q, --quiet, --silent   do not print \`checking...' messages
-      --cache-file=FILE   cache test results in FILE [disabled]
-  -C, --config-cache      alias for \`--cache-file=config.cache'
-  -n, --no-create         do not create output files
-      --srcdir=DIR        find the sources in DIR [configure dir or \`..']
-
-Installation directories:
-  --prefix=PREFIX         install architecture-independent files in PREFIX
-                          [$ac_default_prefix]
-  --exec-prefix=EPREFIX   install architecture-dependent files in EPREFIX
-                          [PREFIX]
-
-By default, \`make install' will install all the files in
-\`$ac_default_prefix/bin', \`$ac_default_prefix/lib' etc.  You can specify
-an installation prefix other than \`$ac_default_prefix' using \`--prefix',
-for instance \`--prefix=\$HOME'.
-
-For better control, use the options below.
-
-Fine tuning of the installation directories:
-  --bindir=DIR            user executables [EPREFIX/bin]
-  --sbindir=DIR           system admin executables [EPREFIX/sbin]
-  --libexecdir=DIR        program executables [EPREFIX/libexec]
-  --sysconfdir=DIR        read-only single-machine data [PREFIX/etc]
-  --sharedstatedir=DIR    modifiable architecture-independent data [PREFIX/com]
-  --localstatedir=DIR     modifiable single-machine data [PREFIX/var]
-  --libdir=DIR            object code libraries [EPREFIX/lib]
-  --includedir=DIR        C header files [PREFIX/include]
-  --oldincludedir=DIR     C header files for non-gcc [/usr/include]
-  --datarootdir=DIR       read-only arch.-independent data root [PREFIX/share]
-  --datadir=DIR           read-only architecture-independent data [DATAROOTDIR]
-  --infodir=DIR           info documentation [DATAROOTDIR/info]
-  --localedir=DIR         locale-dependent data [DATAROOTDIR/locale]
-  --mandir=DIR            man documentation [DATAROOTDIR/man]
-  --docdir=DIR            documentation root [DATAROOTDIR/doc/jellyfish]
-  --htmldir=DIR           html documentation [DOCDIR]
-  --dvidir=DIR            dvi documentation [DOCDIR]
-  --pdfdir=DIR            pdf documentation [DOCDIR]
-  --psdir=DIR             ps documentation [DOCDIR]
-_ACEOF
-
-  cat <<\_ACEOF
-
-Program names:
-  --program-prefix=PREFIX            prepend PREFIX to installed program names
-  --program-suffix=SUFFIX            append SUFFIX to installed program names
-  --program-transform-name=PROGRAM   run sed PROGRAM on installed program names
-
-System types:
-  --build=BUILD     configure for building on BUILD [guessed]
-  --host=HOST       cross-compile to build programs to run on HOST [BUILD]
-_ACEOF
-fi
-
-if test -n "$ac_init_help"; then
-  case $ac_init_help in
-     short | recursive ) echo "Configuration of jellyfish 1.1.5:";;
-   esac
-  cat <<\_ACEOF
-
-Optional Features:
-  --disable-option-checking  ignore unrecognized --enable/--with options
-  --disable-FEATURE       do not include FEATURE (same as --enable-FEATURE=no)
-  --enable-FEATURE[=ARG]  include FEATURE [ARG=yes]
-  --enable-silent-rules          less verbose build output (undo: `make V=1')
-  --disable-silent-rules         verbose build output (undo: `make V=0')
-  --disable-dependency-tracking  speeds up one-time build
-  --enable-dependency-tracking   do not reject slow dependency extractors
-  --enable-shared[=PKGS]  build shared libraries [default=yes]
-  --enable-static[=PKGS]  build static libraries [default=yes]
-  --enable-fast-install[=PKGS]
-                          optimize for fast installation [default=yes]
-  --disable-libtool-lock  avoid locking (might break parallel builds)
-
-Optional Packages:
-  --with-PACKAGE[=ARG]    use PACKAGE [ARG=yes]
-  --without-PACKAGE       do not use PACKAGE (same as --with-PACKAGE=no)
-  --with-sse              enable SSE
-  --with-half             enable half float (16 bits)
-  --with-pic              try to use only PIC/non-PIC objects [default=use
-                          both]
-  --with-gnu-ld           assume the C compiler uses GNU ld [default=no]
-
-Some influential environment variables:
-  CXX         C++ compiler command
-  CXXFLAGS    C++ compiler flags
-  LDFLAGS     linker flags, e.g. -L<lib dir> if you have libraries in a
-              nonstandard directory <lib dir>
-  LIBS        libraries to pass to the linker, e.g. -l<library>
-  CPPFLAGS    C/C++/Objective C preprocessor flags, e.g. -I<include dir> if
-              you have headers in a nonstandard directory <include dir>
-  MD5         Path to md5 hashing program
-  CC          C compiler command
-  CFLAGS      C compiler flags
-  CPP         C preprocessor
-  CXXCPP      C++ preprocessor
-
-Use these variables to override the choices made by `configure' or to help
-it to find libraries and programs with nonstandard names/locations.
-
-Report bugs to <gmarcais at umd.edu>.
-_ACEOF
-ac_status=$?
-fi
-
-if test "$ac_init_help" = "recursive"; then
-  # If there are subdirs, report their specific --help.
-  for ac_dir in : $ac_subdirs_all; do test "x$ac_dir" = x: && continue
-    test -d "$ac_dir" ||
-      { cd "$srcdir" && ac_pwd=`pwd` && srcdir=. && test -d "$ac_dir"; } ||
-      continue
-    ac_builddir=.
-
-case "$ac_dir" in
-.) ac_dir_suffix= ac_top_builddir_sub=. ac_top_build_prefix= ;;
-*)
-  ac_dir_suffix=/`$as_echo "$ac_dir" | sed 's|^\.[\\/]||'`
-  # A ".." for each directory in $ac_dir_suffix.
-  ac_top_builddir_sub=`$as_echo "$ac_dir_suffix" | sed 's|/[^\\/]*|/..|g;s|/||'`
-  case $ac_top_builddir_sub in
-  "") ac_top_builddir_sub=. ac_top_build_prefix= ;;
-  *)  ac_top_build_prefix=$ac_top_builddir_sub/ ;;
-  esac ;;
-esac
-ac_abs_top_builddir=$ac_pwd
-ac_abs_builddir=$ac_pwd$ac_dir_suffix
-# for backward compatibility:
-ac_top_builddir=$ac_top_build_prefix
-
-case $srcdir in
-  .)  # We are building in place.
-    ac_srcdir=.
-    ac_top_srcdir=$ac_top_builddir_sub
-    ac_abs_top_srcdir=$ac_pwd ;;
-  [\\/]* | ?:[\\/]* )  # Absolute name.
-    ac_srcdir=$srcdir$ac_dir_suffix;
-    ac_top_srcdir=$srcdir
-    ac_abs_top_srcdir=$srcdir ;;
-  *) # Relative name.
-    ac_srcdir=$ac_top_build_prefix$srcdir$ac_dir_suffix
-    ac_top_srcdir=$ac_top_build_prefix$srcdir
-    ac_abs_top_srcdir=$ac_pwd/$srcdir ;;
-esac
-ac_abs_srcdir=$ac_abs_top_srcdir$ac_dir_suffix
-
-    cd "$ac_dir" || { ac_status=$?; continue; }
-    # Check for guested configure.
-    if test -f "$ac_srcdir/configure.gnu"; then
-      echo &&
-      $SHELL "$ac_srcdir/configure.gnu" --help=recursive
-    elif test -f "$ac_srcdir/configure"; then
-      echo &&
-      $SHELL "$ac_srcdir/configure" --help=recursive
-    else
-      $as_echo "$as_me: WARNING: no configuration information is in $ac_dir" >&2
-    fi || ac_status=$?
-    cd "$ac_pwd" || { ac_status=$?; break; }
-  done
-fi
-
-test -n "$ac_init_help" && exit $ac_status
-if $ac_init_version; then
-  cat <<\_ACEOF
-jellyfish configure 1.1.5
-generated by GNU Autoconf 2.63
-
-Copyright (C) 1992, 1993, 1994, 1995, 1996, 1998, 1999, 2000, 2001,
-2002, 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc.
-This configure script is free software; the Free Software Foundation
-gives unlimited permission to copy, distribute and modify it.
-_ACEOF
-  exit
-fi
-cat >config.log <<_ACEOF
-This file contains any messages produced by compilers while
-running configure, to aid debugging if configure makes a mistake.
-
-It was created by jellyfish $as_me 1.1.5, which was
-generated by GNU Autoconf 2.63.  Invocation command line was
-
-  $ $0 $@
-
-_ACEOF
-exec 5>>config.log
-{
-cat <<_ASUNAME
-## --------- ##
-## Platform. ##
-## --------- ##
-
-hostname = `(hostname || uname -n) 2>/dev/null | sed 1q`
-uname -m = `(uname -m) 2>/dev/null || echo unknown`
-uname -r = `(uname -r) 2>/dev/null || echo unknown`
-uname -s = `(uname -s) 2>/dev/null || echo unknown`
-uname -v = `(uname -v) 2>/dev/null || echo unknown`
-
-/usr/bin/uname -p = `(/usr/bin/uname -p) 2>/dev/null || echo unknown`
-/bin/uname -X     = `(/bin/uname -X) 2>/dev/null     || echo unknown`
-
-/bin/arch              = `(/bin/arch) 2>/dev/null              || echo unknown`
-/usr/bin/arch -k       = `(/usr/bin/arch -k) 2>/dev/null       || echo unknown`
-/usr/convex/getsysinfo = `(/usr/convex/getsysinfo) 2>/dev/null || echo unknown`
-/usr/bin/hostinfo      = `(/usr/bin/hostinfo) 2>/dev/null      || echo unknown`
-/bin/machine           = `(/bin/machine) 2>/dev/null           || echo unknown`
-/usr/bin/oslevel       = `(/usr/bin/oslevel) 2>/dev/null       || echo unknown`
-/bin/universe          = `(/bin/universe) 2>/dev/null          || echo unknown`
-
-_ASUNAME
-
-as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH
-do
-  IFS=$as_save_IFS
-  test -z "$as_dir" && as_dir=.
-  $as_echo "PATH: $as_dir"
-done
-IFS=$as_save_IFS
-
-} >&5
-
-cat >&5 <<_ACEOF
-
-
-## ----------- ##
-## Core tests. ##
-## ----------- ##
-
-_ACEOF
-
-
-# Keep a trace of the command line.
-# Strip out --no-create and --no-recursion so they do not pile up.
-# Strip out --silent because we don't want to record it for future runs.
-# Also quote any args containing shell meta-characters.
-# Make two passes to allow for proper duplicate-argument suppression.
-ac_configure_args=
-ac_configure_args0=
-ac_configure_args1=
-ac_must_keep_next=false
-for ac_pass in 1 2
-do
-  for ac_arg
-  do
-    case $ac_arg in
-    -no-create | --no-c* | -n | -no-recursion | --no-r*) continue ;;
-    -q | -quiet | --quiet | --quie | --qui | --qu | --q \
-    | -silent | --silent | --silen | --sile | --sil)
-      continue ;;
-    *\'*)
-      ac_arg=`$as_echo "$ac_arg" | sed "s/'/'\\\\\\\\''/g"` ;;
-    esac
-    case $ac_pass in
-    1) ac_configure_args0="$ac_configure_args0 '$ac_arg'" ;;
-    2)
-      ac_configure_args1="$ac_configure_args1 '$ac_arg'"
-      if test $ac_must_keep_next = true; then
-	ac_must_keep_next=false # Got value, back to normal.
-      else
-	case $ac_arg in
-	  *=* | --config-cache | -C | -disable-* | --disable-* \
-	  | -enable-* | --enable-* | -gas | --g* | -nfp | --nf* \
-	  | -q | -quiet | --q* | -silent | --sil* | -v | -verb* \
-	  | -with-* | --with-* | -without-* | --without-* | --x)
-	    case "$ac_configure_args0 " in
-	      "$ac_configure_args1"*" '$ac_arg' "* ) continue ;;
-	    esac
-	    ;;
-	  -* ) ac_must_keep_next=true ;;
-	esac
-      fi
-      ac_configure_args="$ac_configure_args '$ac_arg'"
-      ;;
-    esac
-  done
-done
-$as_unset ac_configure_args0 || test "${ac_configure_args0+set}" != set || { ac_configure_args0=; export ac_configure_args0; }
-$as_unset ac_configure_args1 || test "${ac_configure_args1+set}" != set || { ac_configure_args1=; export ac_configure_args1; }
-
-# When interrupted or exit'd, cleanup temporary files, and complete
-# config.log.  We remove comments because anyway the quotes in there
-# would cause problems or look ugly.
-# WARNING: Use '\'' to represent an apostrophe within the trap.
-# WARNING: Do not start the trap code with a newline, due to a FreeBSD 4.0 bug.
-trap 'exit_status=$?
-  # Save into config.log some information that might help in debugging.
-  {
-    echo
-
-    cat <<\_ASBOX
-## ---------------- ##
-## Cache variables. ##
-## ---------------- ##
-_ASBOX
-    echo
-    # The following way of writing the cache mishandles newlines in values,
-(
-  for ac_var in `(set) 2>&1 | sed -n '\''s/^\([a-zA-Z_][a-zA-Z0-9_]*\)=.*/\1/p'\''`; do
-    eval ac_val=\$$ac_var
-    case $ac_val in #(
-    *${as_nl}*)
-      case $ac_var in #(
-      *_cv_*) { $as_echo "$as_me:$LINENO: WARNING: cache variable $ac_var contains a newline" >&5
-$as_echo "$as_me: WARNING: cache variable $ac_var contains a newline" >&2;} ;;
-      esac
-      case $ac_var in #(
-      _ | IFS | as_nl) ;; #(
-      BASH_ARGV | BASH_SOURCE) eval $ac_var= ;; #(
-      *) $as_unset $ac_var ;;
-      esac ;;
-    esac
-  done
-  (set) 2>&1 |
-    case $as_nl`(ac_space='\'' '\''; set) 2>&1` in #(
-    *${as_nl}ac_space=\ *)
-      sed -n \
-	"s/'\''/'\''\\\\'\'''\''/g;
-	  s/^\\([_$as_cr_alnum]*_cv_[_$as_cr_alnum]*\\)=\\(.*\\)/\\1='\''\\2'\''/p"
-      ;; #(
-    *)
-      sed -n "/^[_$as_cr_alnum]*_cv_[_$as_cr_alnum]*=/p"
-      ;;
-    esac |
-    sort
-)
-    echo
-
-    cat <<\_ASBOX
-## ----------------- ##
-## Output variables. ##
-## ----------------- ##
-_ASBOX
-    echo
-    for ac_var in $ac_subst_vars
-    do
-      eval ac_val=\$$ac_var
-      case $ac_val in
-      *\'\''*) ac_val=`$as_echo "$ac_val" | sed "s/'\''/'\''\\\\\\\\'\'''\''/g"`;;
-      esac
-      $as_echo "$ac_var='\''$ac_val'\''"
-    done | sort
-    echo
-
-    if test -n "$ac_subst_files"; then
-      cat <<\_ASBOX
-## ------------------- ##
-## File substitutions. ##
-## ------------------- ##
-_ASBOX
-      echo
-      for ac_var in $ac_subst_files
-      do
-	eval ac_val=\$$ac_var
-	case $ac_val in
-	*\'\''*) ac_val=`$as_echo "$ac_val" | sed "s/'\''/'\''\\\\\\\\'\'''\''/g"`;;
-	esac
-	$as_echo "$ac_var='\''$ac_val'\''"
-      done | sort
-      echo
-    fi
-
-    if test -s confdefs.h; then
-      cat <<\_ASBOX
-## ----------- ##
-## confdefs.h. ##
-## ----------- ##
-_ASBOX
-      echo
-      cat confdefs.h
-      echo
-    fi
-    test "$ac_signal" != 0 &&
-      $as_echo "$as_me: caught signal $ac_signal"
-    $as_echo "$as_me: exit $exit_status"
-  } >&5
-  rm -f core *.core core.conftest.* &&
-    rm -f -r conftest* confdefs* conf$$* $ac_clean_files &&
-    exit $exit_status
-' 0
-for ac_signal in 1 2 13 15; do
-  trap 'ac_signal='$ac_signal'; { (exit 1); exit 1; }' $ac_signal
-done
-ac_signal=0
-
-# confdefs.h avoids OS command line length limits that DEFS can exceed.
-rm -f -r conftest* confdefs.h
-
-# Predefined preprocessor variables.
-
-cat >>confdefs.h <<_ACEOF
-#define PACKAGE_NAME "$PACKAGE_NAME"
-_ACEOF
 
+test -n "$DJDIR" || exec 7<&0 </dev/null
+exec 6>&1
 
-cat >>confdefs.h <<_ACEOF
-#define PACKAGE_TARNAME "$PACKAGE_TARNAME"
-_ACEOF
+# Name of the host.
+# hostname on some systems (SVR3.2, old GNU/Linux) returns a bogus exit status,
+# so uname gets run too.
+ac_hostname=`(hostname || uname -n) 2>/dev/null | sed 1q`
 
+#
+# Initializations.
+#
+ac_default_prefix=/usr/local
+ac_clean_files=
+ac_config_libobj_dir=.
+LIBOBJS=
+cross_compiling=no
+subdirs=
+MFLAGS=
+MAKEFLAGS=
 
-cat >>confdefs.h <<_ACEOF
-#define PACKAGE_VERSION "$PACKAGE_VERSION"
-_ACEOF
+# Identity of this package.
+PACKAGE_NAME='jellyfish'
+PACKAGE_TARNAME='jellyfish'
+PACKAGE_VERSION='1.1.11'
+PACKAGE_STRING='jellyfish 1.1.11'
+PACKAGE_BUGREPORT='gmarcais at umd.edu'
+PACKAGE_URL=''
 
+ac_unique_file="jellyfish"
+# Factoring default headers for most tests.
+ac_includes_default="\
+#include <stdio.h>
+#ifdef HAVE_SYS_TYPES_H
+# include <sys/types.h>
+#endif
+#ifdef HAVE_SYS_STAT_H
+# include <sys/stat.h>
+#endif
+#ifdef STDC_HEADERS
+# include <stdlib.h>
+# include <stddef.h>
+#else
+# ifdef HAVE_STDLIB_H
+#  include <stdlib.h>
+# endif
+#endif
+#ifdef HAVE_STRING_H
+# if !defined STDC_HEADERS && defined HAVE_MEMORY_H
+#  include <memory.h>
+# endif
+# include <string.h>
+#endif
+#ifdef HAVE_STRINGS_H
+# include <strings.h>
+#endif
+#ifdef HAVE_INTTYPES_H
+# include <inttypes.h>
+#endif
+#ifdef HAVE_STDINT_H
+# include <stdint.h>
+#endif
+#ifdef HAVE_UNISTD_H
+# include <unistd.h>
+#endif"
 
-cat >>confdefs.h <<_ACEOF
-#define PACKAGE_STRING "$PACKAGE_STRING"
-_ACEOF
+ac_subst_vars='am__EXEEXT_FALSE
+am__EXEEXT_TRUE
+LTLIBOBJS
+LIBOBJS
+STATIC_FLAGS
+MD5
+CXXCPP
+am__fastdepCXX_FALSE
+am__fastdepCXX_TRUE
+CXXDEPMODE
+ac_ct_CXX
+CXXFLAGS
+CXX
+CPP
+OTOOL64
+OTOOL
+LIPO
+NMEDIT
+DSYMUTIL
+MANIFEST_TOOL
+RANLIB
+ac_ct_AR
+AR
+DLLTOOL
+OBJDUMP
+LN_S
+NM
+ac_ct_DUMPBIN
+DUMPBIN
+LD
+FGREP
+EGREP
+GREP
+SED
+am__fastdepCC_FALSE
+am__fastdepCC_TRUE
+CCDEPMODE
+am__nodep
+AMDEPBACKSLASH
+AMDEP_FALSE
+AMDEP_TRUE
+am__quote
+am__include
+DEPDIR
+OBJEXT
+EXEEXT
+ac_ct_CC
+CPPFLAGS
+LDFLAGS
+CFLAGS
+CC
+LIBTOOL
+AM_BACKSLASH
+AM_DEFAULT_VERBOSITY
+AM_DEFAULT_V
+AM_V
+am__untar
+am__tar
+AMTAR
+am__leading_dot
+SET_MAKE
+AWK
+mkdir_p
+MKDIR_P
+INSTALL_STRIP_PROGRAM
+STRIP
+install_sh
+MAKEINFO
+AUTOHEADER
+AUTOMAKE
+AUTOCONF
+ACLOCAL
+VERSION
+PACKAGE
+CYGPATH_W
+am__isrc
+INSTALL_DATA
+INSTALL_SCRIPT
+INSTALL_PROGRAM
+host_os
+host_vendor
+host_cpu
+host
+build_os
+build_vendor
+build_cpu
+build
+target_alias
+host_alias
+build_alias
+LIBS
+ECHO_T
+ECHO_N
+ECHO_C
+DEFS
+mandir
+localedir
+libdir
+psdir
+pdfdir
+dvidir
+htmldir
+infodir
+docdir
+oldincludedir
+includedir
+localstatedir
+sharedstatedir
+sysconfdir
+datadir
+datarootdir
+libexecdir
+sbindir
+bindir
+program_transform_name
+prefix
+exec_prefix
+PACKAGE_URL
+PACKAGE_BUGREPORT
+PACKAGE_STRING
+PACKAGE_VERSION
+PACKAGE_TARNAME
+PACKAGE_NAME
+PATH_SEPARATOR
+SHELL'
+ac_subst_files=''
+ac_user_opts='
+enable_option_checking
+enable_silent_rules
+enable_shared
+enable_static
+with_pic
+enable_fast_install
+enable_dependency_tracking
+with_gnu_ld
+with_sysroot
+enable_libtool_lock
+with_sse
+with_half
+enable_all_static
+'
+      ac_precious_vars='build_alias
+host_alias
+target_alias
+CC
+CFLAGS
+LDFLAGS
+LIBS
+CPPFLAGS
+CPP
+CXX
+CXXFLAGS
+CCC
+CXXCPP
+MD5'
 
 
-cat >>confdefs.h <<_ACEOF
-#define PACKAGE_BUGREPORT "$PACKAGE_BUGREPORT"
-_ACEOF
+# Initialize some variables set by options.
+ac_init_help=
+ac_init_version=false
+ac_unrecognized_opts=
+ac_unrecognized_sep=
+# The variables have the same names as the options, with
+# dashes changed to underlines.
+cache_file=/dev/null
+exec_prefix=NONE
+no_create=
+no_recursion=
+prefix=NONE
+program_prefix=NONE
+program_suffix=NONE
+program_transform_name=s,x,x,
+silent=
+site=
+srcdir=
+verbose=
+x_includes=NONE
+x_libraries=NONE
 
+# Installation directory options.
+# These are left unexpanded so users can "make install exec_prefix=/foo"
+# and all the variables that are supposed to be based on exec_prefix
+# by default will actually change.
+# Use braces instead of parens because sh, perl, etc. also accept them.
+# (The list follows the same order as the GNU Coding Standards.)
+bindir='${exec_prefix}/bin'
+sbindir='${exec_prefix}/sbin'
+libexecdir='${exec_prefix}/libexec'
+datarootdir='${prefix}/share'
+datadir='${datarootdir}'
+sysconfdir='${prefix}/etc'
+sharedstatedir='${prefix}/com'
+localstatedir='${prefix}/var'
+includedir='${prefix}/include'
+oldincludedir='/usr/include'
+docdir='${datarootdir}/doc/${PACKAGE_TARNAME}'
+infodir='${datarootdir}/info'
+htmldir='${docdir}'
+dvidir='${docdir}'
+pdfdir='${docdir}'
+psdir='${docdir}'
+libdir='${exec_prefix}/lib'
+localedir='${datarootdir}/locale'
+mandir='${datarootdir}/man'
 
-# Let the site file select an alternate cache file if it wants to.
-# Prefer an explicitly selected file to automatically selected ones.
-ac_site_file1=NONE
-ac_site_file2=NONE
-if test -n "$CONFIG_SITE"; then
-  ac_site_file1=$CONFIG_SITE
-elif test "x$prefix" != xNONE; then
-  ac_site_file1=$prefix/share/config.site
-  ac_site_file2=$prefix/etc/config.site
-else
-  ac_site_file1=$ac_default_prefix/share/config.site
-  ac_site_file2=$ac_default_prefix/etc/config.site
-fi
-for ac_site_file in "$ac_site_file1" "$ac_site_file2"
+ac_prev=
+ac_dashdash=
+for ac_option
 do
-  test "x$ac_site_file" = xNONE && continue
-  if test -r "$ac_site_file"; then
-    { $as_echo "$as_me:$LINENO: loading site script $ac_site_file" >&5
-$as_echo "$as_me: loading site script $ac_site_file" >&6;}
-    sed 's/^/| /' "$ac_site_file" >&5
-    . "$ac_site_file"
-  fi
-done
-
-if test -r "$cache_file"; then
-  # Some versions of bash will fail to source /dev/null (special
-  # files actually), so we avoid doing that.
-  if test -f "$cache_file"; then
-    { $as_echo "$as_me:$LINENO: loading cache $cache_file" >&5
-$as_echo "$as_me: loading cache $cache_file" >&6;}
-    case $cache_file in
-      [\\/]* | ?:[\\/]* ) . "$cache_file";;
-      *)                      . "./$cache_file";;
-    esac
+  # If the previous option needs an argument, assign it.
+  if test -n "$ac_prev"; then
+    eval $ac_prev=\$ac_option
+    ac_prev=
+    continue
   fi
-else
-  { $as_echo "$as_me:$LINENO: creating cache $cache_file" >&5
-$as_echo "$as_me: creating cache $cache_file" >&6;}
-  >$cache_file
-fi
 
-# Check that the precious variables saved in the cache have kept the same
-# value.
-ac_cache_corrupted=false
-for ac_var in $ac_precious_vars; do
-  eval ac_old_set=\$ac_cv_env_${ac_var}_set
-  eval ac_new_set=\$ac_env_${ac_var}_set
-  eval ac_old_val=\$ac_cv_env_${ac_var}_value
-  eval ac_new_val=\$ac_env_${ac_var}_value
-  case $ac_old_set,$ac_new_set in
-    set,)
-      { $as_echo "$as_me:$LINENO: error: \`$ac_var' was set to \`$ac_old_val' in the previous run" >&5
-$as_echo "$as_me: error: \`$ac_var' was set to \`$ac_old_val' in the previous run" >&2;}
-      ac_cache_corrupted=: ;;
-    ,set)
-      { $as_echo "$as_me:$LINENO: error: \`$ac_var' was not set in the previous run" >&5
-$as_echo "$as_me: error: \`$ac_var' was not set in the previous run" >&2;}
-      ac_cache_corrupted=: ;;
-    ,);;
-    *)
-      if test "x$ac_old_val" != "x$ac_new_val"; then
-	# differences in whitespace do not lead to failure.
-	ac_old_val_w=`echo x $ac_old_val`
-	ac_new_val_w=`echo x $ac_new_val`
-	if test "$ac_old_val_w" != "$ac_new_val_w"; then
-	  { $as_echo "$as_me:$LINENO: error: \`$ac_var' has changed since the previous run:" >&5
-$as_echo "$as_me: error: \`$ac_var' has changed since the previous run:" >&2;}
-	  ac_cache_corrupted=:
-	else
-	  { $as_echo "$as_me:$LINENO: warning: ignoring whitespace changes in \`$ac_var' since the previous run:" >&5
-$as_echo "$as_me: warning: ignoring whitespace changes in \`$ac_var' since the previous run:" >&2;}
-	  eval $ac_var=\$ac_old_val
-	fi
-	{ $as_echo "$as_me:$LINENO:   former value:  \`$ac_old_val'" >&5
-$as_echo "$as_me:   former value:  \`$ac_old_val'" >&2;}
-	{ $as_echo "$as_me:$LINENO:   current value: \`$ac_new_val'" >&5
-$as_echo "$as_me:   current value: \`$ac_new_val'" >&2;}
-      fi;;
+  case $ac_option in
+  *=?*) ac_optarg=`expr "X$ac_option" : '[^=]*=\(.*\)'` ;;
+  *=)   ac_optarg= ;;
+  *)    ac_optarg=yes ;;
   esac
-  # Pass precious variables to config.status.
-  if test "$ac_new_set" = set; then
-    case $ac_new_val in
-    *\'*) ac_arg=$ac_var=`$as_echo "$ac_new_val" | sed "s/'/'\\\\\\\\''/g"` ;;
-    *) ac_arg=$ac_var=$ac_new_val ;;
-    esac
-    case " $ac_configure_args " in
-      *" '$ac_arg' "*) ;; # Avoid dups.  Use of quotes ensures accuracy.
-      *) ac_configure_args="$ac_configure_args '$ac_arg'" ;;
-    esac
-  fi
-done
-if $ac_cache_corrupted; then
-  { $as_echo "$as_me:$LINENO: error: in \`$ac_pwd':" >&5
-$as_echo "$as_me: error: in \`$ac_pwd':" >&2;}
-  { $as_echo "$as_me:$LINENO: error: changes in the environment can compromise the build" >&5
-$as_echo "$as_me: error: changes in the environment can compromise the build" >&2;}
-  { { $as_echo "$as_me:$LINENO: error: run \`make distclean' and/or \`rm $cache_file' and start over" >&5
-$as_echo "$as_me: error: run \`make distclean' and/or \`rm $cache_file' and start over" >&2;}
-   { (exit 1); exit 1; }; }
-fi
-
-
-
-
-
-
-
-
-
-
-
 
+  # Accept the important Cygnus configure options, so we can diagnose typos.
 
+  case $ac_dashdash$ac_option in
+  --)
+    ac_dashdash=yes ;;
 
+  -bindir | --bindir | --bindi | --bind | --bin | --bi)
+    ac_prev=bindir ;;
+  -bindir=* | --bindir=* | --bindi=* | --bind=* | --bin=* | --bi=*)
+    bindir=$ac_optarg ;;
 
+  -build | --build | --buil | --bui | --bu)
+    ac_prev=build_alias ;;
+  -build=* | --build=* | --buil=* | --bui=* | --bu=*)
+    build_alias=$ac_optarg ;;
 
+  -cache-file | --cache-file | --cache-fil | --cache-fi \
+  | --cache-f | --cache- | --cache | --cach | --cac | --ca | --c)
+    ac_prev=cache_file ;;
+  -cache-file=* | --cache-file=* | --cache-fil=* | --cache-fi=* \
+  | --cache-f=* | --cache-=* | --cache=* | --cach=* | --cac=* | --ca=* | --c=*)
+    cache_file=$ac_optarg ;;
 
+  --config-cache | -C)
+    cache_file=config.cache ;;
 
+  -datadir | --datadir | --datadi | --datad)
+    ac_prev=datadir ;;
+  -datadir=* | --datadir=* | --datadi=* | --datad=*)
+    datadir=$ac_optarg ;;
 
+  -datarootdir | --datarootdir | --datarootdi | --datarootd | --dataroot \
+  | --dataroo | --dataro | --datar)
+    ac_prev=datarootdir ;;
+  -datarootdir=* | --datarootdir=* | --datarootdi=* | --datarootd=* \
+  | --dataroot=* | --dataroo=* | --dataro=* | --datar=*)
+    datarootdir=$ac_optarg ;;
 
+  -disable-* | --disable-*)
+    ac_useropt=`expr "x$ac_option" : 'x-*disable-\(.*\)'`
+    # Reject names that are not valid shell variable names.
+    expr "x$ac_useropt" : ".*[^-+._$as_cr_alnum]" >/dev/null &&
+      as_fn_error $? "invalid feature name: $ac_useropt"
+    ac_useropt_orig=$ac_useropt
+    ac_useropt=`$as_echo "$ac_useropt" | sed 's/[-+.]/_/g'`
+    case $ac_user_opts in
+      *"
+"enable_$ac_useropt"
+"*) ;;
+      *) ac_unrecognized_opts="$ac_unrecognized_opts$ac_unrecognized_sep--disable-$ac_useropt_orig"
+	 ac_unrecognized_sep=', ';;
+    esac
+    eval enable_$ac_useropt=no ;;
 
+  -docdir | --docdir | --docdi | --doc | --do)
+    ac_prev=docdir ;;
+  -docdir=* | --docdir=* | --docdi=* | --doc=* | --do=*)
+    docdir=$ac_optarg ;;
 
+  -dvidir | --dvidir | --dvidi | --dvid | --dvi | --dv)
+    ac_prev=dvidir ;;
+  -dvidir=* | --dvidir=* | --dvidi=* | --dvid=* | --dvi=* | --dv=*)
+    dvidir=$ac_optarg ;;
 
+  -enable-* | --enable-*)
+    ac_useropt=`expr "x$ac_option" : 'x-*enable-\([^=]*\)'`
+    # Reject names that are not valid shell variable names.
+    expr "x$ac_useropt" : ".*[^-+._$as_cr_alnum]" >/dev/null &&
+      as_fn_error $? "invalid feature name: $ac_useropt"
+    ac_useropt_orig=$ac_useropt
+    ac_useropt=`$as_echo "$ac_useropt" | sed 's/[-+.]/_/g'`
+    case $ac_user_opts in
+      *"
+"enable_$ac_useropt"
+"*) ;;
+      *) ac_unrecognized_opts="$ac_unrecognized_opts$ac_unrecognized_sep--enable-$ac_useropt_orig"
+	 ac_unrecognized_sep=', ';;
+    esac
+    eval enable_$ac_useropt=\$ac_optarg ;;
 
+  -exec-prefix | --exec_prefix | --exec-prefix | --exec-prefi \
+  | --exec-pref | --exec-pre | --exec-pr | --exec-p | --exec- \
+  | --exec | --exe | --ex)
+    ac_prev=exec_prefix ;;
+  -exec-prefix=* | --exec_prefix=* | --exec-prefix=* | --exec-prefi=* \
+  | --exec-pref=* | --exec-pre=* | --exec-pr=* | --exec-p=* | --exec-=* \
+  | --exec=* | --exe=* | --ex=*)
+    exec_prefix=$ac_optarg ;;
 
-ac_ext=c
-ac_cpp='$CPP $CPPFLAGS'
-ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
-ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
-ac_compiler_gnu=$ac_cv_c_compiler_gnu
+  -gas | --gas | --ga | --g)
+    # Obsolete; use --with-gas.
+    with_gas=yes ;;
 
+  -help | --help | --hel | --he | -h)
+    ac_init_help=long ;;
+  -help=r* | --help=r* | --hel=r* | --he=r* | -hr*)
+    ac_init_help=recursive ;;
+  -help=s* | --help=s* | --hel=s* | --he=s* | -hs*)
+    ac_init_help=short ;;
 
-ac_aux_dir=
-for ac_dir in "$srcdir" "$srcdir/.." "$srcdir/../.."; do
-  if test -f "$ac_dir/install-sh"; then
-    ac_aux_dir=$ac_dir
-    ac_install_sh="$ac_aux_dir/install-sh -c"
-    break
-  elif test -f "$ac_dir/install.sh"; then
-    ac_aux_dir=$ac_dir
-    ac_install_sh="$ac_aux_dir/install.sh -c"
-    break
-  elif test -f "$ac_dir/shtool"; then
-    ac_aux_dir=$ac_dir
-    ac_install_sh="$ac_aux_dir/shtool install -c"
-    break
-  fi
-done
-if test -z "$ac_aux_dir"; then
-  { { $as_echo "$as_me:$LINENO: error: cannot find install-sh or install.sh in \"$srcdir\" \"$srcdir/..\" \"$srcdir/../..\"" >&5
-$as_echo "$as_me: error: cannot find install-sh or install.sh in \"$srcdir\" \"$srcdir/..\" \"$srcdir/../..\"" >&2;}
-   { (exit 1); exit 1; }; }
-fi
+  -host | --host | --hos | --ho)
+    ac_prev=host_alias ;;
+  -host=* | --host=* | --hos=* | --ho=*)
+    host_alias=$ac_optarg ;;
 
-# These three variables are undocumented and unsupported,
-# and are intended to be withdrawn in a future Autoconf release.
-# They can cause serious problems if a builder's source tree is in a directory
-# whose full name contains unusual characters.
-ac_config_guess="$SHELL $ac_aux_dir/config.guess"  # Please don't use this var.
-ac_config_sub="$SHELL $ac_aux_dir/config.sub"  # Please don't use this var.
-ac_configure="$SHELL $ac_aux_dir/configure"  # Please don't use this var.
+  -htmldir | --htmldir | --htmldi | --htmld | --html | --htm | --ht)
+    ac_prev=htmldir ;;
+  -htmldir=* | --htmldir=* | --htmldi=* | --htmld=* | --html=* | --htm=* \
+  | --ht=*)
+    htmldir=$ac_optarg ;;
 
+  -includedir | --includedir | --includedi | --included | --include \
+  | --includ | --inclu | --incl | --inc)
+    ac_prev=includedir ;;
+  -includedir=* | --includedir=* | --includedi=* | --included=* | --include=* \
+  | --includ=* | --inclu=* | --incl=* | --inc=*)
+    includedir=$ac_optarg ;;
 
-# Make sure we can run config.sub.
-$SHELL "$ac_aux_dir/config.sub" sun4 >/dev/null 2>&1 ||
-  { { $as_echo "$as_me:$LINENO: error: cannot run $SHELL $ac_aux_dir/config.sub" >&5
-$as_echo "$as_me: error: cannot run $SHELL $ac_aux_dir/config.sub" >&2;}
-   { (exit 1); exit 1; }; }
+  -infodir | --infodir | --infodi | --infod | --info | --inf)
+    ac_prev=infodir ;;
+  -infodir=* | --infodir=* | --infodi=* | --infod=* | --info=* | --inf=*)
+    infodir=$ac_optarg ;;
 
-{ $as_echo "$as_me:$LINENO: checking build system type" >&5
-$as_echo_n "checking build system type... " >&6; }
-if test "${ac_cv_build+set}" = set; then
-  $as_echo_n "(cached) " >&6
-else
-  ac_build_alias=$build_alias
-test "x$ac_build_alias" = x &&
-  ac_build_alias=`$SHELL "$ac_aux_dir/config.guess"`
-test "x$ac_build_alias" = x &&
-  { { $as_echo "$as_me:$LINENO: error: cannot guess build type; you must specify one" >&5
-$as_echo "$as_me: error: cannot guess build type; you must specify one" >&2;}
-   { (exit 1); exit 1; }; }
-ac_cv_build=`$SHELL "$ac_aux_dir/config.sub" $ac_build_alias` ||
-  { { $as_echo "$as_me:$LINENO: error: $SHELL $ac_aux_dir/config.sub $ac_build_alias failed" >&5
-$as_echo "$as_me: error: $SHELL $ac_aux_dir/config.sub $ac_build_alias failed" >&2;}
-   { (exit 1); exit 1; }; }
+  -libdir | --libdir | --libdi | --libd)
+    ac_prev=libdir ;;
+  -libdir=* | --libdir=* | --libdi=* | --libd=*)
+    libdir=$ac_optarg ;;
 
-fi
-{ $as_echo "$as_me:$LINENO: result: $ac_cv_build" >&5
-$as_echo "$ac_cv_build" >&6; }
-case $ac_cv_build in
-*-*-*) ;;
-*) { { $as_echo "$as_me:$LINENO: error: invalid value of canonical build" >&5
-$as_echo "$as_me: error: invalid value of canonical build" >&2;}
-   { (exit 1); exit 1; }; };;
-esac
-build=$ac_cv_build
-ac_save_IFS=$IFS; IFS='-'
-set x $ac_cv_build
-shift
-build_cpu=$1
-build_vendor=$2
-shift; shift
-# Remember, the first character of IFS is used to create $*,
-# except with old shells:
-build_os=$*
-IFS=$ac_save_IFS
-case $build_os in *\ *) build_os=`echo "$build_os" | sed 's/ /-/g'`;; esac
+  -libexecdir | --libexecdir | --libexecdi | --libexecd | --libexec \
+  | --libexe | --libex | --libe)
+    ac_prev=libexecdir ;;
+  -libexecdir=* | --libexecdir=* | --libexecdi=* | --libexecd=* | --libexec=* \
+  | --libexe=* | --libex=* | --libe=*)
+    libexecdir=$ac_optarg ;;
 
+  -localedir | --localedir | --localedi | --localed | --locale)
+    ac_prev=localedir ;;
+  -localedir=* | --localedir=* | --localedi=* | --localed=* | --locale=*)
+    localedir=$ac_optarg ;;
 
-{ $as_echo "$as_me:$LINENO: checking host system type" >&5
-$as_echo_n "checking host system type... " >&6; }
-if test "${ac_cv_host+set}" = set; then
-  $as_echo_n "(cached) " >&6
-else
-  if test "x$host_alias" = x; then
-  ac_cv_host=$ac_cv_build
-else
-  ac_cv_host=`$SHELL "$ac_aux_dir/config.sub" $host_alias` ||
-    { { $as_echo "$as_me:$LINENO: error: $SHELL $ac_aux_dir/config.sub $host_alias failed" >&5
-$as_echo "$as_me: error: $SHELL $ac_aux_dir/config.sub $host_alias failed" >&2;}
-   { (exit 1); exit 1; }; }
-fi
+  -localstatedir | --localstatedir | --localstatedi | --localstated \
+  | --localstate | --localstat | --localsta | --localst | --locals)
+    ac_prev=localstatedir ;;
+  -localstatedir=* | --localstatedir=* | --localstatedi=* | --localstated=* \
+  | --localstate=* | --localstat=* | --localsta=* | --localst=* | --locals=*)
+    localstatedir=$ac_optarg ;;
 
-fi
-{ $as_echo "$as_me:$LINENO: result: $ac_cv_host" >&5
-$as_echo "$ac_cv_host" >&6; }
-case $ac_cv_host in
-*-*-*) ;;
-*) { { $as_echo "$as_me:$LINENO: error: invalid value of canonical host" >&5
-$as_echo "$as_me: error: invalid value of canonical host" >&2;}
-   { (exit 1); exit 1; }; };;
-esac
-host=$ac_cv_host
-ac_save_IFS=$IFS; IFS='-'
-set x $ac_cv_host
-shift
-host_cpu=$1
-host_vendor=$2
-shift; shift
-# Remember, the first character of IFS is used to create $*,
-# except with old shells:
-host_os=$*
-IFS=$ac_save_IFS
-case $host_os in *\ *) host_os=`echo "$host_os" | sed 's/ /-/g'`;; esac
+  -mandir | --mandir | --mandi | --mand | --man | --ma | --m)
+    ac_prev=mandir ;;
+  -mandir=* | --mandir=* | --mandi=* | --mand=* | --man=* | --ma=* | --m=*)
+    mandir=$ac_optarg ;;
 
+  -nfp | --nfp | --nf)
+    # Obsolete; use --without-fp.
+    with_fp=no ;;
 
+  -no-create | --no-create | --no-creat | --no-crea | --no-cre \
+  | --no-cr | --no-c | -n)
+    no_create=yes ;;
 
-am__api_version='1.11'
+  -no-recursion | --no-recursion | --no-recursio | --no-recursi \
+  | --no-recurs | --no-recur | --no-recu | --no-rec | --no-re | --no-r)
+    no_recursion=yes ;;
 
-# Find a good install program.  We prefer a C program (faster),
-# so one script is as good as another.  But avoid the broken or
-# incompatible versions:
-# SysV /etc/install, /usr/sbin/install
-# SunOS /usr/etc/install
-# IRIX /sbin/install
-# AIX /bin/install
-# AmigaOS /C/install, which installs bootblocks on floppy discs
-# AIX 4 /usr/bin/installbsd, which doesn't work without a -g flag
-# AFS /usr/afsws/bin/install, which mishandles nonexistent args
-# SVR4 /usr/ucb/install, which tries to use the nonexistent group "staff"
-# OS/2's system install, which has a completely different semantic
-# ./install, which can be erroneously created by make from ./install.sh.
-# Reject install programs that cannot install multiple files.
-{ $as_echo "$as_me:$LINENO: checking for a BSD-compatible install" >&5
-$as_echo_n "checking for a BSD-compatible install... " >&6; }
-if test -z "$INSTALL"; then
-if test "${ac_cv_path_install+set}" = set; then
-  $as_echo_n "(cached) " >&6
-else
-  as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH
-do
-  IFS=$as_save_IFS
-  test -z "$as_dir" && as_dir=.
-  # Account for people who put trailing slashes in PATH elements.
-case $as_dir/ in
-  ./ | .// | /cC/* | \
-  /etc/* | /usr/sbin/* | /usr/etc/* | /sbin/* | /usr/afsws/bin/* | \
-  ?:\\/os2\\/install\\/* | ?:\\/OS2\\/INSTALL\\/* | \
-  /usr/ucb/* ) ;;
-  *)
-    # OSF1 and SCO ODT 3.0 have their own names for install.
-    # Don't use installbsd from OSF since it installs stuff as root
-    # by default.
-    for ac_prog in ginstall scoinst install; do
-      for ac_exec_ext in '' $ac_executable_extensions; do
-	if { test -f "$as_dir/$ac_prog$ac_exec_ext" && $as_test_x "$as_dir/$ac_prog$ac_exec_ext"; }; then
-	  if test $ac_prog = install &&
-	    grep dspmsg "$as_dir/$ac_prog$ac_exec_ext" >/dev/null 2>&1; then
-	    # AIX install.  It has an incompatible calling convention.
-	    :
-	  elif test $ac_prog = install &&
-	    grep pwplus "$as_dir/$ac_prog$ac_exec_ext" >/dev/null 2>&1; then
-	    # program-specific install script used by HP pwplus--don't use.
-	    :
-	  else
-	    rm -rf conftest.one conftest.two conftest.dir
-	    echo one > conftest.one
-	    echo two > conftest.two
-	    mkdir conftest.dir
-	    if "$as_dir/$ac_prog$ac_exec_ext" -c conftest.one conftest.two "`pwd`/conftest.dir" &&
-	      test -s conftest.one && test -s conftest.two &&
-	      test -s conftest.dir/conftest.one &&
-	      test -s conftest.dir/conftest.two
-	    then
-	      ac_cv_path_install="$as_dir/$ac_prog$ac_exec_ext -c"
-	      break 3
-	    fi
-	  fi
-	fi
-      done
-    done
-    ;;
-esac
+  -oldincludedir | --oldincludedir | --oldincludedi | --oldincluded \
+  | --oldinclude | --oldinclud | --oldinclu | --oldincl | --oldinc \
+  | --oldin | --oldi | --old | --ol | --o)
+    ac_prev=oldincludedir ;;
+  -oldincludedir=* | --oldincludedir=* | --oldincludedi=* | --oldincluded=* \
+  | --oldinclude=* | --oldinclud=* | --oldinclu=* | --oldincl=* | --oldinc=* \
+  | --oldin=* | --oldi=* | --old=* | --ol=* | --o=*)
+    oldincludedir=$ac_optarg ;;
 
-done
-IFS=$as_save_IFS
+  -prefix | --prefix | --prefi | --pref | --pre | --pr | --p)
+    ac_prev=prefix ;;
+  -prefix=* | --prefix=* | --prefi=* | --pref=* | --pre=* | --pr=* | --p=*)
+    prefix=$ac_optarg ;;
 
-rm -rf conftest.one conftest.two conftest.dir
+  -program-prefix | --program-prefix | --program-prefi | --program-pref \
+  | --program-pre | --program-pr | --program-p)
+    ac_prev=program_prefix ;;
+  -program-prefix=* | --program-prefix=* | --program-prefi=* \
+  | --program-pref=* | --program-pre=* | --program-pr=* | --program-p=*)
+    program_prefix=$ac_optarg ;;
 
-fi
-  if test "${ac_cv_path_install+set}" = set; then
-    INSTALL=$ac_cv_path_install
-  else
-    # As a last resort, use the slow shell script.  Don't cache a
-    # value for INSTALL within a source directory, because that will
-    # break other packages using the cache if that directory is
-    # removed, or if the value is a relative name.
-    INSTALL=$ac_install_sh
-  fi
-fi
-{ $as_echo "$as_me:$LINENO: result: $INSTALL" >&5
-$as_echo "$INSTALL" >&6; }
+  -program-suffix | --program-suffix | --program-suffi | --program-suff \
+  | --program-suf | --program-su | --program-s)
+    ac_prev=program_suffix ;;
+  -program-suffix=* | --program-suffix=* | --program-suffi=* \
+  | --program-suff=* | --program-suf=* | --program-su=* | --program-s=*)
+    program_suffix=$ac_optarg ;;
 
-# Use test -z because SunOS4 sh mishandles braces in ${var-val}.
-# It thinks the first close brace ends the variable substitution.
-test -z "$INSTALL_PROGRAM" && INSTALL_PROGRAM='${INSTALL}'
+  -program-transform-name | --program-transform-name \
+  | --program-transform-nam | --program-transform-na \
+  | --program-transform-n | --program-transform- \
+  | --program-transform | --program-transfor \
+  | --program-transfo | --program-transf \
+  | --program-trans | --program-tran \
+  | --progr-tra | --program-tr | --program-t)
+    ac_prev=program_transform_name ;;
+  -program-transform-name=* | --program-transform-name=* \
+  | --program-transform-nam=* | --program-transform-na=* \
+  | --program-transform-n=* | --program-transform-=* \
+  | --program-transform=* | --program-transfor=* \
+  | --program-transfo=* | --program-transf=* \
+  | --program-trans=* | --program-tran=* \
+  | --progr-tra=* | --program-tr=* | --program-t=*)
+    program_transform_name=$ac_optarg ;;
 
-test -z "$INSTALL_SCRIPT" && INSTALL_SCRIPT='${INSTALL}'
+  -pdfdir | --pdfdir | --pdfdi | --pdfd | --pdf | --pd)
+    ac_prev=pdfdir ;;
+  -pdfdir=* | --pdfdir=* | --pdfdi=* | --pdfd=* | --pdf=* | --pd=*)
+    pdfdir=$ac_optarg ;;
 
-test -z "$INSTALL_DATA" && INSTALL_DATA='${INSTALL} -m 644'
+  -psdir | --psdir | --psdi | --psd | --ps)
+    ac_prev=psdir ;;
+  -psdir=* | --psdir=* | --psdi=* | --psd=* | --ps=*)
+    psdir=$ac_optarg ;;
 
-{ $as_echo "$as_me:$LINENO: checking whether build environment is sane" >&5
-$as_echo_n "checking whether build environment is sane... " >&6; }
-# Just in case
-sleep 1
-echo timestamp > conftest.file
-# Reject unsafe characters in $srcdir or the absolute working directory
-# name.  Accept space and tab only in the latter.
-am_lf='
-'
-case `pwd` in
-  *[\\\"\#\$\&\'\`$am_lf]*)
-    { { $as_echo "$as_me:$LINENO: error: unsafe absolute working directory name" >&5
-$as_echo "$as_me: error: unsafe absolute working directory name" >&2;}
-   { (exit 1); exit 1; }; };;
-esac
-case $srcdir in
-  *[\\\"\#\$\&\'\`$am_lf\ \	]*)
-    { { $as_echo "$as_me:$LINENO: error: unsafe srcdir value: \`$srcdir'" >&5
-$as_echo "$as_me: error: unsafe srcdir value: \`$srcdir'" >&2;}
-   { (exit 1); exit 1; }; };;
-esac
+  -q | -quiet | --quiet | --quie | --qui | --qu | --q \
+  | -silent | --silent | --silen | --sile | --sil)
+    silent=yes ;;
 
-# Do `set' in a subshell so we don't clobber the current shell's
-# arguments.  Must try -L first in case configure is actually a
-# symlink; some systems play weird games with the mod time of symlinks
-# (eg FreeBSD returns the mod time of the symlink's containing
-# directory).
-if (
-   set X `ls -Lt "$srcdir/configure" conftest.file 2> /dev/null`
-   if test "$*" = "X"; then
-      # -L didn't work.
-      set X `ls -t "$srcdir/configure" conftest.file`
-   fi
-   rm -f conftest.file
-   if test "$*" != "X $srcdir/configure conftest.file" \
-      && test "$*" != "X conftest.file $srcdir/configure"; then
+  -sbindir | --sbindir | --sbindi | --sbind | --sbin | --sbi | --sb)
+    ac_prev=sbindir ;;
+  -sbindir=* | --sbindir=* | --sbindi=* | --sbind=* | --sbin=* \
+  | --sbi=* | --sb=*)
+    sbindir=$ac_optarg ;;
 
-      # If neither matched, then we have a broken ls.  This can happen
-      # if, for instance, CONFIG_SHELL is bash and it inherits a
-      # broken ls alias from the environment.  This has actually
-      # happened.  Such a system could not be considered "sane".
-      { { $as_echo "$as_me:$LINENO: error: ls -t appears to fail.  Make sure there is not a broken
-alias in your environment" >&5
-$as_echo "$as_me: error: ls -t appears to fail.  Make sure there is not a broken
-alias in your environment" >&2;}
-   { (exit 1); exit 1; }; }
-   fi
+  -sharedstatedir | --sharedstatedir | --sharedstatedi \
+  | --sharedstated | --sharedstate | --sharedstat | --sharedsta \
+  | --sharedst | --shareds | --shared | --share | --shar \
+  | --sha | --sh)
+    ac_prev=sharedstatedir ;;
+  -sharedstatedir=* | --sharedstatedir=* | --sharedstatedi=* \
+  | --sharedstated=* | --sharedstate=* | --sharedstat=* | --sharedsta=* \
+  | --sharedst=* | --shareds=* | --shared=* | --share=* | --shar=* \
+  | --sha=* | --sh=*)
+    sharedstatedir=$ac_optarg ;;
 
-   test "$2" = conftest.file
-   )
-then
-   # Ok.
-   :
-else
-   { { $as_echo "$as_me:$LINENO: error: newly created file is older than distributed files!
-Check your system clock" >&5
-$as_echo "$as_me: error: newly created file is older than distributed files!
-Check your system clock" >&2;}
-   { (exit 1); exit 1; }; }
-fi
-{ $as_echo "$as_me:$LINENO: result: yes" >&5
-$as_echo "yes" >&6; }
-test "$program_prefix" != NONE &&
-  program_transform_name="s&^&$program_prefix&;$program_transform_name"
-# Use a double $ so make ignores it.
-test "$program_suffix" != NONE &&
-  program_transform_name="s&\$&$program_suffix&;$program_transform_name"
-# Double any \ or $.
-# By default was `s,x,x', remove it if useless.
-ac_script='s/[\\$]/&&/g;s/;s,x,x,$//'
-program_transform_name=`$as_echo "$program_transform_name" | sed "$ac_script"`
+  -site | --site | --sit)
+    ac_prev=site ;;
+  -site=* | --site=* | --sit=*)
+    site=$ac_optarg ;;
 
-# expand $ac_aux_dir to an absolute path
-am_aux_dir=`cd $ac_aux_dir && pwd`
+  -srcdir | --srcdir | --srcdi | --srcd | --src | --sr)
+    ac_prev=srcdir ;;
+  -srcdir=* | --srcdir=* | --srcdi=* | --srcd=* | --src=* | --sr=*)
+    srcdir=$ac_optarg ;;
 
-if test x"${MISSING+set}" != xset; then
-  case $am_aux_dir in
-  *\ * | *\	*)
-    MISSING="\${SHELL} \"$am_aux_dir/missing\"" ;;
-  *)
-    MISSING="\${SHELL} $am_aux_dir/missing" ;;
-  esac
-fi
-# Use eval to expand $SHELL
-if eval "$MISSING --run true"; then
-  am_missing_run="$MISSING --run "
-else
-  am_missing_run=
-  { $as_echo "$as_me:$LINENO: WARNING: \`missing' script is too old or missing" >&5
-$as_echo "$as_me: WARNING: \`missing' script is too old or missing" >&2;}
-fi
+  -sysconfdir | --sysconfdir | --sysconfdi | --sysconfd | --sysconf \
+  | --syscon | --sysco | --sysc | --sys | --sy)
+    ac_prev=sysconfdir ;;
+  -sysconfdir=* | --sysconfdir=* | --sysconfdi=* | --sysconfd=* | --sysconf=* \
+  | --syscon=* | --sysco=* | --sysc=* | --sys=* | --sy=*)
+    sysconfdir=$ac_optarg ;;
 
-if test x"${install_sh}" != xset; then
-  case $am_aux_dir in
-  *\ * | *\	*)
-    install_sh="\${SHELL} '$am_aux_dir/install-sh'" ;;
-  *)
-    install_sh="\${SHELL} $am_aux_dir/install-sh"
-  esac
-fi
+  -target | --target | --targe | --targ | --tar | --ta | --t)
+    ac_prev=target_alias ;;
+  -target=* | --target=* | --targe=* | --targ=* | --tar=* | --ta=* | --t=*)
+    target_alias=$ac_optarg ;;
 
-# Installed binaries are usually stripped using `strip' when the user
-# run `make install-strip'.  However `strip' might not be the right
-# tool to use in cross-compilation environments, therefore Automake
-# will honor the `STRIP' environment variable to overrule this program.
-if test "$cross_compiling" != no; then
-  if test -n "$ac_tool_prefix"; then
-  # Extract the first word of "${ac_tool_prefix}strip", so it can be a program name with args.
-set dummy ${ac_tool_prefix}strip; ac_word=$2
-{ $as_echo "$as_me:$LINENO: checking for $ac_word" >&5
-$as_echo_n "checking for $ac_word... " >&6; }
-if test "${ac_cv_prog_STRIP+set}" = set; then
-  $as_echo_n "(cached) " >&6
-else
-  if test -n "$STRIP"; then
-  ac_cv_prog_STRIP="$STRIP" # Let the user override the test.
-else
-as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH
-do
-  IFS=$as_save_IFS
-  test -z "$as_dir" && as_dir=.
-  for ac_exec_ext in '' $ac_executable_extensions; do
-  if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
-    ac_cv_prog_STRIP="${ac_tool_prefix}strip"
-    $as_echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5
-    break 2
-  fi
-done
-done
-IFS=$as_save_IFS
+  -v | -verbose | --verbose | --verbos | --verbo | --verb)
+    verbose=yes ;;
 
-fi
-fi
-STRIP=$ac_cv_prog_STRIP
-if test -n "$STRIP"; then
-  { $as_echo "$as_me:$LINENO: result: $STRIP" >&5
-$as_echo "$STRIP" >&6; }
-else
-  { $as_echo "$as_me:$LINENO: result: no" >&5
-$as_echo "no" >&6; }
-fi
+  -version | --version | --versio | --versi | --vers | -V)
+    ac_init_version=: ;;
+
+  -with-* | --with-*)
+    ac_useropt=`expr "x$ac_option" : 'x-*with-\([^=]*\)'`
+    # Reject names that are not valid shell variable names.
+    expr "x$ac_useropt" : ".*[^-+._$as_cr_alnum]" >/dev/null &&
+      as_fn_error $? "invalid package name: $ac_useropt"
+    ac_useropt_orig=$ac_useropt
+    ac_useropt=`$as_echo "$ac_useropt" | sed 's/[-+.]/_/g'`
+    case $ac_user_opts in
+      *"
+"with_$ac_useropt"
+"*) ;;
+      *) ac_unrecognized_opts="$ac_unrecognized_opts$ac_unrecognized_sep--with-$ac_useropt_orig"
+	 ac_unrecognized_sep=', ';;
+    esac
+    eval with_$ac_useropt=\$ac_optarg ;;
+
+  -without-* | --without-*)
+    ac_useropt=`expr "x$ac_option" : 'x-*without-\(.*\)'`
+    # Reject names that are not valid shell variable names.
+    expr "x$ac_useropt" : ".*[^-+._$as_cr_alnum]" >/dev/null &&
+      as_fn_error $? "invalid package name: $ac_useropt"
+    ac_useropt_orig=$ac_useropt
+    ac_useropt=`$as_echo "$ac_useropt" | sed 's/[-+.]/_/g'`
+    case $ac_user_opts in
+      *"
+"with_$ac_useropt"
+"*) ;;
+      *) ac_unrecognized_opts="$ac_unrecognized_opts$ac_unrecognized_sep--without-$ac_useropt_orig"
+	 ac_unrecognized_sep=', ';;
+    esac
+    eval with_$ac_useropt=no ;;
+
+  --x)
+    # Obsolete; use --with-x.
+    with_x=yes ;;
+
+  -x-includes | --x-includes | --x-include | --x-includ | --x-inclu \
+  | --x-incl | --x-inc | --x-in | --x-i)
+    ac_prev=x_includes ;;
+  -x-includes=* | --x-includes=* | --x-include=* | --x-includ=* | --x-inclu=* \
+  | --x-incl=* | --x-inc=* | --x-in=* | --x-i=*)
+    x_includes=$ac_optarg ;;
+
+  -x-libraries | --x-libraries | --x-librarie | --x-librari \
+  | --x-librar | --x-libra | --x-libr | --x-lib | --x-li | --x-l)
+    ac_prev=x_libraries ;;
+  -x-libraries=* | --x-libraries=* | --x-librarie=* | --x-librari=* \
+  | --x-librar=* | --x-libra=* | --x-libr=* | --x-lib=* | --x-li=* | --x-l=*)
+    x_libraries=$ac_optarg ;;
 
+  -*) as_fn_error $? "unrecognized option: \`$ac_option'
+Try \`$0 --help' for more information"
+    ;;
 
-fi
-if test -z "$ac_cv_prog_STRIP"; then
-  ac_ct_STRIP=$STRIP
-  # Extract the first word of "strip", so it can be a program name with args.
-set dummy strip; ac_word=$2
-{ $as_echo "$as_me:$LINENO: checking for $ac_word" >&5
-$as_echo_n "checking for $ac_word... " >&6; }
-if test "${ac_cv_prog_ac_ct_STRIP+set}" = set; then
-  $as_echo_n "(cached) " >&6
-else
-  if test -n "$ac_ct_STRIP"; then
-  ac_cv_prog_ac_ct_STRIP="$ac_ct_STRIP" # Let the user override the test.
-else
-as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH
-do
-  IFS=$as_save_IFS
-  test -z "$as_dir" && as_dir=.
-  for ac_exec_ext in '' $ac_executable_extensions; do
-  if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
-    ac_cv_prog_ac_ct_STRIP="strip"
-    $as_echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5
-    break 2
-  fi
-done
-done
-IFS=$as_save_IFS
+  *=*)
+    ac_envvar=`expr "x$ac_option" : 'x\([^=]*\)='`
+    # Reject names that are not valid shell variable names.
+    case $ac_envvar in #(
+      '' | [0-9]* | *[!_$as_cr_alnum]* )
+      as_fn_error $? "invalid variable name: \`$ac_envvar'" ;;
+    esac
+    eval $ac_envvar=\$ac_optarg
+    export $ac_envvar ;;
 
-fi
-fi
-ac_ct_STRIP=$ac_cv_prog_ac_ct_STRIP
-if test -n "$ac_ct_STRIP"; then
-  { $as_echo "$as_me:$LINENO: result: $ac_ct_STRIP" >&5
-$as_echo "$ac_ct_STRIP" >&6; }
-else
-  { $as_echo "$as_me:$LINENO: result: no" >&5
-$as_echo "no" >&6; }
-fi
+  *)
+    # FIXME: should be removed in autoconf 3.0.
+    $as_echo "$as_me: WARNING: you should use --build, --host, --target" >&2
+    expr "x$ac_option" : ".*[^-._$as_cr_alnum]" >/dev/null &&
+      $as_echo "$as_me: WARNING: invalid host type: $ac_option" >&2
+    : "${build_alias=$ac_option} ${host_alias=$ac_option} ${target_alias=$ac_option}"
+    ;;
 
-  if test "x$ac_ct_STRIP" = x; then
-    STRIP=":"
-  else
-    case $cross_compiling:$ac_tool_warned in
-yes:)
-{ $as_echo "$as_me:$LINENO: WARNING: using cross tools not prefixed with host triplet" >&5
-$as_echo "$as_me: WARNING: using cross tools not prefixed with host triplet" >&2;}
-ac_tool_warned=yes ;;
-esac
-    STRIP=$ac_ct_STRIP
-  fi
-else
-  STRIP="$ac_cv_prog_STRIP"
+  esac
+done
+
+if test -n "$ac_prev"; then
+  ac_option=--`echo $ac_prev | sed 's/_/-/g'`
+  as_fn_error $? "missing argument to $ac_option"
 fi
 
+if test -n "$ac_unrecognized_opts"; then
+  case $enable_option_checking in
+    no) ;;
+    fatal) as_fn_error $? "unrecognized options: $ac_unrecognized_opts" ;;
+    *)     $as_echo "$as_me: WARNING: unrecognized options: $ac_unrecognized_opts" >&2 ;;
+  esac
 fi
-INSTALL_STRIP_PROGRAM="\$(install_sh) -c -s"
 
-{ $as_echo "$as_me:$LINENO: checking for a thread-safe mkdir -p" >&5
-$as_echo_n "checking for a thread-safe mkdir -p... " >&6; }
-if test -z "$MKDIR_P"; then
-  if test "${ac_cv_path_mkdir+set}" = set; then
-  $as_echo_n "(cached) " >&6
-else
-  as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH$PATH_SEPARATOR/opt/sfw/bin
+# Check all directory arguments for consistency.
+for ac_var in	exec_prefix prefix bindir sbindir libexecdir datarootdir \
+		datadir sysconfdir sharedstatedir localstatedir includedir \
+		oldincludedir docdir infodir htmldir dvidir pdfdir psdir \
+		libdir localedir mandir
 do
-  IFS=$as_save_IFS
-  test -z "$as_dir" && as_dir=.
-  for ac_prog in mkdir gmkdir; do
-	 for ac_exec_ext in '' $ac_executable_extensions; do
-	   { test -f "$as_dir/$ac_prog$ac_exec_ext" && $as_test_x "$as_dir/$ac_prog$ac_exec_ext"; } || continue
-	   case `"$as_dir/$ac_prog$ac_exec_ext" --version 2>&1` in #(
-	     'mkdir (GNU coreutils) '* | \
-	     'mkdir (coreutils) '* | \
-	     'mkdir (fileutils) '4.1*)
-	       ac_cv_path_mkdir=$as_dir/$ac_prog$ac_exec_ext
-	       break 3;;
-	   esac
-	 done
-       done
+  eval ac_val=\$$ac_var
+  # Remove trailing slashes.
+  case $ac_val in
+    */ )
+      ac_val=`expr "X$ac_val" : 'X\(.*[^/]\)' \| "X$ac_val" : 'X\(.*\)'`
+      eval $ac_var=\$ac_val;;
+  esac
+  # Be sure to have absolute directory names.
+  case $ac_val in
+    [\\/$]* | ?:[\\/]* )  continue;;
+    NONE | '' ) case $ac_var in *prefix ) continue;; esac;;
+  esac
+  as_fn_error $? "expected an absolute directory name for --$ac_var: $ac_val"
 done
-IFS=$as_save_IFS
 
-fi
+# There might be people who depend on the old broken behavior: `$host'
+# used to hold the argument of --host etc.
+# FIXME: To remove some day.
+build=$build_alias
+host=$host_alias
+target=$target_alias
 
-  if test "${ac_cv_path_mkdir+set}" = set; then
-    MKDIR_P="$ac_cv_path_mkdir -p"
-  else
-    # As a last resort, use the slow shell script.  Don't cache a
-    # value for MKDIR_P within a source directory, because that will
-    # break other packages using the cache if that directory is
-    # removed, or if the value is a relative name.
-    test -d ./--version && rmdir ./--version
-    MKDIR_P="$ac_install_sh -d"
+# FIXME: To remove some day.
+if test "x$host_alias" != x; then
+  if test "x$build_alias" = x; then
+    cross_compiling=maybe
+    $as_echo "$as_me: WARNING: if you wanted to set the --build type, don't use --host.
+    If a cross compiler is detected then cross compile mode will be used" >&2
+  elif test "x$build_alias" != "x$host_alias"; then
+    cross_compiling=yes
   fi
 fi
-{ $as_echo "$as_me:$LINENO: result: $MKDIR_P" >&5
-$as_echo "$MKDIR_P" >&6; }
-
-mkdir_p="$MKDIR_P"
-case $mkdir_p in
-  [\\/$]* | ?:[\\/]*) ;;
-  */*) mkdir_p="\$(top_builddir)/$mkdir_p" ;;
-esac
-
-for ac_prog in gawk mawk nawk awk
-do
-  # Extract the first word of "$ac_prog", so it can be a program name with args.
-set dummy $ac_prog; ac_word=$2
-{ $as_echo "$as_me:$LINENO: checking for $ac_word" >&5
-$as_echo_n "checking for $ac_word... " >&6; }
-if test "${ac_cv_prog_AWK+set}" = set; then
-  $as_echo_n "(cached) " >&6
-else
-  if test -n "$AWK"; then
-  ac_cv_prog_AWK="$AWK" # Let the user override the test.
-else
-as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH
-do
-  IFS=$as_save_IFS
-  test -z "$as_dir" && as_dir=.
-  for ac_exec_ext in '' $ac_executable_extensions; do
-  if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
-    ac_cv_prog_AWK="$ac_prog"
-    $as_echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5
-    break 2
-  fi
-done
-done
-IFS=$as_save_IFS
 
-fi
-fi
-AWK=$ac_cv_prog_AWK
-if test -n "$AWK"; then
-  { $as_echo "$as_me:$LINENO: result: $AWK" >&5
-$as_echo "$AWK" >&6; }
-else
-  { $as_echo "$as_me:$LINENO: result: no" >&5
-$as_echo "no" >&6; }
-fi
+ac_tool_prefix=
+test -n "$host_alias" && ac_tool_prefix=$host_alias-
 
+test "$silent" = yes && exec 6>/dev/null
 
-  test -n "$AWK" && break
-done
 
-{ $as_echo "$as_me:$LINENO: checking whether ${MAKE-make} sets \$(MAKE)" >&5
-$as_echo_n "checking whether ${MAKE-make} sets \$(MAKE)... " >&6; }
-set x ${MAKE-make}
-ac_make=`$as_echo "$2" | sed 's/+/p/g; s/[^a-zA-Z0-9_]/_/g'`
-if { as_var=ac_cv_prog_make_${ac_make}_set; eval "test \"\${$as_var+set}\" = set"; }; then
-  $as_echo_n "(cached) " >&6
-else
-  cat >conftest.make <<\_ACEOF
-SHELL = /bin/sh
-all:
-	@echo '@@@%%%=$(MAKE)=@@@%%%'
-_ACEOF
-# GNU make sometimes prints "make[1]: Entering...", which would confuse us.
-case `${MAKE-make} -f conftest.make 2>/dev/null` in
-  *@@@%%%=?*=@@@%%%*)
-    eval ac_cv_prog_make_${ac_make}_set=yes;;
-  *)
-    eval ac_cv_prog_make_${ac_make}_set=no;;
-esac
-rm -f conftest.make
-fi
-if eval test \$ac_cv_prog_make_${ac_make}_set = yes; then
-  { $as_echo "$as_me:$LINENO: result: yes" >&5
-$as_echo "yes" >&6; }
-  SET_MAKE=
-else
-  { $as_echo "$as_me:$LINENO: result: no" >&5
-$as_echo "no" >&6; }
-  SET_MAKE="MAKE=${MAKE-make}"
-fi
+ac_pwd=`pwd` && test -n "$ac_pwd" &&
+ac_ls_di=`ls -di .` &&
+ac_pwd_ls_di=`cd "$ac_pwd" && ls -di .` ||
+  as_fn_error $? "working directory cannot be determined"
+test "X$ac_ls_di" = "X$ac_pwd_ls_di" ||
+  as_fn_error $? "pwd does not report name of working directory"
 
-rm -rf .tst 2>/dev/null
-mkdir .tst 2>/dev/null
-if test -d .tst; then
-  am__leading_dot=.
-else
-  am__leading_dot=_
-fi
-rmdir .tst 2>/dev/null
 
-if test "`cd $srcdir && pwd`" != "`pwd`"; then
-  # Use -I$(srcdir) only when $(srcdir) != ., so that make's output
-  # is not polluted with repeated "-I."
-  am__isrc=' -I$(srcdir)'
-  # test to see if srcdir already configured
-  if test -f $srcdir/config.status; then
-    { { $as_echo "$as_me:$LINENO: error: source directory already configured; run \"make distclean\" there first" >&5
-$as_echo "$as_me: error: source directory already configured; run \"make distclean\" there first" >&2;}
-   { (exit 1); exit 1; }; }
+# Find the source files, if location was not specified.
+if test -z "$srcdir"; then
+  ac_srcdir_defaulted=yes
+  # Try the directory containing this script, then the parent directory.
+  ac_confdir=`$as_dirname -- "$as_myself" ||
+$as_expr X"$as_myself" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \
+	 X"$as_myself" : 'X\(//\)[^/]' \| \
+	 X"$as_myself" : 'X\(//\)$' \| \
+	 X"$as_myself" : 'X\(/\)' \| . 2>/dev/null ||
+$as_echo X"$as_myself" |
+    sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{
+	    s//\1/
+	    q
+	  }
+	  /^X\(\/\/\)[^/].*/{
+	    s//\1/
+	    q
+	  }
+	  /^X\(\/\/\)$/{
+	    s//\1/
+	    q
+	  }
+	  /^X\(\/\).*/{
+	    s//\1/
+	    q
+	  }
+	  s/.*/./; q'`
+  srcdir=$ac_confdir
+  if test ! -r "$srcdir/$ac_unique_file"; then
+    srcdir=..
   fi
+else
+  ac_srcdir_defaulted=no
 fi
-
-# test whether we have cygpath
-if test -z "$CYGPATH_W"; then
-  if (cygpath --version) >/dev/null 2>/dev/null; then
-    CYGPATH_W='cygpath -w'
-  else
-    CYGPATH_W=echo
-  fi
+if test ! -r "$srcdir/$ac_unique_file"; then
+  test "$ac_srcdir_defaulted" = yes && srcdir="$ac_confdir or .."
+  as_fn_error $? "cannot find sources ($ac_unique_file) in $srcdir"
 fi
+ac_msg="sources are in $srcdir, but \`cd $srcdir' does not work"
+ac_abs_confdir=`(
+	cd "$srcdir" && test -r "./$ac_unique_file" || as_fn_error $? "$ac_msg"
+	pwd)`
+# When building in place, set srcdir=.
+if test "$ac_abs_confdir" = "$ac_pwd"; then
+  srcdir=.
+fi
+# Remove unnecessary trailing slashes from srcdir.
+# Double slashes in file names in object file debugging info
+# mess up M-x gdb in Emacs.
+case $srcdir in
+*/) srcdir=`expr "X$srcdir" : 'X\(.*[^/]\)' \| "X$srcdir" : 'X\(.*\)'`;;
+esac
+for ac_var in $ac_precious_vars; do
+  eval ac_env_${ac_var}_set=\${${ac_var}+set}
+  eval ac_env_${ac_var}_value=\$${ac_var}
+  eval ac_cv_env_${ac_var}_set=\${${ac_var}+set}
+  eval ac_cv_env_${ac_var}_value=\$${ac_var}
+done
 
+#
+# Report the --help message.
+#
+if test "$ac_init_help" = "long"; then
+  # Omit some internal or obsolete options to make the list less imposing.
+  # This message is too long to be a string in the A/UX 3.1 sh.
+  cat <<_ACEOF
+\`configure' configures jellyfish 1.1.11 to adapt to many kinds of systems.
 
-# Define the identity of the package.
- PACKAGE='jellyfish'
- VERSION='1.1.5'
-
-
-cat >>confdefs.h <<_ACEOF
-#define PACKAGE "$PACKAGE"
-_ACEOF
-
-
-cat >>confdefs.h <<_ACEOF
-#define VERSION "$VERSION"
-_ACEOF
-
-# Some tools Automake needs.
-
-ACLOCAL=${ACLOCAL-"${am_missing_run}aclocal-${am__api_version}"}
+Usage: $0 [OPTION]... [VAR=VALUE]...
 
+To assign environment variables (e.g., CC, CFLAGS...), specify them as
+VAR=VALUE.  See below for descriptions of some of the useful variables.
 
-AUTOCONF=${AUTOCONF-"${am_missing_run}autoconf"}
+Defaults for the options are specified in brackets.
 
+Configuration:
+  -h, --help              display this help and exit
+      --help=short        display options specific to this package
+      --help=recursive    display the short help of all the included packages
+  -V, --version           display version information and exit
+  -q, --quiet, --silent   do not print \`checking ...' messages
+      --cache-file=FILE   cache test results in FILE [disabled]
+  -C, --config-cache      alias for \`--cache-file=config.cache'
+  -n, --no-create         do not create output files
+      --srcdir=DIR        find the sources in DIR [configure dir or \`..']
 
-AUTOMAKE=${AUTOMAKE-"${am_missing_run}automake-${am__api_version}"}
+Installation directories:
+  --prefix=PREFIX         install architecture-independent files in PREFIX
+                          [$ac_default_prefix]
+  --exec-prefix=EPREFIX   install architecture-dependent files in EPREFIX
+                          [PREFIX]
 
+By default, \`make install' will install all the files in
+\`$ac_default_prefix/bin', \`$ac_default_prefix/lib' etc.  You can specify
+an installation prefix other than \`$ac_default_prefix' using \`--prefix',
+for instance \`--prefix=\$HOME'.
 
-AUTOHEADER=${AUTOHEADER-"${am_missing_run}autoheader"}
+For better control, use the options below.
 
+Fine tuning of the installation directories:
+  --bindir=DIR            user executables [EPREFIX/bin]
+  --sbindir=DIR           system admin executables [EPREFIX/sbin]
+  --libexecdir=DIR        program executables [EPREFIX/libexec]
+  --sysconfdir=DIR        read-only single-machine data [PREFIX/etc]
+  --sharedstatedir=DIR    modifiable architecture-independent data [PREFIX/com]
+  --localstatedir=DIR     modifiable single-machine data [PREFIX/var]
+  --libdir=DIR            object code libraries [EPREFIX/lib]
+  --includedir=DIR        C header files [PREFIX/include]
+  --oldincludedir=DIR     C header files for non-gcc [/usr/include]
+  --datarootdir=DIR       read-only arch.-independent data root [PREFIX/share]
+  --datadir=DIR           read-only architecture-independent data [DATAROOTDIR]
+  --infodir=DIR           info documentation [DATAROOTDIR/info]
+  --localedir=DIR         locale-dependent data [DATAROOTDIR/locale]
+  --mandir=DIR            man documentation [DATAROOTDIR/man]
+  --docdir=DIR            documentation root [DATAROOTDIR/doc/jellyfish]
+  --htmldir=DIR           html documentation [DOCDIR]
+  --dvidir=DIR            dvi documentation [DOCDIR]
+  --pdfdir=DIR            pdf documentation [DOCDIR]
+  --psdir=DIR             ps documentation [DOCDIR]
+_ACEOF
 
-MAKEINFO=${MAKEINFO-"${am_missing_run}makeinfo"}
+  cat <<\_ACEOF
 
-# We need awk for the "check" target.  The system "awk" is bad on
-# some platforms.
-# Always define AMTAR for backward compatibility.
+Program names:
+  --program-prefix=PREFIX            prepend PREFIX to installed program names
+  --program-suffix=SUFFIX            append SUFFIX to installed program names
+  --program-transform-name=PROGRAM   run sed PROGRAM on installed program names
 
-AMTAR=${AMTAR-"${am_missing_run}tar"}
+System types:
+  --build=BUILD     configure for building on BUILD [guessed]
+  --host=HOST       cross-compile to build programs to run on HOST [BUILD]
+_ACEOF
+fi
 
-am__tar='${AMTAR} chof - "$$tardir"'; am__untar='${AMTAR} xf -'
+if test -n "$ac_init_help"; then
+  case $ac_init_help in
+     short | recursive ) echo "Configuration of jellyfish 1.1.11:";;
+   esac
+  cat <<\_ACEOF
 
+Optional Features:
+  --disable-option-checking  ignore unrecognized --enable/--with options
+  --disable-FEATURE       do not include FEATURE (same as --enable-FEATURE=no)
+  --enable-FEATURE[=ARG]  include FEATURE [ARG=yes]
+  --enable-silent-rules          less verbose build output (undo: `make V=1')
+  --disable-silent-rules         verbose build output (undo: `make V=0')
+  --enable-shared[=PKGS]  build shared libraries [default=yes]
+  --enable-static[=PKGS]  build static libraries [default=yes]
+  --enable-fast-install[=PKGS]
+                          optimize for fast installation [default=yes]
+  --disable-dependency-tracking  speeds up one-time build
+  --enable-dependency-tracking   do not reject slow dependency extractors
+  --disable-libtool-lock  avoid locking (might break parallel builds)
+  --enable-all-static     create statically linked executable
 
+Optional Packages:
+  --with-PACKAGE[=ARG]    use PACKAGE [ARG=yes]
+  --without-PACKAGE       do not use PACKAGE (same as --with-PACKAGE=no)
+  --with-pic[=PKGS]       try to use only PIC/non-PIC objects [default=use
+                          both]
+  --with-gnu-ld           assume the C compiler uses GNU ld [default=no]
+  --with-sysroot=DIR Search for dependent libraries within DIR
+                        (or the compiler's sysroot if not specified).
+  --with-sse              enable SSE
+  --with-half             enable half float (16 bits)
 
+Some influential environment variables:
+  CC          C compiler command
+  CFLAGS      C compiler flags
+  LDFLAGS     linker flags, e.g. -L<lib dir> if you have libraries in a
+              nonstandard directory <lib dir>
+  LIBS        libraries to pass to the linker, e.g. -l<library>
+  CPPFLAGS    (Objective) C/C++ preprocessor flags, e.g. -I<include dir> if
+              you have headers in a nonstandard directory <include dir>
+  CPP         C preprocessor
+  CXX         C++ compiler command
+  CXXFLAGS    C++ compiler flags
+  CXXCPP      C++ preprocessor
+  MD5         Path to md5 hashing program
 
+Use these variables to override the choices made by `configure' or to help
+it to find libraries and programs with nonstandard names/locations.
 
-# Check whether --enable-silent-rules was given.
-if test "${enable_silent_rules+set}" = set; then
-  enableval=$enable_silent_rules;
+Report bugs to <gmarcais at umd.edu>.
+_ACEOF
+ac_status=$?
 fi
 
-case $enable_silent_rules in
-yes) AM_DEFAULT_VERBOSITY=0;;
-no)  AM_DEFAULT_VERBOSITY=1;;
-*)   AM_DEFAULT_VERBOSITY=0;;
-esac
-AM_BACKSLASH='\'
-
-
-: ${CXXFLAGS=""}
-ac_ext=cpp
-ac_cpp='$CXXCPP $CPPFLAGS'
-ac_compile='$CXX -c $CXXFLAGS $CPPFLAGS conftest.$ac_ext >&5'
-ac_link='$CXX -o conftest$ac_exeext $CXXFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
-ac_compiler_gnu=$ac_cv_cxx_compiler_gnu
-if test -z "$CXX"; then
-  if test -n "$CCC"; then
-    CXX=$CCC
-  else
-    if test -n "$ac_tool_prefix"; then
-  for ac_prog in g++ c++ gpp aCC CC cxx cc++ cl.exe FCC KCC RCC xlC_r xlC
-  do
-    # Extract the first word of "$ac_tool_prefix$ac_prog", so it can be a program name with args.
-set dummy $ac_tool_prefix$ac_prog; ac_word=$2
-{ $as_echo "$as_me:$LINENO: checking for $ac_word" >&5
-$as_echo_n "checking for $ac_word... " >&6; }
-if test "${ac_cv_prog_CXX+set}" = set; then
-  $as_echo_n "(cached) " >&6
-else
-  if test -n "$CXX"; then
-  ac_cv_prog_CXX="$CXX" # Let the user override the test.
-else
-as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH
-do
-  IFS=$as_save_IFS
-  test -z "$as_dir" && as_dir=.
-  for ac_exec_ext in '' $ac_executable_extensions; do
-  if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
-    ac_cv_prog_CXX="$ac_tool_prefix$ac_prog"
-    $as_echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5
-    break 2
-  fi
-done
-done
-IFS=$as_save_IFS
-
-fi
-fi
-CXX=$ac_cv_prog_CXX
-if test -n "$CXX"; then
-  { $as_echo "$as_me:$LINENO: result: $CXX" >&5
-$as_echo "$CXX" >&6; }
-else
-  { $as_echo "$as_me:$LINENO: result: no" >&5
-$as_echo "no" >&6; }
-fi
+if test "$ac_init_help" = "recursive"; then
+  # If there are subdirs, report their specific --help.
+  for ac_dir in : $ac_subdirs_all; do test "x$ac_dir" = x: && continue
+    test -d "$ac_dir" ||
+      { cd "$srcdir" && ac_pwd=`pwd` && srcdir=. && test -d "$ac_dir"; } ||
+      continue
+    ac_builddir=.
 
+case "$ac_dir" in
+.) ac_dir_suffix= ac_top_builddir_sub=. ac_top_build_prefix= ;;
+*)
+  ac_dir_suffix=/`$as_echo "$ac_dir" | sed 's|^\.[\\/]||'`
+  # A ".." for each directory in $ac_dir_suffix.
+  ac_top_builddir_sub=`$as_echo "$ac_dir_suffix" | sed 's|/[^\\/]*|/..|g;s|/||'`
+  case $ac_top_builddir_sub in
+  "") ac_top_builddir_sub=. ac_top_build_prefix= ;;
+  *)  ac_top_build_prefix=$ac_top_builddir_sub/ ;;
+  esac ;;
+esac
+ac_abs_top_builddir=$ac_pwd
+ac_abs_builddir=$ac_pwd$ac_dir_suffix
+# for backward compatibility:
+ac_top_builddir=$ac_top_build_prefix
 
-    test -n "$CXX" && break
-  done
-fi
-if test -z "$CXX"; then
-  ac_ct_CXX=$CXX
-  for ac_prog in g++ c++ gpp aCC CC cxx cc++ cl.exe FCC KCC RCC xlC_r xlC
-do
-  # Extract the first word of "$ac_prog", so it can be a program name with args.
-set dummy $ac_prog; ac_word=$2
-{ $as_echo "$as_me:$LINENO: checking for $ac_word" >&5
-$as_echo_n "checking for $ac_word... " >&6; }
-if test "${ac_cv_prog_ac_ct_CXX+set}" = set; then
-  $as_echo_n "(cached) " >&6
-else
-  if test -n "$ac_ct_CXX"; then
-  ac_cv_prog_ac_ct_CXX="$ac_ct_CXX" # Let the user override the test.
-else
-as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH
-do
-  IFS=$as_save_IFS
-  test -z "$as_dir" && as_dir=.
-  for ac_exec_ext in '' $ac_executable_extensions; do
-  if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
-    ac_cv_prog_ac_ct_CXX="$ac_prog"
-    $as_echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5
-    break 2
-  fi
-done
-done
-IFS=$as_save_IFS
+case $srcdir in
+  .)  # We are building in place.
+    ac_srcdir=.
+    ac_top_srcdir=$ac_top_builddir_sub
+    ac_abs_top_srcdir=$ac_pwd ;;
+  [\\/]* | ?:[\\/]* )  # Absolute name.
+    ac_srcdir=$srcdir$ac_dir_suffix;
+    ac_top_srcdir=$srcdir
+    ac_abs_top_srcdir=$srcdir ;;
+  *) # Relative name.
+    ac_srcdir=$ac_top_build_prefix$srcdir$ac_dir_suffix
+    ac_top_srcdir=$ac_top_build_prefix$srcdir
+    ac_abs_top_srcdir=$ac_pwd/$srcdir ;;
+esac
+ac_abs_srcdir=$ac_abs_top_srcdir$ac_dir_suffix
 
+    cd "$ac_dir" || { ac_status=$?; continue; }
+    # Check for guested configure.
+    if test -f "$ac_srcdir/configure.gnu"; then
+      echo &&
+      $SHELL "$ac_srcdir/configure.gnu" --help=recursive
+    elif test -f "$ac_srcdir/configure"; then
+      echo &&
+      $SHELL "$ac_srcdir/configure" --help=recursive
+    else
+      $as_echo "$as_me: WARNING: no configuration information is in $ac_dir" >&2
+    fi || ac_status=$?
+    cd "$ac_pwd" || { ac_status=$?; break; }
+  done
 fi
-fi
-ac_ct_CXX=$ac_cv_prog_ac_ct_CXX
-if test -n "$ac_ct_CXX"; then
-  { $as_echo "$as_me:$LINENO: result: $ac_ct_CXX" >&5
-$as_echo "$ac_ct_CXX" >&6; }
-else
-  { $as_echo "$as_me:$LINENO: result: no" >&5
-$as_echo "no" >&6; }
-fi
-
 
-  test -n "$ac_ct_CXX" && break
-done
+test -n "$ac_init_help" && exit $ac_status
+if $ac_init_version; then
+  cat <<\_ACEOF
+jellyfish configure 1.1.11
+generated by GNU Autoconf 2.68
 
-  if test "x$ac_ct_CXX" = x; then
-    CXX="g++"
-  else
-    case $cross_compiling:$ac_tool_warned in
-yes:)
-{ $as_echo "$as_me:$LINENO: WARNING: using cross tools not prefixed with host triplet" >&5
-$as_echo "$as_me: WARNING: using cross tools not prefixed with host triplet" >&2;}
-ac_tool_warned=yes ;;
-esac
-    CXX=$ac_ct_CXX
-  fi
+Copyright (C) 2010 Free Software Foundation, Inc.
+This configure script is free software; the Free Software Foundation
+gives unlimited permission to copy, distribute and modify it.
+_ACEOF
+  exit
 fi
 
-  fi
-fi
-# Provide some information about the compiler.
-$as_echo "$as_me:$LINENO: checking for C++ compiler version" >&5
-set X $ac_compile
-ac_compiler=$2
-{ (ac_try="$ac_compiler --version >&5"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_compiler --version >&5") 2>&5
-  ac_status=$?
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); }
-{ (ac_try="$ac_compiler -v >&5"
+## ------------------------ ##
+## Autoconf initialization. ##
+## ------------------------ ##
+
+# ac_fn_c_try_compile LINENO
+# --------------------------
+# Try to compile conftest.$ac_ext, and return whether this succeeded.
+ac_fn_c_try_compile ()
+{
+  as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
+  rm -f conftest.$ac_objext
+  if { { ac_try="$ac_compile"
 case "(($ac_try" in
   *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
   *) ac_try_echo=$ac_try;;
 esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_compiler -v >&5") 2>&5
+eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
+$as_echo "$ac_try_echo"; } >&5
+  (eval "$ac_compile") 2>conftest.err
   ac_status=$?
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); }
-{ (ac_try="$ac_compiler -V >&5"
+  if test -s conftest.err; then
+    grep -v '^ *+' conftest.err >conftest.er1
+    cat conftest.er1 >&5
+    mv -f conftest.er1 conftest.err
+  fi
+  $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+  test $ac_status = 0; } && {
+	 test -z "$ac_c_werror_flag" ||
+	 test ! -s conftest.err
+       } && test -s conftest.$ac_objext; then :
+  ac_retval=0
+else
+  $as_echo "$as_me: failed program was:" >&5
+sed 's/^/| /' conftest.$ac_ext >&5
+
+	ac_retval=1
+fi
+  eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
+  as_fn_set_status $ac_retval
+
+} # ac_fn_c_try_compile
+
+# ac_fn_c_try_link LINENO
+# -----------------------
+# Try to link conftest.$ac_ext, and return whether this succeeded.
+ac_fn_c_try_link ()
+{
+  as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
+  rm -f conftest.$ac_objext conftest$ac_exeext
+  if { { ac_try="$ac_link"
 case "(($ac_try" in
   *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
   *) ac_try_echo=$ac_try;;
 esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_compiler -V >&5") 2>&5
+eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
+$as_echo "$ac_try_echo"; } >&5
+  (eval "$ac_link") 2>conftest.err
   ac_status=$?
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); }
+  if test -s conftest.err; then
+    grep -v '^ *+' conftest.err >conftest.er1
+    cat conftest.er1 >&5
+    mv -f conftest.er1 conftest.err
+  fi
+  $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+  test $ac_status = 0; } && {
+	 test -z "$ac_c_werror_flag" ||
+	 test ! -s conftest.err
+       } && test -s conftest$ac_exeext && {
+	 test "$cross_compiling" = yes ||
+	 $as_test_x conftest$ac_exeext
+       }; then :
+  ac_retval=0
+else
+  $as_echo "$as_me: failed program was:" >&5
+sed 's/^/| /' conftest.$ac_ext >&5
 
-cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
-/* end confdefs.h.  */
+	ac_retval=1
+fi
+  # Delete the IPA/IPO (Inter Procedural Analysis/Optimization) information
+  # created by the PGI compiler (conftest_ipa8_conftest.oo), as it would
+  # interfere with the next link command; also delete a directory that is
+  # left behind by Apple's compiler.  We do this before executing the actions.
+  rm -rf conftest.dSYM conftest_ipa8_conftest.oo
+  eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
+  as_fn_set_status $ac_retval
 
-int
-main ()
-{
+} # ac_fn_c_try_link
 
-  ;
-  return 0;
-}
+# ac_fn_c_check_header_compile LINENO HEADER VAR INCLUDES
+# -------------------------------------------------------
+# Tests whether HEADER exists and can be compiled using the include files in
+# INCLUDES, setting the cache variable VAR accordingly.
+ac_fn_c_check_header_compile ()
+{
+  as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
+  { $as_echo "$as_me:${as_lineno-$LINENO}: checking for $2" >&5
+$as_echo_n "checking for $2... " >&6; }
+if eval \${$3+:} false; then :
+  $as_echo_n "(cached) " >&6
+else
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+$4
+#include <$2>
 _ACEOF
-ac_clean_files_save=$ac_clean_files
-ac_clean_files="$ac_clean_files a.out a.out.dSYM a.exe b.out"
-# Try to create an executable without -o first, disregard a.out.
-# It will help us diagnose broken compilers, and finding out an intuition
-# of exeext.
-{ $as_echo "$as_me:$LINENO: checking for C++ compiler default output file name" >&5
-$as_echo_n "checking for C++ compiler default output file name... " >&6; }
-ac_link_default=`$as_echo "$ac_link" | sed 's/ -o *conftest[^ ]*//'`
-
-# The possible output files:
-ac_files="a.out conftest.exe conftest a.exe a_out.exe b.out conftest.*"
+if ac_fn_c_try_compile "$LINENO"; then :
+  eval "$3=yes"
+else
+  eval "$3=no"
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
+fi
+eval ac_res=\$$3
+	       { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_res" >&5
+$as_echo "$ac_res" >&6; }
+  eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
 
-ac_rmfiles=
-for ac_file in $ac_files
-do
-  case $ac_file in
-    *.$ac_ext | *.xcoff | *.tds | *.d | *.pdb | *.xSYM | *.bb | *.bbg | *.map | *.inf | *.dSYM | *.o | *.obj ) ;;
-    * ) ac_rmfiles="$ac_rmfiles $ac_file";;
-  esac
-done
-rm -f $ac_rmfiles
+} # ac_fn_c_check_header_compile
 
-if { (ac_try="$ac_link_default"
+# ac_fn_c_try_cpp LINENO
+# ----------------------
+# Try to preprocess conftest.$ac_ext, and return whether this succeeded.
+ac_fn_c_try_cpp ()
+{
+  as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
+  if { { ac_try="$ac_cpp conftest.$ac_ext"
 case "(($ac_try" in
   *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
   *) ac_try_echo=$ac_try;;
 esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_link_default") 2>&5
+eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
+$as_echo "$ac_try_echo"; } >&5
+  (eval "$ac_cpp conftest.$ac_ext") 2>conftest.err
   ac_status=$?
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); }; then
-  # Autoconf-2.13 could set the ac_cv_exeext variable to `no'.
-# So ignore a value of `no', otherwise this would lead to `EXEEXT = no'
-# in a Makefile.  We should not override ac_cv_exeext if it was cached,
-# so that the user can short-circuit this test for compilers unknown to
-# Autoconf.
-for ac_file in $ac_files ''
-do
-  test -f "$ac_file" || continue
-  case $ac_file in
-    *.$ac_ext | *.xcoff | *.tds | *.d | *.pdb | *.xSYM | *.bb | *.bbg | *.map | *.inf | *.dSYM | *.o | *.obj )
-	;;
-    [ab].out )
-	# We found the default executable, but exeext='' is most
-	# certainly right.
-	break;;
-    *.* )
-        if test "${ac_cv_exeext+set}" = set && test "$ac_cv_exeext" != no;
-	then :; else
-	   ac_cv_exeext=`expr "$ac_file" : '[^.]*\(\..*\)'`
-	fi
-	# We set ac_cv_exeext here because the later test for it is not
-	# safe: cross compilers may not add the suffix if given an `-o'
-	# argument, so we may need to know it at that point already.
-	# Even if this section looks crufty: it has the advantage of
-	# actually working.
-	break;;
-    * )
-	break;;
-  esac
-done
-test "$ac_cv_exeext" = no && ac_cv_exeext=
-
+  if test -s conftest.err; then
+    grep -v '^ *+' conftest.err >conftest.er1
+    cat conftest.er1 >&5
+    mv -f conftest.er1 conftest.err
+  fi
+  $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+  test $ac_status = 0; } > conftest.i && {
+	 test -z "$ac_c_preproc_warn_flag$ac_c_werror_flag" ||
+	 test ! -s conftest.err
+       }; then :
+  ac_retval=0
 else
-  ac_file=''
-fi
-
-{ $as_echo "$as_me:$LINENO: result: $ac_file" >&5
-$as_echo "$ac_file" >&6; }
-if test -z "$ac_file"; then
   $as_echo "$as_me: failed program was:" >&5
 sed 's/^/| /' conftest.$ac_ext >&5
 
-{ { $as_echo "$as_me:$LINENO: error: in \`$ac_pwd':" >&5
-$as_echo "$as_me: error: in \`$ac_pwd':" >&2;}
-{ { $as_echo "$as_me:$LINENO: error: C++ compiler cannot create executables
-See \`config.log' for more details." >&5
-$as_echo "$as_me: error: C++ compiler cannot create executables
-See \`config.log' for more details." >&2;}
-   { (exit 77); exit 77; }; }; }
+    ac_retval=1
 fi
+  eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
+  as_fn_set_status $ac_retval
 
-ac_exeext=$ac_cv_exeext
+} # ac_fn_c_try_cpp
 
-# Check that the compiler produces executables we can run.  If not, either
-# the compiler is broken, or we cross compile.
-{ $as_echo "$as_me:$LINENO: checking whether the C++ compiler works" >&5
-$as_echo_n "checking whether the C++ compiler works... " >&6; }
-# FIXME: These cross compiler hacks should be removed for Autoconf 3.0
-# If not cross compiling, check that we can run a simple program.
-if test "$cross_compiling" != yes; then
-  if { ac_try='./$ac_file'
-  { (case "(($ac_try" in
+# ac_fn_c_try_run LINENO
+# ----------------------
+# Try to link conftest.$ac_ext, and return whether this succeeded. Assumes
+# that executables *can* be run.
+ac_fn_c_try_run ()
+{
+  as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
+  if { { ac_try="$ac_link"
+case "(($ac_try" in
   *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
   *) ac_try_echo=$ac_try;;
 esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_try") 2>&5
+eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
+$as_echo "$ac_try_echo"; } >&5
+  (eval "$ac_link") 2>&5
   ac_status=$?
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); }; }; then
-    cross_compiling=no
-  else
-    if test "$cross_compiling" = maybe; then
-	cross_compiling=yes
-    else
-	{ { $as_echo "$as_me:$LINENO: error: in \`$ac_pwd':" >&5
-$as_echo "$as_me: error: in \`$ac_pwd':" >&2;}
-{ { $as_echo "$as_me:$LINENO: error: cannot run C++ compiled programs.
-If you meant to cross compile, use \`--host'.
-See \`config.log' for more details." >&5
-$as_echo "$as_me: error: cannot run C++ compiled programs.
-If you meant to cross compile, use \`--host'.
-See \`config.log' for more details." >&2;}
-   { (exit 1); exit 1; }; }; }
-    fi
-  fi
-fi
-{ $as_echo "$as_me:$LINENO: result: yes" >&5
-$as_echo "yes" >&6; }
-
-rm -f -r a.out a.out.dSYM a.exe conftest$ac_cv_exeext b.out
-ac_clean_files=$ac_clean_files_save
-# Check that the compiler produces executables we can run.  If not, either
-# the compiler is broken, or we cross compile.
-{ $as_echo "$as_me:$LINENO: checking whether we are cross compiling" >&5
-$as_echo_n "checking whether we are cross compiling... " >&6; }
-{ $as_echo "$as_me:$LINENO: result: $cross_compiling" >&5
-$as_echo "$cross_compiling" >&6; }
-
-{ $as_echo "$as_me:$LINENO: checking for suffix of executables" >&5
-$as_echo_n "checking for suffix of executables... " >&6; }
-if { (ac_try="$ac_link"
-case "(($ac_try" in
+  $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+  test $ac_status = 0; } && { ac_try='./conftest$ac_exeext'
+  { { case "(($ac_try" in
   *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
   *) ac_try_echo=$ac_try;;
 esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_link") 2>&5
+eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
+$as_echo "$ac_try_echo"; } >&5
+  (eval "$ac_try") 2>&5
   ac_status=$?
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); }; then
-  # If both `conftest.exe' and `conftest' are `present' (well, observable)
-# catch `conftest.exe'.  For instance with Cygwin, `ls conftest' will
-# work properly (i.e., refer to `conftest.exe'), while it won't with
-# `rm'.
-for ac_file in conftest.exe conftest conftest.*; do
-  test -f "$ac_file" || continue
-  case $ac_file in
-    *.$ac_ext | *.xcoff | *.tds | *.d | *.pdb | *.xSYM | *.bb | *.bbg | *.map | *.inf | *.dSYM | *.o | *.obj ) ;;
-    *.* ) ac_cv_exeext=`expr "$ac_file" : '[^.]*\(\..*\)'`
-	  break;;
-    * ) break;;
-  esac
-done
+  $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+  test $ac_status = 0; }; }; then :
+  ac_retval=0
 else
-  { { $as_echo "$as_me:$LINENO: error: in \`$ac_pwd':" >&5
-$as_echo "$as_me: error: in \`$ac_pwd':" >&2;}
-{ { $as_echo "$as_me:$LINENO: error: cannot compute suffix of executables: cannot compile and link
-See \`config.log' for more details." >&5
-$as_echo "$as_me: error: cannot compute suffix of executables: cannot compile and link
-See \`config.log' for more details." >&2;}
-   { (exit 1); exit 1; }; }; }
+  $as_echo "$as_me: program exited with status $ac_status" >&5
+       $as_echo "$as_me: failed program was:" >&5
+sed 's/^/| /' conftest.$ac_ext >&5
+
+       ac_retval=$ac_status
 fi
+  rm -rf conftest.dSYM conftest_ipa8_conftest.oo
+  eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
+  as_fn_set_status $ac_retval
 
-rm -f conftest$ac_cv_exeext
-{ $as_echo "$as_me:$LINENO: result: $ac_cv_exeext" >&5
-$as_echo "$ac_cv_exeext" >&6; }
+} # ac_fn_c_try_run
 
-rm -f conftest.$ac_ext
-EXEEXT=$ac_cv_exeext
-ac_exeext=$EXEEXT
-{ $as_echo "$as_me:$LINENO: checking for suffix of object files" >&5
-$as_echo_n "checking for suffix of object files... " >&6; }
-if test "${ac_cv_objext+set}" = set; then
+# ac_fn_c_check_func LINENO FUNC VAR
+# ----------------------------------
+# Tests whether FUNC exists, setting the cache variable VAR accordingly
+ac_fn_c_check_func ()
+{
+  as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
+  { $as_echo "$as_me:${as_lineno-$LINENO}: checking for $2" >&5
+$as_echo_n "checking for $2... " >&6; }
+if eval \${$3+:} false; then :
   $as_echo_n "(cached) " >&6
 else
-  cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
-/* end confdefs.h.  */
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+/* Define $2 to an innocuous variant, in case <limits.h> declares $2.
+   For example, HP-UX 11i <limits.h> declares gettimeofday.  */
+#define $2 innocuous_$2
+
+/* System header to define __stub macros and hopefully few prototypes,
+    which can conflict with char $2 (); below.
+    Prefer <limits.h> to <assert.h> if __STDC__ is defined, since
+    <limits.h> exists even on freestanding compilers.  */
+
+#ifdef __STDC__
+# include <limits.h>
+#else
+# include <assert.h>
+#endif
+
+#undef $2
+
+/* Override any GCC internal prototype to avoid an error.
+   Use char because int might match the return type of a GCC
+   builtin and then its argument prototype would still apply.  */
+#ifdef __cplusplus
+extern "C"
+#endif
+char $2 ();
+/* The GNU C library defines this for functions which it implements
+    to always fail with ENOSYS.  Some functions are actually named
+    something starting with __ and the normal name is an alias.  */
+#if defined __stub_$2 || defined __stub___$2
+choke me
+#endif
+
+int
+main ()
+{
+return $2 ();
+  ;
+  return 0;
+}
+_ACEOF
+if ac_fn_c_try_link "$LINENO"; then :
+  eval "$3=yes"
+else
+  eval "$3=no"
+fi
+rm -f core conftest.err conftest.$ac_objext \
+    conftest$ac_exeext conftest.$ac_ext
+fi
+eval ac_res=\$$3
+	       { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_res" >&5
+$as_echo "$ac_res" >&6; }
+  eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
+
+} # ac_fn_c_check_func
+
+# ac_fn_cxx_try_compile LINENO
+# ----------------------------
+# Try to compile conftest.$ac_ext, and return whether this succeeded.
+ac_fn_cxx_try_compile ()
+{
+  as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
+  rm -f conftest.$ac_objext
+  if { { ac_try="$ac_compile"
+case "(($ac_try" in
+  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
+  *) ac_try_echo=$ac_try;;
+esac
+eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
+$as_echo "$ac_try_echo"; } >&5
+  (eval "$ac_compile") 2>conftest.err
+  ac_status=$?
+  if test -s conftest.err; then
+    grep -v '^ *+' conftest.err >conftest.er1
+    cat conftest.er1 >&5
+    mv -f conftest.er1 conftest.err
+  fi
+  $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+  test $ac_status = 0; } && {
+	 test -z "$ac_cxx_werror_flag" ||
+	 test ! -s conftest.err
+       } && test -s conftest.$ac_objext; then :
+  ac_retval=0
+else
+  $as_echo "$as_me: failed program was:" >&5
+sed 's/^/| /' conftest.$ac_ext >&5
 
-int
-main ()
-{
+	ac_retval=1
+fi
+  eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
+  as_fn_set_status $ac_retval
 
-  ;
-  return 0;
-}
-_ACEOF
-rm -f conftest.o conftest.obj
-if { (ac_try="$ac_compile"
+} # ac_fn_cxx_try_compile
+
+# ac_fn_cxx_try_cpp LINENO
+# ------------------------
+# Try to preprocess conftest.$ac_ext, and return whether this succeeded.
+ac_fn_cxx_try_cpp ()
+{
+  as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
+  if { { ac_try="$ac_cpp conftest.$ac_ext"
 case "(($ac_try" in
   *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
   *) ac_try_echo=$ac_try;;
 esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_compile") 2>&5
+eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
+$as_echo "$ac_try_echo"; } >&5
+  (eval "$ac_cpp conftest.$ac_ext") 2>conftest.err
   ac_status=$?
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); }; then
-  for ac_file in conftest.o conftest.obj conftest.*; do
-  test -f "$ac_file" || continue;
-  case $ac_file in
-    *.$ac_ext | *.xcoff | *.tds | *.d | *.pdb | *.xSYM | *.bb | *.bbg | *.map | *.inf | *.dSYM ) ;;
-    *) ac_cv_objext=`expr "$ac_file" : '.*\.\(.*\)'`
-       break;;
-  esac
-done
+  if test -s conftest.err; then
+    grep -v '^ *+' conftest.err >conftest.er1
+    cat conftest.er1 >&5
+    mv -f conftest.er1 conftest.err
+  fi
+  $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+  test $ac_status = 0; } > conftest.i && {
+	 test -z "$ac_cxx_preproc_warn_flag$ac_cxx_werror_flag" ||
+	 test ! -s conftest.err
+       }; then :
+  ac_retval=0
 else
   $as_echo "$as_me: failed program was:" >&5
 sed 's/^/| /' conftest.$ac_ext >&5
 
-{ { $as_echo "$as_me:$LINENO: error: in \`$ac_pwd':" >&5
-$as_echo "$as_me: error: in \`$ac_pwd':" >&2;}
-{ { $as_echo "$as_me:$LINENO: error: cannot compute suffix of object files: cannot compile
-See \`config.log' for more details." >&5
-$as_echo "$as_me: error: cannot compute suffix of object files: cannot compile
-See \`config.log' for more details." >&2;}
-   { (exit 1); exit 1; }; }; }
+    ac_retval=1
 fi
+  eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
+  as_fn_set_status $ac_retval
 
-rm -f conftest.$ac_cv_objext conftest.$ac_ext
-fi
-{ $as_echo "$as_me:$LINENO: result: $ac_cv_objext" >&5
-$as_echo "$ac_cv_objext" >&6; }
-OBJEXT=$ac_cv_objext
-ac_objext=$OBJEXT
-{ $as_echo "$as_me:$LINENO: checking whether we are using the GNU C++ compiler" >&5
-$as_echo_n "checking whether we are using the GNU C++ compiler... " >&6; }
-if test "${ac_cv_cxx_compiler_gnu+set}" = set; then
-  $as_echo_n "(cached) " >&6
-else
-  cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
-/* end confdefs.h.  */
+} # ac_fn_cxx_try_cpp
 
-int
-main ()
+# ac_fn_cxx_try_link LINENO
+# -------------------------
+# Try to link conftest.$ac_ext, and return whether this succeeded.
+ac_fn_cxx_try_link ()
 {
-#ifndef __GNUC__
-       choke me
-#endif
-
-  ;
-  return 0;
-}
-_ACEOF
-rm -f conftest.$ac_objext
-if { (ac_try="$ac_compile"
+  as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
+  rm -f conftest.$ac_objext conftest$ac_exeext
+  if { { ac_try="$ac_link"
 case "(($ac_try" in
   *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
   *) ac_try_echo=$ac_try;;
 esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_compile") 2>conftest.er1
+eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
+$as_echo "$ac_try_echo"; } >&5
+  (eval "$ac_link") 2>conftest.err
   ac_status=$?
-  grep -v '^ *+' conftest.er1 >conftest.err
-  rm -f conftest.er1
-  cat conftest.err >&5
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } && {
+  if test -s conftest.err; then
+    grep -v '^ *+' conftest.err >conftest.er1
+    cat conftest.er1 >&5
+    mv -f conftest.er1 conftest.err
+  fi
+  $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+  test $ac_status = 0; } && {
 	 test -z "$ac_cxx_werror_flag" ||
 	 test ! -s conftest.err
-       } && test -s conftest.$ac_objext; then
-  ac_compiler_gnu=yes
+       } && test -s conftest$ac_exeext && {
+	 test "$cross_compiling" = yes ||
+	 $as_test_x conftest$ac_exeext
+       }; then :
+  ac_retval=0
 else
   $as_echo "$as_me: failed program was:" >&5
 sed 's/^/| /' conftest.$ac_ext >&5
 
-	ac_compiler_gnu=no
+	ac_retval=1
 fi
+  # Delete the IPA/IPO (Inter Procedural Analysis/Optimization) information
+  # created by the PGI compiler (conftest_ipa8_conftest.oo), as it would
+  # interfere with the next link command; also delete a directory that is
+  # left behind by Apple's compiler.  We do this before executing the actions.
+  rm -rf conftest.dSYM conftest_ipa8_conftest.oo
+  eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
+  as_fn_set_status $ac_retval
 
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
-ac_cv_cxx_compiler_gnu=$ac_compiler_gnu
+} # ac_fn_cxx_try_link
 
-fi
-{ $as_echo "$as_me:$LINENO: result: $ac_cv_cxx_compiler_gnu" >&5
-$as_echo "$ac_cv_cxx_compiler_gnu" >&6; }
-if test $ac_compiler_gnu = yes; then
-  GXX=yes
-else
-  GXX=
-fi
-ac_test_CXXFLAGS=${CXXFLAGS+set}
-ac_save_CXXFLAGS=$CXXFLAGS
-{ $as_echo "$as_me:$LINENO: checking whether $CXX accepts -g" >&5
-$as_echo_n "checking whether $CXX accepts -g... " >&6; }
-if test "${ac_cv_prog_cxx_g+set}" = set; then
+# ac_fn_cxx_check_type LINENO TYPE VAR INCLUDES
+# ---------------------------------------------
+# Tests whether TYPE exists after having included INCLUDES, setting cache
+# variable VAR accordingly.
+ac_fn_cxx_check_type ()
+{
+  as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
+  { $as_echo "$as_me:${as_lineno-$LINENO}: checking for $2" >&5
+$as_echo_n "checking for $2... " >&6; }
+if eval \${$3+:} false; then :
   $as_echo_n "(cached) " >&6
 else
-  ac_save_cxx_werror_flag=$ac_cxx_werror_flag
-   ac_cxx_werror_flag=yes
-   ac_cv_prog_cxx_g=no
-   CXXFLAGS="-g"
-   cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
+  eval "$3=no"
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+$4
+int
+main ()
+{
+if (sizeof ($2))
+	 return 0;
+  ;
+  return 0;
+}
 _ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
+if ac_fn_cxx_try_compile "$LINENO"; then :
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
 /* end confdefs.h.  */
-
+$4
 int
 main ()
 {
-
+if (sizeof (($2)))
+	    return 0;
   ;
   return 0;
 }
 _ACEOF
-rm -f conftest.$ac_objext
-if { (ac_try="$ac_compile"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_compile") 2>conftest.er1
-  ac_status=$?
-  grep -v '^ *+' conftest.er1 >conftest.err
-  rm -f conftest.er1
-  cat conftest.err >&5
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } && {
-	 test -z "$ac_cxx_werror_flag" ||
-	 test ! -s conftest.err
-       } && test -s conftest.$ac_objext; then
-  ac_cv_prog_cxx_g=yes
+if ac_fn_cxx_try_compile "$LINENO"; then :
+
 else
-  $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
+  eval "$3=yes"
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
+fi
+eval ac_res=\$$3
+	       { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_res" >&5
+$as_echo "$ac_res" >&6; }
+  eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
 
-	CXXFLAGS=""
-      cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
-/* end confdefs.h.  */
+} # ac_fn_cxx_check_type
 
+# ac_fn_cxx_check_decl LINENO SYMBOL VAR INCLUDES
+# -----------------------------------------------
+# Tests whether SYMBOL is declared in INCLUDES, setting cache variable VAR
+# accordingly.
+ac_fn_cxx_check_decl ()
+{
+  as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
+  as_decl_name=`echo $2|sed 's/ *(.*//'`
+  as_decl_use=`echo $2|sed -e 's/(/((/' -e 's/)/) 0&/' -e 's/,/) 0& (/g'`
+  { $as_echo "$as_me:${as_lineno-$LINENO}: checking whether $as_decl_name is declared" >&5
+$as_echo_n "checking whether $as_decl_name is declared... " >&6; }
+if eval \${$3+:} false; then :
+  $as_echo_n "(cached) " >&6
+else
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+$4
 int
 main ()
 {
+#ifndef $as_decl_name
+#ifdef __cplusplus
+  (void) $as_decl_use;
+#else
+  (void) $as_decl_name;
+#endif
+#endif
 
   ;
   return 0;
 }
 _ACEOF
-rm -f conftest.$ac_objext
-if { (ac_try="$ac_compile"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_compile") 2>conftest.er1
-  ac_status=$?
-  grep -v '^ *+' conftest.er1 >conftest.err
-  rm -f conftest.er1
-  cat conftest.err >&5
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } && {
-	 test -z "$ac_cxx_werror_flag" ||
-	 test ! -s conftest.err
-       } && test -s conftest.$ac_objext; then
-  :
+if ac_fn_cxx_try_compile "$LINENO"; then :
+  eval "$3=yes"
 else
-  $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
+  eval "$3=no"
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
+fi
+eval ac_res=\$$3
+	       { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_res" >&5
+$as_echo "$ac_res" >&6; }
+  eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
 
-	ac_cxx_werror_flag=$ac_save_cxx_werror_flag
-	 CXXFLAGS="-g"
-	 cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
+} # ac_fn_cxx_check_decl
+
+# ac_fn_cxx_check_func LINENO FUNC VAR
+# ------------------------------------
+# Tests whether FUNC exists, setting the cache variable VAR accordingly
+ac_fn_cxx_check_func ()
+{
+  as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
+  { $as_echo "$as_me:${as_lineno-$LINENO}: checking for $2" >&5
+$as_echo_n "checking for $2... " >&6; }
+if eval \${$3+:} false; then :
+  $as_echo_n "(cached) " >&6
+else
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
 /* end confdefs.h.  */
+/* Define $2 to an innocuous variant, in case <limits.h> declares $2.
+   For example, HP-UX 11i <limits.h> declares gettimeofday.  */
+#define $2 innocuous_$2
+
+/* System header to define __stub macros and hopefully few prototypes,
+    which can conflict with char $2 (); below.
+    Prefer <limits.h> to <assert.h> if __STDC__ is defined, since
+    <limits.h> exists even on freestanding compilers.  */
+
+#ifdef __STDC__
+# include <limits.h>
+#else
+# include <assert.h>
+#endif
+
+#undef $2
+
+/* Override any GCC internal prototype to avoid an error.
+   Use char because int might match the return type of a GCC
+   builtin and then its argument prototype would still apply.  */
+#ifdef __cplusplus
+extern "C"
+#endif
+char $2 ();
+/* The GNU C library defines this for functions which it implements
+    to always fail with ENOSYS.  Some functions are actually named
+    something starting with __ and the normal name is an alias.  */
+#if defined __stub_$2 || defined __stub___$2
+choke me
+#endif
 
 int
 main ()
 {
-
+return $2 ();
   ;
   return 0;
 }
 _ACEOF
-rm -f conftest.$ac_objext
-if { (ac_try="$ac_compile"
+if ac_fn_cxx_try_link "$LINENO"; then :
+  eval "$3=yes"
+else
+  eval "$3=no"
+fi
+rm -f core conftest.err conftest.$ac_objext \
+    conftest$ac_exeext conftest.$ac_ext
+fi
+eval ac_res=\$$3
+	       { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_res" >&5
+$as_echo "$ac_res" >&6; }
+  eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
+
+} # ac_fn_cxx_check_func
+
+# ac_fn_cxx_try_run LINENO
+# ------------------------
+# Try to link conftest.$ac_ext, and return whether this succeeded. Assumes
+# that executables *can* be run.
+ac_fn_cxx_try_run ()
+{
+  as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
+  if { { ac_try="$ac_link"
 case "(($ac_try" in
   *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
   *) ac_try_echo=$ac_try;;
 esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_compile") 2>conftest.er1
+eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
+$as_echo "$ac_try_echo"; } >&5
+  (eval "$ac_link") 2>&5
   ac_status=$?
-  grep -v '^ *+' conftest.er1 >conftest.err
-  rm -f conftest.er1
-  cat conftest.err >&5
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } && {
-	 test -z "$ac_cxx_werror_flag" ||
-	 test ! -s conftest.err
-       } && test -s conftest.$ac_objext; then
-  ac_cv_prog_cxx_g=yes
+  $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+  test $ac_status = 0; } && { ac_try='./conftest$ac_exeext'
+  { { case "(($ac_try" in
+  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
+  *) ac_try_echo=$ac_try;;
+esac
+eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
+$as_echo "$ac_try_echo"; } >&5
+  (eval "$ac_try") 2>&5
+  ac_status=$?
+  $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+  test $ac_status = 0; }; }; then :
+  ac_retval=0
 else
-  $as_echo "$as_me: failed program was:" >&5
+  $as_echo "$as_me: program exited with status $ac_status" >&5
+       $as_echo "$as_me: failed program was:" >&5
 sed 's/^/| /' conftest.$ac_ext >&5
 
-
+       ac_retval=$ac_status
 fi
+  rm -rf conftest.dSYM conftest_ipa8_conftest.oo
+  eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
+  as_fn_set_status $ac_retval
 
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
-fi
+} # ac_fn_cxx_try_run
 
+# ac_fn_cxx_check_header_mongrel LINENO HEADER VAR INCLUDES
+# ---------------------------------------------------------
+# Tests whether HEADER exists, giving a warning if it cannot be compiled using
+# the include files in INCLUDES and setting the cache variable VAR
+# accordingly.
+ac_fn_cxx_check_header_mongrel ()
+{
+  as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
+  if eval \${$3+:} false; then :
+  { $as_echo "$as_me:${as_lineno-$LINENO}: checking for $2" >&5
+$as_echo_n "checking for $2... " >&6; }
+if eval \${$3+:} false; then :
+  $as_echo_n "(cached) " >&6
+fi
+eval ac_res=\$$3
+	       { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_res" >&5
+$as_echo "$ac_res" >&6; }
+else
+  # Is the header compilable?
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking $2 usability" >&5
+$as_echo_n "checking $2 usability... " >&6; }
+cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+$4
+#include <$2>
+_ACEOF
+if ac_fn_cxx_try_compile "$LINENO"; then :
+  ac_header_compiler=yes
+else
+  ac_header_compiler=no
+fi
 rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_header_compiler" >&5
+$as_echo "$ac_header_compiler" >&6; }
+
+# Is the header present?
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking $2 presence" >&5
+$as_echo_n "checking $2 presence... " >&6; }
+cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+#include <$2>
+_ACEOF
+if ac_fn_cxx_try_cpp "$LINENO"; then :
+  ac_header_preproc=yes
+else
+  ac_header_preproc=no
 fi
+rm -f conftest.err conftest.i conftest.$ac_ext
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_header_preproc" >&5
+$as_echo "$ac_header_preproc" >&6; }
 
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
-   ac_cxx_werror_flag=$ac_save_cxx_werror_flag
+# So?  What about this header?
+case $ac_header_compiler:$ac_header_preproc:$ac_cxx_preproc_warn_flag in #((
+  yes:no: )
+    { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: $2: accepted by the compiler, rejected by the preprocessor!" >&5
+$as_echo "$as_me: WARNING: $2: accepted by the compiler, rejected by the preprocessor!" >&2;}
+    { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: $2: proceeding with the compiler's result" >&5
+$as_echo "$as_me: WARNING: $2: proceeding with the compiler's result" >&2;}
+    ;;
+  no:yes:* )
+    { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: $2: present but cannot be compiled" >&5
+$as_echo "$as_me: WARNING: $2: present but cannot be compiled" >&2;}
+    { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: $2:     check for missing prerequisite headers?" >&5
+$as_echo "$as_me: WARNING: $2:     check for missing prerequisite headers?" >&2;}
+    { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: $2: see the Autoconf documentation" >&5
+$as_echo "$as_me: WARNING: $2: see the Autoconf documentation" >&2;}
+    { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: $2:     section \"Present But Cannot Be Compiled\"" >&5
+$as_echo "$as_me: WARNING: $2:     section \"Present But Cannot Be Compiled\"" >&2;}
+    { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: $2: proceeding with the compiler's result" >&5
+$as_echo "$as_me: WARNING: $2: proceeding with the compiler's result" >&2;}
+( $as_echo "## ------------------------------- ##
+## Report this to gmarcais at umd.edu ##
+## ------------------------------- ##"
+     ) | sed "s/^/$as_me: WARNING:     /" >&2
+    ;;
+esac
+  { $as_echo "$as_me:${as_lineno-$LINENO}: checking for $2" >&5
+$as_echo_n "checking for $2... " >&6; }
+if eval \${$3+:} false; then :
+  $as_echo_n "(cached) " >&6
+else
+  eval "$3=\$ac_header_compiler"
 fi
-{ $as_echo "$as_me:$LINENO: result: $ac_cv_prog_cxx_g" >&5
-$as_echo "$ac_cv_prog_cxx_g" >&6; }
-if test "$ac_test_CXXFLAGS" = set; then
-  CXXFLAGS=$ac_save_CXXFLAGS
-elif test $ac_cv_prog_cxx_g = yes; then
-  if test "$GXX" = yes; then
-    CXXFLAGS="-g -O2"
-  else
-    CXXFLAGS="-g"
-  fi
+eval ac_res=\$$3
+	       { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_res" >&5
+$as_echo "$ac_res" >&6; }
+fi
+  eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
+
+} # ac_fn_cxx_check_header_mongrel
+
+# ac_fn_cxx_check_member LINENO AGGR MEMBER VAR INCLUDES
+# ------------------------------------------------------
+# Tries to find if the field MEMBER exists in type AGGR, after including
+# INCLUDES, setting cache variable VAR accordingly.
+ac_fn_cxx_check_member ()
+{
+  as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
+  { $as_echo "$as_me:${as_lineno-$LINENO}: checking for $2.$3" >&5
+$as_echo_n "checking for $2.$3... " >&6; }
+if eval \${$4+:} false; then :
+  $as_echo_n "(cached) " >&6
 else
-  if test "$GXX" = yes; then
-    CXXFLAGS="-O2"
-  else
-    CXXFLAGS=
-  fi
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+$5
+int
+main ()
+{
+static $2 ac_aggr;
+if (ac_aggr.$3)
+return 0;
+  ;
+  return 0;
+}
+_ACEOF
+if ac_fn_cxx_try_compile "$LINENO"; then :
+  eval "$4=yes"
+else
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+$5
+int
+main ()
+{
+static $2 ac_aggr;
+if (sizeof ac_aggr.$3)
+return 0;
+  ;
+  return 0;
+}
+_ACEOF
+if ac_fn_cxx_try_compile "$LINENO"; then :
+  eval "$4=yes"
+else
+  eval "$4=no"
 fi
-ac_ext=c
-ac_cpp='$CPP $CPPFLAGS'
-ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
-ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
-ac_compiler_gnu=$ac_cv_c_compiler_gnu
-DEPDIR="${am__leading_dot}deps"
+rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
+fi
+eval ac_res=\$$4
+	       { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_res" >&5
+$as_echo "$ac_res" >&6; }
+  eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
 
-ac_config_commands="$ac_config_commands depfiles"
+} # ac_fn_cxx_check_member
+cat >config.log <<_ACEOF
+This file contains any messages produced by compilers while
+running configure, to aid debugging if configure makes a mistake.
 
+It was created by jellyfish $as_me 1.1.11, which was
+generated by GNU Autoconf 2.68.  Invocation command line was
 
-am_make=${MAKE-make}
-cat > confinc << 'END'
-am__doit:
-	@echo this is the am__doit target
-.PHONY: am__doit
-END
-# If we don't find an include directive, just comment out the code.
-{ $as_echo "$as_me:$LINENO: checking for style of include used by $am_make" >&5
-$as_echo_n "checking for style of include used by $am_make... " >&6; }
-am__include="#"
-am__quote=
-_am_result=none
-# First try GNU make style include.
-echo "include confinc" > confmf
-# Ignore all kinds of additional output from `make'.
-case `$am_make -s -f confmf 2> /dev/null` in #(
-*the\ am__doit\ target*)
-  am__include=include
-  am__quote=
-  _am_result=GNU
-  ;;
-esac
-# Now try BSD make style include.
-if test "$am__include" = "#"; then
-   echo '.include "confinc"' > confmf
-   case `$am_make -s -f confmf 2> /dev/null` in #(
-   *the\ am__doit\ target*)
-     am__include=.include
-     am__quote="\""
-     _am_result=BSD
-     ;;
-   esac
-fi
+  $ $0 $@
 
+_ACEOF
+exec 5>>config.log
+{
+cat <<_ASUNAME
+## --------- ##
+## Platform. ##
+## --------- ##
 
-{ $as_echo "$as_me:$LINENO: result: $_am_result" >&5
-$as_echo "$_am_result" >&6; }
-rm -f confinc confmf
+hostname = `(hostname || uname -n) 2>/dev/null | sed 1q`
+uname -m = `(uname -m) 2>/dev/null || echo unknown`
+uname -r = `(uname -r) 2>/dev/null || echo unknown`
+uname -s = `(uname -s) 2>/dev/null || echo unknown`
+uname -v = `(uname -v) 2>/dev/null || echo unknown`
 
-# Check whether --enable-dependency-tracking was given.
-if test "${enable_dependency_tracking+set}" = set; then
-  enableval=$enable_dependency_tracking;
-fi
+/usr/bin/uname -p = `(/usr/bin/uname -p) 2>/dev/null || echo unknown`
+/bin/uname -X     = `(/bin/uname -X) 2>/dev/null     || echo unknown`
 
-if test "x$enable_dependency_tracking" != xno; then
-  am_depcomp="$ac_aux_dir/depcomp"
-  AMDEPBACKSLASH='\'
-fi
- if test "x$enable_dependency_tracking" != xno; then
-  AMDEP_TRUE=
-  AMDEP_FALSE='#'
-else
-  AMDEP_TRUE='#'
-  AMDEP_FALSE=
-fi
+/bin/arch              = `(/bin/arch) 2>/dev/null              || echo unknown`
+/usr/bin/arch -k       = `(/usr/bin/arch -k) 2>/dev/null       || echo unknown`
+/usr/convex/getsysinfo = `(/usr/convex/getsysinfo) 2>/dev/null || echo unknown`
+/usr/bin/hostinfo      = `(/usr/bin/hostinfo) 2>/dev/null      || echo unknown`
+/bin/machine           = `(/bin/machine) 2>/dev/null           || echo unknown`
+/usr/bin/oslevel       = `(/usr/bin/oslevel) 2>/dev/null       || echo unknown`
+/bin/universe          = `(/bin/universe) 2>/dev/null          || echo unknown`
 
+_ASUNAME
 
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+  IFS=$as_save_IFS
+  test -z "$as_dir" && as_dir=.
+    $as_echo "PATH: $as_dir"
+  done
+IFS=$as_save_IFS
 
-depcc="$CXX"  am_compiler_list=
+} >&5
 
-{ $as_echo "$as_me:$LINENO: checking dependency style of $depcc" >&5
-$as_echo_n "checking dependency style of $depcc... " >&6; }
-if test "${am_cv_CXX_dependencies_compiler_type+set}" = set; then
-  $as_echo_n "(cached) " >&6
-else
-  if test -z "$AMDEP_TRUE" && test -f "$am_depcomp"; then
-  # We make a subdir and do the tests there.  Otherwise we can end up
-  # making bogus files that we don't know about and never remove.  For
-  # instance it was reported that on HP-UX the gcc test will end up
-  # making a dummy file named `D' -- because `-MD' means `put the output
-  # in D'.
-  mkdir conftest.dir
-  # Copy depcomp to subdir because otherwise we won't find it if we're
-  # using a relative directory.
-  cp "$am_depcomp" conftest.dir
-  cd conftest.dir
-  # We will build objects and dependencies in a subdirectory because
-  # it helps to detect inapplicable dependency modes.  For instance
-  # both Tru64's cc and ICC support -MD to output dependencies as a
-  # side effect of compilation, but ICC will put the dependencies in
-  # the current directory while Tru64 will put them in the object
-  # directory.
-  mkdir sub
+cat >&5 <<_ACEOF
 
-  am_cv_CXX_dependencies_compiler_type=none
-  if test "$am_compiler_list" = ""; then
-     am_compiler_list=`sed -n 's/^#*\([a-zA-Z0-9]*\))$/\1/p' < ./depcomp`
-  fi
-  am__universal=false
-  case " $depcc " in #(
-     *\ -arch\ *\ -arch\ *) am__universal=true ;;
-     esac
 
-  for depmode in $am_compiler_list; do
-    # Setup a source with many dependencies, because some compilers
-    # like to wrap large dependency lists on column 80 (with \), and
-    # we should not choose a depcomp mode which is confused by this.
-    #
-    # We need to recreate these files for each test, as the compiler may
-    # overwrite some of them when testing with obscure command lines.
-    # This happens at least with the AIX C compiler.
-    : > sub/conftest.c
-    for i in 1 2 3 4 5 6; do
-      echo '#include "conftst'$i'.h"' >> sub/conftest.c
-      # Using `: > sub/conftst$i.h' creates only sub/conftst1.h with
-      # Solaris 8's {/usr,}/bin/sh.
-      touch sub/conftst$i.h
-    done
-    echo "${am__include} ${am__quote}sub/conftest.Po${am__quote}" > confmf
+## ----------- ##
+## Core tests. ##
+## ----------- ##
 
-    # We check with `-c' and `-o' for the sake of the "dashmstdout"
-    # mode.  It turns out that the SunPro C++ compiler does not properly
-    # handle `-M -o', and we need to detect this.  Also, some Intel
-    # versions had trouble with output in subdirs
-    am__obj=sub/conftest.${OBJEXT-o}
-    am__minus_obj="-o $am__obj"
-    case $depmode in
-    gcc)
-      # This depmode causes a compiler race in universal mode.
-      test "$am__universal" = false || continue
-      ;;
-    nosideeffect)
-      # after this tag, mechanisms are not by side-effect, so they'll
-      # only be used when explicitly requested
-      if test "x$enable_dependency_tracking" = xyes; then
-	continue
+_ACEOF
+
+
+# Keep a trace of the command line.
+# Strip out --no-create and --no-recursion so they do not pile up.
+# Strip out --silent because we don't want to record it for future runs.
+# Also quote any args containing shell meta-characters.
+# Make two passes to allow for proper duplicate-argument suppression.
+ac_configure_args=
+ac_configure_args0=
+ac_configure_args1=
+ac_must_keep_next=false
+for ac_pass in 1 2
+do
+  for ac_arg
+  do
+    case $ac_arg in
+    -no-create | --no-c* | -n | -no-recursion | --no-r*) continue ;;
+    -q | -quiet | --quiet | --quie | --qui | --qu | --q \
+    | -silent | --silent | --silen | --sile | --sil)
+      continue ;;
+    *\'*)
+      ac_arg=`$as_echo "$ac_arg" | sed "s/'/'\\\\\\\\''/g"` ;;
+    esac
+    case $ac_pass in
+    1) as_fn_append ac_configure_args0 " '$ac_arg'" ;;
+    2)
+      as_fn_append ac_configure_args1 " '$ac_arg'"
+      if test $ac_must_keep_next = true; then
+	ac_must_keep_next=false # Got value, back to normal.
       else
-	break
+	case $ac_arg in
+	  *=* | --config-cache | -C | -disable-* | --disable-* \
+	  | -enable-* | --enable-* | -gas | --g* | -nfp | --nf* \
+	  | -q | -quiet | --q* | -silent | --sil* | -v | -verb* \
+	  | -with-* | --with-* | -without-* | --without-* | --x)
+	    case "$ac_configure_args0 " in
+	      "$ac_configure_args1"*" '$ac_arg' "* ) continue ;;
+	    esac
+	    ;;
+	  -* ) ac_must_keep_next=true ;;
+	esac
       fi
+      as_fn_append ac_configure_args " '$ac_arg'"
       ;;
-    msvisualcpp | msvcmsys)
-      # This compiler won't grok `-c -o', but also, the minuso test has
-      # not run yet.  These depmodes are late enough in the game, and
-      # so weak that their functioning should not be impacted.
-      am__obj=conftest.${OBJEXT-o}
-      am__minus_obj=
-      ;;
-    none) break ;;
     esac
-    if depmode=$depmode \
-       source=sub/conftest.c object=$am__obj \
-       depfile=sub/conftest.Po tmpdepfile=sub/conftest.TPo \
-       $SHELL ./depcomp $depcc -c $am__minus_obj sub/conftest.c \
-         >/dev/null 2>conftest.err &&
-       grep sub/conftst1.h sub/conftest.Po > /dev/null 2>&1 &&
-       grep sub/conftst6.h sub/conftest.Po > /dev/null 2>&1 &&
-       grep $am__obj sub/conftest.Po > /dev/null 2>&1 &&
-       ${MAKE-make} -s -f confmf > /dev/null 2>&1; then
-      # icc doesn't choke on unknown options, it will just issue warnings
-      # or remarks (even with -Werror).  So we grep stderr for any message
-      # that says an option was ignored or not supported.
-      # When given -MP, icc 7.0 and 7.1 complain thusly:
-      #   icc: Command line warning: ignoring option '-M'; no argument required
-      # The diagnosis changed in icc 8.0:
-      #   icc: Command line remark: option '-MP' not supported
-      if (grep 'ignoring option' conftest.err ||
-          grep 'not supported' conftest.err) >/dev/null 2>&1; then :; else
-        am_cv_CXX_dependencies_compiler_type=$depmode
-        break
-      fi
-    fi
   done
+done
+{ ac_configure_args0=; unset ac_configure_args0;}
+{ ac_configure_args1=; unset ac_configure_args1;}
+
+# When interrupted or exit'd, cleanup temporary files, and complete
+# config.log.  We remove comments because anyway the quotes in there
+# would cause problems or look ugly.
+# WARNING: Use '\'' to represent an apostrophe within the trap.
+# WARNING: Do not start the trap code with a newline, due to a FreeBSD 4.0 bug.
+trap 'exit_status=$?
+  # Save into config.log some information that might help in debugging.
+  {
+    echo
+
+    $as_echo "## ---------------- ##
+## Cache variables. ##
+## ---------------- ##"
+    echo
+    # The following way of writing the cache mishandles newlines in values,
+(
+  for ac_var in `(set) 2>&1 | sed -n '\''s/^\([a-zA-Z_][a-zA-Z0-9_]*\)=.*/\1/p'\''`; do
+    eval ac_val=\$$ac_var
+    case $ac_val in #(
+    *${as_nl}*)
+      case $ac_var in #(
+      *_cv_*) { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: cache variable $ac_var contains a newline" >&5
+$as_echo "$as_me: WARNING: cache variable $ac_var contains a newline" >&2;} ;;
+      esac
+      case $ac_var in #(
+      _ | IFS | as_nl) ;; #(
+      BASH_ARGV | BASH_SOURCE) eval $ac_var= ;; #(
+      *) { eval $ac_var=; unset $ac_var;} ;;
+      esac ;;
+    esac
+  done
+  (set) 2>&1 |
+    case $as_nl`(ac_space='\'' '\''; set) 2>&1` in #(
+    *${as_nl}ac_space=\ *)
+      sed -n \
+	"s/'\''/'\''\\\\'\'''\''/g;
+	  s/^\\([_$as_cr_alnum]*_cv_[_$as_cr_alnum]*\\)=\\(.*\\)/\\1='\''\\2'\''/p"
+      ;; #(
+    *)
+      sed -n "/^[_$as_cr_alnum]*_cv_[_$as_cr_alnum]*=/p"
+      ;;
+    esac |
+    sort
+)
+    echo
 
-  cd ..
-  rm -rf conftest.dir
-else
-  am_cv_CXX_dependencies_compiler_type=none
-fi
+    $as_echo "## ----------------- ##
+## Output variables. ##
+## ----------------- ##"
+    echo
+    for ac_var in $ac_subst_vars
+    do
+      eval ac_val=\$$ac_var
+      case $ac_val in
+      *\'\''*) ac_val=`$as_echo "$ac_val" | sed "s/'\''/'\''\\\\\\\\'\'''\''/g"`;;
+      esac
+      $as_echo "$ac_var='\''$ac_val'\''"
+    done | sort
+    echo
 
-fi
-{ $as_echo "$as_me:$LINENO: result: $am_cv_CXX_dependencies_compiler_type" >&5
-$as_echo "$am_cv_CXX_dependencies_compiler_type" >&6; }
-CXXDEPMODE=depmode=$am_cv_CXX_dependencies_compiler_type
+    if test -n "$ac_subst_files"; then
+      $as_echo "## ------------------- ##
+## File substitutions. ##
+## ------------------- ##"
+      echo
+      for ac_var in $ac_subst_files
+      do
+	eval ac_val=\$$ac_var
+	case $ac_val in
+	*\'\''*) ac_val=`$as_echo "$ac_val" | sed "s/'\''/'\''\\\\\\\\'\'''\''/g"`;;
+	esac
+	$as_echo "$ac_var='\''$ac_val'\''"
+      done | sort
+      echo
+    fi
 
- if
-  test "x$enable_dependency_tracking" != xno \
-  && test "$am_cv_CXX_dependencies_compiler_type" = gcc3; then
-  am__fastdepCXX_TRUE=
-  am__fastdepCXX_FALSE='#'
-else
-  am__fastdepCXX_TRUE='#'
-  am__fastdepCXX_FALSE=
-fi
+    if test -s confdefs.h; then
+      $as_echo "## ----------- ##
+## confdefs.h. ##
+## ----------- ##"
+      echo
+      cat confdefs.h
+      echo
+    fi
+    test "$ac_signal" != 0 &&
+      $as_echo "$as_me: caught signal $ac_signal"
+    $as_echo "$as_me: exit $exit_status"
+  } >&5
+  rm -f core *.core core.conftest.* &&
+    rm -f -r conftest* confdefs* conf$$* $ac_clean_files &&
+    exit $exit_status
+' 0
+for ac_signal in 1 2 13 15; do
+  trap 'ac_signal='$ac_signal'; as_fn_exit 1' $ac_signal
+done
+ac_signal=0
 
+# confdefs.h avoids OS command line length limits that DEFS can exceed.
+rm -f -r conftest* confdefs.h
 
+$as_echo "/* confdefs.h */" > confdefs.h
 
+# Predefined preprocessor variables.
 
-ac_config_headers="$ac_config_headers config.h"
+cat >>confdefs.h <<_ACEOF
+#define PACKAGE_NAME "$PACKAGE_NAME"
+_ACEOF
 
+cat >>confdefs.h <<_ACEOF
+#define PACKAGE_TARNAME "$PACKAGE_TARNAME"
+_ACEOF
 
+cat >>confdefs.h <<_ACEOF
+#define PACKAGE_VERSION "$PACKAGE_VERSION"
+_ACEOF
 
-ac_config_files="$ac_config_files Makefile tests/compat.sh jellyfish-1.1.pc"
+cat >>confdefs.h <<_ACEOF
+#define PACKAGE_STRING "$PACKAGE_STRING"
+_ACEOF
 
+cat >>confdefs.h <<_ACEOF
+#define PACKAGE_BUGREPORT "$PACKAGE_BUGREPORT"
+_ACEOF
 
+cat >>confdefs.h <<_ACEOF
+#define PACKAGE_URL "$PACKAGE_URL"
+_ACEOF
 
-if test "x$MD5" = "x"; then
-  # Extract the first word of "md5sum", so it can be a program name with args.
-set dummy md5sum; ac_word=$2
-{ $as_echo "$as_me:$LINENO: checking for $ac_word" >&5
-$as_echo_n "checking for $ac_word... " >&6; }
-if test "${ac_cv_prog_MD5+set}" = set; then
-  $as_echo_n "(cached) " >&6
-else
-  if test -n "$MD5"; then
-  ac_cv_prog_MD5="$MD5" # Let the user override the test.
+
+# Let the site file select an alternate cache file if it wants to.
+# Prefer an explicitly selected file to automatically selected ones.
+ac_site_file1=NONE
+ac_site_file2=NONE
+if test -n "$CONFIG_SITE"; then
+  # We do not want a PATH search for config.site.
+  case $CONFIG_SITE in #((
+    -*)  ac_site_file1=./$CONFIG_SITE;;
+    */*) ac_site_file1=$CONFIG_SITE;;
+    *)   ac_site_file1=./$CONFIG_SITE;;
+  esac
+elif test "x$prefix" != xNONE; then
+  ac_site_file1=$prefix/share/config.site
+  ac_site_file2=$prefix/etc/config.site
 else
-as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH
+  ac_site_file1=$ac_default_prefix/share/config.site
+  ac_site_file2=$ac_default_prefix/etc/config.site
+fi
+for ac_site_file in "$ac_site_file1" "$ac_site_file2"
 do
-  IFS=$as_save_IFS
-  test -z "$as_dir" && as_dir=.
-  for ac_exec_ext in '' $ac_executable_extensions; do
-  if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
-    ac_cv_prog_MD5="md5sum"
-    $as_echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5
-    break 2
+  test "x$ac_site_file" = xNONE && continue
+  if test /dev/null != "$ac_site_file" && test -r "$ac_site_file"; then
+    { $as_echo "$as_me:${as_lineno-$LINENO}: loading site script $ac_site_file" >&5
+$as_echo "$as_me: loading site script $ac_site_file" >&6;}
+    sed 's/^/| /' "$ac_site_file" >&5
+    . "$ac_site_file" \
+      || { { $as_echo "$as_me:${as_lineno-$LINENO}: error: in \`$ac_pwd':" >&5
+$as_echo "$as_me: error: in \`$ac_pwd':" >&2;}
+as_fn_error $? "failed to load site script $ac_site_file
+See \`config.log' for more details" "$LINENO" 5; }
   fi
 done
-done
-IFS=$as_save_IFS
 
-fi
-fi
-MD5=$ac_cv_prog_MD5
-if test -n "$MD5"; then
-  { $as_echo "$as_me:$LINENO: result: $MD5" >&5
-$as_echo "$MD5" >&6; }
+if test -r "$cache_file"; then
+  # Some versions of bash will fail to source /dev/null (special files
+  # actually), so we avoid doing that.  DJGPP emulates it as a regular file.
+  if test /dev/null != "$cache_file" && test -f "$cache_file"; then
+    { $as_echo "$as_me:${as_lineno-$LINENO}: loading cache $cache_file" >&5
+$as_echo "$as_me: loading cache $cache_file" >&6;}
+    case $cache_file in
+      [\\/]* | ?:[\\/]* ) . "$cache_file";;
+      *)                      . "./$cache_file";;
+    esac
+  fi
 else
-  { $as_echo "$as_me:$LINENO: result: no" >&5
-$as_echo "no" >&6; }
-fi
-
-
+  { $as_echo "$as_me:${as_lineno-$LINENO}: creating cache $cache_file" >&5
+$as_echo "$as_me: creating cache $cache_file" >&6;}
+  >$cache_file
 fi
 
-if test "x$MD5" = "x"; then
-  # Extract the first word of "md5", so it can be a program name with args.
-set dummy md5; ac_word=$2
-{ $as_echo "$as_me:$LINENO: checking for $ac_word" >&5
-$as_echo_n "checking for $ac_word... " >&6; }
-if test "${ac_cv_prog_MD5+set}" = set; then
-  $as_echo_n "(cached) " >&6
-else
-  if test -n "$MD5"; then
-  ac_cv_prog_MD5="$MD5" # Let the user override the test.
-else
-as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH
-do
-  IFS=$as_save_IFS
-  test -z "$as_dir" && as_dir=.
-  for ac_exec_ext in '' $ac_executable_extensions; do
-  if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
-    ac_cv_prog_MD5="md5 -r"
-    $as_echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5
-    break 2
+# Check that the precious variables saved in the cache have kept the same
+# value.
+ac_cache_corrupted=false
+for ac_var in $ac_precious_vars; do
+  eval ac_old_set=\$ac_cv_env_${ac_var}_set
+  eval ac_new_set=\$ac_env_${ac_var}_set
+  eval ac_old_val=\$ac_cv_env_${ac_var}_value
+  eval ac_new_val=\$ac_env_${ac_var}_value
+  case $ac_old_set,$ac_new_set in
+    set,)
+      { $as_echo "$as_me:${as_lineno-$LINENO}: error: \`$ac_var' was set to \`$ac_old_val' in the previous run" >&5
+$as_echo "$as_me: error: \`$ac_var' was set to \`$ac_old_val' in the previous run" >&2;}
+      ac_cache_corrupted=: ;;
+    ,set)
+      { $as_echo "$as_me:${as_lineno-$LINENO}: error: \`$ac_var' was not set in the previous run" >&5
+$as_echo "$as_me: error: \`$ac_var' was not set in the previous run" >&2;}
+      ac_cache_corrupted=: ;;
+    ,);;
+    *)
+      if test "x$ac_old_val" != "x$ac_new_val"; then
+	# differences in whitespace do not lead to failure.
+	ac_old_val_w=`echo x $ac_old_val`
+	ac_new_val_w=`echo x $ac_new_val`
+	if test "$ac_old_val_w" != "$ac_new_val_w"; then
+	  { $as_echo "$as_me:${as_lineno-$LINENO}: error: \`$ac_var' has changed since the previous run:" >&5
+$as_echo "$as_me: error: \`$ac_var' has changed since the previous run:" >&2;}
+	  ac_cache_corrupted=:
+	else
+	  { $as_echo "$as_me:${as_lineno-$LINENO}: warning: ignoring whitespace changes in \`$ac_var' since the previous run:" >&5
+$as_echo "$as_me: warning: ignoring whitespace changes in \`$ac_var' since the previous run:" >&2;}
+	  eval $ac_var=\$ac_old_val
+	fi
+	{ $as_echo "$as_me:${as_lineno-$LINENO}:   former value:  \`$ac_old_val'" >&5
+$as_echo "$as_me:   former value:  \`$ac_old_val'" >&2;}
+	{ $as_echo "$as_me:${as_lineno-$LINENO}:   current value: \`$ac_new_val'" >&5
+$as_echo "$as_me:   current value: \`$ac_new_val'" >&2;}
+      fi;;
+  esac
+  # Pass precious variables to config.status.
+  if test "$ac_new_set" = set; then
+    case $ac_new_val in
+    *\'*) ac_arg=$ac_var=`$as_echo "$ac_new_val" | sed "s/'/'\\\\\\\\''/g"` ;;
+    *) ac_arg=$ac_var=$ac_new_val ;;
+    esac
+    case " $ac_configure_args " in
+      *" '$ac_arg' "*) ;; # Avoid dups.  Use of quotes ensures accuracy.
+      *) as_fn_append ac_configure_args " '$ac_arg'" ;;
+    esac
   fi
 done
-done
-IFS=$as_save_IFS
-
-fi
-fi
-MD5=$ac_cv_prog_MD5
-if test -n "$MD5"; then
-  { $as_echo "$as_me:$LINENO: result: $MD5" >&5
-$as_echo "$MD5" >&6; }
-else
-  { $as_echo "$as_me:$LINENO: result: no" >&5
-$as_echo "no" >&6; }
+if $ac_cache_corrupted; then
+  { $as_echo "$as_me:${as_lineno-$LINENO}: error: in \`$ac_pwd':" >&5
+$as_echo "$as_me: error: in \`$ac_pwd':" >&2;}
+  { $as_echo "$as_me:${as_lineno-$LINENO}: error: changes in the environment can compromise the build" >&5
+$as_echo "$as_me: error: changes in the environment can compromise the build" >&2;}
+  as_fn_error $? "run \`make distclean' and/or \`rm $cache_file' and start over" "$LINENO" 5
 fi
+## -------------------- ##
+## Main body of script. ##
+## -------------------- ##
 
+ac_ext=c
+ac_cpp='$CPP $CPPFLAGS'
+ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
+ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
+ac_compiler_gnu=$ac_cv_c_compiler_gnu
 
-fi
 
-if test "x$MD5" = "x"; then
-  { { $as_echo "$as_me:$LINENO: error: Could not find md5 hashing program in your path" >&5
-$as_echo "$as_me: error: Could not find md5 hashing program in your path" >&2;}
-   { (exit 1); exit 1; }; }
+ac_aux_dir=
+for ac_dir in "$srcdir" "$srcdir/.." "$srcdir/../.."; do
+  if test -f "$ac_dir/install-sh"; then
+    ac_aux_dir=$ac_dir
+    ac_install_sh="$ac_aux_dir/install-sh -c"
+    break
+  elif test -f "$ac_dir/install.sh"; then
+    ac_aux_dir=$ac_dir
+    ac_install_sh="$ac_aux_dir/install.sh -c"
+    break
+  elif test -f "$ac_dir/shtool"; then
+    ac_aux_dir=$ac_dir
+    ac_install_sh="$ac_aux_dir/shtool install -c"
+    break
+  fi
+done
+if test -z "$ac_aux_dir"; then
+  as_fn_error $? "cannot find install-sh, install.sh, or shtool in \"$srcdir\" \"$srcdir/..\" \"$srcdir/../..\"" "$LINENO" 5
 fi
 
+# These three variables are undocumented and unsupported,
+# and are intended to be withdrawn in a future Autoconf release.
+# They can cause serious problems if a builder's source tree is in a directory
+# whose full name contains unusual characters.
+ac_config_guess="$SHELL $ac_aux_dir/config.guess"  # Please don't use this var.
+ac_config_sub="$SHELL $ac_aux_dir/config.sub"  # Please don't use this var.
+ac_configure="$SHELL $ac_aux_dir/configure"  # Please don't use this var.
 
 
-# Check whether --with-sse was given.
-if test "${with_sse+set}" = set; then
-  withval=$with_sse;
-else
-  with_sse=no
-fi
-
-if test "x$with_sse" != xno; then
+# Make sure we can run config.sub.
+$SHELL "$ac_aux_dir/config.sub" sun4 >/dev/null 2>&1 ||
+  as_fn_error $? "cannot run $SHELL $ac_aux_dir/config.sub" "$LINENO" 5
 
-cat >>confdefs.h <<\_ACEOF
-#define HAVE_SSE 1
-_ACEOF
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking build system type" >&5
+$as_echo_n "checking build system type... " >&6; }
+if ${ac_cv_build+:} false; then :
+  $as_echo_n "(cached) " >&6
+else
+  ac_build_alias=$build_alias
+test "x$ac_build_alias" = x &&
+  ac_build_alias=`$SHELL "$ac_aux_dir/config.guess"`
+test "x$ac_build_alias" = x &&
+  as_fn_error $? "cannot guess build type; you must specify one" "$LINENO" 5
+ac_cv_build=`$SHELL "$ac_aux_dir/config.sub" $ac_build_alias` ||
+  as_fn_error $? "$SHELL $ac_aux_dir/config.sub $ac_build_alias failed" "$LINENO" 5
 
 fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_build" >&5
+$as_echo "$ac_cv_build" >&6; }
+case $ac_cv_build in
+*-*-*) ;;
+*) as_fn_error $? "invalid value of canonical build" "$LINENO" 5;;
+esac
+build=$ac_cv_build
+ac_save_IFS=$IFS; IFS='-'
+set x $ac_cv_build
+shift
+build_cpu=$1
+build_vendor=$2
+shift; shift
+# Remember, the first character of IFS is used to create $*,
+# except with old shells:
+build_os=$*
+IFS=$ac_save_IFS
+case $build_os in *\ *) build_os=`echo "$build_os" | sed 's/ /-/g'`;; esac
 
 
-
-# Check whether --with-half was given.
-if test "${with_half+set}" = set; then
-  withval=$with_half;
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking host system type" >&5
+$as_echo_n "checking host system type... " >&6; }
+if ${ac_cv_host+:} false; then :
+  $as_echo_n "(cached) " >&6
 else
-  with_half=no
+  if test "x$host_alias" = x; then
+  ac_cv_host=$ac_cv_build
+else
+  ac_cv_host=`$SHELL "$ac_aux_dir/config.sub" $host_alias` ||
+    as_fn_error $? "$SHELL $ac_aux_dir/config.sub $host_alias failed" "$LINENO" 5
 fi
 
-if test "x$with_half" = "xyes"; then
+fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_host" >&5
+$as_echo "$ac_cv_host" >&6; }
+case $ac_cv_host in
+*-*-*) ;;
+*) as_fn_error $? "invalid value of canonical host" "$LINENO" 5;;
+esac
+host=$ac_cv_host
+ac_save_IFS=$IFS; IFS='-'
+set x $ac_cv_host
+shift
+host_cpu=$1
+host_vendor=$2
+shift; shift
+# Remember, the first character of IFS is used to create $*,
+# except with old shells:
+host_os=$*
+IFS=$ac_save_IFS
+case $host_os in *\ *) host_os=`echo "$host_os" | sed 's/ /-/g'`;; esac
 
-cat >>confdefs.h <<\_ACEOF
-#define HALF_FLOATS 1
-_ACEOF
 
-fi
 
+am__api_version='1.11'
 
-# Check the version of strerror_r
-ac_ext=c
-ac_cpp='$CPP $CPPFLAGS'
-ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
-ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
-ac_compiler_gnu=$ac_cv_c_compiler_gnu
-if test -n "$ac_tool_prefix"; then
-  # Extract the first word of "${ac_tool_prefix}gcc", so it can be a program name with args.
-set dummy ${ac_tool_prefix}gcc; ac_word=$2
-{ $as_echo "$as_me:$LINENO: checking for $ac_word" >&5
-$as_echo_n "checking for $ac_word... " >&6; }
-if test "${ac_cv_prog_CC+set}" = set; then
+# Find a good install program.  We prefer a C program (faster),
+# so one script is as good as another.  But avoid the broken or
+# incompatible versions:
+# SysV /etc/install, /usr/sbin/install
+# SunOS /usr/etc/install
+# IRIX /sbin/install
+# AIX /bin/install
+# AmigaOS /C/install, which installs bootblocks on floppy discs
+# AIX 4 /usr/bin/installbsd, which doesn't work without a -g flag
+# AFS /usr/afsws/bin/install, which mishandles nonexistent args
+# SVR4 /usr/ucb/install, which tries to use the nonexistent group "staff"
+# OS/2's system install, which has a completely different semantic
+# ./install, which can be erroneously created by make from ./install.sh.
+# Reject install programs that cannot install multiple files.
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for a BSD-compatible install" >&5
+$as_echo_n "checking for a BSD-compatible install... " >&6; }
+if test -z "$INSTALL"; then
+if ${ac_cv_path_install+:} false; then :
   $as_echo_n "(cached) " >&6
 else
-  if test -n "$CC"; then
-  ac_cv_prog_CC="$CC" # Let the user override the test.
-else
-as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+  as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
 for as_dir in $PATH
 do
   IFS=$as_save_IFS
   test -z "$as_dir" && as_dir=.
-  for ac_exec_ext in '' $ac_executable_extensions; do
-  if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
-    ac_cv_prog_CC="${ac_tool_prefix}gcc"
-    $as_echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5
-    break 2
-  fi
-done
-done
+    # Account for people who put trailing slashes in PATH elements.
+case $as_dir/ in #((
+  ./ | .// | /[cC]/* | \
+  /etc/* | /usr/sbin/* | /usr/etc/* | /sbin/* | /usr/afsws/bin/* | \
+  ?:[\\/]os2[\\/]install[\\/]* | ?:[\\/]OS2[\\/]INSTALL[\\/]* | \
+  /usr/ucb/* ) ;;
+  *)
+    # OSF1 and SCO ODT 3.0 have their own names for install.
+    # Don't use installbsd from OSF since it installs stuff as root
+    # by default.
+    for ac_prog in ginstall scoinst install; do
+      for ac_exec_ext in '' $ac_executable_extensions; do
+	if { test -f "$as_dir/$ac_prog$ac_exec_ext" && $as_test_x "$as_dir/$ac_prog$ac_exec_ext"; }; then
+	  if test $ac_prog = install &&
+	    grep dspmsg "$as_dir/$ac_prog$ac_exec_ext" >/dev/null 2>&1; then
+	    # AIX install.  It has an incompatible calling convention.
+	    :
+	  elif test $ac_prog = install &&
+	    grep pwplus "$as_dir/$ac_prog$ac_exec_ext" >/dev/null 2>&1; then
+	    # program-specific install script used by HP pwplus--don't use.
+	    :
+	  else
+	    rm -rf conftest.one conftest.two conftest.dir
+	    echo one > conftest.one
+	    echo two > conftest.two
+	    mkdir conftest.dir
+	    if "$as_dir/$ac_prog$ac_exec_ext" -c conftest.one conftest.two "`pwd`/conftest.dir" &&
+	      test -s conftest.one && test -s conftest.two &&
+	      test -s conftest.dir/conftest.one &&
+	      test -s conftest.dir/conftest.two
+	    then
+	      ac_cv_path_install="$as_dir/$ac_prog$ac_exec_ext -c"
+	      break 3
+	    fi
+	  fi
+	fi
+      done
+    done
+    ;;
+esac
+
+  done
 IFS=$as_save_IFS
 
+rm -rf conftest.one conftest.two conftest.dir
+
 fi
+  if test "${ac_cv_path_install+set}" = set; then
+    INSTALL=$ac_cv_path_install
+  else
+    # As a last resort, use the slow shell script.  Don't cache a
+    # value for INSTALL within a source directory, because that will
+    # break other packages using the cache if that directory is
+    # removed, or if the value is a relative name.
+    INSTALL=$ac_install_sh
+  fi
 fi
-CC=$ac_cv_prog_CC
-if test -n "$CC"; then
-  { $as_echo "$as_me:$LINENO: result: $CC" >&5
-$as_echo "$CC" >&6; }
-else
-  { $as_echo "$as_me:$LINENO: result: no" >&5
-$as_echo "no" >&6; }
-fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $INSTALL" >&5
+$as_echo "$INSTALL" >&6; }
 
+# Use test -z because SunOS4 sh mishandles braces in ${var-val}.
+# It thinks the first close brace ends the variable substitution.
+test -z "$INSTALL_PROGRAM" && INSTALL_PROGRAM='${INSTALL}'
 
-fi
-if test -z "$ac_cv_prog_CC"; then
-  ac_ct_CC=$CC
-  # Extract the first word of "gcc", so it can be a program name with args.
-set dummy gcc; ac_word=$2
-{ $as_echo "$as_me:$LINENO: checking for $ac_word" >&5
-$as_echo_n "checking for $ac_word... " >&6; }
-if test "${ac_cv_prog_ac_ct_CC+set}" = set; then
-  $as_echo_n "(cached) " >&6
-else
-  if test -n "$ac_ct_CC"; then
-  ac_cv_prog_ac_ct_CC="$ac_ct_CC" # Let the user override the test.
-else
-as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH
-do
-  IFS=$as_save_IFS
-  test -z "$as_dir" && as_dir=.
-  for ac_exec_ext in '' $ac_executable_extensions; do
-  if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
-    ac_cv_prog_ac_ct_CC="gcc"
-    $as_echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5
-    break 2
-  fi
-done
-done
-IFS=$as_save_IFS
+test -z "$INSTALL_SCRIPT" && INSTALL_SCRIPT='${INSTALL}'
+
+test -z "$INSTALL_DATA" && INSTALL_DATA='${INSTALL} -m 644'
+
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking whether build environment is sane" >&5
+$as_echo_n "checking whether build environment is sane... " >&6; }
+# Just in case
+sleep 1
+echo timestamp > conftest.file
+# Reject unsafe characters in $srcdir or the absolute working directory
+# name.  Accept space and tab only in the latter.
+am_lf='
+'
+case `pwd` in
+  *[\\\"\#\$\&\'\`$am_lf]*)
+    as_fn_error $? "unsafe absolute working directory name" "$LINENO" 5;;
+esac
+case $srcdir in
+  *[\\\"\#\$\&\'\`$am_lf\ \	]*)
+    as_fn_error $? "unsafe srcdir value: \`$srcdir'" "$LINENO" 5;;
+esac
+
+# Do `set' in a subshell so we don't clobber the current shell's
+# arguments.  Must try -L first in case configure is actually a
+# symlink; some systems play weird games with the mod time of symlinks
+# (eg FreeBSD returns the mod time of the symlink's containing
+# directory).
+if (
+   set X `ls -Lt "$srcdir/configure" conftest.file 2> /dev/null`
+   if test "$*" = "X"; then
+      # -L didn't work.
+      set X `ls -t "$srcdir/configure" conftest.file`
+   fi
+   rm -f conftest.file
+   if test "$*" != "X $srcdir/configure conftest.file" \
+      && test "$*" != "X conftest.file $srcdir/configure"; then
+
+      # If neither matched, then we have a broken ls.  This can happen
+      # if, for instance, CONFIG_SHELL is bash and it inherits a
+      # broken ls alias from the environment.  This has actually
+      # happened.  Such a system could not be considered "sane".
+      as_fn_error $? "ls -t appears to fail.  Make sure there is not a broken
+alias in your environment" "$LINENO" 5
+   fi
 
+   test "$2" = conftest.file
+   )
+then
+   # Ok.
+   :
+else
+   as_fn_error $? "newly created file is older than distributed files!
+Check your system clock" "$LINENO" 5
 fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: yes" >&5
+$as_echo "yes" >&6; }
+test "$program_prefix" != NONE &&
+  program_transform_name="s&^&$program_prefix&;$program_transform_name"
+# Use a double $ so make ignores it.
+test "$program_suffix" != NONE &&
+  program_transform_name="s&\$&$program_suffix&;$program_transform_name"
+# Double any \ or $.
+# By default was `s,x,x', remove it if useless.
+ac_script='s/[\\$]/&&/g;s/;s,x,x,$//'
+program_transform_name=`$as_echo "$program_transform_name" | sed "$ac_script"`
+
+# expand $ac_aux_dir to an absolute path
+am_aux_dir=`cd $ac_aux_dir && pwd`
+
+if test x"${MISSING+set}" != xset; then
+  case $am_aux_dir in
+  *\ * | *\	*)
+    MISSING="\${SHELL} \"$am_aux_dir/missing\"" ;;
+  *)
+    MISSING="\${SHELL} $am_aux_dir/missing" ;;
+  esac
 fi
-ac_ct_CC=$ac_cv_prog_ac_ct_CC
-if test -n "$ac_ct_CC"; then
-  { $as_echo "$as_me:$LINENO: result: $ac_ct_CC" >&5
-$as_echo "$ac_ct_CC" >&6; }
+# Use eval to expand $SHELL
+if eval "$MISSING --run true"; then
+  am_missing_run="$MISSING --run "
 else
-  { $as_echo "$as_me:$LINENO: result: no" >&5
-$as_echo "no" >&6; }
+  am_missing_run=
+  { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: \`missing' script is too old or missing" >&5
+$as_echo "$as_me: WARNING: \`missing' script is too old or missing" >&2;}
 fi
 
-  if test "x$ac_ct_CC" = x; then
-    CC=""
-  else
-    case $cross_compiling:$ac_tool_warned in
-yes:)
-{ $as_echo "$as_me:$LINENO: WARNING: using cross tools not prefixed with host triplet" >&5
-$as_echo "$as_me: WARNING: using cross tools not prefixed with host triplet" >&2;}
-ac_tool_warned=yes ;;
-esac
-    CC=$ac_ct_CC
-  fi
-else
-  CC="$ac_cv_prog_CC"
+if test x"${install_sh}" != xset; then
+  case $am_aux_dir in
+  *\ * | *\	*)
+    install_sh="\${SHELL} '$am_aux_dir/install-sh'" ;;
+  *)
+    install_sh="\${SHELL} $am_aux_dir/install-sh"
+  esac
 fi
 
-if test -z "$CC"; then
-          if test -n "$ac_tool_prefix"; then
-    # Extract the first word of "${ac_tool_prefix}cc", so it can be a program name with args.
-set dummy ${ac_tool_prefix}cc; ac_word=$2
-{ $as_echo "$as_me:$LINENO: checking for $ac_word" >&5
+# Installed binaries are usually stripped using `strip' when the user
+# run `make install-strip'.  However `strip' might not be the right
+# tool to use in cross-compilation environments, therefore Automake
+# will honor the `STRIP' environment variable to overrule this program.
+if test "$cross_compiling" != no; then
+  if test -n "$ac_tool_prefix"; then
+  # Extract the first word of "${ac_tool_prefix}strip", so it can be a program name with args.
+set dummy ${ac_tool_prefix}strip; ac_word=$2
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
 $as_echo_n "checking for $ac_word... " >&6; }
-if test "${ac_cv_prog_CC+set}" = set; then
+if ${ac_cv_prog_STRIP+:} false; then :
   $as_echo_n "(cached) " >&6
 else
-  if test -n "$CC"; then
-  ac_cv_prog_CC="$CC" # Let the user override the test.
+  if test -n "$STRIP"; then
+  ac_cv_prog_STRIP="$STRIP" # Let the user override the test.
 else
 as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
 for as_dir in $PATH
 do
   IFS=$as_save_IFS
   test -z "$as_dir" && as_dir=.
-  for ac_exec_ext in '' $ac_executable_extensions; do
+    for ac_exec_ext in '' $ac_executable_extensions; do
   if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
-    ac_cv_prog_CC="${ac_tool_prefix}cc"
-    $as_echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5
+    ac_cv_prog_STRIP="${ac_tool_prefix}strip"
+    $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
     break 2
   fi
 done
-done
+  done
 IFS=$as_save_IFS
 
 fi
 fi
-CC=$ac_cv_prog_CC
-if test -n "$CC"; then
-  { $as_echo "$as_me:$LINENO: result: $CC" >&5
-$as_echo "$CC" >&6; }
+STRIP=$ac_cv_prog_STRIP
+if test -n "$STRIP"; then
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $STRIP" >&5
+$as_echo "$STRIP" >&6; }
 else
-  { $as_echo "$as_me:$LINENO: result: no" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
 $as_echo "no" >&6; }
 fi
 
 
-  fi
 fi
-if test -z "$CC"; then
-  # Extract the first word of "cc", so it can be a program name with args.
-set dummy cc; ac_word=$2
-{ $as_echo "$as_me:$LINENO: checking for $ac_word" >&5
+if test -z "$ac_cv_prog_STRIP"; then
+  ac_ct_STRIP=$STRIP
+  # Extract the first word of "strip", so it can be a program name with args.
+set dummy strip; ac_word=$2
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
 $as_echo_n "checking for $ac_word... " >&6; }
-if test "${ac_cv_prog_CC+set}" = set; then
+if ${ac_cv_prog_ac_ct_STRIP+:} false; then :
   $as_echo_n "(cached) " >&6
 else
-  if test -n "$CC"; then
-  ac_cv_prog_CC="$CC" # Let the user override the test.
+  if test -n "$ac_ct_STRIP"; then
+  ac_cv_prog_ac_ct_STRIP="$ac_ct_STRIP" # Let the user override the test.
 else
-  ac_prog_rejected=no
 as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
 for as_dir in $PATH
 do
   IFS=$as_save_IFS
   test -z "$as_dir" && as_dir=.
-  for ac_exec_ext in '' $ac_executable_extensions; do
+    for ac_exec_ext in '' $ac_executable_extensions; do
   if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
-    if test "$as_dir/$ac_word$ac_exec_ext" = "/usr/ucb/cc"; then
-       ac_prog_rejected=yes
-       continue
-     fi
-    ac_cv_prog_CC="cc"
-    $as_echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5
+    ac_cv_prog_ac_ct_STRIP="strip"
+    $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
     break 2
   fi
 done
-done
+  done
 IFS=$as_save_IFS
 
-if test $ac_prog_rejected = yes; then
-  # We found a bogon in the path, so make sure we never use it.
-  set dummy $ac_cv_prog_CC
-  shift
-  if test $# != 0; then
-    # We chose a different compiler from the bogus one.
-    # However, it has the same basename, so the bogon will be chosen
-    # first if we set CC to just the basename; use the full file name.
-    shift
-    ac_cv_prog_CC="$as_dir/$ac_word${1+' '}$@"
-  fi
 fi
 fi
-fi
-CC=$ac_cv_prog_CC
-if test -n "$CC"; then
-  { $as_echo "$as_me:$LINENO: result: $CC" >&5
-$as_echo "$CC" >&6; }
+ac_ct_STRIP=$ac_cv_prog_ac_ct_STRIP
+if test -n "$ac_ct_STRIP"; then
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_ct_STRIP" >&5
+$as_echo "$ac_ct_STRIP" >&6; }
 else
-  { $as_echo "$as_me:$LINENO: result: no" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
 $as_echo "no" >&6; }
 fi
 
+  if test "x$ac_ct_STRIP" = x; then
+    STRIP=":"
+  else
+    case $cross_compiling:$ac_tool_warned in
+yes:)
+{ $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: using cross tools not prefixed with host triplet" >&5
+$as_echo "$as_me: WARNING: using cross tools not prefixed with host triplet" >&2;}
+ac_tool_warned=yes ;;
+esac
+    STRIP=$ac_ct_STRIP
+  fi
+else
+  STRIP="$ac_cv_prog_STRIP"
+fi
 
 fi
-if test -z "$CC"; then
-  if test -n "$ac_tool_prefix"; then
-  for ac_prog in cl.exe
-  do
-    # Extract the first word of "$ac_tool_prefix$ac_prog", so it can be a program name with args.
-set dummy $ac_tool_prefix$ac_prog; ac_word=$2
-{ $as_echo "$as_me:$LINENO: checking for $ac_word" >&5
-$as_echo_n "checking for $ac_word... " >&6; }
-if test "${ac_cv_prog_CC+set}" = set; then
+INSTALL_STRIP_PROGRAM="\$(install_sh) -c -s"
+
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for a thread-safe mkdir -p" >&5
+$as_echo_n "checking for a thread-safe mkdir -p... " >&6; }
+if test -z "$MKDIR_P"; then
+  if ${ac_cv_path_mkdir+:} false; then :
   $as_echo_n "(cached) " >&6
 else
-  if test -n "$CC"; then
-  ac_cv_prog_CC="$CC" # Let the user override the test.
-else
-as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH
+  as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH$PATH_SEPARATOR/opt/sfw/bin
 do
   IFS=$as_save_IFS
   test -z "$as_dir" && as_dir=.
-  for ac_exec_ext in '' $ac_executable_extensions; do
-  if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
-    ac_cv_prog_CC="$ac_tool_prefix$ac_prog"
-    $as_echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5
-    break 2
-  fi
-done
-done
+    for ac_prog in mkdir gmkdir; do
+	 for ac_exec_ext in '' $ac_executable_extensions; do
+	   { test -f "$as_dir/$ac_prog$ac_exec_ext" && $as_test_x "$as_dir/$ac_prog$ac_exec_ext"; } || continue
+	   case `"$as_dir/$ac_prog$ac_exec_ext" --version 2>&1` in #(
+	     'mkdir (GNU coreutils) '* | \
+	     'mkdir (coreutils) '* | \
+	     'mkdir (fileutils) '4.1*)
+	       ac_cv_path_mkdir=$as_dir/$ac_prog$ac_exec_ext
+	       break 3;;
+	   esac
+	 done
+       done
+  done
 IFS=$as_save_IFS
 
 fi
+
+  test -d ./--version && rmdir ./--version
+  if test "${ac_cv_path_mkdir+set}" = set; then
+    MKDIR_P="$ac_cv_path_mkdir -p"
+  else
+    # As a last resort, use the slow shell script.  Don't cache a
+    # value for MKDIR_P within a source directory, because that will
+    # break other packages using the cache if that directory is
+    # removed, or if the value is a relative name.
+    MKDIR_P="$ac_install_sh -d"
+  fi
 fi
-CC=$ac_cv_prog_CC
-if test -n "$CC"; then
-  { $as_echo "$as_me:$LINENO: result: $CC" >&5
-$as_echo "$CC" >&6; }
-else
-  { $as_echo "$as_me:$LINENO: result: no" >&5
-$as_echo "no" >&6; }
-fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $MKDIR_P" >&5
+$as_echo "$MKDIR_P" >&6; }
 
+mkdir_p="$MKDIR_P"
+case $mkdir_p in
+  [\\/$]* | ?:[\\/]*) ;;
+  */*) mkdir_p="\$(top_builddir)/$mkdir_p" ;;
+esac
 
-    test -n "$CC" && break
-  done
-fi
-if test -z "$CC"; then
-  ac_ct_CC=$CC
-  for ac_prog in cl.exe
+for ac_prog in gawk mawk nawk awk
 do
   # Extract the first word of "$ac_prog", so it can be a program name with args.
 set dummy $ac_prog; ac_word=$2
-{ $as_echo "$as_me:$LINENO: checking for $ac_word" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
 $as_echo_n "checking for $ac_word... " >&6; }
-if test "${ac_cv_prog_ac_ct_CC+set}" = set; then
+if ${ac_cv_prog_AWK+:} false; then :
   $as_echo_n "(cached) " >&6
 else
-  if test -n "$ac_ct_CC"; then
-  ac_cv_prog_ac_ct_CC="$ac_ct_CC" # Let the user override the test.
+  if test -n "$AWK"; then
+  ac_cv_prog_AWK="$AWK" # Let the user override the test.
 else
 as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
 for as_dir in $PATH
 do
   IFS=$as_save_IFS
   test -z "$as_dir" && as_dir=.
-  for ac_exec_ext in '' $ac_executable_extensions; do
+    for ac_exec_ext in '' $ac_executable_extensions; do
   if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
-    ac_cv_prog_ac_ct_CC="$ac_prog"
-    $as_echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5
+    ac_cv_prog_AWK="$ac_prog"
+    $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
     break 2
   fi
 done
-done
+  done
 IFS=$as_save_IFS
 
 fi
 fi
-ac_ct_CC=$ac_cv_prog_ac_ct_CC
-if test -n "$ac_ct_CC"; then
-  { $as_echo "$as_me:$LINENO: result: $ac_ct_CC" >&5
-$as_echo "$ac_ct_CC" >&6; }
+AWK=$ac_cv_prog_AWK
+if test -n "$AWK"; then
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $AWK" >&5
+$as_echo "$AWK" >&6; }
 else
-  { $as_echo "$as_me:$LINENO: result: no" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
 $as_echo "no" >&6; }
 fi
 
 
-  test -n "$ac_ct_CC" && break
+  test -n "$AWK" && break
 done
 
-  if test "x$ac_ct_CC" = x; then
-    CC=""
-  else
-    case $cross_compiling:$ac_tool_warned in
-yes:)
-{ $as_echo "$as_me:$LINENO: WARNING: using cross tools not prefixed with host triplet" >&5
-$as_echo "$as_me: WARNING: using cross tools not prefixed with host triplet" >&2;}
-ac_tool_warned=yes ;;
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking whether ${MAKE-make} sets \$(MAKE)" >&5
+$as_echo_n "checking whether ${MAKE-make} sets \$(MAKE)... " >&6; }
+set x ${MAKE-make}
+ac_make=`$as_echo "$2" | sed 's/+/p/g; s/[^a-zA-Z0-9_]/_/g'`
+if eval \${ac_cv_prog_make_${ac_make}_set+:} false; then :
+  $as_echo_n "(cached) " >&6
+else
+  cat >conftest.make <<\_ACEOF
+SHELL = /bin/sh
+all:
+	@echo '@@@%%%=$(MAKE)=@@@%%%'
+_ACEOF
+# GNU make sometimes prints "make[1]: Entering ...", which would confuse us.
+case `${MAKE-make} -f conftest.make 2>/dev/null` in
+  *@@@%%%=?*=@@@%%%*)
+    eval ac_cv_prog_make_${ac_make}_set=yes;;
+  *)
+    eval ac_cv_prog_make_${ac_make}_set=no;;
 esac
-    CC=$ac_ct_CC
+rm -f conftest.make
+fi
+if eval test \$ac_cv_prog_make_${ac_make}_set = yes; then
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: yes" >&5
+$as_echo "yes" >&6; }
+  SET_MAKE=
+else
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
+$as_echo "no" >&6; }
+  SET_MAKE="MAKE=${MAKE-make}"
+fi
+
+rm -rf .tst 2>/dev/null
+mkdir .tst 2>/dev/null
+if test -d .tst; then
+  am__leading_dot=.
+else
+  am__leading_dot=_
+fi
+rmdir .tst 2>/dev/null
+
+if test "`cd $srcdir && pwd`" != "`pwd`"; then
+  # Use -I$(srcdir) only when $(srcdir) != ., so that make's output
+  # is not polluted with repeated "-I."
+  am__isrc=' -I$(srcdir)'
+  # test to see if srcdir already configured
+  if test -f $srcdir/config.status; then
+    as_fn_error $? "source directory already configured; run \"make distclean\" there first" "$LINENO" 5
+  fi
+fi
+
+# test whether we have cygpath
+if test -z "$CYGPATH_W"; then
+  if (cygpath --version) >/dev/null 2>/dev/null; then
+    CYGPATH_W='cygpath -w'
+  else
+    CYGPATH_W=echo
   fi
 fi
 
-fi
+
+# Define the identity of the package.
+ PACKAGE='jellyfish'
+ VERSION='1.1.11'
+
+
+cat >>confdefs.h <<_ACEOF
+#define PACKAGE "$PACKAGE"
+_ACEOF
+
+
+cat >>confdefs.h <<_ACEOF
+#define VERSION "$VERSION"
+_ACEOF
+
+# Some tools Automake needs.
+
+ACLOCAL=${ACLOCAL-"${am_missing_run}aclocal-${am__api_version}"}
+
+
+AUTOCONF=${AUTOCONF-"${am_missing_run}autoconf"}
+
+
+AUTOMAKE=${AUTOMAKE-"${am_missing_run}automake-${am__api_version}"}
+
+
+AUTOHEADER=${AUTOHEADER-"${am_missing_run}autoheader"}
+
+
+MAKEINFO=${MAKEINFO-"${am_missing_run}makeinfo"}
+
+# We need awk for the "check" target.  The system "awk" is bad on
+# some platforms.
+# Always define AMTAR for backward compatibility.  Yes, it's still used
+# in the wild :-(  We should find a proper way to deprecate it ...
+AMTAR='$${TAR-tar}'
+
+am__tar='$${TAR-tar} chof - "$$tardir"' am__untar='$${TAR-tar} xf -'
 
 
-test -z "$CC" && { { $as_echo "$as_me:$LINENO: error: in \`$ac_pwd':" >&5
-$as_echo "$as_me: error: in \`$ac_pwd':" >&2;}
-{ { $as_echo "$as_me:$LINENO: error: no acceptable C compiler found in \$PATH
-See \`config.log' for more details." >&5
-$as_echo "$as_me: error: no acceptable C compiler found in \$PATH
-See \`config.log' for more details." >&2;}
-   { (exit 1); exit 1; }; }; }
 
-# Provide some information about the compiler.
-$as_echo "$as_me:$LINENO: checking for C compiler version" >&5
-set X $ac_compile
-ac_compiler=$2
-{ (ac_try="$ac_compiler --version >&5"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_compiler --version >&5") 2>&5
-  ac_status=$?
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); }
-{ (ac_try="$ac_compiler -v >&5"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_compiler -v >&5") 2>&5
-  ac_status=$?
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); }
-{ (ac_try="$ac_compiler -V >&5"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_compiler -V >&5") 2>&5
-  ac_status=$?
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); }
 
-{ $as_echo "$as_me:$LINENO: checking whether we are using the GNU C compiler" >&5
-$as_echo_n "checking whether we are using the GNU C compiler... " >&6; }
-if test "${ac_cv_c_compiler_gnu+set}" = set; then
-  $as_echo_n "(cached) " >&6
-else
-  cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
-/* end confdefs.h.  */
 
-int
-main ()
-{
-#ifndef __GNUC__
-       choke me
-#endif
+# Check whether --enable-silent-rules was given.
+if test "${enable_silent_rules+set}" = set; then :
+  enableval=$enable_silent_rules;
+fi
 
-  ;
-  return 0;
-}
-_ACEOF
-rm -f conftest.$ac_objext
-if { (ac_try="$ac_compile"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
+case $enable_silent_rules in
+yes) AM_DEFAULT_VERBOSITY=0;;
+no)  AM_DEFAULT_VERBOSITY=1;;
+*)   AM_DEFAULT_VERBOSITY=0;;
 esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_compile") 2>conftest.er1
-  ac_status=$?
-  grep -v '^ *+' conftest.er1 >conftest.err
-  rm -f conftest.er1
-  cat conftest.err >&5
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } && {
-	 test -z "$ac_c_werror_flag" ||
-	 test ! -s conftest.err
-       } && test -s conftest.$ac_objext; then
-  ac_compiler_gnu=yes
+am_make=${MAKE-make}
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking whether $am_make supports nested variables" >&5
+$as_echo_n "checking whether $am_make supports nested variables... " >&6; }
+if ${am_cv_make_support_nested_variables+:} false; then :
+  $as_echo_n "(cached) " >&6
 else
-  $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
-
-	ac_compiler_gnu=no
+  if $as_echo 'TRUE=$(BAR$(V))
+BAR0=false
+BAR1=true
+V=1
+am__doit:
+	@$(TRUE)
+.PHONY: am__doit' | $am_make -f - >/dev/null 2>&1; then
+  am_cv_make_support_nested_variables=yes
+else
+  am_cv_make_support_nested_variables=no
 fi
-
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
-ac_cv_c_compiler_gnu=$ac_compiler_gnu
-
 fi
-{ $as_echo "$as_me:$LINENO: result: $ac_cv_c_compiler_gnu" >&5
-$as_echo "$ac_cv_c_compiler_gnu" >&6; }
-if test $ac_compiler_gnu = yes; then
-  GCC=yes
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $am_cv_make_support_nested_variables" >&5
+$as_echo "$am_cv_make_support_nested_variables" >&6; }
+if test $am_cv_make_support_nested_variables = yes; then
+    AM_V='$(V)'
+  AM_DEFAULT_V='$(AM_DEFAULT_VERBOSITY)'
 else
-  GCC=
+  AM_V=$AM_DEFAULT_VERBOSITY
+  AM_DEFAULT_V=$AM_DEFAULT_VERBOSITY
 fi
-ac_test_CFLAGS=${CFLAGS+set}
-ac_save_CFLAGS=$CFLAGS
-{ $as_echo "$as_me:$LINENO: checking whether $CC accepts -g" >&5
-$as_echo_n "checking whether $CC accepts -g... " >&6; }
-if test "${ac_cv_prog_cc_g+set}" = set; then
-  $as_echo_n "(cached) " >&6
-else
-  ac_save_c_werror_flag=$ac_c_werror_flag
-   ac_c_werror_flag=yes
-   ac_cv_prog_cc_g=no
-   CFLAGS="-g"
-   cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
-/* end confdefs.h.  */
+AM_BACKSLASH='\'
 
-int
-main ()
-{
 
-  ;
-  return 0;
-}
-_ACEOF
-rm -f conftest.$ac_objext
-if { (ac_try="$ac_compile"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
+ac_config_headers="$ac_config_headers config.h"
+
+
+case `pwd` in
+  *\ * | *\	*)
+    { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: Libtool does not cope well with whitespace in \`pwd\`" >&5
+$as_echo "$as_me: WARNING: Libtool does not cope well with whitespace in \`pwd\`" >&2;} ;;
 esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_compile") 2>conftest.er1
-  ac_status=$?
-  grep -v '^ *+' conftest.er1 >conftest.err
-  rm -f conftest.er1
-  cat conftest.err >&5
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } && {
-	 test -z "$ac_c_werror_flag" ||
-	 test ! -s conftest.err
-       } && test -s conftest.$ac_objext; then
-  ac_cv_prog_cc_g=yes
-else
-  $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
 
-	CFLAGS=""
-      cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
-/* end confdefs.h.  */
 
-int
-main ()
-{
 
-  ;
-  return 0;
-}
-_ACEOF
-rm -f conftest.$ac_objext
-if { (ac_try="$ac_compile"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_compile") 2>conftest.er1
-  ac_status=$?
-  grep -v '^ *+' conftest.er1 >conftest.err
-  rm -f conftest.er1
-  cat conftest.err >&5
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } && {
-	 test -z "$ac_c_werror_flag" ||
-	 test ! -s conftest.err
-       } && test -s conftest.$ac_objext; then
-  :
-else
-  $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
+macro_version='2.4.2'
+macro_revision='1.3337'
 
-	ac_c_werror_flag=$ac_save_c_werror_flag
-	 CFLAGS="-g"
-	 cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
-/* end confdefs.h.  */
 
-int
-main ()
-{
 
-  ;
-  return 0;
-}
-_ACEOF
-rm -f conftest.$ac_objext
-if { (ac_try="$ac_compile"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_compile") 2>conftest.er1
-  ac_status=$?
-  grep -v '^ *+' conftest.er1 >conftest.err
-  rm -f conftest.er1
-  cat conftest.err >&5
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } && {
-	 test -z "$ac_c_werror_flag" ||
-	 test ! -s conftest.err
-       } && test -s conftest.$ac_objext; then
-  ac_cv_prog_cc_g=yes
-else
-  $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
 
 
-fi
 
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
-fi
 
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
-fi
 
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
-   ac_c_werror_flag=$ac_save_c_werror_flag
-fi
-{ $as_echo "$as_me:$LINENO: result: $ac_cv_prog_cc_g" >&5
-$as_echo "$ac_cv_prog_cc_g" >&6; }
-if test "$ac_test_CFLAGS" = set; then
-  CFLAGS=$ac_save_CFLAGS
-elif test $ac_cv_prog_cc_g = yes; then
-  if test "$GCC" = yes; then
-    CFLAGS="-g -O2"
-  else
-    CFLAGS="-g"
-  fi
-else
-  if test "$GCC" = yes; then
-    CFLAGS="-O2"
-  else
-    CFLAGS=
-  fi
-fi
-{ $as_echo "$as_me:$LINENO: checking for $CC option to accept ISO C89" >&5
-$as_echo_n "checking for $CC option to accept ISO C89... " >&6; }
-if test "${ac_cv_prog_cc_c89+set}" = set; then
-  $as_echo_n "(cached) " >&6
-else
-  ac_cv_prog_cc_c89=no
-ac_save_CC=$CC
-cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
-/* end confdefs.h.  */
-#include <stdarg.h>
-#include <stdio.h>
-#include <sys/types.h>
-#include <sys/stat.h>
-/* Most of the following tests are stolen from RCS 5.7's src/conf.sh.  */
-struct buf { int x; };
-FILE * (*rcsopen) (struct buf *, struct stat *, int);
-static char *e (p, i)
-     char **p;
-     int i;
-{
-  return p[i];
-}
-static char *f (char * (*g) (char **, int), char **p, ...)
-{
-  char *s;
-  va_list v;
-  va_start (v,p);
-  s = g (p, va_arg (v,int));
-  va_end (v);
-  return s;
-}
 
-/* OSF 4.0 Compaq cc is some sort of almost-ANSI by default.  It has
-   function prototypes and stuff, but not '\xHH' hex character constants.
-   These don't provoke an error unfortunately, instead are silently treated
-   as 'x'.  The following induces an error, until -std is added to get
-   proper ANSI mode.  Curiously '\x00'!='x' always comes out true, for an
-   array size at least.  It's necessary to write '\x00'==0 to get something
-   that's true only with -std.  */
-int osf4_cc_array ['\x00' == 0 ? 1 : -1];
 
-/* IBM C 6 for AIX is almost-ANSI by default, but it replaces macro parameters
-   inside strings and character constants.  */
-#define FOO(x) 'x'
-int xlc6_cc_array[FOO(a) == 'x' ? 1 : -1];
 
-int test (int i, double x);
-struct s1 {int (*f) (int a);};
-struct s2 {int (*f) (double a);};
-int pairnames (int, char **, FILE *(*)(struct buf *, struct stat *, int), int, int);
-int argc;
-char **argv;
-int
-main ()
-{
-return f (e, argv, 0) != argv[0]  ||  f (e, argv, 1) != argv[1];
-  ;
-  return 0;
-}
-_ACEOF
-for ac_arg in '' -qlanglvl=extc89 -qlanglvl=ansi -std \
-	-Ae "-Aa -D_HPUX_SOURCE" "-Xc -D__EXTENSIONS__"
-do
-  CC="$ac_save_CC $ac_arg"
-  rm -f conftest.$ac_objext
-if { (ac_try="$ac_compile"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_compile") 2>conftest.er1
-  ac_status=$?
-  grep -v '^ *+' conftest.er1 >conftest.err
-  rm -f conftest.er1
-  cat conftest.err >&5
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } && {
-	 test -z "$ac_c_werror_flag" ||
-	 test ! -s conftest.err
-       } && test -s conftest.$ac_objext; then
-  ac_cv_prog_cc_c89=$ac_arg
-else
-  $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
 
 
+ltmain="$ac_aux_dir/ltmain.sh"
+
+# Backslashify metacharacters that are still active within
+# double-quoted strings.
+sed_quote_subst='s/\(["`$\\]\)/\\\1/g'
+
+# Same as above, but do not quote variable references.
+double_quote_subst='s/\(["`\\]\)/\\\1/g'
+
+# Sed substitution to delay expansion of an escaped shell variable in a
+# double_quote_subst'ed string.
+delay_variable_subst='s/\\\\\\\\\\\$/\\\\\\$/g'
+
+# Sed substitution to delay expansion of an escaped single quote.
+delay_single_quote_subst='s/'\''/'\'\\\\\\\'\''/g'
+
+# Sed substitution to avoid accidental globbing in evaled expressions
+no_glob_subst='s/\*/\\\*/g'
+
+ECHO='\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\'
+ECHO=$ECHO$ECHO$ECHO$ECHO$ECHO
+ECHO=$ECHO$ECHO$ECHO$ECHO$ECHO$ECHO
+
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking how to print strings" >&5
+$as_echo_n "checking how to print strings... " >&6; }
+# Test print first, because it will be a builtin if present.
+if test "X`( print -r -- -n ) 2>/dev/null`" = X-n && \
+   test "X`print -r -- $ECHO 2>/dev/null`" = "X$ECHO"; then
+  ECHO='print -r --'
+elif test "X`printf %s $ECHO 2>/dev/null`" = "X$ECHO"; then
+  ECHO='printf %s\n'
+else
+  # Use this function as a fallback that always works.
+  func_fallback_echo ()
+  {
+    eval 'cat <<_LTECHO_EOF
+$1
+_LTECHO_EOF'
+  }
+  ECHO='func_fallback_echo'
 fi
 
-rm -f core conftest.err conftest.$ac_objext
-  test "x$ac_cv_prog_cc_c89" != "xno" && break
-done
-rm -f conftest.$ac_ext
-CC=$ac_save_CC
+# func_echo_all arg...
+# Invoke $ECHO with all args, space-separated.
+func_echo_all ()
+{
+    $ECHO ""
+}
 
-fi
-# AC_CACHE_VAL
-case "x$ac_cv_prog_cc_c89" in
-  x)
-    { $as_echo "$as_me:$LINENO: result: none needed" >&5
-$as_echo "none needed" >&6; } ;;
-  xno)
-    { $as_echo "$as_me:$LINENO: result: unsupported" >&5
-$as_echo "unsupported" >&6; } ;;
-  *)
-    CC="$CC $ac_cv_prog_cc_c89"
-    { $as_echo "$as_me:$LINENO: result: $ac_cv_prog_cc_c89" >&5
-$as_echo "$ac_cv_prog_cc_c89" >&6; } ;;
+case "$ECHO" in
+  printf*) { $as_echo "$as_me:${as_lineno-$LINENO}: result: printf" >&5
+$as_echo "printf" >&6; } ;;
+  print*) { $as_echo "$as_me:${as_lineno-$LINENO}: result: print -r" >&5
+$as_echo "print -r" >&6; } ;;
+  *) { $as_echo "$as_me:${as_lineno-$LINENO}: result: cat" >&5
+$as_echo "cat" >&6; } ;;
 esac
 
 
-ac_ext=c
-ac_cpp='$CPP $CPPFLAGS'
-ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
-ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
-ac_compiler_gnu=$ac_cv_c_compiler_gnu
 
-depcc="$CC"   am_compiler_list=
 
-{ $as_echo "$as_me:$LINENO: checking dependency style of $depcc" >&5
-$as_echo_n "checking dependency style of $depcc... " >&6; }
-if test "${am_cv_CC_dependencies_compiler_type+set}" = set; then
-  $as_echo_n "(cached) " >&6
-else
-  if test -z "$AMDEP_TRUE" && test -f "$am_depcomp"; then
-  # We make a subdir and do the tests there.  Otherwise we can end up
-  # making bogus files that we don't know about and never remove.  For
-  # instance it was reported that on HP-UX the gcc test will end up
-  # making a dummy file named `D' -- because `-MD' means `put the output
-  # in D'.
-  mkdir conftest.dir
-  # Copy depcomp to subdir because otherwise we won't find it if we're
-  # using a relative directory.
-  cp "$am_depcomp" conftest.dir
-  cd conftest.dir
-  # We will build objects and dependencies in a subdirectory because
-  # it helps to detect inapplicable dependency modes.  For instance
-  # both Tru64's cc and ICC support -MD to output dependencies as a
-  # side effect of compilation, but ICC will put the dependencies in
-  # the current directory while Tru64 will put them in the object
-  # directory.
-  mkdir sub
 
-  am_cv_CC_dependencies_compiler_type=none
-  if test "$am_compiler_list" = ""; then
-     am_compiler_list=`sed -n 's/^#*\([a-zA-Z0-9]*\))$/\1/p' < ./depcomp`
-  fi
-  am__universal=false
-  case " $depcc " in #(
-     *\ -arch\ *\ -arch\ *) am__universal=true ;;
-     esac
 
-  for depmode in $am_compiler_list; do
-    # Setup a source with many dependencies, because some compilers
-    # like to wrap large dependency lists on column 80 (with \), and
-    # we should not choose a depcomp mode which is confused by this.
-    #
-    # We need to recreate these files for each test, as the compiler may
-    # overwrite some of them when testing with obscure command lines.
-    # This happens at least with the AIX C compiler.
-    : > sub/conftest.c
-    for i in 1 2 3 4 5 6; do
-      echo '#include "conftst'$i'.h"' >> sub/conftest.c
-      # Using `: > sub/conftst$i.h' creates only sub/conftst1.h with
-      # Solaris 8's {/usr,}/bin/sh.
-      touch sub/conftst$i.h
-    done
-    echo "${am__include} ${am__quote}sub/conftest.Po${am__quote}" > confmf
 
-    # We check with `-c' and `-o' for the sake of the "dashmstdout"
-    # mode.  It turns out that the SunPro C++ compiler does not properly
-    # handle `-M -o', and we need to detect this.  Also, some Intel
-    # versions had trouble with output in subdirs
-    am__obj=sub/conftest.${OBJEXT-o}
-    am__minus_obj="-o $am__obj"
-    case $depmode in
-    gcc)
-      # This depmode causes a compiler race in universal mode.
-      test "$am__universal" = false || continue
-      ;;
-    nosideeffect)
-      # after this tag, mechanisms are not by side-effect, so they'll
-      # only be used when explicitly requested
-      if test "x$enable_dependency_tracking" = xyes; then
-	continue
-      else
-	break
-      fi
-      ;;
-    msvisualcpp | msvcmsys)
-      # This compiler won't grok `-c -o', but also, the minuso test has
-      # not run yet.  These depmodes are late enough in the game, and
-      # so weak that their functioning should not be impacted.
-      am__obj=conftest.${OBJEXT-o}
-      am__minus_obj=
-      ;;
-    none) break ;;
-    esac
-    if depmode=$depmode \
-       source=sub/conftest.c object=$am__obj \
-       depfile=sub/conftest.Po tmpdepfile=sub/conftest.TPo \
-       $SHELL ./depcomp $depcc -c $am__minus_obj sub/conftest.c \
-         >/dev/null 2>conftest.err &&
-       grep sub/conftst1.h sub/conftest.Po > /dev/null 2>&1 &&
-       grep sub/conftst6.h sub/conftest.Po > /dev/null 2>&1 &&
-       grep $am__obj sub/conftest.Po > /dev/null 2>&1 &&
-       ${MAKE-make} -s -f confmf > /dev/null 2>&1; then
-      # icc doesn't choke on unknown options, it will just issue warnings
-      # or remarks (even with -Werror).  So we grep stderr for any message
-      # that says an option was ignored or not supported.
-      # When given -MP, icc 7.0 and 7.1 complain thusly:
-      #   icc: Command line warning: ignoring option '-M'; no argument required
-      # The diagnosis changed in icc 8.0:
-      #   icc: Command line remark: option '-MP' not supported
-      if (grep 'ignoring option' conftest.err ||
-          grep 'not supported' conftest.err) >/dev/null 2>&1; then :; else
-        am_cv_CC_dependencies_compiler_type=$depmode
-        break
-      fi
-    fi
-  done
 
-  cd ..
-  rm -rf conftest.dir
-else
-  am_cv_CC_dependencies_compiler_type=none
-fi
 
-fi
-{ $as_echo "$as_me:$LINENO: result: $am_cv_CC_dependencies_compiler_type" >&5
-$as_echo "$am_cv_CC_dependencies_compiler_type" >&6; }
-CCDEPMODE=depmode=$am_cv_CC_dependencies_compiler_type
 
- if
-  test "x$enable_dependency_tracking" != xno \
-  && test "$am_cv_CC_dependencies_compiler_type" = gcc3; then
-  am__fastdepCC_TRUE=
-  am__fastdepCC_FALSE='#'
-else
-  am__fastdepCC_TRUE='#'
-  am__fastdepCC_FALSE=
-fi
 
 
 
-ac_ext=c
-ac_cpp='$CPP $CPPFLAGS'
-ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
-ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
-ac_compiler_gnu=$ac_cv_c_compiler_gnu
-{ $as_echo "$as_me:$LINENO: checking how to run the C preprocessor" >&5
-$as_echo_n "checking how to run the C preprocessor... " >&6; }
-# On Suns, sometimes $CPP names a directory.
-if test -n "$CPP" && test -d "$CPP"; then
-  CPP=
-fi
-if test -z "$CPP"; then
-  if test "${ac_cv_prog_CPP+set}" = set; then
-  $as_echo_n "(cached) " >&6
-else
-      # Double quotes because CPP needs to be expanded
-    for CPP in "$CC -E" "$CC -E -traditional-cpp" "/lib/cpp"
-    do
-      ac_preproc_ok=false
-for ac_c_preproc_warn_flag in '' yes
-do
-  # Use a header file that comes with gcc, so configuring glibc
-  # with a fresh cross-compiler works.
-  # Prefer <limits.h> to <assert.h> if __STDC__ is defined, since
-  # <limits.h> exists even on freestanding compilers.
-  # On the NeXT, cc -E runs the code through the compiler's parser,
-  # not just through cpp. "Syntax error" is here to catch this case.
-  cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
-/* end confdefs.h.  */
-#ifdef __STDC__
-# include <limits.h>
-#else
-# include <assert.h>
-#endif
-		     Syntax error
-_ACEOF
-if { (ac_try="$ac_cpp conftest.$ac_ext"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_cpp conftest.$ac_ext") 2>conftest.er1
-  ac_status=$?
-  grep -v '^ *+' conftest.er1 >conftest.err
-  rm -f conftest.er1
-  cat conftest.err >&5
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } >/dev/null && {
-	 test -z "$ac_c_preproc_warn_flag$ac_c_werror_flag" ||
-	 test ! -s conftest.err
-       }; then
-  :
-else
-  $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
 
-  # Broken: fails on valid input.
-continue
-fi
+DEPDIR="${am__leading_dot}deps"
+
+ac_config_commands="$ac_config_commands depfiles"
 
-rm -f conftest.err conftest.$ac_ext
 
-  # OK, works on sane cases.  Now check whether nonexistent headers
-  # can be detected and how.
-  cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
-/* end confdefs.h.  */
-#include <ac_nonexistent.h>
-_ACEOF
-if { (ac_try="$ac_cpp conftest.$ac_ext"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
+am_make=${MAKE-make}
+cat > confinc << 'END'
+am__doit:
+	@echo this is the am__doit target
+.PHONY: am__doit
+END
+# If we don't find an include directive, just comment out the code.
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for style of include used by $am_make" >&5
+$as_echo_n "checking for style of include used by $am_make... " >&6; }
+am__include="#"
+am__quote=
+_am_result=none
+# First try GNU make style include.
+echo "include confinc" > confmf
+# Ignore all kinds of additional output from `make'.
+case `$am_make -s -f confmf 2> /dev/null` in #(
+*the\ am__doit\ target*)
+  am__include=include
+  am__quote=
+  _am_result=GNU
+  ;;
 esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_cpp conftest.$ac_ext") 2>conftest.er1
-  ac_status=$?
-  grep -v '^ *+' conftest.er1 >conftest.err
-  rm -f conftest.er1
-  cat conftest.err >&5
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } >/dev/null && {
-	 test -z "$ac_c_preproc_warn_flag$ac_c_werror_flag" ||
-	 test ! -s conftest.err
-       }; then
-  # Broken: success on invalid input.
-continue
-else
-  $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
+# Now try BSD make style include.
+if test "$am__include" = "#"; then
+   echo '.include "confinc"' > confmf
+   case `$am_make -s -f confmf 2> /dev/null` in #(
+   *the\ am__doit\ target*)
+     am__include=.include
+     am__quote="\""
+     _am_result=BSD
+     ;;
+   esac
+fi
 
-  # Passes both tests.
-ac_preproc_ok=:
-break
+
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $_am_result" >&5
+$as_echo "$_am_result" >&6; }
+rm -f confinc confmf
+
+# Check whether --enable-dependency-tracking was given.
+if test "${enable_dependency_tracking+set}" = set; then :
+  enableval=$enable_dependency_tracking;
+fi
+
+if test "x$enable_dependency_tracking" != xno; then
+  am_depcomp="$ac_aux_dir/depcomp"
+  AMDEPBACKSLASH='\'
+  am__nodep='_no'
+fi
+ if test "x$enable_dependency_tracking" != xno; then
+  AMDEP_TRUE=
+  AMDEP_FALSE='#'
+else
+  AMDEP_TRUE='#'
+  AMDEP_FALSE=
 fi
 
-rm -f conftest.err conftest.$ac_ext
 
+ac_ext=c
+ac_cpp='$CPP $CPPFLAGS'
+ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
+ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
+ac_compiler_gnu=$ac_cv_c_compiler_gnu
+if test -n "$ac_tool_prefix"; then
+  # Extract the first word of "${ac_tool_prefix}gcc", so it can be a program name with args.
+set dummy ${ac_tool_prefix}gcc; ac_word=$2
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
+$as_echo_n "checking for $ac_word... " >&6; }
+if ${ac_cv_prog_CC+:} false; then :
+  $as_echo_n "(cached) " >&6
+else
+  if test -n "$CC"; then
+  ac_cv_prog_CC="$CC" # Let the user override the test.
+else
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+  IFS=$as_save_IFS
+  test -z "$as_dir" && as_dir=.
+    for ac_exec_ext in '' $ac_executable_extensions; do
+  if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
+    ac_cv_prog_CC="${ac_tool_prefix}gcc"
+    $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
+    break 2
+  fi
 done
-# Because of `break', _AC_PREPROC_IFELSE's cleaning code was skipped.
-rm -f conftest.err conftest.$ac_ext
-if $ac_preproc_ok; then
-  break
+  done
+IFS=$as_save_IFS
+
+fi
+fi
+CC=$ac_cv_prog_CC
+if test -n "$CC"; then
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $CC" >&5
+$as_echo "$CC" >&6; }
+else
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
+$as_echo "no" >&6; }
 fi
 
-    done
-    ac_cv_prog_CPP=$CPP
 
 fi
-  CPP=$ac_cv_prog_CPP
+if test -z "$ac_cv_prog_CC"; then
+  ac_ct_CC=$CC
+  # Extract the first word of "gcc", so it can be a program name with args.
+set dummy gcc; ac_word=$2
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
+$as_echo_n "checking for $ac_word... " >&6; }
+if ${ac_cv_prog_ac_ct_CC+:} false; then :
+  $as_echo_n "(cached) " >&6
 else
-  ac_cv_prog_CPP=$CPP
-fi
-{ $as_echo "$as_me:$LINENO: result: $CPP" >&5
-$as_echo "$CPP" >&6; }
-ac_preproc_ok=false
-for ac_c_preproc_warn_flag in '' yes
-do
-  # Use a header file that comes with gcc, so configuring glibc
-  # with a fresh cross-compiler works.
-  # Prefer <limits.h> to <assert.h> if __STDC__ is defined, since
-  # <limits.h> exists even on freestanding compilers.
-  # On the NeXT, cc -E runs the code through the compiler's parser,
-  # not just through cpp. "Syntax error" is here to catch this case.
-  cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
-/* end confdefs.h.  */
-#ifdef __STDC__
-# include <limits.h>
-#else
-# include <assert.h>
-#endif
-		     Syntax error
-_ACEOF
-if { (ac_try="$ac_cpp conftest.$ac_ext"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_cpp conftest.$ac_ext") 2>conftest.er1
-  ac_status=$?
-  grep -v '^ *+' conftest.er1 >conftest.err
-  rm -f conftest.er1
-  cat conftest.err >&5
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } >/dev/null && {
-	 test -z "$ac_c_preproc_warn_flag$ac_c_werror_flag" ||
-	 test ! -s conftest.err
-       }; then
-  :
+  if test -n "$ac_ct_CC"; then
+  ac_cv_prog_ac_ct_CC="$ac_ct_CC" # Let the user override the test.
 else
-  $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+  IFS=$as_save_IFS
+  test -z "$as_dir" && as_dir=.
+    for ac_exec_ext in '' $ac_executable_extensions; do
+  if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
+    ac_cv_prog_ac_ct_CC="gcc"
+    $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
+    break 2
+  fi
+done
+  done
+IFS=$as_save_IFS
 
-  # Broken: fails on valid input.
-continue
+fi
+fi
+ac_ct_CC=$ac_cv_prog_ac_ct_CC
+if test -n "$ac_ct_CC"; then
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_ct_CC" >&5
+$as_echo "$ac_ct_CC" >&6; }
+else
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
+$as_echo "no" >&6; }
 fi
 
-rm -f conftest.err conftest.$ac_ext
-
-  # OK, works on sane cases.  Now check whether nonexistent headers
-  # can be detected and how.
-  cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
-/* end confdefs.h.  */
-#include <ac_nonexistent.h>
-_ACEOF
-if { (ac_try="$ac_cpp conftest.$ac_ext"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
+  if test "x$ac_ct_CC" = x; then
+    CC=""
+  else
+    case $cross_compiling:$ac_tool_warned in
+yes:)
+{ $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: using cross tools not prefixed with host triplet" >&5
+$as_echo "$as_me: WARNING: using cross tools not prefixed with host triplet" >&2;}
+ac_tool_warned=yes ;;
 esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_cpp conftest.$ac_ext") 2>conftest.er1
-  ac_status=$?
-  grep -v '^ *+' conftest.er1 >conftest.err
-  rm -f conftest.er1
-  cat conftest.err >&5
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } >/dev/null && {
-	 test -z "$ac_c_preproc_warn_flag$ac_c_werror_flag" ||
-	 test ! -s conftest.err
-       }; then
-  # Broken: success on invalid input.
-continue
+    CC=$ac_ct_CC
+  fi
 else
-  $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
-
-  # Passes both tests.
-ac_preproc_ok=:
-break
+  CC="$ac_cv_prog_CC"
 fi
 
-rm -f conftest.err conftest.$ac_ext
-
+if test -z "$CC"; then
+          if test -n "$ac_tool_prefix"; then
+    # Extract the first word of "${ac_tool_prefix}cc", so it can be a program name with args.
+set dummy ${ac_tool_prefix}cc; ac_word=$2
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
+$as_echo_n "checking for $ac_word... " >&6; }
+if ${ac_cv_prog_CC+:} false; then :
+  $as_echo_n "(cached) " >&6
+else
+  if test -n "$CC"; then
+  ac_cv_prog_CC="$CC" # Let the user override the test.
+else
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+  IFS=$as_save_IFS
+  test -z "$as_dir" && as_dir=.
+    for ac_exec_ext in '' $ac_executable_extensions; do
+  if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
+    ac_cv_prog_CC="${ac_tool_prefix}cc"
+    $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
+    break 2
+  fi
 done
-# Because of `break', _AC_PREPROC_IFELSE's cleaning code was skipped.
-rm -f conftest.err conftest.$ac_ext
-if $ac_preproc_ok; then
-  :
+  done
+IFS=$as_save_IFS
+
+fi
+fi
+CC=$ac_cv_prog_CC
+if test -n "$CC"; then
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $CC" >&5
+$as_echo "$CC" >&6; }
 else
-  { { $as_echo "$as_me:$LINENO: error: in \`$ac_pwd':" >&5
-$as_echo "$as_me: error: in \`$ac_pwd':" >&2;}
-{ { $as_echo "$as_me:$LINENO: error: C preprocessor \"$CPP\" fails sanity check
-See \`config.log' for more details." >&5
-$as_echo "$as_me: error: C preprocessor \"$CPP\" fails sanity check
-See \`config.log' for more details." >&2;}
-   { (exit 1); exit 1; }; }; }
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
+$as_echo "no" >&6; }
 fi
 
-ac_ext=c
-ac_cpp='$CPP $CPPFLAGS'
-ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
-ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
-ac_compiler_gnu=$ac_cv_c_compiler_gnu
-
 
-{ $as_echo "$as_me:$LINENO: checking for grep that handles long lines and -e" >&5
-$as_echo_n "checking for grep that handles long lines and -e... " >&6; }
-if test "${ac_cv_path_GREP+set}" = set; then
+  fi
+fi
+if test -z "$CC"; then
+  # Extract the first word of "cc", so it can be a program name with args.
+set dummy cc; ac_word=$2
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
+$as_echo_n "checking for $ac_word... " >&6; }
+if ${ac_cv_prog_CC+:} false; then :
   $as_echo_n "(cached) " >&6
 else
-  if test -z "$GREP"; then
-  ac_path_GREP_found=false
-  # Loop through the user's path and test for each of PROGNAME-LIST
-  as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH$PATH_SEPARATOR/usr/xpg4/bin
+  if test -n "$CC"; then
+  ac_cv_prog_CC="$CC" # Let the user override the test.
+else
+  ac_prog_rejected=no
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
 do
   IFS=$as_save_IFS
   test -z "$as_dir" && as_dir=.
-  for ac_prog in grep ggrep; do
     for ac_exec_ext in '' $ac_executable_extensions; do
-      ac_path_GREP="$as_dir/$ac_prog$ac_exec_ext"
-      { test -f "$ac_path_GREP" && $as_test_x "$ac_path_GREP"; } || continue
-# Check for GNU ac_path_GREP and select it if it is found.
-  # Check for GNU $ac_path_GREP
-case `"$ac_path_GREP" --version 2>&1` in
-*GNU*)
-  ac_cv_path_GREP="$ac_path_GREP" ac_path_GREP_found=:;;
-*)
-  ac_count=0
-  $as_echo_n 0123456789 >"conftest.in"
-  while :
-  do
-    cat "conftest.in" "conftest.in" >"conftest.tmp"
-    mv "conftest.tmp" "conftest.in"
-    cp "conftest.in" "conftest.nl"
-    $as_echo 'GREP' >> "conftest.nl"
-    "$ac_path_GREP" -e 'GREP$' -e '-(cannot match)-' < "conftest.nl" >"conftest.out" 2>/dev/null || break
-    diff "conftest.out" "conftest.nl" >/dev/null 2>&1 || break
-    ac_count=`expr $ac_count + 1`
-    if test $ac_count -gt ${ac_path_GREP_max-0}; then
-      # Best one so far, save it but keep looking for a better one
-      ac_cv_path_GREP="$ac_path_GREP"
-      ac_path_GREP_max=$ac_count
-    fi
-    # 10*(2^10) chars as input seems more than enough
-    test $ac_count -gt 10 && break
-  done
-  rm -f conftest.in conftest.tmp conftest.nl conftest.out;;
-esac
-
-      $ac_path_GREP_found && break 3
-    done
-  done
+  if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
+    if test "$as_dir/$ac_word$ac_exec_ext" = "/usr/ucb/cc"; then
+       ac_prog_rejected=yes
+       continue
+     fi
+    ac_cv_prog_CC="cc"
+    $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
+    break 2
+  fi
 done
+  done
 IFS=$as_save_IFS
-  if test -z "$ac_cv_path_GREP"; then
-    { { $as_echo "$as_me:$LINENO: error: no acceptable grep could be found in $PATH$PATH_SEPARATOR/usr/xpg4/bin" >&5
-$as_echo "$as_me: error: no acceptable grep could be found in $PATH$PATH_SEPARATOR/usr/xpg4/bin" >&2;}
-   { (exit 1); exit 1; }; }
+
+if test $ac_prog_rejected = yes; then
+  # We found a bogon in the path, so make sure we never use it.
+  set dummy $ac_cv_prog_CC
+  shift
+  if test $# != 0; then
+    # We chose a different compiler from the bogus one.
+    # However, it has the same basename, so the bogon will be chosen
+    # first if we set CC to just the basename; use the full file name.
+    shift
+    ac_cv_prog_CC="$as_dir/$ac_word${1+' '}$@"
   fi
+fi
+fi
+fi
+CC=$ac_cv_prog_CC
+if test -n "$CC"; then
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $CC" >&5
+$as_echo "$CC" >&6; }
 else
-  ac_cv_path_GREP=$GREP
-fi
-
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
+$as_echo "no" >&6; }
 fi
-{ $as_echo "$as_me:$LINENO: result: $ac_cv_path_GREP" >&5
-$as_echo "$ac_cv_path_GREP" >&6; }
- GREP="$ac_cv_path_GREP"
 
 
-{ $as_echo "$as_me:$LINENO: checking for egrep" >&5
-$as_echo_n "checking for egrep... " >&6; }
-if test "${ac_cv_path_EGREP+set}" = set; then
+fi
+if test -z "$CC"; then
+  if test -n "$ac_tool_prefix"; then
+  for ac_prog in cl.exe
+  do
+    # Extract the first word of "$ac_tool_prefix$ac_prog", so it can be a program name with args.
+set dummy $ac_tool_prefix$ac_prog; ac_word=$2
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
+$as_echo_n "checking for $ac_word... " >&6; }
+if ${ac_cv_prog_CC+:} false; then :
   $as_echo_n "(cached) " >&6
 else
-  if echo a | $GREP -E '(a|b)' >/dev/null 2>&1
-   then ac_cv_path_EGREP="$GREP -E"
-   else
-     if test -z "$EGREP"; then
-  ac_path_EGREP_found=false
-  # Loop through the user's path and test for each of PROGNAME-LIST
-  as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH$PATH_SEPARATOR/usr/xpg4/bin
+  if test -n "$CC"; then
+  ac_cv_prog_CC="$CC" # Let the user override the test.
+else
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
 do
   IFS=$as_save_IFS
   test -z "$as_dir" && as_dir=.
-  for ac_prog in egrep; do
     for ac_exec_ext in '' $ac_executable_extensions; do
-      ac_path_EGREP="$as_dir/$ac_prog$ac_exec_ext"
-      { test -f "$ac_path_EGREP" && $as_test_x "$ac_path_EGREP"; } || continue
-# Check for GNU ac_path_EGREP and select it if it is found.
-  # Check for GNU $ac_path_EGREP
-case `"$ac_path_EGREP" --version 2>&1` in
-*GNU*)
-  ac_cv_path_EGREP="$ac_path_EGREP" ac_path_EGREP_found=:;;
-*)
-  ac_count=0
-  $as_echo_n 0123456789 >"conftest.in"
-  while :
-  do
-    cat "conftest.in" "conftest.in" >"conftest.tmp"
-    mv "conftest.tmp" "conftest.in"
-    cp "conftest.in" "conftest.nl"
-    $as_echo 'EGREP' >> "conftest.nl"
-    "$ac_path_EGREP" 'EGREP$' < "conftest.nl" >"conftest.out" 2>/dev/null || break
-    diff "conftest.out" "conftest.nl" >/dev/null 2>&1 || break
-    ac_count=`expr $ac_count + 1`
-    if test $ac_count -gt ${ac_path_EGREP_max-0}; then
-      # Best one so far, save it but keep looking for a better one
-      ac_cv_path_EGREP="$ac_path_EGREP"
-      ac_path_EGREP_max=$ac_count
-    fi
-    # 10*(2^10) chars as input seems more than enough
-    test $ac_count -gt 10 && break
+  if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
+    ac_cv_prog_CC="$ac_tool_prefix$ac_prog"
+    $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
+    break 2
+  fi
+done
   done
-  rm -f conftest.in conftest.tmp conftest.nl conftest.out;;
-esac
+IFS=$as_save_IFS
 
-      $ac_path_EGREP_found && break 3
-    done
+fi
+fi
+CC=$ac_cv_prog_CC
+if test -n "$CC"; then
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $CC" >&5
+$as_echo "$CC" >&6; }
+else
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
+$as_echo "no" >&6; }
+fi
+
+
+    test -n "$CC" && break
   done
+fi
+if test -z "$CC"; then
+  ac_ct_CC=$CC
+  for ac_prog in cl.exe
+do
+  # Extract the first word of "$ac_prog", so it can be a program name with args.
+set dummy $ac_prog; ac_word=$2
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
+$as_echo_n "checking for $ac_word... " >&6; }
+if ${ac_cv_prog_ac_ct_CC+:} false; then :
+  $as_echo_n "(cached) " >&6
+else
+  if test -n "$ac_ct_CC"; then
+  ac_cv_prog_ac_ct_CC="$ac_ct_CC" # Let the user override the test.
+else
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+  IFS=$as_save_IFS
+  test -z "$as_dir" && as_dir=.
+    for ac_exec_ext in '' $ac_executable_extensions; do
+  if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
+    ac_cv_prog_ac_ct_CC="$ac_prog"
+    $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
+    break 2
+  fi
 done
+  done
 IFS=$as_save_IFS
-  if test -z "$ac_cv_path_EGREP"; then
-    { { $as_echo "$as_me:$LINENO: error: no acceptable egrep could be found in $PATH$PATH_SEPARATOR/usr/xpg4/bin" >&5
-$as_echo "$as_me: error: no acceptable egrep could be found in $PATH$PATH_SEPARATOR/usr/xpg4/bin" >&2;}
-   { (exit 1); exit 1; }; }
-  fi
+
+fi
+fi
+ac_ct_CC=$ac_cv_prog_ac_ct_CC
+if test -n "$ac_ct_CC"; then
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_ct_CC" >&5
+$as_echo "$ac_ct_CC" >&6; }
 else
-  ac_cv_path_EGREP=$EGREP
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
+$as_echo "no" >&6; }
 fi
 
-   fi
+
+  test -n "$ac_ct_CC" && break
+done
+
+  if test "x$ac_ct_CC" = x; then
+    CC=""
+  else
+    case $cross_compiling:$ac_tool_warned in
+yes:)
+{ $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: using cross tools not prefixed with host triplet" >&5
+$as_echo "$as_me: WARNING: using cross tools not prefixed with host triplet" >&2;}
+ac_tool_warned=yes ;;
+esac
+    CC=$ac_ct_CC
+  fi
 fi
-{ $as_echo "$as_me:$LINENO: result: $ac_cv_path_EGREP" >&5
-$as_echo "$ac_cv_path_EGREP" >&6; }
- EGREP="$ac_cv_path_EGREP"
 
+fi
 
-{ $as_echo "$as_me:$LINENO: checking for ANSI C header files" >&5
-$as_echo_n "checking for ANSI C header files... " >&6; }
-if test "${ac_cv_header_stdc+set}" = set; then
-  $as_echo_n "(cached) " >&6
-else
-  cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
+
+test -z "$CC" && { { $as_echo "$as_me:${as_lineno-$LINENO}: error: in \`$ac_pwd':" >&5
+$as_echo "$as_me: error: in \`$ac_pwd':" >&2;}
+as_fn_error $? "no acceptable C compiler found in \$PATH
+See \`config.log' for more details" "$LINENO" 5; }
+
+# Provide some information about the compiler.
+$as_echo "$as_me:${as_lineno-$LINENO}: checking for C compiler version" >&5
+set X $ac_compile
+ac_compiler=$2
+for ac_option in --version -v -V -qversion; do
+  { { ac_try="$ac_compiler $ac_option >&5"
+case "(($ac_try" in
+  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
+  *) ac_try_echo=$ac_try;;
+esac
+eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
+$as_echo "$ac_try_echo"; } >&5
+  (eval "$ac_compiler $ac_option >&5") 2>conftest.err
+  ac_status=$?
+  if test -s conftest.err; then
+    sed '10a\
+... rest of stderr output deleted ...
+         10q' conftest.err >conftest.er1
+    cat conftest.er1 >&5
+  fi
+  rm -f conftest.er1 conftest.err
+  $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+  test $ac_status = 0; }
+done
+
+cat confdefs.h - <<_ACEOF >conftest.$ac_ext
 /* end confdefs.h.  */
-#include <stdlib.h>
-#include <stdarg.h>
-#include <string.h>
-#include <float.h>
 
 int
 main ()
@@ -4810,802 +3711,657 @@ main ()
   return 0;
 }
 _ACEOF
-rm -f conftest.$ac_objext
-if { (ac_try="$ac_compile"
+ac_clean_files_save=$ac_clean_files
+ac_clean_files="$ac_clean_files a.out a.out.dSYM a.exe b.out"
+# Try to create an executable without -o first, disregard a.out.
+# It will help us diagnose broken compilers, and finding out an intuition
+# of exeext.
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking whether the C compiler works" >&5
+$as_echo_n "checking whether the C compiler works... " >&6; }
+ac_link_default=`$as_echo "$ac_link" | sed 's/ -o *conftest[^ ]*//'`
+
+# The possible output files:
+ac_files="a.out conftest.exe conftest a.exe a_out.exe b.out conftest.*"
+
+ac_rmfiles=
+for ac_file in $ac_files
+do
+  case $ac_file in
+    *.$ac_ext | *.xcoff | *.tds | *.d | *.pdb | *.xSYM | *.bb | *.bbg | *.map | *.inf | *.dSYM | *.o | *.obj ) ;;
+    * ) ac_rmfiles="$ac_rmfiles $ac_file";;
+  esac
+done
+rm -f $ac_rmfiles
+
+if { { ac_try="$ac_link_default"
 case "(($ac_try" in
   *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
   *) ac_try_echo=$ac_try;;
 esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_compile") 2>conftest.er1
+eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
+$as_echo "$ac_try_echo"; } >&5
+  (eval "$ac_link_default") 2>&5
   ac_status=$?
-  grep -v '^ *+' conftest.er1 >conftest.err
-  rm -f conftest.er1
-  cat conftest.err >&5
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } && {
-	 test -z "$ac_c_werror_flag" ||
-	 test ! -s conftest.err
-       } && test -s conftest.$ac_objext; then
-  ac_cv_header_stdc=yes
-else
-  $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
-
-	ac_cv_header_stdc=no
-fi
-
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
-
-if test $ac_cv_header_stdc = yes; then
-  # SunOS 4.x string.h does not declare mem*, contrary to ANSI.
-  cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
-/* end confdefs.h.  */
-#include <string.h>
+  $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+  test $ac_status = 0; }; then :
+  # Autoconf-2.13 could set the ac_cv_exeext variable to `no'.
+# So ignore a value of `no', otherwise this would lead to `EXEEXT = no'
+# in a Makefile.  We should not override ac_cv_exeext if it was cached,
+# so that the user can short-circuit this test for compilers unknown to
+# Autoconf.
+for ac_file in $ac_files ''
+do
+  test -f "$ac_file" || continue
+  case $ac_file in
+    *.$ac_ext | *.xcoff | *.tds | *.d | *.pdb | *.xSYM | *.bb | *.bbg | *.map | *.inf | *.dSYM | *.o | *.obj )
+	;;
+    [ab].out )
+	# We found the default executable, but exeext='' is most
+	# certainly right.
+	break;;
+    *.* )
+	if test "${ac_cv_exeext+set}" = set && test "$ac_cv_exeext" != no;
+	then :; else
+	   ac_cv_exeext=`expr "$ac_file" : '[^.]*\(\..*\)'`
+	fi
+	# We set ac_cv_exeext here because the later test for it is not
+	# safe: cross compilers may not add the suffix if given an `-o'
+	# argument, so we may need to know it at that point already.
+	# Even if this section looks crufty: it has the advantage of
+	# actually working.
+	break;;
+    * )
+	break;;
+  esac
+done
+test "$ac_cv_exeext" = no && ac_cv_exeext=
 
-_ACEOF
-if (eval "$ac_cpp conftest.$ac_ext") 2>&5 |
-  $EGREP "memchr" >/dev/null 2>&1; then
-  :
 else
-  ac_cv_header_stdc=no
+  ac_file=''
 fi
-rm -f conftest*
+if test -z "$ac_file"; then :
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
+$as_echo "no" >&6; }
+$as_echo "$as_me: failed program was:" >&5
+sed 's/^/| /' conftest.$ac_ext >&5
 
+{ { $as_echo "$as_me:${as_lineno-$LINENO}: error: in \`$ac_pwd':" >&5
+$as_echo "$as_me: error: in \`$ac_pwd':" >&2;}
+as_fn_error 77 "C compiler cannot create executables
+See \`config.log' for more details" "$LINENO" 5; }
+else
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: yes" >&5
+$as_echo "yes" >&6; }
 fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for C compiler default output file name" >&5
+$as_echo_n "checking for C compiler default output file name... " >&6; }
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_file" >&5
+$as_echo "$ac_file" >&6; }
+ac_exeext=$ac_cv_exeext
 
-if test $ac_cv_header_stdc = yes; then
-  # ISC 2.0.2 stdlib.h does not declare free, contrary to ANSI.
-  cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
-/* end confdefs.h.  */
-#include <stdlib.h>
-
-_ACEOF
-if (eval "$ac_cpp conftest.$ac_ext") 2>&5 |
-  $EGREP "free" >/dev/null 2>&1; then
-  :
+rm -f -r a.out a.out.dSYM a.exe conftest$ac_cv_exeext b.out
+ac_clean_files=$ac_clean_files_save
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for suffix of executables" >&5
+$as_echo_n "checking for suffix of executables... " >&6; }
+if { { ac_try="$ac_link"
+case "(($ac_try" in
+  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
+  *) ac_try_echo=$ac_try;;
+esac
+eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
+$as_echo "$ac_try_echo"; } >&5
+  (eval "$ac_link") 2>&5
+  ac_status=$?
+  $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+  test $ac_status = 0; }; then :
+  # If both `conftest.exe' and `conftest' are `present' (well, observable)
+# catch `conftest.exe'.  For instance with Cygwin, `ls conftest' will
+# work properly (i.e., refer to `conftest.exe'), while it won't with
+# `rm'.
+for ac_file in conftest.exe conftest conftest.*; do
+  test -f "$ac_file" || continue
+  case $ac_file in
+    *.$ac_ext | *.xcoff | *.tds | *.d | *.pdb | *.xSYM | *.bb | *.bbg | *.map | *.inf | *.dSYM | *.o | *.obj ) ;;
+    *.* ) ac_cv_exeext=`expr "$ac_file" : '[^.]*\(\..*\)'`
+	  break;;
+    * ) break;;
+  esac
+done
 else
-  ac_cv_header_stdc=no
-fi
-rm -f conftest*
-
+  { { $as_echo "$as_me:${as_lineno-$LINENO}: error: in \`$ac_pwd':" >&5
+$as_echo "$as_me: error: in \`$ac_pwd':" >&2;}
+as_fn_error $? "cannot compute suffix of executables: cannot compile and link
+See \`config.log' for more details" "$LINENO" 5; }
 fi
+rm -f conftest conftest$ac_cv_exeext
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_exeext" >&5
+$as_echo "$ac_cv_exeext" >&6; }
 
-if test $ac_cv_header_stdc = yes; then
-  # /bin/cc in Irix-4.0.5 gets non-ANSI ctype macros unless using -ansi.
-  if test "$cross_compiling" = yes; then
-  :
-else
-  cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
+rm -f conftest.$ac_ext
+EXEEXT=$ac_cv_exeext
+ac_exeext=$EXEEXT
+cat confdefs.h - <<_ACEOF >conftest.$ac_ext
 /* end confdefs.h.  */
-#include <ctype.h>
-#include <stdlib.h>
-#if ((' ' & 0x0FF) == 0x020)
-# define ISLOWER(c) ('a' <= (c) && (c) <= 'z')
-# define TOUPPER(c) (ISLOWER(c) ? 'A' + ((c) - 'a') : (c))
-#else
-# define ISLOWER(c) \
-		   (('a' <= (c) && (c) <= 'i') \
-		     || ('j' <= (c) && (c) <= 'r') \
-		     || ('s' <= (c) && (c) <= 'z'))
-# define TOUPPER(c) (ISLOWER(c) ? ((c) | 0x40) : (c))
-#endif
-
-#define XOR(e, f) (((e) && !(f)) || (!(e) && (f)))
+#include <stdio.h>
 int
 main ()
 {
-  int i;
-  for (i = 0; i < 256; i++)
-    if (XOR (islower (i), ISLOWER (i))
-	|| toupper (i) != TOUPPER (i))
-      return 2;
+FILE *f = fopen ("conftest.out", "w");
+ return ferror (f) || fclose (f) != 0;
+
+  ;
   return 0;
 }
 _ACEOF
-rm -f conftest$ac_exeext
-if { (ac_try="$ac_link"
+ac_clean_files="$ac_clean_files conftest.out"
+# Check that the compiler produces executables we can run.  If not, either
+# the compiler is broken, or we cross compile.
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking whether we are cross compiling" >&5
+$as_echo_n "checking whether we are cross compiling... " >&6; }
+if test "$cross_compiling" != yes; then
+  { { ac_try="$ac_link"
 case "(($ac_try" in
   *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
   *) ac_try_echo=$ac_try;;
 esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
+eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
+$as_echo "$ac_try_echo"; } >&5
   (eval "$ac_link") 2>&5
   ac_status=$?
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } && { ac_try='./conftest$ac_exeext'
-  { (case "(($ac_try" in
+  $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+  test $ac_status = 0; }
+  if { ac_try='./conftest$ac_cv_exeext'
+  { { case "(($ac_try" in
   *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
   *) ac_try_echo=$ac_try;;
 esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
+eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
+$as_echo "$ac_try_echo"; } >&5
   (eval "$ac_try") 2>&5
   ac_status=$?
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); }; }; then
-  :
-else
-  $as_echo "$as_me: program exited with status $ac_status" >&5
-$as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
-
-( exit $ac_status )
-ac_cv_header_stdc=no
-fi
-rm -rf conftest.dSYM
-rm -f core *.core core.conftest.* gmon.out bb.out conftest$ac_exeext conftest.$ac_objext conftest.$ac_ext
-fi
-
-
-fi
-fi
-{ $as_echo "$as_me:$LINENO: result: $ac_cv_header_stdc" >&5
-$as_echo "$ac_cv_header_stdc" >&6; }
-if test $ac_cv_header_stdc = yes; then
-
-cat >>confdefs.h <<\_ACEOF
-#define STDC_HEADERS 1
-_ACEOF
-
+  $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+  test $ac_status = 0; }; }; then
+    cross_compiling=no
+  else
+    if test "$cross_compiling" = maybe; then
+	cross_compiling=yes
+    else
+	{ { $as_echo "$as_me:${as_lineno-$LINENO}: error: in \`$ac_pwd':" >&5
+$as_echo "$as_me: error: in \`$ac_pwd':" >&2;}
+as_fn_error $? "cannot run C compiled programs.
+If you meant to cross compile, use \`--host'.
+See \`config.log' for more details" "$LINENO" 5; }
+    fi
+  fi
 fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $cross_compiling" >&5
+$as_echo "$cross_compiling" >&6; }
 
-# On IRIX 5.3, sys/types and inttypes.h are conflicting.
-
-
-
-
-
-
-
-
-
-for ac_header in sys/types.h sys/stat.h stdlib.h string.h memory.h strings.h \
-		  inttypes.h stdint.h unistd.h
-do
-as_ac_Header=`$as_echo "ac_cv_header_$ac_header" | $as_tr_sh`
-{ $as_echo "$as_me:$LINENO: checking for $ac_header" >&5
-$as_echo_n "checking for $ac_header... " >&6; }
-if { as_var=$as_ac_Header; eval "test \"\${$as_var+set}\" = set"; }; then
+rm -f conftest.$ac_ext conftest$ac_cv_exeext conftest.out
+ac_clean_files=$ac_clean_files_save
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for suffix of object files" >&5
+$as_echo_n "checking for suffix of object files... " >&6; }
+if ${ac_cv_objext+:} false; then :
   $as_echo_n "(cached) " >&6
 else
-  cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
 /* end confdefs.h.  */
-$ac_includes_default
 
-#include <$ac_header>
+int
+main ()
+{
+
+  ;
+  return 0;
+}
 _ACEOF
-rm -f conftest.$ac_objext
-if { (ac_try="$ac_compile"
+rm -f conftest.o conftest.obj
+if { { ac_try="$ac_compile"
 case "(($ac_try" in
   *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
   *) ac_try_echo=$ac_try;;
 esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_compile") 2>conftest.er1
+eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
+$as_echo "$ac_try_echo"; } >&5
+  (eval "$ac_compile") 2>&5
   ac_status=$?
-  grep -v '^ *+' conftest.er1 >conftest.err
-  rm -f conftest.er1
-  cat conftest.err >&5
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } && {
-	 test -z "$ac_c_werror_flag" ||
-	 test ! -s conftest.err
-       } && test -s conftest.$ac_objext; then
-  eval "$as_ac_Header=yes"
+  $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+  test $ac_status = 0; }; then :
+  for ac_file in conftest.o conftest.obj conftest.*; do
+  test -f "$ac_file" || continue;
+  case $ac_file in
+    *.$ac_ext | *.xcoff | *.tds | *.d | *.pdb | *.xSYM | *.bb | *.bbg | *.map | *.inf | *.dSYM ) ;;
+    *) ac_cv_objext=`expr "$ac_file" : '.*\.\(.*\)'`
+       break;;
+  esac
+done
 else
   $as_echo "$as_me: failed program was:" >&5
 sed 's/^/| /' conftest.$ac_ext >&5
 
-	eval "$as_ac_Header=no"
-fi
-
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
+{ { $as_echo "$as_me:${as_lineno-$LINENO}: error: in \`$ac_pwd':" >&5
+$as_echo "$as_me: error: in \`$ac_pwd':" >&2;}
+as_fn_error $? "cannot compute suffix of object files: cannot compile
+See \`config.log' for more details" "$LINENO" 5; }
 fi
-ac_res=`eval 'as_val=${'$as_ac_Header'}
-		 $as_echo "$as_val"'`
-	       { $as_echo "$as_me:$LINENO: result: $ac_res" >&5
-$as_echo "$ac_res" >&6; }
-as_val=`eval 'as_val=${'$as_ac_Header'}
-		 $as_echo "$as_val"'`
-   if test "x$as_val" = x""yes; then
-  cat >>confdefs.h <<_ACEOF
-#define `$as_echo "HAVE_$ac_header" | $as_tr_cpp` 1
-_ACEOF
-
+rm -f conftest.$ac_cv_objext conftest.$ac_ext
 fi
-
-done
-
-
-{ $as_echo "$as_me:$LINENO: checking whether strerror_r is declared" >&5
-$as_echo_n "checking whether strerror_r is declared... " >&6; }
-if test "${ac_cv_have_decl_strerror_r+set}" = set; then
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_objext" >&5
+$as_echo "$ac_cv_objext" >&6; }
+OBJEXT=$ac_cv_objext
+ac_objext=$OBJEXT
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking whether we are using the GNU C compiler" >&5
+$as_echo_n "checking whether we are using the GNU C compiler... " >&6; }
+if ${ac_cv_c_compiler_gnu+:} false; then :
   $as_echo_n "(cached) " >&6
 else
-  cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
 /* end confdefs.h.  */
-$ac_includes_default
+
 int
 main ()
 {
-#ifndef strerror_r
-  (void) strerror_r;
+#ifndef __GNUC__
+       choke me
 #endif
 
   ;
   return 0;
 }
 _ACEOF
-rm -f conftest.$ac_objext
-if { (ac_try="$ac_compile"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_compile") 2>conftest.er1
-  ac_status=$?
-  grep -v '^ *+' conftest.er1 >conftest.err
-  rm -f conftest.er1
-  cat conftest.err >&5
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } && {
-	 test -z "$ac_c_werror_flag" ||
-	 test ! -s conftest.err
-       } && test -s conftest.$ac_objext; then
-  ac_cv_have_decl_strerror_r=yes
+if ac_fn_c_try_compile "$LINENO"; then :
+  ac_compiler_gnu=yes
 else
-  $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
-
-	ac_cv_have_decl_strerror_r=no
+  ac_compiler_gnu=no
 fi
-
 rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
-fi
-{ $as_echo "$as_me:$LINENO: result: $ac_cv_have_decl_strerror_r" >&5
-$as_echo "$ac_cv_have_decl_strerror_r" >&6; }
-if test "x$ac_cv_have_decl_strerror_r" = x""yes; then
-
-cat >>confdefs.h <<_ACEOF
-#define HAVE_DECL_STRERROR_R 1
-_ACEOF
-
+ac_cv_c_compiler_gnu=$ac_compiler_gnu
 
+fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_c_compiler_gnu" >&5
+$as_echo "$ac_cv_c_compiler_gnu" >&6; }
+if test $ac_compiler_gnu = yes; then
+  GCC=yes
 else
-  cat >>confdefs.h <<_ACEOF
-#define HAVE_DECL_STRERROR_R 0
-_ACEOF
-
-
+  GCC=
 fi
-
-
-
-for ac_func in strerror_r
-do
-as_ac_var=`$as_echo "ac_cv_func_$ac_func" | $as_tr_sh`
-{ $as_echo "$as_me:$LINENO: checking for $ac_func" >&5
-$as_echo_n "checking for $ac_func... " >&6; }
-if { as_var=$as_ac_var; eval "test \"\${$as_var+set}\" = set"; }; then
+ac_test_CFLAGS=${CFLAGS+set}
+ac_save_CFLAGS=$CFLAGS
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking whether $CC accepts -g" >&5
+$as_echo_n "checking whether $CC accepts -g... " >&6; }
+if ${ac_cv_prog_cc_g+:} false; then :
   $as_echo_n "(cached) " >&6
 else
-  cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
+  ac_save_c_werror_flag=$ac_c_werror_flag
+   ac_c_werror_flag=yes
+   ac_cv_prog_cc_g=no
+   CFLAGS="-g"
+   cat confdefs.h - <<_ACEOF >conftest.$ac_ext
 /* end confdefs.h.  */
-/* Define $ac_func to an innocuous variant, in case <limits.h> declares $ac_func.
-   For example, HP-UX 11i <limits.h> declares gettimeofday.  */
-#define $ac_func innocuous_$ac_func
-
-/* System header to define __stub macros and hopefully few prototypes,
-    which can conflict with char $ac_func (); below.
-    Prefer <limits.h> to <assert.h> if __STDC__ is defined, since
-    <limits.h> exists even on freestanding compilers.  */
-
-#ifdef __STDC__
-# include <limits.h>
-#else
-# include <assert.h>
-#endif
 
-#undef $ac_func
+int
+main ()
+{
 
-/* Override any GCC internal prototype to avoid an error.
-   Use char because int might match the return type of a GCC
-   builtin and then its argument prototype would still apply.  */
-#ifdef __cplusplus
-extern "C"
-#endif
-char $ac_func ();
-/* The GNU C library defines this for functions which it implements
-    to always fail with ENOSYS.  Some functions are actually named
-    something starting with __ and the normal name is an alias.  */
-#if defined __stub_$ac_func || defined __stub___$ac_func
-choke me
-#endif
+  ;
+  return 0;
+}
+_ACEOF
+if ac_fn_c_try_compile "$LINENO"; then :
+  ac_cv_prog_cc_g=yes
+else
+  CFLAGS=""
+      cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
 
 int
 main ()
 {
-return $ac_func ();
+
   ;
   return 0;
 }
 _ACEOF
-rm -f conftest.$ac_objext conftest$ac_exeext
-if { (ac_try="$ac_link"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_link") 2>conftest.er1
-  ac_status=$?
-  grep -v '^ *+' conftest.er1 >conftest.err
-  rm -f conftest.er1
-  cat conftest.err >&5
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } && {
-	 test -z "$ac_c_werror_flag" ||
-	 test ! -s conftest.err
-       } && test -s conftest$ac_exeext && {
-	 test "$cross_compiling" = yes ||
-	 $as_test_x conftest$ac_exeext
-       }; then
-  eval "$as_ac_var=yes"
+if ac_fn_c_try_compile "$LINENO"; then :
+
 else
-  $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
+  ac_c_werror_flag=$ac_save_c_werror_flag
+	 CFLAGS="-g"
+	 cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
 
-	eval "$as_ac_var=no"
-fi
+int
+main ()
+{
 
-rm -rf conftest.dSYM
-rm -f core conftest.err conftest.$ac_objext conftest_ipa8_conftest.oo \
-      conftest$ac_exeext conftest.$ac_ext
-fi
-ac_res=`eval 'as_val=${'$as_ac_var'}
-		 $as_echo "$as_val"'`
-	       { $as_echo "$as_me:$LINENO: result: $ac_res" >&5
-$as_echo "$ac_res" >&6; }
-as_val=`eval 'as_val=${'$as_ac_var'}
-		 $as_echo "$as_val"'`
-   if test "x$as_val" = x""yes; then
-  cat >>confdefs.h <<_ACEOF
-#define `$as_echo "HAVE_$ac_func" | $as_tr_cpp` 1
+  ;
+  return 0;
+}
 _ACEOF
-
+if ac_fn_c_try_compile "$LINENO"; then :
+  ac_cv_prog_cc_g=yes
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
+   ac_c_werror_flag=$ac_save_c_werror_flag
+fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_prog_cc_g" >&5
+$as_echo "$ac_cv_prog_cc_g" >&6; }
+if test "$ac_test_CFLAGS" = set; then
+  CFLAGS=$ac_save_CFLAGS
+elif test $ac_cv_prog_cc_g = yes; then
+  if test "$GCC" = yes; then
+    CFLAGS="-g -O2"
+  else
+    CFLAGS="-g"
+  fi
+else
+  if test "$GCC" = yes; then
+    CFLAGS="-O2"
+  else
+    CFLAGS=
+  fi
 fi
-done
-
-{ $as_echo "$as_me:$LINENO: checking whether strerror_r returns char *" >&5
-$as_echo_n "checking whether strerror_r returns char *... " >&6; }
-if test "${ac_cv_func_strerror_r_char_p+set}" = set; then
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $CC option to accept ISO C89" >&5
+$as_echo_n "checking for $CC option to accept ISO C89... " >&6; }
+if ${ac_cv_prog_cc_c89+:} false; then :
   $as_echo_n "(cached) " >&6
 else
-
-    ac_cv_func_strerror_r_char_p=no
-    if test $ac_cv_have_decl_strerror_r = yes; then
-      cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
+  ac_cv_prog_cc_c89=no
+ac_save_CC=$CC
+cat confdefs.h - <<_ACEOF >conftest.$ac_ext
 /* end confdefs.h.  */
-$ac_includes_default
-int
-main ()
+#include <stdarg.h>
+#include <stdio.h>
+#include <sys/types.h>
+#include <sys/stat.h>
+/* Most of the following tests are stolen from RCS 5.7's src/conf.sh.  */
+struct buf { int x; };
+FILE * (*rcsopen) (struct buf *, struct stat *, int);
+static char *e (p, i)
+     char **p;
+     int i;
 {
-
-	  char buf[100];
-	  char x = *strerror_r (0, buf, sizeof buf);
-	  char *p = strerror_r (0, buf, sizeof buf);
-	  return !p || x;
-
-  ;
-  return 0;
+  return p[i];
+}
+static char *f (char * (*g) (char **, int), char **p, ...)
+{
+  char *s;
+  va_list v;
+  va_start (v,p);
+  s = g (p, va_arg (v,int));
+  va_end (v);
+  return s;
 }
-_ACEOF
-rm -f conftest.$ac_objext
-if { (ac_try="$ac_compile"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_compile") 2>conftest.er1
-  ac_status=$?
-  grep -v '^ *+' conftest.er1 >conftest.err
-  rm -f conftest.er1
-  cat conftest.err >&5
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } && {
-	 test -z "$ac_c_werror_flag" ||
-	 test ! -s conftest.err
-       } && test -s conftest.$ac_objext; then
-  ac_cv_func_strerror_r_char_p=yes
-else
-  $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
 
+/* OSF 4.0 Compaq cc is some sort of almost-ANSI by default.  It has
+   function prototypes and stuff, but not '\xHH' hex character constants.
+   These don't provoke an error unfortunately, instead are silently treated
+   as 'x'.  The following induces an error, until -std is added to get
+   proper ANSI mode.  Curiously '\x00'!='x' always comes out true, for an
+   array size at least.  It's necessary to write '\x00'==0 to get something
+   that's true only with -std.  */
+int osf4_cc_array ['\x00' == 0 ? 1 : -1];
 
-fi
+/* IBM C 6 for AIX is almost-ANSI by default, but it replaces macro parameters
+   inside strings and character constants.  */
+#define FOO(x) 'x'
+int xlc6_cc_array[FOO(a) == 'x' ? 1 : -1];
 
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
-    else
-      # strerror_r is not declared.  Choose between
-      # systems that have relatively inaccessible declarations for the
-      # function.  BeOS and DEC UNIX 4.0 fall in this category, but the
-      # former has a strerror_r that returns char*, while the latter
-      # has a strerror_r that returns `int'.
-      # This test should segfault on the DEC system.
-      if test "$cross_compiling" = yes; then
-  :
-else
-  cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
-/* end confdefs.h.  */
-$ac_includes_default
-	extern char *strerror_r ();
+int test (int i, double x);
+struct s1 {int (*f) (int a);};
+struct s2 {int (*f) (double a);};
+int pairnames (int, char **, FILE *(*)(struct buf *, struct stat *, int), int, int);
+int argc;
+char **argv;
 int
 main ()
 {
-char buf[100];
-	  char x = *strerror_r (0, buf, sizeof buf);
-	  return ! isalpha (x);
+return f (e, argv, 0) != argv[0]  ||  f (e, argv, 1) != argv[1];
   ;
   return 0;
 }
 _ACEOF
-rm -f conftest$ac_exeext
-if { (ac_try="$ac_link"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_link") 2>&5
-  ac_status=$?
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } && { ac_try='./conftest$ac_exeext'
-  { (case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_try") 2>&5
-  ac_status=$?
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); }; }; then
-  ac_cv_func_strerror_r_char_p=yes
-else
-  $as_echo "$as_me: program exited with status $ac_status" >&5
-$as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
-
-fi
-rm -rf conftest.dSYM
-rm -f core *.core core.conftest.* gmon.out bb.out conftest$ac_exeext conftest.$ac_objext conftest.$ac_ext
+for ac_arg in '' -qlanglvl=extc89 -qlanglvl=ansi -std \
+	-Ae "-Aa -D_HPUX_SOURCE" "-Xc -D__EXTENSIONS__"
+do
+  CC="$ac_save_CC $ac_arg"
+  if ac_fn_c_try_compile "$LINENO"; then :
+  ac_cv_prog_cc_c89=$ac_arg
 fi
-
-
-    fi
+rm -f core conftest.err conftest.$ac_objext
+  test "x$ac_cv_prog_cc_c89" != "xno" && break
+done
+rm -f conftest.$ac_ext
+CC=$ac_save_CC
 
 fi
-{ $as_echo "$as_me:$LINENO: result: $ac_cv_func_strerror_r_char_p" >&5
-$as_echo "$ac_cv_func_strerror_r_char_p" >&6; }
-if test $ac_cv_func_strerror_r_char_p = yes; then
-
-cat >>confdefs.h <<\_ACEOF
-#define STRERROR_R_CHAR_P 1
-_ACEOF
+# AC_CACHE_VAL
+case "x$ac_cv_prog_cc_c89" in
+  x)
+    { $as_echo "$as_me:${as_lineno-$LINENO}: result: none needed" >&5
+$as_echo "none needed" >&6; } ;;
+  xno)
+    { $as_echo "$as_me:${as_lineno-$LINENO}: result: unsupported" >&5
+$as_echo "unsupported" >&6; } ;;
+  *)
+    CC="$CC $ac_cv_prog_cc_c89"
+    { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_prog_cc_c89" >&5
+$as_echo "$ac_cv_prog_cc_c89" >&6; } ;;
+esac
+if test "x$ac_cv_prog_cc_c89" != xno; then :
 
 fi
 
+ac_ext=c
+ac_cpp='$CPP $CPPFLAGS'
+ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
+ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
+ac_compiler_gnu=$ac_cv_c_compiler_gnu
 
+depcc="$CC"   am_compiler_list=
 
-for ac_header in execinfo.h
-do
-as_ac_Header=`$as_echo "ac_cv_header_$ac_header" | $as_tr_sh`
-if { as_var=$as_ac_Header; eval "test \"\${$as_var+set}\" = set"; }; then
-  { $as_echo "$as_me:$LINENO: checking for $ac_header" >&5
-$as_echo_n "checking for $ac_header... " >&6; }
-if { as_var=$as_ac_Header; eval "test \"\${$as_var+set}\" = set"; }; then
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking dependency style of $depcc" >&5
+$as_echo_n "checking dependency style of $depcc... " >&6; }
+if ${am_cv_CC_dependencies_compiler_type+:} false; then :
   $as_echo_n "(cached) " >&6
-fi
-ac_res=`eval 'as_val=${'$as_ac_Header'}
-		 $as_echo "$as_val"'`
-	       { $as_echo "$as_me:$LINENO: result: $ac_res" >&5
-$as_echo "$ac_res" >&6; }
-else
-  # Is the header compilable?
-{ $as_echo "$as_me:$LINENO: checking $ac_header usability" >&5
-$as_echo_n "checking $ac_header usability... " >&6; }
-cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
-/* end confdefs.h.  */
-$ac_includes_default
-#include <$ac_header>
-_ACEOF
-rm -f conftest.$ac_objext
-if { (ac_try="$ac_compile"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_compile") 2>conftest.er1
-  ac_status=$?
-  grep -v '^ *+' conftest.er1 >conftest.err
-  rm -f conftest.er1
-  cat conftest.err >&5
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } && {
-	 test -z "$ac_c_werror_flag" ||
-	 test ! -s conftest.err
-       } && test -s conftest.$ac_objext; then
-  ac_header_compiler=yes
 else
-  $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
-
-	ac_header_compiler=no
-fi
-
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
-{ $as_echo "$as_me:$LINENO: result: $ac_header_compiler" >&5
-$as_echo "$ac_header_compiler" >&6; }
+  if test -z "$AMDEP_TRUE" && test -f "$am_depcomp"; then
+  # We make a subdir and do the tests there.  Otherwise we can end up
+  # making bogus files that we don't know about and never remove.  For
+  # instance it was reported that on HP-UX the gcc test will end up
+  # making a dummy file named `D' -- because `-MD' means `put the output
+  # in D'.
+  rm -rf conftest.dir
+  mkdir conftest.dir
+  # Copy depcomp to subdir because otherwise we won't find it if we're
+  # using a relative directory.
+  cp "$am_depcomp" conftest.dir
+  cd conftest.dir
+  # We will build objects and dependencies in a subdirectory because
+  # it helps to detect inapplicable dependency modes.  For instance
+  # both Tru64's cc and ICC support -MD to output dependencies as a
+  # side effect of compilation, but ICC will put the dependencies in
+  # the current directory while Tru64 will put them in the object
+  # directory.
+  mkdir sub
 
-# Is the header present?
-{ $as_echo "$as_me:$LINENO: checking $ac_header presence" >&5
-$as_echo_n "checking $ac_header presence... " >&6; }
-cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
-/* end confdefs.h.  */
-#include <$ac_header>
-_ACEOF
-if { (ac_try="$ac_cpp conftest.$ac_ext"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_cpp conftest.$ac_ext") 2>conftest.er1
-  ac_status=$?
-  grep -v '^ *+' conftest.er1 >conftest.err
-  rm -f conftest.er1
-  cat conftest.err >&5
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } >/dev/null && {
-	 test -z "$ac_c_preproc_warn_flag$ac_c_werror_flag" ||
-	 test ! -s conftest.err
-       }; then
-  ac_header_preproc=yes
-else
-  $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
+  am_cv_CC_dependencies_compiler_type=none
+  if test "$am_compiler_list" = ""; then
+     am_compiler_list=`sed -n 's/^#*\([a-zA-Z0-9]*\))$/\1/p' < ./depcomp`
+  fi
+  am__universal=false
+  case " $depcc " in #(
+     *\ -arch\ *\ -arch\ *) am__universal=true ;;
+     esac
 
-  ac_header_preproc=no
-fi
+  for depmode in $am_compiler_list; do
+    # Setup a source with many dependencies, because some compilers
+    # like to wrap large dependency lists on column 80 (with \), and
+    # we should not choose a depcomp mode which is confused by this.
+    #
+    # We need to recreate these files for each test, as the compiler may
+    # overwrite some of them when testing with obscure command lines.
+    # This happens at least with the AIX C compiler.
+    : > sub/conftest.c
+    for i in 1 2 3 4 5 6; do
+      echo '#include "conftst'$i'.h"' >> sub/conftest.c
+      # Using `: > sub/conftst$i.h' creates only sub/conftst1.h with
+      # Solaris 8's {/usr,}/bin/sh.
+      touch sub/conftst$i.h
+    done
+    echo "${am__include} ${am__quote}sub/conftest.Po${am__quote}" > confmf
 
-rm -f conftest.err conftest.$ac_ext
-{ $as_echo "$as_me:$LINENO: result: $ac_header_preproc" >&5
-$as_echo "$ac_header_preproc" >&6; }
+    # We check with `-c' and `-o' for the sake of the "dashmstdout"
+    # mode.  It turns out that the SunPro C++ compiler does not properly
+    # handle `-M -o', and we need to detect this.  Also, some Intel
+    # versions had trouble with output in subdirs
+    am__obj=sub/conftest.${OBJEXT-o}
+    am__minus_obj="-o $am__obj"
+    case $depmode in
+    gcc)
+      # This depmode causes a compiler race in universal mode.
+      test "$am__universal" = false || continue
+      ;;
+    nosideeffect)
+      # after this tag, mechanisms are not by side-effect, so they'll
+      # only be used when explicitly requested
+      if test "x$enable_dependency_tracking" = xyes; then
+	continue
+      else
+	break
+      fi
+      ;;
+    msvc7 | msvc7msys | msvisualcpp | msvcmsys)
+      # This compiler won't grok `-c -o', but also, the minuso test has
+      # not run yet.  These depmodes are late enough in the game, and
+      # so weak that their functioning should not be impacted.
+      am__obj=conftest.${OBJEXT-o}
+      am__minus_obj=
+      ;;
+    none) break ;;
+    esac
+    if depmode=$depmode \
+       source=sub/conftest.c object=$am__obj \
+       depfile=sub/conftest.Po tmpdepfile=sub/conftest.TPo \
+       $SHELL ./depcomp $depcc -c $am__minus_obj sub/conftest.c \
+         >/dev/null 2>conftest.err &&
+       grep sub/conftst1.h sub/conftest.Po > /dev/null 2>&1 &&
+       grep sub/conftst6.h sub/conftest.Po > /dev/null 2>&1 &&
+       grep $am__obj sub/conftest.Po > /dev/null 2>&1 &&
+       ${MAKE-make} -s -f confmf > /dev/null 2>&1; then
+      # icc doesn't choke on unknown options, it will just issue warnings
+      # or remarks (even with -Werror).  So we grep stderr for any message
+      # that says an option was ignored or not supported.
+      # When given -MP, icc 7.0 and 7.1 complain thusly:
+      #   icc: Command line warning: ignoring option '-M'; no argument required
+      # The diagnosis changed in icc 8.0:
+      #   icc: Command line remark: option '-MP' not supported
+      if (grep 'ignoring option' conftest.err ||
+          grep 'not supported' conftest.err) >/dev/null 2>&1; then :; else
+        am_cv_CC_dependencies_compiler_type=$depmode
+        break
+      fi
+    fi
+  done
 
-# So?  What about this header?
-case $ac_header_compiler:$ac_header_preproc:$ac_c_preproc_warn_flag in
-  yes:no: )
-    { $as_echo "$as_me:$LINENO: WARNING: $ac_header: accepted by the compiler, rejected by the preprocessor!" >&5
-$as_echo "$as_me: WARNING: $ac_header: accepted by the compiler, rejected by the preprocessor!" >&2;}
-    { $as_echo "$as_me:$LINENO: WARNING: $ac_header: proceeding with the compiler's result" >&5
-$as_echo "$as_me: WARNING: $ac_header: proceeding with the compiler's result" >&2;}
-    ac_header_preproc=yes
-    ;;
-  no:yes:* )
-    { $as_echo "$as_me:$LINENO: WARNING: $ac_header: present but cannot be compiled" >&5
-$as_echo "$as_me: WARNING: $ac_header: present but cannot be compiled" >&2;}
-    { $as_echo "$as_me:$LINENO: WARNING: $ac_header:     check for missing prerequisite headers?" >&5
-$as_echo "$as_me: WARNING: $ac_header:     check for missing prerequisite headers?" >&2;}
-    { $as_echo "$as_me:$LINENO: WARNING: $ac_header: see the Autoconf documentation" >&5
-$as_echo "$as_me: WARNING: $ac_header: see the Autoconf documentation" >&2;}
-    { $as_echo "$as_me:$LINENO: WARNING: $ac_header:     section \"Present But Cannot Be Compiled\"" >&5
-$as_echo "$as_me: WARNING: $ac_header:     section \"Present But Cannot Be Compiled\"" >&2;}
-    { $as_echo "$as_me:$LINENO: WARNING: $ac_header: proceeding with the preprocessor's result" >&5
-$as_echo "$as_me: WARNING: $ac_header: proceeding with the preprocessor's result" >&2;}
-    { $as_echo "$as_me:$LINENO: WARNING: $ac_header: in the future, the compiler will take precedence" >&5
-$as_echo "$as_me: WARNING: $ac_header: in the future, the compiler will take precedence" >&2;}
-    ( cat <<\_ASBOX
-## ------------------------------- ##
-## Report this to gmarcais at umd.edu ##
-## ------------------------------- ##
-_ASBOX
-     ) | sed "s/^/$as_me: WARNING:     /" >&2
-    ;;
-esac
-{ $as_echo "$as_me:$LINENO: checking for $ac_header" >&5
-$as_echo_n "checking for $ac_header... " >&6; }
-if { as_var=$as_ac_Header; eval "test \"\${$as_var+set}\" = set"; }; then
-  $as_echo_n "(cached) " >&6
+  cd ..
+  rm -rf conftest.dir
 else
-  eval "$as_ac_Header=\$ac_header_preproc"
+  am_cv_CC_dependencies_compiler_type=none
 fi
-ac_res=`eval 'as_val=${'$as_ac_Header'}
-		 $as_echo "$as_val"'`
-	       { $as_echo "$as_me:$LINENO: result: $ac_res" >&5
-$as_echo "$ac_res" >&6; }
 
 fi
-as_val=`eval 'as_val=${'$as_ac_Header'}
-		 $as_echo "$as_val"'`
-   if test "x$as_val" = x""yes; then
-  cat >>confdefs.h <<_ACEOF
-#define `$as_echo "HAVE_$ac_header" | $as_tr_cpp` 1
-_ACEOF
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $am_cv_CC_dependencies_compiler_type" >&5
+$as_echo "$am_cv_CC_dependencies_compiler_type" >&6; }
+CCDEPMODE=depmode=$am_cv_CC_dependencies_compiler_type
 
+ if
+  test "x$enable_dependency_tracking" != xno \
+  && test "$am_cv_CC_dependencies_compiler_type" = gcc3; then
+  am__fastdepCC_TRUE=
+  am__fastdepCC_FALSE='#'
+else
+  am__fastdepCC_TRUE='#'
+  am__fastdepCC_FALSE=
 fi
 
-done
-
 
-{ $as_echo "$as_me:$LINENO: checking for siginfo_t.si_int" >&5
-$as_echo_n "checking for siginfo_t.si_int... " >&6; }
-if test "${ac_cv_member_siginfo_t_si_int+set}" = set; then
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for a sed that does not truncate output" >&5
+$as_echo_n "checking for a sed that does not truncate output... " >&6; }
+if ${ac_cv_path_SED+:} false; then :
   $as_echo_n "(cached) " >&6
 else
-  cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
-/* end confdefs.h.  */
-#include <signal.h>
-
-int
-main ()
-{
-static siginfo_t ac_aggr;
-if (ac_aggr.si_int)
-return 0;
-  ;
-  return 0;
-}
-_ACEOF
-rm -f conftest.$ac_objext
-if { (ac_try="$ac_compile"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
+            ac_script=s/aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa/bbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbb/
+     for ac_i in 1 2 3 4 5 6 7; do
+       ac_script="$ac_script$as_nl$ac_script"
+     done
+     echo "$ac_script" 2>/dev/null | sed 99q >conftest.sed
+     { ac_script=; unset ac_script;}
+     if test -z "$SED"; then
+  ac_path_SED_found=false
+  # Loop through the user's path and test for each of PROGNAME-LIST
+  as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+  IFS=$as_save_IFS
+  test -z "$as_dir" && as_dir=.
+    for ac_prog in sed gsed; do
+    for ac_exec_ext in '' $ac_executable_extensions; do
+      ac_path_SED="$as_dir/$ac_prog$ac_exec_ext"
+      { test -f "$ac_path_SED" && $as_test_x "$ac_path_SED"; } || continue
+# Check for GNU ac_path_SED and select it if it is found.
+  # Check for GNU $ac_path_SED
+case `"$ac_path_SED" --version 2>&1` in
+*GNU*)
+  ac_cv_path_SED="$ac_path_SED" ac_path_SED_found=:;;
+*)
+  ac_count=0
+  $as_echo_n 0123456789 >"conftest.in"
+  while :
+  do
+    cat "conftest.in" "conftest.in" >"conftest.tmp"
+    mv "conftest.tmp" "conftest.in"
+    cp "conftest.in" "conftest.nl"
+    $as_echo '' >> "conftest.nl"
+    "$ac_path_SED" -f conftest.sed < "conftest.nl" >"conftest.out" 2>/dev/null || break
+    diff "conftest.out" "conftest.nl" >/dev/null 2>&1 || break
+    as_fn_arith $ac_count + 1 && ac_count=$as_val
+    if test $ac_count -gt ${ac_path_SED_max-0}; then
+      # Best one so far, save it but keep looking for a better one
+      ac_cv_path_SED="$ac_path_SED"
+      ac_path_SED_max=$ac_count
+    fi
+    # 10*(2^10) chars as input seems more than enough
+    test $ac_count -gt 10 && break
+  done
+  rm -f conftest.in conftest.tmp conftest.nl conftest.out;;
 esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_compile") 2>conftest.er1
-  ac_status=$?
-  grep -v '^ *+' conftest.er1 >conftest.err
-  rm -f conftest.er1
-  cat conftest.err >&5
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } && {
-	 test -z "$ac_c_werror_flag" ||
-	 test ! -s conftest.err
-       } && test -s conftest.$ac_objext; then
-  ac_cv_member_siginfo_t_si_int=yes
-else
-  $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
-
-	cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
-/* end confdefs.h.  */
-#include <signal.h>
 
-int
-main ()
-{
-static siginfo_t ac_aggr;
-if (sizeof ac_aggr.si_int)
-return 0;
-  ;
-  return 0;
-}
-_ACEOF
-rm -f conftest.$ac_objext
-if { (ac_try="$ac_compile"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_compile") 2>conftest.er1
-  ac_status=$?
-  grep -v '^ *+' conftest.er1 >conftest.err
-  rm -f conftest.er1
-  cat conftest.err >&5
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } && {
-	 test -z "$ac_c_werror_flag" ||
-	 test ! -s conftest.err
-       } && test -s conftest.$ac_objext; then
-  ac_cv_member_siginfo_t_si_int=yes
+      $ac_path_SED_found && break 3
+    done
+  done
+  done
+IFS=$as_save_IFS
+  if test -z "$ac_cv_path_SED"; then
+    as_fn_error $? "no acceptable sed could be found in \$PATH" "$LINENO" 5
+  fi
 else
-  $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
-
-	ac_cv_member_siginfo_t_si_int=no
-fi
-
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
-fi
-
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
+  ac_cv_path_SED=$SED
 fi
-{ $as_echo "$as_me:$LINENO: result: $ac_cv_member_siginfo_t_si_int" >&5
-$as_echo "$ac_cv_member_siginfo_t_si_int" >&6; }
-if test "x$ac_cv_member_siginfo_t_si_int" = x""yes; then
-
-cat >>confdefs.h <<\_ACEOF
-#define HAVE_SI_INT 1
-_ACEOF
 
 fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_path_SED" >&5
+$as_echo "$ac_cv_path_SED" >&6; }
+ SED="$ac_cv_path_SED"
+  rm -f conftest.sed
 
+test -z "$SED" && SED=sed
+Xsed="$SED -e 1s/^X//"
 
-case `pwd` in
-  *\ * | *\	*)
-    { $as_echo "$as_me:$LINENO: WARNING: Libtool does not cope well with whitespace in \`pwd\`" >&5
-$as_echo "$as_me: WARNING: Libtool does not cope well with whitespace in \`pwd\`" >&2;} ;;
-esac
-
-
-
-macro_version='2.2.6b'
-macro_revision='1.3017'
 
 
 
@@ -5616,39 +4372,94 @@ macro_revision='1.3017'
 
 
 
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for grep that handles long lines and -e" >&5
+$as_echo_n "checking for grep that handles long lines and -e... " >&6; }
+if ${ac_cv_path_GREP+:} false; then :
+  $as_echo_n "(cached) " >&6
+else
+  if test -z "$GREP"; then
+  ac_path_GREP_found=false
+  # Loop through the user's path and test for each of PROGNAME-LIST
+  as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH$PATH_SEPARATOR/usr/xpg4/bin
+do
+  IFS=$as_save_IFS
+  test -z "$as_dir" && as_dir=.
+    for ac_prog in grep ggrep; do
+    for ac_exec_ext in '' $ac_executable_extensions; do
+      ac_path_GREP="$as_dir/$ac_prog$ac_exec_ext"
+      { test -f "$ac_path_GREP" && $as_test_x "$ac_path_GREP"; } || continue
+# Check for GNU ac_path_GREP and select it if it is found.
+  # Check for GNU $ac_path_GREP
+case `"$ac_path_GREP" --version 2>&1` in
+*GNU*)
+  ac_cv_path_GREP="$ac_path_GREP" ac_path_GREP_found=:;;
+*)
+  ac_count=0
+  $as_echo_n 0123456789 >"conftest.in"
+  while :
+  do
+    cat "conftest.in" "conftest.in" >"conftest.tmp"
+    mv "conftest.tmp" "conftest.in"
+    cp "conftest.in" "conftest.nl"
+    $as_echo 'GREP' >> "conftest.nl"
+    "$ac_path_GREP" -e 'GREP$' -e '-(cannot match)-' < "conftest.nl" >"conftest.out" 2>/dev/null || break
+    diff "conftest.out" "conftest.nl" >/dev/null 2>&1 || break
+    as_fn_arith $ac_count + 1 && ac_count=$as_val
+    if test $ac_count -gt ${ac_path_GREP_max-0}; then
+      # Best one so far, save it but keep looking for a better one
+      ac_cv_path_GREP="$ac_path_GREP"
+      ac_path_GREP_max=$ac_count
+    fi
+    # 10*(2^10) chars as input seems more than enough
+    test $ac_count -gt 10 && break
+  done
+  rm -f conftest.in conftest.tmp conftest.nl conftest.out;;
+esac
 
+      $ac_path_GREP_found && break 3
+    done
+  done
+  done
+IFS=$as_save_IFS
+  if test -z "$ac_cv_path_GREP"; then
+    as_fn_error $? "no acceptable grep could be found in $PATH$PATH_SEPARATOR/usr/xpg4/bin" "$LINENO" 5
+  fi
+else
+  ac_cv_path_GREP=$GREP
+fi
 
+fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_path_GREP" >&5
+$as_echo "$ac_cv_path_GREP" >&6; }
+ GREP="$ac_cv_path_GREP"
 
-ltmain="$ac_aux_dir/ltmain.sh"
 
-{ $as_echo "$as_me:$LINENO: checking for a sed that does not truncate output" >&5
-$as_echo_n "checking for a sed that does not truncate output... " >&6; }
-if test "${ac_cv_path_SED+set}" = set; then
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for egrep" >&5
+$as_echo_n "checking for egrep... " >&6; }
+if ${ac_cv_path_EGREP+:} false; then :
   $as_echo_n "(cached) " >&6
 else
-            ac_script=s/aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa/bbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbb/
-     for ac_i in 1 2 3 4 5 6 7; do
-       ac_script="$ac_script$as_nl$ac_script"
-     done
-     echo "$ac_script" 2>/dev/null | sed 99q >conftest.sed
-     $as_unset ac_script || ac_script=
-     if test -z "$SED"; then
-  ac_path_SED_found=false
+  if echo a | $GREP -E '(a|b)' >/dev/null 2>&1
+   then ac_cv_path_EGREP="$GREP -E"
+   else
+     if test -z "$EGREP"; then
+  ac_path_EGREP_found=false
   # Loop through the user's path and test for each of PROGNAME-LIST
   as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH
+for as_dir in $PATH$PATH_SEPARATOR/usr/xpg4/bin
 do
   IFS=$as_save_IFS
   test -z "$as_dir" && as_dir=.
-  for ac_prog in sed gsed; do
+    for ac_prog in egrep; do
     for ac_exec_ext in '' $ac_executable_extensions; do
-      ac_path_SED="$as_dir/$ac_prog$ac_exec_ext"
-      { test -f "$ac_path_SED" && $as_test_x "$ac_path_SED"; } || continue
-# Check for GNU ac_path_SED and select it if it is found.
-  # Check for GNU $ac_path_SED
-case `"$ac_path_SED" --version 2>&1` in
+      ac_path_EGREP="$as_dir/$ac_prog$ac_exec_ext"
+      { test -f "$ac_path_EGREP" && $as_test_x "$ac_path_EGREP"; } || continue
+# Check for GNU ac_path_EGREP and select it if it is found.
+  # Check for GNU $ac_path_EGREP
+case `"$ac_path_EGREP" --version 2>&1` in
 *GNU*)
-  ac_cv_path_SED="$ac_path_SED" ac_path_SED_found=:;;
+  ac_cv_path_EGREP="$ac_path_EGREP" ac_path_EGREP_found=:;;
 *)
   ac_count=0
   $as_echo_n 0123456789 >"conftest.in"
@@ -5657,14 +4468,14 @@ case `"$ac_path_SED" --version 2>&1` in
     cat "conftest.in" "conftest.in" >"conftest.tmp"
     mv "conftest.tmp" "conftest.in"
     cp "conftest.in" "conftest.nl"
-    $as_echo '' >> "conftest.nl"
-    "$ac_path_SED" -f conftest.sed < "conftest.nl" >"conftest.out" 2>/dev/null || break
+    $as_echo 'EGREP' >> "conftest.nl"
+    "$ac_path_EGREP" 'EGREP$' < "conftest.nl" >"conftest.out" 2>/dev/null || break
     diff "conftest.out" "conftest.nl" >/dev/null 2>&1 || break
-    ac_count=`expr $ac_count + 1`
-    if test $ac_count -gt ${ac_path_SED_max-0}; then
+    as_fn_arith $ac_count + 1 && ac_count=$as_val
+    if test $ac_count -gt ${ac_path_EGREP_max-0}; then
       # Best one so far, save it but keep looking for a better one
-      ac_cv_path_SED="$ac_path_SED"
-      ac_path_SED_max=$ac_count
+      ac_cv_path_EGREP="$ac_path_EGREP"
+      ac_path_EGREP_max=$ac_count
     fi
     # 10*(2^10) chars as input seems more than enough
     test $ac_count -gt 10 && break
@@ -5672,42 +4483,28 @@ case `"$ac_path_SED" --version 2>&1` in
   rm -f conftest.in conftest.tmp conftest.nl conftest.out;;
 esac
 
-      $ac_path_SED_found && break 3
+      $ac_path_EGREP_found && break 3
     done
   done
-done
+  done
 IFS=$as_save_IFS
-  if test -z "$ac_cv_path_SED"; then
-    { { $as_echo "$as_me:$LINENO: error: no acceptable sed could be found in \$PATH" >&5
-$as_echo "$as_me: error: no acceptable sed could be found in \$PATH" >&2;}
-   { (exit 1); exit 1; }; }
+  if test -z "$ac_cv_path_EGREP"; then
+    as_fn_error $? "no acceptable egrep could be found in $PATH$PATH_SEPARATOR/usr/xpg4/bin" "$LINENO" 5
   fi
 else
-  ac_cv_path_SED=$SED
+  ac_cv_path_EGREP=$EGREP
 fi
 
+   fi
 fi
-{ $as_echo "$as_me:$LINENO: result: $ac_cv_path_SED" >&5
-$as_echo "$ac_cv_path_SED" >&6; }
- SED="$ac_cv_path_SED"
-  rm -f conftest.sed
-
-test -z "$SED" && SED=sed
-Xsed="$SED -e 1s/^X//"
-
-
-
-
-
-
-
-
-
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_path_EGREP" >&5
+$as_echo "$ac_cv_path_EGREP" >&6; }
+ EGREP="$ac_cv_path_EGREP"
 
 
-{ $as_echo "$as_me:$LINENO: checking for fgrep" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for fgrep" >&5
 $as_echo_n "checking for fgrep... " >&6; }
-if test "${ac_cv_path_FGREP+set}" = set; then
+if ${ac_cv_path_FGREP+:} false; then :
   $as_echo_n "(cached) " >&6
 else
   if echo 'ab*c' | $GREP -F 'ab*c' >/dev/null 2>&1
@@ -5721,7 +4518,7 @@ for as_dir in $PATH$PATH_SEPARATOR/usr/xpg4/bin
 do
   IFS=$as_save_IFS
   test -z "$as_dir" && as_dir=.
-  for ac_prog in fgrep; do
+    for ac_prog in fgrep; do
     for ac_exec_ext in '' $ac_executable_extensions; do
       ac_path_FGREP="$as_dir/$ac_prog$ac_exec_ext"
       { test -f "$ac_path_FGREP" && $as_test_x "$ac_path_FGREP"; } || continue
@@ -5741,7 +4538,7 @@ case `"$ac_path_FGREP" --version 2>&1` in
     $as_echo 'FGREP' >> "conftest.nl"
     "$ac_path_FGREP" FGREP < "conftest.nl" >"conftest.out" 2>/dev/null || break
     diff "conftest.out" "conftest.nl" >/dev/null 2>&1 || break
-    ac_count=`expr $ac_count + 1`
+    as_fn_arith $ac_count + 1 && ac_count=$as_val
     if test $ac_count -gt ${ac_path_FGREP_max-0}; then
       # Best one so far, save it but keep looking for a better one
       ac_cv_path_FGREP="$ac_path_FGREP"
@@ -5756,12 +4553,10 @@ esac
       $ac_path_FGREP_found && break 3
     done
   done
-done
+  done
 IFS=$as_save_IFS
   if test -z "$ac_cv_path_FGREP"; then
-    { { $as_echo "$as_me:$LINENO: error: no acceptable fgrep could be found in $PATH$PATH_SEPARATOR/usr/xpg4/bin" >&5
-$as_echo "$as_me: error: no acceptable fgrep could be found in $PATH$PATH_SEPARATOR/usr/xpg4/bin" >&2;}
-   { (exit 1); exit 1; }; }
+    as_fn_error $? "no acceptable fgrep could be found in $PATH$PATH_SEPARATOR/usr/xpg4/bin" "$LINENO" 5
   fi
 else
   ac_cv_path_FGREP=$FGREP
@@ -5769,7 +4564,7 @@ fi
 
    fi
 fi
-{ $as_echo "$as_me:$LINENO: result: $ac_cv_path_FGREP" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_path_FGREP" >&5
 $as_echo "$ac_cv_path_FGREP" >&6; }
  FGREP="$ac_cv_path_FGREP"
 
@@ -5795,7 +4590,7 @@ test -z "$GREP" && GREP=grep
 
 
 # Check whether --with-gnu-ld was given.
-if test "${with_gnu_ld+set}" = set; then
+if test "${with_gnu_ld+set}" = set; then :
   withval=$with_gnu_ld; test "$withval" = no || with_gnu_ld=yes
 else
   with_gnu_ld=no
@@ -5804,7 +4599,7 @@ fi
 ac_prog=ld
 if test "$GCC" = yes; then
   # Check if gcc -print-prog-name=ld gives a path.
-  { $as_echo "$as_me:$LINENO: checking for ld used by $CC" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: checking for ld used by $CC" >&5
 $as_echo_n "checking for ld used by $CC... " >&6; }
   case $host in
   *-*-mingw*)
@@ -5834,13 +4629,13 @@ $as_echo_n "checking for ld used by $CC... " >&6; }
     ;;
   esac
 elif test "$with_gnu_ld" = yes; then
-  { $as_echo "$as_me:$LINENO: checking for GNU ld" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: checking for GNU ld" >&5
 $as_echo_n "checking for GNU ld... " >&6; }
 else
-  { $as_echo "$as_me:$LINENO: checking for non-GNU ld" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: checking for non-GNU ld" >&5
 $as_echo_n "checking for non-GNU ld... " >&6; }
 fi
-if test "${lt_cv_path_LD+set}" = set; then
+if ${lt_cv_path_LD+:} false; then :
   $as_echo_n "(cached) " >&6
 else
   if test -z "$LD"; then
@@ -5871,18 +4666,16 @@ fi
 
 LD="$lt_cv_path_LD"
 if test -n "$LD"; then
-  { $as_echo "$as_me:$LINENO: result: $LD" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $LD" >&5
 $as_echo "$LD" >&6; }
 else
-  { $as_echo "$as_me:$LINENO: result: no" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
 $as_echo "no" >&6; }
 fi
-test -z "$LD" && { { $as_echo "$as_me:$LINENO: error: no acceptable ld found in \$PATH" >&5
-$as_echo "$as_me: error: no acceptable ld found in \$PATH" >&2;}
-   { (exit 1); exit 1; }; }
-{ $as_echo "$as_me:$LINENO: checking if the linker ($LD) is GNU ld" >&5
+test -z "$LD" && as_fn_error $? "no acceptable ld found in \$PATH" "$LINENO" 5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking if the linker ($LD) is GNU ld" >&5
 $as_echo_n "checking if the linker ($LD) is GNU ld... " >&6; }
-if test "${lt_cv_prog_gnu_ld+set}" = set; then
+if ${lt_cv_prog_gnu_ld+:} false; then :
   $as_echo_n "(cached) " >&6
 else
   # I'd rather use --version here, but apparently some GNU lds only accept -v.
@@ -5895,7 +4688,7 @@ case `$LD -v 2>&1 </dev/null` in
   ;;
 esac
 fi
-{ $as_echo "$as_me:$LINENO: result: $lt_cv_prog_gnu_ld" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $lt_cv_prog_gnu_ld" >&5
 $as_echo "$lt_cv_prog_gnu_ld" >&6; }
 with_gnu_ld=$lt_cv_prog_gnu_ld
 
@@ -5907,9 +4700,9 @@ with_gnu_ld=$lt_cv_prog_gnu_ld
 
 
 
-{ $as_echo "$as_me:$LINENO: checking for BSD- or MS-compatible name lister (nm)" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for BSD- or MS-compatible name lister (nm)" >&5
 $as_echo_n "checking for BSD- or MS-compatible name lister (nm)... " >&6; }
-if test "${lt_cv_path_NM+set}" = set; then
+if ${lt_cv_path_NM+:} false; then :
   $as_echo_n "(cached) " >&6
 else
   if test -n "$NM"; then
@@ -5956,20 +4749,23 @@ else
   : ${lt_cv_path_NM=no}
 fi
 fi
-{ $as_echo "$as_me:$LINENO: result: $lt_cv_path_NM" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $lt_cv_path_NM" >&5
 $as_echo "$lt_cv_path_NM" >&6; }
 if test "$lt_cv_path_NM" != "no"; then
   NM="$lt_cv_path_NM"
 else
   # Didn't find any BSD compatible name lister, look for dumpbin.
-  if test -n "$ac_tool_prefix"; then
-  for ac_prog in "dumpbin -symbols" "link -dump -symbols"
+  if test -n "$DUMPBIN"; then :
+    # Let the user override the test.
+  else
+    if test -n "$ac_tool_prefix"; then
+  for ac_prog in dumpbin "link -dump"
   do
     # Extract the first word of "$ac_tool_prefix$ac_prog", so it can be a program name with args.
 set dummy $ac_tool_prefix$ac_prog; ac_word=$2
-{ $as_echo "$as_me:$LINENO: checking for $ac_word" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
 $as_echo_n "checking for $ac_word... " >&6; }
-if test "${ac_cv_prog_DUMPBIN+set}" = set; then
+if ${ac_cv_prog_DUMPBIN+:} false; then :
   $as_echo_n "(cached) " >&6
 else
   if test -n "$DUMPBIN"; then
@@ -5980,24 +4776,24 @@ for as_dir in $PATH
 do
   IFS=$as_save_IFS
   test -z "$as_dir" && as_dir=.
-  for ac_exec_ext in '' $ac_executable_extensions; do
+    for ac_exec_ext in '' $ac_executable_extensions; do
   if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
     ac_cv_prog_DUMPBIN="$ac_tool_prefix$ac_prog"
-    $as_echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5
+    $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
     break 2
   fi
 done
-done
+  done
 IFS=$as_save_IFS
 
 fi
 fi
 DUMPBIN=$ac_cv_prog_DUMPBIN
 if test -n "$DUMPBIN"; then
-  { $as_echo "$as_me:$LINENO: result: $DUMPBIN" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $DUMPBIN" >&5
 $as_echo "$DUMPBIN" >&6; }
 else
-  { $as_echo "$as_me:$LINENO: result: no" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
 $as_echo "no" >&6; }
 fi
 
@@ -6007,13 +4803,13 @@ fi
 fi
 if test -z "$DUMPBIN"; then
   ac_ct_DUMPBIN=$DUMPBIN
-  for ac_prog in "dumpbin -symbols" "link -dump -symbols"
+  for ac_prog in dumpbin "link -dump"
 do
   # Extract the first word of "$ac_prog", so it can be a program name with args.
 set dummy $ac_prog; ac_word=$2
-{ $as_echo "$as_me:$LINENO: checking for $ac_word" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
 $as_echo_n "checking for $ac_word... " >&6; }
-if test "${ac_cv_prog_ac_ct_DUMPBIN+set}" = set; then
+if ${ac_cv_prog_ac_ct_DUMPBIN+:} false; then :
   $as_echo_n "(cached) " >&6
 else
   if test -n "$ac_ct_DUMPBIN"; then
@@ -6024,24 +4820,24 @@ for as_dir in $PATH
 do
   IFS=$as_save_IFS
   test -z "$as_dir" && as_dir=.
-  for ac_exec_ext in '' $ac_executable_extensions; do
+    for ac_exec_ext in '' $ac_executable_extensions; do
   if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
     ac_cv_prog_ac_ct_DUMPBIN="$ac_prog"
-    $as_echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5
+    $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
     break 2
   fi
 done
-done
+  done
 IFS=$as_save_IFS
 
 fi
 fi
 ac_ct_DUMPBIN=$ac_cv_prog_ac_ct_DUMPBIN
 if test -n "$ac_ct_DUMPBIN"; then
-  { $as_echo "$as_me:$LINENO: result: $ac_ct_DUMPBIN" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_ct_DUMPBIN" >&5
 $as_echo "$ac_ct_DUMPBIN" >&6; }
 else
-  { $as_echo "$as_me:$LINENO: result: no" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
 $as_echo "no" >&6; }
 fi
 
@@ -6054,7 +4850,7 @@ done
   else
     case $cross_compiling:$ac_tool_warned in
 yes:)
-{ $as_echo "$as_me:$LINENO: WARNING: using cross tools not prefixed with host triplet" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: using cross tools not prefixed with host triplet" >&5
 $as_echo "$as_me: WARNING: using cross tools not prefixed with host triplet" >&2;}
 ac_tool_warned=yes ;;
 esac
@@ -6062,6 +4858,15 @@ esac
   fi
 fi
 
+    case `$DUMPBIN -symbols /dev/null 2>&1 | sed '1q'` in
+    *COFF*)
+      DUMPBIN="$DUMPBIN -symbols"
+      ;;
+    *)
+      DUMPBIN=:
+      ;;
+    esac
+  fi
 
   if test "$DUMPBIN" != ":"; then
     NM="$DUMPBIN"
@@ -6074,44 +4879,44 @@ test -z "$NM" && NM=nm
 
 
 
-{ $as_echo "$as_me:$LINENO: checking the name lister ($NM) interface" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking the name lister ($NM) interface" >&5
 $as_echo_n "checking the name lister ($NM) interface... " >&6; }
-if test "${lt_cv_nm_interface+set}" = set; then
+if ${lt_cv_nm_interface+:} false; then :
   $as_echo_n "(cached) " >&6
 else
   lt_cv_nm_interface="BSD nm"
   echo "int some_variable = 0;" > conftest.$ac_ext
-  (eval echo "\"\$as_me:6084: $ac_compile\"" >&5)
+  (eval echo "\"\$as_me:$LINENO: $ac_compile\"" >&5)
   (eval "$ac_compile" 2>conftest.err)
   cat conftest.err >&5
-  (eval echo "\"\$as_me:6087: $NM \\\"conftest.$ac_objext\\\"\"" >&5)
+  (eval echo "\"\$as_me:$LINENO: $NM \\\"conftest.$ac_objext\\\"\"" >&5)
   (eval "$NM \"conftest.$ac_objext\"" 2>conftest.err > conftest.out)
   cat conftest.err >&5
-  (eval echo "\"\$as_me:6090: output\"" >&5)
+  (eval echo "\"\$as_me:$LINENO: output\"" >&5)
   cat conftest.out >&5
   if $GREP 'External.*some_variable' conftest.out > /dev/null; then
     lt_cv_nm_interface="MS dumpbin"
   fi
   rm -f conftest*
 fi
-{ $as_echo "$as_me:$LINENO: result: $lt_cv_nm_interface" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $lt_cv_nm_interface" >&5
 $as_echo "$lt_cv_nm_interface" >&6; }
 
-{ $as_echo "$as_me:$LINENO: checking whether ln -s works" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking whether ln -s works" >&5
 $as_echo_n "checking whether ln -s works... " >&6; }
 LN_S=$as_ln_s
 if test "$LN_S" = "ln -s"; then
-  { $as_echo "$as_me:$LINENO: result: yes" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: yes" >&5
 $as_echo "yes" >&6; }
 else
-  { $as_echo "$as_me:$LINENO: result: no, using $LN_S" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no, using $LN_S" >&5
 $as_echo "no, using $LN_S" >&6; }
 fi
 
 # find the maximum length of command line arguments
-{ $as_echo "$as_me:$LINENO: checking the maximum length of command line arguments" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking the maximum length of command line arguments" >&5
 $as_echo_n "checking the maximum length of command line arguments... " >&6; }
-if test "${lt_cv_sys_max_cmd_len+set}" = set; then
+if ${lt_cv_sys_max_cmd_len+:} false; then :
   $as_echo_n "(cached) " >&6
 else
     i=0
@@ -6144,6 +4949,11 @@ else
     lt_cv_sys_max_cmd_len=8192;
     ;;
 
+  mint*)
+    # On MiNT this can take a long time and run out of memory.
+    lt_cv_sys_max_cmd_len=8192;
+    ;;
+
   amigaos*)
     # On AmigaOS with pdksh, this test takes hours, literally.
     # So we just punt and use a minimum line length of 8192.
@@ -6169,6 +4979,11 @@ else
     lt_cv_sys_max_cmd_len=196608
     ;;
 
+  os2*)
+    # The test takes a long time on OS/2.
+    lt_cv_sys_max_cmd_len=8192
+    ;;
+
   osf*)
     # Dr. Hans Ekkehard Plesser reports seeing a kernel panic running configure
     # due to this test when exec_disable_arg_limit is 1 on Tru64. It is not
@@ -6208,8 +5023,8 @@ else
       # If test is not a shell built-in, we'll probably end up computing a
       # maximum length that is only half of the actual maximum length, but
       # we can't tell.
-      while { test "X"`$SHELL $0 --fallback-echo "X$teststring$teststring" 2>/dev/null` \
-	         = "XX$teststring$teststring"; } >/dev/null 2>&1 &&
+      while { test "X"`env echo "$teststring$teststring" 2>/dev/null` \
+	         = "X$teststring$teststring"; } >/dev/null 2>&1 &&
 	      test $i != 17 # 1/2 MB should be enough
       do
         i=`expr $i + 1`
@@ -6229,10 +5044,10 @@ else
 fi
 
 if test -n $lt_cv_sys_max_cmd_len ; then
-  { $as_echo "$as_me:$LINENO: result: $lt_cv_sys_max_cmd_len" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $lt_cv_sys_max_cmd_len" >&5
 $as_echo "$lt_cv_sys_max_cmd_len" >&6; }
 else
-  { $as_echo "$as_me:$LINENO: result: none" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: none" >&5
 $as_echo "none" >&6; }
 fi
 max_cmd_len=$lt_cv_sys_max_cmd_len
@@ -6246,27 +5061,27 @@ max_cmd_len=$lt_cv_sys_max_cmd_len
 : ${MV="mv -f"}
 : ${RM="rm -f"}
 
-{ $as_echo "$as_me:$LINENO: checking whether the shell understands some XSI constructs" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking whether the shell understands some XSI constructs" >&5
 $as_echo_n "checking whether the shell understands some XSI constructs... " >&6; }
 # Try some XSI features
 xsi_shell=no
 ( _lt_dummy="a/b/c"
-  test "${_lt_dummy##*/},${_lt_dummy%/*},"${_lt_dummy%"$_lt_dummy"}, \
-      = c,a/b,, \
+  test "${_lt_dummy##*/},${_lt_dummy%/*},${_lt_dummy#??}"${_lt_dummy%"$_lt_dummy"}, \
+      = c,a/b,b/c, \
     && eval 'test $(( 1 + 1 )) -eq 2 \
     && test "${#_lt_dummy}" -eq 5' ) >/dev/null 2>&1 \
   && xsi_shell=yes
-{ $as_echo "$as_me:$LINENO: result: $xsi_shell" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $xsi_shell" >&5
 $as_echo "$xsi_shell" >&6; }
 
 
-{ $as_echo "$as_me:$LINENO: checking whether the shell understands \"+=\"" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking whether the shell understands \"+=\"" >&5
 $as_echo_n "checking whether the shell understands \"+=\"... " >&6; }
 lt_shell_append=no
 ( foo=bar; set foo baz; eval "$1+=\$2" && test "$foo" = barbaz ) \
     >/dev/null 2>&1 \
   && lt_shell_append=yes
-{ $as_echo "$as_me:$LINENO: result: $lt_shell_append" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $lt_shell_append" >&5
 $as_echo "$lt_shell_append" >&6; }
 
 
@@ -6301,14 +5116,88 @@ esac
 
 
 
-{ $as_echo "$as_me:$LINENO: checking for $LD option to reload object files" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking how to convert $build file names to $host format" >&5
+$as_echo_n "checking how to convert $build file names to $host format... " >&6; }
+if ${lt_cv_to_host_file_cmd+:} false; then :
+  $as_echo_n "(cached) " >&6
+else
+  case $host in
+  *-*-mingw* )
+    case $build in
+      *-*-mingw* ) # actually msys
+        lt_cv_to_host_file_cmd=func_convert_file_msys_to_w32
+        ;;
+      *-*-cygwin* )
+        lt_cv_to_host_file_cmd=func_convert_file_cygwin_to_w32
+        ;;
+      * ) # otherwise, assume *nix
+        lt_cv_to_host_file_cmd=func_convert_file_nix_to_w32
+        ;;
+    esac
+    ;;
+  *-*-cygwin* )
+    case $build in
+      *-*-mingw* ) # actually msys
+        lt_cv_to_host_file_cmd=func_convert_file_msys_to_cygwin
+        ;;
+      *-*-cygwin* )
+        lt_cv_to_host_file_cmd=func_convert_file_noop
+        ;;
+      * ) # otherwise, assume *nix
+        lt_cv_to_host_file_cmd=func_convert_file_nix_to_cygwin
+        ;;
+    esac
+    ;;
+  * ) # unhandled hosts (and "normal" native builds)
+    lt_cv_to_host_file_cmd=func_convert_file_noop
+    ;;
+esac
+
+fi
+
+to_host_file_cmd=$lt_cv_to_host_file_cmd
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $lt_cv_to_host_file_cmd" >&5
+$as_echo "$lt_cv_to_host_file_cmd" >&6; }
+
+
+
+
+
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking how to convert $build file names to toolchain format" >&5
+$as_echo_n "checking how to convert $build file names to toolchain format... " >&6; }
+if ${lt_cv_to_tool_file_cmd+:} false; then :
+  $as_echo_n "(cached) " >&6
+else
+  #assume ordinary cross tools, or native build.
+lt_cv_to_tool_file_cmd=func_convert_file_noop
+case $host in
+  *-*-mingw* )
+    case $build in
+      *-*-mingw* ) # actually msys
+        lt_cv_to_tool_file_cmd=func_convert_file_msys_to_w32
+        ;;
+    esac
+    ;;
+esac
+
+fi
+
+to_tool_file_cmd=$lt_cv_to_tool_file_cmd
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $lt_cv_to_tool_file_cmd" >&5
+$as_echo "$lt_cv_to_tool_file_cmd" >&6; }
+
+
+
+
+
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $LD option to reload object files" >&5
 $as_echo_n "checking for $LD option to reload object files... " >&6; }
-if test "${lt_cv_ld_reload_flag+set}" = set; then
+if ${lt_cv_ld_reload_flag+:} false; then :
   $as_echo_n "(cached) " >&6
 else
   lt_cv_ld_reload_flag='-r'
 fi
-{ $as_echo "$as_me:$LINENO: result: $lt_cv_ld_reload_flag" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $lt_cv_ld_reload_flag" >&5
 $as_echo "$lt_cv_ld_reload_flag" >&6; }
 reload_flag=$lt_cv_ld_reload_flag
 case $reload_flag in
@@ -6317,6 +5206,11 @@ case $reload_flag in
 esac
 reload_cmds='$LD$reload_flag -o $output$reload_objs'
 case $host_os in
+  cygwin* | mingw* | pw32* | cegcc*)
+    if test "$GCC" != yes; then
+      reload_cmds=false
+    fi
+    ;;
   darwin*)
     if test "$GCC" = yes; then
       reload_cmds='$LTCC $LTCFLAGS -nostdlib ${wl}-r -o $output$reload_objs'
@@ -6337,9 +5231,9 @@ esac
 if test -n "$ac_tool_prefix"; then
   # Extract the first word of "${ac_tool_prefix}objdump", so it can be a program name with args.
 set dummy ${ac_tool_prefix}objdump; ac_word=$2
-{ $as_echo "$as_me:$LINENO: checking for $ac_word" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
 $as_echo_n "checking for $ac_word... " >&6; }
-if test "${ac_cv_prog_OBJDUMP+set}" = set; then
+if ${ac_cv_prog_OBJDUMP+:} false; then :
   $as_echo_n "(cached) " >&6
 else
   if test -n "$OBJDUMP"; then
@@ -6350,24 +5244,24 @@ for as_dir in $PATH
 do
   IFS=$as_save_IFS
   test -z "$as_dir" && as_dir=.
-  for ac_exec_ext in '' $ac_executable_extensions; do
+    for ac_exec_ext in '' $ac_executable_extensions; do
   if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
     ac_cv_prog_OBJDUMP="${ac_tool_prefix}objdump"
-    $as_echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5
+    $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
     break 2
   fi
 done
-done
+  done
 IFS=$as_save_IFS
 
 fi
 fi
 OBJDUMP=$ac_cv_prog_OBJDUMP
 if test -n "$OBJDUMP"; then
-  { $as_echo "$as_me:$LINENO: result: $OBJDUMP" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $OBJDUMP" >&5
 $as_echo "$OBJDUMP" >&6; }
 else
-  { $as_echo "$as_me:$LINENO: result: no" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
 $as_echo "no" >&6; }
 fi
 
@@ -6377,9 +5271,9 @@ if test -z "$ac_cv_prog_OBJDUMP"; then
   ac_ct_OBJDUMP=$OBJDUMP
   # Extract the first word of "objdump", so it can be a program name with args.
 set dummy objdump; ac_word=$2
-{ $as_echo "$as_me:$LINENO: checking for $ac_word" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
 $as_echo_n "checking for $ac_word... " >&6; }
-if test "${ac_cv_prog_ac_ct_OBJDUMP+set}" = set; then
+if ${ac_cv_prog_ac_ct_OBJDUMP+:} false; then :
   $as_echo_n "(cached) " >&6
 else
   if test -n "$ac_ct_OBJDUMP"; then
@@ -6390,24 +5284,24 @@ for as_dir in $PATH
 do
   IFS=$as_save_IFS
   test -z "$as_dir" && as_dir=.
-  for ac_exec_ext in '' $ac_executable_extensions; do
+    for ac_exec_ext in '' $ac_executable_extensions; do
   if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
     ac_cv_prog_ac_ct_OBJDUMP="objdump"
-    $as_echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5
+    $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
     break 2
   fi
 done
-done
+  done
 IFS=$as_save_IFS
 
 fi
 fi
 ac_ct_OBJDUMP=$ac_cv_prog_ac_ct_OBJDUMP
 if test -n "$ac_ct_OBJDUMP"; then
-  { $as_echo "$as_me:$LINENO: result: $ac_ct_OBJDUMP" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_ct_OBJDUMP" >&5
 $as_echo "$ac_ct_OBJDUMP" >&6; }
 else
-  { $as_echo "$as_me:$LINENO: result: no" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
 $as_echo "no" >&6; }
 fi
 
@@ -6416,7 +5310,7 @@ fi
   else
     case $cross_compiling:$ac_tool_warned in
 yes:)
-{ $as_echo "$as_me:$LINENO: WARNING: using cross tools not prefixed with host triplet" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: using cross tools not prefixed with host triplet" >&5
 $as_echo "$as_me: WARNING: using cross tools not prefixed with host triplet" >&2;}
 ac_tool_warned=yes ;;
 esac
@@ -6436,9 +5330,9 @@ test -z "$OBJDUMP" && OBJDUMP=objdump
 
 
 
-{ $as_echo "$as_me:$LINENO: checking how to recognize dependent libraries" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking how to recognize dependent libraries" >&5
 $as_echo_n "checking how to recognize dependent libraries... " >&6; }
-if test "${lt_cv_deplibs_check_method+set}" = set; then
+if ${lt_cv_deplibs_check_method+:} false; then :
   $as_echo_n "(cached) " >&6
 else
   lt_cv_file_magic_cmd='$MAGIC_CMD'
@@ -6480,16 +5374,18 @@ mingw* | pw32*)
   # Base MSYS/MinGW do not provide the 'file' command needed by
   # func_win32_libid shell function, so use a weaker test based on 'objdump',
   # unless we find 'file', for example because we are cross-compiling.
-  if ( file / ) >/dev/null 2>&1; then
+  # func_win32_libid assumes BSD nm, so disallow it if using MS dumpbin.
+  if ( test "$lt_cv_nm_interface" = "BSD nm" && file / ) >/dev/null 2>&1; then
     lt_cv_deplibs_check_method='file_magic ^x86 archive import|^x86 DLL'
     lt_cv_file_magic_cmd='func_win32_libid'
   else
-    lt_cv_deplibs_check_method='file_magic file format pei*-i386(.*architecture: i386)?'
+    # Keep this pattern in sync with the one in func_win32_libid.
+    lt_cv_deplibs_check_method='file_magic file format (pei*-i386(.*architecture: i386)?|pe-arm-wince|pe-x86-64)'
     lt_cv_file_magic_cmd='$OBJDUMP -f'
   fi
   ;;
 
-cegcc)
+cegcc*)
   # use the weaker test based on 'objdump'. See mingw*.
   lt_cv_deplibs_check_method='file_magic file format pe-arm-.*little(.*architecture: arm)?'
   lt_cv_file_magic_cmd='$OBJDUMP -f'
@@ -6519,6 +5415,10 @@ gnu*)
   lt_cv_deplibs_check_method=pass_all
   ;;
 
+haiku*)
+  lt_cv_deplibs_check_method=pass_all
+  ;;
+
 hpux10.20* | hpux11*)
   lt_cv_file_magic_cmd=/usr/bin/file
   case $host_cpu in
@@ -6527,11 +5427,11 @@ hpux10.20* | hpux11*)
     lt_cv_file_magic_test_file=/usr/lib/hpux32/libc.so
     ;;
   hppa*64*)
-    lt_cv_deplibs_check_method='file_magic (s[0-9][0-9][0-9]|ELF-[0-9][0-9]) shared object file - PA-RISC [0-9].[0-9]'
+    lt_cv_deplibs_check_method='file_magic (s[0-9][0-9][0-9]|ELF[ -][0-9][0-9])(-bit)?( [LM]SB)? shared object( file)?[, -]* PA-RISC [0-9]\.[0-9]'
     lt_cv_file_magic_test_file=/usr/lib/pa20_64/libc.sl
     ;;
   *)
-    lt_cv_deplibs_check_method='file_magic (s[0-9][0-9][0-9]|PA-RISC[0-9].[0-9]) shared library'
+    lt_cv_deplibs_check_method='file_magic (s[0-9][0-9][0-9]|PA-RISC[0-9]\.[0-9]) shared library'
     lt_cv_file_magic_test_file=/usr/lib/libc.sl
     ;;
   esac
@@ -6552,8 +5452,8 @@ irix5* | irix6* | nonstopux*)
   lt_cv_deplibs_check_method=pass_all
   ;;
 
-# This must be Linux ELF.
-linux* | k*bsd*-gnu)
+# This must be glibc/ELF.
+linux* | k*bsd*-gnu | kopensolaris*-gnu)
   lt_cv_deplibs_check_method=pass_all
   ;;
 
@@ -6632,8 +5532,23 @@ tpf*)
 esac
 
 fi
-{ $as_echo "$as_me:$LINENO: result: $lt_cv_deplibs_check_method" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $lt_cv_deplibs_check_method" >&5
 $as_echo "$lt_cv_deplibs_check_method" >&6; }
+
+file_magic_glob=
+want_nocaseglob=no
+if test "$build" = "$host"; then
+  case $host_os in
+  mingw* | pw32*)
+    if ( shopt | grep nocaseglob ) >/dev/null 2>&1; then
+      want_nocaseglob=yes
+    else
+      file_magic_glob=`echo aAbBcCdDeEfFgGhHiIjJkKlLmMnNoOpPqQrRsStTuUvVwWxXyYzZ | $SED -e "s/\(..\)/s\/[\1]\/[\1]\/g;/g"`
+    fi
+    ;;
+  esac
+fi
+
 file_magic_cmd=$lt_cv_file_magic_cmd
 deplibs_check_method=$lt_cv_deplibs_check_method
 test -z "$deplibs_check_method" && deplibs_check_method=unknown
@@ -6649,12 +5564,166 @@ test -z "$deplibs_check_method" && deplibs_check_method=unknown
 
 
 
+
+
+
+
+
+
+
+
+
+
+if test -n "$ac_tool_prefix"; then
+  # Extract the first word of "${ac_tool_prefix}dlltool", so it can be a program name with args.
+set dummy ${ac_tool_prefix}dlltool; ac_word=$2
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
+$as_echo_n "checking for $ac_word... " >&6; }
+if ${ac_cv_prog_DLLTOOL+:} false; then :
+  $as_echo_n "(cached) " >&6
+else
+  if test -n "$DLLTOOL"; then
+  ac_cv_prog_DLLTOOL="$DLLTOOL" # Let the user override the test.
+else
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+  IFS=$as_save_IFS
+  test -z "$as_dir" && as_dir=.
+    for ac_exec_ext in '' $ac_executable_extensions; do
+  if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
+    ac_cv_prog_DLLTOOL="${ac_tool_prefix}dlltool"
+    $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
+    break 2
+  fi
+done
+  done
+IFS=$as_save_IFS
+
+fi
+fi
+DLLTOOL=$ac_cv_prog_DLLTOOL
+if test -n "$DLLTOOL"; then
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $DLLTOOL" >&5
+$as_echo "$DLLTOOL" >&6; }
+else
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
+$as_echo "no" >&6; }
+fi
+
+
+fi
+if test -z "$ac_cv_prog_DLLTOOL"; then
+  ac_ct_DLLTOOL=$DLLTOOL
+  # Extract the first word of "dlltool", so it can be a program name with args.
+set dummy dlltool; ac_word=$2
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
+$as_echo_n "checking for $ac_word... " >&6; }
+if ${ac_cv_prog_ac_ct_DLLTOOL+:} false; then :
+  $as_echo_n "(cached) " >&6
+else
+  if test -n "$ac_ct_DLLTOOL"; then
+  ac_cv_prog_ac_ct_DLLTOOL="$ac_ct_DLLTOOL" # Let the user override the test.
+else
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+  IFS=$as_save_IFS
+  test -z "$as_dir" && as_dir=.
+    for ac_exec_ext in '' $ac_executable_extensions; do
+  if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
+    ac_cv_prog_ac_ct_DLLTOOL="dlltool"
+    $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
+    break 2
+  fi
+done
+  done
+IFS=$as_save_IFS
+
+fi
+fi
+ac_ct_DLLTOOL=$ac_cv_prog_ac_ct_DLLTOOL
+if test -n "$ac_ct_DLLTOOL"; then
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_ct_DLLTOOL" >&5
+$as_echo "$ac_ct_DLLTOOL" >&6; }
+else
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
+$as_echo "no" >&6; }
+fi
+
+  if test "x$ac_ct_DLLTOOL" = x; then
+    DLLTOOL="false"
+  else
+    case $cross_compiling:$ac_tool_warned in
+yes:)
+{ $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: using cross tools not prefixed with host triplet" >&5
+$as_echo "$as_me: WARNING: using cross tools not prefixed with host triplet" >&2;}
+ac_tool_warned=yes ;;
+esac
+    DLLTOOL=$ac_ct_DLLTOOL
+  fi
+else
+  DLLTOOL="$ac_cv_prog_DLLTOOL"
+fi
+
+test -z "$DLLTOOL" && DLLTOOL=dlltool
+
+
+
+
+
+
+
+
+
+
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking how to associate runtime and link libraries" >&5
+$as_echo_n "checking how to associate runtime and link libraries... " >&6; }
+if ${lt_cv_sharedlib_from_linklib_cmd+:} false; then :
+  $as_echo_n "(cached) " >&6
+else
+  lt_cv_sharedlib_from_linklib_cmd='unknown'
+
+case $host_os in
+cygwin* | mingw* | pw32* | cegcc*)
+  # two different shell functions defined in ltmain.sh
+  # decide which to use based on capabilities of $DLLTOOL
+  case `$DLLTOOL --help 2>&1` in
+  *--identify-strict*)
+    lt_cv_sharedlib_from_linklib_cmd=func_cygming_dll_for_implib
+    ;;
+  *)
+    lt_cv_sharedlib_from_linklib_cmd=func_cygming_dll_for_implib_fallback
+    ;;
+  esac
+  ;;
+*)
+  # fallback: assume linklib IS sharedlib
+  lt_cv_sharedlib_from_linklib_cmd="$ECHO"
+  ;;
+esac
+
+fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $lt_cv_sharedlib_from_linklib_cmd" >&5
+$as_echo "$lt_cv_sharedlib_from_linklib_cmd" >&6; }
+sharedlib_from_linklib_cmd=$lt_cv_sharedlib_from_linklib_cmd
+test -z "$sharedlib_from_linklib_cmd" && sharedlib_from_linklib_cmd=$ECHO
+
+
+
+
+
+
+
+
 if test -n "$ac_tool_prefix"; then
-  # Extract the first word of "${ac_tool_prefix}ar", so it can be a program name with args.
-set dummy ${ac_tool_prefix}ar; ac_word=$2
-{ $as_echo "$as_me:$LINENO: checking for $ac_word" >&5
+  for ac_prog in ar
+  do
+    # Extract the first word of "$ac_tool_prefix$ac_prog", so it can be a program name with args.
+set dummy $ac_tool_prefix$ac_prog; ac_word=$2
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
 $as_echo_n "checking for $ac_word... " >&6; }
-if test "${ac_cv_prog_AR+set}" = set; then
+if ${ac_cv_prog_AR+:} false; then :
   $as_echo_n "(cached) " >&6
 else
   if test -n "$AR"; then
@@ -6665,36 +5734,40 @@ for as_dir in $PATH
 do
   IFS=$as_save_IFS
   test -z "$as_dir" && as_dir=.
-  for ac_exec_ext in '' $ac_executable_extensions; do
+    for ac_exec_ext in '' $ac_executable_extensions; do
   if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
-    ac_cv_prog_AR="${ac_tool_prefix}ar"
-    $as_echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5
+    ac_cv_prog_AR="$ac_tool_prefix$ac_prog"
+    $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
     break 2
   fi
 done
-done
+  done
 IFS=$as_save_IFS
 
 fi
 fi
 AR=$ac_cv_prog_AR
 if test -n "$AR"; then
-  { $as_echo "$as_me:$LINENO: result: $AR" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $AR" >&5
 $as_echo "$AR" >&6; }
 else
-  { $as_echo "$as_me:$LINENO: result: no" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
 $as_echo "no" >&6; }
 fi
 
 
+    test -n "$AR" && break
+  done
 fi
-if test -z "$ac_cv_prog_AR"; then
+if test -z "$AR"; then
   ac_ct_AR=$AR
-  # Extract the first word of "ar", so it can be a program name with args.
-set dummy ar; ac_word=$2
-{ $as_echo "$as_me:$LINENO: checking for $ac_word" >&5
+  for ac_prog in ar
+do
+  # Extract the first word of "$ac_prog", so it can be a program name with args.
+set dummy $ac_prog; ac_word=$2
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
 $as_echo_n "checking for $ac_word... " >&6; }
-if test "${ac_cv_prog_ac_ct_AR+set}" = set; then
+if ${ac_cv_prog_ac_ct_AR+:} false; then :
   $as_echo_n "(cached) " >&6
 else
   if test -n "$ac_ct_AR"; then
@@ -6705,48 +5778,108 @@ for as_dir in $PATH
 do
   IFS=$as_save_IFS
   test -z "$as_dir" && as_dir=.
-  for ac_exec_ext in '' $ac_executable_extensions; do
+    for ac_exec_ext in '' $ac_executable_extensions; do
   if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
-    ac_cv_prog_ac_ct_AR="ar"
-    $as_echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5
+    ac_cv_prog_ac_ct_AR="$ac_prog"
+    $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
     break 2
   fi
 done
-done
+  done
 IFS=$as_save_IFS
 
 fi
 fi
 ac_ct_AR=$ac_cv_prog_ac_ct_AR
 if test -n "$ac_ct_AR"; then
-  { $as_echo "$as_me:$LINENO: result: $ac_ct_AR" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_ct_AR" >&5
 $as_echo "$ac_ct_AR" >&6; }
 else
-  { $as_echo "$as_me:$LINENO: result: no" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
 $as_echo "no" >&6; }
 fi
 
+
+  test -n "$ac_ct_AR" && break
+done
+
   if test "x$ac_ct_AR" = x; then
     AR="false"
   else
     case $cross_compiling:$ac_tool_warned in
 yes:)
-{ $as_echo "$as_me:$LINENO: WARNING: using cross tools not prefixed with host triplet" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: using cross tools not prefixed with host triplet" >&5
 $as_echo "$as_me: WARNING: using cross tools not prefixed with host triplet" >&2;}
 ac_tool_warned=yes ;;
 esac
     AR=$ac_ct_AR
   fi
-else
-  AR="$ac_cv_prog_AR"
 fi
 
-test -z "$AR" && AR=ar
-test -z "$AR_FLAGS" && AR_FLAGS=cru
+: ${AR=ar}
+: ${AR_FLAGS=cru}
+
+
+
+
+
+
+
+
+
+
+
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for archiver @FILE support" >&5
+$as_echo_n "checking for archiver @FILE support... " >&6; }
+if ${lt_cv_ar_at_file+:} false; then :
+  $as_echo_n "(cached) " >&6
+else
+  lt_cv_ar_at_file=no
+   cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+
+int
+main ()
+{
 
+  ;
+  return 0;
+}
+_ACEOF
+if ac_fn_c_try_compile "$LINENO"; then :
+  echo conftest.$ac_objext > conftest.lst
+      lt_ar_try='$AR $AR_FLAGS libconftest.a @conftest.lst >&5'
+      { { eval echo "\"\$as_me\":${as_lineno-$LINENO}: \"$lt_ar_try\""; } >&5
+  (eval $lt_ar_try) 2>&5
+  ac_status=$?
+  $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+  test $ac_status = 0; }
+      if test "$ac_status" -eq 0; then
+	# Ensure the archiver fails upon bogus file names.
+	rm -f conftest.$ac_objext libconftest.a
+	{ { eval echo "\"\$as_me\":${as_lineno-$LINENO}: \"$lt_ar_try\""; } >&5
+  (eval $lt_ar_try) 2>&5
+  ac_status=$?
+  $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+  test $ac_status = 0; }
+	if test "$ac_status" -ne 0; then
+          lt_cv_ar_at_file=@
+        fi
+      fi
+      rm -f conftest.* libconftest.a
 
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
 
+fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $lt_cv_ar_at_file" >&5
+$as_echo "$lt_cv_ar_at_file" >&6; }
 
+if test "x$lt_cv_ar_at_file" = xno; then
+  archiver_list_spec=
+else
+  archiver_list_spec=$lt_cv_ar_at_file
+fi
 
 
 
@@ -6757,9 +5890,9 @@ test -z "$AR_FLAGS" && AR_FLAGS=cru
 if test -n "$ac_tool_prefix"; then
   # Extract the first word of "${ac_tool_prefix}strip", so it can be a program name with args.
 set dummy ${ac_tool_prefix}strip; ac_word=$2
-{ $as_echo "$as_me:$LINENO: checking for $ac_word" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
 $as_echo_n "checking for $ac_word... " >&6; }
-if test "${ac_cv_prog_STRIP+set}" = set; then
+if ${ac_cv_prog_STRIP+:} false; then :
   $as_echo_n "(cached) " >&6
 else
   if test -n "$STRIP"; then
@@ -6770,24 +5903,24 @@ for as_dir in $PATH
 do
   IFS=$as_save_IFS
   test -z "$as_dir" && as_dir=.
-  for ac_exec_ext in '' $ac_executable_extensions; do
+    for ac_exec_ext in '' $ac_executable_extensions; do
   if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
     ac_cv_prog_STRIP="${ac_tool_prefix}strip"
-    $as_echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5
+    $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
     break 2
   fi
 done
-done
+  done
 IFS=$as_save_IFS
 
 fi
 fi
 STRIP=$ac_cv_prog_STRIP
 if test -n "$STRIP"; then
-  { $as_echo "$as_me:$LINENO: result: $STRIP" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $STRIP" >&5
 $as_echo "$STRIP" >&6; }
 else
-  { $as_echo "$as_me:$LINENO: result: no" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
 $as_echo "no" >&6; }
 fi
 
@@ -6797,9 +5930,9 @@ if test -z "$ac_cv_prog_STRIP"; then
   ac_ct_STRIP=$STRIP
   # Extract the first word of "strip", so it can be a program name with args.
 set dummy strip; ac_word=$2
-{ $as_echo "$as_me:$LINENO: checking for $ac_word" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
 $as_echo_n "checking for $ac_word... " >&6; }
-if test "${ac_cv_prog_ac_ct_STRIP+set}" = set; then
+if ${ac_cv_prog_ac_ct_STRIP+:} false; then :
   $as_echo_n "(cached) " >&6
 else
   if test -n "$ac_ct_STRIP"; then
@@ -6810,24 +5943,24 @@ for as_dir in $PATH
 do
   IFS=$as_save_IFS
   test -z "$as_dir" && as_dir=.
-  for ac_exec_ext in '' $ac_executable_extensions; do
+    for ac_exec_ext in '' $ac_executable_extensions; do
   if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
     ac_cv_prog_ac_ct_STRIP="strip"
-    $as_echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5
+    $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
     break 2
   fi
 done
-done
+  done
 IFS=$as_save_IFS
 
 fi
 fi
 ac_ct_STRIP=$ac_cv_prog_ac_ct_STRIP
 if test -n "$ac_ct_STRIP"; then
-  { $as_echo "$as_me:$LINENO: result: $ac_ct_STRIP" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_ct_STRIP" >&5
 $as_echo "$ac_ct_STRIP" >&6; }
 else
-  { $as_echo "$as_me:$LINENO: result: no" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
 $as_echo "no" >&6; }
 fi
 
@@ -6836,7 +5969,7 @@ fi
   else
     case $cross_compiling:$ac_tool_warned in
 yes:)
-{ $as_echo "$as_me:$LINENO: WARNING: using cross tools not prefixed with host triplet" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: using cross tools not prefixed with host triplet" >&5
 $as_echo "$as_me: WARNING: using cross tools not prefixed with host triplet" >&2;}
 ac_tool_warned=yes ;;
 esac
@@ -6856,9 +5989,9 @@ test -z "$STRIP" && STRIP=:
 if test -n "$ac_tool_prefix"; then
   # Extract the first word of "${ac_tool_prefix}ranlib", so it can be a program name with args.
 set dummy ${ac_tool_prefix}ranlib; ac_word=$2
-{ $as_echo "$as_me:$LINENO: checking for $ac_word" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
 $as_echo_n "checking for $ac_word... " >&6; }
-if test "${ac_cv_prog_RANLIB+set}" = set; then
+if ${ac_cv_prog_RANLIB+:} false; then :
   $as_echo_n "(cached) " >&6
 else
   if test -n "$RANLIB"; then
@@ -6869,24 +6002,24 @@ for as_dir in $PATH
 do
   IFS=$as_save_IFS
   test -z "$as_dir" && as_dir=.
-  for ac_exec_ext in '' $ac_executable_extensions; do
+    for ac_exec_ext in '' $ac_executable_extensions; do
   if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
     ac_cv_prog_RANLIB="${ac_tool_prefix}ranlib"
-    $as_echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5
+    $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
     break 2
   fi
 done
-done
+  done
 IFS=$as_save_IFS
 
 fi
 fi
 RANLIB=$ac_cv_prog_RANLIB
 if test -n "$RANLIB"; then
-  { $as_echo "$as_me:$LINENO: result: $RANLIB" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $RANLIB" >&5
 $as_echo "$RANLIB" >&6; }
 else
-  { $as_echo "$as_me:$LINENO: result: no" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
 $as_echo "no" >&6; }
 fi
 
@@ -6896,9 +6029,9 @@ if test -z "$ac_cv_prog_RANLIB"; then
   ac_ct_RANLIB=$RANLIB
   # Extract the first word of "ranlib", so it can be a program name with args.
 set dummy ranlib; ac_word=$2
-{ $as_echo "$as_me:$LINENO: checking for $ac_word" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
 $as_echo_n "checking for $ac_word... " >&6; }
-if test "${ac_cv_prog_ac_ct_RANLIB+set}" = set; then
+if ${ac_cv_prog_ac_ct_RANLIB+:} false; then :
   $as_echo_n "(cached) " >&6
 else
   if test -n "$ac_ct_RANLIB"; then
@@ -6909,24 +6042,24 @@ for as_dir in $PATH
 do
   IFS=$as_save_IFS
   test -z "$as_dir" && as_dir=.
-  for ac_exec_ext in '' $ac_executable_extensions; do
+    for ac_exec_ext in '' $ac_executable_extensions; do
   if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
     ac_cv_prog_ac_ct_RANLIB="ranlib"
-    $as_echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5
+    $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
     break 2
   fi
 done
-done
+  done
 IFS=$as_save_IFS
 
 fi
 fi
 ac_ct_RANLIB=$ac_cv_prog_ac_ct_RANLIB
 if test -n "$ac_ct_RANLIB"; then
-  { $as_echo "$as_me:$LINENO: result: $ac_ct_RANLIB" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_ct_RANLIB" >&5
 $as_echo "$ac_ct_RANLIB" >&6; }
 else
-  { $as_echo "$as_me:$LINENO: result: no" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
 $as_echo "no" >&6; }
 fi
 
@@ -6935,7 +6068,7 @@ fi
   else
     case $cross_compiling:$ac_tool_warned in
 yes:)
-{ $as_echo "$as_me:$LINENO: WARNING: using cross tools not prefixed with host triplet" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: using cross tools not prefixed with host triplet" >&5
 $as_echo "$as_me: WARNING: using cross tools not prefixed with host triplet" >&2;}
 ac_tool_warned=yes ;;
 esac
@@ -6960,15 +6093,27 @@ old_postuninstall_cmds=
 if test -n "$RANLIB"; then
   case $host_os in
   openbsd*)
-    old_postinstall_cmds="$old_postinstall_cmds~\$RANLIB -t \$oldlib"
+    old_postinstall_cmds="$old_postinstall_cmds~\$RANLIB -t \$tool_oldlib"
     ;;
   *)
-    old_postinstall_cmds="$old_postinstall_cmds~\$RANLIB \$oldlib"
+    old_postinstall_cmds="$old_postinstall_cmds~\$RANLIB \$tool_oldlib"
     ;;
   esac
-  old_archive_cmds="$old_archive_cmds~\$RANLIB \$oldlib"
+  old_archive_cmds="$old_archive_cmds~\$RANLIB \$tool_oldlib"
 fi
 
+case $host_os in
+  darwin*)
+    lock_old_archive_extraction=yes ;;
+  *)
+    lock_old_archive_extraction=no ;;
+esac
+
+
+
+
+
+
 
 
 
@@ -7013,9 +6158,9 @@ compiler=$CC
 
 
 # Check for command to grab the raw symbol name followed by C symbol from nm.
-{ $as_echo "$as_me:$LINENO: checking command to parse $NM output from $compiler object" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking command to parse $NM output from $compiler object" >&5
 $as_echo_n "checking command to parse $NM output from $compiler object... " >&6; }
-if test "${lt_cv_sys_global_symbol_pipe+set}" = set; then
+if ${lt_cv_sys_global_symbol_pipe+:} false; then :
   $as_echo_n "(cached) " >&6
 else
 
@@ -7076,8 +6221,8 @@ esac
 lt_cv_sys_global_symbol_to_cdecl="sed -n -e 's/^T .* \(.*\)$/extern int \1();/p' -e 's/^$symcode* .* \(.*\)$/extern char \1;/p'"
 
 # Transform an extracted symbol line into symbol name and symbol address
-lt_cv_sys_global_symbol_to_c_name_address="sed -n -e 's/^: \([^ ]*\) $/  {\\\"\1\\\", (void *) 0},/p' -e 's/^$symcode* \([^ ]*\) \([^ ]*\)$/  {\"\2\", (void *) \&\2},/p'"
-lt_cv_sys_global_symbol_to_c_name_address_lib_prefix="sed -n -e 's/^: \([^ ]*\) $/  {\\\"\1\\\", (void *) 0},/p' -e 's/^$symcode* \([^ ]*\) \(lib[^ ]*\)$/  {\"\2\", (void *) \&\2},/p' -e 's/^$symcode* \([^ ]*\) \([^ ]*\)$/  {\"lib\2\", (void *) \&\2},/p'"
+lt_cv_sys_global_symbol_to_c_name_address="sed -n -e 's/^: \([^ ]*\)[ ]*$/  {\\\"\1\\\", (void *) 0},/p' -e 's/^$symcode* \([^ ]*\) \([^ ]*\)$/  {\"\2\", (void *) \&\2},/p'"
+lt_cv_sys_global_symbol_to_c_name_address_lib_prefix="sed -n -e 's/^: \([^ ]*\)[ ]*$/  {\\\"\1\\\", (void *) 0},/p' -e 's/^$symcode* \([^ ]*\) \(lib[^ ]*\)$/  {\"\2\", (void *) \&\2},/p' -e 's/^$symcode* \([^ ]*\) \([^ ]*\)$/  {\"lib\2\", (void *) \&\2},/p'"
 
 # Handle CRLF in mingw tool chain
 opt_cr=
@@ -7101,6 +6246,7 @@ for ac_symprfx in "" "_"; do
     # which start with @ or ?.
     lt_cv_sys_global_symbol_pipe="$AWK '"\
 "     {last_section=section; section=\$ 3};"\
+"     /^COFF SYMBOL TABLE/{for(i in hide) delete hide[i]};"\
 "     /Section length .*#relocs.*(pick any)/{hide[last_section]=1};"\
 "     \$ 0!~/External *\|/{next};"\
 "     / 0+ UNDEF /{next}; / UNDEF \([^|]\)*()/{next};"\
@@ -7113,6 +6259,7 @@ for ac_symprfx in "" "_"; do
   else
     lt_cv_sys_global_symbol_pipe="sed -n -e 's/^.*[	 ]\($symcode$symcode*\)[	 ][	 ]*$ac_symprfx$sympat$opt_cr$/$symxfrm/p'"
   fi
+  lt_cv_sys_global_symbol_pipe="$lt_cv_sys_global_symbol_pipe | sed '/ __gnu_lto/d'"
 
   # Check to see that the pipe works correctly.
   pipe_works=no
@@ -7131,18 +6278,18 @@ void nm_test_func(void){}
 int main(){nm_test_var='a';nm_test_func();return(0);}
 _LT_EOF
 
-  if { (eval echo "$as_me:$LINENO: \"$ac_compile\"") >&5
+  if { { eval echo "\"\$as_me\":${as_lineno-$LINENO}: \"$ac_compile\""; } >&5
   (eval $ac_compile) 2>&5
   ac_status=$?
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); }; then
+  $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+  test $ac_status = 0; }; then
     # Now try to grab the symbols.
     nlist=conftest.nm
-    if { (eval echo "$as_me:$LINENO: \"$NM conftest.$ac_objext \| $lt_cv_sys_global_symbol_pipe \> $nlist\"") >&5
-  (eval $NM conftest.$ac_objext \| $lt_cv_sys_global_symbol_pipe \> $nlist) 2>&5
+    if { { eval echo "\"\$as_me\":${as_lineno-$LINENO}: \"$NM conftest.$ac_objext \| "$lt_cv_sys_global_symbol_pipe" \> $nlist\""; } >&5
+  (eval $NM conftest.$ac_objext \| "$lt_cv_sys_global_symbol_pipe" \> $nlist) 2>&5
   ac_status=$?
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } && test -s "$nlist"; then
+  $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+  test $ac_status = 0; } && test -s "$nlist"; then
       # Try sorting and uniquifying the output.
       if sort "$nlist" | uniq > "$nlist"T; then
 	mv -f "$nlist"T "$nlist"
@@ -7154,6 +6301,18 @@ _LT_EOF
       if $GREP ' nm_test_var$' "$nlist" >/dev/null; then
 	if $GREP ' nm_test_func$' "$nlist" >/dev/null; then
 	  cat <<_LT_EOF > conftest.$ac_ext
+/* Keep this code in sync between libtool.m4, ltmain, lt_system.h, and tests.  */
+#if defined(_WIN32) || defined(__CYGWIN__) || defined(_WIN32_WCE)
+/* DATA imports from DLLs on WIN32 con't be const, because runtime
+   relocations are performed -- see ld's documentation on pseudo-relocs.  */
+# define LT_DLSYM_CONST
+#elif defined(__osf__)
+/* This system does not cope well with relocations in const data.  */
+# define LT_DLSYM_CONST
+#else
+# define LT_DLSYM_CONST const
+#endif
+
 #ifdef __cplusplus
 extern "C" {
 #endif
@@ -7165,7 +6324,7 @@ _LT_EOF
 	  cat <<_LT_EOF >> conftest.$ac_ext
 
 /* The mapping between symbol names and symbols.  */
-const struct {
+LT_DLSYM_CONST struct {
   const char *name;
   void       *address;
 }
@@ -7191,19 +6350,19 @@ static const void *lt_preloaded_setup() {
 _LT_EOF
 	  # Now try linking the two files.
 	  mv conftest.$ac_objext conftstm.$ac_objext
-	  lt_save_LIBS="$LIBS"
-	  lt_save_CFLAGS="$CFLAGS"
+	  lt_globsym_save_LIBS=$LIBS
+	  lt_globsym_save_CFLAGS=$CFLAGS
 	  LIBS="conftstm.$ac_objext"
 	  CFLAGS="$CFLAGS$lt_prog_compiler_no_builtin_flag"
-	  if { (eval echo "$as_me:$LINENO: \"$ac_link\"") >&5
+	  if { { eval echo "\"\$as_me\":${as_lineno-$LINENO}: \"$ac_link\""; } >&5
   (eval $ac_link) 2>&5
   ac_status=$?
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } && test -s conftest${ac_exeext}; then
+  $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+  test $ac_status = 0; } && test -s conftest${ac_exeext}; then
 	    pipe_works=yes
 	  fi
-	  LIBS="$lt_save_LIBS"
-	  CFLAGS="$lt_save_CFLAGS"
+	  LIBS=$lt_globsym_save_LIBS
+	  CFLAGS=$lt_globsym_save_CFLAGS
 	else
 	  echo "cannot find nm_test_func in $nlist" >&5
 	fi
@@ -7233,13 +6392,21 @@ if test -z "$lt_cv_sys_global_symbol_pipe"; then
   lt_cv_sys_global_symbol_to_cdecl=
 fi
 if test -z "$lt_cv_sys_global_symbol_pipe$lt_cv_sys_global_symbol_to_cdecl"; then
-  { $as_echo "$as_me:$LINENO: result: failed" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: failed" >&5
 $as_echo "failed" >&6; }
 else
-  { $as_echo "$as_me:$LINENO: result: ok" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: ok" >&5
 $as_echo "ok" >&6; }
 fi
 
+# Response file support.
+if test "$lt_cv_nm_interface" = "MS dumpbin"; then
+  nm_file_list_spec='@'
+elif $NM --help 2>/dev/null | grep '[@]FILE' >/dev/null; then
+  nm_file_list_spec='@'
+fi
+
+
 
 
 
@@ -7261,8 +6428,49 @@ fi
 
 
 
+
+
+
+
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for sysroot" >&5
+$as_echo_n "checking for sysroot... " >&6; }
+
+# Check whether --with-sysroot was given.
+if test "${with_sysroot+set}" = set; then :
+  withval=$with_sysroot;
+else
+  with_sysroot=no
+fi
+
+
+lt_sysroot=
+case ${with_sysroot} in #(
+ yes)
+   if test "$GCC" = yes; then
+     lt_sysroot=`$CC --print-sysroot 2>/dev/null`
+   fi
+   ;; #(
+ /*)
+   lt_sysroot=`echo "$with_sysroot" | sed -e "$sed_quote_subst"`
+   ;; #(
+ no|'')
+   ;; #(
+ *)
+   { $as_echo "$as_me:${as_lineno-$LINENO}: result: ${with_sysroot}" >&5
+$as_echo "${with_sysroot}" >&6; }
+   as_fn_error $? "The sysroot must be an absolute path." "$LINENO" 5
+   ;;
+esac
+
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: ${lt_sysroot:-no}" >&5
+$as_echo "${lt_sysroot:-no}" >&6; }
+
+
+
+
+
 # Check whether --enable-libtool-lock was given.
-if test "${enable_libtool_lock+set}" = set; then
+if test "${enable_libtool_lock+set}" = set; then :
   enableval=$enable_libtool_lock;
 fi
 
@@ -7274,11 +6482,11 @@ case $host in
 ia64-*-hpux*)
   # Find out which ABI we are using.
   echo 'int i;' > conftest.$ac_ext
-  if { (eval echo "$as_me:$LINENO: \"$ac_compile\"") >&5
+  if { { eval echo "\"\$as_me\":${as_lineno-$LINENO}: \"$ac_compile\""; } >&5
   (eval $ac_compile) 2>&5
   ac_status=$?
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); }; then
+  $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+  test $ac_status = 0; }; then
     case `/usr/bin/file conftest.$ac_objext` in
       *ELF-32*)
 	HPUX_IA64_MODE="32"
@@ -7292,12 +6500,12 @@ ia64-*-hpux*)
   ;;
 *-*-irix6*)
   # Find out which ABI we are using.
-  echo '#line 7295 "configure"' > conftest.$ac_ext
-  if { (eval echo "$as_me:$LINENO: \"$ac_compile\"") >&5
+  echo '#line '$LINENO' "configure"' > conftest.$ac_ext
+  if { { eval echo "\"\$as_me\":${as_lineno-$LINENO}: \"$ac_compile\""; } >&5
   (eval $ac_compile) 2>&5
   ac_status=$?
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); }; then
+  $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+  test $ac_status = 0; }; then
     if test "$lt_cv_prog_gnu_ld" = yes; then
       case `/usr/bin/file conftest.$ac_objext` in
 	*32-bit*)
@@ -7331,11 +6539,11 @@ x86_64-*kfreebsd*-gnu|x86_64-*linux*|ppc*-*linux*|powerpc*-*linux*| \
 s390*-*linux*|s390*-*tpf*|sparc*-*linux*)
   # Find out which ABI we are using.
   echo 'int i;' > conftest.$ac_ext
-  if { (eval echo "$as_me:$LINENO: \"$ac_compile\"") >&5
+  if { { eval echo "\"\$as_me\":${as_lineno-$LINENO}: \"$ac_compile\""; } >&5
   (eval $ac_compile) 2>&5
   ac_status=$?
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); }; then
+  $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+  test $ac_status = 0; }; then
     case `/usr/bin/file conftest.o` in
       *32-bit*)
 	case $host in
@@ -7384,9 +6592,9 @@ s390*-*linux*|s390*-*tpf*|sparc*-*linux*)
   # On SCO OpenServer 5, we need -belf to get full-featured binaries.
   SAVE_CFLAGS="$CFLAGS"
   CFLAGS="$CFLAGS -belf"
-  { $as_echo "$as_me:$LINENO: checking whether the C compiler needs -belf" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: checking whether the C compiler needs -belf" >&5
 $as_echo_n "checking whether the C compiler needs -belf... " >&6; }
-if test "${lt_cv_cc_needs_belf+set}" = set; then
+if ${lt_cv_cc_needs_belf+:} false; then :
   $as_echo_n "(cached) " >&6
 else
   ac_ext=c
@@ -7395,11 +6603,7 @@ ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
 ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
 ac_compiler_gnu=$ac_cv_c_compiler_gnu
 
-     cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
+     cat confdefs.h - <<_ACEOF >conftest.$ac_ext
 /* end confdefs.h.  */
 
 int
@@ -7410,38 +6614,13 @@ main ()
   return 0;
 }
 _ACEOF
-rm -f conftest.$ac_objext conftest$ac_exeext
-if { (ac_try="$ac_link"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_link") 2>conftest.er1
-  ac_status=$?
-  grep -v '^ *+' conftest.er1 >conftest.err
-  rm -f conftest.er1
-  cat conftest.err >&5
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } && {
-	 test -z "$ac_c_werror_flag" ||
-	 test ! -s conftest.err
-       } && test -s conftest$ac_exeext && {
-	 test "$cross_compiling" = yes ||
-	 $as_test_x conftest$ac_exeext
-       }; then
+if ac_fn_c_try_link "$LINENO"; then :
   lt_cv_cc_needs_belf=yes
 else
-  $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
-
-	lt_cv_cc_needs_belf=no
+  lt_cv_cc_needs_belf=no
 fi
-
-rm -rf conftest.dSYM
-rm -f core conftest.err conftest.$ac_objext conftest_ipa8_conftest.oo \
-      conftest$ac_exeext conftest.$ac_ext
+rm -f core conftest.err conftest.$ac_objext \
+    conftest$ac_exeext conftest.$ac_ext
      ac_ext=c
 ac_cpp='$CPP $CPPFLAGS'
 ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
@@ -7449,25 +6628,38 @@ ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $
 ac_compiler_gnu=$ac_cv_c_compiler_gnu
 
 fi
-{ $as_echo "$as_me:$LINENO: result: $lt_cv_cc_needs_belf" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $lt_cv_cc_needs_belf" >&5
 $as_echo "$lt_cv_cc_needs_belf" >&6; }
   if test x"$lt_cv_cc_needs_belf" != x"yes"; then
     # this is probably gcc 2.8.0, egcs 1.0 or newer; no need for -belf
     CFLAGS="$SAVE_CFLAGS"
   fi
   ;;
-sparc*-*solaris*)
+*-*solaris*)
   # Find out which ABI we are using.
   echo 'int i;' > conftest.$ac_ext
-  if { (eval echo "$as_me:$LINENO: \"$ac_compile\"") >&5
+  if { { eval echo "\"\$as_me\":${as_lineno-$LINENO}: \"$ac_compile\""; } >&5
   (eval $ac_compile) 2>&5
   ac_status=$?
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); }; then
+  $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+  test $ac_status = 0; }; then
     case `/usr/bin/file conftest.o` in
     *64-bit*)
       case $lt_cv_prog_gnu_ld in
-      yes*) LD="${LD-ld} -m elf64_sparc" ;;
+      yes*)
+        case $host in
+        i?86-*-solaris*)
+          LD="${LD-ld} -m elf_x86_64"
+          ;;
+        sparc*-*-solaris*)
+          LD="${LD-ld} -m elf64_sparc"
+          ;;
+        esac
+        # GNU ld 2.21 introduced _sol2 emulations.  Use them if available.
+        if ${LD-ld} -V | grep _sol2 >/dev/null 2>&1; then
+          LD="${LD-ld}_sol2"
+        fi
+        ;;
       *)
 	if ${LD-ld} -64 -r -o conftest2.o conftest.o >/dev/null 2>&1; then
 	  LD="${LD-ld} -64"
@@ -7483,1202 +6675,770 @@ esac
 
 need_locks="$enable_libtool_lock"
 
-
-  case $host_os in
-    rhapsody* | darwin*)
-    if test -n "$ac_tool_prefix"; then
-  # Extract the first word of "${ac_tool_prefix}dsymutil", so it can be a program name with args.
-set dummy ${ac_tool_prefix}dsymutil; ac_word=$2
-{ $as_echo "$as_me:$LINENO: checking for $ac_word" >&5
-$as_echo_n "checking for $ac_word... " >&6; }
-if test "${ac_cv_prog_DSYMUTIL+set}" = set; then
-  $as_echo_n "(cached) " >&6
-else
-  if test -n "$DSYMUTIL"; then
-  ac_cv_prog_DSYMUTIL="$DSYMUTIL" # Let the user override the test.
-else
-as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH
-do
-  IFS=$as_save_IFS
-  test -z "$as_dir" && as_dir=.
-  for ac_exec_ext in '' $ac_executable_extensions; do
-  if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
-    ac_cv_prog_DSYMUTIL="${ac_tool_prefix}dsymutil"
-    $as_echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5
-    break 2
-  fi
-done
-done
-IFS=$as_save_IFS
-
-fi
-fi
-DSYMUTIL=$ac_cv_prog_DSYMUTIL
-if test -n "$DSYMUTIL"; then
-  { $as_echo "$as_me:$LINENO: result: $DSYMUTIL" >&5
-$as_echo "$DSYMUTIL" >&6; }
-else
-  { $as_echo "$as_me:$LINENO: result: no" >&5
-$as_echo "no" >&6; }
-fi
-
-
-fi
-if test -z "$ac_cv_prog_DSYMUTIL"; then
-  ac_ct_DSYMUTIL=$DSYMUTIL
-  # Extract the first word of "dsymutil", so it can be a program name with args.
-set dummy dsymutil; ac_word=$2
-{ $as_echo "$as_me:$LINENO: checking for $ac_word" >&5
-$as_echo_n "checking for $ac_word... " >&6; }
-if test "${ac_cv_prog_ac_ct_DSYMUTIL+set}" = set; then
-  $as_echo_n "(cached) " >&6
-else
-  if test -n "$ac_ct_DSYMUTIL"; then
-  ac_cv_prog_ac_ct_DSYMUTIL="$ac_ct_DSYMUTIL" # Let the user override the test.
-else
-as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH
-do
-  IFS=$as_save_IFS
-  test -z "$as_dir" && as_dir=.
-  for ac_exec_ext in '' $ac_executable_extensions; do
-  if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
-    ac_cv_prog_ac_ct_DSYMUTIL="dsymutil"
-    $as_echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5
-    break 2
-  fi
-done
-done
-IFS=$as_save_IFS
-
-fi
-fi
-ac_ct_DSYMUTIL=$ac_cv_prog_ac_ct_DSYMUTIL
-if test -n "$ac_ct_DSYMUTIL"; then
-  { $as_echo "$as_me:$LINENO: result: $ac_ct_DSYMUTIL" >&5
-$as_echo "$ac_ct_DSYMUTIL" >&6; }
-else
-  { $as_echo "$as_me:$LINENO: result: no" >&5
-$as_echo "no" >&6; }
-fi
-
-  if test "x$ac_ct_DSYMUTIL" = x; then
-    DSYMUTIL=":"
-  else
-    case $cross_compiling:$ac_tool_warned in
-yes:)
-{ $as_echo "$as_me:$LINENO: WARNING: using cross tools not prefixed with host triplet" >&5
-$as_echo "$as_me: WARNING: using cross tools not prefixed with host triplet" >&2;}
-ac_tool_warned=yes ;;
-esac
-    DSYMUTIL=$ac_ct_DSYMUTIL
-  fi
-else
-  DSYMUTIL="$ac_cv_prog_DSYMUTIL"
-fi
-
-    if test -n "$ac_tool_prefix"; then
-  # Extract the first word of "${ac_tool_prefix}nmedit", so it can be a program name with args.
-set dummy ${ac_tool_prefix}nmedit; ac_word=$2
-{ $as_echo "$as_me:$LINENO: checking for $ac_word" >&5
-$as_echo_n "checking for $ac_word... " >&6; }
-if test "${ac_cv_prog_NMEDIT+set}" = set; then
-  $as_echo_n "(cached) " >&6
-else
-  if test -n "$NMEDIT"; then
-  ac_cv_prog_NMEDIT="$NMEDIT" # Let the user override the test.
-else
-as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH
-do
-  IFS=$as_save_IFS
-  test -z "$as_dir" && as_dir=.
-  for ac_exec_ext in '' $ac_executable_extensions; do
-  if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
-    ac_cv_prog_NMEDIT="${ac_tool_prefix}nmedit"
-    $as_echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5
-    break 2
-  fi
-done
-done
-IFS=$as_save_IFS
-
-fi
-fi
-NMEDIT=$ac_cv_prog_NMEDIT
-if test -n "$NMEDIT"; then
-  { $as_echo "$as_me:$LINENO: result: $NMEDIT" >&5
-$as_echo "$NMEDIT" >&6; }
-else
-  { $as_echo "$as_me:$LINENO: result: no" >&5
-$as_echo "no" >&6; }
-fi
-
-
-fi
-if test -z "$ac_cv_prog_NMEDIT"; then
-  ac_ct_NMEDIT=$NMEDIT
-  # Extract the first word of "nmedit", so it can be a program name with args.
-set dummy nmedit; ac_word=$2
-{ $as_echo "$as_me:$LINENO: checking for $ac_word" >&5
-$as_echo_n "checking for $ac_word... " >&6; }
-if test "${ac_cv_prog_ac_ct_NMEDIT+set}" = set; then
-  $as_echo_n "(cached) " >&6
-else
-  if test -n "$ac_ct_NMEDIT"; then
-  ac_cv_prog_ac_ct_NMEDIT="$ac_ct_NMEDIT" # Let the user override the test.
-else
-as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH
-do
-  IFS=$as_save_IFS
-  test -z "$as_dir" && as_dir=.
-  for ac_exec_ext in '' $ac_executable_extensions; do
-  if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
-    ac_cv_prog_ac_ct_NMEDIT="nmedit"
-    $as_echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5
-    break 2
-  fi
-done
-done
-IFS=$as_save_IFS
-
-fi
-fi
-ac_ct_NMEDIT=$ac_cv_prog_ac_ct_NMEDIT
-if test -n "$ac_ct_NMEDIT"; then
-  { $as_echo "$as_me:$LINENO: result: $ac_ct_NMEDIT" >&5
-$as_echo "$ac_ct_NMEDIT" >&6; }
-else
-  { $as_echo "$as_me:$LINENO: result: no" >&5
-$as_echo "no" >&6; }
-fi
-
-  if test "x$ac_ct_NMEDIT" = x; then
-    NMEDIT=":"
-  else
-    case $cross_compiling:$ac_tool_warned in
-yes:)
-{ $as_echo "$as_me:$LINENO: WARNING: using cross tools not prefixed with host triplet" >&5
-$as_echo "$as_me: WARNING: using cross tools not prefixed with host triplet" >&2;}
-ac_tool_warned=yes ;;
-esac
-    NMEDIT=$ac_ct_NMEDIT
-  fi
-else
-  NMEDIT="$ac_cv_prog_NMEDIT"
-fi
-
-    if test -n "$ac_tool_prefix"; then
-  # Extract the first word of "${ac_tool_prefix}lipo", so it can be a program name with args.
-set dummy ${ac_tool_prefix}lipo; ac_word=$2
-{ $as_echo "$as_me:$LINENO: checking for $ac_word" >&5
+if test -n "$ac_tool_prefix"; then
+  # Extract the first word of "${ac_tool_prefix}mt", so it can be a program name with args.
+set dummy ${ac_tool_prefix}mt; ac_word=$2
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
 $as_echo_n "checking for $ac_word... " >&6; }
-if test "${ac_cv_prog_LIPO+set}" = set; then
+if ${ac_cv_prog_MANIFEST_TOOL+:} false; then :
   $as_echo_n "(cached) " >&6
 else
-  if test -n "$LIPO"; then
-  ac_cv_prog_LIPO="$LIPO" # Let the user override the test.
+  if test -n "$MANIFEST_TOOL"; then
+  ac_cv_prog_MANIFEST_TOOL="$MANIFEST_TOOL" # Let the user override the test.
 else
 as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
 for as_dir in $PATH
 do
   IFS=$as_save_IFS
   test -z "$as_dir" && as_dir=.
-  for ac_exec_ext in '' $ac_executable_extensions; do
+    for ac_exec_ext in '' $ac_executable_extensions; do
   if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
-    ac_cv_prog_LIPO="${ac_tool_prefix}lipo"
-    $as_echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5
+    ac_cv_prog_MANIFEST_TOOL="${ac_tool_prefix}mt"
+    $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
     break 2
   fi
 done
-done
+  done
 IFS=$as_save_IFS
 
 fi
 fi
-LIPO=$ac_cv_prog_LIPO
-if test -n "$LIPO"; then
-  { $as_echo "$as_me:$LINENO: result: $LIPO" >&5
-$as_echo "$LIPO" >&6; }
+MANIFEST_TOOL=$ac_cv_prog_MANIFEST_TOOL
+if test -n "$MANIFEST_TOOL"; then
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $MANIFEST_TOOL" >&5
+$as_echo "$MANIFEST_TOOL" >&6; }
 else
-  { $as_echo "$as_me:$LINENO: result: no" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
 $as_echo "no" >&6; }
 fi
 
 
 fi
-if test -z "$ac_cv_prog_LIPO"; then
-  ac_ct_LIPO=$LIPO
-  # Extract the first word of "lipo", so it can be a program name with args.
-set dummy lipo; ac_word=$2
-{ $as_echo "$as_me:$LINENO: checking for $ac_word" >&5
+if test -z "$ac_cv_prog_MANIFEST_TOOL"; then
+  ac_ct_MANIFEST_TOOL=$MANIFEST_TOOL
+  # Extract the first word of "mt", so it can be a program name with args.
+set dummy mt; ac_word=$2
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
 $as_echo_n "checking for $ac_word... " >&6; }
-if test "${ac_cv_prog_ac_ct_LIPO+set}" = set; then
+if ${ac_cv_prog_ac_ct_MANIFEST_TOOL+:} false; then :
   $as_echo_n "(cached) " >&6
 else
-  if test -n "$ac_ct_LIPO"; then
-  ac_cv_prog_ac_ct_LIPO="$ac_ct_LIPO" # Let the user override the test.
+  if test -n "$ac_ct_MANIFEST_TOOL"; then
+  ac_cv_prog_ac_ct_MANIFEST_TOOL="$ac_ct_MANIFEST_TOOL" # Let the user override the test.
 else
 as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
 for as_dir in $PATH
 do
   IFS=$as_save_IFS
   test -z "$as_dir" && as_dir=.
-  for ac_exec_ext in '' $ac_executable_extensions; do
+    for ac_exec_ext in '' $ac_executable_extensions; do
   if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
-    ac_cv_prog_ac_ct_LIPO="lipo"
-    $as_echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5
+    ac_cv_prog_ac_ct_MANIFEST_TOOL="mt"
+    $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
     break 2
   fi
 done
-done
+  done
 IFS=$as_save_IFS
 
 fi
-fi
-ac_ct_LIPO=$ac_cv_prog_ac_ct_LIPO
-if test -n "$ac_ct_LIPO"; then
-  { $as_echo "$as_me:$LINENO: result: $ac_ct_LIPO" >&5
-$as_echo "$ac_ct_LIPO" >&6; }
+fi
+ac_ct_MANIFEST_TOOL=$ac_cv_prog_ac_ct_MANIFEST_TOOL
+if test -n "$ac_ct_MANIFEST_TOOL"; then
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_ct_MANIFEST_TOOL" >&5
+$as_echo "$ac_ct_MANIFEST_TOOL" >&6; }
 else
-  { $as_echo "$as_me:$LINENO: result: no" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
 $as_echo "no" >&6; }
 fi
 
-  if test "x$ac_ct_LIPO" = x; then
-    LIPO=":"
+  if test "x$ac_ct_MANIFEST_TOOL" = x; then
+    MANIFEST_TOOL=":"
   else
     case $cross_compiling:$ac_tool_warned in
 yes:)
-{ $as_echo "$as_me:$LINENO: WARNING: using cross tools not prefixed with host triplet" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: using cross tools not prefixed with host triplet" >&5
 $as_echo "$as_me: WARNING: using cross tools not prefixed with host triplet" >&2;}
 ac_tool_warned=yes ;;
 esac
-    LIPO=$ac_ct_LIPO
+    MANIFEST_TOOL=$ac_ct_MANIFEST_TOOL
   fi
 else
-  LIPO="$ac_cv_prog_LIPO"
+  MANIFEST_TOOL="$ac_cv_prog_MANIFEST_TOOL"
+fi
+
+test -z "$MANIFEST_TOOL" && MANIFEST_TOOL=mt
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking if $MANIFEST_TOOL is a manifest tool" >&5
+$as_echo_n "checking if $MANIFEST_TOOL is a manifest tool... " >&6; }
+if ${lt_cv_path_mainfest_tool+:} false; then :
+  $as_echo_n "(cached) " >&6
+else
+  lt_cv_path_mainfest_tool=no
+  echo "$as_me:$LINENO: $MANIFEST_TOOL '-?'" >&5
+  $MANIFEST_TOOL '-?' 2>conftest.err > conftest.out
+  cat conftest.err >&5
+  if $GREP 'Manifest Tool' conftest.out > /dev/null; then
+    lt_cv_path_mainfest_tool=yes
+  fi
+  rm -f conftest*
 fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $lt_cv_path_mainfest_tool" >&5
+$as_echo "$lt_cv_path_mainfest_tool" >&6; }
+if test "x$lt_cv_path_mainfest_tool" != xyes; then
+  MANIFEST_TOOL=:
+fi
+
+
+
 
+
+
+  case $host_os in
+    rhapsody* | darwin*)
     if test -n "$ac_tool_prefix"; then
-  # Extract the first word of "${ac_tool_prefix}otool", so it can be a program name with args.
-set dummy ${ac_tool_prefix}otool; ac_word=$2
-{ $as_echo "$as_me:$LINENO: checking for $ac_word" >&5
+  # Extract the first word of "${ac_tool_prefix}dsymutil", so it can be a program name with args.
+set dummy ${ac_tool_prefix}dsymutil; ac_word=$2
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
 $as_echo_n "checking for $ac_word... " >&6; }
-if test "${ac_cv_prog_OTOOL+set}" = set; then
+if ${ac_cv_prog_DSYMUTIL+:} false; then :
   $as_echo_n "(cached) " >&6
 else
-  if test -n "$OTOOL"; then
-  ac_cv_prog_OTOOL="$OTOOL" # Let the user override the test.
+  if test -n "$DSYMUTIL"; then
+  ac_cv_prog_DSYMUTIL="$DSYMUTIL" # Let the user override the test.
 else
 as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
 for as_dir in $PATH
 do
   IFS=$as_save_IFS
   test -z "$as_dir" && as_dir=.
-  for ac_exec_ext in '' $ac_executable_extensions; do
+    for ac_exec_ext in '' $ac_executable_extensions; do
   if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
-    ac_cv_prog_OTOOL="${ac_tool_prefix}otool"
-    $as_echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5
+    ac_cv_prog_DSYMUTIL="${ac_tool_prefix}dsymutil"
+    $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
     break 2
   fi
 done
-done
+  done
 IFS=$as_save_IFS
 
 fi
 fi
-OTOOL=$ac_cv_prog_OTOOL
-if test -n "$OTOOL"; then
-  { $as_echo "$as_me:$LINENO: result: $OTOOL" >&5
-$as_echo "$OTOOL" >&6; }
+DSYMUTIL=$ac_cv_prog_DSYMUTIL
+if test -n "$DSYMUTIL"; then
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $DSYMUTIL" >&5
+$as_echo "$DSYMUTIL" >&6; }
 else
-  { $as_echo "$as_me:$LINENO: result: no" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
 $as_echo "no" >&6; }
 fi
 
 
 fi
-if test -z "$ac_cv_prog_OTOOL"; then
-  ac_ct_OTOOL=$OTOOL
-  # Extract the first word of "otool", so it can be a program name with args.
-set dummy otool; ac_word=$2
-{ $as_echo "$as_me:$LINENO: checking for $ac_word" >&5
+if test -z "$ac_cv_prog_DSYMUTIL"; then
+  ac_ct_DSYMUTIL=$DSYMUTIL
+  # Extract the first word of "dsymutil", so it can be a program name with args.
+set dummy dsymutil; ac_word=$2
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
 $as_echo_n "checking for $ac_word... " >&6; }
-if test "${ac_cv_prog_ac_ct_OTOOL+set}" = set; then
+if ${ac_cv_prog_ac_ct_DSYMUTIL+:} false; then :
   $as_echo_n "(cached) " >&6
 else
-  if test -n "$ac_ct_OTOOL"; then
-  ac_cv_prog_ac_ct_OTOOL="$ac_ct_OTOOL" # Let the user override the test.
+  if test -n "$ac_ct_DSYMUTIL"; then
+  ac_cv_prog_ac_ct_DSYMUTIL="$ac_ct_DSYMUTIL" # Let the user override the test.
 else
 as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
 for as_dir in $PATH
 do
   IFS=$as_save_IFS
   test -z "$as_dir" && as_dir=.
-  for ac_exec_ext in '' $ac_executable_extensions; do
+    for ac_exec_ext in '' $ac_executable_extensions; do
   if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
-    ac_cv_prog_ac_ct_OTOOL="otool"
-    $as_echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5
+    ac_cv_prog_ac_ct_DSYMUTIL="dsymutil"
+    $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
     break 2
   fi
 done
-done
+  done
 IFS=$as_save_IFS
 
 fi
 fi
-ac_ct_OTOOL=$ac_cv_prog_ac_ct_OTOOL
-if test -n "$ac_ct_OTOOL"; then
-  { $as_echo "$as_me:$LINENO: result: $ac_ct_OTOOL" >&5
-$as_echo "$ac_ct_OTOOL" >&6; }
+ac_ct_DSYMUTIL=$ac_cv_prog_ac_ct_DSYMUTIL
+if test -n "$ac_ct_DSYMUTIL"; then
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_ct_DSYMUTIL" >&5
+$as_echo "$ac_ct_DSYMUTIL" >&6; }
 else
-  { $as_echo "$as_me:$LINENO: result: no" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
 $as_echo "no" >&6; }
 fi
 
-  if test "x$ac_ct_OTOOL" = x; then
-    OTOOL=":"
+  if test "x$ac_ct_DSYMUTIL" = x; then
+    DSYMUTIL=":"
   else
     case $cross_compiling:$ac_tool_warned in
 yes:)
-{ $as_echo "$as_me:$LINENO: WARNING: using cross tools not prefixed with host triplet" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: using cross tools not prefixed with host triplet" >&5
 $as_echo "$as_me: WARNING: using cross tools not prefixed with host triplet" >&2;}
 ac_tool_warned=yes ;;
 esac
-    OTOOL=$ac_ct_OTOOL
+    DSYMUTIL=$ac_ct_DSYMUTIL
   fi
 else
-  OTOOL="$ac_cv_prog_OTOOL"
+  DSYMUTIL="$ac_cv_prog_DSYMUTIL"
 fi
 
     if test -n "$ac_tool_prefix"; then
-  # Extract the first word of "${ac_tool_prefix}otool64", so it can be a program name with args.
-set dummy ${ac_tool_prefix}otool64; ac_word=$2
-{ $as_echo "$as_me:$LINENO: checking for $ac_word" >&5
+  # Extract the first word of "${ac_tool_prefix}nmedit", so it can be a program name with args.
+set dummy ${ac_tool_prefix}nmedit; ac_word=$2
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
 $as_echo_n "checking for $ac_word... " >&6; }
-if test "${ac_cv_prog_OTOOL64+set}" = set; then
+if ${ac_cv_prog_NMEDIT+:} false; then :
   $as_echo_n "(cached) " >&6
 else
-  if test -n "$OTOOL64"; then
-  ac_cv_prog_OTOOL64="$OTOOL64" # Let the user override the test.
+  if test -n "$NMEDIT"; then
+  ac_cv_prog_NMEDIT="$NMEDIT" # Let the user override the test.
 else
 as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
 for as_dir in $PATH
 do
   IFS=$as_save_IFS
   test -z "$as_dir" && as_dir=.
-  for ac_exec_ext in '' $ac_executable_extensions; do
+    for ac_exec_ext in '' $ac_executable_extensions; do
   if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
-    ac_cv_prog_OTOOL64="${ac_tool_prefix}otool64"
-    $as_echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5
+    ac_cv_prog_NMEDIT="${ac_tool_prefix}nmedit"
+    $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
     break 2
   fi
 done
-done
+  done
 IFS=$as_save_IFS
 
 fi
 fi
-OTOOL64=$ac_cv_prog_OTOOL64
-if test -n "$OTOOL64"; then
-  { $as_echo "$as_me:$LINENO: result: $OTOOL64" >&5
-$as_echo "$OTOOL64" >&6; }
+NMEDIT=$ac_cv_prog_NMEDIT
+if test -n "$NMEDIT"; then
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $NMEDIT" >&5
+$as_echo "$NMEDIT" >&6; }
 else
-  { $as_echo "$as_me:$LINENO: result: no" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
 $as_echo "no" >&6; }
 fi
 
 
 fi
-if test -z "$ac_cv_prog_OTOOL64"; then
-  ac_ct_OTOOL64=$OTOOL64
-  # Extract the first word of "otool64", so it can be a program name with args.
-set dummy otool64; ac_word=$2
-{ $as_echo "$as_me:$LINENO: checking for $ac_word" >&5
+if test -z "$ac_cv_prog_NMEDIT"; then
+  ac_ct_NMEDIT=$NMEDIT
+  # Extract the first word of "nmedit", so it can be a program name with args.
+set dummy nmedit; ac_word=$2
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
 $as_echo_n "checking for $ac_word... " >&6; }
-if test "${ac_cv_prog_ac_ct_OTOOL64+set}" = set; then
+if ${ac_cv_prog_ac_ct_NMEDIT+:} false; then :
   $as_echo_n "(cached) " >&6
 else
-  if test -n "$ac_ct_OTOOL64"; then
-  ac_cv_prog_ac_ct_OTOOL64="$ac_ct_OTOOL64" # Let the user override the test.
+  if test -n "$ac_ct_NMEDIT"; then
+  ac_cv_prog_ac_ct_NMEDIT="$ac_ct_NMEDIT" # Let the user override the test.
 else
 as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
 for as_dir in $PATH
 do
   IFS=$as_save_IFS
   test -z "$as_dir" && as_dir=.
-  for ac_exec_ext in '' $ac_executable_extensions; do
+    for ac_exec_ext in '' $ac_executable_extensions; do
   if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
-    ac_cv_prog_ac_ct_OTOOL64="otool64"
-    $as_echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5
+    ac_cv_prog_ac_ct_NMEDIT="nmedit"
+    $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
     break 2
   fi
 done
-done
+  done
 IFS=$as_save_IFS
 
 fi
 fi
-ac_ct_OTOOL64=$ac_cv_prog_ac_ct_OTOOL64
-if test -n "$ac_ct_OTOOL64"; then
-  { $as_echo "$as_me:$LINENO: result: $ac_ct_OTOOL64" >&5
-$as_echo "$ac_ct_OTOOL64" >&6; }
+ac_ct_NMEDIT=$ac_cv_prog_ac_ct_NMEDIT
+if test -n "$ac_ct_NMEDIT"; then
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_ct_NMEDIT" >&5
+$as_echo "$ac_ct_NMEDIT" >&6; }
 else
-  { $as_echo "$as_me:$LINENO: result: no" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
 $as_echo "no" >&6; }
 fi
 
-  if test "x$ac_ct_OTOOL64" = x; then
-    OTOOL64=":"
+  if test "x$ac_ct_NMEDIT" = x; then
+    NMEDIT=":"
   else
     case $cross_compiling:$ac_tool_warned in
 yes:)
-{ $as_echo "$as_me:$LINENO: WARNING: using cross tools not prefixed with host triplet" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: using cross tools not prefixed with host triplet" >&5
 $as_echo "$as_me: WARNING: using cross tools not prefixed with host triplet" >&2;}
 ac_tool_warned=yes ;;
 esac
-    OTOOL64=$ac_ct_OTOOL64
+    NMEDIT=$ac_ct_NMEDIT
   fi
 else
-  OTOOL64="$ac_cv_prog_OTOOL64"
+  NMEDIT="$ac_cv_prog_NMEDIT"
 fi
 
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-    { $as_echo "$as_me:$LINENO: checking for -single_module linker flag" >&5
-$as_echo_n "checking for -single_module linker flag... " >&6; }
-if test "${lt_cv_apple_cc_single_mod+set}" = set; then
-  $as_echo_n "(cached) " >&6
-else
-  lt_cv_apple_cc_single_mod=no
-      if test -z "${LT_MULTI_MODULE}"; then
-	# By default we will add the -single_module flag. You can override
-	# by either setting the environment variable LT_MULTI_MODULE
-	# non-empty at configure time, or by adding -multi_module to the
-	# link flags.
-	rm -rf libconftest.dylib*
-	echo "int foo(void){return 1;}" > conftest.c
-	echo "$LTCC $LTCFLAGS $LDFLAGS -o libconftest.dylib \
--dynamiclib -Wl,-single_module conftest.c" >&5
-	$LTCC $LTCFLAGS $LDFLAGS -o libconftest.dylib \
-	  -dynamiclib -Wl,-single_module conftest.c 2>conftest.err
-        _lt_result=$?
-	if test -f libconftest.dylib && test ! -s conftest.err && test $_lt_result = 0; then
-	  lt_cv_apple_cc_single_mod=yes
-	else
-	  cat conftest.err >&5
-	fi
-	rm -rf libconftest.dylib*
-	rm -f conftest.*
-      fi
-fi
-{ $as_echo "$as_me:$LINENO: result: $lt_cv_apple_cc_single_mod" >&5
-$as_echo "$lt_cv_apple_cc_single_mod" >&6; }
-    { $as_echo "$as_me:$LINENO: checking for -exported_symbols_list linker flag" >&5
-$as_echo_n "checking for -exported_symbols_list linker flag... " >&6; }
-if test "${lt_cv_ld_exported_symbols_list+set}" = set; then
+    if test -n "$ac_tool_prefix"; then
+  # Extract the first word of "${ac_tool_prefix}lipo", so it can be a program name with args.
+set dummy ${ac_tool_prefix}lipo; ac_word=$2
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
+$as_echo_n "checking for $ac_word... " >&6; }
+if ${ac_cv_prog_LIPO+:} false; then :
   $as_echo_n "(cached) " >&6
 else
-  lt_cv_ld_exported_symbols_list=no
-      save_LDFLAGS=$LDFLAGS
-      echo "_main" > conftest.sym
-      LDFLAGS="$LDFLAGS -Wl,-exported_symbols_list,conftest.sym"
-      cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
-/* end confdefs.h.  */
-
-int
-main ()
-{
-
-  ;
-  return 0;
-}
-_ACEOF
-rm -f conftest.$ac_objext conftest$ac_exeext
-if { (ac_try="$ac_link"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_link") 2>conftest.er1
-  ac_status=$?
-  grep -v '^ *+' conftest.er1 >conftest.err
-  rm -f conftest.er1
-  cat conftest.err >&5
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } && {
-	 test -z "$ac_c_werror_flag" ||
-	 test ! -s conftest.err
-       } && test -s conftest$ac_exeext && {
-	 test "$cross_compiling" = yes ||
-	 $as_test_x conftest$ac_exeext
-       }; then
-  lt_cv_ld_exported_symbols_list=yes
+  if test -n "$LIPO"; then
+  ac_cv_prog_LIPO="$LIPO" # Let the user override the test.
 else
-  $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
-
-	lt_cv_ld_exported_symbols_list=no
-fi
-
-rm -rf conftest.dSYM
-rm -f core conftest.err conftest.$ac_objext conftest_ipa8_conftest.oo \
-      conftest$ac_exeext conftest.$ac_ext
-	LDFLAGS="$save_LDFLAGS"
-
-fi
-{ $as_echo "$as_me:$LINENO: result: $lt_cv_ld_exported_symbols_list" >&5
-$as_echo "$lt_cv_ld_exported_symbols_list" >&6; }
-    case $host_os in
-    rhapsody* | darwin1.[012])
-      _lt_dar_allow_undefined='${wl}-undefined ${wl}suppress' ;;
-    darwin1.*)
-      _lt_dar_allow_undefined='${wl}-flat_namespace ${wl}-undefined ${wl}suppress' ;;
-    darwin*) # darwin 5.x on
-      # if running on 10.5 or later, the deployment target defaults
-      # to the OS version, if on x86, and 10.4, the deployment
-      # target defaults to 10.4. Don't you love it?
-      case ${MACOSX_DEPLOYMENT_TARGET-10.0},$host in
-	10.0,*86*-darwin8*|10.0,*-darwin[91]*)
-	  _lt_dar_allow_undefined='${wl}-undefined ${wl}dynamic_lookup' ;;
-	10.[012]*)
-	  _lt_dar_allow_undefined='${wl}-flat_namespace ${wl}-undefined ${wl}suppress' ;;
-	10.*)
-	  _lt_dar_allow_undefined='${wl}-undefined ${wl}dynamic_lookup' ;;
-      esac
-    ;;
-  esac
-    if test "$lt_cv_apple_cc_single_mod" = "yes"; then
-      _lt_dar_single_mod='$single_module'
-    fi
-    if test "$lt_cv_ld_exported_symbols_list" = "yes"; then
-      _lt_dar_export_syms=' ${wl}-exported_symbols_list,$output_objdir/${libname}-symbols.expsym'
-    else
-      _lt_dar_export_syms='~$NMEDIT -s $output_objdir/${libname}-symbols.expsym ${lib}'
-    fi
-    if test "$DSYMUTIL" != ":"; then
-      _lt_dsymutil='~$DSYMUTIL $lib || :'
-    else
-      _lt_dsymutil=
-    fi
-    ;;
-  esac
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+  IFS=$as_save_IFS
+  test -z "$as_dir" && as_dir=.
+    for ac_exec_ext in '' $ac_executable_extensions; do
+  if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
+    ac_cv_prog_LIPO="${ac_tool_prefix}lipo"
+    $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
+    break 2
+  fi
+done
+  done
+IFS=$as_save_IFS
+
+fi
+fi
+LIPO=$ac_cv_prog_LIPO
+if test -n "$LIPO"; then
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $LIPO" >&5
+$as_echo "$LIPO" >&6; }
+else
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
+$as_echo "no" >&6; }
+fi
 
 
-for ac_header in dlfcn.h
-do
-as_ac_Header=`$as_echo "ac_cv_header_$ac_header" | $as_tr_sh`
-{ $as_echo "$as_me:$LINENO: checking for $ac_header" >&5
-$as_echo_n "checking for $ac_header... " >&6; }
-if { as_var=$as_ac_Header; eval "test \"\${$as_var+set}\" = set"; }; then
+fi
+if test -z "$ac_cv_prog_LIPO"; then
+  ac_ct_LIPO=$LIPO
+  # Extract the first word of "lipo", so it can be a program name with args.
+set dummy lipo; ac_word=$2
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
+$as_echo_n "checking for $ac_word... " >&6; }
+if ${ac_cv_prog_ac_ct_LIPO+:} false; then :
   $as_echo_n "(cached) " >&6
 else
-  cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
-/* end confdefs.h.  */
-$ac_includes_default
-
-#include <$ac_header>
-_ACEOF
-rm -f conftest.$ac_objext
-if { (ac_try="$ac_compile"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_compile") 2>conftest.er1
-  ac_status=$?
-  grep -v '^ *+' conftest.er1 >conftest.err
-  rm -f conftest.er1
-  cat conftest.err >&5
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } && {
-	 test -z "$ac_c_werror_flag" ||
-	 test ! -s conftest.err
-       } && test -s conftest.$ac_objext; then
-  eval "$as_ac_Header=yes"
+  if test -n "$ac_ct_LIPO"; then
+  ac_cv_prog_ac_ct_LIPO="$ac_ct_LIPO" # Let the user override the test.
 else
-  $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+  IFS=$as_save_IFS
+  test -z "$as_dir" && as_dir=.
+    for ac_exec_ext in '' $ac_executable_extensions; do
+  if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
+    ac_cv_prog_ac_ct_LIPO="lipo"
+    $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
+    break 2
+  fi
+done
+  done
+IFS=$as_save_IFS
 
-	eval "$as_ac_Header=no"
 fi
-
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
 fi
-ac_res=`eval 'as_val=${'$as_ac_Header'}
-		 $as_echo "$as_val"'`
-	       { $as_echo "$as_me:$LINENO: result: $ac_res" >&5
-$as_echo "$ac_res" >&6; }
-as_val=`eval 'as_val=${'$as_ac_Header'}
-		 $as_echo "$as_val"'`
-   if test "x$as_val" = x""yes; then
-  cat >>confdefs.h <<_ACEOF
-#define `$as_echo "HAVE_$ac_header" | $as_tr_cpp` 1
-_ACEOF
-
+ac_ct_LIPO=$ac_cv_prog_ac_ct_LIPO
+if test -n "$ac_ct_LIPO"; then
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_ct_LIPO" >&5
+$as_echo "$ac_ct_LIPO" >&6; }
+else
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
+$as_echo "no" >&6; }
 fi
 
-done
-
-
-
-ac_ext=cpp
-ac_cpp='$CXXCPP $CPPFLAGS'
-ac_compile='$CXX -c $CXXFLAGS $CPPFLAGS conftest.$ac_ext >&5'
-ac_link='$CXX -o conftest$ac_exeext $CXXFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
-ac_compiler_gnu=$ac_cv_cxx_compiler_gnu
-if test -z "$CXX"; then
-  if test -n "$CCC"; then
-    CXX=$CCC
+  if test "x$ac_ct_LIPO" = x; then
+    LIPO=":"
   else
+    case $cross_compiling:$ac_tool_warned in
+yes:)
+{ $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: using cross tools not prefixed with host triplet" >&5
+$as_echo "$as_me: WARNING: using cross tools not prefixed with host triplet" >&2;}
+ac_tool_warned=yes ;;
+esac
+    LIPO=$ac_ct_LIPO
+  fi
+else
+  LIPO="$ac_cv_prog_LIPO"
+fi
+
     if test -n "$ac_tool_prefix"; then
-  for ac_prog in g++ c++ gpp aCC CC cxx cc++ cl.exe FCC KCC RCC xlC_r xlC
-  do
-    # Extract the first word of "$ac_tool_prefix$ac_prog", so it can be a program name with args.
-set dummy $ac_tool_prefix$ac_prog; ac_word=$2
-{ $as_echo "$as_me:$LINENO: checking for $ac_word" >&5
+  # Extract the first word of "${ac_tool_prefix}otool", so it can be a program name with args.
+set dummy ${ac_tool_prefix}otool; ac_word=$2
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
 $as_echo_n "checking for $ac_word... " >&6; }
-if test "${ac_cv_prog_CXX+set}" = set; then
+if ${ac_cv_prog_OTOOL+:} false; then :
   $as_echo_n "(cached) " >&6
 else
-  if test -n "$CXX"; then
-  ac_cv_prog_CXX="$CXX" # Let the user override the test.
+  if test -n "$OTOOL"; then
+  ac_cv_prog_OTOOL="$OTOOL" # Let the user override the test.
 else
 as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
 for as_dir in $PATH
 do
   IFS=$as_save_IFS
   test -z "$as_dir" && as_dir=.
-  for ac_exec_ext in '' $ac_executable_extensions; do
+    for ac_exec_ext in '' $ac_executable_extensions; do
   if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
-    ac_cv_prog_CXX="$ac_tool_prefix$ac_prog"
-    $as_echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5
+    ac_cv_prog_OTOOL="${ac_tool_prefix}otool"
+    $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
     break 2
   fi
 done
-done
+  done
 IFS=$as_save_IFS
 
 fi
 fi
-CXX=$ac_cv_prog_CXX
-if test -n "$CXX"; then
-  { $as_echo "$as_me:$LINENO: result: $CXX" >&5
-$as_echo "$CXX" >&6; }
+OTOOL=$ac_cv_prog_OTOOL
+if test -n "$OTOOL"; then
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $OTOOL" >&5
+$as_echo "$OTOOL" >&6; }
 else
-  { $as_echo "$as_me:$LINENO: result: no" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
 $as_echo "no" >&6; }
 fi
 
 
-    test -n "$CXX" && break
-  done
 fi
-if test -z "$CXX"; then
-  ac_ct_CXX=$CXX
-  for ac_prog in g++ c++ gpp aCC CC cxx cc++ cl.exe FCC KCC RCC xlC_r xlC
-do
-  # Extract the first word of "$ac_prog", so it can be a program name with args.
-set dummy $ac_prog; ac_word=$2
-{ $as_echo "$as_me:$LINENO: checking for $ac_word" >&5
+if test -z "$ac_cv_prog_OTOOL"; then
+  ac_ct_OTOOL=$OTOOL
+  # Extract the first word of "otool", so it can be a program name with args.
+set dummy otool; ac_word=$2
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
 $as_echo_n "checking for $ac_word... " >&6; }
-if test "${ac_cv_prog_ac_ct_CXX+set}" = set; then
+if ${ac_cv_prog_ac_ct_OTOOL+:} false; then :
   $as_echo_n "(cached) " >&6
 else
-  if test -n "$ac_ct_CXX"; then
-  ac_cv_prog_ac_ct_CXX="$ac_ct_CXX" # Let the user override the test.
+  if test -n "$ac_ct_OTOOL"; then
+  ac_cv_prog_ac_ct_OTOOL="$ac_ct_OTOOL" # Let the user override the test.
 else
 as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
 for as_dir in $PATH
 do
   IFS=$as_save_IFS
   test -z "$as_dir" && as_dir=.
-  for ac_exec_ext in '' $ac_executable_extensions; do
+    for ac_exec_ext in '' $ac_executable_extensions; do
   if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
-    ac_cv_prog_ac_ct_CXX="$ac_prog"
-    $as_echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5
+    ac_cv_prog_ac_ct_OTOOL="otool"
+    $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
     break 2
   fi
 done
-done
+  done
 IFS=$as_save_IFS
 
 fi
 fi
-ac_ct_CXX=$ac_cv_prog_ac_ct_CXX
-if test -n "$ac_ct_CXX"; then
-  { $as_echo "$as_me:$LINENO: result: $ac_ct_CXX" >&5
-$as_echo "$ac_ct_CXX" >&6; }
+ac_ct_OTOOL=$ac_cv_prog_ac_ct_OTOOL
+if test -n "$ac_ct_OTOOL"; then
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_ct_OTOOL" >&5
+$as_echo "$ac_ct_OTOOL" >&6; }
 else
-  { $as_echo "$as_me:$LINENO: result: no" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
 $as_echo "no" >&6; }
 fi
 
-
-  test -n "$ac_ct_CXX" && break
-done
-
-  if test "x$ac_ct_CXX" = x; then
-    CXX="g++"
+  if test "x$ac_ct_OTOOL" = x; then
+    OTOOL=":"
   else
     case $cross_compiling:$ac_tool_warned in
 yes:)
-{ $as_echo "$as_me:$LINENO: WARNING: using cross tools not prefixed with host triplet" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: using cross tools not prefixed with host triplet" >&5
 $as_echo "$as_me: WARNING: using cross tools not prefixed with host triplet" >&2;}
 ac_tool_warned=yes ;;
 esac
-    CXX=$ac_ct_CXX
+    OTOOL=$ac_ct_OTOOL
   fi
+else
+  OTOOL="$ac_cv_prog_OTOOL"
 fi
 
+    if test -n "$ac_tool_prefix"; then
+  # Extract the first word of "${ac_tool_prefix}otool64", so it can be a program name with args.
+set dummy ${ac_tool_prefix}otool64; ac_word=$2
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
+$as_echo_n "checking for $ac_word... " >&6; }
+if ${ac_cv_prog_OTOOL64+:} false; then :
+  $as_echo_n "(cached) " >&6
+else
+  if test -n "$OTOOL64"; then
+  ac_cv_prog_OTOOL64="$OTOOL64" # Let the user override the test.
+else
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+  IFS=$as_save_IFS
+  test -z "$as_dir" && as_dir=.
+    for ac_exec_ext in '' $ac_executable_extensions; do
+  if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
+    ac_cv_prog_OTOOL64="${ac_tool_prefix}otool64"
+    $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
+    break 2
   fi
+done
+  done
+IFS=$as_save_IFS
+
+fi
+fi
+OTOOL64=$ac_cv_prog_OTOOL64
+if test -n "$OTOOL64"; then
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $OTOOL64" >&5
+$as_echo "$OTOOL64" >&6; }
+else
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
+$as_echo "no" >&6; }
 fi
-# Provide some information about the compiler.
-$as_echo "$as_me:$LINENO: checking for C++ compiler version" >&5
-set X $ac_compile
-ac_compiler=$2
-{ (ac_try="$ac_compiler --version >&5"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_compiler --version >&5") 2>&5
-  ac_status=$?
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); }
-{ (ac_try="$ac_compiler -v >&5"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_compiler -v >&5") 2>&5
-  ac_status=$?
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); }
-{ (ac_try="$ac_compiler -V >&5"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_compiler -V >&5") 2>&5
-  ac_status=$?
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); }
 
-{ $as_echo "$as_me:$LINENO: checking whether we are using the GNU C++ compiler" >&5
-$as_echo_n "checking whether we are using the GNU C++ compiler... " >&6; }
-if test "${ac_cv_cxx_compiler_gnu+set}" = set; then
+
+fi
+if test -z "$ac_cv_prog_OTOOL64"; then
+  ac_ct_OTOOL64=$OTOOL64
+  # Extract the first word of "otool64", so it can be a program name with args.
+set dummy otool64; ac_word=$2
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
+$as_echo_n "checking for $ac_word... " >&6; }
+if ${ac_cv_prog_ac_ct_OTOOL64+:} false; then :
   $as_echo_n "(cached) " >&6
 else
-  cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
-/* end confdefs.h.  */
+  if test -n "$ac_ct_OTOOL64"; then
+  ac_cv_prog_ac_ct_OTOOL64="$ac_ct_OTOOL64" # Let the user override the test.
+else
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+  IFS=$as_save_IFS
+  test -z "$as_dir" && as_dir=.
+    for ac_exec_ext in '' $ac_executable_extensions; do
+  if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
+    ac_cv_prog_ac_ct_OTOOL64="otool64"
+    $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
+    break 2
+  fi
+done
+  done
+IFS=$as_save_IFS
 
-int
-main ()
-{
-#ifndef __GNUC__
-       choke me
-#endif
+fi
+fi
+ac_ct_OTOOL64=$ac_cv_prog_ac_ct_OTOOL64
+if test -n "$ac_ct_OTOOL64"; then
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_ct_OTOOL64" >&5
+$as_echo "$ac_ct_OTOOL64" >&6; }
+else
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
+$as_echo "no" >&6; }
+fi
 
-  ;
-  return 0;
-}
-_ACEOF
-rm -f conftest.$ac_objext
-if { (ac_try="$ac_compile"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
+  if test "x$ac_ct_OTOOL64" = x; then
+    OTOOL64=":"
+  else
+    case $cross_compiling:$ac_tool_warned in
+yes:)
+{ $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: using cross tools not prefixed with host triplet" >&5
+$as_echo "$as_me: WARNING: using cross tools not prefixed with host triplet" >&2;}
+ac_tool_warned=yes ;;
 esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_compile") 2>conftest.er1
-  ac_status=$?
-  grep -v '^ *+' conftest.er1 >conftest.err
-  rm -f conftest.er1
-  cat conftest.err >&5
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } && {
-	 test -z "$ac_cxx_werror_flag" ||
-	 test ! -s conftest.err
-       } && test -s conftest.$ac_objext; then
-  ac_compiler_gnu=yes
+    OTOOL64=$ac_ct_OTOOL64
+  fi
 else
-  $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
-
-	ac_compiler_gnu=no
+  OTOOL64="$ac_cv_prog_OTOOL64"
 fi
 
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
-ac_cv_cxx_compiler_gnu=$ac_compiler_gnu
 
-fi
-{ $as_echo "$as_me:$LINENO: result: $ac_cv_cxx_compiler_gnu" >&5
-$as_echo "$ac_cv_cxx_compiler_gnu" >&6; }
-if test $ac_compiler_gnu = yes; then
-  GXX=yes
-else
-  GXX=
-fi
-ac_test_CXXFLAGS=${CXXFLAGS+set}
-ac_save_CXXFLAGS=$CXXFLAGS
-{ $as_echo "$as_me:$LINENO: checking whether $CXX accepts -g" >&5
-$as_echo_n "checking whether $CXX accepts -g... " >&6; }
-if test "${ac_cv_prog_cxx_g+set}" = set; then
-  $as_echo_n "(cached) " >&6
-else
-  ac_save_cxx_werror_flag=$ac_cxx_werror_flag
-   ac_cxx_werror_flag=yes
-   ac_cv_prog_cxx_g=no
-   CXXFLAGS="-g"
-   cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
-/* end confdefs.h.  */
 
-int
-main ()
-{
 
-  ;
-  return 0;
-}
-_ACEOF
-rm -f conftest.$ac_objext
-if { (ac_try="$ac_compile"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_compile") 2>conftest.er1
-  ac_status=$?
-  grep -v '^ *+' conftest.er1 >conftest.err
-  rm -f conftest.er1
-  cat conftest.err >&5
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } && {
-	 test -z "$ac_cxx_werror_flag" ||
-	 test ! -s conftest.err
-       } && test -s conftest.$ac_objext; then
-  ac_cv_prog_cxx_g=yes
-else
-  $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
 
-	CXXFLAGS=""
-      cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
-/* end confdefs.h.  */
 
-int
-main ()
-{
 
-  ;
-  return 0;
-}
-_ACEOF
-rm -f conftest.$ac_objext
-if { (ac_try="$ac_compile"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_compile") 2>conftest.er1
-  ac_status=$?
-  grep -v '^ *+' conftest.er1 >conftest.err
-  rm -f conftest.er1
-  cat conftest.err >&5
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } && {
-	 test -z "$ac_cxx_werror_flag" ||
-	 test ! -s conftest.err
-       } && test -s conftest.$ac_objext; then
-  :
-else
-  $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
 
-	ac_cxx_werror_flag=$ac_save_cxx_werror_flag
-	 CXXFLAGS="-g"
-	 cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
-/* end confdefs.h.  */
 
-int
-main ()
-{
 
-  ;
-  return 0;
-}
-_ACEOF
-rm -f conftest.$ac_objext
-if { (ac_try="$ac_compile"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_compile") 2>conftest.er1
-  ac_status=$?
-  grep -v '^ *+' conftest.er1 >conftest.err
-  rm -f conftest.er1
-  cat conftest.err >&5
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } && {
-	 test -z "$ac_cxx_werror_flag" ||
-	 test ! -s conftest.err
-       } && test -s conftest.$ac_objext; then
-  ac_cv_prog_cxx_g=yes
-else
-  $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
 
 
-fi
 
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
-fi
 
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
-fi
 
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
-   ac_cxx_werror_flag=$ac_save_cxx_werror_flag
-fi
-{ $as_echo "$as_me:$LINENO: result: $ac_cv_prog_cxx_g" >&5
-$as_echo "$ac_cv_prog_cxx_g" >&6; }
-if test "$ac_test_CXXFLAGS" = set; then
-  CXXFLAGS=$ac_save_CXXFLAGS
-elif test $ac_cv_prog_cxx_g = yes; then
-  if test "$GXX" = yes; then
-    CXXFLAGS="-g -O2"
-  else
-    CXXFLAGS="-g"
-  fi
-else
-  if test "$GXX" = yes; then
-    CXXFLAGS="-O2"
-  else
-    CXXFLAGS=
-  fi
-fi
-ac_ext=c
-ac_cpp='$CPP $CPPFLAGS'
-ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
-ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
-ac_compiler_gnu=$ac_cv_c_compiler_gnu
 
-depcc="$CXX"  am_compiler_list=
 
-{ $as_echo "$as_me:$LINENO: checking dependency style of $depcc" >&5
-$as_echo_n "checking dependency style of $depcc... " >&6; }
-if test "${am_cv_CXX_dependencies_compiler_type+set}" = set; then
-  $as_echo_n "(cached) " >&6
-else
-  if test -z "$AMDEP_TRUE" && test -f "$am_depcomp"; then
-  # We make a subdir and do the tests there.  Otherwise we can end up
-  # making bogus files that we don't know about and never remove.  For
-  # instance it was reported that on HP-UX the gcc test will end up
-  # making a dummy file named `D' -- because `-MD' means `put the output
-  # in D'.
-  mkdir conftest.dir
-  # Copy depcomp to subdir because otherwise we won't find it if we're
-  # using a relative directory.
-  cp "$am_depcomp" conftest.dir
-  cd conftest.dir
-  # We will build objects and dependencies in a subdirectory because
-  # it helps to detect inapplicable dependency modes.  For instance
-  # both Tru64's cc and ICC support -MD to output dependencies as a
-  # side effect of compilation, but ICC will put the dependencies in
-  # the current directory while Tru64 will put them in the object
-  # directory.
-  mkdir sub
 
-  am_cv_CXX_dependencies_compiler_type=none
-  if test "$am_compiler_list" = ""; then
-     am_compiler_list=`sed -n 's/^#*\([a-zA-Z0-9]*\))$/\1/p' < ./depcomp`
-  fi
-  am__universal=false
-  case " $depcc " in #(
-     *\ -arch\ *\ -arch\ *) am__universal=true ;;
-     esac
 
-  for depmode in $am_compiler_list; do
-    # Setup a source with many dependencies, because some compilers
-    # like to wrap large dependency lists on column 80 (with \), and
-    # we should not choose a depcomp mode which is confused by this.
-    #
-    # We need to recreate these files for each test, as the compiler may
-    # overwrite some of them when testing with obscure command lines.
-    # This happens at least with the AIX C compiler.
-    : > sub/conftest.c
-    for i in 1 2 3 4 5 6; do
-      echo '#include "conftst'$i'.h"' >> sub/conftest.c
-      # Using `: > sub/conftst$i.h' creates only sub/conftst1.h with
-      # Solaris 8's {/usr,}/bin/sh.
-      touch sub/conftst$i.h
-    done
-    echo "${am__include} ${am__quote}sub/conftest.Po${am__quote}" > confmf
 
-    # We check with `-c' and `-o' for the sake of the "dashmstdout"
-    # mode.  It turns out that the SunPro C++ compiler does not properly
-    # handle `-M -o', and we need to detect this.  Also, some Intel
-    # versions had trouble with output in subdirs
-    am__obj=sub/conftest.${OBJEXT-o}
-    am__minus_obj="-o $am__obj"
-    case $depmode in
-    gcc)
-      # This depmode causes a compiler race in universal mode.
-      test "$am__universal" = false || continue
-      ;;
-    nosideeffect)
-      # after this tag, mechanisms are not by side-effect, so they'll
-      # only be used when explicitly requested
-      if test "x$enable_dependency_tracking" = xyes; then
-	continue
-      else
-	break
-      fi
-      ;;
-    msvisualcpp | msvcmsys)
-      # This compiler won't grok `-c -o', but also, the minuso test has
-      # not run yet.  These depmodes are late enough in the game, and
-      # so weak that their functioning should not be impacted.
-      am__obj=conftest.${OBJEXT-o}
-      am__minus_obj=
-      ;;
-    none) break ;;
-    esac
-    if depmode=$depmode \
-       source=sub/conftest.c object=$am__obj \
-       depfile=sub/conftest.Po tmpdepfile=sub/conftest.TPo \
-       $SHELL ./depcomp $depcc -c $am__minus_obj sub/conftest.c \
-         >/dev/null 2>conftest.err &&
-       grep sub/conftst1.h sub/conftest.Po > /dev/null 2>&1 &&
-       grep sub/conftst6.h sub/conftest.Po > /dev/null 2>&1 &&
-       grep $am__obj sub/conftest.Po > /dev/null 2>&1 &&
-       ${MAKE-make} -s -f confmf > /dev/null 2>&1; then
-      # icc doesn't choke on unknown options, it will just issue warnings
-      # or remarks (even with -Werror).  So we grep stderr for any message
-      # that says an option was ignored or not supported.
-      # When given -MP, icc 7.0 and 7.1 complain thusly:
-      #   icc: Command line warning: ignoring option '-M'; no argument required
-      # The diagnosis changed in icc 8.0:
-      #   icc: Command line remark: option '-MP' not supported
-      if (grep 'ignoring option' conftest.err ||
-          grep 'not supported' conftest.err) >/dev/null 2>&1; then :; else
-        am_cv_CXX_dependencies_compiler_type=$depmode
-        break
+
+
+
+
+
+
+
+    { $as_echo "$as_me:${as_lineno-$LINENO}: checking for -single_module linker flag" >&5
+$as_echo_n "checking for -single_module linker flag... " >&6; }
+if ${lt_cv_apple_cc_single_mod+:} false; then :
+  $as_echo_n "(cached) " >&6
+else
+  lt_cv_apple_cc_single_mod=no
+      if test -z "${LT_MULTI_MODULE}"; then
+	# By default we will add the -single_module flag. You can override
+	# by either setting the environment variable LT_MULTI_MODULE
+	# non-empty at configure time, or by adding -multi_module to the
+	# link flags.
+	rm -rf libconftest.dylib*
+	echo "int foo(void){return 1;}" > conftest.c
+	echo "$LTCC $LTCFLAGS $LDFLAGS -o libconftest.dylib \
+-dynamiclib -Wl,-single_module conftest.c" >&5
+	$LTCC $LTCFLAGS $LDFLAGS -o libconftest.dylib \
+	  -dynamiclib -Wl,-single_module conftest.c 2>conftest.err
+        _lt_result=$?
+	# If there is a non-empty error log, and "single_module"
+	# appears in it, assume the flag caused a linker warning
+        if test -s conftest.err && $GREP single_module conftest.err; then
+	  cat conftest.err >&5
+	# Otherwise, if the output was created with a 0 exit code from
+	# the compiler, it worked.
+	elif test -f libconftest.dylib && test $_lt_result -eq 0; then
+	  lt_cv_apple_cc_single_mod=yes
+	else
+	  cat conftest.err >&5
+	fi
+	rm -rf libconftest.dylib*
+	rm -f conftest.*
       fi
-    fi
-  done
+fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $lt_cv_apple_cc_single_mod" >&5
+$as_echo "$lt_cv_apple_cc_single_mod" >&6; }
+
+    { $as_echo "$as_me:${as_lineno-$LINENO}: checking for -exported_symbols_list linker flag" >&5
+$as_echo_n "checking for -exported_symbols_list linker flag... " >&6; }
+if ${lt_cv_ld_exported_symbols_list+:} false; then :
+  $as_echo_n "(cached) " >&6
+else
+  lt_cv_ld_exported_symbols_list=no
+      save_LDFLAGS=$LDFLAGS
+      echo "_main" > conftest.sym
+      LDFLAGS="$LDFLAGS -Wl,-exported_symbols_list,conftest.sym"
+      cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+
+int
+main ()
+{
 
-  cd ..
-  rm -rf conftest.dir
+  ;
+  return 0;
+}
+_ACEOF
+if ac_fn_c_try_link "$LINENO"; then :
+  lt_cv_ld_exported_symbols_list=yes
 else
-  am_cv_CXX_dependencies_compiler_type=none
+  lt_cv_ld_exported_symbols_list=no
 fi
+rm -f core conftest.err conftest.$ac_objext \
+    conftest$ac_exeext conftest.$ac_ext
+	LDFLAGS="$save_LDFLAGS"
 
 fi
-{ $as_echo "$as_me:$LINENO: result: $am_cv_CXX_dependencies_compiler_type" >&5
-$as_echo "$am_cv_CXX_dependencies_compiler_type" >&6; }
-CXXDEPMODE=depmode=$am_cv_CXX_dependencies_compiler_type
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $lt_cv_ld_exported_symbols_list" >&5
+$as_echo "$lt_cv_ld_exported_symbols_list" >&6; }
 
- if
-  test "x$enable_dependency_tracking" != xno \
-  && test "$am_cv_CXX_dependencies_compiler_type" = gcc3; then
-  am__fastdepCXX_TRUE=
-  am__fastdepCXX_FALSE='#'
+    { $as_echo "$as_me:${as_lineno-$LINENO}: checking for -force_load linker flag" >&5
+$as_echo_n "checking for -force_load linker flag... " >&6; }
+if ${lt_cv_ld_force_load+:} false; then :
+  $as_echo_n "(cached) " >&6
 else
-  am__fastdepCXX_TRUE='#'
-  am__fastdepCXX_FALSE=
-fi
+  lt_cv_ld_force_load=no
+      cat > conftest.c << _LT_EOF
+int forced_loaded() { return 2;}
+_LT_EOF
+      echo "$LTCC $LTCFLAGS -c -o conftest.o conftest.c" >&5
+      $LTCC $LTCFLAGS -c -o conftest.o conftest.c 2>&5
+      echo "$AR cru libconftest.a conftest.o" >&5
+      $AR cru libconftest.a conftest.o 2>&5
+      echo "$RANLIB libconftest.a" >&5
+      $RANLIB libconftest.a 2>&5
+      cat > conftest.c << _LT_EOF
+int main() { return 0;}
+_LT_EOF
+      echo "$LTCC $LTCFLAGS $LDFLAGS -o conftest conftest.c -Wl,-force_load,./libconftest.a" >&5
+      $LTCC $LTCFLAGS $LDFLAGS -o conftest conftest.c -Wl,-force_load,./libconftest.a 2>conftest.err
+      _lt_result=$?
+      if test -s conftest.err && $GREP force_load conftest.err; then
+	cat conftest.err >&5
+      elif test -f conftest && test $_lt_result -eq 0 && $GREP forced_load conftest >/dev/null 2>&1 ; then
+	lt_cv_ld_force_load=yes
+      else
+	cat conftest.err >&5
+      fi
+        rm -f conftest.err libconftest.a conftest conftest.c
+        rm -rf conftest.dSYM
 
+fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $lt_cv_ld_force_load" >&5
+$as_echo "$lt_cv_ld_force_load" >&6; }
+    case $host_os in
+    rhapsody* | darwin1.[012])
+      _lt_dar_allow_undefined='${wl}-undefined ${wl}suppress' ;;
+    darwin1.*)
+      _lt_dar_allow_undefined='${wl}-flat_namespace ${wl}-undefined ${wl}suppress' ;;
+    darwin*) # darwin 5.x on
+      # if running on 10.5 or later, the deployment target defaults
+      # to the OS version, if on x86, and 10.4, the deployment
+      # target defaults to 10.4. Don't you love it?
+      case ${MACOSX_DEPLOYMENT_TARGET-10.0},$host in
+	10.0,*86*-darwin8*|10.0,*-darwin[91]*)
+	  _lt_dar_allow_undefined='${wl}-undefined ${wl}dynamic_lookup' ;;
+	10.[012]*)
+	  _lt_dar_allow_undefined='${wl}-flat_namespace ${wl}-undefined ${wl}suppress' ;;
+	10.*)
+	  _lt_dar_allow_undefined='${wl}-undefined ${wl}dynamic_lookup' ;;
+      esac
+    ;;
+  esac
+    if test "$lt_cv_apple_cc_single_mod" = "yes"; then
+      _lt_dar_single_mod='$single_module'
+    fi
+    if test "$lt_cv_ld_exported_symbols_list" = "yes"; then
+      _lt_dar_export_syms=' ${wl}-exported_symbols_list,$output_objdir/${libname}-symbols.expsym'
+    else
+      _lt_dar_export_syms='~$NMEDIT -s $output_objdir/${libname}-symbols.expsym ${lib}'
+    fi
+    if test "$DSYMUTIL" != ":" && test "$lt_cv_ld_force_load" = "no"; then
+      _lt_dsymutil='~$DSYMUTIL $lib || :'
+    else
+      _lt_dsymutil=
+    fi
+    ;;
+  esac
 
-if test -n "$CXX" && ( test "X$CXX" != "Xno" &&
-    ( (test "X$CXX" = "Xg++" && `g++ -v >/dev/null 2>&1` ) ||
-    (test "X$CXX" != "Xg++"))) ; then
-  ac_ext=cpp
-ac_cpp='$CXXCPP $CPPFLAGS'
-ac_compile='$CXX -c $CXXFLAGS $CPPFLAGS conftest.$ac_ext >&5'
-ac_link='$CXX -o conftest$ac_exeext $CXXFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
-ac_compiler_gnu=$ac_cv_cxx_compiler_gnu
-{ $as_echo "$as_me:$LINENO: checking how to run the C++ preprocessor" >&5
-$as_echo_n "checking how to run the C++ preprocessor... " >&6; }
-if test -z "$CXXCPP"; then
-  if test "${ac_cv_prog_CXXCPP+set}" = set; then
+ac_ext=c
+ac_cpp='$CPP $CPPFLAGS'
+ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
+ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
+ac_compiler_gnu=$ac_cv_c_compiler_gnu
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking how to run the C preprocessor" >&5
+$as_echo_n "checking how to run the C preprocessor... " >&6; }
+# On Suns, sometimes $CPP names a directory.
+if test -n "$CPP" && test -d "$CPP"; then
+  CPP=
+fi
+if test -z "$CPP"; then
+  if ${ac_cv_prog_CPP+:} false; then :
   $as_echo_n "(cached) " >&6
 else
-      # Double quotes because CXXCPP needs to be expanded
-    for CXXCPP in "$CXX -E" "/lib/cpp"
+      # Double quotes because CPP needs to be expanded
+    for CPP in "$CC -E" "$CC -E -traditional-cpp" "/lib/cpp"
     do
       ac_preproc_ok=false
-for ac_cxx_preproc_warn_flag in '' yes
+for ac_c_preproc_warn_flag in '' yes
 do
   # Use a header file that comes with gcc, so configuring glibc
   # with a fresh cross-compiler works.
@@ -8686,11 +7446,7 @@ do
   # <limits.h> exists even on freestanding compilers.
   # On the NeXT, cc -E runs the code through the compiler's parser,
   # not just through cpp. "Syntax error" is here to catch this case.
-  cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
 /* end confdefs.h.  */
 #ifdef __STDC__
 # include <limits.h>
@@ -8699,93 +7455,49 @@ cat >>conftest.$ac_ext <<_ACEOF
 #endif
 		     Syntax error
 _ACEOF
-if { (ac_try="$ac_cpp conftest.$ac_ext"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_cpp conftest.$ac_ext") 2>conftest.er1
-  ac_status=$?
-  grep -v '^ *+' conftest.er1 >conftest.err
-  rm -f conftest.er1
-  cat conftest.err >&5
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } >/dev/null && {
-	 test -z "$ac_cxx_preproc_warn_flag$ac_cxx_werror_flag" ||
-	 test ! -s conftest.err
-       }; then
-  :
-else
-  $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
+if ac_fn_c_try_cpp "$LINENO"; then :
 
+else
   # Broken: fails on valid input.
 continue
 fi
-
-rm -f conftest.err conftest.$ac_ext
+rm -f conftest.err conftest.i conftest.$ac_ext
 
   # OK, works on sane cases.  Now check whether nonexistent headers
   # can be detected and how.
-  cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
 /* end confdefs.h.  */
 #include <ac_nonexistent.h>
 _ACEOF
-if { (ac_try="$ac_cpp conftest.$ac_ext"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_cpp conftest.$ac_ext") 2>conftest.er1
-  ac_status=$?
-  grep -v '^ *+' conftest.er1 >conftest.err
-  rm -f conftest.er1
-  cat conftest.err >&5
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } >/dev/null && {
-	 test -z "$ac_cxx_preproc_warn_flag$ac_cxx_werror_flag" ||
-	 test ! -s conftest.err
-       }; then
+if ac_fn_c_try_cpp "$LINENO"; then :
   # Broken: success on invalid input.
 continue
 else
-  $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
-
   # Passes both tests.
 ac_preproc_ok=:
 break
 fi
-
-rm -f conftest.err conftest.$ac_ext
+rm -f conftest.err conftest.i conftest.$ac_ext
 
 done
 # Because of `break', _AC_PREPROC_IFELSE's cleaning code was skipped.
-rm -f conftest.err conftest.$ac_ext
-if $ac_preproc_ok; then
+rm -f conftest.i conftest.err conftest.$ac_ext
+if $ac_preproc_ok; then :
   break
 fi
 
     done
-    ac_cv_prog_CXXCPP=$CXXCPP
+    ac_cv_prog_CPP=$CPP
 
 fi
-  CXXCPP=$ac_cv_prog_CXXCPP
+  CPP=$ac_cv_prog_CPP
 else
-  ac_cv_prog_CXXCPP=$CXXCPP
+  ac_cv_prog_CPP=$CPP
 fi
-{ $as_echo "$as_me:$LINENO: result: $CXXCPP" >&5
-$as_echo "$CXXCPP" >&6; }
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $CPP" >&5
+$as_echo "$CPP" >&6; }
 ac_preproc_ok=false
-for ac_cxx_preproc_warn_flag in '' yes
+for ac_c_preproc_warn_flag in '' yes
 do
   # Use a header file that comes with gcc, so configuring glibc
   # with a fresh cross-compiler works.
@@ -8793,11 +7505,7 @@ do
   # <limits.h> exists even on freestanding compilers.
   # On the NeXT, cc -E runs the code through the compiler's parser,
   # not just through cpp. "Syntax error" is here to catch this case.
-  cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
 /* end confdefs.h.  */
 #ifdef __STDC__
 # include <limits.h>
@@ -8806,95 +7514,191 @@ cat >>conftest.$ac_ext <<_ACEOF
 #endif
 		     Syntax error
 _ACEOF
-if { (ac_try="$ac_cpp conftest.$ac_ext"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_cpp conftest.$ac_ext") 2>conftest.er1
-  ac_status=$?
-  grep -v '^ *+' conftest.er1 >conftest.err
-  rm -f conftest.er1
-  cat conftest.err >&5
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } >/dev/null && {
-	 test -z "$ac_cxx_preproc_warn_flag$ac_cxx_werror_flag" ||
-	 test ! -s conftest.err
-       }; then
-  :
-else
-  $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
+if ac_fn_c_try_cpp "$LINENO"; then :
 
+else
   # Broken: fails on valid input.
 continue
 fi
-
-rm -f conftest.err conftest.$ac_ext
+rm -f conftest.err conftest.i conftest.$ac_ext
 
   # OK, works on sane cases.  Now check whether nonexistent headers
   # can be detected and how.
-  cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
 /* end confdefs.h.  */
 #include <ac_nonexistent.h>
 _ACEOF
-if { (ac_try="$ac_cpp conftest.$ac_ext"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_cpp conftest.$ac_ext") 2>conftest.er1
-  ac_status=$?
-  grep -v '^ *+' conftest.er1 >conftest.err
-  rm -f conftest.er1
-  cat conftest.err >&5
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } >/dev/null && {
-	 test -z "$ac_cxx_preproc_warn_flag$ac_cxx_werror_flag" ||
-	 test ! -s conftest.err
-       }; then
+if ac_fn_c_try_cpp "$LINENO"; then :
   # Broken: success on invalid input.
 continue
 else
-  $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
+  # Passes both tests.
+ac_preproc_ok=:
+break
+fi
+rm -f conftest.err conftest.i conftest.$ac_ext
+
+done
+# Because of `break', _AC_PREPROC_IFELSE's cleaning code was skipped.
+rm -f conftest.i conftest.err conftest.$ac_ext
+if $ac_preproc_ok; then :
+
+else
+  { { $as_echo "$as_me:${as_lineno-$LINENO}: error: in \`$ac_pwd':" >&5
+$as_echo "$as_me: error: in \`$ac_pwd':" >&2;}
+as_fn_error $? "C preprocessor \"$CPP\" fails sanity check
+See \`config.log' for more details" "$LINENO" 5; }
+fi
+
+ac_ext=c
+ac_cpp='$CPP $CPPFLAGS'
+ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
+ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
+ac_compiler_gnu=$ac_cv_c_compiler_gnu
+
+
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for ANSI C header files" >&5
+$as_echo_n "checking for ANSI C header files... " >&6; }
+if ${ac_cv_header_stdc+:} false; then :
+  $as_echo_n "(cached) " >&6
+else
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+#include <stdlib.h>
+#include <stdarg.h>
+#include <string.h>
+#include <float.h>
+
+int
+main ()
+{
+
+  ;
+  return 0;
+}
+_ACEOF
+if ac_fn_c_try_compile "$LINENO"; then :
+  ac_cv_header_stdc=yes
+else
+  ac_cv_header_stdc=no
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
+
+if test $ac_cv_header_stdc = yes; then
+  # SunOS 4.x string.h does not declare mem*, contrary to ANSI.
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+#include <string.h>
+
+_ACEOF
+if (eval "$ac_cpp conftest.$ac_ext") 2>&5 |
+  $EGREP "memchr" >/dev/null 2>&1; then :
+
+else
+  ac_cv_header_stdc=no
+fi
+rm -f conftest*
+
+fi
+
+if test $ac_cv_header_stdc = yes; then
+  # ISC 2.0.2 stdlib.h does not declare free, contrary to ANSI.
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+#include <stdlib.h>
+
+_ACEOF
+if (eval "$ac_cpp conftest.$ac_ext") 2>&5 |
+  $EGREP "free" >/dev/null 2>&1; then :
+
+else
+  ac_cv_header_stdc=no
+fi
+rm -f conftest*
+
+fi
+
+if test $ac_cv_header_stdc = yes; then
+  # /bin/cc in Irix-4.0.5 gets non-ANSI ctype macros unless using -ansi.
+  if test "$cross_compiling" = yes; then :
+  :
+else
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+#include <ctype.h>
+#include <stdlib.h>
+#if ((' ' & 0x0FF) == 0x020)
+# define ISLOWER(c) ('a' <= (c) && (c) <= 'z')
+# define TOUPPER(c) (ISLOWER(c) ? 'A' + ((c) - 'a') : (c))
+#else
+# define ISLOWER(c) \
+		   (('a' <= (c) && (c) <= 'i') \
+		     || ('j' <= (c) && (c) <= 'r') \
+		     || ('s' <= (c) && (c) <= 'z'))
+# define TOUPPER(c) (ISLOWER(c) ? ((c) | 0x40) : (c))
+#endif
+
+#define XOR(e, f) (((e) && !(f)) || (!(e) && (f)))
+int
+main ()
+{
+  int i;
+  for (i = 0; i < 256; i++)
+    if (XOR (islower (i), ISLOWER (i))
+	|| toupper (i) != TOUPPER (i))
+      return 2;
+  return 0;
+}
+_ACEOF
+if ac_fn_c_try_run "$LINENO"; then :
+
+else
+  ac_cv_header_stdc=no
+fi
+rm -f core *.core core.conftest.* gmon.out bb.out conftest$ac_exeext \
+  conftest.$ac_objext conftest.beam conftest.$ac_ext
+fi
 
-  # Passes both tests.
-ac_preproc_ok=:
-break
 fi
+fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_header_stdc" >&5
+$as_echo "$ac_cv_header_stdc" >&6; }
+if test $ac_cv_header_stdc = yes; then
 
-rm -f conftest.err conftest.$ac_ext
+$as_echo "#define STDC_HEADERS 1" >>confdefs.h
 
-done
-# Because of `break', _AC_PREPROC_IFELSE's cleaning code was skipped.
-rm -f conftest.err conftest.$ac_ext
-if $ac_preproc_ok; then
-  :
-else
-  { { $as_echo "$as_me:$LINENO: error: in \`$ac_pwd':" >&5
-$as_echo "$as_me: error: in \`$ac_pwd':" >&2;}
-_lt_caught_CXX_error=yes; }
 fi
 
-ac_ext=c
-ac_cpp='$CPP $CPPFLAGS'
-ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
-ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
-ac_compiler_gnu=$ac_cv_c_compiler_gnu
+# On IRIX 5.3, sys/types and inttypes.h are conflicting.
+for ac_header in sys/types.h sys/stat.h stdlib.h string.h memory.h strings.h \
+		  inttypes.h stdint.h unistd.h
+do :
+  as_ac_Header=`$as_echo "ac_cv_header_$ac_header" | $as_tr_sh`
+ac_fn_c_check_header_compile "$LINENO" "$ac_header" "$as_ac_Header" "$ac_includes_default
+"
+if eval test \"x\$"$as_ac_Header"\" = x"yes"; then :
+  cat >>confdefs.h <<_ACEOF
+#define `$as_echo "HAVE_$ac_header" | $as_tr_cpp` 1
+_ACEOF
+
+fi
+
+done
+
+
+for ac_header in dlfcn.h
+do :
+  ac_fn_c_check_header_compile "$LINENO" "dlfcn.h" "ac_cv_header_dlfcn_h" "$ac_includes_default
+"
+if test "x$ac_cv_header_dlfcn_h" = xyes; then :
+  cat >>confdefs.h <<_ACEOF
+#define HAVE_DLFCN_H 1
+_ACEOF
 
-else
-  _lt_caught_CXX_error=yes
 fi
 
+done
+
 
 
 
@@ -8910,7 +7714,7 @@ fi
 
 
             # Check whether --enable-shared was given.
-if test "${enable_shared+set}" = set; then
+if test "${enable_shared+set}" = set; then :
   enableval=$enable_shared; p=${PACKAGE-default}
     case $enableval in
     yes) enable_shared=yes ;;
@@ -8941,7 +7745,7 @@ fi
 
 
   # Check whether --enable-static was given.
-if test "${enable_static+set}" = set; then
+if test "${enable_static+set}" = set; then :
   enableval=$enable_static; p=${PACKAGE-default}
     case $enableval in
     yes) enable_static=yes ;;
@@ -8973,8 +7777,23 @@ fi
 
 
 # Check whether --with-pic was given.
-if test "${with_pic+set}" = set; then
-  withval=$with_pic; pic_mode="$withval"
+if test "${with_pic+set}" = set; then :
+  withval=$with_pic; lt_p=${PACKAGE-default}
+    case $withval in
+    yes|no) pic_mode=$withval ;;
+    *)
+      pic_mode=default
+      # Look at the argument we got.  We use all the common list separators.
+      lt_save_ifs="$IFS"; IFS="${IFS}$PATH_SEPARATOR,"
+      for lt_pkg in $withval; do
+	IFS="$lt_save_ifs"
+	if test "X$lt_pkg" = "X$lt_p"; then
+	  pic_mode=yes
+	fi
+      done
+      IFS="$lt_save_ifs"
+      ;;
+    esac
 else
   pic_mode=default
 fi
@@ -8989,7 +7808,7 @@ test -z "$pic_mode" && pic_mode=default
 
 
   # Check whether --enable-fast-install was given.
-if test "${enable_fast_install+set}" = set; then
+if test "${enable_fast_install+set}" = set; then :
   enableval=$enable_fast_install; p=${PACKAGE-default}
     case $enableval in
     yes) enable_fast_install=yes ;;
@@ -9051,6 +7870,11 @@ LIBTOOL='$(SHELL) $(top_builddir)/libtool'
 
 
 
+
+
+
+
+
 test -z "$LN_S" && LN_S="ln -s"
 
 
@@ -9070,9 +7894,9 @@ if test -n "${ZSH_VERSION+set}" ; then
    setopt NO_GLOB_SUBST
 fi
 
-{ $as_echo "$as_me:$LINENO: checking for objdir" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for objdir" >&5
 $as_echo_n "checking for objdir... " >&6; }
-if test "${lt_cv_objdir+set}" = set; then
+if ${lt_cv_objdir+:} false; then :
   $as_echo_n "(cached) " >&6
 else
   rm -f .libs 2>/dev/null
@@ -9085,7 +7909,7 @@ else
 fi
 rmdir .libs 2>/dev/null
 fi
-{ $as_echo "$as_me:$LINENO: result: $lt_cv_objdir" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $lt_cv_objdir" >&5
 $as_echo "$lt_cv_objdir" >&6; }
 objdir=$lt_cv_objdir
 
@@ -9100,19 +7924,6 @@ _ACEOF
 
 
 
-
-
-
-
-
-
-
-
-
-
-
-
-
 case $host_os in
 aix3*)
   # AIX sometimes has problems with the GCC collect2 program.  For some
@@ -9125,23 +7936,6 @@ aix3*)
   ;;
 esac
 
-# Sed substitution that helps us do robust quoting.  It backslashifies
-# metacharacters that are still active within double-quoted strings.
-sed_quote_subst='s/\(["`$\\]\)/\\\1/g'
-
-# Same as above, but do not quote variable references.
-double_quote_subst='s/\(["`\\]\)/\\\1/g'
-
-# Sed substitution to delay expansion of an escaped shell variable in a
-# double_quote_subst'ed string.
-delay_variable_subst='s/\\\\\\\\\\\$/\\\\\\$/g'
-
-# Sed substitution to delay expansion of an escaped single quote.
-delay_single_quote_subst='s/'\''/'\'\\\\\\\'\''/g'
-
-# Sed substitution to avoid accidental globbing in evaled expressions
-no_glob_subst='s/\*/\\\*/g'
-
 # Global variables:
 ofile=libtool
 can_build_shared=yes
@@ -9170,7 +7964,7 @@ for cc_temp in $compiler""; do
     *) break;;
   esac
 done
-cc_basename=`$ECHO "X$cc_temp" | $Xsed -e 's%.*/%%' -e "s%^$host_alias-%%"`
+cc_basename=`$ECHO "$cc_temp" | $SED "s%.*/%%; s%^$host_alias-%%"`
 
 
 # Only perform the check for file, if the check method requires it
@@ -9178,9 +7972,9 @@ test -z "$MAGIC_CMD" && MAGIC_CMD=file
 case $deplibs_check_method in
 file_magic*)
   if test "$file_magic_cmd" = '$MAGIC_CMD'; then
-    { $as_echo "$as_me:$LINENO: checking for ${ac_tool_prefix}file" >&5
+    { $as_echo "$as_me:${as_lineno-$LINENO}: checking for ${ac_tool_prefix}file" >&5
 $as_echo_n "checking for ${ac_tool_prefix}file... " >&6; }
-if test "${lt_cv_path_MAGIC_CMD+set}" = set; then
+if ${lt_cv_path_MAGIC_CMD+:} false; then :
   $as_echo_n "(cached) " >&6
 else
   case $MAGIC_CMD in
@@ -9231,10 +8025,10 @@ fi
 
 MAGIC_CMD="$lt_cv_path_MAGIC_CMD"
 if test -n "$MAGIC_CMD"; then
-  { $as_echo "$as_me:$LINENO: result: $MAGIC_CMD" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $MAGIC_CMD" >&5
 $as_echo "$MAGIC_CMD" >&6; }
 else
-  { $as_echo "$as_me:$LINENO: result: no" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
 $as_echo "no" >&6; }
 fi
 
@@ -9244,9 +8038,9 @@ fi
 
 if test -z "$lt_cv_path_MAGIC_CMD"; then
   if test -n "$ac_tool_prefix"; then
-    { $as_echo "$as_me:$LINENO: checking for file" >&5
+    { $as_echo "$as_me:${as_lineno-$LINENO}: checking for file" >&5
 $as_echo_n "checking for file... " >&6; }
-if test "${lt_cv_path_MAGIC_CMD+set}" = set; then
+if ${lt_cv_path_MAGIC_CMD+:} false; then :
   $as_echo_n "(cached) " >&6
 else
   case $MAGIC_CMD in
@@ -9297,10 +8091,10 @@ fi
 
 MAGIC_CMD="$lt_cv_path_MAGIC_CMD"
 if test -n "$MAGIC_CMD"; then
-  { $as_echo "$as_me:$LINENO: result: $MAGIC_CMD" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $MAGIC_CMD" >&5
 $as_echo "$MAGIC_CMD" >&6; }
 else
-  { $as_echo "$as_me:$LINENO: result: no" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
 $as_echo "no" >&6; }
 fi
 
@@ -9379,11 +8173,16 @@ if test -n "$compiler"; then
 lt_prog_compiler_no_builtin_flag=
 
 if test "$GCC" = yes; then
-  lt_prog_compiler_no_builtin_flag=' -fno-builtin'
+  case $cc_basename in
+  nvcc*)
+    lt_prog_compiler_no_builtin_flag=' -Xcompiler -fno-builtin' ;;
+  *)
+    lt_prog_compiler_no_builtin_flag=' -fno-builtin' ;;
+  esac
 
-  { $as_echo "$as_me:$LINENO: checking if $compiler supports -fno-rtti -fno-exceptions" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: checking if $compiler supports -fno-rtti -fno-exceptions" >&5
 $as_echo_n "checking if $compiler supports -fno-rtti -fno-exceptions... " >&6; }
-if test "${lt_cv_prog_compiler_rtti_exceptions+set}" = set; then
+if ${lt_cv_prog_compiler_rtti_exceptions+:} false; then :
   $as_echo_n "(cached) " >&6
 else
   lt_cv_prog_compiler_rtti_exceptions=no
@@ -9399,15 +8198,15 @@ else
    -e 's:.*FLAGS}\{0,1\} :&$lt_compiler_flag :; t' \
    -e 's: [^ ]*conftest\.: $lt_compiler_flag&:; t' \
    -e 's:$: $lt_compiler_flag:'`
-   (eval echo "\"\$as_me:9402: $lt_compile\"" >&5)
+   (eval echo "\"\$as_me:$LINENO: $lt_compile\"" >&5)
    (eval "$lt_compile" 2>conftest.err)
    ac_status=$?
    cat conftest.err >&5
-   echo "$as_me:9406: \$? = $ac_status" >&5
+   echo "$as_me:$LINENO: \$? = $ac_status" >&5
    if (exit $ac_status) && test -s "$ac_outfile"; then
      # The compiler can only warn and ignore the option if not recognized
      # So say no if there are warnings other than the usual output.
-     $ECHO "X$_lt_compiler_boilerplate" | $Xsed -e '/^$/d' >conftest.exp
+     $ECHO "$_lt_compiler_boilerplate" | $SED '/^$/d' >conftest.exp
      $SED '/^$/d; /^ *+/d' conftest.err >conftest.er2
      if test ! -s conftest.er2 || diff conftest.exp conftest.er2 >/dev/null; then
        lt_cv_prog_compiler_rtti_exceptions=yes
@@ -9416,7 +8215,7 @@ else
    $RM conftest*
 
 fi
-{ $as_echo "$as_me:$LINENO: result: $lt_cv_prog_compiler_rtti_exceptions" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $lt_cv_prog_compiler_rtti_exceptions" >&5
 $as_echo "$lt_cv_prog_compiler_rtti_exceptions" >&6; }
 
 if test x"$lt_cv_prog_compiler_rtti_exceptions" = xyes; then
@@ -9436,8 +8235,6 @@ fi
 lt_prog_compiler_pic=
 lt_prog_compiler_static=
 
-{ $as_echo "$as_me:$LINENO: checking for $compiler option to produce PIC" >&5
-$as_echo_n "checking for $compiler option to produce PIC... " >&6; }
 
   if test "$GCC" = yes; then
     lt_prog_compiler_wl='-Wl,'
@@ -9485,6 +8282,12 @@ $as_echo_n "checking for $compiler option to produce PIC... " >&6; }
       lt_prog_compiler_pic='-fno-common'
       ;;
 
+    haiku*)
+      # PIC is the default for Haiku.
+      # The "-static" flag exists, but is broken.
+      lt_prog_compiler_static=
+      ;;
+
     hpux*)
       # PIC is the default for 64-bit PA HP-UX, but not for 32-bit
       # PA HP-UX.  On IA64 HP-UX, PIC is the default but the pic flag
@@ -9527,6 +8330,15 @@ $as_echo_n "checking for $compiler option to produce PIC... " >&6; }
       lt_prog_compiler_pic='-fPIC'
       ;;
     esac
+
+    case $cc_basename in
+    nvcc*) # Cuda Compiler Driver 2.2
+      lt_prog_compiler_wl='-Xlinker '
+      if test -n "$lt_prog_compiler_pic"; then
+        lt_prog_compiler_pic="-Xcompiler $lt_prog_compiler_pic"
+      fi
+      ;;
+    esac
   else
     # PORTME Check for flag to pass linker flags through the system compiler.
     case $host_os in
@@ -9568,7 +8380,7 @@ $as_echo_n "checking for $compiler option to produce PIC... " >&6; }
       lt_prog_compiler_static='-non_shared'
       ;;
 
-    linux* | k*bsd*-gnu)
+    linux* | k*bsd*-gnu | kopensolaris*-gnu)
       case $cc_basename in
       # old Intel for x86_64 which still supported -KPIC.
       ecc*)
@@ -9589,7 +8401,13 @@ $as_echo_n "checking for $compiler option to produce PIC... " >&6; }
 	lt_prog_compiler_pic='--shared'
 	lt_prog_compiler_static='--static'
 	;;
-      pgcc* | pgf77* | pgf90* | pgf95*)
+      nagfor*)
+	# NAG Fortran compiler
+	lt_prog_compiler_wl='-Wl,-Wl,,'
+	lt_prog_compiler_pic='-PIC'
+	lt_prog_compiler_static='-Bstatic'
+	;;
+      pgcc* | pgf77* | pgf90* | pgf95* | pgfortran*)
         # Portland Group compilers (*not* the Pentium gcc compiler,
 	# which looks to be a dead project)
 	lt_prog_compiler_wl='-Wl,'
@@ -9601,25 +8419,40 @@ $as_echo_n "checking for $compiler option to produce PIC... " >&6; }
         # All Alpha code is PIC.
         lt_prog_compiler_static='-non_shared'
         ;;
-      xl*)
-	# IBM XL C 8.0/Fortran 10.1 on PPC
+      xl* | bgxl* | bgf* | mpixl*)
+	# IBM XL C 8.0/Fortran 10.1, 11.1 on PPC and BlueGene
 	lt_prog_compiler_wl='-Wl,'
 	lt_prog_compiler_pic='-qpic'
 	lt_prog_compiler_static='-qstaticlink'
 	;;
       *)
 	case `$CC -V 2>&1 | sed 5q` in
+	*Sun\ Ceres\ Fortran* | *Sun*Fortran*\ [1-7].* | *Sun*Fortran*\ 8.[0-3]*)
+	  # Sun Fortran 8.3 passes all unrecognized flags to the linker
+	  lt_prog_compiler_pic='-KPIC'
+	  lt_prog_compiler_static='-Bstatic'
+	  lt_prog_compiler_wl=''
+	  ;;
+	*Sun\ F* | *Sun*Fortran*)
+	  lt_prog_compiler_pic='-KPIC'
+	  lt_prog_compiler_static='-Bstatic'
+	  lt_prog_compiler_wl='-Qoption ld '
+	  ;;
 	*Sun\ C*)
 	  # Sun C 5.9
 	  lt_prog_compiler_pic='-KPIC'
 	  lt_prog_compiler_static='-Bstatic'
 	  lt_prog_compiler_wl='-Wl,'
 	  ;;
-	*Sun\ F*)
-	  # Sun Fortran 8.3 passes all unrecognized flags to the linker
-	  lt_prog_compiler_pic='-KPIC'
+        *Intel*\ [CF]*Compiler*)
+	  lt_prog_compiler_wl='-Wl,'
+	  lt_prog_compiler_pic='-fPIC'
+	  lt_prog_compiler_static='-static'
+	  ;;
+	*Portland\ Group*)
+	  lt_prog_compiler_wl='-Wl,'
+	  lt_prog_compiler_pic='-fpic'
 	  lt_prog_compiler_static='-Bstatic'
-	  lt_prog_compiler_wl=''
 	  ;;
 	esac
 	;;
@@ -9651,7 +8484,7 @@ $as_echo_n "checking for $compiler option to produce PIC... " >&6; }
       lt_prog_compiler_pic='-KPIC'
       lt_prog_compiler_static='-Bstatic'
       case $cc_basename in
-      f77* | f90* | f95*)
+      f77* | f90* | f95* | sunf77* | sunf90* | sunf95*)
 	lt_prog_compiler_wl='-Qoption ld ';;
       *)
 	lt_prog_compiler_wl='-Wl,';;
@@ -9708,21 +8541,25 @@ case $host_os in
     lt_prog_compiler_pic="$lt_prog_compiler_pic -DPIC"
     ;;
 esac
-{ $as_echo "$as_me:$LINENO: result: $lt_prog_compiler_pic" >&5
-$as_echo "$lt_prog_compiler_pic" >&6; }
-
-
-
-
 
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $compiler option to produce PIC" >&5
+$as_echo_n "checking for $compiler option to produce PIC... " >&6; }
+if ${lt_cv_prog_compiler_pic+:} false; then :
+  $as_echo_n "(cached) " >&6
+else
+  lt_cv_prog_compiler_pic=$lt_prog_compiler_pic
+fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $lt_cv_prog_compiler_pic" >&5
+$as_echo "$lt_cv_prog_compiler_pic" >&6; }
+lt_prog_compiler_pic=$lt_cv_prog_compiler_pic
 
 #
 # Check to make sure the PIC flag actually works.
 #
 if test -n "$lt_prog_compiler_pic"; then
-  { $as_echo "$as_me:$LINENO: checking if $compiler PIC flag $lt_prog_compiler_pic works" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: checking if $compiler PIC flag $lt_prog_compiler_pic works" >&5
 $as_echo_n "checking if $compiler PIC flag $lt_prog_compiler_pic works... " >&6; }
-if test "${lt_cv_prog_compiler_pic_works+set}" = set; then
+if ${lt_cv_prog_compiler_pic_works+:} false; then :
   $as_echo_n "(cached) " >&6
 else
   lt_cv_prog_compiler_pic_works=no
@@ -9738,15 +8575,15 @@ else
    -e 's:.*FLAGS}\{0,1\} :&$lt_compiler_flag :; t' \
    -e 's: [^ ]*conftest\.: $lt_compiler_flag&:; t' \
    -e 's:$: $lt_compiler_flag:'`
-   (eval echo "\"\$as_me:9741: $lt_compile\"" >&5)
+   (eval echo "\"\$as_me:$LINENO: $lt_compile\"" >&5)
    (eval "$lt_compile" 2>conftest.err)
    ac_status=$?
    cat conftest.err >&5
-   echo "$as_me:9745: \$? = $ac_status" >&5
+   echo "$as_me:$LINENO: \$? = $ac_status" >&5
    if (exit $ac_status) && test -s "$ac_outfile"; then
      # The compiler can only warn and ignore the option if not recognized
      # So say no if there are warnings other than the usual output.
-     $ECHO "X$_lt_compiler_boilerplate" | $Xsed -e '/^$/d' >conftest.exp
+     $ECHO "$_lt_compiler_boilerplate" | $SED '/^$/d' >conftest.exp
      $SED '/^$/d; /^ *+/d' conftest.err >conftest.er2
      if test ! -s conftest.er2 || diff conftest.exp conftest.er2 >/dev/null; then
        lt_cv_prog_compiler_pic_works=yes
@@ -9755,7 +8592,7 @@ else
    $RM conftest*
 
 fi
-{ $as_echo "$as_me:$LINENO: result: $lt_cv_prog_compiler_pic_works" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $lt_cv_prog_compiler_pic_works" >&5
 $as_echo "$lt_cv_prog_compiler_pic_works" >&6; }
 
 if test x"$lt_cv_prog_compiler_pic_works" = xyes; then
@@ -9775,13 +8612,18 @@ fi
 
 
 
+
+
+
+
+
 #
 # Check to make sure the static flag actually works.
 #
 wl=$lt_prog_compiler_wl eval lt_tmp_static_flag=\"$lt_prog_compiler_static\"
-{ $as_echo "$as_me:$LINENO: checking if $compiler static flag $lt_tmp_static_flag works" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking if $compiler static flag $lt_tmp_static_flag works" >&5
 $as_echo_n "checking if $compiler static flag $lt_tmp_static_flag works... " >&6; }
-if test "${lt_cv_prog_compiler_static_works+set}" = set; then
+if ${lt_cv_prog_compiler_static_works+:} false; then :
   $as_echo_n "(cached) " >&6
 else
   lt_cv_prog_compiler_static_works=no
@@ -9794,7 +8636,7 @@ else
      if test -s conftest.err; then
        # Append any errors to the config.log.
        cat conftest.err 1>&5
-       $ECHO "X$_lt_linker_boilerplate" | $Xsed -e '/^$/d' > conftest.exp
+       $ECHO "$_lt_linker_boilerplate" | $SED '/^$/d' > conftest.exp
        $SED '/^$/d; /^ *+/d' conftest.err >conftest.er2
        if diff conftest.exp conftest.er2 >/dev/null; then
          lt_cv_prog_compiler_static_works=yes
@@ -9807,7 +8649,7 @@ else
    LDFLAGS="$save_LDFLAGS"
 
 fi
-{ $as_echo "$as_me:$LINENO: result: $lt_cv_prog_compiler_static_works" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $lt_cv_prog_compiler_static_works" >&5
 $as_echo "$lt_cv_prog_compiler_static_works" >&6; }
 
 if test x"$lt_cv_prog_compiler_static_works" = xyes; then
@@ -9822,9 +8664,9 @@ fi
 
 
 
-  { $as_echo "$as_me:$LINENO: checking if $compiler supports -c -o file.$ac_objext" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: checking if $compiler supports -c -o file.$ac_objext" >&5
 $as_echo_n "checking if $compiler supports -c -o file.$ac_objext... " >&6; }
-if test "${lt_cv_prog_compiler_c_o+set}" = set; then
+if ${lt_cv_prog_compiler_c_o+:} false; then :
   $as_echo_n "(cached) " >&6
 else
   lt_cv_prog_compiler_c_o=no
@@ -9843,16 +8685,16 @@ else
    -e 's:.*FLAGS}\{0,1\} :&$lt_compiler_flag :; t' \
    -e 's: [^ ]*conftest\.: $lt_compiler_flag&:; t' \
    -e 's:$: $lt_compiler_flag:'`
-   (eval echo "\"\$as_me:9846: $lt_compile\"" >&5)
+   (eval echo "\"\$as_me:$LINENO: $lt_compile\"" >&5)
    (eval "$lt_compile" 2>out/conftest.err)
    ac_status=$?
    cat out/conftest.err >&5
-   echo "$as_me:9850: \$? = $ac_status" >&5
+   echo "$as_me:$LINENO: \$? = $ac_status" >&5
    if (exit $ac_status) && test -s out/conftest2.$ac_objext
    then
      # The compiler can only warn and ignore the option if not recognized
      # So say no if there are warnings
-     $ECHO "X$_lt_compiler_boilerplate" | $Xsed -e '/^$/d' > out/conftest.exp
+     $ECHO "$_lt_compiler_boilerplate" | $SED '/^$/d' > out/conftest.exp
      $SED '/^$/d; /^ *+/d' out/conftest.err >out/conftest.er2
      if test ! -s out/conftest.er2 || diff out/conftest.exp out/conftest.er2 >/dev/null; then
        lt_cv_prog_compiler_c_o=yes
@@ -9869,7 +8711,7 @@ else
    $RM conftest*
 
 fi
-{ $as_echo "$as_me:$LINENO: result: $lt_cv_prog_compiler_c_o" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $lt_cv_prog_compiler_c_o" >&5
 $as_echo "$lt_cv_prog_compiler_c_o" >&6; }
 
 
@@ -9877,9 +8719,9 @@ $as_echo "$lt_cv_prog_compiler_c_o" >&6; }
 
 
 
-  { $as_echo "$as_me:$LINENO: checking if $compiler supports -c -o file.$ac_objext" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: checking if $compiler supports -c -o file.$ac_objext" >&5
 $as_echo_n "checking if $compiler supports -c -o file.$ac_objext... " >&6; }
-if test "${lt_cv_prog_compiler_c_o+set}" = set; then
+if ${lt_cv_prog_compiler_c_o+:} false; then :
   $as_echo_n "(cached) " >&6
 else
   lt_cv_prog_compiler_c_o=no
@@ -9898,16 +8740,16 @@ else
    -e 's:.*FLAGS}\{0,1\} :&$lt_compiler_flag :; t' \
    -e 's: [^ ]*conftest\.: $lt_compiler_flag&:; t' \
    -e 's:$: $lt_compiler_flag:'`
-   (eval echo "\"\$as_me:9901: $lt_compile\"" >&5)
+   (eval echo "\"\$as_me:$LINENO: $lt_compile\"" >&5)
    (eval "$lt_compile" 2>out/conftest.err)
    ac_status=$?
    cat out/conftest.err >&5
-   echo "$as_me:9905: \$? = $ac_status" >&5
+   echo "$as_me:$LINENO: \$? = $ac_status" >&5
    if (exit $ac_status) && test -s out/conftest2.$ac_objext
    then
      # The compiler can only warn and ignore the option if not recognized
      # So say no if there are warnings
-     $ECHO "X$_lt_compiler_boilerplate" | $Xsed -e '/^$/d' > out/conftest.exp
+     $ECHO "$_lt_compiler_boilerplate" | $SED '/^$/d' > out/conftest.exp
      $SED '/^$/d; /^ *+/d' out/conftest.err >out/conftest.er2
      if test ! -s out/conftest.er2 || diff out/conftest.exp out/conftest.er2 >/dev/null; then
        lt_cv_prog_compiler_c_o=yes
@@ -9924,7 +8766,7 @@ else
    $RM conftest*
 
 fi
-{ $as_echo "$as_me:$LINENO: result: $lt_cv_prog_compiler_c_o" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $lt_cv_prog_compiler_c_o" >&5
 $as_echo "$lt_cv_prog_compiler_c_o" >&6; }
 
 
@@ -9933,7 +8775,7 @@ $as_echo "$lt_cv_prog_compiler_c_o" >&6; }
 hard_links="nottested"
 if test "$lt_cv_prog_compiler_c_o" = no && test "$need_locks" != no; then
   # do not overwrite the value of need_locks provided by the user
-  { $as_echo "$as_me:$LINENO: checking if we can lock with hard links" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: checking if we can lock with hard links" >&5
 $as_echo_n "checking if we can lock with hard links... " >&6; }
   hard_links=yes
   $RM conftest*
@@ -9941,10 +8783,10 @@ $as_echo_n "checking if we can lock with hard links... " >&6; }
   touch conftest.a
   ln conftest.a conftest.b 2>&5 || hard_links=no
   ln conftest.a conftest.b 2>/dev/null && hard_links=no
-  { $as_echo "$as_me:$LINENO: result: $hard_links" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $hard_links" >&5
 $as_echo "$hard_links" >&6; }
   if test "$hard_links" = no; then
-    { $as_echo "$as_me:$LINENO: WARNING: \`$CC' does not support \`-c -o', so \`make -j' may be unsafe" >&5
+    { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: \`$CC' does not support \`-c -o', so \`make -j' may be unsafe" >&5
 $as_echo "$as_me: WARNING: \`$CC' does not support \`-c -o', so \`make -j' may be unsafe" >&2;}
     need_locks=warn
   fi
@@ -9957,7 +8799,7 @@ fi
 
 
 
-  { $as_echo "$as_me:$LINENO: checking whether the $compiler linker ($LD) supports shared libraries" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: checking whether the $compiler linker ($LD) supports shared libraries" >&5
 $as_echo_n "checking whether the $compiler linker ($LD) supports shared libraries... " >&6; }
 
   runpath_var=
@@ -9973,7 +8815,6 @@ $as_echo_n "checking whether the $compiler linker ($LD) supports shared librarie
   hardcode_direct=no
   hardcode_direct_absolute=no
   hardcode_libdir_flag_spec=
-  hardcode_libdir_flag_spec_ld=
   hardcode_libdir_separator=
   hardcode_minus_L=no
   hardcode_shlibpath_var=unsupported
@@ -10020,7 +8861,33 @@ $as_echo_n "checking whether the $compiler linker ($LD) supports shared librarie
   esac
 
   ld_shlibs=yes
+
+  # On some targets, GNU ld is compatible enough with the native linker
+  # that we're better off using the native interface for both.
+  lt_use_gnu_ld_interface=no
   if test "$with_gnu_ld" = yes; then
+    case $host_os in
+      aix*)
+	# The AIX port of GNU ld has always aspired to compatibility
+	# with the native linker.  However, as the warning in the GNU ld
+	# block says, versions before 2.19.5* couldn't really create working
+	# shared libraries, regardless of the interface used.
+	case `$LD -v 2>&1` in
+	  *\ \(GNU\ Binutils\)\ 2.19.5*) ;;
+	  *\ \(GNU\ Binutils\)\ 2.[2-9]*) ;;
+	  *\ \(GNU\ Binutils\)\ [3-9]*) ;;
+	  *)
+	    lt_use_gnu_ld_interface=yes
+	    ;;
+	esac
+	;;
+      *)
+	lt_use_gnu_ld_interface=yes
+	;;
+    esac
+  fi
+
+  if test "$lt_use_gnu_ld_interface" = yes; then
     # If archive_cmds runs LD, not CC, wlarc should be empty
     wlarc='${wl}'
 
@@ -10038,6 +8905,7 @@ $as_echo_n "checking whether the $compiler linker ($LD) supports shared librarie
     fi
     supports_anon_versioning=no
     case `$LD -v 2>&1` in
+      *GNU\ gold*) supports_anon_versioning=yes ;;
       *\ [01].* | *\ 2.[0-9].* | *\ 2.10.*) ;; # catch versions < 2.11
       *\ 2.11.93.0.2\ *) supports_anon_versioning=yes ;; # RH7.3 ...
       *\ 2.11.92.0.12\ *) supports_anon_versioning=yes ;; # Mandrake 8.2 ...
@@ -10053,11 +8921,12 @@ $as_echo_n "checking whether the $compiler linker ($LD) supports shared librarie
 	ld_shlibs=no
 	cat <<_LT_EOF 1>&2
 
-*** Warning: the GNU linker, at least up to release 2.9.1, is reported
+*** Warning: the GNU linker, at least up to release 2.19, is reported
 *** to be unable to reliably create shared libraries on AIX.
 *** Therefore, libtool is disabling shared libraries support.  If you
-*** really care for shared libraries, you may want to modify your PATH
-*** so that a non-GNU linker is found, and then restart.
+*** really care for shared libraries, you may want to install binutils
+*** 2.20 or above, or modify your PATH so that a non-GNU linker is found.
+*** You will then need to restart the configuration process.
 
 _LT_EOF
       fi
@@ -10093,10 +8962,12 @@ _LT_EOF
       # _LT_TAGVAR(hardcode_libdir_flag_spec, ) is actually meaningless,
       # as there is no search path for DLLs.
       hardcode_libdir_flag_spec='-L$libdir'
+      export_dynamic_flag_spec='${wl}--export-all-symbols'
       allow_undefined_flag=unsupported
       always_export_symbols=no
       enable_shared_with_static_runtimes=yes
-      export_symbols_cmds='$NM $libobjs $convenience | $global_symbol_pipe | $SED -e '\''/^[BCDGRS][ ]/s/.*[ ]\([^ ]*\)/\1 DATA/'\'' | $SED -e '\''/^[AITW][ ]/s/.*[ ]//'\'' | sort | uniq > $export_symbols'
+      export_symbols_cmds='$NM $libobjs $convenience | $global_symbol_pipe | $SED -e '\''/^[BCDGRS][ ]/s/.*[ ]\([^ ]*\)/\1 DATA/;s/^.*[ ]__nm__\([^ ]*\)[ ][^ ]*/\1 DATA/;/^I[ ]/d;/^[AITW][ ]/s/.* //'\'' | sort | uniq > $export_symbols'
+      exclude_expsyms='[_]+GLOBAL_OFFSET_TABLE_|[_]+GLOBAL__[FID]_.*|[_]+head_[A-Za-z0-9_]+_dll|[A-Za-z0-9_]+_dll_iname'
 
       if $LD --help 2>&1 | $GREP 'auto-import' > /dev/null; then
         archive_cmds='$CC -shared $libobjs $deplibs $compiler_flags -o $output_objdir/$soname ${wl}--enable-auto-image-base -Xlinker --out-implib -Xlinker $lib'
@@ -10114,6 +8985,11 @@ _LT_EOF
       fi
       ;;
 
+    haiku*)
+      archive_cmds='$CC -shared $libobjs $deplibs $compiler_flags ${wl}-soname $wl$soname -o $lib'
+      link_all_deplibs=yes
+      ;;
+
     interix[3-9]*)
       hardcode_direct=no
       hardcode_shlibpath_var=no
@@ -10129,7 +9005,7 @@ _LT_EOF
       archive_expsym_cmds='sed "s,^,_," $export_symbols >$output_objdir/$soname.expsym~$CC -shared $pic_flag $libobjs $deplibs $compiler_flags ${wl}-h,$soname ${wl}--retain-symbols-file,$output_objdir/$soname.expsym ${wl}--image-base,`expr ${RANDOM-$$} % 4096 / 2 \* 262144 + 1342177280` -o $lib'
       ;;
 
-    gnu* | linux* | tpf* | k*bsd*-gnu)
+    gnu* | linux* | tpf* | k*bsd*-gnu | kopensolaris*-gnu)
       tmp_diet=no
       if test "$host_os" = linux-dietlibc; then
 	case $cc_basename in
@@ -10139,15 +9015,16 @@ _LT_EOF
       if $LD --help 2>&1 | $EGREP ': supported targets:.* elf' > /dev/null \
 	 && test "$tmp_diet" = no
       then
-	tmp_addflag=
+	tmp_addflag=' $pic_flag'
 	tmp_sharedflag='-shared'
 	case $cc_basename,$host_cpu in
         pgcc*)				# Portland Group C compiler
-	  whole_archive_flag_spec='${wl}--whole-archive`for conv in $convenience\"\"; do test  -n \"$conv\" && new_convenience=\"$new_convenience,$conv\"; done; $ECHO \"$new_convenience\"` ${wl}--no-whole-archive'
+	  whole_archive_flag_spec='${wl}--whole-archive`for conv in $convenience\"\"; do test  -n \"$conv\" && new_convenience=\"$new_convenience,$conv\"; done; func_echo_all \"$new_convenience\"` ${wl}--no-whole-archive'
 	  tmp_addflag=' $pic_flag'
 	  ;;
-	pgf77* | pgf90* | pgf95*)	# Portland Group f77 and f90 compilers
-	  whole_archive_flag_spec='${wl}--whole-archive`for conv in $convenience\"\"; do test  -n \"$conv\" && new_convenience=\"$new_convenience,$conv\"; done; $ECHO \"$new_convenience\"` ${wl}--no-whole-archive'
+	pgf77* | pgf90* | pgf95* | pgfortran*)
+					# Portland Group f77 and f90 compilers
+	  whole_archive_flag_spec='${wl}--whole-archive`for conv in $convenience\"\"; do test  -n \"$conv\" && new_convenience=\"$new_convenience,$conv\"; done; func_echo_all \"$new_convenience\"` ${wl}--no-whole-archive'
 	  tmp_addflag=' $pic_flag -Mnomain' ;;
 	ecc*,ia64* | icc*,ia64*)	# Intel C compiler on ia64
 	  tmp_addflag=' -i_dynamic' ;;
@@ -10158,13 +9035,17 @@ _LT_EOF
 	lf95*)				# Lahey Fortran 8.1
 	  whole_archive_flag_spec=
 	  tmp_sharedflag='--shared' ;;
-	xl[cC]*)			# IBM XL C 8.0 on PPC (deal with xlf below)
+	xl[cC]* | bgxl[cC]* | mpixl[cC]*) # IBM XL C 8.0 on PPC (deal with xlf below)
 	  tmp_sharedflag='-qmkshrobj'
 	  tmp_addflag= ;;
+	nvcc*)	# Cuda Compiler Driver 2.2
+	  whole_archive_flag_spec='${wl}--whole-archive`for conv in $convenience\"\"; do test  -n \"$conv\" && new_convenience=\"$new_convenience,$conv\"; done; func_echo_all \"$new_convenience\"` ${wl}--no-whole-archive'
+	  compiler_needs_object=yes
+	  ;;
 	esac
 	case `$CC -V 2>&1 | sed 5q` in
 	*Sun\ C*)			# Sun C 5.9
-	  whole_archive_flag_spec='${wl}--whole-archive`new_convenience=; for conv in $convenience\"\"; do test -z \"$conv\" || new_convenience=\"$new_convenience,$conv\"; done; $ECHO \"$new_convenience\"` ${wl}--no-whole-archive'
+	  whole_archive_flag_spec='${wl}--whole-archive`new_convenience=; for conv in $convenience\"\"; do test -z \"$conv\" || new_convenience=\"$new_convenience,$conv\"; done; func_echo_all \"$new_convenience\"` ${wl}--no-whole-archive'
 	  compiler_needs_object=yes
 	  tmp_sharedflag='-G' ;;
 	*Sun\ F*)			# Sun Fortran 8.3
@@ -10180,17 +9061,16 @@ _LT_EOF
         fi
 
 	case $cc_basename in
-	xlf*)
+	xlf* | bgf* | bgxlf* | mpixlf*)
 	  # IBM XL Fortran 10.1 on PPC cannot create shared libs itself
 	  whole_archive_flag_spec='--whole-archive$convenience --no-whole-archive'
-	  hardcode_libdir_flag_spec=
-	  hardcode_libdir_flag_spec_ld='-rpath $libdir'
-	  archive_cmds='$LD -shared $libobjs $deplibs $compiler_flags -soname $soname -o $lib'
+	  hardcode_libdir_flag_spec='${wl}-rpath ${wl}$libdir'
+	  archive_cmds='$LD -shared $libobjs $deplibs $linker_flags -soname $soname -o $lib'
 	  if test "x$supports_anon_versioning" = xyes; then
 	    archive_expsym_cmds='echo "{ global:" > $output_objdir/$libname.ver~
 	      cat $export_symbols | sed -e "s/\(.*\)/\1;/" >> $output_objdir/$libname.ver~
 	      echo "local: *; };" >> $output_objdir/$libname.ver~
-	      $LD -shared $libobjs $deplibs $compiler_flags -soname $soname -version-script $output_objdir/$libname.ver -o $lib'
+	      $LD -shared $libobjs $deplibs $linker_flags -soname $soname -version-script $output_objdir/$libname.ver -o $lib'
 	  fi
 	  ;;
 	esac
@@ -10204,8 +9084,8 @@ _LT_EOF
 	archive_cmds='$LD -Bshareable $libobjs $deplibs $linker_flags -o $lib'
 	wlarc=
       else
-	archive_cmds='$CC -shared $libobjs $deplibs $compiler_flags ${wl}-soname $wl$soname -o $lib'
-	archive_expsym_cmds='$CC -shared $libobjs $deplibs $compiler_flags ${wl}-soname $wl$soname ${wl}-retain-symbols-file $wl$export_symbols -o $lib'
+	archive_cmds='$CC -shared $pic_flag $libobjs $deplibs $compiler_flags ${wl}-soname $wl$soname -o $lib'
+	archive_expsym_cmds='$CC -shared $pic_flag $libobjs $deplibs $compiler_flags ${wl}-soname $wl$soname ${wl}-retain-symbols-file $wl$export_symbols -o $lib'
       fi
       ;;
 
@@ -10223,8 +9103,8 @@ _LT_EOF
 
 _LT_EOF
       elif $LD --help 2>&1 | $GREP ': supported targets:.* elf' > /dev/null; then
-	archive_cmds='$CC -shared $libobjs $deplibs $compiler_flags ${wl}-soname $wl$soname -o $lib'
-	archive_expsym_cmds='$CC -shared $libobjs $deplibs $compiler_flags ${wl}-soname $wl$soname ${wl}-retain-symbols-file $wl$export_symbols -o $lib'
+	archive_cmds='$CC -shared $pic_flag $libobjs $deplibs $compiler_flags ${wl}-soname $wl$soname -o $lib'
+	archive_expsym_cmds='$CC -shared $pic_flag $libobjs $deplibs $compiler_flags ${wl}-soname $wl$soname ${wl}-retain-symbols-file $wl$export_symbols -o $lib'
       else
 	ld_shlibs=no
       fi
@@ -10270,8 +9150,8 @@ _LT_EOF
 
     *)
       if $LD --help 2>&1 | $GREP ': supported targets:.* elf' > /dev/null; then
-	archive_cmds='$CC -shared $libobjs $deplibs $compiler_flags ${wl}-soname $wl$soname -o $lib'
-	archive_expsym_cmds='$CC -shared $libobjs $deplibs $compiler_flags ${wl}-soname $wl$soname ${wl}-retain-symbols-file $wl$export_symbols -o $lib'
+	archive_cmds='$CC -shared $pic_flag $libobjs $deplibs $compiler_flags ${wl}-soname $wl$soname -o $lib'
+	archive_expsym_cmds='$CC -shared $pic_flag $libobjs $deplibs $compiler_flags ${wl}-soname $wl$soname ${wl}-retain-symbols-file $wl$export_symbols -o $lib'
       else
 	ld_shlibs=no
       fi
@@ -10311,8 +9191,10 @@ _LT_EOF
       else
 	# If we're using GNU nm, then we don't want the "-C" option.
 	# -C means demangle to AIX nm, but means don't demangle with GNU nm
+	# Also, AIX nm treats weak defined symbols like other global
+	# defined symbols, whereas GNU nm marks them as "W".
 	if $NM -V 2>&1 | $GREP 'GNU' > /dev/null; then
-	  export_symbols_cmds='$NM -Bpg $libobjs $convenience | awk '\''{ if (((\$ 2 == "T") || (\$ 2 == "D") || (\$ 2 == "B")) && (substr(\$ 3,1,1) != ".")) { print \$ 3 } }'\'' | sort -u > $export_symbols'
+	  export_symbols_cmds='$NM -Bpg $libobjs $convenience | awk '\''{ if (((\$ 2 == "T") || (\$ 2 == "D") || (\$ 2 == "B") || (\$ 2 == "W")) && (substr(\$ 3,1,1) != ".")) { print \$ 3 } }'\'' | sort -u > $export_symbols'
 	else
 	  export_symbols_cmds='$NM -BCpg $libobjs $convenience | awk '\''{ if (((\$ 2 == "T") || (\$ 2 == "D") || (\$ 2 == "B")) && (substr(\$ 3,1,1) != ".")) { print \$ 3 } }'\'' | sort -u > $export_symbols'
 	fi
@@ -10399,11 +9281,13 @@ _LT_EOF
 	allow_undefined_flag='-berok'
         # Determine the default libpath from the value encoded in an
         # empty executable.
-        cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
+        if test "${lt_cv_aix_libpath+set}" = set; then
+  aix_libpath=$lt_cv_aix_libpath
+else
+  if ${lt_cv_aix_libpath_+:} false; then :
+  $as_echo_n "(cached) " >&6
+else
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
 /* end confdefs.h.  */
 
 int
@@ -10414,54 +9298,34 @@ main ()
   return 0;
 }
 _ACEOF
-rm -f conftest.$ac_objext conftest$ac_exeext
-if { (ac_try="$ac_link"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_link") 2>conftest.er1
-  ac_status=$?
-  grep -v '^ *+' conftest.er1 >conftest.err
-  rm -f conftest.er1
-  cat conftest.err >&5
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } && {
-	 test -z "$ac_c_werror_flag" ||
-	 test ! -s conftest.err
-       } && test -s conftest$ac_exeext && {
-	 test "$cross_compiling" = yes ||
-	 $as_test_x conftest$ac_exeext
-       }; then
+if ac_fn_c_try_link "$LINENO"; then :
 
-lt_aix_libpath_sed='
-    /Import File Strings/,/^$/ {
-	/^0/ {
-	    s/^0  *\(.*\)$/\1/
-	    p
-	}
-    }'
-aix_libpath=`dump -H conftest$ac_exeext 2>/dev/null | $SED -n -e "$lt_aix_libpath_sed"`
-# Check for a 64-bit object if we didn't find anything.
-if test -z "$aix_libpath"; then
-  aix_libpath=`dump -HX64 conftest$ac_exeext 2>/dev/null | $SED -n -e "$lt_aix_libpath_sed"`
+  lt_aix_libpath_sed='
+      /Import File Strings/,/^$/ {
+	  /^0/ {
+	      s/^0  *\([^ ]*\) *$/\1/
+	      p
+	  }
+      }'
+  lt_cv_aix_libpath_=`dump -H conftest$ac_exeext 2>/dev/null | $SED -n -e "$lt_aix_libpath_sed"`
+  # Check for a 64-bit object if we didn't find anything.
+  if test -z "$lt_cv_aix_libpath_"; then
+    lt_cv_aix_libpath_=`dump -HX64 conftest$ac_exeext 2>/dev/null | $SED -n -e "$lt_aix_libpath_sed"`
+  fi
 fi
-else
-  $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
-
+rm -f core conftest.err conftest.$ac_objext \
+    conftest$ac_exeext conftest.$ac_ext
+  if test -z "$lt_cv_aix_libpath_"; then
+    lt_cv_aix_libpath_="/usr/lib:/lib"
+  fi
 
 fi
 
-rm -rf conftest.dSYM
-rm -f core conftest.err conftest.$ac_objext conftest_ipa8_conftest.oo \
-      conftest$ac_exeext conftest.$ac_ext
-if test -z "$aix_libpath"; then aix_libpath="/usr/lib:/lib"; fi
+  aix_libpath=$lt_cv_aix_libpath_
+fi
 
         hardcode_libdir_flag_spec='${wl}-blibpath:$libdir:'"$aix_libpath"
-        archive_expsym_cmds='$CC -o $output_objdir/$soname $libobjs $deplibs '"\${wl}$no_entry_flag"' $compiler_flags `if test "x${allow_undefined_flag}" != "x"; then $ECHO "X${wl}${allow_undefined_flag}" | $Xsed; else :; fi` '"\${wl}$exp_sym_flag:\$export_symbols $shared_flag"
+        archive_expsym_cmds='$CC -o $output_objdir/$soname $libobjs $deplibs '"\${wl}$no_entry_flag"' $compiler_flags `if test "x${allow_undefined_flag}" != "x"; then func_echo_all "${wl}${allow_undefined_flag}"; else :; fi` '"\${wl}$exp_sym_flag:\$export_symbols $shared_flag"
       else
 	if test "$host_cpu" = ia64; then
 	  hardcode_libdir_flag_spec='${wl}-R $libdir:/usr/lib:/lib'
@@ -10470,11 +9334,13 @@ if test -z "$aix_libpath"; then aix_libpath="/usr/lib:/lib"; fi
 	else
 	 # Determine the default libpath from the value encoded in an
 	 # empty executable.
-	 cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
+	 if test "${lt_cv_aix_libpath+set}" = set; then
+  aix_libpath=$lt_cv_aix_libpath
+else
+  if ${lt_cv_aix_libpath_+:} false; then :
+  $as_echo_n "(cached) " >&6
+else
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
 /* end confdefs.h.  */
 
 int
@@ -10485,59 +9351,44 @@ main ()
   return 0;
 }
 _ACEOF
-rm -f conftest.$ac_objext conftest$ac_exeext
-if { (ac_try="$ac_link"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_link") 2>conftest.er1
-  ac_status=$?
-  grep -v '^ *+' conftest.er1 >conftest.err
-  rm -f conftest.er1
-  cat conftest.err >&5
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } && {
-	 test -z "$ac_c_werror_flag" ||
-	 test ! -s conftest.err
-       } && test -s conftest$ac_exeext && {
-	 test "$cross_compiling" = yes ||
-	 $as_test_x conftest$ac_exeext
-       }; then
+if ac_fn_c_try_link "$LINENO"; then :
 
-lt_aix_libpath_sed='
-    /Import File Strings/,/^$/ {
-	/^0/ {
-	    s/^0  *\(.*\)$/\1/
-	    p
-	}
-    }'
-aix_libpath=`dump -H conftest$ac_exeext 2>/dev/null | $SED -n -e "$lt_aix_libpath_sed"`
-# Check for a 64-bit object if we didn't find anything.
-if test -z "$aix_libpath"; then
-  aix_libpath=`dump -HX64 conftest$ac_exeext 2>/dev/null | $SED -n -e "$lt_aix_libpath_sed"`
+  lt_aix_libpath_sed='
+      /Import File Strings/,/^$/ {
+	  /^0/ {
+	      s/^0  *\([^ ]*\) *$/\1/
+	      p
+	  }
+      }'
+  lt_cv_aix_libpath_=`dump -H conftest$ac_exeext 2>/dev/null | $SED -n -e "$lt_aix_libpath_sed"`
+  # Check for a 64-bit object if we didn't find anything.
+  if test -z "$lt_cv_aix_libpath_"; then
+    lt_cv_aix_libpath_=`dump -HX64 conftest$ac_exeext 2>/dev/null | $SED -n -e "$lt_aix_libpath_sed"`
+  fi
 fi
-else
-  $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
-
+rm -f core conftest.err conftest.$ac_objext \
+    conftest$ac_exeext conftest.$ac_ext
+  if test -z "$lt_cv_aix_libpath_"; then
+    lt_cv_aix_libpath_="/usr/lib:/lib"
+  fi
 
 fi
 
-rm -rf conftest.dSYM
-rm -f core conftest.err conftest.$ac_objext conftest_ipa8_conftest.oo \
-      conftest$ac_exeext conftest.$ac_ext
-if test -z "$aix_libpath"; then aix_libpath="/usr/lib:/lib"; fi
+  aix_libpath=$lt_cv_aix_libpath_
+fi
 
 	 hardcode_libdir_flag_spec='${wl}-blibpath:$libdir:'"$aix_libpath"
 	  # Warning - without using the other run time loading flags,
 	  # -berok will link without error, but may produce a broken library.
 	  no_undefined_flag=' ${wl}-bernotok'
 	  allow_undefined_flag=' ${wl}-berok'
-	  # Exported symbols can be pulled into shared objects from archives
-	  whole_archive_flag_spec='$convenience'
+	  if test "$with_gnu_ld" = yes; then
+	    # We only use this code for GNU lds that support --whole-archive.
+	    whole_archive_flag_spec='${wl}--whole-archive$convenience ${wl}--no-whole-archive'
+	  else
+	    # Exported symbols can be pulled into shared objects from archives
+	    whole_archive_flag_spec='$convenience'
+	  fi
 	  archive_cmds_need_lc=yes
 	  # This is similar to how AIX traditionally builds its shared libraries.
 	  archive_expsym_cmds="\$CC $shared_flag"' -o $output_objdir/$soname $libobjs $deplibs ${wl}-bnoentry $compiler_flags ${wl}-bE:$export_symbols${allow_undefined_flag}~$AR $AR_FLAGS $output_objdir/$libname$release.a $output_objdir/$soname'
@@ -10569,20 +9420,64 @@ if test -z "$aix_libpath"; then aix_libpath="/usr/lib:/lib"; fi
       # Microsoft Visual C++.
       # hardcode_libdir_flag_spec is actually meaningless, as there is
       # no search path for DLLs.
-      hardcode_libdir_flag_spec=' '
-      allow_undefined_flag=unsupported
-      # Tell ltmain to make .lib files, not .a files.
-      libext=lib
-      # Tell ltmain to make .dll files, not .so files.
-      shrext_cmds=".dll"
-      # FIXME: Setting linknames here is a bad hack.
-      archive_cmds='$CC -o $lib $libobjs $compiler_flags `$ECHO "X$deplibs" | $Xsed -e '\''s/ -lc$//'\''` -link -dll~linknames='
-      # The linker will automatically build a .lib file if we build a DLL.
-      old_archive_from_new_cmds='true'
-      # FIXME: Should let the user specify the lib program.
-      old_archive_cmds='lib -OUT:$oldlib$oldobjs$old_deplibs'
-      fix_srcfile_path='`cygpath -w "$srcfile"`'
-      enable_shared_with_static_runtimes=yes
+      case $cc_basename in
+      cl*)
+	# Native MSVC
+	hardcode_libdir_flag_spec=' '
+	allow_undefined_flag=unsupported
+	always_export_symbols=yes
+	file_list_spec='@'
+	# Tell ltmain to make .lib files, not .a files.
+	libext=lib
+	# Tell ltmain to make .dll files, not .so files.
+	shrext_cmds=".dll"
+	# FIXME: Setting linknames here is a bad hack.
+	archive_cmds='$CC -o $output_objdir/$soname $libobjs $compiler_flags $deplibs -Wl,-dll~linknames='
+	archive_expsym_cmds='if test "x`$SED 1q $export_symbols`" = xEXPORTS; then
+	    sed -n -e 's/\\\\\\\(.*\\\\\\\)/-link\\\ -EXPORT:\\\\\\\1/' -e '1\\\!p' < $export_symbols > $output_objdir/$soname.exp;
+	  else
+	    sed -e 's/\\\\\\\(.*\\\\\\\)/-link\\\ -EXPORT:\\\\\\\1/' < $export_symbols > $output_objdir/$soname.exp;
+	  fi~
+	  $CC -o $tool_output_objdir$soname $libobjs $compiler_flags $deplibs "@$tool_output_objdir$soname.exp" -Wl,-DLL,-IMPLIB:"$tool_output_objdir$libname.dll.lib"~
+	  linknames='
+	# The linker will not automatically build a static lib if we build a DLL.
+	# _LT_TAGVAR(old_archive_from_new_cmds, )='true'
+	enable_shared_with_static_runtimes=yes
+	exclude_expsyms='_NULL_IMPORT_DESCRIPTOR|_IMPORT_DESCRIPTOR_.*'
+	export_symbols_cmds='$NM $libobjs $convenience | $global_symbol_pipe | $SED -e '\''/^[BCDGRS][ ]/s/.*[ ]\([^ ]*\)/\1,DATA/'\'' | $SED -e '\''/^[AITW][ ]/s/.*[ ]//'\'' | sort | uniq > $export_symbols'
+	# Don't use ranlib
+	old_postinstall_cmds='chmod 644 $oldlib'
+	postlink_cmds='lt_outputfile="@OUTPUT@"~
+	  lt_tool_outputfile="@TOOL_OUTPUT@"~
+	  case $lt_outputfile in
+	    *.exe|*.EXE) ;;
+	    *)
+	      lt_outputfile="$lt_outputfile.exe"
+	      lt_tool_outputfile="$lt_tool_outputfile.exe"
+	      ;;
+	  esac~
+	  if test "$MANIFEST_TOOL" != ":" && test -f "$lt_outputfile.manifest"; then
+	    $MANIFEST_TOOL -manifest "$lt_tool_outputfile.manifest" -outputresource:"$lt_tool_outputfile" || exit 1;
+	    $RM "$lt_outputfile.manifest";
+	  fi'
+	;;
+      *)
+	# Assume MSVC wrapper
+	hardcode_libdir_flag_spec=' '
+	allow_undefined_flag=unsupported
+	# Tell ltmain to make .lib files, not .a files.
+	libext=lib
+	# Tell ltmain to make .dll files, not .so files.
+	shrext_cmds=".dll"
+	# FIXME: Setting linknames here is a bad hack.
+	archive_cmds='$CC -o $lib $libobjs $compiler_flags `func_echo_all "$deplibs" | $SED '\''s/ -lc$//'\''` -link -dll~linknames='
+	# The linker will automatically build a .lib file if we build a DLL.
+	old_archive_from_new_cmds='true'
+	# FIXME: Should let the user specify the lib program.
+	old_archive_cmds='lib -OUT:$oldlib$oldobjs$old_deplibs'
+	enable_shared_with_static_runtimes=yes
+	;;
+      esac
       ;;
 
     darwin* | rhapsody*)
@@ -10592,7 +9487,12 @@ if test -z "$aix_libpath"; then aix_libpath="/usr/lib:/lib"; fi
   hardcode_direct=no
   hardcode_automatic=yes
   hardcode_shlibpath_var=unsupported
-  whole_archive_flag_spec=''
+  if test "$lt_cv_ld_force_load" = "yes"; then
+    whole_archive_flag_spec='`for conv in $convenience\"\"; do test  -n \"$conv\" && new_convenience=\"$new_convenience ${wl}-force_load,$conv\"; done; func_echo_all \"$new_convenience\"`'
+
+  else
+    whole_archive_flag_spec=''
+  fi
   link_all_deplibs=yes
   allow_undefined_flag="$_lt_dar_allow_undefined"
   case $cc_basename in
@@ -10600,7 +9500,7 @@ if test -z "$aix_libpath"; then aix_libpath="/usr/lib:/lib"; fi
      *) _lt_dar_can_shared=$GCC ;;
   esac
   if test "$_lt_dar_can_shared" = "yes"; then
-    output_verbose_link_cmd=echo
+    output_verbose_link_cmd=func_echo_all
     archive_cmds="\$CC -dynamiclib \$allow_undefined_flag -o \$lib \$libobjs \$deplibs \$compiler_flags -install_name \$rpath/\$soname \$verstring $_lt_dar_single_mod${_lt_dsymutil}"
     module_cmds="\$CC \$allow_undefined_flag -o \$lib -bundle \$libobjs \$deplibs \$compiler_flags${_lt_dsymutil}"
     archive_expsym_cmds="sed 's,^,_,' < \$export_symbols > \$output_objdir/\${libname}-symbols.expsym~\$CC -dynamiclib \$allow_undefined_flag -o \$lib \$libobjs \$deplibs \$compiler_flags -install_name \$rpath/\$soname \$verstring ${_lt_dar_single_mod}${_lt_dar_export_syms}${_lt_dsymutil}"
@@ -10618,10 +9518,6 @@ if test -z "$aix_libpath"; then aix_libpath="/usr/lib:/lib"; fi
       hardcode_shlibpath_var=no
       ;;
 
-    freebsd1*)
-      ld_shlibs=no
-      ;;
-
     # FreeBSD 2.2.[012] allows us to include c++rt0.o to get C++ constructor
     # support.  Future versions do this automatically, but an explicit c++rt0.o
     # does not break anything, and helps significantly (at the cost of a little
@@ -10634,7 +9530,7 @@ if test -z "$aix_libpath"; then aix_libpath="/usr/lib:/lib"; fi
       ;;
 
     # Unfortunately, older versions of FreeBSD 2 do not have this feature.
-    freebsd2*)
+    freebsd2.*)
       archive_cmds='$LD -Bshareable -o $lib $libobjs $deplibs $linker_flags'
       hardcode_direct=yes
       hardcode_minus_L=yes
@@ -10643,7 +9539,7 @@ if test -z "$aix_libpath"; then aix_libpath="/usr/lib:/lib"; fi
 
     # FreeBSD 3 and greater uses gcc -shared to do shared libraries.
     freebsd* | dragonfly*)
-      archive_cmds='$CC -shared -o $lib $libobjs $deplibs $compiler_flags'
+      archive_cmds='$CC -shared $pic_flag -o $lib $libobjs $deplibs $compiler_flags'
       hardcode_libdir_flag_spec='-R$libdir'
       hardcode_direct=yes
       hardcode_shlibpath_var=no
@@ -10651,7 +9547,7 @@ if test -z "$aix_libpath"; then aix_libpath="/usr/lib:/lib"; fi
 
     hpux9*)
       if test "$GCC" = yes; then
-	archive_cmds='$RM $output_objdir/$soname~$CC -shared -fPIC ${wl}+b ${wl}$install_libdir -o $output_objdir/$soname $libobjs $deplibs $compiler_flags~test $output_objdir/$soname = $lib || mv $output_objdir/$soname $lib'
+	archive_cmds='$RM $output_objdir/$soname~$CC -shared $pic_flag ${wl}+b ${wl}$install_libdir -o $output_objdir/$soname $libobjs $deplibs $compiler_flags~test $output_objdir/$soname = $lib || mv $output_objdir/$soname $lib'
       else
 	archive_cmds='$RM $output_objdir/$soname~$LD -b +b $install_libdir -o $output_objdir/$soname $libobjs $deplibs $linker_flags~test $output_objdir/$soname = $lib || mv $output_objdir/$soname $lib'
       fi
@@ -10666,14 +9562,13 @@ if test -z "$aix_libpath"; then aix_libpath="/usr/lib:/lib"; fi
       ;;
 
     hpux10*)
-      if test "$GCC" = yes -a "$with_gnu_ld" = no; then
-	archive_cmds='$CC -shared -fPIC ${wl}+h ${wl}$soname ${wl}+b ${wl}$install_libdir -o $lib $libobjs $deplibs $compiler_flags'
+      if test "$GCC" = yes && test "$with_gnu_ld" = no; then
+	archive_cmds='$CC -shared $pic_flag ${wl}+h ${wl}$soname ${wl}+b ${wl}$install_libdir -o $lib $libobjs $deplibs $compiler_flags'
       else
 	archive_cmds='$LD -b +h $soname +b $install_libdir -o $lib $libobjs $deplibs $linker_flags'
       fi
       if test "$with_gnu_ld" = no; then
 	hardcode_libdir_flag_spec='${wl}+b ${wl}$libdir'
-	hardcode_libdir_flag_spec_ld='+b $libdir'
 	hardcode_libdir_separator=:
 	hardcode_direct=yes
 	hardcode_direct_absolute=yes
@@ -10685,16 +9580,16 @@ if test -z "$aix_libpath"; then aix_libpath="/usr/lib:/lib"; fi
       ;;
 
     hpux11*)
-      if test "$GCC" = yes -a "$with_gnu_ld" = no; then
+      if test "$GCC" = yes && test "$with_gnu_ld" = no; then
 	case $host_cpu in
 	hppa*64*)
 	  archive_cmds='$CC -shared ${wl}+h ${wl}$soname -o $lib $libobjs $deplibs $compiler_flags'
 	  ;;
 	ia64*)
-	  archive_cmds='$CC -shared -fPIC ${wl}+h ${wl}$soname ${wl}+nodefaultrpath -o $lib $libobjs $deplibs $compiler_flags'
+	  archive_cmds='$CC -shared $pic_flag ${wl}+h ${wl}$soname ${wl}+nodefaultrpath -o $lib $libobjs $deplibs $compiler_flags'
 	  ;;
 	*)
-	  archive_cmds='$CC -shared -fPIC ${wl}+h ${wl}$soname ${wl}+b ${wl}$install_libdir -o $lib $libobjs $deplibs $compiler_flags'
+	  archive_cmds='$CC -shared $pic_flag ${wl}+h ${wl}$soname ${wl}+b ${wl}$install_libdir -o $lib $libobjs $deplibs $compiler_flags'
 	  ;;
 	esac
       else
@@ -10706,7 +9601,46 @@ if test -z "$aix_libpath"; then aix_libpath="/usr/lib:/lib"; fi
 	  archive_cmds='$CC -b ${wl}+h ${wl}$soname ${wl}+nodefaultrpath -o $lib $libobjs $deplibs $compiler_flags'
 	  ;;
 	*)
-	  archive_cmds='$CC -b ${wl}+h ${wl}$soname ${wl}+b ${wl}$install_libdir -o $lib $libobjs $deplibs $compiler_flags'
+
+	  # Older versions of the 11.00 compiler do not understand -b yet
+	  # (HP92453-01 A.11.01.20 doesn't, HP92453-01 B.11.X.35175-35176.GP does)
+	  { $as_echo "$as_me:${as_lineno-$LINENO}: checking if $CC understands -b" >&5
+$as_echo_n "checking if $CC understands -b... " >&6; }
+if ${lt_cv_prog_compiler__b+:} false; then :
+  $as_echo_n "(cached) " >&6
+else
+  lt_cv_prog_compiler__b=no
+   save_LDFLAGS="$LDFLAGS"
+   LDFLAGS="$LDFLAGS -b"
+   echo "$lt_simple_link_test_code" > conftest.$ac_ext
+   if (eval $ac_link 2>conftest.err) && test -s conftest$ac_exeext; then
+     # The linker can only warn and ignore the option if not recognized
+     # So say no if there are warnings
+     if test -s conftest.err; then
+       # Append any errors to the config.log.
+       cat conftest.err 1>&5
+       $ECHO "$_lt_linker_boilerplate" | $SED '/^$/d' > conftest.exp
+       $SED '/^$/d; /^ *+/d' conftest.err >conftest.er2
+       if diff conftest.exp conftest.er2 >/dev/null; then
+         lt_cv_prog_compiler__b=yes
+       fi
+     else
+       lt_cv_prog_compiler__b=yes
+     fi
+   fi
+   $RM -r conftest*
+   LDFLAGS="$save_LDFLAGS"
+
+fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $lt_cv_prog_compiler__b" >&5
+$as_echo "$lt_cv_prog_compiler__b" >&6; }
+
+if test x"$lt_cv_prog_compiler__b" = xyes; then
+    archive_cmds='$CC -b ${wl}+h ${wl}$soname ${wl}+b ${wl}$install_libdir -o $lib $libobjs $deplibs $compiler_flags'
+else
+    archive_cmds='$LD -b +h $soname +b $install_libdir -o $lib $libobjs $deplibs $linker_flags'
+fi
+
 	  ;;
 	esac
       fi
@@ -10734,52 +9668,39 @@ if test -z "$aix_libpath"; then aix_libpath="/usr/lib:/lib"; fi
 
     irix5* | irix6* | nonstopux*)
       if test "$GCC" = yes; then
-	archive_cmds='$CC -shared $libobjs $deplibs $compiler_flags ${wl}-soname ${wl}$soname `test -n "$verstring" && $ECHO "X${wl}-set_version ${wl}$verstring" | $Xsed` ${wl}-update_registry ${wl}${output_objdir}/so_locations -o $lib'
+	archive_cmds='$CC -shared $pic_flag $libobjs $deplibs $compiler_flags ${wl}-soname ${wl}$soname `test -n "$verstring" && func_echo_all "${wl}-set_version ${wl}$verstring"` ${wl}-update_registry ${wl}${output_objdir}/so_locations -o $lib'
 	# Try to use the -exported_symbol ld option, if it does not
 	# work, assume that -exports_file does not work either and
 	# implicitly export all symbols.
-        save_LDFLAGS="$LDFLAGS"
-        LDFLAGS="$LDFLAGS -shared ${wl}-exported_symbol ${wl}foo ${wl}-update_registry ${wl}/dev/null"
-        cat >conftest.$ac_ext <<_ACEOF
-int foo(void) {}
+	# This should be the same for all languages, so no per-tag cache variable.
+	{ $as_echo "$as_me:${as_lineno-$LINENO}: checking whether the $host_os linker accepts -exported_symbol" >&5
+$as_echo_n "checking whether the $host_os linker accepts -exported_symbol... " >&6; }
+if ${lt_cv_irix_exported_symbol+:} false; then :
+  $as_echo_n "(cached) " >&6
+else
+  save_LDFLAGS="$LDFLAGS"
+	   LDFLAGS="$LDFLAGS -shared ${wl}-exported_symbol ${wl}foo ${wl}-update_registry ${wl}/dev/null"
+	   cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+int foo (void) { return 0; }
 _ACEOF
-rm -f conftest.$ac_objext conftest$ac_exeext
-if { (ac_try="$ac_link"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_link") 2>conftest.er1
-  ac_status=$?
-  grep -v '^ *+' conftest.er1 >conftest.err
-  rm -f conftest.er1
-  cat conftest.err >&5
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } && {
-	 test -z "$ac_c_werror_flag" ||
-	 test ! -s conftest.err
-       } && test -s conftest$ac_exeext && {
-	 test "$cross_compiling" = yes ||
-	 $as_test_x conftest$ac_exeext
-       }; then
-  archive_expsym_cmds='$CC -shared $libobjs $deplibs $compiler_flags ${wl}-soname ${wl}$soname `test -n "$verstring" && $ECHO "X${wl}-set_version ${wl}$verstring" | $Xsed` ${wl}-update_registry ${wl}${output_objdir}/so_locations ${wl}-exports_file ${wl}$export_symbols -o $lib'
-
+if ac_fn_c_try_link "$LINENO"; then :
+  lt_cv_irix_exported_symbol=yes
 else
-  $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
-
-
+  lt_cv_irix_exported_symbol=no
 fi
-
-rm -rf conftest.dSYM
-rm -f core conftest.err conftest.$ac_objext conftest_ipa8_conftest.oo \
-      conftest$ac_exeext conftest.$ac_ext
-        LDFLAGS="$save_LDFLAGS"
+rm -f core conftest.err conftest.$ac_objext \
+    conftest$ac_exeext conftest.$ac_ext
+           LDFLAGS="$save_LDFLAGS"
+fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $lt_cv_irix_exported_symbol" >&5
+$as_echo "$lt_cv_irix_exported_symbol" >&6; }
+	if test "$lt_cv_irix_exported_symbol" = yes; then
+          archive_expsym_cmds='$CC -shared $pic_flag $libobjs $deplibs $compiler_flags ${wl}-soname ${wl}$soname `test -n "$verstring" && func_echo_all "${wl}-set_version ${wl}$verstring"` ${wl}-update_registry ${wl}${output_objdir}/so_locations ${wl}-exports_file ${wl}$export_symbols -o $lib'
+	fi
       else
-	archive_cmds='$CC -shared $libobjs $deplibs $compiler_flags -soname $soname `test -n "$verstring" && $ECHO "X-set_version $verstring" | $Xsed` -update_registry ${output_objdir}/so_locations -o $lib'
-	archive_expsym_cmds='$CC -shared $libobjs $deplibs $compiler_flags -soname $soname `test -n "$verstring" && $ECHO "X-set_version $verstring" | $Xsed` -update_registry ${output_objdir}/so_locations -exports_file $export_symbols -o $lib'
+	archive_cmds='$CC -shared $libobjs $deplibs $compiler_flags -soname $soname `test -n "$verstring" && func_echo_all "-set_version $verstring"` -update_registry ${output_objdir}/so_locations -o $lib'
+	archive_expsym_cmds='$CC -shared $libobjs $deplibs $compiler_flags -soname $soname `test -n "$verstring" && func_echo_all "-set_version $verstring"` -update_registry ${output_objdir}/so_locations -exports_file $export_symbols -o $lib'
       fi
       archive_cmds_need_lc='no'
       hardcode_libdir_flag_spec='${wl}-rpath ${wl}$libdir'
@@ -10841,17 +9762,17 @@ rm -f core conftest.err conftest.$ac_objext conftest_ipa8_conftest.oo \
       hardcode_libdir_flag_spec='-L$libdir'
       hardcode_minus_L=yes
       allow_undefined_flag=unsupported
-      archive_cmds='$ECHO "LIBRARY $libname INITINSTANCE" > $output_objdir/$libname.def~$ECHO "DESCRIPTION \"$libname\"" >> $output_objdir/$libname.def~$ECHO DATA >> $output_objdir/$libname.def~$ECHO " SINGLE NONSHARED" >> $output_objdir/$libname.def~$ECHO EXPORTS >> $output_objdir/$libname.def~emxexp $libobjs >> $output_objdir/$libname.def~$CC -Zdll -Zcrtdll -o $lib $libobjs $deplibs $compiler_flags $output_objdir/$libname.def'
+      archive_cmds='$ECHO "LIBRARY $libname INITINSTANCE" > $output_objdir/$libname.def~$ECHO "DESCRIPTION \"$libname\"" >> $output_objdir/$libname.def~echo DATA >> $output_objdir/$libname.def~echo " SINGLE NONSHARED" >> $output_objdir/$libname.def~echo EXPORTS >> $output_objdir/$libname.def~emxexp $libobjs >> $output_objdir/$libname.def~$CC -Zdll -Zcrtdll -o $lib $libobjs $deplibs $compiler_flags $output_objdir/$libname.def'
       old_archive_from_new_cmds='emximp -o $output_objdir/$libname.a $output_objdir/$libname.def'
       ;;
 
     osf3*)
       if test "$GCC" = yes; then
 	allow_undefined_flag=' ${wl}-expect_unresolved ${wl}\*'
-	archive_cmds='$CC -shared${allow_undefined_flag} $libobjs $deplibs $compiler_flags ${wl}-soname ${wl}$soname `test -n "$verstring" && $ECHO "X${wl}-set_version ${wl}$verstring" | $Xsed` ${wl}-update_registry ${wl}${output_objdir}/so_locations -o $lib'
+	archive_cmds='$CC -shared${allow_undefined_flag} $libobjs $deplibs $compiler_flags ${wl}-soname ${wl}$soname `test -n "$verstring" && func_echo_all "${wl}-set_version ${wl}$verstring"` ${wl}-update_registry ${wl}${output_objdir}/so_locations -o $lib'
       else
 	allow_undefined_flag=' -expect_unresolved \*'
-	archive_cmds='$CC -shared${allow_undefined_flag} $libobjs $deplibs $compiler_flags -soname $soname `test -n "$verstring" && $ECHO "X-set_version $verstring" | $Xsed` -update_registry ${output_objdir}/so_locations -o $lib'
+	archive_cmds='$CC -shared${allow_undefined_flag} $libobjs $deplibs $compiler_flags -soname $soname `test -n "$verstring" && func_echo_all "-set_version $verstring"` -update_registry ${output_objdir}/so_locations -o $lib'
       fi
       archive_cmds_need_lc='no'
       hardcode_libdir_flag_spec='${wl}-rpath ${wl}$libdir'
@@ -10861,13 +9782,13 @@ rm -f core conftest.err conftest.$ac_objext conftest_ipa8_conftest.oo \
     osf4* | osf5*)	# as osf3* with the addition of -msym flag
       if test "$GCC" = yes; then
 	allow_undefined_flag=' ${wl}-expect_unresolved ${wl}\*'
-	archive_cmds='$CC -shared${allow_undefined_flag} $libobjs $deplibs $compiler_flags ${wl}-msym ${wl}-soname ${wl}$soname `test -n "$verstring" && $ECHO "X${wl}-set_version ${wl}$verstring" | $Xsed` ${wl}-update_registry ${wl}${output_objdir}/so_locations -o $lib'
+	archive_cmds='$CC -shared${allow_undefined_flag} $pic_flag $libobjs $deplibs $compiler_flags ${wl}-msym ${wl}-soname ${wl}$soname `test -n "$verstring" && func_echo_all "${wl}-set_version ${wl}$verstring"` ${wl}-update_registry ${wl}${output_objdir}/so_locations -o $lib'
 	hardcode_libdir_flag_spec='${wl}-rpath ${wl}$libdir'
       else
 	allow_undefined_flag=' -expect_unresolved \*'
-	archive_cmds='$CC -shared${allow_undefined_flag} $libobjs $deplibs $compiler_flags -msym -soname $soname `test -n "$verstring" && $ECHO "X-set_version $verstring" | $Xsed` -update_registry ${output_objdir}/so_locations -o $lib'
+	archive_cmds='$CC -shared${allow_undefined_flag} $libobjs $deplibs $compiler_flags -msym -soname $soname `test -n "$verstring" && func_echo_all "-set_version $verstring"` -update_registry ${output_objdir}/so_locations -o $lib'
 	archive_expsym_cmds='for i in `cat $export_symbols`; do printf "%s %s\\n" -exported_symbol "\$i" >> $lib.exp; done; printf "%s\\n" "-hidden">> $lib.exp~
-	$CC -shared${allow_undefined_flag} ${wl}-input ${wl}$lib.exp $compiler_flags $libobjs $deplibs -soname $soname `test -n "$verstring" && $ECHO "X-set_version $verstring" | $Xsed` -update_registry ${output_objdir}/so_locations -o $lib~$RM $lib.exp'
+	$CC -shared${allow_undefined_flag} ${wl}-input ${wl}$lib.exp $compiler_flags $libobjs $deplibs -soname $soname `test -n "$verstring" && $ECHO "-set_version $verstring"` -update_registry ${output_objdir}/so_locations -o $lib~$RM $lib.exp'
 
 	# Both c and cxx compiler support -rpath directly
 	hardcode_libdir_flag_spec='-rpath $libdir'
@@ -10880,9 +9801,9 @@ rm -f core conftest.err conftest.$ac_objext conftest_ipa8_conftest.oo \
       no_undefined_flag=' -z defs'
       if test "$GCC" = yes; then
 	wlarc='${wl}'
-	archive_cmds='$CC -shared ${wl}-z ${wl}text ${wl}-h ${wl}$soname -o $lib $libobjs $deplibs $compiler_flags'
+	archive_cmds='$CC -shared $pic_flag ${wl}-z ${wl}text ${wl}-h ${wl}$soname -o $lib $libobjs $deplibs $compiler_flags'
 	archive_expsym_cmds='echo "{ global:" > $lib.exp~cat $export_symbols | $SED -e "s/\(.*\)/\1;/" >> $lib.exp~echo "local: *; };" >> $lib.exp~
-	  $CC -shared ${wl}-z ${wl}text ${wl}-M ${wl}$lib.exp ${wl}-h ${wl}$soname -o $lib $libobjs $deplibs $compiler_flags~$RM $lib.exp'
+	  $CC -shared $pic_flag ${wl}-z ${wl}text ${wl}-M ${wl}$lib.exp ${wl}-h ${wl}$soname -o $lib $libobjs $deplibs $compiler_flags~$RM $lib.exp'
       else
 	case `$CC -V 2>&1` in
 	*"Compilers 5.0"*)
@@ -11031,7 +9952,7 @@ rm -f core conftest.err conftest.$ac_objext conftest_ipa8_conftest.oo \
     fi
   fi
 
-{ $as_echo "$as_me:$LINENO: result: $ld_shlibs" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ld_shlibs" >&5
 $as_echo "$ld_shlibs" >&6; }
 test "$ld_shlibs" = no && can_build_shared=no
 
@@ -11068,46 +9989,52 @@ x|xyes)
       # Test whether the compiler implicitly links with -lc since on some
       # systems, -lgcc has to come before -lc. If gcc already passes -lc
       # to ld, don't add -lc before -lgcc.
-      { $as_echo "$as_me:$LINENO: checking whether -lc should be explicitly linked in" >&5
+      { $as_echo "$as_me:${as_lineno-$LINENO}: checking whether -lc should be explicitly linked in" >&5
 $as_echo_n "checking whether -lc should be explicitly linked in... " >&6; }
-      $RM conftest*
-      echo "$lt_simple_compile_test_code" > conftest.$ac_ext
+if ${lt_cv_archive_cmds_need_lc+:} false; then :
+  $as_echo_n "(cached) " >&6
+else
+  $RM conftest*
+	echo "$lt_simple_compile_test_code" > conftest.$ac_ext
 
-      if { (eval echo "$as_me:$LINENO: \"$ac_compile\"") >&5
+	if { { eval echo "\"\$as_me\":${as_lineno-$LINENO}: \"$ac_compile\""; } >&5
   (eval $ac_compile) 2>&5
   ac_status=$?
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } 2>conftest.err; then
-        soname=conftest
-        lib=conftest
-        libobjs=conftest.$ac_objext
-        deplibs=
-        wl=$lt_prog_compiler_wl
-	pic_flag=$lt_prog_compiler_pic
-        compiler_flags=-v
-        linker_flags=-v
-        verstring=
-        output_objdir=.
-        libname=conftest
-        lt_save_allow_undefined_flag=$allow_undefined_flag
-        allow_undefined_flag=
-        if { (eval echo "$as_me:$LINENO: \"$archive_cmds 2\>\&1 \| $GREP \" -lc \" \>/dev/null 2\>\&1\"") >&5
+  $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+  test $ac_status = 0; } 2>conftest.err; then
+	  soname=conftest
+	  lib=conftest
+	  libobjs=conftest.$ac_objext
+	  deplibs=
+	  wl=$lt_prog_compiler_wl
+	  pic_flag=$lt_prog_compiler_pic
+	  compiler_flags=-v
+	  linker_flags=-v
+	  verstring=
+	  output_objdir=.
+	  libname=conftest
+	  lt_save_allow_undefined_flag=$allow_undefined_flag
+	  allow_undefined_flag=
+	  if { { eval echo "\"\$as_me\":${as_lineno-$LINENO}: \"$archive_cmds 2\>\&1 \| $GREP \" -lc \" \>/dev/null 2\>\&1\""; } >&5
   (eval $archive_cmds 2\>\&1 \| $GREP \" -lc \" \>/dev/null 2\>\&1) 2>&5
   ac_status=$?
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); }
-        then
-	  archive_cmds_need_lc=no
-        else
-	  archive_cmds_need_lc=yes
-        fi
-        allow_undefined_flag=$lt_save_allow_undefined_flag
-      else
-        cat conftest.err 1>&5
-      fi
-      $RM conftest*
-      { $as_echo "$as_me:$LINENO: result: $archive_cmds_need_lc" >&5
-$as_echo "$archive_cmds_need_lc" >&6; }
+  $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+  test $ac_status = 0; }
+	  then
+	    lt_cv_archive_cmds_need_lc=no
+	  else
+	    lt_cv_archive_cmds_need_lc=yes
+	  fi
+	  allow_undefined_flag=$lt_save_allow_undefined_flag
+	else
+	  cat conftest.err 1>&5
+	fi
+	$RM conftest*
+
+fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $lt_cv_archive_cmds_need_lc" >&5
+$as_echo "$lt_cv_archive_cmds_need_lc" >&6; }
+      archive_cmds_need_lc=$lt_cv_archive_cmds_need_lc
       ;;
     esac
   fi
@@ -11265,12 +10192,7 @@ esac
 
 
 
-
-
-
-
-
-  { $as_echo "$as_me:$LINENO: checking dynamic linker characteristics" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: checking dynamic linker characteristics" >&5
 $as_echo_n "checking dynamic linker characteristics... " >&6; }
 
 if test "$GCC" = yes; then
@@ -11278,16 +10200,23 @@ if test "$GCC" = yes; then
     darwin*) lt_awk_arg="/^libraries:/,/LR/" ;;
     *) lt_awk_arg="/^libraries:/" ;;
   esac
-  lt_search_path_spec=`$CC -print-search-dirs | awk $lt_awk_arg | $SED -e "s/^libraries://" -e "s,=/,/,g"`
-  if $ECHO "$lt_search_path_spec" | $GREP ';' >/dev/null ; then
+  case $host_os in
+    mingw* | cegcc*) lt_sed_strip_eq="s,=\([A-Za-z]:\),\1,g" ;;
+    *) lt_sed_strip_eq="s,=/,/,g" ;;
+  esac
+  lt_search_path_spec=`$CC -print-search-dirs | awk $lt_awk_arg | $SED -e "s/^libraries://" -e $lt_sed_strip_eq`
+  case $lt_search_path_spec in
+  *\;*)
     # if the path contains ";" then we assume it to be the separator
     # otherwise default to the standard path separator (i.e. ":") - it is
     # assumed that no part of a normal pathname contains ";" but that should
     # okay in the real world where ";" in dirpaths is itself problematic.
-    lt_search_path_spec=`$ECHO "$lt_search_path_spec" | $SED -e 's/;/ /g'`
-  else
-    lt_search_path_spec=`$ECHO "$lt_search_path_spec" | $SED  -e "s/$PATH_SEPARATOR/ /g"`
-  fi
+    lt_search_path_spec=`$ECHO "$lt_search_path_spec" | $SED 's/;/ /g'`
+    ;;
+  *)
+    lt_search_path_spec=`$ECHO "$lt_search_path_spec" | $SED "s/$PATH_SEPARATOR/ /g"`
+    ;;
+  esac
   # Ok, now we have the path, separated by spaces, we can step through it
   # and add multilib dir if necessary.
   lt_tmp_lt_search_path_spec=
@@ -11300,7 +10229,7 @@ if test "$GCC" = yes; then
 	lt_tmp_lt_search_path_spec="$lt_tmp_lt_search_path_spec $lt_sys_path"
     fi
   done
-  lt_search_path_spec=`$ECHO $lt_tmp_lt_search_path_spec | awk '
+  lt_search_path_spec=`$ECHO "$lt_tmp_lt_search_path_spec" | awk '
 BEGIN {RS=" "; FS="/|\n";} {
   lt_foo="";
   lt_count=0;
@@ -11320,7 +10249,13 @@ BEGIN {RS=" "; FS="/|\n";} {
   if (lt_foo != "") { lt_freq[lt_foo]++; }
   if (lt_freq[lt_foo] == 1) { print lt_foo; }
 }'`
-  sys_lib_search_path_spec=`$ECHO $lt_search_path_spec`
+  # AWK program above erroneously prepends '/' to C:/dos/paths
+  # for these hosts.
+  case $host_os in
+    mingw* | cegcc*) lt_search_path_spec=`$ECHO "$lt_search_path_spec" |\
+      $SED 's,/\([A-Za-z]:\),\1,g'` ;;
+  esac
+  sys_lib_search_path_spec=`$ECHO "$lt_search_path_spec" | $lt_NL2SP`
 else
   sys_lib_search_path_spec="/lib /usr/lib /usr/local/lib"
 fi
@@ -11346,7 +10281,7 @@ need_version=unknown
 
 case $host_os in
 aix3*)
-  version_type=linux
+  version_type=linux # correct to gnu/linux during the next big refactor
   library_names_spec='${libname}${release}${shared_ext}$versuffix $libname.a'
   shlibpath_var=LIBPATH
 
@@ -11355,7 +10290,7 @@ aix3*)
   ;;
 
 aix[4-9]*)
-  version_type=linux
+  version_type=linux # correct to gnu/linux during the next big refactor
   need_lib_prefix=no
   need_version=no
   hardcode_into_libs=yes
@@ -11408,7 +10343,7 @@ amigaos*)
   m68k)
     library_names_spec='$libname.ixlibrary $libname.a'
     # Create ${libname}_ixlibrary.a entries in /sys/libs.
-    finish_eval='for lib in `ls $libdir/*.ixlibrary 2>/dev/null`; do libname=`$ECHO "X$lib" | $Xsed -e '\''s%^.*/\([^/]*\)\.ixlibrary$%\1%'\''`; test $RM /sys/libs/${libname}_ixlibrary.a; $show "cd /sys/libs && $LN_S $lib ${libname}_ixlibrary.a"; cd /sys/libs && $LN_S $lib ${libname}_ixlibrary.a || exit 1; done'
+    finish_eval='for lib in `ls $libdir/*.ixlibrary 2>/dev/null`; do libname=`func_echo_all "$lib" | $SED '\''s%^.*/\([^/]*\)\.ixlibrary$%\1%'\''`; test $RM /sys/libs/${libname}_ixlibrary.a; $show "cd /sys/libs && $LN_S $lib ${libname}_ixlibrary.a"; cd /sys/libs && $LN_S $lib ${libname}_ixlibrary.a || exit 1; done'
     ;;
   esac
   ;;
@@ -11420,7 +10355,7 @@ beos*)
   ;;
 
 bsdi[45]*)
-  version_type=linux
+  version_type=linux # correct to gnu/linux during the next big refactor
   need_version=no
   library_names_spec='${libname}${release}${shared_ext}$versuffix ${libname}${release}${shared_ext}$major $libname${shared_ext}'
   soname_spec='${libname}${release}${shared_ext}$major'
@@ -11439,8 +10374,9 @@ cygwin* | mingw* | pw32* | cegcc*)
   need_version=no
   need_lib_prefix=no
 
-  case $GCC,$host_os in
-  yes,cygwin* | yes,mingw* | yes,pw32* | yes,cegcc*)
+  case $GCC,$cc_basename in
+  yes,*)
+    # gcc
     library_names_spec='$libname.dll.a'
     # DLL is installed to $(libdir)/../bin by postinstall_cmds
     postinstall_cmds='base_file=`basename \${file}`~
@@ -11461,36 +10397,83 @@ cygwin* | mingw* | pw32* | cegcc*)
     cygwin*)
       # Cygwin DLLs use 'cyg' prefix rather than 'lib'
       soname_spec='`echo ${libname} | sed -e 's/^lib/cyg/'``echo ${release} | $SED -e 's/[.]/-/g'`${versuffix}${shared_ext}'
-      sys_lib_search_path_spec="/usr/lib /lib/w32api /lib /usr/local/lib"
+
+      sys_lib_search_path_spec="$sys_lib_search_path_spec /usr/lib/w32api"
       ;;
     mingw* | cegcc*)
       # MinGW DLLs use traditional 'lib' prefix
       soname_spec='${libname}`echo ${release} | $SED -e 's/[.]/-/g'`${versuffix}${shared_ext}'
-      sys_lib_search_path_spec=`$CC -print-search-dirs | $GREP "^libraries:" | $SED -e "s/^libraries://" -e "s,=/,/,g"`
-      if $ECHO "$sys_lib_search_path_spec" | $GREP ';[c-zC-Z]:/' >/dev/null; then
-        # It is most probably a Windows format PATH printed by
-        # mingw gcc, but we are running on Cygwin. Gcc prints its search
-        # path with ; separators, and with drive letters. We can handle the
-        # drive letters (cygwin fileutils understands them), so leave them,
-        # especially as we might pass files found there to a mingw objdump,
-        # which wouldn't understand a cygwinified path. Ahh.
-        sys_lib_search_path_spec=`$ECHO "$sys_lib_search_path_spec" | $SED -e 's/;/ /g'`
-      else
-        sys_lib_search_path_spec=`$ECHO "$sys_lib_search_path_spec" | $SED  -e "s/$PATH_SEPARATOR/ /g"`
-      fi
       ;;
     pw32*)
       # pw32 DLLs use 'pw' prefix rather than 'lib'
       library_names_spec='`echo ${libname} | sed -e 's/^lib/pw/'``echo ${release} | $SED -e 's/[.]/-/g'`${versuffix}${shared_ext}'
       ;;
     esac
+    dynamic_linker='Win32 ld.exe'
+    ;;
+
+  *,cl*)
+    # Native MSVC
+    libname_spec='$name'
+    soname_spec='${libname}`echo ${release} | $SED -e 's/[.]/-/g'`${versuffix}${shared_ext}'
+    library_names_spec='${libname}.dll.lib'
+
+    case $build_os in
+    mingw*)
+      sys_lib_search_path_spec=
+      lt_save_ifs=$IFS
+      IFS=';'
+      for lt_path in $LIB
+      do
+        IFS=$lt_save_ifs
+        # Let DOS variable expansion print the short 8.3 style file name.
+        lt_path=`cd "$lt_path" 2>/dev/null && cmd //C "for %i in (".") do @echo %~si"`
+        sys_lib_search_path_spec="$sys_lib_search_path_spec $lt_path"
+      done
+      IFS=$lt_save_ifs
+      # Convert to MSYS style.
+      sys_lib_search_path_spec=`$ECHO "$sys_lib_search_path_spec" | sed -e 's|\\\\|/|g' -e 's| \\([a-zA-Z]\\):| /\\1|g' -e 's|^ ||'`
+      ;;
+    cygwin*)
+      # Convert to unix form, then to dos form, then back to unix form
+      # but this time dos style (no spaces!) so that the unix form looks
+      # like /cygdrive/c/PROGRA~1:/cygdr...
+      sys_lib_search_path_spec=`cygpath --path --unix "$LIB"`
+      sys_lib_search_path_spec=`cygpath --path --dos "$sys_lib_search_path_spec" 2>/dev/null`
+      sys_lib_search_path_spec=`cygpath --path --unix "$sys_lib_search_path_spec" | $SED -e "s/$PATH_SEPARATOR/ /g"`
+      ;;
+    *)
+      sys_lib_search_path_spec="$LIB"
+      if $ECHO "$sys_lib_search_path_spec" | $GREP ';[c-zC-Z]:/' >/dev/null; then
+        # It is most probably a Windows format PATH.
+        sys_lib_search_path_spec=`$ECHO "$sys_lib_search_path_spec" | $SED -e 's/;/ /g'`
+      else
+        sys_lib_search_path_spec=`$ECHO "$sys_lib_search_path_spec" | $SED -e "s/$PATH_SEPARATOR/ /g"`
+      fi
+      # FIXME: find the short name or the path components, as spaces are
+      # common. (e.g. "Program Files" -> "PROGRA~1")
+      ;;
+    esac
+
+    # DLL is installed to $(libdir)/../bin by postinstall_cmds
+    postinstall_cmds='base_file=`basename \${file}`~
+      dlpath=`$SHELL 2>&1 -c '\''. $dir/'\''\${base_file}'\''i; echo \$dlname'\''`~
+      dldir=$destdir/`dirname \$dlpath`~
+      test -d \$dldir || mkdir -p \$dldir~
+      $install_prog $dir/$dlname \$dldir/$dlname'
+    postuninstall_cmds='dldll=`$SHELL 2>&1 -c '\''. $file; echo \$dlname'\''`~
+      dlpath=$dir/\$dldll~
+       $RM \$dlpath'
+    shlibpath_overrides_runpath=yes
+    dynamic_linker='Win32 link.exe'
     ;;
 
   *)
+    # Assume MSVC wrapper
     library_names_spec='${libname}`echo ${release} | $SED -e 's/[.]/-/g'`${versuffix}${shared_ext} $libname.lib'
+    dynamic_linker='Win32 ld.exe'
     ;;
   esac
-  dynamic_linker='Win32 ld.exe'
   # FIXME: first we should search . and the directory the executable is in
   shlibpath_var=PATH
   ;;
@@ -11511,7 +10494,7 @@ darwin* | rhapsody*)
   ;;
 
 dgux*)
-  version_type=linux
+  version_type=linux # correct to gnu/linux during the next big refactor
   need_lib_prefix=no
   need_version=no
   library_names_spec='${libname}${release}${shared_ext}$versuffix ${libname}${release}${shared_ext}$major $libname$shared_ext'
@@ -11519,10 +10502,6 @@ dgux*)
   shlibpath_var=LD_LIBRARY_PATH
   ;;
 
-freebsd1*)
-  dynamic_linker=no
-  ;;
-
 freebsd* | dragonfly*)
   # DragonFly does not have aout.  When/if they implement a new
   # versioning mechanism, adjust this.
@@ -11530,7 +10509,7 @@ freebsd* | dragonfly*)
     objformat=`/usr/bin/objformat`
   else
     case $host_os in
-    freebsd[123]*) objformat=aout ;;
+    freebsd[23].*) objformat=aout ;;
     *) objformat=elf ;;
     esac
   fi
@@ -11548,7 +10527,7 @@ freebsd* | dragonfly*)
   esac
   shlibpath_var=LD_LIBRARY_PATH
   case $host_os in
-  freebsd2*)
+  freebsd2.*)
     shlibpath_overrides_runpath=yes
     ;;
   freebsd3.[01]* | freebsdelf3.[01]*)
@@ -11568,12 +10547,26 @@ freebsd* | dragonfly*)
   ;;
 
 gnu*)
-  version_type=linux
+  version_type=linux # correct to gnu/linux during the next big refactor
   need_lib_prefix=no
   need_version=no
   library_names_spec='${libname}${release}${shared_ext}$versuffix ${libname}${release}${shared_ext}${major} ${libname}${shared_ext}'
   soname_spec='${libname}${release}${shared_ext}$major'
   shlibpath_var=LD_LIBRARY_PATH
+  shlibpath_overrides_runpath=no
+  hardcode_into_libs=yes
+  ;;
+
+haiku*)
+  version_type=linux # correct to gnu/linux during the next big refactor
+  need_lib_prefix=no
+  need_version=no
+  dynamic_linker="$host_os runtime_loader"
+  library_names_spec='${libname}${release}${shared_ext}$versuffix ${libname}${release}${shared_ext}${major} ${libname}${shared_ext}'
+  soname_spec='${libname}${release}${shared_ext}$major'
+  shlibpath_var=LIBRARY_PATH
+  shlibpath_overrides_runpath=yes
+  sys_lib_dlsearch_path_spec='/boot/home/config/lib /boot/common/lib /boot/system/lib'
   hardcode_into_libs=yes
   ;;
 
@@ -11619,12 +10612,14 @@ hpux9* | hpux10* | hpux11*)
     soname_spec='${libname}${release}${shared_ext}$major'
     ;;
   esac
-  # HP-UX runs *really* slowly unless shared libraries are mode 555.
+  # HP-UX runs *really* slowly unless shared libraries are mode 555, ...
   postinstall_cmds='chmod 555 $lib'
+  # or fails outright, so override atomically:
+  install_override_mode=555
   ;;
 
 interix[3-9]*)
-  version_type=linux
+  version_type=linux # correct to gnu/linux during the next big refactor
   need_lib_prefix=no
   need_version=no
   library_names_spec='${libname}${release}${shared_ext}$versuffix ${libname}${release}${shared_ext}$major ${libname}${shared_ext}'
@@ -11640,7 +10635,7 @@ irix5* | irix6* | nonstopux*)
     nonstopux*) version_type=nonstopux ;;
     *)
 	if test "$lt_cv_prog_gnu_ld" = yes; then
-		version_type=linux
+		version_type=linux # correct to gnu/linux during the next big refactor
 	else
 		version_type=irix
 	fi ;;
@@ -11677,9 +10672,9 @@ linux*oldld* | linux*aout* | linux*coff*)
   dynamic_linker=no
   ;;
 
-# This must be Linux ELF.
-linux* | k*bsd*-gnu)
-  version_type=linux
+# This must be glibc/ELF.
+linux* | k*bsd*-gnu | kopensolaris*-gnu)
+  version_type=linux # correct to gnu/linux during the next big refactor
   need_lib_prefix=no
   need_version=no
   library_names_spec='${libname}${release}${shared_ext}$versuffix ${libname}${release}${shared_ext}$major $libname${shared_ext}'
@@ -11687,16 +10682,17 @@ linux* | k*bsd*-gnu)
   finish_cmds='PATH="\$PATH:/sbin" ldconfig -n $libdir'
   shlibpath_var=LD_LIBRARY_PATH
   shlibpath_overrides_runpath=no
+
   # Some binutils ld are patched to set DT_RUNPATH
-  save_LDFLAGS=$LDFLAGS
-  save_libdir=$libdir
-  eval "libdir=/foo; wl=\"$lt_prog_compiler_wl\"; \
-       LDFLAGS=\"\$LDFLAGS $hardcode_libdir_flag_spec\""
-  cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
+  if ${lt_cv_shlibpath_overrides_runpath+:} false; then :
+  $as_echo_n "(cached) " >&6
+else
+  lt_cv_shlibpath_overrides_runpath=no
+    save_LDFLAGS=$LDFLAGS
+    save_libdir=$libdir
+    eval "libdir=/foo; wl=\"$lt_prog_compiler_wl\"; \
+	 LDFLAGS=\"\$LDFLAGS $hardcode_libdir_flag_spec\""
+    cat confdefs.h - <<_ACEOF >conftest.$ac_ext
 /* end confdefs.h.  */
 
 int
@@ -11707,43 +10703,19 @@ main ()
   return 0;
 }
 _ACEOF
-rm -f conftest.$ac_objext conftest$ac_exeext
-if { (ac_try="$ac_link"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_link") 2>conftest.er1
-  ac_status=$?
-  grep -v '^ *+' conftest.er1 >conftest.err
-  rm -f conftest.er1
-  cat conftest.err >&5
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } && {
-	 test -z "$ac_c_werror_flag" ||
-	 test ! -s conftest.err
-       } && test -s conftest$ac_exeext && {
-	 test "$cross_compiling" = yes ||
-	 $as_test_x conftest$ac_exeext
-       }; then
-  if  ($OBJDUMP -p conftest$ac_exeext) 2>/dev/null | grep "RUNPATH.*$libdir" >/dev/null; then
-  shlibpath_overrides_runpath=yes
+if ac_fn_c_try_link "$LINENO"; then :
+  if  ($OBJDUMP -p conftest$ac_exeext) 2>/dev/null | grep "RUNPATH.*$libdir" >/dev/null; then :
+  lt_cv_shlibpath_overrides_runpath=yes
 fi
-
-else
-  $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
-
+fi
+rm -f core conftest.err conftest.$ac_objext \
+    conftest$ac_exeext conftest.$ac_ext
+    LDFLAGS=$save_LDFLAGS
+    libdir=$save_libdir
 
 fi
 
-rm -rf conftest.dSYM
-rm -f core conftest.err conftest.$ac_objext conftest_ipa8_conftest.oo \
-      conftest$ac_exeext conftest.$ac_ext
-  LDFLAGS=$save_LDFLAGS
-  libdir=$save_libdir
+  shlibpath_overrides_runpath=$lt_cv_shlibpath_overrides_runpath
 
   # This implies no fast_install, which is unacceptable.
   # Some rework will be needed to allow for fast_install
@@ -11755,8 +10727,9 @@ rm -f core conftest.err conftest.$ac_objext conftest_ipa8_conftest.oo \
 
   # Append ld.so.conf contents to the search path
   if test -f /etc/ld.so.conf; then
-    lt_ld_extra=`awk '/^include / { system(sprintf("cd /etc; cat %s 2>/dev/null", \$2)); skip = 1; } { if (!skip) print \$0; skip = 0; }' < /etc/ld.so.conf | $SED -e 's/#.*//;/^[	 ]*hwcap[	 ]/d;s/[:,	]/ /g;s/=[^=]*$//;s/=[^= ]* / /g;/^$/d' | tr '\n' ' '`
+    lt_ld_extra=`awk '/^include / { system(sprintf("cd /etc; cat %s 2>/dev/null", \$2)); skip = 1; } { if (!skip) print \$0; skip = 0; }' < /etc/ld.so.conf | $SED -e 's/#.*//;/^[	 ]*hwcap[	 ]/d;s/[:,	]/ /g;s/=[^=]*$//;s/=[^= ]* / /g;s/"//g;/^$/d' | tr '\n' ' '`
     sys_lib_dlsearch_path_spec="$sys_lib_dlsearch_path_spec $lt_ld_extra"
+
   fi
 
   # We used to test for /lib/ld.so.1 and disable shared libraries on
@@ -11787,7 +10760,7 @@ netbsd*)
   ;;
 
 newsos6)
-  version_type=linux
+  version_type=linux # correct to gnu/linux during the next big refactor
   library_names_spec='${libname}${release}${shared_ext}$versuffix ${libname}${release}${shared_ext}$major $libname${shared_ext}'
   shlibpath_var=LD_LIBRARY_PATH
   shlibpath_overrides_runpath=yes
@@ -11856,7 +10829,7 @@ rdos*)
   ;;
 
 solaris*)
-  version_type=linux
+  version_type=linux # correct to gnu/linux during the next big refactor
   need_lib_prefix=no
   need_version=no
   library_names_spec='${libname}${release}${shared_ext}$versuffix ${libname}${release}${shared_ext}$major $libname${shared_ext}'
@@ -11881,7 +10854,7 @@ sunos4*)
   ;;
 
 sysv4 | sysv4.3*)
-  version_type=linux
+  version_type=linux # correct to gnu/linux during the next big refactor
   library_names_spec='${libname}${release}${shared_ext}$versuffix ${libname}${release}${shared_ext}$major $libname${shared_ext}'
   soname_spec='${libname}${release}${shared_ext}$major'
   shlibpath_var=LD_LIBRARY_PATH
@@ -11905,7 +10878,7 @@ sysv4 | sysv4.3*)
 
 sysv4*MP*)
   if test -d /usr/nec ;then
-    version_type=linux
+    version_type=linux # correct to gnu/linux during the next big refactor
     library_names_spec='$libname${shared_ext}.$versuffix $libname${shared_ext}.$major $libname${shared_ext}'
     soname_spec='$libname${shared_ext}.$major'
     shlibpath_var=LD_LIBRARY_PATH
@@ -11936,7 +10909,7 @@ sysv5* | sco3.2v5* | sco5v6* | unixware* | OpenUNIX* | sysv4*uw2*)
 
 tpf*)
   # TPF is a cross-target only.  Preferred cross-host = GNU/Linux.
-  version_type=linux
+  version_type=linux # correct to gnu/linux during the next big refactor
   need_lib_prefix=no
   need_version=no
   library_names_spec='${libname}${release}${shared_ext}$versuffix ${libname}${release}${shared_ext}$major $libname${shared_ext}'
@@ -11946,7 +10919,7 @@ tpf*)
   ;;
 
 uts4*)
-  version_type=linux
+  version_type=linux # correct to gnu/linux during the next big refactor
   library_names_spec='${libname}${release}${shared_ext}$versuffix ${libname}${release}${shared_ext}$major $libname${shared_ext}'
   soname_spec='${libname}${release}${shared_ext}$major'
   shlibpath_var=LD_LIBRARY_PATH
@@ -11956,7 +10929,7 @@ uts4*)
   dynamic_linker=no
   ;;
 esac
-{ $as_echo "$as_me:$LINENO: result: $dynamic_linker" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $dynamic_linker" >&5
 $as_echo "$dynamic_linker" >&6; }
 test "$dynamic_linker" = no && can_build_shared=no
 
@@ -12058,7 +11031,12 @@ fi
 
 
 
-  { $as_echo "$as_me:$LINENO: checking how to hardcode library paths into programs" >&5
+
+
+
+
+
+  { $as_echo "$as_me:${as_lineno-$LINENO}: checking how to hardcode library paths into programs" >&5
 $as_echo_n "checking how to hardcode library paths into programs... " >&6; }
 hardcode_action=
 if test -n "$hardcode_libdir_flag_spec" ||
@@ -12083,7 +11061,7 @@ else
   # directories.
   hardcode_action=unsupported
 fi
-{ $as_echo "$as_me:$LINENO: result: $hardcode_action" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $hardcode_action" >&5
 $as_echo "$hardcode_action" >&6; }
 
 if test "$hardcode_action" = relink ||
@@ -12128,18 +11106,14 @@ else
 
   darwin*)
   # if libdl is installed we need to link against it
-    { $as_echo "$as_me:$LINENO: checking for dlopen in -ldl" >&5
+    { $as_echo "$as_me:${as_lineno-$LINENO}: checking for dlopen in -ldl" >&5
 $as_echo_n "checking for dlopen in -ldl... " >&6; }
-if test "${ac_cv_lib_dl_dlopen+set}" = set; then
+if ${ac_cv_lib_dl_dlopen+:} false; then :
   $as_echo_n "(cached) " >&6
 else
   ac_check_lib_save_LIBS=$LIBS
 LIBS="-ldl  $LIBS"
-cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
+cat confdefs.h - <<_ACEOF >conftest.$ac_ext
 /* end confdefs.h.  */
 
 /* Override any GCC internal prototype to avoid an error.
@@ -12157,43 +11131,18 @@ return dlopen ();
   return 0;
 }
 _ACEOF
-rm -f conftest.$ac_objext conftest$ac_exeext
-if { (ac_try="$ac_link"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_link") 2>conftest.er1
-  ac_status=$?
-  grep -v '^ *+' conftest.er1 >conftest.err
-  rm -f conftest.er1
-  cat conftest.err >&5
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } && {
-	 test -z "$ac_c_werror_flag" ||
-	 test ! -s conftest.err
-       } && test -s conftest$ac_exeext && {
-	 test "$cross_compiling" = yes ||
-	 $as_test_x conftest$ac_exeext
-       }; then
+if ac_fn_c_try_link "$LINENO"; then :
   ac_cv_lib_dl_dlopen=yes
 else
-  $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
-
-	ac_cv_lib_dl_dlopen=no
+  ac_cv_lib_dl_dlopen=no
 fi
-
-rm -rf conftest.dSYM
-rm -f core conftest.err conftest.$ac_objext conftest_ipa8_conftest.oo \
-      conftest$ac_exeext conftest.$ac_ext
+rm -f core conftest.err conftest.$ac_objext \
+    conftest$ac_exeext conftest.$ac_ext
 LIBS=$ac_check_lib_save_LIBS
 fi
-{ $as_echo "$as_me:$LINENO: result: $ac_cv_lib_dl_dlopen" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_lib_dl_dlopen" >&5
 $as_echo "$ac_cv_lib_dl_dlopen" >&6; }
-if test "x$ac_cv_lib_dl_dlopen" = x""yes; then
+if test "x$ac_cv_lib_dl_dlopen" = xyes; then :
   lt_cv_dlopen="dlopen" lt_cv_dlopen_libs="-ldl"
 else
 
@@ -12206,106 +11155,18 @@ fi
     ;;
 
   *)
-    { $as_echo "$as_me:$LINENO: checking for shl_load" >&5
-$as_echo_n "checking for shl_load... " >&6; }
-if test "${ac_cv_func_shl_load+set}" = set; then
-  $as_echo_n "(cached) " >&6
-else
-  cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
-/* end confdefs.h.  */
-/* Define shl_load to an innocuous variant, in case <limits.h> declares shl_load.
-   For example, HP-UX 11i <limits.h> declares gettimeofday.  */
-#define shl_load innocuous_shl_load
-
-/* System header to define __stub macros and hopefully few prototypes,
-    which can conflict with char shl_load (); below.
-    Prefer <limits.h> to <assert.h> if __STDC__ is defined, since
-    <limits.h> exists even on freestanding compilers.  */
-
-#ifdef __STDC__
-# include <limits.h>
-#else
-# include <assert.h>
-#endif
-
-#undef shl_load
-
-/* Override any GCC internal prototype to avoid an error.
-   Use char because int might match the return type of a GCC
-   builtin and then its argument prototype would still apply.  */
-#ifdef __cplusplus
-extern "C"
-#endif
-char shl_load ();
-/* The GNU C library defines this for functions which it implements
-    to always fail with ENOSYS.  Some functions are actually named
-    something starting with __ and the normal name is an alias.  */
-#if defined __stub_shl_load || defined __stub___shl_load
-choke me
-#endif
-
-int
-main ()
-{
-return shl_load ();
-  ;
-  return 0;
-}
-_ACEOF
-rm -f conftest.$ac_objext conftest$ac_exeext
-if { (ac_try="$ac_link"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_link") 2>conftest.er1
-  ac_status=$?
-  grep -v '^ *+' conftest.er1 >conftest.err
-  rm -f conftest.er1
-  cat conftest.err >&5
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } && {
-	 test -z "$ac_c_werror_flag" ||
-	 test ! -s conftest.err
-       } && test -s conftest$ac_exeext && {
-	 test "$cross_compiling" = yes ||
-	 $as_test_x conftest$ac_exeext
-       }; then
-  ac_cv_func_shl_load=yes
-else
-  $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
-
-	ac_cv_func_shl_load=no
-fi
-
-rm -rf conftest.dSYM
-rm -f core conftest.err conftest.$ac_objext conftest_ipa8_conftest.oo \
-      conftest$ac_exeext conftest.$ac_ext
-fi
-{ $as_echo "$as_me:$LINENO: result: $ac_cv_func_shl_load" >&5
-$as_echo "$ac_cv_func_shl_load" >&6; }
-if test "x$ac_cv_func_shl_load" = x""yes; then
+    ac_fn_c_check_func "$LINENO" "shl_load" "ac_cv_func_shl_load"
+if test "x$ac_cv_func_shl_load" = xyes; then :
   lt_cv_dlopen="shl_load"
 else
-  { $as_echo "$as_me:$LINENO: checking for shl_load in -ldld" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: checking for shl_load in -ldld" >&5
 $as_echo_n "checking for shl_load in -ldld... " >&6; }
-if test "${ac_cv_lib_dld_shl_load+set}" = set; then
+if ${ac_cv_lib_dld_shl_load+:} false; then :
   $as_echo_n "(cached) " >&6
 else
   ac_check_lib_save_LIBS=$LIBS
 LIBS="-ldld  $LIBS"
-cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
+cat confdefs.h - <<_ACEOF >conftest.$ac_ext
 /* end confdefs.h.  */
 
 /* Override any GCC internal prototype to avoid an error.
@@ -12323,145 +11184,32 @@ return shl_load ();
   return 0;
 }
 _ACEOF
-rm -f conftest.$ac_objext conftest$ac_exeext
-if { (ac_try="$ac_link"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_link") 2>conftest.er1
-  ac_status=$?
-  grep -v '^ *+' conftest.er1 >conftest.err
-  rm -f conftest.er1
-  cat conftest.err >&5
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } && {
-	 test -z "$ac_c_werror_flag" ||
-	 test ! -s conftest.err
-       } && test -s conftest$ac_exeext && {
-	 test "$cross_compiling" = yes ||
-	 $as_test_x conftest$ac_exeext
-       }; then
+if ac_fn_c_try_link "$LINENO"; then :
   ac_cv_lib_dld_shl_load=yes
 else
-  $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
-
-	ac_cv_lib_dld_shl_load=no
+  ac_cv_lib_dld_shl_load=no
 fi
-
-rm -rf conftest.dSYM
-rm -f core conftest.err conftest.$ac_objext conftest_ipa8_conftest.oo \
-      conftest$ac_exeext conftest.$ac_ext
+rm -f core conftest.err conftest.$ac_objext \
+    conftest$ac_exeext conftest.$ac_ext
 LIBS=$ac_check_lib_save_LIBS
 fi
-{ $as_echo "$as_me:$LINENO: result: $ac_cv_lib_dld_shl_load" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_lib_dld_shl_load" >&5
 $as_echo "$ac_cv_lib_dld_shl_load" >&6; }
-if test "x$ac_cv_lib_dld_shl_load" = x""yes; then
+if test "x$ac_cv_lib_dld_shl_load" = xyes; then :
   lt_cv_dlopen="shl_load" lt_cv_dlopen_libs="-ldld"
 else
-  { $as_echo "$as_me:$LINENO: checking for dlopen" >&5
-$as_echo_n "checking for dlopen... " >&6; }
-if test "${ac_cv_func_dlopen+set}" = set; then
-  $as_echo_n "(cached) " >&6
-else
-  cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
-/* end confdefs.h.  */
-/* Define dlopen to an innocuous variant, in case <limits.h> declares dlopen.
-   For example, HP-UX 11i <limits.h> declares gettimeofday.  */
-#define dlopen innocuous_dlopen
-
-/* System header to define __stub macros and hopefully few prototypes,
-    which can conflict with char dlopen (); below.
-    Prefer <limits.h> to <assert.h> if __STDC__ is defined, since
-    <limits.h> exists even on freestanding compilers.  */
-
-#ifdef __STDC__
-# include <limits.h>
-#else
-# include <assert.h>
-#endif
-
-#undef dlopen
-
-/* Override any GCC internal prototype to avoid an error.
-   Use char because int might match the return type of a GCC
-   builtin and then its argument prototype would still apply.  */
-#ifdef __cplusplus
-extern "C"
-#endif
-char dlopen ();
-/* The GNU C library defines this for functions which it implements
-    to always fail with ENOSYS.  Some functions are actually named
-    something starting with __ and the normal name is an alias.  */
-#if defined __stub_dlopen || defined __stub___dlopen
-choke me
-#endif
-
-int
-main ()
-{
-return dlopen ();
-  ;
-  return 0;
-}
-_ACEOF
-rm -f conftest.$ac_objext conftest$ac_exeext
-if { (ac_try="$ac_link"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_link") 2>conftest.er1
-  ac_status=$?
-  grep -v '^ *+' conftest.er1 >conftest.err
-  rm -f conftest.er1
-  cat conftest.err >&5
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } && {
-	 test -z "$ac_c_werror_flag" ||
-	 test ! -s conftest.err
-       } && test -s conftest$ac_exeext && {
-	 test "$cross_compiling" = yes ||
-	 $as_test_x conftest$ac_exeext
-       }; then
-  ac_cv_func_dlopen=yes
-else
-  $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
-
-	ac_cv_func_dlopen=no
-fi
-
-rm -rf conftest.dSYM
-rm -f core conftest.err conftest.$ac_objext conftest_ipa8_conftest.oo \
-      conftest$ac_exeext conftest.$ac_ext
-fi
-{ $as_echo "$as_me:$LINENO: result: $ac_cv_func_dlopen" >&5
-$as_echo "$ac_cv_func_dlopen" >&6; }
-if test "x$ac_cv_func_dlopen" = x""yes; then
+  ac_fn_c_check_func "$LINENO" "dlopen" "ac_cv_func_dlopen"
+if test "x$ac_cv_func_dlopen" = xyes; then :
   lt_cv_dlopen="dlopen"
 else
-  { $as_echo "$as_me:$LINENO: checking for dlopen in -ldl" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: checking for dlopen in -ldl" >&5
 $as_echo_n "checking for dlopen in -ldl... " >&6; }
-if test "${ac_cv_lib_dl_dlopen+set}" = set; then
+if ${ac_cv_lib_dl_dlopen+:} false; then :
   $as_echo_n "(cached) " >&6
 else
   ac_check_lib_save_LIBS=$LIBS
 LIBS="-ldl  $LIBS"
-cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
+cat confdefs.h - <<_ACEOF >conftest.$ac_ext
 /* end confdefs.h.  */
 
 /* Override any GCC internal prototype to avoid an error.
@@ -12476,60 +11224,31 @@ main ()
 {
 return dlopen ();
   ;
-  return 0;
-}
-_ACEOF
-rm -f conftest.$ac_objext conftest$ac_exeext
-if { (ac_try="$ac_link"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_link") 2>conftest.er1
-  ac_status=$?
-  grep -v '^ *+' conftest.er1 >conftest.err
-  rm -f conftest.er1
-  cat conftest.err >&5
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } && {
-	 test -z "$ac_c_werror_flag" ||
-	 test ! -s conftest.err
-       } && test -s conftest$ac_exeext && {
-	 test "$cross_compiling" = yes ||
-	 $as_test_x conftest$ac_exeext
-       }; then
+  return 0;
+}
+_ACEOF
+if ac_fn_c_try_link "$LINENO"; then :
   ac_cv_lib_dl_dlopen=yes
 else
-  $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
-
-	ac_cv_lib_dl_dlopen=no
+  ac_cv_lib_dl_dlopen=no
 fi
-
-rm -rf conftest.dSYM
-rm -f core conftest.err conftest.$ac_objext conftest_ipa8_conftest.oo \
-      conftest$ac_exeext conftest.$ac_ext
+rm -f core conftest.err conftest.$ac_objext \
+    conftest$ac_exeext conftest.$ac_ext
 LIBS=$ac_check_lib_save_LIBS
 fi
-{ $as_echo "$as_me:$LINENO: result: $ac_cv_lib_dl_dlopen" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_lib_dl_dlopen" >&5
 $as_echo "$ac_cv_lib_dl_dlopen" >&6; }
-if test "x$ac_cv_lib_dl_dlopen" = x""yes; then
+if test "x$ac_cv_lib_dl_dlopen" = xyes; then :
   lt_cv_dlopen="dlopen" lt_cv_dlopen_libs="-ldl"
 else
-  { $as_echo "$as_me:$LINENO: checking for dlopen in -lsvld" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: checking for dlopen in -lsvld" >&5
 $as_echo_n "checking for dlopen in -lsvld... " >&6; }
-if test "${ac_cv_lib_svld_dlopen+set}" = set; then
+if ${ac_cv_lib_svld_dlopen+:} false; then :
   $as_echo_n "(cached) " >&6
 else
   ac_check_lib_save_LIBS=$LIBS
 LIBS="-lsvld  $LIBS"
-cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
+cat confdefs.h - <<_ACEOF >conftest.$ac_ext
 /* end confdefs.h.  */
 
 /* Override any GCC internal prototype to avoid an error.
@@ -12547,57 +11266,28 @@ return dlopen ();
   return 0;
 }
 _ACEOF
-rm -f conftest.$ac_objext conftest$ac_exeext
-if { (ac_try="$ac_link"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_link") 2>conftest.er1
-  ac_status=$?
-  grep -v '^ *+' conftest.er1 >conftest.err
-  rm -f conftest.er1
-  cat conftest.err >&5
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } && {
-	 test -z "$ac_c_werror_flag" ||
-	 test ! -s conftest.err
-       } && test -s conftest$ac_exeext && {
-	 test "$cross_compiling" = yes ||
-	 $as_test_x conftest$ac_exeext
-       }; then
+if ac_fn_c_try_link "$LINENO"; then :
   ac_cv_lib_svld_dlopen=yes
 else
-  $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
-
-	ac_cv_lib_svld_dlopen=no
+  ac_cv_lib_svld_dlopen=no
 fi
-
-rm -rf conftest.dSYM
-rm -f core conftest.err conftest.$ac_objext conftest_ipa8_conftest.oo \
-      conftest$ac_exeext conftest.$ac_ext
+rm -f core conftest.err conftest.$ac_objext \
+    conftest$ac_exeext conftest.$ac_ext
 LIBS=$ac_check_lib_save_LIBS
 fi
-{ $as_echo "$as_me:$LINENO: result: $ac_cv_lib_svld_dlopen" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_lib_svld_dlopen" >&5
 $as_echo "$ac_cv_lib_svld_dlopen" >&6; }
-if test "x$ac_cv_lib_svld_dlopen" = x""yes; then
+if test "x$ac_cv_lib_svld_dlopen" = xyes; then :
   lt_cv_dlopen="dlopen" lt_cv_dlopen_libs="-lsvld"
 else
-  { $as_echo "$as_me:$LINENO: checking for dld_link in -ldld" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: checking for dld_link in -ldld" >&5
 $as_echo_n "checking for dld_link in -ldld... " >&6; }
-if test "${ac_cv_lib_dld_dld_link+set}" = set; then
+if ${ac_cv_lib_dld_dld_link+:} false; then :
   $as_echo_n "(cached) " >&6
 else
   ac_check_lib_save_LIBS=$LIBS
 LIBS="-ldld  $LIBS"
-cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
+cat confdefs.h - <<_ACEOF >conftest.$ac_ext
 /* end confdefs.h.  */
 
 /* Override any GCC internal prototype to avoid an error.
@@ -12615,43 +11305,18 @@ return dld_link ();
   return 0;
 }
 _ACEOF
-rm -f conftest.$ac_objext conftest$ac_exeext
-if { (ac_try="$ac_link"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_link") 2>conftest.er1
-  ac_status=$?
-  grep -v '^ *+' conftest.er1 >conftest.err
-  rm -f conftest.er1
-  cat conftest.err >&5
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } && {
-	 test -z "$ac_c_werror_flag" ||
-	 test ! -s conftest.err
-       } && test -s conftest$ac_exeext && {
-	 test "$cross_compiling" = yes ||
-	 $as_test_x conftest$ac_exeext
-       }; then
+if ac_fn_c_try_link "$LINENO"; then :
   ac_cv_lib_dld_dld_link=yes
 else
-  $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
-
-	ac_cv_lib_dld_dld_link=no
+  ac_cv_lib_dld_dld_link=no
 fi
-
-rm -rf conftest.dSYM
-rm -f core conftest.err conftest.$ac_objext conftest_ipa8_conftest.oo \
-      conftest$ac_exeext conftest.$ac_ext
+rm -f core conftest.err conftest.$ac_objext \
+    conftest$ac_exeext conftest.$ac_ext
 LIBS=$ac_check_lib_save_LIBS
 fi
-{ $as_echo "$as_me:$LINENO: result: $ac_cv_lib_dld_dld_link" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_lib_dld_dld_link" >&5
 $as_echo "$ac_cv_lib_dld_dld_link" >&6; }
-if test "x$ac_cv_lib_dld_dld_link" = x""yes; then
+if test "x$ac_cv_lib_dld_dld_link" = xyes; then :
   lt_cv_dlopen="dld_link" lt_cv_dlopen_libs="-ldld"
 fi
 
@@ -12690,9 +11355,9 @@ fi
     save_LIBS="$LIBS"
     LIBS="$lt_cv_dlopen_libs $LIBS"
 
-    { $as_echo "$as_me:$LINENO: checking whether a program can dlopen itself" >&5
+    { $as_echo "$as_me:${as_lineno-$LINENO}: checking whether a program can dlopen itself" >&5
 $as_echo_n "checking whether a program can dlopen itself... " >&6; }
-if test "${lt_cv_dlopen_self+set}" = set; then
+if ${lt_cv_dlopen_self+:} false; then :
   $as_echo_n "(cached) " >&6
 else
   	  if test "$cross_compiling" = yes; then :
@@ -12701,7 +11366,7 @@ else
   lt_dlunknown=0; lt_dlno_uscore=1; lt_dlneed_uscore=2
   lt_status=$lt_dlunknown
   cat > conftest.$ac_ext <<_LT_EOF
-#line 12704 "configure"
+#line $LINENO "configure"
 #include "confdefs.h"
 
 #if HAVE_DLFCN_H
@@ -12742,7 +11407,13 @@ else
 #  endif
 #endif
 
-void fnord() { int i=42;}
+/* When -fvisbility=hidden is used, assume the code has been annotated
+   correspondingly for the symbols needed.  */
+#if defined(__GNUC__) && (((__GNUC__ == 3) && (__GNUC_MINOR__ >= 3)) || (__GNUC__ > 3))
+int fnord () __attribute__((visibility("default")));
+#endif
+
+int fnord () { return 42; }
 int main ()
 {
   void *self = dlopen (0, LT_DLGLOBAL|LT_DLLAZY_OR_NOW);
@@ -12751,7 +11422,11 @@ int main ()
   if (self)
     {
       if (dlsym (self,"fnord"))       status = $lt_dlno_uscore;
-      else if (dlsym( self,"_fnord")) status = $lt_dlneed_uscore;
+      else
+        {
+	  if (dlsym( self,"_fnord"))  status = $lt_dlneed_uscore;
+          else puts (dlerror ());
+	}
       /* dlclose (self); */
     }
   else
@@ -12760,11 +11435,11 @@ int main ()
   return status;
 }
 _LT_EOF
-  if { (eval echo "$as_me:$LINENO: \"$ac_link\"") >&5
+  if { { eval echo "\"\$as_me\":${as_lineno-$LINENO}: \"$ac_link\""; } >&5
   (eval $ac_link) 2>&5
   ac_status=$?
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } && test -s conftest${ac_exeext} 2>/dev/null; then
+  $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+  test $ac_status = 0; } && test -s conftest${ac_exeext} 2>/dev/null; then
     (./conftest; exit; ) >&5 2>/dev/null
     lt_status=$?
     case x$lt_status in
@@ -12781,14 +11456,14 @@ rm -fr conftest*
 
 
 fi
-{ $as_echo "$as_me:$LINENO: result: $lt_cv_dlopen_self" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $lt_cv_dlopen_self" >&5
 $as_echo "$lt_cv_dlopen_self" >&6; }
 
     if test "x$lt_cv_dlopen_self" = xyes; then
       wl=$lt_prog_compiler_wl eval LDFLAGS=\"\$LDFLAGS $lt_prog_compiler_static\"
-      { $as_echo "$as_me:$LINENO: checking whether a statically linked program can dlopen itself" >&5
+      { $as_echo "$as_me:${as_lineno-$LINENO}: checking whether a statically linked program can dlopen itself" >&5
 $as_echo_n "checking whether a statically linked program can dlopen itself... " >&6; }
-if test "${lt_cv_dlopen_self_static+set}" = set; then
+if ${lt_cv_dlopen_self_static+:} false; then :
   $as_echo_n "(cached) " >&6
 else
   	  if test "$cross_compiling" = yes; then :
@@ -12797,7 +11472,7 @@ else
   lt_dlunknown=0; lt_dlno_uscore=1; lt_dlneed_uscore=2
   lt_status=$lt_dlunknown
   cat > conftest.$ac_ext <<_LT_EOF
-#line 12800 "configure"
+#line $LINENO "configure"
 #include "confdefs.h"
 
 #if HAVE_DLFCN_H
@@ -12838,7 +11513,13 @@ else
 #  endif
 #endif
 
-void fnord() { int i=42;}
+/* When -fvisbility=hidden is used, assume the code has been annotated
+   correspondingly for the symbols needed.  */
+#if defined(__GNUC__) && (((__GNUC__ == 3) && (__GNUC_MINOR__ >= 3)) || (__GNUC__ > 3))
+int fnord () __attribute__((visibility("default")));
+#endif
+
+int fnord () { return 42; }
 int main ()
 {
   void *self = dlopen (0, LT_DLGLOBAL|LT_DLLAZY_OR_NOW);
@@ -12847,7 +11528,11 @@ int main ()
   if (self)
     {
       if (dlsym (self,"fnord"))       status = $lt_dlno_uscore;
-      else if (dlsym( self,"_fnord")) status = $lt_dlneed_uscore;
+      else
+        {
+	  if (dlsym( self,"_fnord"))  status = $lt_dlneed_uscore;
+          else puts (dlerror ());
+	}
       /* dlclose (self); */
     }
   else
@@ -12856,11 +11541,11 @@ int main ()
   return status;
 }
 _LT_EOF
-  if { (eval echo "$as_me:$LINENO: \"$ac_link\"") >&5
+  if { { eval echo "\"\$as_me\":${as_lineno-$LINENO}: \"$ac_link\""; } >&5
   (eval $ac_link) 2>&5
   ac_status=$?
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } && test -s conftest${ac_exeext} 2>/dev/null; then
+  $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+  test $ac_status = 0; } && test -s conftest${ac_exeext} 2>/dev/null; then
     (./conftest; exit; ) >&5 2>/dev/null
     lt_status=$?
     case x$lt_status in
@@ -12872,138 +11557,704 @@ _LT_EOF
     # compilation failed
     lt_cv_dlopen_self_static=no
   fi
-fi
-rm -fr conftest*
-
+fi
+rm -fr conftest*
+
+
+fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $lt_cv_dlopen_self_static" >&5
+$as_echo "$lt_cv_dlopen_self_static" >&6; }
+    fi
+
+    CPPFLAGS="$save_CPPFLAGS"
+    LDFLAGS="$save_LDFLAGS"
+    LIBS="$save_LIBS"
+    ;;
+  esac
+
+  case $lt_cv_dlopen_self in
+  yes|no) enable_dlopen_self=$lt_cv_dlopen_self ;;
+  *) enable_dlopen_self=unknown ;;
+  esac
+
+  case $lt_cv_dlopen_self_static in
+  yes|no) enable_dlopen_self_static=$lt_cv_dlopen_self_static ;;
+  *) enable_dlopen_self_static=unknown ;;
+  esac
+fi
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+striplib=
+old_striplib=
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking whether stripping libraries is possible" >&5
+$as_echo_n "checking whether stripping libraries is possible... " >&6; }
+if test -n "$STRIP" && $STRIP -V 2>&1 | $GREP "GNU strip" >/dev/null; then
+  test -z "$old_striplib" && old_striplib="$STRIP --strip-debug"
+  test -z "$striplib" && striplib="$STRIP --strip-unneeded"
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: yes" >&5
+$as_echo "yes" >&6; }
+else
+# FIXME - insert some real tests, host_os isn't really good enough
+  case $host_os in
+  darwin*)
+    if test -n "$STRIP" ; then
+      striplib="$STRIP -x"
+      old_striplib="$STRIP -S"
+      { $as_echo "$as_me:${as_lineno-$LINENO}: result: yes" >&5
+$as_echo "yes" >&6; }
+    else
+      { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
+$as_echo "no" >&6; }
+    fi
+    ;;
+  *)
+    { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
+$as_echo "no" >&6; }
+    ;;
+  esac
+fi
+
+
+
+
+
+
+
+
+
+
+
+
+  # Report which library types will actually be built
+  { $as_echo "$as_me:${as_lineno-$LINENO}: checking if libtool supports shared libraries" >&5
+$as_echo_n "checking if libtool supports shared libraries... " >&6; }
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $can_build_shared" >&5
+$as_echo "$can_build_shared" >&6; }
+
+  { $as_echo "$as_me:${as_lineno-$LINENO}: checking whether to build shared libraries" >&5
+$as_echo_n "checking whether to build shared libraries... " >&6; }
+  test "$can_build_shared" = "no" && enable_shared=no
+
+  # On AIX, shared libraries and static libraries use the same namespace, and
+  # are all built from PIC.
+  case $host_os in
+  aix3*)
+    test "$enable_shared" = yes && enable_static=no
+    if test -n "$RANLIB"; then
+      archive_cmds="$archive_cmds~\$RANLIB \$lib"
+      postinstall_cmds='$RANLIB $lib'
+    fi
+    ;;
+
+  aix[4-9]*)
+    if test "$host_cpu" != ia64 && test "$aix_use_runtimelinking" = no ; then
+      test "$enable_shared" = yes && enable_static=no
+    fi
+    ;;
+  esac
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $enable_shared" >&5
+$as_echo "$enable_shared" >&6; }
+
+  { $as_echo "$as_me:${as_lineno-$LINENO}: checking whether to build static libraries" >&5
+$as_echo_n "checking whether to build static libraries... " >&6; }
+  # Make sure either enable_shared or enable_static is yes.
+  test "$enable_shared" = yes || enable_static=yes
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $enable_static" >&5
+$as_echo "$enable_static" >&6; }
+
+
+
+
+fi
+ac_ext=c
+ac_cpp='$CPP $CPPFLAGS'
+ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
+ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
+ac_compiler_gnu=$ac_cv_c_compiler_gnu
+
+CC="$lt_save_CC"
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+        ac_config_commands="$ac_config_commands libtool"
+
+
+
+
+# Only expand once:
+
+
+
+# Change default compilation flags
+#AC_SUBST([ALL_CXXFLAGS], [-std=c++0x])
+#CXXFLAGS="-std=c++0x $CXXFLAGS"
+ac_ext=cpp
+ac_cpp='$CXXCPP $CPPFLAGS'
+ac_compile='$CXX -c $CXXFLAGS $CPPFLAGS conftest.$ac_ext >&5'
+ac_link='$CXX -o conftest$ac_exeext $CXXFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
+ac_compiler_gnu=$ac_cv_cxx_compiler_gnu
+
+ac_ext=cpp
+ac_cpp='$CXXCPP $CPPFLAGS'
+ac_compile='$CXX -c $CXXFLAGS $CPPFLAGS conftest.$ac_ext >&5'
+ac_link='$CXX -o conftest$ac_exeext $CXXFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
+ac_compiler_gnu=$ac_cv_cxx_compiler_gnu
+if test -z "$CXX"; then
+  if test -n "$CCC"; then
+    CXX=$CCC
+  else
+    if test -n "$ac_tool_prefix"; then
+  for ac_prog in g++ c++ gpp aCC CC cxx cc++ cl.exe FCC KCC RCC xlC_r xlC
+  do
+    # Extract the first word of "$ac_tool_prefix$ac_prog", so it can be a program name with args.
+set dummy $ac_tool_prefix$ac_prog; ac_word=$2
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
+$as_echo_n "checking for $ac_word... " >&6; }
+if ${ac_cv_prog_CXX+:} false; then :
+  $as_echo_n "(cached) " >&6
+else
+  if test -n "$CXX"; then
+  ac_cv_prog_CXX="$CXX" # Let the user override the test.
+else
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+  IFS=$as_save_IFS
+  test -z "$as_dir" && as_dir=.
+    for ac_exec_ext in '' $ac_executable_extensions; do
+  if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
+    ac_cv_prog_CXX="$ac_tool_prefix$ac_prog"
+    $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
+    break 2
+  fi
+done
+  done
+IFS=$as_save_IFS
+
+fi
+fi
+CXX=$ac_cv_prog_CXX
+if test -n "$CXX"; then
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $CXX" >&5
+$as_echo "$CXX" >&6; }
+else
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
+$as_echo "no" >&6; }
+fi
+
+
+    test -n "$CXX" && break
+  done
+fi
+if test -z "$CXX"; then
+  ac_ct_CXX=$CXX
+  for ac_prog in g++ c++ gpp aCC CC cxx cc++ cl.exe FCC KCC RCC xlC_r xlC
+do
+  # Extract the first word of "$ac_prog", so it can be a program name with args.
+set dummy $ac_prog; ac_word=$2
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
+$as_echo_n "checking for $ac_word... " >&6; }
+if ${ac_cv_prog_ac_ct_CXX+:} false; then :
+  $as_echo_n "(cached) " >&6
+else
+  if test -n "$ac_ct_CXX"; then
+  ac_cv_prog_ac_ct_CXX="$ac_ct_CXX" # Let the user override the test.
+else
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+  IFS=$as_save_IFS
+  test -z "$as_dir" && as_dir=.
+    for ac_exec_ext in '' $ac_executable_extensions; do
+  if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
+    ac_cv_prog_ac_ct_CXX="$ac_prog"
+    $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
+    break 2
+  fi
+done
+  done
+IFS=$as_save_IFS
 
 fi
-{ $as_echo "$as_me:$LINENO: result: $lt_cv_dlopen_self_static" >&5
-$as_echo "$lt_cv_dlopen_self_static" >&6; }
-    fi
+fi
+ac_ct_CXX=$ac_cv_prog_ac_ct_CXX
+if test -n "$ac_ct_CXX"; then
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_ct_CXX" >&5
+$as_echo "$ac_ct_CXX" >&6; }
+else
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
+$as_echo "no" >&6; }
+fi
 
-    CPPFLAGS="$save_CPPFLAGS"
-    LDFLAGS="$save_LDFLAGS"
-    LIBS="$save_LIBS"
-    ;;
-  esac
 
-  case $lt_cv_dlopen_self in
-  yes|no) enable_dlopen_self=$lt_cv_dlopen_self ;;
-  *) enable_dlopen_self=unknown ;;
-  esac
+  test -n "$ac_ct_CXX" && break
+done
 
-  case $lt_cv_dlopen_self_static in
-  yes|no) enable_dlopen_self_static=$lt_cv_dlopen_self_static ;;
-  *) enable_dlopen_self_static=unknown ;;
-  esac
+  if test "x$ac_ct_CXX" = x; then
+    CXX="g++"
+  else
+    case $cross_compiling:$ac_tool_warned in
+yes:)
+{ $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: using cross tools not prefixed with host triplet" >&5
+$as_echo "$as_me: WARNING: using cross tools not prefixed with host triplet" >&2;}
+ac_tool_warned=yes ;;
+esac
+    CXX=$ac_ct_CXX
+  fi
 fi
 
+  fi
+fi
+# Provide some information about the compiler.
+$as_echo "$as_me:${as_lineno-$LINENO}: checking for C++ compiler version" >&5
+set X $ac_compile
+ac_compiler=$2
+for ac_option in --version -v -V -qversion; do
+  { { ac_try="$ac_compiler $ac_option >&5"
+case "(($ac_try" in
+  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
+  *) ac_try_echo=$ac_try;;
+esac
+eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
+$as_echo "$ac_try_echo"; } >&5
+  (eval "$ac_compiler $ac_option >&5") 2>conftest.err
+  ac_status=$?
+  if test -s conftest.err; then
+    sed '10a\
+... rest of stderr output deleted ...
+         10q' conftest.err >conftest.er1
+    cat conftest.er1 >&5
+  fi
+  rm -f conftest.er1 conftest.err
+  $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+  test $ac_status = 0; }
+done
 
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking whether we are using the GNU C++ compiler" >&5
+$as_echo_n "checking whether we are using the GNU C++ compiler... " >&6; }
+if ${ac_cv_cxx_compiler_gnu+:} false; then :
+  $as_echo_n "(cached) " >&6
+else
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
 
+int
+main ()
+{
+#ifndef __GNUC__
+       choke me
+#endif
 
+  ;
+  return 0;
+}
+_ACEOF
+if ac_fn_cxx_try_compile "$LINENO"; then :
+  ac_compiler_gnu=yes
+else
+  ac_compiler_gnu=no
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
+ac_cv_cxx_compiler_gnu=$ac_compiler_gnu
 
+fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_cxx_compiler_gnu" >&5
+$as_echo "$ac_cv_cxx_compiler_gnu" >&6; }
+if test $ac_compiler_gnu = yes; then
+  GXX=yes
+else
+  GXX=
+fi
+ac_test_CXXFLAGS=${CXXFLAGS+set}
+ac_save_CXXFLAGS=$CXXFLAGS
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking whether $CXX accepts -g" >&5
+$as_echo_n "checking whether $CXX accepts -g... " >&6; }
+if ${ac_cv_prog_cxx_g+:} false; then :
+  $as_echo_n "(cached) " >&6
+else
+  ac_save_cxx_werror_flag=$ac_cxx_werror_flag
+   ac_cxx_werror_flag=yes
+   ac_cv_prog_cxx_g=no
+   CXXFLAGS="-g"
+   cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
 
+int
+main ()
+{
 
+  ;
+  return 0;
+}
+_ACEOF
+if ac_fn_cxx_try_compile "$LINENO"; then :
+  ac_cv_prog_cxx_g=yes
+else
+  CXXFLAGS=""
+      cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
 
+int
+main ()
+{
 
+  ;
+  return 0;
+}
+_ACEOF
+if ac_fn_cxx_try_compile "$LINENO"; then :
 
+else
+  ac_cxx_werror_flag=$ac_save_cxx_werror_flag
+	 CXXFLAGS="-g"
+	 cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
 
+int
+main ()
+{
 
+  ;
+  return 0;
+}
+_ACEOF
+if ac_fn_cxx_try_compile "$LINENO"; then :
+  ac_cv_prog_cxx_g=yes
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
+   ac_cxx_werror_flag=$ac_save_cxx_werror_flag
+fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_prog_cxx_g" >&5
+$as_echo "$ac_cv_prog_cxx_g" >&6; }
+if test "$ac_test_CXXFLAGS" = set; then
+  CXXFLAGS=$ac_save_CXXFLAGS
+elif test $ac_cv_prog_cxx_g = yes; then
+  if test "$GXX" = yes; then
+    CXXFLAGS="-g -O2"
+  else
+    CXXFLAGS="-g"
+  fi
+else
+  if test "$GXX" = yes; then
+    CXXFLAGS="-O2"
+  else
+    CXXFLAGS=
+  fi
+fi
+ac_ext=cpp
+ac_cpp='$CXXCPP $CPPFLAGS'
+ac_compile='$CXX -c $CXXFLAGS $CPPFLAGS conftest.$ac_ext >&5'
+ac_link='$CXX -o conftest$ac_exeext $CXXFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
+ac_compiler_gnu=$ac_cv_cxx_compiler_gnu
 
+depcc="$CXX"  am_compiler_list=
 
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking dependency style of $depcc" >&5
+$as_echo_n "checking dependency style of $depcc... " >&6; }
+if ${am_cv_CXX_dependencies_compiler_type+:} false; then :
+  $as_echo_n "(cached) " >&6
+else
+  if test -z "$AMDEP_TRUE" && test -f "$am_depcomp"; then
+  # We make a subdir and do the tests there.  Otherwise we can end up
+  # making bogus files that we don't know about and never remove.  For
+  # instance it was reported that on HP-UX the gcc test will end up
+  # making a dummy file named `D' -- because `-MD' means `put the output
+  # in D'.
+  rm -rf conftest.dir
+  mkdir conftest.dir
+  # Copy depcomp to subdir because otherwise we won't find it if we're
+  # using a relative directory.
+  cp "$am_depcomp" conftest.dir
+  cd conftest.dir
+  # We will build objects and dependencies in a subdirectory because
+  # it helps to detect inapplicable dependency modes.  For instance
+  # both Tru64's cc and ICC support -MD to output dependencies as a
+  # side effect of compilation, but ICC will put the dependencies in
+  # the current directory while Tru64 will put them in the object
+  # directory.
+  mkdir sub
 
+  am_cv_CXX_dependencies_compiler_type=none
+  if test "$am_compiler_list" = ""; then
+     am_compiler_list=`sed -n 's/^#*\([a-zA-Z0-9]*\))$/\1/p' < ./depcomp`
+  fi
+  am__universal=false
+  case " $depcc " in #(
+     *\ -arch\ *\ -arch\ *) am__universal=true ;;
+     esac
 
+  for depmode in $am_compiler_list; do
+    # Setup a source with many dependencies, because some compilers
+    # like to wrap large dependency lists on column 80 (with \), and
+    # we should not choose a depcomp mode which is confused by this.
+    #
+    # We need to recreate these files for each test, as the compiler may
+    # overwrite some of them when testing with obscure command lines.
+    # This happens at least with the AIX C compiler.
+    : > sub/conftest.c
+    for i in 1 2 3 4 5 6; do
+      echo '#include "conftst'$i'.h"' >> sub/conftest.c
+      # Using `: > sub/conftst$i.h' creates only sub/conftst1.h with
+      # Solaris 8's {/usr,}/bin/sh.
+      touch sub/conftst$i.h
+    done
+    echo "${am__include} ${am__quote}sub/conftest.Po${am__quote}" > confmf
 
-striplib=
-old_striplib=
-{ $as_echo "$as_me:$LINENO: checking whether stripping libraries is possible" >&5
-$as_echo_n "checking whether stripping libraries is possible... " >&6; }
-if test -n "$STRIP" && $STRIP -V 2>&1 | $GREP "GNU strip" >/dev/null; then
-  test -z "$old_striplib" && old_striplib="$STRIP --strip-debug"
-  test -z "$striplib" && striplib="$STRIP --strip-unneeded"
-  { $as_echo "$as_me:$LINENO: result: yes" >&5
-$as_echo "yes" >&6; }
-else
-# FIXME - insert some real tests, host_os isn't really good enough
-  case $host_os in
-  darwin*)
-    if test -n "$STRIP" ; then
-      striplib="$STRIP -x"
-      old_striplib="$STRIP -S"
-      { $as_echo "$as_me:$LINENO: result: yes" >&5
-$as_echo "yes" >&6; }
-    else
-      { $as_echo "$as_me:$LINENO: result: no" >&5
-$as_echo "no" >&6; }
+    # We check with `-c' and `-o' for the sake of the "dashmstdout"
+    # mode.  It turns out that the SunPro C++ compiler does not properly
+    # handle `-M -o', and we need to detect this.  Also, some Intel
+    # versions had trouble with output in subdirs
+    am__obj=sub/conftest.${OBJEXT-o}
+    am__minus_obj="-o $am__obj"
+    case $depmode in
+    gcc)
+      # This depmode causes a compiler race in universal mode.
+      test "$am__universal" = false || continue
+      ;;
+    nosideeffect)
+      # after this tag, mechanisms are not by side-effect, so they'll
+      # only be used when explicitly requested
+      if test "x$enable_dependency_tracking" = xyes; then
+	continue
+      else
+	break
+      fi
+      ;;
+    msvc7 | msvc7msys | msvisualcpp | msvcmsys)
+      # This compiler won't grok `-c -o', but also, the minuso test has
+      # not run yet.  These depmodes are late enough in the game, and
+      # so weak that their functioning should not be impacted.
+      am__obj=conftest.${OBJEXT-o}
+      am__minus_obj=
+      ;;
+    none) break ;;
+    esac
+    if depmode=$depmode \
+       source=sub/conftest.c object=$am__obj \
+       depfile=sub/conftest.Po tmpdepfile=sub/conftest.TPo \
+       $SHELL ./depcomp $depcc -c $am__minus_obj sub/conftest.c \
+         >/dev/null 2>conftest.err &&
+       grep sub/conftst1.h sub/conftest.Po > /dev/null 2>&1 &&
+       grep sub/conftst6.h sub/conftest.Po > /dev/null 2>&1 &&
+       grep $am__obj sub/conftest.Po > /dev/null 2>&1 &&
+       ${MAKE-make} -s -f confmf > /dev/null 2>&1; then
+      # icc doesn't choke on unknown options, it will just issue warnings
+      # or remarks (even with -Werror).  So we grep stderr for any message
+      # that says an option was ignored or not supported.
+      # When given -MP, icc 7.0 and 7.1 complain thusly:
+      #   icc: Command line warning: ignoring option '-M'; no argument required
+      # The diagnosis changed in icc 8.0:
+      #   icc: Command line remark: option '-MP' not supported
+      if (grep 'ignoring option' conftest.err ||
+          grep 'not supported' conftest.err) >/dev/null 2>&1; then :; else
+        am_cv_CXX_dependencies_compiler_type=$depmode
+        break
+      fi
     fi
-    ;;
-  *)
-    { $as_echo "$as_me:$LINENO: result: no" >&5
-$as_echo "no" >&6; }
-    ;;
-  esac
-fi
-
-
-
+  done
 
+  cd ..
+  rm -rf conftest.dir
+else
+  am_cv_CXX_dependencies_compiler_type=none
+fi
 
+fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $am_cv_CXX_dependencies_compiler_type" >&5
+$as_echo "$am_cv_CXX_dependencies_compiler_type" >&6; }
+CXXDEPMODE=depmode=$am_cv_CXX_dependencies_compiler_type
 
+ if
+  test "x$enable_dependency_tracking" != xno \
+  && test "$am_cv_CXX_dependencies_compiler_type" = gcc3; then
+  am__fastdepCXX_TRUE=
+  am__fastdepCXX_FALSE='#'
+else
+  am__fastdepCXX_TRUE='#'
+  am__fastdepCXX_FALSE=
+fi
 
 
 
 
+func_stripname_cnf ()
+{
+  case ${2} in
+  .*) func_stripname_result=`$ECHO "${3}" | $SED "s%^${1}%%; s%\\\\${2}\$%%"`;;
+  *)  func_stripname_result=`$ECHO "${3}" | $SED "s%^${1}%%; s%${2}\$%%"`;;
+  esac
+} # func_stripname_cnf
 
+      if test -n "$CXX" && ( test "X$CXX" != "Xno" &&
+    ( (test "X$CXX" = "Xg++" && `g++ -v >/dev/null 2>&1` ) ||
+    (test "X$CXX" != "Xg++"))) ; then
+  ac_ext=cpp
+ac_cpp='$CXXCPP $CPPFLAGS'
+ac_compile='$CXX -c $CXXFLAGS $CPPFLAGS conftest.$ac_ext >&5'
+ac_link='$CXX -o conftest$ac_exeext $CXXFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
+ac_compiler_gnu=$ac_cv_cxx_compiler_gnu
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking how to run the C++ preprocessor" >&5
+$as_echo_n "checking how to run the C++ preprocessor... " >&6; }
+if test -z "$CXXCPP"; then
+  if ${ac_cv_prog_CXXCPP+:} false; then :
+  $as_echo_n "(cached) " >&6
+else
+      # Double quotes because CXXCPP needs to be expanded
+    for CXXCPP in "$CXX -E" "/lib/cpp"
+    do
+      ac_preproc_ok=false
+for ac_cxx_preproc_warn_flag in '' yes
+do
+  # Use a header file that comes with gcc, so configuring glibc
+  # with a fresh cross-compiler works.
+  # Prefer <limits.h> to <assert.h> if __STDC__ is defined, since
+  # <limits.h> exists even on freestanding compilers.
+  # On the NeXT, cc -E runs the code through the compiler's parser,
+  # not just through cpp. "Syntax error" is here to catch this case.
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+#ifdef __STDC__
+# include <limits.h>
+#else
+# include <assert.h>
+#endif
+		     Syntax error
+_ACEOF
+if ac_fn_cxx_try_cpp "$LINENO"; then :
 
-  # Report which library types will actually be built
-  { $as_echo "$as_me:$LINENO: checking if libtool supports shared libraries" >&5
-$as_echo_n "checking if libtool supports shared libraries... " >&6; }
-  { $as_echo "$as_me:$LINENO: result: $can_build_shared" >&5
-$as_echo "$can_build_shared" >&6; }
+else
+  # Broken: fails on valid input.
+continue
+fi
+rm -f conftest.err conftest.i conftest.$ac_ext
 
-  { $as_echo "$as_me:$LINENO: checking whether to build shared libraries" >&5
-$as_echo_n "checking whether to build shared libraries... " >&6; }
-  test "$can_build_shared" = "no" && enable_shared=no
+  # OK, works on sane cases.  Now check whether nonexistent headers
+  # can be detected and how.
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+#include <ac_nonexistent.h>
+_ACEOF
+if ac_fn_cxx_try_cpp "$LINENO"; then :
+  # Broken: success on invalid input.
+continue
+else
+  # Passes both tests.
+ac_preproc_ok=:
+break
+fi
+rm -f conftest.err conftest.i conftest.$ac_ext
 
-  # On AIX, shared libraries and static libraries use the same namespace, and
-  # are all built from PIC.
-  case $host_os in
-  aix3*)
-    test "$enable_shared" = yes && enable_static=no
-    if test -n "$RANLIB"; then
-      archive_cmds="$archive_cmds~\$RANLIB \$lib"
-      postinstall_cmds='$RANLIB $lib'
-    fi
-    ;;
+done
+# Because of `break', _AC_PREPROC_IFELSE's cleaning code was skipped.
+rm -f conftest.i conftest.err conftest.$ac_ext
+if $ac_preproc_ok; then :
+  break
+fi
 
-  aix[4-9]*)
-    if test "$host_cpu" != ia64 && test "$aix_use_runtimelinking" = no ; then
-      test "$enable_shared" = yes && enable_static=no
-    fi
-    ;;
-  esac
-  { $as_echo "$as_me:$LINENO: result: $enable_shared" >&5
-$as_echo "$enable_shared" >&6; }
+    done
+    ac_cv_prog_CXXCPP=$CXXCPP
 
-  { $as_echo "$as_me:$LINENO: checking whether to build static libraries" >&5
-$as_echo_n "checking whether to build static libraries... " >&6; }
-  # Make sure either enable_shared or enable_static is yes.
-  test "$enable_shared" = yes || enable_static=yes
-  { $as_echo "$as_me:$LINENO: result: $enable_static" >&5
-$as_echo "$enable_static" >&6; }
+fi
+  CXXCPP=$ac_cv_prog_CXXCPP
+else
+  ac_cv_prog_CXXCPP=$CXXCPP
+fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $CXXCPP" >&5
+$as_echo "$CXXCPP" >&6; }
+ac_preproc_ok=false
+for ac_cxx_preproc_warn_flag in '' yes
+do
+  # Use a header file that comes with gcc, so configuring glibc
+  # with a fresh cross-compiler works.
+  # Prefer <limits.h> to <assert.h> if __STDC__ is defined, since
+  # <limits.h> exists even on freestanding compilers.
+  # On the NeXT, cc -E runs the code through the compiler's parser,
+  # not just through cpp. "Syntax error" is here to catch this case.
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+#ifdef __STDC__
+# include <limits.h>
+#else
+# include <assert.h>
+#endif
+		     Syntax error
+_ACEOF
+if ac_fn_cxx_try_cpp "$LINENO"; then :
 
+else
+  # Broken: fails on valid input.
+continue
+fi
+rm -f conftest.err conftest.i conftest.$ac_ext
 
+  # OK, works on sane cases.  Now check whether nonexistent headers
+  # can be detected and how.
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+#include <ac_nonexistent.h>
+_ACEOF
+if ac_fn_cxx_try_cpp "$LINENO"; then :
+  # Broken: success on invalid input.
+continue
+else
+  # Passes both tests.
+ac_preproc_ok=:
+break
+fi
+rm -f conftest.err conftest.i conftest.$ac_ext
 
+done
+# Because of `break', _AC_PREPROC_IFELSE's cleaning code was skipped.
+rm -f conftest.i conftest.err conftest.$ac_ext
+if $ac_preproc_ok; then :
 
+else
+  { { $as_echo "$as_me:${as_lineno-$LINENO}: error: in \`$ac_pwd':" >&5
+$as_echo "$as_me: error: in \`$ac_pwd':" >&2;}
+as_fn_error $? "C++ preprocessor \"$CXXCPP\" fails sanity check
+See \`config.log' for more details" "$LINENO" 5; }
 fi
-ac_ext=c
-ac_cpp='$CPP $CPPFLAGS'
-ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
-ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
-ac_compiler_gnu=$ac_cv_c_compiler_gnu
 
-CC="$lt_save_CC"
+ac_ext=cpp
+ac_cpp='$CXXCPP $CPPFLAGS'
+ac_compile='$CXX -c $CXXFLAGS $CPPFLAGS conftest.$ac_ext >&5'
+ac_link='$CXX -o conftest$ac_exeext $CXXFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
+ac_compiler_gnu=$ac_cv_cxx_compiler_gnu
 
+else
+  _lt_caught_CXX_error=yes
+fi
 
 ac_ext=cpp
 ac_cpp='$CXXCPP $CPPFLAGS'
@@ -13020,7 +12271,6 @@ export_dynamic_flag_spec_CXX=
 hardcode_direct_CXX=no
 hardcode_direct_absolute_CXX=no
 hardcode_libdir_flag_spec_CXX=
-hardcode_libdir_flag_spec_ld_CXX=
 hardcode_libdir_separator_CXX=
 hardcode_minus_L_CXX=no
 hardcode_shlibpath_var_CXX=unsupported
@@ -13030,6 +12280,8 @@ module_cmds_CXX=
 module_expsym_cmds_CXX=
 link_all_deplibs_CXX=unknown
 old_archive_cmds_CXX=$old_archive_cmds
+reload_flag_CXX=$reload_flag
+reload_cmds_CXX=$reload_cmds
 no_undefined_flag_CXX=
 whole_archive_flag_spec_CXX=
 enable_shared_with_static_runtimes_CXX=no
@@ -13085,6 +12337,7 @@ $RM -r conftest*
 
   # Allow CC to be a program name with arguments.
   lt_save_CC=$CC
+  lt_save_CFLAGS=$CFLAGS
   lt_save_LD=$LD
   lt_save_GCC=$GCC
   GCC=$GXX
@@ -13102,6 +12355,7 @@ $RM -r conftest*
   fi
   test -z "${LDCXX+set}" || LD=$LDCXX
   CC=${CXX-"c++"}
+  CFLAGS=$CXXFLAGS
   compiler=$CC
   compiler_CXX=$CC
   for cc_temp in $compiler""; do
@@ -13112,7 +12366,7 @@ $RM -r conftest*
     *) break;;
   esac
 done
-cc_basename=`$ECHO "X$cc_temp" | $Xsed -e 's%.*/%%' -e "s%^$host_alias-%%"`
+cc_basename=`$ECHO "$cc_temp" | $SED "s%.*/%%; s%^$host_alias-%%"`
 
 
   if test -n "$compiler"; then
@@ -13130,7 +12384,7 @@ cc_basename=`$ECHO "X$cc_temp" | $Xsed -e 's%.*/%%' -e "s%^$host_alias-%%"`
 
 
 # Check whether --with-gnu-ld was given.
-if test "${with_gnu_ld+set}" = set; then
+if test "${with_gnu_ld+set}" = set; then :
   withval=$with_gnu_ld; test "$withval" = no || with_gnu_ld=yes
 else
   with_gnu_ld=no
@@ -13139,7 +12393,7 @@ fi
 ac_prog=ld
 if test "$GCC" = yes; then
   # Check if gcc -print-prog-name=ld gives a path.
-  { $as_echo "$as_me:$LINENO: checking for ld used by $CC" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: checking for ld used by $CC" >&5
 $as_echo_n "checking for ld used by $CC... " >&6; }
   case $host in
   *-*-mingw*)
@@ -13169,13 +12423,13 @@ $as_echo_n "checking for ld used by $CC... " >&6; }
     ;;
   esac
 elif test "$with_gnu_ld" = yes; then
-  { $as_echo "$as_me:$LINENO: checking for GNU ld" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: checking for GNU ld" >&5
 $as_echo_n "checking for GNU ld... " >&6; }
 else
-  { $as_echo "$as_me:$LINENO: checking for non-GNU ld" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: checking for non-GNU ld" >&5
 $as_echo_n "checking for non-GNU ld... " >&6; }
 fi
-if test "${lt_cv_path_LD+set}" = set; then
+if ${lt_cv_path_LD+:} false; then :
   $as_echo_n "(cached) " >&6
 else
   if test -z "$LD"; then
@@ -13206,18 +12460,16 @@ fi
 
 LD="$lt_cv_path_LD"
 if test -n "$LD"; then
-  { $as_echo "$as_me:$LINENO: result: $LD" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $LD" >&5
 $as_echo "$LD" >&6; }
 else
-  { $as_echo "$as_me:$LINENO: result: no" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
 $as_echo "no" >&6; }
 fi
-test -z "$LD" && { { $as_echo "$as_me:$LINENO: error: no acceptable ld found in \$PATH" >&5
-$as_echo "$as_me: error: no acceptable ld found in \$PATH" >&2;}
-   { (exit 1); exit 1; }; }
-{ $as_echo "$as_me:$LINENO: checking if the linker ($LD) is GNU ld" >&5
+test -z "$LD" && as_fn_error $? "no acceptable ld found in \$PATH" "$LINENO" 5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking if the linker ($LD) is GNU ld" >&5
 $as_echo_n "checking if the linker ($LD) is GNU ld... " >&6; }
-if test "${lt_cv_prog_gnu_ld+set}" = set; then
+if ${lt_cv_prog_gnu_ld+:} false; then :
   $as_echo_n "(cached) " >&6
 else
   # I'd rather use --version here, but apparently some GNU lds only accept -v.
@@ -13230,7 +12482,7 @@ case `$LD -v 2>&1 </dev/null` in
   ;;
 esac
 fi
-{ $as_echo "$as_me:$LINENO: result: $lt_cv_prog_gnu_ld" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $lt_cv_prog_gnu_ld" >&5
 $as_echo "$lt_cv_prog_gnu_ld" >&6; }
 with_gnu_ld=$lt_cv_prog_gnu_ld
 
@@ -13243,8 +12495,8 @@ with_gnu_ld=$lt_cv_prog_gnu_ld
       # Check if GNU C++ uses GNU ld as the underlying linker, since the
       # archiving commands below assume that GNU ld is being used.
       if test "$with_gnu_ld" = yes; then
-        archive_cmds_CXX='$CC -shared -nostdlib $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags ${wl}-soname $wl$soname -o $lib'
-        archive_expsym_cmds_CXX='$CC -shared -nostdlib $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags ${wl}-soname $wl$soname ${wl}-retain-symbols-file $wl$export_symbols -o $lib'
+        archive_cmds_CXX='$CC $pic_flag -shared -nostdlib $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags ${wl}-soname $wl$soname -o $lib'
+        archive_expsym_cmds_CXX='$CC $pic_flag -shared -nostdlib $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags ${wl}-soname $wl$soname ${wl}-retain-symbols-file $wl$export_symbols -o $lib'
 
         hardcode_libdir_flag_spec_CXX='${wl}-rpath ${wl}$libdir'
         export_dynamic_flag_spec_CXX='${wl}--export-dynamic'
@@ -13276,7 +12528,7 @@ with_gnu_ld=$lt_cv_prog_gnu_ld
       # Commands to make compiler produce verbose output that lists
       # what "hidden" libraries, object files and flags are used when
       # linking a shared library.
-      output_verbose_link_cmd='$CC -shared $CFLAGS -v conftest.$objext 2>&1 | $GREP "\-L"'
+      output_verbose_link_cmd='$CC -shared $CFLAGS -v conftest.$objext 2>&1 | $GREP -v "^Configured with:" | $GREP "\-L"'
 
     else
       GXX=no
@@ -13285,7 +12537,7 @@ with_gnu_ld=$lt_cv_prog_gnu_ld
     fi
 
     # PORTME: fill in a description of your system's C++ link characteristics
-    { $as_echo "$as_me:$LINENO: checking whether the $compiler linker ($LD) supports shared libraries" >&5
+    { $as_echo "$as_me:${as_lineno-$LINENO}: checking whether the $compiler linker ($LD) supports shared libraries" >&5
 $as_echo_n "checking whether the $compiler linker ($LD) supports shared libraries... " >&6; }
     ld_shlibs_CXX=yes
     case $host_os in
@@ -13386,11 +12638,13 @@ $as_echo_n "checking whether the $compiler linker ($LD) supports shared librarie
           allow_undefined_flag_CXX='-berok'
           # Determine the default libpath from the value encoded in an empty
           # executable.
-          cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
+          if test "${lt_cv_aix_libpath+set}" = set; then
+  aix_libpath=$lt_cv_aix_libpath
+else
+  if ${lt_cv_aix_libpath__CXX+:} false; then :
+  $as_echo_n "(cached) " >&6
+else
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
 /* end confdefs.h.  */
 
 int
@@ -13401,55 +12655,35 @@ main ()
   return 0;
 }
 _ACEOF
-rm -f conftest.$ac_objext conftest$ac_exeext
-if { (ac_try="$ac_link"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_link") 2>conftest.er1
-  ac_status=$?
-  grep -v '^ *+' conftest.er1 >conftest.err
-  rm -f conftest.er1
-  cat conftest.err >&5
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } && {
-	 test -z "$ac_cxx_werror_flag" ||
-	 test ! -s conftest.err
-       } && test -s conftest$ac_exeext && {
-	 test "$cross_compiling" = yes ||
-	 $as_test_x conftest$ac_exeext
-       }; then
+if ac_fn_cxx_try_link "$LINENO"; then :
 
-lt_aix_libpath_sed='
-    /Import File Strings/,/^$/ {
-	/^0/ {
-	    s/^0  *\(.*\)$/\1/
-	    p
-	}
-    }'
-aix_libpath=`dump -H conftest$ac_exeext 2>/dev/null | $SED -n -e "$lt_aix_libpath_sed"`
-# Check for a 64-bit object if we didn't find anything.
-if test -z "$aix_libpath"; then
-  aix_libpath=`dump -HX64 conftest$ac_exeext 2>/dev/null | $SED -n -e "$lt_aix_libpath_sed"`
+  lt_aix_libpath_sed='
+      /Import File Strings/,/^$/ {
+	  /^0/ {
+	      s/^0  *\([^ ]*\) *$/\1/
+	      p
+	  }
+      }'
+  lt_cv_aix_libpath__CXX=`dump -H conftest$ac_exeext 2>/dev/null | $SED -n -e "$lt_aix_libpath_sed"`
+  # Check for a 64-bit object if we didn't find anything.
+  if test -z "$lt_cv_aix_libpath__CXX"; then
+    lt_cv_aix_libpath__CXX=`dump -HX64 conftest$ac_exeext 2>/dev/null | $SED -n -e "$lt_aix_libpath_sed"`
+  fi
 fi
-else
-  $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
-
+rm -f core conftest.err conftest.$ac_objext \
+    conftest$ac_exeext conftest.$ac_ext
+  if test -z "$lt_cv_aix_libpath__CXX"; then
+    lt_cv_aix_libpath__CXX="/usr/lib:/lib"
+  fi
 
 fi
 
-rm -rf conftest.dSYM
-rm -f core conftest.err conftest.$ac_objext conftest_ipa8_conftest.oo \
-      conftest$ac_exeext conftest.$ac_ext
-if test -z "$aix_libpath"; then aix_libpath="/usr/lib:/lib"; fi
+  aix_libpath=$lt_cv_aix_libpath__CXX
+fi
 
           hardcode_libdir_flag_spec_CXX='${wl}-blibpath:$libdir:'"$aix_libpath"
 
-          archive_expsym_cmds_CXX='$CC -o $output_objdir/$soname $libobjs $deplibs '"\${wl}$no_entry_flag"' $compiler_flags `if test "x${allow_undefined_flag}" != "x"; then $ECHO "X${wl}${allow_undefined_flag}" | $Xsed; else :; fi` '"\${wl}$exp_sym_flag:\$export_symbols $shared_flag"
+          archive_expsym_cmds_CXX='$CC -o $output_objdir/$soname $libobjs $deplibs '"\${wl}$no_entry_flag"' $compiler_flags `if test "x${allow_undefined_flag}" != "x"; then func_echo_all "${wl}${allow_undefined_flag}"; else :; fi` '"\${wl}$exp_sym_flag:\$export_symbols $shared_flag"
         else
           if test "$host_cpu" = ia64; then
 	    hardcode_libdir_flag_spec_CXX='${wl}-R $libdir:/usr/lib:/lib'
@@ -13458,11 +12692,13 @@ if test -z "$aix_libpath"; then aix_libpath="/usr/lib:/lib"; fi
           else
 	    # Determine the default libpath from the value encoded in an
 	    # empty executable.
-	    cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
+	    if test "${lt_cv_aix_libpath+set}" = set; then
+  aix_libpath=$lt_cv_aix_libpath
+else
+  if ${lt_cv_aix_libpath__CXX+:} false; then :
+  $as_echo_n "(cached) " >&6
+else
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
 /* end confdefs.h.  */
 
 int
@@ -13473,59 +12709,44 @@ main ()
   return 0;
 }
 _ACEOF
-rm -f conftest.$ac_objext conftest$ac_exeext
-if { (ac_try="$ac_link"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_link") 2>conftest.er1
-  ac_status=$?
-  grep -v '^ *+' conftest.er1 >conftest.err
-  rm -f conftest.er1
-  cat conftest.err >&5
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } && {
-	 test -z "$ac_cxx_werror_flag" ||
-	 test ! -s conftest.err
-       } && test -s conftest$ac_exeext && {
-	 test "$cross_compiling" = yes ||
-	 $as_test_x conftest$ac_exeext
-       }; then
+if ac_fn_cxx_try_link "$LINENO"; then :
 
-lt_aix_libpath_sed='
-    /Import File Strings/,/^$/ {
-	/^0/ {
-	    s/^0  *\(.*\)$/\1/
-	    p
-	}
-    }'
-aix_libpath=`dump -H conftest$ac_exeext 2>/dev/null | $SED -n -e "$lt_aix_libpath_sed"`
-# Check for a 64-bit object if we didn't find anything.
-if test -z "$aix_libpath"; then
-  aix_libpath=`dump -HX64 conftest$ac_exeext 2>/dev/null | $SED -n -e "$lt_aix_libpath_sed"`
+  lt_aix_libpath_sed='
+      /Import File Strings/,/^$/ {
+	  /^0/ {
+	      s/^0  *\([^ ]*\) *$/\1/
+	      p
+	  }
+      }'
+  lt_cv_aix_libpath__CXX=`dump -H conftest$ac_exeext 2>/dev/null | $SED -n -e "$lt_aix_libpath_sed"`
+  # Check for a 64-bit object if we didn't find anything.
+  if test -z "$lt_cv_aix_libpath__CXX"; then
+    lt_cv_aix_libpath__CXX=`dump -HX64 conftest$ac_exeext 2>/dev/null | $SED -n -e "$lt_aix_libpath_sed"`
+  fi
 fi
-else
-  $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
-
+rm -f core conftest.err conftest.$ac_objext \
+    conftest$ac_exeext conftest.$ac_ext
+  if test -z "$lt_cv_aix_libpath__CXX"; then
+    lt_cv_aix_libpath__CXX="/usr/lib:/lib"
+  fi
 
 fi
 
-rm -rf conftest.dSYM
-rm -f core conftest.err conftest.$ac_objext conftest_ipa8_conftest.oo \
-      conftest$ac_exeext conftest.$ac_ext
-if test -z "$aix_libpath"; then aix_libpath="/usr/lib:/lib"; fi
+  aix_libpath=$lt_cv_aix_libpath__CXX
+fi
 
 	    hardcode_libdir_flag_spec_CXX='${wl}-blibpath:$libdir:'"$aix_libpath"
 	    # Warning - without using the other run time loading flags,
 	    # -berok will link without error, but may produce a broken library.
 	    no_undefined_flag_CXX=' ${wl}-bernotok'
 	    allow_undefined_flag_CXX=' ${wl}-berok'
-	    # Exported symbols can be pulled into shared objects from archives
-	    whole_archive_flag_spec_CXX='$convenience'
+	    if test "$with_gnu_ld" = yes; then
+	      # We only use this code for GNU lds that support --whole-archive.
+	      whole_archive_flag_spec_CXX='${wl}--whole-archive$convenience ${wl}--no-whole-archive'
+	    else
+	      # Exported symbols can be pulled into shared objects from archives
+	      whole_archive_flag_spec_CXX='$convenience'
+	    fi
 	    archive_cmds_need_lc_CXX=yes
 	    # This is similar to how AIX traditionally builds its shared
 	    # libraries.
@@ -13555,28 +12776,75 @@ if test -z "$aix_libpath"; then aix_libpath="/usr/lib:/lib"; fi
         ;;
 
       cygwin* | mingw* | pw32* | cegcc*)
-        # _LT_TAGVAR(hardcode_libdir_flag_spec, CXX) is actually meaningless,
-        # as there is no search path for DLLs.
-        hardcode_libdir_flag_spec_CXX='-L$libdir'
-        allow_undefined_flag_CXX=unsupported
-        always_export_symbols_CXX=no
-        enable_shared_with_static_runtimes_CXX=yes
-
-        if $LD --help 2>&1 | $GREP 'auto-import' > /dev/null; then
-          archive_cmds_CXX='$CC -shared -nostdlib $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags -o $output_objdir/$soname ${wl}--enable-auto-image-base -Xlinker --out-implib -Xlinker $lib'
-          # If the export-symbols file already is a .def file (1st line
-          # is EXPORTS), use it as is; otherwise, prepend...
-          archive_expsym_cmds_CXX='if test "x`$SED 1q $export_symbols`" = xEXPORTS; then
-	    cp $export_symbols $output_objdir/$soname.def;
-          else
-	    echo EXPORTS > $output_objdir/$soname.def;
-	    cat $export_symbols >> $output_objdir/$soname.def;
-          fi~
-          $CC -shared -nostdlib $output_objdir/$soname.def $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags -o $output_objdir/$soname ${wl}--enable-auto-image-base -Xlinker --out-implib -Xlinker $lib'
-        else
-          ld_shlibs_CXX=no
-        fi
-        ;;
+	case $GXX,$cc_basename in
+	,cl* | no,cl*)
+	  # Native MSVC
+	  # hardcode_libdir_flag_spec is actually meaningless, as there is
+	  # no search path for DLLs.
+	  hardcode_libdir_flag_spec_CXX=' '
+	  allow_undefined_flag_CXX=unsupported
+	  always_export_symbols_CXX=yes
+	  file_list_spec_CXX='@'
+	  # Tell ltmain to make .lib files, not .a files.
+	  libext=lib
+	  # Tell ltmain to make .dll files, not .so files.
+	  shrext_cmds=".dll"
+	  # FIXME: Setting linknames here is a bad hack.
+	  archive_cmds_CXX='$CC -o $output_objdir/$soname $libobjs $compiler_flags $deplibs -Wl,-dll~linknames='
+	  archive_expsym_cmds_CXX='if test "x`$SED 1q $export_symbols`" = xEXPORTS; then
+	      $SED -n -e 's/\\\\\\\(.*\\\\\\\)/-link\\\ -EXPORT:\\\\\\\1/' -e '1\\\!p' < $export_symbols > $output_objdir/$soname.exp;
+	    else
+	      $SED -e 's/\\\\\\\(.*\\\\\\\)/-link\\\ -EXPORT:\\\\\\\1/' < $export_symbols > $output_objdir/$soname.exp;
+	    fi~
+	    $CC -o $tool_output_objdir$soname $libobjs $compiler_flags $deplibs "@$tool_output_objdir$soname.exp" -Wl,-DLL,-IMPLIB:"$tool_output_objdir$libname.dll.lib"~
+	    linknames='
+	  # The linker will not automatically build a static lib if we build a DLL.
+	  # _LT_TAGVAR(old_archive_from_new_cmds, CXX)='true'
+	  enable_shared_with_static_runtimes_CXX=yes
+	  # Don't use ranlib
+	  old_postinstall_cmds_CXX='chmod 644 $oldlib'
+	  postlink_cmds_CXX='lt_outputfile="@OUTPUT@"~
+	    lt_tool_outputfile="@TOOL_OUTPUT@"~
+	    case $lt_outputfile in
+	      *.exe|*.EXE) ;;
+	      *)
+		lt_outputfile="$lt_outputfile.exe"
+		lt_tool_outputfile="$lt_tool_outputfile.exe"
+		;;
+	    esac~
+	    func_to_tool_file "$lt_outputfile"~
+	    if test "$MANIFEST_TOOL" != ":" && test -f "$lt_outputfile.manifest"; then
+	      $MANIFEST_TOOL -manifest "$lt_tool_outputfile.manifest" -outputresource:"$lt_tool_outputfile" || exit 1;
+	      $RM "$lt_outputfile.manifest";
+	    fi'
+	  ;;
+	*)
+	  # g++
+	  # _LT_TAGVAR(hardcode_libdir_flag_spec, CXX) is actually meaningless,
+	  # as there is no search path for DLLs.
+	  hardcode_libdir_flag_spec_CXX='-L$libdir'
+	  export_dynamic_flag_spec_CXX='${wl}--export-all-symbols'
+	  allow_undefined_flag_CXX=unsupported
+	  always_export_symbols_CXX=no
+	  enable_shared_with_static_runtimes_CXX=yes
+
+	  if $LD --help 2>&1 | $GREP 'auto-import' > /dev/null; then
+	    archive_cmds_CXX='$CC -shared -nostdlib $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags -o $output_objdir/$soname ${wl}--enable-auto-image-base -Xlinker --out-implib -Xlinker $lib'
+	    # If the export-symbols file already is a .def file (1st line
+	    # is EXPORTS), use it as is; otherwise, prepend...
+	    archive_expsym_cmds_CXX='if test "x`$SED 1q $export_symbols`" = xEXPORTS; then
+	      cp $export_symbols $output_objdir/$soname.def;
+	    else
+	      echo EXPORTS > $output_objdir/$soname.def;
+	      cat $export_symbols >> $output_objdir/$soname.def;
+	    fi~
+	    $CC -shared -nostdlib $output_objdir/$soname.def $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags -o $output_objdir/$soname ${wl}--enable-auto-image-base -Xlinker --out-implib -Xlinker $lib'
+	  else
+	    ld_shlibs_CXX=no
+	  fi
+	  ;;
+	esac
+	;;
       darwin* | rhapsody*)
 
 
@@ -13584,7 +12852,12 @@ if test -z "$aix_libpath"; then aix_libpath="/usr/lib:/lib"; fi
   hardcode_direct_CXX=no
   hardcode_automatic_CXX=yes
   hardcode_shlibpath_var_CXX=unsupported
-  whole_archive_flag_spec_CXX=''
+  if test "$lt_cv_ld_force_load" = "yes"; then
+    whole_archive_flag_spec_CXX='`for conv in $convenience\"\"; do test  -n \"$conv\" && new_convenience=\"$new_convenience ${wl}-force_load,$conv\"; done; func_echo_all \"$new_convenience\"`'
+
+  else
+    whole_archive_flag_spec_CXX=''
+  fi
   link_all_deplibs_CXX=yes
   allow_undefined_flag_CXX="$_lt_dar_allow_undefined"
   case $cc_basename in
@@ -13592,7 +12865,7 @@ if test -z "$aix_libpath"; then aix_libpath="/usr/lib:/lib"; fi
      *) _lt_dar_can_shared=$GCC ;;
   esac
   if test "$_lt_dar_can_shared" = "yes"; then
-    output_verbose_link_cmd=echo
+    output_verbose_link_cmd=func_echo_all
     archive_cmds_CXX="\$CC -dynamiclib \$allow_undefined_flag -o \$lib \$libobjs \$deplibs \$compiler_flags -install_name \$rpath/\$soname \$verstring $_lt_dar_single_mod${_lt_dsymutil}"
     module_cmds_CXX="\$CC \$allow_undefined_flag -o \$lib -bundle \$libobjs \$deplibs \$compiler_flags${_lt_dsymutil}"
     archive_expsym_cmds_CXX="sed 's,^,_,' < \$export_symbols > \$output_objdir/\${libname}-symbols.expsym~\$CC -dynamiclib \$allow_undefined_flag -o \$lib \$libobjs \$deplibs \$compiler_flags -install_name \$rpath/\$soname \$verstring ${_lt_dar_single_mod}${_lt_dar_export_syms}${_lt_dsymutil}"
@@ -13626,7 +12899,7 @@ if test -z "$aix_libpath"; then aix_libpath="/usr/lib:/lib"; fi
         esac
         ;;
 
-      freebsd[12]*)
+      freebsd2.*)
         # C++ shared libraries reported to be fairly broken before
 	# switch to ELF
         ld_shlibs_CXX=no
@@ -13645,6 +12918,11 @@ if test -z "$aix_libpath"; then aix_libpath="/usr/lib:/lib"; fi
       gnu*)
         ;;
 
+      haiku*)
+        archive_cmds_CXX='$CC -shared $libobjs $deplibs $compiler_flags ${wl}-soname $wl$soname -o $lib'
+        link_all_deplibs_CXX=yes
+        ;;
+
       hpux9*)
         hardcode_libdir_flag_spec_CXX='${wl}+b ${wl}$libdir'
         hardcode_libdir_separator_CXX=:
@@ -13669,11 +12947,11 @@ if test -z "$aix_libpath"; then aix_libpath="/usr/lib:/lib"; fi
             # explicitly linking system object files so we need to strip them
             # from the output so that they don't get included in the library
             # dependencies.
-            output_verbose_link_cmd='templist=`($CC -b $CFLAGS -v conftest.$objext 2>&1) | $EGREP "\-L"`; list=""; for z in $templist; do case $z in conftest.$objext) list="$list $z";; *.$objext);; *) list="$list $z";;esac; done; $ECHO "X$list" | $Xsed'
+            output_verbose_link_cmd='templist=`($CC -b $CFLAGS -v conftest.$objext 2>&1) | $EGREP "\-L"`; list=""; for z in $templist; do case $z in conftest.$objext) list="$list $z";; *.$objext);; *) list="$list $z";;esac; done; func_echo_all "$list"'
             ;;
           *)
             if test "$GXX" = yes; then
-              archive_cmds_CXX='$RM $output_objdir/$soname~$CC -shared -nostdlib -fPIC ${wl}+b ${wl}$install_libdir -o $output_objdir/$soname $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags~test $output_objdir/$soname = $lib || mv $output_objdir/$soname $lib'
+              archive_cmds_CXX='$RM $output_objdir/$soname~$CC -shared -nostdlib $pic_flag ${wl}+b ${wl}$install_libdir -o $output_objdir/$soname $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags~test $output_objdir/$soname = $lib || mv $output_objdir/$soname $lib'
             else
               # FIXME: insert proper C++ library support
               ld_shlibs_CXX=no
@@ -13734,7 +13012,7 @@ if test -z "$aix_libpath"; then aix_libpath="/usr/lib:/lib"; fi
 	    # explicitly linking system object files so we need to strip them
 	    # from the output so that they don't get included in the library
 	    # dependencies.
-	    output_verbose_link_cmd='templist=`($CC -b $CFLAGS -v conftest.$objext 2>&1) | $GREP "\-L"`; list=""; for z in $templist; do case $z in conftest.$objext) list="$list $z";; *.$objext);; *) list="$list $z";;esac; done; $ECHO "X$list" | $Xsed'
+	    output_verbose_link_cmd='templist=`($CC -b $CFLAGS -v conftest.$objext 2>&1) | $GREP "\-L"`; list=""; for z in $templist; do case $z in conftest.$objext) list="$list $z";; *.$objext);; *) list="$list $z";;esac; done; func_echo_all "$list"'
 	    ;;
           *)
 	    if test "$GXX" = yes; then
@@ -13744,10 +13022,10 @@ if test -z "$aix_libpath"; then aix_libpath="/usr/lib:/lib"; fi
 	            archive_cmds_CXX='$CC -shared -nostdlib -fPIC ${wl}+h ${wl}$soname -o $lib $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags'
 	            ;;
 	          ia64*)
-	            archive_cmds_CXX='$CC -shared -nostdlib -fPIC ${wl}+h ${wl}$soname ${wl}+nodefaultrpath -o $lib $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags'
+	            archive_cmds_CXX='$CC -shared -nostdlib $pic_flag ${wl}+h ${wl}$soname ${wl}+nodefaultrpath -o $lib $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags'
 	            ;;
 	          *)
-	            archive_cmds_CXX='$CC -shared -nostdlib -fPIC ${wl}+h ${wl}$soname ${wl}+b ${wl}$install_libdir -o $lib $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags'
+	            archive_cmds_CXX='$CC -shared -nostdlib $pic_flag ${wl}+h ${wl}$soname ${wl}+b ${wl}$install_libdir -o $lib $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags'
 	            ;;
 	        esac
 	      fi
@@ -13777,7 +13055,7 @@ if test -z "$aix_libpath"; then aix_libpath="/usr/lib:/lib"; fi
         case $cc_basename in
           CC*)
 	    # SGI C++
-	    archive_cmds_CXX='$CC -shared -all -multigot $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags -soname $soname `test -n "$verstring" && $ECHO "X-set_version $verstring" | $Xsed` -update_registry ${output_objdir}/so_locations -o $lib'
+	    archive_cmds_CXX='$CC -shared -all -multigot $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags -soname $soname `test -n "$verstring" && func_echo_all "-set_version $verstring"` -update_registry ${output_objdir}/so_locations -o $lib'
 
 	    # Archives containing C++ object files must be created using
 	    # "CC -ar", where "CC" is the IRIX C++ compiler.  This is
@@ -13788,9 +13066,9 @@ if test -z "$aix_libpath"; then aix_libpath="/usr/lib:/lib"; fi
           *)
 	    if test "$GXX" = yes; then
 	      if test "$with_gnu_ld" = no; then
-	        archive_cmds_CXX='$CC -shared -nostdlib $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags ${wl}-soname ${wl}$soname `test -n "$verstring" && $ECHO "X${wl}-set_version ${wl}$verstring" | $Xsed` ${wl}-update_registry ${wl}${output_objdir}/so_locations -o $lib'
+	        archive_cmds_CXX='$CC -shared $pic_flag -nostdlib $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags ${wl}-soname ${wl}$soname `test -n "$verstring" && func_echo_all "${wl}-set_version ${wl}$verstring"` ${wl}-update_registry ${wl}${output_objdir}/so_locations -o $lib'
 	      else
-	        archive_cmds_CXX='$CC -shared -nostdlib $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags ${wl}-soname ${wl}$soname `test -n "$verstring" && $ECHO "X${wl}-set_version ${wl}$verstring" | $Xsed` -o $lib'
+	        archive_cmds_CXX='$CC -shared $pic_flag -nostdlib $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags ${wl}-soname ${wl}$soname `test -n "$verstring" && func_echo_all "${wl}-set_version ${wl}$verstring"` -o $lib'
 	      fi
 	    fi
 	    link_all_deplibs_CXX=yes
@@ -13801,7 +13079,7 @@ if test -z "$aix_libpath"; then aix_libpath="/usr/lib:/lib"; fi
         inherit_rpath_CXX=yes
         ;;
 
-      linux* | k*bsd*-gnu)
+      linux* | k*bsd*-gnu | kopensolaris*-gnu)
         case $cc_basename in
           KCC*)
 	    # Kuck and Associates, Inc. (KAI) C++ Compiler
@@ -13819,7 +13097,7 @@ if test -z "$aix_libpath"; then aix_libpath="/usr/lib:/lib"; fi
 	    # explicitly linking system object files so we need to strip them
 	    # from the output so that they don't get included in the library
 	    # dependencies.
-	    output_verbose_link_cmd='templist=`$CC $CFLAGS -v conftest.$objext -o libconftest$shared_ext 2>&1 | $GREP "ld"`; rm -f libconftest$shared_ext; list=""; for z in $templist; do case $z in conftest.$objext) list="$list $z";; *.$objext);; *) list="$list $z";;esac; done; $ECHO "X$list" | $Xsed'
+	    output_verbose_link_cmd='templist=`$CC $CFLAGS -v conftest.$objext -o libconftest$shared_ext 2>&1 | $GREP "ld"`; rm -f libconftest$shared_ext; list=""; for z in $templist; do case $z in conftest.$objext) list="$list $z";; *.$objext);; *) list="$list $z";;esac; done; func_echo_all "$list"'
 
 	    hardcode_libdir_flag_spec_CXX='${wl}-rpath,$libdir'
 	    export_dynamic_flag_spec_CXX='${wl}--export-dynamic'
@@ -13856,26 +13134,26 @@ if test -z "$aix_libpath"; then aix_libpath="/usr/lib:/lib"; fi
           pgCC* | pgcpp*)
             # Portland Group C++ compiler
 	    case `$CC -V` in
-	    *pgCC\ [1-5]* | *pgcpp\ [1-5]*)
+	    *pgCC\ [1-5].* | *pgcpp\ [1-5].*)
 	      prelink_cmds_CXX='tpldir=Template.dir~
 		rm -rf $tpldir~
 		$CC --prelink_objects --instantiation_dir $tpldir $objs $libobjs $compile_deplibs~
-		compile_command="$compile_command `find $tpldir -name \*.o | $NL2SP`"'
+		compile_command="$compile_command `find $tpldir -name \*.o | sort | $NL2SP`"'
 	      old_archive_cmds_CXX='tpldir=Template.dir~
 		rm -rf $tpldir~
 		$CC --prelink_objects --instantiation_dir $tpldir $oldobjs$old_deplibs~
-		$AR $AR_FLAGS $oldlib$oldobjs$old_deplibs `find $tpldir -name \*.o | $NL2SP`~
+		$AR $AR_FLAGS $oldlib$oldobjs$old_deplibs `find $tpldir -name \*.o | sort | $NL2SP`~
 		$RANLIB $oldlib'
 	      archive_cmds_CXX='tpldir=Template.dir~
 		rm -rf $tpldir~
 		$CC --prelink_objects --instantiation_dir $tpldir $predep_objects $libobjs $deplibs $convenience $postdep_objects~
-		$CC -shared $pic_flag $predep_objects $libobjs $deplibs `find $tpldir -name \*.o | $NL2SP` $postdep_objects $compiler_flags ${wl}-soname ${wl}$soname -o $lib'
+		$CC -shared $pic_flag $predep_objects $libobjs $deplibs `find $tpldir -name \*.o | sort | $NL2SP` $postdep_objects $compiler_flags ${wl}-soname ${wl}$soname -o $lib'
 	      archive_expsym_cmds_CXX='tpldir=Template.dir~
 		rm -rf $tpldir~
 		$CC --prelink_objects --instantiation_dir $tpldir $predep_objects $libobjs $deplibs $convenience $postdep_objects~
-		$CC -shared $pic_flag $predep_objects $libobjs $deplibs `find $tpldir -name \*.o | $NL2SP` $postdep_objects $compiler_flags ${wl}-soname ${wl}$soname ${wl}-retain-symbols-file ${wl}$export_symbols -o $lib'
+		$CC -shared $pic_flag $predep_objects $libobjs $deplibs `find $tpldir -name \*.o | sort | $NL2SP` $postdep_objects $compiler_flags ${wl}-soname ${wl}$soname ${wl}-retain-symbols-file ${wl}$export_symbols -o $lib'
 	      ;;
-	    *) # Version 6 will use weak symbols
+	    *) # Version 6 and above use weak symbols
 	      archive_cmds_CXX='$CC -shared $pic_flag $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags ${wl}-soname ${wl}$soname -o $lib'
 	      archive_expsym_cmds_CXX='$CC -shared $pic_flag $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags ${wl}-soname ${wl}$soname ${wl}-retain-symbols-file ${wl}$export_symbols -o $lib'
 	      ;;
@@ -13883,7 +13161,7 @@ if test -z "$aix_libpath"; then aix_libpath="/usr/lib:/lib"; fi
 
 	    hardcode_libdir_flag_spec_CXX='${wl}--rpath ${wl}$libdir'
 	    export_dynamic_flag_spec_CXX='${wl}--export-dynamic'
-	    whole_archive_flag_spec_CXX='${wl}--whole-archive`for conv in $convenience\"\"; do test  -n \"$conv\" && new_convenience=\"$new_convenience,$conv\"; done; $ECHO \"$new_convenience\"` ${wl}--no-whole-archive'
+	    whole_archive_flag_spec_CXX='${wl}--whole-archive`for conv in $convenience\"\"; do test  -n \"$conv\" && new_convenience=\"$new_convenience,$conv\"; done; func_echo_all \"$new_convenience\"` ${wl}--no-whole-archive'
             ;;
 	  cxx*)
 	    # Compaq C++
@@ -13902,9 +13180,9 @@ if test -z "$aix_libpath"; then aix_libpath="/usr/lib:/lib"; fi
 	    # explicitly linking system object files so we need to strip them
 	    # from the output so that they don't get included in the library
 	    # dependencies.
-	    output_verbose_link_cmd='templist=`$CC -shared $CFLAGS -v conftest.$objext 2>&1 | $GREP "ld"`; templist=`$ECHO "X$templist" | $Xsed -e "s/\(^.*ld.*\)\( .*ld .*$\)/\1/"`; list=""; for z in $templist; do case $z in conftest.$objext) list="$list $z";; *.$objext);; *) list="$list $z";;esac; done; $ECHO "X$list" | $Xsed'
+	    output_verbose_link_cmd='templist=`$CC -shared $CFLAGS -v conftest.$objext 2>&1 | $GREP "ld"`; templist=`func_echo_all "$templist" | $SED "s/\(^.*ld.*\)\( .*ld .*$\)/\1/"`; list=""; for z in $templist; do case $z in conftest.$objext) list="$list $z";; *.$objext);; *) list="$list $z";;esac; done; func_echo_all "X$list" | $Xsed'
 	    ;;
-	  xl*)
+	  xl* | mpixl* | bgxl*)
 	    # IBM XL 8.0 on PPC, with GNU ld
 	    hardcode_libdir_flag_spec_CXX='${wl}-rpath ${wl}$libdir'
 	    export_dynamic_flag_spec_CXX='${wl}--export-dynamic'
@@ -13924,13 +13202,13 @@ if test -z "$aix_libpath"; then aix_libpath="/usr/lib:/lib"; fi
 	      archive_cmds_CXX='$CC -G${allow_undefined_flag} -h$soname -o $lib $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags'
 	      archive_expsym_cmds_CXX='$CC -G${allow_undefined_flag} -h$soname -o $lib $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags ${wl}-retain-symbols-file ${wl}$export_symbols'
 	      hardcode_libdir_flag_spec_CXX='-R$libdir'
-	      whole_archive_flag_spec_CXX='${wl}--whole-archive`new_convenience=; for conv in $convenience\"\"; do test -z \"$conv\" || new_convenience=\"$new_convenience,$conv\"; done; $ECHO \"$new_convenience\"` ${wl}--no-whole-archive'
+	      whole_archive_flag_spec_CXX='${wl}--whole-archive`new_convenience=; for conv in $convenience\"\"; do test -z \"$conv\" || new_convenience=\"$new_convenience,$conv\"; done; func_echo_all \"$new_convenience\"` ${wl}--no-whole-archive'
 	      compiler_needs_object_CXX=yes
 
 	      # Not sure whether something based on
 	      # $CC $CFLAGS -v conftest.$objext -o libconftest$shared_ext 2>&1
 	      # would be better.
-	      output_verbose_link_cmd='echo'
+	      output_verbose_link_cmd='func_echo_all'
 
 	      # Archives containing C++ object files must be created using
 	      # "CC -xar", where "CC" is the Sun C++ compiler.  This is
@@ -13999,7 +13277,7 @@ if test -z "$aix_libpath"; then aix_libpath="/usr/lib:/lib"; fi
 	    export_dynamic_flag_spec_CXX='${wl}-E'
 	    whole_archive_flag_spec_CXX="$wlarc"'--whole-archive$convenience '"$wlarc"'--no-whole-archive'
 	  fi
-	  output_verbose_link_cmd=echo
+	  output_verbose_link_cmd=func_echo_all
 	else
 	  ld_shlibs_CXX=no
 	fi
@@ -14034,15 +13312,15 @@ if test -z "$aix_libpath"; then aix_libpath="/usr/lib:/lib"; fi
 	    case $host in
 	      osf3*)
 	        allow_undefined_flag_CXX=' ${wl}-expect_unresolved ${wl}\*'
-	        archive_cmds_CXX='$CC -shared${allow_undefined_flag} $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags ${wl}-soname $soname `test -n "$verstring" && $ECHO "X${wl}-set_version $verstring" | $Xsed` -update_registry ${output_objdir}/so_locations -o $lib'
+	        archive_cmds_CXX='$CC -shared${allow_undefined_flag} $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags ${wl}-soname $soname `test -n "$verstring" && func_echo_all "${wl}-set_version $verstring"` -update_registry ${output_objdir}/so_locations -o $lib'
 	        hardcode_libdir_flag_spec_CXX='${wl}-rpath ${wl}$libdir'
 		;;
 	      *)
 	        allow_undefined_flag_CXX=' -expect_unresolved \*'
-	        archive_cmds_CXX='$CC -shared${allow_undefined_flag} $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags -msym -soname $soname `test -n "$verstring" && $ECHO "X-set_version $verstring" | $Xsed` -update_registry ${output_objdir}/so_locations -o $lib'
+	        archive_cmds_CXX='$CC -shared${allow_undefined_flag} $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags -msym -soname $soname `test -n "$verstring" && func_echo_all "-set_version $verstring"` -update_registry ${output_objdir}/so_locations -o $lib'
 	        archive_expsym_cmds_CXX='for i in `cat $export_symbols`; do printf "%s %s\\n" -exported_symbol "\$i" >> $lib.exp; done~
 	          echo "-hidden">> $lib.exp~
-	          $CC -shared$allow_undefined_flag $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags -msym -soname $soname ${wl}-input ${wl}$lib.exp  `test -n "$verstring" && $ECHO "X-set_version $verstring" | $Xsed` -update_registry ${output_objdir}/so_locations -o $lib~
+	          $CC -shared$allow_undefined_flag $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags -msym -soname $soname ${wl}-input ${wl}$lib.exp  `test -n "$verstring" && $ECHO "-set_version $verstring"` -update_registry ${output_objdir}/so_locations -o $lib~
 	          $RM $lib.exp'
 	        hardcode_libdir_flag_spec_CXX='-rpath $libdir'
 		;;
@@ -14058,17 +13336,17 @@ if test -z "$aix_libpath"; then aix_libpath="/usr/lib:/lib"; fi
 	    # explicitly linking system object files so we need to strip them
 	    # from the output so that they don't get included in the library
 	    # dependencies.
-	    output_verbose_link_cmd='templist=`$CC -shared $CFLAGS -v conftest.$objext 2>&1 | $GREP "ld" | $GREP -v "ld:"`; templist=`$ECHO "X$templist" | $Xsed -e "s/\(^.*ld.*\)\( .*ld.*$\)/\1/"`; list=""; for z in $templist; do case $z in conftest.$objext) list="$list $z";; *.$objext);; *) list="$list $z";;esac; done; $ECHO "X$list" | $Xsed'
+	    output_verbose_link_cmd='templist=`$CC -shared $CFLAGS -v conftest.$objext 2>&1 | $GREP "ld" | $GREP -v "ld:"`; templist=`func_echo_all "$templist" | $SED "s/\(^.*ld.*\)\( .*ld.*$\)/\1/"`; list=""; for z in $templist; do case $z in conftest.$objext) list="$list $z";; *.$objext);; *) list="$list $z";;esac; done; func_echo_all "$list"'
 	    ;;
 	  *)
 	    if test "$GXX" = yes && test "$with_gnu_ld" = no; then
 	      allow_undefined_flag_CXX=' ${wl}-expect_unresolved ${wl}\*'
 	      case $host in
 	        osf3*)
-	          archive_cmds_CXX='$CC -shared -nostdlib ${allow_undefined_flag} $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags ${wl}-soname ${wl}$soname `test -n "$verstring" && $ECHO "X${wl}-set_version ${wl}$verstring" | $Xsed` ${wl}-update_registry ${wl}${output_objdir}/so_locations -o $lib'
+	          archive_cmds_CXX='$CC -shared -nostdlib ${allow_undefined_flag} $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags ${wl}-soname ${wl}$soname `test -n "$verstring" && func_echo_all "${wl}-set_version ${wl}$verstring"` ${wl}-update_registry ${wl}${output_objdir}/so_locations -o $lib'
 		  ;;
 	        *)
-	          archive_cmds_CXX='$CC -shared -nostdlib ${allow_undefined_flag} $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags ${wl}-msym ${wl}-soname ${wl}$soname `test -n "$verstring" && $ECHO "${wl}-set_version ${wl}$verstring" | $Xsed` ${wl}-update_registry ${wl}${output_objdir}/so_locations -o $lib'
+	          archive_cmds_CXX='$CC -shared $pic_flag -nostdlib ${allow_undefined_flag} $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags ${wl}-msym ${wl}-soname ${wl}$soname `test -n "$verstring" && func_echo_all "${wl}-set_version ${wl}$verstring"` ${wl}-update_registry ${wl}${output_objdir}/so_locations -o $lib'
 		  ;;
 	      esac
 
@@ -14078,7 +13356,7 @@ if test -z "$aix_libpath"; then aix_libpath="/usr/lib:/lib"; fi
 	      # Commands to make compiler produce verbose output that lists
 	      # what "hidden" libraries, object files and flags are used when
 	      # linking a shared library.
-	      output_verbose_link_cmd='$CC -shared $CFLAGS -v conftest.$objext 2>&1 | $GREP "\-L"'
+	      output_verbose_link_cmd='$CC -shared $CFLAGS -v conftest.$objext 2>&1 | $GREP -v "^Configured with:" | $GREP "\-L"'
 
 	    else
 	      # FIXME: insert proper C++ library support
@@ -14114,7 +13392,7 @@ if test -z "$aix_libpath"; then aix_libpath="/usr/lib:/lib"; fi
 
       solaris*)
         case $cc_basename in
-          CC*)
+          CC* | sunCC*)
 	    # Sun C++ 4.2, 5.x and Centerline C++
             archive_cmds_need_lc_CXX=yes
 	    no_undefined_flag_CXX=' -zdefs'
@@ -14135,7 +13413,7 @@ if test -z "$aix_libpath"; then aix_libpath="/usr/lib:/lib"; fi
 	    esac
 	    link_all_deplibs_CXX=yes
 
-	    output_verbose_link_cmd='echo'
+	    output_verbose_link_cmd='func_echo_all'
 
 	    # Archives containing C++ object files must be created using
 	    # "CC -xar", where "CC" is the Sun C++ compiler.  This is
@@ -14155,14 +13433,14 @@ if test -z "$aix_libpath"; then aix_libpath="/usr/lib:/lib"; fi
 	    if test "$GXX" = yes && test "$with_gnu_ld" = no; then
 	      no_undefined_flag_CXX=' ${wl}-z ${wl}defs'
 	      if $CC --version | $GREP -v '^2\.7' > /dev/null; then
-	        archive_cmds_CXX='$CC -shared -nostdlib $LDFLAGS $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags ${wl}-h $wl$soname -o $lib'
+	        archive_cmds_CXX='$CC -shared $pic_flag -nostdlib $LDFLAGS $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags ${wl}-h $wl$soname -o $lib'
 	        archive_expsym_cmds_CXX='echo "{ global:" > $lib.exp~cat $export_symbols | $SED -e "s/\(.*\)/\1;/" >> $lib.exp~echo "local: *; };" >> $lib.exp~
-		  $CC -shared -nostdlib ${wl}-M $wl$lib.exp -o $lib $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags~$RM $lib.exp'
+		  $CC -shared $pic_flag -nostdlib ${wl}-M $wl$lib.exp -o $lib $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags~$RM $lib.exp'
 
 	        # Commands to make compiler produce verbose output that lists
 	        # what "hidden" libraries, object files and flags are used when
 	        # linking a shared library.
-	        output_verbose_link_cmd='$CC -shared $CFLAGS -v conftest.$objext 2>&1 | $GREP "\-L"'
+	        output_verbose_link_cmd='$CC -shared $CFLAGS -v conftest.$objext 2>&1 | $GREP -v "^Configured with:" | $GREP "\-L"'
 	      else
 	        # g++ 2.7 appears to require `-G' NOT `-shared' on this
 	        # platform.
@@ -14173,7 +13451,7 @@ if test -z "$aix_libpath"; then aix_libpath="/usr/lib:/lib"; fi
 	        # Commands to make compiler produce verbose output that lists
 	        # what "hidden" libraries, object files and flags are used when
 	        # linking a shared library.
-	        output_verbose_link_cmd='$CC -G $CFLAGS -v conftest.$objext 2>&1 | $GREP "\-L"'
+	        output_verbose_link_cmd='$CC -G $CFLAGS -v conftest.$objext 2>&1 | $GREP -v "^Configured with:" | $GREP "\-L"'
 	      fi
 
 	      hardcode_libdir_flag_spec_CXX='${wl}-R $wl$libdir'
@@ -14227,6 +13505,10 @@ if test -z "$aix_libpath"; then aix_libpath="/usr/lib:/lib"; fi
           CC*)
 	    archive_cmds_CXX='$CC -G ${wl}-h,$soname -o $lib $libobjs $deplibs $compiler_flags'
 	    archive_expsym_cmds_CXX='$CC -G ${wl}-Bexport:$export_symbols ${wl}-h,$soname -o $lib $libobjs $deplibs $compiler_flags'
+	    old_archive_cmds_CXX='$CC -Tprelink_objects $oldobjs~
+	      '"$old_archive_cmds_CXX"
+	    reload_cmds_CXX='$CC -Tprelink_objects $reload_objs~
+	      '"$reload_cmds_CXX"
 	    ;;
 	  *)
 	    archive_cmds_CXX='$CC -shared ${wl}-h,$soname -o $lib $libobjs $deplibs $compiler_flags'
@@ -14260,7 +13542,7 @@ if test -z "$aix_libpath"; then aix_libpath="/usr/lib:/lib"; fi
         ;;
     esac
 
-    { $as_echo "$as_me:$LINENO: result: $ld_shlibs_CXX" >&5
+    { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ld_shlibs_CXX" >&5
 $as_echo "$ld_shlibs_CXX" >&6; }
     test "$ld_shlibs_CXX" = no && can_build_shared=no
 
@@ -14288,11 +13570,19 @@ private:
 };
 _LT_EOF
 
-if { (eval echo "$as_me:$LINENO: \"$ac_compile\"") >&5
+
+_lt_libdeps_save_CFLAGS=$CFLAGS
+case "$CC $CFLAGS " in #(
+*\ -flto*\ *) CFLAGS="$CFLAGS -fno-lto" ;;
+*\ -fwhopr*\ *) CFLAGS="$CFLAGS -fno-whopr" ;;
+*\ -fuse-linker-plugin*\ *) CFLAGS="$CFLAGS -fno-use-linker-plugin" ;;
+esac
+
+if { { eval echo "\"\$as_me\":${as_lineno-$LINENO}: \"$ac_compile\""; } >&5
   (eval $ac_compile) 2>&5
   ac_status=$?
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); }; then
+  $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+  test $ac_status = 0; }; then
   # Parse the compiler output and extract the necessary
   # objects, libraries and library flags.
 
@@ -14301,7 +13591,7 @@ if { (eval echo "$as_me:$LINENO: \"$ac_compile\"") >&5
   pre_test_object_deps_done=no
 
   for p in `eval "$output_verbose_link_cmd"`; do
-    case $p in
+    case ${prev}${p} in
 
     -L* | -R* | -l*)
        # Some compilers place space between "-{L,R}" and the path.
@@ -14310,13 +13600,22 @@ if { (eval echo "$as_me:$LINENO: \"$ac_compile\"") >&5
           test $p = "-R"; then
 	 prev=$p
 	 continue
-       else
-	 prev=
        fi
 
+       # Expand the sysroot to ease extracting the directories later.
+       if test -z "$prev"; then
+         case $p in
+         -L*) func_stripname_cnf '-L' '' "$p"; prev=-L; p=$func_stripname_result ;;
+         -R*) func_stripname_cnf '-R' '' "$p"; prev=-R; p=$func_stripname_result ;;
+         -l*) func_stripname_cnf '-l' '' "$p"; prev=-l; p=$func_stripname_result ;;
+         esac
+       fi
+       case $p in
+       =*) func_stripname_cnf '=' '' "$p"; p=$lt_sysroot$func_stripname_result ;;
+       esac
        if test "$pre_test_object_deps_done" = no; then
-	 case $p in
-	 -L* | -R*)
+	 case ${prev} in
+	 -L | -R)
 	   # Internal compiler library paths should come after those
 	   # provided the user.  The postdeps already come after the
 	   # user supplied libs so there is no need to process them.
@@ -14336,8 +13635,10 @@ if { (eval echo "$as_me:$LINENO: \"$ac_compile\"") >&5
 	   postdeps_CXX="${postdeps_CXX} ${prev}${p}"
 	 fi
        fi
+       prev=
        ;;
 
+    *.lto.$objext) ;; # Ignore GCC LTO objects
     *.$objext)
        # This assumes that the test object file only shows up
        # once in the compiler output.
@@ -14373,6 +13674,7 @@ else
 fi
 
 $RM -f confest.$objext
+CFLAGS=$_lt_libdeps_save_CFLAGS
 
 # PORTME: override above test on systems where it is broken
 case $host_os in
@@ -14408,7 +13710,7 @@ linux*)
 
 solaris*)
   case $cc_basename in
-  CC*)
+  CC* | sunCC*)
     # The more standards-conforming stlport4 library is
     # incompatible with the Cstd library. Avoid specifying
     # it if it's in CXXFLAGS. Ignore libCrun as
@@ -14473,8 +13775,6 @@ fi
 lt_prog_compiler_pic_CXX=
 lt_prog_compiler_static_CXX=
 
-{ $as_echo "$as_me:$LINENO: checking for $compiler option to produce PIC" >&5
-$as_echo_n "checking for $compiler option to produce PIC... " >&6; }
 
   # C++ specific cases for pic, static, wl, etc.
   if test "$GXX" = yes; then
@@ -14524,6 +13824,11 @@ $as_echo_n "checking for $compiler option to produce PIC... " >&6; }
       # DJGPP does not support shared libraries at all
       lt_prog_compiler_pic_CXX=
       ;;
+    haiku*)
+      # PIC is the default for Haiku.
+      # The "-static" flag exists, but is broken.
+      lt_prog_compiler_static_CXX=
+      ;;
     interix[3-9]*)
       # Interix 3.x gcc -fpic/-fPIC options generate broken code.
       # Instead, we relocate shared libraries at runtime.
@@ -14573,6 +13878,11 @@ $as_echo_n "checking for $compiler option to produce PIC... " >&6; }
 	  ;;
 	esac
 	;;
+      mingw* | cygwin* | os2* | pw32* | cegcc*)
+	# This hack is so that the source file can tell whether it is being
+	# built for inclusion in a dll (and should export symbols for example).
+	lt_prog_compiler_pic_CXX='-DDLL_EXPORT'
+	;;
       dgux*)
 	case $cc_basename in
 	  ec++*)
@@ -14629,7 +13939,7 @@ $as_echo_n "checking for $compiler option to produce PIC... " >&6; }
 	    ;;
 	esac
 	;;
-      linux* | k*bsd*-gnu)
+      linux* | k*bsd*-gnu | kopensolaris*-gnu)
 	case $cc_basename in
 	  KCC*)
 	    # KAI C++ Compiler
@@ -14662,8 +13972,8 @@ $as_echo_n "checking for $compiler option to produce PIC... " >&6; }
 	    lt_prog_compiler_pic_CXX=
 	    lt_prog_compiler_static_CXX='-non_shared'
 	    ;;
-	  xlc* | xlC*)
-	    # IBM XL 8.0 on PPC
+	  xlc* | xlC* | bgxl[cC]* | mpixl[cC]*)
+	    # IBM XL 8.0, 9.0 on PPC and BlueGene
 	    lt_prog_compiler_wl_CXX='-Wl,'
 	    lt_prog_compiler_pic_CXX='-qpic'
 	    lt_prog_compiler_static_CXX='-qstaticlink'
@@ -14725,7 +14035,7 @@ $as_echo_n "checking for $compiler option to produce PIC... " >&6; }
 	;;
       solaris*)
 	case $cc_basename in
-	  CC*)
+	  CC* | sunCC*)
 	    # Sun C++ 4.2, 5.x and Centerline C++
 	    lt_prog_compiler_pic_CXX='-KPIC'
 	    lt_prog_compiler_static_CXX='-Bstatic'
@@ -14790,18 +14100,25 @@ case $host_os in
     lt_prog_compiler_pic_CXX="$lt_prog_compiler_pic_CXX -DPIC"
     ;;
 esac
-{ $as_echo "$as_me:$LINENO: result: $lt_prog_compiler_pic_CXX" >&5
-$as_echo "$lt_prog_compiler_pic_CXX" >&6; }
-
 
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $compiler option to produce PIC" >&5
+$as_echo_n "checking for $compiler option to produce PIC... " >&6; }
+if ${lt_cv_prog_compiler_pic_CXX+:} false; then :
+  $as_echo_n "(cached) " >&6
+else
+  lt_cv_prog_compiler_pic_CXX=$lt_prog_compiler_pic_CXX
+fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $lt_cv_prog_compiler_pic_CXX" >&5
+$as_echo "$lt_cv_prog_compiler_pic_CXX" >&6; }
+lt_prog_compiler_pic_CXX=$lt_cv_prog_compiler_pic_CXX
 
 #
 # Check to make sure the PIC flag actually works.
 #
 if test -n "$lt_prog_compiler_pic_CXX"; then
-  { $as_echo "$as_me:$LINENO: checking if $compiler PIC flag $lt_prog_compiler_pic_CXX works" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: checking if $compiler PIC flag $lt_prog_compiler_pic_CXX works" >&5
 $as_echo_n "checking if $compiler PIC flag $lt_prog_compiler_pic_CXX works... " >&6; }
-if test "${lt_cv_prog_compiler_pic_works_CXX+set}" = set; then
+if ${lt_cv_prog_compiler_pic_works_CXX+:} false; then :
   $as_echo_n "(cached) " >&6
 else
   lt_cv_prog_compiler_pic_works_CXX=no
@@ -14817,15 +14134,15 @@ else
    -e 's:.*FLAGS}\{0,1\} :&$lt_compiler_flag :; t' \
    -e 's: [^ ]*conftest\.: $lt_compiler_flag&:; t' \
    -e 's:$: $lt_compiler_flag:'`
-   (eval echo "\"\$as_me:14820: $lt_compile\"" >&5)
+   (eval echo "\"\$as_me:$LINENO: $lt_compile\"" >&5)
    (eval "$lt_compile" 2>conftest.err)
    ac_status=$?
    cat conftest.err >&5
-   echo "$as_me:14824: \$? = $ac_status" >&5
+   echo "$as_me:$LINENO: \$? = $ac_status" >&5
    if (exit $ac_status) && test -s "$ac_outfile"; then
      # The compiler can only warn and ignore the option if not recognized
      # So say no if there are warnings other than the usual output.
-     $ECHO "X$_lt_compiler_boilerplate" | $Xsed -e '/^$/d' >conftest.exp
+     $ECHO "$_lt_compiler_boilerplate" | $SED '/^$/d' >conftest.exp
      $SED '/^$/d; /^ *+/d' conftest.err >conftest.er2
      if test ! -s conftest.er2 || diff conftest.exp conftest.er2 >/dev/null; then
        lt_cv_prog_compiler_pic_works_CXX=yes
@@ -14834,7 +14151,7 @@ else
    $RM conftest*
 
 fi
-{ $as_echo "$as_me:$LINENO: result: $lt_cv_prog_compiler_pic_works_CXX" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $lt_cv_prog_compiler_pic_works_CXX" >&5
 $as_echo "$lt_cv_prog_compiler_pic_works_CXX" >&6; }
 
 if test x"$lt_cv_prog_compiler_pic_works_CXX" = xyes; then
@@ -14851,13 +14168,15 @@ fi
 
 
 
+
+
 #
 # Check to make sure the static flag actually works.
 #
 wl=$lt_prog_compiler_wl_CXX eval lt_tmp_static_flag=\"$lt_prog_compiler_static_CXX\"
-{ $as_echo "$as_me:$LINENO: checking if $compiler static flag $lt_tmp_static_flag works" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking if $compiler static flag $lt_tmp_static_flag works" >&5
 $as_echo_n "checking if $compiler static flag $lt_tmp_static_flag works... " >&6; }
-if test "${lt_cv_prog_compiler_static_works_CXX+set}" = set; then
+if ${lt_cv_prog_compiler_static_works_CXX+:} false; then :
   $as_echo_n "(cached) " >&6
 else
   lt_cv_prog_compiler_static_works_CXX=no
@@ -14870,7 +14189,7 @@ else
      if test -s conftest.err; then
        # Append any errors to the config.log.
        cat conftest.err 1>&5
-       $ECHO "X$_lt_linker_boilerplate" | $Xsed -e '/^$/d' > conftest.exp
+       $ECHO "$_lt_linker_boilerplate" | $SED '/^$/d' > conftest.exp
        $SED '/^$/d; /^ *+/d' conftest.err >conftest.er2
        if diff conftest.exp conftest.er2 >/dev/null; then
          lt_cv_prog_compiler_static_works_CXX=yes
@@ -14883,7 +14202,7 @@ else
    LDFLAGS="$save_LDFLAGS"
 
 fi
-{ $as_echo "$as_me:$LINENO: result: $lt_cv_prog_compiler_static_works_CXX" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $lt_cv_prog_compiler_static_works_CXX" >&5
 $as_echo "$lt_cv_prog_compiler_static_works_CXX" >&6; }
 
 if test x"$lt_cv_prog_compiler_static_works_CXX" = xyes; then
@@ -14895,9 +14214,9 @@ fi
 
 
 
-    { $as_echo "$as_me:$LINENO: checking if $compiler supports -c -o file.$ac_objext" >&5
+    { $as_echo "$as_me:${as_lineno-$LINENO}: checking if $compiler supports -c -o file.$ac_objext" >&5
 $as_echo_n "checking if $compiler supports -c -o file.$ac_objext... " >&6; }
-if test "${lt_cv_prog_compiler_c_o_CXX+set}" = set; then
+if ${lt_cv_prog_compiler_c_o_CXX+:} false; then :
   $as_echo_n "(cached) " >&6
 else
   lt_cv_prog_compiler_c_o_CXX=no
@@ -14916,16 +14235,16 @@ else
    -e 's:.*FLAGS}\{0,1\} :&$lt_compiler_flag :; t' \
    -e 's: [^ ]*conftest\.: $lt_compiler_flag&:; t' \
    -e 's:$: $lt_compiler_flag:'`
-   (eval echo "\"\$as_me:14919: $lt_compile\"" >&5)
+   (eval echo "\"\$as_me:$LINENO: $lt_compile\"" >&5)
    (eval "$lt_compile" 2>out/conftest.err)
    ac_status=$?
    cat out/conftest.err >&5
-   echo "$as_me:14923: \$? = $ac_status" >&5
+   echo "$as_me:$LINENO: \$? = $ac_status" >&5
    if (exit $ac_status) && test -s out/conftest2.$ac_objext
    then
      # The compiler can only warn and ignore the option if not recognized
      # So say no if there are warnings
-     $ECHO "X$_lt_compiler_boilerplate" | $Xsed -e '/^$/d' > out/conftest.exp
+     $ECHO "$_lt_compiler_boilerplate" | $SED '/^$/d' > out/conftest.exp
      $SED '/^$/d; /^ *+/d' out/conftest.err >out/conftest.er2
      if test ! -s out/conftest.er2 || diff out/conftest.exp out/conftest.er2 >/dev/null; then
        lt_cv_prog_compiler_c_o_CXX=yes
@@ -14942,14 +14261,14 @@ else
    $RM conftest*
 
 fi
-{ $as_echo "$as_me:$LINENO: result: $lt_cv_prog_compiler_c_o_CXX" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $lt_cv_prog_compiler_c_o_CXX" >&5
 $as_echo "$lt_cv_prog_compiler_c_o_CXX" >&6; }
 
 
 
-    { $as_echo "$as_me:$LINENO: checking if $compiler supports -c -o file.$ac_objext" >&5
+    { $as_echo "$as_me:${as_lineno-$LINENO}: checking if $compiler supports -c -o file.$ac_objext" >&5
 $as_echo_n "checking if $compiler supports -c -o file.$ac_objext... " >&6; }
-if test "${lt_cv_prog_compiler_c_o_CXX+set}" = set; then
+if ${lt_cv_prog_compiler_c_o_CXX+:} false; then :
   $as_echo_n "(cached) " >&6
 else
   lt_cv_prog_compiler_c_o_CXX=no
@@ -14968,16 +14287,16 @@ else
    -e 's:.*FLAGS}\{0,1\} :&$lt_compiler_flag :; t' \
    -e 's: [^ ]*conftest\.: $lt_compiler_flag&:; t' \
    -e 's:$: $lt_compiler_flag:'`
-   (eval echo "\"\$as_me:14971: $lt_compile\"" >&5)
+   (eval echo "\"\$as_me:$LINENO: $lt_compile\"" >&5)
    (eval "$lt_compile" 2>out/conftest.err)
    ac_status=$?
    cat out/conftest.err >&5
-   echo "$as_me:14975: \$? = $ac_status" >&5
+   echo "$as_me:$LINENO: \$? = $ac_status" >&5
    if (exit $ac_status) && test -s out/conftest2.$ac_objext
    then
      # The compiler can only warn and ignore the option if not recognized
      # So say no if there are warnings
-     $ECHO "X$_lt_compiler_boilerplate" | $Xsed -e '/^$/d' > out/conftest.exp
+     $ECHO "$_lt_compiler_boilerplate" | $SED '/^$/d' > out/conftest.exp
      $SED '/^$/d; /^ *+/d' out/conftest.err >out/conftest.er2
      if test ! -s out/conftest.er2 || diff out/conftest.exp out/conftest.er2 >/dev/null; then
        lt_cv_prog_compiler_c_o_CXX=yes
@@ -14994,7 +14313,7 @@ else
    $RM conftest*
 
 fi
-{ $as_echo "$as_me:$LINENO: result: $lt_cv_prog_compiler_c_o_CXX" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $lt_cv_prog_compiler_c_o_CXX" >&5
 $as_echo "$lt_cv_prog_compiler_c_o_CXX" >&6; }
 
 
@@ -15003,7 +14322,7 @@ $as_echo "$lt_cv_prog_compiler_c_o_CXX" >&6; }
 hard_links="nottested"
 if test "$lt_cv_prog_compiler_c_o_CXX" = no && test "$need_locks" != no; then
   # do not overwrite the value of need_locks provided by the user
-  { $as_echo "$as_me:$LINENO: checking if we can lock with hard links" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: checking if we can lock with hard links" >&5
 $as_echo_n "checking if we can lock with hard links... " >&6; }
   hard_links=yes
   $RM conftest*
@@ -15011,10 +14330,10 @@ $as_echo_n "checking if we can lock with hard links... " >&6; }
   touch conftest.a
   ln conftest.a conftest.b 2>&5 || hard_links=no
   ln conftest.a conftest.b 2>/dev/null && hard_links=no
-  { $as_echo "$as_me:$LINENO: result: $hard_links" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $hard_links" >&5
 $as_echo "$hard_links" >&6; }
   if test "$hard_links" = no; then
-    { $as_echo "$as_me:$LINENO: WARNING: \`$CC' does not support \`-c -o', so \`make -j' may be unsafe" >&5
+    { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: \`$CC' does not support \`-c -o', so \`make -j' may be unsafe" >&5
 $as_echo "$as_me: WARNING: \`$CC' does not support \`-c -o', so \`make -j' may be unsafe" >&2;}
     need_locks=warn
   fi
@@ -15024,33 +14343,43 @@ fi
 
 
 
-    { $as_echo "$as_me:$LINENO: checking whether the $compiler linker ($LD) supports shared libraries" >&5
+    { $as_echo "$as_me:${as_lineno-$LINENO}: checking whether the $compiler linker ($LD) supports shared libraries" >&5
 $as_echo_n "checking whether the $compiler linker ($LD) supports shared libraries... " >&6; }
 
   export_symbols_cmds_CXX='$NM $libobjs $convenience | $global_symbol_pipe | $SED '\''s/.* //'\'' | sort | uniq > $export_symbols'
+  exclude_expsyms_CXX='_GLOBAL_OFFSET_TABLE_|_GLOBAL__F[ID]_.*'
   case $host_os in
   aix[4-9]*)
     # If we're using GNU nm, then we don't want the "-C" option.
     # -C means demangle to AIX nm, but means don't demangle with GNU nm
+    # Also, AIX nm treats weak defined symbols like other global defined
+    # symbols, whereas GNU nm marks them as "W".
     if $NM -V 2>&1 | $GREP 'GNU' > /dev/null; then
-      export_symbols_cmds_CXX='$NM -Bpg $libobjs $convenience | awk '\''{ if (((\$ 2 == "T") || (\$ 2 == "D") || (\$ 2 == "B")) && (substr(\$ 3,1,1) != ".")) { print \$ 3 } }'\'' | sort -u > $export_symbols'
+      export_symbols_cmds_CXX='$NM -Bpg $libobjs $convenience | awk '\''{ if (((\$ 2 == "T") || (\$ 2 == "D") || (\$ 2 == "B") || (\$ 2 == "W")) && (substr(\$ 3,1,1) != ".")) { print \$ 3 } }'\'' | sort -u > $export_symbols'
     else
       export_symbols_cmds_CXX='$NM -BCpg $libobjs $convenience | awk '\''{ if (((\$ 2 == "T") || (\$ 2 == "D") || (\$ 2 == "B")) && (substr(\$ 3,1,1) != ".")) { print \$ 3 } }'\'' | sort -u > $export_symbols'
     fi
     ;;
   pw32*)
     export_symbols_cmds_CXX="$ltdll_cmds"
-  ;;
+    ;;
   cygwin* | mingw* | cegcc*)
-    export_symbols_cmds_CXX='$NM $libobjs $convenience | $global_symbol_pipe | $SED -e '\''/^[BCDGRS][ ]/s/.*[ ]\([^ ]*\)/\1 DATA/;/^.*[ ]__nm__/s/^.*[ ]__nm__\([^ ]*\)[ ][^ ]*/\1 DATA/;/^I[ ]/d;/^[AITW][ ]/s/.* //'\'' | sort | uniq > $export_symbols'
-  ;;
+    case $cc_basename in
+    cl*)
+      exclude_expsyms_CXX='_NULL_IMPORT_DESCRIPTOR|_IMPORT_DESCRIPTOR_.*'
+      ;;
+    *)
+      export_symbols_cmds_CXX='$NM $libobjs $convenience | $global_symbol_pipe | $SED -e '\''/^[BCDGRS][ ]/s/.*[ ]\([^ ]*\)/\1 DATA/;s/^.*[ ]__nm__\([^ ]*\)[ ][^ ]*/\1 DATA/;/^I[ ]/d;/^[AITW][ ]/s/.* //'\'' | sort | uniq > $export_symbols'
+      exclude_expsyms_CXX='[_]+GLOBAL_OFFSET_TABLE_|[_]+GLOBAL__[FID]_.*|[_]+head_[A-Za-z0-9_]+_dll|[A-Za-z0-9_]+_dll_iname'
+      ;;
+    esac
+    ;;
   *)
     export_symbols_cmds_CXX='$NM $libobjs $convenience | $global_symbol_pipe | $SED '\''s/.* //'\'' | sort | uniq > $export_symbols'
-  ;;
+    ;;
   esac
-  exclude_expsyms_CXX='_GLOBAL_OFFSET_TABLE_|_GLOBAL__F[ID]_.*'
 
-{ $as_echo "$as_me:$LINENO: result: $ld_shlibs_CXX" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ld_shlibs_CXX" >&5
 $as_echo "$ld_shlibs_CXX" >&6; }
 test "$ld_shlibs_CXX" = no && can_build_shared=no
 
@@ -15078,46 +14407,52 @@ x|xyes)
       # Test whether the compiler implicitly links with -lc since on some
       # systems, -lgcc has to come before -lc. If gcc already passes -lc
       # to ld, don't add -lc before -lgcc.
-      { $as_echo "$as_me:$LINENO: checking whether -lc should be explicitly linked in" >&5
+      { $as_echo "$as_me:${as_lineno-$LINENO}: checking whether -lc should be explicitly linked in" >&5
 $as_echo_n "checking whether -lc should be explicitly linked in... " >&6; }
-      $RM conftest*
-      echo "$lt_simple_compile_test_code" > conftest.$ac_ext
+if ${lt_cv_archive_cmds_need_lc_CXX+:} false; then :
+  $as_echo_n "(cached) " >&6
+else
+  $RM conftest*
+	echo "$lt_simple_compile_test_code" > conftest.$ac_ext
 
-      if { (eval echo "$as_me:$LINENO: \"$ac_compile\"") >&5
+	if { { eval echo "\"\$as_me\":${as_lineno-$LINENO}: \"$ac_compile\""; } >&5
   (eval $ac_compile) 2>&5
   ac_status=$?
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } 2>conftest.err; then
-        soname=conftest
-        lib=conftest
-        libobjs=conftest.$ac_objext
-        deplibs=
-        wl=$lt_prog_compiler_wl_CXX
-	pic_flag=$lt_prog_compiler_pic_CXX
-        compiler_flags=-v
-        linker_flags=-v
-        verstring=
-        output_objdir=.
-        libname=conftest
-        lt_save_allow_undefined_flag=$allow_undefined_flag_CXX
-        allow_undefined_flag_CXX=
-        if { (eval echo "$as_me:$LINENO: \"$archive_cmds_CXX 2\>\&1 \| $GREP \" -lc \" \>/dev/null 2\>\&1\"") >&5
+  $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+  test $ac_status = 0; } 2>conftest.err; then
+	  soname=conftest
+	  lib=conftest
+	  libobjs=conftest.$ac_objext
+	  deplibs=
+	  wl=$lt_prog_compiler_wl_CXX
+	  pic_flag=$lt_prog_compiler_pic_CXX
+	  compiler_flags=-v
+	  linker_flags=-v
+	  verstring=
+	  output_objdir=.
+	  libname=conftest
+	  lt_save_allow_undefined_flag=$allow_undefined_flag_CXX
+	  allow_undefined_flag_CXX=
+	  if { { eval echo "\"\$as_me\":${as_lineno-$LINENO}: \"$archive_cmds_CXX 2\>\&1 \| $GREP \" -lc \" \>/dev/null 2\>\&1\""; } >&5
   (eval $archive_cmds_CXX 2\>\&1 \| $GREP \" -lc \" \>/dev/null 2\>\&1) 2>&5
   ac_status=$?
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); }
-        then
-	  archive_cmds_need_lc_CXX=no
-        else
-	  archive_cmds_need_lc_CXX=yes
-        fi
-        allow_undefined_flag_CXX=$lt_save_allow_undefined_flag
-      else
-        cat conftest.err 1>&5
-      fi
-      $RM conftest*
-      { $as_echo "$as_me:$LINENO: result: $archive_cmds_need_lc_CXX" >&5
-$as_echo "$archive_cmds_need_lc_CXX" >&6; }
+  $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+  test $ac_status = 0; }
+	  then
+	    lt_cv_archive_cmds_need_lc_CXX=no
+	  else
+	    lt_cv_archive_cmds_need_lc_CXX=yes
+	  fi
+	  allow_undefined_flag_CXX=$lt_save_allow_undefined_flag
+	else
+	  cat conftest.err 1>&5
+	fi
+	$RM conftest*
+
+fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $lt_cv_archive_cmds_need_lc_CXX" >&5
+$as_echo "$lt_cv_archive_cmds_need_lc_CXX" >&6; }
+      archive_cmds_need_lc_CXX=$lt_cv_archive_cmds_need_lc_CXX
       ;;
     esac
   fi
@@ -15185,9 +14520,7 @@ esac
 
 
 
-
-
-    { $as_echo "$as_me:$LINENO: checking dynamic linker characteristics" >&5
+    { $as_echo "$as_me:${as_lineno-$LINENO}: checking dynamic linker characteristics" >&5
 $as_echo_n "checking dynamic linker characteristics... " >&6; }
 
 library_names_spec=
@@ -15212,7 +14545,7 @@ need_version=unknown
 
 case $host_os in
 aix3*)
-  version_type=linux
+  version_type=linux # correct to gnu/linux during the next big refactor
   library_names_spec='${libname}${release}${shared_ext}$versuffix $libname.a'
   shlibpath_var=LIBPATH
 
@@ -15221,7 +14554,7 @@ aix3*)
   ;;
 
 aix[4-9]*)
-  version_type=linux
+  version_type=linux # correct to gnu/linux during the next big refactor
   need_lib_prefix=no
   need_version=no
   hardcode_into_libs=yes
@@ -15274,7 +14607,7 @@ amigaos*)
   m68k)
     library_names_spec='$libname.ixlibrary $libname.a'
     # Create ${libname}_ixlibrary.a entries in /sys/libs.
-    finish_eval='for lib in `ls $libdir/*.ixlibrary 2>/dev/null`; do libname=`$ECHO "X$lib" | $Xsed -e '\''s%^.*/\([^/]*\)\.ixlibrary$%\1%'\''`; test $RM /sys/libs/${libname}_ixlibrary.a; $show "cd /sys/libs && $LN_S $lib ${libname}_ixlibrary.a"; cd /sys/libs && $LN_S $lib ${libname}_ixlibrary.a || exit 1; done'
+    finish_eval='for lib in `ls $libdir/*.ixlibrary 2>/dev/null`; do libname=`func_echo_all "$lib" | $SED '\''s%^.*/\([^/]*\)\.ixlibrary$%\1%'\''`; test $RM /sys/libs/${libname}_ixlibrary.a; $show "cd /sys/libs && $LN_S $lib ${libname}_ixlibrary.a"; cd /sys/libs && $LN_S $lib ${libname}_ixlibrary.a || exit 1; done'
     ;;
   esac
   ;;
@@ -15286,7 +14619,7 @@ beos*)
   ;;
 
 bsdi[45]*)
-  version_type=linux
+  version_type=linux # correct to gnu/linux during the next big refactor
   need_version=no
   library_names_spec='${libname}${release}${shared_ext}$versuffix ${libname}${release}${shared_ext}$major $libname${shared_ext}'
   soname_spec='${libname}${release}${shared_ext}$major'
@@ -15305,8 +14638,9 @@ cygwin* | mingw* | pw32* | cegcc*)
   need_version=no
   need_lib_prefix=no
 
-  case $GCC,$host_os in
-  yes,cygwin* | yes,mingw* | yes,pw32* | yes,cegcc*)
+  case $GCC,$cc_basename in
+  yes,*)
+    # gcc
     library_names_spec='$libname.dll.a'
     # DLL is installed to $(libdir)/../bin by postinstall_cmds
     postinstall_cmds='base_file=`basename \${file}`~
@@ -15327,36 +14661,82 @@ cygwin* | mingw* | pw32* | cegcc*)
     cygwin*)
       # Cygwin DLLs use 'cyg' prefix rather than 'lib'
       soname_spec='`echo ${libname} | sed -e 's/^lib/cyg/'``echo ${release} | $SED -e 's/[.]/-/g'`${versuffix}${shared_ext}'
-      sys_lib_search_path_spec="/usr/lib /lib/w32api /lib /usr/local/lib"
+
       ;;
     mingw* | cegcc*)
       # MinGW DLLs use traditional 'lib' prefix
       soname_spec='${libname}`echo ${release} | $SED -e 's/[.]/-/g'`${versuffix}${shared_ext}'
-      sys_lib_search_path_spec=`$CC -print-search-dirs | $GREP "^libraries:" | $SED -e "s/^libraries://" -e "s,=/,/,g"`
-      if $ECHO "$sys_lib_search_path_spec" | $GREP ';[c-zC-Z]:/' >/dev/null; then
-        # It is most probably a Windows format PATH printed by
-        # mingw gcc, but we are running on Cygwin. Gcc prints its search
-        # path with ; separators, and with drive letters. We can handle the
-        # drive letters (cygwin fileutils understands them), so leave them,
-        # especially as we might pass files found there to a mingw objdump,
-        # which wouldn't understand a cygwinified path. Ahh.
-        sys_lib_search_path_spec=`$ECHO "$sys_lib_search_path_spec" | $SED -e 's/;/ /g'`
-      else
-        sys_lib_search_path_spec=`$ECHO "$sys_lib_search_path_spec" | $SED  -e "s/$PATH_SEPARATOR/ /g"`
-      fi
       ;;
     pw32*)
       # pw32 DLLs use 'pw' prefix rather than 'lib'
       library_names_spec='`echo ${libname} | sed -e 's/^lib/pw/'``echo ${release} | $SED -e 's/[.]/-/g'`${versuffix}${shared_ext}'
       ;;
     esac
+    dynamic_linker='Win32 ld.exe'
+    ;;
+
+  *,cl*)
+    # Native MSVC
+    libname_spec='$name'
+    soname_spec='${libname}`echo ${release} | $SED -e 's/[.]/-/g'`${versuffix}${shared_ext}'
+    library_names_spec='${libname}.dll.lib'
+
+    case $build_os in
+    mingw*)
+      sys_lib_search_path_spec=
+      lt_save_ifs=$IFS
+      IFS=';'
+      for lt_path in $LIB
+      do
+        IFS=$lt_save_ifs
+        # Let DOS variable expansion print the short 8.3 style file name.
+        lt_path=`cd "$lt_path" 2>/dev/null && cmd //C "for %i in (".") do @echo %~si"`
+        sys_lib_search_path_spec="$sys_lib_search_path_spec $lt_path"
+      done
+      IFS=$lt_save_ifs
+      # Convert to MSYS style.
+      sys_lib_search_path_spec=`$ECHO "$sys_lib_search_path_spec" | sed -e 's|\\\\|/|g' -e 's| \\([a-zA-Z]\\):| /\\1|g' -e 's|^ ||'`
+      ;;
+    cygwin*)
+      # Convert to unix form, then to dos form, then back to unix form
+      # but this time dos style (no spaces!) so that the unix form looks
+      # like /cygdrive/c/PROGRA~1:/cygdr...
+      sys_lib_search_path_spec=`cygpath --path --unix "$LIB"`
+      sys_lib_search_path_spec=`cygpath --path --dos "$sys_lib_search_path_spec" 2>/dev/null`
+      sys_lib_search_path_spec=`cygpath --path --unix "$sys_lib_search_path_spec" | $SED -e "s/$PATH_SEPARATOR/ /g"`
+      ;;
+    *)
+      sys_lib_search_path_spec="$LIB"
+      if $ECHO "$sys_lib_search_path_spec" | $GREP ';[c-zC-Z]:/' >/dev/null; then
+        # It is most probably a Windows format PATH.
+        sys_lib_search_path_spec=`$ECHO "$sys_lib_search_path_spec" | $SED -e 's/;/ /g'`
+      else
+        sys_lib_search_path_spec=`$ECHO "$sys_lib_search_path_spec" | $SED -e "s/$PATH_SEPARATOR/ /g"`
+      fi
+      # FIXME: find the short name or the path components, as spaces are
+      # common. (e.g. "Program Files" -> "PROGRA~1")
+      ;;
+    esac
+
+    # DLL is installed to $(libdir)/../bin by postinstall_cmds
+    postinstall_cmds='base_file=`basename \${file}`~
+      dlpath=`$SHELL 2>&1 -c '\''. $dir/'\''\${base_file}'\''i; echo \$dlname'\''`~
+      dldir=$destdir/`dirname \$dlpath`~
+      test -d \$dldir || mkdir -p \$dldir~
+      $install_prog $dir/$dlname \$dldir/$dlname'
+    postuninstall_cmds='dldll=`$SHELL 2>&1 -c '\''. $file; echo \$dlname'\''`~
+      dlpath=$dir/\$dldll~
+       $RM \$dlpath'
+    shlibpath_overrides_runpath=yes
+    dynamic_linker='Win32 link.exe'
     ;;
 
   *)
+    # Assume MSVC wrapper
     library_names_spec='${libname}`echo ${release} | $SED -e 's/[.]/-/g'`${versuffix}${shared_ext} $libname.lib'
+    dynamic_linker='Win32 ld.exe'
     ;;
   esac
-  dynamic_linker='Win32 ld.exe'
   # FIXME: first we should search . and the directory the executable is in
   shlibpath_var=PATH
   ;;
@@ -15376,7 +14756,7 @@ darwin* | rhapsody*)
   ;;
 
 dgux*)
-  version_type=linux
+  version_type=linux # correct to gnu/linux during the next big refactor
   need_lib_prefix=no
   need_version=no
   library_names_spec='${libname}${release}${shared_ext}$versuffix ${libname}${release}${shared_ext}$major $libname$shared_ext'
@@ -15384,10 +14764,6 @@ dgux*)
   shlibpath_var=LD_LIBRARY_PATH
   ;;
 
-freebsd1*)
-  dynamic_linker=no
-  ;;
-
 freebsd* | dragonfly*)
   # DragonFly does not have aout.  When/if they implement a new
   # versioning mechanism, adjust this.
@@ -15395,7 +14771,7 @@ freebsd* | dragonfly*)
     objformat=`/usr/bin/objformat`
   else
     case $host_os in
-    freebsd[123]*) objformat=aout ;;
+    freebsd[23].*) objformat=aout ;;
     *) objformat=elf ;;
     esac
   fi
@@ -15413,7 +14789,7 @@ freebsd* | dragonfly*)
   esac
   shlibpath_var=LD_LIBRARY_PATH
   case $host_os in
-  freebsd2*)
+  freebsd2.*)
     shlibpath_overrides_runpath=yes
     ;;
   freebsd3.[01]* | freebsdelf3.[01]*)
@@ -15433,12 +14809,26 @@ freebsd* | dragonfly*)
   ;;
 
 gnu*)
-  version_type=linux
+  version_type=linux # correct to gnu/linux during the next big refactor
   need_lib_prefix=no
   need_version=no
   library_names_spec='${libname}${release}${shared_ext}$versuffix ${libname}${release}${shared_ext}${major} ${libname}${shared_ext}'
   soname_spec='${libname}${release}${shared_ext}$major'
   shlibpath_var=LD_LIBRARY_PATH
+  shlibpath_overrides_runpath=no
+  hardcode_into_libs=yes
+  ;;
+
+haiku*)
+  version_type=linux # correct to gnu/linux during the next big refactor
+  need_lib_prefix=no
+  need_version=no
+  dynamic_linker="$host_os runtime_loader"
+  library_names_spec='${libname}${release}${shared_ext}$versuffix ${libname}${release}${shared_ext}${major} ${libname}${shared_ext}'
+  soname_spec='${libname}${release}${shared_ext}$major'
+  shlibpath_var=LIBRARY_PATH
+  shlibpath_overrides_runpath=yes
+  sys_lib_dlsearch_path_spec='/boot/home/config/lib /boot/common/lib /boot/system/lib'
   hardcode_into_libs=yes
   ;;
 
@@ -15484,12 +14874,14 @@ hpux9* | hpux10* | hpux11*)
     soname_spec='${libname}${release}${shared_ext}$major'
     ;;
   esac
-  # HP-UX runs *really* slowly unless shared libraries are mode 555.
+  # HP-UX runs *really* slowly unless shared libraries are mode 555, ...
   postinstall_cmds='chmod 555 $lib'
+  # or fails outright, so override atomically:
+  install_override_mode=555
   ;;
 
 interix[3-9]*)
-  version_type=linux
+  version_type=linux # correct to gnu/linux during the next big refactor
   need_lib_prefix=no
   need_version=no
   library_names_spec='${libname}${release}${shared_ext}$versuffix ${libname}${release}${shared_ext}$major ${libname}${shared_ext}'
@@ -15505,7 +14897,7 @@ irix5* | irix6* | nonstopux*)
     nonstopux*) version_type=nonstopux ;;
     *)
 	if test "$lt_cv_prog_gnu_ld" = yes; then
-		version_type=linux
+		version_type=linux # correct to gnu/linux during the next big refactor
 	else
 		version_type=irix
 	fi ;;
@@ -15542,9 +14934,9 @@ linux*oldld* | linux*aout* | linux*coff*)
   dynamic_linker=no
   ;;
 
-# This must be Linux ELF.
-linux* | k*bsd*-gnu)
-  version_type=linux
+# This must be glibc/ELF.
+linux* | k*bsd*-gnu | kopensolaris*-gnu)
+  version_type=linux # correct to gnu/linux during the next big refactor
   need_lib_prefix=no
   need_version=no
   library_names_spec='${libname}${release}${shared_ext}$versuffix ${libname}${release}${shared_ext}$major $libname${shared_ext}'
@@ -15552,16 +14944,17 @@ linux* | k*bsd*-gnu)
   finish_cmds='PATH="\$PATH:/sbin" ldconfig -n $libdir'
   shlibpath_var=LD_LIBRARY_PATH
   shlibpath_overrides_runpath=no
+
   # Some binutils ld are patched to set DT_RUNPATH
-  save_LDFLAGS=$LDFLAGS
-  save_libdir=$libdir
-  eval "libdir=/foo; wl=\"$lt_prog_compiler_wl_CXX\"; \
-       LDFLAGS=\"\$LDFLAGS $hardcode_libdir_flag_spec_CXX\""
-  cat >conftest.$ac_ext <<_ACEOF
-/* confdefs.h.  */
-_ACEOF
-cat confdefs.h >>conftest.$ac_ext
-cat >>conftest.$ac_ext <<_ACEOF
+  if ${lt_cv_shlibpath_overrides_runpath+:} false; then :
+  $as_echo_n "(cached) " >&6
+else
+  lt_cv_shlibpath_overrides_runpath=no
+    save_LDFLAGS=$LDFLAGS
+    save_libdir=$libdir
+    eval "libdir=/foo; wl=\"$lt_prog_compiler_wl_CXX\"; \
+	 LDFLAGS=\"\$LDFLAGS $hardcode_libdir_flag_spec_CXX\""
+    cat confdefs.h - <<_ACEOF >conftest.$ac_ext
 /* end confdefs.h.  */
 
 int
@@ -15572,43 +14965,19 @@ main ()
   return 0;
 }
 _ACEOF
-rm -f conftest.$ac_objext conftest$ac_exeext
-if { (ac_try="$ac_link"
-case "(($ac_try" in
-  *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
-  *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:$LINENO: $ac_try_echo\""
-$as_echo "$ac_try_echo") >&5
-  (eval "$ac_link") 2>conftest.er1
-  ac_status=$?
-  grep -v '^ *+' conftest.er1 >conftest.err
-  rm -f conftest.er1
-  cat conftest.err >&5
-  $as_echo "$as_me:$LINENO: \$? = $ac_status" >&5
-  (exit $ac_status); } && {
-	 test -z "$ac_cxx_werror_flag" ||
-	 test ! -s conftest.err
-       } && test -s conftest$ac_exeext && {
-	 test "$cross_compiling" = yes ||
-	 $as_test_x conftest$ac_exeext
-       }; then
-  if  ($OBJDUMP -p conftest$ac_exeext) 2>/dev/null | grep "RUNPATH.*$libdir" >/dev/null; then
-  shlibpath_overrides_runpath=yes
+if ac_fn_cxx_try_link "$LINENO"; then :
+  if  ($OBJDUMP -p conftest$ac_exeext) 2>/dev/null | grep "RUNPATH.*$libdir" >/dev/null; then :
+  lt_cv_shlibpath_overrides_runpath=yes
 fi
-
-else
-  $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
-
+fi
+rm -f core conftest.err conftest.$ac_objext \
+    conftest$ac_exeext conftest.$ac_ext
+    LDFLAGS=$save_LDFLAGS
+    libdir=$save_libdir
 
 fi
 
-rm -rf conftest.dSYM
-rm -f core conftest.err conftest.$ac_objext conftest_ipa8_conftest.oo \
-      conftest$ac_exeext conftest.$ac_ext
-  LDFLAGS=$save_LDFLAGS
-  libdir=$save_libdir
+  shlibpath_overrides_runpath=$lt_cv_shlibpath_overrides_runpath
 
   # This implies no fast_install, which is unacceptable.
   # Some rework will be needed to allow for fast_install
@@ -15620,8 +14989,9 @@ rm -f core conftest.err conftest.$ac_objext conftest_ipa8_conftest.oo \
 
   # Append ld.so.conf contents to the search path
   if test -f /etc/ld.so.conf; then
-    lt_ld_extra=`awk '/^include / { system(sprintf("cd /etc; cat %s 2>/dev/null", \$2)); skip = 1; } { if (!skip) print \$0; skip = 0; }' < /etc/ld.so.conf | $SED -e 's/#.*//;/^[	 ]*hwcap[	 ]/d;s/[:,	]/ /g;s/=[^=]*$//;s/=[^= ]* / /g;/^$/d' | tr '\n' ' '`
+    lt_ld_extra=`awk '/^include / { system(sprintf("cd /etc; cat %s 2>/dev/null", \$2)); skip = 1; } { if (!skip) print \$0; skip = 0; }' < /etc/ld.so.conf | $SED -e 's/#.*//;/^[	 ]*hwcap[	 ]/d;s/[:,	]/ /g;s/=[^=]*$//;s/=[^= ]* / /g;s/"//g;/^$/d' | tr '\n' ' '`
     sys_lib_dlsearch_path_spec="$sys_lib_dlsearch_path_spec $lt_ld_extra"
+
   fi
 
   # We used to test for /lib/ld.so.1 and disable shared libraries on
@@ -15652,7 +15022,7 @@ netbsd*)
   ;;
 
 newsos6)
-  version_type=linux
+  version_type=linux # correct to gnu/linux during the next big refactor
   library_names_spec='${libname}${release}${shared_ext}$versuffix ${libname}${release}${shared_ext}$major $libname${shared_ext}'
   shlibpath_var=LD_LIBRARY_PATH
   shlibpath_overrides_runpath=yes
@@ -15721,7 +15091,7 @@ rdos*)
   ;;
 
 solaris*)
-  version_type=linux
+  version_type=linux # correct to gnu/linux during the next big refactor
   need_lib_prefix=no
   need_version=no
   library_names_spec='${libname}${release}${shared_ext}$versuffix ${libname}${release}${shared_ext}$major $libname${shared_ext}'
@@ -15746,7 +15116,7 @@ sunos4*)
   ;;
 
 sysv4 | sysv4.3*)
-  version_type=linux
+  version_type=linux # correct to gnu/linux during the next big refactor
   library_names_spec='${libname}${release}${shared_ext}$versuffix ${libname}${release}${shared_ext}$major $libname${shared_ext}'
   soname_spec='${libname}${release}${shared_ext}$major'
   shlibpath_var=LD_LIBRARY_PATH
@@ -15770,7 +15140,7 @@ sysv4 | sysv4.3*)
 
 sysv4*MP*)
   if test -d /usr/nec ;then
-    version_type=linux
+    version_type=linux # correct to gnu/linux during the next big refactor
     library_names_spec='$libname${shared_ext}.$versuffix $libname${shared_ext}.$major $libname${shared_ext}'
     soname_spec='$libname${shared_ext}.$major'
     shlibpath_var=LD_LIBRARY_PATH
@@ -15801,7 +15171,7 @@ sysv5* | sco3.2v5* | sco5v6* | unixware* | OpenUNIX* | sysv4*uw2*)
 
 tpf*)
   # TPF is a cross-target only.  Preferred cross-host = GNU/Linux.
-  version_type=linux
+  version_type=linux # correct to gnu/linux during the next big refactor
   need_lib_prefix=no
   need_version=no
   library_names_spec='${libname}${release}${shared_ext}$versuffix ${libname}${release}${shared_ext}$major $libname${shared_ext}'
@@ -15811,7 +15181,7 @@ tpf*)
   ;;
 
 uts4*)
-  version_type=linux
+  version_type=linux # correct to gnu/linux during the next big refactor
   library_names_spec='${libname}${release}${shared_ext}$versuffix ${libname}${release}${shared_ext}$major $libname${shared_ext}'
   soname_spec='${libname}${release}${shared_ext}$major'
   shlibpath_var=LD_LIBRARY_PATH
@@ -15821,7 +15191,7 @@ uts4*)
   dynamic_linker=no
   ;;
 esac
-{ $as_echo "$as_me:$LINENO: result: $dynamic_linker" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $dynamic_linker" >&5
 $as_echo "$dynamic_linker" >&6; }
 test "$dynamic_linker" = no && can_build_shared=no
 
@@ -15872,88 +15242,329 @@ fi
 
 
 
-    { $as_echo "$as_me:$LINENO: checking how to hardcode library paths into programs" >&5
-$as_echo_n "checking how to hardcode library paths into programs... " >&6; }
-hardcode_action_CXX=
-if test -n "$hardcode_libdir_flag_spec_CXX" ||
-   test -n "$runpath_var_CXX" ||
-   test "X$hardcode_automatic_CXX" = "Xyes" ; then
 
-  # We can hardcode non-existent directories.
-  if test "$hardcode_direct_CXX" != no &&
-     # If the only mechanism to avoid hardcoding is shlibpath_var, we
-     # have to relink, otherwise we might link with an installed library
-     # when we should be linking with a yet-to-be-installed one
-     ## test "$_LT_TAGVAR(hardcode_shlibpath_var, CXX)" != no &&
-     test "$hardcode_minus_L_CXX" != no; then
-    # Linking always hardcodes the temporary library directory.
-    hardcode_action_CXX=relink
-  else
-    # We can link without hardcoding, and we can hardcode nonexisting dirs.
-    hardcode_action_CXX=immediate
-  fi
-else
-  # We cannot hardcode anything, or else we can only hardcode existing
-  # directories.
-  hardcode_action_CXX=unsupported
-fi
-{ $as_echo "$as_me:$LINENO: result: $hardcode_action_CXX" >&5
-$as_echo "$hardcode_action_CXX" >&6; }
 
-if test "$hardcode_action_CXX" = relink ||
-   test "$inherit_rpath_CXX" = yes; then
-  # Fast installation is not supported
-  enable_fast_install=no
-elif test "$shlibpath_overrides_runpath" = yes ||
-     test "$enable_shared" = no; then
-  # Fast installation is not necessary
-  enable_fast_install=needless
+    { $as_echo "$as_me:${as_lineno-$LINENO}: checking how to hardcode library paths into programs" >&5
+$as_echo_n "checking how to hardcode library paths into programs... " >&6; }
+hardcode_action_CXX=
+if test -n "$hardcode_libdir_flag_spec_CXX" ||
+   test -n "$runpath_var_CXX" ||
+   test "X$hardcode_automatic_CXX" = "Xyes" ; then
+
+  # We can hardcode non-existent directories.
+  if test "$hardcode_direct_CXX" != no &&
+     # If the only mechanism to avoid hardcoding is shlibpath_var, we
+     # have to relink, otherwise we might link with an installed library
+     # when we should be linking with a yet-to-be-installed one
+     ## test "$_LT_TAGVAR(hardcode_shlibpath_var, CXX)" != no &&
+     test "$hardcode_minus_L_CXX" != no; then
+    # Linking always hardcodes the temporary library directory.
+    hardcode_action_CXX=relink
+  else
+    # We can link without hardcoding, and we can hardcode nonexisting dirs.
+    hardcode_action_CXX=immediate
+  fi
+else
+  # We cannot hardcode anything, or else we can only hardcode existing
+  # directories.
+  hardcode_action_CXX=unsupported
+fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $hardcode_action_CXX" >&5
+$as_echo "$hardcode_action_CXX" >&6; }
+
+if test "$hardcode_action_CXX" = relink ||
+   test "$inherit_rpath_CXX" = yes; then
+  # Fast installation is not supported
+  enable_fast_install=no
+elif test "$shlibpath_overrides_runpath" = yes ||
+     test "$enable_shared" = no; then
+  # Fast installation is not necessary
+  enable_fast_install=needless
+fi
+
+
+
+
+
+
+
+  fi # test -n "$compiler"
+
+  CC=$lt_save_CC
+  CFLAGS=$lt_save_CFLAGS
+  LDCXX=$LD
+  LD=$lt_save_LD
+  GCC=$lt_save_GCC
+  with_gnu_ld=$lt_save_with_gnu_ld
+  lt_cv_path_LDCXX=$lt_cv_path_LD
+  lt_cv_path_LD=$lt_save_path_LD
+  lt_cv_prog_gnu_ldcxx=$lt_cv_prog_gnu_ld
+  lt_cv_prog_gnu_ld=$lt_save_with_gnu_ld
+fi # test "$_lt_caught_CXX_error" != yes
+
+ac_ext=cpp
+ac_cpp='$CXXCPP $CPPFLAGS'
+ac_compile='$CXX -c $CXXFLAGS $CPPFLAGS conftest.$ac_ext >&5'
+ac_link='$CXX -o conftest$ac_exeext $CXXFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
+ac_compiler_gnu=$ac_cv_cxx_compiler_gnu
+
+
+
+
+
+ac_config_files="$ac_config_files Makefile tests/compat.sh jellyfish-1.1.pc"
+
+
+
+if test "x$MD5" = "x"; then :
+  # Extract the first word of "md5sum", so it can be a program name with args.
+set dummy md5sum; ac_word=$2
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
+$as_echo_n "checking for $ac_word... " >&6; }
+if ${ac_cv_prog_MD5+:} false; then :
+  $as_echo_n "(cached) " >&6
+else
+  if test -n "$MD5"; then
+  ac_cv_prog_MD5="$MD5" # Let the user override the test.
+else
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+  IFS=$as_save_IFS
+  test -z "$as_dir" && as_dir=.
+    for ac_exec_ext in '' $ac_executable_extensions; do
+  if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
+    ac_cv_prog_MD5="md5sum"
+    $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
+    break 2
+  fi
+done
+  done
+IFS=$as_save_IFS
+
+fi
+fi
+MD5=$ac_cv_prog_MD5
+if test -n "$MD5"; then
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $MD5" >&5
+$as_echo "$MD5" >&6; }
+else
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
+$as_echo "no" >&6; }
+fi
+
+
+fi
+if test "x$MD5" = "x"; then :
+  # Extract the first word of "md5", so it can be a program name with args.
+set dummy md5; ac_word=$2
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
+$as_echo_n "checking for $ac_word... " >&6; }
+if ${ac_cv_prog_MD5+:} false; then :
+  $as_echo_n "(cached) " >&6
+else
+  if test -n "$MD5"; then
+  ac_cv_prog_MD5="$MD5" # Let the user override the test.
+else
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+  IFS=$as_save_IFS
+  test -z "$as_dir" && as_dir=.
+    for ac_exec_ext in '' $ac_executable_extensions; do
+  if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then
+    ac_cv_prog_MD5="md5 -r"
+    $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
+    break 2
+  fi
+done
+  done
+IFS=$as_save_IFS
+
+fi
+fi
+MD5=$ac_cv_prog_MD5
+if test -n "$MD5"; then
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: $MD5" >&5
+$as_echo "$MD5" >&6; }
+else
+  { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
+$as_echo "no" >&6; }
+fi
+
+
+fi
+if test "x$MD5" = "x"; then :
+  as_fn_error $? "Could not find md5 hashing program in your path" "$LINENO" 5
+fi
+
+
+# Check whether --with-sse was given.
+if test "${with_sse+set}" = set; then :
+  withval=$with_sse;
+else
+  with_sse=no
+fi
+
+if test "x$with_sse" != xno; then :
+
+$as_echo "#define HAVE_SSE 1" >>confdefs.h
+
+fi
+
+
+# Check whether --with-half was given.
+if test "${with_half+set}" = set; then :
+  withval=$with_half;
+else
+  with_half=no
+fi
+
+if test "x$with_half" = "xyes"; then :
+
+$as_echo "#define HALF_FLOATS 1" >>confdefs.h
+
+fi
+
+ac_fn_cxx_check_type "$LINENO" "__int128" "ac_cv_type___int128" "$ac_includes_default"
+if test "x$ac_cv_type___int128" = xyes; then :
+
+$as_echo "#define HAVE_INT128 1" >>confdefs.h
+
 fi
 
 
 
+# Check the version of strerror_r
+ac_fn_cxx_check_decl "$LINENO" "strerror_r" "ac_cv_have_decl_strerror_r" "$ac_includes_default"
+if test "x$ac_cv_have_decl_strerror_r" = xyes; then :
+  ac_have_decl=1
+else
+  ac_have_decl=0
+fi
 
+cat >>confdefs.h <<_ACEOF
+#define HAVE_DECL_STRERROR_R $ac_have_decl
+_ACEOF
 
+for ac_func in strerror_r
+do :
+  ac_fn_cxx_check_func "$LINENO" "strerror_r" "ac_cv_func_strerror_r"
+if test "x$ac_cv_func_strerror_r" = xyes; then :
+  cat >>confdefs.h <<_ACEOF
+#define HAVE_STRERROR_R 1
+_ACEOF
 
+fi
+done
 
-  fi # test -n "$compiler"
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking whether strerror_r returns char *" >&5
+$as_echo_n "checking whether strerror_r returns char *... " >&6; }
+if ${ac_cv_func_strerror_r_char_p+:} false; then :
+  $as_echo_n "(cached) " >&6
+else
 
-  CC=$lt_save_CC
-  LDCXX=$LD
-  LD=$lt_save_LD
-  GCC=$lt_save_GCC
-  with_gnu_ld=$lt_save_with_gnu_ld
-  lt_cv_path_LDCXX=$lt_cv_path_LD
-  lt_cv_path_LD=$lt_save_path_LD
-  lt_cv_prog_gnu_ldcxx=$lt_cv_prog_gnu_ld
-  lt_cv_prog_gnu_ld=$lt_save_with_gnu_ld
-fi # test "$_lt_caught_CXX_error" != yes
+    ac_cv_func_strerror_r_char_p=no
+    if test $ac_cv_have_decl_strerror_r = yes; then
+      cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+$ac_includes_default
+int
+main ()
+{
 
-ac_ext=c
-ac_cpp='$CPP $CPPFLAGS'
-ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
-ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
-ac_compiler_gnu=$ac_cv_c_compiler_gnu
+	  char buf[100];
+	  char x = *strerror_r (0, buf, sizeof buf);
+	  char *p = strerror_r (0, buf, sizeof buf);
+	  return !p || x;
 
+  ;
+  return 0;
+}
+_ACEOF
+if ac_fn_cxx_try_compile "$LINENO"; then :
+  ac_cv_func_strerror_r_char_p=yes
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
+    else
+      # strerror_r is not declared.  Choose between
+      # systems that have relatively inaccessible declarations for the
+      # function.  BeOS and DEC UNIX 4.0 fall in this category, but the
+      # former has a strerror_r that returns char*, while the latter
+      # has a strerror_r that returns `int'.
+      # This test should segfault on the DEC system.
+      if test "$cross_compiling" = yes; then :
+  :
+else
+  cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h.  */
+$ac_includes_default
+	extern char *strerror_r ();
+int
+main ()
+{
+char buf[100];
+	  char x = *strerror_r (0, buf, sizeof buf);
+	  return ! isalpha (x);
+  ;
+  return 0;
+}
+_ACEOF
+if ac_fn_cxx_try_run "$LINENO"; then :
+  ac_cv_func_strerror_r_char_p=yes
+fi
+rm -f core *.core core.conftest.* gmon.out bb.out conftest$ac_exeext \
+  conftest.$ac_objext conftest.beam conftest.$ac_ext
+fi
 
+    fi
 
+fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_func_strerror_r_char_p" >&5
+$as_echo "$ac_cv_func_strerror_r_char_p" >&6; }
+if test $ac_cv_func_strerror_r_char_p = yes; then
 
+$as_echo "#define STRERROR_R_CHAR_P 1" >>confdefs.h
 
+fi
 
 
 
+for ac_header in execinfo.h sys/syscall.h
+do :
+  as_ac_Header=`$as_echo "ac_cv_header_$ac_header" | $as_tr_sh`
+ac_fn_cxx_check_header_mongrel "$LINENO" "$ac_header" "$as_ac_Header" "$ac_includes_default"
+if eval test \"x\$"$as_ac_Header"\" = x"yes"; then :
+  cat >>confdefs.h <<_ACEOF
+#define `$as_echo "HAVE_$ac_header" | $as_tr_cpp` 1
+_ACEOF
 
+fi
 
+done
 
 
+ac_fn_cxx_check_member "$LINENO" "siginfo_t" "si_int" "ac_cv_member_siginfo_t_si_int" "#include <signal.h>
+"
+if test "x$ac_cv_member_siginfo_t_si_int" = xyes; then :
 
-        ac_config_commands="$ac_config_commands libtool"
+$as_echo "#define HAVE_SI_INT 1" >>confdefs.h
 
+fi
 
 
+# --enable-all-static
+# Do not use libtool if building all static
+# Check whether --enable-all-static was given.
+if test "${enable_all_static+set}" = set; then :
+  enableval=$enable_all_static;
+fi
 
-# Only expand once:
+STATIC_FLAGS=
+if test x$enable_all_static = xyes; then :
+  STATIC_FLAGS=-all-static
 
+fi
 
 cat >confcache <<\_ACEOF
 # This file is a shell script that caches the results of configure
@@ -15982,13 +15593,13 @@ _ACEOF
     case $ac_val in #(
     *${as_nl}*)
       case $ac_var in #(
-      *_cv_*) { $as_echo "$as_me:$LINENO: WARNING: cache variable $ac_var contains a newline" >&5
+      *_cv_*) { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: cache variable $ac_var contains a newline" >&5
 $as_echo "$as_me: WARNING: cache variable $ac_var contains a newline" >&2;} ;;
       esac
       case $ac_var in #(
       _ | IFS | as_nl) ;; #(
       BASH_ARGV | BASH_SOURCE) eval $ac_var= ;; #(
-      *) $as_unset $ac_var ;;
+      *) { eval $ac_var=; unset $ac_var;} ;;
       esac ;;
     esac
   done
@@ -15996,8 +15607,8 @@ $as_echo "$as_me: WARNING: cache variable $ac_var contains a newline" >&2;} ;;
   (set) 2>&1 |
     case $as_nl`(ac_space=' '; set) 2>&1` in #(
     *${as_nl}ac_space=\ *)
-      # `set' does not quote correctly, so add quotes (double-quote
-      # substitution turns \\\\ into \\, and sed turns \\ into \).
+      # `set' does not quote correctly, so add quotes: double-quote
+      # substitution turns \\\\ into \\, and sed turns \\ into \.
       sed -n \
 	"s/'/'\\\\''/g;
 	  s/^\\([_$as_cr_alnum]*_cv_[_$as_cr_alnum]*\\)=\\(.*\\)/\\1='\\2'/p"
@@ -16019,12 +15630,23 @@ $as_echo "$as_me: WARNING: cache variable $ac_var contains a newline" >&2;} ;;
      :end' >>confcache
 if diff "$cache_file" confcache >/dev/null 2>&1; then :; else
   if test -w "$cache_file"; then
-    test "x$cache_file" != "x/dev/null" &&
-      { $as_echo "$as_me:$LINENO: updating cache $cache_file" >&5
+    if test "x$cache_file" != "x/dev/null"; then
+      { $as_echo "$as_me:${as_lineno-$LINENO}: updating cache $cache_file" >&5
 $as_echo "$as_me: updating cache $cache_file" >&6;}
-    cat confcache >$cache_file
+      if test ! -f "$cache_file" || test -h "$cache_file"; then
+	cat confcache >"$cache_file"
+      else
+        case $cache_file in #(
+        */* | ?:*)
+	  mv -f confcache "$cache_file"$$ &&
+	  mv -f "$cache_file"$$ "$cache_file" ;; #(
+        *)
+	  mv -f confcache "$cache_file" ;;
+	esac
+      fi
+    fi
   else
-    { $as_echo "$as_me:$LINENO: not updating unwritable cache $cache_file" >&5
+    { $as_echo "$as_me:${as_lineno-$LINENO}: not updating unwritable cache $cache_file" >&5
 $as_echo "$as_me: not updating unwritable cache $cache_file" >&6;}
   fi
 fi
@@ -16038,14 +15660,15 @@ DEFS=-DHAVE_CONFIG_H
 
 ac_libobjs=
 ac_ltlibobjs=
+U=
 for ac_i in : $LIBOBJS; do test "x$ac_i" = x: && continue
   # 1. Remove the extension, and $U if already installed.
   ac_script='s/\$U\././;s/\.o$//;s/\.obj$//'
   ac_i=`$as_echo "$ac_i" | sed "$ac_script"`
   # 2. Prepend LIBOBJDIR.  When used with automake>=1.10 LIBOBJDIR
   #    will be set to the directory where LIBOBJS objects are built.
-  ac_libobjs="$ac_libobjs \${LIBOBJDIR}$ac_i\$U.$ac_objext"
-  ac_ltlibobjs="$ac_ltlibobjs \${LIBOBJDIR}$ac_i"'$U.lo'
+  as_fn_append ac_libobjs " \${LIBOBJDIR}$ac_i\$U.$ac_objext"
+  as_fn_append ac_ltlibobjs " \${LIBOBJDIR}$ac_i"'$U.lo'
 done
 LIBOBJS=$ac_libobjs
 
@@ -16061,41 +15684,26 @@ else
 fi
 
 if test -z "${AMDEP_TRUE}" && test -z "${AMDEP_FALSE}"; then
-  { { $as_echo "$as_me:$LINENO: error: conditional \"AMDEP\" was never defined.
-Usually this means the macro was only invoked conditionally." >&5
-$as_echo "$as_me: error: conditional \"AMDEP\" was never defined.
-Usually this means the macro was only invoked conditionally." >&2;}
-   { (exit 1); exit 1; }; }
-fi
-if test -z "${am__fastdepCXX_TRUE}" && test -z "${am__fastdepCXX_FALSE}"; then
-  { { $as_echo "$as_me:$LINENO: error: conditional \"am__fastdepCXX\" was never defined.
-Usually this means the macro was only invoked conditionally." >&5
-$as_echo "$as_me: error: conditional \"am__fastdepCXX\" was never defined.
-Usually this means the macro was only invoked conditionally." >&2;}
-   { (exit 1); exit 1; }; }
+  as_fn_error $? "conditional \"AMDEP\" was never defined.
+Usually this means the macro was only invoked conditionally." "$LINENO" 5
 fi
 if test -z "${am__fastdepCC_TRUE}" && test -z "${am__fastdepCC_FALSE}"; then
-  { { $as_echo "$as_me:$LINENO: error: conditional \"am__fastdepCC\" was never defined.
-Usually this means the macro was only invoked conditionally." >&5
-$as_echo "$as_me: error: conditional \"am__fastdepCC\" was never defined.
-Usually this means the macro was only invoked conditionally." >&2;}
-   { (exit 1); exit 1; }; }
+  as_fn_error $? "conditional \"am__fastdepCC\" was never defined.
+Usually this means the macro was only invoked conditionally." "$LINENO" 5
 fi
 if test -z "${am__fastdepCXX_TRUE}" && test -z "${am__fastdepCXX_FALSE}"; then
-  { { $as_echo "$as_me:$LINENO: error: conditional \"am__fastdepCXX\" was never defined.
-Usually this means the macro was only invoked conditionally." >&5
-$as_echo "$as_me: error: conditional \"am__fastdepCXX\" was never defined.
-Usually this means the macro was only invoked conditionally." >&2;}
-   { (exit 1); exit 1; }; }
+  as_fn_error $? "conditional \"am__fastdepCXX\" was never defined.
+Usually this means the macro was only invoked conditionally." "$LINENO" 5
 fi
 
-: ${CONFIG_STATUS=./config.status}
+: "${CONFIG_STATUS=./config.status}"
 ac_write_fail=0
 ac_clean_files_save=$ac_clean_files
 ac_clean_files="$ac_clean_files $CONFIG_STATUS"
-{ $as_echo "$as_me:$LINENO: creating $CONFIG_STATUS" >&5
+{ $as_echo "$as_me:${as_lineno-$LINENO}: creating $CONFIG_STATUS" >&5
 $as_echo "$as_me: creating $CONFIG_STATUS" >&6;}
-cat >$CONFIG_STATUS <<_ACEOF || ac_write_fail=1
+as_write_fail=0
+cat >$CONFIG_STATUS <<_ASEOF || as_write_fail=1
 #! $SHELL
 # Generated by $as_me.
 # Run this file to recreate the current configuration.
@@ -16105,17 +15713,18 @@ cat >$CONFIG_STATUS <<_ACEOF || ac_write_fail=1
 debug=false
 ac_cs_recheck=false
 ac_cs_silent=false
-SHELL=\${CONFIG_SHELL-$SHELL}
-_ACEOF
 
-cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1
-## --------------------- ##
-## M4sh Initialization.  ##
-## --------------------- ##
+SHELL=\${CONFIG_SHELL-$SHELL}
+export SHELL
+_ASEOF
+cat >>$CONFIG_STATUS <<\_ASEOF || as_write_fail=1
+## -------------------- ##
+## M4sh Initialization. ##
+## -------------------- ##
 
 # Be more Bourne compatible
 DUALCASE=1; export DUALCASE # for MKS sh
-if test -n "${ZSH_VERSION+set}" && (emulate sh) >/dev/null 2>&1; then
+if test -n "${ZSH_VERSION+set}" && (emulate sh) >/dev/null 2>&1; then :
   emulate sh
   NULLCMD=:
   # Pre-4.2 versions of Zsh do word splitting on ${1+"$@"}, which
@@ -16123,23 +15732,15 @@ if test -n "${ZSH_VERSION+set}" && (emulate sh) >/dev/null 2>&1; then
   alias -g '${1+"$@"}'='"$@"'
   setopt NO_GLOB_SUBST
 else
-  case `(set -o) 2>/dev/null` in
-  *posix*) set -o posix ;;
+  case `(set -o) 2>/dev/null` in #(
+  *posix*) :
+    set -o posix ;; #(
+  *) :
+     ;;
 esac
-
 fi
 
 
-
-
-# PATH needs CR
-# Avoid depending upon Character Ranges.
-as_cr_letters='abcdefghijklmnopqrstuvwxyz'
-as_cr_LETTERS='ABCDEFGHIJKLMNOPQRSTUVWXYZ'
-as_cr_Letters=$as_cr_letters$as_cr_LETTERS
-as_cr_digits='0123456789'
-as_cr_alnum=$as_cr_Letters$as_cr_digits
-
 as_nl='
 '
 export as_nl
@@ -16147,7 +15748,13 @@ export as_nl
 as_echo='\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\'
 as_echo=$as_echo$as_echo$as_echo$as_echo$as_echo
 as_echo=$as_echo$as_echo$as_echo$as_echo$as_echo$as_echo
-if (test "X`printf %s $as_echo`" = "X$as_echo") 2>/dev/null; then
+# Prefer a ksh shell builtin over an external printf program on Solaris,
+# but without wasting forks for bash or zsh.
+if test -z "$BASH_VERSION$ZSH_VERSION" \
+    && (test "X`print -r -- $as_echo`" = "X$as_echo") 2>/dev/null; then
+  as_echo='print -r --'
+  as_echo_n='print -rn --'
+elif (test "X`printf %s $as_echo`" = "X$as_echo") 2>/dev/null; then
   as_echo='printf %s\n'
   as_echo_n='printf %s'
 else
@@ -16158,7 +15765,7 @@ else
     as_echo_body='eval expr "X$1" : "X\\(.*\\)"'
     as_echo_n_body='eval
       arg=$1;
-      case $arg in
+      case $arg in #(
       *"$as_nl"*)
 	expr "X$arg" : "X\\(.*\\)$as_nl";
 	arg=`expr "X$arg" : ".*$as_nl\\(.*\\)"`;;
@@ -16181,13 +15788,6 @@ if test "${PATH_SEPARATOR+set}" != set; then
   }
 fi
 
-# Support unset when possible.
-if ( (MAIL=60; unset MAIL) || exit) >/dev/null 2>&1; then
-  as_unset=unset
-else
-  as_unset=false
-fi
-
 
 # IFS
 # We need space, tab and new line, in precisely that order.  Quoting is
@@ -16197,15 +15797,16 @@ fi
 IFS=" ""	$as_nl"
 
 # Find who we are.  Look in the path if we contain no directory separator.
-case $0 in
+as_myself=
+case $0 in #((
   *[\\/]* ) as_myself=$0 ;;
   *) as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
 for as_dir in $PATH
 do
   IFS=$as_save_IFS
   test -z "$as_dir" && as_dir=.
-  test -r "$as_dir/$0" && as_myself=$as_dir/$0 && break
-done
+    test -r "$as_dir/$0" && as_myself=$as_dir/$0 && break
+  done
 IFS=$as_save_IFS
 
      ;;
@@ -16217,12 +15818,16 @@ if test "x$as_myself" = x; then
 fi
 if test ! -f "$as_myself"; then
   $as_echo "$as_myself: error: cannot find myself; rerun with an absolute file name" >&2
-  { (exit 1); exit 1; }
+  exit 1
 fi
 
-# Work around bugs in pre-3.0 UWIN ksh.
-for as_var in ENV MAIL MAILPATH
-do ($as_unset $as_var) >/dev/null 2>&1 && $as_unset $as_var
+# Unset variables that we do not need and which cause bugs (e.g. in
+# pre-3.0 UWIN ksh).  But do not cause bugs in bash 2.01; the "|| exit 1"
+# suppresses any "Segmentation fault" message there.  '((' could
+# trigger a bug in pdksh 5.2.14.
+for as_var in BASH_ENV ENV MAIL MAILPATH
+do eval test x\${$as_var+set} = xset \
+  && ( (unset $as_var) || exit 1) >/dev/null 2>&1 && unset $as_var || :
 done
 PS1='$ '
 PS2='> '
@@ -16234,7 +15839,89 @@ export LC_ALL
 LANGUAGE=C
 export LANGUAGE
 
-# Required to use basename.
+# CDPATH.
+(unset CDPATH) >/dev/null 2>&1 && unset CDPATH
+
+
+# as_fn_error STATUS ERROR [LINENO LOG_FD]
+# ----------------------------------------
+# Output "`basename $0`: error: ERROR" to stderr. If LINENO and LOG_FD are
+# provided, also output the error to LOG_FD, referencing LINENO. Then exit the
+# script with STATUS, using 1 if that was 0.
+as_fn_error ()
+{
+  as_status=$1; test $as_status -eq 0 && as_status=1
+  if test "$4"; then
+    as_lineno=${as_lineno-"$3"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
+    $as_echo "$as_me:${as_lineno-$LINENO}: error: $2" >&$4
+  fi
+  $as_echo "$as_me: error: $2" >&2
+  as_fn_exit $as_status
+} # as_fn_error
+
+
+# as_fn_set_status STATUS
+# -----------------------
+# Set $? to STATUS, without forking.
+as_fn_set_status ()
+{
+  return $1
+} # as_fn_set_status
+
+# as_fn_exit STATUS
+# -----------------
+# Exit the shell with STATUS, even in a "trap 0" or "set -e" context.
+as_fn_exit ()
+{
+  set +e
+  as_fn_set_status $1
+  exit $1
+} # as_fn_exit
+
+# as_fn_unset VAR
+# ---------------
+# Portably unset VAR.
+as_fn_unset ()
+{
+  { eval $1=; unset $1;}
+}
+as_unset=as_fn_unset
+# as_fn_append VAR VALUE
+# ----------------------
+# Append the text in VALUE to the end of the definition contained in VAR. Take
+# advantage of any shell optimizations that allow amortized linear growth over
+# repeated appends, instead of the typical quadratic growth present in naive
+# implementations.
+if (eval "as_var=1; as_var+=2; test x\$as_var = x12") 2>/dev/null; then :
+  eval 'as_fn_append ()
+  {
+    eval $1+=\$2
+  }'
+else
+  as_fn_append ()
+  {
+    eval $1=\$$1\$2
+  }
+fi # as_fn_append
+
+# as_fn_arith ARG...
+# ------------------
+# Perform arithmetic evaluation on the ARGs, and store the result in the
+# global $as_val. Take advantage of shells that can avoid forks. The arguments
+# must be portable across $(()) and expr.
+if (eval "test \$(( 1 + 1 )) = 2") 2>/dev/null; then :
+  eval 'as_fn_arith ()
+  {
+    as_val=$(( $* ))
+  }'
+else
+  as_fn_arith ()
+  {
+    as_val=`expr "$@" || test $? -eq 1`
+  }
+fi # as_fn_arith
+
+
 if expr a : '\(a\)' >/dev/null 2>&1 &&
    test "X`expr 00001 : '.*\(...\)'`" = X001; then
   as_expr=expr
@@ -16248,8 +15935,12 @@ else
   as_basename=false
 fi
 
+if (as_dir=`dirname -- /` && test "X$as_dir" = X/) >/dev/null 2>&1; then
+  as_dirname=dirname
+else
+  as_dirname=false
+fi
 
-# Name of the executable.
 as_me=`$as_basename -- "$0" ||
 $as_expr X/"$0" : '.*/\([^/][^/]*\)/*$' \| \
 	 X"$0" : 'X\(//\)$' \| \
@@ -16269,76 +15960,25 @@ $as_echo X/"$0" |
 	  }
 	  s/.*/./; q'`
 
-# CDPATH.
-$as_unset CDPATH
-
-
-
-  as_lineno_1=$LINENO
-  as_lineno_2=$LINENO
-  test "x$as_lineno_1" != "x$as_lineno_2" &&
-  test "x`expr $as_lineno_1 + 1`" = "x$as_lineno_2" || {
-
-  # Create $as_me.lineno as a copy of $as_myself, but with $LINENO
-  # uniformly replaced by the line number.  The first 'sed' inserts a
-  # line-number line after each line using $LINENO; the second 'sed'
-  # does the real work.  The second script uses 'N' to pair each
-  # line-number line with the line containing $LINENO, and appends
-  # trailing '-' during substitution so that $LINENO is not a special
-  # case at line end.
-  # (Raja R Harinath suggested sed '=', and Paul Eggert wrote the
-  # scripts with optimization help from Paolo Bonzini.  Blame Lee
-  # E. McMahon (1931-1989) for sed's syntax.  :-)
-  sed -n '
-    p
-    /[$]LINENO/=
-  ' <$as_myself |
-    sed '
-      s/[$]LINENO.*/&-/
-      t lineno
-      b
-      :lineno
-      N
-      :loop
-      s/[$]LINENO\([^'$as_cr_alnum'_].*\n\)\(.*\)/\2\1\2/
-      t loop
-      s/-\n.*//
-    ' >$as_me.lineno &&
-  chmod +x "$as_me.lineno" ||
-    { $as_echo "$as_me: error: cannot create $as_me.lineno; rerun with a POSIX shell" >&2
-   { (exit 1); exit 1; }; }
-
-  # Don't try to exec as it changes $[0], causing all sort of problems
-  # (the dirname of $[0] is not the place where we might find the
-  # original and so on.  Autoconf is especially sensitive to this).
-  . "./$as_me.lineno"
-  # Exit status is that of the last command.
-  exit
-}
-
-
-if (as_dir=`dirname -- /` && test "X$as_dir" = X/) >/dev/null 2>&1; then
-  as_dirname=dirname
-else
-  as_dirname=false
-fi
+# Avoid depending upon Character Ranges.
+as_cr_letters='abcdefghijklmnopqrstuvwxyz'
+as_cr_LETTERS='ABCDEFGHIJKLMNOPQRSTUVWXYZ'
+as_cr_Letters=$as_cr_letters$as_cr_LETTERS
+as_cr_digits='0123456789'
+as_cr_alnum=$as_cr_Letters$as_cr_digits
 
 ECHO_C= ECHO_N= ECHO_T=
-case `echo -n x` in
+case `echo -n x` in #(((((
 -n*)
-  case `echo 'x\c'` in
+  case `echo 'xy\c'` in
   *c*) ECHO_T='	';;	# ECHO_T is single tab character.
-  *)   ECHO_C='\c';;
+  xy)  ECHO_C='\c';;
+  *)   echo `echo ksh88 bug on AIX 6.1` > /dev/null
+       ECHO_T='	';;
   esac;;
 *)
   ECHO_N='-n';;
 esac
-if expr a : '\(a\)' >/dev/null 2>&1 &&
-   test "X`expr 00001 : '.*\(...\)'`" = X001; then
-  as_expr=expr
-else
-  as_expr=false
-fi
 
 rm -f conf$$ conf$$.exe conf$$.file
 if test -d conf$$.dir; then
@@ -16367,8 +16007,56 @@ fi
 rm -f conf$$ conf$$.exe conf$$.dir/conf$$.file conf$$.file
 rmdir conf$$.dir 2>/dev/null
 
+
+# as_fn_mkdir_p
+# -------------
+# Create "$as_dir" as a directory, including parents if necessary.
+as_fn_mkdir_p ()
+{
+
+  case $as_dir in #(
+  -*) as_dir=./$as_dir;;
+  esac
+  test -d "$as_dir" || eval $as_mkdir_p || {
+    as_dirs=
+    while :; do
+      case $as_dir in #(
+      *\'*) as_qdir=`$as_echo "$as_dir" | sed "s/'/'\\\\\\\\''/g"`;; #'(
+      *) as_qdir=$as_dir;;
+      esac
+      as_dirs="'$as_qdir' $as_dirs"
+      as_dir=`$as_dirname -- "$as_dir" ||
+$as_expr X"$as_dir" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \
+	 X"$as_dir" : 'X\(//\)[^/]' \| \
+	 X"$as_dir" : 'X\(//\)$' \| \
+	 X"$as_dir" : 'X\(/\)' \| . 2>/dev/null ||
+$as_echo X"$as_dir" |
+    sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{
+	    s//\1/
+	    q
+	  }
+	  /^X\(\/\/\)[^/].*/{
+	    s//\1/
+	    q
+	  }
+	  /^X\(\/\/\)$/{
+	    s//\1/
+	    q
+	  }
+	  /^X\(\/\).*/{
+	    s//\1/
+	    q
+	  }
+	  s/.*/./; q'`
+      test -d "$as_dir" && break
+    done
+    test -z "$as_dirs" || eval "mkdir $as_dirs"
+  } || test -d "$as_dir" || as_fn_error $? "cannot create directory $as_dir"
+
+
+} # as_fn_mkdir_p
 if mkdir -p . 2>/dev/null; then
-  as_mkdir_p=:
+  as_mkdir_p='mkdir -p "$as_dir"'
 else
   test -d ./-p && rmdir ./-p
   as_mkdir_p=false
@@ -16387,10 +16075,10 @@ else
       if test -d "$1"; then
 	test -d "$1/.";
       else
-	case $1 in
+	case $1 in #(
 	-*)set "./$1";;
 	esac;
-	case `ls -ld'$as_ls_L_option' "$1" 2>/dev/null` in
+	case `ls -ld'$as_ls_L_option' "$1" 2>/dev/null` in #((
 	???[sx]*):;;*)false;;esac;fi
     '\'' sh
   '
@@ -16405,13 +16093,19 @@ as_tr_sh="eval sed 'y%*+%pp%;s%[^_$as_cr_alnum]%_%g'"
 
 
 exec 6>&1
+## ----------------------------------- ##
+## Main body of $CONFIG_STATUS script. ##
+## ----------------------------------- ##
+_ASEOF
+test $as_write_fail = 0 && chmod +x $CONFIG_STATUS || ac_write_fail=1
 
-# Save the log message, to keep $[0] and so on meaningful, and to
+cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1
+# Save the log message, to keep $0 and so on meaningful, and to
 # report actual input values of CONFIG_FILES etc. instead of their
 # values after options handling.
 ac_log="
-This file was extended by jellyfish $as_me 1.1.5, which was
-generated by GNU Autoconf 2.63.  Invocation command line was
+This file was extended by jellyfish $as_me 1.1.11, which was
+generated by GNU Autoconf 2.68.  Invocation command line was
 
   CONFIG_FILES    = $CONFIG_FILES
   CONFIG_HEADERS  = $CONFIG_HEADERS
@@ -16443,13 +16137,15 @@ _ACEOF
 
 cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1
 ac_cs_usage="\
-\`$as_me' instantiates files from templates according to the
-current configuration.
+\`$as_me' instantiates files and other configuration actions
+from templates according to the current configuration.  Unless the files
+and actions are specified as TAGs, all are instantiated by default.
 
-Usage: $0 [OPTION]... [FILE]...
+Usage: $0 [OPTION]... [TAG]...
 
   -h, --help       print this help, then exit
   -V, --version    print version number and configuration settings, then exit
+      --config     print configuration, then exit
   -q, --quiet, --silent
                    do not print progress messages
   -d, --debug      don't remove temporary files
@@ -16468,16 +16164,17 @@ $config_headers
 Configuration commands:
 $config_commands
 
-Report bugs to <bug-autoconf at gnu.org>."
+Report bugs to <gmarcais at umd.edu>."
 
 _ACEOF
 cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1
+ac_cs_config="`$as_echo "$ac_configure_args" | sed 's/^ //; s/[\\""\`\$]/\\\\&/g'`"
 ac_cs_version="\\
-jellyfish config.status 1.1.5
-configured by $0, generated by GNU Autoconf 2.63,
-  with options \\"`$as_echo "$ac_configure_args" | sed 's/^ //; s/[\\""\`\$]/\\\\&/g'`\\"
+jellyfish config.status 1.1.11
+configured by $0, generated by GNU Autoconf 2.68,
+  with options \\"\$ac_cs_config\\"
 
-Copyright (C) 2008 Free Software Foundation, Inc.
+Copyright (C) 2010 Free Software Foundation, Inc.
 This config.status script is free software; the Free Software Foundation
 gives unlimited permission to copy, distribute and modify it."
 
@@ -16495,11 +16192,16 @@ ac_need_defaults=:
 while test $# != 0
 do
   case $1 in
-  --*=*)
+  --*=?*)
     ac_option=`expr "X$1" : 'X\([^=]*\)='`
     ac_optarg=`expr "X$1" : 'X[^=]*=\(.*\)'`
     ac_shift=:
     ;;
+  --*=)
+    ac_option=`expr "X$1" : 'X\([^=]*\)='`
+    ac_optarg=
+    ac_shift=:
+    ;;
   *)
     ac_option=$1
     ac_optarg=$2
@@ -16513,27 +16215,29 @@ do
     ac_cs_recheck=: ;;
   --version | --versio | --versi | --vers | --ver | --ve | --v | -V )
     $as_echo "$ac_cs_version"; exit ;;
+  --config | --confi | --conf | --con | --co | --c )
+    $as_echo "$ac_cs_config"; exit ;;
   --debug | --debu | --deb | --de | --d | -d )
     debug=: ;;
   --file | --fil | --fi | --f )
     $ac_shift
     case $ac_optarg in
     *\'*) ac_optarg=`$as_echo "$ac_optarg" | sed "s/'/'\\\\\\\\''/g"` ;;
+    '') as_fn_error $? "missing file argument" ;;
     esac
-    CONFIG_FILES="$CONFIG_FILES '$ac_optarg'"
+    as_fn_append CONFIG_FILES " '$ac_optarg'"
     ac_need_defaults=false;;
   --header | --heade | --head | --hea )
     $ac_shift
     case $ac_optarg in
     *\'*) ac_optarg=`$as_echo "$ac_optarg" | sed "s/'/'\\\\\\\\''/g"` ;;
     esac
-    CONFIG_HEADERS="$CONFIG_HEADERS '$ac_optarg'"
+    as_fn_append CONFIG_HEADERS " '$ac_optarg'"
     ac_need_defaults=false;;
   --he | --h)
     # Conflict between --help and --header
-    { $as_echo "$as_me: error: ambiguous option: $1
-Try \`$0 --help' for more information." >&2
-   { (exit 1); exit 1; }; };;
+    as_fn_error $? "ambiguous option: \`$1'
+Try \`$0 --help' for more information.";;
   --help | --hel | -h )
     $as_echo "$ac_cs_usage"; exit ;;
   -q | -quiet | --quiet | --quie | --qui | --qu | --q \
@@ -16541,11 +16245,10 @@ Try \`$0 --help' for more information." >&2
     ac_cs_silent=: ;;
 
   # This is an error.
-  -*) { $as_echo "$as_me: error: unrecognized option: $1
-Try \`$0 --help' for more information." >&2
-   { (exit 1); exit 1; }; } ;;
+  -*) as_fn_error $? "unrecognized option: \`$1'
+Try \`$0 --help' for more information." ;;
 
-  *) ac_config_targets="$ac_config_targets $1"
+  *) as_fn_append ac_config_targets " $1"
      ac_need_defaults=false ;;
 
   esac
@@ -16596,184 +16299,208 @@ AMDEP_TRUE="$AMDEP_TRUE" ac_aux_dir="$ac_aux_dir"
 sed_quote_subst='$sed_quote_subst'
 double_quote_subst='$double_quote_subst'
 delay_variable_subst='$delay_variable_subst'
-macro_version='`$ECHO "X$macro_version" | $Xsed -e "$delay_single_quote_subst"`'
-macro_revision='`$ECHO "X$macro_revision" | $Xsed -e "$delay_single_quote_subst"`'
-enable_shared='`$ECHO "X$enable_shared" | $Xsed -e "$delay_single_quote_subst"`'
-enable_static='`$ECHO "X$enable_static" | $Xsed -e "$delay_single_quote_subst"`'
-pic_mode='`$ECHO "X$pic_mode" | $Xsed -e "$delay_single_quote_subst"`'
-enable_fast_install='`$ECHO "X$enable_fast_install" | $Xsed -e "$delay_single_quote_subst"`'
-host_alias='`$ECHO "X$host_alias" | $Xsed -e "$delay_single_quote_subst"`'
-host='`$ECHO "X$host" | $Xsed -e "$delay_single_quote_subst"`'
-host_os='`$ECHO "X$host_os" | $Xsed -e "$delay_single_quote_subst"`'
-build_alias='`$ECHO "X$build_alias" | $Xsed -e "$delay_single_quote_subst"`'
-build='`$ECHO "X$build" | $Xsed -e "$delay_single_quote_subst"`'
-build_os='`$ECHO "X$build_os" | $Xsed -e "$delay_single_quote_subst"`'
-SED='`$ECHO "X$SED" | $Xsed -e "$delay_single_quote_subst"`'
-Xsed='`$ECHO "X$Xsed" | $Xsed -e "$delay_single_quote_subst"`'
-GREP='`$ECHO "X$GREP" | $Xsed -e "$delay_single_quote_subst"`'
-EGREP='`$ECHO "X$EGREP" | $Xsed -e "$delay_single_quote_subst"`'
-FGREP='`$ECHO "X$FGREP" | $Xsed -e "$delay_single_quote_subst"`'
-LD='`$ECHO "X$LD" | $Xsed -e "$delay_single_quote_subst"`'
-NM='`$ECHO "X$NM" | $Xsed -e "$delay_single_quote_subst"`'
-LN_S='`$ECHO "X$LN_S" | $Xsed -e "$delay_single_quote_subst"`'
-max_cmd_len='`$ECHO "X$max_cmd_len" | $Xsed -e "$delay_single_quote_subst"`'
-ac_objext='`$ECHO "X$ac_objext" | $Xsed -e "$delay_single_quote_subst"`'
-exeext='`$ECHO "X$exeext" | $Xsed -e "$delay_single_quote_subst"`'
-lt_unset='`$ECHO "X$lt_unset" | $Xsed -e "$delay_single_quote_subst"`'
-lt_SP2NL='`$ECHO "X$lt_SP2NL" | $Xsed -e "$delay_single_quote_subst"`'
-lt_NL2SP='`$ECHO "X$lt_NL2SP" | $Xsed -e "$delay_single_quote_subst"`'
-reload_flag='`$ECHO "X$reload_flag" | $Xsed -e "$delay_single_quote_subst"`'
-reload_cmds='`$ECHO "X$reload_cmds" | $Xsed -e "$delay_single_quote_subst"`'
-OBJDUMP='`$ECHO "X$OBJDUMP" | $Xsed -e "$delay_single_quote_subst"`'
-deplibs_check_method='`$ECHO "X$deplibs_check_method" | $Xsed -e "$delay_single_quote_subst"`'
-file_magic_cmd='`$ECHO "X$file_magic_cmd" | $Xsed -e "$delay_single_quote_subst"`'
-AR='`$ECHO "X$AR" | $Xsed -e "$delay_single_quote_subst"`'
-AR_FLAGS='`$ECHO "X$AR_FLAGS" | $Xsed -e "$delay_single_quote_subst"`'
-STRIP='`$ECHO "X$STRIP" | $Xsed -e "$delay_single_quote_subst"`'
-RANLIB='`$ECHO "X$RANLIB" | $Xsed -e "$delay_single_quote_subst"`'
-old_postinstall_cmds='`$ECHO "X$old_postinstall_cmds" | $Xsed -e "$delay_single_quote_subst"`'
-old_postuninstall_cmds='`$ECHO "X$old_postuninstall_cmds" | $Xsed -e "$delay_single_quote_subst"`'
-old_archive_cmds='`$ECHO "X$old_archive_cmds" | $Xsed -e "$delay_single_quote_subst"`'
-CC='`$ECHO "X$CC" | $Xsed -e "$delay_single_quote_subst"`'
-CFLAGS='`$ECHO "X$CFLAGS" | $Xsed -e "$delay_single_quote_subst"`'
-compiler='`$ECHO "X$compiler" | $Xsed -e "$delay_single_quote_subst"`'
-GCC='`$ECHO "X$GCC" | $Xsed -e "$delay_single_quote_subst"`'
-lt_cv_sys_global_symbol_pipe='`$ECHO "X$lt_cv_sys_global_symbol_pipe" | $Xsed -e "$delay_single_quote_subst"`'
-lt_cv_sys_global_symbol_to_cdecl='`$ECHO "X$lt_cv_sys_global_symbol_to_cdecl" | $Xsed -e "$delay_single_quote_subst"`'
-lt_cv_sys_global_symbol_to_c_name_address='`$ECHO "X$lt_cv_sys_global_symbol_to_c_name_address" | $Xsed -e "$delay_single_quote_subst"`'
-lt_cv_sys_global_symbol_to_c_name_address_lib_prefix='`$ECHO "X$lt_cv_sys_global_symbol_to_c_name_address_lib_prefix" | $Xsed -e "$delay_single_quote_subst"`'
-objdir='`$ECHO "X$objdir" | $Xsed -e "$delay_single_quote_subst"`'
-SHELL='`$ECHO "X$SHELL" | $Xsed -e "$delay_single_quote_subst"`'
-ECHO='`$ECHO "X$ECHO" | $Xsed -e "$delay_single_quote_subst"`'
-MAGIC_CMD='`$ECHO "X$MAGIC_CMD" | $Xsed -e "$delay_single_quote_subst"`'
-lt_prog_compiler_no_builtin_flag='`$ECHO "X$lt_prog_compiler_no_builtin_flag" | $Xsed -e "$delay_single_quote_subst"`'
-lt_prog_compiler_wl='`$ECHO "X$lt_prog_compiler_wl" | $Xsed -e "$delay_single_quote_subst"`'
-lt_prog_compiler_pic='`$ECHO "X$lt_prog_compiler_pic" | $Xsed -e "$delay_single_quote_subst"`'
-lt_prog_compiler_static='`$ECHO "X$lt_prog_compiler_static" | $Xsed -e "$delay_single_quote_subst"`'
-lt_cv_prog_compiler_c_o='`$ECHO "X$lt_cv_prog_compiler_c_o" | $Xsed -e "$delay_single_quote_subst"`'
-need_locks='`$ECHO "X$need_locks" | $Xsed -e "$delay_single_quote_subst"`'
-DSYMUTIL='`$ECHO "X$DSYMUTIL" | $Xsed -e "$delay_single_quote_subst"`'
-NMEDIT='`$ECHO "X$NMEDIT" | $Xsed -e "$delay_single_quote_subst"`'
-LIPO='`$ECHO "X$LIPO" | $Xsed -e "$delay_single_quote_subst"`'
-OTOOL='`$ECHO "X$OTOOL" | $Xsed -e "$delay_single_quote_subst"`'
-OTOOL64='`$ECHO "X$OTOOL64" | $Xsed -e "$delay_single_quote_subst"`'
-libext='`$ECHO "X$libext" | $Xsed -e "$delay_single_quote_subst"`'
-shrext_cmds='`$ECHO "X$shrext_cmds" | $Xsed -e "$delay_single_quote_subst"`'
-extract_expsyms_cmds='`$ECHO "X$extract_expsyms_cmds" | $Xsed -e "$delay_single_quote_subst"`'
-archive_cmds_need_lc='`$ECHO "X$archive_cmds_need_lc" | $Xsed -e "$delay_single_quote_subst"`'
-enable_shared_with_static_runtimes='`$ECHO "X$enable_shared_with_static_runtimes" | $Xsed -e "$delay_single_quote_subst"`'
-export_dynamic_flag_spec='`$ECHO "X$export_dynamic_flag_spec" | $Xsed -e "$delay_single_quote_subst"`'
-whole_archive_flag_spec='`$ECHO "X$whole_archive_flag_spec" | $Xsed -e "$delay_single_quote_subst"`'
-compiler_needs_object='`$ECHO "X$compiler_needs_object" | $Xsed -e "$delay_single_quote_subst"`'
-old_archive_from_new_cmds='`$ECHO "X$old_archive_from_new_cmds" | $Xsed -e "$delay_single_quote_subst"`'
-old_archive_from_expsyms_cmds='`$ECHO "X$old_archive_from_expsyms_cmds" | $Xsed -e "$delay_single_quote_subst"`'
-archive_cmds='`$ECHO "X$archive_cmds" | $Xsed -e "$delay_single_quote_subst"`'
-archive_expsym_cmds='`$ECHO "X$archive_expsym_cmds" | $Xsed -e "$delay_single_quote_subst"`'
-module_cmds='`$ECHO "X$module_cmds" | $Xsed -e "$delay_single_quote_subst"`'
-module_expsym_cmds='`$ECHO "X$module_expsym_cmds" | $Xsed -e "$delay_single_quote_subst"`'
-with_gnu_ld='`$ECHO "X$with_gnu_ld" | $Xsed -e "$delay_single_quote_subst"`'
-allow_undefined_flag='`$ECHO "X$allow_undefined_flag" | $Xsed -e "$delay_single_quote_subst"`'
-no_undefined_flag='`$ECHO "X$no_undefined_flag" | $Xsed -e "$delay_single_quote_subst"`'
-hardcode_libdir_flag_spec='`$ECHO "X$hardcode_libdir_flag_spec" | $Xsed -e "$delay_single_quote_subst"`'
-hardcode_libdir_flag_spec_ld='`$ECHO "X$hardcode_libdir_flag_spec_ld" | $Xsed -e "$delay_single_quote_subst"`'
-hardcode_libdir_separator='`$ECHO "X$hardcode_libdir_separator" | $Xsed -e "$delay_single_quote_subst"`'
-hardcode_direct='`$ECHO "X$hardcode_direct" | $Xsed -e "$delay_single_quote_subst"`'
-hardcode_direct_absolute='`$ECHO "X$hardcode_direct_absolute" | $Xsed -e "$delay_single_quote_subst"`'
-hardcode_minus_L='`$ECHO "X$hardcode_minus_L" | $Xsed -e "$delay_single_quote_subst"`'
-hardcode_shlibpath_var='`$ECHO "X$hardcode_shlibpath_var" | $Xsed -e "$delay_single_quote_subst"`'
-hardcode_automatic='`$ECHO "X$hardcode_automatic" | $Xsed -e "$delay_single_quote_subst"`'
-inherit_rpath='`$ECHO "X$inherit_rpath" | $Xsed -e "$delay_single_quote_subst"`'
-link_all_deplibs='`$ECHO "X$link_all_deplibs" | $Xsed -e "$delay_single_quote_subst"`'
-fix_srcfile_path='`$ECHO "X$fix_srcfile_path" | $Xsed -e "$delay_single_quote_subst"`'
-always_export_symbols='`$ECHO "X$always_export_symbols" | $Xsed -e "$delay_single_quote_subst"`'
-export_symbols_cmds='`$ECHO "X$export_symbols_cmds" | $Xsed -e "$delay_single_quote_subst"`'
-exclude_expsyms='`$ECHO "X$exclude_expsyms" | $Xsed -e "$delay_single_quote_subst"`'
-include_expsyms='`$ECHO "X$include_expsyms" | $Xsed -e "$delay_single_quote_subst"`'
-prelink_cmds='`$ECHO "X$prelink_cmds" | $Xsed -e "$delay_single_quote_subst"`'
-file_list_spec='`$ECHO "X$file_list_spec" | $Xsed -e "$delay_single_quote_subst"`'
-variables_saved_for_relink='`$ECHO "X$variables_saved_for_relink" | $Xsed -e "$delay_single_quote_subst"`'
-need_lib_prefix='`$ECHO "X$need_lib_prefix" | $Xsed -e "$delay_single_quote_subst"`'
-need_version='`$ECHO "X$need_version" | $Xsed -e "$delay_single_quote_subst"`'
-version_type='`$ECHO "X$version_type" | $Xsed -e "$delay_single_quote_subst"`'
-runpath_var='`$ECHO "X$runpath_var" | $Xsed -e "$delay_single_quote_subst"`'
-shlibpath_var='`$ECHO "X$shlibpath_var" | $Xsed -e "$delay_single_quote_subst"`'
-shlibpath_overrides_runpath='`$ECHO "X$shlibpath_overrides_runpath" | $Xsed -e "$delay_single_quote_subst"`'
-libname_spec='`$ECHO "X$libname_spec" | $Xsed -e "$delay_single_quote_subst"`'
-library_names_spec='`$ECHO "X$library_names_spec" | $Xsed -e "$delay_single_quote_subst"`'
-soname_spec='`$ECHO "X$soname_spec" | $Xsed -e "$delay_single_quote_subst"`'
-postinstall_cmds='`$ECHO "X$postinstall_cmds" | $Xsed -e "$delay_single_quote_subst"`'
-postuninstall_cmds='`$ECHO "X$postuninstall_cmds" | $Xsed -e "$delay_single_quote_subst"`'
-finish_cmds='`$ECHO "X$finish_cmds" | $Xsed -e "$delay_single_quote_subst"`'
-finish_eval='`$ECHO "X$finish_eval" | $Xsed -e "$delay_single_quote_subst"`'
-hardcode_into_libs='`$ECHO "X$hardcode_into_libs" | $Xsed -e "$delay_single_quote_subst"`'
-sys_lib_search_path_spec='`$ECHO "X$sys_lib_search_path_spec" | $Xsed -e "$delay_single_quote_subst"`'
-sys_lib_dlsearch_path_spec='`$ECHO "X$sys_lib_dlsearch_path_spec" | $Xsed -e "$delay_single_quote_subst"`'
-hardcode_action='`$ECHO "X$hardcode_action" | $Xsed -e "$delay_single_quote_subst"`'
-enable_dlopen='`$ECHO "X$enable_dlopen" | $Xsed -e "$delay_single_quote_subst"`'
-enable_dlopen_self='`$ECHO "X$enable_dlopen_self" | $Xsed -e "$delay_single_quote_subst"`'
-enable_dlopen_self_static='`$ECHO "X$enable_dlopen_self_static" | $Xsed -e "$delay_single_quote_subst"`'
-old_striplib='`$ECHO "X$old_striplib" | $Xsed -e "$delay_single_quote_subst"`'
-striplib='`$ECHO "X$striplib" | $Xsed -e "$delay_single_quote_subst"`'
-compiler_lib_search_dirs='`$ECHO "X$compiler_lib_search_dirs" | $Xsed -e "$delay_single_quote_subst"`'
-predep_objects='`$ECHO "X$predep_objects" | $Xsed -e "$delay_single_quote_subst"`'
-postdep_objects='`$ECHO "X$postdep_objects" | $Xsed -e "$delay_single_quote_subst"`'
-predeps='`$ECHO "X$predeps" | $Xsed -e "$delay_single_quote_subst"`'
-postdeps='`$ECHO "X$postdeps" | $Xsed -e "$delay_single_quote_subst"`'
-compiler_lib_search_path='`$ECHO "X$compiler_lib_search_path" | $Xsed -e "$delay_single_quote_subst"`'
-LD_CXX='`$ECHO "X$LD_CXX" | $Xsed -e "$delay_single_quote_subst"`'
-old_archive_cmds_CXX='`$ECHO "X$old_archive_cmds_CXX" | $Xsed -e "$delay_single_quote_subst"`'
-compiler_CXX='`$ECHO "X$compiler_CXX" | $Xsed -e "$delay_single_quote_subst"`'
-GCC_CXX='`$ECHO "X$GCC_CXX" | $Xsed -e "$delay_single_quote_subst"`'
-lt_prog_compiler_no_builtin_flag_CXX='`$ECHO "X$lt_prog_compiler_no_builtin_flag_CXX" | $Xsed -e "$delay_single_quote_subst"`'
-lt_prog_compiler_wl_CXX='`$ECHO "X$lt_prog_compiler_wl_CXX" | $Xsed -e "$delay_single_quote_subst"`'
-lt_prog_compiler_pic_CXX='`$ECHO "X$lt_prog_compiler_pic_CXX" | $Xsed -e "$delay_single_quote_subst"`'
-lt_prog_compiler_static_CXX='`$ECHO "X$lt_prog_compiler_static_CXX" | $Xsed -e "$delay_single_quote_subst"`'
-lt_cv_prog_compiler_c_o_CXX='`$ECHO "X$lt_cv_prog_compiler_c_o_CXX" | $Xsed -e "$delay_single_quote_subst"`'
-archive_cmds_need_lc_CXX='`$ECHO "X$archive_cmds_need_lc_CXX" | $Xsed -e "$delay_single_quote_subst"`'
-enable_shared_with_static_runtimes_CXX='`$ECHO "X$enable_shared_with_static_runtimes_CXX" | $Xsed -e "$delay_single_quote_subst"`'
-export_dynamic_flag_spec_CXX='`$ECHO "X$export_dynamic_flag_spec_CXX" | $Xsed -e "$delay_single_quote_subst"`'
-whole_archive_flag_spec_CXX='`$ECHO "X$whole_archive_flag_spec_CXX" | $Xsed -e "$delay_single_quote_subst"`'
-compiler_needs_object_CXX='`$ECHO "X$compiler_needs_object_CXX" | $Xsed -e "$delay_single_quote_subst"`'
-old_archive_from_new_cmds_CXX='`$ECHO "X$old_archive_from_new_cmds_CXX" | $Xsed -e "$delay_single_quote_subst"`'
-old_archive_from_expsyms_cmds_CXX='`$ECHO "X$old_archive_from_expsyms_cmds_CXX" | $Xsed -e "$delay_single_quote_subst"`'
-archive_cmds_CXX='`$ECHO "X$archive_cmds_CXX" | $Xsed -e "$delay_single_quote_subst"`'
-archive_expsym_cmds_CXX='`$ECHO "X$archive_expsym_cmds_CXX" | $Xsed -e "$delay_single_quote_subst"`'
-module_cmds_CXX='`$ECHO "X$module_cmds_CXX" | $Xsed -e "$delay_single_quote_subst"`'
-module_expsym_cmds_CXX='`$ECHO "X$module_expsym_cmds_CXX" | $Xsed -e "$delay_single_quote_subst"`'
-with_gnu_ld_CXX='`$ECHO "X$with_gnu_ld_CXX" | $Xsed -e "$delay_single_quote_subst"`'
-allow_undefined_flag_CXX='`$ECHO "X$allow_undefined_flag_CXX" | $Xsed -e "$delay_single_quote_subst"`'
-no_undefined_flag_CXX='`$ECHO "X$no_undefined_flag_CXX" | $Xsed -e "$delay_single_quote_subst"`'
-hardcode_libdir_flag_spec_CXX='`$ECHO "X$hardcode_libdir_flag_spec_CXX" | $Xsed -e "$delay_single_quote_subst"`'
-hardcode_libdir_flag_spec_ld_CXX='`$ECHO "X$hardcode_libdir_flag_spec_ld_CXX" | $Xsed -e "$delay_single_quote_subst"`'
-hardcode_libdir_separator_CXX='`$ECHO "X$hardcode_libdir_separator_CXX" | $Xsed -e "$delay_single_quote_subst"`'
-hardcode_direct_CXX='`$ECHO "X$hardcode_direct_CXX" | $Xsed -e "$delay_single_quote_subst"`'
-hardcode_direct_absolute_CXX='`$ECHO "X$hardcode_direct_absolute_CXX" | $Xsed -e "$delay_single_quote_subst"`'
-hardcode_minus_L_CXX='`$ECHO "X$hardcode_minus_L_CXX" | $Xsed -e "$delay_single_quote_subst"`'
-hardcode_shlibpath_var_CXX='`$ECHO "X$hardcode_shlibpath_var_CXX" | $Xsed -e "$delay_single_quote_subst"`'
-hardcode_automatic_CXX='`$ECHO "X$hardcode_automatic_CXX" | $Xsed -e "$delay_single_quote_subst"`'
-inherit_rpath_CXX='`$ECHO "X$inherit_rpath_CXX" | $Xsed -e "$delay_single_quote_subst"`'
-link_all_deplibs_CXX='`$ECHO "X$link_all_deplibs_CXX" | $Xsed -e "$delay_single_quote_subst"`'
-fix_srcfile_path_CXX='`$ECHO "X$fix_srcfile_path_CXX" | $Xsed -e "$delay_single_quote_subst"`'
-always_export_symbols_CXX='`$ECHO "X$always_export_symbols_CXX" | $Xsed -e "$delay_single_quote_subst"`'
-export_symbols_cmds_CXX='`$ECHO "X$export_symbols_cmds_CXX" | $Xsed -e "$delay_single_quote_subst"`'
-exclude_expsyms_CXX='`$ECHO "X$exclude_expsyms_CXX" | $Xsed -e "$delay_single_quote_subst"`'
-include_expsyms_CXX='`$ECHO "X$include_expsyms_CXX" | $Xsed -e "$delay_single_quote_subst"`'
-prelink_cmds_CXX='`$ECHO "X$prelink_cmds_CXX" | $Xsed -e "$delay_single_quote_subst"`'
-file_list_spec_CXX='`$ECHO "X$file_list_spec_CXX" | $Xsed -e "$delay_single_quote_subst"`'
-hardcode_action_CXX='`$ECHO "X$hardcode_action_CXX" | $Xsed -e "$delay_single_quote_subst"`'
-compiler_lib_search_dirs_CXX='`$ECHO "X$compiler_lib_search_dirs_CXX" | $Xsed -e "$delay_single_quote_subst"`'
-predep_objects_CXX='`$ECHO "X$predep_objects_CXX" | $Xsed -e "$delay_single_quote_subst"`'
-postdep_objects_CXX='`$ECHO "X$postdep_objects_CXX" | $Xsed -e "$delay_single_quote_subst"`'
-predeps_CXX='`$ECHO "X$predeps_CXX" | $Xsed -e "$delay_single_quote_subst"`'
-postdeps_CXX='`$ECHO "X$postdeps_CXX" | $Xsed -e "$delay_single_quote_subst"`'
-compiler_lib_search_path_CXX='`$ECHO "X$compiler_lib_search_path_CXX" | $Xsed -e "$delay_single_quote_subst"`'
+macro_version='`$ECHO "$macro_version" | $SED "$delay_single_quote_subst"`'
+macro_revision='`$ECHO "$macro_revision" | $SED "$delay_single_quote_subst"`'
+enable_shared='`$ECHO "$enable_shared" | $SED "$delay_single_quote_subst"`'
+enable_static='`$ECHO "$enable_static" | $SED "$delay_single_quote_subst"`'
+pic_mode='`$ECHO "$pic_mode" | $SED "$delay_single_quote_subst"`'
+enable_fast_install='`$ECHO "$enable_fast_install" | $SED "$delay_single_quote_subst"`'
+SHELL='`$ECHO "$SHELL" | $SED "$delay_single_quote_subst"`'
+ECHO='`$ECHO "$ECHO" | $SED "$delay_single_quote_subst"`'
+PATH_SEPARATOR='`$ECHO "$PATH_SEPARATOR" | $SED "$delay_single_quote_subst"`'
+host_alias='`$ECHO "$host_alias" | $SED "$delay_single_quote_subst"`'
+host='`$ECHO "$host" | $SED "$delay_single_quote_subst"`'
+host_os='`$ECHO "$host_os" | $SED "$delay_single_quote_subst"`'
+build_alias='`$ECHO "$build_alias" | $SED "$delay_single_quote_subst"`'
+build='`$ECHO "$build" | $SED "$delay_single_quote_subst"`'
+build_os='`$ECHO "$build_os" | $SED "$delay_single_quote_subst"`'
+SED='`$ECHO "$SED" | $SED "$delay_single_quote_subst"`'
+Xsed='`$ECHO "$Xsed" | $SED "$delay_single_quote_subst"`'
+GREP='`$ECHO "$GREP" | $SED "$delay_single_quote_subst"`'
+EGREP='`$ECHO "$EGREP" | $SED "$delay_single_quote_subst"`'
+FGREP='`$ECHO "$FGREP" | $SED "$delay_single_quote_subst"`'
+LD='`$ECHO "$LD" | $SED "$delay_single_quote_subst"`'
+NM='`$ECHO "$NM" | $SED "$delay_single_quote_subst"`'
+LN_S='`$ECHO "$LN_S" | $SED "$delay_single_quote_subst"`'
+max_cmd_len='`$ECHO "$max_cmd_len" | $SED "$delay_single_quote_subst"`'
+ac_objext='`$ECHO "$ac_objext" | $SED "$delay_single_quote_subst"`'
+exeext='`$ECHO "$exeext" | $SED "$delay_single_quote_subst"`'
+lt_unset='`$ECHO "$lt_unset" | $SED "$delay_single_quote_subst"`'
+lt_SP2NL='`$ECHO "$lt_SP2NL" | $SED "$delay_single_quote_subst"`'
+lt_NL2SP='`$ECHO "$lt_NL2SP" | $SED "$delay_single_quote_subst"`'
+lt_cv_to_host_file_cmd='`$ECHO "$lt_cv_to_host_file_cmd" | $SED "$delay_single_quote_subst"`'
+lt_cv_to_tool_file_cmd='`$ECHO "$lt_cv_to_tool_file_cmd" | $SED "$delay_single_quote_subst"`'
+reload_flag='`$ECHO "$reload_flag" | $SED "$delay_single_quote_subst"`'
+reload_cmds='`$ECHO "$reload_cmds" | $SED "$delay_single_quote_subst"`'
+OBJDUMP='`$ECHO "$OBJDUMP" | $SED "$delay_single_quote_subst"`'
+deplibs_check_method='`$ECHO "$deplibs_check_method" | $SED "$delay_single_quote_subst"`'
+file_magic_cmd='`$ECHO "$file_magic_cmd" | $SED "$delay_single_quote_subst"`'
+file_magic_glob='`$ECHO "$file_magic_glob" | $SED "$delay_single_quote_subst"`'
+want_nocaseglob='`$ECHO "$want_nocaseglob" | $SED "$delay_single_quote_subst"`'
+DLLTOOL='`$ECHO "$DLLTOOL" | $SED "$delay_single_quote_subst"`'
+sharedlib_from_linklib_cmd='`$ECHO "$sharedlib_from_linklib_cmd" | $SED "$delay_single_quote_subst"`'
+AR='`$ECHO "$AR" | $SED "$delay_single_quote_subst"`'
+AR_FLAGS='`$ECHO "$AR_FLAGS" | $SED "$delay_single_quote_subst"`'
+archiver_list_spec='`$ECHO "$archiver_list_spec" | $SED "$delay_single_quote_subst"`'
+STRIP='`$ECHO "$STRIP" | $SED "$delay_single_quote_subst"`'
+RANLIB='`$ECHO "$RANLIB" | $SED "$delay_single_quote_subst"`'
+old_postinstall_cmds='`$ECHO "$old_postinstall_cmds" | $SED "$delay_single_quote_subst"`'
+old_postuninstall_cmds='`$ECHO "$old_postuninstall_cmds" | $SED "$delay_single_quote_subst"`'
+old_archive_cmds='`$ECHO "$old_archive_cmds" | $SED "$delay_single_quote_subst"`'
+lock_old_archive_extraction='`$ECHO "$lock_old_archive_extraction" | $SED "$delay_single_quote_subst"`'
+CC='`$ECHO "$CC" | $SED "$delay_single_quote_subst"`'
+CFLAGS='`$ECHO "$CFLAGS" | $SED "$delay_single_quote_subst"`'
+compiler='`$ECHO "$compiler" | $SED "$delay_single_quote_subst"`'
+GCC='`$ECHO "$GCC" | $SED "$delay_single_quote_subst"`'
+lt_cv_sys_global_symbol_pipe='`$ECHO "$lt_cv_sys_global_symbol_pipe" | $SED "$delay_single_quote_subst"`'
+lt_cv_sys_global_symbol_to_cdecl='`$ECHO "$lt_cv_sys_global_symbol_to_cdecl" | $SED "$delay_single_quote_subst"`'
+lt_cv_sys_global_symbol_to_c_name_address='`$ECHO "$lt_cv_sys_global_symbol_to_c_name_address" | $SED "$delay_single_quote_subst"`'
+lt_cv_sys_global_symbol_to_c_name_address_lib_prefix='`$ECHO "$lt_cv_sys_global_symbol_to_c_name_address_lib_prefix" | $SED "$delay_single_quote_subst"`'
+nm_file_list_spec='`$ECHO "$nm_file_list_spec" | $SED "$delay_single_quote_subst"`'
+lt_sysroot='`$ECHO "$lt_sysroot" | $SED "$delay_single_quote_subst"`'
+objdir='`$ECHO "$objdir" | $SED "$delay_single_quote_subst"`'
+MAGIC_CMD='`$ECHO "$MAGIC_CMD" | $SED "$delay_single_quote_subst"`'
+lt_prog_compiler_no_builtin_flag='`$ECHO "$lt_prog_compiler_no_builtin_flag" | $SED "$delay_single_quote_subst"`'
+lt_prog_compiler_pic='`$ECHO "$lt_prog_compiler_pic" | $SED "$delay_single_quote_subst"`'
+lt_prog_compiler_wl='`$ECHO "$lt_prog_compiler_wl" | $SED "$delay_single_quote_subst"`'
+lt_prog_compiler_static='`$ECHO "$lt_prog_compiler_static" | $SED "$delay_single_quote_subst"`'
+lt_cv_prog_compiler_c_o='`$ECHO "$lt_cv_prog_compiler_c_o" | $SED "$delay_single_quote_subst"`'
+need_locks='`$ECHO "$need_locks" | $SED "$delay_single_quote_subst"`'
+MANIFEST_TOOL='`$ECHO "$MANIFEST_TOOL" | $SED "$delay_single_quote_subst"`'
+DSYMUTIL='`$ECHO "$DSYMUTIL" | $SED "$delay_single_quote_subst"`'
+NMEDIT='`$ECHO "$NMEDIT" | $SED "$delay_single_quote_subst"`'
+LIPO='`$ECHO "$LIPO" | $SED "$delay_single_quote_subst"`'
+OTOOL='`$ECHO "$OTOOL" | $SED "$delay_single_quote_subst"`'
+OTOOL64='`$ECHO "$OTOOL64" | $SED "$delay_single_quote_subst"`'
+libext='`$ECHO "$libext" | $SED "$delay_single_quote_subst"`'
+shrext_cmds='`$ECHO "$shrext_cmds" | $SED "$delay_single_quote_subst"`'
+extract_expsyms_cmds='`$ECHO "$extract_expsyms_cmds" | $SED "$delay_single_quote_subst"`'
+archive_cmds_need_lc='`$ECHO "$archive_cmds_need_lc" | $SED "$delay_single_quote_subst"`'
+enable_shared_with_static_runtimes='`$ECHO "$enable_shared_with_static_runtimes" | $SED "$delay_single_quote_subst"`'
+export_dynamic_flag_spec='`$ECHO "$export_dynamic_flag_spec" | $SED "$delay_single_quote_subst"`'
+whole_archive_flag_spec='`$ECHO "$whole_archive_flag_spec" | $SED "$delay_single_quote_subst"`'
+compiler_needs_object='`$ECHO "$compiler_needs_object" | $SED "$delay_single_quote_subst"`'
+old_archive_from_new_cmds='`$ECHO "$old_archive_from_new_cmds" | $SED "$delay_single_quote_subst"`'
+old_archive_from_expsyms_cmds='`$ECHO "$old_archive_from_expsyms_cmds" | $SED "$delay_single_quote_subst"`'
+archive_cmds='`$ECHO "$archive_cmds" | $SED "$delay_single_quote_subst"`'
+archive_expsym_cmds='`$ECHO "$archive_expsym_cmds" | $SED "$delay_single_quote_subst"`'
+module_cmds='`$ECHO "$module_cmds" | $SED "$delay_single_quote_subst"`'
+module_expsym_cmds='`$ECHO "$module_expsym_cmds" | $SED "$delay_single_quote_subst"`'
+with_gnu_ld='`$ECHO "$with_gnu_ld" | $SED "$delay_single_quote_subst"`'
+allow_undefined_flag='`$ECHO "$allow_undefined_flag" | $SED "$delay_single_quote_subst"`'
+no_undefined_flag='`$ECHO "$no_undefined_flag" | $SED "$delay_single_quote_subst"`'
+hardcode_libdir_flag_spec='`$ECHO "$hardcode_libdir_flag_spec" | $SED "$delay_single_quote_subst"`'
+hardcode_libdir_separator='`$ECHO "$hardcode_libdir_separator" | $SED "$delay_single_quote_subst"`'
+hardcode_direct='`$ECHO "$hardcode_direct" | $SED "$delay_single_quote_subst"`'
+hardcode_direct_absolute='`$ECHO "$hardcode_direct_absolute" | $SED "$delay_single_quote_subst"`'
+hardcode_minus_L='`$ECHO "$hardcode_minus_L" | $SED "$delay_single_quote_subst"`'
+hardcode_shlibpath_var='`$ECHO "$hardcode_shlibpath_var" | $SED "$delay_single_quote_subst"`'
+hardcode_automatic='`$ECHO "$hardcode_automatic" | $SED "$delay_single_quote_subst"`'
+inherit_rpath='`$ECHO "$inherit_rpath" | $SED "$delay_single_quote_subst"`'
+link_all_deplibs='`$ECHO "$link_all_deplibs" | $SED "$delay_single_quote_subst"`'
+always_export_symbols='`$ECHO "$always_export_symbols" | $SED "$delay_single_quote_subst"`'
+export_symbols_cmds='`$ECHO "$export_symbols_cmds" | $SED "$delay_single_quote_subst"`'
+exclude_expsyms='`$ECHO "$exclude_expsyms" | $SED "$delay_single_quote_subst"`'
+include_expsyms='`$ECHO "$include_expsyms" | $SED "$delay_single_quote_subst"`'
+prelink_cmds='`$ECHO "$prelink_cmds" | $SED "$delay_single_quote_subst"`'
+postlink_cmds='`$ECHO "$postlink_cmds" | $SED "$delay_single_quote_subst"`'
+file_list_spec='`$ECHO "$file_list_spec" | $SED "$delay_single_quote_subst"`'
+variables_saved_for_relink='`$ECHO "$variables_saved_for_relink" | $SED "$delay_single_quote_subst"`'
+need_lib_prefix='`$ECHO "$need_lib_prefix" | $SED "$delay_single_quote_subst"`'
+need_version='`$ECHO "$need_version" | $SED "$delay_single_quote_subst"`'
+version_type='`$ECHO "$version_type" | $SED "$delay_single_quote_subst"`'
+runpath_var='`$ECHO "$runpath_var" | $SED "$delay_single_quote_subst"`'
+shlibpath_var='`$ECHO "$shlibpath_var" | $SED "$delay_single_quote_subst"`'
+shlibpath_overrides_runpath='`$ECHO "$shlibpath_overrides_runpath" | $SED "$delay_single_quote_subst"`'
+libname_spec='`$ECHO "$libname_spec" | $SED "$delay_single_quote_subst"`'
+library_names_spec='`$ECHO "$library_names_spec" | $SED "$delay_single_quote_subst"`'
+soname_spec='`$ECHO "$soname_spec" | $SED "$delay_single_quote_subst"`'
+install_override_mode='`$ECHO "$install_override_mode" | $SED "$delay_single_quote_subst"`'
+postinstall_cmds='`$ECHO "$postinstall_cmds" | $SED "$delay_single_quote_subst"`'
+postuninstall_cmds='`$ECHO "$postuninstall_cmds" | $SED "$delay_single_quote_subst"`'
+finish_cmds='`$ECHO "$finish_cmds" | $SED "$delay_single_quote_subst"`'
+finish_eval='`$ECHO "$finish_eval" | $SED "$delay_single_quote_subst"`'
+hardcode_into_libs='`$ECHO "$hardcode_into_libs" | $SED "$delay_single_quote_subst"`'
+sys_lib_search_path_spec='`$ECHO "$sys_lib_search_path_spec" | $SED "$delay_single_quote_subst"`'
+sys_lib_dlsearch_path_spec='`$ECHO "$sys_lib_dlsearch_path_spec" | $SED "$delay_single_quote_subst"`'
+hardcode_action='`$ECHO "$hardcode_action" | $SED "$delay_single_quote_subst"`'
+enable_dlopen='`$ECHO "$enable_dlopen" | $SED "$delay_single_quote_subst"`'
+enable_dlopen_self='`$ECHO "$enable_dlopen_self" | $SED "$delay_single_quote_subst"`'
+enable_dlopen_self_static='`$ECHO "$enable_dlopen_self_static" | $SED "$delay_single_quote_subst"`'
+old_striplib='`$ECHO "$old_striplib" | $SED "$delay_single_quote_subst"`'
+striplib='`$ECHO "$striplib" | $SED "$delay_single_quote_subst"`'
+compiler_lib_search_dirs='`$ECHO "$compiler_lib_search_dirs" | $SED "$delay_single_quote_subst"`'
+predep_objects='`$ECHO "$predep_objects" | $SED "$delay_single_quote_subst"`'
+postdep_objects='`$ECHO "$postdep_objects" | $SED "$delay_single_quote_subst"`'
+predeps='`$ECHO "$predeps" | $SED "$delay_single_quote_subst"`'
+postdeps='`$ECHO "$postdeps" | $SED "$delay_single_quote_subst"`'
+compiler_lib_search_path='`$ECHO "$compiler_lib_search_path" | $SED "$delay_single_quote_subst"`'
+LD_CXX='`$ECHO "$LD_CXX" | $SED "$delay_single_quote_subst"`'
+reload_flag_CXX='`$ECHO "$reload_flag_CXX" | $SED "$delay_single_quote_subst"`'
+reload_cmds_CXX='`$ECHO "$reload_cmds_CXX" | $SED "$delay_single_quote_subst"`'
+old_archive_cmds_CXX='`$ECHO "$old_archive_cmds_CXX" | $SED "$delay_single_quote_subst"`'
+compiler_CXX='`$ECHO "$compiler_CXX" | $SED "$delay_single_quote_subst"`'
+GCC_CXX='`$ECHO "$GCC_CXX" | $SED "$delay_single_quote_subst"`'
+lt_prog_compiler_no_builtin_flag_CXX='`$ECHO "$lt_prog_compiler_no_builtin_flag_CXX" | $SED "$delay_single_quote_subst"`'
+lt_prog_compiler_pic_CXX='`$ECHO "$lt_prog_compiler_pic_CXX" | $SED "$delay_single_quote_subst"`'
+lt_prog_compiler_wl_CXX='`$ECHO "$lt_prog_compiler_wl_CXX" | $SED "$delay_single_quote_subst"`'
+lt_prog_compiler_static_CXX='`$ECHO "$lt_prog_compiler_static_CXX" | $SED "$delay_single_quote_subst"`'
+lt_cv_prog_compiler_c_o_CXX='`$ECHO "$lt_cv_prog_compiler_c_o_CXX" | $SED "$delay_single_quote_subst"`'
+archive_cmds_need_lc_CXX='`$ECHO "$archive_cmds_need_lc_CXX" | $SED "$delay_single_quote_subst"`'
+enable_shared_with_static_runtimes_CXX='`$ECHO "$enable_shared_with_static_runtimes_CXX" | $SED "$delay_single_quote_subst"`'
+export_dynamic_flag_spec_CXX='`$ECHO "$export_dynamic_flag_spec_CXX" | $SED "$delay_single_quote_subst"`'
+whole_archive_flag_spec_CXX='`$ECHO "$whole_archive_flag_spec_CXX" | $SED "$delay_single_quote_subst"`'
+compiler_needs_object_CXX='`$ECHO "$compiler_needs_object_CXX" | $SED "$delay_single_quote_subst"`'
+old_archive_from_new_cmds_CXX='`$ECHO "$old_archive_from_new_cmds_CXX" | $SED "$delay_single_quote_subst"`'
+old_archive_from_expsyms_cmds_CXX='`$ECHO "$old_archive_from_expsyms_cmds_CXX" | $SED "$delay_single_quote_subst"`'
+archive_cmds_CXX='`$ECHO "$archive_cmds_CXX" | $SED "$delay_single_quote_subst"`'
+archive_expsym_cmds_CXX='`$ECHO "$archive_expsym_cmds_CXX" | $SED "$delay_single_quote_subst"`'
+module_cmds_CXX='`$ECHO "$module_cmds_CXX" | $SED "$delay_single_quote_subst"`'
+module_expsym_cmds_CXX='`$ECHO "$module_expsym_cmds_CXX" | $SED "$delay_single_quote_subst"`'
+with_gnu_ld_CXX='`$ECHO "$with_gnu_ld_CXX" | $SED "$delay_single_quote_subst"`'
+allow_undefined_flag_CXX='`$ECHO "$allow_undefined_flag_CXX" | $SED "$delay_single_quote_subst"`'
+no_undefined_flag_CXX='`$ECHO "$no_undefined_flag_CXX" | $SED "$delay_single_quote_subst"`'
+hardcode_libdir_flag_spec_CXX='`$ECHO "$hardcode_libdir_flag_spec_CXX" | $SED "$delay_single_quote_subst"`'
+hardcode_libdir_separator_CXX='`$ECHO "$hardcode_libdir_separator_CXX" | $SED "$delay_single_quote_subst"`'
+hardcode_direct_CXX='`$ECHO "$hardcode_direct_CXX" | $SED "$delay_single_quote_subst"`'
+hardcode_direct_absolute_CXX='`$ECHO "$hardcode_direct_absolute_CXX" | $SED "$delay_single_quote_subst"`'
+hardcode_minus_L_CXX='`$ECHO "$hardcode_minus_L_CXX" | $SED "$delay_single_quote_subst"`'
+hardcode_shlibpath_var_CXX='`$ECHO "$hardcode_shlibpath_var_CXX" | $SED "$delay_single_quote_subst"`'
+hardcode_automatic_CXX='`$ECHO "$hardcode_automatic_CXX" | $SED "$delay_single_quote_subst"`'
+inherit_rpath_CXX='`$ECHO "$inherit_rpath_CXX" | $SED "$delay_single_quote_subst"`'
+link_all_deplibs_CXX='`$ECHO "$link_all_deplibs_CXX" | $SED "$delay_single_quote_subst"`'
+always_export_symbols_CXX='`$ECHO "$always_export_symbols_CXX" | $SED "$delay_single_quote_subst"`'
+export_symbols_cmds_CXX='`$ECHO "$export_symbols_cmds_CXX" | $SED "$delay_single_quote_subst"`'
+exclude_expsyms_CXX='`$ECHO "$exclude_expsyms_CXX" | $SED "$delay_single_quote_subst"`'
+include_expsyms_CXX='`$ECHO "$include_expsyms_CXX" | $SED "$delay_single_quote_subst"`'
+prelink_cmds_CXX='`$ECHO "$prelink_cmds_CXX" | $SED "$delay_single_quote_subst"`'
+postlink_cmds_CXX='`$ECHO "$postlink_cmds_CXX" | $SED "$delay_single_quote_subst"`'
+file_list_spec_CXX='`$ECHO "$file_list_spec_CXX" | $SED "$delay_single_quote_subst"`'
+hardcode_action_CXX='`$ECHO "$hardcode_action_CXX" | $SED "$delay_single_quote_subst"`'
+compiler_lib_search_dirs_CXX='`$ECHO "$compiler_lib_search_dirs_CXX" | $SED "$delay_single_quote_subst"`'
+predep_objects_CXX='`$ECHO "$predep_objects_CXX" | $SED "$delay_single_quote_subst"`'
+postdep_objects_CXX='`$ECHO "$postdep_objects_CXX" | $SED "$delay_single_quote_subst"`'
+predeps_CXX='`$ECHO "$predeps_CXX" | $SED "$delay_single_quote_subst"`'
+postdeps_CXX='`$ECHO "$postdeps_CXX" | $SED "$delay_single_quote_subst"`'
+compiler_lib_search_path_CXX='`$ECHO "$compiler_lib_search_path_CXX" | $SED "$delay_single_quote_subst"`'
 
 LTCC='$LTCC'
 LTCFLAGS='$LTCFLAGS'
 compiler='$compiler_DEFAULT'
 
+# A function that is used when there is no print builtin or printf.
+func_fallback_echo ()
+{
+  eval 'cat <<_LTECHO_EOF
+\$1
+_LTECHO_EOF'
+}
+
 # Quote evaled strings.
-for var in SED \
+for var in SHELL \
+ECHO \
+PATH_SEPARATOR \
+SED \
 GREP \
 EGREP \
 FGREP \
@@ -16786,8 +16513,13 @@ reload_flag \
 OBJDUMP \
 deplibs_check_method \
 file_magic_cmd \
+file_magic_glob \
+want_nocaseglob \
+DLLTOOL \
+sharedlib_from_linklib_cmd \
 AR \
 AR_FLAGS \
+archiver_list_spec \
 STRIP \
 RANLIB \
 CC \
@@ -16797,14 +16529,14 @@ lt_cv_sys_global_symbol_pipe \
 lt_cv_sys_global_symbol_to_cdecl \
 lt_cv_sys_global_symbol_to_c_name_address \
 lt_cv_sys_global_symbol_to_c_name_address_lib_prefix \
-SHELL \
-ECHO \
+nm_file_list_spec \
 lt_prog_compiler_no_builtin_flag \
-lt_prog_compiler_wl \
 lt_prog_compiler_pic \
+lt_prog_compiler_wl \
 lt_prog_compiler_static \
 lt_cv_prog_compiler_c_o \
 need_locks \
+MANIFEST_TOOL \
 DSYMUTIL \
 NMEDIT \
 LIPO \
@@ -16818,9 +16550,7 @@ with_gnu_ld \
 allow_undefined_flag \
 no_undefined_flag \
 hardcode_libdir_flag_spec \
-hardcode_libdir_flag_spec_ld \
 hardcode_libdir_separator \
-fix_srcfile_path \
 exclude_expsyms \
 include_expsyms \
 file_list_spec \
@@ -16828,6 +16558,7 @@ variables_saved_for_relink \
 libname_spec \
 library_names_spec \
 soname_spec \
+install_override_mode \
 finish_eval \
 old_striplib \
 striplib \
@@ -16838,10 +16569,11 @@ predeps \
 postdeps \
 compiler_lib_search_path \
 LD_CXX \
+reload_flag_CXX \
 compiler_CXX \
 lt_prog_compiler_no_builtin_flag_CXX \
-lt_prog_compiler_wl_CXX \
 lt_prog_compiler_pic_CXX \
+lt_prog_compiler_wl_CXX \
 lt_prog_compiler_static_CXX \
 lt_cv_prog_compiler_c_o_CXX \
 export_dynamic_flag_spec_CXX \
@@ -16851,9 +16583,7 @@ with_gnu_ld_CXX \
 allow_undefined_flag_CXX \
 no_undefined_flag_CXX \
 hardcode_libdir_flag_spec_CXX \
-hardcode_libdir_flag_spec_ld_CXX \
 hardcode_libdir_separator_CXX \
-fix_srcfile_path_CXX \
 exclude_expsyms_CXX \
 include_expsyms_CXX \
 file_list_spec_CXX \
@@ -16863,9 +16593,9 @@ postdep_objects_CXX \
 predeps_CXX \
 postdeps_CXX \
 compiler_lib_search_path_CXX; do
-    case \`eval \\\\\$ECHO "X\\\\\$\$var"\` in
+    case \`eval \\\\\$ECHO \\\\""\\\\\$\$var"\\\\"\` in
     *[\\\\\\\`\\"\\\$]*)
-      eval "lt_\$var=\\\\\\"\\\`\\\$ECHO \\"X\\\$\$var\\" | \\\$Xsed -e \\"\\\$sed_quote_subst\\"\\\`\\\\\\""
+      eval "lt_\$var=\\\\\\"\\\`\\\$ECHO \\"\\\$\$var\\" | \\\$SED \\"\\\$sed_quote_subst\\"\\\`\\\\\\""
       ;;
     *)
       eval "lt_\$var=\\\\\\"\\\$\$var\\\\\\""
@@ -16887,11 +16617,13 @@ module_cmds \
 module_expsym_cmds \
 export_symbols_cmds \
 prelink_cmds \
+postlink_cmds \
 postinstall_cmds \
 postuninstall_cmds \
 finish_cmds \
 sys_lib_search_path_spec \
 sys_lib_dlsearch_path_spec \
+reload_cmds_CXX \
 old_archive_cmds_CXX \
 old_archive_from_new_cmds_CXX \
 old_archive_from_expsyms_cmds_CXX \
@@ -16900,10 +16632,11 @@ archive_expsym_cmds_CXX \
 module_cmds_CXX \
 module_expsym_cmds_CXX \
 export_symbols_cmds_CXX \
-prelink_cmds_CXX; do
-    case \`eval \\\\\$ECHO "X\\\\\$\$var"\` in
+prelink_cmds_CXX \
+postlink_cmds_CXX; do
+    case \`eval \\\\\$ECHO \\\\""\\\\\$\$var"\\\\"\` in
     *[\\\\\\\`\\"\\\$]*)
-      eval "lt_\$var=\\\\\\"\\\`\\\$ECHO \\"X\\\$\$var\\" | \\\$Xsed -e \\"\\\$double_quote_subst\\" -e \\"\\\$sed_quote_subst\\" -e \\"\\\$delay_variable_subst\\"\\\`\\\\\\""
+      eval "lt_\$var=\\\\\\"\\\`\\\$ECHO \\"\\\$\$var\\" | \\\$SED -e \\"\\\$double_quote_subst\\" -e \\"\\\$sed_quote_subst\\" -e \\"\\\$delay_variable_subst\\"\\\`\\\\\\""
       ;;
     *)
       eval "lt_\$var=\\\\\\"\\\$\$var\\\\\\""
@@ -16911,12 +16644,6 @@ prelink_cmds_CXX; do
     esac
 done
 
-# Fix-up fallback echo if it was mangled by the above quoting rules.
-case \$lt_ECHO in
-*'\\\$0 --fallback-echo"')  lt_ECHO=\`\$ECHO "X\$lt_ECHO" | \$Xsed -e 's/\\\\\\\\\\\\\\\$0 --fallback-echo"\$/\$0 --fallback-echo"/'\`
-  ;;
-esac
-
 ac_aux_dir='$ac_aux_dir'
 xsi_shell='$xsi_shell'
 lt_shell_append='$lt_shell_append'
@@ -16947,16 +16674,14 @@ cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1
 for ac_config_target in $ac_config_targets
 do
   case $ac_config_target in
-    "depfiles") CONFIG_COMMANDS="$CONFIG_COMMANDS depfiles" ;;
     "config.h") CONFIG_HEADERS="$CONFIG_HEADERS config.h" ;;
+    "depfiles") CONFIG_COMMANDS="$CONFIG_COMMANDS depfiles" ;;
+    "libtool") CONFIG_COMMANDS="$CONFIG_COMMANDS libtool" ;;
     "Makefile") CONFIG_FILES="$CONFIG_FILES Makefile" ;;
     "tests/compat.sh") CONFIG_FILES="$CONFIG_FILES tests/compat.sh" ;;
     "jellyfish-1.1.pc") CONFIG_FILES="$CONFIG_FILES jellyfish-1.1.pc" ;;
-    "libtool") CONFIG_COMMANDS="$CONFIG_COMMANDS libtool" ;;
 
-  *) { { $as_echo "$as_me:$LINENO: error: invalid argument: $ac_config_target" >&5
-$as_echo "$as_me: error: invalid argument: $ac_config_target" >&2;}
-   { (exit 1); exit 1; }; };;
+  *) as_fn_error $? "invalid argument: \`$ac_config_target'" "$LINENO" 5;;
   esac
 done
 
@@ -16979,26 +16704,24 @@ fi
 # after its creation but before its name has been assigned to `$tmp'.
 $debug ||
 {
-  tmp=
+  tmp= ac_tmp=
   trap 'exit_status=$?
-  { test -z "$tmp" || test ! -d "$tmp" || rm -fr "$tmp"; } && exit $exit_status
+  : "${ac_tmp:=$tmp}"
+  { test ! -d "$ac_tmp" || rm -fr "$ac_tmp"; } && exit $exit_status
 ' 0
-  trap '{ (exit 1); exit 1; }' 1 2 13 15
+  trap 'as_fn_exit 1' 1 2 13 15
 }
 # Create a (secure) tmp directory for tmp files.
 
 {
   tmp=`(umask 077 && mktemp -d "./confXXXXXX") 2>/dev/null` &&
-  test -n "$tmp" && test -d "$tmp"
+  test -d "$tmp"
 }  ||
 {
   tmp=./conf$$-$RANDOM
   (umask 077 && mkdir "$tmp")
-} ||
-{
-   $as_echo "$as_me: cannot create a temporary directory in ." >&2
-   { (exit 1); exit 1; }
-}
+} || as_fn_error $? "cannot create a temporary directory in ." "$LINENO" 5
+ac_tmp=$tmp
 
 # Set up the scripts for CONFIG_FILES section.
 # No need to generate them if there are no CONFIG_FILES.
@@ -17006,7 +16729,13 @@ $debug ||
 if test -n "$CONFIG_FILES"; then
 
 
-ac_cr='
'
+ac_cr=`echo X | tr X '\015'`
+# On cygwin, bash can eat \r inside `` if the user requested igncr.
+# But we know of no other shell where ac_cr would be empty at this
+# point, so we can use a bashism as a fallback.
+if test "x$ac_cr" = x; then
+  eval ac_cr=\$\'\\r\'
+fi
 ac_cs_awk_cr=`$AWK 'BEGIN { print "a\rb" }' </dev/null 2>/dev/null`
 if test "$ac_cs_awk_cr" = "a${ac_cr}b"; then
   ac_cs_awk_cr='\\r'
@@ -17014,7 +16743,7 @@ else
   ac_cs_awk_cr=$ac_cr
 fi
 
-echo 'BEGIN {' >"$tmp/subs1.awk" &&
+echo 'BEGIN {' >"$ac_tmp/subs1.awk" &&
 _ACEOF
 
 
@@ -17023,24 +16752,18 @@ _ACEOF
   echo "$ac_subst_vars" | sed 's/.*/&!$&$ac_delim/' &&
   echo "_ACEOF"
 } >conf$$subs.sh ||
-  { { $as_echo "$as_me:$LINENO: error: could not make $CONFIG_STATUS" >&5
-$as_echo "$as_me: error: could not make $CONFIG_STATUS" >&2;}
-   { (exit 1); exit 1; }; }
-ac_delim_num=`echo "$ac_subst_vars" | grep -c '$'`
+  as_fn_error $? "could not make $CONFIG_STATUS" "$LINENO" 5
+ac_delim_num=`echo "$ac_subst_vars" | grep -c '^'`
 ac_delim='%!_!# '
 for ac_last_try in false false false false false :; do
   . ./conf$$subs.sh ||
-    { { $as_echo "$as_me:$LINENO: error: could not make $CONFIG_STATUS" >&5
-$as_echo "$as_me: error: could not make $CONFIG_STATUS" >&2;}
-   { (exit 1); exit 1; }; }
+    as_fn_error $? "could not make $CONFIG_STATUS" "$LINENO" 5
 
   ac_delim_n=`sed -n "s/.*$ac_delim\$/X/p" conf$$subs.awk | grep -c X`
   if test $ac_delim_n = $ac_delim_num; then
     break
   elif $ac_last_try; then
-    { { $as_echo "$as_me:$LINENO: error: could not make $CONFIG_STATUS" >&5
-$as_echo "$as_me: error: could not make $CONFIG_STATUS" >&2;}
-   { (exit 1); exit 1; }; }
+    as_fn_error $? "could not make $CONFIG_STATUS" "$LINENO" 5
   else
     ac_delim="$ac_delim!$ac_delim _$ac_delim!! "
   fi
@@ -17048,7 +16771,7 @@ done
 rm -f conf$$subs.sh
 
 cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1
-cat >>"\$tmp/subs1.awk" <<\\_ACAWK &&
+cat >>"\$ac_tmp/subs1.awk" <<\\_ACAWK &&
 _ACEOF
 sed -n '
 h
@@ -17062,7 +16785,7 @@ s/'"$ac_delim"'$//
 t delim
 :nl
 h
-s/\(.\{148\}\).*/\1/
+s/\(.\{148\}\)..*/\1/
 t more1
 s/["\\]/\\&/g; s/^/"/; s/$/\\n"\\/
 p
@@ -17076,7 +16799,7 @@ s/.\{148\}//
 t nl
 :delim
 h
-s/\(.\{148\}\).*/\1/
+s/\(.\{148\}\)..*/\1/
 t more2
 s/["\\]/\\&/g; s/^/"/; s/$/"/
 p
@@ -17096,7 +16819,7 @@ t delim
 rm -f conf$$subs.awk
 cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1
 _ACAWK
-cat >>"\$tmp/subs1.awk" <<_ACAWK &&
+cat >>"\$ac_tmp/subs1.awk" <<_ACAWK &&
   for (key in S) S_is_set[key] = 1
   FS = ""
 
@@ -17128,23 +16851,29 @@ if sed "s/$ac_cr//" < /dev/null > /dev/null 2>&1; then
   sed "s/$ac_cr\$//; s/$ac_cr/$ac_cs_awk_cr/g"
 else
   cat
-fi < "$tmp/subs1.awk" > "$tmp/subs.awk" \
-  || { { $as_echo "$as_me:$LINENO: error: could not setup config files machinery" >&5
-$as_echo "$as_me: error: could not setup config files machinery" >&2;}
-   { (exit 1); exit 1; }; }
+fi < "$ac_tmp/subs1.awk" > "$ac_tmp/subs.awk" \
+  || as_fn_error $? "could not setup config files machinery" "$LINENO" 5
 _ACEOF
 
-# VPATH may cause trouble with some makes, so we remove $(srcdir),
-# ${srcdir} and @srcdir@ from VPATH if srcdir is ".", strip leading and
+# VPATH may cause trouble with some makes, so we remove sole $(srcdir),
+# ${srcdir} and @srcdir@ entries from VPATH if srcdir is ".", strip leading and
 # trailing colons and then remove the whole line if VPATH becomes empty
 # (actually we leave an empty line to preserve line numbers).
 if test "x$srcdir" = x.; then
-  ac_vpsub='/^[	 ]*VPATH[	 ]*=/{
-s/:*\$(srcdir):*/:/
-s/:*\${srcdir}:*/:/
-s/:*@srcdir@:*/:/
-s/^\([^=]*=[	 ]*\):*/\1/
+  ac_vpsub='/^[	 ]*VPATH[	 ]*=[	 ]*/{
+h
+s///
+s/^/:/
+s/[	 ]*$/:/
+s/:\$(srcdir):/:/g
+s/:\${srcdir}:/:/g
+s/:@srcdir@:/:/g
+s/^:*//
 s/:*$//
+x
+s/\(=[	 ]*\).*/\1/
+G
+s/\n//
 s/^[^=]*=[	 ]*$//
 }'
 fi
@@ -17156,7 +16885,7 @@ fi # test -n "$CONFIG_FILES"
 # No need to generate them if there are no CONFIG_HEADERS.
 # This happens for instance with `./config.status Makefile'.
 if test -n "$CONFIG_HEADERS"; then
-cat >"$tmp/defines.awk" <<\_ACAWK ||
+cat >"$ac_tmp/defines.awk" <<\_ACAWK ||
 BEGIN {
 _ACEOF
 
@@ -17168,13 +16897,11 @@ _ACEOF
 # handling of long lines.
 ac_delim='%!_!# '
 for ac_last_try in false false :; do
-  ac_t=`sed -n "/$ac_delim/p" confdefs.h`
-  if test -z "$ac_t"; then
+  ac_tt=`sed -n "/$ac_delim/p" confdefs.h`
+  if test -z "$ac_tt"; then
     break
   elif $ac_last_try; then
-    { { $as_echo "$as_me:$LINENO: error: could not make $CONFIG_HEADERS" >&5
-$as_echo "$as_me: error: could not make $CONFIG_HEADERS" >&2;}
-   { (exit 1); exit 1; }; }
+    as_fn_error $? "could not make $CONFIG_HEADERS" "$LINENO" 5
   else
     ac_delim="$ac_delim!$ac_delim _$ac_delim!! "
   fi
@@ -17259,9 +16986,7 @@ cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1
 _ACAWK
 _ACEOF
 cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1
-  { { $as_echo "$as_me:$LINENO: error: could not setup config headers machinery" >&5
-$as_echo "$as_me: error: could not setup config headers machinery" >&2;}
-   { (exit 1); exit 1; }; }
+  as_fn_error $? "could not setup config headers machinery" "$LINENO" 5
 fi # test -n "$CONFIG_HEADERS"
 
 
@@ -17274,9 +16999,7 @@ do
   esac
   case $ac_mode$ac_tag in
   :[FHL]*:*);;
-  :L* | :C*:*) { { $as_echo "$as_me:$LINENO: error: invalid tag $ac_tag" >&5
-$as_echo "$as_me: error: invalid tag $ac_tag" >&2;}
-   { (exit 1); exit 1; }; };;
+  :L* | :C*:*) as_fn_error $? "invalid tag \`$ac_tag'" "$LINENO" 5;;
   :[FH]-) ac_tag=-:-;;
   :[FH]*) ac_tag=$ac_tag:$ac_tag.in;;
   esac
@@ -17295,7 +17018,7 @@ $as_echo "$as_me: error: invalid tag $ac_tag" >&2;}
     for ac_f
     do
       case $ac_f in
-      -) ac_f="$tmp/stdin";;
+      -) ac_f="$ac_tmp/stdin";;
       *) # Look for the file first in the build tree, then in the source tree
 	 # (if the path is not absolute).  The absolute path cannot be DOS-style,
 	 # because $ac_f cannot contain `:'.
@@ -17304,12 +17027,10 @@ $as_echo "$as_me: error: invalid tag $ac_tag" >&2;}
 	   [\\/$]*) false;;
 	   *) test -f "$srcdir/$ac_f" && ac_f="$srcdir/$ac_f";;
 	   esac ||
-	   { { $as_echo "$as_me:$LINENO: error: cannot find input file: $ac_f" >&5
-$as_echo "$as_me: error: cannot find input file: $ac_f" >&2;}
-   { (exit 1); exit 1; }; };;
+	   as_fn_error 1 "cannot find input file: \`$ac_f'" "$LINENO" 5;;
       esac
       case $ac_f in *\'*) ac_f=`$as_echo "$ac_f" | sed "s/'/'\\\\\\\\''/g"`;; esac
-      ac_file_inputs="$ac_file_inputs '$ac_f'"
+      as_fn_append ac_file_inputs " '$ac_f'"
     done
 
     # Let's still pretend it is `configure' which instantiates (i.e., don't
@@ -17320,7 +17041,7 @@ $as_echo "$as_me: error: cannot find input file: $ac_f" >&2;}
 	`' by configure.'
     if test x"$ac_file" != x-; then
       configure_input="$ac_file.  $configure_input"
-      { $as_echo "$as_me:$LINENO: creating $ac_file" >&5
+      { $as_echo "$as_me:${as_lineno-$LINENO}: creating $ac_file" >&5
 $as_echo "$as_me: creating $ac_file" >&6;}
     fi
     # Neutralize special characters interpreted by sed in replacement strings.
@@ -17332,10 +17053,8 @@ $as_echo "$as_me: creating $ac_file" >&6;}
     esac
 
     case $ac_tag in
-    *:-:* | *:-) cat >"$tmp/stdin" \
-      || { { $as_echo "$as_me:$LINENO: error: could not create $ac_file" >&5
-$as_echo "$as_me: error: could not create $ac_file" >&2;}
-   { (exit 1); exit 1; }; } ;;
+    *:-:* | *:-) cat >"$ac_tmp/stdin" \
+      || as_fn_error $? "could not create $ac_file" "$LINENO" 5 ;;
     esac
     ;;
   esac
@@ -17363,47 +17082,7 @@ $as_echo X"$ac_file" |
 	    q
 	  }
 	  s/.*/./; q'`
-  { as_dir="$ac_dir"
-  case $as_dir in #(
-  -*) as_dir=./$as_dir;;
-  esac
-  test -d "$as_dir" || { $as_mkdir_p && mkdir -p "$as_dir"; } || {
-    as_dirs=
-    while :; do
-      case $as_dir in #(
-      *\'*) as_qdir=`$as_echo "$as_dir" | sed "s/'/'\\\\\\\\''/g"`;; #'(
-      *) as_qdir=$as_dir;;
-      esac
-      as_dirs="'$as_qdir' $as_dirs"
-      as_dir=`$as_dirname -- "$as_dir" ||
-$as_expr X"$as_dir" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \
-	 X"$as_dir" : 'X\(//\)[^/]' \| \
-	 X"$as_dir" : 'X\(//\)$' \| \
-	 X"$as_dir" : 'X\(/\)' \| . 2>/dev/null ||
-$as_echo X"$as_dir" |
-    sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{
-	    s//\1/
-	    q
-	  }
-	  /^X\(\/\/\)[^/].*/{
-	    s//\1/
-	    q
-	  }
-	  /^X\(\/\/\)$/{
-	    s//\1/
-	    q
-	  }
-	  /^X\(\/\).*/{
-	    s//\1/
-	    q
-	  }
-	  s/.*/./; q'`
-      test -d "$as_dir" && break
-    done
-    test -z "$as_dirs" || eval "mkdir $as_dirs"
-  } || test -d "$as_dir" || { { $as_echo "$as_me:$LINENO: error: cannot create directory $as_dir" >&5
-$as_echo "$as_me: error: cannot create directory $as_dir" >&2;}
-   { (exit 1); exit 1; }; }; }
+  as_dir="$ac_dir"; as_fn_mkdir_p
   ac_builddir=.
 
 case "$ac_dir" in
@@ -17460,7 +17139,6 @@ cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1
 # If the template does not know about datarootdir, expand it.
 # FIXME: This hack should be removed a few years after 2.60.
 ac_datarootdir_hack=; ac_datarootdir_seen=
-
 ac_sed_dataroot='
 /datarootdir/ {
   p
@@ -17470,12 +17148,11 @@ ac_sed_dataroot='
 /@docdir@/p
 /@infodir@/p
 /@localedir@/p
-/@mandir@/p
-'
+/@mandir@/p'
 case `eval "sed -n \"\$ac_sed_dataroot\" $ac_file_inputs"` in
 *datarootdir*) ac_datarootdir_seen=yes;;
 *@datadir@*|*@docdir@*|*@infodir@*|*@localedir@*|*@mandir@*)
-  { $as_echo "$as_me:$LINENO: WARNING: $ac_file_inputs seems to ignore the --datarootdir setting" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: $ac_file_inputs seems to ignore the --datarootdir setting" >&5
 $as_echo "$as_me: WARNING: $ac_file_inputs seems to ignore the --datarootdir setting" >&2;}
 _ACEOF
 cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1
@@ -17485,7 +17162,7 @@ cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1
   s&@infodir@&$infodir&g
   s&@localedir@&$localedir&g
   s&@mandir@&$mandir&g
-    s&\\\${datarootdir}&$datarootdir&g' ;;
+  s&\\\${datarootdir}&$datarootdir&g' ;;
 esac
 _ACEOF
 
@@ -17513,27 +17190,24 @@ s&@INSTALL@&$ac_INSTALL&;t t
 s&@MKDIR_P@&$ac_MKDIR_P&;t t
 $ac_datarootdir_hack
 "
-eval sed \"\$ac_sed_extra\" "$ac_file_inputs" | $AWK -f "$tmp/subs.awk" >$tmp/out \
-  || { { $as_echo "$as_me:$LINENO: error: could not create $ac_file" >&5
-$as_echo "$as_me: error: could not create $ac_file" >&2;}
-   { (exit 1); exit 1; }; }
+eval sed \"\$ac_sed_extra\" "$ac_file_inputs" | $AWK -f "$ac_tmp/subs.awk" \
+  >$ac_tmp/out || as_fn_error $? "could not create $ac_file" "$LINENO" 5
 
 test -z "$ac_datarootdir_hack$ac_datarootdir_seen" &&
-  { ac_out=`sed -n '/\${datarootdir}/p' "$tmp/out"`; test -n "$ac_out"; } &&
-  { ac_out=`sed -n '/^[	 ]*datarootdir[	 ]*:*=/p' "$tmp/out"`; test -z "$ac_out"; } &&
-  { $as_echo "$as_me:$LINENO: WARNING: $ac_file contains a reference to the variable \`datarootdir'
-which seems to be undefined.  Please make sure it is defined." >&5
+  { ac_out=`sed -n '/\${datarootdir}/p' "$ac_tmp/out"`; test -n "$ac_out"; } &&
+  { ac_out=`sed -n '/^[	 ]*datarootdir[	 ]*:*=/p' \
+      "$ac_tmp/out"`; test -z "$ac_out"; } &&
+  { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: $ac_file contains a reference to the variable \`datarootdir'
+which seems to be undefined.  Please make sure it is defined" >&5
 $as_echo "$as_me: WARNING: $ac_file contains a reference to the variable \`datarootdir'
-which seems to be undefined.  Please make sure it is defined." >&2;}
+which seems to be undefined.  Please make sure it is defined" >&2;}
 
-  rm -f "$tmp/stdin"
+  rm -f "$ac_tmp/stdin"
   case $ac_file in
-  -) cat "$tmp/out" && rm -f "$tmp/out";;
-  *) rm -f "$ac_file" && mv "$tmp/out" "$ac_file";;
+  -) cat "$ac_tmp/out" && rm -f "$ac_tmp/out";;
+  *) rm -f "$ac_file" && mv "$ac_tmp/out" "$ac_file";;
   esac \
-  || { { $as_echo "$as_me:$LINENO: error: could not create $ac_file" >&5
-$as_echo "$as_me: error: could not create $ac_file" >&2;}
-   { (exit 1); exit 1; }; }
+  || as_fn_error $? "could not create $ac_file" "$LINENO" 5
  ;;
   :H)
   #
@@ -17542,27 +17216,21 @@ $as_echo "$as_me: error: could not create $ac_file" >&2;}
   if test x"$ac_file" != x-; then
     {
       $as_echo "/* $configure_input  */" \
-      && eval '$AWK -f "$tmp/defines.awk"' "$ac_file_inputs"
-    } >"$tmp/config.h" \
-      || { { $as_echo "$as_me:$LINENO: error: could not create $ac_file" >&5
-$as_echo "$as_me: error: could not create $ac_file" >&2;}
-   { (exit 1); exit 1; }; }
-    if diff "$ac_file" "$tmp/config.h" >/dev/null 2>&1; then
-      { $as_echo "$as_me:$LINENO: $ac_file is unchanged" >&5
+      && eval '$AWK -f "$ac_tmp/defines.awk"' "$ac_file_inputs"
+    } >"$ac_tmp/config.h" \
+      || as_fn_error $? "could not create $ac_file" "$LINENO" 5
+    if diff "$ac_file" "$ac_tmp/config.h" >/dev/null 2>&1; then
+      { $as_echo "$as_me:${as_lineno-$LINENO}: $ac_file is unchanged" >&5
 $as_echo "$as_me: $ac_file is unchanged" >&6;}
     else
       rm -f "$ac_file"
-      mv "$tmp/config.h" "$ac_file" \
-	|| { { $as_echo "$as_me:$LINENO: error: could not create $ac_file" >&5
-$as_echo "$as_me: error: could not create $ac_file" >&2;}
-   { (exit 1); exit 1; }; }
+      mv "$ac_tmp/config.h" "$ac_file" \
+	|| as_fn_error $? "could not create $ac_file" "$LINENO" 5
     fi
   else
     $as_echo "/* $configure_input  */" \
-      && eval '$AWK -f "$tmp/defines.awk"' "$ac_file_inputs" \
-      || { { $as_echo "$as_me:$LINENO: error: could not create -" >&5
-$as_echo "$as_me: error: could not create -" >&2;}
-   { (exit 1); exit 1; }; }
+      && eval '$AWK -f "$ac_tmp/defines.awk"' "$ac_file_inputs" \
+      || as_fn_error $? "could not create -" "$LINENO" 5
   fi
 # Compute "$ac_file"'s index in $config_headers.
 _am_arg="$ac_file"
@@ -17600,7 +17268,7 @@ $as_echo X"$_am_arg" |
 	  s/.*/./; q'`/stamp-h$_am_stamp_count
  ;;
 
-  :C)  { $as_echo "$as_me:$LINENO: executing $ac_file commands" >&5
+  :C)  { $as_echo "$as_me:${as_lineno-$LINENO}: executing $ac_file commands" >&5
 $as_echo "$as_me: executing $ac_file commands" >&6;}
  ;;
   esac
@@ -17695,47 +17363,7 @@ $as_echo X"$file" |
 	    q
 	  }
 	  s/.*/./; q'`
-      { as_dir=$dirpart/$fdir
-  case $as_dir in #(
-  -*) as_dir=./$as_dir;;
-  esac
-  test -d "$as_dir" || { $as_mkdir_p && mkdir -p "$as_dir"; } || {
-    as_dirs=
-    while :; do
-      case $as_dir in #(
-      *\'*) as_qdir=`$as_echo "$as_dir" | sed "s/'/'\\\\\\\\''/g"`;; #'(
-      *) as_qdir=$as_dir;;
-      esac
-      as_dirs="'$as_qdir' $as_dirs"
-      as_dir=`$as_dirname -- "$as_dir" ||
-$as_expr X"$as_dir" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \
-	 X"$as_dir" : 'X\(//\)[^/]' \| \
-	 X"$as_dir" : 'X\(//\)$' \| \
-	 X"$as_dir" : 'X\(/\)' \| . 2>/dev/null ||
-$as_echo X"$as_dir" |
-    sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{
-	    s//\1/
-	    q
-	  }
-	  /^X\(\/\/\)[^/].*/{
-	    s//\1/
-	    q
-	  }
-	  /^X\(\/\/\)$/{
-	    s//\1/
-	    q
-	  }
-	  /^X\(\/\).*/{
-	    s//\1/
-	    q
-	  }
-	  s/.*/./; q'`
-      test -d "$as_dir" && break
-    done
-    test -z "$as_dirs" || eval "mkdir $as_dirs"
-  } || test -d "$as_dir" || { { $as_echo "$as_me:$LINENO: error: cannot create directory $as_dir" >&5
-$as_echo "$as_me: error: cannot create directory $as_dir" >&2;}
-   { (exit 1); exit 1; }; }; }
+      as_dir=$dirpart/$fdir; as_fn_mkdir_p
       # echo "creating $dirpart/$file"
       echo '# dummy' > "$dirpart/$file"
     done
@@ -17763,7 +17391,8 @@ $as_echo "$as_me: error: cannot create directory $as_dir" >&2;}
 # NOTE: Changes made to this file will be lost: look at ltmain.sh.
 #
 #   Copyright (C) 1996, 1997, 1998, 1999, 2000, 2001, 2003, 2004, 2005,
-#                 2006, 2007, 2008 Free Software Foundation, Inc.
+#                 2006, 2007, 2008, 2009, 2010, 2011 Free Software
+#                 Foundation, Inc.
 #   Written by Gordon Matzigkeit, 1996
 #
 #   This file is part of GNU Libtool.
@@ -17811,6 +17440,15 @@ pic_mode=$pic_mode
 # Whether or not to optimize for fast installation.
 fast_install=$enable_fast_install
 
+# Shell to use when invoking shell scripts.
+SHELL=$lt_SHELL
+
+# An echo program that protects backslashes.
+ECHO=$lt_ECHO
+
+# The PATH separator for the build system.
+PATH_SEPARATOR=$lt_PATH_SEPARATOR
+
 # The host system.
 host_alias=$host_alias
 host=$host
@@ -17860,9 +17498,11 @@ SP2NL=$lt_lt_SP2NL
 # turn newlines into spaces.
 NL2SP=$lt_lt_NL2SP
 
-# How to create reloadable object files.
-reload_flag=$lt_reload_flag
-reload_cmds=$lt_reload_cmds
+# convert \$build file names to \$host format.
+to_host_file_cmd=$lt_cv_to_host_file_cmd
+
+# convert \$build files to toolchain format.
+to_tool_file_cmd=$lt_cv_to_tool_file_cmd
 
 # An object symbol dumper.
 OBJDUMP=$lt_OBJDUMP
@@ -17870,13 +17510,30 @@ OBJDUMP=$lt_OBJDUMP
 # Method to check whether dependent libraries are shared objects.
 deplibs_check_method=$lt_deplibs_check_method
 
-# Command to use when deplibs_check_method == "file_magic".
+# Command to use when deplibs_check_method = "file_magic".
 file_magic_cmd=$lt_file_magic_cmd
 
+# How to find potential files when deplibs_check_method = "file_magic".
+file_magic_glob=$lt_file_magic_glob
+
+# Find potential files using nocaseglob when deplibs_check_method = "file_magic".
+want_nocaseglob=$lt_want_nocaseglob
+
+# DLL creation program.
+DLLTOOL=$lt_DLLTOOL
+
+# Command to associate shared and link libraries.
+sharedlib_from_linklib_cmd=$lt_sharedlib_from_linklib_cmd
+
 # The archiver.
 AR=$lt_AR
+
+# Flags to create an archive.
 AR_FLAGS=$lt_AR_FLAGS
 
+# How to feed a file listing to the archiver.
+archiver_list_spec=$lt_archiver_list_spec
+
 # A symbol stripping program.
 STRIP=$lt_STRIP
 
@@ -17885,6 +17542,9 @@ RANLIB=$lt_RANLIB
 old_postinstall_cmds=$lt_old_postinstall_cmds
 old_postuninstall_cmds=$lt_old_postuninstall_cmds
 
+# Whether to use a lock for old archive extraction.
+lock_old_archive_extraction=$lock_old_archive_extraction
+
 # A C compiler.
 LTCC=$lt_CC
 
@@ -17903,14 +17563,14 @@ global_symbol_to_c_name_address=$lt_lt_cv_sys_global_symbol_to_c_name_address
 # Transform the output of nm in a C name address pair when lib prefix is needed.
 global_symbol_to_c_name_address_lib_prefix=$lt_lt_cv_sys_global_symbol_to_c_name_address_lib_prefix
 
-# The name of the directory that contains temporary libtool files.
-objdir=$objdir
+# Specify filename containing input files for \$NM.
+nm_file_list_spec=$lt_nm_file_list_spec
 
-# Shell to use when invoking shell scripts.
-SHELL=$lt_SHELL
+# The root where to search for dependent libraries,and in which our libraries should be installed.
+lt_sysroot=$lt_sysroot
 
-# An echo program that does not interpret backslashes.
-ECHO=$lt_ECHO
+# The name of the directory that contains temporary libtool files.
+objdir=$objdir
 
 # Used to examine libraries when file_magic_cmd begins with "file".
 MAGIC_CMD=$MAGIC_CMD
@@ -17918,6 +17578,9 @@ MAGIC_CMD=$MAGIC_CMD
 # Must we lock files when doing compilation?
 need_locks=$lt_need_locks
 
+# Manifest tool.
+MANIFEST_TOOL=$lt_MANIFEST_TOOL
+
 # Tool to manipulate archived DWARF debug symbol files on Mac OS X.
 DSYMUTIL=$lt_DSYMUTIL
 
@@ -17974,6 +17637,9 @@ library_names_spec=$lt_library_names_spec
 # The coded name of the library, if different from the real name.
 soname_spec=$lt_soname_spec
 
+# Permission mode override for installation of shared libraries.
+install_override_mode=$lt_install_override_mode
+
 # Command to use after installation of a shared archive.
 postinstall_cmds=$lt_postinstall_cmds
 
@@ -18013,6 +17679,10 @@ striplib=$lt_striplib
 # The linker used to build libraries.
 LD=$lt_LD
 
+# How to create reloadable object files.
+reload_flag=$lt_reload_flag
+reload_cmds=$lt_reload_cmds
+
 # Commands used to build an old-style archive.
 old_archive_cmds=$lt_old_archive_cmds
 
@@ -18025,12 +17695,12 @@ with_gcc=$GCC
 # Compiler flag to turn off builtin functions.
 no_builtin_flag=$lt_lt_prog_compiler_no_builtin_flag
 
-# How to pass a linker flag through the compiler.
-wl=$lt_lt_prog_compiler_wl
-
 # Additional compiler flags for building library objects.
 pic_flag=$lt_lt_prog_compiler_pic
 
+# How to pass a linker flag through the compiler.
+wl=$lt_lt_prog_compiler_wl
+
 # Compiler flag to prevent dynamic linking.
 link_static_flag=$lt_lt_prog_compiler_static
 
@@ -18080,10 +17750,6 @@ no_undefined_flag=$lt_no_undefined_flag
 # This must work even if \$libdir does not exist
 hardcode_libdir_flag_spec=$lt_hardcode_libdir_flag_spec
 
-# If ld is used when linking, flag to hardcode \$libdir into a binary
-# during linking.  This must work even if \$libdir does not exist.
-hardcode_libdir_flag_spec_ld=$lt_hardcode_libdir_flag_spec_ld
-
 # Whether we need a single "-rpath" flag with a separated argument.
 hardcode_libdir_separator=$lt_hardcode_libdir_separator
 
@@ -18117,9 +17783,6 @@ inherit_rpath=$inherit_rpath
 # Whether libtool must link a program against all its dependency libraries.
 link_all_deplibs=$link_all_deplibs
 
-# Fix the shell variable \$srcfile for the compiler.
-fix_srcfile_path=$lt_fix_srcfile_path
-
 # Set to "yes" if exported symbols are required.
 always_export_symbols=$always_export_symbols
 
@@ -18135,6 +17798,9 @@ include_expsyms=$lt_include_expsyms
 # Commands necessary for linking programs (against libraries) with templates.
 prelink_cmds=$lt_prelink_cmds
 
+# Commands necessary for finishing linking programs.
+postlink_cmds=$lt_postlink_cmds
+
 # Specify filename containing input files.
 file_list_spec=$lt_file_list_spec
 
@@ -18181,212 +17847,169 @@ ltmain="$ac_aux_dir/ltmain.sh"
   # if finds mixed CR/LF and LF-only lines.  Since sed operates in
   # text mode, it properly converts lines to CR/LF.  This bash problem
   # is reportedly fixed, but why not run on old versions too?
-  sed '/^# Generated shell functions inserted here/q' "$ltmain" >> "$cfgfile" \
-    || (rm -f "$cfgfile"; exit 1)
-
-  case $xsi_shell in
-  yes)
-    cat << \_LT_EOF >> "$cfgfile"
-
-# func_dirname file append nondir_replacement
-# Compute the dirname of FILE.  If nonempty, add APPEND to the result,
-# otherwise set result to NONDIR_REPLACEMENT.
-func_dirname ()
-{
-  case ${1} in
-    */*) func_dirname_result="${1%/*}${2}" ;;
-    *  ) func_dirname_result="${3}" ;;
-  esac
-}
-
-# func_basename file
-func_basename ()
-{
-  func_basename_result="${1##*/}"
-}
-
-# func_dirname_and_basename file append nondir_replacement
-# perform func_basename and func_dirname in a single function
-# call:
-#   dirname:  Compute the dirname of FILE.  If nonempty,
-#             add APPEND to the result, otherwise set result
-#             to NONDIR_REPLACEMENT.
-#             value returned in "$func_dirname_result"
-#   basename: Compute filename of FILE.
-#             value retuned in "$func_basename_result"
-# Implementation must be kept synchronized with func_dirname
-# and func_basename. For efficiency, we do not delegate to
-# those functions but instead duplicate the functionality here.
-func_dirname_and_basename ()
-{
-  case ${1} in
-    */*) func_dirname_result="${1%/*}${2}" ;;
-    *  ) func_dirname_result="${3}" ;;
-  esac
-  func_basename_result="${1##*/}"
-}
-
-# func_stripname prefix suffix name
-# strip PREFIX and SUFFIX off of NAME.
-# PREFIX and SUFFIX must not contain globbing or regex special
-# characters, hashes, percent signs, but SUFFIX may contain a leading
-# dot (in which case that matches only a dot).
-func_stripname ()
-{
-  # pdksh 5.2.14 does not do ${X%$Y} correctly if both X and Y are
-  # positional parameters, so assign one to ordinary parameter first.
-  func_stripname_result=${3}
-  func_stripname_result=${func_stripname_result#"${1}"}
-  func_stripname_result=${func_stripname_result%"${2}"}
-}
-
-# func_opt_split
-func_opt_split ()
-{
-  func_opt_split_opt=${1%%=*}
-  func_opt_split_arg=${1#*=}
-}
-
-# func_lo2o object
-func_lo2o ()
-{
-  case ${1} in
-    *.lo) func_lo2o_result=${1%.lo}.${objext} ;;
-    *)    func_lo2o_result=${1} ;;
-  esac
-}
-
-# func_xform libobj-or-source
-func_xform ()
-{
-  func_xform_result=${1%.*}.lo
-}
-
-# func_arith arithmetic-term...
-func_arith ()
-{
-  func_arith_result=$(( $* ))
-}
-
-# func_len string
-# STRING may not start with a hyphen.
-func_len ()
-{
-  func_len_result=${#1}
-}
-
-_LT_EOF
-    ;;
-  *) # Bourne compatible functions.
-    cat << \_LT_EOF >> "$cfgfile"
-
-# func_dirname file append nondir_replacement
-# Compute the dirname of FILE.  If nonempty, add APPEND to the result,
-# otherwise set result to NONDIR_REPLACEMENT.
-func_dirname ()
-{
-  # Extract subdirectory from the argument.
-  func_dirname_result=`$ECHO "X${1}" | $Xsed -e "$dirname"`
-  if test "X$func_dirname_result" = "X${1}"; then
-    func_dirname_result="${3}"
-  else
-    func_dirname_result="$func_dirname_result${2}"
-  fi
-}
-
-# func_basename file
-func_basename ()
-{
-  func_basename_result=`$ECHO "X${1}" | $Xsed -e "$basename"`
-}
-
-
-# func_stripname prefix suffix name
-# strip PREFIX and SUFFIX off of NAME.
-# PREFIX and SUFFIX must not contain globbing or regex special
-# characters, hashes, percent signs, but SUFFIX may contain a leading
-# dot (in which case that matches only a dot).
-# func_strip_suffix prefix name
-func_stripname ()
-{
-  case ${2} in
-    .*) func_stripname_result=`$ECHO "X${3}" \
-           | $Xsed -e "s%^${1}%%" -e "s%\\\\${2}\$%%"`;;
-    *)  func_stripname_result=`$ECHO "X${3}" \
-           | $Xsed -e "s%^${1}%%" -e "s%${2}\$%%"`;;
-  esac
-}
-
-# sed scripts:
-my_sed_long_opt='1s/^\(-[^=]*\)=.*/\1/;q'
-my_sed_long_arg='1s/^-[^=]*=//'
-
-# func_opt_split
-func_opt_split ()
-{
-  func_opt_split_opt=`$ECHO "X${1}" | $Xsed -e "$my_sed_long_opt"`
-  func_opt_split_arg=`$ECHO "X${1}" | $Xsed -e "$my_sed_long_arg"`
-}
-
-# func_lo2o object
-func_lo2o ()
-{
-  func_lo2o_result=`$ECHO "X${1}" | $Xsed -e "$lo2o"`
-}
-
-# func_xform libobj-or-source
-func_xform ()
-{
-  func_xform_result=`$ECHO "X${1}" | $Xsed -e 's/\.[^.]*$/.lo/'`
-}
-
-# func_arith arithmetic-term...
-func_arith ()
-{
-  func_arith_result=`expr "$@"`
-}
-
-# func_len string
-# STRING may not start with a hyphen.
-func_len ()
-{
-  func_len_result=`expr "$1" : ".*" 2>/dev/null || echo $max_cmd_len`
-}
-
-_LT_EOF
-esac
-
-case $lt_shell_append in
-  yes)
-    cat << \_LT_EOF >> "$cfgfile"
-
-# func_append var value
-# Append VALUE to the end of shell variable VAR.
-func_append ()
-{
-  eval "$1+=\$2"
-}
-_LT_EOF
-    ;;
-  *)
-    cat << \_LT_EOF >> "$cfgfile"
-
-# func_append var value
-# Append VALUE to the end of shell variable VAR.
-func_append ()
-{
-  eval "$1=\$$1\$2"
-}
-
-_LT_EOF
-    ;;
-  esac
-
-
-  sed -n '/^# Generated shell functions inserted here/,$p' "$ltmain" >> "$cfgfile" \
-    || (rm -f "$cfgfile"; exit 1)
-
-  mv -f "$cfgfile" "$ofile" ||
+  sed '$q' "$ltmain" >> "$cfgfile" \
+     || (rm -f "$cfgfile"; exit 1)
+
+  if test x"$xsi_shell" = xyes; then
+  sed -e '/^func_dirname ()$/,/^} # func_dirname /c\
+func_dirname ()\
+{\
+\    case ${1} in\
+\      */*) func_dirname_result="${1%/*}${2}" ;;\
+\      *  ) func_dirname_result="${3}" ;;\
+\    esac\
+} # Extended-shell func_dirname implementation' "$cfgfile" > $cfgfile.tmp \
+  && mv -f "$cfgfile.tmp" "$cfgfile" \
+    || (rm -f "$cfgfile" && cp "$cfgfile.tmp" "$cfgfile" && rm -f "$cfgfile.tmp")
+test 0 -eq $? || _lt_function_replace_fail=:
+
+
+  sed -e '/^func_basename ()$/,/^} # func_basename /c\
+func_basename ()\
+{\
+\    func_basename_result="${1##*/}"\
+} # Extended-shell func_basename implementation' "$cfgfile" > $cfgfile.tmp \
+  && mv -f "$cfgfile.tmp" "$cfgfile" \
+    || (rm -f "$cfgfile" && cp "$cfgfile.tmp" "$cfgfile" && rm -f "$cfgfile.tmp")
+test 0 -eq $? || _lt_function_replace_fail=:
+
+
+  sed -e '/^func_dirname_and_basename ()$/,/^} # func_dirname_and_basename /c\
+func_dirname_and_basename ()\
+{\
+\    case ${1} in\
+\      */*) func_dirname_result="${1%/*}${2}" ;;\
+\      *  ) func_dirname_result="${3}" ;;\
+\    esac\
+\    func_basename_result="${1##*/}"\
+} # Extended-shell func_dirname_and_basename implementation' "$cfgfile" > $cfgfile.tmp \
+  && mv -f "$cfgfile.tmp" "$cfgfile" \
+    || (rm -f "$cfgfile" && cp "$cfgfile.tmp" "$cfgfile" && rm -f "$cfgfile.tmp")
+test 0 -eq $? || _lt_function_replace_fail=:
+
+
+  sed -e '/^func_stripname ()$/,/^} # func_stripname /c\
+func_stripname ()\
+{\
+\    # pdksh 5.2.14 does not do ${X%$Y} correctly if both X and Y are\
+\    # positional parameters, so assign one to ordinary parameter first.\
+\    func_stripname_result=${3}\
+\    func_stripname_result=${func_stripname_result#"${1}"}\
+\    func_stripname_result=${func_stripname_result%"${2}"}\
+} # Extended-shell func_stripname implementation' "$cfgfile" > $cfgfile.tmp \
+  && mv -f "$cfgfile.tmp" "$cfgfile" \
+    || (rm -f "$cfgfile" && cp "$cfgfile.tmp" "$cfgfile" && rm -f "$cfgfile.tmp")
+test 0 -eq $? || _lt_function_replace_fail=:
+
+
+  sed -e '/^func_split_long_opt ()$/,/^} # func_split_long_opt /c\
+func_split_long_opt ()\
+{\
+\    func_split_long_opt_name=${1%%=*}\
+\    func_split_long_opt_arg=${1#*=}\
+} # Extended-shell func_split_long_opt implementation' "$cfgfile" > $cfgfile.tmp \
+  && mv -f "$cfgfile.tmp" "$cfgfile" \
+    || (rm -f "$cfgfile" && cp "$cfgfile.tmp" "$cfgfile" && rm -f "$cfgfile.tmp")
+test 0 -eq $? || _lt_function_replace_fail=:
+
+
+  sed -e '/^func_split_short_opt ()$/,/^} # func_split_short_opt /c\
+func_split_short_opt ()\
+{\
+\    func_split_short_opt_arg=${1#??}\
+\    func_split_short_opt_name=${1%"$func_split_short_opt_arg"}\
+} # Extended-shell func_split_short_opt implementation' "$cfgfile" > $cfgfile.tmp \
+  && mv -f "$cfgfile.tmp" "$cfgfile" \
+    || (rm -f "$cfgfile" && cp "$cfgfile.tmp" "$cfgfile" && rm -f "$cfgfile.tmp")
+test 0 -eq $? || _lt_function_replace_fail=:
+
+
+  sed -e '/^func_lo2o ()$/,/^} # func_lo2o /c\
+func_lo2o ()\
+{\
+\    case ${1} in\
+\      *.lo) func_lo2o_result=${1%.lo}.${objext} ;;\
+\      *)    func_lo2o_result=${1} ;;\
+\    esac\
+} # Extended-shell func_lo2o implementation' "$cfgfile" > $cfgfile.tmp \
+  && mv -f "$cfgfile.tmp" "$cfgfile" \
+    || (rm -f "$cfgfile" && cp "$cfgfile.tmp" "$cfgfile" && rm -f "$cfgfile.tmp")
+test 0 -eq $? || _lt_function_replace_fail=:
+
+
+  sed -e '/^func_xform ()$/,/^} # func_xform /c\
+func_xform ()\
+{\
+    func_xform_result=${1%.*}.lo\
+} # Extended-shell func_xform implementation' "$cfgfile" > $cfgfile.tmp \
+  && mv -f "$cfgfile.tmp" "$cfgfile" \
+    || (rm -f "$cfgfile" && cp "$cfgfile.tmp" "$cfgfile" && rm -f "$cfgfile.tmp")
+test 0 -eq $? || _lt_function_replace_fail=:
+
+
+  sed -e '/^func_arith ()$/,/^} # func_arith /c\
+func_arith ()\
+{\
+    func_arith_result=$(( $* ))\
+} # Extended-shell func_arith implementation' "$cfgfile" > $cfgfile.tmp \
+  && mv -f "$cfgfile.tmp" "$cfgfile" \
+    || (rm -f "$cfgfile" && cp "$cfgfile.tmp" "$cfgfile" && rm -f "$cfgfile.tmp")
+test 0 -eq $? || _lt_function_replace_fail=:
+
+
+  sed -e '/^func_len ()$/,/^} # func_len /c\
+func_len ()\
+{\
+    func_len_result=${#1}\
+} # Extended-shell func_len implementation' "$cfgfile" > $cfgfile.tmp \
+  && mv -f "$cfgfile.tmp" "$cfgfile" \
+    || (rm -f "$cfgfile" && cp "$cfgfile.tmp" "$cfgfile" && rm -f "$cfgfile.tmp")
+test 0 -eq $? || _lt_function_replace_fail=:
+
+fi
+
+if test x"$lt_shell_append" = xyes; then
+  sed -e '/^func_append ()$/,/^} # func_append /c\
+func_append ()\
+{\
+    eval "${1}+=\\${2}"\
+} # Extended-shell func_append implementation' "$cfgfile" > $cfgfile.tmp \
+  && mv -f "$cfgfile.tmp" "$cfgfile" \
+    || (rm -f "$cfgfile" && cp "$cfgfile.tmp" "$cfgfile" && rm -f "$cfgfile.tmp")
+test 0 -eq $? || _lt_function_replace_fail=:
+
+
+  sed -e '/^func_append_quoted ()$/,/^} # func_append_quoted /c\
+func_append_quoted ()\
+{\
+\    func_quote_for_eval "${2}"\
+\    eval "${1}+=\\\\ \\$func_quote_for_eval_result"\
+} # Extended-shell func_append_quoted implementation' "$cfgfile" > $cfgfile.tmp \
+  && mv -f "$cfgfile.tmp" "$cfgfile" \
+    || (rm -f "$cfgfile" && cp "$cfgfile.tmp" "$cfgfile" && rm -f "$cfgfile.tmp")
+test 0 -eq $? || _lt_function_replace_fail=:
+
+
+  # Save a `func_append' function call where possible by direct use of '+='
+  sed -e 's%func_append \([a-zA-Z_]\{1,\}\) "%\1+="%g' $cfgfile > $cfgfile.tmp \
+    && mv -f "$cfgfile.tmp" "$cfgfile" \
+      || (rm -f "$cfgfile" && cp "$cfgfile.tmp" "$cfgfile" && rm -f "$cfgfile.tmp")
+  test 0 -eq $? || _lt_function_replace_fail=:
+else
+  # Save a `func_append' function call even when '+=' is not available
+  sed -e 's%func_append \([a-zA-Z_]\{1,\}\) "%\1="$\1%g' $cfgfile > $cfgfile.tmp \
+    && mv -f "$cfgfile.tmp" "$cfgfile" \
+      || (rm -f "$cfgfile" && cp "$cfgfile.tmp" "$cfgfile" && rm -f "$cfgfile.tmp")
+  test 0 -eq $? || _lt_function_replace_fail=:
+fi
+
+if test x"$_lt_function_replace_fail" = x":"; then
+  { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: Unable to substitute extended shell functions in $ofile" >&5
+$as_echo "$as_me: WARNING: Unable to substitute extended shell functions in $ofile" >&2;}
+fi
+
+
+   mv -f "$cfgfile" "$ofile" ||
     (rm -f "$ofile" && cp "$cfgfile" "$ofile" && rm -f "$cfgfile")
   chmod +x "$ofile"
 
@@ -18398,6 +18021,10 @@ _LT_EOF
 # The linker used to build libraries.
 LD=$lt_LD_CXX
 
+# How to create reloadable object files.
+reload_flag=$lt_reload_flag_CXX
+reload_cmds=$lt_reload_cmds_CXX
+
 # Commands used to build an old-style archive.
 old_archive_cmds=$lt_old_archive_cmds_CXX
 
@@ -18410,12 +18037,12 @@ with_gcc=$GCC_CXX
 # Compiler flag to turn off builtin functions.
 no_builtin_flag=$lt_lt_prog_compiler_no_builtin_flag_CXX
 
-# How to pass a linker flag through the compiler.
-wl=$lt_lt_prog_compiler_wl_CXX
-
 # Additional compiler flags for building library objects.
 pic_flag=$lt_lt_prog_compiler_pic_CXX
 
+# How to pass a linker flag through the compiler.
+wl=$lt_lt_prog_compiler_wl_CXX
+
 # Compiler flag to prevent dynamic linking.
 link_static_flag=$lt_lt_prog_compiler_static_CXX
 
@@ -18465,10 +18092,6 @@ no_undefined_flag=$lt_no_undefined_flag_CXX
 # This must work even if \$libdir does not exist
 hardcode_libdir_flag_spec=$lt_hardcode_libdir_flag_spec_CXX
 
-# If ld is used when linking, flag to hardcode \$libdir into a binary
-# during linking.  This must work even if \$libdir does not exist.
-hardcode_libdir_flag_spec_ld=$lt_hardcode_libdir_flag_spec_ld_CXX
-
 # Whether we need a single "-rpath" flag with a separated argument.
 hardcode_libdir_separator=$lt_hardcode_libdir_separator_CXX
 
@@ -18502,9 +18125,6 @@ inherit_rpath=$inherit_rpath_CXX
 # Whether libtool must link a program against all its dependency libraries.
 link_all_deplibs=$link_all_deplibs_CXX
 
-# Fix the shell variable \$srcfile for the compiler.
-fix_srcfile_path=$lt_fix_srcfile_path_CXX
-
 # Set to "yes" if exported symbols are required.
 always_export_symbols=$always_export_symbols_CXX
 
@@ -18520,6 +18140,9 @@ include_expsyms=$lt_include_expsyms_CXX
 # Commands necessary for linking programs (against libraries) with templates.
 prelink_cmds=$lt_prelink_cmds_CXX
 
+# Commands necessary for finishing linking programs.
+postlink_cmds=$lt_postlink_cmds_CXX
+
 # Specify filename containing input files.
 file_list_spec=$lt_file_list_spec_CXX
 
@@ -18549,15 +18172,12 @@ _LT_EOF
 done # for ac_tag
 
 
-{ (exit 0); exit 0; }
+as_fn_exit 0
 _ACEOF
-chmod +x $CONFIG_STATUS
 ac_clean_files=$ac_clean_files_save
 
 test $ac_write_fail = 0 ||
-  { { $as_echo "$as_me:$LINENO: error: write failure creating $CONFIG_STATUS" >&5
-$as_echo "$as_me: error: write failure creating $CONFIG_STATUS" >&2;}
-   { (exit 1); exit 1; }; }
+  as_fn_error $? "write failure creating $CONFIG_STATUS" "$LINENO" 5
 
 
 # configure is writing to config.log, and then calls config.status.
@@ -18578,10 +18198,10 @@ if test "$no_create" != yes; then
   exec 5>>config.log
   # Use ||, not &&, to avoid exiting from the if with $? = 1, which
   # would make configure fail if this is the last instruction.
-  $ac_cs_success || { (exit 1); exit 1; }
+  $ac_cs_success || as_fn_exit 1
 fi
 if test -n "$ac_unrecognized_opts" && test "$enable_option_checking" != no; then
-  { $as_echo "$as_me:$LINENO: WARNING: unrecognized options: $ac_unrecognized_opts" >&5
+  { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: unrecognized options: $ac_unrecognized_opts" >&5
 $as_echo "$as_me: WARNING: unrecognized options: $ac_unrecognized_opts" >&2;}
 fi
 
diff --git a/configure.ac b/configure.ac
index b8e8ff4..d650d0f 100644
--- a/configure.ac
+++ b/configure.ac
@@ -1,14 +1,19 @@
-AC_INIT([jellyfish], [1.1.5], [gmarcais at umd.edu])
+AC_INIT([jellyfish], [1.1.11], [gmarcais at umd.edu])
 AC_CANONICAL_HOST
 AC_CONFIG_MACRO_DIR([m4])
-AM_INIT_AUTOMAKE([-Wall -Werror subdir-objects foreign parallel-tests color-tests])
+AM_INIT_AUTOMAKE([subdir-objects foreign parallel-tests color-tests])
 AM_SILENT_RULES([yes])
+AC_CONFIG_SRCDIR([jellyfish])
+AC_CONFIG_HEADERS([config.h])
+AC_CONFIG_MACRO_DIR([m4])
+AC_PROG_LIBTOOL
 
-: ${CXXFLAGS=""}
+# Change default compilation flags
+#AC_SUBST([ALL_CXXFLAGS], [-std=c++0x])
+#CXXFLAGS="-std=c++0x $CXXFLAGS"
+AC_LANG(C++)
 AC_PROG_CXX
 
-AC_CONFIG_MACRO_DIR([m4])
-AC_CONFIG_HEADERS([config.h])
 
 dnl define([concat], $1$2$3)dnl
 dnl define([PC_FILE], concat([jellyfish-],AC_PACKAGE_VERSION,[.pc]))
@@ -39,16 +44,27 @@ AS_IF([test "x$with_half" = "xyes"],
       [AC_DEFINE([HALF_FLOATS], [1], [Define if you use half floats for qmer counting])],
       [])
 
+AC_CHECK_TYPE([__int128],
+              [AC_DEFINE([HAVE_INT128], [1], [Define if type __int128 is supported])])
+
+
 # Check the version of strerror_r
 AC_FUNC_STRERROR_R      
 
-AC_CHECK_HEADERS([execinfo.h])
+AC_CHECK_HEADERS([execinfo.h sys/syscall.h])
 
 AC_CHECK_MEMBER([siginfo_t.si_int],
                 [AC_DEFINE([HAVE_SI_INT], [1], [Define if siginfo_t.si_int exists])],
                 [], [[#include <signal.h>]])
 
-LT_INIT
+# --enable-all-static
+# Do not use libtool if building all static
+AC_ARG_ENABLE([all-static],
+              [AC_HELP_STRING([--enable-all-static], [create statically linked executable])])
+STATIC_FLAGS=
+AS_IF([test x$enable_all_static = xyes],
+      [AC_SUBST([STATIC_FLAGS], [-all-static])])
+
 AC_OUTPUT
 
 
diff --git a/depcomp b/depcomp
index df8eea7..25a39e6 100755
--- a/depcomp
+++ b/depcomp
@@ -1,10 +1,10 @@
 #! /bin/sh
 # depcomp - compile a program generating dependencies as side-effects
 
-scriptversion=2009-04-28.21; # UTC
+scriptversion=2012-03-27.16; # UTC
 
-# Copyright (C) 1999, 2000, 2003, 2004, 2005, 2006, 2007, 2009 Free
-# Software Foundation, Inc.
+# Copyright (C) 1999, 2000, 2003, 2004, 2005, 2006, 2007, 2009, 2010,
+# 2011, 2012 Free Software Foundation, Inc.
 
 # This program is free software; you can redistribute it and/or modify
 # it under the terms of the GNU General Public License as published by
@@ -28,7 +28,7 @@ scriptversion=2009-04-28.21; # UTC
 
 case $1 in
   '')
-     echo "$0: No command.  Try \`$0 --help' for more information." 1>&2
+     echo "$0: No command.  Try '$0 --help' for more information." 1>&2
      exit 1;
      ;;
   -h | --h*)
@@ -40,11 +40,11 @@ as side-effects.
 
 Environment variables:
   depmode     Dependency tracking mode.
-  source      Source file read by `PROGRAMS ARGS'.
-  object      Object file output by `PROGRAMS ARGS'.
+  source      Source file read by 'PROGRAMS ARGS'.
+  object      Object file output by 'PROGRAMS ARGS'.
   DEPDIR      directory where to store dependencies.
   depfile     Dependency file to output.
-  tmpdepfile  Temporary file to use when outputing dependencies.
+  tmpdepfile  Temporary file to use when outputting dependencies.
   libtool     Whether libtool is used (yes/no).
 
 Report bugs to <bug-automake at gnu.org>.
@@ -57,6 +57,12 @@ EOF
     ;;
 esac
 
+# A tabulation character.
+tab='	'
+# A newline character.
+nl='
+'
+
 if test -z "$depmode" || test -z "$source" || test -z "$object"; then
   echo "depcomp: Variables source, object and depmode must be set" 1>&2
   exit 1
@@ -90,10 +96,24 @@ if test "$depmode" = msvcmsys; then
    # This is just like msvisualcpp but w/o cygpath translation.
    # Just convert the backslash-escaped backslashes to single forward
    # slashes to satisfy depend.m4
-   cygpath_u="sed s,\\\\\\\\,/,g"
+   cygpath_u='sed s,\\\\,/,g'
    depmode=msvisualcpp
 fi
 
+if test "$depmode" = msvc7msys; then
+   # This is just like msvc7 but w/o cygpath translation.
+   # Just convert the backslash-escaped backslashes to single forward
+   # slashes to satisfy depend.m4
+   cygpath_u='sed s,\\\\,/,g'
+   depmode=msvc7
+fi
+
+if test "$depmode" = xlc; then
+   # IBM C/C++ Compilers xlc/xlC can output gcc-like dependency informations.
+   gccflag=-qmakedep=gcc,-MF
+   depmode=gcc
+fi
+
 case "$depmode" in
 gcc3)
 ## gcc 3 implements dependency tracking that does exactly what
@@ -148,20 +168,21 @@ gcc)
 ## The second -e expression handles DOS-style file names with drive letters.
   sed -e 's/^[^:]*: / /' \
       -e 's/^['$alpha']:\/[^:]*: / /' < "$tmpdepfile" >> "$depfile"
-## This next piece of magic avoids the `deleted header file' problem.
+## This next piece of magic avoids the "deleted header file" problem.
 ## The problem is that when a header file which appears in a .P file
 ## is deleted, the dependency causes make to die (because there is
 ## typically no way to rebuild the header).  We avoid this by adding
 ## dummy dependencies for each header file.  Too bad gcc doesn't do
 ## this for us directly.
-  tr ' ' '
-' < "$tmpdepfile" |
-## Some versions of gcc put a space before the `:'.  On the theory
+  tr ' ' "$nl" < "$tmpdepfile" |
+## Some versions of gcc put a space before the ':'.  On the theory
 ## that the space means something, we add a space to the output as
-## well.
+## well.  hp depmode also adds that space, but also prefixes the VPATH
+## to the object.  Take care to not repeat it in the output.
 ## Some versions of the HPUX 10.20 sed can't process this invocation
 ## correctly.  Breaking it into two sed invocations is a workaround.
-    sed -e 's/^\\$//' -e '/^$/d' -e '/:$/d' | sed -e 's/$/ :/' >> "$depfile"
+    sed -e 's/^\\$//' -e '/^$/d' -e "s|.*$object$||" -e '/:$/d' \
+      | sed -e 's/$/ :/' >> "$depfile"
   rm -f "$tmpdepfile"
   ;;
 
@@ -193,18 +214,15 @@ sgi)
     # clever and replace this with sed code, as IRIX sed won't handle
     # lines with more than a fixed number of characters (4096 in
     # IRIX 6.2 sed, 8192 in IRIX 6.5).  We also remove comment lines;
-    # the IRIX cc adds comments like `#:fec' to the end of the
+    # the IRIX cc adds comments like '#:fec' to the end of the
     # dependency line.
-    tr ' ' '
-' < "$tmpdepfile" \
+    tr ' ' "$nl" < "$tmpdepfile" \
     | sed -e 's/^.*\.o://' -e 's/#.*$//' -e '/^$/ d' | \
-    tr '
-' ' ' >> "$depfile"
+    tr "$nl" ' ' >> "$depfile"
     echo >> "$depfile"
 
     # The second pass generates a dummy entry for each header file.
-    tr ' ' '
-' < "$tmpdepfile" \
+    tr ' ' "$nl" < "$tmpdepfile" \
    | sed -e 's/^.*\.o://' -e 's/#.*$//' -e '/^$/ d' -e 's/$/:/' \
    >> "$depfile"
   else
@@ -216,10 +234,17 @@ sgi)
   rm -f "$tmpdepfile"
   ;;
 
+xlc)
+  # This case exists only to let depend.m4 do its work.  It works by
+  # looking at the text of this script.  This case will never be run,
+  # since it is checked for above.
+  exit 1
+  ;;
+
 aix)
   # The C for AIX Compiler uses -M and outputs the dependencies
   # in a .u file.  In older versions, this file always lives in the
-  # current directory.  Also, the AIX compiler puts `$object:' at the
+  # current directory.  Also, the AIX compiler puts '$object:' at the
   # start of each line; $object doesn't have directory information.
   # Version 6 uses the directory in both cases.
   dir=`echo "$object" | sed -e 's|/[^/]*$|/|'`
@@ -249,12 +274,11 @@ aix)
     test -f "$tmpdepfile" && break
   done
   if test -f "$tmpdepfile"; then
-    # Each line is of the form `foo.o: dependent.h'.
+    # Each line is of the form 'foo.o: dependent.h'.
     # Do two passes, one to just change these to
-    # `$object: dependent.h' and one to simply `dependent.h:'.
+    # '$object: dependent.h' and one to simply 'dependent.h:'.
     sed -e "s,^.*\.[a-z]*:,$object:," < "$tmpdepfile" > "$depfile"
-    # That's a tab and a space in the [].
-    sed -e 's,^.*\.[a-z]*:[	 ]*,,' -e 's,$,:,' < "$tmpdepfile" >> "$depfile"
+    sed -e 's,^.*\.[a-z]*:['"$tab"' ]*,,' -e 's,$,:,' < "$tmpdepfile" >> "$depfile"
   else
     # The sourcefile does not contain any dependencies, so just
     # store a dummy comment line, to avoid errors with the Makefile
@@ -265,23 +289,26 @@ aix)
   ;;
 
 icc)
-  # Intel's C compiler understands `-MD -MF file'.  However on
-  #    icc -MD -MF foo.d -c -o sub/foo.o sub/foo.c
+  # Intel's C compiler anf tcc (Tiny C Compiler) understand '-MD -MF file'.
+  # However on
+  #    $CC -MD -MF foo.d -c -o sub/foo.o sub/foo.c
   # ICC 7.0 will fill foo.d with something like
   #    foo.o: sub/foo.c
   #    foo.o: sub/foo.h
-  # which is wrong.  We want:
+  # which is wrong.  We want
   #    sub/foo.o: sub/foo.c
   #    sub/foo.o: sub/foo.h
   #    sub/foo.c:
   #    sub/foo.h:
   # ICC 7.1 will output
   #    foo.o: sub/foo.c sub/foo.h
-  # and will wrap long lines using \ :
+  # and will wrap long lines using '\':
   #    foo.o: sub/foo.c ... \
   #     sub/foo.h ... \
   #     ...
-
+  # tcc 0.9.26 (FIXME still under development at the moment of writing)
+  # will emit a similar output, but also prepend the continuation lines
+  # with horizontal tabulation characters.
   "$@" -MD -MF "$tmpdepfile"
   stat=$?
   if test $stat -eq 0; then :
@@ -290,15 +317,21 @@ icc)
     exit $stat
   fi
   rm -f "$depfile"
-  # Each line is of the form `foo.o: dependent.h',
-  # or `foo.o: dep1.h dep2.h \', or ` dep3.h dep4.h \'.
+  # Each line is of the form 'foo.o: dependent.h',
+  # or 'foo.o: dep1.h dep2.h \', or ' dep3.h dep4.h \'.
   # Do two passes, one to just change these to
-  # `$object: dependent.h' and one to simply `dependent.h:'.
-  sed "s,^[^:]*:,$object :," < "$tmpdepfile" > "$depfile"
-  # Some versions of the HPUX 10.20 sed can't process this invocation
-  # correctly.  Breaking it into two sed invocations is a workaround.
-  sed 's,^[^:]*: \(.*\)$,\1,;s/^\\$//;/^$/d;/:$/d' < "$tmpdepfile" |
-    sed -e 's/$/ :/' >> "$depfile"
+  # '$object: dependent.h' and one to simply 'dependent.h:'.
+  sed -e "s/^[ $tab][ $tab]*/  /" -e "s,^[^:]*:,$object :," \
+    < "$tmpdepfile" > "$depfile"
+  sed '
+    s/[ '"$tab"'][ '"$tab"']*/ /g
+    s/^ *//
+    s/ *\\*$//
+    s/^[^:]*: *//
+    /^$/d
+    /:$/d
+    s/$/ :/
+  ' < "$tmpdepfile" >> "$depfile"
   rm -f "$tmpdepfile"
   ;;
 
@@ -334,7 +367,7 @@ hp2)
   done
   if test -f "$tmpdepfile"; then
     sed -e "s,^.*\.[a-z]*:,$object:," "$tmpdepfile" > "$depfile"
-    # Add `dependent.h:' lines.
+    # Add 'dependent.h:' lines.
     sed -ne '2,${
 	       s/^ *//
 	       s/ \\*$//
@@ -349,9 +382,9 @@ hp2)
 
 tru64)
    # The Tru64 compiler uses -MD to generate dependencies as a side
-   # effect.  `cc -MD -o foo.o ...' puts the dependencies into `foo.o.d'.
+   # effect.  'cc -MD -o foo.o ...' puts the dependencies into 'foo.o.d'.
    # At least on Alpha/Redhat 6.1, Compaq CCC V6.2-504 seems to put
-   # dependencies in `foo.d' instead, so we check for that too.
+   # dependencies in 'foo.d' instead, so we check for that too.
    # Subdirectories are respected.
    dir=`echo "$object" | sed -e 's|/[^/]*$|/|'`
    test "x$dir" = "x$object" && dir=
@@ -397,14 +430,59 @@ tru64)
    done
    if test -f "$tmpdepfile"; then
       sed -e "s,^.*\.[a-z]*:,$object:," < "$tmpdepfile" > "$depfile"
-      # That's a tab and a space in the [].
-      sed -e 's,^.*\.[a-z]*:[	 ]*,,' -e 's,$,:,' < "$tmpdepfile" >> "$depfile"
+      sed -e 's,^.*\.[a-z]*:['"$tab"' ]*,,' -e 's,$,:,' < "$tmpdepfile" >> "$depfile"
    else
       echo "#dummy" > "$depfile"
    fi
    rm -f "$tmpdepfile"
    ;;
 
+msvc7)
+  if test "$libtool" = yes; then
+    showIncludes=-Wc,-showIncludes
+  else
+    showIncludes=-showIncludes
+  fi
+  "$@" $showIncludes > "$tmpdepfile"
+  stat=$?
+  grep -v '^Note: including file: ' "$tmpdepfile"
+  if test "$stat" = 0; then :
+  else
+    rm -f "$tmpdepfile"
+    exit $stat
+  fi
+  rm -f "$depfile"
+  echo "$object : \\" > "$depfile"
+  # The first sed program below extracts the file names and escapes
+  # backslashes for cygpath.  The second sed program outputs the file
+  # name when reading, but also accumulates all include files in the
+  # hold buffer in order to output them again at the end.  This only
+  # works with sed implementations that can handle large buffers.
+  sed < "$tmpdepfile" -n '
+/^Note: including file:  *\(.*\)/ {
+  s//\1/
+  s/\\/\\\\/g
+  p
+}' | $cygpath_u | sort -u | sed -n '
+s/ /\\ /g
+s/\(.*\)/'"$tab"'\1 \\/p
+s/.\(.*\) \\/\1:/
+H
+$ {
+  s/.*/'"$tab"'/
+  G
+  p
+}' >> "$depfile"
+  rm -f "$tmpdepfile"
+  ;;
+
+msvc7msys)
+  # This case exists only to let depend.m4 do its work.  It works by
+  # looking at the text of this script.  This case will never be run,
+  # since it is checked for above.
+  exit 1
+  ;;
+
 #nosideeffect)
   # This comment above is used by automake to tell side-effect
   # dependency tracking mechanisms from slower ones.
@@ -422,7 +500,7 @@ dashmstdout)
     shift
   fi
 
-  # Remove `-o $object'.
+  # Remove '-o $object'.
   IFS=" "
   for arg
   do
@@ -442,15 +520,14 @@ dashmstdout)
   done
 
   test -z "$dashmflag" && dashmflag=-M
-  # Require at least two characters before searching for `:'
+  # Require at least two characters before searching for ':'
   # in the target name.  This is to cope with DOS-style filenames:
-  # a dependency such as `c:/foo/bar' could be seen as target `c' otherwise.
+  # a dependency such as 'c:/foo/bar' could be seen as target 'c' otherwise.
   "$@" $dashmflag |
-    sed 's:^[  ]*[^: ][^:][^:]*\:[    ]*:'"$object"'\: :' > "$tmpdepfile"
+    sed 's:^['"$tab"' ]*[^:'"$tab"' ][^:][^:]*\:['"$tab"' ]*:'"$object"'\: :' > "$tmpdepfile"
   rm -f "$depfile"
   cat < "$tmpdepfile" > "$depfile"
-  tr ' ' '
-' < "$tmpdepfile" | \
+  tr ' ' "$nl" < "$tmpdepfile" | \
 ## Some versions of the HPUX 10.20 sed can't process this invocation
 ## correctly.  Breaking it into two sed invocations is a workaround.
     sed -e 's/^\\$//' -e '/^$/d' -e '/:$/d' | sed -e 's/$/ :/' >> "$depfile"
@@ -503,9 +580,10 @@ makedepend)
   touch "$tmpdepfile"
   ${MAKEDEPEND-makedepend} -o"$obj_suffix" -f"$tmpdepfile" "$@"
   rm -f "$depfile"
-  cat < "$tmpdepfile" > "$depfile"
-  sed '1,2d' "$tmpdepfile" | tr ' ' '
-' | \
+  # makedepend may prepend the VPATH from the source file name to the object.
+  # No need to regex-escape $object, excess matching of '.' is harmless.
+  sed "s|^.*\($object *:\)|\1|" "$tmpdepfile" > "$depfile"
+  sed '1,2d' "$tmpdepfile" | tr ' ' "$nl" | \
 ## Some versions of the HPUX 10.20 sed can't process this invocation
 ## correctly.  Breaking it into two sed invocations is a workaround.
     sed -e 's/^\\$//' -e '/^$/d' -e '/:$/d' | sed -e 's/$/ :/' >> "$depfile"
@@ -525,7 +603,7 @@ cpp)
     shift
   fi
 
-  # Remove `-o $object'.
+  # Remove '-o $object'.
   IFS=" "
   for arg
   do
@@ -594,8 +672,8 @@ msvisualcpp)
   sed -n '/^#line [0-9][0-9]* "\([^"]*\)"/ s::\1:p' | $cygpath_u | sort -u > "$tmpdepfile"
   rm -f "$depfile"
   echo "$object : \\" > "$depfile"
-  sed < "$tmpdepfile" -n -e 's% %\\ %g' -e '/^\(.*\)$/ s::	\1 \\:p' >> "$depfile"
-  echo "	" >> "$depfile"
+  sed < "$tmpdepfile" -n -e 's% %\\ %g' -e '/^\(.*\)$/ s::'"$tab"'\1 \\:p' >> "$depfile"
+  echo "$tab" >> "$depfile"
   sed < "$tmpdepfile" -n -e 's% %\\ %g' -e '/^\(.*\)$/ s::\1\::p' >> "$depfile"
   rm -f "$tmpdepfile"
   ;;
diff --git a/gtest.mk b/gtest.mk
index d82a4a4..007e84d 100755
--- a/gtest.mk
+++ b/gtest.mk
@@ -2,14 +2,15 @@
 # Gtest build.
 ##############################
 # Build rules for libraries.
-check_LTLIBRARIES = libgtest.la libgtest_main.la
+# check_LTLIBRARIES = libgtest.la libgtest_main.la
+check_LIBRARIES = libgtest.a libgtest_main.a
 
-libgtest_la_SOURCES = unit_tests/gtest/src/gtest-all.cc
-libgtest_main_la_SOURCES = unit_tests/gtest/src/gtest_main.cc
-libgtest_main_la_LIBADD = libgtest.la
-libgtest_la_CXXFLAGS = -I$(top_srcdir)/unit_tests/gtest	\
+libgtest_a_SOURCES = unit_tests/gtest/src/gtest-all.cc
+libgtest_main_a_SOURCES = unit_tests/gtest/src/gtest_main.cc
+libgtest_main_a_LIBADD = libgtest.a
+libgtest_a_CXXFLAGS = -I$(top_srcdir)/unit_tests/gtest	\
 -I$(top_srcdir)/unit_tests/gtest/include
-libgtest_main_la_CXXFLAGS = -I$(top_srcdir)/unit_tests/gtest	\
+libgtest_main_a_CXXFLAGS = -I$(top_srcdir)/unit_tests/gtest	\
 -I$(top_srcdir)/unit_tests/gtest/include
 
 # gtest source files that we don't compile directly.  They are
diff --git a/install-sh b/install-sh
index 6781b98..a9244eb 100755
--- a/install-sh
+++ b/install-sh
@@ -1,7 +1,7 @@
 #!/bin/sh
 # install - install a program, script, or datafile
 
-scriptversion=2009-04-28.21; # UTC
+scriptversion=2011-01-19.21; # UTC
 
 # This originates from X11R5 (mit/util/scripts/install.sh), which was
 # later released in X11R6 (xc/config/util/install.sh) with the
@@ -156,6 +156,10 @@ while test $# -ne 0; do
     -s) stripcmd=$stripprog;;
 
     -t) dst_arg=$2
+	# Protect names problematic for `test' and other utilities.
+	case $dst_arg in
+	  -* | [=\(\)!]) dst_arg=./$dst_arg;;
+	esac
 	shift;;
 
     -T) no_target_directory=true;;
@@ -186,6 +190,10 @@ if test $# -ne 0 && test -z "$dir_arg$dst_arg"; then
     fi
     shift # arg
     dst_arg=$arg
+    # Protect names problematic for `test' and other utilities.
+    case $dst_arg in
+      -* | [=\(\)!]) dst_arg=./$dst_arg;;
+    esac
   done
 fi
 
@@ -200,7 +208,11 @@ if test $# -eq 0; then
 fi
 
 if test -z "$dir_arg"; then
-  trap '(exit $?); exit' 1 2 13 15
+  do_exit='(exit $ret); exit $ret'
+  trap "ret=129; $do_exit" 1
+  trap "ret=130; $do_exit" 2
+  trap "ret=141; $do_exit" 13
+  trap "ret=143; $do_exit" 15
 
   # Set umask so as not to create temps with too-generous modes.
   # However, 'strip' requires both read and write access to temps.
@@ -228,9 +240,9 @@ fi
 
 for src
 do
-  # Protect names starting with `-'.
+  # Protect names problematic for `test' and other utilities.
   case $src in
-    -*) src=./$src;;
+    -* | [=\(\)!]) src=./$src;;
   esac
 
   if test -n "$dir_arg"; then
@@ -252,12 +264,7 @@ do
       echo "$0: no destination specified." >&2
       exit 1
     fi
-
     dst=$dst_arg
-    # Protect names starting with `-'.
-    case $dst in
-      -*) dst=./$dst;;
-    esac
 
     # If destination is a directory, append the input filename; won't work
     # if double slashes aren't ignored.
@@ -385,7 +392,7 @@ do
 
       case $dstdir in
 	/*) prefix='/';;
-	-*) prefix='./';;
+	[-=\(\)!]*) prefix='./';;
 	*)  prefix='';;
       esac
 
@@ -403,7 +410,7 @@ do
 
       for d
       do
-	test -z "$d" && continue
+	test X"$d" = X && continue
 
 	prefix=$prefix$d
 	if test -d "$prefix"; then
diff --git a/jellyfish-1.1.pc.in b/jellyfish-1.1.pc.in
index cad53c7..4dd3bd0 100644
--- a/jellyfish-1.1.pc.in
+++ b/jellyfish-1.1.pc.in
@@ -6,5 +6,5 @@ includedir=@includedir@
 Name: Jellyfish
 Description: A multi-threaded hash based k-mer counter.
 Version: @PACKAGE_VERSION@
-Libs: -L${libdir} -ljellyfish -lpthread
+Libs: -L${libdir} -ljellyfish-1.1 -lpthread
 Cflags: -I${includedir}/jellyfish- at PACKAGE_VERSION@
diff --git a/jellyfish/allocators_malloc.hpp b/jellyfish/allocators_malloc.hpp
index 9601843..e010733 100644
--- a/jellyfish/allocators_malloc.hpp
+++ b/jellyfish/allocators_malloc.hpp
@@ -30,7 +30,7 @@ namespace allocators
 
   public:
     malloc() : ptr(NULL), size(0) {}
-    malloc(size_t _size) : ptr(NULL), size(0) {
+    explicit malloc(size_t _size) : ptr(NULL), size(0) {
         realloc(_size);
     }
     ~malloc() {
diff --git a/jellyfish/allocators_mmap.hpp b/jellyfish/allocators_mmap.hpp
index 5121d3a..8d975cd 100644
--- a/jellyfish/allocators_mmap.hpp
+++ b/jellyfish/allocators_mmap.hpp
@@ -30,7 +30,7 @@ namespace allocators {
    
   public:
     mmap() : ptr(MAP_FAILED), size(0) {}
-    mmap(size_t _size) : ptr(MAP_FAILED), size(0) {
+    explicit mmap(size_t _size) : ptr(MAP_FAILED), size(0) {
       realloc(_size);
       fast_zero();
     }
diff --git a/jellyfish/allocators_shm.hpp b/jellyfish/allocators_shm.hpp
index 8c6c846..123f49f 100644
--- a/jellyfish/allocators_shm.hpp
+++ b/jellyfish/allocators_shm.hpp
@@ -35,7 +35,7 @@ namespace allocators {
   public:
     shm() : fd(-1), ptr(MAP_FAILED), size(0), name(""),
                       unlink(true) {}
-    shm(size_t _size) :
+    explicit shm(size_t _size) :
       fd(-1), ptr(MAP_FAILED), size(0), name(""), unlink(true) {
       realloc(_size);
     }
diff --git a/jellyfish/capped_integer.hpp b/jellyfish/capped_integer.hpp
index 5b13bdb..fa0b994 100644
--- a/jellyfish/capped_integer.hpp
+++ b/jellyfish/capped_integer.hpp
@@ -33,7 +33,7 @@ namespace jellyfish {
     static const T cap = (T)-1;
 
     capped_integer() : x(0) {}
-    capped_integer(bits_t _x) : x(_x) {}
+    explicit capped_integer(bits_t _x) : x(_x) {}
 
     static const capped_integer zero;
     static const capped_integer one;
@@ -41,11 +41,15 @@ namespace jellyfish {
     const capped_integer operator+(const capped_integer y) const {
       return capped_integer((y.x > ~x) ? cap : y.x + x);
     }
+    const capped_integer operator+(const T& y) const {
+      return capped_integer((y > ~x) ? cap : y + x);
+    }
 
     bits_t bits() const { return x; }
     float to_float() const { return (float)x; }
    
     bool operator==(const capped_integer &o) { return x == o.x; }
+    bool operator!() const { return x == 0; }
     
     friend std::ostream &operator<< <> (std::ostream &os, 
                                         const capped_integer<T> &i);
diff --git a/jellyfish/circular_buffer.hpp b/jellyfish/circular_buffer.hpp
index c10c689..860135c 100644
--- a/jellyfish/circular_buffer.hpp
+++ b/jellyfish/circular_buffer.hpp
@@ -27,7 +27,7 @@ namespace jellyfish {
     T         *start;
 
   public:
-    circular_buffer(int _size) : size(_size) {
+    explicit circular_buffer(int _size) : size(_size) {
       buffer = new T[size];
       end    = buffer + size;
       start  = buffer;
diff --git a/jellyfish/cite.cc b/jellyfish/cite.cc
index 2c3d0cb..087ab3a 100644
--- a/jellyfish/cite.cc
+++ b/jellyfish/cite.cc
@@ -40,11 +40,12 @@ const char *bibtex =
 #include <iostream>
 #include <fstream>
 #include <stdlib.h>
-#include <jellyfish/cite_cmdline.hpp>
 #include <jellyfish/err.hpp>
 #include <jellyfish/misc.hpp>
 #include <jellyfish/fstream_default.hpp>
 
+#include <jellyfish/cite_cmdline.hpp>
+
 int cite_main(int argc, char *argv[])
 {
   cite_cmdline args(argc, argv);
diff --git a/jellyfish/compacted_hash.hpp b/jellyfish/compacted_hash.hpp
index d43a22d..75c7bd0 100644
--- a/jellyfish/compacted_hash.hpp
+++ b/jellyfish/compacted_hash.hpp
@@ -45,7 +45,7 @@ namespace jellyfish {
       uint64_t max_count;
 
       header() { }
-      header(char *ptr) {
+      explicit header(char *ptr) {
         if(memcmp(ptr, file_type, sizeof(type)))
           eraise(ErrorReading) << "Bad file type '" << err::substr(ptr, sizeof(type))
                               << "', expected '" << err::substr(file_type, sizeof(type)) << "'";
@@ -127,6 +127,14 @@ namespace jellyfish {
 
       void update_stats_with(std::ostream *out, uint64_t _unique, uint64_t _distinct,
                              uint64_t _total, uint64_t _max_count) const {
+        if(!out->good())
+          return;
+        out->seekp(0);
+        if(!out->good()) {
+          out->clear();
+          return;
+        }
+
         struct header head;
         memcpy(&head.type, file_type, sizeof(head.type));
         head.key_len     = klen;
@@ -137,7 +145,6 @@ namespace jellyfish {
         head.distinct    = _distinct;
         head.total       = _total;
         head.max_count   = _max_count;
-        out->seekp(0);
         out->write((char *)&head, sizeof(head));
       }
 
@@ -155,24 +162,26 @@ namespace jellyfish {
     
     template<typename key_t, typename val_t>
     class reader {
-      struct header              header;
-      std::ifstream             *io;
-      uint_t                     key_len;
-      SquareBinaryMatrix         hash_matrix, hash_inverse_matrix;
-      size_t                     record_len, buffer_len;
-      size_t                     size_mask;
-      char                      *buffer, *end_buffer, *ptr;
+      struct header       header;
+      std::ifstream      *io;
+      uint_t              key_len;
+      SquareBinaryMatrix  hash_matrix, hash_inverse_matrix;
+      size_t              record_len, buffer_len;
+      size_t              size_mask;
+      char               *buffer, *end_buffer, *ptr;
+      char                dna_str[33];
 
     public:
       key_t key;
       val_t val;
 
-      reader() { io = 0; buffer = 0; }
-      reader(std::string filename, size_t _buff_len = 10000000UL) { 
+      reader() { io = 0; buffer = 0; memset(dna_str, '\0', sizeof(dna_str)); }
+      explicit reader(std::string filename, size_t _buff_len = 10000000UL) { 
         initialize(filename, _buff_len);
       }
 
       void initialize(std::string filename, size_t _buff_len) {
+        memset(dna_str, '\0', sizeof(dna_str)); 
         io = new std::ifstream(filename.c_str());
         io->read((char *)&header, sizeof(header));
         if(!io->good())
@@ -201,15 +210,17 @@ namespace jellyfish {
 
         hash_matrix.load(io);
         hash_inverse_matrix.load(io);
-        std::streampos cpos = io->tellg();
-        io->seekg(0, std::ios::end);
-        std::streamoff list_size = io->tellg() - cpos;
-        io->seekg(cpos);
-        if(list_size - (header.distinct * record_len) != 0)
-          eraise(ErrorReading) << "'" << filename << "': " 
-                               << "Bad hash size '" << list_size 
-                               << "', expected '"
-                              << (header.distinct * record_len) << "' bytes";
+        
+        if(header.distinct != 0) {
+          std::streamoff list_size = get_file_size(*io);
+          if(list_size != (std::streamoff)-1 &&
+             list_size - (header.distinct * record_len) != 0) {
+            eraise(ErrorReading) << "'" << filename << "': " 
+                                 << "Bad hash size '" << list_size 
+                                 << "', expected '"
+                                 << (header.distinct * record_len) << "' bytes";
+          }
+        }
         key = val = 0;
         size_mask = header.size - 1;
       }
@@ -238,9 +249,17 @@ namespace jellyfish {
         hash_inverse_matrix.dump(out);
       }
 
+      key_t get_key() const { return key; }
+      val_t get_val() const { return val; }
+      
+
       void get_string(char *out) const {
         parse_dna::mer_binary_to_string(key, get_mer_len(), out);
       }
+      char* get_dna_str() {
+        parse_dna::mer_binary_to_string(key, get_mer_len(), dna_str);
+        return dna_str;
+      }
       uint64_t get_hash() const { return hash_matrix.times(key); }
       uint64_t get_pos() const { return hash_matrix.times(key) & size_mask; }
 
@@ -288,7 +307,7 @@ namespace jellyfish {
       /* Can't wait for C++0x to be finalized and call constructor
          from constructor!
        */
-      query(mapped_file &map) :
+      explicit query(mapped_file &map) :
         file(map),
         header(file.base()), 
         key_len((header.key_len / 8) + (header.key_len % 8 != 0)),
@@ -302,7 +321,7 @@ namespace jellyfish {
         last_id((file.end() - base) / record_len),
         canonical(false)
       {
-        if(file.end() - base - header.distinct * record_len != 0)
+        if(header.distinct != 0 && file.end() - base - header.distinct * record_len != 0)
           eraise(ErrorReading) << "'" << file.path() << "': " 
                                << "Bad hash size '" << (file.end() - base)
                                << "', expected '" << header.distinct * record_len << "' bytes";
@@ -312,7 +331,7 @@ namespace jellyfish {
         get_key(last_id - 1, &last_key);
         last_pos = get_pos(last_key);
       }
-      query(std::string filename) : 
+      explicit query(std::string filename) : 
         file(filename.c_str()), 
         header(file.base()), 
         key_len((header.key_len / 8) + (header.key_len % 8 != 0)),
@@ -326,7 +345,7 @@ namespace jellyfish {
         last_id((file.end() - base) / record_len),
         canonical(false)
       { 
-        if(file.end() - base - header.distinct * record_len != 0)
+        if(header.distinct != 0 && file.end() - base - header.distinct * record_len != 0)
           eraise(ErrorReading) << "'" << file.path() << "': " 
                                << "Bad hash size '" << (file.end() - base)
                                << "', expected '" << header.distinct * record_len << "' bytes";
@@ -425,17 +444,16 @@ namespace jellyfish {
       }
       
       class iterator {
-        char                  *base, *ptr;
-        uint64_t               last_id;
-        uint_t                 key_len;
-        uint_t                 val_len;
-        uint_t                 record_len;
-        uint_t                 mer_len;
-        uint64_t               id;
-        key_t key;
-        val_t val;
-
-        char                   dna_str[33];
+        char     *base, *ptr;
+        uint64_t  last_id;
+        uint_t    key_len;
+        uint_t    val_len;
+        uint_t    record_len;
+        uint_t    mer_len;
+        uint64_t  id;
+        key_t     key;
+        val_t     val;
+        char      dna_str[33];
 
       public:
         iterator(char *_base, uint64_t _last_id, uint_t _key_len, uint_t _val_len, uint_t _mer_len) :
diff --git a/jellyfish/concurrent_queues.hpp b/jellyfish/concurrent_queues.hpp
index a7dba87..4068849 100644
--- a/jellyfish/concurrent_queues.hpp
+++ b/jellyfish/concurrent_queues.hpp
@@ -18,7 +18,6 @@
 #define __JELLYFISH_CONCURRENT_QUEUES_HPP__
 
 #include <sys/time.h>
-#include <sys/syscall.h>
 #include <unistd.h>
 #include <string.h>
 #include <errno.h>
@@ -47,111 +46,115 @@
  * loop of dequeue() handles this situation.
  */
 
-template<class Val>
-class concurrent_queue {
-  Val                   **queue;
-  const uint64_t      size;
-  uint64_t volatile   head;
-  uint64_t volatile   tail;
-  bool volatile           closed;
-  divisor64               size_div;
+namespace jellyfish {
+  template<class Val>
+  class concurrent_queue {
+    Val               **queue;
+    const uint64_t      size;
+    uint64_t volatile   head;
+    uint64_t volatile   tail;
+    bool volatile       closed;
+    divisor64           size_div;
   
-public:
-  concurrent_queue(uint64_t _size) : 
-    size(20 *_size), head(0), tail(0), closed(false), size_div(size) 
-  { 
-    queue = new Val *[size];
-    memset(queue, 0, sizeof(Val *) * size);
-  }
-  ~concurrent_queue() { delete [] queue; }
-
-  void enqueue(Val *v);
-  Val *dequeue();
-  bool is_closed() { return closed; }
-  void close() { closed = true; __sync_synchronize(); }
-  bool has_space() { return head != tail; }
-  bool is_low() { 
-    uint64_t ctail = tail;
-    __sync_synchronize();
-    uint64_t chead = head;
-    int64_t len = chead - ctail;
-    if(len < 0)
-      len += size;
-    return (uint64_t)(4*len) <= size;
-  }
-  uint64_t usage() {
-    uint64_t ctail = tail;
-    __sync_synchronize();
-    uint64_t chead = head;
-    int64_t len = chead - ctail;
-    if(len < 0)
-      len += size;
-    return len;
-  }
-};
-
-template<class Val>
-void concurrent_queue<Val>::enqueue(Val *v) {
-  int          done = 0;
-  uint64_t chead;
-
-  chead = head;
-  do {
-    uint64_t q, nhead;
-    size_div.division(chead + 1, q, nhead);
-    //    uint64_t nhead = (chead + 1) % size;
+  public:
+    explicit concurrent_queue(uint64_t _size) : 
+      size(20 *_size), head(0), tail(0), closed(false), size_div(size) 
+    { 
+      queue = new Val *[size];
+      memset(queue, 0, sizeof(Val *) * size);
+    }
+    ~concurrent_queue() { delete [] queue; }
+
+    void enqueue(Val *v);
+    Val *dequeue();
+    bool is_closed() { return closed; }
+    void close() { closed = true; __sync_synchronize(); }
+    bool has_space() { return head != tail; }
+    bool is_low() { 
+      uint64_t ctail = tail;
+      __sync_synchronize();
+      uint64_t chead = head;
+      int64_t len = chead - ctail;
+      if(len < 0)
+        len += size;
+      return (uint64_t)(4*len) <= size;
+    }
+    uint64_t usage() {
+      uint64_t ctail = tail;
+      __sync_synchronize();
+      uint64_t chead = head;
+      int64_t len = chead - ctail;
+      if(len < 0)
+        len += size;
+      return len;
+    }
+  };
+
+  template<class Val>
+  void concurrent_queue<Val>::enqueue(Val *v) {
+    int          done = 0;
+    uint64_t chead;
+
+    chead = head;
+    do {
+      //      uint64_t q, nhead;
+      uint64_t nhead = (chead + 1) % size_div;
+      //      size_div.division(chead + 1, q, nhead);
+      //    uint64_t nhead = (chead + 1) % size;
 
-    done = (atomic::gcc::cas(&queue[chead], (Val*)0, v) == (Val*)0);
-    chead = atomic::gcc::cas(&head, chead, nhead);
-  } while(!done);
+      done = (atomic::gcc::cas(&queue[chead], (Val*)0, v) == (Val*)0);
+      chead = atomic::gcc::cas(&head, chead, nhead);
+    } while(!done);
 
-  assert(head >= 0 && head < size);
-  assert(tail >= 0 && tail < size);
-}
+    assert(head < size);
+    assert(tail < size);
+  }
 
-template<class Val>
-Val *concurrent_queue<Val>::dequeue() {
-  bool done = false;
-  Val *res;
-  uint64_t ctail, ntail;
+  template<class Val>
+  Val *concurrent_queue<Val>::dequeue() {
+    bool done = false;
+    Val *res;
+    uint64_t ctail, ntail;
 
-  ctail = tail;
-  //  __sync_synchronize();
-  do {
-    bool dequeued = false;
+    ctail = tail;
+    //  __sync_synchronize();
     do {
-      //    if(ctail == head)
-      //      return NULL;
-
-      // Complicated way to do ctail == head. Is it necessary? Or is
-      // the memory barrier above sufficient? Or even necessary?
-      if(atomic::gcc::cas(&head, ctail, ctail) == ctail) {
-        assert(head >= 0 && head < size);
-        assert(tail >= 0 && tail < size);
-        return NULL;
-      }
-      //      ntail    = (ctail + 1) % size;
-      uint64_t q;
-      size_div.division(ctail + 1, q, ntail);
-      ntail    = atomic::gcc::cas(&tail, ctail, ntail);
-      dequeued = ntail == ctail;
-      ctail    = ntail;
-    } while(!dequeued);
-
-    // Claim dequeued slot.  We may have dequeued an element which is
-    // empty or that another thread also has dequeued but not yet
-    // claimed. This can happen if a thread is slow to claim (set
-    // pointer to 0) and the enqueue method has queued elements past
-    // this one.
-    res = queue[ctail];
-    if(res)
-      done = atomic::gcc::cas(&queue[ctail], res, (Val*)0) == res;
-  } while(!done);
-
-  assert(head >= 0 && head < size);
-  assert(tail >= 0 && tail < size);
-
-  return res;
+      bool dequeued = false;
+      do {
+        //    if(ctail == head)
+        //      return NULL;
+
+        // Complicated way to do ctail == head. Is it necessary? Or is
+        // the memory barrier above sufficient? Or even necessary?
+        if(atomic::gcc::cas(&head, ctail, ctail) == ctail) {
+          assert(head < size);
+          assert(tail < size);
+          return NULL;
+        }
+        //      ntail    = (ctail + 1) % size;
+        //        uint64_t q;
+        //        size_div.division(ctail + 1, q, ntail);
+        ntail = (ctail + 1) % size_div;
+        ntail    = atomic::gcc::cas(&tail, ctail, ntail);
+        dequeued = ntail == ctail;
+        ctail    = ntail;
+      } while(!dequeued);
+
+      // Claim dequeued slot.  We may have dequeued an element which is
+      // empty or that another thread also has dequeued but not yet
+      // claimed. This can happen if a thread is slow to claim (set
+      // pointer to 0) and the enqueue method has queued elements past
+      // this one.
+      res = queue[ctail];
+      if(res)
+        done = atomic::gcc::cas(&queue[ctail], res, (Val*)0) == res;
+    } while(!done);
+
+    assert(head < size);
+    assert(tail < size);
+
+    return res;
+  }
 }
   
 #endif
diff --git a/jellyfish/count_main_cmdline.hpp b/jellyfish/count_main_cmdline.hpp
index 2bdfc51..3e6ce7b 100644
--- a/jellyfish/count_main_cmdline.hpp
+++ b/jellyfish/count_main_cmdline.hpp
@@ -3,9 +3,268 @@
 #ifndef __COUNT_ARGS_HPP__
 #define __COUNT_ARGS_HPP__
 
-#include <jellyfish/yaggo.hpp>
+#include <stdint.h>
+#include <unistd.h>
+#include <stdlib.h>
+#include <getopt.h>
+#include <errno.h>
+#include <string.h>
+#include <stdexcept>
+#include <string>
+#include <limits>
+#include <vector>
+#include <iostream>
+#include <sstream>
 
 class count_args {
+ // Boiler plate stuff. Conversion from string to other formats
+  static bool adjust_double_si_suffix(double &res, const char *suffix) {
+    if(*suffix == '\0')
+      return true;
+    if(*(suffix + 1) != '\0')
+      return false;
+
+    switch(*suffix) {
+    case 'a': res *= 1e-18; break;
+    case 'f': res *= 1e-15; break;
+    case 'p': res *= 1e-12; break;
+    case 'n': res *= 1e-9;  break;
+    case 'u': res *= 1e-6;  break;
+    case 'm': res *= 1e-3;  break;
+    case 'k': res *= 1e3;   break;
+    case 'M': res *= 1e6;   break;
+    case 'G': res *= 1e9;   break;
+    case 'T': res *= 1e12;  break;
+    case 'P': res *= 1e15;  break;
+    case 'E': res *= 1e18;  break;
+    default: return false;
+    }
+    return true;
+  }
+
+  static double conv_double(const char *str, ::std::string &err, bool si_suffix) {
+    char *endptr = 0;
+    errno = 0;
+    double res = strtod(str, &endptr);
+    if(errno) {
+      err.assign(strerror(errno));
+      return (double)0.0;
+    }
+    bool invalid =
+      si_suffix ? !adjust_double_si_suffix(res, endptr) : *endptr != '\0';
+    if(invalid) {
+      err.assign("Invalid character");
+      return (double)0.0;
+    }
+    return res;
+  }
+
+  static int conv_enum(const char* str, ::std::string& err, const char* const strs[]) {
+    int res = 0;
+    for(const char* const* cstr = strs; *cstr; ++cstr, ++res)
+      if(!strcmp(*cstr, str))
+        return res;
+    err += "Invalid constant '";
+    err += str;
+    err += "'. Expected one of { ";
+    for(const char* const* cstr = strs; *cstr; ++cstr) {
+      if(cstr != strs)
+        err += ", ";
+      err += *cstr;
+    }
+    err += " }";
+    return -1;
+  }
+
+  template<typename T>
+  static bool adjust_int_si_suffix(T &res, const char *suffix) {
+    if(*suffix == '\0')
+      return true;
+    if(*(suffix + 1) != '\0')
+      return false;
+
+    switch(*suffix) {
+    case 'k': res *= (T)1000; break;
+    case 'M': res *= (T)1000000; break;
+    case 'G': res *= (T)1000000000; break;
+    case 'T': res *= (T)1000000000000; break;
+    case 'P': res *= (T)1000000000000000; break;
+    case 'E': res *= (T)1000000000000000000; break;
+    default: return false;
+    }
+    return true;
+  }
+
+  template<typename T>
+  static T conv_int(const char *str, ::std::string &err, bool si_suffix) {
+    char *endptr = 0;
+    errno = 0;
+    long long int res = strtoll(str, &endptr, 0);
+    if(errno) {
+      err.assign(strerror(errno));
+      return (T)0;
+    }
+    bool invalid =
+      si_suffix ? !adjust_int_si_suffix(res, endptr) : *endptr != '\0';
+    if(invalid) {
+      err.assign("Invalid character");
+      return (T)0;
+    }
+    if(res > ::std::numeric_limits<T>::max() ||
+       res < ::std::numeric_limits<T>::min()) {
+      err.assign("Value out of range");
+      return (T)0;
+    }
+    return (T)res;
+  }
+
+  template<typename T>
+  static T conv_uint(const char *str, ::std::string &err, bool si_suffix) {
+    char *endptr = 0;
+    errno = 0;
+    while(isspace(*str)) { ++str; }
+    if(*str == '-') {
+      err.assign("Negative value");
+      return (T)0;
+    }
+    unsigned long long int res = strtoull(str, &endptr, 0);
+    if(errno) {
+      err.assign(strerror(errno));
+      return (T)0;
+    }
+    bool invalid =
+      si_suffix ? !adjust_int_si_suffix(res, endptr) : *endptr != '\0';
+    if(invalid) {
+      err.assign("Invalid character");
+      return (T)0;
+    }
+    if(res > ::std::numeric_limits<T>::max() ||
+       res < ::std::numeric_limits<T>::min()) {
+      err.assign("Value out of range");
+      return (T)0;
+    }
+    return (T)res;
+  }
+
+  template<typename T>
+  static ::std::string vec_str(const std::vector<T> &vec) {
+    ::std::ostringstream os;
+    for(typename ::std::vector<T>::const_iterator it = vec.begin();
+        it != vec.end(); ++it) {
+      if(it != vec.begin())
+        os << ",";
+      os << *it;
+    }
+    return os.str();
+  }
+
+  class string : public ::std::string {
+  public:
+    string() : ::std::string() {}
+    explicit string(const ::std::string &s) : std::string(s) {}
+    explicit string(const char *s) : ::std::string(s) {}
+    int as_enum(const char* const strs[]) {
+      ::std::string err;
+      int res = conv_enum((const char*)this->c_str(), err, strs);
+      if(!err.empty())
+        throw ::std::runtime_error(err);
+      return res;
+    }
+
+
+    uint32_t as_uint32_suffix() const { return as_uint32(true); }
+    uint32_t as_uint32(bool si_suffix = false) const {
+      ::std::string err;
+      uint32_t res = conv_uint<uint32_t>((const char*)this->c_str(), err, si_suffix);
+      if(!err.empty()) {
+        ::std::string msg("Invalid conversion of '");
+        msg += *this;
+        msg += "' to uint32_t: ";
+        msg += err;
+        throw ::std::runtime_error(msg);
+      }
+      return res;
+    }
+    uint64_t as_uint64_suffix() const { return as_uint64(true); }
+    uint64_t as_uint64(bool si_suffix = false) const {
+      ::std::string err;
+      uint64_t res = conv_uint<uint64_t>((const char*)this->c_str(), err, si_suffix);
+      if(!err.empty()) {
+        ::std::string msg("Invalid conversion of '");
+        msg += *this;
+        msg += "' to uint64_t: ";
+        msg += err;
+        throw ::std::runtime_error(msg);
+      }
+      return res;
+    }
+    int32_t as_int32_suffix() const { return as_int32(true); }
+    int32_t as_int32(bool si_suffix = false) const {
+      ::std::string err;
+      int32_t res = conv_int<int32_t>((const char*)this->c_str(), err, si_suffix);
+      if(!err.empty()) {
+        ::std::string msg("Invalid conversion of '");
+        msg += *this;
+        msg += "' to int32_t: ";
+        msg += err;
+        throw ::std::runtime_error(msg);
+      }
+      return res;
+    }
+    int64_t as_int64_suffix() const { return as_int64(true); }
+    int64_t as_int64(bool si_suffix = false) const {
+      ::std::string err;
+      int64_t res = conv_int<int64_t>((const char*)this->c_str(), err, si_suffix);
+      if(!err.empty()) {
+        ::std::string msg("Invalid conversion of '");
+        msg += *this;
+        msg += "' to int64_t: ";
+        msg += err;
+        throw ::std::runtime_error(msg);
+      }
+      return res;
+    }
+    int as_int_suffix() const { return as_int(true); }
+    int as_int(bool si_suffix = false) const {
+      ::std::string err;
+      int res = conv_int<int>((const char*)this->c_str(), err, si_suffix);
+      if(!err.empty()) {
+        ::std::string msg("Invalid conversion of '");
+        msg += *this;
+        msg += "' to int_t: ";
+        msg += err;
+        throw ::std::runtime_error(msg);
+      }
+      return res;
+    }
+    long as_long_suffix() const { return as_long(true); }
+    long as_long(bool si_suffix = false) const {
+      ::std::string err;
+      long res = conv_int<long>((const char*)this->c_str(), err, si_suffix);
+      if(!err.empty()) {
+        ::std::string msg("Invalid conversion of '");
+        msg += *this;
+        msg += "' to long_t: ";
+        msg += err;
+        throw ::std::runtime_error(msg);
+      }
+      return res;
+    }
+    double as_double_suffix() const { return as_double(true); }
+    double as_double(bool si_suffix = false) const {
+      ::std::string err;
+      double res = conv_double((const char*)this->c_str(), err, si_suffix);
+      if(!err.empty()) {
+        ::std::string msg("Invalid conversion of '");
+        msg += *this;
+        msg += "' to double_t: ";
+        msg += err;
+        throw ::std::runtime_error(msg);
+      }
+      return res;
+    }
+  };
+
 public:
   struct invalid_char {
     enum { warn, ignore, error };
@@ -18,8 +277,9 @@ public:
   bool                           size_given;
   uint32_t                       threads_arg;
   bool                           threads_given;
-  yaggo::string                  output_arg;
+  string                         output_arg;
   bool                           output_given;
+  bool                           O_flag;
   uint32_t                       counter_len_arg;
   bool                           counter_len_given;
   uint32_t                       out_counter_len_arg;
@@ -40,7 +300,7 @@ public:
   bool                           upper_count_given;
   int                            invalid_char_arg;
   bool                           invalid_char_given;
-  yaggo::string                  matrix_arg;
+  string                         matrix_arg;
   bool                           matrix_given;
   const char *                   timing_arg;
   bool                           timing_given;
@@ -56,13 +316,14 @@ public:
   bool                           out_buffer_size_given;
   bool                           lock_flag;
   bool                           stream_flag;
-  std::vector<const char *>      file_arg;
-  typedef std::vector<const char *>::iterator file_arg_it;
-  typedef std::vector<const char *>::const_iterator file_arg_const_it;
+  ::std::vector<const char *>    file_arg;
+  typedef ::std::vector<const char *>::iterator file_arg_it;
+  typedef ::std::vector<const char *>::const_iterator file_arg_const_it;
 
   enum {
-    USAGE_OPT = 1000,
+    START_OPT = 1000,
     FULL_HELP_OPT,
+    USAGE_OPT,
     OUT_COUNTER_LEN_OPT,
     BOTH_OPT,
     QUALITY_START_OPT,
@@ -78,11 +339,12 @@ public:
     STREAM_OPT
   };
 
-  count_args() : 
+  count_args() :
     mer_len_arg(), mer_len_given(false),
     size_arg(), size_given(false),
     threads_arg(1), threads_given(false),
     output_arg("mer_counts"), output_given(false),
+    O_flag(false),
     counter_len_arg(7), counter_len_given(false),
     out_counter_len_arg(4), out_counter_len_given(false),
     both_strands_flag(false),
@@ -104,7 +366,8 @@ public:
     buffer_size_arg(8192), buffer_size_given(false),
     out_buffer_size_arg(20000000), out_buffer_size_given(false),
     lock_flag(false),
-    stream_flag(false)
+    stream_flag(false),
+    file_arg()
   { }
 
   count_args(int argc, char* argv[]) :
@@ -112,6 +375,7 @@ public:
     size_arg(), size_given(false),
     threads_arg(1), threads_given(false),
     output_arg("mer_counts"), output_given(false),
+    O_flag(false),
     counter_len_arg(7), counter_len_given(false),
     out_counter_len_arg(4), out_counter_len_given(false),
     both_strands_flag(false),
@@ -133,7 +397,8 @@ public:
     buffer_size_arg(8192), buffer_size_given(false),
     out_buffer_size_arg(20000000), out_buffer_size_given(false),
     lock_flag(false),
-    stream_flag(false)
+    stream_flag(false),
+    file_arg()
   { parse(argc, argv); }
 
   void parse(int argc, char* argv[]) {
@@ -142,6 +407,7 @@ public:
       {"size", 1, 0, 's'},
       {"threads", 1, 0, 't'},
       {"output", 1, 0, 'o'},
+      {"", 0, 0, 'O'},
       {"counter-len", 1, 0, 'c'},
       {"out-counter-len", 1, 0, OUT_COUNTER_LEN_OPT},
       {"both-strands", 0, 0, 'C'},
@@ -170,62 +436,65 @@ public:
       {"version", 0, 0, 'V'},
       {0, 0, 0, 0}
     };
-    static const char *short_options = "hVm:s:t:o:c:Cp:rqL:U:wu";
+    static const char *short_options = "hVm:s:t:o:Oc:Cp:rqL:U:wu";
 
-    std::string err;
-#define CHECK_ERR(type,val,which) if(!err.empty()) { std::cerr << "Invalid " #type " '" << val << "' for [" which "]: " << err << "\n"; exit(1); }
-    while(true) { 
+    ::std::string err;
+#define CHECK_ERR(type,val,which) if(!err.empty()) { ::std::cerr << "Invalid " #type " '" << val << "' for [" which "]: " << err << "\n"; exit(1); }
+    while(true) {
       int index = -1;
       int c = getopt_long(argc, argv, short_options, long_options, &index);
       if(c == -1) break;
       switch(c) {
-      case ':': 
-        std::cerr << "Missing required argument for "
-                  << (index == -1 ? std::string(1, (char)optopt) : std::string(long_options[index].name))
-                  << std::endl;
+      case ':':
+        ::std::cerr << "Missing required argument for "
+                  << (index == -1 ? ::std::string(1, (char)optopt) : std::string(long_options[index].name))
+                  << ::std::endl;
         exit(1);
       case 'h':
-        std::cout << usage() << "\n\n" << help() << std::endl;
+        ::std::cout << usage() << "\n\n" << help() << std::endl;
         exit(0);
       case USAGE_OPT:
-        std::cout << usage() << "\nUse --help for more information." << std::endl;
+        ::std::cout << usage() << "\nUse --help for more information." << std::endl;
         exit(0);
       case 'V':
         print_version();
         exit(0);
       case '?':
-        std::cerr << "Use --usage or --help for some help\n";
+        ::std::cerr << "Use --usage or --help for some help\n";
         exit(1);
       case FULL_HELP_OPT:
-        std::cout << usage() << "\n\n" << help() << "\n\n" << hidden() << std::endl;
+        ::std::cout << usage() << "\n\n" << help() << "\n\n" << hidden() << std::endl;
         exit(0);
       case 'm':
         mer_len_given = true;
-        mer_len_arg = yaggo::conv_uint<uint32_t>((const char*)optarg, err, false);
+        mer_len_arg = conv_uint<uint32_t>((const char*)optarg, err, false);
         CHECK_ERR(uint32_t, optarg, "-m, --mer-len=uint32")
         break;
       case 's':
         size_given = true;
-        size_arg = yaggo::conv_uint<uint64_t>((const char*)optarg, err, true);
+        size_arg = conv_uint<uint64_t>((const char*)optarg, err, true);
         CHECK_ERR(uint64_t, optarg, "-s, --size=uint64")
         break;
       case 't':
         threads_given = true;
-        threads_arg = yaggo::conv_uint<uint32_t>((const char*)optarg, err, false);
+        threads_arg = conv_uint<uint32_t>((const char*)optarg, err, false);
         CHECK_ERR(uint32_t, optarg, "-t, --threads=uint32")
         break;
       case 'o':
         output_given = true;
         output_arg.assign(optarg);
         break;
+      case 'O':
+        O_flag = true;
+        break;
       case 'c':
         counter_len_given = true;
-        counter_len_arg = yaggo::conv_uint<uint32_t>((const char*)optarg, err, false);
+        counter_len_arg = conv_uint<uint32_t>((const char*)optarg, err, false);
         CHECK_ERR(uint32_t, optarg, "-c, --counter-len=Length in bits")
         break;
       case OUT_COUNTER_LEN_OPT:
         out_counter_len_given = true;
-        out_counter_len_arg = yaggo::conv_uint<uint32_t>((const char*)optarg, err, false);
+        out_counter_len_arg = conv_uint<uint32_t>((const char*)optarg, err, false);
         CHECK_ERR(uint32_t, optarg, "    --out-counter-len=Length in bytes")
         break;
       case 'C':
@@ -233,7 +502,7 @@ public:
         break;
       case 'p':
         reprobes_given = true;
-        reprobes_arg = yaggo::conv_uint<uint32_t>((const char*)optarg, err, false);
+        reprobes_arg = conv_uint<uint32_t>((const char*)optarg, err, false);
         CHECK_ERR(uint32_t, optarg, "-p, --reprobes=uint32")
         break;
       case 'r':
@@ -247,27 +516,27 @@ public:
         break;
       case QUALITY_START_OPT:
         quality_start_given = true;
-        quality_start_arg = yaggo::conv_uint<uint32_t>((const char*)optarg, err, false);
+        quality_start_arg = conv_uint<uint32_t>((const char*)optarg, err, false);
         CHECK_ERR(uint32_t, optarg, "    --quality-start=uint32")
         break;
       case MIN_QUALITY_OPT:
         min_quality_given = true;
-        min_quality_arg = yaggo::conv_uint<uint32_t>((const char*)optarg, err, false);
+        min_quality_arg = conv_uint<uint32_t>((const char*)optarg, err, false);
         CHECK_ERR(uint32_t, optarg, "    --min-quality=uint32")
         break;
       case 'L':
         lower_count_given = true;
-        lower_count_arg = yaggo::conv_uint<uint64_t>((const char*)optarg, err, false);
+        lower_count_arg = conv_uint<uint64_t>((const char*)optarg, err, false);
         CHECK_ERR(uint64_t, optarg, "-L, --lower-count=uint64")
         break;
       case 'U':
         upper_count_given = true;
-        upper_count_arg = yaggo::conv_uint<uint64_t>((const char*)optarg, err, false);
+        upper_count_arg = conv_uint<uint64_t>((const char*)optarg, err, false);
         CHECK_ERR(uint64_t, optarg, "-U, --upper-count=uint64")
         break;
       case INVALID_CHAR_OPT:
         invalid_char_given = true;
-        invalid_char_arg = yaggo::conv_enum((const char*)optarg, err, invalid_char::strs);
+        invalid_char_arg = conv_enum((const char*)optarg, err, invalid_char::strs);
         CHECK_ERR(enum, optarg, "    --invalid-char=warn|ignore|error")
         break;
       case MATRIX_OPT:
@@ -290,17 +559,17 @@ public:
         break;
       case BUFFERS_OPT:
         buffers_given = true;
-        buffers_arg = yaggo::conv_uint<uint64_t>((const char*)optarg, err, false);
+        buffers_arg = conv_uint<uint64_t>((const char*)optarg, err, false);
         CHECK_ERR(uint64_t, optarg, "    --buffers=uint64")
         break;
       case BUFFER_SIZE_OPT:
         buffer_size_given = true;
-        buffer_size_arg = yaggo::conv_uint<uint64_t>((const char*)optarg, err, false);
+        buffer_size_arg = conv_uint<uint64_t>((const char*)optarg, err, false);
         CHECK_ERR(uint64_t, optarg, "    --buffer-size=uint64")
         break;
       case OUT_BUFFER_SIZE_OPT:
         out_buffer_size_given = true;
-        out_buffer_size_arg = yaggo::conv_uint<uint64_t>((const char*)optarg, err, false);
+        out_buffer_size_arg = conv_uint<uint64_t>((const char*)optarg, err, false);
         CHECK_ERR(uint64_t, optarg, "    --out-buffer-size=uint64")
         break;
       case LOCK_OPT:
@@ -319,19 +588,20 @@ public:
       error("[-s, --size=uint64] required switch");
 
     // Parse arguments
-    if(argc - optind < 0)
-      error("Requires at least 0 argument.");
+    if(argc - optind < 1)
+      error("Requires at least 1 argument.");
     for( ; optind < argc; ++optind) {
       file_arg.push_back(argv[optind]);
     }
   }
 
 #define count_args_USAGE "Usage: jellyfish count [options] file:path+"
+
   const char * usage() const { return count_args_USAGE; }
-  void error(const char *msg) { 
-    std::cerr << "Error: " << msg << "\n" << usage()
+  void error(const char *msg) {
+    ::std::cerr << "Error: " << msg << "\n" << usage()
               << "\nUse --help for more information"
-              << std::endl;
+              << ::std::endl;
     exit(1);
   }
 
@@ -359,9 +629,10 @@ public:
   " -h, --help                               This message\n" \
   "     --full-help                          Detailed help\n" \
   " -V, --version                            Version"
-
   const char * help() const { return count_args_HELP; }
+
 #define count_args_HIDDEN "Hidden options:\n" \
+  " -O                                       Output is the file name (not a prefix) (false)\n" \
   "     --both                               Write list and raw database (false)\n" \
   " -w, --no-write                           Don't write database (false)\n" \
   " -u, --measure                            Write usage statistics (false)\n" \
@@ -372,17 +643,18 @@ public:
   "     --stream                             Read from stream, not memory map (false)"
 
   const char * hidden() const { return count_args_HIDDEN; }
-  void print_version(std::ostream &os = std::cout) const {
+  void print_version(::std::ostream &os = std::cout) const {
 #ifndef PACKAGE_VERSION
 #define PACKAGE_VERSION "0.0.0"
 #endif
     os << PACKAGE_VERSION << "\n";
   }
-  void dump(std::ostream &os = std::cout) {
+  void dump(::std::ostream &os = std::cout) {
     os << "mer_len_given:" << mer_len_given << " mer_len_arg:" << mer_len_arg << "\n";
     os << "size_given:" << size_given << " size_arg:" << size_arg << "\n";
     os << "threads_given:" << threads_given << " threads_arg:" << threads_arg << "\n";
     os << "output_given:" << output_given << " output_arg:" << output_arg << "\n";
+    os << "O_flag:" << O_flag << "\n";
     os << "counter_len_given:" << counter_len_given << " counter_len_arg:" << counter_len_arg << "\n";
     os << "out_counter_len_given:" << out_counter_len_given << " out_counter_len_arg:" << out_counter_len_arg << "\n";
     os << "both_strands_flag:" << both_strands_flag << "\n";
@@ -405,9 +677,8 @@ public:
     os << "out_buffer_size_given:" << out_buffer_size_given << " out_buffer_size_arg:" << out_buffer_size_arg << "\n";
     os << "lock_flag:" << lock_flag << "\n";
     os << "stream_flag:" << stream_flag << "\n";
-    os << "file_arg:" << yaggo::vec_str(file_arg) << "\n";
+    os << "file_arg:" << vec_str(file_arg) << "\n";
   }
-private:
 };
 const char* const count_args::invalid_char::strs[4] = { "warn", "ignore", "error", (const char*)0 };
 #endif // __COUNT_ARGS_HPP__"
diff --git a/jellyfish/dbg.cc b/jellyfish/dbg.cc
index b953224..4652939 100644
--- a/jellyfish/dbg.cc
+++ b/jellyfish/dbg.cc
@@ -16,7 +16,14 @@
 
 #include <jellyfish/dbg.hpp>
 #include <jellyfish/time.hpp>
+
+#ifdef HAVE_CONFIG_H
+#include <config.h>
+#endif
+
+#ifdef HAVE_SYS_SYSCALL_H
 #include <sys/syscall.h>
+#endif
 
 namespace dbg {
   pthread_mutex_t print_t::_lock      = PTHREAD_MUTEX_INITIALIZER;
diff --git a/jellyfish/dbg.hpp b/jellyfish/dbg.hpp
index ff7f6d0..d894696 100644
--- a/jellyfish/dbg.hpp
+++ b/jellyfish/dbg.hpp
@@ -38,7 +38,7 @@ namespace dbg {
   class stringbuf : public std::stringbuf {
   public:
     stringbuf() : std::stringbuf(std::ios_base::out) { }
-    stringbuf(const std::string &str) : 
+    explicit stringbuf(const std::string &str) : 
       std::stringbuf(str, std::ios_base::out) { }
 
     bool end_is_space() {
diff --git a/jellyfish/direct_indexing_array.hpp b/jellyfish/direct_indexing_array.hpp
index dca7464..d6b4e9c 100644
--- a/jellyfish/direct_indexing_array.hpp
+++ b/jellyfish/direct_indexing_array.hpp
@@ -32,7 +32,7 @@ namespace jellyfish {
       
 
     public:
-      array(uint_t _key_len) :
+      explicit array(uint_t _key_len) :
         key_len(_key_len), size(((size_t)1) << key_len),
         mem_block(size * sizeof(bits_t)),
         data((bits_t *)mem_block.get_ptr())
@@ -65,7 +65,7 @@ namespace jellyfish {
           bits_t noval = atomic.cas(&data[key], oval, nval.bits());
           if(noval == oval) {
             if(_oval)
-              *_oval = oval;
+              *_oval = val_t(oval);
             return true;
           }
           oval = noval;
@@ -143,7 +143,7 @@ namespace jellyfish {
         out->write((char *)(data + start), length * sizeof(*data));
       }
 
-      val_t operator[](key_t key) const { return data[key]; }
+      val_t operator[](key_t key) const { return val_t(data[key]); }
     };
   }
 }
diff --git a/jellyfish/direct_sorted_dumper.hpp b/jellyfish/direct_sorted_dumper.hpp
index a731a8b..163bd7f 100644
--- a/jellyfish/direct_sorted_dumper.hpp
+++ b/jellyfish/direct_sorted_dumper.hpp
@@ -14,6 +14,7 @@
     along with Jellyfish.  If not, see <http://www.gnu.org/licenses/>.
 */
 
+#include <limits>
 #include <jellyfish/dumper.hpp>
 #include <jellyfish/thread_exec.hpp>
 #include <jellyfish/token_ring.hpp>
@@ -39,16 +40,19 @@ namespace jellyfish {
     storage_t            *ary;
     int                   file_index;
     token_ring_t          tr;
+    uint64_t              lower_count, upper_count;
     struct thread_info_t *thread_info;
     uint64_t volatile     unique, distinct, total, max_count;
     std::ofstream        *out;
+    bool                  one_file;
 
   public:
     direct_sorted_dumper(uint_t _threads, const char *_file_prefix, 
                          size_t _buffer_size, uint_t _vlen, storage_t *_ary) :
       threads(_threads), file_prefix(_file_prefix), buffer_size(_buffer_size),
       klen(_ary->get_key_len()), vlen(_vlen), ary(_ary),
-      tr()
+      tr() , lower_count(0), upper_count(std::numeric_limits<uint64_t>::max()),
+      one_file(false)
     {
       key_len    = bits_to_bytes(klen);
       val_len    = bits_to_bytes(vlen);
@@ -67,6 +71,12 @@ namespace jellyfish {
         delete[] thread_info;
     }
 
+    bool get_one_file() const { return one_file; }
+    void set_one_file(bool nv) { one_file = nv; }
+
+    void set_lower_count(uint64_t l) { lower_count = l; }
+    void set_upper_count(uint64_t u) { upper_count = u; }
+
     virtual void start(int i) { dump_to_file(i); }
     void dump_to_file(int i);
 
@@ -80,7 +90,11 @@ namespace jellyfish {
   template<typename storage_t, typename atomic_t>
   void direct_sorted_dumper<storage_t,atomic_t>::_dump() {
     std::ofstream _out;
-    open_next_file(file_prefix, &file_index, _out);
+    if(one_file) {
+      _out.open(file_prefix);
+    } else {
+      open_next_file(file_prefix, &file_index, _out);
+    }
     out = &_out;
     unique = distinct = total = max_count = 0;
     tr.reset();
@@ -101,7 +115,9 @@ namespace jellyfish {
     for(i = id; i * nb_records < ary->get_size(); i += threads) {
       iterator it(ary, i * nb_records, (i + 1) * nb_records);
       while(it.next())
-        my_info->writer.append(it.get_key(), it.get_val().bits());
+        if(it.get_val().bits() >= lower_count && it.get_val().bits() <= upper_count)
+          my_info->writer.append(it.get_key(), it.get_val().bits());
+
       my_info->token->wait();
       my_info->writer.dump(out);
       my_info->token->pass();
diff --git a/jellyfish/divisor.hpp b/jellyfish/divisor.hpp
index 470c78f..9ef45cb 100644
--- a/jellyfish/divisor.hpp
+++ b/jellyfish/divisor.hpp
@@ -14,42 +14,122 @@
     along with Jellyfish.  If not, see <http://www.gnu.org/licenses/>.
 */
 
-#ifndef __DIVISOR_HPP__
-#define __DIVISOR_HPP__
+#ifndef __JELLYFISH_DIVISOR_HPP__
+#define __JELLYFISH_DIVISOR_HPP__
 
-#include <jellyfish/misc.hpp>
 #include <stdint.h>
+#include <jellyfish/misc.hpp>
+#ifdef HAVE_CONFIG_H
+#include <config.h>
+#endif
 
-class divisor64 {
-  uint64_t d, p, m;
-public:
-  // This initialization works provided that 0<=_d<2**32
-  divisor64(uint64_t _d) : d(_d) {
-    uint64_t q = (1UL << 63) / d;
-    uint64_t r = (1UL << 63) % d;
-    p = ceilLog2(d) - 1;
-    m = q * (1UL << (p + 2)) + div_ceil(r * (1UL << (p + 2)), d);
-  }
+namespace jellyfish {
+  class divisor64 {
+    const uint64_t d_;
+#ifdef HAVE_INT128
+    const uint16_t p_;
+    const unsigned __int128 m_;
+#endif
+    
+  public:
+    explicit divisor64(uint64_t d) : 
+      d_(d)
+#ifdef HAVE_INT128
+      , p_(ceilLog2(d_)),
+      m_((div_ceil((unsigned __int128)1 << (64 + p_), (unsigned __int128)d_)) & (uint64_t)-1)
+#endif
+    { }
 
-  divisor64() : d(0), p(0), m(0) {}
-  
-  uint64_t divide(uint64_t x) const {
-    __asm__("movq %0, %%rax\n\t"
-            "mulq %1\n\t"
-            "subq %%rdx, %0\n\t"
-            "shrq %0\n\t"
-            "addq %%rdx, %0\n\t"
-            "shrq %%cl, %0\n\t"
-            : "=r" (x)
-            : "r" (m), "c" (p), "0" (x)
-            : "rax", "rdx");
-    return x;
-  }
+    divisor64() :
+      d_(0)
+#ifdef HAVE_INT128
+      , p_(0), m_(0)
+#endif
+    { }
+
+    explicit divisor64(const divisor64& rhs) :
+      d_(rhs.d_)
+#ifdef HAVE_INT128
+      , p_(rhs.p_),
+      m_(rhs.m_)
+#endif
+    { }
+
+    inline uint64_t divide(const uint64_t n) const {
+#ifdef HAVE_INT128
+      switch(m_) {
+      case 0:
+        return n >> p_;
+      default:
+        const unsigned __int128 n_ = (unsigned __int128)n;
+        return (n_ + ((n_ * m_) >> 64)) >> p_;
+      }
+#else
+      return n / d_;
+#endif
+    }
 
-  void division(uint64_t x, uint64_t &q, uint64_t &r) const {
-    q = divide(x);
-    r = x - q * d;
+    inline uint64_t remainder(uint64_t n) const {
+#ifdef HAVE_INT128
+      switch(m_) {
+      case 0:
+        return n & (((uint64_t)1 << p_) - 1);
+      default:
+        return n - divide(n) * d_;
+      }
+#else
+      return n % d_;
+#endif
+    }
+
+    // Euclidian division: d.division(n, q, r) sets q <- n / d and r
+    // <- n % d. This is faster than doing each independently.
+    inline void division(uint64_t n, uint64_t &q, uint64_t &r) const {
+#ifdef HAVE_INT128
+      switch(m_) {
+      case 0:
+        q = n >> p_;
+        r = n & (((uint64_t)1 << p_) - 1);
+        break;
+      default:
+        q = divide(n);
+        r = n - q * d_;
+        break;
+      }
+#else
+      q = n / d_;
+      r = n % d_;
+#endif
+    }
+
+    uint64_t d() const { return d_; }
+    uint64_t p() const { 
+#ifdef HAVE_INT128
+      return p_;
+#else
+      return 0;
+#endif
+    }
+    uint64_t m() const {
+#ifdef HAVE_INT128
+      return m_;
+#else
+      return 0;
+#endif
+    }
+  };
+
+  inline uint64_t operator/(uint64_t n, const divisor64& d) {
+    return d.divide(n);
   }
-};
+  inline uint64_t operator%(uint64_t n, const divisor64& d) {
+    return d.remainder(n);
+  }
+}
 
-#endif /* __DIVISOR_HPP__ */
+inline std::ostream& operator<<(std::ostream& os, const jellyfish::divisor64& d) {
+  return os << "d:" << d.d() << ",p:" << d.p() << ",m:" << d.m();
+}
+  
+#endif /* __JELLYFISH_DIVISOR_HPP__ */
+  
diff --git a/jellyfish/dna_codes.hpp b/jellyfish/dna_codes.hpp
index 568e78b..80e92cd 100644
--- a/jellyfish/dna_codes.hpp
+++ b/jellyfish/dna_codes.hpp
@@ -5,16 +5,16 @@
 #include <jellyfish/misc.hpp>
 
 namespace jellyfish {
-  static const uint_t CODE_A       = 0;
-  static const uint_t CODE_C       = 0;
-  static const uint_t CODE_G       = 0;
-  static const uint_t CODE_T       = 0;
-  // Non DNA codes have the MSB on
-  static const uint_t CODE_RESET   = -1;
-  static const uint_t CODE_IGNORE  = -2;
-  static const uint_t CODE_COMMENT = -3;
-  static const uint_t CODE_NOT_DNA = ((uint_t)1) << (bsizeof(uint_t) - 1);
-  extern const char   dna_codes[256];
+static const uint_t CODE_A       = 0;
+static const uint_t CODE_C       = 0;
+static const uint_t CODE_G       = 0;
+static const uint_t CODE_T       = 0;
+// Non DNA codes have the MSB on
+static const uint_t CODE_RESET   = (uint_t)-1;
+static const uint_t CODE_IGNORE  = (uint_t)-2;
+static const uint_t CODE_COMMENT = (uint_t)-3;
+static const uint_t CODE_NOT_DNA = ((uint_t)1) << (bsizeof(uint_t) - 1);
+extern const char   dna_codes[256];
 };
 
 #endif /* __DNA_CODE_HPP__ */
diff --git a/jellyfish/double_fifo_input.hpp b/jellyfish/double_fifo_input.hpp
index f730bb5..19fa2b8 100644
--- a/jellyfish/double_fifo_input.hpp
+++ b/jellyfish/double_fifo_input.hpp
@@ -61,7 +61,7 @@ namespace jellyfish {
     
   public:
     typedef T bucket_t;
-    double_fifo_input(unsigned long _nb_buckets);
+    explicit double_fifo_input(unsigned long _nb_buckets);
     virtual ~double_fifo_input();
 
     virtual void fill() = 0;
diff --git a/jellyfish/dump_main.cc b/jellyfish/dump_main.cc
index c8855ea..187d29d 100644
--- a/jellyfish/dump_main.cc
+++ b/jellyfish/dump_main.cc
@@ -28,10 +28,11 @@
 #include <jellyfish/dump_main_cmdline.hpp>
 #include <jellyfish/fstream_default.hpp>
 
-template<typename hash_t>
-void dump(const hash_t &h, std::ostream &out,
+dump_args args; // Command line switches and arguments
+
+template<typename iterator>
+void dump(iterator& it, std::ostream &out,
           const dump_args &args, uint64_t lower_count, uint64_t upper_count) {
-  typename hash_t::iterator it = h.iterator_all();
   if(args.column_flag) {
     char spacer = args.tab_flag ? '\t' : ' ';
     while(it.next()) {
@@ -48,15 +49,7 @@ void dump(const hash_t &h, std::ostream &out,
   }
 }
 
-int dump_main(int argc, char *argv[])
-{
-  dump_args args(argc, argv);
-
-  ofstream_default out(args.output_given ? args.output_arg : 0, std::cout);
-  if(!out.good())
-    die << "Error opening output file '" << args.output_arg << "'";
-
-  mapped_file dbf(args.db_arg.c_str());
+void dump_mapped_file(mapped_file& dbf, std::ostream& out) {
   dbf.sequential().will_need();
   char type[8];
   memcpy(type, dbf.base(), sizeof(type));
@@ -65,14 +58,42 @@ int dump_main(int argc, char *argv[])
   uint64_t upper_count = args.upper_count_given ? args.upper_count_arg : (uint64_t)-1;
 
   if(!strncmp(type, jellyfish::compacted_hash::file_type, sizeof(type))) {
-    hash_query_t hash(dbf);
-    dump(hash, out, args, lower_count, upper_count);
+    hash_query_t           hash(dbf);
+    hash_query_t::iterator it = hash.iterator_all();
+    dump(it, out, args, lower_count, upper_count);
   } else if(!strncmp(type, jellyfish::raw_hash::file_type, sizeof(type))) {
-    raw_inv_hash_query_t hash(dbf);
-    dump(hash, out, args, lower_count, upper_count);
+    raw_inv_hash_query_t           hash(dbf);
+    raw_inv_hash_query_t::iterator it = hash.iterator_all();
+    dump(it, out, args, lower_count, upper_count);
   } else {
     die << "Invalid file type '" << err::substr(type, sizeof(type)) << "'.";
   }
+}
+
+int dump_main(int argc, char *argv[])
+{
+  args.parse(argc, argv);
+
+  ofstream_default out(args.output_given ? args.output_arg : 0, std::cout);
+  if(!out.good())
+    die << "Error opening output file '" << args.output_arg << "'";
+
+  bool dumped = false;
+  try {
+    mapped_file dbf(args.db_arg.c_str());
+    dump_mapped_file(dbf, out);
+    dumped = true;
+  } catch(mapped_file::ErrorMMap) {
+    dumped = false;
+  }
+
+  if(!dumped) { // Memory map failed. Try streaming
+    hash_reader_t hash(args.db_arg.c_str());
+    uint64_t lower_count = args.lower_count_given ? args.lower_count_arg : 0;
+    uint64_t upper_count = args.upper_count_given ? args.upper_count_arg : (uint64_t)-1;
+    dump(hash, out, args, lower_count, upper_count);
+  }
+
   out.close();
 
   return 0;
diff --git a/jellyfish/dumper.hpp b/jellyfish/dumper.hpp
index 47b8098..7d2138b 100644
--- a/jellyfish/dumper.hpp
+++ b/jellyfish/dumper.hpp
@@ -19,6 +19,7 @@
 
 #include <iostream>
 #include <fstream>
+#include <sstream>
 #include <jellyfish/err.hpp>
 #include <jellyfish/time.hpp>
 
@@ -34,27 +35,13 @@ namespace jellyfish {
 
   protected:
     void open_next_file(const char *prefix, int *index, std::ofstream &out) {
-      static const long file_len = pathconf("/", _PC_PATH_MAX);
+      int eindex = atomic::gcc::fetch_add(index, (int)1);
+      std::ostringstream file_path;
+      file_path << prefix << "_" << eindex;
 
-      char file[file_len + 1];
-      file[file_len] = '\0';
-      int off = snprintf(file, file_len, "%s", prefix);
-      if(off < 0)
-        eraise(ErrorWriting) << "Error creating output path" << err::no;
-      if(off > 0 && off < file_len) {
-        int eindex = atomic::gcc::fetch_add(index, (int)1);
-        int _off = snprintf(file + off, file_len - off, "_%d", eindex);
-        if(_off < 0)
-          eraise(ErrorWriting) << "Error creating output path" << err::no;
-        off += _off;
-      }
-      if(off >= file_len)
-        eraise(ErrorWriting) << "Output path is longer than maximum path length (" 
-                            << off << " > " << file_len << ")";
-      
-      out.open(file);
+      out.open(file_path.str().c_str());
       if(out.fail())
-        eraise(ErrorWriting) << "'" << (char*)file << "': "
+        eraise(ErrorWriting) << "'" << file_path.str() << "': "
                              << "Can't open file for writing" << err::no;
     }
 
diff --git a/jellyfish/err.hpp b/jellyfish/err.hpp
index b6f5e80..e960aa3 100644
--- a/jellyfish/err.hpp
+++ b/jellyfish/err.hpp
@@ -26,11 +26,23 @@
 #include <string.h>
 #include <errno.h>
 
+#ifdef HAVE_CONFIG_H
+#include <config.h>
+#endif
+
+#if HAVE_DECL_STRERROR_R == 0
+#ifdef STRERROR_R_CHAR_P
+extern char* strerror_r(int, char*, size_t);
+#else
+extern int strerror_r(int, char*, size_t);
+#endif
+#endif
+
 namespace err {
   class code {
     int _code;
   public:
-    code(int c) : _code(c) {}
+    explicit code(int c) : _code(c) {}
     int get_code() const { return _code; }
   };
 
@@ -38,9 +50,22 @@ namespace err {
   public:
     no_t() {}
     static void write(std::ostream &os, int e) {
-      char err_str[4096];
-      strerror_r(e, err_str, sizeof(err_str));
-      os << ": " << err_str;
+    char  err_str[1024];
+    char* str;
+
+#ifdef STRERROR_R_CHAR_P
+    str = strerror_r(e, err_str, sizeof(err_str));
+    if(!str) { // Should never happen
+      strcpy(err_str, "error");
+    str = err_str;
+    }
+#else
+    int err = strerror_r(e, err_str, sizeof(err_str));
+    if(err)
+      strcpy(err_str, "error");
+      str = err_str;
+#endif
+    os << ": " << str;
     }
   };
   static const no_t no;
@@ -59,7 +84,7 @@ namespace err {
     int _errno;
   public:
     die_t() : _code(1), _errno(errno) {}
-    die_t(int c) : _code(c), _errno(errno) {}
+    explicit die_t(int c) : _code(c), _errno(errno) {}
     ~die_t() {
       std::cerr << std::endl;
       exit(_code);
@@ -112,9 +137,9 @@ namespace err {
 
 #define die if(1) err::die_t()
 #define eraise(e) if(1) err::raise_t<e>()
-#define define_error_class(name)                                    \
-  class name : public std::runtime_error {                          \
-  public: name(const std::string &txt) : std::runtime_error(txt) {} \
+#define define_error_class(name)                                        \
+  class name : public std::runtime_error {                              \
+  public: explicit name(const std::string &txt) : std::runtime_error(txt) {} \
   }
 
 #endif
diff --git a/jellyfish/fastq_dumper.hpp b/jellyfish/fastq_dumper.hpp
index 7a70294..1613f17 100644
--- a/jellyfish/fastq_dumper.hpp
+++ b/jellyfish/fastq_dumper.hpp
@@ -41,7 +41,7 @@ namespace jellyfish {
         memcpy(&type, file_type, sizeof(type));
       }
 
-      header(const char *ptr) {
+      explicit header(const char *ptr) {
         if(memcmp(ptr, file_type, sizeof(type)))
           eraise(ErrorReading) << "Bad file type '" << err::substr(ptr, sizeof(type))
                                << "', expected '" << err::substr(file_type, sizeof(type)) << "'";
diff --git a/jellyfish/file_parser.cc b/jellyfish/file_parser.cc
index f3c78ff..e374220 100644
--- a/jellyfish/file_parser.cc
+++ b/jellyfish/file_parser.cc
@@ -34,7 +34,7 @@ int jellyfish::file_parser::file_peek(const char *path, char *peek) {
                             << path << "'" << err::no;
       
   if(read(fd, peek, 1) <= 0)
-    eraise(FileParserError) << "Empty input file '" << path << "'";
+    eraise(FileParserError) << "Empty input file '" << path << "'" << err::no;
   
   return fd;
 }
@@ -48,7 +48,7 @@ jellyfish::file_parser::file_parser(int fd, const char *path,
     eraise(FileParserError) << "Can't fstat '" << path << "'" << err::no;
   _size       = stat_buf.st_size;
   if(_do_mmap) {
-    _buffer     = (char *)mmap(0, _size , PROT_READ, MAP_SHARED, fd, 0);
+    _buffer     = (char *)mmap(0, _size , PROT_READ, MAP_PRIVATE, fd, 0);
     _is_mmapped = _buffer != MAP_FAILED;
   } else {
     _is_mmapped  = false;
diff --git a/jellyfish/floats.hpp b/jellyfish/floats.hpp
index 045784d..06042c2 100644
--- a/jellyfish/floats.hpp
+++ b/jellyfish/floats.hpp
@@ -38,16 +38,16 @@ namespace jellyfish {
     union float_int {
       float_t      fv;
       bits_t     iv;
-      float_int(float_t v) : fv(v) {}
-      float_int(bits_t v) : iv(v) {}
+      explicit float_int(float_t v) : fv(v) {}
+      explicit float_int(bits_t v) : iv(v) {}
     };
     float_int v;
 
   public:
     Float() : v(0.0f) {}
-    Float(int _v) : v((bits_t)_v) {}
-    Float(float_t _v) : v(_v) {}
-    Float(bits_t _v) : v(_v) {}
+    explicit Float(int _v) : v((bits_t)_v) {}
+    explicit Float(float_t _v) : v(_v) {}
+    explicit Float(bits_t _v) : v(_v) {}
 
     // static const Float zero;
     // static const Float one;
@@ -55,6 +55,9 @@ namespace jellyfish {
     const Float operator+(const Float &y) const {
       return Float(v.fv + y.v.fv);
     }
+    const Float operator+(const float& y) const {
+      return Float(v.fv + y);
+    }
 
     bits_t bits() const { return v.iv; };
     float_t to_float() const { return v.fv; };
diff --git a/jellyfish/generate_sequence.cc b/jellyfish/generate_sequence.cc
index 9321f23..47630c9 100644
--- a/jellyfish/generate_sequence.cc
+++ b/jellyfish/generate_sequence.cc
@@ -27,7 +27,7 @@
 
 class rDNAg_t {
 public:
-  rDNAg_t(CRandomMersenne *_rng) : rng(_rng), i(15), buff(0) {}
+  explicit rDNAg_t(CRandomMersenne *_rng) : rng(_rng), i(15), buff(0) {}
   char letter() {
     i = (i+1) % 16;
     if(i == 0)
diff --git a/jellyfish/half.h b/jellyfish/half.h
index 09cc7ab..2d89200 100644
--- a/jellyfish/half.h
+++ b/jellyfish/half.h
@@ -108,7 +108,7 @@ class HALF_EXPORT half
     //-------------
 
     half ();			// no initialization
-    half (float f);
+    explicit half (float f);
 
 
     //--------------------
diff --git a/jellyfish/hash.hpp b/jellyfish/hash.hpp
index e39bc8b..6daeb7a 100644
--- a/jellyfish/hash.hpp
+++ b/jellyfish/hash.hpp
@@ -54,7 +54,7 @@ namespace jellyfish {
     typedef typename ary_t::iterator iterator;
 
     hash() : ary(NULL), dumper(NULL), dumping_initiated(false) {}
-    hash(ary_t *_ary) : ary(_ary), dumper(NULL), dumping_initiated(false) {}
+    explicit hash(ary_t *_ary) : ary(_ary), dumper(NULL), dumping_initiated(false) {}
 
     virtual ~hash() {}
 
@@ -126,15 +126,14 @@ namespace jellyfish {
     typedef std::list<thread> thread_list_t;
     class thread_ptr_t : public thread_list_t::iterator {
     public:
-      thread_ptr_t(const typename thread_list_t::iterator &thl) : thread_list_t::iterator(thl) {}
+      explicit thread_ptr_t(const typename thread_list_t::iterator &thl) : thread_list_t::iterator(thl) {}
       typedef val_t val_type;
     };
-    //    typedef typename thread_list_t::iterator thread_ptr_t;
+    // typedef typename thread_list_t::iterator thread_ptr_t;
 
     thread_ptr_t new_thread() { 
       user_thread_lock.lock();
-      thread_ptr_t res = 
-        user_thread_list.insert(user_thread_list.begin(), thread(ary, this));
+      thread_ptr_t res(user_thread_list.insert(user_thread_list.begin(), thread(ary, this)));
       user_thread_lock.unlock();
       return res;
     }
@@ -210,7 +209,7 @@ namespace jellyfish {
       inuse_thread_count = 0;
       
       // Block access to hash and wait for threads with INUSE state
-      for(thread_ptr_t it = user_thread_list.begin(); 
+      for(thread_ptr_t it(user_thread_list.begin());
           it != user_thread_list.end();
           it++) {
         it->ostatus = atomic::set(&it->status, BLOCKED);
@@ -228,7 +227,7 @@ namespace jellyfish {
 
     void release_event_locks() {
       event_cond.lock();
-      for(thread_ptr_t it = user_thread_list.begin(); 
+      for(thread_ptr_t it(user_thread_list.begin());
           it != user_thread_list.end();
           it++) {
         atomic::set(&it->status, FREE);
diff --git a/jellyfish/hash_fastq_merge.cc b/jellyfish/hash_fastq_merge.cc
index a138b32..b018ff7 100644
--- a/jellyfish/hash_fastq_merge.cc
+++ b/jellyfish/hash_fastq_merge.cc
@@ -14,11 +14,11 @@
     along with Jellyfish.  If not, see <http://www.gnu.org/licenses/>.
 */
 
-#include <jellyfish/hash_fastq_merge_cmdline.hpp>
 #include <jellyfish/err.hpp>
 #include <jellyfish/misc.hpp>
 #include <jellyfish/mer_counting.hpp>
 #include <jellyfish/fastq_dumper.hpp>
+#include <jellyfish/hash_fastq_merge_cmdline.hpp>
 
 int hash_fastq_merge_main(int argc, char *argv[])
 {
diff --git a/jellyfish/hash_merge.cc b/jellyfish/hash_merge.cc
index 8ae76bf..5ee4b90 100644
--- a/jellyfish/hash_merge.cc
+++ b/jellyfish/hash_merge.cc
@@ -41,7 +41,7 @@
 class ErrorWriting : public std::exception {
   std::string msg;
 public:
-  ErrorWriting(const std::string &_msg) : msg(_msg) {}
+  explicit ErrorWriting(const std::string &_msg) : msg(_msg) {}
   virtual ~ErrorWriting() throw() {}
   virtual const char* what() const throw() {
     return msg.c_str();
diff --git a/jellyfish/heap.hpp b/jellyfish/heap.hpp
index fcf110c..cae37f1 100644
--- a/jellyfish/heap.hpp
+++ b/jellyfish/heap.hpp
@@ -29,7 +29,7 @@ namespace jellyfish {
 
     heap_item_t() : key(0), val(0), pos(0) { }
 
-    heap_item_t(iterator &iter) { 
+    explicit heap_item_t(iterator &iter) { 
       initialize(iter);
     }
 
@@ -68,7 +68,7 @@ namespace jellyfish {
     typedef const heap_item_t<iterator> *const_item_t;
 
     heap_t() : storage(0), elts(0), capacity_(0), h(0) { }
-    heap_t(size_t _capacity)  { initialize(_capacity); }
+    explicit heap_t(size_t _capacity)  { initialize(_capacity); }
     ~heap_t() {
       delete[] storage;
       delete[] elts;
diff --git a/jellyfish/invertible_hash_array.hpp b/jellyfish/invertible_hash_array.hpp
index 7fefcc4..f86f3f4 100644
--- a/jellyfish/invertible_hash_array.hpp
+++ b/jellyfish/invertible_hash_array.hpp
@@ -33,6 +33,7 @@
 #include <jellyfish/offsets_key_value.hpp>
 #include <jellyfish/parse_dna.hpp>
 #include <jellyfish/misc.hpp>
+#include <jellyfish/simple_circular_buffer.hpp>
 
 namespace jellyfish {
   namespace invertible_hash {
@@ -556,61 +557,95 @@ namespace jellyfish {
                         full, carry_bit);
       }
 
-      /* InputIterator points to keys (words). OutputIterator points
-         to struct containing at least the fields { bool found; size_t
-         key_id; word val; }.
-       */
-      template<typename InputIterator, typename OutputIterator>
-      void get_multi_val(InputIterator key, const InputIterator& key_end,
-                         OutputIterator val, bool full, bool carry_bit) const {
-        uint64_t        phash, chash;
-        const offset_t *po, *plo, *co, *clo;
-        const word     *pw, *cw;
-
-        if(key == key_end)
-          return;
-
-        // Call __get_val with a delay. Let prefetch work while we
-        // compute the hash/get the previous key.
-        phash = hash_matrix.times(*key);
-        pw    = offsets.get_word_offset(phash & size_mask, &po, &plo, data);
-        //__builtin_prefetch(pw + po->key.woff, 0, 3);
-
-        for(++key; key != key_end; ++key, ++val) {
-          chash = hash_matrix.times(*key);
-          cw    = offsets.get_word_offset(chash & size_mask, &co, &clo, data);
-          //__builtin_prefetch(cw + co->key.woff, 0, 3);
-
-          val->found = __get_val(phash & size_mask, val->key_id, 
-                                 (phash >> lsize) & key_mask, val->val,
-                                 full, carry_bit, pw, po, plo);
-
-
-          pw    = cw;
-          po    = co;
-          plo   = clo;
-          phash = chash;
+      // /* InputIterator points to keys (words). OutputIterator points
+      //    to struct containing at least the fields { bool found; size_t
+      //    key_id; word val; }.
+      //  */
+      // template<typename InputIterator, typename OutputIterator>
+      // void get_multi_val(InputIterator key, const InputIterator& key_end,
+      //                    OutputIterator val, bool full, bool carry_bit) const {
+      //   uint64_t        phash, chash;
+      //   const offset_t *po, *plo, *co, *clo;
+      //   const word     *pw, *cw;
+
+      //   if(key == key_end)
+      //     return;
+
+      //   // Call __get_val with a delay. Let prefetch work while we
+      //   // compute the hash/get the previous key.
+      //   phash = hash_matrix.times(*key);
+      //   pw    = offsets.get_word_offset(phash & size_mask, &po, &plo, data);
+      //   //__builtin_prefetch(pw + po->key.woff, 0, 3);
+
+      //   for(++key; key != key_end; ++key, ++val) {
+      //     chash = hash_matrix.times(*key);
+      //     cw    = offsets.get_word_offset(chash & size_mask, &co, &clo, data);
+      //     //__builtin_prefetch(cw + co->key.woff, 0, 3);
+
+      //     val->found = __get_val(phash & size_mask, val->key_id, 
+      //                            (phash >> lsize) & key_mask, val->val,
+      //                            full, carry_bit, pw, po, plo);
+
+
+      //     pw    = cw;
+      //     po    = co;
+      //     plo   = clo;
+      //     phash = chash;
+      //   }
+      //   // Last one
+      //   val->found =  __get_val(phash & size_mask, val->key_id, 
+      //                           (phash >> lsize) & key_mask, val->val,
+      //                           full, carry_bit, pw, po, plo);
+      // }
+
+      struct prefetch_info {
+        const word*     w;
+        const offset_t *o, *lo;
+      };
+      typedef simple_circular_buffer::pre_alloc<prefetch_info, 8> prefetch_buffer;
+
+      void warm_up_cache(prefetch_buffer& buffer, size_t id, bool load_lo) const {
+        buffer.clear();
+        for(int i = 0; i < buffer.capacity(); ++i) {
+          buffer.push_back();
+          prefetch_info& info = buffer.back();
+          size_t         cid  = (id + (i > 0 ? reprobes[i] : 0)) & size_mask;
+          info.w              = offsets.get_word_offset(cid, &info.o, &info.lo, data);
+          __builtin_prefetch(info.w + info.o->key.woff, 0, 1);
+          __builtin_prefetch(info.o, 0, 3);
+          if(load_lo)
+            __builtin_prefetch(info.lo, 0, 3);
         }
-        // Last one
-        val->found =  __get_val(phash & size_mask, val->key_id, 
-                                (phash >> lsize) & key_mask, val->val,
-                                full, carry_bit, pw, po, plo);
       }
 
-      inline bool _get_val(const size_t id, size_t &key_id, const word key, word &val, 
+      void prefetch_next(prefetch_buffer& buffer, size_t id, uint_t reprobe, bool load_lo) const {
+        buffer.pop_front();
+        if(reprobe + buffer.capacity() <= reprobe_limit.val()) {
+          buffer.push_back();
+          prefetch_info& info = buffer.back();
+          size_t         fid  = (id + reprobes[reprobe + buffer.capacity() - 1]) & size_mask;
+          info.w = offsets.get_word_offset(fid, &info.o, &info.lo, data);
+          __builtin_prefetch(info.w + info.o->key.woff, 0, 1);
+          __builtin_prefetch(info.o, 0, 3);
+          if(load_lo)
+            __builtin_prefetch(info.lo, 0, 3);
+        }
+
+      }
+
+      bool _get_val(const size_t id, size_t &key_id, const word key, word &val, 
                            bool full = false, bool carry_bit = false) const {
-        const word*     w;
-        const offset_t *o, *lo;
+        // Buffer for pre-cached information
+        prefetch_info info_ary[prefetch_buffer::capacity()];
+        prefetch_buffer buffer(info_ary);
+        warm_up_cache(buffer, id, false);
 
-        // Warm up cache
-        w   = offsets.get_word_offset(id, &o, &lo, data);
-        //__builtin_prefetch(w + o->key.woff, 0, 1);
-        return __get_val(id, key_id, key, val, full, carry_bit, w, o, lo);
+        return __get_val(id, key_id, key, val, full, carry_bit, buffer);
       }
 
       bool __get_val(const size_t id, size_t &key_id, const word key, word &val, 
                      const bool full, bool carry_bit,
-                     const word* w, const offset_t* o, const offset_t* lo) const {
+                     prefetch_buffer& buffer) const {
         const word     *kvw;
         word            nkey, nval;
         size_t          cid     = id;
@@ -618,16 +653,14 @@ namespace jellyfish {
         word            akey    = key | ((word)1 << key_off);
 
         // Find key
+        const offset_t *o, *lo;
+        const word* w;
         while(true) {
-          // Prefetch next reprobe word
-          word* nw;
-          const offset_t *no, *nlo;
-          nw   = offsets.get_word_offset((id + reprobes[reprobe + 1]) & size_mask, &no, &nlo, data);
-          __builtin_prefetch(nw + no->key.woff, 0, 1);
-
-
-          kvw = w + o->key.woff;
-          nkey = *kvw;
+          prefetch_info& info = buffer.front();
+          w                   = info.w;
+          o                   = info.o;
+          kvw                 = w + o->key.woff;
+          nkey                = *kvw;
       
           if(!(nkey & o->key.lb_mask)) {
             if(o->key.mask2) {
@@ -641,11 +674,11 @@ namespace jellyfish {
           }
           if(++reprobe > reprobe_limit.val())
             return false;
+          // Do reprobe
           cid  = (id + reprobes[reprobe]) & size_mask;
           akey = key | ((reprobe + 1) << key_off);
-          w    = nw;
-          o    = no;
-          lo   = nlo;
+
+          prefetch_next(buffer, id, reprobe, false);
         }
 
         // Get value
@@ -656,8 +689,8 @@ namespace jellyfish {
         }
         bool do_reprobe = true;
         if(carry_bit) {
-          do_reprobe = val & 0x1;
-          val >>= 1;
+          do_reprobe   = val & 0x1;
+          val        >>= 1;
         }
         key_id = cid;
 
@@ -667,11 +700,17 @@ namespace jellyfish {
         if(full && do_reprobe) {
           const size_t bid = (cid + reprobes[0]) & size_mask;
           cid = bid;
+
+          warm_up_cache(buffer, bid, true);
+
           reprobe = 0;
           do {
-            w   = offsets.get_word_offset(cid, &o, &lo, data);
-            kvw = w + o->key.woff;
-            nkey = *kvw;
+            prefetch_info& info = buffer.front();
+            const word*    w    = info.w;
+            o                   = info.o;
+            lo                  = info.lo;
+            kvw                 = w + o->key.woff;
+            nkey                = *kvw;
             if(nkey & o->key.lb_mask) {
               if(lo->key.mask2) {
                 nkey = (nkey & lo->key.mask1 & ~lo->key.sb_mask1) >> lo->key.boff;
@@ -696,6 +735,8 @@ namespace jellyfish {
             }
 
             cid = (bid + reprobes[++reprobe]) & size_mask;
+            
+            prefetch_next(buffer, bid, reprobe, true);
           } while(reprobe <= reprobe_limit.val());
         }
 
diff --git a/jellyfish/locking_hash_counters.hpp b/jellyfish/locking_hash_counters.hpp
index 048dad7..d26ec5e 100644
--- a/jellyfish/locking_hash_counters.hpp
+++ b/jellyfish/locking_hash_counters.hpp
@@ -48,7 +48,7 @@ public:
   Key key;
   Val val;
 
-  arys_iterator(A *_ary) : ary(_ary), pos(0) {
+  explicit arys_iterator(A *_ary) : ary(_ary), pos(0) {
   }
 
   ~arys_iterator() { }
@@ -108,7 +108,7 @@ public:
    * ensure proper order of deletion.
    * The constructor is not thread safe (protect by mutex)
    */
-  arys_t(unsigned long _size) : 
+  explicit arys_t(unsigned long _size) : 
     allocated(true) {
     size = 1;
     while(_size > size) { size <<= 1; }
diff --git a/jellyfish/locks_pthread.hpp b/jellyfish/locks_pthread.hpp
index 0216f36..63d2422 100644
--- a/jellyfish/locks_pthread.hpp
+++ b/jellyfish/locks_pthread.hpp
@@ -67,7 +67,7 @@ namespace locks {
         int _value, _wakeups;
         cond _cv;
     public:
-        Semaphore(int value) :
+        explicit Semaphore(int value) :
           _value(value),
           _wakeups(0)
         {
@@ -105,7 +105,7 @@ namespace locks {
       pthread_barrier_t _barrier;
       
     public:
-      barrier(unsigned count) {
+      explicit barrier(unsigned count) {
 
 	pthread_barrier_init(&_barrier, NULL, count);
       }
@@ -133,7 +133,7 @@ namespace locks {
       Semaphore barrier2;
 
     public:
-      barrier(unsigned cnt) 
+      explicit barrier(unsigned cnt) 
         : count(cnt), current(0), barrier1(0), barrier2(0) {
       }
 
diff --git a/jellyfish/mapped_file.hpp b/jellyfish/mapped_file.hpp
index 63107e6..9c94d6c 100644
--- a/jellyfish/mapped_file.hpp
+++ b/jellyfish/mapped_file.hpp
@@ -49,7 +49,7 @@ protected:
       eraise(ErrorMMap) << "Can't stat file '" << filename << "'" << err::no;
 
     _length = stat.st_size;
-    _base = (char *)mmap(NULL, _length, PROT_READ, MAP_SHARED, fd, 0);
+    _base = (char *)mmap(NULL, _length, PROT_READ, MAP_PRIVATE, fd, 0);
     if(_base == MAP_FAILED)
       eraise(ErrorMMap) << "Can't mmap file '" << filename << "'" << err::no;
     close(fd);
@@ -61,7 +61,7 @@ public:
   mapped_file(char *__base, size_t __length) :
     _unmap(false), _base(__base), _end(__base + __length), _length(__length) {}
 
-  mapped_file(const char *filename) : _path(filename), _unmap(false) {
+  explicit mapped_file(const char *filename) : _path(filename), _unmap(false) {
     map(filename);
   }
   mapped_file(const mapped_file &mf) : 
@@ -138,7 +138,7 @@ class lazy_mapped_file_t : public mapped_file {
   volatile long     used_counter;
 
 public:
-  lazy_mapped_file_t(const char *path) : 
+  explicit lazy_mapped_file_t(const char *path) : 
     mapped_file((char *)0, (size_t)0),
     _path(path), done(false), used_counter(0) {}
   
diff --git a/jellyfish/mer_counter.cc b/jellyfish/mer_counter.cc
index 12c3cac..0a4502f 100644
--- a/jellyfish/mer_counter.cc
+++ b/jellyfish/mer_counter.cc
@@ -79,7 +79,7 @@ protected:
   uint64_t                    distinct, total;
 
 public:
-  mer_counting(count_args &_args) :
+  explicit mer_counting(count_args &_args) :
     args(&_args), sync_barrier(args->threads_arg),
     distinct(0), total(0) {}
 
@@ -164,6 +164,7 @@ public:
           new inv_hash_dumper_t(args->threads_arg, args->output_arg.c_str(),
                                 args->out_buffer_size_arg, 
                                 8*args->out_counter_len_arg, ary);
+        _dumper->set_one_file(args->O_flag);
         if(args->lower_count_given)
           _dumper->set_lower_count(args->lower_count_arg);
         if(args->upper_count_given)
@@ -211,6 +212,7 @@ public:
           new inv_hash_dumper_t(args->threads_arg, args->output_arg.c_str(),
                                 args->out_buffer_size_arg, 
                                 8*args->out_counter_len_arg, ary);
+        _dumper->set_one_file(args->O_flag);
         if(args->lower_count_given)
           _dumper->set_lower_count(args->lower_count_arg);
         if(args->upper_count_given)
@@ -240,10 +242,51 @@ public:
     } else {
       if(args->raw_flag)
         std::cerr << "Switch --raw not (yet) supported with direct indexing. Ignoring." << std::endl;
-      dumper = new direct_index_dumper_t(args->threads_arg, args->output_arg.c_str(),
-                                         args->out_buffer_size_arg,
-                                         8*args->out_counter_len_arg,
-                                         ary);
+      direct_index_dumper_t *_dumper =
+        new direct_index_dumper_t(args->threads_arg, args->output_arg.c_str(),
+                                  args->out_buffer_size_arg,
+                                  8*args->out_counter_len_arg,
+                                  ary);
+      _dumper->set_one_file(args->O_flag);
+      if(args->lower_count_given)
+        _dumper->set_lower_count(args->lower_count_arg);
+      if(args->upper_count_given)
+        _dumper->set_upper_count(args->upper_count_arg);
+      dumper = _dumper;
+    }
+    hash->set_dumper(dumper);
+    parser->set_canonical(args->both_strands_flag);
+  }
+};
+
+class mer_counting_qual_fasta_direct : public mer_counting<jellyfish::parse_qual_dna, direct_index_t> {
+public:
+  mer_counting_qual_fasta_direct(const std::vector<const char *> &files,
+                                 count_args &_args) :
+    mer_counting<jellyfish::parse_qual_dna, direct_index_t>(_args)
+  {
+    parser = new jellyfish::parse_qual_dna(files,
+                                           args->mer_len_arg, args->buffers_arg,
+                                           args->buffer_size_arg, args->quality_start_arg,
+                                           args->min_quality_arg);
+    ary = new direct_index_t::storage_t(2 * args->mer_len_arg);
+    hash = new direct_index_t(ary);
+    if(args->no_write_flag) {
+      dumper = new jellyfish::noop_dumper();
+    } else {
+      if(args->raw_flag)
+        std::cerr << "Switch --raw not (yet) supported with direct indexing. Ignoring." << std::endl;
+      direct_index_dumper_t *_dumper =
+        new direct_index_dumper_t(args->threads_arg, args->output_arg.c_str(),
+                                  args->out_buffer_size_arg,
+                                  8*args->out_counter_len_arg,
+                                  ary);
+      _dumper->set_one_file(args->O_flag);
+      if(args->lower_count_given)
+        _dumper->set_lower_count(args->lower_count_arg);
+      if(args->upper_count_given)
+        _dumper->set_upper_count(args->upper_count_arg);
+      dumper = _dumper;
     }
     hash->set_dumper(dumper);
     parser->set_canonical(args->both_strands_flag);
@@ -292,7 +335,10 @@ int count_main(int argc, char *argv[])
   if(args.quake_flag) {
     counter = new mer_counting_quake(args.file_arg, args);
   } else if(ceilLog2((unsigned long)args.size_arg) > 2 * (unsigned long)args.mer_len_arg) {
-    counter = new mer_counting_fasta_direct(args.file_arg, args);
+    if(args.min_quality_given)
+      counter = new mer_counting_qual_fasta_direct(args.file_arg, args);
+    else
+      counter = new mer_counting_fasta_direct(args.file_arg, args);
   } else if(args.min_quality_given) {
     counter = new mer_counting_qual_fasta_hash(args.file_arg, args);
   } else {
diff --git a/jellyfish/misc.cc b/jellyfish/misc.cc
index ff72370..4f6b0c9 100644
--- a/jellyfish/misc.cc
+++ b/jellyfish/misc.cc
@@ -47,3 +47,16 @@ void disabled_misaligned_mem_access() {
 # endif
 #endif 
 }
+
+// Return -1 if size cannot be obtained.
+std::streamoff get_file_size(std::istream& is) {
+  if(!is.good()) return -1;
+  std::streampos cpos = is.tellg();
+  if(!is.good()) { is.clear(); return -1; }
+  is.seekg(0, std::ios::end);
+  if(!is.good()) { is.clear(); return -1; }
+  std::streamoff res = is.tellg() - cpos;
+  if(!is.good()) { is.clear(); return -1; }
+  is.seekg(cpos);
+  return res;
+}
diff --git a/jellyfish/misc.hpp b/jellyfish/misc.hpp
index 5352e36..889adf5 100644
--- a/jellyfish/misc.hpp
+++ b/jellyfish/misc.hpp
@@ -139,4 +139,6 @@ std::pair<T,T> slice(T i, T number_of_slices, T total) {
   T end = std::min(total, (i + 1) * slice_size + (i + 1) * slice_remain / number_of_slices);
   return std::make_pair(start, end);
 }
+
+std::streamoff get_file_size(std::istream& is);
 #endif // __MISC_HPP__
diff --git a/jellyfish/offsets_key_value.hpp b/jellyfish/offsets_key_value.hpp
index f58257c..fdc16e3 100644
--- a/jellyfish/offsets_key_value.hpp
+++ b/jellyfish/offsets_key_value.hpp
@@ -74,27 +74,26 @@ namespace jellyfish {
       offset_t    normal;
       offset_t    large;
     } offset_pair_t;
-  
-    Offsets() {}
-
-    Offsets(uint_t _key_len, uint_t _val_len, uint_t _reprobe_limit) {
-      init(_key_len, _val_len, _reprobe_limit);
-    }
+    struct block_info {
+      uint_t len;
+      uint_t word_len;
+    };
+    //    Offsets() {}
+
+    Offsets(uint_t _key_len, uint_t _val_len, uint_t _reprobe_limit) :
+      key_len(_key_len),
+      val_len(_val_len),
+      reprobe_limit(_reprobe_limit),
+      reprobe_len(bitsize(reprobe_limit)),
+      lval_len(key_len + val_len - reprobe_len),
+      block(compute_offsets()),
+      bld(block.len)
+    { }
 
     ~Offsets() {}
 
-    void init(uint_t _key_len, uint_t _val_len, uint_t _reprobe_limit) {
-      key_len       = _key_len;
-      val_len       = _val_len;
-      reprobe_limit = _reprobe_limit;
-      reprobe_len   = bitsize(_reprobe_limit);
-      lval_len      = key_len + val_len - reprobe_len;
-
-      compute_offsets();
-      bld           = divisor64(block_len);
-    }
-    uint_t get_block_len() const { return block_len; }
-    uint_t get_block_word_len() const { return block_word_len; }
+    uint_t get_block_len() const { return block.len; }
+    uint_t get_block_word_len() const { return block.word_len; }
     uint_t get_reprobe_len() const { return reprobe_len; }
     uint_t get_key_len() const { return key_len; }
     uint_t get_val_len() const { return val_len; }
@@ -106,31 +105,28 @@ namespace jellyfish {
     // Discretize and round down number of entries according to length
     // of a block. Return in blocks the number of blocks.
     size_t floor_block(size_t entries, size_t &blocks) const {
-      blocks = entries / block_len;
-      return block_len * blocks;
+      blocks = entries / bld;
+      return block.len * blocks;
     }
 
     word *get_word_offset(size_t id, const offset_t **o, const offset_t **lo,
 			  word * const base) const {
-      uint64_t q = id / block_len;
-      uint64_t r = id % block_len;
-      // uint64_t q, r;
-      // bld.division(id, q, r);
-      word *w = base + (block_word_len * q);
+      uint64_t q, r;
+      bld.division(id, q, r);
+      word *w = base + (block.word_len * q);
       *o = &offsets[r].normal;
       *lo = &offsets[r].large;
       return w;
     }
 
   private:
-    uint_t        key_len, val_len;
-    uint_t        block_len; // Length of a block in number of entries
-    uint_t        block_word_len; // Length of a block in number of words
-    uint_t        reprobe_limit, reprobe_len, lval_len;
-    divisor64     bld; // Fast divisor by block_len
-    offset_pair_t offsets[bsizeof(word)];
-
-    void compute_offsets();
+    const uint_t     key_len, val_len;
+    const uint_t     reprobe_limit, reprobe_len, lval_len;
+    const block_info block;
+    const divisor64  bld;       // Fast divisor by block.len
+    offset_pair_t    offsets[bsizeof(word)];
+
+    block_info compute_offsets();
     bool update_current_offsets(uint_t &cword, uint_t &cboff, uint_t add);
     word mask(uint_t length, uint_t shift);
   };
@@ -154,7 +150,7 @@ namespace jellyfish {
   }
 
   template<typename word>
-  void Offsets<word>::compute_offsets()
+  typename Offsets<word>::block_info Offsets<word>::compute_offsets()
   {
     offset_pair_t *offset = offsets;
     uint_t         cword  = 0;    // current word in block
@@ -235,8 +231,8 @@ namespace jellyfish {
       offset++;
     } while(cboff != 0 && cboff < bsizeof(word) - 2);
 
-    block_len = offset - offsets;
-    block_word_len = cword + (cboff == 0 ? 0 : 1);
+    block_info res = { static_cast<uint_t>(offset - offsets), cword + (cboff == 0 ? 0 : 1) };
+    return res;
   }
 }
 
diff --git a/jellyfish/parse_dna.hpp b/jellyfish/parse_dna.hpp
index f5d0103..cd1eb83 100644
--- a/jellyfish/parse_dna.hpp
+++ b/jellyfish/parse_dna.hpp
@@ -100,7 +100,7 @@ namespace jellyfish {
       error_reporter  error_report;
 
     public:
-      thread(parse_dna *_parser) :
+      explicit thread(parse_dna *_parser) :
         parser(_parser), sequence(0),
         mer_len(_parser->mer_len), lshift(2 * (mer_len - 1)),
         kmer(0), rkmer(0), masq((1UL << (2 * mer_len)) - 1),
diff --git a/jellyfish/parse_qual_dna.hpp b/jellyfish/parse_qual_dna.hpp
index 7aef94b..cdaa2d0 100644
--- a/jellyfish/parse_qual_dna.hpp
+++ b/jellyfish/parse_qual_dna.hpp
@@ -108,8 +108,8 @@ namespace jellyfish {
               kmer = ((kmer << 2) & masq) | c;
               rkmer = (rkmer >> 2) | ((0x3 - c) << lshift);
               if(++cmlen >= mer_len) {
-                cmlen  = mer_len;
-                uint64_t oval;
+                cmlen = mer_len;
+                typename T::val_type oval;
                 if(canonical)
                   counter->add(kmer < rkmer ? kmer : rkmer, 1, &oval);
                 else
diff --git a/jellyfish/parse_read.hpp b/jellyfish/parse_read.hpp
index 07cc6c4..f87d5ae 100644
--- a/jellyfish/parse_read.hpp
+++ b/jellyfish/parse_read.hpp
@@ -17,11 +17,13 @@
 #ifndef __JELLYFISH_FASTQ_READ_PARSER_HPP__
 #define __JELLYFISH_FASTQ_READ_PARSER_HPP__
 
+#include <vector>
+#include <limits>
+
 #include <jellyfish/double_fifo_input.hpp>
 #include <jellyfish/read_parser.hpp>
 #include <jellyfish/misc.hpp>
 #include <jellyfish/dbg.hpp>
-#include <vector>
 
 namespace jellyfish {
   class parse_read : public double_fifo_input<read_parser::reads_t> {
@@ -37,7 +39,7 @@ namespace jellyfish {
     typedef read_parser::read_t read_t;
 
     static const uint_t codes[256];
-    static const uint_t CODE_RESET = -1;
+    static const uint_t CODE_RESET = (uint_t)-1;
 
     //    parse_read(int nb_files, char *argv[], unsigned int nb_buffers);
     template<typename T>
@@ -55,7 +57,7 @@ namespace jellyfish {
       int         current_read;
 
     public:
-      thread(parse_read *_parser) :
+      explicit thread(parse_read *_parser) :
         parser(_parser), sequence(parser->next()),
         current_read(0) {}
 
diff --git a/jellyfish/randomc.h b/jellyfish/randomc.h
index 39724f4..dccd64c 100644
--- a/jellyfish/randomc.h
+++ b/jellyfish/randomc.h
@@ -165,7 +165,7 @@ class CRandomMersenne {                // Encapsulate random number generator
 #endif
 
 public:
-   CRandomMersenne(int seed) {         // Constructor
+   explicit CRandomMersenne(int seed) {         // Constructor
       RandomInit(seed); LastInterval = 0;}
    void RandomInit(int seed);          // Re-seed
    void RandomInitByArray(int const seeds[], int NumSeeds); // Seed by more than 32 bits
@@ -188,7 +188,7 @@ public:
    int IRandom(int min, int max);      // Get integer random number in desired interval
    double Random();                    // Get floating point random number
    uint32_t BRandom();                 // Output random bits
-   CRandomMother(int seed) {           // Constructor
+   explicit CRandomMother(int seed) {           // Constructor
       RandomInit(seed);}
 protected:
    uint32_t x[5];                      // History buffer
diff --git a/jellyfish/raw_dumper.hpp b/jellyfish/raw_dumper.hpp
index fdc5811..3b9c8af 100644
--- a/jellyfish/raw_dumper.hpp
+++ b/jellyfish/raw_dumper.hpp
@@ -93,14 +93,20 @@ namespace jellyfish {
       SquareBinaryMatrix  hash_inverse_matrix;
 
     public:
-      query(mapped_file &map) : 
-        _file(map), _ary(0), _canonical(false), _cary_bit(false) { init(); }
-      query(std::string filename) : 
+      explicit query(mapped_file &map) : 
+        _file(map), _ary(0), _canonical(false), _cary_bit(false) { 
+        _ary = init(_file, hash_matrix, hash_inverse_matrix); 
+      }
+      explicit query(std::string filename) : 
         _file(filename.c_str()), _ary(0), _canonical(false), _cary_bit(false)
-      { init(); }
-      query(const char* filename) : 
+      { 
+        _ary = init(_file, hash_matrix, hash_inverse_matrix); 
+      }
+      explicit query(const char* filename) : 
         _file(filename), _ary(0), _canonical(false), _cary_bit(false)
-      { init(); }
+      { 
+        _ary = init(_file, hash_matrix, hash_inverse_matrix); 
+      }
 
       ~query() {
         if(_ary)
@@ -155,8 +161,10 @@ namespace jellyfish {
         }
       }
 
-    private:
-      void init() {
+      
+      static storage_t* init(mapped_file& _file, 
+                             SquareBinaryMatrix& hash_matrix,
+                             SquareBinaryMatrix& hash_inverse_matrix) {
         if(_file.length() < sizeof(struct header))
           eraise(ErrorReading) << "'" << _file.path() << "': "
                                << "File truncated";
@@ -188,7 +196,7 @@ namespace jellyfish {
                                << "' not equal to key length '" << header->key_len << "'";
         if((size_t)map & 0x7)
           map += 0x8 - ((size_t)map & 0x7); // Make sure aligned for 64bits word. TODO: use alignof?
-        _ary = new storage_t(map, header->size, header->key_len, header->val_len,
+        return new storage_t(map, header->size, header->key_len, header->val_len,
                              header->max_reprobe, jellyfish::quadratic_reprobes,
                              hash_matrix, hash_inverse_matrix);
       }
diff --git a/jellyfish/simple_circular_buffer.hpp b/jellyfish/simple_circular_buffer.hpp
new file mode 100644
index 0000000..cf1f7d3
--- /dev/null
+++ b/jellyfish/simple_circular_buffer.hpp
@@ -0,0 +1,134 @@
+/* Jellyfish
+ * Copyright (C) 2012  Genome group at University of Maryland.
+ * 
+ * This program is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License as
+ * published by the Free Software Foundation, either version 3 of the
+ * License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the GNU
+ * General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program.  If not, see <http://www.gnu.org/licenses/>.
+ */
+
+#ifndef __SIMPLE_CIRCULAR_BUFFER_H__
+#define __SIMPLE_CIRCULAR_BUFFER_H__
+
+#include <memory>
+
+namespace jellyfish {
+  namespace simple_circular_buffer {
+    
+    // T: type of element in container. D: type of derived class for
+    // CRTP. A: allocator type.
+    template<typename T, typename D>
+    class base {
+    public:
+      explicit base(T* data) :
+        data_(data), front_(0), back_(0), full_(false)
+      { }
+
+      // Return true if empty
+      bool empty() const {
+        return front_ == back_ && !full();
+      }
+      // Return true if full
+      bool full() const {
+        return full_;
+      }
+      void clear() {
+        front_ = back_;
+        full_  = false;
+      }
+      
+      // Valid only if empty() is false
+      T& front() {
+        return data_[front_];
+      }
+      // Valid only if empty() is false
+      T& back() {
+        return data_[prev_index(back_)];
+      }
+
+      // Unlike the corresponding method on list or deqeue, push_back may
+      // fail if full() is true. Then false is returned.
+      bool push_back(const T& x) {
+        if(full())
+          return false;
+        data_[back_] = x;
+        back_        = next_index(back_);
+        full_        = back_ == front_;
+        return true;
+      }
+
+      bool push_back() {
+        if(full())
+          return false;
+        back_ = next_index(back_);
+        full_ = back_ == front_;
+        return true;
+      }
+
+      // Pop an element from the front. It has no effect if empty() is true
+      void pop_front() {
+        if(empty())
+          return;
+        front_ = next_index(front_);
+        full_  = false;
+      }
+
+      int size() const {
+        if(full())
+          return static_cast<const D*>(this)->capacity();
+        int s = back_ - front_;
+        return s < 0 ? s + static_cast<const D*>(this)->capacity() : s;
+      }
+    
+    protected:
+      int next_index(int i) const { 
+        return (i + 1) % static_cast<const D*>(this)->capacity();
+      }
+      int prev_index(int i) const {
+        return i ? i - 1 : static_cast<const D*>(this)->capacity() - 1;
+      }
+      T* data() const { return data_; }
+    
+      T*   data_;
+      int  front_, back_;
+      bool full_;
+    };
+
+    template<typename T, int capa>
+    class pre_alloc : public base<T, pre_alloc<T, capa> > {
+      typedef base<T, pre_alloc<T, capa> > super;
+    public:
+      explicit pre_alloc(T* data) : super(data) { }
+      static int capacity() { return capa; }
+    };
+
+    // template<typename T, int capa, typename A = std::allocator<T> >
+    // class fixed : public base<T, fixed<T, capa, A>, A> {
+    //   typedef base<T, fixed<T, capa, A>, A> super;
+    // public:
+    //   explicit fixed(const T v = T()) : super(capa, v) { }
+    //   //    fixed(const int ignored_size, const T v = T()) : super(capa, v) { }
+
+    //   int capacity() const { return capa; }
+    // };
+
+    // template<typename T, typename A = std::allocator<T> >
+    // class dyn : public base<T, dyn<T, A>, A> {
+    //   typedef base<T, dyn<T, A>, A> super;
+    // public:
+    //   explicit dyn(int size, const T v = T()) : super(size, v), capa_(size) { }
+    
+    //   int capacity() const { return capa_; }
+    //   int capa_;
+    // };
+  }
+}
+#endif /* __SIMPLE_CIRCULAR_BUFFER_H__ */
diff --git a/jellyfish/simple_growing_array.hpp b/jellyfish/simple_growing_array.hpp
index cb1b77a..9a7f117 100644
--- a/jellyfish/simple_growing_array.hpp
+++ b/jellyfish/simple_growing_array.hpp
@@ -23,7 +23,7 @@ namespace jellyfish {
     size_t  _size;
     T      *_data;
   public:
-    simple_growing_array(size_t capacity = 100) : 
+    explicit simple_growing_array(size_t capacity = 100) : 
       _capacity(capacity / 2), _size(0), _data(0) { resize(); }
 
     virtual ~simple_growing_array() {
diff --git a/jellyfish/sorted_dumper.hpp b/jellyfish/sorted_dumper.hpp
index 1ad002b..ef34738 100644
--- a/jellyfish/sorted_dumper.hpp
+++ b/jellyfish/sorted_dumper.hpp
@@ -35,29 +35,31 @@ namespace jellyfish {
       token_ring_t::token *token;
     };
 
-    uint_t                threads;
-    std::string           file_prefix;
-    size_t                buffer_size;
-    uint_t                klen, vlen;
-    uint_t                key_len, val_len;
-    size_t                record_len, nb_records, nb_blocks;
-    storage_t            *ary;
-    int                   file_index;
-    token_ring_t          tr;
-    uint64_t              lower_count, upper_count;
-    struct thread_info_t *thread_info;
-    uint64_t volatile     unique, distinct, total, max_count;
-    std::ofstream        *out;
-    locks::pthread::mutex dump_mutex;
+    uint_t                 threads;
+    std::string            file_prefix;
+    size_t                 buffer_size;
+    uint_t                 klen, vlen;
+    uint_t                 key_len, val_len;
+    size_t                 record_len, nb_records, nb_blocks;
+    storage_t             *ary;
+    int                    file_index;
+    token_ring_t           tr;
+    uint64_t               lower_count, upper_count;
+    struct thread_info_t  *thread_info;
+    uint64_t volatile      unique, distinct, total, max_count;
+    std::ofstream         *out;
+    locks::pthread::mutex  dump_mutex;
+    bool                   one_file;
 
   public:
     // klen: key field length in bits in hash (i.e before rounding up to bytes)
     // vlen: value field length in bits
     sorted_dumper(uint_t _threads, const char *_file_prefix, size_t _buffer_size, 
-                     uint_t _vlen, storage_t *_ary) :
+                  uint_t _vlen, storage_t *_ary) :
       threads(_threads), file_prefix(_file_prefix), buffer_size(_buffer_size),
       klen(_ary->get_key_len()), vlen(_vlen), ary(_ary), file_index(0),
-      tr(), lower_count(0), upper_count((uint64_t)-1)
+      tr(), lower_count(0), upper_count(std::numeric_limits<uint64_t>::max()),
+      one_file(false)
     {
       key_len    = bits_to_bytes(klen);
       val_len    = bits_to_bytes(vlen);
@@ -83,6 +85,9 @@ namespace jellyfish {
       }
     }
     
+    bool get_one_file() const { return one_file; }
+    void set_one_file(bool nv) { one_file = nv; }
+
     void set_lower_count(uint64_t l) { lower_count = l; }
     void set_upper_count(uint64_t u) { upper_count = u; }
 
@@ -100,7 +105,11 @@ namespace jellyfish {
   void sorted_dumper<storage_t,atomic_t>::_dump() {
     std::ofstream _out;
     assert(dump_mutex.try_lock());
-    open_next_file(file_prefix.c_str(), &file_index, _out);
+    if(one_file) {
+      _out.open(file_prefix.c_str());
+    } else {
+      open_next_file(file_prefix.c_str(), &file_index, _out);
+    }
     out = &_out;
     unique = distinct = total = max_count = 0;
     tr.reset();
diff --git a/jellyfish/square_binary_matrix.cc b/jellyfish/square_binary_matrix.cc
index 03de29f..5ecab6d 100644
--- a/jellyfish/square_binary_matrix.cc
+++ b/jellyfish/square_binary_matrix.cc
@@ -15,9 +15,18 @@
 */
 
 #include <config.h>
-#include <jellyfish/square_binary_matrix.hpp>
 #include <iostream>
 #include <sstream>
+#include <jellyfish/misc.hpp>
+#include <jellyfish/square_binary_matrix.hpp>
+
+#ifndef random
+// Implement random from the old rand() function. Don't trust low bit
+// to be as random, so call rand twice and reverse one of the result.
+long random() {
+  return rand() ^ reverse_bits((uint32_t)rand());
+}
+#endif
 
 void SquareBinaryMatrix::init_random() {
   uint64_t _mask = mask();
@@ -200,16 +209,9 @@ uint64_t SquareBinaryMatrix::times_sse(uint64_t v) const {
   return res;
 }
 
-uint64_t SquareBinaryMatrix::times(uint64_t v) const {
-  return times_sse(v);
-}
-
 #else
 
 uint64_t SquareBinaryMatrix::times_sse(uint64_t v) const { return 0; }
-uint64_t SquareBinaryMatrix::times(uint64_t v) const {
-  return times_unrolled(v);
-}
 
 #endif
 
diff --git a/jellyfish/square_binary_matrix.hpp b/jellyfish/square_binary_matrix.hpp
index 55b1293..67e3f49 100644
--- a/jellyfish/square_binary_matrix.hpp
+++ b/jellyfish/square_binary_matrix.hpp
@@ -58,7 +58,7 @@ private:
 public:
   SquareBinaryMatrix() : columns(0), size(0) { }
 
-  SquareBinaryMatrix(int _size) :columns(first_alloc(_size)), size(_size) {
+  explicit SquareBinaryMatrix(int _size) :columns(first_alloc(_size)), size(_size) {
     memset(columns, '\0', sizeof(uint64_t) * _size);
   }
   SquareBinaryMatrix(const SquareBinaryMatrix &rhs) : columns(first_alloc(rhs.get_size())), size(rhs.get_size()) {
@@ -75,10 +75,10 @@ public:
     for(i = 0; i < size; i++)
       columns[i] = _columns[i] & _mask;
   }
-  SquareBinaryMatrix(const char *map) : columns(0), size(0) {
+  explicit SquareBinaryMatrix(const char *map) : columns(0), size(0) {
     read(map);
   }
-  SquareBinaryMatrix(std::istream *is) : columns(0), size(0) {
+  explicit SquareBinaryMatrix(std::istream *is) : columns(0), size(0) {
     load(is);
   }
 
@@ -163,7 +163,14 @@ public:
 
   uint64_t times_unrolled(uint64_t v) const;
   uint64_t times_sse(uint64_t v) const;
-  uint64_t times(uint64_t v) const;
+  
+  inline uint64_t times(uint64_t v) const {
+#ifdef HAVE_SSE
+    return times_sse(v);
+#else
+    return times_unrolled(v);
+#endif
+  }
 
   SquareBinaryMatrix transpose() const;
   SquareBinaryMatrix operator*(const SquareBinaryMatrix &other) const;
diff --git a/jellyfish/test_double_fifo_input.cc b/jellyfish/test_double_fifo_input.cc
index 90e8b27..a703e63 100644
--- a/jellyfish/test_double_fifo_input.cc
+++ b/jellyfish/test_double_fifo_input.cc
@@ -25,7 +25,7 @@ class display_kmer {
   unsigned long count;
 public:
   typedef unsigned long val_type;
-  display_kmer(int k) : _k(k), count(0) {}
+  explicit display_kmer(int k) : _k(k), count(0) {}
 
   void add(uint64_t mer, int i, val_type *oval = 0) {
     ++count;
diff --git a/jellyfish/time.hpp b/jellyfish/time.hpp
index 594bc1a..e490c1c 100644
--- a/jellyfish/time.hpp
+++ b/jellyfish/time.hpp
@@ -28,7 +28,7 @@ class Time {
 
  public:
   static const Time zero;
-  Time(bool init = true) {
+  explicit Time(bool init = true) {
     if(init)
       now();
   }
@@ -71,6 +71,10 @@ class Time {
     return Time(*this) += o;
   }
 
+  bool operator<(const Time& o) const {
+    return tv.tv_sec < o.tv.tv_sec || (tv.tv_sec == o.tv.tv_sec && tv.tv_usec < o.tv.tv_usec);
+  }
+
   void now() { gettimeofday(&tv, NULL); }
   Time elapsed() const {
     return Time() - *this;
diff --git a/jellyfish/yaggo.hpp b/jellyfish/yaggo.hpp
index eaa218a..9cff366 100644
--- a/jellyfish/yaggo.hpp
+++ b/jellyfish/yaggo.hpp
@@ -41,8 +41,8 @@ namespace yaggo {
   class string : public std::string {
   public:
     string() : std::string() {}
-    string(const std::string &s) : std::string(s) {}
-    string(const char *s) : std::string(s) {}
+    explicit string(const std::string &s) : std::string(s) {}
+    explicit string(const char *s) : std::string(s) {}
     int as_enum(const char* const strs[]);
 
     uint32_t as_uint32_suffix() const { return as_uint32(true); }
diff --git a/ltmain.sh b/ltmain.sh
old mode 100755
new mode 100644
index a72f2fd..63ae69d
--- a/ltmain.sh
+++ b/ltmain.sh
@@ -1,9 +1,9 @@
-# Generated from ltmain.m4sh.
 
-# ltmain.sh (GNU libtool) 2.2.6b
+# libtool (GNU libtool) 2.4.2
 # Written by Gordon Matzigkeit <gord at gnu.ai.mit.edu>, 1996
 
-# Copyright (C) 1996, 1997, 1998, 1999, 2000, 2001, 2003, 2004, 2005, 2006, 2007 2008 Free Software Foundation, Inc.
+# Copyright (C) 1996, 1997, 1998, 1999, 2000, 2001, 2003, 2004, 2005, 2006,
+# 2007, 2008, 2009, 2010, 2011 Free Software Foundation, Inc.
 # This is free software; see the source for copying conditions.  There is NO
 # warranty; not even for MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.
 
@@ -32,50 +32,57 @@
 #
 # Provide generalized library-building support services.
 #
-#     --config             show all configuration variables
-#     --debug              enable verbose shell tracing
-# -n, --dry-run            display commands without modifying any files
-#     --features           display basic configuration information and exit
-#     --mode=MODE          use operation mode MODE
-#     --preserve-dup-deps  don't remove duplicate dependency libraries
-#     --quiet, --silent    don't print informational messages
-#     --tag=TAG            use configuration variables from tag TAG
-# -v, --verbose            print informational messages (default)
-#     --version            print version information
-# -h, --help               print short or long help message
+#       --config             show all configuration variables
+#       --debug              enable verbose shell tracing
+#   -n, --dry-run            display commands without modifying any files
+#       --features           display basic configuration information and exit
+#       --mode=MODE          use operation mode MODE
+#       --preserve-dup-deps  don't remove duplicate dependency libraries
+#       --quiet, --silent    don't print informational messages
+#       --no-quiet, --no-silent
+#                            print informational messages (default)
+#       --no-warn            don't display warning messages
+#       --tag=TAG            use configuration variables from tag TAG
+#   -v, --verbose            print more informational messages than default
+#       --no-verbose         don't print the extra informational messages
+#       --version            print version information
+#   -h, --help, --help-all   print short, long, or detailed help message
 #
 # MODE must be one of the following:
 #
-#       clean              remove files from the build directory
-#       compile            compile a source file into a libtool object
-#       execute            automatically set library path, then run a program
-#       finish             complete the installation of libtool libraries
-#       install            install libraries or executables
-#       link               create a library or an executable
-#       uninstall          remove libraries from an installed directory
+#         clean              remove files from the build directory
+#         compile            compile a source file into a libtool object
+#         execute            automatically set library path, then run a program
+#         finish             complete the installation of libtool libraries
+#         install            install libraries or executables
+#         link               create a library or an executable
+#         uninstall          remove libraries from an installed directory
 #
-# MODE-ARGS vary depending on the MODE.
+# MODE-ARGS vary depending on the MODE.  When passed as first option,
+# `--mode=MODE' may be abbreviated as `MODE' or a unique abbreviation of that.
 # Try `$progname --help --mode=MODE' for a more detailed description of MODE.
 #
 # When reporting a bug, please describe a test case to reproduce it and
 # include the following information:
 #
-#       host-triplet:	$host
-#       shell:		$SHELL
-#       compiler:		$LTCC
-#       compiler flags:		$LTCFLAGS
-#       linker:		$LD (gnu? $with_gnu_ld)
-#       $progname:		(GNU libtool) 2.2.6b
-#       automake:		$automake_version
-#       autoconf:		$autoconf_version
+#         host-triplet:	$host
+#         shell:		$SHELL
+#         compiler:		$LTCC
+#         compiler flags:		$LTCFLAGS
+#         linker:		$LD (gnu? $with_gnu_ld)
+#         $progname:	(GNU libtool) 2.4.2
+#         automake:	$automake_version
+#         autoconf:	$autoconf_version
 #
 # Report bugs to <bug-libtool at gnu.org>.
+# GNU libtool home page: <http://www.gnu.org/software/libtool/>.
+# General help using GNU software: <http://www.gnu.org/gethelp/>.
 
-PROGRAM=ltmain.sh
+PROGRAM=libtool
 PACKAGE=libtool
-VERSION=2.2.6b
+VERSION=2.4.2
 TIMESTAMP=""
-package_revision=1.3017
+package_revision=1.3337
 
 # Be Bourne compatible
 if test -n "${ZSH_VERSION+set}" && (emulate sh) >/dev/null 2>&1; then
@@ -91,10 +98,15 @@ fi
 BIN_SH=xpg4; export BIN_SH # for Tru64
 DUALCASE=1; export DUALCASE # for MKS sh
 
+# A function that is used when there is no print builtin or printf.
+func_fallback_echo ()
+{
+  eval 'cat <<_LTECHO_EOF
+$1
+_LTECHO_EOF'
+}
+
 # NLS nuisances: We save the old values to restore during execute mode.
-# Only set LANG and LC_ALL to C if already set.
-# These must not be set unconditionally because not all systems understand
-# e.g. LANG=C (notably SCO).
 lt_user_locale=
 lt_safe_locale=
 for lt_var in LANG LANGUAGE LC_ALL LC_CTYPE LC_COLLATE LC_MESSAGES
@@ -107,24 +119,28 @@ do
 	  lt_safe_locale=\"$lt_var=C; \$lt_safe_locale\"
 	fi"
 done
+LC_ALL=C
+LANGUAGE=C
+export LANGUAGE LC_ALL
 
 $lt_unset CDPATH
 
 
+# Work around backward compatibility issue on IRIX 6.5. On IRIX 6.4+, sh
+# is ksh but when the shell is invoked as "sh" and the current value of
+# the _XPG environment variable is not equal to 1 (one), the special
+# positional parameter $0, within a function call, is the name of the
+# function.
+progpath="$0"
 
 
 
 : ${CP="cp -f"}
-: ${ECHO="echo"}
-: ${EGREP="/bin/grep -E"}
-: ${FGREP="/bin/grep -F"}
-: ${GREP="/bin/grep"}
-: ${LN_S="ln -s"}
+test "${ECHO+set}" = set || ECHO=${as_echo-'printf %s\n'}
 : ${MAKE="make"}
 : ${MKDIR="mkdir"}
 : ${MV="mv -f"}
 : ${RM="rm -f"}
-: ${SED="/bin/sed"}
 : ${SHELL="${CONFIG_SHELL-/bin/sh}"}
 : ${Xsed="$SED -e 1s/^X//"}
 
@@ -144,6 +160,27 @@ IFS=" 	$lt_nl"
 dirname="s,/[^/]*$,,"
 basename="s,^.*/,,"
 
+# func_dirname file append nondir_replacement
+# Compute the dirname of FILE.  If nonempty, add APPEND to the result,
+# otherwise set result to NONDIR_REPLACEMENT.
+func_dirname ()
+{
+    func_dirname_result=`$ECHO "${1}" | $SED "$dirname"`
+    if test "X$func_dirname_result" = "X${1}"; then
+      func_dirname_result="${3}"
+    else
+      func_dirname_result="$func_dirname_result${2}"
+    fi
+} # func_dirname may be replaced by extended shell implementation
+
+
+# func_basename file
+func_basename ()
+{
+    func_basename_result=`$ECHO "${1}" | $SED "$basename"`
+} # func_basename may be replaced by extended shell implementation
+
+
 # func_dirname_and_basename file append nondir_replacement
 # perform func_basename and func_dirname in a single function
 # call:
@@ -158,33 +195,183 @@ basename="s,^.*/,,"
 # those functions but instead duplicate the functionality here.
 func_dirname_and_basename ()
 {
-  # Extract subdirectory from the argument.
-  func_dirname_result=`$ECHO "X${1}" | $Xsed -e "$dirname"`
-  if test "X$func_dirname_result" = "X${1}"; then
-    func_dirname_result="${3}"
-  else
-    func_dirname_result="$func_dirname_result${2}"
-  fi
-  func_basename_result=`$ECHO "X${1}" | $Xsed -e "$basename"`
+    # Extract subdirectory from the argument.
+    func_dirname_result=`$ECHO "${1}" | $SED -e "$dirname"`
+    if test "X$func_dirname_result" = "X${1}"; then
+      func_dirname_result="${3}"
+    else
+      func_dirname_result="$func_dirname_result${2}"
+    fi
+    func_basename_result=`$ECHO "${1}" | $SED -e "$basename"`
+} # func_dirname_and_basename may be replaced by extended shell implementation
+
+
+# func_stripname prefix suffix name
+# strip PREFIX and SUFFIX off of NAME.
+# PREFIX and SUFFIX must not contain globbing or regex special
+# characters, hashes, percent signs, but SUFFIX may contain a leading
+# dot (in which case that matches only a dot).
+# func_strip_suffix prefix name
+func_stripname ()
+{
+    case ${2} in
+      .*) func_stripname_result=`$ECHO "${3}" | $SED "s%^${1}%%; s%\\\\${2}\$%%"`;;
+      *)  func_stripname_result=`$ECHO "${3}" | $SED "s%^${1}%%; s%${2}\$%%"`;;
+    esac
+} # func_stripname may be replaced by extended shell implementation
+
+
+# These SED scripts presuppose an absolute path with a trailing slash.
+pathcar='s,^/\([^/]*\).*$,\1,'
+pathcdr='s,^/[^/]*,,'
+removedotparts=':dotsl
+		s@/\./@/@g
+		t dotsl
+		s,/\.$,/,'
+collapseslashes='s@/\{1,\}@/@g'
+finalslash='s,/*$,/,'
+
+# func_normal_abspath PATH
+# Remove doubled-up and trailing slashes, "." path components,
+# and cancel out any ".." path components in PATH after making
+# it an absolute path.
+#             value returned in "$func_normal_abspath_result"
+func_normal_abspath ()
+{
+  # Start from root dir and reassemble the path.
+  func_normal_abspath_result=
+  func_normal_abspath_tpath=$1
+  func_normal_abspath_altnamespace=
+  case $func_normal_abspath_tpath in
+    "")
+      # Empty path, that just means $cwd.
+      func_stripname '' '/' "`pwd`"
+      func_normal_abspath_result=$func_stripname_result
+      return
+    ;;
+    # The next three entries are used to spot a run of precisely
+    # two leading slashes without using negated character classes;
+    # we take advantage of case's first-match behaviour.
+    ///*)
+      # Unusual form of absolute path, do nothing.
+    ;;
+    //*)
+      # Not necessarily an ordinary path; POSIX reserves leading '//'
+      # and for example Cygwin uses it to access remote file shares
+      # over CIFS/SMB, so we conserve a leading double slash if found.
+      func_normal_abspath_altnamespace=/
+    ;;
+    /*)
+      # Absolute path, do nothing.
+    ;;
+    *)
+      # Relative path, prepend $cwd.
+      func_normal_abspath_tpath=`pwd`/$func_normal_abspath_tpath
+    ;;
+  esac
+  # Cancel out all the simple stuff to save iterations.  We also want
+  # the path to end with a slash for ease of parsing, so make sure
+  # there is one (and only one) here.
+  func_normal_abspath_tpath=`$ECHO "$func_normal_abspath_tpath" | $SED \
+        -e "$removedotparts" -e "$collapseslashes" -e "$finalslash"`
+  while :; do
+    # Processed it all yet?
+    if test "$func_normal_abspath_tpath" = / ; then
+      # If we ascended to the root using ".." the result may be empty now.
+      if test -z "$func_normal_abspath_result" ; then
+        func_normal_abspath_result=/
+      fi
+      break
+    fi
+    func_normal_abspath_tcomponent=`$ECHO "$func_normal_abspath_tpath" | $SED \
+        -e "$pathcar"`
+    func_normal_abspath_tpath=`$ECHO "$func_normal_abspath_tpath" | $SED \
+        -e "$pathcdr"`
+    # Figure out what to do with it
+    case $func_normal_abspath_tcomponent in
+      "")
+        # Trailing empty path component, ignore it.
+      ;;
+      ..)
+        # Parent dir; strip last assembled component from result.
+        func_dirname "$func_normal_abspath_result"
+        func_normal_abspath_result=$func_dirname_result
+      ;;
+      *)
+        # Actual path component, append it.
+        func_normal_abspath_result=$func_normal_abspath_result/$func_normal_abspath_tcomponent
+      ;;
+    esac
+  done
+  # Restore leading double-slash if one was found on entry.
+  func_normal_abspath_result=$func_normal_abspath_altnamespace$func_normal_abspath_result
 }
 
-# Generated shell functions inserted here.
+# func_relative_path SRCDIR DSTDIR
+# generates a relative path from SRCDIR to DSTDIR, with a trailing
+# slash if non-empty, suitable for immediately appending a filename
+# without needing to append a separator.
+#             value returned in "$func_relative_path_result"
+func_relative_path ()
+{
+  func_relative_path_result=
+  func_normal_abspath "$1"
+  func_relative_path_tlibdir=$func_normal_abspath_result
+  func_normal_abspath "$2"
+  func_relative_path_tbindir=$func_normal_abspath_result
+
+  # Ascend the tree starting from libdir
+  while :; do
+    # check if we have found a prefix of bindir
+    case $func_relative_path_tbindir in
+      $func_relative_path_tlibdir)
+        # found an exact match
+        func_relative_path_tcancelled=
+        break
+        ;;
+      $func_relative_path_tlibdir*)
+        # found a matching prefix
+        func_stripname "$func_relative_path_tlibdir" '' "$func_relative_path_tbindir"
+        func_relative_path_tcancelled=$func_stripname_result
+        if test -z "$func_relative_path_result"; then
+          func_relative_path_result=.
+        fi
+        break
+        ;;
+      *)
+        func_dirname $func_relative_path_tlibdir
+        func_relative_path_tlibdir=${func_dirname_result}
+        if test "x$func_relative_path_tlibdir" = x ; then
+          # Have to descend all the way to the root!
+          func_relative_path_result=../$func_relative_path_result
+          func_relative_path_tcancelled=$func_relative_path_tbindir
+          break
+        fi
+        func_relative_path_result=../$func_relative_path_result
+        ;;
+    esac
+  done
 
-# Work around backward compatibility issue on IRIX 6.5. On IRIX 6.4+, sh
-# is ksh but when the shell is invoked as "sh" and the current value of
-# the _XPG environment variable is not equal to 1 (one), the special
-# positional parameter $0, within a function call, is the name of the
-# function.
-progpath="$0"
+  # Now calculate path; take care to avoid doubling-up slashes.
+  func_stripname '' '/' "$func_relative_path_result"
+  func_relative_path_result=$func_stripname_result
+  func_stripname '/' '/' "$func_relative_path_tcancelled"
+  if test "x$func_stripname_result" != x ; then
+    func_relative_path_result=${func_relative_path_result}/${func_stripname_result}
+  fi
+
+  # Normalisation. If bindir is libdir, return empty string,
+  # else relative path ending with a slash; either way, target
+  # file name can be directly appended.
+  if test ! -z "$func_relative_path_result"; then
+    func_stripname './' '' "$func_relative_path_result/"
+    func_relative_path_result=$func_stripname_result
+  fi
+}
 
 # The name of this program:
-# In the unlikely event $progname began with a '-', it would play havoc with
-# func_echo (imagine progname=-n), so we prepend ./ in that case:
 func_dirname_and_basename "$progpath"
 progname=$func_basename_result
-case $progname in
-  -*) progname=./$progname ;;
-esac
 
 # Make sure we have an absolute path for reexecution:
 case $progpath in
@@ -196,7 +383,7 @@ case $progpath in
      ;;
   *)
      save_IFS="$IFS"
-     IFS=:
+     IFS=${PATH_SEPARATOR-:}
      for progdir in $PATH; do
        IFS="$save_IFS"
        test -x "$progdir/$progname" && break
@@ -215,6 +402,15 @@ sed_quote_subst='s/\([`"$\\]\)/\\\1/g'
 # Same as above, but do not quote variable references.
 double_quote_subst='s/\(["`\\]\)/\\\1/g'
 
+# Sed substitution that turns a string into a regex matching for the
+# string literally.
+sed_make_literal_regex='s,[].[^$\\*\/],\\&,g'
+
+# Sed substitution that converts a w32 file name or path
+# which contains forward slashes, into one that contains
+# (escaped) backslashes.  A very naive implementation.
+lt_sed_naive_backslashify='s|\\\\*|\\|g;s|/|\\|g;s|\\|\\\\|g'
+
 # Re-`\' parameter expansions in output of double_quote_subst that were
 # `\'-ed in input to the same.  If an odd number of `\' preceded a '$'
 # in input to double_quote_subst, that '$' was protected from expansion.
@@ -243,7 +439,7 @@ opt_warning=:
 # name if it has been set yet.
 func_echo ()
 {
-    $ECHO "$progname${mode+: }$mode: $*"
+    $ECHO "$progname: ${opt_mode+$opt_mode: }$*"
 }
 
 # func_verbose arg...
@@ -258,18 +454,25 @@ func_verbose ()
     :
 }
 
+# func_echo_all arg...
+# Invoke $ECHO with all args, space-separated.
+func_echo_all ()
+{
+    $ECHO "$*"
+}
+
 # func_error arg...
 # Echo program name prefixed message to standard error.
 func_error ()
 {
-    $ECHO "$progname${mode+: }$mode: "${1+"$@"} 1>&2
+    $ECHO "$progname: ${opt_mode+$opt_mode: }"${1+"$@"} 1>&2
 }
 
 # func_warning arg...
 # Echo program name prefixed warning message to standard error.
 func_warning ()
 {
-    $opt_warning && $ECHO "$progname${mode+: }$mode: warning: "${1+"$@"} 1>&2
+    $opt_warning && $ECHO "$progname: ${opt_mode+$opt_mode: }warning: "${1+"$@"} 1>&2
 
     # bash bug again:
     :
@@ -326,9 +529,9 @@ func_mkdir_p ()
         case $my_directory_path in */*) ;; *) break ;; esac
 
         # ...otherwise throw away the child directory and loop
-        my_directory_path=`$ECHO "X$my_directory_path" | $Xsed -e "$dirname"`
+        my_directory_path=`$ECHO "$my_directory_path" | $SED -e "$dirname"`
       done
-      my_dir_list=`$ECHO "X$my_dir_list" | $Xsed -e 's,:*$,,'`
+      my_dir_list=`$ECHO "$my_dir_list" | $SED 's,:*$,,'`
 
       save_mkdir_p_IFS="$IFS"; IFS=':'
       for my_dir in $my_dir_list; do
@@ -378,7 +581,7 @@ func_mktempdir ()
         func_fatal_error "cannot create temporary directory \`$my_tmpdir'"
     fi
 
-    $ECHO "X$my_tmpdir" | $Xsed
+    $ECHO "$my_tmpdir"
 }
 
 
@@ -392,7 +595,7 @@ func_quote_for_eval ()
 {
     case $1 in
       *[\\\`\"\$]*)
-	func_quote_for_eval_unquoted_result=`$ECHO "X$1" | $Xsed -e "$sed_quote_subst"` ;;
+	func_quote_for_eval_unquoted_result=`$ECHO "$1" | $SED "$sed_quote_subst"` ;;
       *)
         func_quote_for_eval_unquoted_result="$1" ;;
     esac
@@ -419,7 +622,7 @@ func_quote_for_expand ()
 {
     case $1 in
       *[\\\`\"]*)
-	my_arg=`$ECHO "X$1" | $Xsed \
+	my_arg=`$ECHO "$1" | $SED \
 	    -e "$double_quote_subst" -e "$sed_double_backslash"` ;;
       *)
         my_arg="$1" ;;
@@ -488,15 +691,39 @@ func_show_eval_locale ()
     fi
 }
 
-
-
+# func_tr_sh
+# Turn $1 into a string suitable for a shell variable name.
+# Result is stored in $func_tr_sh_result.  All characters
+# not in the set a-zA-Z0-9_ are replaced with '_'. Further,
+# if $1 begins with a digit, a '_' is prepended as well.
+func_tr_sh ()
+{
+  case $1 in
+  [0-9]* | *[!a-zA-Z0-9_]*)
+    func_tr_sh_result=`$ECHO "$1" | $SED 's/^\([0-9]\)/_\1/; s/[^a-zA-Z0-9_]/_/g'`
+    ;;
+  * )
+    func_tr_sh_result=$1
+    ;;
+  esac
+}
 
 
 # func_version
 # Echo version message to standard output and exit.
 func_version ()
 {
-    $SED -n '/^# '$PROGRAM' (GNU /,/# warranty; / {
+    $opt_debug
+
+    $SED -n '/(C)/!b go
+	:more
+	/\./!{
+	  N
+	  s/\n# / /
+	  b more
+	}
+	:go
+	/^# '$PROGRAM' (GNU /,/# warranty; / {
         s/^# //
 	s/^# *$//
         s/\((C)\)[ 0-9,-]*\( [1-9][0-9]*\)/\1\2/
@@ -509,22 +736,28 @@ func_version ()
 # Echo short help message to standard output and exit.
 func_usage ()
 {
-    $SED -n '/^# Usage:/,/# -h/ {
+    $opt_debug
+
+    $SED -n '/^# Usage:/,/^#  *.*--help/ {
         s/^# //
 	s/^# *$//
 	s/\$progname/'$progname'/
 	p
     }' < "$progpath"
-    $ECHO
+    echo
     $ECHO "run \`$progname --help | more' for full usage"
     exit $?
 }
 
-# func_help
-# Echo long help message to standard output and exit.
+# func_help [NOEXIT]
+# Echo long help message to standard output and exit,
+# unless 'noexit' is passed as argument.
 func_help ()
 {
+    $opt_debug
+
     $SED -n '/^# Usage:/,/# Report bugs to/ {
+	:print
         s/^# //
 	s/^# *$//
 	s*\$progname*'$progname'*
@@ -534,11 +767,18 @@ func_help ()
 	s*\$LTCFLAGS*'"$LTCFLAGS"'*
 	s*\$LD*'"$LD"'*
 	s/\$with_gnu_ld/'"$with_gnu_ld"'/
-	s/\$automake_version/'"`(automake --version) 2>/dev/null |$SED 1q`"'/
-	s/\$autoconf_version/'"`(autoconf --version) 2>/dev/null |$SED 1q`"'/
+	s/\$automake_version/'"`(${AUTOMAKE-automake} --version) 2>/dev/null |$SED 1q`"'/
+	s/\$autoconf_version/'"`(${AUTOCONF-autoconf} --version) 2>/dev/null |$SED 1q`"'/
 	p
-     }' < "$progpath"
-    exit $?
+	d
+     }
+     /^# .* home page:/b print
+     /^# General help using/b print
+     ' < "$progpath"
+    ret=$?
+    if test -z "$1"; then
+      exit $ret
+    fi
 }
 
 # func_missing_arg argname
@@ -546,63 +786,106 @@ func_help ()
 # exit_cmd.
 func_missing_arg ()
 {
-    func_error "missing argument for $1"
+    $opt_debug
+
+    func_error "missing argument for $1."
     exit_cmd=exit
 }
 
-exit_cmd=:
 
+# func_split_short_opt shortopt
+# Set func_split_short_opt_name and func_split_short_opt_arg shell
+# variables after splitting SHORTOPT after the 2nd character.
+func_split_short_opt ()
+{
+    my_sed_short_opt='1s/^\(..\).*$/\1/;q'
+    my_sed_short_rest='1s/^..\(.*\)$/\1/;q'
 
+    func_split_short_opt_name=`$ECHO "$1" | $SED "$my_sed_short_opt"`
+    func_split_short_opt_arg=`$ECHO "$1" | $SED "$my_sed_short_rest"`
+} # func_split_short_opt may be replaced by extended shell implementation
+
+
+# func_split_long_opt longopt
+# Set func_split_long_opt_name and func_split_long_opt_arg shell
+# variables after splitting LONGOPT at the `=' sign.
+func_split_long_opt ()
+{
+    my_sed_long_opt='1s/^\(--[^=]*\)=.*/\1/;q'
+    my_sed_long_arg='1s/^--[^=]*=//'
+
+    func_split_long_opt_name=`$ECHO "$1" | $SED "$my_sed_long_opt"`
+    func_split_long_opt_arg=`$ECHO "$1" | $SED "$my_sed_long_arg"`
+} # func_split_long_opt may be replaced by extended shell implementation
+
+exit_cmd=:
 
 
 
-# Check that we have a working $ECHO.
-if test "X$1" = X--no-reexec; then
-  # Discard the --no-reexec flag, and continue.
-  shift
-elif test "X$1" = X--fallback-echo; then
-  # Avoid inline document here, it may be left over
-  :
-elif test "X`{ $ECHO '\t'; } 2>/dev/null`" = 'X\t'; then
-  # Yippee, $ECHO works!
-  :
-else
-  # Restart under the correct shell, and then maybe $ECHO will work.
-  exec $SHELL "$progpath" --no-reexec ${1+"$@"}
-fi
 
-if test "X$1" = X--fallback-echo; then
-  # used as fallback echo
-  shift
-  cat <<EOF
-$*
-EOF
-  exit $EXIT_SUCCESS
-fi
 
 magic="%%%MAGIC variable%%%"
 magic_exe="%%%MAGIC EXE variable%%%"
 
 # Global variables.
-# $mode is unset
 nonopt=
-execute_dlfiles=
 preserve_args=
 lo2o="s/\\.lo\$/.${objext}/"
 o2lo="s/\\.${objext}\$/.lo/"
 extracted_archives=
 extracted_serial=0
 
-opt_dry_run=false
-opt_duplicate_deps=false
-opt_silent=false
-opt_debug=:
-
 # If this variable is set in any of the actions, the command in it
 # will be execed at the end.  This prevents here-documents from being
 # left over by shells.
 exec_cmd=
 
+# func_append var value
+# Append VALUE to the end of shell variable VAR.
+func_append ()
+{
+    eval "${1}=\$${1}\${2}"
+} # func_append may be replaced by extended shell implementation
+
+# func_append_quoted var value
+# Quote VALUE and append to the end of shell variable VAR, separated
+# by a space.
+func_append_quoted ()
+{
+    func_quote_for_eval "${2}"
+    eval "${1}=\$${1}\\ \$func_quote_for_eval_result"
+} # func_append_quoted may be replaced by extended shell implementation
+
+
+# func_arith arithmetic-term...
+func_arith ()
+{
+    func_arith_result=`expr "${@}"`
+} # func_arith may be replaced by extended shell implementation
+
+
+# func_len string
+# STRING may not start with a hyphen.
+func_len ()
+{
+    func_len_result=`expr "${1}" : ".*" 2>/dev/null || echo $max_cmd_len`
+} # func_len may be replaced by extended shell implementation
+
+
+# func_lo2o object
+func_lo2o ()
+{
+    func_lo2o_result=`$ECHO "${1}" | $SED "$lo2o"`
+} # func_lo2o may be replaced by extended shell implementation
+
+
+# func_xform libobj-or-source
+func_xform ()
+{
+    func_xform_result=`$ECHO "${1}" | $SED 's/\.[^.]*$/.lo/'`
+} # func_xform may be replaced by extended shell implementation
+
+
 # func_fatal_configuration arg...
 # Echo program name prefixed message to standard error, followed by
 # a configuration failure hint, and exit.
@@ -636,16 +919,16 @@ func_config ()
 # Display the features supported by this script.
 func_features ()
 {
-    $ECHO "host: $host"
+    echo "host: $host"
     if test "$build_libtool_libs" = yes; then
-      $ECHO "enable shared libraries"
+      echo "enable shared libraries"
     else
-      $ECHO "disable shared libraries"
+      echo "disable shared libraries"
     fi
     if test "$build_old_libs" = yes; then
-      $ECHO "enable static libraries"
+      echo "enable static libraries"
     else
-      $ECHO "disable static libraries"
+      echo "disable static libraries"
     fi
 
     exit $?
@@ -692,117 +975,209 @@ func_enable_tag ()
   esac
 }
 
-# Parse options once, thoroughly.  This comes as soon as possible in
-# the script to make things like `libtool --version' happen quickly.
+# func_check_version_match
+# Ensure that we are using m4 macros, and libtool script from the same
+# release of libtool.
+func_check_version_match ()
 {
+  if test "$package_revision" != "$macro_revision"; then
+    if test "$VERSION" != "$macro_version"; then
+      if test -z "$macro_version"; then
+        cat >&2 <<_LT_EOF
+$progname: Version mismatch error.  This is $PACKAGE $VERSION, but the
+$progname: definition of this LT_INIT comes from an older release.
+$progname: You should recreate aclocal.m4 with macros from $PACKAGE $VERSION
+$progname: and run autoconf again.
+_LT_EOF
+      else
+        cat >&2 <<_LT_EOF
+$progname: Version mismatch error.  This is $PACKAGE $VERSION, but the
+$progname: definition of this LT_INIT comes from $PACKAGE $macro_version.
+$progname: You should recreate aclocal.m4 with macros from $PACKAGE $VERSION
+$progname: and run autoconf again.
+_LT_EOF
+      fi
+    else
+      cat >&2 <<_LT_EOF
+$progname: Version mismatch error.  This is $PACKAGE $VERSION, revision $package_revision,
+$progname: but the definition of this LT_INIT comes from revision $macro_revision.
+$progname: You should recreate aclocal.m4 with macros from revision $package_revision
+$progname: of $PACKAGE $VERSION and run autoconf again.
+_LT_EOF
+    fi
+
+    exit $EXIT_MISMATCH
+  fi
+}
+
+
+# Shorthand for --mode=foo, only valid as the first argument
+case $1 in
+clean|clea|cle|cl)
+  shift; set dummy --mode clean ${1+"$@"}; shift
+  ;;
+compile|compil|compi|comp|com|co|c)
+  shift; set dummy --mode compile ${1+"$@"}; shift
+  ;;
+execute|execut|execu|exec|exe|ex|e)
+  shift; set dummy --mode execute ${1+"$@"}; shift
+  ;;
+finish|finis|fini|fin|fi|f)
+  shift; set dummy --mode finish ${1+"$@"}; shift
+  ;;
+install|instal|insta|inst|ins|in|i)
+  shift; set dummy --mode install ${1+"$@"}; shift
+  ;;
+link|lin|li|l)
+  shift; set dummy --mode link ${1+"$@"}; shift
+  ;;
+uninstall|uninstal|uninsta|uninst|unins|unin|uni|un|u)
+  shift; set dummy --mode uninstall ${1+"$@"}; shift
+  ;;
+esac
+
+
+
+# Option defaults:
+opt_debug=:
+opt_dry_run=false
+opt_config=false
+opt_preserve_dup_deps=false
+opt_features=false
+opt_finish=false
+opt_help=false
+opt_help_all=false
+opt_silent=:
+opt_warning=:
+opt_verbose=:
+opt_silent=false
+opt_verbose=false
 
-  # Shorthand for --mode=foo, only valid as the first argument
-  case $1 in
-  clean|clea|cle|cl)
-    shift; set dummy --mode clean ${1+"$@"}; shift
-    ;;
-  compile|compil|compi|comp|com|co|c)
-    shift; set dummy --mode compile ${1+"$@"}; shift
-    ;;
-  execute|execut|execu|exec|exe|ex|e)
-    shift; set dummy --mode execute ${1+"$@"}; shift
-    ;;
-  finish|finis|fini|fin|fi|f)
-    shift; set dummy --mode finish ${1+"$@"}; shift
-    ;;
-  install|instal|insta|inst|ins|in|i)
-    shift; set dummy --mode install ${1+"$@"}; shift
-    ;;
-  link|lin|li|l)
-    shift; set dummy --mode link ${1+"$@"}; shift
-    ;;
-  uninstall|uninstal|uninsta|uninst|unins|unin|uni|un|u)
-    shift; set dummy --mode uninstall ${1+"$@"}; shift
-    ;;
-  esac
 
-  # Parse non-mode specific arguments:
-  while test "$#" -gt 0; do
+# Parse options once, thoroughly.  This comes as soon as possible in the
+# script to make things like `--version' happen as quickly as we can.
+{
+  # this just eases exit handling
+  while test $# -gt 0; do
     opt="$1"
     shift
-
     case $opt in
-      --config)		func_config					;;
-
-      --debug)		preserve_args="$preserve_args $opt"
+      --debug|-x)	opt_debug='set -x'
 			func_echo "enabling shell trace mode"
-			opt_debug='set -x'
 			$opt_debug
 			;;
-
-      -dlopen)		test "$#" -eq 0 && func_missing_arg "$opt" && break
-			execute_dlfiles="$execute_dlfiles $1"
-			shift
+      --dry-run|--dryrun|-n)
+			opt_dry_run=:
 			;;
-
-      --dry-run | -n)	opt_dry_run=:					;;
-      --features)       func_features					;;
-      --finish)		mode="finish"					;;
-
-      --mode)		test "$#" -eq 0 && func_missing_arg "$opt" && break
-			case $1 in
-			  # Valid mode arguments:
-			  clean)	;;
-			  compile)	;;
-			  execute)	;;
-			  finish)	;;
-			  install)	;;
-			  link)		;;
-			  relink)	;;
-			  uninstall)	;;
-
-			  # Catch anything else as an error
-			  *) func_error "invalid argument for $opt"
-			     exit_cmd=exit
-			     break
-			     ;;
-		        esac
-
-			mode="$1"
+      --config)
+			opt_config=:
+func_config
+			;;
+      --dlopen|-dlopen)
+			optarg="$1"
+			opt_dlopen="${opt_dlopen+$opt_dlopen
+}$optarg"
 			shift
 			;;
-
       --preserve-dup-deps)
-			opt_duplicate_deps=:				;;
-
-      --quiet|--silent)	preserve_args="$preserve_args $opt"
-			opt_silent=:
+			opt_preserve_dup_deps=:
 			;;
-
-      --verbose| -v)	preserve_args="$preserve_args $opt"
+      --features)
+			opt_features=:
+func_features
+			;;
+      --finish)
+			opt_finish=:
+set dummy --mode finish ${1+"$@"}; shift
+			;;
+      --help)
+			opt_help=:
+			;;
+      --help-all)
+			opt_help_all=:
+opt_help=': help-all'
+			;;
+      --mode)
+			test $# = 0 && func_missing_arg $opt && break
+			optarg="$1"
+			opt_mode="$optarg"
+case $optarg in
+  # Valid mode arguments:
+  clean|compile|execute|finish|install|link|relink|uninstall) ;;
+
+  # Catch anything else as an error
+  *) func_error "invalid argument for $opt"
+     exit_cmd=exit
+     break
+     ;;
+esac
+			shift
+			;;
+      --no-silent|--no-quiet)
 			opt_silent=false
+func_append preserve_args " $opt"
 			;;
-
-      --tag)		test "$#" -eq 0 && func_missing_arg "$opt" && break
-			preserve_args="$preserve_args $opt $1"
-			func_enable_tag "$1"	# tagname is set here
+      --no-warning|--no-warn)
+			opt_warning=false
+func_append preserve_args " $opt"
+			;;
+      --no-verbose)
+			opt_verbose=false
+func_append preserve_args " $opt"
+			;;
+      --silent|--quiet)
+			opt_silent=:
+func_append preserve_args " $opt"
+        opt_verbose=false
+			;;
+      --verbose|-v)
+			opt_verbose=:
+func_append preserve_args " $opt"
+opt_silent=false
+			;;
+      --tag)
+			test $# = 0 && func_missing_arg $opt && break
+			optarg="$1"
+			opt_tag="$optarg"
+func_append preserve_args " $opt $optarg"
+func_enable_tag "$optarg"
 			shift
 			;;
 
+      -\?|-h)		func_usage				;;
+      --help)		func_help				;;
+      --version)	func_version				;;
+
       # Separate optargs to long options:
-      -dlopen=*|--mode=*|--tag=*)
-			func_opt_split "$opt"
-			set dummy "$func_opt_split_opt" "$func_opt_split_arg" ${1+"$@"}
+      --*=*)
+			func_split_long_opt "$opt"
+			set dummy "$func_split_long_opt_name" "$func_split_long_opt_arg" ${1+"$@"}
 			shift
 			;;
 
-      -\?|-h)		func_usage					;;
-      --help)		opt_help=:					;;
-      --version)	func_version					;;
-
-      -*)		func_fatal_help "unrecognized option \`$opt'"	;;
-
-      *)		nonopt="$opt"
-			break
+      # Separate non-argument short options:
+      -\?*|-h*|-n*|-v*)
+			func_split_short_opt "$opt"
+			set dummy "$func_split_short_opt_name" "-$func_split_short_opt_arg" ${1+"$@"}
+			shift
 			;;
+
+      --)		break					;;
+      -*)		func_fatal_help "unrecognized option \`$opt'" ;;
+      *)		set dummy "$opt" ${1+"$@"};	shift; break  ;;
     esac
   done
 
+  # Validate options:
+
+  # save first non-option argument
+  if test "$#" -gt 0; then
+    nonopt="$opt"
+    shift
+  fi
+
+  # preserve --debug
+  test "$opt_debug" = : || func_append preserve_args " --debug"
 
   case $host in
     *cygwin* | *mingw* | *pw32* | *cegcc*)
@@ -810,82 +1185,44 @@ func_enable_tag ()
       opt_duplicate_compiler_generated_deps=:
       ;;
     *)
-      opt_duplicate_compiler_generated_deps=$opt_duplicate_deps
+      opt_duplicate_compiler_generated_deps=$opt_preserve_dup_deps
       ;;
   esac
 
-  # Having warned about all mis-specified options, bail out if
-  # anything was wrong.
-  $exit_cmd $EXIT_FAILURE
-}
+  $opt_help || {
+    # Sanity checks first:
+    func_check_version_match
 
-# func_check_version_match
-# Ensure that we are using m4 macros, and libtool script from the same
-# release of libtool.
-func_check_version_match ()
-{
-  if test "$package_revision" != "$macro_revision"; then
-    if test "$VERSION" != "$macro_version"; then
-      if test -z "$macro_version"; then
-        cat >&2 <<_LT_EOF
-$progname: Version mismatch error.  This is $PACKAGE $VERSION, but the
-$progname: definition of this LT_INIT comes from an older release.
-$progname: You should recreate aclocal.m4 with macros from $PACKAGE $VERSION
-$progname: and run autoconf again.
-_LT_EOF
-      else
-        cat >&2 <<_LT_EOF
-$progname: Version mismatch error.  This is $PACKAGE $VERSION, but the
-$progname: definition of this LT_INIT comes from $PACKAGE $macro_version.
-$progname: You should recreate aclocal.m4 with macros from $PACKAGE $VERSION
-$progname: and run autoconf again.
-_LT_EOF
-      fi
-    else
-      cat >&2 <<_LT_EOF
-$progname: Version mismatch error.  This is $PACKAGE $VERSION, revision $package_revision,
-$progname: but the definition of this LT_INIT comes from revision $macro_revision.
-$progname: You should recreate aclocal.m4 with macros from revision $package_revision
-$progname: of $PACKAGE $VERSION and run autoconf again.
-_LT_EOF
+    if test "$build_libtool_libs" != yes && test "$build_old_libs" != yes; then
+      func_fatal_configuration "not configured to build any kind of library"
     fi
 
-    exit $EXIT_MISMATCH
-  fi
-}
-
-
-## ----------- ##
-##    Main.    ##
-## ----------- ##
-
-$opt_help || {
-  # Sanity checks first:
-  func_check_version_match
+    # Darwin sucks
+    eval std_shrext=\"$shrext_cmds\"
 
-  if test "$build_libtool_libs" != yes && test "$build_old_libs" != yes; then
-    func_fatal_configuration "not configured to build any kind of library"
-  fi
+    # Only execute mode is allowed to have -dlopen flags.
+    if test -n "$opt_dlopen" && test "$opt_mode" != execute; then
+      func_error "unrecognized option \`-dlopen'"
+      $ECHO "$help" 1>&2
+      exit $EXIT_FAILURE
+    fi
 
-  test -z "$mode" && func_fatal_error "error: you must specify a MODE."
+    # Change the help message to a mode-specific one.
+    generic_help="$help"
+    help="Try \`$progname --help --mode=$opt_mode' for more information."
+  }
 
 
-  # Darwin sucks
-  eval std_shrext=\"$shrext_cmds\"
+  # Bail if the options were screwed
+  $exit_cmd $EXIT_FAILURE
+}
 
 
-  # Only execute mode is allowed to have -dlopen flags.
-  if test -n "$execute_dlfiles" && test "$mode" != execute; then
-    func_error "unrecognized option \`-dlopen'"
-    $ECHO "$help" 1>&2
-    exit $EXIT_FAILURE
-  fi
 
-  # Change the help message to a mode-specific one.
-  generic_help="$help"
-  help="Try \`$progname --help --mode=$mode' for more information."
-}
 
+## ----------- ##
+##    Main.    ##
+## ----------- ##
 
 # func_lalib_p file
 # True iff FILE is a libtool `.la' library or `.lo' object file.
@@ -950,12 +1287,9 @@ func_ltwrapper_executable_p ()
 # temporary ltwrapper_script.
 func_ltwrapper_scriptname ()
 {
-    func_ltwrapper_scriptname_result=""
-    if func_ltwrapper_executable_p "$1"; then
-	func_dirname_and_basename "$1" "" "."
-	func_stripname '' '.exe' "$func_basename_result"
-	func_ltwrapper_scriptname_result="$func_dirname_result/$objdir/${func_stripname_result}_ltshwrapper"
-    fi
+    func_dirname_and_basename "$1" "" "."
+    func_stripname '' '.exe' "$func_basename_result"
+    func_ltwrapper_scriptname_result="$func_dirname_result/$objdir/${func_stripname_result}_ltshwrapper"
 }
 
 # func_ltwrapper_p file
@@ -1001,6 +1335,37 @@ func_source ()
 }
 
 
+# func_resolve_sysroot PATH
+# Replace a leading = in PATH with a sysroot.  Store the result into
+# func_resolve_sysroot_result
+func_resolve_sysroot ()
+{
+  func_resolve_sysroot_result=$1
+  case $func_resolve_sysroot_result in
+  =*)
+    func_stripname '=' '' "$func_resolve_sysroot_result"
+    func_resolve_sysroot_result=$lt_sysroot$func_stripname_result
+    ;;
+  esac
+}
+
+# func_replace_sysroot PATH
+# If PATH begins with the sysroot, replace it with = and
+# store the result into func_replace_sysroot_result.
+func_replace_sysroot ()
+{
+  case "$lt_sysroot:$1" in
+  ?*:"$lt_sysroot"*)
+    func_stripname "$lt_sysroot" '' "$1"
+    func_replace_sysroot_result="=$func_stripname_result"
+    ;;
+  *)
+    # Including no sysroot.
+    func_replace_sysroot_result=$1
+    ;;
+  esac
+}
+
 # func_infer_tag arg
 # Infer tagged configuration to use if any are available and
 # if one wasn't chosen via the "--tag" command line option.
@@ -1013,13 +1378,15 @@ func_infer_tag ()
     if test -n "$available_tags" && test -z "$tagname"; then
       CC_quoted=
       for arg in $CC; do
-        func_quote_for_eval "$arg"
-	CC_quoted="$CC_quoted $func_quote_for_eval_result"
+	func_append_quoted CC_quoted "$arg"
       done
+      CC_expanded=`func_echo_all $CC`
+      CC_quoted_expanded=`func_echo_all $CC_quoted`
       case $@ in
       # Blanks in the command may have been stripped by the calling shell,
       # but not from the CC environment variable when configure was run.
-      " $CC "* | "$CC "* | " `$ECHO $CC` "* | "`$ECHO $CC` "* | " $CC_quoted"* | "$CC_quoted "* | " `$ECHO $CC_quoted` "* | "`$ECHO $CC_quoted` "*) ;;
+      " $CC "* | "$CC "* | " $CC_expanded "* | "$CC_expanded "* | \
+      " $CC_quoted"* | "$CC_quoted "* | " $CC_quoted_expanded "* | "$CC_quoted_expanded "*) ;;
       # Blanks at the start of $base_compile will cause this to fail
       # if we don't check for them as well.
       *)
@@ -1030,11 +1397,13 @@ func_infer_tag ()
 	    CC_quoted=
 	    for arg in $CC; do
 	      # Double-quote args containing other shell metacharacters.
-	      func_quote_for_eval "$arg"
-	      CC_quoted="$CC_quoted $func_quote_for_eval_result"
+	      func_append_quoted CC_quoted "$arg"
 	    done
+	    CC_expanded=`func_echo_all $CC`
+	    CC_quoted_expanded=`func_echo_all $CC_quoted`
 	    case "$@ " in
-	      " $CC "* | "$CC "* | " `$ECHO $CC` "* | "`$ECHO $CC` "* | " $CC_quoted"* | "$CC_quoted "* | " `$ECHO $CC_quoted` "* | "`$ECHO $CC_quoted` "*)
+	    " $CC "* | "$CC "* | " $CC_expanded "* | "$CC_expanded "* | \
+	    " $CC_quoted"* | "$CC_quoted "* | " $CC_quoted_expanded "* | "$CC_quoted_expanded "*)
 	      # The compiler in the base compile command matches
 	      # the one in the tagged configuration.
 	      # Assume this is the tagged configuration we want.
@@ -1097,6 +1466,486 @@ EOF
     }
 }
 
+
+##################################################
+# FILE NAME AND PATH CONVERSION HELPER FUNCTIONS #
+##################################################
+
+# func_convert_core_file_wine_to_w32 ARG
+# Helper function used by file name conversion functions when $build is *nix,
+# and $host is mingw, cygwin, or some other w32 environment. Relies on a
+# correctly configured wine environment available, with the winepath program
+# in $build's $PATH.
+#
+# ARG is the $build file name to be converted to w32 format.
+# Result is available in $func_convert_core_file_wine_to_w32_result, and will
+# be empty on error (or when ARG is empty)
+func_convert_core_file_wine_to_w32 ()
+{
+  $opt_debug
+  func_convert_core_file_wine_to_w32_result="$1"
+  if test -n "$1"; then
+    # Unfortunately, winepath does not exit with a non-zero error code, so we
+    # are forced to check the contents of stdout. On the other hand, if the
+    # command is not found, the shell will set an exit code of 127 and print
+    # *an error message* to stdout. So we must check for both error code of
+    # zero AND non-empty stdout, which explains the odd construction:
+    func_convert_core_file_wine_to_w32_tmp=`winepath -w "$1" 2>/dev/null`
+    if test "$?" -eq 0 && test -n "${func_convert_core_file_wine_to_w32_tmp}"; then
+      func_convert_core_file_wine_to_w32_result=`$ECHO "$func_convert_core_file_wine_to_w32_tmp" |
+        $SED -e "$lt_sed_naive_backslashify"`
+    else
+      func_convert_core_file_wine_to_w32_result=
+    fi
+  fi
+}
+# end: func_convert_core_file_wine_to_w32
+
+
+# func_convert_core_path_wine_to_w32 ARG
+# Helper function used by path conversion functions when $build is *nix, and
+# $host is mingw, cygwin, or some other w32 environment. Relies on a correctly
+# configured wine environment available, with the winepath program in $build's
+# $PATH. Assumes ARG has no leading or trailing path separator characters.
+#
+# ARG is path to be converted from $build format to win32.
+# Result is available in $func_convert_core_path_wine_to_w32_result.
+# Unconvertible file (directory) names in ARG are skipped; if no directory names
+# are convertible, then the result may be empty.
+func_convert_core_path_wine_to_w32 ()
+{
+  $opt_debug
+  # unfortunately, winepath doesn't convert paths, only file names
+  func_convert_core_path_wine_to_w32_result=""
+  if test -n "$1"; then
+    oldIFS=$IFS
+    IFS=:
+    for func_convert_core_path_wine_to_w32_f in $1; do
+      IFS=$oldIFS
+      func_convert_core_file_wine_to_w32 "$func_convert_core_path_wine_to_w32_f"
+      if test -n "$func_convert_core_file_wine_to_w32_result" ; then
+        if test -z "$func_convert_core_path_wine_to_w32_result"; then
+          func_convert_core_path_wine_to_w32_result="$func_convert_core_file_wine_to_w32_result"
+        else
+          func_append func_convert_core_path_wine_to_w32_result ";$func_convert_core_file_wine_to_w32_result"
+        fi
+      fi
+    done
+    IFS=$oldIFS
+  fi
+}
+# end: func_convert_core_path_wine_to_w32
+
+
+# func_cygpath ARGS...
+# Wrapper around calling the cygpath program via LT_CYGPATH. This is used when
+# when (1) $build is *nix and Cygwin is hosted via a wine environment; or (2)
+# $build is MSYS and $host is Cygwin, or (3) $build is Cygwin. In case (1) or
+# (2), returns the Cygwin file name or path in func_cygpath_result (input
+# file name or path is assumed to be in w32 format, as previously converted
+# from $build's *nix or MSYS format). In case (3), returns the w32 file name
+# or path in func_cygpath_result (input file name or path is assumed to be in
+# Cygwin format). Returns an empty string on error.
+#
+# ARGS are passed to cygpath, with the last one being the file name or path to
+# be converted.
+#
+# Specify the absolute *nix (or w32) name to cygpath in the LT_CYGPATH
+# environment variable; do not put it in $PATH.
+func_cygpath ()
+{
+  $opt_debug
+  if test -n "$LT_CYGPATH" && test -f "$LT_CYGPATH"; then
+    func_cygpath_result=`$LT_CYGPATH "$@" 2>/dev/null`
+    if test "$?" -ne 0; then
+      # on failure, ensure result is empty
+      func_cygpath_result=
+    fi
+  else
+    func_cygpath_result=
+    func_error "LT_CYGPATH is empty or specifies non-existent file: \`$LT_CYGPATH'"
+  fi
+}
+#end: func_cygpath
+
+
+# func_convert_core_msys_to_w32 ARG
+# Convert file name or path ARG from MSYS format to w32 format.  Return
+# result in func_convert_core_msys_to_w32_result.
+func_convert_core_msys_to_w32 ()
+{
+  $opt_debug
+  # awkward: cmd appends spaces to result
+  func_convert_core_msys_to_w32_result=`( cmd //c echo "$1" ) 2>/dev/null |
+    $SED -e 's/[ ]*$//' -e "$lt_sed_naive_backslashify"`
+}
+#end: func_convert_core_msys_to_w32
+
+
+# func_convert_file_check ARG1 ARG2
+# Verify that ARG1 (a file name in $build format) was converted to $host
+# format in ARG2. Otherwise, emit an error message, but continue (resetting
+# func_to_host_file_result to ARG1).
+func_convert_file_check ()
+{
+  $opt_debug
+  if test -z "$2" && test -n "$1" ; then
+    func_error "Could not determine host file name corresponding to"
+    func_error "  \`$1'"
+    func_error "Continuing, but uninstalled executables may not work."
+    # Fallback:
+    func_to_host_file_result="$1"
+  fi
+}
+# end func_convert_file_check
+
+
+# func_convert_path_check FROM_PATHSEP TO_PATHSEP FROM_PATH TO_PATH
+# Verify that FROM_PATH (a path in $build format) was converted to $host
+# format in TO_PATH. Otherwise, emit an error message, but continue, resetting
+# func_to_host_file_result to a simplistic fallback value (see below).
+func_convert_path_check ()
+{
+  $opt_debug
+  if test -z "$4" && test -n "$3"; then
+    func_error "Could not determine the host path corresponding to"
+    func_error "  \`$3'"
+    func_error "Continuing, but uninstalled executables may not work."
+    # Fallback.  This is a deliberately simplistic "conversion" and
+    # should not be "improved".  See libtool.info.
+    if test "x$1" != "x$2"; then
+      lt_replace_pathsep_chars="s|$1|$2|g"
+      func_to_host_path_result=`echo "$3" |
+        $SED -e "$lt_replace_pathsep_chars"`
+    else
+      func_to_host_path_result="$3"
+    fi
+  fi
+}
+# end func_convert_path_check
+
+
+# func_convert_path_front_back_pathsep FRONTPAT BACKPAT REPL ORIG
+# Modifies func_to_host_path_result by prepending REPL if ORIG matches FRONTPAT
+# and appending REPL if ORIG matches BACKPAT.
+func_convert_path_front_back_pathsep ()
+{
+  $opt_debug
+  case $4 in
+  $1 ) func_to_host_path_result="$3$func_to_host_path_result"
+    ;;
+  esac
+  case $4 in
+  $2 ) func_append func_to_host_path_result "$3"
+    ;;
+  esac
+}
+# end func_convert_path_front_back_pathsep
+
+
+##################################################
+# $build to $host FILE NAME CONVERSION FUNCTIONS #
+##################################################
+# invoked via `$to_host_file_cmd ARG'
+#
+# In each case, ARG is the path to be converted from $build to $host format.
+# Result will be available in $func_to_host_file_result.
+
+
+# func_to_host_file ARG
+# Converts the file name ARG from $build format to $host format. Return result
+# in func_to_host_file_result.
+func_to_host_file ()
+{
+  $opt_debug
+  $to_host_file_cmd "$1"
+}
+# end func_to_host_file
+
+
+# func_to_tool_file ARG LAZY
+# converts the file name ARG from $build format to toolchain format. Return
+# result in func_to_tool_file_result.  If the conversion in use is listed
+# in (the comma separated) LAZY, no conversion takes place.
+func_to_tool_file ()
+{
+  $opt_debug
+  case ,$2, in
+    *,"$to_tool_file_cmd",*)
+      func_to_tool_file_result=$1
+      ;;
+    *)
+      $to_tool_file_cmd "$1"
+      func_to_tool_file_result=$func_to_host_file_result
+      ;;
+  esac
+}
+# end func_to_tool_file
+
+
+# func_convert_file_noop ARG
+# Copy ARG to func_to_host_file_result.
+func_convert_file_noop ()
+{
+  func_to_host_file_result="$1"
+}
+# end func_convert_file_noop
+
+
+# func_convert_file_msys_to_w32 ARG
+# Convert file name ARG from (mingw) MSYS to (mingw) w32 format; automatic
+# conversion to w32 is not available inside the cwrapper.  Returns result in
+# func_to_host_file_result.
+func_convert_file_msys_to_w32 ()
+{
+  $opt_debug
+  func_to_host_file_result="$1"
+  if test -n "$1"; then
+    func_convert_core_msys_to_w32 "$1"
+    func_to_host_file_result="$func_convert_core_msys_to_w32_result"
+  fi
+  func_convert_file_check "$1" "$func_to_host_file_result"
+}
+# end func_convert_file_msys_to_w32
+
+
+# func_convert_file_cygwin_to_w32 ARG
+# Convert file name ARG from Cygwin to w32 format.  Returns result in
+# func_to_host_file_result.
+func_convert_file_cygwin_to_w32 ()
+{
+  $opt_debug
+  func_to_host_file_result="$1"
+  if test -n "$1"; then
+    # because $build is cygwin, we call "the" cygpath in $PATH; no need to use
+    # LT_CYGPATH in this case.
+    func_to_host_file_result=`cygpath -m "$1"`
+  fi
+  func_convert_file_check "$1" "$func_to_host_file_result"
+}
+# end func_convert_file_cygwin_to_w32
+
+
+# func_convert_file_nix_to_w32 ARG
+# Convert file name ARG from *nix to w32 format.  Requires a wine environment
+# and a working winepath. Returns result in func_to_host_file_result.
+func_convert_file_nix_to_w32 ()
+{
+  $opt_debug
+  func_to_host_file_result="$1"
+  if test -n "$1"; then
+    func_convert_core_file_wine_to_w32 "$1"
+    func_to_host_file_result="$func_convert_core_file_wine_to_w32_result"
+  fi
+  func_convert_file_check "$1" "$func_to_host_file_result"
+}
+# end func_convert_file_nix_to_w32
+
+
+# func_convert_file_msys_to_cygwin ARG
+# Convert file name ARG from MSYS to Cygwin format.  Requires LT_CYGPATH set.
+# Returns result in func_to_host_file_result.
+func_convert_file_msys_to_cygwin ()
+{
+  $opt_debug
+  func_to_host_file_result="$1"
+  if test -n "$1"; then
+    func_convert_core_msys_to_w32 "$1"
+    func_cygpath -u "$func_convert_core_msys_to_w32_result"
+    func_to_host_file_result="$func_cygpath_result"
+  fi
+  func_convert_file_check "$1" "$func_to_host_file_result"
+}
+# end func_convert_file_msys_to_cygwin
+
+
+# func_convert_file_nix_to_cygwin ARG
+# Convert file name ARG from *nix to Cygwin format.  Requires Cygwin installed
+# in a wine environment, working winepath, and LT_CYGPATH set.  Returns result
+# in func_to_host_file_result.
+func_convert_file_nix_to_cygwin ()
+{
+  $opt_debug
+  func_to_host_file_result="$1"
+  if test -n "$1"; then
+    # convert from *nix to w32, then use cygpath to convert from w32 to cygwin.
+    func_convert_core_file_wine_to_w32 "$1"
+    func_cygpath -u "$func_convert_core_file_wine_to_w32_result"
+    func_to_host_file_result="$func_cygpath_result"
+  fi
+  func_convert_file_check "$1" "$func_to_host_file_result"
+}
+# end func_convert_file_nix_to_cygwin
+
+
+#############################################
+# $build to $host PATH CONVERSION FUNCTIONS #
+#############################################
+# invoked via `$to_host_path_cmd ARG'
+#
+# In each case, ARG is the path to be converted from $build to $host format.
+# The result will be available in $func_to_host_path_result.
+#
+# Path separators are also converted from $build format to $host format.  If
+# ARG begins or ends with a path separator character, it is preserved (but
+# converted to $host format) on output.
+#
+# All path conversion functions are named using the following convention:
+#   file name conversion function    : func_convert_file_X_to_Y ()
+#   path conversion function         : func_convert_path_X_to_Y ()
+# where, for any given $build/$host combination the 'X_to_Y' value is the
+# same.  If conversion functions are added for new $build/$host combinations,
+# the two new functions must follow this pattern, or func_init_to_host_path_cmd
+# will break.
+
+
+# func_init_to_host_path_cmd
+# Ensures that function "pointer" variable $to_host_path_cmd is set to the
+# appropriate value, based on the value of $to_host_file_cmd.
+to_host_path_cmd=
+func_init_to_host_path_cmd ()
+{
+  $opt_debug
+  if test -z "$to_host_path_cmd"; then
+    func_stripname 'func_convert_file_' '' "$to_host_file_cmd"
+    to_host_path_cmd="func_convert_path_${func_stripname_result}"
+  fi
+}
+
+
+# func_to_host_path ARG
+# Converts the path ARG from $build format to $host format. Return result
+# in func_to_host_path_result.
+func_to_host_path ()
+{
+  $opt_debug
+  func_init_to_host_path_cmd
+  $to_host_path_cmd "$1"
+}
+# end func_to_host_path
+
+
+# func_convert_path_noop ARG
+# Copy ARG to func_to_host_path_result.
+func_convert_path_noop ()
+{
+  func_to_host_path_result="$1"
+}
+# end func_convert_path_noop
+
+
+# func_convert_path_msys_to_w32 ARG
+# Convert path ARG from (mingw) MSYS to (mingw) w32 format; automatic
+# conversion to w32 is not available inside the cwrapper.  Returns result in
+# func_to_host_path_result.
+func_convert_path_msys_to_w32 ()
+{
+  $opt_debug
+  func_to_host_path_result="$1"
+  if test -n "$1"; then
+    # Remove leading and trailing path separator characters from ARG.  MSYS
+    # behavior is inconsistent here; cygpath turns them into '.;' and ';.';
+    # and winepath ignores them completely.
+    func_stripname : : "$1"
+    func_to_host_path_tmp1=$func_stripname_result
+    func_convert_core_msys_to_w32 "$func_to_host_path_tmp1"
+    func_to_host_path_result="$func_convert_core_msys_to_w32_result"
+    func_convert_path_check : ";" \
+      "$func_to_host_path_tmp1" "$func_to_host_path_result"
+    func_convert_path_front_back_pathsep ":*" "*:" ";" "$1"
+  fi
+}
+# end func_convert_path_msys_to_w32
+
+
+# func_convert_path_cygwin_to_w32 ARG
+# Convert path ARG from Cygwin to w32 format.  Returns result in
+# func_to_host_file_result.
+func_convert_path_cygwin_to_w32 ()
+{
+  $opt_debug
+  func_to_host_path_result="$1"
+  if test -n "$1"; then
+    # See func_convert_path_msys_to_w32:
+    func_stripname : : "$1"
+    func_to_host_path_tmp1=$func_stripname_result
+    func_to_host_path_result=`cygpath -m -p "$func_to_host_path_tmp1"`
+    func_convert_path_check : ";" \
+      "$func_to_host_path_tmp1" "$func_to_host_path_result"
+    func_convert_path_front_back_pathsep ":*" "*:" ";" "$1"
+  fi
+}
+# end func_convert_path_cygwin_to_w32
+
+
+# func_convert_path_nix_to_w32 ARG
+# Convert path ARG from *nix to w32 format.  Requires a wine environment and
+# a working winepath.  Returns result in func_to_host_file_result.
+func_convert_path_nix_to_w32 ()
+{
+  $opt_debug
+  func_to_host_path_result="$1"
+  if test -n "$1"; then
+    # See func_convert_path_msys_to_w32:
+    func_stripname : : "$1"
+    func_to_host_path_tmp1=$func_stripname_result
+    func_convert_core_path_wine_to_w32 "$func_to_host_path_tmp1"
+    func_to_host_path_result="$func_convert_core_path_wine_to_w32_result"
+    func_convert_path_check : ";" \
+      "$func_to_host_path_tmp1" "$func_to_host_path_result"
+    func_convert_path_front_back_pathsep ":*" "*:" ";" "$1"
+  fi
+}
+# end func_convert_path_nix_to_w32
+
+
+# func_convert_path_msys_to_cygwin ARG
+# Convert path ARG from MSYS to Cygwin format.  Requires LT_CYGPATH set.
+# Returns result in func_to_host_file_result.
+func_convert_path_msys_to_cygwin ()
+{
+  $opt_debug
+  func_to_host_path_result="$1"
+  if test -n "$1"; then
+    # See func_convert_path_msys_to_w32:
+    func_stripname : : "$1"
+    func_to_host_path_tmp1=$func_stripname_result
+    func_convert_core_msys_to_w32 "$func_to_host_path_tmp1"
+    func_cygpath -u -p "$func_convert_core_msys_to_w32_result"
+    func_to_host_path_result="$func_cygpath_result"
+    func_convert_path_check : : \
+      "$func_to_host_path_tmp1" "$func_to_host_path_result"
+    func_convert_path_front_back_pathsep ":*" "*:" : "$1"
+  fi
+}
+# end func_convert_path_msys_to_cygwin
+
+
+# func_convert_path_nix_to_cygwin ARG
+# Convert path ARG from *nix to Cygwin format.  Requires Cygwin installed in a
+# a wine environment, working winepath, and LT_CYGPATH set.  Returns result in
+# func_to_host_file_result.
+func_convert_path_nix_to_cygwin ()
+{
+  $opt_debug
+  func_to_host_path_result="$1"
+  if test -n "$1"; then
+    # Remove leading and trailing path separator characters from
+    # ARG. msys behavior is inconsistent here, cygpath turns them
+    # into '.;' and ';.', and winepath ignores them completely.
+    func_stripname : : "$1"
+    func_to_host_path_tmp1=$func_stripname_result
+    func_convert_core_path_wine_to_w32 "$func_to_host_path_tmp1"
+    func_cygpath -u -p "$func_convert_core_path_wine_to_w32_result"
+    func_to_host_path_result="$func_cygpath_result"
+    func_convert_path_check : : \
+      "$func_to_host_path_tmp1" "$func_to_host_path_result"
+    func_convert_path_front_back_pathsep ":*" "*:" : "$1"
+  fi
+}
+# end func_convert_path_nix_to_cygwin
+
+
 # func_mode_compile arg...
 func_mode_compile ()
 {
@@ -1137,12 +1986,12 @@ func_mode_compile ()
 	  ;;
 
 	-pie | -fpie | -fPIE)
-          pie_flag="$pie_flag $arg"
+          func_append pie_flag " $arg"
 	  continue
 	  ;;
 
 	-shared | -static | -prefer-pic | -prefer-non-pic)
-	  later="$later $arg"
+	  func_append later " $arg"
 	  continue
 	  ;;
 
@@ -1163,15 +2012,14 @@ func_mode_compile ()
 	  save_ifs="$IFS"; IFS=','
 	  for arg in $args; do
 	    IFS="$save_ifs"
-	    func_quote_for_eval "$arg"
-	    lastarg="$lastarg $func_quote_for_eval_result"
+	    func_append_quoted lastarg "$arg"
 	  done
 	  IFS="$save_ifs"
 	  func_stripname ' ' '' "$lastarg"
 	  lastarg=$func_stripname_result
 
 	  # Add the arguments to base_compile.
-	  base_compile="$base_compile $lastarg"
+	  func_append base_compile " $lastarg"
 	  continue
 	  ;;
 
@@ -1187,8 +2035,7 @@ func_mode_compile ()
       esac    #  case $arg_mode
 
       # Aesthetically quote the previous argument.
-      func_quote_for_eval "$lastarg"
-      base_compile="$base_compile $func_quote_for_eval_result"
+      func_append_quoted base_compile "$lastarg"
     done # for arg
 
     case $arg_mode in
@@ -1213,7 +2060,7 @@ func_mode_compile ()
     *.[cCFSifmso] | \
     *.ada | *.adb | *.ads | *.asm | \
     *.c++ | *.cc | *.ii | *.class | *.cpp | *.cxx | \
-    *.[fF][09]? | *.for | *.java | *.obj | *.sx)
+    *.[fF][09]? | *.for | *.java | *.go | *.obj | *.sx | *.cu | *.cup)
       func_xform "$libobj"
       libobj=$func_xform_result
       ;;
@@ -1288,7 +2135,7 @@ func_mode_compile ()
     # Calculate the filename of the output object if compiler does
     # not support -o with -c
     if test "$compiler_c_o" = no; then
-      output_obj=`$ECHO "X$srcfile" | $Xsed -e 's%^.*/%%' -e 's%\.[^.]*$%%'`.${objext}
+      output_obj=`$ECHO "$srcfile" | $SED 's%^.*/%%; s%\.[^.]*$%%'`.${objext}
       lockfile="$output_obj.lock"
     else
       output_obj=
@@ -1319,17 +2166,16 @@ compiler."
 	$opt_dry_run || $RM $removelist
 	exit $EXIT_FAILURE
       fi
-      removelist="$removelist $output_obj"
+      func_append removelist " $output_obj"
       $ECHO "$srcfile" > "$lockfile"
     fi
 
     $opt_dry_run || $RM $removelist
-    removelist="$removelist $lockfile"
+    func_append removelist " $lockfile"
     trap '$opt_dry_run || $RM $removelist; exit $EXIT_FAILURE' 1 2 15
 
-    if test -n "$fix_srcfile_path"; then
-      eval srcfile=\"$fix_srcfile_path\"
-    fi
+    func_to_tool_file "$srcfile" func_convert_file_msys_to_w32
+    srcfile=$func_to_tool_file_result
     func_quote_for_eval "$srcfile"
     qsrcfile=$func_quote_for_eval_result
 
@@ -1349,7 +2195,7 @@ compiler."
 
       if test -z "$output_obj"; then
 	# Place PIC objects in $objdir
-	command="$command -o $lobj"
+	func_append command " -o $lobj"
       fi
 
       func_show_eval_locale "$command"	\
@@ -1396,11 +2242,11 @@ compiler."
 	command="$base_compile $qsrcfile $pic_flag"
       fi
       if test "$compiler_c_o" = yes; then
-	command="$command -o $obj"
+	func_append command " -o $obj"
       fi
 
       # Suppress compiler output if we already did a PIC compilation.
-      command="$command$suppress_output"
+      func_append command "$suppress_output"
       func_show_eval_locale "$command" \
         '$opt_dry_run || $RM $removelist; exit $EXIT_FAILURE'
 
@@ -1445,13 +2291,13 @@ compiler."
 }
 
 $opt_help || {
-test "$mode" = compile && func_mode_compile ${1+"$@"}
+  test "$opt_mode" = compile && func_mode_compile ${1+"$@"}
 }
 
 func_mode_help ()
 {
     # We need to display help for each of the modes.
-    case $mode in
+    case $opt_mode in
       "")
         # Generic help is extracted from the usage comments
         # at the start of this file.
@@ -1482,10 +2328,11 @@ This mode accepts the following additional options:
 
   -o OUTPUT-FILE    set the output file name to OUTPUT-FILE
   -no-suppress      do not suppress compiler output for multiple passes
-  -prefer-pic       try to building PIC objects only
-  -prefer-non-pic   try to building non-PIC objects only
+  -prefer-pic       try to build PIC objects only
+  -prefer-non-pic   try to build non-PIC objects only
   -shared           do not build a \`.o' file suitable for static linking
   -static           only build a \`.o' file suitable for static linking
+  -Wc,FLAG          pass FLAG directly to the compiler
 
 COMPILE-COMMAND is a command to be used in creating a \`standard' object file
 from the given SOURCEFILE.
@@ -1538,7 +2385,7 @@ either the \`install' or \`cp' program.
 
 The following components of INSTALL-COMMAND are treated specially:
 
-  -inst-prefix PREFIX-DIR  Use PREFIX-DIR as a staging area for installation
+  -inst-prefix-dir PREFIX-DIR  Use PREFIX-DIR as a staging area for installation
 
 The rest of the components are interpreted as arguments to that command (only
 BSD-compatible install options are recognized)."
@@ -1558,6 +2405,8 @@ The following components of LINK-COMMAND are treated specially:
 
   -all-static       do not do any dynamic linking at all
   -avoid-version    do not add a version suffix if possible
+  -bindir BINDIR    specify path to binaries directory (for systems where
+                    libraries must be found in the PATH setting at runtime)
   -dlopen FILE      \`-dlpreopen' FILE if it cannot be dlopened at runtime
   -dlpreopen FILE   link in FILE and add its symbols to lt_preloaded_symbols
   -export-dynamic   allow symbols from OUTPUT-FILE to be resolved with dlsym(3)
@@ -1586,6 +2435,11 @@ The following components of LINK-COMMAND are treated specially:
   -version-info CURRENT[:REVISION[:AGE]]
                     specify library version info [each variable defaults to 0]
   -weak LIBNAME     declare that the target provides the LIBNAME interface
+  -Wc,FLAG
+  -Xcompiler FLAG   pass linker-specific FLAG directly to the compiler
+  -Wl,FLAG
+  -Xlinker FLAG     pass linker-specific FLAG directly to the linker
+  -XCClinker FLAG   pass link-specific FLAG to the compiler driver (CC)
 
 All other options (arguments beginning with \`-') are ignored.
 
@@ -1619,18 +2473,44 @@ Otherwise, only FILE itself is deleted using RM."
         ;;
 
       *)
-        func_fatal_help "invalid operation mode \`$mode'"
+        func_fatal_help "invalid operation mode \`$opt_mode'"
         ;;
     esac
 
-    $ECHO
+    echo
     $ECHO "Try \`$progname --help' for more information about other modes."
-
-    exit $?
 }
 
-  # Now that we've collected a possible --mode arg, show help if necessary
-  $opt_help && func_mode_help
+# Now that we've collected a possible --mode arg, show help if necessary
+if $opt_help; then
+  if test "$opt_help" = :; then
+    func_mode_help
+  else
+    {
+      func_help noexit
+      for opt_mode in compile link execute install finish uninstall clean; do
+	func_mode_help
+      done
+    } | sed -n '1p; 2,$s/^Usage:/  or: /p'
+    {
+      func_help noexit
+      for opt_mode in compile link execute install finish uninstall clean; do
+	echo
+	func_mode_help
+      done
+    } |
+    sed '1d
+      /^When reporting/,/^Report/{
+	H
+	d
+      }
+      $x
+      /information about other modes/d
+      /more detailed .*MODE/d
+      s/^Usage:.*--mode=\([^ ]*\) .*/Description of \1 mode:/'
+  fi
+  exit $?
+fi
 
 
 # func_mode_execute arg...
@@ -1643,13 +2523,16 @@ func_mode_execute ()
       func_fatal_help "you must specify a COMMAND"
 
     # Handle -dlopen flags immediately.
-    for file in $execute_dlfiles; do
+    for file in $opt_dlopen; do
       test -f "$file" \
 	|| func_fatal_help "\`$file' is not a file"
 
       dir=
       case $file in
       *.la)
+	func_resolve_sysroot "$file"
+	file=$func_resolve_sysroot_result
+
 	# Check to see that this really is a libtool archive.
 	func_lalib_unsafe_p "$file" \
 	  || func_fatal_help "\`$lib' is not a valid libtool archive"
@@ -1671,7 +2554,7 @@ func_mode_execute ()
 	dir="$func_dirname_result"
 
 	if test -f "$dir/$objdir/$dlname"; then
-	  dir="$dir/$objdir"
+	  func_append dir "/$objdir"
 	else
 	  if test ! -f "$dir/$dlname"; then
 	    func_fatal_error "cannot find \`$dlname' in \`$dir' or \`$dir/$objdir'"
@@ -1712,7 +2595,7 @@ func_mode_execute ()
     for file
     do
       case $file in
-      -*) ;;
+      -* | *.la | *.lo ) ;;
       *)
 	# Do a test to see if this is really a libtool program.
 	if func_ltwrapper_script_p "$file"; then
@@ -1728,8 +2611,7 @@ func_mode_execute ()
 	;;
       esac
       # Quote arguments (to preserve shell metacharacters).
-      func_quote_for_eval "$file"
-      args="$args $func_quote_for_eval_result"
+      func_append_quoted args "$file"
     done
 
     if test "X$opt_dry_run" = Xfalse; then
@@ -1754,29 +2636,66 @@ func_mode_execute ()
       # Display what would be done.
       if test -n "$shlibpath_var"; then
 	eval "\$ECHO \"\$shlibpath_var=\$$shlibpath_var\""
-	$ECHO "export $shlibpath_var"
+	echo "export $shlibpath_var"
       fi
       $ECHO "$cmd$args"
       exit $EXIT_SUCCESS
     fi
 }
 
-test "$mode" = execute && func_mode_execute ${1+"$@"}
+test "$opt_mode" = execute && func_mode_execute ${1+"$@"}
 
 
 # func_mode_finish arg...
 func_mode_finish ()
 {
     $opt_debug
-    libdirs="$nonopt"
+    libs=
+    libdirs=
     admincmds=
 
-    if test -n "$finish_cmds$finish_eval" && test -n "$libdirs"; then
-      for dir
-      do
-	libdirs="$libdirs $dir"
-      done
+    for opt in "$nonopt" ${1+"$@"}
+    do
+      if test -d "$opt"; then
+	func_append libdirs " $opt"
+
+      elif test -f "$opt"; then
+	if func_lalib_unsafe_p "$opt"; then
+	  func_append libs " $opt"
+	else
+	  func_warning "\`$opt' is not a valid libtool archive"
+	fi
+
+      else
+	func_fatal_error "invalid argument \`$opt'"
+      fi
+    done
+
+    if test -n "$libs"; then
+      if test -n "$lt_sysroot"; then
+        sysroot_regex=`$ECHO "$lt_sysroot" | $SED "$sed_make_literal_regex"`
+        sysroot_cmd="s/\([ ']\)$sysroot_regex/\1/g;"
+      else
+        sysroot_cmd=
+      fi
+
+      # Remove sysroot references
+      if $opt_dry_run; then
+        for lib in $libs; do
+          echo "removing references to $lt_sysroot and \`=' prefixes from $lib"
+        done
+      else
+        tmpdir=`func_mktempdir`
+        for lib in $libs; do
+	  sed -e "${sysroot_cmd} s/\([ ']-[LR]\)=/\1/g; s/\([ ']\)=/\1/g" $lib \
+	    > $tmpdir/tmp-la
+	  mv -f $tmpdir/tmp-la $lib
+	done
+        ${RM}r "$tmpdir"
+      fi
+    fi
 
+    if test -n "$finish_cmds$finish_eval" && test -n "$libdirs"; then
       for libdir in $libdirs; do
 	if test -n "$finish_cmds"; then
 	  # Do each command in the finish commands.
@@ -1786,7 +2705,7 @@ func_mode_finish ()
 	if test -n "$finish_eval"; then
 	  # Do the single finish_eval.
 	  eval cmds=\"$finish_eval\"
-	  $opt_dry_run || eval "$cmds" || admincmds="$admincmds
+	  $opt_dry_run || eval "$cmds" || func_append admincmds "
        $cmds"
 	fi
       done
@@ -1795,53 +2714,55 @@ func_mode_finish ()
     # Exit here if they wanted silent mode.
     $opt_silent && exit $EXIT_SUCCESS
 
-    $ECHO "X----------------------------------------------------------------------" | $Xsed
-    $ECHO "Libraries have been installed in:"
-    for libdir in $libdirs; do
-      $ECHO "   $libdir"
-    done
-    $ECHO
-    $ECHO "If you ever happen to want to link against installed libraries"
-    $ECHO "in a given directory, LIBDIR, you must either use libtool, and"
-    $ECHO "specify the full pathname of the library, or use the \`-LLIBDIR'"
-    $ECHO "flag during linking and do at least one of the following:"
-    if test -n "$shlibpath_var"; then
-      $ECHO "   - add LIBDIR to the \`$shlibpath_var' environment variable"
-      $ECHO "     during execution"
-    fi
-    if test -n "$runpath_var"; then
-      $ECHO "   - add LIBDIR to the \`$runpath_var' environment variable"
-      $ECHO "     during linking"
-    fi
-    if test -n "$hardcode_libdir_flag_spec"; then
-      libdir=LIBDIR
-      eval flag=\"$hardcode_libdir_flag_spec\"
+    if test -n "$finish_cmds$finish_eval" && test -n "$libdirs"; then
+      echo "----------------------------------------------------------------------"
+      echo "Libraries have been installed in:"
+      for libdir in $libdirs; do
+	$ECHO "   $libdir"
+      done
+      echo
+      echo "If you ever happen to want to link against installed libraries"
+      echo "in a given directory, LIBDIR, you must either use libtool, and"
+      echo "specify the full pathname of the library, or use the \`-LLIBDIR'"
+      echo "flag during linking and do at least one of the following:"
+      if test -n "$shlibpath_var"; then
+	echo "   - add LIBDIR to the \`$shlibpath_var' environment variable"
+	echo "     during execution"
+      fi
+      if test -n "$runpath_var"; then
+	echo "   - add LIBDIR to the \`$runpath_var' environment variable"
+	echo "     during linking"
+      fi
+      if test -n "$hardcode_libdir_flag_spec"; then
+	libdir=LIBDIR
+	eval flag=\"$hardcode_libdir_flag_spec\"
 
-      $ECHO "   - use the \`$flag' linker flag"
-    fi
-    if test -n "$admincmds"; then
-      $ECHO "   - have your system administrator run these commands:$admincmds"
-    fi
-    if test -f /etc/ld.so.conf; then
-      $ECHO "   - have your system administrator add LIBDIR to \`/etc/ld.so.conf'"
-    fi
-    $ECHO
+	$ECHO "   - use the \`$flag' linker flag"
+      fi
+      if test -n "$admincmds"; then
+	$ECHO "   - have your system administrator run these commands:$admincmds"
+      fi
+      if test -f /etc/ld.so.conf; then
+	echo "   - have your system administrator add LIBDIR to \`/etc/ld.so.conf'"
+      fi
+      echo
 
-    $ECHO "See any operating system documentation about shared libraries for"
-    case $host in
-      solaris2.[6789]|solaris2.1[0-9])
-        $ECHO "more information, such as the ld(1), crle(1) and ld.so(8) manual"
-	$ECHO "pages."
-	;;
-      *)
-        $ECHO "more information, such as the ld(1) and ld.so(8) manual pages."
-        ;;
-    esac
-    $ECHO "X----------------------------------------------------------------------" | $Xsed
+      echo "See any operating system documentation about shared libraries for"
+      case $host in
+	solaris2.[6789]|solaris2.1[0-9])
+	  echo "more information, such as the ld(1), crle(1) and ld.so(8) manual"
+	  echo "pages."
+	  ;;
+	*)
+	  echo "more information, such as the ld(1) and ld.so(8) manual pages."
+	  ;;
+      esac
+      echo "----------------------------------------------------------------------"
+    fi
     exit $EXIT_SUCCESS
 }
 
-test "$mode" = finish && func_mode_finish ${1+"$@"}
+test "$opt_mode" = finish && func_mode_finish ${1+"$@"}
 
 
 # func_mode_install arg...
@@ -1852,7 +2773,7 @@ func_mode_install ()
     # install_prog (especially on Windows NT).
     if test "$nonopt" = "$SHELL" || test "$nonopt" = /bin/sh ||
        # Allow the use of GNU shtool's install command.
-       $ECHO "X$nonopt" | $GREP shtool >/dev/null; then
+       case $nonopt in *shtool*) :;; *) false;; esac; then
       # Aesthetically quote it.
       func_quote_for_eval "$nonopt"
       install_prog="$func_quote_for_eval_result "
@@ -1866,7 +2787,12 @@ func_mode_install ()
     # The real first argument should be the name of the installation program.
     # Aesthetically quote it.
     func_quote_for_eval "$arg"
-    install_prog="$install_prog$func_quote_for_eval_result"
+    func_append install_prog "$func_quote_for_eval_result"
+    install_shared_prog=$install_prog
+    case " $install_prog " in
+      *[\\\ /]cp\ *) install_cp=: ;;
+      *) install_cp=false ;;
+    esac
 
     # We need to accept at least all the BSD install flags.
     dest=
@@ -1876,10 +2802,12 @@ func_mode_install ()
     install_type=
     isdir=no
     stripme=
+    no_mode=:
     for arg
     do
+      arg2=
       if test -n "$dest"; then
-	files="$files $dest"
+	func_append files " $dest"
 	dest=$arg
 	continue
       fi
@@ -1887,10 +2815,9 @@ func_mode_install ()
       case $arg in
       -d) isdir=yes ;;
       -f)
-	case " $install_prog " in
-	*[\\\ /]cp\ *) ;;
-	*) prev=$arg ;;
-	esac
+	if $install_cp; then :; else
+	  prev=$arg
+	fi
 	;;
       -g | -m | -o)
 	prev=$arg
@@ -1904,6 +2831,10 @@ func_mode_install ()
       *)
 	# If the previous option needed an argument, then skip it.
 	if test -n "$prev"; then
+	  if test "x$prev" = x-m && test -n "$install_override_mode"; then
+	    arg2=$install_override_mode
+	    no_mode=false
+	  fi
 	  prev=
 	else
 	  dest=$arg
@@ -1914,7 +2845,11 @@ func_mode_install ()
 
       # Aesthetically quote the argument.
       func_quote_for_eval "$arg"
-      install_prog="$install_prog $func_quote_for_eval_result"
+      func_append install_prog " $func_quote_for_eval_result"
+      if test -n "$arg2"; then
+	func_quote_for_eval "$arg2"
+      fi
+      func_append install_shared_prog " $func_quote_for_eval_result"
     done
 
     test -z "$install_prog" && \
@@ -1923,6 +2858,13 @@ func_mode_install ()
     test -n "$prev" && \
       func_fatal_help "the \`$prev' option requires an argument"
 
+    if test -n "$install_override_mode" && $no_mode; then
+      if $install_cp; then :; else
+	func_quote_for_eval "$install_override_mode"
+	func_append install_shared_prog " -m $func_quote_for_eval_result"
+      fi
+    fi
+
     if test -z "$files"; then
       if test -z "$dest"; then
 	func_fatal_help "no file or destination specified"
@@ -1977,10 +2919,13 @@ func_mode_install ()
       case $file in
       *.$libext)
 	# Do the static libraries later.
-	staticlibs="$staticlibs $file"
+	func_append staticlibs " $file"
 	;;
 
       *.la)
+	func_resolve_sysroot "$file"
+	file=$func_resolve_sysroot_result
+
 	# Check to see that this really is a libtool archive.
 	func_lalib_unsafe_p "$file" \
 	  || func_fatal_help "\`$file' is not a valid libtool archive"
@@ -1994,23 +2939,23 @@ func_mode_install ()
 	if test "X$destdir" = "X$libdir"; then
 	  case "$current_libdirs " in
 	  *" $libdir "*) ;;
-	  *) current_libdirs="$current_libdirs $libdir" ;;
+	  *) func_append current_libdirs " $libdir" ;;
 	  esac
 	else
 	  # Note the libdir as a future libdir.
 	  case "$future_libdirs " in
 	  *" $libdir "*) ;;
-	  *) future_libdirs="$future_libdirs $libdir" ;;
+	  *) func_append future_libdirs " $libdir" ;;
 	  esac
 	fi
 
 	func_dirname "$file" "/" ""
 	dir="$func_dirname_result"
-	dir="$dir$objdir"
+	func_append dir "$objdir"
 
 	if test -n "$relink_command"; then
 	  # Determine the prefix the user has applied to our future dir.
-	  inst_prefix_dir=`$ECHO "X$destdir" | $Xsed -e "s%$libdir\$%%"`
+	  inst_prefix_dir=`$ECHO "$destdir" | $SED -e "s%$libdir\$%%"`
 
 	  # Don't allow the user to place us outside of our expected
 	  # location b/c this prevents finding dependent libraries that
@@ -2023,9 +2968,9 @@ func_mode_install ()
 
 	  if test -n "$inst_prefix_dir"; then
 	    # Stick the inst_prefix_dir data into the link command.
-	    relink_command=`$ECHO "X$relink_command" | $Xsed -e "s%@inst_prefix_dir@%-inst-prefix-dir $inst_prefix_dir%"`
+	    relink_command=`$ECHO "$relink_command" | $SED "s%@inst_prefix_dir@%-inst-prefix-dir $inst_prefix_dir%"`
 	  else
-	    relink_command=`$ECHO "X$relink_command" | $Xsed -e "s%@inst_prefix_dir@%%"`
+	    relink_command=`$ECHO "$relink_command" | $SED "s%@inst_prefix_dir@%%"`
 	  fi
 
 	  func_warning "relinking \`$file'"
@@ -2043,7 +2988,7 @@ func_mode_install ()
 	  test -n "$relink_command" && srcname="$realname"T
 
 	  # Install the shared library and build the symlinks.
-	  func_show_eval "$install_prog $dir/$srcname $destdir/$realname" \
+	  func_show_eval "$install_shared_prog $dir/$srcname $destdir/$realname" \
 	      'exit $?'
 	  tstripme="$stripme"
 	  case $host_os in
@@ -2083,7 +3028,7 @@ func_mode_install ()
 	func_show_eval "$install_prog $instname $destdir/$name" 'exit $?'
 
 	# Maybe install the static library, too.
-	test -n "$old_library" && staticlibs="$staticlibs $dir/$old_library"
+	test -n "$old_library" && func_append staticlibs " $dir/$old_library"
 	;;
 
       *.lo)
@@ -2183,7 +3128,7 @@ func_mode_install ()
 	    if test -f "$lib"; then
 	      func_source "$lib"
 	    fi
-	    libfile="$libdir/"`$ECHO "X$lib" | $Xsed -e 's%^.*/%%g'` ### testsuite: skip nested quoting test
+	    libfile="$libdir/"`$ECHO "$lib" | $SED 's%^.*/%%g'` ### testsuite: skip nested quoting test
 	    if test -n "$libdir" && test ! -f "$libfile"; then
 	      func_warning "\`$lib' has not been installed in \`$libdir'"
 	      finalize=no
@@ -2202,7 +3147,7 @@ func_mode_install ()
 		file="$func_basename_result"
 	        outputname="$tmpdir/$file"
 	        # Replace the output file specification.
-	        relink_command=`$ECHO "X$relink_command" | $Xsed -e 's%@OUTPUT@%'"$outputname"'%g'`
+	        relink_command=`$ECHO "$relink_command" | $SED 's%@OUTPUT@%'"$outputname"'%g'`
 
 	        $opt_silent || {
 	          func_quote_for_expand "$relink_command"
@@ -2221,7 +3166,7 @@ func_mode_install ()
 	    }
 	  else
 	    # Install the binary that we compiled earlier.
-	    file=`$ECHO "X$file$stripped_ext" | $Xsed -e "s%\([^/]*\)$%$objdir/\1%"`
+	    file=`$ECHO "$file$stripped_ext" | $SED "s%\([^/]*\)$%$objdir/\1%"`
 	  fi
 	fi
 
@@ -2257,11 +3202,13 @@ func_mode_install ()
 
       # Set up the ranlib parameters.
       oldlib="$destdir/$name"
+      func_to_tool_file "$oldlib" func_convert_file_msys_to_w32
+      tool_oldlib=$func_to_tool_file_result
 
       func_show_eval "$install_prog \$file \$oldlib" 'exit $?'
 
       if test -n "$stripme" && test -n "$old_striplib"; then
-	func_show_eval "$old_striplib $oldlib" 'exit $?'
+	func_show_eval "$old_striplib $tool_oldlib" 'exit $?'
       fi
 
       # Do each command in the postinstall commands.
@@ -2280,7 +3227,7 @@ func_mode_install ()
     fi
 }
 
-test "$mode" = install && func_mode_install ${1+"$@"}
+test "$opt_mode" = install && func_mode_install ${1+"$@"}
 
 
 # func_generate_dlsyms outputname originator pic_p
@@ -2323,6 +3270,22 @@ func_generate_dlsyms ()
 extern \"C\" {
 #endif
 
+#if defined(__GNUC__) && (((__GNUC__ == 4) && (__GNUC_MINOR__ >= 4)) || (__GNUC__ > 4))
+#pragma GCC diagnostic ignored \"-Wstrict-prototypes\"
+#endif
+
+/* Keep this code in sync between libtool.m4, ltmain, lt_system.h, and tests.  */
+#if defined(_WIN32) || defined(__CYGWIN__) || defined(_WIN32_WCE)
+/* DATA imports from DLLs on WIN32 con't be const, because runtime
+   relocations are performed -- see ld's documentation on pseudo-relocs.  */
+# define LT_DLSYM_CONST
+#elif defined(__osf__)
+/* This system does not cope well with relocations in const data.  */
+# define LT_DLSYM_CONST
+#else
+# define LT_DLSYM_CONST const
+#endif
+
 /* External symbol declarations for the compiler. */\
 "
 
@@ -2332,10 +3295,11 @@ extern \"C\" {
 	  $opt_dry_run || echo ': @PROGRAM@ ' > "$nlist"
 
 	  # Add our own program objects to the symbol list.
-	  progfiles=`$ECHO "X$objs$old_deplibs" | $SP2NL | $Xsed -e "$lo2o" | $NL2SP`
+	  progfiles=`$ECHO "$objs$old_deplibs" | $SP2NL | $SED "$lo2o" | $NL2SP`
 	  for progfile in $progfiles; do
-	    func_verbose "extracting global C symbols from \`$progfile'"
-	    $opt_dry_run || eval "$NM $progfile | $global_symbol_pipe >> '$nlist'"
+	    func_to_tool_file "$progfile" func_convert_file_msys_to_w32
+	    func_verbose "extracting global C symbols from \`$func_to_tool_file_result'"
+	    $opt_dry_run || eval "$NM $func_to_tool_file_result | $global_symbol_pipe >> '$nlist'"
 	  done
 
 	  if test -n "$exclude_expsyms"; then
@@ -2371,7 +3335,7 @@ extern \"C\" {
 	      eval '$GREP -f "$output_objdir/$outputname.exp" < "$nlist" > "$nlist"T'
 	      eval '$MV "$nlist"T "$nlist"'
 	      case $host in
-	        *cygwin | *mingw* | *cegcc* )
+	        *cygwin* | *mingw* | *cegcc* )
 	          eval "echo EXPORTS "'> "$output_objdir/$outputname.def"'
 	          eval 'cat "$nlist" >> "$output_objdir/$outputname.def"'
 	          ;;
@@ -2384,10 +3348,52 @@ extern \"C\" {
 	  func_verbose "extracting global C symbols from \`$dlprefile'"
 	  func_basename "$dlprefile"
 	  name="$func_basename_result"
-	  $opt_dry_run || {
-	    eval '$ECHO ": $name " >> "$nlist"'
-	    eval "$NM $dlprefile 2>/dev/null | $global_symbol_pipe >> '$nlist'"
-	  }
+          case $host in
+	    *cygwin* | *mingw* | *cegcc* )
+	      # if an import library, we need to obtain dlname
+	      if func_win32_import_lib_p "$dlprefile"; then
+	        func_tr_sh "$dlprefile"
+	        eval "curr_lafile=\$libfile_$func_tr_sh_result"
+	        dlprefile_dlbasename=""
+	        if test -n "$curr_lafile" && func_lalib_p "$curr_lafile"; then
+	          # Use subshell, to avoid clobbering current variable values
+	          dlprefile_dlname=`source "$curr_lafile" && echo "$dlname"`
+	          if test -n "$dlprefile_dlname" ; then
+	            func_basename "$dlprefile_dlname"
+	            dlprefile_dlbasename="$func_basename_result"
+	          else
+	            # no lafile. user explicitly requested -dlpreopen <import library>.
+	            $sharedlib_from_linklib_cmd "$dlprefile"
+	            dlprefile_dlbasename=$sharedlib_from_linklib_result
+	          fi
+	        fi
+	        $opt_dry_run || {
+	          if test -n "$dlprefile_dlbasename" ; then
+	            eval '$ECHO ": $dlprefile_dlbasename" >> "$nlist"'
+	          else
+	            func_warning "Could not compute DLL name from $name"
+	            eval '$ECHO ": $name " >> "$nlist"'
+	          fi
+	          func_to_tool_file "$dlprefile" func_convert_file_msys_to_w32
+	          eval "$NM \"$func_to_tool_file_result\" 2>/dev/null | $global_symbol_pipe |
+	            $SED -e '/I __imp/d' -e 's/I __nm_/D /;s/_nm__//' >> '$nlist'"
+	        }
+	      else # not an import lib
+	        $opt_dry_run || {
+	          eval '$ECHO ": $name " >> "$nlist"'
+	          func_to_tool_file "$dlprefile" func_convert_file_msys_to_w32
+	          eval "$NM \"$func_to_tool_file_result\" 2>/dev/null | $global_symbol_pipe >> '$nlist'"
+	        }
+	      fi
+	    ;;
+	    *)
+	      $opt_dry_run || {
+	        eval '$ECHO ": $name " >> "$nlist"'
+	        func_to_tool_file "$dlprefile" func_convert_file_msys_to_w32
+	        eval "$NM \"$func_to_tool_file_result\" 2>/dev/null | $global_symbol_pipe >> '$nlist'"
+	      }
+	    ;;
+          esac
 	done
 
 	$opt_dry_run || {
@@ -2415,36 +3421,19 @@ extern \"C\" {
 	  if test -f "$nlist"S; then
 	    eval "$global_symbol_to_cdecl"' < "$nlist"S >> "$output_objdir/$my_dlsyms"'
 	  else
-	    $ECHO '/* NONE */' >> "$output_objdir/$my_dlsyms"
+	    echo '/* NONE */' >> "$output_objdir/$my_dlsyms"
 	  fi
 
-	  $ECHO >> "$output_objdir/$my_dlsyms" "\
+	  echo >> "$output_objdir/$my_dlsyms" "\
 
 /* The mapping between symbol names and symbols.  */
 typedef struct {
   const char *name;
   void *address;
 } lt_dlsymlist;
-"
-	  case $host in
-	  *cygwin* | *mingw* | *cegcc* )
-	    $ECHO >> "$output_objdir/$my_dlsyms" "\
-/* DATA imports from DLLs on WIN32 con't be const, because
-   runtime relocations are performed -- see ld's documentation
-   on pseudo-relocs.  */"
-	    lt_dlsym_const= ;;
-	  *osf5*)
-	    echo >> "$output_objdir/$my_dlsyms" "\
-/* This system does not cope well with relocations in const data */"
-	    lt_dlsym_const= ;;
-	  *)
-	    lt_dlsym_const=const ;;
-	  esac
-
-	  $ECHO >> "$output_objdir/$my_dlsyms" "\
-extern $lt_dlsym_const lt_dlsymlist
+extern LT_DLSYM_CONST lt_dlsymlist
 lt_${my_prefix}_LTX_preloaded_symbols[];
-$lt_dlsym_const lt_dlsymlist
+LT_DLSYM_CONST lt_dlsymlist
 lt_${my_prefix}_LTX_preloaded_symbols[] =
 {\
   { \"$my_originator\", (void *) 0 },"
@@ -2457,7 +3446,7 @@ lt_${my_prefix}_LTX_preloaded_symbols[] =
 	    eval "$global_symbol_to_c_name_address_lib_prefix" < "$nlist" >> "$output_objdir/$my_dlsyms"
 	    ;;
 	  esac
-	  $ECHO >> "$output_objdir/$my_dlsyms" "\
+	  echo >> "$output_objdir/$my_dlsyms" "\
   {0, (void *) 0}
 };
 
@@ -2484,7 +3473,7 @@ static const void *lt_preloaded_setup() {
 	  # linked before any other PIC object.  But we must not use
 	  # pic_flag when linking with -static.  The problem exists in
 	  # FreeBSD 2.2.6 and is fixed in FreeBSD 3.1.
-	  *-*-freebsd2*|*-*-freebsd3.0*|*-*-freebsdelf3.0*)
+	  *-*-freebsd2.*|*-*-freebsd3.0*|*-*-freebsdelf3.0*)
 	    pic_flag_for_symtable=" $pic_flag -DFREEBSD_WORKAROUND" ;;
 	  *-*-hpux*)
 	    pic_flag_for_symtable=" $pic_flag"  ;;
@@ -2500,7 +3489,7 @@ static const void *lt_preloaded_setup() {
 	for arg in $LTCFLAGS; do
 	  case $arg in
 	  -pie | -fpie | -fPIE) ;;
-	  *) symtab_cflags="$symtab_cflags $arg" ;;
+	  *) func_append symtab_cflags " $arg" ;;
 	  esac
 	done
 
@@ -2515,16 +3504,16 @@ static const void *lt_preloaded_setup() {
 	case $host in
 	*cygwin* | *mingw* | *cegcc* )
 	  if test -f "$output_objdir/$my_outputname.def"; then
-	    compile_command=`$ECHO "X$compile_command" | $Xsed -e "s%@SYMFILE@%$output_objdir/$my_outputname.def $symfileobj%"`
-	    finalize_command=`$ECHO "X$finalize_command" | $Xsed -e "s%@SYMFILE@%$output_objdir/$my_outputname.def $symfileobj%"`
+	    compile_command=`$ECHO "$compile_command" | $SED "s%@SYMFILE@%$output_objdir/$my_outputname.def $symfileobj%"`
+	    finalize_command=`$ECHO "$finalize_command" | $SED "s%@SYMFILE@%$output_objdir/$my_outputname.def $symfileobj%"`
 	  else
-	    compile_command=`$ECHO "X$compile_command" | $Xsed -e "s%@SYMFILE@%$symfileobj%"`
-	    finalize_command=`$ECHO "X$finalize_command" | $Xsed -e "s%@SYMFILE@%$symfileobj%"`
+	    compile_command=`$ECHO "$compile_command" | $SED "s%@SYMFILE@%$symfileobj%"`
+	    finalize_command=`$ECHO "$finalize_command" | $SED "s%@SYMFILE@%$symfileobj%"`
 	  fi
 	  ;;
 	*)
-	  compile_command=`$ECHO "X$compile_command" | $Xsed -e "s%@SYMFILE@%$symfileobj%"`
-	  finalize_command=`$ECHO "X$finalize_command" | $Xsed -e "s%@SYMFILE@%$symfileobj%"`
+	  compile_command=`$ECHO "$compile_command" | $SED "s%@SYMFILE@%$symfileobj%"`
+	  finalize_command=`$ECHO "$finalize_command" | $SED "s%@SYMFILE@%$symfileobj%"`
 	  ;;
 	esac
 	;;
@@ -2538,8 +3527,8 @@ static const void *lt_preloaded_setup() {
       # really was required.
 
       # Nullify the symbol file.
-      compile_command=`$ECHO "X$compile_command" | $Xsed -e "s% @SYMFILE@%%"`
-      finalize_command=`$ECHO "X$finalize_command" | $Xsed -e "s% @SYMFILE@%%"`
+      compile_command=`$ECHO "$compile_command" | $SED "s% @SYMFILE@%%"`
+      finalize_command=`$ECHO "$finalize_command" | $SED "s% @SYMFILE@%%"`
     fi
 }
 
@@ -2549,6 +3538,7 @@ static const void *lt_preloaded_setup() {
 # Need a lot of goo to handle *both* DLLs and import libs
 # Has to be a shell function in order to 'eat' the argument
 # that is supplied when $file_magic_command is called.
+# Despite the name, also deal with 64 bit binaries.
 func_win32_libid ()
 {
   $opt_debug
@@ -2559,9 +3549,11 @@ func_win32_libid ()
     win32_libid_type="x86 archive import"
     ;;
   *ar\ archive*) # could be an import, or static
+    # Keep the egrep pattern in sync with the one in _LT_CHECK_MAGIC_METHOD.
     if eval $OBJDUMP -f $1 | $SED -e '10q' 2>/dev/null |
-       $EGREP 'file format pe-i386(.*architecture: i386)?' >/dev/null ; then
-      win32_nmres=`eval $NM -f posix -A $1 |
+       $EGREP 'file format (pei*-i386(.*architecture: i386)?|pe-arm-wince|pe-x86-64)' >/dev/null; then
+      func_to_tool_file "$1" func_convert_file_msys_to_w32
+      win32_nmres=`eval $NM -f posix -A \"$func_to_tool_file_result\" |
 	$SED -n -e '
 	    1,100{
 		/ I /{
@@ -2590,6 +3582,131 @@ func_win32_libid ()
   $ECHO "$win32_libid_type"
 }
 
+# func_cygming_dll_for_implib ARG
+#
+# Platform-specific function to extract the
+# name of the DLL associated with the specified
+# import library ARG.
+# Invoked by eval'ing the libtool variable
+#    $sharedlib_from_linklib_cmd
+# Result is available in the variable
+#    $sharedlib_from_linklib_result
+func_cygming_dll_for_implib ()
+{
+  $opt_debug
+  sharedlib_from_linklib_result=`$DLLTOOL --identify-strict --identify "$1"`
+}
+
+# func_cygming_dll_for_implib_fallback_core SECTION_NAME LIBNAMEs
+#
+# The is the core of a fallback implementation of a
+# platform-specific function to extract the name of the
+# DLL associated with the specified import library LIBNAME.
+#
+# SECTION_NAME is either .idata$6 or .idata$7, depending
+# on the platform and compiler that created the implib.
+#
+# Echos the name of the DLL associated with the
+# specified import library.
+func_cygming_dll_for_implib_fallback_core ()
+{
+  $opt_debug
+  match_literal=`$ECHO "$1" | $SED "$sed_make_literal_regex"`
+  $OBJDUMP -s --section "$1" "$2" 2>/dev/null |
+    $SED '/^Contents of section '"$match_literal"':/{
+      # Place marker at beginning of archive member dllname section
+      s/.*/====MARK====/
+      p
+      d
+    }
+    # These lines can sometimes be longer than 43 characters, but
+    # are always uninteresting
+    /:[	 ]*file format pe[i]\{,1\}-/d
+    /^In archive [^:]*:/d
+    # Ensure marker is printed
+    /^====MARK====/p
+    # Remove all lines with less than 43 characters
+    /^.\{43\}/!d
+    # From remaining lines, remove first 43 characters
+    s/^.\{43\}//' |
+    $SED -n '
+      # Join marker and all lines until next marker into a single line
+      /^====MARK====/ b para
+      H
+      $ b para
+      b
+      :para
+      x
+      s/\n//g
+      # Remove the marker
+      s/^====MARK====//
+      # Remove trailing dots and whitespace
+      s/[\. \t]*$//
+      # Print
+      /./p' |
+    # we now have a list, one entry per line, of the stringified
+    # contents of the appropriate section of all members of the
+    # archive which possess that section. Heuristic: eliminate
+    # all those which have a first or second character that is
+    # a '.' (that is, objdump's representation of an unprintable
+    # character.) This should work for all archives with less than
+    # 0x302f exports -- but will fail for DLLs whose name actually
+    # begins with a literal '.' or a single character followed by
+    # a '.'.
+    #
+    # Of those that remain, print the first one.
+    $SED -e '/^\./d;/^.\./d;q'
+}
+
+# func_cygming_gnu_implib_p ARG
+# This predicate returns with zero status (TRUE) if
+# ARG is a GNU/binutils-style import library. Returns
+# with nonzero status (FALSE) otherwise.
+func_cygming_gnu_implib_p ()
+{
+  $opt_debug
+  func_to_tool_file "$1" func_convert_file_msys_to_w32
+  func_cygming_gnu_implib_tmp=`$NM "$func_to_tool_file_result" | eval "$global_symbol_pipe" | $EGREP ' (_head_[A-Za-z0-9_]+_[ad]l*|[A-Za-z0-9_]+_[ad]l*_iname)$'`
+  test -n "$func_cygming_gnu_implib_tmp"
+}
+
+# func_cygming_ms_implib_p ARG
+# This predicate returns with zero status (TRUE) if
+# ARG is an MS-style import library. Returns
+# with nonzero status (FALSE) otherwise.
+func_cygming_ms_implib_p ()
+{
+  $opt_debug
+  func_to_tool_file "$1" func_convert_file_msys_to_w32
+  func_cygming_ms_implib_tmp=`$NM "$func_to_tool_file_result" | eval "$global_symbol_pipe" | $GREP '_NULL_IMPORT_DESCRIPTOR'`
+  test -n "$func_cygming_ms_implib_tmp"
+}
+
+# func_cygming_dll_for_implib_fallback ARG
+# Platform-specific function to extract the
+# name of the DLL associated with the specified
+# import library ARG.
+#
+# This fallback implementation is for use when $DLLTOOL
+# does not support the --identify-strict option.
+# Invoked by eval'ing the libtool variable
+#    $sharedlib_from_linklib_cmd
+# Result is available in the variable
+#    $sharedlib_from_linklib_result
+func_cygming_dll_for_implib_fallback ()
+{
+  $opt_debug
+  if func_cygming_gnu_implib_p "$1" ; then
+    # binutils import library
+    sharedlib_from_linklib_result=`func_cygming_dll_for_implib_fallback_core '.idata$7' "$1"`
+  elif func_cygming_ms_implib_p "$1" ; then
+    # ms-generated import library
+    sharedlib_from_linklib_result=`func_cygming_dll_for_implib_fallback_core '.idata$6' "$1"`
+  else
+    # unknown
+    sharedlib_from_linklib_result=""
+  fi
+}
 
 
 # func_extract_an_archive dir oldlib
@@ -2598,7 +3715,18 @@ func_extract_an_archive ()
     $opt_debug
     f_ex_an_ar_dir="$1"; shift
     f_ex_an_ar_oldlib="$1"
-    func_show_eval "(cd \$f_ex_an_ar_dir && $AR x \"\$f_ex_an_ar_oldlib\")" 'exit $?'
+    if test "$lock_old_archive_extraction" = yes; then
+      lockfile=$f_ex_an_ar_oldlib.lock
+      until $opt_dry_run || ln "$progpath" "$lockfile" 2>/dev/null; do
+	func_echo "Waiting for $lockfile to be removed"
+	sleep 2
+      done
+    fi
+    func_show_eval "(cd \$f_ex_an_ar_dir && $AR x \"\$f_ex_an_ar_oldlib\")" \
+		   'stat=$?; rm -f "$lockfile"; exit $stat'
+    if test "$lock_old_archive_extraction" = yes; then
+      $opt_dry_run || rm -f "$lockfile"
+    fi
     if ($AR t "$f_ex_an_ar_oldlib" | sort | sort -uc >/dev/null 2>&1); then
      :
     else
@@ -2669,7 +3797,7 @@ func_extract_archives ()
 	    darwin_file=
 	    darwin_files=
 	    for darwin_file in $darwin_filelist; do
-	      darwin_files=`find unfat-$$ -name $darwin_file -print | $NL2SP`
+	      darwin_files=`find unfat-$$ -name $darwin_file -print | sort | $NL2SP`
 	      $LIPO -create -output "$darwin_file" $darwin_files
 	    done # $darwin_filelist
 	    $RM -rf unfat-$$
@@ -2684,25 +3812,30 @@ func_extract_archives ()
         func_extract_an_archive "$my_xdir" "$my_xabs"
 	;;
       esac
-      my_oldobjs="$my_oldobjs "`find $my_xdir -name \*.$objext -print -o -name \*.lo -print | $NL2SP`
+      my_oldobjs="$my_oldobjs "`find $my_xdir -name \*.$objext -print -o -name \*.lo -print | sort | $NL2SP`
     done
 
     func_extract_archives_result="$my_oldobjs"
 }
 
 
-
-# func_emit_wrapper_part1 [arg=no]
+# func_emit_wrapper [arg=no]
+#
+# Emit a libtool wrapper script on stdout.
+# Don't directly open a file because we may want to
+# incorporate the script contents within a cygwin/mingw
+# wrapper executable.  Must ONLY be called from within
+# func_mode_link because it depends on a number of variables
+# set therein.
 #
-# Emit the first part of a libtool wrapper script on stdout.
-# For more information, see the description associated with
-# func_emit_wrapper(), below.
-func_emit_wrapper_part1 ()
+# ARG is the value that the WRAPPER_SCRIPT_BELONGS_IN_OBJDIR
+# variable will take.  If 'yes', then the emitted script
+# will assume that the directory in which it is stored is
+# the $objdir directory.  This is a cygwin/mingw-specific
+# behavior.
+func_emit_wrapper ()
 {
-	func_emit_wrapper_part1_arg1=no
-	if test -n "$1" ; then
-	  func_emit_wrapper_part1_arg1=$1
-	fi
+	func_emit_wrapper_arg1=${1-no}
 
 	$ECHO "\
 #! $SHELL
@@ -2718,7 +3851,6 @@ func_emit_wrapper_part1 ()
 
 # Sed substitution that helps us do robust quoting.  It backslashifies
 # metacharacters that are still active within double-quoted strings.
-Xsed='${SED} -e 1s/^X//'
 sed_quote_subst='$sed_quote_subst'
 
 # Be Bourne compatible
@@ -2749,31 +3881,135 @@ if test \"\$libtool_install_magic\" = \"$magic\"; then
 else
   # When we are sourced in execute mode, \$file and \$ECHO are already set.
   if test \"\$libtool_execute_magic\" != \"$magic\"; then
-    ECHO=\"$qecho\"
-    file=\"\$0\"
-    # Make sure echo works.
-    if test \"X\$1\" = X--no-reexec; then
-      # Discard the --no-reexec flag, and continue.
-      shift
-    elif test \"X\`{ \$ECHO '\t'; } 2>/dev/null\`\" = 'X\t'; then
-      # Yippee, \$ECHO works!
-      :
-    else
-      # Restart under the correct shell, and then maybe \$ECHO will work.
-      exec $SHELL \"\$0\" --no-reexec \${1+\"\$@\"}
-    fi
-  fi\
+    file=\"\$0\""
+
+    qECHO=`$ECHO "$ECHO" | $SED "$sed_quote_subst"`
+    $ECHO "\
+
+# A function that is used when there is no print builtin or printf.
+func_fallback_echo ()
+{
+  eval 'cat <<_LTECHO_EOF
+\$1
+_LTECHO_EOF'
+}
+    ECHO=\"$qECHO\"
+  fi
+
+# Very basic option parsing. These options are (a) specific to
+# the libtool wrapper, (b) are identical between the wrapper
+# /script/ and the wrapper /executable/ which is used only on
+# windows platforms, and (c) all begin with the string "--lt-"
+# (application programs are unlikely to have options which match
+# this pattern).
+#
+# There are only two supported options: --lt-debug and
+# --lt-dump-script. There is, deliberately, no --lt-help.
+#
+# The first argument to this parsing function should be the
+# script's $0 value, followed by "$@".
+lt_option_debug=
+func_parse_lt_options ()
+{
+  lt_script_arg0=\$0
+  shift
+  for lt_opt
+  do
+    case \"\$lt_opt\" in
+    --lt-debug) lt_option_debug=1 ;;
+    --lt-dump-script)
+        lt_dump_D=\`\$ECHO \"X\$lt_script_arg0\" | $SED -e 's/^X//' -e 's%/[^/]*$%%'\`
+        test \"X\$lt_dump_D\" = \"X\$lt_script_arg0\" && lt_dump_D=.
+        lt_dump_F=\`\$ECHO \"X\$lt_script_arg0\" | $SED -e 's/^X//' -e 's%^.*/%%'\`
+        cat \"\$lt_dump_D/\$lt_dump_F\"
+        exit 0
+      ;;
+    --lt-*)
+        \$ECHO \"Unrecognized --lt- option: '\$lt_opt'\" 1>&2
+        exit 1
+      ;;
+    esac
+  done
+
+  # Print the debug banner immediately:
+  if test -n \"\$lt_option_debug\"; then
+    echo \"${outputname}:${output}:\${LINENO}: libtool wrapper (GNU $PACKAGE$TIMESTAMP) $VERSION\" 1>&2
+  fi
+}
+
+# Used when --lt-debug. Prints its arguments to stdout
+# (redirection is the responsibility of the caller)
+func_lt_dump_args ()
+{
+  lt_dump_args_N=1;
+  for lt_arg
+  do
+    \$ECHO \"${outputname}:${output}:\${LINENO}: newargv[\$lt_dump_args_N]: \$lt_arg\"
+    lt_dump_args_N=\`expr \$lt_dump_args_N + 1\`
+  done
+}
+
+# Core function for launching the target application
+func_exec_program_core ()
+{
 "
-	$ECHO "\
+  case $host in
+  # Backslashes separate directories on plain windows
+  *-*-mingw | *-*-os2* | *-cegcc*)
+    $ECHO "\
+      if test -n \"\$lt_option_debug\"; then
+        \$ECHO \"${outputname}:${output}:\${LINENO}: newargv[0]: \$progdir\\\\\$program\" 1>&2
+        func_lt_dump_args \${1+\"\$@\"} 1>&2
+      fi
+      exec \"\$progdir\\\\\$program\" \${1+\"\$@\"}
+"
+    ;;
+
+  *)
+    $ECHO "\
+      if test -n \"\$lt_option_debug\"; then
+        \$ECHO \"${outputname}:${output}:\${LINENO}: newargv[0]: \$progdir/\$program\" 1>&2
+        func_lt_dump_args \${1+\"\$@\"} 1>&2
+      fi
+      exec \"\$progdir/\$program\" \${1+\"\$@\"}
+"
+    ;;
+  esac
+  $ECHO "\
+      \$ECHO \"\$0: cannot exec \$program \$*\" 1>&2
+      exit 1
+}
+
+# A function to encapsulate launching the target application
+# Strips options in the --lt-* namespace from \$@ and
+# launches target application with the remaining arguments.
+func_exec_program ()
+{
+  case \" \$* \" in
+  *\\ --lt-*)
+    for lt_wr_arg
+    do
+      case \$lt_wr_arg in
+      --lt-*) ;;
+      *) set x \"\$@\" \"\$lt_wr_arg\"; shift;;
+      esac
+      shift
+    done ;;
+  esac
+  func_exec_program_core \${1+\"\$@\"}
+}
+
+  # Parse options
+  func_parse_lt_options \"\$0\" \${1+\"\$@\"}
 
   # Find the directory that this script lives in.
-  thisdir=\`\$ECHO \"X\$file\" | \$Xsed -e 's%/[^/]*$%%'\`
+  thisdir=\`\$ECHO \"\$file\" | $SED 's%/[^/]*$%%'\`
   test \"x\$thisdir\" = \"x\$file\" && thisdir=.
 
   # Follow symbolic links until we get to the real thisdir.
-  file=\`ls -ld \"\$file\" | ${SED} -n 's/.*-> //p'\`
+  file=\`ls -ld \"\$file\" | $SED -n 's/.*-> //p'\`
   while test -n \"\$file\"; do
-    destdir=\`\$ECHO \"X\$file\" | \$Xsed -e 's%/[^/]*\$%%'\`
+    destdir=\`\$ECHO \"\$file\" | $SED 's%/[^/]*\$%%'\`
 
     # If there was a directory component, then change thisdir.
     if test \"x\$destdir\" != \"x\$file\"; then
@@ -2783,30 +4019,13 @@ else
       esac
     fi
 
-    file=\`\$ECHO \"X\$file\" | \$Xsed -e 's%^.*/%%'\`
-    file=\`ls -ld \"\$thisdir/\$file\" | ${SED} -n 's/.*-> //p'\`
+    file=\`\$ECHO \"\$file\" | $SED 's%^.*/%%'\`
+    file=\`ls -ld \"\$thisdir/\$file\" | $SED -n 's/.*-> //p'\`
   done
-"
-}
-# end: func_emit_wrapper_part1
-
-# func_emit_wrapper_part2 [arg=no]
-#
-# Emit the second part of a libtool wrapper script on stdout.
-# For more information, see the description associated with
-# func_emit_wrapper(), below.
-func_emit_wrapper_part2 ()
-{
-	func_emit_wrapper_part2_arg1=no
-	if test -n "$1" ; then
-	  func_emit_wrapper_part2_arg1=$1
-	fi
-
-	$ECHO "\
 
   # Usually 'no', except on cygwin/mingw when embedded into
   # the cwrapper.
-  WRAPPER_SCRIPT_BELONGS_IN_OBJDIR=$func_emit_wrapper_part2_arg1
+  WRAPPER_SCRIPT_BELONGS_IN_OBJDIR=$func_emit_wrapper_arg1
   if test \"\$WRAPPER_SCRIPT_BELONGS_IN_OBJDIR\" = \"yes\"; then
     # special case for '.'
     if test \"\$thisdir\" = \".\"; then
@@ -2814,7 +4033,7 @@ func_emit_wrapper_part2 ()
     fi
     # remove .libs from thisdir
     case \"\$thisdir\" in
-    *[\\\\/]$objdir ) thisdir=\`\$ECHO \"X\$thisdir\" | \$Xsed -e 's%[\\\\/][^\\\\/]*$%%'\` ;;
+    *[\\\\/]$objdir ) thisdir=\`\$ECHO \"\$thisdir\" | $SED 's%[\\\\/][^\\\\/]*$%%'\` ;;
     $objdir )   thisdir=. ;;
     esac
   fi
@@ -2869,6 +4088,18 @@ func_emit_wrapper_part2 ()
 
   if test -f \"\$progdir/\$program\"; then"
 
+	# fixup the dll searchpath if we need to.
+	#
+	# Fix the DLL searchpath if we need to.  Do this before prepending
+	# to shlibpath, because on Windows, both are PATH and uninstalled
+	# libraries must come first.
+	if test -n "$dllsearchpath"; then
+	  $ECHO "\
+    # Add the dll search path components to the executable PATH
+    PATH=$dllsearchpath:\$PATH
+"
+	fi
+
 	# Export our shlibpath_var if we have one.
 	if test "$shlibpath_overrides_runpath" = yes && test -n "$shlibpath_var" && test -n "$temp_rpath"; then
 	  $ECHO "\
@@ -2877,253 +4108,28 @@ func_emit_wrapper_part2 ()
 
     # Some systems cannot cope with colon-terminated $shlibpath_var
     # The second colon is a workaround for a bug in BeOS R4 sed
-    $shlibpath_var=\`\$ECHO \"X\$$shlibpath_var\" | \$Xsed -e 's/::*\$//'\`
+    $shlibpath_var=\`\$ECHO \"\$$shlibpath_var\" | $SED 's/::*\$//'\`
 
     export $shlibpath_var
 "
 	fi
 
-	# fixup the dll searchpath if we need to.
-	if test -n "$dllsearchpath"; then
-	  $ECHO "\
-    # Add the dll search path components to the executable PATH
-    PATH=$dllsearchpath:\$PATH
-"
-	fi
-
 	$ECHO "\
     if test \"\$libtool_execute_magic\" != \"$magic\"; then
       # Run the actual program with our arguments.
-"
-	case $host in
-	# Backslashes separate directories on plain windows
-	*-*-mingw | *-*-os2* | *-cegcc*)
-	  $ECHO "\
-      exec \"\$progdir\\\\\$program\" \${1+\"\$@\"}
-"
-	  ;;
-
-	*)
-	  $ECHO "\
-      exec \"\$progdir/\$program\" \${1+\"\$@\"}
-"
-	  ;;
-	esac
-	$ECHO "\
-      \$ECHO \"\$0: cannot exec \$program \$*\" 1>&2
-      exit 1
+      func_exec_program \${1+\"\$@\"}
     fi
   else
     # The program doesn't exist.
     \$ECHO \"\$0: error: \\\`\$progdir/\$program' does not exist\" 1>&2
     \$ECHO \"This script is just a wrapper for \$program.\" 1>&2
-    $ECHO \"See the $PACKAGE documentation for more information.\" 1>&2
+    \$ECHO \"See the $PACKAGE documentation for more information.\" 1>&2
     exit 1
   fi
 fi\
 "
 }
-# end: func_emit_wrapper_part2
-
-
-# func_emit_wrapper [arg=no]
-#
-# Emit a libtool wrapper script on stdout.
-# Don't directly open a file because we may want to
-# incorporate the script contents within a cygwin/mingw
-# wrapper executable.  Must ONLY be called from within
-# func_mode_link because it depends on a number of variables
-# set therein.
-#
-# ARG is the value that the WRAPPER_SCRIPT_BELONGS_IN_OBJDIR
-# variable will take.  If 'yes', then the emitted script
-# will assume that the directory in which it is stored is
-# the $objdir directory.  This is a cygwin/mingw-specific
-# behavior.
-func_emit_wrapper ()
-{
-	func_emit_wrapper_arg1=no
-	if test -n "$1" ; then
-	  func_emit_wrapper_arg1=$1
-	fi
-
-	# split this up so that func_emit_cwrapperexe_src
-	# can call each part independently.
-	func_emit_wrapper_part1 "${func_emit_wrapper_arg1}"
-	func_emit_wrapper_part2 "${func_emit_wrapper_arg1}"
-}
-
-
-# func_to_host_path arg
-#
-# Convert paths to host format when used with build tools.
-# Intended for use with "native" mingw (where libtool itself
-# is running under the msys shell), or in the following cross-
-# build environments:
-#    $build          $host
-#    mingw (msys)    mingw  [e.g. native]
-#    cygwin          mingw
-#    *nix + wine     mingw
-# where wine is equipped with the `winepath' executable.
-# In the native mingw case, the (msys) shell automatically
-# converts paths for any non-msys applications it launches,
-# but that facility isn't available from inside the cwrapper.
-# Similar accommodations are necessary for $host mingw and
-# $build cygwin.  Calling this function does no harm for other
-# $host/$build combinations not listed above.
-#
-# ARG is the path (on $build) that should be converted to
-# the proper representation for $host. The result is stored
-# in $func_to_host_path_result.
-func_to_host_path ()
-{
-  func_to_host_path_result="$1"
-  if test -n "$1" ; then
-    case $host in
-      *mingw* )
-        lt_sed_naive_backslashify='s|\\\\*|\\|g;s|/|\\|g;s|\\|\\\\|g'
-        case $build in
-          *mingw* ) # actually, msys
-            # awkward: cmd appends spaces to result
-            lt_sed_strip_trailing_spaces="s/[ ]*\$//"
-            func_to_host_path_tmp1=`( cmd //c echo "$1" |\
-              $SED -e "$lt_sed_strip_trailing_spaces" ) 2>/dev/null || echo ""`
-            func_to_host_path_result=`echo "$func_to_host_path_tmp1" |\
-              $SED -e "$lt_sed_naive_backslashify"`
-            ;;
-          *cygwin* )
-            func_to_host_path_tmp1=`cygpath -w "$1"`
-            func_to_host_path_result=`echo "$func_to_host_path_tmp1" |\
-              $SED -e "$lt_sed_naive_backslashify"`
-            ;;
-          * )
-            # Unfortunately, winepath does not exit with a non-zero
-            # error code, so we are forced to check the contents of
-            # stdout. On the other hand, if the command is not
-            # found, the shell will set an exit code of 127 and print
-            # *an error message* to stdout. So we must check for both
-            # error code of zero AND non-empty stdout, which explains
-            # the odd construction:
-            func_to_host_path_tmp1=`winepath -w "$1" 2>/dev/null`
-            if test "$?" -eq 0 && test -n "${func_to_host_path_tmp1}"; then
-              func_to_host_path_result=`echo "$func_to_host_path_tmp1" |\
-                $SED -e "$lt_sed_naive_backslashify"`
-            else
-              # Allow warning below.
-              func_to_host_path_result=""
-            fi
-            ;;
-        esac
-        if test -z "$func_to_host_path_result" ; then
-          func_error "Could not determine host path corresponding to"
-          func_error "  '$1'"
-          func_error "Continuing, but uninstalled executables may not work."
-          # Fallback:
-          func_to_host_path_result="$1"
-        fi
-        ;;
-    esac
-  fi
-}
-# end: func_to_host_path
 
-# func_to_host_pathlist arg
-#
-# Convert pathlists to host format when used with build tools.
-# See func_to_host_path(), above. This function supports the
-# following $build/$host combinations (but does no harm for
-# combinations not listed here):
-#    $build          $host
-#    mingw (msys)    mingw  [e.g. native]
-#    cygwin          mingw
-#    *nix + wine     mingw
-#
-# Path separators are also converted from $build format to
-# $host format. If ARG begins or ends with a path separator
-# character, it is preserved (but converted to $host format)
-# on output.
-#
-# ARG is a pathlist (on $build) that should be converted to
-# the proper representation on $host. The result is stored
-# in $func_to_host_pathlist_result.
-func_to_host_pathlist ()
-{
-  func_to_host_pathlist_result="$1"
-  if test -n "$1" ; then
-    case $host in
-      *mingw* )
-        lt_sed_naive_backslashify='s|\\\\*|\\|g;s|/|\\|g;s|\\|\\\\|g'
-        # Remove leading and trailing path separator characters from
-        # ARG. msys behavior is inconsistent here, cygpath turns them
-        # into '.;' and ';.', and winepath ignores them completely.
-        func_to_host_pathlist_tmp2="$1"
-        # Once set for this call, this variable should not be
-        # reassigned. It is used in tha fallback case.
-        func_to_host_pathlist_tmp1=`echo "$func_to_host_pathlist_tmp2" |\
-          $SED -e 's|^:*||' -e 's|:*$||'`
-        case $build in
-          *mingw* ) # Actually, msys.
-            # Awkward: cmd appends spaces to result.
-            lt_sed_strip_trailing_spaces="s/[ ]*\$//"
-            func_to_host_pathlist_tmp2=`( cmd //c echo "$func_to_host_pathlist_tmp1" |\
-              $SED -e "$lt_sed_strip_trailing_spaces" ) 2>/dev/null || echo ""`
-            func_to_host_pathlist_result=`echo "$func_to_host_pathlist_tmp2" |\
-              $SED -e "$lt_sed_naive_backslashify"`
-            ;;
-          *cygwin* )
-            func_to_host_pathlist_tmp2=`cygpath -w -p "$func_to_host_pathlist_tmp1"`
-            func_to_host_pathlist_result=`echo "$func_to_host_pathlist_tmp2" |\
-              $SED -e "$lt_sed_naive_backslashify"`
-            ;;
-          * )
-            # unfortunately, winepath doesn't convert pathlists
-            func_to_host_pathlist_result=""
-            func_to_host_pathlist_oldIFS=$IFS
-            IFS=:
-            for func_to_host_pathlist_f in $func_to_host_pathlist_tmp1 ; do
-              IFS=$func_to_host_pathlist_oldIFS
-              if test -n "$func_to_host_pathlist_f" ; then
-                func_to_host_path "$func_to_host_pathlist_f"
-                if test -n "$func_to_host_path_result" ; then
-                  if test -z "$func_to_host_pathlist_result" ; then
-                    func_to_host_pathlist_result="$func_to_host_path_result"
-                  else
-                    func_to_host_pathlist_result="$func_to_host_pathlist_result;$func_to_host_path_result"
-                  fi
-                fi
-              fi
-              IFS=:
-            done
-            IFS=$func_to_host_pathlist_oldIFS
-            ;;
-        esac
-        if test -z "$func_to_host_pathlist_result" ; then
-          func_error "Could not determine the host path(s) corresponding to"
-          func_error "  '$1'"
-          func_error "Continuing, but uninstalled executables may not work."
-          # Fallback. This may break if $1 contains DOS-style drive
-          # specifications. The fix is not to complicate the expression
-          # below, but for the user to provide a working wine installation
-          # with winepath so that path translation in the cross-to-mingw
-          # case works properly.
-          lt_replace_pathsep_nix_to_dos="s|:|;|g"
-          func_to_host_pathlist_result=`echo "$func_to_host_pathlist_tmp1" |\
-            $SED -e "$lt_replace_pathsep_nix_to_dos"`
-        fi
-        # Now, add the leading and trailing path separators back
-        case "$1" in
-          :* ) func_to_host_pathlist_result=";$func_to_host_pathlist_result"
-            ;;
-        esac
-        case "$1" in
-          *: ) func_to_host_pathlist_result="$func_to_host_pathlist_result;"
-            ;;
-        esac
-        ;;
-    esac
-  fi
-}
-# end: func_to_host_pathlist
 
 # func_emit_cwrapperexe_src
 # emit the source code for a wrapper executable on stdout
@@ -3141,31 +4147,23 @@ func_emit_cwrapperexe_src ()
 
    This wrapper executable should never be moved out of the build directory.
    If it is, it will not operate correctly.
-
-   Currently, it simply execs the wrapper *script* "$SHELL $output",
-   but could eventually absorb all of the scripts functionality and
-   exec $objdir/$outputname directly.
 */
 EOF
 	    cat <<"EOF"
+#ifdef _MSC_VER
+# define _CRT_SECURE_NO_DEPRECATE 1
+#endif
 #include <stdio.h>
 #include <stdlib.h>
 #ifdef _MSC_VER
 # include <direct.h>
 # include <process.h>
 # include <io.h>
-# define setmode _setmode
 #else
 # include <unistd.h>
 # include <stdint.h>
 # ifdef __CYGWIN__
 #  include <io.h>
-#  define HAVE_SETENV
-#  ifdef __STRICT_ANSI__
-char *realpath (const char *, char *);
-int putenv (char *);
-int setenv (const char *, const char *, int);
-#  endif
 # endif
 #endif
 #include <malloc.h>
@@ -3177,6 +4175,44 @@ int setenv (const char *, const char *, int);
 #include <fcntl.h>
 #include <sys/stat.h>
 
+/* declarations of non-ANSI functions */
+#if defined(__MINGW32__)
+# ifdef __STRICT_ANSI__
+int _putenv (const char *);
+# endif
+#elif defined(__CYGWIN__)
+# ifdef __STRICT_ANSI__
+char *realpath (const char *, char *);
+int putenv (char *);
+int setenv (const char *, const char *, int);
+# endif
+/* #elif defined (other platforms) ... */
+#endif
+
+/* portability defines, excluding path handling macros */
+#if defined(_MSC_VER)
+# define setmode _setmode
+# define stat    _stat
+# define chmod   _chmod
+# define getcwd  _getcwd
+# define putenv  _putenv
+# define S_IXUSR _S_IEXEC
+# ifndef _INTPTR_T_DEFINED
+#  define _INTPTR_T_DEFINED
+#  define intptr_t int
+# endif
+#elif defined(__MINGW32__)
+# define setmode _setmode
+# define stat    _stat
+# define chmod   _chmod
+# define getcwd  _getcwd
+# define putenv  _putenv
+#elif defined(__CYGWIN__)
+# define HAVE_SETENV
+# define FOPEN_WB "wb"
+/* #elif defined (other platforms) ... */
+#endif
+
 #if defined(PATH_MAX)
 # define LT_PATHMAX PATH_MAX
 #elif defined(MAXPATHLEN)
@@ -3192,14 +4228,7 @@ int setenv (const char *, const char *, int);
 # define S_IXGRP 0
 #endif
 
-#ifdef _MSC_VER
-# define S_IXUSR _S_IEXEC
-# define stat _stat
-# ifndef _INTPTR_T_DEFINED
-#  define intptr_t int
-# endif
-#endif
-
+/* path handling portability macros */
 #ifndef DIR_SEPARATOR
 # define DIR_SEPARATOR '/'
 # define PATH_SEPARATOR ':'
@@ -3230,10 +4259,6 @@ int setenv (const char *, const char *, int);
 # define IS_PATH_SEPARATOR(ch) ((ch) == PATH_SEPARATOR_2)
 #endif /* PATH_SEPARATOR_2 */
 
-#ifdef __CYGWIN__
-# define FOPEN_WB "wb"
-#endif
-
 #ifndef FOPEN_WB
 # define FOPEN_WB "w"
 #endif
@@ -3246,22 +4271,13 @@ int setenv (const char *, const char *, int);
   if (stale) { free ((void *) stale); stale = 0; } \
 } while (0)
 
-#undef LTWRAPPER_DEBUGPRINTF
-#if defined DEBUGWRAPPER
-# define LTWRAPPER_DEBUGPRINTF(args) ltwrapper_debugprintf args
-static void
-ltwrapper_debugprintf (const char *fmt, ...)
-{
-    va_list args;
-    va_start (args, fmt);
-    (void) vfprintf (stderr, fmt, args);
-    va_end (args);
-}
+#if defined(LT_DEBUGWRAPPER)
+static int lt_debug = 1;
 #else
-# define LTWRAPPER_DEBUGPRINTF(args)
+static int lt_debug = 0;
 #endif
 
-const char *program_name = NULL;
+const char *program_name = "libtool-wrapper"; /* in case xstrdup fails */
 
 void *xmalloc (size_t num);
 char *xstrdup (const char *string);
@@ -3271,41 +4287,27 @@ char *chase_symlinks (const char *pathspec);
 int make_executable (const char *path);
 int check_executable (const char *path);
 char *strendzap (char *str, const char *pat);
-void lt_fatal (const char *message, ...);
+void lt_debugprintf (const char *file, int line, const char *fmt, ...);
+void lt_fatal (const char *file, int line, const char *message, ...);
+static const char *nonnull (const char *s);
+static const char *nonempty (const char *s);
 void lt_setenv (const char *name, const char *value);
 char *lt_extend_str (const char *orig_value, const char *add, int to_end);
-void lt_opt_process_env_set (const char *arg);
-void lt_opt_process_env_prepend (const char *arg);
-void lt_opt_process_env_append (const char *arg);
-int lt_split_name_value (const char *arg, char** name, char** value);
 void lt_update_exe_path (const char *name, const char *value);
 void lt_update_lib_path (const char *name, const char *value);
-
-static const char *script_text_part1 =
-EOF
-
-	    func_emit_wrapper_part1 yes |
-	        $SED -e 's/\([\\"]\)/\\\1/g' \
-	             -e 's/^/  "/' -e 's/$/\\n"/'
-	    echo ";"
-	    cat <<EOF
-
-static const char *script_text_part2 =
+char **prepare_spawn (char **argv);
+void lt_dump_script (FILE *f);
 EOF
-	    func_emit_wrapper_part2 yes |
-	        $SED -e 's/\([\\"]\)/\\\1/g' \
-	             -e 's/^/  "/' -e 's/$/\\n"/'
-	    echo ";"
 
 	    cat <<EOF
-const char * MAGIC_EXE = "$magic_exe";
+volatile const char * MAGIC_EXE = "$magic_exe";
 const char * LIB_PATH_VARNAME = "$shlibpath_var";
 EOF
 
 	    if test "$shlibpath_overrides_runpath" = yes && test -n "$shlibpath_var" && test -n "$temp_rpath"; then
-              func_to_host_pathlist "$temp_rpath"
+              func_to_host_path "$temp_rpath"
 	      cat <<EOF
-const char * LIB_PATH_VALUE   = "$func_to_host_pathlist_result";
+const char * LIB_PATH_VALUE   = "$func_to_host_path_result";
 EOF
 	    else
 	      cat <<"EOF"
@@ -3314,10 +4316,10 @@ EOF
 	    fi
 
 	    if test -n "$dllsearchpath"; then
-              func_to_host_pathlist "$dllsearchpath:"
+              func_to_host_path "$dllsearchpath:"
 	      cat <<EOF
 const char * EXE_PATH_VARNAME = "PATH";
-const char * EXE_PATH_VALUE   = "$func_to_host_pathlist_result";
+const char * EXE_PATH_VALUE   = "$func_to_host_path_result";
 EOF
 	    else
 	      cat <<"EOF"
@@ -3340,24 +4342,10 @@ EOF
 	    cat <<"EOF"
 
 #define LTWRAPPER_OPTION_PREFIX         "--lt-"
-#define LTWRAPPER_OPTION_PREFIX_LENGTH  5
 
-static const size_t opt_prefix_len         = LTWRAPPER_OPTION_PREFIX_LENGTH;
 static const char *ltwrapper_option_prefix = LTWRAPPER_OPTION_PREFIX;
-
 static const char *dumpscript_opt       = LTWRAPPER_OPTION_PREFIX "dump-script";
-
-static const size_t env_set_opt_len     = LTWRAPPER_OPTION_PREFIX_LENGTH + 7;
-static const char *env_set_opt          = LTWRAPPER_OPTION_PREFIX "env-set";
-  /* argument is putenv-style "foo=bar", value of foo is set to bar */
-
-static const size_t env_prepend_opt_len = LTWRAPPER_OPTION_PREFIX_LENGTH + 11;
-static const char *env_prepend_opt      = LTWRAPPER_OPTION_PREFIX "env-prepend";
-  /* argument is putenv-style "foo=bar", new value of foo is bar${foo} */
-
-static const size_t env_append_opt_len  = LTWRAPPER_OPTION_PREFIX_LENGTH + 10;
-static const char *env_append_opt       = LTWRAPPER_OPTION_PREFIX "env-append";
-  /* argument is putenv-style "foo=bar", new value of foo is ${foo}bar */
+static const char *debug_opt            = LTWRAPPER_OPTION_PREFIX "debug";
 
 int
 main (int argc, char *argv[])
@@ -3374,10 +4362,13 @@ main (int argc, char *argv[])
   int i;
 
   program_name = (char *) xstrdup (base_name (argv[0]));
-  LTWRAPPER_DEBUGPRINTF (("(main) argv[0]      : %s\n", argv[0]));
-  LTWRAPPER_DEBUGPRINTF (("(main) program_name : %s\n", program_name));
+  newargz = XMALLOC (char *, argc + 1);
 
-  /* very simple arg parsing; don't want to rely on getopt */
+  /* very simple arg parsing; don't want to rely on getopt
+   * also, copy all non cwrapper options to newargz, except
+   * argz[0], which is handled differently
+   */
+  newargc=0;
   for (i = 1; i < argc; i++)
     {
       if (strcmp (argv[i], dumpscript_opt) == 0)
@@ -3391,25 +4382,57 @@ EOF
 	      esac
 
 	    cat <<"EOF"
-	  printf ("%s", script_text_part1);
-	  printf ("%s", script_text_part2);
+	  lt_dump_script (stdout);
 	  return 0;
 	}
+      if (strcmp (argv[i], debug_opt) == 0)
+	{
+          lt_debug = 1;
+          continue;
+	}
+      if (strcmp (argv[i], ltwrapper_option_prefix) == 0)
+        {
+          /* however, if there is an option in the LTWRAPPER_OPTION_PREFIX
+             namespace, but it is not one of the ones we know about and
+             have already dealt with, above (inluding dump-script), then
+             report an error. Otherwise, targets might begin to believe
+             they are allowed to use options in the LTWRAPPER_OPTION_PREFIX
+             namespace. The first time any user complains about this, we'll
+             need to make LTWRAPPER_OPTION_PREFIX a configure-time option
+             or a configure.ac-settable value.
+           */
+          lt_fatal (__FILE__, __LINE__,
+		    "unrecognized %s option: '%s'",
+                    ltwrapper_option_prefix, argv[i]);
+        }
+      /* otherwise ... */
+      newargz[++newargc] = xstrdup (argv[i]);
     }
+  newargz[++newargc] = NULL;
+
+EOF
+	    cat <<EOF
+  /* The GNU banner must be the first non-error debug message */
+  lt_debugprintf (__FILE__, __LINE__, "libtool wrapper (GNU $PACKAGE$TIMESTAMP) $VERSION\n");
+EOF
+	    cat <<"EOF"
+  lt_debugprintf (__FILE__, __LINE__, "(main) argv[0]: %s\n", argv[0]);
+  lt_debugprintf (__FILE__, __LINE__, "(main) program_name: %s\n", program_name);
 
-  newargz = XMALLOC (char *, argc + 1);
   tmp_pathspec = find_executable (argv[0]);
   if (tmp_pathspec == NULL)
-    lt_fatal ("Couldn't find %s", argv[0]);
-  LTWRAPPER_DEBUGPRINTF (("(main) found exe (before symlink chase) at : %s\n",
-			  tmp_pathspec));
+    lt_fatal (__FILE__, __LINE__, "couldn't find %s", argv[0]);
+  lt_debugprintf (__FILE__, __LINE__,
+                  "(main) found exe (before symlink chase) at: %s\n",
+		  tmp_pathspec);
 
   actual_cwrapper_path = chase_symlinks (tmp_pathspec);
-  LTWRAPPER_DEBUGPRINTF (("(main) found exe (after symlink chase) at : %s\n",
-			  actual_cwrapper_path));
+  lt_debugprintf (__FILE__, __LINE__,
+                  "(main) found exe (after symlink chase) at: %s\n",
+		  actual_cwrapper_path);
   XFREE (tmp_pathspec);
 
-  actual_cwrapper_name = xstrdup( base_name (actual_cwrapper_path));
+  actual_cwrapper_name = xstrdup (base_name (actual_cwrapper_path));
   strendzap (actual_cwrapper_path, actual_cwrapper_name);
 
   /* wrapper name transforms */
@@ -3427,8 +4450,9 @@ EOF
   target_name = tmp_pathspec;
   tmp_pathspec = 0;
 
-  LTWRAPPER_DEBUGPRINTF (("(main) libtool target name: %s\n",
-			  target_name));
+  lt_debugprintf (__FILE__, __LINE__,
+		  "(main) libtool target name: %s\n",
+		  target_name);
 EOF
 
 	    cat <<EOF
@@ -3478,80 +4502,19 @@ EOF
 
   lt_setenv ("BIN_SH", "xpg4"); /* for Tru64 */
   lt_setenv ("DUALCASE", "1");  /* for MSK sh */
-  lt_update_lib_path (LIB_PATH_VARNAME, LIB_PATH_VALUE);
+  /* Update the DLL searchpath.  EXE_PATH_VALUE ($dllsearchpath) must
+     be prepended before (that is, appear after) LIB_PATH_VALUE ($temp_rpath)
+     because on Windows, both *_VARNAMEs are PATH but uninstalled
+     libraries must come first. */
   lt_update_exe_path (EXE_PATH_VARNAME, EXE_PATH_VALUE);
+  lt_update_lib_path (LIB_PATH_VARNAME, LIB_PATH_VALUE);
 
-  newargc=0;
-  for (i = 1; i < argc; i++)
-    {
-      if (strncmp (argv[i], env_set_opt, env_set_opt_len) == 0)
-        {
-          if (argv[i][env_set_opt_len] == '=')
-            {
-              const char *p = argv[i] + env_set_opt_len + 1;
-              lt_opt_process_env_set (p);
-            }
-          else if (argv[i][env_set_opt_len] == '\0' && i + 1 < argc)
-            {
-              lt_opt_process_env_set (argv[++i]); /* don't copy */
-            }
-          else
-            lt_fatal ("%s missing required argument", env_set_opt);
-          continue;
-        }
-      if (strncmp (argv[i], env_prepend_opt, env_prepend_opt_len) == 0)
-        {
-          if (argv[i][env_prepend_opt_len] == '=')
-            {
-              const char *p = argv[i] + env_prepend_opt_len + 1;
-              lt_opt_process_env_prepend (p);
-            }
-          else if (argv[i][env_prepend_opt_len] == '\0' && i + 1 < argc)
-            {
-              lt_opt_process_env_prepend (argv[++i]); /* don't copy */
-            }
-          else
-            lt_fatal ("%s missing required argument", env_prepend_opt);
-          continue;
-        }
-      if (strncmp (argv[i], env_append_opt, env_append_opt_len) == 0)
-        {
-          if (argv[i][env_append_opt_len] == '=')
-            {
-              const char *p = argv[i] + env_append_opt_len + 1;
-              lt_opt_process_env_append (p);
-            }
-          else if (argv[i][env_append_opt_len] == '\0' && i + 1 < argc)
-            {
-              lt_opt_process_env_append (argv[++i]); /* don't copy */
-            }
-          else
-            lt_fatal ("%s missing required argument", env_append_opt);
-          continue;
-        }
-      if (strncmp (argv[i], ltwrapper_option_prefix, opt_prefix_len) == 0)
-        {
-          /* however, if there is an option in the LTWRAPPER_OPTION_PREFIX
-             namespace, but it is not one of the ones we know about and
-             have already dealt with, above (inluding dump-script), then
-             report an error. Otherwise, targets might begin to believe
-             they are allowed to use options in the LTWRAPPER_OPTION_PREFIX
-             namespace. The first time any user complains about this, we'll
-             need to make LTWRAPPER_OPTION_PREFIX a configure-time option
-             or a configure.ac-settable value.
-           */
-          lt_fatal ("Unrecognized option in %s namespace: '%s'",
-                    ltwrapper_option_prefix, argv[i]);
-        }
-      /* otherwise ... */
-      newargz[++newargc] = xstrdup (argv[i]);
-    }
-  newargz[++newargc] = NULL;
-
-  LTWRAPPER_DEBUGPRINTF     (("(main) lt_argv_zero : %s\n", (lt_argv_zero ? lt_argv_zero : "<NULL>")));
+  lt_debugprintf (__FILE__, __LINE__, "(main) lt_argv_zero: %s\n",
+		  nonnull (lt_argv_zero));
   for (i = 0; i < newargc; i++)
     {
-      LTWRAPPER_DEBUGPRINTF (("(main) newargz[%d]   : %s\n", i, (newargz[i] ? newargz[i] : "<NULL>")));
+      lt_debugprintf (__FILE__, __LINE__, "(main) newargz[%d]: %s\n",
+		      i, nonnull (newargz[i]));
     }
 
 EOF
@@ -3560,11 +4523,14 @@ EOF
 	      mingw*)
 		cat <<"EOF"
   /* execv doesn't actually work on mingw as expected on unix */
+  newargz = prepare_spawn (newargz);
   rval = _spawnv (_P_WAIT, lt_argv_zero, (const char * const *) newargz);
   if (rval == -1)
     {
       /* failed to start process */
-      LTWRAPPER_DEBUGPRINTF (("(main) failed to launch target \"%s\": errno = %d\n", lt_argv_zero, errno));
+      lt_debugprintf (__FILE__, __LINE__,
+		      "(main) failed to launch target \"%s\": %s\n",
+		      lt_argv_zero, nonnull (strerror (errno)));
       return 127;
     }
   return rval;
@@ -3586,7 +4552,7 @@ xmalloc (size_t num)
 {
   void *p = (void *) malloc (num);
   if (!p)
-    lt_fatal ("Memory exhausted");
+    lt_fatal (__FILE__, __LINE__, "memory exhausted");
 
   return p;
 }
@@ -3620,8 +4586,8 @@ check_executable (const char *path)
 {
   struct stat st;
 
-  LTWRAPPER_DEBUGPRINTF (("(check_executable)  : %s\n",
-			  path ? (*path ? path : "EMPTY!") : "NULL!"));
+  lt_debugprintf (__FILE__, __LINE__, "(check_executable): %s\n",
+                  nonempty (path));
   if ((!path) || (!*path))
     return 0;
 
@@ -3638,8 +4604,8 @@ make_executable (const char *path)
   int rval = 0;
   struct stat st;
 
-  LTWRAPPER_DEBUGPRINTF (("(make_executable)   : %s\n",
-			  path ? (*path ? path : "EMPTY!") : "NULL!"));
+  lt_debugprintf (__FILE__, __LINE__, "(make_executable): %s\n",
+                  nonempty (path));
   if ((!path) || (!*path))
     return 0;
 
@@ -3665,8 +4631,8 @@ find_executable (const char *wrapper)
   int tmp_len;
   char *concat_name;
 
-  LTWRAPPER_DEBUGPRINTF (("(find_executable)   : %s\n",
-			  wrapper ? (*wrapper ? wrapper : "EMPTY!") : "NULL!"));
+  lt_debugprintf (__FILE__, __LINE__, "(find_executable): %s\n",
+                  nonempty (wrapper));
 
   if ((wrapper == NULL) || (*wrapper == '\0'))
     return NULL;
@@ -3719,7 +4685,8 @@ find_executable (const char *wrapper)
 		{
 		  /* empty path: current directory */
 		  if (getcwd (tmp, LT_PATHMAX) == NULL)
-		    lt_fatal ("getcwd failed");
+		    lt_fatal (__FILE__, __LINE__, "getcwd failed: %s",
+                              nonnull (strerror (errno)));
 		  tmp_len = strlen (tmp);
 		  concat_name =
 		    XMALLOC (char, tmp_len + 1 + strlen (wrapper) + 1);
@@ -3744,7 +4711,8 @@ find_executable (const char *wrapper)
     }
   /* Relative path | not found in path: prepend cwd */
   if (getcwd (tmp, LT_PATHMAX) == NULL)
-    lt_fatal ("getcwd failed");
+    lt_fatal (__FILE__, __LINE__, "getcwd failed: %s",
+              nonnull (strerror (errno)));
   tmp_len = strlen (tmp);
   concat_name = XMALLOC (char, tmp_len + 1 + strlen (wrapper) + 1);
   memcpy (concat_name, tmp, tmp_len);
@@ -3770,8 +4738,9 @@ chase_symlinks (const char *pathspec)
   int has_symlinks = 0;
   while (strlen (tmp_pathspec) && !has_symlinks)
     {
-      LTWRAPPER_DEBUGPRINTF (("checking path component for symlinks: %s\n",
-			      tmp_pathspec));
+      lt_debugprintf (__FILE__, __LINE__,
+		      "checking path component for symlinks: %s\n",
+		      tmp_pathspec);
       if (lstat (tmp_pathspec, &s) == 0)
 	{
 	  if (S_ISLNK (s.st_mode) != 0)
@@ -3793,8 +4762,9 @@ chase_symlinks (const char *pathspec)
 	}
       else
 	{
-	  char *errstr = strerror (errno);
-	  lt_fatal ("Error accessing file %s (%s)", tmp_pathspec, errstr);
+	  lt_fatal (__FILE__, __LINE__,
+		    "error accessing file \"%s\": %s",
+		    tmp_pathspec, nonnull (strerror (errno)));
 	}
     }
   XFREE (tmp_pathspec);
@@ -3807,7 +4777,8 @@ chase_symlinks (const char *pathspec)
   tmp_pathspec = realpath (pathspec, buf);
   if (tmp_pathspec == 0)
     {
-      lt_fatal ("Could not follow symlinks for %s", pathspec);
+      lt_fatal (__FILE__, __LINE__,
+		"could not follow symlinks for %s", pathspec);
     }
   return xstrdup (tmp_pathspec);
 #endif
@@ -3833,11 +4804,25 @@ strendzap (char *str, const char *pat)
   return str;
 }
 
+void
+lt_debugprintf (const char *file, int line, const char *fmt, ...)
+{
+  va_list args;
+  if (lt_debug)
+    {
+      (void) fprintf (stderr, "%s:%s:%d: ", program_name, file, line);
+      va_start (args, fmt);
+      (void) vfprintf (stderr, fmt, args);
+      va_end (args);
+    }
+}
+
 static void
-lt_error_core (int exit_status, const char *mode,
+lt_error_core (int exit_status, const char *file,
+	       int line, const char *mode,
 	       const char *message, va_list ap)
 {
-  fprintf (stderr, "%s: %s: ", program_name, mode);
+  fprintf (stderr, "%s:%s:%d: %s: ", program_name, file, line, mode);
   vfprintf (stderr, message, ap);
   fprintf (stderr, ".\n");
 
@@ -3846,20 +4831,32 @@ lt_error_core (int exit_status, const char *mode,
 }
 
 void
-lt_fatal (const char *message, ...)
+lt_fatal (const char *file, int line, const char *message, ...)
 {
   va_list ap;
   va_start (ap, message);
-  lt_error_core (EXIT_FAILURE, "FATAL", message, ap);
+  lt_error_core (EXIT_FAILURE, file, line, "FATAL", message, ap);
   va_end (ap);
 }
 
+static const char *
+nonnull (const char *s)
+{
+  return s ? s : "(null)";
+}
+
+static const char *
+nonempty (const char *s)
+{
+  return (s && !*s) ? "(empty)" : nonnull (s);
+}
+
 void
 lt_setenv (const char *name, const char *value)
 {
-  LTWRAPPER_DEBUGPRINTF (("(lt_setenv) setting '%s' to '%s'\n",
-                          (name ? name : "<NULL>"),
-                          (value ? value : "<NULL>")));
+  lt_debugprintf (__FILE__, __LINE__,
+		  "(lt_setenv) setting '%s' to '%s'\n",
+                  nonnull (name), nonnull (value));
   {
 #ifdef HAVE_SETENV
     /* always make a copy, for consistency with !HAVE_SETENV */
@@ -3904,95 +4901,12 @@ lt_extend_str (const char *orig_value, const char *add, int to_end)
   return new_value;
 }
 
-int
-lt_split_name_value (const char *arg, char** name, char** value)
-{
-  const char *p;
-  int len;
-  if (!arg || !*arg)
-    return 1;
-
-  p = strchr (arg, (int)'=');
-
-  if (!p)
-    return 1;
-
-  *value = xstrdup (++p);
-
-  len = strlen (arg) - strlen (*value);
-  *name = XMALLOC (char, len);
-  strncpy (*name, arg, len-1);
-  (*name)[len - 1] = '\0';
-
-  return 0;
-}
-
-void
-lt_opt_process_env_set (const char *arg)
-{
-  char *name = NULL;
-  char *value = NULL;
-
-  if (lt_split_name_value (arg, &name, &value) != 0)
-    {
-      XFREE (name);
-      XFREE (value);
-      lt_fatal ("bad argument for %s: '%s'", env_set_opt, arg);
-    }
-
-  lt_setenv (name, value);
-  XFREE (name);
-  XFREE (value);
-}
-
-void
-lt_opt_process_env_prepend (const char *arg)
-{
-  char *name = NULL;
-  char *value = NULL;
-  char *new_value = NULL;
-
-  if (lt_split_name_value (arg, &name, &value) != 0)
-    {
-      XFREE (name);
-      XFREE (value);
-      lt_fatal ("bad argument for %s: '%s'", env_prepend_opt, arg);
-    }
-
-  new_value = lt_extend_str (getenv (name), value, 0);
-  lt_setenv (name, new_value);
-  XFREE (new_value);
-  XFREE (name);
-  XFREE (value);
-}
-
-void
-lt_opt_process_env_append (const char *arg)
-{
-  char *name = NULL;
-  char *value = NULL;
-  char *new_value = NULL;
-
-  if (lt_split_name_value (arg, &name, &value) != 0)
-    {
-      XFREE (name);
-      XFREE (value);
-      lt_fatal ("bad argument for %s: '%s'", env_append_opt, arg);
-    }
-
-  new_value = lt_extend_str (getenv (name), value, 1);
-  lt_setenv (name, new_value);
-  XFREE (new_value);
-  XFREE (name);
-  XFREE (value);
-}
-
 void
 lt_update_exe_path (const char *name, const char *value)
 {
-  LTWRAPPER_DEBUGPRINTF (("(lt_update_exe_path) modifying '%s' by prepending '%s'\n",
-                          (name ? name : "<NULL>"),
-                          (value ? value : "<NULL>")));
+  lt_debugprintf (__FILE__, __LINE__,
+		  "(lt_update_exe_path) modifying '%s' by prepending '%s'\n",
+                  nonnull (name), nonnull (value));
 
   if (name && *name && value && *value)
     {
@@ -4011,9 +4925,9 @@ lt_update_exe_path (const char *name, const char *value)
 void
 lt_update_lib_path (const char *name, const char *value)
 {
-  LTWRAPPER_DEBUGPRINTF (("(lt_update_lib_path) modifying '%s' by prepending '%s'\n",
-                          (name ? name : "<NULL>"),
-                          (value ? value : "<NULL>")));
+  lt_debugprintf (__FILE__, __LINE__,
+		  "(lt_update_lib_path) modifying '%s' by prepending '%s'\n",
+                  nonnull (name), nonnull (value));
 
   if (name && *name && value && *value)
     {
@@ -4023,11 +4937,158 @@ lt_update_lib_path (const char *name, const char *value)
     }
 }
 
+EOF
+	    case $host_os in
+	      mingw*)
+		cat <<"EOF"
+
+/* Prepares an argument vector before calling spawn().
+   Note that spawn() does not by itself call the command interpreter
+     (getenv ("COMSPEC") != NULL ? getenv ("COMSPEC") :
+      ({ OSVERSIONINFO v; v.dwOSVersionInfoSize = sizeof(OSVERSIONINFO);
+         GetVersionEx(&v);
+         v.dwPlatformId == VER_PLATFORM_WIN32_NT;
+      }) ? "cmd.exe" : "command.com").
+   Instead it simply concatenates the arguments, separated by ' ', and calls
+   CreateProcess().  We must quote the arguments since Win32 CreateProcess()
+   interprets characters like ' ', '\t', '\\', '"' (but not '<' and '>') in a
+   special way:
+   - Space and tab are interpreted as delimiters. They are not treated as
+     delimiters if they are surrounded by double quotes: "...".
+   - Unescaped double quotes are removed from the input. Their only effect is
+     that within double quotes, space and tab are treated like normal
+     characters.
+   - Backslashes not followed by double quotes are not special.
+   - But 2*n+1 backslashes followed by a double quote become
+     n backslashes followed by a double quote (n >= 0):
+       \" -> "
+       \\\" -> \"
+       \\\\\" -> \\"
+ */
+#define SHELL_SPECIAL_CHARS "\"\\ \001\002\003\004\005\006\007\010\011\012\013\014\015\016\017\020\021\022\023\024\025\026\027\030\031\032\033\034\035\036\037"
+#define SHELL_SPACE_CHARS " \001\002\003\004\005\006\007\010\011\012\013\014\015\016\017\020\021\022\023\024\025\026\027\030\031\032\033\034\035\036\037"
+char **
+prepare_spawn (char **argv)
+{
+  size_t argc;
+  char **new_argv;
+  size_t i;
+
+  /* Count number of arguments.  */
+  for (argc = 0; argv[argc] != NULL; argc++)
+    ;
+
+  /* Allocate new argument vector.  */
+  new_argv = XMALLOC (char *, argc + 1);
+
+  /* Put quoted arguments into the new argument vector.  */
+  for (i = 0; i < argc; i++)
+    {
+      const char *string = argv[i];
+
+      if (string[0] == '\0')
+	new_argv[i] = xstrdup ("\"\"");
+      else if (strpbrk (string, SHELL_SPECIAL_CHARS) != NULL)
+	{
+	  int quote_around = (strpbrk (string, SHELL_SPACE_CHARS) != NULL);
+	  size_t length;
+	  unsigned int backslashes;
+	  const char *s;
+	  char *quoted_string;
+	  char *p;
+
+	  length = 0;
+	  backslashes = 0;
+	  if (quote_around)
+	    length++;
+	  for (s = string; *s != '\0'; s++)
+	    {
+	      char c = *s;
+	      if (c == '"')
+		length += backslashes + 1;
+	      length++;
+	      if (c == '\\')
+		backslashes++;
+	      else
+		backslashes = 0;
+	    }
+	  if (quote_around)
+	    length += backslashes + 1;
+
+	  quoted_string = XMALLOC (char, length + 1);
+
+	  p = quoted_string;
+	  backslashes = 0;
+	  if (quote_around)
+	    *p++ = '"';
+	  for (s = string; *s != '\0'; s++)
+	    {
+	      char c = *s;
+	      if (c == '"')
+		{
+		  unsigned int j;
+		  for (j = backslashes + 1; j > 0; j--)
+		    *p++ = '\\';
+		}
+	      *p++ = c;
+	      if (c == '\\')
+		backslashes++;
+	      else
+		backslashes = 0;
+	    }
+	  if (quote_around)
+	    {
+	      unsigned int j;
+	      for (j = backslashes; j > 0; j--)
+		*p++ = '\\';
+	      *p++ = '"';
+	    }
+	  *p = '\0';
+
+	  new_argv[i] = quoted_string;
+	}
+      else
+	new_argv[i] = (char *) string;
+    }
+  new_argv[argc] = NULL;
+
+  return new_argv;
+}
+EOF
+		;;
+	    esac
 
+            cat <<"EOF"
+void lt_dump_script (FILE* f)
+{
+EOF
+	    func_emit_wrapper yes |
+	      $SED -n -e '
+s/^\(.\{79\}\)\(..*\)/\1\
+\2/
+h
+s/\([\\"]\)/\\\1/g
+s/$/\\n/
+s/\([^\n]*\).*/  fputs ("\1", f);/p
+g
+D'
+            cat <<"EOF"
+}
 EOF
 }
 # end: func_emit_cwrapperexe_src
 
+# func_win32_import_lib_p ARG
+# True if ARG is an import lib, as indicated by $file_magic_cmd
+func_win32_import_lib_p ()
+{
+    $opt_debug
+    case `eval $file_magic_cmd \"\$1\" 2>/dev/null | $SED -e 10q` in
+    *import*) : ;;
+    *) false ;;
+    esac
+}
+
 # func_mode_link arg...
 func_mode_link ()
 {
@@ -4072,6 +5133,7 @@ func_mode_link ()
     new_inherited_linker_flags=
 
     avoid_version=no
+    bindir=
     dlfiles=
     dlprefiles=
     dlself=no
@@ -4164,6 +5226,11 @@ func_mode_link ()
 	esac
 
 	case $prev in
+	bindir)
+	  bindir="$arg"
+	  prev=
+	  continue
+	  ;;
 	dlfiles|dlprefiles)
 	  if test "$preload" = no; then
 	    # Add the symbol object into the linking commands.
@@ -4195,9 +5262,9 @@ func_mode_link ()
 	    ;;
 	  *)
 	    if test "$prev" = dlfiles; then
-	      dlfiles="$dlfiles $arg"
+	      func_append dlfiles " $arg"
 	    else
-	      dlprefiles="$dlprefiles $arg"
+	      func_append dlprefiles " $arg"
 	    fi
 	    prev=
 	    continue
@@ -4221,7 +5288,7 @@ func_mode_link ()
 	    *-*-darwin*)
 	      case "$deplibs " in
 		*" $qarg.ltframework "*) ;;
-		*) deplibs="$deplibs $qarg.ltframework" # this is fixed later
+		*) func_append deplibs " $qarg.ltframework" # this is fixed later
 		   ;;
 	      esac
 	      ;;
@@ -4240,7 +5307,7 @@ func_mode_link ()
 	    moreargs=
 	    for fil in `cat "$save_arg"`
 	    do
-#	      moreargs="$moreargs $fil"
+#	      func_append moreargs " $fil"
 	      arg=$fil
 	      # A libtool-controlled object.
 
@@ -4269,7 +5336,7 @@ func_mode_link ()
 
 		  if test "$prev" = dlfiles; then
 		    if test "$build_libtool_libs" = yes && test "$dlopen_support" = yes; then
-		      dlfiles="$dlfiles $pic_object"
+		      func_append dlfiles " $pic_object"
 		      prev=
 		      continue
 		    else
@@ -4281,7 +5348,7 @@ func_mode_link ()
 		  # CHECK ME:  I think I busted this.  -Ossama
 		  if test "$prev" = dlprefiles; then
 		    # Preload the old-style object.
-		    dlprefiles="$dlprefiles $pic_object"
+		    func_append dlprefiles " $pic_object"
 		    prev=
 		  fi
 
@@ -4351,12 +5418,12 @@ func_mode_link ()
 	  if test "$prev" = rpath; then
 	    case "$rpath " in
 	    *" $arg "*) ;;
-	    *) rpath="$rpath $arg" ;;
+	    *) func_append rpath " $arg" ;;
 	    esac
 	  else
 	    case "$xrpath " in
 	    *" $arg "*) ;;
-	    *) xrpath="$xrpath $arg" ;;
+	    *) func_append xrpath " $arg" ;;
 	    esac
 	  fi
 	  prev=
@@ -4368,28 +5435,28 @@ func_mode_link ()
 	  continue
 	  ;;
 	weak)
-	  weak_libs="$weak_libs $arg"
+	  func_append weak_libs " $arg"
 	  prev=
 	  continue
 	  ;;
 	xcclinker)
-	  linker_flags="$linker_flags $qarg"
-	  compiler_flags="$compiler_flags $qarg"
+	  func_append linker_flags " $qarg"
+	  func_append compiler_flags " $qarg"
 	  prev=
 	  func_append compile_command " $qarg"
 	  func_append finalize_command " $qarg"
 	  continue
 	  ;;
 	xcompiler)
-	  compiler_flags="$compiler_flags $qarg"
+	  func_append compiler_flags " $qarg"
 	  prev=
 	  func_append compile_command " $qarg"
 	  func_append finalize_command " $qarg"
 	  continue
 	  ;;
 	xlinker)
-	  linker_flags="$linker_flags $qarg"
-	  compiler_flags="$compiler_flags $wl$qarg"
+	  func_append linker_flags " $qarg"
+	  func_append compiler_flags " $wl$qarg"
 	  prev=
 	  func_append compile_command " $wl$qarg"
 	  func_append finalize_command " $wl$qarg"
@@ -4425,6 +5492,11 @@ func_mode_link ()
 	continue
 	;;
 
+      -bindir)
+	prev=bindir
+	continue
+	;;
+
       -dlopen)
 	prev=dlfiles
 	continue
@@ -4475,15 +5547,16 @@ func_mode_link ()
 	;;
 
       -L*)
-	func_stripname '-L' '' "$arg"
-	dir=$func_stripname_result
-	if test -z "$dir"; then
+	func_stripname "-L" '' "$arg"
+	if test -z "$func_stripname_result"; then
 	  if test "$#" -gt 0; then
 	    func_fatal_error "require no space between \`-L' and \`$1'"
 	  else
 	    func_fatal_error "need path for \`-L' option"
 	  fi
 	fi
+	func_resolve_sysroot "$func_stripname_result"
+	dir=$func_resolve_sysroot_result
 	# We need an absolute path.
 	case $dir in
 	[\\/]* | [A-Za-z]:[\\/]*) ;;
@@ -4495,24 +5568,30 @@ func_mode_link ()
 	  ;;
 	esac
 	case "$deplibs " in
-	*" -L$dir "*) ;;
+	*" -L$dir "* | *" $arg "*)
+	  # Will only happen for absolute or sysroot arguments
+	  ;;
 	*)
-	  deplibs="$deplibs -L$dir"
-	  lib_search_path="$lib_search_path $dir"
+	  # Preserve sysroot, but never include relative directories
+	  case $dir in
+	    [\\/]* | [A-Za-z]:[\\/]* | =*) func_append deplibs " $arg" ;;
+	    *) func_append deplibs " -L$dir" ;;
+	  esac
+	  func_append lib_search_path " $dir"
 	  ;;
 	esac
 	case $host in
 	*-*-cygwin* | *-*-mingw* | *-*-pw32* | *-*-os2* | *-cegcc*)
-	  testbindir=`$ECHO "X$dir" | $Xsed -e 's*/lib$*/bin*'`
+	  testbindir=`$ECHO "$dir" | $SED 's*/lib$*/bin*'`
 	  case :$dllsearchpath: in
 	  *":$dir:"*) ;;
 	  ::) dllsearchpath=$dir;;
-	  *) dllsearchpath="$dllsearchpath:$dir";;
+	  *) func_append dllsearchpath ":$dir";;
 	  esac
 	  case :$dllsearchpath: in
 	  *":$testbindir:"*) ;;
 	  ::) dllsearchpath=$testbindir;;
-	  *) dllsearchpath="$dllsearchpath:$testbindir";;
+	  *) func_append dllsearchpath ":$testbindir";;
 	  esac
 	  ;;
 	esac
@@ -4522,7 +5601,7 @@ func_mode_link ()
       -l*)
 	if test "X$arg" = "X-lc" || test "X$arg" = "X-lm"; then
 	  case $host in
-	  *-*-cygwin* | *-*-mingw* | *-*-pw32* | *-*-beos* | *-cegcc*)
+	  *-*-cygwin* | *-*-mingw* | *-*-pw32* | *-*-beos* | *-cegcc* | *-*-haiku*)
 	    # These systems don't actually have a C or math library (as such)
 	    continue
 	    ;;
@@ -4536,7 +5615,7 @@ func_mode_link ()
 	    ;;
 	  *-*-rhapsody* | *-*-darwin1.[012])
 	    # Rhapsody C and math libraries are in the System framework
-	    deplibs="$deplibs System.ltframework"
+	    func_append deplibs " System.ltframework"
 	    continue
 	    ;;
 	  *-*-sco3.2v5* | *-*-sco5v6*)
@@ -4556,7 +5635,7 @@ func_mode_link ()
 	   ;;
 	 esac
 	fi
-	deplibs="$deplibs $arg"
+	func_append deplibs " $arg"
 	continue
 	;;
 
@@ -4568,21 +5647,22 @@ func_mode_link ()
       # Tru64 UNIX uses -model [arg] to determine the layout of C++
       # classes, name mangling, and exception handling.
       # Darwin uses the -arch flag to determine output architecture.
-      -model|-arch|-isysroot)
-	compiler_flags="$compiler_flags $arg"
+      -model|-arch|-isysroot|--sysroot)
+	func_append compiler_flags " $arg"
 	func_append compile_command " $arg"
 	func_append finalize_command " $arg"
 	prev=xcompiler
 	continue
 	;;
 
-      -mt|-mthreads|-kthread|-Kthread|-pthread|-pthreads|--thread-safe|-threads)
-	compiler_flags="$compiler_flags $arg"
+      -mt|-mthreads|-kthread|-Kthread|-pthread|-pthreads|--thread-safe \
+      |-threads|-fopenmp|-openmp|-mp|-xopenmp|-omp|-qsmp=*)
+	func_append compiler_flags " $arg"
 	func_append compile_command " $arg"
 	func_append finalize_command " $arg"
 	case "$new_inherited_linker_flags " in
 	    *" $arg "*) ;;
-	    * ) new_inherited_linker_flags="$new_inherited_linker_flags $arg" ;;
+	    * ) func_append new_inherited_linker_flags " $arg" ;;
 	esac
 	continue
 	;;
@@ -4649,13 +5729,17 @@ func_mode_link ()
 	# We need an absolute path.
 	case $dir in
 	[\\/]* | [A-Za-z]:[\\/]*) ;;
+	=*)
+	  func_stripname '=' '' "$dir"
+	  dir=$lt_sysroot$func_stripname_result
+	  ;;
 	*)
 	  func_fatal_error "only absolute run-paths are allowed"
 	  ;;
 	esac
 	case "$xrpath " in
 	*" $dir "*) ;;
-	*) xrpath="$xrpath $dir" ;;
+	*) func_append xrpath " $dir" ;;
 	esac
 	continue
 	;;
@@ -4708,8 +5792,8 @@ func_mode_link ()
 	for flag in $args; do
 	  IFS="$save_ifs"
           func_quote_for_eval "$flag"
-	  arg="$arg $wl$func_quote_for_eval_result"
-	  compiler_flags="$compiler_flags $func_quote_for_eval_result"
+	  func_append arg " $func_quote_for_eval_result"
+	  func_append compiler_flags " $func_quote_for_eval_result"
 	done
 	IFS="$save_ifs"
 	func_stripname ' ' '' "$arg"
@@ -4724,9 +5808,9 @@ func_mode_link ()
 	for flag in $args; do
 	  IFS="$save_ifs"
           func_quote_for_eval "$flag"
-	  arg="$arg $wl$func_quote_for_eval_result"
-	  compiler_flags="$compiler_flags $wl$func_quote_for_eval_result"
-	  linker_flags="$linker_flags $func_quote_for_eval_result"
+	  func_append arg " $wl$func_quote_for_eval_result"
+	  func_append compiler_flags " $wl$func_quote_for_eval_result"
+	  func_append linker_flags " $func_quote_for_eval_result"
 	done
 	IFS="$save_ifs"
 	func_stripname ' ' '' "$arg"
@@ -4754,23 +5838,27 @@ func_mode_link ()
 	arg="$func_quote_for_eval_result"
 	;;
 
-      # -64, -mips[0-9] enable 64-bit mode on the SGI compiler
-      # -r[0-9][0-9]* specifies the processor on the SGI compiler
-      # -xarch=*, -xtarget=* enable 64-bit mode on the Sun compiler
-      # +DA*, +DD* enable 64-bit mode on the HP compiler
-      # -q* pass through compiler args for the IBM compiler
-      # -m*, -t[45]*, -txscale* pass through architecture-specific
-      # compiler args for GCC
-      # -F/path gives path to uninstalled frameworks, gcc on darwin
-      # -p, -pg, --coverage, -fprofile-* pass through profiling flag for GCC
-      # @file GCC response files
+      # Flags to be passed through unchanged, with rationale:
+      # -64, -mips[0-9]      enable 64-bit mode for the SGI compiler
+      # -r[0-9][0-9]*        specify processor for the SGI compiler
+      # -xarch=*, -xtarget=* enable 64-bit mode for the Sun compiler
+      # +DA*, +DD*           enable 64-bit mode for the HP compiler
+      # -q*                  compiler args for the IBM compiler
+      # -m*, -t[45]*, -txscale* architecture-specific flags for GCC
+      # -F/path              path to uninstalled frameworks, gcc on darwin
+      # -p, -pg, --coverage, -fprofile-*  profiling flags for GCC
+      # @file                GCC response files
+      # -tp=*                Portland pgcc target processor selection
+      # --sysroot=*          for sysroot support
+      # -O*, -flto*, -fwhopr*, -fuse-linker-plugin GCC link-time optimization
       -64|-mips[0-9]|-r[0-9][0-9]*|-xarch=*|-xtarget=*|+DA*|+DD*|-q*|-m*| \
-      -t[45]*|-txscale*|-p|-pg|--coverage|-fprofile-*|-F*|@*)
+      -t[45]*|-txscale*|-p|-pg|--coverage|-fprofile-*|-F*|@*|-tp=*|--sysroot=*| \
+      -O*|-flto*|-fwhopr*|-fuse-linker-plugin)
         func_quote_for_eval "$arg"
 	arg="$func_quote_for_eval_result"
         func_append compile_command " $arg"
         func_append finalize_command " $arg"
-        compiler_flags="$compiler_flags $arg"
+        func_append compiler_flags " $arg"
         continue
         ;;
 
@@ -4782,7 +5870,7 @@ func_mode_link ()
 
       *.$objext)
 	# A standard object.
-	objs="$objs $arg"
+	func_append objs " $arg"
 	;;
 
       *.lo)
@@ -4813,7 +5901,7 @@ func_mode_link ()
 
 	    if test "$prev" = dlfiles; then
 	      if test "$build_libtool_libs" = yes && test "$dlopen_support" = yes; then
-		dlfiles="$dlfiles $pic_object"
+		func_append dlfiles " $pic_object"
 		prev=
 		continue
 	      else
@@ -4825,7 +5913,7 @@ func_mode_link ()
 	    # CHECK ME:  I think I busted this.  -Ossama
 	    if test "$prev" = dlprefiles; then
 	      # Preload the old-style object.
-	      dlprefiles="$dlprefiles $pic_object"
+	      func_append dlprefiles " $pic_object"
 	      prev=
 	    fi
 
@@ -4870,24 +5958,25 @@ func_mode_link ()
 
       *.$libext)
 	# An archive.
-	deplibs="$deplibs $arg"
-	old_deplibs="$old_deplibs $arg"
+	func_append deplibs " $arg"
+	func_append old_deplibs " $arg"
 	continue
 	;;
 
       *.la)
 	# A libtool-controlled library.
 
+	func_resolve_sysroot "$arg"
 	if test "$prev" = dlfiles; then
 	  # This library was specified with -dlopen.
-	  dlfiles="$dlfiles $arg"
+	  func_append dlfiles " $func_resolve_sysroot_result"
 	  prev=
 	elif test "$prev" = dlprefiles; then
 	  # The library was specified with -dlpreopen.
-	  dlprefiles="$dlprefiles $arg"
+	  func_append dlprefiles " $func_resolve_sysroot_result"
 	  prev=
 	else
-	  deplibs="$deplibs $arg"
+	  func_append deplibs " $func_resolve_sysroot_result"
 	fi
 	continue
 	;;
@@ -4925,7 +6014,7 @@ func_mode_link ()
 
     if test -n "$shlibpath_var"; then
       # get the directories listed in $shlibpath_var
-      eval shlib_search_path=\`\$ECHO \"X\${$shlibpath_var}\" \| \$Xsed -e \'s/:/ /g\'\`
+      eval shlib_search_path=\`\$ECHO \"\${$shlibpath_var}\" \| \$SED \'s/:/ /g\'\`
     else
       shlib_search_path=
     fi
@@ -4934,6 +6023,8 @@ func_mode_link ()
 
     func_dirname "$output" "/" ""
     output_objdir="$func_dirname_result$objdir"
+    func_to_tool_file "$output_objdir/"
+    tool_output_objdir=$func_to_tool_file_result
     # Create the object directory.
     func_mkdir_p "$output_objdir"
 
@@ -4954,12 +6045,12 @@ func_mode_link ()
     # Find all interdependent deplibs by searching for libraries
     # that are linked more than once (e.g. -la -lb -la)
     for deplib in $deplibs; do
-      if $opt_duplicate_deps ; then
+      if $opt_preserve_dup_deps ; then
 	case "$libs " in
-	*" $deplib "*) specialdeplibs="$specialdeplibs $deplib" ;;
+	*" $deplib "*) func_append specialdeplibs " $deplib" ;;
 	esac
       fi
-      libs="$libs $deplib"
+      func_append libs " $deplib"
     done
 
     if test "$linkmode" = lib; then
@@ -4972,9 +6063,9 @@ func_mode_link ()
       if $opt_duplicate_compiler_generated_deps; then
 	for pre_post_dep in $predeps $postdeps; do
 	  case "$pre_post_deps " in
-	  *" $pre_post_dep "*) specialdeplibs="$specialdeplibs $pre_post_deps" ;;
+	  *" $pre_post_dep "*) func_append specialdeplibs " $pre_post_deps" ;;
 	  esac
-	  pre_post_deps="$pre_post_deps $pre_post_dep"
+	  func_append pre_post_deps " $pre_post_dep"
 	done
       fi
       pre_post_deps=
@@ -5041,17 +6132,19 @@ func_mode_link ()
 	for lib in $dlprefiles; do
 	  # Ignore non-libtool-libs
 	  dependency_libs=
+	  func_resolve_sysroot "$lib"
 	  case $lib in
-	  *.la)	func_source "$lib" ;;
+	  *.la)	func_source "$func_resolve_sysroot_result" ;;
 	  esac
 
 	  # Collect preopened libtool deplibs, except any this library
 	  # has declared as weak libs
 	  for deplib in $dependency_libs; do
-            deplib_base=`$ECHO "X$deplib" | $Xsed -e "$basename"`
+	    func_basename "$deplib"
+            deplib_base=$func_basename_result
 	    case " $weak_libs " in
 	    *" $deplib_base "*) ;;
-	    *) deplibs="$deplibs $deplib" ;;
+	    *) func_append deplibs " $deplib" ;;
 	    esac
 	  done
 	done
@@ -5067,16 +6160,17 @@ func_mode_link ()
 	lib=
 	found=no
 	case $deplib in
-	-mt|-mthreads|-kthread|-Kthread|-pthread|-pthreads|--thread-safe|-threads)
+	-mt|-mthreads|-kthread|-Kthread|-pthread|-pthreads|--thread-safe \
+        |-threads|-fopenmp|-openmp|-mp|-xopenmp|-omp|-qsmp=*)
 	  if test "$linkmode,$pass" = "prog,link"; then
 	    compile_deplibs="$deplib $compile_deplibs"
 	    finalize_deplibs="$deplib $finalize_deplibs"
 	  else
-	    compiler_flags="$compiler_flags $deplib"
+	    func_append compiler_flags " $deplib"
 	    if test "$linkmode" = lib ; then
 		case "$new_inherited_linker_flags " in
 		    *" $deplib "*) ;;
-		    * ) new_inherited_linker_flags="$new_inherited_linker_flags $deplib" ;;
+		    * ) func_append new_inherited_linker_flags " $deplib" ;;
 		esac
 	    fi
 	  fi
@@ -5161,7 +6255,7 @@ func_mode_link ()
 	    if test "$linkmode" = lib ; then
 		case "$new_inherited_linker_flags " in
 		    *" $deplib "*) ;;
-		    * ) new_inherited_linker_flags="$new_inherited_linker_flags $deplib" ;;
+		    * ) func_append new_inherited_linker_flags " $deplib" ;;
 		esac
 	    fi
 	  fi
@@ -5174,7 +6268,8 @@ func_mode_link ()
 	    test "$pass" = conv && continue
 	    newdependency_libs="$deplib $newdependency_libs"
 	    func_stripname '-L' '' "$deplib"
-	    newlib_search_path="$newlib_search_path $func_stripname_result"
+	    func_resolve_sysroot "$func_stripname_result"
+	    func_append newlib_search_path " $func_resolve_sysroot_result"
 	    ;;
 	  prog)
 	    if test "$pass" = conv; then
@@ -5188,7 +6283,8 @@ func_mode_link ()
 	      finalize_deplibs="$deplib $finalize_deplibs"
 	    fi
 	    func_stripname '-L' '' "$deplib"
-	    newlib_search_path="$newlib_search_path $func_stripname_result"
+	    func_resolve_sysroot "$func_stripname_result"
+	    func_append newlib_search_path " $func_resolve_sysroot_result"
 	    ;;
 	  *)
 	    func_warning "\`-L' is ignored for archives/objects"
@@ -5199,17 +6295,21 @@ func_mode_link ()
 	-R*)
 	  if test "$pass" = link; then
 	    func_stripname '-R' '' "$deplib"
-	    dir=$func_stripname_result
+	    func_resolve_sysroot "$func_stripname_result"
+	    dir=$func_resolve_sysroot_result
 	    # Make sure the xrpath contains only unique directories.
 	    case "$xrpath " in
 	    *" $dir "*) ;;
-	    *) xrpath="$xrpath $dir" ;;
+	    *) func_append xrpath " $dir" ;;
 	    esac
 	  fi
 	  deplibs="$deplib $deplibs"
 	  continue
 	  ;;
-	*.la) lib="$deplib" ;;
+	*.la)
+	  func_resolve_sysroot "$deplib"
+	  lib=$func_resolve_sysroot_result
+	  ;;
 	*.$libext)
 	  if test "$pass" = conv; then
 	    deplibs="$deplib $deplibs"
@@ -5227,7 +6327,7 @@ func_mode_link ()
 		match_pattern*)
 		  set dummy $deplibs_check_method; shift
 		  match_pattern_regex=`expr "$deplibs_check_method" : "$1 \(.*\)"`
-		  if eval "\$ECHO \"X$deplib\"" 2>/dev/null | $Xsed -e 10q \
+		  if eval "\$ECHO \"$deplib\"" 2>/dev/null | $SED 10q \
 		    | $EGREP "$match_pattern_regex" > /dev/null; then
 		    valid_a_lib=yes
 		  fi
@@ -5237,15 +6337,15 @@ func_mode_link ()
 		;;
 	      esac
 	      if test "$valid_a_lib" != yes; then
-		$ECHO
+		echo
 		$ECHO "*** Warning: Trying to link with static lib archive $deplib."
-		$ECHO "*** I have the capability to make that library automatically link in when"
-		$ECHO "*** you link to this library.  But I can only do this if you have a"
-		$ECHO "*** shared version of the library, which you do not appear to have"
-		$ECHO "*** because the file extensions .$libext of this argument makes me believe"
-		$ECHO "*** that it is just a static archive that I should not use here."
+		echo "*** I have the capability to make that library automatically link in when"
+		echo "*** you link to this library.  But I can only do this if you have a"
+		echo "*** shared version of the library, which you do not appear to have"
+		echo "*** because the file extensions .$libext of this argument makes me believe"
+		echo "*** that it is just a static archive that I should not use here."
 	      else
-		$ECHO
+		echo
 		$ECHO "*** Warning: Linking the shared library $output against the"
 		$ECHO "*** static library $deplib is not portable!"
 		deplibs="$deplib $deplibs"
@@ -5272,11 +6372,11 @@ func_mode_link ()
 	    if test "$pass" = dlpreopen || test "$dlopen_support" != yes || test "$build_libtool_libs" = no; then
 	      # If there is no dlopen support or we're linking statically,
 	      # we need to preload.
-	      newdlprefiles="$newdlprefiles $deplib"
+	      func_append newdlprefiles " $deplib"
 	      compile_deplibs="$deplib $compile_deplibs"
 	      finalize_deplibs="$deplib $finalize_deplibs"
 	    else
-	      newdlfiles="$newdlfiles $deplib"
+	      func_append newdlfiles " $deplib"
 	    fi
 	  fi
 	  continue
@@ -5318,20 +6418,20 @@ func_mode_link ()
 
 	# Convert "-framework foo" to "foo.ltframework"
 	if test -n "$inherited_linker_flags"; then
-	  tmp_inherited_linker_flags=`$ECHO "X$inherited_linker_flags" | $Xsed -e 's/-framework \([^ $]*\)/\1.ltframework/g'`
+	  tmp_inherited_linker_flags=`$ECHO "$inherited_linker_flags" | $SED 's/-framework \([^ $]*\)/\1.ltframework/g'`
 	  for tmp_inherited_linker_flag in $tmp_inherited_linker_flags; do
 	    case " $new_inherited_linker_flags " in
 	      *" $tmp_inherited_linker_flag "*) ;;
-	      *) new_inherited_linker_flags="$new_inherited_linker_flags $tmp_inherited_linker_flag";;
+	      *) func_append new_inherited_linker_flags " $tmp_inherited_linker_flag";;
 	    esac
 	  done
 	fi
-	dependency_libs=`$ECHO "X $dependency_libs" | $Xsed -e 's% \([^ $]*\).ltframework% -framework \1%g'`
+	dependency_libs=`$ECHO " $dependency_libs" | $SED 's% \([^ $]*\).ltframework% -framework \1%g'`
 	if test "$linkmode,$pass" = "lib,link" ||
 	   test "$linkmode,$pass" = "prog,scan" ||
 	   { test "$linkmode" != prog && test "$linkmode" != lib; }; then
-	  test -n "$dlopen" && dlfiles="$dlfiles $dlopen"
-	  test -n "$dlpreopen" && dlprefiles="$dlprefiles $dlpreopen"
+	  test -n "$dlopen" && func_append dlfiles " $dlopen"
+	  test -n "$dlpreopen" && func_append dlprefiles " $dlpreopen"
 	fi
 
 	if test "$pass" = conv; then
@@ -5342,20 +6442,20 @@ func_mode_link ()
 	      func_fatal_error "cannot find name of link library for \`$lib'"
 	    fi
 	    # It is a libtool convenience library, so add in its objects.
-	    convenience="$convenience $ladir/$objdir/$old_library"
-	    old_convenience="$old_convenience $ladir/$objdir/$old_library"
+	    func_append convenience " $ladir/$objdir/$old_library"
+	    func_append old_convenience " $ladir/$objdir/$old_library"
 	  elif test "$linkmode" != prog && test "$linkmode" != lib; then
 	    func_fatal_error "\`$lib' is not a convenience library"
 	  fi
 	  tmp_libs=
 	  for deplib in $dependency_libs; do
 	    deplibs="$deplib $deplibs"
-	    if $opt_duplicate_deps ; then
+	    if $opt_preserve_dup_deps ; then
 	      case "$tmp_libs " in
-	      *" $deplib "*) specialdeplibs="$specialdeplibs $deplib" ;;
+	      *" $deplib "*) func_append specialdeplibs " $deplib" ;;
 	      esac
 	    fi
-	    tmp_libs="$tmp_libs $deplib"
+	    func_append tmp_libs " $deplib"
 	  done
 	  continue
 	fi # $pass = conv
@@ -5363,9 +6463,15 @@ func_mode_link ()
 
 	# Get the name of the library we link against.
 	linklib=
-	for l in $old_library $library_names; do
-	  linklib="$l"
-	done
+	if test -n "$old_library" &&
+	   { test "$prefer_static_libs" = yes ||
+	     test "$prefer_static_libs,$installed" = "built,no"; }; then
+	  linklib=$old_library
+	else
+	  for l in $old_library $library_names; do
+	    linklib="$l"
+	  done
+	fi
 	if test -z "$linklib"; then
 	  func_fatal_error "cannot find name of link library for \`$lib'"
 	fi
@@ -5382,9 +6488,9 @@ func_mode_link ()
 	    # statically, we need to preload.  We also need to preload any
 	    # dependent libraries so libltdl's deplib preloader doesn't
 	    # bomb out in the load deplibs phase.
-	    dlprefiles="$dlprefiles $lib $dependency_libs"
+	    func_append dlprefiles " $lib $dependency_libs"
 	  else
-	    newdlfiles="$newdlfiles $lib"
+	    func_append newdlfiles " $lib"
 	  fi
 	  continue
 	fi # $pass = dlopen
@@ -5406,14 +6512,14 @@ func_mode_link ()
 
 	# Find the relevant object directory and library name.
 	if test "X$installed" = Xyes; then
-	  if test ! -f "$libdir/$linklib" && test -f "$abs_ladir/$linklib"; then
+	  if test ! -f "$lt_sysroot$libdir/$linklib" && test -f "$abs_ladir/$linklib"; then
 	    func_warning "library \`$lib' was moved."
 	    dir="$ladir"
 	    absdir="$abs_ladir"
 	    libdir="$abs_ladir"
 	  else
-	    dir="$libdir"
-	    absdir="$libdir"
+	    dir="$lt_sysroot$libdir"
+	    absdir="$lt_sysroot$libdir"
 	  fi
 	  test "X$hardcode_automatic" = Xyes && avoidtemprpath=yes
 	else
@@ -5421,12 +6527,12 @@ func_mode_link ()
 	    dir="$ladir"
 	    absdir="$abs_ladir"
 	    # Remove this search path later
-	    notinst_path="$notinst_path $abs_ladir"
+	    func_append notinst_path " $abs_ladir"
 	  else
 	    dir="$ladir/$objdir"
 	    absdir="$abs_ladir/$objdir"
 	    # Remove this search path later
-	    notinst_path="$notinst_path $abs_ladir"
+	    func_append notinst_path " $abs_ladir"
 	  fi
 	fi # $installed = yes
 	func_stripname 'lib' '.la' "$laname"
@@ -5437,20 +6543,46 @@ func_mode_link ()
 	  if test -z "$libdir" && test "$linkmode" = prog; then
 	    func_fatal_error "only libraries may -dlpreopen a convenience library: \`$lib'"
 	  fi
-	  # Prefer using a static library (so that no silly _DYNAMIC symbols
-	  # are required to link).
-	  if test -n "$old_library"; then
-	    newdlprefiles="$newdlprefiles $dir/$old_library"
-	    # Keep a list of preopened convenience libraries to check
-	    # that they are being used correctly in the link pass.
-	    test -z "$libdir" && \
-		dlpreconveniencelibs="$dlpreconveniencelibs $dir/$old_library"
-	  # Otherwise, use the dlname, so that lt_dlopen finds it.
-	  elif test -n "$dlname"; then
-	    newdlprefiles="$newdlprefiles $dir/$dlname"
-	  else
-	    newdlprefiles="$newdlprefiles $dir/$linklib"
-	  fi
+	  case "$host" in
+	    # special handling for platforms with PE-DLLs.
+	    *cygwin* | *mingw* | *cegcc* )
+	      # Linker will automatically link against shared library if both
+	      # static and shared are present.  Therefore, ensure we extract
+	      # symbols from the import library if a shared library is present
+	      # (otherwise, the dlopen module name will be incorrect).  We do
+	      # this by putting the import library name into $newdlprefiles.
+	      # We recover the dlopen module name by 'saving' the la file
+	      # name in a special purpose variable, and (later) extracting the
+	      # dlname from the la file.
+	      if test -n "$dlname"; then
+	        func_tr_sh "$dir/$linklib"
+	        eval "libfile_$func_tr_sh_result=\$abs_ladir/\$laname"
+	        func_append newdlprefiles " $dir/$linklib"
+	      else
+	        func_append newdlprefiles " $dir/$old_library"
+	        # Keep a list of preopened convenience libraries to check
+	        # that they are being used correctly in the link pass.
+	        test -z "$libdir" && \
+	          func_append dlpreconveniencelibs " $dir/$old_library"
+	      fi
+	    ;;
+	    * )
+	      # Prefer using a static library (so that no silly _DYNAMIC symbols
+	      # are required to link).
+	      if test -n "$old_library"; then
+	        func_append newdlprefiles " $dir/$old_library"
+	        # Keep a list of preopened convenience libraries to check
+	        # that they are being used correctly in the link pass.
+	        test -z "$libdir" && \
+	          func_append dlpreconveniencelibs " $dir/$old_library"
+	      # Otherwise, use the dlname, so that lt_dlopen finds it.
+	      elif test -n "$dlname"; then
+	        func_append newdlprefiles " $dir/$dlname"
+	      else
+	        func_append newdlprefiles " $dir/$linklib"
+	      fi
+	    ;;
+	  esac
 	fi # $pass = dlpreopen
 
 	if test -z "$libdir"; then
@@ -5468,7 +6600,7 @@ func_mode_link ()
 
 
 	if test "$linkmode" = prog && test "$pass" != link; then
-	  newlib_search_path="$newlib_search_path $ladir"
+	  func_append newlib_search_path " $ladir"
 	  deplibs="$lib $deplibs"
 
 	  linkalldeplibs=no
@@ -5481,7 +6613,8 @@ func_mode_link ()
 	  for deplib in $dependency_libs; do
 	    case $deplib in
 	    -L*) func_stripname '-L' '' "$deplib"
-	         newlib_search_path="$newlib_search_path $func_stripname_result"
+	         func_resolve_sysroot "$func_stripname_result"
+	         func_append newlib_search_path " $func_resolve_sysroot_result"
 		 ;;
 	    esac
 	    # Need to link against all dependency_libs?
@@ -5492,12 +6625,12 @@ func_mode_link ()
 	      # or/and link against static libraries
 	      newdependency_libs="$deplib $newdependency_libs"
 	    fi
-	    if $opt_duplicate_deps ; then
+	    if $opt_preserve_dup_deps ; then
 	      case "$tmp_libs " in
-	      *" $deplib "*) specialdeplibs="$specialdeplibs $deplib" ;;
+	      *" $deplib "*) func_append specialdeplibs " $deplib" ;;
 	      esac
 	    fi
-	    tmp_libs="$tmp_libs $deplib"
+	    func_append tmp_libs " $deplib"
 	  done # for deplib
 	  continue
 	fi # $linkmode = prog...
@@ -5512,7 +6645,7 @@ func_mode_link ()
 	      # Make sure the rpath contains only unique directories.
 	      case "$temp_rpath:" in
 	      *"$absdir:"*) ;;
-	      *) temp_rpath="$temp_rpath$absdir:" ;;
+	      *) func_append temp_rpath "$absdir:" ;;
 	      esac
 	    fi
 
@@ -5524,7 +6657,7 @@ func_mode_link ()
 	    *)
 	      case "$compile_rpath " in
 	      *" $absdir "*) ;;
-	      *) compile_rpath="$compile_rpath $absdir"
+	      *) func_append compile_rpath " $absdir" ;;
 	      esac
 	      ;;
 	    esac
@@ -5533,7 +6666,7 @@ func_mode_link ()
 	    *)
 	      case "$finalize_rpath " in
 	      *" $libdir "*) ;;
-	      *) finalize_rpath="$finalize_rpath $libdir"
+	      *) func_append finalize_rpath " $libdir" ;;
 	      esac
 	      ;;
 	    esac
@@ -5558,12 +6691,12 @@ func_mode_link ()
 	  case $host in
 	  *cygwin* | *mingw* | *cegcc*)
 	      # No point in relinking DLLs because paths are not encoded
-	      notinst_deplibs="$notinst_deplibs $lib"
+	      func_append notinst_deplibs " $lib"
 	      need_relink=no
 	    ;;
 	  *)
 	    if test "$installed" = no; then
-	      notinst_deplibs="$notinst_deplibs $lib"
+	      func_append notinst_deplibs " $lib"
 	      need_relink=yes
 	    fi
 	    ;;
@@ -5580,7 +6713,7 @@ func_mode_link ()
 	    fi
 	  done
 	  if test -z "$dlopenmodule" && test "$shouldnotlink" = yes && test "$pass" = link; then
-	    $ECHO
+	    echo
 	    if test "$linkmode" = prog; then
 	      $ECHO "*** Warning: Linking the executable $output against the loadable module"
 	    else
@@ -5598,7 +6731,7 @@ func_mode_link ()
 	    *)
 	      case "$compile_rpath " in
 	      *" $absdir "*) ;;
-	      *) compile_rpath="$compile_rpath $absdir"
+	      *) func_append compile_rpath " $absdir" ;;
 	      esac
 	      ;;
 	    esac
@@ -5607,7 +6740,7 @@ func_mode_link ()
 	    *)
 	      case "$finalize_rpath " in
 	      *" $libdir "*) ;;
-	      *) finalize_rpath="$finalize_rpath $libdir"
+	      *) func_append finalize_rpath " $libdir" ;;
 	      esac
 	      ;;
 	    esac
@@ -5661,7 +6794,7 @@ func_mode_link ()
 	    linklib=$newlib
 	  fi # test -n "$old_archive_from_expsyms_cmds"
 
-	  if test "$linkmode" = prog || test "$mode" != relink; then
+	  if test "$linkmode" = prog || test "$opt_mode" != relink; then
 	    add_shlibpath=
 	    add_dir=
 	    add=
@@ -5683,9 +6816,9 @@ func_mode_link ()
 		      if test "X$dlopenmodule" != "X$lib"; then
 			$ECHO "*** Warning: lib $linklib is a module, not a shared library"
 			if test -z "$old_library" ; then
-			  $ECHO
-			  $ECHO "*** And there doesn't seem to be a static archive available"
-			  $ECHO "*** The link will probably fail, sorry"
+			  echo
+			  echo "*** And there doesn't seem to be a static archive available"
+			  echo "*** The link will probably fail, sorry"
 			else
 			  add="$dir/$old_library"
 			fi
@@ -5712,12 +6845,12 @@ func_mode_link ()
 	         test "$hardcode_direct_absolute" = no; then
 		add="$dir/$linklib"
 	      elif test "$hardcode_minus_L" = yes; then
-		add_dir="-L$dir"
+		add_dir="-L$absdir"
 		# Try looking first in the location we're being installed to.
 		if test -n "$inst_prefix_dir"; then
 		  case $libdir in
 		    [\\/]*)
-		      add_dir="$add_dir -L$inst_prefix_dir$libdir"
+		      func_append add_dir " -L$inst_prefix_dir$libdir"
 		      ;;
 		  esac
 		fi
@@ -5739,7 +6872,7 @@ func_mode_link ()
 	    if test -n "$add_shlibpath"; then
 	      case :$compile_shlibpath: in
 	      *":$add_shlibpath:"*) ;;
-	      *) compile_shlibpath="$compile_shlibpath$add_shlibpath:" ;;
+	      *) func_append compile_shlibpath "$add_shlibpath:" ;;
 	      esac
 	    fi
 	    if test "$linkmode" = prog; then
@@ -5753,13 +6886,13 @@ func_mode_link ()
 		 test "$hardcode_shlibpath_var" = yes; then
 		case :$finalize_shlibpath: in
 		*":$libdir:"*) ;;
-		*) finalize_shlibpath="$finalize_shlibpath$libdir:" ;;
+		*) func_append finalize_shlibpath "$libdir:" ;;
 		esac
 	      fi
 	    fi
 	  fi
 
-	  if test "$linkmode" = prog || test "$mode" = relink; then
+	  if test "$linkmode" = prog || test "$opt_mode" = relink; then
 	    add_shlibpath=
 	    add_dir=
 	    add=
@@ -5773,7 +6906,7 @@ func_mode_link ()
 	    elif test "$hardcode_shlibpath_var" = yes; then
 	      case :$finalize_shlibpath: in
 	      *":$libdir:"*) ;;
-	      *) finalize_shlibpath="$finalize_shlibpath$libdir:" ;;
+	      *) func_append finalize_shlibpath "$libdir:" ;;
 	      esac
 	      add="-l$name"
 	    elif test "$hardcode_automatic" = yes; then
@@ -5790,7 +6923,7 @@ func_mode_link ()
 	      if test -n "$inst_prefix_dir"; then
 		case $libdir in
 		  [\\/]*)
-		    add_dir="$add_dir -L$inst_prefix_dir$libdir"
+		    func_append add_dir " -L$inst_prefix_dir$libdir"
 		    ;;
 		esac
 	      fi
@@ -5825,21 +6958,21 @@ func_mode_link ()
 
 	    # Just print a warning and add the library to dependency_libs so
 	    # that the program can be linked against the static library.
-	    $ECHO
+	    echo
 	    $ECHO "*** Warning: This system can not link to static lib archive $lib."
-	    $ECHO "*** I have the capability to make that library automatically link in when"
-	    $ECHO "*** you link to this library.  But I can only do this if you have a"
-	    $ECHO "*** shared version of the library, which you do not appear to have."
+	    echo "*** I have the capability to make that library automatically link in when"
+	    echo "*** you link to this library.  But I can only do this if you have a"
+	    echo "*** shared version of the library, which you do not appear to have."
 	    if test "$module" = yes; then
-	      $ECHO "*** But as you try to build a module library, libtool will still create "
-	      $ECHO "*** a static module, that should work as long as the dlopening application"
-	      $ECHO "*** is linked with the -dlopen flag to resolve symbols at runtime."
+	      echo "*** But as you try to build a module library, libtool will still create "
+	      echo "*** a static module, that should work as long as the dlopening application"
+	      echo "*** is linked with the -dlopen flag to resolve symbols at runtime."
 	      if test -z "$global_symbol_pipe"; then
-		$ECHO
-		$ECHO "*** However, this would only work if libtool was able to extract symbol"
-		$ECHO "*** lists from a program, using \`nm' or equivalent, but libtool could"
-		$ECHO "*** not find such a program.  So, this module is probably useless."
-		$ECHO "*** \`nm' from GNU binutils and a full rebuild may help."
+		echo
+		echo "*** However, this would only work if libtool was able to extract symbol"
+		echo "*** lists from a program, using \`nm' or equivalent, but libtool could"
+		echo "*** not find such a program.  So, this module is probably useless."
+		echo "*** \`nm' from GNU binutils and a full rebuild may help."
 	      fi
 	      if test "$build_old_libs" = no; then
 		build_libtool_libs=module
@@ -5867,37 +7000,46 @@ func_mode_link ()
 	           temp_xrpath=$func_stripname_result
 		   case " $xrpath " in
 		   *" $temp_xrpath "*) ;;
-		   *) xrpath="$xrpath $temp_xrpath";;
+		   *) func_append xrpath " $temp_xrpath";;
 		   esac;;
-	      *) temp_deplibs="$temp_deplibs $libdir";;
+	      *) func_append temp_deplibs " $libdir";;
 	      esac
 	    done
 	    dependency_libs="$temp_deplibs"
 	  fi
 
-	  newlib_search_path="$newlib_search_path $absdir"
+	  func_append newlib_search_path " $absdir"
 	  # Link against this library
 	  test "$link_static" = no && newdependency_libs="$abs_ladir/$laname $newdependency_libs"
 	  # ... and its dependency_libs
 	  tmp_libs=
 	  for deplib in $dependency_libs; do
 	    newdependency_libs="$deplib $newdependency_libs"
-	    if $opt_duplicate_deps ; then
+	    case $deplib in
+              -L*) func_stripname '-L' '' "$deplib"
+                   func_resolve_sysroot "$func_stripname_result";;
+              *) func_resolve_sysroot "$deplib" ;;
+            esac
+	    if $opt_preserve_dup_deps ; then
 	      case "$tmp_libs " in
-	      *" $deplib "*) specialdeplibs="$specialdeplibs $deplib" ;;
+	      *" $func_resolve_sysroot_result "*)
+                func_append specialdeplibs " $func_resolve_sysroot_result" ;;
 	      esac
 	    fi
-	    tmp_libs="$tmp_libs $deplib"
+	    func_append tmp_libs " $func_resolve_sysroot_result"
 	  done
 
 	  if test "$link_all_deplibs" != no; then
 	    # Add the search paths of all dependency libraries
 	    for deplib in $dependency_libs; do
+	      path=
 	      case $deplib in
 	      -L*) path="$deplib" ;;
 	      *.la)
+	        func_resolve_sysroot "$deplib"
+	        deplib=$func_resolve_sysroot_result
 	        func_dirname "$deplib" "" "."
-		dir="$func_dirname_result"
+		dir=$func_dirname_result
 		# We need an absolute path.
 		case $dir in
 		[\\/]* | [A-Za-z]:[\\/]*) absdir="$dir" ;;
@@ -5924,8 +7066,8 @@ func_mode_link ()
                       if test -z "$darwin_install_name"; then
                           darwin_install_name=`${OTOOL64} -L $depdepl  | awk '{if (NR == 2) {print $1;exit}}'`
                       fi
-		      compiler_flags="$compiler_flags ${wl}-dylib_file ${wl}${darwin_install_name}:${depdepl}"
-		      linker_flags="$linker_flags -dylib_file ${darwin_install_name}:${depdepl}"
+		      func_append compiler_flags " ${wl}-dylib_file ${wl}${darwin_install_name}:${depdepl}"
+		      func_append linker_flags " -dylib_file ${darwin_install_name}:${depdepl}"
 		      path=
 		    fi
 		  fi
@@ -5958,7 +7100,7 @@ func_mode_link ()
 	  compile_deplibs="$new_inherited_linker_flags $compile_deplibs"
 	  finalize_deplibs="$new_inherited_linker_flags $finalize_deplibs"
 	else
-	  compiler_flags="$compiler_flags "`$ECHO "X $new_inherited_linker_flags" | $Xsed -e 's% \([^ $]*\).ltframework% -framework \1%g'`
+	  compiler_flags="$compiler_flags "`$ECHO " $new_inherited_linker_flags" | $SED 's% \([^ $]*\).ltframework% -framework \1%g'`
 	fi
       fi
       dependency_libs="$newdependency_libs"
@@ -5975,7 +7117,7 @@ func_mode_link ()
 	  for dir in $newlib_search_path; do
 	    case "$lib_search_path " in
 	    *" $dir "*) ;;
-	    *) lib_search_path="$lib_search_path $dir" ;;
+	    *) func_append lib_search_path " $dir" ;;
 	    esac
 	  done
 	  newlib_search_path=
@@ -6033,10 +7175,10 @@ func_mode_link ()
 	    -L*)
 	      case " $tmp_libs " in
 	      *" $deplib "*) ;;
-	      *) tmp_libs="$tmp_libs $deplib" ;;
+	      *) func_append tmp_libs " $deplib" ;;
 	      esac
 	      ;;
-	    *) tmp_libs="$tmp_libs $deplib" ;;
+	    *) func_append tmp_libs " $deplib" ;;
 	    esac
 	  done
 	  eval $var=\"$tmp_libs\"
@@ -6052,7 +7194,7 @@ func_mode_link ()
 	  ;;
 	esac
 	if test -n "$i" ; then
-	  tmp_libs="$tmp_libs $i"
+	  func_append tmp_libs " $i"
 	fi
       done
       dependency_libs=$tmp_libs
@@ -6093,7 +7235,7 @@ func_mode_link ()
       # Now set the variables for building old libraries.
       build_libtool_libs=no
       oldlibs="$output"
-      objs="$objs$old_deplibs"
+      func_append objs "$old_deplibs"
       ;;
 
     lib)
@@ -6126,10 +7268,10 @@ func_mode_link ()
 	if test "$deplibs_check_method" != pass_all; then
 	  func_fatal_error "cannot build libtool library \`$output' from non-libtool objects on this host:$objs"
 	else
-	  $ECHO
+	  echo
 	  $ECHO "*** Warning: Linking the shared library $output against the non-libtool"
 	  $ECHO "*** objects $objs is not portable!"
-	  libobjs="$libobjs $objs"
+	  func_append libobjs " $objs"
 	fi
       fi
 
@@ -6188,13 +7330,14 @@ func_mode_link ()
 	  # which has an extra 1 added just for fun
 	  #
 	  case $version_type in
+	  # correct linux to gnu/linux during the next big refactor
 	  darwin|linux|osf|windows|none)
 	    func_arith $number_major + $number_minor
 	    current=$func_arith_result
 	    age="$number_minor"
 	    revision="$number_revision"
 	    ;;
-	  freebsd-aout|freebsd-elf|sunos)
+	  freebsd-aout|freebsd-elf|qnx|sunos)
 	    current="$number_major"
 	    revision="$number_minor"
 	    age="0"
@@ -6304,7 +7447,7 @@ func_mode_link ()
 	  versuffix="$major.$revision"
 	  ;;
 
-	linux)
+	linux) # correct to gnu/linux during the next big refactor
 	  func_arith $current - $age
 	  major=.$func_arith_result
 	  versuffix="$major.$age.$revision"
@@ -6327,7 +7470,7 @@ func_mode_link ()
 	  done
 
 	  # Make executables depend on our current version.
-	  verstring="$verstring:${current}.0"
+	  func_append verstring ":${current}.0"
 	  ;;
 
 	qnx)
@@ -6395,10 +7538,10 @@ func_mode_link ()
       fi
 
       func_generate_dlsyms "$libname" "$libname" "yes"
-      libobjs="$libobjs $symfileobj"
+      func_append libobjs " $symfileobj"
       test "X$libobjs" = "X " && libobjs=
 
-      if test "$mode" != relink; then
+      if test "$opt_mode" != relink; then
 	# Remove our outputs, but don't remove object files since they
 	# may have been created when compiling PIC objects.
 	removelist=
@@ -6414,7 +7557,7 @@ func_mode_link ()
 		   continue
 		 fi
 	       fi
-	       removelist="$removelist $p"
+	       func_append removelist " $p"
 	       ;;
 	    *) ;;
 	  esac
@@ -6425,27 +7568,28 @@ func_mode_link ()
 
       # Now set the variables for building old libraries.
       if test "$build_old_libs" = yes && test "$build_libtool_libs" != convenience ; then
-	oldlibs="$oldlibs $output_objdir/$libname.$libext"
+	func_append oldlibs " $output_objdir/$libname.$libext"
 
 	# Transform .lo files to .o files.
-	oldobjs="$objs "`$ECHO "X$libobjs" | $SP2NL | $Xsed -e '/\.'${libext}'$/d' -e "$lo2o" | $NL2SP`
+	oldobjs="$objs "`$ECHO "$libobjs" | $SP2NL | $SED "/\.${libext}$/d; $lo2o" | $NL2SP`
       fi
 
       # Eliminate all temporary directories.
       #for path in $notinst_path; do
-      #	lib_search_path=`$ECHO "X$lib_search_path " | $Xsed -e "s% $path % %g"`
-      #	deplibs=`$ECHO "X$deplibs " | $Xsed -e "s% -L$path % %g"`
-      #	dependency_libs=`$ECHO "X$dependency_libs " | $Xsed -e "s% -L$path % %g"`
+      #	lib_search_path=`$ECHO "$lib_search_path " | $SED "s% $path % %g"`
+      #	deplibs=`$ECHO "$deplibs " | $SED "s% -L$path % %g"`
+      #	dependency_libs=`$ECHO "$dependency_libs " | $SED "s% -L$path % %g"`
       #done
 
       if test -n "$xrpath"; then
 	# If the user specified any rpath flags, then add them.
 	temp_xrpath=
 	for libdir in $xrpath; do
-	  temp_xrpath="$temp_xrpath -R$libdir"
+	  func_replace_sysroot "$libdir"
+	  func_append temp_xrpath " -R$func_replace_sysroot_result"
 	  case "$finalize_rpath " in
 	  *" $libdir "*) ;;
-	  *) finalize_rpath="$finalize_rpath $libdir" ;;
+	  *) func_append finalize_rpath " $libdir" ;;
 	  esac
 	done
 	if test "$hardcode_into_libs" != yes || test "$build_old_libs" = yes; then
@@ -6459,7 +7603,7 @@ func_mode_link ()
       for lib in $old_dlfiles; do
 	case " $dlprefiles $dlfiles " in
 	*" $lib "*) ;;
-	*) dlfiles="$dlfiles $lib" ;;
+	*) func_append dlfiles " $lib" ;;
 	esac
       done
 
@@ -6469,19 +7613,19 @@ func_mode_link ()
       for lib in $old_dlprefiles; do
 	case "$dlprefiles " in
 	*" $lib "*) ;;
-	*) dlprefiles="$dlprefiles $lib" ;;
+	*) func_append dlprefiles " $lib" ;;
 	esac
       done
 
       if test "$build_libtool_libs" = yes; then
 	if test -n "$rpath"; then
 	  case $host in
-	  *-*-cygwin* | *-*-mingw* | *-*-pw32* | *-*-os2* | *-*-beos* | *-cegcc*)
+	  *-*-cygwin* | *-*-mingw* | *-*-pw32* | *-*-os2* | *-*-beos* | *-cegcc* | *-*-haiku*)
 	    # these systems don't actually have a c library (as such)!
 	    ;;
 	  *-*-rhapsody* | *-*-darwin1.[012])
 	    # Rhapsody C library is in the System framework
-	    deplibs="$deplibs System.ltframework"
+	    func_append deplibs " System.ltframework"
 	    ;;
 	  *-*-netbsd*)
 	    # Don't link with libc until the a.out ld.so is fixed.
@@ -6498,7 +7642,7 @@ func_mode_link ()
 	  *)
 	    # Add libc to deplibs on all other systems if necessary.
 	    if test "$build_libtool_need_lc" = "yes"; then
-	      deplibs="$deplibs -lc"
+	      func_append deplibs " -lc"
 	    fi
 	    ;;
 	  esac
@@ -6547,7 +7691,7 @@ EOF
 		if test "X$allow_libtool_libs_with_static_runtimes" = "Xyes" ; then
 		  case " $predeps $postdeps " in
 		  *" $i "*)
-		    newdeplibs="$newdeplibs $i"
+		    func_append newdeplibs " $i"
 		    i=""
 		    ;;
 		  esac
@@ -6558,21 +7702,21 @@ EOF
 		  set dummy $deplib_matches; shift
 		  deplib_match=$1
 		  if test `expr "$ldd_output" : ".*$deplib_match"` -ne 0 ; then
-		    newdeplibs="$newdeplibs $i"
+		    func_append newdeplibs " $i"
 		  else
 		    droppeddeps=yes
-		    $ECHO
+		    echo
 		    $ECHO "*** Warning: dynamic linker does not accept needed library $i."
-		    $ECHO "*** I have the capability to make that library automatically link in when"
-		    $ECHO "*** you link to this library.  But I can only do this if you have a"
-		    $ECHO "*** shared version of the library, which I believe you do not have"
-		    $ECHO "*** because a test_compile did reveal that the linker did not use it for"
-		    $ECHO "*** its dynamic dependency list that programs get resolved with at runtime."
+		    echo "*** I have the capability to make that library automatically link in when"
+		    echo "*** you link to this library.  But I can only do this if you have a"
+		    echo "*** shared version of the library, which I believe you do not have"
+		    echo "*** because a test_compile did reveal that the linker did not use it for"
+		    echo "*** its dynamic dependency list that programs get resolved with at runtime."
 		  fi
 		fi
 		;;
 	      *)
-		newdeplibs="$newdeplibs $i"
+		func_append newdeplibs " $i"
 		;;
 	      esac
 	    done
@@ -6590,7 +7734,7 @@ EOF
 		  if test "X$allow_libtool_libs_with_static_runtimes" = "Xyes" ; then
 		    case " $predeps $postdeps " in
 		    *" $i "*)
-		      newdeplibs="$newdeplibs $i"
+		      func_append newdeplibs " $i"
 		      i=""
 		      ;;
 		    esac
@@ -6601,29 +7745,29 @@ EOF
 		    set dummy $deplib_matches; shift
 		    deplib_match=$1
 		    if test `expr "$ldd_output" : ".*$deplib_match"` -ne 0 ; then
-		      newdeplibs="$newdeplibs $i"
+		      func_append newdeplibs " $i"
 		    else
 		      droppeddeps=yes
-		      $ECHO
+		      echo
 		      $ECHO "*** Warning: dynamic linker does not accept needed library $i."
-		      $ECHO "*** I have the capability to make that library automatically link in when"
-		      $ECHO "*** you link to this library.  But I can only do this if you have a"
-		      $ECHO "*** shared version of the library, which you do not appear to have"
-		      $ECHO "*** because a test_compile did reveal that the linker did not use this one"
-		      $ECHO "*** as a dynamic dependency that programs can get resolved with at runtime."
+		      echo "*** I have the capability to make that library automatically link in when"
+		      echo "*** you link to this library.  But I can only do this if you have a"
+		      echo "*** shared version of the library, which you do not appear to have"
+		      echo "*** because a test_compile did reveal that the linker did not use this one"
+		      echo "*** as a dynamic dependency that programs can get resolved with at runtime."
 		    fi
 		  fi
 		else
 		  droppeddeps=yes
-		  $ECHO
+		  echo
 		  $ECHO "*** Warning!  Library $i is needed by this library but I was not able to"
-		  $ECHO "*** make it link in!  You will probably need to install it or some"
-		  $ECHO "*** library that it depends on before this library will be fully"
-		  $ECHO "*** functional.  Installing it before continuing would be even better."
+		  echo "*** make it link in!  You will probably need to install it or some"
+		  echo "*** library that it depends on before this library will be fully"
+		  echo "*** functional.  Installing it before continuing would be even better."
 		fi
 		;;
 	      *)
-		newdeplibs="$newdeplibs $i"
+		func_append newdeplibs " $i"
 		;;
 	      esac
 	    done
@@ -6640,15 +7784,27 @@ EOF
 	      if test "X$allow_libtool_libs_with_static_runtimes" = "Xyes" ; then
 		case " $predeps $postdeps " in
 		*" $a_deplib "*)
-		  newdeplibs="$newdeplibs $a_deplib"
+		  func_append newdeplibs " $a_deplib"
 		  a_deplib=""
 		  ;;
 		esac
 	      fi
 	      if test -n "$a_deplib" ; then
 		libname=`eval "\\$ECHO \"$libname_spec\""`
+		if test -n "$file_magic_glob"; then
+		  libnameglob=`func_echo_all "$libname" | $SED -e $file_magic_glob`
+		else
+		  libnameglob=$libname
+		fi
+		test "$want_nocaseglob" = yes && nocaseglob=`shopt -p nocaseglob`
 		for i in $lib_search_path $sys_lib_search_path $shlib_search_path; do
-		  potential_libs=`ls $i/$libname[.-]* 2>/dev/null`
+		  if test "$want_nocaseglob" = yes; then
+		    shopt -s nocaseglob
+		    potential_libs=`ls $i/$libnameglob[.-]* 2>/dev/null`
+		    $nocaseglob
+		  else
+		    potential_libs=`ls $i/$libnameglob[.-]* 2>/dev/null`
+		  fi
 		  for potent_lib in $potential_libs; do
 		      # Follow soft links.
 		      if ls -lLd "$potent_lib" 2>/dev/null |
@@ -6665,13 +7821,13 @@ EOF
 			potliblink=`ls -ld $potlib | ${SED} 's/.* -> //'`
 			case $potliblink in
 			[\\/]* | [A-Za-z]:[\\/]*) potlib="$potliblink";;
-			*) potlib=`$ECHO "X$potlib" | $Xsed -e 's,[^/]*$,,'`"$potliblink";;
+			*) potlib=`$ECHO "$potlib" | $SED 's,[^/]*$,,'`"$potliblink";;
 			esac
 		      done
 		      if eval $file_magic_cmd \"\$potlib\" 2>/dev/null |
 			 $SED -e 10q |
 			 $EGREP "$file_magic_regex" > /dev/null; then
-			newdeplibs="$newdeplibs $a_deplib"
+			func_append newdeplibs " $a_deplib"
 			a_deplib=""
 			break 2
 		      fi
@@ -6680,12 +7836,12 @@ EOF
 	      fi
 	      if test -n "$a_deplib" ; then
 		droppeddeps=yes
-		$ECHO
+		echo
 		$ECHO "*** Warning: linker path does not have real file for library $a_deplib."
-		$ECHO "*** I have the capability to make that library automatically link in when"
-		$ECHO "*** you link to this library.  But I can only do this if you have a"
-		$ECHO "*** shared version of the library, which you do not appear to have"
-		$ECHO "*** because I did check the linker path looking for a file starting"
+		echo "*** I have the capability to make that library automatically link in when"
+		echo "*** you link to this library.  But I can only do this if you have a"
+		echo "*** shared version of the library, which you do not appear to have"
+		echo "*** because I did check the linker path looking for a file starting"
 		if test -z "$potlib" ; then
 		  $ECHO "*** with $libname but no candidates were found. (...for file magic test)"
 		else
@@ -6696,7 +7852,7 @@ EOF
 	      ;;
 	    *)
 	      # Add a -L argument.
-	      newdeplibs="$newdeplibs $a_deplib"
+	      func_append newdeplibs " $a_deplib"
 	      ;;
 	    esac
 	  done # Gone through all deplibs.
@@ -6712,7 +7868,7 @@ EOF
 	      if test "X$allow_libtool_libs_with_static_runtimes" = "Xyes" ; then
 		case " $predeps $postdeps " in
 		*" $a_deplib "*)
-		  newdeplibs="$newdeplibs $a_deplib"
+		  func_append newdeplibs " $a_deplib"
 		  a_deplib=""
 		  ;;
 		esac
@@ -6723,9 +7879,9 @@ EOF
 		  potential_libs=`ls $i/$libname[.-]* 2>/dev/null`
 		  for potent_lib in $potential_libs; do
 		    potlib="$potent_lib" # see symlink-check above in file_magic test
-		    if eval "\$ECHO \"X$potent_lib\"" 2>/dev/null | $Xsed -e 10q | \
+		    if eval "\$ECHO \"$potent_lib\"" 2>/dev/null | $SED 10q | \
 		       $EGREP "$match_pattern_regex" > /dev/null; then
-		      newdeplibs="$newdeplibs $a_deplib"
+		      func_append newdeplibs " $a_deplib"
 		      a_deplib=""
 		      break 2
 		    fi
@@ -6734,12 +7890,12 @@ EOF
 	      fi
 	      if test -n "$a_deplib" ; then
 		droppeddeps=yes
-		$ECHO
+		echo
 		$ECHO "*** Warning: linker path does not have real file for library $a_deplib."
-		$ECHO "*** I have the capability to make that library automatically link in when"
-		$ECHO "*** you link to this library.  But I can only do this if you have a"
-		$ECHO "*** shared version of the library, which you do not appear to have"
-		$ECHO "*** because I did check the linker path looking for a file starting"
+		echo "*** I have the capability to make that library automatically link in when"
+		echo "*** you link to this library.  But I can only do this if you have a"
+		echo "*** shared version of the library, which you do not appear to have"
+		echo "*** because I did check the linker path looking for a file starting"
 		if test -z "$potlib" ; then
 		  $ECHO "*** with $libname but no candidates were found. (...for regex pattern test)"
 		else
@@ -6750,32 +7906,32 @@ EOF
 	      ;;
 	    *)
 	      # Add a -L argument.
-	      newdeplibs="$newdeplibs $a_deplib"
+	      func_append newdeplibs " $a_deplib"
 	      ;;
 	    esac
 	  done # Gone through all deplibs.
 	  ;;
 	none | unknown | *)
 	  newdeplibs=""
-	  tmp_deplibs=`$ECHO "X $deplibs" | $Xsed \
-	      -e 's/ -lc$//' -e 's/ -[LR][^ ]*//g'`
+	  tmp_deplibs=`$ECHO " $deplibs" | $SED 's/ -lc$//; s/ -[LR][^ ]*//g'`
 	  if test "X$allow_libtool_libs_with_static_runtimes" = "Xyes" ; then
 	    for i in $predeps $postdeps ; do
 	      # can't use Xsed below, because $i might contain '/'
-	      tmp_deplibs=`$ECHO "X $tmp_deplibs" | $Xsed -e "s,$i,,"`
+	      tmp_deplibs=`$ECHO " $tmp_deplibs" | $SED "s,$i,,"`
 	    done
 	  fi
-	  if $ECHO "X $tmp_deplibs" | $Xsed -e 's/[	 ]//g' |
-	     $GREP . >/dev/null; then
-	    $ECHO
+	  case $tmp_deplibs in
+	  *[!\	\ ]*)
+	    echo
 	    if test "X$deplibs_check_method" = "Xnone"; then
-	      $ECHO "*** Warning: inter-library dependencies are not supported in this platform."
+	      echo "*** Warning: inter-library dependencies are not supported in this platform."
 	    else
-	      $ECHO "*** Warning: inter-library dependencies are not known to be supported."
+	      echo "*** Warning: inter-library dependencies are not known to be supported."
 	    fi
-	    $ECHO "*** All declared inter-library dependencies are being dropped."
+	    echo "*** All declared inter-library dependencies are being dropped."
 	    droppeddeps=yes
-	  fi
+	    ;;
+	  esac
 	  ;;
 	esac
 	versuffix=$versuffix_save
@@ -6787,23 +7943,23 @@ EOF
 	case $host in
 	*-*-rhapsody* | *-*-darwin1.[012])
 	  # On Rhapsody replace the C library with the System framework
-	  newdeplibs=`$ECHO "X $newdeplibs" | $Xsed -e 's/ -lc / System.ltframework /'`
+	  newdeplibs=`$ECHO " $newdeplibs" | $SED 's/ -lc / System.ltframework /'`
 	  ;;
 	esac
 
 	if test "$droppeddeps" = yes; then
 	  if test "$module" = yes; then
-	    $ECHO
-	    $ECHO "*** Warning: libtool could not satisfy all declared inter-library"
+	    echo
+	    echo "*** Warning: libtool could not satisfy all declared inter-library"
 	    $ECHO "*** dependencies of module $libname.  Therefore, libtool will create"
-	    $ECHO "*** a static module, that should work as long as the dlopening"
-	    $ECHO "*** application is linked with the -dlopen flag."
+	    echo "*** a static module, that should work as long as the dlopening"
+	    echo "*** application is linked with the -dlopen flag."
 	    if test -z "$global_symbol_pipe"; then
-	      $ECHO
-	      $ECHO "*** However, this would only work if libtool was able to extract symbol"
-	      $ECHO "*** lists from a program, using \`nm' or equivalent, but libtool could"
-	      $ECHO "*** not find such a program.  So, this module is probably useless."
-	      $ECHO "*** \`nm' from GNU binutils and a full rebuild may help."
+	      echo
+	      echo "*** However, this would only work if libtool was able to extract symbol"
+	      echo "*** lists from a program, using \`nm' or equivalent, but libtool could"
+	      echo "*** not find such a program.  So, this module is probably useless."
+	      echo "*** \`nm' from GNU binutils and a full rebuild may help."
 	    fi
 	    if test "$build_old_libs" = no; then
 	      oldlibs="$output_objdir/$libname.$libext"
@@ -6813,16 +7969,16 @@ EOF
 	      build_libtool_libs=no
 	    fi
 	  else
-	    $ECHO "*** The inter-library dependencies that have been dropped here will be"
-	    $ECHO "*** automatically added whenever a program is linked with this library"
-	    $ECHO "*** or is declared to -dlopen it."
+	    echo "*** The inter-library dependencies that have been dropped here will be"
+	    echo "*** automatically added whenever a program is linked with this library"
+	    echo "*** or is declared to -dlopen it."
 
 	    if test "$allow_undefined" = no; then
-	      $ECHO
-	      $ECHO "*** Since this library must not contain undefined symbols,"
-	      $ECHO "*** because either the platform does not support them or"
-	      $ECHO "*** it was explicitly requested with -no-undefined,"
-	      $ECHO "*** libtool will only create a static version of it."
+	      echo
+	      echo "*** Since this library must not contain undefined symbols,"
+	      echo "*** because either the platform does not support them or"
+	      echo "*** it was explicitly requested with -no-undefined,"
+	      echo "*** libtool will only create a static version of it."
 	      if test "$build_old_libs" = no; then
 		oldlibs="$output_objdir/$libname.$libext"
 		build_libtool_libs=module
@@ -6839,9 +7995,9 @@ EOF
       # Time to change all our "foo.ltframework" stuff back to "-framework foo"
       case $host in
 	*-*-darwin*)
-	  newdeplibs=`$ECHO "X $newdeplibs" | $Xsed -e 's% \([^ $]*\).ltframework% -framework \1%g'`
-	  new_inherited_linker_flags=`$ECHO "X $new_inherited_linker_flags" | $Xsed -e 's% \([^ $]*\).ltframework% -framework \1%g'`
-	  deplibs=`$ECHO "X $deplibs" | $Xsed -e 's% \([^ $]*\).ltframework% -framework \1%g'`
+	  newdeplibs=`$ECHO " $newdeplibs" | $SED 's% \([^ $]*\).ltframework% -framework \1%g'`
+	  new_inherited_linker_flags=`$ECHO " $new_inherited_linker_flags" | $SED 's% \([^ $]*\).ltframework% -framework \1%g'`
+	  deplibs=`$ECHO " $deplibs" | $SED 's% \([^ $]*\).ltframework% -framework \1%g'`
 	  ;;
       esac
 
@@ -6854,7 +8010,7 @@ EOF
 	*)
 	  case " $deplibs " in
 	  *" -L$path/$objdir "*)
-	    new_libs="$new_libs -L$path/$objdir" ;;
+	    func_append new_libs " -L$path/$objdir" ;;
 	  esac
 	  ;;
 	esac
@@ -6864,10 +8020,10 @@ EOF
 	-L*)
 	  case " $new_libs " in
 	  *" $deplib "*) ;;
-	  *) new_libs="$new_libs $deplib" ;;
+	  *) func_append new_libs " $deplib" ;;
 	  esac
 	  ;;
-	*) new_libs="$new_libs $deplib" ;;
+	*) func_append new_libs " $deplib" ;;
 	esac
       done
       deplibs="$new_libs"
@@ -6879,15 +8035,22 @@ EOF
 
       # Test again, we may have decided not to build it any more
       if test "$build_libtool_libs" = yes; then
+	# Remove ${wl} instances when linking with ld.
+	# FIXME: should test the right _cmds variable.
+	case $archive_cmds in
+	  *\$LD\ *) wl= ;;
+        esac
 	if test "$hardcode_into_libs" = yes; then
 	  # Hardcode the library paths
 	  hardcode_libdirs=
 	  dep_rpath=
 	  rpath="$finalize_rpath"
-	  test "$mode" != relink && rpath="$compile_rpath$rpath"
+	  test "$opt_mode" != relink && rpath="$compile_rpath$rpath"
 	  for libdir in $rpath; do
 	    if test -n "$hardcode_libdir_flag_spec"; then
 	      if test -n "$hardcode_libdir_separator"; then
+		func_replace_sysroot "$libdir"
+		libdir=$func_replace_sysroot_result
 		if test -z "$hardcode_libdirs"; then
 		  hardcode_libdirs="$libdir"
 		else
@@ -6896,18 +8059,18 @@ EOF
 		  *"$hardcode_libdir_separator$libdir$hardcode_libdir_separator"*)
 		    ;;
 		  *)
-		    hardcode_libdirs="$hardcode_libdirs$hardcode_libdir_separator$libdir"
+		    func_append hardcode_libdirs "$hardcode_libdir_separator$libdir"
 		    ;;
 		  esac
 		fi
 	      else
 		eval flag=\"$hardcode_libdir_flag_spec\"
-		dep_rpath="$dep_rpath $flag"
+		func_append dep_rpath " $flag"
 	      fi
 	    elif test -n "$runpath_var"; then
 	      case "$perm_rpath " in
 	      *" $libdir "*) ;;
-	      *) perm_rpath="$perm_rpath $libdir" ;;
+	      *) func_append perm_rpath " $libdir" ;;
 	      esac
 	    fi
 	  done
@@ -6915,17 +8078,13 @@ EOF
 	  if test -n "$hardcode_libdir_separator" &&
 	     test -n "$hardcode_libdirs"; then
 	    libdir="$hardcode_libdirs"
-	    if test -n "$hardcode_libdir_flag_spec_ld"; then
-	      eval dep_rpath=\"$hardcode_libdir_flag_spec_ld\"
-	    else
-	      eval dep_rpath=\"$hardcode_libdir_flag_spec\"
-	    fi
+	    eval "dep_rpath=\"$hardcode_libdir_flag_spec\""
 	  fi
 	  if test -n "$runpath_var" && test -n "$perm_rpath"; then
 	    # We should set the runpath_var.
 	    rpath=
 	    for dir in $perm_rpath; do
-	      rpath="$rpath$dir:"
+	      func_append rpath "$dir:"
 	    done
 	    eval "$runpath_var='$rpath\$$runpath_var'; export $runpath_var"
 	  fi
@@ -6933,7 +8092,7 @@ EOF
 	fi
 
 	shlibpath="$finalize_shlibpath"
-	test "$mode" != relink && shlibpath="$compile_shlibpath$shlibpath"
+	test "$opt_mode" != relink && shlibpath="$compile_shlibpath$shlibpath"
 	if test -n "$shlibpath"; then
 	  eval "$shlibpath_var='$shlibpath\$$shlibpath_var'; export $shlibpath_var"
 	fi
@@ -6959,18 +8118,18 @@ EOF
 	linknames=
 	for link
 	do
-	  linknames="$linknames $link"
+	  func_append linknames " $link"
 	done
 
 	# Use standard objects if they are pic
-	test -z "$pic_flag" && libobjs=`$ECHO "X$libobjs" | $SP2NL | $Xsed -e "$lo2o" | $NL2SP`
+	test -z "$pic_flag" && libobjs=`$ECHO "$libobjs" | $SP2NL | $SED "$lo2o" | $NL2SP`
 	test "X$libobjs" = "X " && libobjs=
 
 	delfiles=
 	if test -n "$export_symbols" && test -n "$include_expsyms"; then
 	  $opt_dry_run || cp "$export_symbols" "$output_objdir/$libname.uexp"
 	  export_symbols="$output_objdir/$libname.uexp"
-	  delfiles="$delfiles $export_symbols"
+	  func_append delfiles " $export_symbols"
 	fi
 
 	orig_export_symbols=
@@ -7001,13 +8160,45 @@ EOF
 	    $opt_dry_run || $RM $export_symbols
 	    cmds=$export_symbols_cmds
 	    save_ifs="$IFS"; IFS='~'
-	    for cmd in $cmds; do
+	    for cmd1 in $cmds; do
 	      IFS="$save_ifs"
-	      eval cmd=\"$cmd\"
-	      func_len " $cmd"
-	      len=$func_len_result
-	      if test "$len" -lt "$max_cmd_len" || test "$max_cmd_len" -le -1; then
+	      # Take the normal branch if the nm_file_list_spec branch
+	      # doesn't work or if tool conversion is not needed.
+	      case $nm_file_list_spec~$to_tool_file_cmd in
+		*~func_convert_file_noop | *~func_convert_file_msys_to_w32 | ~*)
+		  try_normal_branch=yes
+		  eval cmd=\"$cmd1\"
+		  func_len " $cmd"
+		  len=$func_len_result
+		  ;;
+		*)
+		  try_normal_branch=no
+		  ;;
+	      esac
+	      if test "$try_normal_branch" = yes \
+		 && { test "$len" -lt "$max_cmd_len" \
+		      || test "$max_cmd_len" -le -1; }
+	      then
+		func_show_eval "$cmd" 'exit $?'
+		skipped_export=false
+	      elif test -n "$nm_file_list_spec"; then
+		func_basename "$output"
+		output_la=$func_basename_result
+		save_libobjs=$libobjs
+		save_output=$output
+		output=${output_objdir}/${output_la}.nm
+		func_to_tool_file "$output"
+		libobjs=$nm_file_list_spec$func_to_tool_file_result
+		func_append delfiles " $output"
+		func_verbose "creating $NM input file list: $output"
+		for obj in $save_libobjs; do
+		  func_to_tool_file "$obj"
+		  $ECHO "$func_to_tool_file_result"
+		done > "$output"
+		eval cmd=\"$cmd1\"
 		func_show_eval "$cmd" 'exit $?'
+		output=$save_output
+		libobjs=$save_libobjs
 		skipped_export=false
 	      else
 		# The command line is too long to execute in one step.
@@ -7029,7 +8220,7 @@ EOF
 	if test -n "$export_symbols" && test -n "$include_expsyms"; then
 	  tmp_export_symbols="$export_symbols"
 	  test -n "$orig_export_symbols" && tmp_export_symbols="$orig_export_symbols"
-	  $opt_dry_run || eval '$ECHO "X$include_expsyms" | $Xsed | $SP2NL >> "$tmp_export_symbols"'
+	  $opt_dry_run || eval '$ECHO "$include_expsyms" | $SP2NL >> "$tmp_export_symbols"'
 	fi
 
 	if test "X$skipped_export" != "X:" && test -n "$orig_export_symbols"; then
@@ -7041,7 +8232,7 @@ EOF
 	  # global variables. join(1) would be nice here, but unfortunately
 	  # isn't a blessed tool.
 	  $opt_dry_run || $SED -e '/[ ,]DATA/!d;s,\(.*\)\([ \,].*\),s|^\1$|\1\2|,' < $export_symbols > $output_objdir/$libname.filter
-	  delfiles="$delfiles $export_symbols $output_objdir/$libname.filter"
+	  func_append delfiles " $export_symbols $output_objdir/$libname.filter"
 	  export_symbols=$output_objdir/$libname.def
 	  $opt_dry_run || $SED -f $output_objdir/$libname.filter < $orig_export_symbols > $export_symbols
 	fi
@@ -7051,7 +8242,7 @@ EOF
 	  case " $convenience " in
 	  *" $test_deplib "*) ;;
 	  *)
-	    tmp_deplibs="$tmp_deplibs $test_deplib"
+	    func_append tmp_deplibs " $test_deplib"
 	    ;;
 	  esac
 	done
@@ -7071,21 +8262,21 @@ EOF
 	    test "X$libobjs" = "X " && libobjs=
 	  else
 	    gentop="$output_objdir/${outputname}x"
-	    generated="$generated $gentop"
+	    func_append generated " $gentop"
 
 	    func_extract_archives $gentop $convenience
-	    libobjs="$libobjs $func_extract_archives_result"
+	    func_append libobjs " $func_extract_archives_result"
 	    test "X$libobjs" = "X " && libobjs=
 	  fi
 	fi
 
 	if test "$thread_safe" = yes && test -n "$thread_safe_flag_spec"; then
 	  eval flag=\"$thread_safe_flag_spec\"
-	  linker_flags="$linker_flags $flag"
+	  func_append linker_flags " $flag"
 	fi
 
 	# Make a backup of the uninstalled library when relinking
-	if test "$mode" = relink; then
+	if test "$opt_mode" = relink; then
 	  $opt_dry_run || eval '(cd $output_objdir && $RM ${realname}U && $MV $realname ${realname}U)' || exit $?
 	fi
 
@@ -7130,7 +8321,8 @@ EOF
 	    save_libobjs=$libobjs
 	  fi
 	  save_output=$output
-	  output_la=`$ECHO "X$output" | $Xsed -e "$basename"`
+	  func_basename "$output"
+	  output_la=$func_basename_result
 
 	  # Clear the reloadable object creation command queue and
 	  # initialize k to one.
@@ -7143,13 +8335,16 @@ EOF
 	  if test -n "$save_libobjs" && test "X$skipped_export" != "X:" && test "$with_gnu_ld" = yes; then
 	    output=${output_objdir}/${output_la}.lnkscript
 	    func_verbose "creating GNU ld script: $output"
-	    $ECHO 'INPUT (' > $output
+	    echo 'INPUT (' > $output
 	    for obj in $save_libobjs
 	    do
-	      $ECHO "$obj" >> $output
+	      func_to_tool_file "$obj"
+	      $ECHO "$func_to_tool_file_result" >> $output
 	    done
-	    $ECHO ')' >> $output
-	    delfiles="$delfiles $output"
+	    echo ')' >> $output
+	    func_append delfiles " $output"
+	    func_to_tool_file "$output"
+	    output=$func_to_tool_file_result
 	  elif test -n "$save_libobjs" && test "X$skipped_export" != "X:" && test "X$file_list_spec" != X; then
 	    output=${output_objdir}/${output_la}.lnk
 	    func_verbose "creating linker input file list: $output"
@@ -7163,10 +8358,12 @@ EOF
 	    fi
 	    for obj
 	    do
-	      $ECHO "$obj" >> $output
+	      func_to_tool_file "$obj"
+	      $ECHO "$func_to_tool_file_result" >> $output
 	    done
-	    delfiles="$delfiles $output"
-	    output=$firstobj\"$file_list_spec$output\"
+	    func_append delfiles " $output"
+	    func_to_tool_file "$output"
+	    output=$firstobj\"$file_list_spec$func_to_tool_file_result\"
 	  else
 	    if test -n "$save_libobjs"; then
 	      func_verbose "creating reloadable object files..."
@@ -7190,17 +8387,19 @@ EOF
 		  # command to the queue.
 		  if test "$k" -eq 1 ; then
 		    # The first file doesn't have a previous command to add.
-		    eval concat_cmds=\"$reload_cmds $objlist $last_robj\"
+		    reload_objs=$objlist
+		    eval concat_cmds=\"$reload_cmds\"
 		  else
 		    # All subsequent reloadable object files will link in
 		    # the last one created.
-		    eval concat_cmds=\"\$concat_cmds~$reload_cmds $objlist $last_robj~\$RM $last_robj\"
+		    reload_objs="$objlist $last_robj"
+		    eval concat_cmds=\"\$concat_cmds~$reload_cmds~\$RM $last_robj\"
 		  fi
 		  last_robj=$output_objdir/$output_la-${k}.$objext
 		  func_arith $k + 1
 		  k=$func_arith_result
 		  output=$output_objdir/$output_la-${k}.$objext
-		  objlist=$obj
+		  objlist=" $obj"
 		  func_len " $last_robj"
 		  func_arith $len0 + $func_len_result
 		  len=$func_arith_result
@@ -7210,11 +8409,12 @@ EOF
 	      # reloadable object file.  All subsequent reloadable object
 	      # files will link in the last one created.
 	      test -z "$concat_cmds" || concat_cmds=$concat_cmds~
-	      eval concat_cmds=\"\${concat_cmds}$reload_cmds $objlist $last_robj\"
+	      reload_objs="$objlist $last_robj"
+	      eval concat_cmds=\"\${concat_cmds}$reload_cmds\"
 	      if test -n "$last_robj"; then
 	        eval concat_cmds=\"\${concat_cmds}~\$RM $last_robj\"
 	      fi
-	      delfiles="$delfiles $output"
+	      func_append delfiles " $output"
 
 	    else
 	      output=
@@ -7248,7 +8448,7 @@ EOF
 		lt_exit=$?
 
 		# Restore the uninstalled library and exit
-		if test "$mode" = relink; then
+		if test "$opt_mode" = relink; then
 		  ( cd "$output_objdir" && \
 		    $RM "${realname}T" && \
 		    $MV "${realname}U" "$realname" )
@@ -7269,7 +8469,7 @@ EOF
 	    if test -n "$export_symbols" && test -n "$include_expsyms"; then
 	      tmp_export_symbols="$export_symbols"
 	      test -n "$orig_export_symbols" && tmp_export_symbols="$orig_export_symbols"
-	      $opt_dry_run || eval '$ECHO "X$include_expsyms" | $Xsed | $SP2NL >> "$tmp_export_symbols"'
+	      $opt_dry_run || eval '$ECHO "$include_expsyms" | $SP2NL >> "$tmp_export_symbols"'
 	    fi
 
 	    if test -n "$orig_export_symbols"; then
@@ -7281,7 +8481,7 @@ EOF
 	      # global variables. join(1) would be nice here, but unfortunately
 	      # isn't a blessed tool.
 	      $opt_dry_run || $SED -e '/[ ,]DATA/!d;s,\(.*\)\([ \,].*\),s|^\1$|\1\2|,' < $export_symbols > $output_objdir/$libname.filter
-	      delfiles="$delfiles $export_symbols $output_objdir/$libname.filter"
+	      func_append delfiles " $export_symbols $output_objdir/$libname.filter"
 	      export_symbols=$output_objdir/$libname.def
 	      $opt_dry_run || $SED -f $output_objdir/$libname.filter < $orig_export_symbols > $export_symbols
 	    fi
@@ -7322,10 +8522,10 @@ EOF
 	# Add any objects from preloaded convenience libraries
 	if test -n "$dlprefiles"; then
 	  gentop="$output_objdir/${outputname}x"
-	  generated="$generated $gentop"
+	  func_append generated " $gentop"
 
 	  func_extract_archives $gentop $dlprefiles
-	  libobjs="$libobjs $func_extract_archives_result"
+	  func_append libobjs " $func_extract_archives_result"
 	  test "X$libobjs" = "X " && libobjs=
 	fi
 
@@ -7341,7 +8541,7 @@ EOF
 	    lt_exit=$?
 
 	    # Restore the uninstalled library and exit
-	    if test "$mode" = relink; then
+	    if test "$opt_mode" = relink; then
 	      ( cd "$output_objdir" && \
 	        $RM "${realname}T" && \
 		$MV "${realname}U" "$realname" )
@@ -7353,7 +8553,7 @@ EOF
 	IFS="$save_ifs"
 
 	# Restore the uninstalled library and exit
-	if test "$mode" = relink; then
+	if test "$opt_mode" = relink; then
 	  $opt_dry_run || eval '(cd $output_objdir && $RM ${realname}T && $MV $realname ${realname}T && $MV ${realname}U $realname)' || exit $?
 
 	  if test -n "$convenience"; then
@@ -7434,18 +8634,21 @@ EOF
       if test -n "$convenience"; then
 	if test -n "$whole_archive_flag_spec"; then
 	  eval tmp_whole_archive_flags=\"$whole_archive_flag_spec\"
-	  reload_conv_objs=$reload_objs\ `$ECHO "X$tmp_whole_archive_flags" | $Xsed -e 's|,| |g'`
+	  reload_conv_objs=$reload_objs\ `$ECHO "$tmp_whole_archive_flags" | $SED 's|,| |g'`
 	else
 	  gentop="$output_objdir/${obj}x"
-	  generated="$generated $gentop"
+	  func_append generated " $gentop"
 
 	  func_extract_archives $gentop $convenience
 	  reload_conv_objs="$reload_objs $func_extract_archives_result"
 	fi
       fi
 
+      # If we're not building shared, we need to use non_pic_objs
+      test "$build_libtool_libs" != yes && libobjs="$non_pic_objects"
+
       # Create the old-style object.
-      reload_objs="$objs$old_deplibs "`$ECHO "X$libobjs" | $SP2NL | $Xsed -e '/\.'${libext}$'/d' -e '/\.lib$/d' -e "$lo2o" | $NL2SP`" $reload_conv_objs" ### testsuite: skip nested quoting test
+      reload_objs="$objs$old_deplibs "`$ECHO "$libobjs" | $SP2NL | $SED "/\.${libext}$/d; /\.lib$/d; $lo2o" | $NL2SP`" $reload_conv_objs" ### testsuite: skip nested quoting test
 
       output="$obj"
       func_execute_cmds "$reload_cmds" 'exit $?'
@@ -7505,8 +8708,8 @@ EOF
       case $host in
       *-*-rhapsody* | *-*-darwin1.[012])
 	# On Rhapsody replace the C library is the System framework
-	compile_deplibs=`$ECHO "X $compile_deplibs" | $Xsed -e 's/ -lc / System.ltframework /'`
-	finalize_deplibs=`$ECHO "X $finalize_deplibs" | $Xsed -e 's/ -lc / System.ltframework /'`
+	compile_deplibs=`$ECHO " $compile_deplibs" | $SED 's/ -lc / System.ltframework /'`
+	finalize_deplibs=`$ECHO " $finalize_deplibs" | $SED 's/ -lc / System.ltframework /'`
 	;;
       esac
 
@@ -7517,14 +8720,14 @@ EOF
 	if test "$tagname" = CXX ; then
 	  case ${MACOSX_DEPLOYMENT_TARGET-10.0} in
 	    10.[0123])
-	      compile_command="$compile_command ${wl}-bind_at_load"
-	      finalize_command="$finalize_command ${wl}-bind_at_load"
+	      func_append compile_command " ${wl}-bind_at_load"
+	      func_append finalize_command " ${wl}-bind_at_load"
 	    ;;
 	  esac
 	fi
 	# Time to change all our "foo.ltframework" stuff back to "-framework foo"
-	compile_deplibs=`$ECHO "X $compile_deplibs" | $Xsed -e 's% \([^ $]*\).ltframework% -framework \1%g'`
-	finalize_deplibs=`$ECHO "X $finalize_deplibs" | $Xsed -e 's% \([^ $]*\).ltframework% -framework \1%g'`
+	compile_deplibs=`$ECHO " $compile_deplibs" | $SED 's% \([^ $]*\).ltframework% -framework \1%g'`
+	finalize_deplibs=`$ECHO " $finalize_deplibs" | $SED 's% \([^ $]*\).ltframework% -framework \1%g'`
 	;;
       esac
 
@@ -7538,7 +8741,7 @@ EOF
 	*)
 	  case " $compile_deplibs " in
 	  *" -L$path/$objdir "*)
-	    new_libs="$new_libs -L$path/$objdir" ;;
+	    func_append new_libs " -L$path/$objdir" ;;
 	  esac
 	  ;;
 	esac
@@ -7548,17 +8751,17 @@ EOF
 	-L*)
 	  case " $new_libs " in
 	  *" $deplib "*) ;;
-	  *) new_libs="$new_libs $deplib" ;;
+	  *) func_append new_libs " $deplib" ;;
 	  esac
 	  ;;
-	*) new_libs="$new_libs $deplib" ;;
+	*) func_append new_libs " $deplib" ;;
 	esac
       done
       compile_deplibs="$new_libs"
 
 
-      compile_command="$compile_command $compile_deplibs"
-      finalize_command="$finalize_command $finalize_deplibs"
+      func_append compile_command " $compile_deplibs"
+      func_append finalize_command " $finalize_deplibs"
 
       if test -n "$rpath$xrpath"; then
 	# If the user specified any rpath flags, then add them.
@@ -7566,7 +8769,7 @@ EOF
 	  # This is the magic to use -rpath.
 	  case "$finalize_rpath " in
 	  *" $libdir "*) ;;
-	  *) finalize_rpath="$finalize_rpath $libdir" ;;
+	  *) func_append finalize_rpath " $libdir" ;;
 	  esac
 	done
       fi
@@ -7585,18 +8788,18 @@ EOF
 	      *"$hardcode_libdir_separator$libdir$hardcode_libdir_separator"*)
 		;;
 	      *)
-		hardcode_libdirs="$hardcode_libdirs$hardcode_libdir_separator$libdir"
+		func_append hardcode_libdirs "$hardcode_libdir_separator$libdir"
 		;;
 	      esac
 	    fi
 	  else
 	    eval flag=\"$hardcode_libdir_flag_spec\"
-	    rpath="$rpath $flag"
+	    func_append rpath " $flag"
 	  fi
 	elif test -n "$runpath_var"; then
 	  case "$perm_rpath " in
 	  *" $libdir "*) ;;
-	  *) perm_rpath="$perm_rpath $libdir" ;;
+	  *) func_append perm_rpath " $libdir" ;;
 	  esac
 	fi
 	case $host in
@@ -7605,12 +8808,12 @@ EOF
 	  case :$dllsearchpath: in
 	  *":$libdir:"*) ;;
 	  ::) dllsearchpath=$libdir;;
-	  *) dllsearchpath="$dllsearchpath:$libdir";;
+	  *) func_append dllsearchpath ":$libdir";;
 	  esac
 	  case :$dllsearchpath: in
 	  *":$testbindir:"*) ;;
 	  ::) dllsearchpath=$testbindir;;
-	  *) dllsearchpath="$dllsearchpath:$testbindir";;
+	  *) func_append dllsearchpath ":$testbindir";;
 	  esac
 	  ;;
 	esac
@@ -7636,18 +8839,18 @@ EOF
 	      *"$hardcode_libdir_separator$libdir$hardcode_libdir_separator"*)
 		;;
 	      *)
-		hardcode_libdirs="$hardcode_libdirs$hardcode_libdir_separator$libdir"
+		func_append hardcode_libdirs "$hardcode_libdir_separator$libdir"
 		;;
 	      esac
 	    fi
 	  else
 	    eval flag=\"$hardcode_libdir_flag_spec\"
-	    rpath="$rpath $flag"
+	    func_append rpath " $flag"
 	  fi
 	elif test -n "$runpath_var"; then
 	  case "$finalize_perm_rpath " in
 	  *" $libdir "*) ;;
-	  *) finalize_perm_rpath="$finalize_perm_rpath $libdir" ;;
+	  *) func_append finalize_perm_rpath " $libdir" ;;
 	  esac
 	fi
       done
@@ -7661,8 +8864,8 @@ EOF
 
       if test -n "$libobjs" && test "$build_old_libs" = yes; then
 	# Transform all the library objects into standard objects.
-	compile_command=`$ECHO "X$compile_command" | $SP2NL | $Xsed -e "$lo2o" | $NL2SP`
-	finalize_command=`$ECHO "X$finalize_command" | $SP2NL | $Xsed -e "$lo2o" | $NL2SP`
+	compile_command=`$ECHO "$compile_command" | $SP2NL | $SED "$lo2o" | $NL2SP`
+	finalize_command=`$ECHO "$finalize_command" | $SP2NL | $SED "$lo2o" | $NL2SP`
       fi
 
       func_generate_dlsyms "$outputname" "@PROGRAM@" "no"
@@ -7674,15 +8877,15 @@ EOF
 
       wrappers_required=yes
       case $host in
+      *cegcc* | *mingw32ce*)
+        # Disable wrappers for cegcc and mingw32ce hosts, we are cross compiling anyway.
+        wrappers_required=no
+        ;;
       *cygwin* | *mingw* )
         if test "$build_libtool_libs" != yes; then
           wrappers_required=no
         fi
         ;;
-      *cegcc)
-        # Disable wrappers for cegcc, we are cross compiling anyway.
-        wrappers_required=no
-        ;;
       *)
         if test "$need_relink" = no || test "$build_libtool_libs" != yes; then
           wrappers_required=no
@@ -7691,13 +8894,19 @@ EOF
       esac
       if test "$wrappers_required" = no; then
 	# Replace the output file specification.
-	compile_command=`$ECHO "X$compile_command" | $Xsed -e 's%@OUTPUT@%'"$output"'%g'`
+	compile_command=`$ECHO "$compile_command" | $SED 's%@OUTPUT@%'"$output"'%g'`
 	link_command="$compile_command$compile_rpath"
 
 	# We have no uninstalled library dependencies, so finalize right now.
 	exit_status=0
 	func_show_eval "$link_command" 'exit_status=$?'
 
+	if test -n "$postlink_cmds"; then
+	  func_to_tool_file "$output"
+	  postlink_cmds=`func_echo_all "$postlink_cmds" | $SED -e 's%@OUTPUT@%'"$output"'%g' -e 's%@TOOL_OUTPUT@%'"$func_to_tool_file_result"'%g'`
+	  func_execute_cmds "$postlink_cmds" 'exit $?'
+	fi
+
 	# Delete the generated files.
 	if test -f "$output_objdir/${outputname}S.${objext}"; then
 	  func_show_eval '$RM "$output_objdir/${outputname}S.${objext}"'
@@ -7720,7 +8929,7 @@ EOF
 	  # We should set the runpath_var.
 	  rpath=
 	  for dir in $perm_rpath; do
-	    rpath="$rpath$dir:"
+	    func_append rpath "$dir:"
 	  done
 	  compile_var="$runpath_var=\"$rpath\$$runpath_var\" "
 	fi
@@ -7728,7 +8937,7 @@ EOF
 	  # We should set the runpath_var.
 	  rpath=
 	  for dir in $finalize_perm_rpath; do
-	    rpath="$rpath$dir:"
+	    func_append rpath "$dir:"
 	  done
 	  finalize_var="$runpath_var=\"$rpath\$$runpath_var\" "
 	fi
@@ -7738,11 +8947,18 @@ EOF
 	# We don't need to create a wrapper script.
 	link_command="$compile_var$compile_command$compile_rpath"
 	# Replace the output file specification.
-	link_command=`$ECHO "X$link_command" | $Xsed -e 's%@OUTPUT@%'"$output"'%g'`
+	link_command=`$ECHO "$link_command" | $SED 's%@OUTPUT@%'"$output"'%g'`
 	# Delete the old output file.
 	$opt_dry_run || $RM $output
 	# Link the executable and exit
 	func_show_eval "$link_command" 'exit $?'
+
+	if test -n "$postlink_cmds"; then
+	  func_to_tool_file "$output"
+	  postlink_cmds=`func_echo_all "$postlink_cmds" | $SED -e 's%@OUTPUT@%'"$output"'%g' -e 's%@TOOL_OUTPUT@%'"$func_to_tool_file_result"'%g'`
+	  func_execute_cmds "$postlink_cmds" 'exit $?'
+	fi
+
 	exit $EXIT_SUCCESS
       fi
 
@@ -7757,7 +8973,7 @@ EOF
 	if test "$fast_install" != no; then
 	  link_command="$finalize_var$compile_command$finalize_rpath"
 	  if test "$fast_install" = yes; then
-	    relink_command=`$ECHO "X$compile_var$compile_command$compile_rpath" | $Xsed -e 's%@OUTPUT@%\$progdir/\$file%g'`
+	    relink_command=`$ECHO "$compile_var$compile_command$compile_rpath" | $SED 's%@OUTPUT@%\$progdir/\$file%g'`
 	  else
 	    # fast_install is set to needless
 	    relink_command=
@@ -7769,13 +8985,19 @@ EOF
       fi
 
       # Replace the output file specification.
-      link_command=`$ECHO "X$link_command" | $Xsed -e 's%@OUTPUT@%'"$output_objdir/$outputname"'%g'`
+      link_command=`$ECHO "$link_command" | $SED 's%@OUTPUT@%'"$output_objdir/$outputname"'%g'`
 
       # Delete the old output files.
       $opt_dry_run || $RM $output $output_objdir/$outputname $output_objdir/lt-$outputname
 
       func_show_eval "$link_command" 'exit $?'
 
+      if test -n "$postlink_cmds"; then
+	func_to_tool_file "$output_objdir/$outputname"
+	postlink_cmds=`func_echo_all "$postlink_cmds" | $SED -e 's%@OUTPUT@%'"$output_objdir/$outputname"'%g' -e 's%@TOOL_OUTPUT@%'"$func_to_tool_file_result"'%g'`
+	func_execute_cmds "$postlink_cmds" 'exit $?'
+      fi
+
       # Now create the wrapper script.
       func_verbose "creating $output"
 
@@ -7793,18 +9015,7 @@ EOF
 	  fi
 	done
 	relink_command="(cd `pwd`; $relink_command)"
-	relink_command=`$ECHO "X$relink_command" | $Xsed -e "$sed_quote_subst"`
-      fi
-
-      # Quote $ECHO for shipping.
-      if test "X$ECHO" = "X$SHELL $progpath --fallback-echo"; then
-	case $progpath in
-	[\\/]* | [A-Za-z]:[\\/]*) qecho="$SHELL $progpath --fallback-echo";;
-	*) qecho="$SHELL `pwd`/$progpath --fallback-echo";;
-	esac
-	qecho=`$ECHO "X$qecho" | $Xsed -e "$sed_quote_subst"`
-      else
-	qecho=`$ECHO "X$ECHO" | $Xsed -e "$sed_quote_subst"`
+	relink_command=`$ECHO "$relink_command" | $SED "$sed_quote_subst"`
       fi
 
       # Only actually do things if not in dry run mode.
@@ -7884,7 +9095,7 @@ EOF
 	else
 	  oldobjs="$old_deplibs $non_pic_objects"
 	  if test "$preload" = yes && test -f "$symfileobj"; then
-	    oldobjs="$oldobjs $symfileobj"
+	    func_append oldobjs " $symfileobj"
 	  fi
 	fi
 	addlibs="$old_convenience"
@@ -7892,10 +9103,10 @@ EOF
 
       if test -n "$addlibs"; then
 	gentop="$output_objdir/${outputname}x"
-	generated="$generated $gentop"
+	func_append generated " $gentop"
 
 	func_extract_archives $gentop $addlibs
-	oldobjs="$oldobjs $func_extract_archives_result"
+	func_append oldobjs " $func_extract_archives_result"
       fi
 
       # Do each command in the archive commands.
@@ -7906,10 +9117,10 @@ EOF
 	# Add any objects from preloaded convenience libraries
 	if test -n "$dlprefiles"; then
 	  gentop="$output_objdir/${outputname}x"
-	  generated="$generated $gentop"
+	  func_append generated " $gentop"
 
 	  func_extract_archives $gentop $dlprefiles
-	  oldobjs="$oldobjs $func_extract_archives_result"
+	  func_append oldobjs " $func_extract_archives_result"
 	fi
 
 	# POSIX demands no paths to be encoded in archives.  We have
@@ -7925,9 +9136,9 @@ EOF
 	    done | sort | sort -uc >/dev/null 2>&1); then
 	  :
 	else
-	  $ECHO "copying selected object files to avoid basename conflicts..."
+	  echo "copying selected object files to avoid basename conflicts..."
 	  gentop="$output_objdir/${outputname}x"
-	  generated="$generated $gentop"
+	  func_append generated " $gentop"
 	  func_mkdir_p "$gentop"
 	  save_oldobjs=$oldobjs
 	  oldobjs=
@@ -7951,18 +9162,30 @@ EOF
 		esac
 	      done
 	      func_show_eval "ln $obj $gentop/$newobj || cp $obj $gentop/$newobj"
-	      oldobjs="$oldobjs $gentop/$newobj"
+	      func_append oldobjs " $gentop/$newobj"
 	      ;;
-	    *) oldobjs="$oldobjs $obj" ;;
+	    *) func_append oldobjs " $obj" ;;
 	    esac
 	  done
 	fi
+	func_to_tool_file "$oldlib" func_convert_file_msys_to_w32
+	tool_oldlib=$func_to_tool_file_result
 	eval cmds=\"$old_archive_cmds\"
 
 	func_len " $cmds"
 	len=$func_len_result
 	if test "$len" -lt "$max_cmd_len" || test "$max_cmd_len" -le -1; then
 	  cmds=$old_archive_cmds
+	elif test -n "$archiver_list_spec"; then
+	  func_verbose "using command file archive linking..."
+	  for obj in $oldobjs
+	  do
+	    func_to_tool_file "$obj"
+	    $ECHO "$func_to_tool_file_result"
+	  done > $output_objdir/$libname.libcmd
+	  func_to_tool_file "$output_objdir/$libname.libcmd"
+	  oldobjs=" $archiver_list_spec$func_to_tool_file_result"
+	  cmds=$old_archive_cmds
 	else
 	  # the command line is too long to link in one step, link in parts
 	  func_verbose "using piecewise archive linking..."
@@ -8036,7 +9259,7 @@ EOF
       done
       # Quote the link command for shipping.
       relink_command="(cd `pwd`; $SHELL $progpath $preserve_args --mode=relink $libtool_args @inst_prefix_dir@)"
-      relink_command=`$ECHO "X$relink_command" | $Xsed -e "$sed_quote_subst"`
+      relink_command=`$ECHO "$relink_command" | $SED "$sed_quote_subst"`
       if test "$hardcode_automatic" = yes ; then
 	relink_command=
       fi
@@ -8056,12 +9279,23 @@ EOF
 	      *.la)
 		func_basename "$deplib"
 		name="$func_basename_result"
-		eval libdir=`${SED} -n -e 's/^libdir=\(.*\)$/\1/p' $deplib`
+		func_resolve_sysroot "$deplib"
+		eval libdir=`${SED} -n -e 's/^libdir=\(.*\)$/\1/p' $func_resolve_sysroot_result`
 		test -z "$libdir" && \
 		  func_fatal_error "\`$deplib' is not a valid libtool archive"
-		newdependency_libs="$newdependency_libs $libdir/$name"
+		func_append newdependency_libs " ${lt_sysroot:+=}$libdir/$name"
+		;;
+	      -L*)
+		func_stripname -L '' "$deplib"
+		func_replace_sysroot "$func_stripname_result"
+		func_append newdependency_libs " -L$func_replace_sysroot_result"
 		;;
-	      *) newdependency_libs="$newdependency_libs $deplib" ;;
+	      -R*)
+		func_stripname -R '' "$deplib"
+		func_replace_sysroot "$func_stripname_result"
+		func_append newdependency_libs " -R$func_replace_sysroot_result"
+		;;
+	      *) func_append newdependency_libs " $deplib" ;;
 	      esac
 	    done
 	    dependency_libs="$newdependency_libs"
@@ -8075,9 +9309,9 @@ EOF
 		eval libdir=`${SED} -n -e 's/^libdir=\(.*\)$/\1/p' $lib`
 		test -z "$libdir" && \
 		  func_fatal_error "\`$lib' is not a valid libtool archive"
-		newdlfiles="$newdlfiles $libdir/$name"
+		func_append newdlfiles " ${lt_sysroot:+=}$libdir/$name"
 		;;
-	      *) newdlfiles="$newdlfiles $lib" ;;
+	      *) func_append newdlfiles " $lib" ;;
 	      esac
 	    done
 	    dlfiles="$newdlfiles"
@@ -8094,7 +9328,7 @@ EOF
 		eval libdir=`${SED} -n -e 's/^libdir=\(.*\)$/\1/p' $lib`
 		test -z "$libdir" && \
 		  func_fatal_error "\`$lib' is not a valid libtool archive"
-		newdlprefiles="$newdlprefiles $libdir/$name"
+		func_append newdlprefiles " ${lt_sysroot:+=}$libdir/$name"
 		;;
 	      esac
 	    done
@@ -8106,7 +9340,7 @@ EOF
 		[\\/]* | [A-Za-z]:[\\/]*) abs="$lib" ;;
 		*) abs=`pwd`"/$lib" ;;
 	      esac
-	      newdlfiles="$newdlfiles $abs"
+	      func_append newdlfiles " $abs"
 	    done
 	    dlfiles="$newdlfiles"
 	    newdlprefiles=
@@ -8115,15 +9349,33 @@ EOF
 		[\\/]* | [A-Za-z]:[\\/]*) abs="$lib" ;;
 		*) abs=`pwd`"/$lib" ;;
 	      esac
-	      newdlprefiles="$newdlprefiles $abs"
+	      func_append newdlprefiles " $abs"
 	    done
 	    dlprefiles="$newdlprefiles"
 	  fi
 	  $RM $output
 	  # place dlname in correct position for cygwin
+	  # In fact, it would be nice if we could use this code for all target
+	  # systems that can't hard-code library paths into their executables
+	  # and that have no shared library path variable independent of PATH,
+	  # but it turns out we can't easily determine that from inspecting
+	  # libtool variables, so we have to hard-code the OSs to which it
+	  # applies here; at the moment, that means platforms that use the PE
+	  # object format with DLL files.  See the long comment at the top of
+	  # tests/bindir.at for full details.
 	  tdlname=$dlname
 	  case $host,$output,$installed,$module,$dlname in
-	    *cygwin*,*lai,yes,no,*.dll | *mingw*,*lai,yes,no,*.dll | *cegcc*,*lai,yes,no,*.dll) tdlname=../bin/$dlname ;;
+	    *cygwin*,*lai,yes,no,*.dll | *mingw*,*lai,yes,no,*.dll | *cegcc*,*lai,yes,no,*.dll)
+	      # If a -bindir argument was supplied, place the dll there.
+	      if test "x$bindir" != x ;
+	      then
+		func_relative_path "$install_libdir" "$bindir"
+		tdlname=$func_relative_path_result$dlname
+	      else
+		# Otherwise fall back on heuristic.
+		tdlname=../bin/$dlname
+	      fi
+	      ;;
 	  esac
 	  $ECHO > $output "\
 # $outputname - a libtool library file
@@ -8182,7 +9434,7 @@ relink_command=\"$relink_command\""
     exit $EXIT_SUCCESS
 }
 
-{ test "$mode" = link || test "$mode" = relink; } &&
+{ test "$opt_mode" = link || test "$opt_mode" = relink; } &&
     func_mode_link ${1+"$@"}
 
 
@@ -8202,9 +9454,9 @@ func_mode_uninstall ()
     for arg
     do
       case $arg in
-      -f) RM="$RM $arg"; rmforce=yes ;;
-      -*) RM="$RM $arg" ;;
-      *) files="$files $arg" ;;
+      -f) func_append RM " $arg"; rmforce=yes ;;
+      -*) func_append RM " $arg" ;;
+      *) func_append files " $arg" ;;
       esac
     done
 
@@ -8213,24 +9465,23 @@ func_mode_uninstall ()
 
     rmdirs=
 
-    origobjdir="$objdir"
     for file in $files; do
       func_dirname "$file" "" "."
       dir="$func_dirname_result"
       if test "X$dir" = X.; then
-	objdir="$origobjdir"
+	odir="$objdir"
       else
-	objdir="$dir/$origobjdir"
+	odir="$dir/$objdir"
       fi
       func_basename "$file"
       name="$func_basename_result"
-      test "$mode" = uninstall && objdir="$dir"
+      test "$opt_mode" = uninstall && odir="$dir"
 
-      # Remember objdir for removal later, being careful to avoid duplicates
-      if test "$mode" = clean; then
+      # Remember odir for removal later, being careful to avoid duplicates
+      if test "$opt_mode" = clean; then
 	case " $rmdirs " in
-	  *" $objdir "*) ;;
-	  *) rmdirs="$rmdirs $objdir" ;;
+	  *" $odir "*) ;;
+	  *) func_append rmdirs " $odir" ;;
 	esac
       fi
 
@@ -8256,18 +9507,17 @@ func_mode_uninstall ()
 
 	  # Delete the libtool libraries and symlinks.
 	  for n in $library_names; do
-	    rmfiles="$rmfiles $objdir/$n"
+	    func_append rmfiles " $odir/$n"
 	  done
-	  test -n "$old_library" && rmfiles="$rmfiles $objdir/$old_library"
+	  test -n "$old_library" && func_append rmfiles " $odir/$old_library"
 
-	  case "$mode" in
+	  case "$opt_mode" in
 	  clean)
-	    case "  $library_names " in
-	    # "  " in the beginning catches empty $dlname
+	    case " $library_names " in
 	    *" $dlname "*) ;;
-	    *) rmfiles="$rmfiles $objdir/$dlname" ;;
+	    *) test -n "$dlname" && func_append rmfiles " $odir/$dlname" ;;
 	    esac
-	    test -n "$libdir" && rmfiles="$rmfiles $objdir/$name $objdir/${name}i"
+	    test -n "$libdir" && func_append rmfiles " $odir/$name $odir/${name}i"
 	    ;;
 	  uninstall)
 	    if test -n "$library_names"; then
@@ -8295,19 +9545,19 @@ func_mode_uninstall ()
 	  # Add PIC object to the list of files to remove.
 	  if test -n "$pic_object" &&
 	     test "$pic_object" != none; then
-	    rmfiles="$rmfiles $dir/$pic_object"
+	    func_append rmfiles " $dir/$pic_object"
 	  fi
 
 	  # Add non-PIC object to the list of files to remove.
 	  if test -n "$non_pic_object" &&
 	     test "$non_pic_object" != none; then
-	    rmfiles="$rmfiles $dir/$non_pic_object"
+	    func_append rmfiles " $dir/$non_pic_object"
 	  fi
 	fi
 	;;
 
       *)
-	if test "$mode" = clean ; then
+	if test "$opt_mode" = clean ; then
 	  noexename=$name
 	  case $file in
 	  *.exe)
@@ -8317,7 +9567,7 @@ func_mode_uninstall ()
 	    noexename=$func_stripname_result
 	    # $file with .exe has already been added to rmfiles,
 	    # add $file without .exe
-	    rmfiles="$rmfiles $file"
+	    func_append rmfiles " $file"
 	    ;;
 	  esac
 	  # Do a test to see if this is a libtool program.
@@ -8326,7 +9576,7 @@ func_mode_uninstall ()
 	      func_ltwrapper_scriptname "$file"
 	      relink_command=
 	      func_source $func_ltwrapper_scriptname_result
-	      rmfiles="$rmfiles $func_ltwrapper_scriptname_result"
+	      func_append rmfiles " $func_ltwrapper_scriptname_result"
 	    else
 	      relink_command=
 	      func_source $dir/$noexename
@@ -8334,12 +9584,12 @@ func_mode_uninstall ()
 
 	    # note $name still contains .exe if it was in $file originally
 	    # as does the version of $file that was added into $rmfiles
-	    rmfiles="$rmfiles $objdir/$name $objdir/${name}S.${objext}"
+	    func_append rmfiles " $odir/$name $odir/${name}S.${objext}"
 	    if test "$fast_install" = yes && test -n "$relink_command"; then
-	      rmfiles="$rmfiles $objdir/lt-$name"
+	      func_append rmfiles " $odir/lt-$name"
 	    fi
 	    if test "X$noexename" != "X$name" ; then
-	      rmfiles="$rmfiles $objdir/lt-${noexename}.c"
+	      func_append rmfiles " $odir/lt-${noexename}.c"
 	    fi
 	  fi
 	fi
@@ -8347,7 +9597,6 @@ func_mode_uninstall ()
       esac
       func_show_eval "$RM $rmfiles" 'exit_status=1'
     done
-    objdir="$origobjdir"
 
     # Try to remove the ${objdir}s in the directories where we deleted files
     for dir in $rmdirs; do
@@ -8359,16 +9608,16 @@ func_mode_uninstall ()
     exit $exit_status
 }
 
-{ test "$mode" = uninstall || test "$mode" = clean; } &&
+{ test "$opt_mode" = uninstall || test "$opt_mode" = clean; } &&
     func_mode_uninstall ${1+"$@"}
 
-test -z "$mode" && {
+test -z "$opt_mode" && {
   help="$generic_help"
   func_fatal_help "you must specify a MODE"
 }
 
 test -z "$exec_cmd" && \
-  func_fatal_help "invalid operation mode \`$mode'"
+  func_fatal_help "invalid operation mode \`$opt_mode'"
 
 if test -n "$exec_cmd"; then
   eval exec "$exec_cmd"
diff --git a/m4/gnulib-cache.m4 b/m4/gnulib-cache.m4
deleted file mode 100644
index f922445..0000000
--- a/m4/gnulib-cache.m4
+++ /dev/null
@@ -1,35 +0,0 @@
-# Copyright (C) 2002-2010 Free Software Foundation, Inc.
-#
-# This file is free software, distributed under the terms of the GNU
-# General Public License.  As a special exception to the GNU General
-# Public License, this file may be distributed as part of a program
-# that contains a configuration script generated by Autoconf, under
-# the same distribution terms as the rest of that program.
-#
-# Generated by gnulib-tool.
-#
-# This file represents the specification of how gnulib-tool is used.
-# It acts as a cache: It is written and read by gnulib-tool.
-# In projects using CVS, this file is meant to be stored in CVS,
-# like the configure.ac and various Makefile.am files.
-
-
-# Specification in the form of a command-line invocation:
-#   gnulib-tool --import --dir=. --lib=libgnu --source-base=gnulib --m4-base=m4 --doc-base=doc --tests-base=tests --aux-dir=. --no-libtool --macro-prefix=gl --no-vc-files argp
-
-# Specification in the form of a few gnulib-tool.m4 macro invocations:
-gl_LOCAL_DIR([])
-gl_MODULES([
-  argp
-])
-gl_AVOID([])
-gl_SOURCE_BASE([gnulib])
-gl_M4_BASE([m4])
-gl_PO_BASE([])
-gl_DOC_BASE([doc])
-gl_TESTS_BASE([tests])
-gl_LIB([libgnu])
-gl_MAKEFILE_NAME([])
-gl_MACRO_PREFIX([gl])
-gl_PO_DOMAIN([])
-gl_VC_FILES([false])
diff --git a/m4/libtool.m4 b/m4/libtool.m4
index 671cde1..56666f0 100644
--- a/m4/libtool.m4
+++ b/m4/libtool.m4
@@ -1,7 +1,8 @@
 # libtool.m4 - Configure libtool for the host system. -*-Autoconf-*-
 #
 #   Copyright (C) 1996, 1997, 1998, 1999, 2000, 2001, 2003, 2004, 2005,
-#                 2006, 2007, 2008 Free Software Foundation, Inc.
+#                 2006, 2007, 2008, 2009, 2010, 2011 Free Software
+#                 Foundation, Inc.
 #   Written by Gordon Matzigkeit, 1996
 #
 # This file is free software; the Free Software Foundation gives
@@ -10,7 +11,8 @@
 
 m4_define([_LT_COPYING], [dnl
 #   Copyright (C) 1996, 1997, 1998, 1999, 2000, 2001, 2003, 2004, 2005,
-#                 2006, 2007, 2008 Free Software Foundation, Inc.
+#                 2006, 2007, 2008, 2009, 2010, 2011 Free Software
+#                 Foundation, Inc.
 #   Written by Gordon Matzigkeit, 1996
 #
 #   This file is part of GNU Libtool.
@@ -37,7 +39,7 @@ m4_define([_LT_COPYING], [dnl
 # 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA.
 ])
 
-# serial 56 LT_INIT
+# serial 57 LT_INIT
 
 
 # LT_PREREQ(VERSION)
@@ -66,6 +68,7 @@ esac
 # ------------------
 AC_DEFUN([LT_INIT],
 [AC_PREREQ([2.58])dnl We use AC_INCLUDES_DEFAULT
+AC_REQUIRE([AC_CONFIG_AUX_DIR_DEFAULT])dnl
 AC_BEFORE([$0], [LT_LANG])dnl
 AC_BEFORE([$0], [LT_OUTPUT])dnl
 AC_BEFORE([$0], [LTDL_INIT])dnl
@@ -82,6 +85,8 @@ AC_REQUIRE([LTVERSION_VERSION])dnl
 AC_REQUIRE([LTOBSOLETE_VERSION])dnl
 m4_require([_LT_PROG_LTMAIN])dnl
 
+_LT_SHELL_INIT([SHELL=${CONFIG_SHELL-/bin/sh}])
+
 dnl Parse OPTIONS
 _LT_SET_OPTIONS([$0], [$1])
 
@@ -118,7 +123,7 @@ m4_defun([_LT_CC_BASENAME],
     *) break;;
   esac
 done
-cc_basename=`$ECHO "X$cc_temp" | $Xsed -e 's%.*/%%' -e "s%^$host_alias-%%"`
+cc_basename=`$ECHO "$cc_temp" | $SED "s%.*/%%; s%^$host_alias-%%"`
 ])
 
 
@@ -138,6 +143,11 @@ m4_defun([_LT_FILEUTILS_DEFAULTS],
 m4_defun([_LT_SETUP],
 [AC_REQUIRE([AC_CANONICAL_HOST])dnl
 AC_REQUIRE([AC_CANONICAL_BUILD])dnl
+AC_REQUIRE([_LT_PREPARE_SED_QUOTE_VARS])dnl
+AC_REQUIRE([_LT_PROG_ECHO_BACKSLASH])dnl
+
+_LT_DECL([], [PATH_SEPARATOR], [1], [The PATH separator for the build system])dnl
+dnl
 _LT_DECL([], [host_alias], [0], [The host system])dnl
 _LT_DECL([], [host], [0])dnl
 _LT_DECL([], [host_os], [0])dnl
@@ -160,10 +170,13 @@ _LT_DECL([], [exeext], [0], [Executable file suffix (normally "")])dnl
 dnl
 m4_require([_LT_FILEUTILS_DEFAULTS])dnl
 m4_require([_LT_CHECK_SHELL_FEATURES])dnl
+m4_require([_LT_PATH_CONVERSION_FUNCTIONS])dnl
 m4_require([_LT_CMD_RELOAD])dnl
 m4_require([_LT_CHECK_MAGIC_METHOD])dnl
+m4_require([_LT_CHECK_SHAREDLIB_FROM_LINKLIB])dnl
 m4_require([_LT_CMD_OLD_ARCHIVE])dnl
 m4_require([_LT_CMD_GLOBAL_SYMBOLS])dnl
+m4_require([_LT_WITH_SYSROOT])dnl
 
 _LT_CONFIG_LIBTOOL_INIT([
 # See if we are running on zsh, and set the options which allow our
@@ -179,7 +192,6 @@ fi
 _LT_CHECK_OBJDIR
 
 m4_require([_LT_TAG_COMPILER])dnl
-_LT_PROG_ECHO_BACKSLASH
 
 case $host_os in
 aix3*)
@@ -193,23 +205,6 @@ aix3*)
   ;;
 esac
 
-# Sed substitution that helps us do robust quoting.  It backslashifies
-# metacharacters that are still active within double-quoted strings.
-sed_quote_subst='s/\([["`$\\]]\)/\\\1/g'
-
-# Same as above, but do not quote variable references.
-double_quote_subst='s/\([["`\\]]\)/\\\1/g'
-
-# Sed substitution to delay expansion of an escaped shell variable in a
-# double_quote_subst'ed string.
-delay_variable_subst='s/\\\\\\\\\\\$/\\\\\\$/g'
-
-# Sed substitution to delay expansion of an escaped single quote.
-delay_single_quote_subst='s/'\''/'\'\\\\\\\'\''/g'
-
-# Sed substitution to avoid accidental globbing in evaled expressions
-no_glob_subst='s/\*/\\\*/g'
-
 # Global variables:
 ofile=libtool
 can_build_shared=yes
@@ -250,6 +245,28 @@ _LT_CONFIG_COMMANDS
 ])# _LT_SETUP
 
 
+# _LT_PREPARE_SED_QUOTE_VARS
+# --------------------------
+# Define a few sed substitution that help us do robust quoting.
+m4_defun([_LT_PREPARE_SED_QUOTE_VARS],
+[# Backslashify metacharacters that are still active within
+# double-quoted strings.
+sed_quote_subst='s/\([["`$\\]]\)/\\\1/g'
+
+# Same as above, but do not quote variable references.
+double_quote_subst='s/\([["`\\]]\)/\\\1/g'
+
+# Sed substitution to delay expansion of an escaped shell variable in a
+# double_quote_subst'ed string.
+delay_variable_subst='s/\\\\\\\\\\\$/\\\\\\$/g'
+
+# Sed substitution to delay expansion of an escaped single quote.
+delay_single_quote_subst='s/'\''/'\'\\\\\\\'\''/g'
+
+# Sed substitution to avoid accidental globbing in evaled expressions
+no_glob_subst='s/\*/\\\*/g'
+])
+
 # _LT_PROG_LTMAIN
 # ---------------
 # Note that this code is called both from `configure', and `config.status'
@@ -408,7 +425,7 @@ m4_define([_lt_decl_all_varnames],
 # declaration there will have the same value as in `configure'.  VARNAME
 # must have a single quote delimited value for this to work.
 m4_define([_LT_CONFIG_STATUS_DECLARE],
-[$1='`$ECHO "X$][$1" | $Xsed -e "$delay_single_quote_subst"`'])
+[$1='`$ECHO "$][$1" | $SED "$delay_single_quote_subst"`'])
 
 
 # _LT_CONFIG_STATUS_DECLARATIONS
@@ -418,7 +435,7 @@ m4_define([_LT_CONFIG_STATUS_DECLARE],
 # embedded single quotes properly.  In configure, this macro expands
 # each variable declared with _LT_DECL (and _LT_TAGDECL) into:
 #
-#    <var>='`$ECHO "X$<var>" | $Xsed -e "$delay_single_quote_subst"`'
+#    <var>='`$ECHO "$<var>" | $SED "$delay_single_quote_subst"`'
 m4_defun([_LT_CONFIG_STATUS_DECLARATIONS],
 [m4_foreach([_lt_var], m4_quote(lt_decl_all_varnames),
     [m4_n([_LT_CONFIG_STATUS_DECLARE(_lt_var)])])])
@@ -517,12 +534,20 @@ LTCC='$LTCC'
 LTCFLAGS='$LTCFLAGS'
 compiler='$compiler_DEFAULT'
 
+# A function that is used when there is no print builtin or printf.
+func_fallback_echo ()
+{
+  eval 'cat <<_LTECHO_EOF
+\$[]1
+_LTECHO_EOF'
+}
+
 # Quote evaled strings.
 for var in lt_decl_all_varnames([[ \
 ]], lt_decl_quote_varnames); do
-    case \`eval \\\\\$ECHO "X\\\\\$\$var"\` in
+    case \`eval \\\\\$ECHO \\\\""\\\\\$\$var"\\\\"\` in
     *[[\\\\\\\`\\"\\\$]]*)
-      eval "lt_\$var=\\\\\\"\\\`\\\$ECHO \\"X\\\$\$var\\" | \\\$Xsed -e \\"\\\$sed_quote_subst\\"\\\`\\\\\\""
+      eval "lt_\$var=\\\\\\"\\\`\\\$ECHO \\"\\\$\$var\\" | \\\$SED \\"\\\$sed_quote_subst\\"\\\`\\\\\\""
       ;;
     *)
       eval "lt_\$var=\\\\\\"\\\$\$var\\\\\\""
@@ -533,9 +558,9 @@ done
 # Double-quote double-evaled strings.
 for var in lt_decl_all_varnames([[ \
 ]], lt_decl_dquote_varnames); do
-    case \`eval \\\\\$ECHO "X\\\\\$\$var"\` in
+    case \`eval \\\\\$ECHO \\\\""\\\\\$\$var"\\\\"\` in
     *[[\\\\\\\`\\"\\\$]]*)
-      eval "lt_\$var=\\\\\\"\\\`\\\$ECHO \\"X\\\$\$var\\" | \\\$Xsed -e \\"\\\$double_quote_subst\\" -e \\"\\\$sed_quote_subst\\" -e \\"\\\$delay_variable_subst\\"\\\`\\\\\\""
+      eval "lt_\$var=\\\\\\"\\\`\\\$ECHO \\"\\\$\$var\\" | \\\$SED -e \\"\\\$double_quote_subst\\" -e \\"\\\$sed_quote_subst\\" -e \\"\\\$delay_variable_subst\\"\\\`\\\\\\""
       ;;
     *)
       eval "lt_\$var=\\\\\\"\\\$\$var\\\\\\""
@@ -543,16 +568,38 @@ for var in lt_decl_all_varnames([[ \
     esac
 done
 
-# Fix-up fallback echo if it was mangled by the above quoting rules.
-case \$lt_ECHO in
-*'\\\[$]0 --fallback-echo"')dnl "
-  lt_ECHO=\`\$ECHO "X\$lt_ECHO" | \$Xsed -e 's/\\\\\\\\\\\\\\\[$]0 --fallback-echo"\[$]/\[$]0 --fallback-echo"/'\`
-  ;;
-esac
-
 _LT_OUTPUT_LIBTOOL_INIT
 ])
 
+# _LT_GENERATED_FILE_INIT(FILE, [COMMENT])
+# ------------------------------------
+# Generate a child script FILE with all initialization necessary to
+# reuse the environment learned by the parent script, and make the
+# file executable.  If COMMENT is supplied, it is inserted after the
+# `#!' sequence but before initialization text begins.  After this
+# macro, additional text can be appended to FILE to form the body of
+# the child script.  The macro ends with non-zero status if the
+# file could not be fully written (such as if the disk is full).
+m4_ifdef([AS_INIT_GENERATED],
+[m4_defun([_LT_GENERATED_FILE_INIT],[AS_INIT_GENERATED($@)])],
+[m4_defun([_LT_GENERATED_FILE_INIT],
+[m4_require([AS_PREPARE])]dnl
+[m4_pushdef([AS_MESSAGE_LOG_FD])]dnl
+[lt_write_fail=0
+cat >$1 <<_ASEOF || lt_write_fail=1
+#! $SHELL
+# Generated by $as_me.
+$2
+SHELL=\${CONFIG_SHELL-$SHELL}
+export SHELL
+_ASEOF
+cat >>$1 <<\_ASEOF || lt_write_fail=1
+AS_SHELL_SANITIZE
+_AS_PREPARE
+exec AS_MESSAGE_FD>&1
+_ASEOF
+test $lt_write_fail = 0 && chmod +x $1[]dnl
+m4_popdef([AS_MESSAGE_LOG_FD])])])# _LT_GENERATED_FILE_INIT
 
 # LT_OUTPUT
 # ---------
@@ -562,20 +609,11 @@ _LT_OUTPUT_LIBTOOL_INIT
 AC_DEFUN([LT_OUTPUT],
 [: ${CONFIG_LT=./config.lt}
 AC_MSG_NOTICE([creating $CONFIG_LT])
-cat >"$CONFIG_LT" <<_LTEOF
-#! $SHELL
-# Generated by $as_me.
-# Run this file to recreate a libtool stub with the current configuration.
-
-lt_cl_silent=false
-SHELL=\${CONFIG_SHELL-$SHELL}
-_LTEOF
+_LT_GENERATED_FILE_INIT(["$CONFIG_LT"],
+[# Run this file to recreate a libtool stub with the current configuration.])
 
 cat >>"$CONFIG_LT" <<\_LTEOF
-AS_SHELL_SANITIZE
-_AS_PREPARE
-
-exec AS_MESSAGE_FD>&1
+lt_cl_silent=false
 exec AS_MESSAGE_LOG_FD>>config.log
 {
   echo
@@ -601,7 +639,7 @@ m4_ifset([AC_PACKAGE_NAME], [AC_PACKAGE_NAME ])config.lt[]dnl
 m4_ifset([AC_PACKAGE_VERSION], [ AC_PACKAGE_VERSION])
 configured by $[0], generated by m4_PACKAGE_STRING.
 
-Copyright (C) 2008 Free Software Foundation, Inc.
+Copyright (C) 2011 Free Software Foundation, Inc.
 This config.lt script is free software; the Free Software Foundation
 gives unlimited permision to copy, distribute and modify it."
 
@@ -646,15 +684,13 @@ chmod +x "$CONFIG_LT"
 # appending to config.log, which fails on DOS, as config.log is still kept
 # open by configure.  Here we exec the FD to /dev/null, effectively closing
 # config.log, so it can be properly (re)opened and appended to by config.lt.
-if test "$no_create" != yes; then
-  lt_cl_success=:
-  test "$silent" = yes &&
-    lt_config_lt_args="$lt_config_lt_args --quiet"
-  exec AS_MESSAGE_LOG_FD>/dev/null
-  $SHELL "$CONFIG_LT" $lt_config_lt_args || lt_cl_success=false
-  exec AS_MESSAGE_LOG_FD>>config.log
-  $lt_cl_success || AS_EXIT(1)
-fi
+lt_cl_success=:
+test "$silent" = yes &&
+  lt_config_lt_args="$lt_config_lt_args --quiet"
+exec AS_MESSAGE_LOG_FD>/dev/null
+$SHELL "$CONFIG_LT" $lt_config_lt_args || lt_cl_success=false
+exec AS_MESSAGE_LOG_FD>>config.log
+$lt_cl_success || AS_EXIT(1)
 ])# LT_OUTPUT
 
 
@@ -717,15 +753,12 @@ _LT_EOF
   # if finds mixed CR/LF and LF-only lines.  Since sed operates in
   # text mode, it properly converts lines to CR/LF.  This bash problem
   # is reportedly fixed, but why not run on old versions too?
-  sed '/^# Generated shell functions inserted here/q' "$ltmain" >> "$cfgfile" \
-    || (rm -f "$cfgfile"; exit 1)
-
-  _LT_PROG_XSI_SHELLFNS
+  sed '$q' "$ltmain" >> "$cfgfile" \
+     || (rm -f "$cfgfile"; exit 1)
 
-  sed -n '/^# Generated shell functions inserted here/,$p' "$ltmain" >> "$cfgfile" \
-    || (rm -f "$cfgfile"; exit 1)
+  _LT_PROG_REPLACE_SHELLFNS
 
-  mv -f "$cfgfile" "$ofile" ||
+   mv -f "$cfgfile" "$ofile" ||
     (rm -f "$ofile" && cp "$cfgfile" "$ofile" && rm -f "$cfgfile")
   chmod +x "$ofile"
 ],
@@ -770,6 +803,7 @@ AC_DEFUN([LT_LANG],
 m4_case([$1],
   [C],			[_LT_LANG(C)],
   [C++],		[_LT_LANG(CXX)],
+  [Go],			[_LT_LANG(GO)],
   [Java],		[_LT_LANG(GCJ)],
   [Fortran 77],		[_LT_LANG(F77)],
   [Fortran],		[_LT_LANG(FC)],
@@ -791,6 +825,31 @@ m4_defun([_LT_LANG],
 ])# _LT_LANG
 
 
+m4_ifndef([AC_PROG_GO], [
+############################################################
+# NOTE: This macro has been submitted for inclusion into   #
+#  GNU Autoconf as AC_PROG_GO.  When it is available in    #
+#  a released version of Autoconf we should remove this    #
+#  macro and use it instead.                               #
+############################################################
+m4_defun([AC_PROG_GO],
+[AC_LANG_PUSH(Go)dnl
+AC_ARG_VAR([GOC],     [Go compiler command])dnl
+AC_ARG_VAR([GOFLAGS], [Go compiler flags])dnl
+_AC_ARG_VAR_LDFLAGS()dnl
+AC_CHECK_TOOL(GOC, gccgo)
+if test -z "$GOC"; then
+  if test -n "$ac_tool_prefix"; then
+    AC_CHECK_PROG(GOC, [${ac_tool_prefix}gccgo], [${ac_tool_prefix}gccgo])
+  fi
+fi
+if test -z "$GOC"; then
+  AC_CHECK_PROG(GOC, gccgo, gccgo, false)
+fi
+])#m4_defun
+])#m4_ifndef
+
+
 # _LT_LANG_DEFAULT_CONFIG
 # -----------------------
 m4_defun([_LT_LANG_DEFAULT_CONFIG],
@@ -821,6 +880,10 @@ AC_PROVIDE_IFELSE([AC_PROG_GCJ],
        m4_ifdef([LT_PROG_GCJ],
 	[m4_define([LT_PROG_GCJ], defn([LT_PROG_GCJ])[LT_LANG(GCJ)])])])])])
 
+AC_PROVIDE_IFELSE([AC_PROG_GO],
+  [LT_LANG(GO)],
+  [m4_define([AC_PROG_GO], defn([AC_PROG_GO])[LT_LANG(GO)])])
+
 AC_PROVIDE_IFELSE([LT_PROG_RC],
   [LT_LANG(RC)],
   [m4_define([LT_PROG_RC], defn([LT_PROG_RC])[LT_LANG(RC)])])
@@ -831,11 +894,13 @@ AU_DEFUN([AC_LIBTOOL_CXX], [LT_LANG(C++)])
 AU_DEFUN([AC_LIBTOOL_F77], [LT_LANG(Fortran 77)])
 AU_DEFUN([AC_LIBTOOL_FC], [LT_LANG(Fortran)])
 AU_DEFUN([AC_LIBTOOL_GCJ], [LT_LANG(Java)])
+AU_DEFUN([AC_LIBTOOL_RC], [LT_LANG(Windows Resource)])
 dnl aclocal-1.4 backwards compatibility:
 dnl AC_DEFUN([AC_LIBTOOL_CXX], [])
 dnl AC_DEFUN([AC_LIBTOOL_F77], [])
 dnl AC_DEFUN([AC_LIBTOOL_FC], [])
 dnl AC_DEFUN([AC_LIBTOOL_GCJ], [])
+dnl AC_DEFUN([AC_LIBTOOL_RC], [])
 
 
 # _LT_TAG_COMPILER
@@ -921,7 +986,13 @@ m4_defun_once([_LT_REQUIRED_DARWIN_CHECKS],[
 	$LTCC $LTCFLAGS $LDFLAGS -o libconftest.dylib \
 	  -dynamiclib -Wl,-single_module conftest.c 2>conftest.err
         _lt_result=$?
-	if test -f libconftest.dylib && test ! -s conftest.err && test $_lt_result = 0; then
+	# If there is a non-empty error log, and "single_module"
+	# appears in it, assume the flag caused a linker warning
+        if test -s conftest.err && $GREP single_module conftest.err; then
+	  cat conftest.err >&AS_MESSAGE_LOG_FD
+	# Otherwise, if the output was created with a 0 exit code from
+	# the compiler, it worked.
+	elif test -f libconftest.dylib && test $_lt_result -eq 0; then
 	  lt_cv_apple_cc_single_mod=yes
 	else
 	  cat conftest.err >&AS_MESSAGE_LOG_FD
@@ -929,6 +1000,7 @@ m4_defun_once([_LT_REQUIRED_DARWIN_CHECKS],[
 	rm -rf libconftest.dylib*
 	rm -f conftest.*
       fi])
+
     AC_CACHE_CHECK([for -exported_symbols_list linker flag],
       [lt_cv_ld_exported_symbols_list],
       [lt_cv_ld_exported_symbols_list=no
@@ -940,6 +1012,34 @@ m4_defun_once([_LT_REQUIRED_DARWIN_CHECKS],[
 	[lt_cv_ld_exported_symbols_list=no])
 	LDFLAGS="$save_LDFLAGS"
     ])
+
+    AC_CACHE_CHECK([for -force_load linker flag],[lt_cv_ld_force_load],
+      [lt_cv_ld_force_load=no
+      cat > conftest.c << _LT_EOF
+int forced_loaded() { return 2;}
+_LT_EOF
+      echo "$LTCC $LTCFLAGS -c -o conftest.o conftest.c" >&AS_MESSAGE_LOG_FD
+      $LTCC $LTCFLAGS -c -o conftest.o conftest.c 2>&AS_MESSAGE_LOG_FD
+      echo "$AR cru libconftest.a conftest.o" >&AS_MESSAGE_LOG_FD
+      $AR cru libconftest.a conftest.o 2>&AS_MESSAGE_LOG_FD
+      echo "$RANLIB libconftest.a" >&AS_MESSAGE_LOG_FD
+      $RANLIB libconftest.a 2>&AS_MESSAGE_LOG_FD
+      cat > conftest.c << _LT_EOF
+int main() { return 0;}
+_LT_EOF
+      echo "$LTCC $LTCFLAGS $LDFLAGS -o conftest conftest.c -Wl,-force_load,./libconftest.a" >&AS_MESSAGE_LOG_FD
+      $LTCC $LTCFLAGS $LDFLAGS -o conftest conftest.c -Wl,-force_load,./libconftest.a 2>conftest.err
+      _lt_result=$?
+      if test -s conftest.err && $GREP force_load conftest.err; then
+	cat conftest.err >&AS_MESSAGE_LOG_FD
+      elif test -f conftest && test $_lt_result -eq 0 && $GREP forced_load conftest >/dev/null 2>&1 ; then
+	lt_cv_ld_force_load=yes
+      else
+	cat conftest.err >&AS_MESSAGE_LOG_FD
+      fi
+        rm -f conftest.err libconftest.a conftest conftest.c
+        rm -rf conftest.dSYM
+    ])
     case $host_os in
     rhapsody* | darwin1.[[012]])
       _lt_dar_allow_undefined='${wl}-undefined ${wl}suppress' ;;
@@ -967,7 +1067,7 @@ m4_defun_once([_LT_REQUIRED_DARWIN_CHECKS],[
     else
       _lt_dar_export_syms='~$NMEDIT -s $output_objdir/${libname}-symbols.expsym ${lib}'
     fi
-    if test "$DSYMUTIL" != ":"; then
+    if test "$DSYMUTIL" != ":" && test "$lt_cv_ld_force_load" = "no"; then
       _lt_dsymutil='~$DSYMUTIL $lib || :'
     else
       _lt_dsymutil=
@@ -977,8 +1077,8 @@ m4_defun_once([_LT_REQUIRED_DARWIN_CHECKS],[
 ])
 
 
-# _LT_DARWIN_LINKER_FEATURES
-# --------------------------
+# _LT_DARWIN_LINKER_FEATURES([TAG])
+# ---------------------------------
 # Checks for linker and compiler features on darwin
 m4_defun([_LT_DARWIN_LINKER_FEATURES],
 [
@@ -987,7 +1087,13 @@ m4_defun([_LT_DARWIN_LINKER_FEATURES],
   _LT_TAGVAR(hardcode_direct, $1)=no
   _LT_TAGVAR(hardcode_automatic, $1)=yes
   _LT_TAGVAR(hardcode_shlibpath_var, $1)=unsupported
-  _LT_TAGVAR(whole_archive_flag_spec, $1)=''
+  if test "$lt_cv_ld_force_load" = "yes"; then
+    _LT_TAGVAR(whole_archive_flag_spec, $1)='`for conv in $convenience\"\"; do test  -n \"$conv\" && new_convenience=\"$new_convenience ${wl}-force_load,$conv\"; done; func_echo_all \"$new_convenience\"`'
+    m4_case([$1], [F77], [_LT_TAGVAR(compiler_needs_object, $1)=yes],
+                  [FC],  [_LT_TAGVAR(compiler_needs_object, $1)=yes])
+  else
+    _LT_TAGVAR(whole_archive_flag_spec, $1)=''
+  fi
   _LT_TAGVAR(link_all_deplibs, $1)=yes
   _LT_TAGVAR(allow_undefined_flag, $1)="$_lt_dar_allow_undefined"
   case $cc_basename in
@@ -995,7 +1101,7 @@ m4_defun([_LT_DARWIN_LINKER_FEATURES],
      *) _lt_dar_can_shared=$GCC ;;
   esac
   if test "$_lt_dar_can_shared" = "yes"; then
-    output_verbose_link_cmd=echo
+    output_verbose_link_cmd=func_echo_all
     _LT_TAGVAR(archive_cmds, $1)="\$CC -dynamiclib \$allow_undefined_flag -o \$lib \$libobjs \$deplibs \$compiler_flags -install_name \$rpath/\$soname \$verstring $_lt_dar_single_mod${_lt_dsymutil}"
     _LT_TAGVAR(module_cmds, $1)="\$CC \$allow_undefined_flag -o \$lib -bundle \$libobjs \$deplibs \$compiler_flags${_lt_dsymutil}"
     _LT_TAGVAR(archive_expsym_cmds, $1)="sed 's,^,_,' < \$export_symbols > \$output_objdir/\${libname}-symbols.expsym~\$CC -dynamiclib \$allow_undefined_flag -o \$lib \$libobjs \$deplibs \$compiler_flags -install_name \$rpath/\$soname \$verstring ${_lt_dar_single_mod}${_lt_dar_export_syms}${_lt_dsymutil}"
@@ -1011,203 +1117,142 @@ m4_defun([_LT_DARWIN_LINKER_FEATURES],
   fi
 ])
 
-# _LT_SYS_MODULE_PATH_AIX
-# -----------------------
+# _LT_SYS_MODULE_PATH_AIX([TAGNAME])
+# ----------------------------------
 # Links a minimal program and checks the executable
 # for the system default hardcoded library path. In most cases,
 # this is /usr/lib:/lib, but when the MPI compilers are used
 # the location of the communication and MPI libs are included too.
 # If we don't find anything, use the default library path according
 # to the aix ld manual.
+# Store the results from the different compilers for each TAGNAME.
+# Allow to override them for all tags through lt_cv_aix_libpath.
 m4_defun([_LT_SYS_MODULE_PATH_AIX],
 [m4_require([_LT_DECL_SED])dnl
-AC_LINK_IFELSE(AC_LANG_PROGRAM,[
-lt_aix_libpath_sed='
-    /Import File Strings/,/^$/ {
-	/^0/ {
-	    s/^0  *\(.*\)$/\1/
-	    p
-	}
-    }'
-aix_libpath=`dump -H conftest$ac_exeext 2>/dev/null | $SED -n -e "$lt_aix_libpath_sed"`
-# Check for a 64-bit object if we didn't find anything.
-if test -z "$aix_libpath"; then
-  aix_libpath=`dump -HX64 conftest$ac_exeext 2>/dev/null | $SED -n -e "$lt_aix_libpath_sed"`
-fi],[])
-if test -z "$aix_libpath"; then aix_libpath="/usr/lib:/lib"; fi
+if test "${lt_cv_aix_libpath+set}" = set; then
+  aix_libpath=$lt_cv_aix_libpath
+else
+  AC_CACHE_VAL([_LT_TAGVAR([lt_cv_aix_libpath_], [$1])],
+  [AC_LINK_IFELSE([AC_LANG_PROGRAM],[
+  lt_aix_libpath_sed='[
+      /Import File Strings/,/^$/ {
+	  /^0/ {
+	      s/^0  *\([^ ]*\) *$/\1/
+	      p
+	  }
+      }]'
+  _LT_TAGVAR([lt_cv_aix_libpath_], [$1])=`dump -H conftest$ac_exeext 2>/dev/null | $SED -n -e "$lt_aix_libpath_sed"`
+  # Check for a 64-bit object if we didn't find anything.
+  if test -z "$_LT_TAGVAR([lt_cv_aix_libpath_], [$1])"; then
+    _LT_TAGVAR([lt_cv_aix_libpath_], [$1])=`dump -HX64 conftest$ac_exeext 2>/dev/null | $SED -n -e "$lt_aix_libpath_sed"`
+  fi],[])
+  if test -z "$_LT_TAGVAR([lt_cv_aix_libpath_], [$1])"; then
+    _LT_TAGVAR([lt_cv_aix_libpath_], [$1])="/usr/lib:/lib"
+  fi
+  ])
+  aix_libpath=$_LT_TAGVAR([lt_cv_aix_libpath_], [$1])
+fi
 ])# _LT_SYS_MODULE_PATH_AIX
 
 
 # _LT_SHELL_INIT(ARG)
 # -------------------
 m4_define([_LT_SHELL_INIT],
-[ifdef([AC_DIVERSION_NOTICE],
-	     [AC_DIVERT_PUSH(AC_DIVERSION_NOTICE)],
-	 [AC_DIVERT_PUSH(NOTICE)])
-$1
-AC_DIVERT_POP
-])# _LT_SHELL_INIT
+[m4_divert_text([M4SH-INIT], [$1
+])])# _LT_SHELL_INIT
+
 
 
 # _LT_PROG_ECHO_BACKSLASH
 # -----------------------
-# Add some code to the start of the generated configure script which
-# will find an echo command which doesn't interpret backslashes.
+# Find how we can fake an echo command that does not interpret backslash.
+# In particular, with Autoconf 2.60 or later we add some code to the start
+# of the generated configure script which will find a shell with a builtin
+# printf (which we can use as an echo command).
 m4_defun([_LT_PROG_ECHO_BACKSLASH],
-[_LT_SHELL_INIT([
-# Check that we are running under the correct shell.
-SHELL=${CONFIG_SHELL-/bin/sh}
-
-case X$lt_ECHO in
-X*--fallback-echo)
-  # Remove one level of quotation (which was required for Make).
-  ECHO=`echo "$lt_ECHO" | sed 's,\\\\\[$]\\[$]0,'[$]0','`
-  ;;
-esac
-
-ECHO=${lt_ECHO-echo}
-if test "X[$]1" = X--no-reexec; then
-  # Discard the --no-reexec flag, and continue.
-  shift
-elif test "X[$]1" = X--fallback-echo; then
-  # Avoid inline document here, it may be left over
-  :
-elif test "X`{ $ECHO '\t'; } 2>/dev/null`" = 'X\t' ; then
-  # Yippee, $ECHO works!
-  :
+[ECHO='\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\'
+ECHO=$ECHO$ECHO$ECHO$ECHO$ECHO
+ECHO=$ECHO$ECHO$ECHO$ECHO$ECHO$ECHO
+
+AC_MSG_CHECKING([how to print strings])
+# Test print first, because it will be a builtin if present.
+if test "X`( print -r -- -n ) 2>/dev/null`" = X-n && \
+   test "X`print -r -- $ECHO 2>/dev/null`" = "X$ECHO"; then
+  ECHO='print -r --'
+elif test "X`printf %s $ECHO 2>/dev/null`" = "X$ECHO"; then
+  ECHO='printf %s\n'
 else
-  # Restart under the correct shell.
-  exec $SHELL "[$]0" --no-reexec ${1+"[$]@"}
-fi
-
-if test "X[$]1" = X--fallback-echo; then
-  # used as fallback echo
-  shift
-  cat <<_LT_EOF
-[$]*
-_LT_EOF
-  exit 0
+  # Use this function as a fallback that always works.
+  func_fallback_echo ()
+  {
+    eval 'cat <<_LTECHO_EOF
+$[]1
+_LTECHO_EOF'
+  }
+  ECHO='func_fallback_echo'
 fi
 
-# The HP-UX ksh and POSIX shell print the target directory to stdout
-# if CDPATH is set.
-(unset CDPATH) >/dev/null 2>&1 && unset CDPATH
-
-if test -z "$lt_ECHO"; then
-  if test "X${echo_test_string+set}" != Xset; then
-    # find a string as large as possible, as long as the shell can cope with it
-    for cmd in 'sed 50q "[$]0"' 'sed 20q "[$]0"' 'sed 10q "[$]0"' 'sed 2q "[$]0"' 'echo test'; do
-      # expected sizes: less than 2Kb, 1Kb, 512 bytes, 16 bytes, ...
-      if { echo_test_string=`eval $cmd`; } 2>/dev/null &&
-	 { test "X$echo_test_string" = "X$echo_test_string"; } 2>/dev/null
-      then
-        break
-      fi
-    done
-  fi
-
-  if test "X`{ $ECHO '\t'; } 2>/dev/null`" = 'X\t' &&
-     echo_testing_string=`{ $ECHO "$echo_test_string"; } 2>/dev/null` &&
-     test "X$echo_testing_string" = "X$echo_test_string"; then
-    :
-  else
-    # The Solaris, AIX, and Digital Unix default echo programs unquote
-    # backslashes.  This makes it impossible to quote backslashes using
-    #   echo "$something" | sed 's/\\/\\\\/g'
-    #
-    # So, first we look for a working echo in the user's PATH.
-
-    lt_save_ifs="$IFS"; IFS=$PATH_SEPARATOR
-    for dir in $PATH /usr/ucb; do
-      IFS="$lt_save_ifs"
-      if (test -f $dir/echo || test -f $dir/echo$ac_exeext) &&
-         test "X`($dir/echo '\t') 2>/dev/null`" = 'X\t' &&
-         echo_testing_string=`($dir/echo "$echo_test_string") 2>/dev/null` &&
-         test "X$echo_testing_string" = "X$echo_test_string"; then
-        ECHO="$dir/echo"
-        break
-      fi
-    done
-    IFS="$lt_save_ifs"
-
-    if test "X$ECHO" = Xecho; then
-      # We didn't find a better echo, so look for alternatives.
-      if test "X`{ print -r '\t'; } 2>/dev/null`" = 'X\t' &&
-         echo_testing_string=`{ print -r "$echo_test_string"; } 2>/dev/null` &&
-         test "X$echo_testing_string" = "X$echo_test_string"; then
-        # This shell has a builtin print -r that does the trick.
-        ECHO='print -r'
-      elif { test -f /bin/ksh || test -f /bin/ksh$ac_exeext; } &&
-	   test "X$CONFIG_SHELL" != X/bin/ksh; then
-        # If we have ksh, try running configure again with it.
-        ORIGINAL_CONFIG_SHELL=${CONFIG_SHELL-/bin/sh}
-        export ORIGINAL_CONFIG_SHELL
-        CONFIG_SHELL=/bin/ksh
-        export CONFIG_SHELL
-        exec $CONFIG_SHELL "[$]0" --no-reexec ${1+"[$]@"}
-      else
-        # Try using printf.
-        ECHO='printf %s\n'
-        if test "X`{ $ECHO '\t'; } 2>/dev/null`" = 'X\t' &&
-	   echo_testing_string=`{ $ECHO "$echo_test_string"; } 2>/dev/null` &&
-	   test "X$echo_testing_string" = "X$echo_test_string"; then
-	  # Cool, printf works
-	  :
-        elif echo_testing_string=`($ORIGINAL_CONFIG_SHELL "[$]0" --fallback-echo '\t') 2>/dev/null` &&
-	     test "X$echo_testing_string" = 'X\t' &&
-	     echo_testing_string=`($ORIGINAL_CONFIG_SHELL "[$]0" --fallback-echo "$echo_test_string") 2>/dev/null` &&
-	     test "X$echo_testing_string" = "X$echo_test_string"; then
-	  CONFIG_SHELL=$ORIGINAL_CONFIG_SHELL
-	  export CONFIG_SHELL
-	  SHELL="$CONFIG_SHELL"
-	  export SHELL
-	  ECHO="$CONFIG_SHELL [$]0 --fallback-echo"
-        elif echo_testing_string=`($CONFIG_SHELL "[$]0" --fallback-echo '\t') 2>/dev/null` &&
-	     test "X$echo_testing_string" = 'X\t' &&
-	     echo_testing_string=`($CONFIG_SHELL "[$]0" --fallback-echo "$echo_test_string") 2>/dev/null` &&
-	     test "X$echo_testing_string" = "X$echo_test_string"; then
-	  ECHO="$CONFIG_SHELL [$]0 --fallback-echo"
-        else
-	  # maybe with a smaller string...
-	  prev=:
-
-	  for cmd in 'echo test' 'sed 2q "[$]0"' 'sed 10q "[$]0"' 'sed 20q "[$]0"' 'sed 50q "[$]0"'; do
-	    if { test "X$echo_test_string" = "X`eval $cmd`"; } 2>/dev/null
-	    then
-	      break
-	    fi
-	    prev="$cmd"
-	  done
+# func_echo_all arg...
+# Invoke $ECHO with all args, space-separated.
+func_echo_all ()
+{
+    $ECHO "$*" 
+}
 
-	  if test "$prev" != 'sed 50q "[$]0"'; then
-	    echo_test_string=`eval $prev`
-	    export echo_test_string
-	    exec ${ORIGINAL_CONFIG_SHELL-${CONFIG_SHELL-/bin/sh}} "[$]0" ${1+"[$]@"}
-	  else
-	    # Oops.  We lost completely, so just stick with echo.
-	    ECHO=echo
-	  fi
-        fi
-      fi
-    fi
-  fi
-fi
+case "$ECHO" in
+  printf*) AC_MSG_RESULT([printf]) ;;
+  print*) AC_MSG_RESULT([print -r]) ;;
+  *) AC_MSG_RESULT([cat]) ;;
+esac
 
-# Copy echo and quote the copy suitably for passing to libtool from
-# the Makefile, instead of quoting the original, which is used later.
-lt_ECHO=$ECHO
-if test "X$lt_ECHO" = "X$CONFIG_SHELL [$]0 --fallback-echo"; then
-   lt_ECHO="$CONFIG_SHELL \\\$\[$]0 --fallback-echo"
-fi
+m4_ifdef([_AS_DETECT_SUGGESTED],
+[_AS_DETECT_SUGGESTED([
+  test -n "${ZSH_VERSION+set}${BASH_VERSION+set}" || (
+    ECHO='\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\'
+    ECHO=$ECHO$ECHO$ECHO$ECHO$ECHO
+    ECHO=$ECHO$ECHO$ECHO$ECHO$ECHO$ECHO
+    PATH=/empty FPATH=/empty; export PATH FPATH
+    test "X`printf %s $ECHO`" = "X$ECHO" \
+      || test "X`print -r -- $ECHO`" = "X$ECHO" )])])
 
-AC_SUBST(lt_ECHO)
-])
 _LT_DECL([], [SHELL], [1], [Shell to use when invoking shell scripts])
-_LT_DECL([], [ECHO], [1],
-    [An echo program that does not interpret backslashes])
+_LT_DECL([], [ECHO], [1], [An echo program that protects backslashes])
 ])# _LT_PROG_ECHO_BACKSLASH
 
 
+# _LT_WITH_SYSROOT
+# ----------------
+AC_DEFUN([_LT_WITH_SYSROOT],
+[AC_MSG_CHECKING([for sysroot])
+AC_ARG_WITH([sysroot],
+[  --with-sysroot[=DIR] Search for dependent libraries within DIR
+                        (or the compiler's sysroot if not specified).],
+[], [with_sysroot=no])
+
+dnl lt_sysroot will always be passed unquoted.  We quote it here
+dnl in case the user passed a directory name.
+lt_sysroot=
+case ${with_sysroot} in #(
+ yes)
+   if test "$GCC" = yes; then
+     lt_sysroot=`$CC --print-sysroot 2>/dev/null`
+   fi
+   ;; #(
+ /*)
+   lt_sysroot=`echo "$with_sysroot" | sed -e "$sed_quote_subst"`
+   ;; #(
+ no|'')
+   ;; #(
+ *)
+   AC_MSG_RESULT([${with_sysroot}])
+   AC_MSG_ERROR([The sysroot must be an absolute path.])
+   ;;
+esac
+
+ AC_MSG_RESULT([${lt_sysroot:-no}])
+_LT_DECL([], [lt_sysroot], [0], [The root where to search for ]dnl
+[dependent libraries, and in which our libraries should be installed.])])
+
 # _LT_ENABLE_LOCK
 # ---------------
 m4_defun([_LT_ENABLE_LOCK],
@@ -1236,7 +1281,7 @@ ia64-*-hpux*)
   ;;
 *-*-irix6*)
   # Find out which ABI we are using.
-  echo '[#]line __oline__ "configure"' > conftest.$ac_ext
+  echo '[#]line '$LINENO' "configure"' > conftest.$ac_ext
   if AC_TRY_EVAL(ac_compile); then
     if test "$lt_cv_prog_gnu_ld" = yes; then
       case `/usr/bin/file conftest.$ac_objext` in
@@ -1329,14 +1374,27 @@ s390*-*linux*|s390*-*tpf*|sparc*-*linux*)
     CFLAGS="$SAVE_CFLAGS"
   fi
   ;;
-sparc*-*solaris*)
+*-*solaris*)
   # Find out which ABI we are using.
   echo 'int i;' > conftest.$ac_ext
   if AC_TRY_EVAL(ac_compile); then
     case `/usr/bin/file conftest.o` in
     *64-bit*)
       case $lt_cv_prog_gnu_ld in
-      yes*) LD="${LD-ld} -m elf64_sparc" ;;
+      yes*)
+        case $host in
+        i?86-*-solaris*)
+          LD="${LD-ld} -m elf_x86_64"
+          ;;
+        sparc*-*-solaris*)
+          LD="${LD-ld} -m elf64_sparc"
+          ;;
+        esac
+        # GNU ld 2.21 introduced _sol2 emulations.  Use them if available.
+        if ${LD-ld} -V | grep _sol2 >/dev/null 2>&1; then
+          LD="${LD-ld}_sol2"
+        fi
+        ;;
       *)
 	if ${LD-ld} -64 -r -o conftest2.o conftest.o >/dev/null 2>&1; then
 	  LD="${LD-ld} -64"
@@ -1354,14 +1412,47 @@ need_locks="$enable_libtool_lock"
 ])# _LT_ENABLE_LOCK
 
 
+# _LT_PROG_AR
+# -----------
+m4_defun([_LT_PROG_AR],
+[AC_CHECK_TOOLS(AR, [ar], false)
+: ${AR=ar}
+: ${AR_FLAGS=cru}
+_LT_DECL([], [AR], [1], [The archiver])
+_LT_DECL([], [AR_FLAGS], [1], [Flags to create an archive])
+
+AC_CACHE_CHECK([for archiver @FILE support], [lt_cv_ar_at_file],
+  [lt_cv_ar_at_file=no
+   AC_COMPILE_IFELSE([AC_LANG_PROGRAM],
+     [echo conftest.$ac_objext > conftest.lst
+      lt_ar_try='$AR $AR_FLAGS libconftest.a @conftest.lst >&AS_MESSAGE_LOG_FD'
+      AC_TRY_EVAL([lt_ar_try])
+      if test "$ac_status" -eq 0; then
+	# Ensure the archiver fails upon bogus file names.
+	rm -f conftest.$ac_objext libconftest.a
+	AC_TRY_EVAL([lt_ar_try])
+	if test "$ac_status" -ne 0; then
+          lt_cv_ar_at_file=@
+        fi
+      fi
+      rm -f conftest.* libconftest.a
+     ])
+  ])
+
+if test "x$lt_cv_ar_at_file" = xno; then
+  archiver_list_spec=
+else
+  archiver_list_spec=$lt_cv_ar_at_file
+fi
+_LT_DECL([], [archiver_list_spec], [1],
+  [How to feed a file listing to the archiver])
+])# _LT_PROG_AR
+
+
 # _LT_CMD_OLD_ARCHIVE
 # -------------------
 m4_defun([_LT_CMD_OLD_ARCHIVE],
-[AC_CHECK_TOOL(AR, ar, false)
-test -z "$AR" && AR=ar
-test -z "$AR_FLAGS" && AR_FLAGS=cru
-_LT_DECL([], [AR], [1], [The archiver])
-_LT_DECL([], [AR_FLAGS], [1])
+[_LT_PROG_AR
 
 AC_CHECK_TOOL(STRIP, strip, :)
 test -z "$STRIP" && STRIP=:
@@ -1380,18 +1471,27 @@ old_postuninstall_cmds=
 if test -n "$RANLIB"; then
   case $host_os in
   openbsd*)
-    old_postinstall_cmds="$old_postinstall_cmds~\$RANLIB -t \$oldlib"
+    old_postinstall_cmds="$old_postinstall_cmds~\$RANLIB -t \$tool_oldlib"
     ;;
   *)
-    old_postinstall_cmds="$old_postinstall_cmds~\$RANLIB \$oldlib"
+    old_postinstall_cmds="$old_postinstall_cmds~\$RANLIB \$tool_oldlib"
     ;;
   esac
-  old_archive_cmds="$old_archive_cmds~\$RANLIB \$oldlib"
+  old_archive_cmds="$old_archive_cmds~\$RANLIB \$tool_oldlib"
 fi
+
+case $host_os in
+  darwin*)
+    lock_old_archive_extraction=yes ;;
+  *)
+    lock_old_archive_extraction=no ;;
+esac
 _LT_DECL([], [old_postinstall_cmds], [2])
 _LT_DECL([], [old_postuninstall_cmds], [2])
 _LT_TAGDECL([], [old_archive_cmds], [2],
     [Commands used to build an old-style archive])
+_LT_DECL([], [lock_old_archive_extraction], [0],
+    [Whether to use a lock for old archive extraction])
 ])# _LT_CMD_OLD_ARCHIVE
 
 
@@ -1416,15 +1516,15 @@ AC_CACHE_CHECK([$1], [$2],
    -e 's:.*FLAGS}\{0,1\} :&$lt_compiler_flag :; t' \
    -e 's: [[^ ]]*conftest\.: $lt_compiler_flag&:; t' \
    -e 's:$: $lt_compiler_flag:'`
-   (eval echo "\"\$as_me:__oline__: $lt_compile\"" >&AS_MESSAGE_LOG_FD)
+   (eval echo "\"\$as_me:$LINENO: $lt_compile\"" >&AS_MESSAGE_LOG_FD)
    (eval "$lt_compile" 2>conftest.err)
    ac_status=$?
    cat conftest.err >&AS_MESSAGE_LOG_FD
-   echo "$as_me:__oline__: \$? = $ac_status" >&AS_MESSAGE_LOG_FD
+   echo "$as_me:$LINENO: \$? = $ac_status" >&AS_MESSAGE_LOG_FD
    if (exit $ac_status) && test -s "$ac_outfile"; then
      # The compiler can only warn and ignore the option if not recognized
      # So say no if there are warnings other than the usual output.
-     $ECHO "X$_lt_compiler_boilerplate" | $Xsed -e '/^$/d' >conftest.exp
+     $ECHO "$_lt_compiler_boilerplate" | $SED '/^$/d' >conftest.exp
      $SED '/^$/d; /^ *+/d' conftest.err >conftest.er2
      if test ! -s conftest.er2 || diff conftest.exp conftest.er2 >/dev/null; then
        $2=yes
@@ -1464,7 +1564,7 @@ AC_CACHE_CHECK([$1], [$2],
      if test -s conftest.err; then
        # Append any errors to the config.log.
        cat conftest.err 1>&AS_MESSAGE_LOG_FD
-       $ECHO "X$_lt_linker_boilerplate" | $Xsed -e '/^$/d' > conftest.exp
+       $ECHO "$_lt_linker_boilerplate" | $SED '/^$/d' > conftest.exp
        $SED '/^$/d; /^ *+/d' conftest.err >conftest.er2
        if diff conftest.exp conftest.er2 >/dev/null; then
          $2=yes
@@ -1527,6 +1627,11 @@ AC_CACHE_VAL([lt_cv_sys_max_cmd_len], [dnl
     lt_cv_sys_max_cmd_len=8192;
     ;;
 
+  mint*)
+    # On MiNT this can take a long time and run out of memory.
+    lt_cv_sys_max_cmd_len=8192;
+    ;;
+
   amigaos*)
     # On AmigaOS with pdksh, this test takes hours, literally.
     # So we just punt and use a minimum line length of 8192.
@@ -1552,6 +1657,11 @@ AC_CACHE_VAL([lt_cv_sys_max_cmd_len], [dnl
     lt_cv_sys_max_cmd_len=196608
     ;;
 
+  os2*)
+    # The test takes a long time on OS/2.
+    lt_cv_sys_max_cmd_len=8192
+    ;;
+
   osf*)
     # Dr. Hans Ekkehard Plesser reports seeing a kernel panic running configure
     # due to this test when exec_disable_arg_limit is 1 on Tru64. It is not
@@ -1591,8 +1701,8 @@ AC_CACHE_VAL([lt_cv_sys_max_cmd_len], [dnl
       # If test is not a shell built-in, we'll probably end up computing a
       # maximum length that is only half of the actual maximum length, but
       # we can't tell.
-      while { test "X"`$SHELL [$]0 --fallback-echo "X$teststring$teststring" 2>/dev/null` \
-	         = "XX$teststring$teststring"; } >/dev/null 2>&1 &&
+      while { test "X"`env echo "$teststring$teststring" 2>/dev/null` \
+	         = "X$teststring$teststring"; } >/dev/null 2>&1 &&
 	      test $i != 17 # 1/2 MB should be enough
       do
         i=`expr $i + 1`
@@ -1643,7 +1753,7 @@ else
   lt_dlunknown=0; lt_dlno_uscore=1; lt_dlneed_uscore=2
   lt_status=$lt_dlunknown
   cat > conftest.$ac_ext <<_LT_EOF
-[#line __oline__ "configure"
+[#line $LINENO "configure"
 #include "confdefs.h"
 
 #if HAVE_DLFCN_H
@@ -1684,7 +1794,13 @@ else
 #  endif
 #endif
 
-void fnord() { int i=42;}
+/* When -fvisbility=hidden is used, assume the code has been annotated
+   correspondingly for the symbols needed.  */
+#if defined(__GNUC__) && (((__GNUC__ == 3) && (__GNUC_MINOR__ >= 3)) || (__GNUC__ > 3))
+int fnord () __attribute__((visibility("default")));
+#endif
+
+int fnord () { return 42; }
 int main ()
 {
   void *self = dlopen (0, LT_DLGLOBAL|LT_DLLAZY_OR_NOW);
@@ -1693,7 +1809,11 @@ int main ()
   if (self)
     {
       if (dlsym (self,"fnord"))       status = $lt_dlno_uscore;
-      else if (dlsym( self,"_fnord")) status = $lt_dlneed_uscore;
+      else
+        {
+	  if (dlsym( self,"_fnord"))  status = $lt_dlneed_uscore;
+          else puts (dlerror ());
+	}
       /* dlclose (self); */
     }
   else
@@ -1869,16 +1989,16 @@ AC_CACHE_CHECK([if $compiler supports -c -o file.$ac_objext],
    -e 's:.*FLAGS}\{0,1\} :&$lt_compiler_flag :; t' \
    -e 's: [[^ ]]*conftest\.: $lt_compiler_flag&:; t' \
    -e 's:$: $lt_compiler_flag:'`
-   (eval echo "\"\$as_me:__oline__: $lt_compile\"" >&AS_MESSAGE_LOG_FD)
+   (eval echo "\"\$as_me:$LINENO: $lt_compile\"" >&AS_MESSAGE_LOG_FD)
    (eval "$lt_compile" 2>out/conftest.err)
    ac_status=$?
    cat out/conftest.err >&AS_MESSAGE_LOG_FD
-   echo "$as_me:__oline__: \$? = $ac_status" >&AS_MESSAGE_LOG_FD
+   echo "$as_me:$LINENO: \$? = $ac_status" >&AS_MESSAGE_LOG_FD
    if (exit $ac_status) && test -s out/conftest2.$ac_objext
    then
      # The compiler can only warn and ignore the option if not recognized
      # So say no if there are warnings
-     $ECHO "X$_lt_compiler_boilerplate" | $Xsed -e '/^$/d' > out/conftest.exp
+     $ECHO "$_lt_compiler_boilerplate" | $SED '/^$/d' > out/conftest.exp
      $SED '/^$/d; /^ *+/d' out/conftest.err >out/conftest.er2
      if test ! -s out/conftest.er2 || diff out/conftest.exp out/conftest.er2 >/dev/null; then
        _LT_TAGVAR(lt_cv_prog_compiler_c_o, $1)=yes
@@ -2037,6 +2157,7 @@ m4_require([_LT_DECL_EGREP])dnl
 m4_require([_LT_FILEUTILS_DEFAULTS])dnl
 m4_require([_LT_DECL_OBJDUMP])dnl
 m4_require([_LT_DECL_SED])dnl
+m4_require([_LT_CHECK_SHELL_FEATURES])dnl
 AC_MSG_CHECKING([dynamic linker characteristics])
 m4_if([$1],
 	[], [
@@ -2045,16 +2166,23 @@ if test "$GCC" = yes; then
     darwin*) lt_awk_arg="/^libraries:/,/LR/" ;;
     *) lt_awk_arg="/^libraries:/" ;;
   esac
-  lt_search_path_spec=`$CC -print-search-dirs | awk $lt_awk_arg | $SED -e "s/^libraries://" -e "s,=/,/,g"`
-  if $ECHO "$lt_search_path_spec" | $GREP ';' >/dev/null ; then
+  case $host_os in
+    mingw* | cegcc*) lt_sed_strip_eq="s,=\([[A-Za-z]]:\),\1,g" ;;
+    *) lt_sed_strip_eq="s,=/,/,g" ;;
+  esac
+  lt_search_path_spec=`$CC -print-search-dirs | awk $lt_awk_arg | $SED -e "s/^libraries://" -e $lt_sed_strip_eq`
+  case $lt_search_path_spec in
+  *\;*)
     # if the path contains ";" then we assume it to be the separator
     # otherwise default to the standard path separator (i.e. ":") - it is
     # assumed that no part of a normal pathname contains ";" but that should
     # okay in the real world where ";" in dirpaths is itself problematic.
-    lt_search_path_spec=`$ECHO "$lt_search_path_spec" | $SED -e 's/;/ /g'`
-  else
-    lt_search_path_spec=`$ECHO "$lt_search_path_spec" | $SED  -e "s/$PATH_SEPARATOR/ /g"`
-  fi
+    lt_search_path_spec=`$ECHO "$lt_search_path_spec" | $SED 's/;/ /g'`
+    ;;
+  *)
+    lt_search_path_spec=`$ECHO "$lt_search_path_spec" | $SED "s/$PATH_SEPARATOR/ /g"`
+    ;;
+  esac
   # Ok, now we have the path, separated by spaces, we can step through it
   # and add multilib dir if necessary.
   lt_tmp_lt_search_path_spec=
@@ -2067,7 +2195,7 @@ if test "$GCC" = yes; then
 	lt_tmp_lt_search_path_spec="$lt_tmp_lt_search_path_spec $lt_sys_path"
     fi
   done
-  lt_search_path_spec=`$ECHO $lt_tmp_lt_search_path_spec | awk '
+  lt_search_path_spec=`$ECHO "$lt_tmp_lt_search_path_spec" | awk '
 BEGIN {RS=" "; FS="/|\n";} {
   lt_foo="";
   lt_count=0;
@@ -2087,7 +2215,13 @@ BEGIN {RS=" "; FS="/|\n";} {
   if (lt_foo != "") { lt_freq[[lt_foo]]++; }
   if (lt_freq[[lt_foo]] == 1) { print lt_foo; }
 }'`
-  sys_lib_search_path_spec=`$ECHO $lt_search_path_spec`
+  # AWK program above erroneously prepends '/' to C:/dos/paths
+  # for these hosts.
+  case $host_os in
+    mingw* | cegcc*) lt_search_path_spec=`$ECHO "$lt_search_path_spec" |\
+      $SED 's,/\([[A-Za-z]]:\),\1,g'` ;;
+  esac
+  sys_lib_search_path_spec=`$ECHO "$lt_search_path_spec" | $lt_NL2SP`
 else
   sys_lib_search_path_spec="/lib /usr/lib /usr/local/lib"
 fi])
@@ -2113,7 +2247,7 @@ need_version=unknown
 
 case $host_os in
 aix3*)
-  version_type=linux
+  version_type=linux # correct to gnu/linux during the next big refactor
   library_names_spec='${libname}${release}${shared_ext}$versuffix $libname.a'
   shlibpath_var=LIBPATH
 
@@ -2122,7 +2256,7 @@ aix3*)
   ;;
 
 aix[[4-9]]*)
-  version_type=linux
+  version_type=linux # correct to gnu/linux during the next big refactor
   need_lib_prefix=no
   need_version=no
   hardcode_into_libs=yes
@@ -2175,7 +2309,7 @@ amigaos*)
   m68k)
     library_names_spec='$libname.ixlibrary $libname.a'
     # Create ${libname}_ixlibrary.a entries in /sys/libs.
-    finish_eval='for lib in `ls $libdir/*.ixlibrary 2>/dev/null`; do libname=`$ECHO "X$lib" | $Xsed -e '\''s%^.*/\([[^/]]*\)\.ixlibrary$%\1%'\''`; test $RM /sys/libs/${libname}_ixlibrary.a; $show "cd /sys/libs && $LN_S $lib ${libname}_ixlibrary.a"; cd /sys/libs && $LN_S $lib ${libname}_ixlibrary.a || exit 1; done'
+    finish_eval='for lib in `ls $libdir/*.ixlibrary 2>/dev/null`; do libname=`func_echo_all "$lib" | $SED '\''s%^.*/\([[^/]]*\)\.ixlibrary$%\1%'\''`; test $RM /sys/libs/${libname}_ixlibrary.a; $show "cd /sys/libs && $LN_S $lib ${libname}_ixlibrary.a"; cd /sys/libs && $LN_S $lib ${libname}_ixlibrary.a || exit 1; done'
     ;;
   esac
   ;;
@@ -2187,7 +2321,7 @@ beos*)
   ;;
 
 bsdi[[45]]*)
-  version_type=linux
+  version_type=linux # correct to gnu/linux during the next big refactor
   need_version=no
   library_names_spec='${libname}${release}${shared_ext}$versuffix ${libname}${release}${shared_ext}$major $libname${shared_ext}'
   soname_spec='${libname}${release}${shared_ext}$major'
@@ -2206,8 +2340,9 @@ cygwin* | mingw* | pw32* | cegcc*)
   need_version=no
   need_lib_prefix=no
 
-  case $GCC,$host_os in
-  yes,cygwin* | yes,mingw* | yes,pw32* | yes,cegcc*)
+  case $GCC,$cc_basename in
+  yes,*)
+    # gcc
     library_names_spec='$libname.dll.a'
     # DLL is installed to $(libdir)/../bin by postinstall_cmds
     postinstall_cmds='base_file=`basename \${file}`~
@@ -2228,36 +2363,83 @@ cygwin* | mingw* | pw32* | cegcc*)
     cygwin*)
       # Cygwin DLLs use 'cyg' prefix rather than 'lib'
       soname_spec='`echo ${libname} | sed -e 's/^lib/cyg/'``echo ${release} | $SED -e 's/[[.]]/-/g'`${versuffix}${shared_ext}'
-      sys_lib_search_path_spec="/usr/lib /lib/w32api /lib /usr/local/lib"
+m4_if([$1], [],[
+      sys_lib_search_path_spec="$sys_lib_search_path_spec /usr/lib/w32api"])
       ;;
     mingw* | cegcc*)
       # MinGW DLLs use traditional 'lib' prefix
       soname_spec='${libname}`echo ${release} | $SED -e 's/[[.]]/-/g'`${versuffix}${shared_ext}'
-      sys_lib_search_path_spec=`$CC -print-search-dirs | $GREP "^libraries:" | $SED -e "s/^libraries://" -e "s,=/,/,g"`
-      if $ECHO "$sys_lib_search_path_spec" | [$GREP ';[c-zC-Z]:/' >/dev/null]; then
-        # It is most probably a Windows format PATH printed by
-        # mingw gcc, but we are running on Cygwin. Gcc prints its search
-        # path with ; separators, and with drive letters. We can handle the
-        # drive letters (cygwin fileutils understands them), so leave them,
-        # especially as we might pass files found there to a mingw objdump,
-        # which wouldn't understand a cygwinified path. Ahh.
-        sys_lib_search_path_spec=`$ECHO "$sys_lib_search_path_spec" | $SED -e 's/;/ /g'`
-      else
-        sys_lib_search_path_spec=`$ECHO "$sys_lib_search_path_spec" | $SED  -e "s/$PATH_SEPARATOR/ /g"`
-      fi
       ;;
     pw32*)
       # pw32 DLLs use 'pw' prefix rather than 'lib'
       library_names_spec='`echo ${libname} | sed -e 's/^lib/pw/'``echo ${release} | $SED -e 's/[[.]]/-/g'`${versuffix}${shared_ext}'
       ;;
     esac
+    dynamic_linker='Win32 ld.exe'
+    ;;
+
+  *,cl*)
+    # Native MSVC
+    libname_spec='$name'
+    soname_spec='${libname}`echo ${release} | $SED -e 's/[[.]]/-/g'`${versuffix}${shared_ext}'
+    library_names_spec='${libname}.dll.lib'
+
+    case $build_os in
+    mingw*)
+      sys_lib_search_path_spec=
+      lt_save_ifs=$IFS
+      IFS=';'
+      for lt_path in $LIB
+      do
+        IFS=$lt_save_ifs
+        # Let DOS variable expansion print the short 8.3 style file name.
+        lt_path=`cd "$lt_path" 2>/dev/null && cmd //C "for %i in (".") do @echo %~si"`
+        sys_lib_search_path_spec="$sys_lib_search_path_spec $lt_path"
+      done
+      IFS=$lt_save_ifs
+      # Convert to MSYS style.
+      sys_lib_search_path_spec=`$ECHO "$sys_lib_search_path_spec" | sed -e 's|\\\\|/|g' -e 's| \\([[a-zA-Z]]\\):| /\\1|g' -e 's|^ ||'`
+      ;;
+    cygwin*)
+      # Convert to unix form, then to dos form, then back to unix form
+      # but this time dos style (no spaces!) so that the unix form looks
+      # like /cygdrive/c/PROGRA~1:/cygdr...
+      sys_lib_search_path_spec=`cygpath --path --unix "$LIB"`
+      sys_lib_search_path_spec=`cygpath --path --dos "$sys_lib_search_path_spec" 2>/dev/null`
+      sys_lib_search_path_spec=`cygpath --path --unix "$sys_lib_search_path_spec" | $SED -e "s/$PATH_SEPARATOR/ /g"`
+      ;;
+    *)
+      sys_lib_search_path_spec="$LIB"
+      if $ECHO "$sys_lib_search_path_spec" | [$GREP ';[c-zC-Z]:/' >/dev/null]; then
+        # It is most probably a Windows format PATH.
+        sys_lib_search_path_spec=`$ECHO "$sys_lib_search_path_spec" | $SED -e 's/;/ /g'`
+      else
+        sys_lib_search_path_spec=`$ECHO "$sys_lib_search_path_spec" | $SED -e "s/$PATH_SEPARATOR/ /g"`
+      fi
+      # FIXME: find the short name or the path components, as spaces are
+      # common. (e.g. "Program Files" -> "PROGRA~1")
+      ;;
+    esac
+
+    # DLL is installed to $(libdir)/../bin by postinstall_cmds
+    postinstall_cmds='base_file=`basename \${file}`~
+      dlpath=`$SHELL 2>&1 -c '\''. $dir/'\''\${base_file}'\''i; echo \$dlname'\''`~
+      dldir=$destdir/`dirname \$dlpath`~
+      test -d \$dldir || mkdir -p \$dldir~
+      $install_prog $dir/$dlname \$dldir/$dlname'
+    postuninstall_cmds='dldll=`$SHELL 2>&1 -c '\''. $file; echo \$dlname'\''`~
+      dlpath=$dir/\$dldll~
+       $RM \$dlpath'
+    shlibpath_overrides_runpath=yes
+    dynamic_linker='Win32 link.exe'
     ;;
 
   *)
+    # Assume MSVC wrapper
     library_names_spec='${libname}`echo ${release} | $SED -e 's/[[.]]/-/g'`${versuffix}${shared_ext} $libname.lib'
+    dynamic_linker='Win32 ld.exe'
     ;;
   esac
-  dynamic_linker='Win32 ld.exe'
   # FIXME: first we should search . and the directory the executable is in
   shlibpath_var=PATH
   ;;
@@ -2278,7 +2460,7 @@ m4_if([$1], [],[
   ;;
 
 dgux*)
-  version_type=linux
+  version_type=linux # correct to gnu/linux during the next big refactor
   need_lib_prefix=no
   need_version=no
   library_names_spec='${libname}${release}${shared_ext}$versuffix ${libname}${release}${shared_ext}$major $libname$shared_ext'
@@ -2286,10 +2468,6 @@ dgux*)
   shlibpath_var=LD_LIBRARY_PATH
   ;;
 
-freebsd1*)
-  dynamic_linker=no
-  ;;
-
 freebsd* | dragonfly*)
   # DragonFly does not have aout.  When/if they implement a new
   # versioning mechanism, adjust this.
@@ -2297,7 +2475,7 @@ freebsd* | dragonfly*)
     objformat=`/usr/bin/objformat`
   else
     case $host_os in
-    freebsd[[123]]*) objformat=aout ;;
+    freebsd[[23]].*) objformat=aout ;;
     *) objformat=elf ;;
     esac
   fi
@@ -2315,7 +2493,7 @@ freebsd* | dragonfly*)
   esac
   shlibpath_var=LD_LIBRARY_PATH
   case $host_os in
-  freebsd2*)
+  freebsd2.*)
     shlibpath_overrides_runpath=yes
     ;;
   freebsd3.[[01]]* | freebsdelf3.[[01]]*)
@@ -2335,12 +2513,26 @@ freebsd* | dragonfly*)
   ;;
 
 gnu*)
-  version_type=linux
+  version_type=linux # correct to gnu/linux during the next big refactor
   need_lib_prefix=no
   need_version=no
   library_names_spec='${libname}${release}${shared_ext}$versuffix ${libname}${release}${shared_ext}${major} ${libname}${shared_ext}'
   soname_spec='${libname}${release}${shared_ext}$major'
   shlibpath_var=LD_LIBRARY_PATH
+  shlibpath_overrides_runpath=no
+  hardcode_into_libs=yes
+  ;;
+
+haiku*)
+  version_type=linux # correct to gnu/linux during the next big refactor
+  need_lib_prefix=no
+  need_version=no
+  dynamic_linker="$host_os runtime_loader"
+  library_names_spec='${libname}${release}${shared_ext}$versuffix ${libname}${release}${shared_ext}${major} ${libname}${shared_ext}'
+  soname_spec='${libname}${release}${shared_ext}$major'
+  shlibpath_var=LIBRARY_PATH
+  shlibpath_overrides_runpath=yes
+  sys_lib_dlsearch_path_spec='/boot/home/config/lib /boot/common/lib /boot/system/lib'
   hardcode_into_libs=yes
   ;;
 
@@ -2386,12 +2578,14 @@ hpux9* | hpux10* | hpux11*)
     soname_spec='${libname}${release}${shared_ext}$major'
     ;;
   esac
-  # HP-UX runs *really* slowly unless shared libraries are mode 555.
+  # HP-UX runs *really* slowly unless shared libraries are mode 555, ...
   postinstall_cmds='chmod 555 $lib'
+  # or fails outright, so override atomically:
+  install_override_mode=555
   ;;
 
 interix[[3-9]]*)
-  version_type=linux
+  version_type=linux # correct to gnu/linux during the next big refactor
   need_lib_prefix=no
   need_version=no
   library_names_spec='${libname}${release}${shared_ext}$versuffix ${libname}${release}${shared_ext}$major ${libname}${shared_ext}'
@@ -2407,7 +2601,7 @@ irix5* | irix6* | nonstopux*)
     nonstopux*) version_type=nonstopux ;;
     *)
 	if test "$lt_cv_prog_gnu_ld" = yes; then
-		version_type=linux
+		version_type=linux # correct to gnu/linux during the next big refactor
 	else
 		version_type=irix
 	fi ;;
@@ -2444,9 +2638,9 @@ linux*oldld* | linux*aout* | linux*coff*)
   dynamic_linker=no
   ;;
 
-# This must be Linux ELF.
-linux* | k*bsd*-gnu)
-  version_type=linux
+# This must be glibc/ELF.
+linux* | k*bsd*-gnu | kopensolaris*-gnu)
+  version_type=linux # correct to gnu/linux during the next big refactor
   need_lib_prefix=no
   need_version=no
   library_names_spec='${libname}${release}${shared_ext}$versuffix ${libname}${release}${shared_ext}$major $libname${shared_ext}'
@@ -2454,16 +2648,21 @@ linux* | k*bsd*-gnu)
   finish_cmds='PATH="\$PATH:/sbin" ldconfig -n $libdir'
   shlibpath_var=LD_LIBRARY_PATH
   shlibpath_overrides_runpath=no
+
   # Some binutils ld are patched to set DT_RUNPATH
-  save_LDFLAGS=$LDFLAGS
-  save_libdir=$libdir
-  eval "libdir=/foo; wl=\"$_LT_TAGVAR(lt_prog_compiler_wl, $1)\"; \
-       LDFLAGS=\"\$LDFLAGS $_LT_TAGVAR(hardcode_libdir_flag_spec, $1)\""
-  AC_LINK_IFELSE([AC_LANG_PROGRAM([],[])],
-    [AS_IF([ ($OBJDUMP -p conftest$ac_exeext) 2>/dev/null | grep "RUNPATH.*$libdir" >/dev/null],
-       [shlibpath_overrides_runpath=yes])])
-  LDFLAGS=$save_LDFLAGS
-  libdir=$save_libdir
+  AC_CACHE_VAL([lt_cv_shlibpath_overrides_runpath],
+    [lt_cv_shlibpath_overrides_runpath=no
+    save_LDFLAGS=$LDFLAGS
+    save_libdir=$libdir
+    eval "libdir=/foo; wl=\"$_LT_TAGVAR(lt_prog_compiler_wl, $1)\"; \
+	 LDFLAGS=\"\$LDFLAGS $_LT_TAGVAR(hardcode_libdir_flag_spec, $1)\""
+    AC_LINK_IFELSE([AC_LANG_PROGRAM([],[])],
+      [AS_IF([ ($OBJDUMP -p conftest$ac_exeext) 2>/dev/null | grep "RUNPATH.*$libdir" >/dev/null],
+	 [lt_cv_shlibpath_overrides_runpath=yes])])
+    LDFLAGS=$save_LDFLAGS
+    libdir=$save_libdir
+    ])
+  shlibpath_overrides_runpath=$lt_cv_shlibpath_overrides_runpath
 
   # This implies no fast_install, which is unacceptable.
   # Some rework will be needed to allow for fast_install
@@ -2475,8 +2674,9 @@ linux* | k*bsd*-gnu)
 
   # Append ld.so.conf contents to the search path
   if test -f /etc/ld.so.conf; then
-    lt_ld_extra=`awk '/^include / { system(sprintf("cd /etc; cat %s 2>/dev/null", \[$]2)); skip = 1; } { if (!skip) print \[$]0; skip = 0; }' < /etc/ld.so.conf | $SED -e 's/#.*//;/^[	 ]*hwcap[	 ]/d;s/[:,	]/ /g;s/=[^=]*$//;s/=[^= ]* / /g;/^$/d' | tr '\n' ' '`
+    lt_ld_extra=`awk '/^include / { system(sprintf("cd /etc; cat %s 2>/dev/null", \[$]2)); skip = 1; } { if (!skip) print \[$]0; skip = 0; }' < /etc/ld.so.conf | $SED -e 's/#.*//;/^[	 ]*hwcap[	 ]/d;s/[:,	]/ /g;s/=[^=]*$//;s/=[^= ]* / /g;s/"//g;/^$/d' | tr '\n' ' '`
     sys_lib_dlsearch_path_spec="$sys_lib_dlsearch_path_spec $lt_ld_extra"
+
   fi
 
   # We used to test for /lib/ld.so.1 and disable shared libraries on
@@ -2507,7 +2707,7 @@ netbsd*)
   ;;
 
 newsos6)
-  version_type=linux
+  version_type=linux # correct to gnu/linux during the next big refactor
   library_names_spec='${libname}${release}${shared_ext}$versuffix ${libname}${release}${shared_ext}$major $libname${shared_ext}'
   shlibpath_var=LD_LIBRARY_PATH
   shlibpath_overrides_runpath=yes
@@ -2576,7 +2776,7 @@ rdos*)
   ;;
 
 solaris*)
-  version_type=linux
+  version_type=linux # correct to gnu/linux during the next big refactor
   need_lib_prefix=no
   need_version=no
   library_names_spec='${libname}${release}${shared_ext}$versuffix ${libname}${release}${shared_ext}$major $libname${shared_ext}'
@@ -2601,7 +2801,7 @@ sunos4*)
   ;;
 
 sysv4 | sysv4.3*)
-  version_type=linux
+  version_type=linux # correct to gnu/linux during the next big refactor
   library_names_spec='${libname}${release}${shared_ext}$versuffix ${libname}${release}${shared_ext}$major $libname${shared_ext}'
   soname_spec='${libname}${release}${shared_ext}$major'
   shlibpath_var=LD_LIBRARY_PATH
@@ -2625,7 +2825,7 @@ sysv4 | sysv4.3*)
 
 sysv4*MP*)
   if test -d /usr/nec ;then
-    version_type=linux
+    version_type=linux # correct to gnu/linux during the next big refactor
     library_names_spec='$libname${shared_ext}.$versuffix $libname${shared_ext}.$major $libname${shared_ext}'
     soname_spec='$libname${shared_ext}.$major'
     shlibpath_var=LD_LIBRARY_PATH
@@ -2656,7 +2856,7 @@ sysv5* | sco3.2v5* | sco5v6* | unixware* | OpenUNIX* | sysv4*uw2*)
 
 tpf*)
   # TPF is a cross-target only.  Preferred cross-host = GNU/Linux.
-  version_type=linux
+  version_type=linux # correct to gnu/linux during the next big refactor
   need_lib_prefix=no
   need_version=no
   library_names_spec='${libname}${release}${shared_ext}$versuffix ${libname}${release}${shared_ext}$major $libname${shared_ext}'
@@ -2666,7 +2866,7 @@ tpf*)
   ;;
 
 uts4*)
-  version_type=linux
+  version_type=linux # correct to gnu/linux during the next big refactor
   library_names_spec='${libname}${release}${shared_ext}$versuffix ${libname}${release}${shared_ext}$major $libname${shared_ext}'
   soname_spec='${libname}${release}${shared_ext}$major'
   shlibpath_var=LD_LIBRARY_PATH
@@ -2708,6 +2908,8 @@ _LT_DECL([], [library_names_spec], [1],
     The last name is the one that the linker finds with -lNAME]])
 _LT_DECL([], [soname_spec], [1],
     [[The coded name of the library, if different from the real name]])
+_LT_DECL([], [install_override_mode], [1],
+    [Permission mode override for installation of shared libraries])
 _LT_DECL([], [postinstall_cmds], [2],
     [Command to use after installation of a shared archive])
 _LT_DECL([], [postuninstall_cmds], [2],
@@ -2820,6 +3022,7 @@ AC_REQUIRE([AC_CANONICAL_HOST])dnl
 AC_REQUIRE([AC_CANONICAL_BUILD])dnl
 m4_require([_LT_DECL_SED])dnl
 m4_require([_LT_DECL_EGREP])dnl
+m4_require([_LT_PROG_ECHO_BACKSLASH])dnl
 
 AC_ARG_WITH([gnu-ld],
     [AS_HELP_STRING([--with-gnu-ld],
@@ -2941,6 +3144,11 @@ case $reload_flag in
 esac
 reload_cmds='$LD$reload_flag -o $output$reload_objs'
 case $host_os in
+  cygwin* | mingw* | pw32* | cegcc*)
+    if test "$GCC" != yes; then
+      reload_cmds=false
+    fi
+    ;;
   darwin*)
     if test "$GCC" = yes; then
       reload_cmds='$LTCC $LTCFLAGS -nostdlib ${wl}-r -o $output$reload_objs'
@@ -2949,8 +3157,8 @@ case $host_os in
     fi
     ;;
 esac
-_LT_DECL([], [reload_flag], [1], [How to create reloadable object files])dnl
-_LT_DECL([], [reload_cmds], [2])dnl
+_LT_TAGDECL([], [reload_flag], [1], [How to create reloadable object files])dnl
+_LT_TAGDECL([], [reload_cmds], [2])dnl
 ])# _LT_CMD_RELOAD
 
 
@@ -3002,16 +3210,18 @@ mingw* | pw32*)
   # Base MSYS/MinGW do not provide the 'file' command needed by
   # func_win32_libid shell function, so use a weaker test based on 'objdump',
   # unless we find 'file', for example because we are cross-compiling.
-  if ( file / ) >/dev/null 2>&1; then
+  # func_win32_libid assumes BSD nm, so disallow it if using MS dumpbin.
+  if ( test "$lt_cv_nm_interface" = "BSD nm" && file / ) >/dev/null 2>&1; then
     lt_cv_deplibs_check_method='file_magic ^x86 archive import|^x86 DLL'
     lt_cv_file_magic_cmd='func_win32_libid'
   else
-    lt_cv_deplibs_check_method='file_magic file format pei*-i386(.*architecture: i386)?'
+    # Keep this pattern in sync with the one in func_win32_libid.
+    lt_cv_deplibs_check_method='file_magic file format (pei*-i386(.*architecture: i386)?|pe-arm-wince|pe-x86-64)'
     lt_cv_file_magic_cmd='$OBJDUMP -f'
   fi
   ;;
 
-cegcc)
+cegcc*)
   # use the weaker test based on 'objdump'. See mingw*.
   lt_cv_deplibs_check_method='file_magic file format pe-arm-.*little(.*architecture: arm)?'
   lt_cv_file_magic_cmd='$OBJDUMP -f'
@@ -3041,6 +3251,10 @@ gnu*)
   lt_cv_deplibs_check_method=pass_all
   ;;
 
+haiku*)
+  lt_cv_deplibs_check_method=pass_all
+  ;;
+
 hpux10.20* | hpux11*)
   lt_cv_file_magic_cmd=/usr/bin/file
   case $host_cpu in
@@ -3049,11 +3263,11 @@ hpux10.20* | hpux11*)
     lt_cv_file_magic_test_file=/usr/lib/hpux32/libc.so
     ;;
   hppa*64*)
-    [lt_cv_deplibs_check_method='file_magic (s[0-9][0-9][0-9]|ELF-[0-9][0-9]) shared object file - PA-RISC [0-9].[0-9]']
+    [lt_cv_deplibs_check_method='file_magic (s[0-9][0-9][0-9]|ELF[ -][0-9][0-9])(-bit)?( [LM]SB)? shared object( file)?[, -]* PA-RISC [0-9]\.[0-9]']
     lt_cv_file_magic_test_file=/usr/lib/pa20_64/libc.sl
     ;;
   *)
-    lt_cv_deplibs_check_method='file_magic (s[[0-9]][[0-9]][[0-9]]|PA-RISC[[0-9]].[[0-9]]) shared library'
+    lt_cv_deplibs_check_method='file_magic (s[[0-9]][[0-9]][[0-9]]|PA-RISC[[0-9]]\.[[0-9]]) shared library'
     lt_cv_file_magic_test_file=/usr/lib/libc.sl
     ;;
   esac
@@ -3074,8 +3288,8 @@ irix5* | irix6* | nonstopux*)
   lt_cv_deplibs_check_method=pass_all
   ;;
 
-# This must be Linux ELF.
-linux* | k*bsd*-gnu)
+# This must be glibc/ELF.
+linux* | k*bsd*-gnu | kopensolaris*-gnu)
   lt_cv_deplibs_check_method=pass_all
   ;;
 
@@ -3153,6 +3367,21 @@ tpf*)
   ;;
 esac
 ])
+
+file_magic_glob=
+want_nocaseglob=no
+if test "$build" = "$host"; then
+  case $host_os in
+  mingw* | pw32*)
+    if ( shopt | grep nocaseglob ) >/dev/null 2>&1; then
+      want_nocaseglob=yes
+    else
+      file_magic_glob=`echo aAbBcCdDeEfFgGhHiIjJkKlLmMnNoOpPqQrRsStTuUvVwWxXyYzZ | $SED -e "s/\(..\)/s\/[[\1]]\/[[\1]]\/g;/g"`
+    fi
+    ;;
+  esac
+fi
+
 file_magic_cmd=$lt_cv_file_magic_cmd
 deplibs_check_method=$lt_cv_deplibs_check_method
 test -z "$deplibs_check_method" && deplibs_check_method=unknown
@@ -3160,7 +3389,11 @@ test -z "$deplibs_check_method" && deplibs_check_method=unknown
 _LT_DECL([], [deplibs_check_method], [1],
     [Method to check whether dependent libraries are shared objects])
 _LT_DECL([], [file_magic_cmd], [1],
-    [Command to use when deplibs_check_method == "file_magic"])
+    [Command to use when deplibs_check_method = "file_magic"])
+_LT_DECL([], [file_magic_glob], [1],
+    [How to find potential files when deplibs_check_method = "file_magic"])
+_LT_DECL([], [want_nocaseglob], [1],
+    [Find potential files using nocaseglob when deplibs_check_method = "file_magic"])
 ])# _LT_CHECK_MAGIC_METHOD
 
 
@@ -3217,7 +3450,19 @@ if test "$lt_cv_path_NM" != "no"; then
   NM="$lt_cv_path_NM"
 else
   # Didn't find any BSD compatible name lister, look for dumpbin.
-  AC_CHECK_TOOLS(DUMPBIN, ["dumpbin -symbols" "link -dump -symbols"], :)
+  if test -n "$DUMPBIN"; then :
+    # Let the user override the test.
+  else
+    AC_CHECK_TOOLS(DUMPBIN, [dumpbin "link -dump"], :)
+    case `$DUMPBIN -symbols /dev/null 2>&1 | sed '1q'` in
+    *COFF*)
+      DUMPBIN="$DUMPBIN -symbols"
+      ;;
+    *)
+      DUMPBIN=:
+      ;;
+    esac
+  fi
   AC_SUBST([DUMPBIN])
   if test "$DUMPBIN" != ":"; then
     NM="$DUMPBIN"
@@ -3230,13 +3475,13 @@ _LT_DECL([], [NM], [1], [A BSD- or MS-compatible name lister])dnl
 AC_CACHE_CHECK([the name lister ($NM) interface], [lt_cv_nm_interface],
   [lt_cv_nm_interface="BSD nm"
   echo "int some_variable = 0;" > conftest.$ac_ext
-  (eval echo "\"\$as_me:__oline__: $ac_compile\"" >&AS_MESSAGE_LOG_FD)
+  (eval echo "\"\$as_me:$LINENO: $ac_compile\"" >&AS_MESSAGE_LOG_FD)
   (eval "$ac_compile" 2>conftest.err)
   cat conftest.err >&AS_MESSAGE_LOG_FD
-  (eval echo "\"\$as_me:__oline__: $NM \\\"conftest.$ac_objext\\\"\"" >&AS_MESSAGE_LOG_FD)
+  (eval echo "\"\$as_me:$LINENO: $NM \\\"conftest.$ac_objext\\\"\"" >&AS_MESSAGE_LOG_FD)
   (eval "$NM \"conftest.$ac_objext\"" 2>conftest.err > conftest.out)
   cat conftest.err >&AS_MESSAGE_LOG_FD
-  (eval echo "\"\$as_me:__oline__: output\"" >&AS_MESSAGE_LOG_FD)
+  (eval echo "\"\$as_me:$LINENO: output\"" >&AS_MESSAGE_LOG_FD)
   cat conftest.out >&AS_MESSAGE_LOG_FD
   if $GREP 'External.*some_variable' conftest.out > /dev/null; then
     lt_cv_nm_interface="MS dumpbin"
@@ -3251,15 +3496,76 @@ dnl aclocal-1.4 backwards compatibility:
 dnl AC_DEFUN([AM_PROG_NM], [])
 dnl AC_DEFUN([AC_PROG_NM], [])
 
+# _LT_CHECK_SHAREDLIB_FROM_LINKLIB
+# --------------------------------
+# how to determine the name of the shared library
+# associated with a specific link library.
+#  -- PORTME fill in with the dynamic library characteristics
+m4_defun([_LT_CHECK_SHAREDLIB_FROM_LINKLIB],
+[m4_require([_LT_DECL_EGREP])
+m4_require([_LT_DECL_OBJDUMP])
+m4_require([_LT_DECL_DLLTOOL])
+AC_CACHE_CHECK([how to associate runtime and link libraries],
+lt_cv_sharedlib_from_linklib_cmd,
+[lt_cv_sharedlib_from_linklib_cmd='unknown'
 
-# LT_LIB_M
-# --------
-# check for math library
+case $host_os in
+cygwin* | mingw* | pw32* | cegcc*)
+  # two different shell functions defined in ltmain.sh
+  # decide which to use based on capabilities of $DLLTOOL
+  case `$DLLTOOL --help 2>&1` in
+  *--identify-strict*)
+    lt_cv_sharedlib_from_linklib_cmd=func_cygming_dll_for_implib
+    ;;
+  *)
+    lt_cv_sharedlib_from_linklib_cmd=func_cygming_dll_for_implib_fallback
+    ;;
+  esac
+  ;;
+*)
+  # fallback: assume linklib IS sharedlib
+  lt_cv_sharedlib_from_linklib_cmd="$ECHO"
+  ;;
+esac
+])
+sharedlib_from_linklib_cmd=$lt_cv_sharedlib_from_linklib_cmd
+test -z "$sharedlib_from_linklib_cmd" && sharedlib_from_linklib_cmd=$ECHO
+
+_LT_DECL([], [sharedlib_from_linklib_cmd], [1],
+    [Command to associate shared and link libraries])
+])# _LT_CHECK_SHAREDLIB_FROM_LINKLIB
+
+
+# _LT_PATH_MANIFEST_TOOL
+# ----------------------
+# locate the manifest tool
+m4_defun([_LT_PATH_MANIFEST_TOOL],
+[AC_CHECK_TOOL(MANIFEST_TOOL, mt, :)
+test -z "$MANIFEST_TOOL" && MANIFEST_TOOL=mt
+AC_CACHE_CHECK([if $MANIFEST_TOOL is a manifest tool], [lt_cv_path_mainfest_tool],
+  [lt_cv_path_mainfest_tool=no
+  echo "$as_me:$LINENO: $MANIFEST_TOOL '-?'" >&AS_MESSAGE_LOG_FD
+  $MANIFEST_TOOL '-?' 2>conftest.err > conftest.out
+  cat conftest.err >&AS_MESSAGE_LOG_FD
+  if $GREP 'Manifest Tool' conftest.out > /dev/null; then
+    lt_cv_path_mainfest_tool=yes
+  fi
+  rm -f conftest*])
+if test "x$lt_cv_path_mainfest_tool" != xyes; then
+  MANIFEST_TOOL=:
+fi
+_LT_DECL([], [MANIFEST_TOOL], [1], [Manifest tool])dnl
+])# _LT_PATH_MANIFEST_TOOL
+
+
+# LT_LIB_M
+# --------
+# check for math library
 AC_DEFUN([LT_LIB_M],
 [AC_REQUIRE([AC_CANONICAL_HOST])dnl
 LIBM=
 case $host in
-*-*-beos* | *-*-cygwin* | *-*-pw32* | *-*-darwin*)
+*-*-beos* | *-*-cegcc* | *-*-cygwin* | *-*-haiku* | *-*-pw32* | *-*-darwin*)
   # These system don't have libm, or don't need it
   ;;
 *-ncr-sysv4.3*)
@@ -3287,7 +3593,12 @@ m4_defun([_LT_COMPILER_NO_RTTI],
 _LT_TAGVAR(lt_prog_compiler_no_builtin_flag, $1)=
 
 if test "$GCC" = yes; then
-  _LT_TAGVAR(lt_prog_compiler_no_builtin_flag, $1)=' -fno-builtin'
+  case $cc_basename in
+  nvcc*)
+    _LT_TAGVAR(lt_prog_compiler_no_builtin_flag, $1)=' -Xcompiler -fno-builtin' ;;
+  *)
+    _LT_TAGVAR(lt_prog_compiler_no_builtin_flag, $1)=' -fno-builtin' ;;
+  esac
 
   _LT_COMPILER_OPTION([if $compiler supports -fno-rtti -fno-exceptions],
     lt_cv_prog_compiler_rtti_exceptions,
@@ -3304,6 +3615,7 @@ _LT_TAGDECL([no_builtin_flag], [lt_prog_compiler_no_builtin_flag], [1],
 m4_defun([_LT_CMD_GLOBAL_SYMBOLS],
 [AC_REQUIRE([AC_CANONICAL_HOST])dnl
 AC_REQUIRE([AC_PROG_CC])dnl
+AC_REQUIRE([AC_PROG_AWK])dnl
 AC_REQUIRE([LT_PATH_NM])dnl
 AC_REQUIRE([LT_PATH_LD])dnl
 m4_require([_LT_DECL_SED])dnl
@@ -3371,8 +3683,8 @@ esac
 lt_cv_sys_global_symbol_to_cdecl="sed -n -e 's/^T .* \(.*\)$/extern int \1();/p' -e 's/^$symcode* .* \(.*\)$/extern char \1;/p'"
 
 # Transform an extracted symbol line into symbol name and symbol address
-lt_cv_sys_global_symbol_to_c_name_address="sed -n -e 's/^: \([[^ ]]*\) $/  {\\\"\1\\\", (void *) 0},/p' -e 's/^$symcode* \([[^ ]]*\) \([[^ ]]*\)$/  {\"\2\", (void *) \&\2},/p'"
-lt_cv_sys_global_symbol_to_c_name_address_lib_prefix="sed -n -e 's/^: \([[^ ]]*\) $/  {\\\"\1\\\", (void *) 0},/p' -e 's/^$symcode* \([[^ ]]*\) \(lib[[^ ]]*\)$/  {\"\2\", (void *) \&\2},/p' -e 's/^$symcode* \([[^ ]]*\) \([[^ ]]*\)$/  {\"lib\2\", (void *) \&\2},/p'"
+lt_cv_sys_global_symbol_to_c_name_address="sed -n -e 's/^: \([[^ ]]*\)[[ ]]*$/  {\\\"\1\\\", (void *) 0},/p' -e 's/^$symcode* \([[^ ]]*\) \([[^ ]]*\)$/  {\"\2\", (void *) \&\2},/p'"
+lt_cv_sys_global_symbol_to_c_name_address_lib_prefix="sed -n -e 's/^: \([[^ ]]*\)[[ ]]*$/  {\\\"\1\\\", (void *) 0},/p' -e 's/^$symcode* \([[^ ]]*\) \(lib[[^ ]]*\)$/  {\"\2\", (void *) \&\2},/p' -e 's/^$symcode* \([[^ ]]*\) \([[^ ]]*\)$/  {\"lib\2\", (void *) \&\2},/p'"
 
 # Handle CRLF in mingw tool chain
 opt_cr=
@@ -3396,6 +3708,7 @@ for ac_symprfx in "" "_"; do
     # which start with @ or ?.
     lt_cv_sys_global_symbol_pipe="$AWK ['"\
 "     {last_section=section; section=\$ 3};"\
+"     /^COFF SYMBOL TABLE/{for(i in hide) delete hide[i]};"\
 "     /Section length .*#relocs.*(pick any)/{hide[last_section]=1};"\
 "     \$ 0!~/External *\|/{next};"\
 "     / 0+ UNDEF /{next}; / UNDEF \([^|]\)*()/{next};"\
@@ -3408,6 +3721,7 @@ for ac_symprfx in "" "_"; do
   else
     lt_cv_sys_global_symbol_pipe="sed -n -e 's/^.*[[	 ]]\($symcode$symcode*\)[[	 ]][[	 ]]*$ac_symprfx$sympat$opt_cr$/$symxfrm/p'"
   fi
+  lt_cv_sys_global_symbol_pipe="$lt_cv_sys_global_symbol_pipe | sed '/ __gnu_lto/d'"
 
   # Check to see that the pipe works correctly.
   pipe_works=no
@@ -3429,7 +3743,7 @@ _LT_EOF
   if AC_TRY_EVAL(ac_compile); then
     # Now try to grab the symbols.
     nlist=conftest.nm
-    if AC_TRY_EVAL(NM conftest.$ac_objext \| $lt_cv_sys_global_symbol_pipe \> $nlist) && test -s "$nlist"; then
+    if AC_TRY_EVAL(NM conftest.$ac_objext \| "$lt_cv_sys_global_symbol_pipe" \> $nlist) && test -s "$nlist"; then
       # Try sorting and uniquifying the output.
       if sort "$nlist" | uniq > "$nlist"T; then
 	mv -f "$nlist"T "$nlist"
@@ -3441,6 +3755,18 @@ _LT_EOF
       if $GREP ' nm_test_var$' "$nlist" >/dev/null; then
 	if $GREP ' nm_test_func$' "$nlist" >/dev/null; then
 	  cat <<_LT_EOF > conftest.$ac_ext
+/* Keep this code in sync between libtool.m4, ltmain, lt_system.h, and tests.  */
+#if defined(_WIN32) || defined(__CYGWIN__) || defined(_WIN32_WCE)
+/* DATA imports from DLLs on WIN32 con't be const, because runtime
+   relocations are performed -- see ld's documentation on pseudo-relocs.  */
+# define LT@&t at _DLSYM_CONST
+#elif defined(__osf__)
+/* This system does not cope well with relocations in const data.  */
+# define LT@&t at _DLSYM_CONST
+#else
+# define LT@&t at _DLSYM_CONST const
+#endif
+
 #ifdef __cplusplus
 extern "C" {
 #endif
@@ -3452,7 +3778,7 @@ _LT_EOF
 	  cat <<_LT_EOF >> conftest.$ac_ext
 
 /* The mapping between symbol names and symbols.  */
-const struct {
+LT@&t at _DLSYM_CONST struct {
   const char *name;
   void       *address;
 }
@@ -3478,15 +3804,15 @@ static const void *lt_preloaded_setup() {
 _LT_EOF
 	  # Now try linking the two files.
 	  mv conftest.$ac_objext conftstm.$ac_objext
-	  lt_save_LIBS="$LIBS"
-	  lt_save_CFLAGS="$CFLAGS"
+	  lt_globsym_save_LIBS=$LIBS
+	  lt_globsym_save_CFLAGS=$CFLAGS
 	  LIBS="conftstm.$ac_objext"
 	  CFLAGS="$CFLAGS$_LT_TAGVAR(lt_prog_compiler_no_builtin_flag, $1)"
 	  if AC_TRY_EVAL(ac_link) && test -s conftest${ac_exeext}; then
 	    pipe_works=yes
 	  fi
-	  LIBS="$lt_save_LIBS"
-	  CFLAGS="$lt_save_CFLAGS"
+	  LIBS=$lt_globsym_save_LIBS
+	  CFLAGS=$lt_globsym_save_CFLAGS
 	else
 	  echo "cannot find nm_test_func in $nlist" >&AS_MESSAGE_LOG_FD
 	fi
@@ -3519,6 +3845,13 @@ else
   AC_MSG_RESULT(ok)
 fi
 
+# Response file support.
+if test "$lt_cv_nm_interface" = "MS dumpbin"; then
+  nm_file_list_spec='@'
+elif $NM --help 2>/dev/null | grep '[[@]]FILE' >/dev/null; then
+  nm_file_list_spec='@'
+fi
+
 _LT_DECL([global_symbol_pipe], [lt_cv_sys_global_symbol_pipe], [1],
     [Take the output of nm and produce a listing of raw symbols and C names])
 _LT_DECL([global_symbol_to_cdecl], [lt_cv_sys_global_symbol_to_cdecl], [1],
@@ -3529,6 +3862,8 @@ _LT_DECL([global_symbol_to_c_name_address],
 _LT_DECL([global_symbol_to_c_name_address_lib_prefix],
     [lt_cv_sys_global_symbol_to_c_name_address_lib_prefix], [1],
     [Transform the output of nm in a C name address pair when lib prefix is needed])
+_LT_DECL([], [nm_file_list_spec], [1],
+    [Specify filename containing input files for $NM])
 ]) # _LT_CMD_GLOBAL_SYMBOLS
 
 
@@ -3540,7 +3875,6 @@ _LT_TAGVAR(lt_prog_compiler_wl, $1)=
 _LT_TAGVAR(lt_prog_compiler_pic, $1)=
 _LT_TAGVAR(lt_prog_compiler_static, $1)=
 
-AC_MSG_CHECKING([for $compiler option to produce PIC])
 m4_if([$1], [CXX], [
   # C++ specific cases for pic, static, wl, etc.
   if test "$GXX" = yes; then
@@ -3591,6 +3925,11 @@ m4_if([$1], [CXX], [
       # DJGPP does not support shared libraries at all
       _LT_TAGVAR(lt_prog_compiler_pic, $1)=
       ;;
+    haiku*)
+      # PIC is the default for Haiku.
+      # The "-static" flag exists, but is broken.
+      _LT_TAGVAR(lt_prog_compiler_static, $1)=
+      ;;
     interix[[3-9]]*)
       # Interix 3.x gcc -fpic/-fPIC options generate broken code.
       # Instead, we relocate shared libraries at runtime.
@@ -3640,6 +3979,12 @@ m4_if([$1], [CXX], [
 	  ;;
 	esac
 	;;
+      mingw* | cygwin* | os2* | pw32* | cegcc*)
+	# This hack is so that the source file can tell whether it is being
+	# built for inclusion in a dll (and should export symbols for example).
+	m4_if([$1], [GCJ], [],
+	  [_LT_TAGVAR(lt_prog_compiler_pic, $1)='-DDLL_EXPORT'])
+	;;
       dgux*)
 	case $cc_basename in
 	  ec++*)
@@ -3696,7 +4041,7 @@ m4_if([$1], [CXX], [
 	    ;;
 	esac
 	;;
-      linux* | k*bsd*-gnu)
+      linux* | k*bsd*-gnu | kopensolaris*-gnu)
 	case $cc_basename in
 	  KCC*)
 	    # KAI C++ Compiler
@@ -3729,8 +4074,8 @@ m4_if([$1], [CXX], [
 	    _LT_TAGVAR(lt_prog_compiler_pic, $1)=
 	    _LT_TAGVAR(lt_prog_compiler_static, $1)='-non_shared'
 	    ;;
-	  xlc* | xlC*)
-	    # IBM XL 8.0 on PPC
+	  xlc* | xlC* | bgxl[[cC]]* | mpixl[[cC]]*)
+	    # IBM XL 8.0, 9.0 on PPC and BlueGene
 	    _LT_TAGVAR(lt_prog_compiler_wl, $1)='-Wl,'
 	    _LT_TAGVAR(lt_prog_compiler_pic, $1)='-qpic'
 	    _LT_TAGVAR(lt_prog_compiler_static, $1)='-qstaticlink'
@@ -3792,7 +4137,7 @@ m4_if([$1], [CXX], [
 	;;
       solaris*)
 	case $cc_basename in
-	  CC*)
+	  CC* | sunCC*)
 	    # Sun C++ 4.2, 5.x and Centerline C++
 	    _LT_TAGVAR(lt_prog_compiler_pic, $1)='-KPIC'
 	    _LT_TAGVAR(lt_prog_compiler_static, $1)='-Bstatic'
@@ -3896,6 +4241,12 @@ m4_if([$1], [CXX], [
       _LT_TAGVAR(lt_prog_compiler_pic, $1)='-fno-common'
       ;;
 
+    haiku*)
+      # PIC is the default for Haiku.
+      # The "-static" flag exists, but is broken.
+      _LT_TAGVAR(lt_prog_compiler_static, $1)=
+      ;;
+
     hpux*)
       # PIC is the default for 64-bit PA HP-UX, but not for 32-bit
       # PA HP-UX.  On IA64 HP-UX, PIC is the default but the pic flag
@@ -3938,6 +4289,15 @@ m4_if([$1], [CXX], [
       _LT_TAGVAR(lt_prog_compiler_pic, $1)='-fPIC'
       ;;
     esac
+
+    case $cc_basename in
+    nvcc*) # Cuda Compiler Driver 2.2
+      _LT_TAGVAR(lt_prog_compiler_wl, $1)='-Xlinker '
+      if test -n "$_LT_TAGVAR(lt_prog_compiler_pic, $1)"; then
+        _LT_TAGVAR(lt_prog_compiler_pic, $1)="-Xcompiler $_LT_TAGVAR(lt_prog_compiler_pic, $1)"
+      fi
+      ;;
+    esac
   else
     # PORTME Check for flag to pass linker flags through the system compiler.
     case $host_os in
@@ -3980,7 +4340,7 @@ m4_if([$1], [CXX], [
       _LT_TAGVAR(lt_prog_compiler_static, $1)='-non_shared'
       ;;
 
-    linux* | k*bsd*-gnu)
+    linux* | k*bsd*-gnu | kopensolaris*-gnu)
       case $cc_basename in
       # old Intel for x86_64 which still supported -KPIC.
       ecc*)
@@ -4001,7 +4361,13 @@ m4_if([$1], [CXX], [
 	_LT_TAGVAR(lt_prog_compiler_pic, $1)='--shared'
 	_LT_TAGVAR(lt_prog_compiler_static, $1)='--static'
 	;;
-      pgcc* | pgf77* | pgf90* | pgf95*)
+      nagfor*)
+	# NAG Fortran compiler
+	_LT_TAGVAR(lt_prog_compiler_wl, $1)='-Wl,-Wl,,'
+	_LT_TAGVAR(lt_prog_compiler_pic, $1)='-PIC'
+	_LT_TAGVAR(lt_prog_compiler_static, $1)='-Bstatic'
+	;;
+      pgcc* | pgf77* | pgf90* | pgf95* | pgfortran*)
         # Portland Group compilers (*not* the Pentium gcc compiler,
 	# which looks to be a dead project)
 	_LT_TAGVAR(lt_prog_compiler_wl, $1)='-Wl,'
@@ -4013,25 +4379,40 @@ m4_if([$1], [CXX], [
         # All Alpha code is PIC.
         _LT_TAGVAR(lt_prog_compiler_static, $1)='-non_shared'
         ;;
-      xl*)
-	# IBM XL C 8.0/Fortran 10.1 on PPC
+      xl* | bgxl* | bgf* | mpixl*)
+	# IBM XL C 8.0/Fortran 10.1, 11.1 on PPC and BlueGene
 	_LT_TAGVAR(lt_prog_compiler_wl, $1)='-Wl,'
 	_LT_TAGVAR(lt_prog_compiler_pic, $1)='-qpic'
 	_LT_TAGVAR(lt_prog_compiler_static, $1)='-qstaticlink'
 	;;
       *)
 	case `$CC -V 2>&1 | sed 5q` in
+	*Sun\ Ceres\ Fortran* | *Sun*Fortran*\ [[1-7]].* | *Sun*Fortran*\ 8.[[0-3]]*)
+	  # Sun Fortran 8.3 passes all unrecognized flags to the linker
+	  _LT_TAGVAR(lt_prog_compiler_pic, $1)='-KPIC'
+	  _LT_TAGVAR(lt_prog_compiler_static, $1)='-Bstatic'
+	  _LT_TAGVAR(lt_prog_compiler_wl, $1)=''
+	  ;;
+	*Sun\ F* | *Sun*Fortran*)
+	  _LT_TAGVAR(lt_prog_compiler_pic, $1)='-KPIC'
+	  _LT_TAGVAR(lt_prog_compiler_static, $1)='-Bstatic'
+	  _LT_TAGVAR(lt_prog_compiler_wl, $1)='-Qoption ld '
+	  ;;
 	*Sun\ C*)
 	  # Sun C 5.9
 	  _LT_TAGVAR(lt_prog_compiler_pic, $1)='-KPIC'
 	  _LT_TAGVAR(lt_prog_compiler_static, $1)='-Bstatic'
 	  _LT_TAGVAR(lt_prog_compiler_wl, $1)='-Wl,'
 	  ;;
-	*Sun\ F*)
-	  # Sun Fortran 8.3 passes all unrecognized flags to the linker
-	  _LT_TAGVAR(lt_prog_compiler_pic, $1)='-KPIC'
+        *Intel*\ [[CF]]*Compiler*)
+	  _LT_TAGVAR(lt_prog_compiler_wl, $1)='-Wl,'
+	  _LT_TAGVAR(lt_prog_compiler_pic, $1)='-fPIC'
+	  _LT_TAGVAR(lt_prog_compiler_static, $1)='-static'
+	  ;;
+	*Portland\ Group*)
+	  _LT_TAGVAR(lt_prog_compiler_wl, $1)='-Wl,'
+	  _LT_TAGVAR(lt_prog_compiler_pic, $1)='-fpic'
 	  _LT_TAGVAR(lt_prog_compiler_static, $1)='-Bstatic'
-	  _LT_TAGVAR(lt_prog_compiler_wl, $1)=''
 	  ;;
 	esac
 	;;
@@ -4063,7 +4444,7 @@ m4_if([$1], [CXX], [
       _LT_TAGVAR(lt_prog_compiler_pic, $1)='-KPIC'
       _LT_TAGVAR(lt_prog_compiler_static, $1)='-Bstatic'
       case $cc_basename in
-      f77* | f90* | f95*)
+      f77* | f90* | f95* | sunf77* | sunf90* | sunf95*)
 	_LT_TAGVAR(lt_prog_compiler_wl, $1)='-Qoption ld ';;
       *)
 	_LT_TAGVAR(lt_prog_compiler_wl, $1)='-Wl,';;
@@ -4120,9 +4501,11 @@ case $host_os in
     _LT_TAGVAR(lt_prog_compiler_pic, $1)="$_LT_TAGVAR(lt_prog_compiler_pic, $1)@&t at m4_if([$1],[],[ -DPIC],[m4_if([$1],[CXX],[ -DPIC],[])])"
     ;;
 esac
-AC_MSG_RESULT([$_LT_TAGVAR(lt_prog_compiler_pic, $1)])
-_LT_TAGDECL([wl], [lt_prog_compiler_wl], [1],
-	[How to pass a linker flag through the compiler])
+
+AC_CACHE_CHECK([for $compiler option to produce PIC],
+  [_LT_TAGVAR(lt_cv_prog_compiler_pic, $1)],
+  [_LT_TAGVAR(lt_cv_prog_compiler_pic, $1)=$_LT_TAGVAR(lt_prog_compiler_pic, $1)])
+_LT_TAGVAR(lt_prog_compiler_pic, $1)=$_LT_TAGVAR(lt_cv_prog_compiler_pic, $1)
 
 #
 # Check to make sure the PIC flag actually works.
@@ -4141,6 +4524,8 @@ fi
 _LT_TAGDECL([pic_flag], [lt_prog_compiler_pic], [1],
 	[Additional compiler flags for building library objects])
 
+_LT_TAGDECL([wl], [lt_prog_compiler_wl], [1],
+	[How to pass a linker flag through the compiler])
 #
 # Check to make sure the static flag actually works.
 #
@@ -4161,6 +4546,7 @@ _LT_TAGDECL([link_static_flag], [lt_prog_compiler_static], [1],
 m4_defun([_LT_LINKER_SHLIBS],
 [AC_REQUIRE([LT_PATH_LD])dnl
 AC_REQUIRE([LT_PATH_NM])dnl
+m4_require([_LT_PATH_MANIFEST_TOOL])dnl
 m4_require([_LT_FILEUTILS_DEFAULTS])dnl
 m4_require([_LT_DECL_EGREP])dnl
 m4_require([_LT_DECL_SED])dnl
@@ -4169,27 +4555,37 @@ m4_require([_LT_TAG_COMPILER])dnl
 AC_MSG_CHECKING([whether the $compiler linker ($LD) supports shared libraries])
 m4_if([$1], [CXX], [
   _LT_TAGVAR(export_symbols_cmds, $1)='$NM $libobjs $convenience | $global_symbol_pipe | $SED '\''s/.* //'\'' | sort | uniq > $export_symbols'
+  _LT_TAGVAR(exclude_expsyms, $1)=['_GLOBAL_OFFSET_TABLE_|_GLOBAL__F[ID]_.*']
   case $host_os in
   aix[[4-9]]*)
     # If we're using GNU nm, then we don't want the "-C" option.
     # -C means demangle to AIX nm, but means don't demangle with GNU nm
+    # Also, AIX nm treats weak defined symbols like other global defined
+    # symbols, whereas GNU nm marks them as "W".
     if $NM -V 2>&1 | $GREP 'GNU' > /dev/null; then
-      _LT_TAGVAR(export_symbols_cmds, $1)='$NM -Bpg $libobjs $convenience | awk '\''{ if (((\$ 2 == "T") || (\$ 2 == "D") || (\$ 2 == "B")) && ([substr](\$ 3,1,1) != ".")) { print \$ 3 } }'\'' | sort -u > $export_symbols'
+      _LT_TAGVAR(export_symbols_cmds, $1)='$NM -Bpg $libobjs $convenience | awk '\''{ if (((\$ 2 == "T") || (\$ 2 == "D") || (\$ 2 == "B") || (\$ 2 == "W")) && ([substr](\$ 3,1,1) != ".")) { print \$ 3 } }'\'' | sort -u > $export_symbols'
     else
       _LT_TAGVAR(export_symbols_cmds, $1)='$NM -BCpg $libobjs $convenience | awk '\''{ if (((\$ 2 == "T") || (\$ 2 == "D") || (\$ 2 == "B")) && ([substr](\$ 3,1,1) != ".")) { print \$ 3 } }'\'' | sort -u > $export_symbols'
     fi
     ;;
   pw32*)
     _LT_TAGVAR(export_symbols_cmds, $1)="$ltdll_cmds"
-  ;;
+    ;;
   cygwin* | mingw* | cegcc*)
-    _LT_TAGVAR(export_symbols_cmds, $1)='$NM $libobjs $convenience | $global_symbol_pipe | $SED -e '\''/^[[BCDGRS]][[ ]]/s/.*[[ ]]\([[^ ]]*\)/\1 DATA/;/^.*[[ ]]__nm__/s/^.*[[ ]]__nm__\([[^ ]]*\)[[ ]][[^ ]]*/\1 DATA/;/^I[[ ]]/d;/^[[AITW]][[ ]]/s/.* //'\'' | sort | uniq > $export_symbols'
-  ;;
+    case $cc_basename in
+    cl*)
+      _LT_TAGVAR(exclude_expsyms, $1)='_NULL_IMPORT_DESCRIPTOR|_IMPORT_DESCRIPTOR_.*'
+      ;;
+    *)
+      _LT_TAGVAR(export_symbols_cmds, $1)='$NM $libobjs $convenience | $global_symbol_pipe | $SED -e '\''/^[[BCDGRS]][[ ]]/s/.*[[ ]]\([[^ ]]*\)/\1 DATA/;s/^.*[[ ]]__nm__\([[^ ]]*\)[[ ]][[^ ]]*/\1 DATA/;/^I[[ ]]/d;/^[[AITW]][[ ]]/s/.* //'\'' | sort | uniq > $export_symbols'
+      _LT_TAGVAR(exclude_expsyms, $1)=['[_]+GLOBAL_OFFSET_TABLE_|[_]+GLOBAL__[FID]_.*|[_]+head_[A-Za-z0-9_]+_dll|[A-Za-z0-9_]+_dll_iname']
+      ;;
+    esac
+    ;;
   *)
     _LT_TAGVAR(export_symbols_cmds, $1)='$NM $libobjs $convenience | $global_symbol_pipe | $SED '\''s/.* //'\'' | sort | uniq > $export_symbols'
-  ;;
+    ;;
   esac
-  _LT_TAGVAR(exclude_expsyms, $1)=['_GLOBAL_OFFSET_TABLE_|_GLOBAL__F[ID]_.*']
 ], [
   runpath_var=
   _LT_TAGVAR(allow_undefined_flag, $1)=
@@ -4204,7 +4600,6 @@ m4_if([$1], [CXX], [
   _LT_TAGVAR(hardcode_direct, $1)=no
   _LT_TAGVAR(hardcode_direct_absolute, $1)=no
   _LT_TAGVAR(hardcode_libdir_flag_spec, $1)=
-  _LT_TAGVAR(hardcode_libdir_flag_spec_ld, $1)=
   _LT_TAGVAR(hardcode_libdir_separator, $1)=
   _LT_TAGVAR(hardcode_minus_L, $1)=no
   _LT_TAGVAR(hardcode_shlibpath_var, $1)=unsupported
@@ -4252,7 +4647,33 @@ dnl Note also adjust exclude_expsyms for C++ above.
   esac
 
   _LT_TAGVAR(ld_shlibs, $1)=yes
+
+  # On some targets, GNU ld is compatible enough with the native linker
+  # that we're better off using the native interface for both.
+  lt_use_gnu_ld_interface=no
   if test "$with_gnu_ld" = yes; then
+    case $host_os in
+      aix*)
+	# The AIX port of GNU ld has always aspired to compatibility
+	# with the native linker.  However, as the warning in the GNU ld
+	# block says, versions before 2.19.5* couldn't really create working
+	# shared libraries, regardless of the interface used.
+	case `$LD -v 2>&1` in
+	  *\ \(GNU\ Binutils\)\ 2.19.5*) ;;
+	  *\ \(GNU\ Binutils\)\ 2.[[2-9]]*) ;;
+	  *\ \(GNU\ Binutils\)\ [[3-9]]*) ;;
+	  *)
+	    lt_use_gnu_ld_interface=yes
+	    ;;
+	esac
+	;;
+      *)
+	lt_use_gnu_ld_interface=yes
+	;;
+    esac
+  fi
+
+  if test "$lt_use_gnu_ld_interface" = yes; then
     # If archive_cmds runs LD, not CC, wlarc should be empty
     wlarc='${wl}'
 
@@ -4270,6 +4691,7 @@ dnl Note also adjust exclude_expsyms for C++ above.
     fi
     supports_anon_versioning=no
     case `$LD -v 2>&1` in
+      *GNU\ gold*) supports_anon_versioning=yes ;;
       *\ [[01]].* | *\ 2.[[0-9]].* | *\ 2.10.*) ;; # catch versions < 2.11
       *\ 2.11.93.0.2\ *) supports_anon_versioning=yes ;; # RH7.3 ...
       *\ 2.11.92.0.12\ *) supports_anon_versioning=yes ;; # Mandrake 8.2 ...
@@ -4285,11 +4707,12 @@ dnl Note also adjust exclude_expsyms for C++ above.
 	_LT_TAGVAR(ld_shlibs, $1)=no
 	cat <<_LT_EOF 1>&2
 
-*** Warning: the GNU linker, at least up to release 2.9.1, is reported
+*** Warning: the GNU linker, at least up to release 2.19, is reported
 *** to be unable to reliably create shared libraries on AIX.
 *** Therefore, libtool is disabling shared libraries support.  If you
-*** really care for shared libraries, you may want to modify your PATH
-*** so that a non-GNU linker is found, and then restart.
+*** really care for shared libraries, you may want to install binutils
+*** 2.20 or above, or modify your PATH so that a non-GNU linker is found.
+*** You will then need to restart the configuration process.
 
 _LT_EOF
       fi
@@ -4325,10 +4748,12 @@ _LT_EOF
       # _LT_TAGVAR(hardcode_libdir_flag_spec, $1) is actually meaningless,
       # as there is no search path for DLLs.
       _LT_TAGVAR(hardcode_libdir_flag_spec, $1)='-L$libdir'
+      _LT_TAGVAR(export_dynamic_flag_spec, $1)='${wl}--export-all-symbols'
       _LT_TAGVAR(allow_undefined_flag, $1)=unsupported
       _LT_TAGVAR(always_export_symbols, $1)=no
       _LT_TAGVAR(enable_shared_with_static_runtimes, $1)=yes
-      _LT_TAGVAR(export_symbols_cmds, $1)='$NM $libobjs $convenience | $global_symbol_pipe | $SED -e '\''/^[[BCDGRS]][[ ]]/s/.*[[ ]]\([[^ ]]*\)/\1 DATA/'\'' | $SED -e '\''/^[[AITW]][[ ]]/s/.*[[ ]]//'\'' | sort | uniq > $export_symbols'
+      _LT_TAGVAR(export_symbols_cmds, $1)='$NM $libobjs $convenience | $global_symbol_pipe | $SED -e '\''/^[[BCDGRS]][[ ]]/s/.*[[ ]]\([[^ ]]*\)/\1 DATA/;s/^.*[[ ]]__nm__\([[^ ]]*\)[[ ]][[^ ]]*/\1 DATA/;/^I[[ ]]/d;/^[[AITW]][[ ]]/s/.* //'\'' | sort | uniq > $export_symbols'
+      _LT_TAGVAR(exclude_expsyms, $1)=['[_]+GLOBAL_OFFSET_TABLE_|[_]+GLOBAL__[FID]_.*|[_]+head_[A-Za-z0-9_]+_dll|[A-Za-z0-9_]+_dll_iname']
 
       if $LD --help 2>&1 | $GREP 'auto-import' > /dev/null; then
         _LT_TAGVAR(archive_cmds, $1)='$CC -shared $libobjs $deplibs $compiler_flags -o $output_objdir/$soname ${wl}--enable-auto-image-base -Xlinker --out-implib -Xlinker $lib'
@@ -4346,6 +4771,11 @@ _LT_EOF
       fi
       ;;
 
+    haiku*)
+      _LT_TAGVAR(archive_cmds, $1)='$CC -shared $libobjs $deplibs $compiler_flags ${wl}-soname $wl$soname -o $lib'
+      _LT_TAGVAR(link_all_deplibs, $1)=yes
+      ;;
+
     interix[[3-9]]*)
       _LT_TAGVAR(hardcode_direct, $1)=no
       _LT_TAGVAR(hardcode_shlibpath_var, $1)=no
@@ -4361,7 +4791,7 @@ _LT_EOF
       _LT_TAGVAR(archive_expsym_cmds, $1)='sed "s,^,_," $export_symbols >$output_objdir/$soname.expsym~$CC -shared $pic_flag $libobjs $deplibs $compiler_flags ${wl}-h,$soname ${wl}--retain-symbols-file,$output_objdir/$soname.expsym ${wl}--image-base,`expr ${RANDOM-$$} % 4096 / 2 \* 262144 + 1342177280` -o $lib'
       ;;
 
-    gnu* | linux* | tpf* | k*bsd*-gnu)
+    gnu* | linux* | tpf* | k*bsd*-gnu | kopensolaris*-gnu)
       tmp_diet=no
       if test "$host_os" = linux-dietlibc; then
 	case $cc_basename in
@@ -4371,15 +4801,16 @@ _LT_EOF
       if $LD --help 2>&1 | $EGREP ': supported targets:.* elf' > /dev/null \
 	 && test "$tmp_diet" = no
       then
-	tmp_addflag=
+	tmp_addflag=' $pic_flag'
 	tmp_sharedflag='-shared'
 	case $cc_basename,$host_cpu in
         pgcc*)				# Portland Group C compiler
-	  _LT_TAGVAR(whole_archive_flag_spec, $1)='${wl}--whole-archive`for conv in $convenience\"\"; do test  -n \"$conv\" && new_convenience=\"$new_convenience,$conv\"; done; $ECHO \"$new_convenience\"` ${wl}--no-whole-archive'
+	  _LT_TAGVAR(whole_archive_flag_spec, $1)='${wl}--whole-archive`for conv in $convenience\"\"; do test  -n \"$conv\" && new_convenience=\"$new_convenience,$conv\"; done; func_echo_all \"$new_convenience\"` ${wl}--no-whole-archive'
 	  tmp_addflag=' $pic_flag'
 	  ;;
-	pgf77* | pgf90* | pgf95*)	# Portland Group f77 and f90 compilers
-	  _LT_TAGVAR(whole_archive_flag_spec, $1)='${wl}--whole-archive`for conv in $convenience\"\"; do test  -n \"$conv\" && new_convenience=\"$new_convenience,$conv\"; done; $ECHO \"$new_convenience\"` ${wl}--no-whole-archive'
+	pgf77* | pgf90* | pgf95* | pgfortran*)
+					# Portland Group f77 and f90 compilers
+	  _LT_TAGVAR(whole_archive_flag_spec, $1)='${wl}--whole-archive`for conv in $convenience\"\"; do test  -n \"$conv\" && new_convenience=\"$new_convenience,$conv\"; done; func_echo_all \"$new_convenience\"` ${wl}--no-whole-archive'
 	  tmp_addflag=' $pic_flag -Mnomain' ;;
 	ecc*,ia64* | icc*,ia64*)	# Intel C compiler on ia64
 	  tmp_addflag=' -i_dynamic' ;;
@@ -4390,13 +4821,17 @@ _LT_EOF
 	lf95*)				# Lahey Fortran 8.1
 	  _LT_TAGVAR(whole_archive_flag_spec, $1)=
 	  tmp_sharedflag='--shared' ;;
-	xl[[cC]]*)			# IBM XL C 8.0 on PPC (deal with xlf below)
+	xl[[cC]]* | bgxl[[cC]]* | mpixl[[cC]]*) # IBM XL C 8.0 on PPC (deal with xlf below)
 	  tmp_sharedflag='-qmkshrobj'
 	  tmp_addflag= ;;
+	nvcc*)	# Cuda Compiler Driver 2.2
+	  _LT_TAGVAR(whole_archive_flag_spec, $1)='${wl}--whole-archive`for conv in $convenience\"\"; do test  -n \"$conv\" && new_convenience=\"$new_convenience,$conv\"; done; func_echo_all \"$new_convenience\"` ${wl}--no-whole-archive'
+	  _LT_TAGVAR(compiler_needs_object, $1)=yes
+	  ;;
 	esac
 	case `$CC -V 2>&1 | sed 5q` in
 	*Sun\ C*)			# Sun C 5.9
-	  _LT_TAGVAR(whole_archive_flag_spec, $1)='${wl}--whole-archive`new_convenience=; for conv in $convenience\"\"; do test -z \"$conv\" || new_convenience=\"$new_convenience,$conv\"; done; $ECHO \"$new_convenience\"` ${wl}--no-whole-archive'
+	  _LT_TAGVAR(whole_archive_flag_spec, $1)='${wl}--whole-archive`new_convenience=; for conv in $convenience\"\"; do test -z \"$conv\" || new_convenience=\"$new_convenience,$conv\"; done; func_echo_all \"$new_convenience\"` ${wl}--no-whole-archive'
 	  _LT_TAGVAR(compiler_needs_object, $1)=yes
 	  tmp_sharedflag='-G' ;;
 	*Sun\ F*)			# Sun Fortran 8.3
@@ -4412,17 +4847,16 @@ _LT_EOF
         fi
 
 	case $cc_basename in
-	xlf*)
+	xlf* | bgf* | bgxlf* | mpixlf*)
 	  # IBM XL Fortran 10.1 on PPC cannot create shared libs itself
 	  _LT_TAGVAR(whole_archive_flag_spec, $1)='--whole-archive$convenience --no-whole-archive'
-	  _LT_TAGVAR(hardcode_libdir_flag_spec, $1)=
-	  _LT_TAGVAR(hardcode_libdir_flag_spec_ld, $1)='-rpath $libdir'
-	  _LT_TAGVAR(archive_cmds, $1)='$LD -shared $libobjs $deplibs $compiler_flags -soname $soname -o $lib'
+	  _LT_TAGVAR(hardcode_libdir_flag_spec, $1)='${wl}-rpath ${wl}$libdir'
+	  _LT_TAGVAR(archive_cmds, $1)='$LD -shared $libobjs $deplibs $linker_flags -soname $soname -o $lib'
 	  if test "x$supports_anon_versioning" = xyes; then
 	    _LT_TAGVAR(archive_expsym_cmds, $1)='echo "{ global:" > $output_objdir/$libname.ver~
 	      cat $export_symbols | sed -e "s/\(.*\)/\1;/" >> $output_objdir/$libname.ver~
 	      echo "local: *; };" >> $output_objdir/$libname.ver~
-	      $LD -shared $libobjs $deplibs $compiler_flags -soname $soname -version-script $output_objdir/$libname.ver -o $lib'
+	      $LD -shared $libobjs $deplibs $linker_flags -soname $soname -version-script $output_objdir/$libname.ver -o $lib'
 	  fi
 	  ;;
 	esac
@@ -4436,8 +4870,8 @@ _LT_EOF
 	_LT_TAGVAR(archive_cmds, $1)='$LD -Bshareable $libobjs $deplibs $linker_flags -o $lib'
 	wlarc=
       else
-	_LT_TAGVAR(archive_cmds, $1)='$CC -shared $libobjs $deplibs $compiler_flags ${wl}-soname $wl$soname -o $lib'
-	_LT_TAGVAR(archive_expsym_cmds, $1)='$CC -shared $libobjs $deplibs $compiler_flags ${wl}-soname $wl$soname ${wl}-retain-symbols-file $wl$export_symbols -o $lib'
+	_LT_TAGVAR(archive_cmds, $1)='$CC -shared $pic_flag $libobjs $deplibs $compiler_flags ${wl}-soname $wl$soname -o $lib'
+	_LT_TAGVAR(archive_expsym_cmds, $1)='$CC -shared $pic_flag $libobjs $deplibs $compiler_flags ${wl}-soname $wl$soname ${wl}-retain-symbols-file $wl$export_symbols -o $lib'
       fi
       ;;
 
@@ -4455,8 +4889,8 @@ _LT_EOF
 
 _LT_EOF
       elif $LD --help 2>&1 | $GREP ': supported targets:.* elf' > /dev/null; then
-	_LT_TAGVAR(archive_cmds, $1)='$CC -shared $libobjs $deplibs $compiler_flags ${wl}-soname $wl$soname -o $lib'
-	_LT_TAGVAR(archive_expsym_cmds, $1)='$CC -shared $libobjs $deplibs $compiler_flags ${wl}-soname $wl$soname ${wl}-retain-symbols-file $wl$export_symbols -o $lib'
+	_LT_TAGVAR(archive_cmds, $1)='$CC -shared $pic_flag $libobjs $deplibs $compiler_flags ${wl}-soname $wl$soname -o $lib'
+	_LT_TAGVAR(archive_expsym_cmds, $1)='$CC -shared $pic_flag $libobjs $deplibs $compiler_flags ${wl}-soname $wl$soname ${wl}-retain-symbols-file $wl$export_symbols -o $lib'
       else
 	_LT_TAGVAR(ld_shlibs, $1)=no
       fi
@@ -4502,8 +4936,8 @@ _LT_EOF
 
     *)
       if $LD --help 2>&1 | $GREP ': supported targets:.* elf' > /dev/null; then
-	_LT_TAGVAR(archive_cmds, $1)='$CC -shared $libobjs $deplibs $compiler_flags ${wl}-soname $wl$soname -o $lib'
-	_LT_TAGVAR(archive_expsym_cmds, $1)='$CC -shared $libobjs $deplibs $compiler_flags ${wl}-soname $wl$soname ${wl}-retain-symbols-file $wl$export_symbols -o $lib'
+	_LT_TAGVAR(archive_cmds, $1)='$CC -shared $pic_flag $libobjs $deplibs $compiler_flags ${wl}-soname $wl$soname -o $lib'
+	_LT_TAGVAR(archive_expsym_cmds, $1)='$CC -shared $pic_flag $libobjs $deplibs $compiler_flags ${wl}-soname $wl$soname ${wl}-retain-symbols-file $wl$export_symbols -o $lib'
       else
 	_LT_TAGVAR(ld_shlibs, $1)=no
       fi
@@ -4543,8 +4977,10 @@ _LT_EOF
       else
 	# If we're using GNU nm, then we don't want the "-C" option.
 	# -C means demangle to AIX nm, but means don't demangle with GNU nm
+	# Also, AIX nm treats weak defined symbols like other global
+	# defined symbols, whereas GNU nm marks them as "W".
 	if $NM -V 2>&1 | $GREP 'GNU' > /dev/null; then
-	  _LT_TAGVAR(export_symbols_cmds, $1)='$NM -Bpg $libobjs $convenience | awk '\''{ if (((\$ 2 == "T") || (\$ 2 == "D") || (\$ 2 == "B")) && ([substr](\$ 3,1,1) != ".")) { print \$ 3 } }'\'' | sort -u > $export_symbols'
+	  _LT_TAGVAR(export_symbols_cmds, $1)='$NM -Bpg $libobjs $convenience | awk '\''{ if (((\$ 2 == "T") || (\$ 2 == "D") || (\$ 2 == "B") || (\$ 2 == "W")) && ([substr](\$ 3,1,1) != ".")) { print \$ 3 } }'\'' | sort -u > $export_symbols'
 	else
 	  _LT_TAGVAR(export_symbols_cmds, $1)='$NM -BCpg $libobjs $convenience | awk '\''{ if (((\$ 2 == "T") || (\$ 2 == "D") || (\$ 2 == "B")) && ([substr](\$ 3,1,1) != ".")) { print \$ 3 } }'\'' | sort -u > $export_symbols'
 	fi
@@ -4631,9 +5067,9 @@ _LT_EOF
 	_LT_TAGVAR(allow_undefined_flag, $1)='-berok'
         # Determine the default libpath from the value encoded in an
         # empty executable.
-        _LT_SYS_MODULE_PATH_AIX
+        _LT_SYS_MODULE_PATH_AIX([$1])
         _LT_TAGVAR(hardcode_libdir_flag_spec, $1)='${wl}-blibpath:$libdir:'"$aix_libpath"
-        _LT_TAGVAR(archive_expsym_cmds, $1)='$CC -o $output_objdir/$soname $libobjs $deplibs '"\${wl}$no_entry_flag"' $compiler_flags `if test "x${allow_undefined_flag}" != "x"; then $ECHO "X${wl}${allow_undefined_flag}" | $Xsed; else :; fi` '"\${wl}$exp_sym_flag:\$export_symbols $shared_flag"
+        _LT_TAGVAR(archive_expsym_cmds, $1)='$CC -o $output_objdir/$soname $libobjs $deplibs '"\${wl}$no_entry_flag"' $compiler_flags `if test "x${allow_undefined_flag}" != "x"; then func_echo_all "${wl}${allow_undefined_flag}"; else :; fi` '"\${wl}$exp_sym_flag:\$export_symbols $shared_flag"
       else
 	if test "$host_cpu" = ia64; then
 	  _LT_TAGVAR(hardcode_libdir_flag_spec, $1)='${wl}-R $libdir:/usr/lib:/lib'
@@ -4642,14 +5078,19 @@ _LT_EOF
 	else
 	 # Determine the default libpath from the value encoded in an
 	 # empty executable.
-	 _LT_SYS_MODULE_PATH_AIX
+	 _LT_SYS_MODULE_PATH_AIX([$1])
 	 _LT_TAGVAR(hardcode_libdir_flag_spec, $1)='${wl}-blibpath:$libdir:'"$aix_libpath"
 	  # Warning - without using the other run time loading flags,
 	  # -berok will link without error, but may produce a broken library.
 	  _LT_TAGVAR(no_undefined_flag, $1)=' ${wl}-bernotok'
 	  _LT_TAGVAR(allow_undefined_flag, $1)=' ${wl}-berok'
-	  # Exported symbols can be pulled into shared objects from archives
-	  _LT_TAGVAR(whole_archive_flag_spec, $1)='$convenience'
+	  if test "$with_gnu_ld" = yes; then
+	    # We only use this code for GNU lds that support --whole-archive.
+	    _LT_TAGVAR(whole_archive_flag_spec, $1)='${wl}--whole-archive$convenience ${wl}--no-whole-archive'
+	  else
+	    # Exported symbols can be pulled into shared objects from archives
+	    _LT_TAGVAR(whole_archive_flag_spec, $1)='$convenience'
+	  fi
 	  _LT_TAGVAR(archive_cmds_need_lc, $1)=yes
 	  # This is similar to how AIX traditionally builds its shared libraries.
 	  _LT_TAGVAR(archive_expsym_cmds, $1)="\$CC $shared_flag"' -o $output_objdir/$soname $libobjs $deplibs ${wl}-bnoentry $compiler_flags ${wl}-bE:$export_symbols${allow_undefined_flag}~$AR $AR_FLAGS $output_objdir/$libname$release.a $output_objdir/$soname'
@@ -4681,20 +5122,64 @@ _LT_EOF
       # Microsoft Visual C++.
       # hardcode_libdir_flag_spec is actually meaningless, as there is
       # no search path for DLLs.
-      _LT_TAGVAR(hardcode_libdir_flag_spec, $1)=' '
-      _LT_TAGVAR(allow_undefined_flag, $1)=unsupported
-      # Tell ltmain to make .lib files, not .a files.
-      libext=lib
-      # Tell ltmain to make .dll files, not .so files.
-      shrext_cmds=".dll"
-      # FIXME: Setting linknames here is a bad hack.
-      _LT_TAGVAR(archive_cmds, $1)='$CC -o $lib $libobjs $compiler_flags `$ECHO "X$deplibs" | $Xsed -e '\''s/ -lc$//'\''` -link -dll~linknames='
-      # The linker will automatically build a .lib file if we build a DLL.
-      _LT_TAGVAR(old_archive_from_new_cmds, $1)='true'
-      # FIXME: Should let the user specify the lib program.
-      _LT_TAGVAR(old_archive_cmds, $1)='lib -OUT:$oldlib$oldobjs$old_deplibs'
-      _LT_TAGVAR(fix_srcfile_path, $1)='`cygpath -w "$srcfile"`'
-      _LT_TAGVAR(enable_shared_with_static_runtimes, $1)=yes
+      case $cc_basename in
+      cl*)
+	# Native MSVC
+	_LT_TAGVAR(hardcode_libdir_flag_spec, $1)=' '
+	_LT_TAGVAR(allow_undefined_flag, $1)=unsupported
+	_LT_TAGVAR(always_export_symbols, $1)=yes
+	_LT_TAGVAR(file_list_spec, $1)='@'
+	# Tell ltmain to make .lib files, not .a files.
+	libext=lib
+	# Tell ltmain to make .dll files, not .so files.
+	shrext_cmds=".dll"
+	# FIXME: Setting linknames here is a bad hack.
+	_LT_TAGVAR(archive_cmds, $1)='$CC -o $output_objdir/$soname $libobjs $compiler_flags $deplibs -Wl,-dll~linknames='
+	_LT_TAGVAR(archive_expsym_cmds, $1)='if test "x`$SED 1q $export_symbols`" = xEXPORTS; then
+	    sed -n -e 's/\\\\\\\(.*\\\\\\\)/-link\\\ -EXPORT:\\\\\\\1/' -e '1\\\!p' < $export_symbols > $output_objdir/$soname.exp;
+	  else
+	    sed -e 's/\\\\\\\(.*\\\\\\\)/-link\\\ -EXPORT:\\\\\\\1/' < $export_symbols > $output_objdir/$soname.exp;
+	  fi~
+	  $CC -o $tool_output_objdir$soname $libobjs $compiler_flags $deplibs "@$tool_output_objdir$soname.exp" -Wl,-DLL,-IMPLIB:"$tool_output_objdir$libname.dll.lib"~
+	  linknames='
+	# The linker will not automatically build a static lib if we build a DLL.
+	# _LT_TAGVAR(old_archive_from_new_cmds, $1)='true'
+	_LT_TAGVAR(enable_shared_with_static_runtimes, $1)=yes
+	_LT_TAGVAR(exclude_expsyms, $1)='_NULL_IMPORT_DESCRIPTOR|_IMPORT_DESCRIPTOR_.*'
+	_LT_TAGVAR(export_symbols_cmds, $1)='$NM $libobjs $convenience | $global_symbol_pipe | $SED -e '\''/^[[BCDGRS]][[ ]]/s/.*[[ ]]\([[^ ]]*\)/\1,DATA/'\'' | $SED -e '\''/^[[AITW]][[ ]]/s/.*[[ ]]//'\'' | sort | uniq > $export_symbols'
+	# Don't use ranlib
+	_LT_TAGVAR(old_postinstall_cmds, $1)='chmod 644 $oldlib'
+	_LT_TAGVAR(postlink_cmds, $1)='lt_outputfile="@OUTPUT@"~
+	  lt_tool_outputfile="@TOOL_OUTPUT@"~
+	  case $lt_outputfile in
+	    *.exe|*.EXE) ;;
+	    *)
+	      lt_outputfile="$lt_outputfile.exe"
+	      lt_tool_outputfile="$lt_tool_outputfile.exe"
+	      ;;
+	  esac~
+	  if test "$MANIFEST_TOOL" != ":" && test -f "$lt_outputfile.manifest"; then
+	    $MANIFEST_TOOL -manifest "$lt_tool_outputfile.manifest" -outputresource:"$lt_tool_outputfile" || exit 1;
+	    $RM "$lt_outputfile.manifest";
+	  fi'
+	;;
+      *)
+	# Assume MSVC wrapper
+	_LT_TAGVAR(hardcode_libdir_flag_spec, $1)=' '
+	_LT_TAGVAR(allow_undefined_flag, $1)=unsupported
+	# Tell ltmain to make .lib files, not .a files.
+	libext=lib
+	# Tell ltmain to make .dll files, not .so files.
+	shrext_cmds=".dll"
+	# FIXME: Setting linknames here is a bad hack.
+	_LT_TAGVAR(archive_cmds, $1)='$CC -o $lib $libobjs $compiler_flags `func_echo_all "$deplibs" | $SED '\''s/ -lc$//'\''` -link -dll~linknames='
+	# The linker will automatically build a .lib file if we build a DLL.
+	_LT_TAGVAR(old_archive_from_new_cmds, $1)='true'
+	# FIXME: Should let the user specify the lib program.
+	_LT_TAGVAR(old_archive_cmds, $1)='lib -OUT:$oldlib$oldobjs$old_deplibs'
+	_LT_TAGVAR(enable_shared_with_static_runtimes, $1)=yes
+	;;
+      esac
       ;;
 
     darwin* | rhapsody*)
@@ -4707,10 +5192,6 @@ _LT_EOF
       _LT_TAGVAR(hardcode_shlibpath_var, $1)=no
       ;;
 
-    freebsd1*)
-      _LT_TAGVAR(ld_shlibs, $1)=no
-      ;;
-
     # FreeBSD 2.2.[012] allows us to include c++rt0.o to get C++ constructor
     # support.  Future versions do this automatically, but an explicit c++rt0.o
     # does not break anything, and helps significantly (at the cost of a little
@@ -4723,7 +5204,7 @@ _LT_EOF
       ;;
 
     # Unfortunately, older versions of FreeBSD 2 do not have this feature.
-    freebsd2*)
+    freebsd2.*)
       _LT_TAGVAR(archive_cmds, $1)='$LD -Bshareable -o $lib $libobjs $deplibs $linker_flags'
       _LT_TAGVAR(hardcode_direct, $1)=yes
       _LT_TAGVAR(hardcode_minus_L, $1)=yes
@@ -4732,7 +5213,7 @@ _LT_EOF
 
     # FreeBSD 3 and greater uses gcc -shared to do shared libraries.
     freebsd* | dragonfly*)
-      _LT_TAGVAR(archive_cmds, $1)='$CC -shared -o $lib $libobjs $deplibs $compiler_flags'
+      _LT_TAGVAR(archive_cmds, $1)='$CC -shared $pic_flag -o $lib $libobjs $deplibs $compiler_flags'
       _LT_TAGVAR(hardcode_libdir_flag_spec, $1)='-R$libdir'
       _LT_TAGVAR(hardcode_direct, $1)=yes
       _LT_TAGVAR(hardcode_shlibpath_var, $1)=no
@@ -4740,7 +5221,7 @@ _LT_EOF
 
     hpux9*)
       if test "$GCC" = yes; then
-	_LT_TAGVAR(archive_cmds, $1)='$RM $output_objdir/$soname~$CC -shared -fPIC ${wl}+b ${wl}$install_libdir -o $output_objdir/$soname $libobjs $deplibs $compiler_flags~test $output_objdir/$soname = $lib || mv $output_objdir/$soname $lib'
+	_LT_TAGVAR(archive_cmds, $1)='$RM $output_objdir/$soname~$CC -shared $pic_flag ${wl}+b ${wl}$install_libdir -o $output_objdir/$soname $libobjs $deplibs $compiler_flags~test $output_objdir/$soname = $lib || mv $output_objdir/$soname $lib'
       else
 	_LT_TAGVAR(archive_cmds, $1)='$RM $output_objdir/$soname~$LD -b +b $install_libdir -o $output_objdir/$soname $libobjs $deplibs $linker_flags~test $output_objdir/$soname = $lib || mv $output_objdir/$soname $lib'
       fi
@@ -4755,14 +5236,13 @@ _LT_EOF
       ;;
 
     hpux10*)
-      if test "$GCC" = yes -a "$with_gnu_ld" = no; then
-	_LT_TAGVAR(archive_cmds, $1)='$CC -shared -fPIC ${wl}+h ${wl}$soname ${wl}+b ${wl}$install_libdir -o $lib $libobjs $deplibs $compiler_flags'
+      if test "$GCC" = yes && test "$with_gnu_ld" = no; then
+	_LT_TAGVAR(archive_cmds, $1)='$CC -shared $pic_flag ${wl}+h ${wl}$soname ${wl}+b ${wl}$install_libdir -o $lib $libobjs $deplibs $compiler_flags'
       else
 	_LT_TAGVAR(archive_cmds, $1)='$LD -b +h $soname +b $install_libdir -o $lib $libobjs $deplibs $linker_flags'
       fi
       if test "$with_gnu_ld" = no; then
 	_LT_TAGVAR(hardcode_libdir_flag_spec, $1)='${wl}+b ${wl}$libdir'
-	_LT_TAGVAR(hardcode_libdir_flag_spec_ld, $1)='+b $libdir'
 	_LT_TAGVAR(hardcode_libdir_separator, $1)=:
 	_LT_TAGVAR(hardcode_direct, $1)=yes
 	_LT_TAGVAR(hardcode_direct_absolute, $1)=yes
@@ -4774,16 +5254,16 @@ _LT_EOF
       ;;
 
     hpux11*)
-      if test "$GCC" = yes -a "$with_gnu_ld" = no; then
+      if test "$GCC" = yes && test "$with_gnu_ld" = no; then
 	case $host_cpu in
 	hppa*64*)
 	  _LT_TAGVAR(archive_cmds, $1)='$CC -shared ${wl}+h ${wl}$soname -o $lib $libobjs $deplibs $compiler_flags'
 	  ;;
 	ia64*)
-	  _LT_TAGVAR(archive_cmds, $1)='$CC -shared -fPIC ${wl}+h ${wl}$soname ${wl}+nodefaultrpath -o $lib $libobjs $deplibs $compiler_flags'
+	  _LT_TAGVAR(archive_cmds, $1)='$CC -shared $pic_flag ${wl}+h ${wl}$soname ${wl}+nodefaultrpath -o $lib $libobjs $deplibs $compiler_flags'
 	  ;;
 	*)
-	  _LT_TAGVAR(archive_cmds, $1)='$CC -shared -fPIC ${wl}+h ${wl}$soname ${wl}+b ${wl}$install_libdir -o $lib $libobjs $deplibs $compiler_flags'
+	  _LT_TAGVAR(archive_cmds, $1)='$CC -shared $pic_flag ${wl}+h ${wl}$soname ${wl}+b ${wl}$install_libdir -o $lib $libobjs $deplibs $compiler_flags'
 	  ;;
 	esac
       else
@@ -4795,7 +5275,14 @@ _LT_EOF
 	  _LT_TAGVAR(archive_cmds, $1)='$CC -b ${wl}+h ${wl}$soname ${wl}+nodefaultrpath -o $lib $libobjs $deplibs $compiler_flags'
 	  ;;
 	*)
-	  _LT_TAGVAR(archive_cmds, $1)='$CC -b ${wl}+h ${wl}$soname ${wl}+b ${wl}$install_libdir -o $lib $libobjs $deplibs $compiler_flags'
+	m4_if($1, [], [
+	  # Older versions of the 11.00 compiler do not understand -b yet
+	  # (HP92453-01 A.11.01.20 doesn't, HP92453-01 B.11.X.35175-35176.GP does)
+	  _LT_LINKER_OPTION([if $CC understands -b],
+	    _LT_TAGVAR(lt_cv_prog_compiler__b, $1), [-b],
+	    [_LT_TAGVAR(archive_cmds, $1)='$CC -b ${wl}+h ${wl}$soname ${wl}+b ${wl}$install_libdir -o $lib $libobjs $deplibs $compiler_flags'],
+	    [_LT_TAGVAR(archive_cmds, $1)='$LD -b +h $soname +b $install_libdir -o $lib $libobjs $deplibs $linker_flags'])],
+	  [_LT_TAGVAR(archive_cmds, $1)='$CC -b ${wl}+h ${wl}$soname ${wl}+b ${wl}$install_libdir -o $lib $libobjs $deplibs $compiler_flags'])
 	  ;;
 	esac
       fi
@@ -4823,19 +5310,34 @@ _LT_EOF
 
     irix5* | irix6* | nonstopux*)
       if test "$GCC" = yes; then
-	_LT_TAGVAR(archive_cmds, $1)='$CC -shared $libobjs $deplibs $compiler_flags ${wl}-soname ${wl}$soname `test -n "$verstring" && $ECHO "X${wl}-set_version ${wl}$verstring" | $Xsed` ${wl}-update_registry ${wl}${output_objdir}/so_locations -o $lib'
+	_LT_TAGVAR(archive_cmds, $1)='$CC -shared $pic_flag $libobjs $deplibs $compiler_flags ${wl}-soname ${wl}$soname `test -n "$verstring" && func_echo_all "${wl}-set_version ${wl}$verstring"` ${wl}-update_registry ${wl}${output_objdir}/so_locations -o $lib'
 	# Try to use the -exported_symbol ld option, if it does not
 	# work, assume that -exports_file does not work either and
 	# implicitly export all symbols.
-        save_LDFLAGS="$LDFLAGS"
-        LDFLAGS="$LDFLAGS -shared ${wl}-exported_symbol ${wl}foo ${wl}-update_registry ${wl}/dev/null"
-        AC_LINK_IFELSE(int foo(void) {},
-          _LT_TAGVAR(archive_expsym_cmds, $1)='$CC -shared $libobjs $deplibs $compiler_flags ${wl}-soname ${wl}$soname `test -n "$verstring" && $ECHO "X${wl}-set_version ${wl}$verstring" | $Xsed` ${wl}-update_registry ${wl}${output_objdir}/so_locations ${wl}-exports_file ${wl}$export_symbols -o $lib'
-        )
-        LDFLAGS="$save_LDFLAGS"
+	# This should be the same for all languages, so no per-tag cache variable.
+	AC_CACHE_CHECK([whether the $host_os linker accepts -exported_symbol],
+	  [lt_cv_irix_exported_symbol],
+	  [save_LDFLAGS="$LDFLAGS"
+	   LDFLAGS="$LDFLAGS -shared ${wl}-exported_symbol ${wl}foo ${wl}-update_registry ${wl}/dev/null"
+	   AC_LINK_IFELSE(
+	     [AC_LANG_SOURCE(
+	        [AC_LANG_CASE([C], [[int foo (void) { return 0; }]],
+			      [C++], [[int foo (void) { return 0; }]],
+			      [Fortran 77], [[
+      subroutine foo
+      end]],
+			      [Fortran], [[
+      subroutine foo
+      end]])])],
+	      [lt_cv_irix_exported_symbol=yes],
+	      [lt_cv_irix_exported_symbol=no])
+           LDFLAGS="$save_LDFLAGS"])
+	if test "$lt_cv_irix_exported_symbol" = yes; then
+          _LT_TAGVAR(archive_expsym_cmds, $1)='$CC -shared $pic_flag $libobjs $deplibs $compiler_flags ${wl}-soname ${wl}$soname `test -n "$verstring" && func_echo_all "${wl}-set_version ${wl}$verstring"` ${wl}-update_registry ${wl}${output_objdir}/so_locations ${wl}-exports_file ${wl}$export_symbols -o $lib'
+	fi
       else
-	_LT_TAGVAR(archive_cmds, $1)='$CC -shared $libobjs $deplibs $compiler_flags -soname $soname `test -n "$verstring" && $ECHO "X-set_version $verstring" | $Xsed` -update_registry ${output_objdir}/so_locations -o $lib'
-	_LT_TAGVAR(archive_expsym_cmds, $1)='$CC -shared $libobjs $deplibs $compiler_flags -soname $soname `test -n "$verstring" && $ECHO "X-set_version $verstring" | $Xsed` -update_registry ${output_objdir}/so_locations -exports_file $export_symbols -o $lib'
+	_LT_TAGVAR(archive_cmds, $1)='$CC -shared $libobjs $deplibs $compiler_flags -soname $soname `test -n "$verstring" && func_echo_all "-set_version $verstring"` -update_registry ${output_objdir}/so_locations -o $lib'
+	_LT_TAGVAR(archive_expsym_cmds, $1)='$CC -shared $libobjs $deplibs $compiler_flags -soname $soname `test -n "$verstring" && func_echo_all "-set_version $verstring"` -update_registry ${output_objdir}/so_locations -exports_file $export_symbols -o $lib'
       fi
       _LT_TAGVAR(archive_cmds_need_lc, $1)='no'
       _LT_TAGVAR(hardcode_libdir_flag_spec, $1)='${wl}-rpath ${wl}$libdir'
@@ -4897,17 +5399,17 @@ _LT_EOF
       _LT_TAGVAR(hardcode_libdir_flag_spec, $1)='-L$libdir'
       _LT_TAGVAR(hardcode_minus_L, $1)=yes
       _LT_TAGVAR(allow_undefined_flag, $1)=unsupported
-      _LT_TAGVAR(archive_cmds, $1)='$ECHO "LIBRARY $libname INITINSTANCE" > $output_objdir/$libname.def~$ECHO "DESCRIPTION \"$libname\"" >> $output_objdir/$libname.def~$ECHO DATA >> $output_objdir/$libname.def~$ECHO " SINGLE NONSHARED" >> $output_objdir/$libname.def~$ECHO EXPORTS >> $output_objdir/$libname.def~emxexp $libobjs >> $output_objdir/$libname.def~$CC -Zdll -Zcrtdll -o $lib $libobjs $deplibs $compiler_flags $output_objdir/$libname.def'
+      _LT_TAGVAR(archive_cmds, $1)='$ECHO "LIBRARY $libname INITINSTANCE" > $output_objdir/$libname.def~$ECHO "DESCRIPTION \"$libname\"" >> $output_objdir/$libname.def~echo DATA >> $output_objdir/$libname.def~echo " SINGLE NONSHARED" >> $output_objdir/$libname.def~echo EXPORTS >> $output_objdir/$libname.def~emxexp $libobjs >> $output_objdir/$libname.def~$CC -Zdll -Zcrtdll -o $lib $libobjs $deplibs $compiler_flags $output_objdir/$libname.def'
       _LT_TAGVAR(old_archive_from_new_cmds, $1)='emximp -o $output_objdir/$libname.a $output_objdir/$libname.def'
       ;;
 
     osf3*)
       if test "$GCC" = yes; then
 	_LT_TAGVAR(allow_undefined_flag, $1)=' ${wl}-expect_unresolved ${wl}\*'
-	_LT_TAGVAR(archive_cmds, $1)='$CC -shared${allow_undefined_flag} $libobjs $deplibs $compiler_flags ${wl}-soname ${wl}$soname `test -n "$verstring" && $ECHO "X${wl}-set_version ${wl}$verstring" | $Xsed` ${wl}-update_registry ${wl}${output_objdir}/so_locations -o $lib'
+	_LT_TAGVAR(archive_cmds, $1)='$CC -shared${allow_undefined_flag} $libobjs $deplibs $compiler_flags ${wl}-soname ${wl}$soname `test -n "$verstring" && func_echo_all "${wl}-set_version ${wl}$verstring"` ${wl}-update_registry ${wl}${output_objdir}/so_locations -o $lib'
       else
 	_LT_TAGVAR(allow_undefined_flag, $1)=' -expect_unresolved \*'
-	_LT_TAGVAR(archive_cmds, $1)='$CC -shared${allow_undefined_flag} $libobjs $deplibs $compiler_flags -soname $soname `test -n "$verstring" && $ECHO "X-set_version $verstring" | $Xsed` -update_registry ${output_objdir}/so_locations -o $lib'
+	_LT_TAGVAR(archive_cmds, $1)='$CC -shared${allow_undefined_flag} $libobjs $deplibs $compiler_flags -soname $soname `test -n "$verstring" && func_echo_all "-set_version $verstring"` -update_registry ${output_objdir}/so_locations -o $lib'
       fi
       _LT_TAGVAR(archive_cmds_need_lc, $1)='no'
       _LT_TAGVAR(hardcode_libdir_flag_spec, $1)='${wl}-rpath ${wl}$libdir'
@@ -4917,13 +5419,13 @@ _LT_EOF
     osf4* | osf5*)	# as osf3* with the addition of -msym flag
       if test "$GCC" = yes; then
 	_LT_TAGVAR(allow_undefined_flag, $1)=' ${wl}-expect_unresolved ${wl}\*'
-	_LT_TAGVAR(archive_cmds, $1)='$CC -shared${allow_undefined_flag} $libobjs $deplibs $compiler_flags ${wl}-msym ${wl}-soname ${wl}$soname `test -n "$verstring" && $ECHO "X${wl}-set_version ${wl}$verstring" | $Xsed` ${wl}-update_registry ${wl}${output_objdir}/so_locations -o $lib'
+	_LT_TAGVAR(archive_cmds, $1)='$CC -shared${allow_undefined_flag} $pic_flag $libobjs $deplibs $compiler_flags ${wl}-msym ${wl}-soname ${wl}$soname `test -n "$verstring" && func_echo_all "${wl}-set_version ${wl}$verstring"` ${wl}-update_registry ${wl}${output_objdir}/so_locations -o $lib'
 	_LT_TAGVAR(hardcode_libdir_flag_spec, $1)='${wl}-rpath ${wl}$libdir'
       else
 	_LT_TAGVAR(allow_undefined_flag, $1)=' -expect_unresolved \*'
-	_LT_TAGVAR(archive_cmds, $1)='$CC -shared${allow_undefined_flag} $libobjs $deplibs $compiler_flags -msym -soname $soname `test -n "$verstring" && $ECHO "X-set_version $verstring" | $Xsed` -update_registry ${output_objdir}/so_locations -o $lib'
+	_LT_TAGVAR(archive_cmds, $1)='$CC -shared${allow_undefined_flag} $libobjs $deplibs $compiler_flags -msym -soname $soname `test -n "$verstring" && func_echo_all "-set_version $verstring"` -update_registry ${output_objdir}/so_locations -o $lib'
 	_LT_TAGVAR(archive_expsym_cmds, $1)='for i in `cat $export_symbols`; do printf "%s %s\\n" -exported_symbol "\$i" >> $lib.exp; done; printf "%s\\n" "-hidden">> $lib.exp~
-	$CC -shared${allow_undefined_flag} ${wl}-input ${wl}$lib.exp $compiler_flags $libobjs $deplibs -soname $soname `test -n "$verstring" && $ECHO "X-set_version $verstring" | $Xsed` -update_registry ${output_objdir}/so_locations -o $lib~$RM $lib.exp'
+	$CC -shared${allow_undefined_flag} ${wl}-input ${wl}$lib.exp $compiler_flags $libobjs $deplibs -soname $soname `test -n "$verstring" && $ECHO "-set_version $verstring"` -update_registry ${output_objdir}/so_locations -o $lib~$RM $lib.exp'
 
 	# Both c and cxx compiler support -rpath directly
 	_LT_TAGVAR(hardcode_libdir_flag_spec, $1)='-rpath $libdir'
@@ -4936,9 +5438,9 @@ _LT_EOF
       _LT_TAGVAR(no_undefined_flag, $1)=' -z defs'
       if test "$GCC" = yes; then
 	wlarc='${wl}'
-	_LT_TAGVAR(archive_cmds, $1)='$CC -shared ${wl}-z ${wl}text ${wl}-h ${wl}$soname -o $lib $libobjs $deplibs $compiler_flags'
+	_LT_TAGVAR(archive_cmds, $1)='$CC -shared $pic_flag ${wl}-z ${wl}text ${wl}-h ${wl}$soname -o $lib $libobjs $deplibs $compiler_flags'
 	_LT_TAGVAR(archive_expsym_cmds, $1)='echo "{ global:" > $lib.exp~cat $export_symbols | $SED -e "s/\(.*\)/\1;/" >> $lib.exp~echo "local: *; };" >> $lib.exp~
-	  $CC -shared ${wl}-z ${wl}text ${wl}-M ${wl}$lib.exp ${wl}-h ${wl}$soname -o $lib $libobjs $deplibs $compiler_flags~$RM $lib.exp'
+	  $CC -shared $pic_flag ${wl}-z ${wl}text ${wl}-M ${wl}$lib.exp ${wl}-h ${wl}$soname -o $lib $libobjs $deplibs $compiler_flags~$RM $lib.exp'
       else
 	case `$CC -V 2>&1` in
 	*"Compilers 5.0"*)
@@ -5114,36 +5616,38 @@ x|xyes)
       # Test whether the compiler implicitly links with -lc since on some
       # systems, -lgcc has to come before -lc. If gcc already passes -lc
       # to ld, don't add -lc before -lgcc.
-      AC_MSG_CHECKING([whether -lc should be explicitly linked in])
-      $RM conftest*
-      echo "$lt_simple_compile_test_code" > conftest.$ac_ext
-
-      if AC_TRY_EVAL(ac_compile) 2>conftest.err; then
-        soname=conftest
-        lib=conftest
-        libobjs=conftest.$ac_objext
-        deplibs=
-        wl=$_LT_TAGVAR(lt_prog_compiler_wl, $1)
-	pic_flag=$_LT_TAGVAR(lt_prog_compiler_pic, $1)
-        compiler_flags=-v
-        linker_flags=-v
-        verstring=
-        output_objdir=.
-        libname=conftest
-        lt_save_allow_undefined_flag=$_LT_TAGVAR(allow_undefined_flag, $1)
-        _LT_TAGVAR(allow_undefined_flag, $1)=
-        if AC_TRY_EVAL(_LT_TAGVAR(archive_cmds, $1) 2\>\&1 \| $GREP \" -lc \" \>/dev/null 2\>\&1)
-        then
-	  _LT_TAGVAR(archive_cmds_need_lc, $1)=no
-        else
-	  _LT_TAGVAR(archive_cmds_need_lc, $1)=yes
-        fi
-        _LT_TAGVAR(allow_undefined_flag, $1)=$lt_save_allow_undefined_flag
-      else
-        cat conftest.err 1>&5
-      fi
-      $RM conftest*
-      AC_MSG_RESULT([$_LT_TAGVAR(archive_cmds_need_lc, $1)])
+      AC_CACHE_CHECK([whether -lc should be explicitly linked in],
+	[lt_cv_]_LT_TAGVAR(archive_cmds_need_lc, $1),
+	[$RM conftest*
+	echo "$lt_simple_compile_test_code" > conftest.$ac_ext
+
+	if AC_TRY_EVAL(ac_compile) 2>conftest.err; then
+	  soname=conftest
+	  lib=conftest
+	  libobjs=conftest.$ac_objext
+	  deplibs=
+	  wl=$_LT_TAGVAR(lt_prog_compiler_wl, $1)
+	  pic_flag=$_LT_TAGVAR(lt_prog_compiler_pic, $1)
+	  compiler_flags=-v
+	  linker_flags=-v
+	  verstring=
+	  output_objdir=.
+	  libname=conftest
+	  lt_save_allow_undefined_flag=$_LT_TAGVAR(allow_undefined_flag, $1)
+	  _LT_TAGVAR(allow_undefined_flag, $1)=
+	  if AC_TRY_EVAL(_LT_TAGVAR(archive_cmds, $1) 2\>\&1 \| $GREP \" -lc \" \>/dev/null 2\>\&1)
+	  then
+	    lt_cv_[]_LT_TAGVAR(archive_cmds_need_lc, $1)=no
+	  else
+	    lt_cv_[]_LT_TAGVAR(archive_cmds_need_lc, $1)=yes
+	  fi
+	  _LT_TAGVAR(allow_undefined_flag, $1)=$lt_save_allow_undefined_flag
+	else
+	  cat conftest.err 1>&5
+	fi
+	$RM conftest*
+	])
+      _LT_TAGVAR(archive_cmds_need_lc, $1)=$lt_cv_[]_LT_TAGVAR(archive_cmds_need_lc, $1)
       ;;
     esac
   fi
@@ -5180,9 +5684,6 @@ _LT_TAGDECL([], [no_undefined_flag], [1],
 _LT_TAGDECL([], [hardcode_libdir_flag_spec], [1],
     [Flag to hardcode $libdir into a binary during linking.
     This must work even if $libdir does not exist])
-_LT_TAGDECL([], [hardcode_libdir_flag_spec_ld], [1],
-    [[If ld is used when linking, flag to hardcode $libdir into a binary
-    during linking.  This must work even if $libdir does not exist]])
 _LT_TAGDECL([], [hardcode_libdir_separator], [1],
     [Whether we need a single "-rpath" flag with a separated argument])
 _LT_TAGDECL([], [hardcode_direct], [0],
@@ -5208,8 +5709,6 @@ _LT_TAGDECL([], [inherit_rpath], [0],
     to runtime path list])
 _LT_TAGDECL([], [link_all_deplibs], [0],
     [Whether libtool must link a program against all its dependency libraries])
-_LT_TAGDECL([], [fix_srcfile_path], [1],
-    [Fix the shell variable $srcfile for the compiler])
 _LT_TAGDECL([], [always_export_symbols], [0],
     [Set to "yes" if exported symbols are required])
 _LT_TAGDECL([], [export_symbols_cmds], [2],
@@ -5220,6 +5719,8 @@ _LT_TAGDECL([], [include_expsyms], [1],
     [Symbols that must always be exported])
 _LT_TAGDECL([], [prelink_cmds], [2],
     [Commands necessary for linking programs (against libraries) with templates])
+_LT_TAGDECL([], [postlink_cmds], [2],
+    [Commands necessary for finishing linking programs])
 _LT_TAGDECL([], [file_list_spec], [1],
     [Specify filename containing input files])
 dnl FIXME: Not yet implemented
@@ -5313,37 +5814,22 @@ CC="$lt_save_CC"
 ])# _LT_LANG_C_CONFIG
 
 
-# _LT_PROG_CXX
-# ------------
-# Since AC_PROG_CXX is broken, in that it returns g++ if there is no c++
-# compiler, we have our own version here.
-m4_defun([_LT_PROG_CXX],
-[
-pushdef([AC_MSG_ERROR], [_lt_caught_CXX_error=yes])
-AC_PROG_CXX
-if test -n "$CXX" && ( test "X$CXX" != "Xno" &&
-    ( (test "X$CXX" = "Xg++" && `g++ -v >/dev/null 2>&1` ) ||
-    (test "X$CXX" != "Xg++"))) ; then
-  AC_PROG_CXXCPP
-else
-  _lt_caught_CXX_error=yes
-fi
-popdef([AC_MSG_ERROR])
-])# _LT_PROG_CXX
-
-dnl aclocal-1.4 backwards compatibility:
-dnl AC_DEFUN([_LT_PROG_CXX], [])
-
-
 # _LT_LANG_CXX_CONFIG([TAG])
 # --------------------------
 # Ensure that the configuration variables for a C++ compiler are suitably
 # defined.  These variables are subsequently used by _LT_CONFIG to write
 # the compiler configuration to `libtool'.
 m4_defun([_LT_LANG_CXX_CONFIG],
-[AC_REQUIRE([_LT_PROG_CXX])dnl
-m4_require([_LT_FILEUTILS_DEFAULTS])dnl
+[m4_require([_LT_FILEUTILS_DEFAULTS])dnl
 m4_require([_LT_DECL_EGREP])dnl
+m4_require([_LT_PATH_MANIFEST_TOOL])dnl
+if test -n "$CXX" && ( test "X$CXX" != "Xno" &&
+    ( (test "X$CXX" = "Xg++" && `g++ -v >/dev/null 2>&1` ) ||
+    (test "X$CXX" != "Xg++"))) ; then
+  AC_PROG_CXXCPP
+else
+  _lt_caught_CXX_error=yes
+fi
 
 AC_LANG_PUSH(C++)
 _LT_TAGVAR(archive_cmds_need_lc, $1)=no
@@ -5355,7 +5841,6 @@ _LT_TAGVAR(export_dynamic_flag_spec, $1)=
 _LT_TAGVAR(hardcode_direct, $1)=no
 _LT_TAGVAR(hardcode_direct_absolute, $1)=no
 _LT_TAGVAR(hardcode_libdir_flag_spec, $1)=
-_LT_TAGVAR(hardcode_libdir_flag_spec_ld, $1)=
 _LT_TAGVAR(hardcode_libdir_separator, $1)=
 _LT_TAGVAR(hardcode_minus_L, $1)=no
 _LT_TAGVAR(hardcode_shlibpath_var, $1)=unsupported
@@ -5365,6 +5850,8 @@ _LT_TAGVAR(module_cmds, $1)=
 _LT_TAGVAR(module_expsym_cmds, $1)=
 _LT_TAGVAR(link_all_deplibs, $1)=unknown
 _LT_TAGVAR(old_archive_cmds, $1)=$old_archive_cmds
+_LT_TAGVAR(reload_flag, $1)=$reload_flag
+_LT_TAGVAR(reload_cmds, $1)=$reload_cmds
 _LT_TAGVAR(no_undefined_flag, $1)=
 _LT_TAGVAR(whole_archive_flag_spec, $1)=
 _LT_TAGVAR(enable_shared_with_static_runtimes, $1)=no
@@ -5396,6 +5883,7 @@ if test "$_lt_caught_CXX_error" != yes; then
 
   # Allow CC to be a program name with arguments.
   lt_save_CC=$CC
+  lt_save_CFLAGS=$CFLAGS
   lt_save_LD=$LD
   lt_save_GCC=$GCC
   GCC=$GXX
@@ -5413,6 +5901,7 @@ if test "$_lt_caught_CXX_error" != yes; then
   fi
   test -z "${LDCXX+set}" || LD=$LDCXX
   CC=${CXX-"c++"}
+  CFLAGS=$CXXFLAGS
   compiler=$CC
   _LT_TAGVAR(compiler, $1)=$CC
   _LT_CC_BASENAME([$compiler])
@@ -5434,8 +5923,8 @@ if test "$_lt_caught_CXX_error" != yes; then
       # Check if GNU C++ uses GNU ld as the underlying linker, since the
       # archiving commands below assume that GNU ld is being used.
       if test "$with_gnu_ld" = yes; then
-        _LT_TAGVAR(archive_cmds, $1)='$CC -shared -nostdlib $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags ${wl}-soname $wl$soname -o $lib'
-        _LT_TAGVAR(archive_expsym_cmds, $1)='$CC -shared -nostdlib $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags ${wl}-soname $wl$soname ${wl}-retain-symbols-file $wl$export_symbols -o $lib'
+        _LT_TAGVAR(archive_cmds, $1)='$CC $pic_flag -shared -nostdlib $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags ${wl}-soname $wl$soname -o $lib'
+        _LT_TAGVAR(archive_expsym_cmds, $1)='$CC $pic_flag -shared -nostdlib $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags ${wl}-soname $wl$soname ${wl}-retain-symbols-file $wl$export_symbols -o $lib'
 
         _LT_TAGVAR(hardcode_libdir_flag_spec, $1)='${wl}-rpath ${wl}$libdir'
         _LT_TAGVAR(export_dynamic_flag_spec, $1)='${wl}--export-dynamic'
@@ -5467,7 +5956,7 @@ if test "$_lt_caught_CXX_error" != yes; then
       # Commands to make compiler produce verbose output that lists
       # what "hidden" libraries, object files and flags are used when
       # linking a shared library.
-      output_verbose_link_cmd='$CC -shared $CFLAGS -v conftest.$objext 2>&1 | $GREP "\-L"'
+      output_verbose_link_cmd='$CC -shared $CFLAGS -v conftest.$objext 2>&1 | $GREP -v "^Configured with:" | $GREP "\-L"'
 
     else
       GXX=no
@@ -5576,10 +6065,10 @@ if test "$_lt_caught_CXX_error" != yes; then
           _LT_TAGVAR(allow_undefined_flag, $1)='-berok'
           # Determine the default libpath from the value encoded in an empty
           # executable.
-          _LT_SYS_MODULE_PATH_AIX
+          _LT_SYS_MODULE_PATH_AIX([$1])
           _LT_TAGVAR(hardcode_libdir_flag_spec, $1)='${wl}-blibpath:$libdir:'"$aix_libpath"
 
-          _LT_TAGVAR(archive_expsym_cmds, $1)='$CC -o $output_objdir/$soname $libobjs $deplibs '"\${wl}$no_entry_flag"' $compiler_flags `if test "x${allow_undefined_flag}" != "x"; then $ECHO "X${wl}${allow_undefined_flag}" | $Xsed; else :; fi` '"\${wl}$exp_sym_flag:\$export_symbols $shared_flag"
+          _LT_TAGVAR(archive_expsym_cmds, $1)='$CC -o $output_objdir/$soname $libobjs $deplibs '"\${wl}$no_entry_flag"' $compiler_flags `if test "x${allow_undefined_flag}" != "x"; then func_echo_all "${wl}${allow_undefined_flag}"; else :; fi` '"\${wl}$exp_sym_flag:\$export_symbols $shared_flag"
         else
           if test "$host_cpu" = ia64; then
 	    _LT_TAGVAR(hardcode_libdir_flag_spec, $1)='${wl}-R $libdir:/usr/lib:/lib'
@@ -5588,14 +6077,19 @@ if test "$_lt_caught_CXX_error" != yes; then
           else
 	    # Determine the default libpath from the value encoded in an
 	    # empty executable.
-	    _LT_SYS_MODULE_PATH_AIX
+	    _LT_SYS_MODULE_PATH_AIX([$1])
 	    _LT_TAGVAR(hardcode_libdir_flag_spec, $1)='${wl}-blibpath:$libdir:'"$aix_libpath"
 	    # Warning - without using the other run time loading flags,
 	    # -berok will link without error, but may produce a broken library.
 	    _LT_TAGVAR(no_undefined_flag, $1)=' ${wl}-bernotok'
 	    _LT_TAGVAR(allow_undefined_flag, $1)=' ${wl}-berok'
-	    # Exported symbols can be pulled into shared objects from archives
-	    _LT_TAGVAR(whole_archive_flag_spec, $1)='$convenience'
+	    if test "$with_gnu_ld" = yes; then
+	      # We only use this code for GNU lds that support --whole-archive.
+	      _LT_TAGVAR(whole_archive_flag_spec, $1)='${wl}--whole-archive$convenience ${wl}--no-whole-archive'
+	    else
+	      # Exported symbols can be pulled into shared objects from archives
+	      _LT_TAGVAR(whole_archive_flag_spec, $1)='$convenience'
+	    fi
 	    _LT_TAGVAR(archive_cmds_need_lc, $1)=yes
 	    # This is similar to how AIX traditionally builds its shared
 	    # libraries.
@@ -5625,28 +6119,75 @@ if test "$_lt_caught_CXX_error" != yes; then
         ;;
 
       cygwin* | mingw* | pw32* | cegcc*)
-        # _LT_TAGVAR(hardcode_libdir_flag_spec, $1) is actually meaningless,
-        # as there is no search path for DLLs.
-        _LT_TAGVAR(hardcode_libdir_flag_spec, $1)='-L$libdir'
-        _LT_TAGVAR(allow_undefined_flag, $1)=unsupported
-        _LT_TAGVAR(always_export_symbols, $1)=no
-        _LT_TAGVAR(enable_shared_with_static_runtimes, $1)=yes
-
-        if $LD --help 2>&1 | $GREP 'auto-import' > /dev/null; then
-          _LT_TAGVAR(archive_cmds, $1)='$CC -shared -nostdlib $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags -o $output_objdir/$soname ${wl}--enable-auto-image-base -Xlinker --out-implib -Xlinker $lib'
-          # If the export-symbols file already is a .def file (1st line
-          # is EXPORTS), use it as is; otherwise, prepend...
-          _LT_TAGVAR(archive_expsym_cmds, $1)='if test "x`$SED 1q $export_symbols`" = xEXPORTS; then
-	    cp $export_symbols $output_objdir/$soname.def;
-          else
-	    echo EXPORTS > $output_objdir/$soname.def;
-	    cat $export_symbols >> $output_objdir/$soname.def;
-          fi~
-          $CC -shared -nostdlib $output_objdir/$soname.def $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags -o $output_objdir/$soname ${wl}--enable-auto-image-base -Xlinker --out-implib -Xlinker $lib'
-        else
-          _LT_TAGVAR(ld_shlibs, $1)=no
-        fi
-        ;;
+	case $GXX,$cc_basename in
+	,cl* | no,cl*)
+	  # Native MSVC
+	  # hardcode_libdir_flag_spec is actually meaningless, as there is
+	  # no search path for DLLs.
+	  _LT_TAGVAR(hardcode_libdir_flag_spec, $1)=' '
+	  _LT_TAGVAR(allow_undefined_flag, $1)=unsupported
+	  _LT_TAGVAR(always_export_symbols, $1)=yes
+	  _LT_TAGVAR(file_list_spec, $1)='@'
+	  # Tell ltmain to make .lib files, not .a files.
+	  libext=lib
+	  # Tell ltmain to make .dll files, not .so files.
+	  shrext_cmds=".dll"
+	  # FIXME: Setting linknames here is a bad hack.
+	  _LT_TAGVAR(archive_cmds, $1)='$CC -o $output_objdir/$soname $libobjs $compiler_flags $deplibs -Wl,-dll~linknames='
+	  _LT_TAGVAR(archive_expsym_cmds, $1)='if test "x`$SED 1q $export_symbols`" = xEXPORTS; then
+	      $SED -n -e 's/\\\\\\\(.*\\\\\\\)/-link\\\ -EXPORT:\\\\\\\1/' -e '1\\\!p' < $export_symbols > $output_objdir/$soname.exp;
+	    else
+	      $SED -e 's/\\\\\\\(.*\\\\\\\)/-link\\\ -EXPORT:\\\\\\\1/' < $export_symbols > $output_objdir/$soname.exp;
+	    fi~
+	    $CC -o $tool_output_objdir$soname $libobjs $compiler_flags $deplibs "@$tool_output_objdir$soname.exp" -Wl,-DLL,-IMPLIB:"$tool_output_objdir$libname.dll.lib"~
+	    linknames='
+	  # The linker will not automatically build a static lib if we build a DLL.
+	  # _LT_TAGVAR(old_archive_from_new_cmds, $1)='true'
+	  _LT_TAGVAR(enable_shared_with_static_runtimes, $1)=yes
+	  # Don't use ranlib
+	  _LT_TAGVAR(old_postinstall_cmds, $1)='chmod 644 $oldlib'
+	  _LT_TAGVAR(postlink_cmds, $1)='lt_outputfile="@OUTPUT@"~
+	    lt_tool_outputfile="@TOOL_OUTPUT@"~
+	    case $lt_outputfile in
+	      *.exe|*.EXE) ;;
+	      *)
+		lt_outputfile="$lt_outputfile.exe"
+		lt_tool_outputfile="$lt_tool_outputfile.exe"
+		;;
+	    esac~
+	    func_to_tool_file "$lt_outputfile"~
+	    if test "$MANIFEST_TOOL" != ":" && test -f "$lt_outputfile.manifest"; then
+	      $MANIFEST_TOOL -manifest "$lt_tool_outputfile.manifest" -outputresource:"$lt_tool_outputfile" || exit 1;
+	      $RM "$lt_outputfile.manifest";
+	    fi'
+	  ;;
+	*)
+	  # g++
+	  # _LT_TAGVAR(hardcode_libdir_flag_spec, $1) is actually meaningless,
+	  # as there is no search path for DLLs.
+	  _LT_TAGVAR(hardcode_libdir_flag_spec, $1)='-L$libdir'
+	  _LT_TAGVAR(export_dynamic_flag_spec, $1)='${wl}--export-all-symbols'
+	  _LT_TAGVAR(allow_undefined_flag, $1)=unsupported
+	  _LT_TAGVAR(always_export_symbols, $1)=no
+	  _LT_TAGVAR(enable_shared_with_static_runtimes, $1)=yes
+
+	  if $LD --help 2>&1 | $GREP 'auto-import' > /dev/null; then
+	    _LT_TAGVAR(archive_cmds, $1)='$CC -shared -nostdlib $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags -o $output_objdir/$soname ${wl}--enable-auto-image-base -Xlinker --out-implib -Xlinker $lib'
+	    # If the export-symbols file already is a .def file (1st line
+	    # is EXPORTS), use it as is; otherwise, prepend...
+	    _LT_TAGVAR(archive_expsym_cmds, $1)='if test "x`$SED 1q $export_symbols`" = xEXPORTS; then
+	      cp $export_symbols $output_objdir/$soname.def;
+	    else
+	      echo EXPORTS > $output_objdir/$soname.def;
+	      cat $export_symbols >> $output_objdir/$soname.def;
+	    fi~
+	    $CC -shared -nostdlib $output_objdir/$soname.def $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags -o $output_objdir/$soname ${wl}--enable-auto-image-base -Xlinker --out-implib -Xlinker $lib'
+	  else
+	    _LT_TAGVAR(ld_shlibs, $1)=no
+	  fi
+	  ;;
+	esac
+	;;
       darwin* | rhapsody*)
         _LT_DARWIN_LINKER_FEATURES($1)
 	;;
@@ -5669,7 +6210,7 @@ if test "$_lt_caught_CXX_error" != yes; then
         esac
         ;;
 
-      freebsd[[12]]*)
+      freebsd2.*)
         # C++ shared libraries reported to be fairly broken before
 	# switch to ELF
         _LT_TAGVAR(ld_shlibs, $1)=no
@@ -5688,6 +6229,11 @@ if test "$_lt_caught_CXX_error" != yes; then
       gnu*)
         ;;
 
+      haiku*)
+        _LT_TAGVAR(archive_cmds, $1)='$CC -shared $libobjs $deplibs $compiler_flags ${wl}-soname $wl$soname -o $lib'
+        _LT_TAGVAR(link_all_deplibs, $1)=yes
+        ;;
+
       hpux9*)
         _LT_TAGVAR(hardcode_libdir_flag_spec, $1)='${wl}+b ${wl}$libdir'
         _LT_TAGVAR(hardcode_libdir_separator, $1)=:
@@ -5712,11 +6258,11 @@ if test "$_lt_caught_CXX_error" != yes; then
             # explicitly linking system object files so we need to strip them
             # from the output so that they don't get included in the library
             # dependencies.
-            output_verbose_link_cmd='templist=`($CC -b $CFLAGS -v conftest.$objext 2>&1) | $EGREP "\-L"`; list=""; for z in $templist; do case $z in conftest.$objext) list="$list $z";; *.$objext);; *) list="$list $z";;esac; done; $ECHO "X$list" | $Xsed'
+            output_verbose_link_cmd='templist=`($CC -b $CFLAGS -v conftest.$objext 2>&1) | $EGREP "\-L"`; list=""; for z in $templist; do case $z in conftest.$objext) list="$list $z";; *.$objext);; *) list="$list $z";;esac; done; func_echo_all "$list"'
             ;;
           *)
             if test "$GXX" = yes; then
-              _LT_TAGVAR(archive_cmds, $1)='$RM $output_objdir/$soname~$CC -shared -nostdlib -fPIC ${wl}+b ${wl}$install_libdir -o $output_objdir/$soname $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags~test $output_objdir/$soname = $lib || mv $output_objdir/$soname $lib'
+              _LT_TAGVAR(archive_cmds, $1)='$RM $output_objdir/$soname~$CC -shared -nostdlib $pic_flag ${wl}+b ${wl}$install_libdir -o $output_objdir/$soname $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags~test $output_objdir/$soname = $lib || mv $output_objdir/$soname $lib'
             else
               # FIXME: insert proper C++ library support
               _LT_TAGVAR(ld_shlibs, $1)=no
@@ -5777,7 +6323,7 @@ if test "$_lt_caught_CXX_error" != yes; then
 	    # explicitly linking system object files so we need to strip them
 	    # from the output so that they don't get included in the library
 	    # dependencies.
-	    output_verbose_link_cmd='templist=`($CC -b $CFLAGS -v conftest.$objext 2>&1) | $GREP "\-L"`; list=""; for z in $templist; do case $z in conftest.$objext) list="$list $z";; *.$objext);; *) list="$list $z";;esac; done; $ECHO "X$list" | $Xsed'
+	    output_verbose_link_cmd='templist=`($CC -b $CFLAGS -v conftest.$objext 2>&1) | $GREP "\-L"`; list=""; for z in $templist; do case $z in conftest.$objext) list="$list $z";; *.$objext);; *) list="$list $z";;esac; done; func_echo_all "$list"'
 	    ;;
           *)
 	    if test "$GXX" = yes; then
@@ -5787,10 +6333,10 @@ if test "$_lt_caught_CXX_error" != yes; then
 	            _LT_TAGVAR(archive_cmds, $1)='$CC -shared -nostdlib -fPIC ${wl}+h ${wl}$soname -o $lib $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags'
 	            ;;
 	          ia64*)
-	            _LT_TAGVAR(archive_cmds, $1)='$CC -shared -nostdlib -fPIC ${wl}+h ${wl}$soname ${wl}+nodefaultrpath -o $lib $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags'
+	            _LT_TAGVAR(archive_cmds, $1)='$CC -shared -nostdlib $pic_flag ${wl}+h ${wl}$soname ${wl}+nodefaultrpath -o $lib $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags'
 	            ;;
 	          *)
-	            _LT_TAGVAR(archive_cmds, $1)='$CC -shared -nostdlib -fPIC ${wl}+h ${wl}$soname ${wl}+b ${wl}$install_libdir -o $lib $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags'
+	            _LT_TAGVAR(archive_cmds, $1)='$CC -shared -nostdlib $pic_flag ${wl}+h ${wl}$soname ${wl}+b ${wl}$install_libdir -o $lib $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags'
 	            ;;
 	        esac
 	      fi
@@ -5820,7 +6366,7 @@ if test "$_lt_caught_CXX_error" != yes; then
         case $cc_basename in
           CC*)
 	    # SGI C++
-	    _LT_TAGVAR(archive_cmds, $1)='$CC -shared -all -multigot $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags -soname $soname `test -n "$verstring" && $ECHO "X-set_version $verstring" | $Xsed` -update_registry ${output_objdir}/so_locations -o $lib'
+	    _LT_TAGVAR(archive_cmds, $1)='$CC -shared -all -multigot $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags -soname $soname `test -n "$verstring" && func_echo_all "-set_version $verstring"` -update_registry ${output_objdir}/so_locations -o $lib'
 
 	    # Archives containing C++ object files must be created using
 	    # "CC -ar", where "CC" is the IRIX C++ compiler.  This is
@@ -5831,9 +6377,9 @@ if test "$_lt_caught_CXX_error" != yes; then
           *)
 	    if test "$GXX" = yes; then
 	      if test "$with_gnu_ld" = no; then
-	        _LT_TAGVAR(archive_cmds, $1)='$CC -shared -nostdlib $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags ${wl}-soname ${wl}$soname `test -n "$verstring" && $ECHO "X${wl}-set_version ${wl}$verstring" | $Xsed` ${wl}-update_registry ${wl}${output_objdir}/so_locations -o $lib'
+	        _LT_TAGVAR(archive_cmds, $1)='$CC -shared $pic_flag -nostdlib $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags ${wl}-soname ${wl}$soname `test -n "$verstring" && func_echo_all "${wl}-set_version ${wl}$verstring"` ${wl}-update_registry ${wl}${output_objdir}/so_locations -o $lib'
 	      else
-	        _LT_TAGVAR(archive_cmds, $1)='$CC -shared -nostdlib $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags ${wl}-soname ${wl}$soname `test -n "$verstring" && $ECHO "X${wl}-set_version ${wl}$verstring" | $Xsed` -o $lib'
+	        _LT_TAGVAR(archive_cmds, $1)='$CC -shared $pic_flag -nostdlib $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags ${wl}-soname ${wl}$soname `test -n "$verstring" && func_echo_all "${wl}-set_version ${wl}$verstring"` -o $lib'
 	      fi
 	    fi
 	    _LT_TAGVAR(link_all_deplibs, $1)=yes
@@ -5844,7 +6390,7 @@ if test "$_lt_caught_CXX_error" != yes; then
         _LT_TAGVAR(inherit_rpath, $1)=yes
         ;;
 
-      linux* | k*bsd*-gnu)
+      linux* | k*bsd*-gnu | kopensolaris*-gnu)
         case $cc_basename in
           KCC*)
 	    # Kuck and Associates, Inc. (KAI) C++ Compiler
@@ -5862,7 +6408,7 @@ if test "$_lt_caught_CXX_error" != yes; then
 	    # explicitly linking system object files so we need to strip them
 	    # from the output so that they don't get included in the library
 	    # dependencies.
-	    output_verbose_link_cmd='templist=`$CC $CFLAGS -v conftest.$objext -o libconftest$shared_ext 2>&1 | $GREP "ld"`; rm -f libconftest$shared_ext; list=""; for z in $templist; do case $z in conftest.$objext) list="$list $z";; *.$objext);; *) list="$list $z";;esac; done; $ECHO "X$list" | $Xsed'
+	    output_verbose_link_cmd='templist=`$CC $CFLAGS -v conftest.$objext -o libconftest$shared_ext 2>&1 | $GREP "ld"`; rm -f libconftest$shared_ext; list=""; for z in $templist; do case $z in conftest.$objext) list="$list $z";; *.$objext);; *) list="$list $z";;esac; done; func_echo_all "$list"'
 
 	    _LT_TAGVAR(hardcode_libdir_flag_spec, $1)='${wl}-rpath,$libdir'
 	    _LT_TAGVAR(export_dynamic_flag_spec, $1)='${wl}--export-dynamic'
@@ -5899,26 +6445,26 @@ if test "$_lt_caught_CXX_error" != yes; then
           pgCC* | pgcpp*)
             # Portland Group C++ compiler
 	    case `$CC -V` in
-	    *pgCC\ [[1-5]]* | *pgcpp\ [[1-5]]*)
+	    *pgCC\ [[1-5]].* | *pgcpp\ [[1-5]].*)
 	      _LT_TAGVAR(prelink_cmds, $1)='tpldir=Template.dir~
 		rm -rf $tpldir~
 		$CC --prelink_objects --instantiation_dir $tpldir $objs $libobjs $compile_deplibs~
-		compile_command="$compile_command `find $tpldir -name \*.o | $NL2SP`"'
+		compile_command="$compile_command `find $tpldir -name \*.o | sort | $NL2SP`"'
 	      _LT_TAGVAR(old_archive_cmds, $1)='tpldir=Template.dir~
 		rm -rf $tpldir~
 		$CC --prelink_objects --instantiation_dir $tpldir $oldobjs$old_deplibs~
-		$AR $AR_FLAGS $oldlib$oldobjs$old_deplibs `find $tpldir -name \*.o | $NL2SP`~
+		$AR $AR_FLAGS $oldlib$oldobjs$old_deplibs `find $tpldir -name \*.o | sort | $NL2SP`~
 		$RANLIB $oldlib'
 	      _LT_TAGVAR(archive_cmds, $1)='tpldir=Template.dir~
 		rm -rf $tpldir~
 		$CC --prelink_objects --instantiation_dir $tpldir $predep_objects $libobjs $deplibs $convenience $postdep_objects~
-		$CC -shared $pic_flag $predep_objects $libobjs $deplibs `find $tpldir -name \*.o | $NL2SP` $postdep_objects $compiler_flags ${wl}-soname ${wl}$soname -o $lib'
+		$CC -shared $pic_flag $predep_objects $libobjs $deplibs `find $tpldir -name \*.o | sort | $NL2SP` $postdep_objects $compiler_flags ${wl}-soname ${wl}$soname -o $lib'
 	      _LT_TAGVAR(archive_expsym_cmds, $1)='tpldir=Template.dir~
 		rm -rf $tpldir~
 		$CC --prelink_objects --instantiation_dir $tpldir $predep_objects $libobjs $deplibs $convenience $postdep_objects~
-		$CC -shared $pic_flag $predep_objects $libobjs $deplibs `find $tpldir -name \*.o | $NL2SP` $postdep_objects $compiler_flags ${wl}-soname ${wl}$soname ${wl}-retain-symbols-file ${wl}$export_symbols -o $lib'
+		$CC -shared $pic_flag $predep_objects $libobjs $deplibs `find $tpldir -name \*.o | sort | $NL2SP` $postdep_objects $compiler_flags ${wl}-soname ${wl}$soname ${wl}-retain-symbols-file ${wl}$export_symbols -o $lib'
 	      ;;
-	    *) # Version 6 will use weak symbols
+	    *) # Version 6 and above use weak symbols
 	      _LT_TAGVAR(archive_cmds, $1)='$CC -shared $pic_flag $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags ${wl}-soname ${wl}$soname -o $lib'
 	      _LT_TAGVAR(archive_expsym_cmds, $1)='$CC -shared $pic_flag $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags ${wl}-soname ${wl}$soname ${wl}-retain-symbols-file ${wl}$export_symbols -o $lib'
 	      ;;
@@ -5926,7 +6472,7 @@ if test "$_lt_caught_CXX_error" != yes; then
 
 	    _LT_TAGVAR(hardcode_libdir_flag_spec, $1)='${wl}--rpath ${wl}$libdir'
 	    _LT_TAGVAR(export_dynamic_flag_spec, $1)='${wl}--export-dynamic'
-	    _LT_TAGVAR(whole_archive_flag_spec, $1)='${wl}--whole-archive`for conv in $convenience\"\"; do test  -n \"$conv\" && new_convenience=\"$new_convenience,$conv\"; done; $ECHO \"$new_convenience\"` ${wl}--no-whole-archive'
+	    _LT_TAGVAR(whole_archive_flag_spec, $1)='${wl}--whole-archive`for conv in $convenience\"\"; do test  -n \"$conv\" && new_convenience=\"$new_convenience,$conv\"; done; func_echo_all \"$new_convenience\"` ${wl}--no-whole-archive'
             ;;
 	  cxx*)
 	    # Compaq C++
@@ -5945,9 +6491,9 @@ if test "$_lt_caught_CXX_error" != yes; then
 	    # explicitly linking system object files so we need to strip them
 	    # from the output so that they don't get included in the library
 	    # dependencies.
-	    output_verbose_link_cmd='templist=`$CC -shared $CFLAGS -v conftest.$objext 2>&1 | $GREP "ld"`; templist=`$ECHO "X$templist" | $Xsed -e "s/\(^.*ld.*\)\( .*ld .*$\)/\1/"`; list=""; for z in $templist; do case $z in conftest.$objext) list="$list $z";; *.$objext);; *) list="$list $z";;esac; done; $ECHO "X$list" | $Xsed'
+	    output_verbose_link_cmd='templist=`$CC -shared $CFLAGS -v conftest.$objext 2>&1 | $GREP "ld"`; templist=`func_echo_all "$templist" | $SED "s/\(^.*ld.*\)\( .*ld .*$\)/\1/"`; list=""; for z in $templist; do case $z in conftest.$objext) list="$list $z";; *.$objext);; *) list="$list $z";;esac; done; func_echo_all "X$list" | $Xsed'
 	    ;;
-	  xl*)
+	  xl* | mpixl* | bgxl*)
 	    # IBM XL 8.0 on PPC, with GNU ld
 	    _LT_TAGVAR(hardcode_libdir_flag_spec, $1)='${wl}-rpath ${wl}$libdir'
 	    _LT_TAGVAR(export_dynamic_flag_spec, $1)='${wl}--export-dynamic'
@@ -5967,13 +6513,13 @@ if test "$_lt_caught_CXX_error" != yes; then
 	      _LT_TAGVAR(archive_cmds, $1)='$CC -G${allow_undefined_flag} -h$soname -o $lib $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags'
 	      _LT_TAGVAR(archive_expsym_cmds, $1)='$CC -G${allow_undefined_flag} -h$soname -o $lib $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags ${wl}-retain-symbols-file ${wl}$export_symbols'
 	      _LT_TAGVAR(hardcode_libdir_flag_spec, $1)='-R$libdir'
-	      _LT_TAGVAR(whole_archive_flag_spec, $1)='${wl}--whole-archive`new_convenience=; for conv in $convenience\"\"; do test -z \"$conv\" || new_convenience=\"$new_convenience,$conv\"; done; $ECHO \"$new_convenience\"` ${wl}--no-whole-archive'
+	      _LT_TAGVAR(whole_archive_flag_spec, $1)='${wl}--whole-archive`new_convenience=; for conv in $convenience\"\"; do test -z \"$conv\" || new_convenience=\"$new_convenience,$conv\"; done; func_echo_all \"$new_convenience\"` ${wl}--no-whole-archive'
 	      _LT_TAGVAR(compiler_needs_object, $1)=yes
 
 	      # Not sure whether something based on
 	      # $CC $CFLAGS -v conftest.$objext -o libconftest$shared_ext 2>&1
 	      # would be better.
-	      output_verbose_link_cmd='echo'
+	      output_verbose_link_cmd='func_echo_all'
 
 	      # Archives containing C++ object files must be created using
 	      # "CC -xar", where "CC" is the Sun C++ compiler.  This is
@@ -6042,7 +6588,7 @@ if test "$_lt_caught_CXX_error" != yes; then
 	    _LT_TAGVAR(export_dynamic_flag_spec, $1)='${wl}-E'
 	    _LT_TAGVAR(whole_archive_flag_spec, $1)="$wlarc"'--whole-archive$convenience '"$wlarc"'--no-whole-archive'
 	  fi
-	  output_verbose_link_cmd=echo
+	  output_verbose_link_cmd=func_echo_all
 	else
 	  _LT_TAGVAR(ld_shlibs, $1)=no
 	fi
@@ -6077,15 +6623,15 @@ if test "$_lt_caught_CXX_error" != yes; then
 	    case $host in
 	      osf3*)
 	        _LT_TAGVAR(allow_undefined_flag, $1)=' ${wl}-expect_unresolved ${wl}\*'
-	        _LT_TAGVAR(archive_cmds, $1)='$CC -shared${allow_undefined_flag} $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags ${wl}-soname $soname `test -n "$verstring" && $ECHO "X${wl}-set_version $verstring" | $Xsed` -update_registry ${output_objdir}/so_locations -o $lib'
+	        _LT_TAGVAR(archive_cmds, $1)='$CC -shared${allow_undefined_flag} $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags ${wl}-soname $soname `test -n "$verstring" && func_echo_all "${wl}-set_version $verstring"` -update_registry ${output_objdir}/so_locations -o $lib'
 	        _LT_TAGVAR(hardcode_libdir_flag_spec, $1)='${wl}-rpath ${wl}$libdir'
 		;;
 	      *)
 	        _LT_TAGVAR(allow_undefined_flag, $1)=' -expect_unresolved \*'
-	        _LT_TAGVAR(archive_cmds, $1)='$CC -shared${allow_undefined_flag} $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags -msym -soname $soname `test -n "$verstring" && $ECHO "X-set_version $verstring" | $Xsed` -update_registry ${output_objdir}/so_locations -o $lib'
+	        _LT_TAGVAR(archive_cmds, $1)='$CC -shared${allow_undefined_flag} $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags -msym -soname $soname `test -n "$verstring" && func_echo_all "-set_version $verstring"` -update_registry ${output_objdir}/so_locations -o $lib'
 	        _LT_TAGVAR(archive_expsym_cmds, $1)='for i in `cat $export_symbols`; do printf "%s %s\\n" -exported_symbol "\$i" >> $lib.exp; done~
 	          echo "-hidden">> $lib.exp~
-	          $CC -shared$allow_undefined_flag $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags -msym -soname $soname ${wl}-input ${wl}$lib.exp  `test -n "$verstring" && $ECHO "X-set_version $verstring" | $Xsed` -update_registry ${output_objdir}/so_locations -o $lib~
+	          $CC -shared$allow_undefined_flag $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags -msym -soname $soname ${wl}-input ${wl}$lib.exp  `test -n "$verstring" && $ECHO "-set_version $verstring"` -update_registry ${output_objdir}/so_locations -o $lib~
 	          $RM $lib.exp'
 	        _LT_TAGVAR(hardcode_libdir_flag_spec, $1)='-rpath $libdir'
 		;;
@@ -6101,17 +6647,17 @@ if test "$_lt_caught_CXX_error" != yes; then
 	    # explicitly linking system object files so we need to strip them
 	    # from the output so that they don't get included in the library
 	    # dependencies.
-	    output_verbose_link_cmd='templist=`$CC -shared $CFLAGS -v conftest.$objext 2>&1 | $GREP "ld" | $GREP -v "ld:"`; templist=`$ECHO "X$templist" | $Xsed -e "s/\(^.*ld.*\)\( .*ld.*$\)/\1/"`; list=""; for z in $templist; do case $z in conftest.$objext) list="$list $z";; *.$objext);; *) list="$list $z";;esac; done; $ECHO "X$list" | $Xsed'
+	    output_verbose_link_cmd='templist=`$CC -shared $CFLAGS -v conftest.$objext 2>&1 | $GREP "ld" | $GREP -v "ld:"`; templist=`func_echo_all "$templist" | $SED "s/\(^.*ld.*\)\( .*ld.*$\)/\1/"`; list=""; for z in $templist; do case $z in conftest.$objext) list="$list $z";; *.$objext);; *) list="$list $z";;esac; done; func_echo_all "$list"'
 	    ;;
 	  *)
 	    if test "$GXX" = yes && test "$with_gnu_ld" = no; then
 	      _LT_TAGVAR(allow_undefined_flag, $1)=' ${wl}-expect_unresolved ${wl}\*'
 	      case $host in
 	        osf3*)
-	          _LT_TAGVAR(archive_cmds, $1)='$CC -shared -nostdlib ${allow_undefined_flag} $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags ${wl}-soname ${wl}$soname `test -n "$verstring" && $ECHO "X${wl}-set_version ${wl}$verstring" | $Xsed` ${wl}-update_registry ${wl}${output_objdir}/so_locations -o $lib'
+	          _LT_TAGVAR(archive_cmds, $1)='$CC -shared -nostdlib ${allow_undefined_flag} $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags ${wl}-soname ${wl}$soname `test -n "$verstring" && func_echo_all "${wl}-set_version ${wl}$verstring"` ${wl}-update_registry ${wl}${output_objdir}/so_locations -o $lib'
 		  ;;
 	        *)
-	          _LT_TAGVAR(archive_cmds, $1)='$CC -shared -nostdlib ${allow_undefined_flag} $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags ${wl}-msym ${wl}-soname ${wl}$soname `test -n "$verstring" && $ECHO "${wl}-set_version ${wl}$verstring" | $Xsed` ${wl}-update_registry ${wl}${output_objdir}/so_locations -o $lib'
+	          _LT_TAGVAR(archive_cmds, $1)='$CC -shared $pic_flag -nostdlib ${allow_undefined_flag} $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags ${wl}-msym ${wl}-soname ${wl}$soname `test -n "$verstring" && func_echo_all "${wl}-set_version ${wl}$verstring"` ${wl}-update_registry ${wl}${output_objdir}/so_locations -o $lib'
 		  ;;
 	      esac
 
@@ -6121,7 +6667,7 @@ if test "$_lt_caught_CXX_error" != yes; then
 	      # Commands to make compiler produce verbose output that lists
 	      # what "hidden" libraries, object files and flags are used when
 	      # linking a shared library.
-	      output_verbose_link_cmd='$CC -shared $CFLAGS -v conftest.$objext 2>&1 | $GREP "\-L"'
+	      output_verbose_link_cmd='$CC -shared $CFLAGS -v conftest.$objext 2>&1 | $GREP -v "^Configured with:" | $GREP "\-L"'
 
 	    else
 	      # FIXME: insert proper C++ library support
@@ -6157,7 +6703,7 @@ if test "$_lt_caught_CXX_error" != yes; then
 
       solaris*)
         case $cc_basename in
-          CC*)
+          CC* | sunCC*)
 	    # Sun C++ 4.2, 5.x and Centerline C++
             _LT_TAGVAR(archive_cmds_need_lc,$1)=yes
 	    _LT_TAGVAR(no_undefined_flag, $1)=' -zdefs'
@@ -6178,7 +6724,7 @@ if test "$_lt_caught_CXX_error" != yes; then
 	    esac
 	    _LT_TAGVAR(link_all_deplibs, $1)=yes
 
-	    output_verbose_link_cmd='echo'
+	    output_verbose_link_cmd='func_echo_all'
 
 	    # Archives containing C++ object files must be created using
 	    # "CC -xar", where "CC" is the Sun C++ compiler.  This is
@@ -6198,14 +6744,14 @@ if test "$_lt_caught_CXX_error" != yes; then
 	    if test "$GXX" = yes && test "$with_gnu_ld" = no; then
 	      _LT_TAGVAR(no_undefined_flag, $1)=' ${wl}-z ${wl}defs'
 	      if $CC --version | $GREP -v '^2\.7' > /dev/null; then
-	        _LT_TAGVAR(archive_cmds, $1)='$CC -shared -nostdlib $LDFLAGS $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags ${wl}-h $wl$soname -o $lib'
+	        _LT_TAGVAR(archive_cmds, $1)='$CC -shared $pic_flag -nostdlib $LDFLAGS $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags ${wl}-h $wl$soname -o $lib'
 	        _LT_TAGVAR(archive_expsym_cmds, $1)='echo "{ global:" > $lib.exp~cat $export_symbols | $SED -e "s/\(.*\)/\1;/" >> $lib.exp~echo "local: *; };" >> $lib.exp~
-		  $CC -shared -nostdlib ${wl}-M $wl$lib.exp -o $lib $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags~$RM $lib.exp'
+		  $CC -shared $pic_flag -nostdlib ${wl}-M $wl$lib.exp -o $lib $predep_objects $libobjs $deplibs $postdep_objects $compiler_flags~$RM $lib.exp'
 
 	        # Commands to make compiler produce verbose output that lists
 	        # what "hidden" libraries, object files and flags are used when
 	        # linking a shared library.
-	        output_verbose_link_cmd='$CC -shared $CFLAGS -v conftest.$objext 2>&1 | $GREP "\-L"'
+	        output_verbose_link_cmd='$CC -shared $CFLAGS -v conftest.$objext 2>&1 | $GREP -v "^Configured with:" | $GREP "\-L"'
 	      else
 	        # g++ 2.7 appears to require `-G' NOT `-shared' on this
 	        # platform.
@@ -6216,7 +6762,7 @@ if test "$_lt_caught_CXX_error" != yes; then
 	        # Commands to make compiler produce verbose output that lists
 	        # what "hidden" libraries, object files and flags are used when
 	        # linking a shared library.
-	        output_verbose_link_cmd='$CC -G $CFLAGS -v conftest.$objext 2>&1 | $GREP "\-L"'
+	        output_verbose_link_cmd='$CC -G $CFLAGS -v conftest.$objext 2>&1 | $GREP -v "^Configured with:" | $GREP "\-L"'
 	      fi
 
 	      _LT_TAGVAR(hardcode_libdir_flag_spec, $1)='${wl}-R $wl$libdir'
@@ -6270,6 +6816,10 @@ if test "$_lt_caught_CXX_error" != yes; then
           CC*)
 	    _LT_TAGVAR(archive_cmds, $1)='$CC -G ${wl}-h,$soname -o $lib $libobjs $deplibs $compiler_flags'
 	    _LT_TAGVAR(archive_expsym_cmds, $1)='$CC -G ${wl}-Bexport:$export_symbols ${wl}-h,$soname -o $lib $libobjs $deplibs $compiler_flags'
+	    _LT_TAGVAR(old_archive_cmds, $1)='$CC -Tprelink_objects $oldobjs~
+	      '"$_LT_TAGVAR(old_archive_cmds, $1)"
+	    _LT_TAGVAR(reload_cmds, $1)='$CC -Tprelink_objects $reload_objs~
+	      '"$_LT_TAGVAR(reload_cmds, $1)"
 	    ;;
 	  *)
 	    _LT_TAGVAR(archive_cmds, $1)='$CC -shared ${wl}-h,$soname -o $lib $libobjs $deplibs $compiler_flags'
@@ -6325,6 +6875,7 @@ if test "$_lt_caught_CXX_error" != yes; then
   fi # test -n "$compiler"
 
   CC=$lt_save_CC
+  CFLAGS=$lt_save_CFLAGS
   LDCXX=$LD
   LD=$lt_save_LD
   GCC=$lt_save_GCC
@@ -6339,6 +6890,29 @@ AC_LANG_POP
 ])# _LT_LANG_CXX_CONFIG
 
 
+# _LT_FUNC_STRIPNAME_CNF
+# ----------------------
+# func_stripname_cnf prefix suffix name
+# strip PREFIX and SUFFIX off of NAME.
+# PREFIX and SUFFIX must not contain globbing or regex special
+# characters, hashes, percent signs, but SUFFIX may contain a leading
+# dot (in which case that matches only a dot).
+#
+# This function is identical to the (non-XSI) version of func_stripname,
+# except this one can be used by m4 code that may be executed by configure,
+# rather than the libtool script.
+m4_defun([_LT_FUNC_STRIPNAME_CNF],[dnl
+AC_REQUIRE([_LT_DECL_SED])
+AC_REQUIRE([_LT_PROG_ECHO_BACKSLASH])
+func_stripname_cnf ()
+{
+  case ${2} in
+  .*) func_stripname_result=`$ECHO "${3}" | $SED "s%^${1}%%; s%\\\\${2}\$%%"`;;
+  *)  func_stripname_result=`$ECHO "${3}" | $SED "s%^${1}%%; s%${2}\$%%"`;;
+  esac
+} # func_stripname_cnf
+])# _LT_FUNC_STRIPNAME_CNF
+
 # _LT_SYS_HIDDEN_LIBDEPS([TAGNAME])
 # ---------------------------------
 # Figure out "hidden" library dependencies from verbose
@@ -6347,6 +6921,7 @@ AC_LANG_POP
 # objects, libraries and library flags.
 m4_defun([_LT_SYS_HIDDEN_LIBDEPS],
 [m4_require([_LT_FILEUTILS_DEFAULTS])dnl
+AC_REQUIRE([_LT_FUNC_STRIPNAME_CNF])dnl
 # Dependencies to place before and after the object being linked:
 _LT_TAGVAR(predep_objects, $1)=
 _LT_TAGVAR(postdep_objects, $1)=
@@ -6396,7 +6971,20 @@ public class foo {
   }
 };
 _LT_EOF
+], [$1], [GO], [cat > conftest.$ac_ext <<_LT_EOF
+package foo
+func foo() {
+}
+_LT_EOF
 ])
+
+_lt_libdeps_save_CFLAGS=$CFLAGS
+case "$CC $CFLAGS " in #(
+*\ -flto*\ *) CFLAGS="$CFLAGS -fno-lto" ;;
+*\ -fwhopr*\ *) CFLAGS="$CFLAGS -fno-whopr" ;;
+*\ -fuse-linker-plugin*\ *) CFLAGS="$CFLAGS -fno-use-linker-plugin" ;;
+esac
+
 dnl Parse the compiler output and extract the necessary
 dnl objects, libraries and library flags.
 if AC_TRY_EVAL(ac_compile); then
@@ -6408,7 +6996,7 @@ if AC_TRY_EVAL(ac_compile); then
   pre_test_object_deps_done=no
 
   for p in `eval "$output_verbose_link_cmd"`; do
-    case $p in
+    case ${prev}${p} in
 
     -L* | -R* | -l*)
        # Some compilers place space between "-{L,R}" and the path.
@@ -6417,13 +7005,22 @@ if AC_TRY_EVAL(ac_compile); then
           test $p = "-R"; then
 	 prev=$p
 	 continue
-       else
-	 prev=
        fi
 
+       # Expand the sysroot to ease extracting the directories later.
+       if test -z "$prev"; then
+         case $p in
+         -L*) func_stripname_cnf '-L' '' "$p"; prev=-L; p=$func_stripname_result ;;
+         -R*) func_stripname_cnf '-R' '' "$p"; prev=-R; p=$func_stripname_result ;;
+         -l*) func_stripname_cnf '-l' '' "$p"; prev=-l; p=$func_stripname_result ;;
+         esac
+       fi
+       case $p in
+       =*) func_stripname_cnf '=' '' "$p"; p=$lt_sysroot$func_stripname_result ;;
+       esac
        if test "$pre_test_object_deps_done" = no; then
-	 case $p in
-	 -L* | -R*)
+	 case ${prev} in
+	 -L | -R)
 	   # Internal compiler library paths should come after those
 	   # provided the user.  The postdeps already come after the
 	   # user supplied libs so there is no need to process them.
@@ -6443,8 +7040,10 @@ if AC_TRY_EVAL(ac_compile); then
 	   _LT_TAGVAR(postdeps, $1)="${_LT_TAGVAR(postdeps, $1)} ${prev}${p}"
 	 fi
        fi
+       prev=
        ;;
 
+    *.lto.$objext) ;; # Ignore GCC LTO objects
     *.$objext)
        # This assumes that the test object file only shows up
        # once in the compiler output.
@@ -6480,6 +7079,7 @@ else
 fi
 
 $RM -f confest.$objext
+CFLAGS=$_lt_libdeps_save_CFLAGS
 
 # PORTME: override above test on systems where it is broken
 m4_if([$1], [CXX],
@@ -6516,7 +7116,7 @@ linux*)
 
 solaris*)
   case $cc_basename in
-  CC*)
+  CC* | sunCC*)
     # The more standards-conforming stlport4 library is
     # incompatible with the Cstd library. Avoid specifying
     # it if it's in CXXFLAGS. Ignore libCrun as
@@ -6560,32 +7160,16 @@ _LT_TAGDECL([], [compiler_lib_search_path], [1],
 ])# _LT_SYS_HIDDEN_LIBDEPS
 
 
-# _LT_PROG_F77
-# ------------
-# Since AC_PROG_F77 is broken, in that it returns the empty string
-# if there is no fortran compiler, we have our own version here.
-m4_defun([_LT_PROG_F77],
-[
-pushdef([AC_MSG_ERROR], [_lt_disable_F77=yes])
-AC_PROG_F77
-if test -z "$F77" || test "X$F77" = "Xno"; then
-  _lt_disable_F77=yes
-fi
-popdef([AC_MSG_ERROR])
-])# _LT_PROG_F77
-
-dnl aclocal-1.4 backwards compatibility:
-dnl AC_DEFUN([_LT_PROG_F77], [])
-
-
 # _LT_LANG_F77_CONFIG([TAG])
 # --------------------------
 # Ensure that the configuration variables for a Fortran 77 compiler are
 # suitably defined.  These variables are subsequently used by _LT_CONFIG
 # to write the compiler configuration to `libtool'.
 m4_defun([_LT_LANG_F77_CONFIG],
-[AC_REQUIRE([_LT_PROG_F77])dnl
-AC_LANG_PUSH(Fortran 77)
+[AC_LANG_PUSH(Fortran 77)
+if test -z "$F77" || test "X$F77" = "Xno"; then
+  _lt_disable_F77=yes
+fi
 
 _LT_TAGVAR(archive_cmds_need_lc, $1)=no
 _LT_TAGVAR(allow_undefined_flag, $1)=
@@ -6595,7 +7179,6 @@ _LT_TAGVAR(export_dynamic_flag_spec, $1)=
 _LT_TAGVAR(hardcode_direct, $1)=no
 _LT_TAGVAR(hardcode_direct_absolute, $1)=no
 _LT_TAGVAR(hardcode_libdir_flag_spec, $1)=
-_LT_TAGVAR(hardcode_libdir_flag_spec_ld, $1)=
 _LT_TAGVAR(hardcode_libdir_separator, $1)=
 _LT_TAGVAR(hardcode_minus_L, $1)=no
 _LT_TAGVAR(hardcode_automatic, $1)=no
@@ -6604,6 +7187,8 @@ _LT_TAGVAR(module_cmds, $1)=
 _LT_TAGVAR(module_expsym_cmds, $1)=
 _LT_TAGVAR(link_all_deplibs, $1)=unknown
 _LT_TAGVAR(old_archive_cmds, $1)=$old_archive_cmds
+_LT_TAGVAR(reload_flag, $1)=$reload_flag
+_LT_TAGVAR(reload_cmds, $1)=$reload_cmds
 _LT_TAGVAR(no_undefined_flag, $1)=
 _LT_TAGVAR(whole_archive_flag_spec, $1)=
 _LT_TAGVAR(enable_shared_with_static_runtimes, $1)=no
@@ -6643,7 +7228,9 @@ if test "$_lt_disable_F77" != yes; then
   # Allow CC to be a program name with arguments.
   lt_save_CC="$CC"
   lt_save_GCC=$GCC
+  lt_save_CFLAGS=$CFLAGS
   CC=${F77-"f77"}
+  CFLAGS=$FFLAGS
   compiler=$CC
   _LT_TAGVAR(compiler, $1)=$CC
   _LT_CC_BASENAME([$compiler])
@@ -6697,38 +7284,24 @@ if test "$_lt_disable_F77" != yes; then
 
   GCC=$lt_save_GCC
   CC="$lt_save_CC"
+  CFLAGS="$lt_save_CFLAGS"
 fi # test "$_lt_disable_F77" != yes
 
 AC_LANG_POP
 ])# _LT_LANG_F77_CONFIG
 
 
-# _LT_PROG_FC
-# -----------
-# Since AC_PROG_FC is broken, in that it returns the empty string
-# if there is no fortran compiler, we have our own version here.
-m4_defun([_LT_PROG_FC],
-[
-pushdef([AC_MSG_ERROR], [_lt_disable_FC=yes])
-AC_PROG_FC
-if test -z "$FC" || test "X$FC" = "Xno"; then
-  _lt_disable_FC=yes
-fi
-popdef([AC_MSG_ERROR])
-])# _LT_PROG_FC
-
-dnl aclocal-1.4 backwards compatibility:
-dnl AC_DEFUN([_LT_PROG_FC], [])
-
-
 # _LT_LANG_FC_CONFIG([TAG])
 # -------------------------
 # Ensure that the configuration variables for a Fortran compiler are
 # suitably defined.  These variables are subsequently used by _LT_CONFIG
 # to write the compiler configuration to `libtool'.
 m4_defun([_LT_LANG_FC_CONFIG],
-[AC_REQUIRE([_LT_PROG_FC])dnl
-AC_LANG_PUSH(Fortran)
+[AC_LANG_PUSH(Fortran)
+
+if test -z "$FC" || test "X$FC" = "Xno"; then
+  _lt_disable_FC=yes
+fi
 
 _LT_TAGVAR(archive_cmds_need_lc, $1)=no
 _LT_TAGVAR(allow_undefined_flag, $1)=
@@ -6738,7 +7311,6 @@ _LT_TAGVAR(export_dynamic_flag_spec, $1)=
 _LT_TAGVAR(hardcode_direct, $1)=no
 _LT_TAGVAR(hardcode_direct_absolute, $1)=no
 _LT_TAGVAR(hardcode_libdir_flag_spec, $1)=
-_LT_TAGVAR(hardcode_libdir_flag_spec_ld, $1)=
 _LT_TAGVAR(hardcode_libdir_separator, $1)=
 _LT_TAGVAR(hardcode_minus_L, $1)=no
 _LT_TAGVAR(hardcode_automatic, $1)=no
@@ -6747,6 +7319,8 @@ _LT_TAGVAR(module_cmds, $1)=
 _LT_TAGVAR(module_expsym_cmds, $1)=
 _LT_TAGVAR(link_all_deplibs, $1)=unknown
 _LT_TAGVAR(old_archive_cmds, $1)=$old_archive_cmds
+_LT_TAGVAR(reload_flag, $1)=$reload_flag
+_LT_TAGVAR(reload_cmds, $1)=$reload_cmds
 _LT_TAGVAR(no_undefined_flag, $1)=
 _LT_TAGVAR(whole_archive_flag_spec, $1)=
 _LT_TAGVAR(enable_shared_with_static_runtimes, $1)=no
@@ -6786,7 +7360,9 @@ if test "$_lt_disable_FC" != yes; then
   # Allow CC to be a program name with arguments.
   lt_save_CC="$CC"
   lt_save_GCC=$GCC
+  lt_save_CFLAGS=$CFLAGS
   CC=${FC-"f95"}
+  CFLAGS=$FCFLAGS
   compiler=$CC
   GCC=$ac_cv_fc_compiler_gnu
 
@@ -6842,7 +7418,8 @@ if test "$_lt_disable_FC" != yes; then
   fi # test -n "$compiler"
 
   GCC=$lt_save_GCC
-  CC="$lt_save_CC"
+  CC=$lt_save_CC
+  CFLAGS=$lt_save_CFLAGS
 fi # test "$_lt_disable_FC" != yes
 
 AC_LANG_POP
@@ -6879,10 +7456,12 @@ _LT_COMPILER_BOILERPLATE
 _LT_LINKER_BOILERPLATE
 
 # Allow CC to be a program name with arguments.
-lt_save_CC="$CC"
+lt_save_CC=$CC
+lt_save_CFLAGS=$CFLAGS
 lt_save_GCC=$GCC
 GCC=yes
 CC=${GCJ-"gcj"}
+CFLAGS=$GCJFLAGS
 compiler=$CC
 _LT_TAGVAR(compiler, $1)=$CC
 _LT_TAGVAR(LD, $1)="$LD"
@@ -6892,6 +7471,8 @@ _LT_CC_BASENAME([$compiler])
 _LT_TAGVAR(archive_cmds_need_lc, $1)=no
 
 _LT_TAGVAR(old_archive_cmds, $1)=$old_archive_cmds
+_LT_TAGVAR(reload_flag, $1)=$reload_flag
+_LT_TAGVAR(reload_cmds, $1)=$reload_cmds
 
 ## CAVEAT EMPTOR:
 ## There is no encapsulation within the following macros, do not change
@@ -6911,10 +7492,82 @@ fi
 AC_LANG_RESTORE
 
 GCC=$lt_save_GCC
-CC="$lt_save_CC"
+CC=$lt_save_CC
+CFLAGS=$lt_save_CFLAGS
 ])# _LT_LANG_GCJ_CONFIG
 
 
+# _LT_LANG_GO_CONFIG([TAG])
+# --------------------------
+# Ensure that the configuration variables for the GNU Go compiler
+# are suitably defined.  These variables are subsequently used by _LT_CONFIG
+# to write the compiler configuration to `libtool'.
+m4_defun([_LT_LANG_GO_CONFIG],
+[AC_REQUIRE([LT_PROG_GO])dnl
+AC_LANG_SAVE
+
+# Source file extension for Go test sources.
+ac_ext=go
+
+# Object file extension for compiled Go test sources.
+objext=o
+_LT_TAGVAR(objext, $1)=$objext
+
+# Code to be used in simple compile tests
+lt_simple_compile_test_code="package main; func main() { }"
+
+# Code to be used in simple link tests
+lt_simple_link_test_code='package main; func main() { }'
+
+# ltmain only uses $CC for tagged configurations so make sure $CC is set.
+_LT_TAG_COMPILER
+
+# save warnings/boilerplate of simple test code
+_LT_COMPILER_BOILERPLATE
+_LT_LINKER_BOILERPLATE
+
+# Allow CC to be a program name with arguments.
+lt_save_CC=$CC
+lt_save_CFLAGS=$CFLAGS
+lt_save_GCC=$GCC
+GCC=yes
+CC=${GOC-"gccgo"}
+CFLAGS=$GOFLAGS
+compiler=$CC
+_LT_TAGVAR(compiler, $1)=$CC
+_LT_TAGVAR(LD, $1)="$LD"
+_LT_CC_BASENAME([$compiler])
+
+# Go did not exist at the time GCC didn't implicitly link libc in.
+_LT_TAGVAR(archive_cmds_need_lc, $1)=no
+
+_LT_TAGVAR(old_archive_cmds, $1)=$old_archive_cmds
+_LT_TAGVAR(reload_flag, $1)=$reload_flag
+_LT_TAGVAR(reload_cmds, $1)=$reload_cmds
+
+## CAVEAT EMPTOR:
+## There is no encapsulation within the following macros, do not change
+## the running order or otherwise move them around unless you know exactly
+## what you are doing...
+if test -n "$compiler"; then
+  _LT_COMPILER_NO_RTTI($1)
+  _LT_COMPILER_PIC($1)
+  _LT_COMPILER_C_O($1)
+  _LT_COMPILER_FILE_LOCKS($1)
+  _LT_LINKER_SHLIBS($1)
+  _LT_LINKER_HARDCODE_LIBPATH($1)
+
+  _LT_CONFIG($1)
+fi
+
+AC_LANG_RESTORE
+
+GCC=$lt_save_GCC
+CC=$lt_save_CC
+CFLAGS=$lt_save_CFLAGS
+])# _LT_LANG_GO_CONFIG
+
+
 # _LT_LANG_RC_CONFIG([TAG])
 # -------------------------
 # Ensure that the configuration variables for the Windows resource compiler
@@ -6946,9 +7599,11 @@ _LT_LINKER_BOILERPLATE
 
 # Allow CC to be a program name with arguments.
 lt_save_CC="$CC"
+lt_save_CFLAGS=$CFLAGS
 lt_save_GCC=$GCC
 GCC=
 CC=${RC-"windres"}
+CFLAGS=
 compiler=$CC
 _LT_TAGVAR(compiler, $1)=$CC
 _LT_CC_BASENAME([$compiler])
@@ -6961,7 +7616,8 @@ fi
 
 GCC=$lt_save_GCC
 AC_LANG_RESTORE
-CC="$lt_save_CC"
+CC=$lt_save_CC
+CFLAGS=$lt_save_CFLAGS
 ])# _LT_LANG_RC_CONFIG
 
 
@@ -6981,6 +7637,13 @@ dnl aclocal-1.4 backwards compatibility:
 dnl AC_DEFUN([LT_AC_PROG_GCJ], [])
 
 
+# LT_PROG_GO
+# ----------
+AC_DEFUN([LT_PROG_GO],
+[AC_CHECK_TOOL(GOC, gccgo,)
+])
+
+
 # LT_PROG_RC
 # ----------
 AC_DEFUN([LT_PROG_RC],
@@ -7020,6 +7683,15 @@ _LT_DECL([], [OBJDUMP], [1], [An object symbol dumper])
 AC_SUBST([OBJDUMP])
 ])
 
+# _LT_DECL_DLLTOOL
+# ----------------
+# Ensure DLLTOOL variable is set.
+m4_defun([_LT_DECL_DLLTOOL],
+[AC_CHECK_TOOL(DLLTOOL, dlltool, false)
+test -z "$DLLTOOL" && DLLTOOL=dlltool
+_LT_DECL([], [DLLTOOL], [1], [DLL creation program])
+AC_SUBST([DLLTOOL])
+])
 
 # _LT_DECL_SED
 # ------------
@@ -7113,8 +7785,8 @@ m4_defun([_LT_CHECK_SHELL_FEATURES],
 # Try some XSI features
 xsi_shell=no
 ( _lt_dummy="a/b/c"
-  test "${_lt_dummy##*/},${_lt_dummy%/*},"${_lt_dummy%"$_lt_dummy"}, \
-      = c,a/b,, \
+  test "${_lt_dummy##*/},${_lt_dummy%/*},${_lt_dummy#??}"${_lt_dummy%"$_lt_dummy"}, \
+      = c,a/b,b/c, \
     && eval 'test $(( 1 + 1 )) -eq 2 \
     && test "${#_lt_dummy}" -eq 5' ) >/dev/null 2>&1 \
   && xsi_shell=yes
@@ -7153,208 +7825,162 @@ _LT_DECL([NL2SP], [lt_NL2SP], [1], [turn newlines into spaces])dnl
 ])# _LT_CHECK_SHELL_FEATURES
 
 
-# _LT_PROG_XSI_SHELLFNS
-# ---------------------
-# Bourne and XSI compatible variants of some useful shell functions.
-m4_defun([_LT_PROG_XSI_SHELLFNS],
-[case $xsi_shell in
-  yes)
-    cat << \_LT_EOF >> "$cfgfile"
-
-# func_dirname file append nondir_replacement
-# Compute the dirname of FILE.  If nonempty, add APPEND to the result,
-# otherwise set result to NONDIR_REPLACEMENT.
-func_dirname ()
-{
-  case ${1} in
-    */*) func_dirname_result="${1%/*}${2}" ;;
-    *  ) func_dirname_result="${3}" ;;
-  esac
-}
-
-# func_basename file
-func_basename ()
-{
-  func_basename_result="${1##*/}"
-}
-
-# func_dirname_and_basename file append nondir_replacement
-# perform func_basename and func_dirname in a single function
-# call:
-#   dirname:  Compute the dirname of FILE.  If nonempty,
-#             add APPEND to the result, otherwise set result
-#             to NONDIR_REPLACEMENT.
-#             value returned in "$func_dirname_result"
-#   basename: Compute filename of FILE.
-#             value retuned in "$func_basename_result"
-# Implementation must be kept synchronized with func_dirname
-# and func_basename. For efficiency, we do not delegate to
-# those functions but instead duplicate the functionality here.
-func_dirname_and_basename ()
-{
-  case ${1} in
-    */*) func_dirname_result="${1%/*}${2}" ;;
-    *  ) func_dirname_result="${3}" ;;
-  esac
-  func_basename_result="${1##*/}"
-}
-
-# func_stripname prefix suffix name
-# strip PREFIX and SUFFIX off of NAME.
-# PREFIX and SUFFIX must not contain globbing or regex special
-# characters, hashes, percent signs, but SUFFIX may contain a leading
-# dot (in which case that matches only a dot).
-func_stripname ()
-{
-  # pdksh 5.2.14 does not do ${X%$Y} correctly if both X and Y are
-  # positional parameters, so assign one to ordinary parameter first.
-  func_stripname_result=${3}
-  func_stripname_result=${func_stripname_result#"${1}"}
-  func_stripname_result=${func_stripname_result%"${2}"}
-}
-
-# func_opt_split
-func_opt_split ()
-{
-  func_opt_split_opt=${1%%=*}
-  func_opt_split_arg=${1#*=}
-}
-
-# func_lo2o object
-func_lo2o ()
-{
-  case ${1} in
-    *.lo) func_lo2o_result=${1%.lo}.${objext} ;;
-    *)    func_lo2o_result=${1} ;;
-  esac
-}
-
-# func_xform libobj-or-source
-func_xform ()
-{
-  func_xform_result=${1%.*}.lo
-}
-
-# func_arith arithmetic-term...
-func_arith ()
-{
-  func_arith_result=$(( $[*] ))
-}
-
-# func_len string
-# STRING may not start with a hyphen.
-func_len ()
-{
-  func_len_result=${#1}
-}
+# _LT_PROG_FUNCTION_REPLACE (FUNCNAME, REPLACEMENT-BODY)
+# ------------------------------------------------------
+# In `$cfgfile', look for function FUNCNAME delimited by `^FUNCNAME ()$' and
+# '^} FUNCNAME ', and replace its body with REPLACEMENT-BODY.
+m4_defun([_LT_PROG_FUNCTION_REPLACE],
+[dnl {
+sed -e '/^$1 ()$/,/^} # $1 /c\
+$1 ()\
+{\
+m4_bpatsubsts([$2], [$], [\\], [^\([	 ]\)], [\\\1])
+} # Extended-shell $1 implementation' "$cfgfile" > $cfgfile.tmp \
+  && mv -f "$cfgfile.tmp" "$cfgfile" \
+    || (rm -f "$cfgfile" && cp "$cfgfile.tmp" "$cfgfile" && rm -f "$cfgfile.tmp")
+test 0 -eq $? || _lt_function_replace_fail=:
+])
 
-_LT_EOF
-    ;;
-  *) # Bourne compatible functions.
-    cat << \_LT_EOF >> "$cfgfile"
 
-# func_dirname file append nondir_replacement
-# Compute the dirname of FILE.  If nonempty, add APPEND to the result,
-# otherwise set result to NONDIR_REPLACEMENT.
-func_dirname ()
-{
-  # Extract subdirectory from the argument.
-  func_dirname_result=`$ECHO "X${1}" | $Xsed -e "$dirname"`
-  if test "X$func_dirname_result" = "X${1}"; then
-    func_dirname_result="${3}"
-  else
-    func_dirname_result="$func_dirname_result${2}"
-  fi
-}
+# _LT_PROG_REPLACE_SHELLFNS
+# -------------------------
+# Replace existing portable implementations of several shell functions with
+# equivalent extended shell implementations where those features are available..
+m4_defun([_LT_PROG_REPLACE_SHELLFNS],
+[if test x"$xsi_shell" = xyes; then
+  _LT_PROG_FUNCTION_REPLACE([func_dirname], [dnl
+    case ${1} in
+      */*) func_dirname_result="${1%/*}${2}" ;;
+      *  ) func_dirname_result="${3}" ;;
+    esac])
+
+  _LT_PROG_FUNCTION_REPLACE([func_basename], [dnl
+    func_basename_result="${1##*/}"])
+
+  _LT_PROG_FUNCTION_REPLACE([func_dirname_and_basename], [dnl
+    case ${1} in
+      */*) func_dirname_result="${1%/*}${2}" ;;
+      *  ) func_dirname_result="${3}" ;;
+    esac
+    func_basename_result="${1##*/}"])
 
-# func_basename file
-func_basename ()
-{
-  func_basename_result=`$ECHO "X${1}" | $Xsed -e "$basename"`
-}
+  _LT_PROG_FUNCTION_REPLACE([func_stripname], [dnl
+    # pdksh 5.2.14 does not do ${X%$Y} correctly if both X and Y are
+    # positional parameters, so assign one to ordinary parameter first.
+    func_stripname_result=${3}
+    func_stripname_result=${func_stripname_result#"${1}"}
+    func_stripname_result=${func_stripname_result%"${2}"}])
 
-dnl func_dirname_and_basename
-dnl A portable version of this function is already defined in general.m4sh
-dnl so there is no need for it here.
+  _LT_PROG_FUNCTION_REPLACE([func_split_long_opt], [dnl
+    func_split_long_opt_name=${1%%=*}
+    func_split_long_opt_arg=${1#*=}])
 
-# func_stripname prefix suffix name
-# strip PREFIX and SUFFIX off of NAME.
-# PREFIX and SUFFIX must not contain globbing or regex special
-# characters, hashes, percent signs, but SUFFIX may contain a leading
-# dot (in which case that matches only a dot).
-# func_strip_suffix prefix name
-func_stripname ()
-{
-  case ${2} in
-    .*) func_stripname_result=`$ECHO "X${3}" \
-           | $Xsed -e "s%^${1}%%" -e "s%\\\\${2}\$%%"`;;
-    *)  func_stripname_result=`$ECHO "X${3}" \
-           | $Xsed -e "s%^${1}%%" -e "s%${2}\$%%"`;;
-  esac
-}
+  _LT_PROG_FUNCTION_REPLACE([func_split_short_opt], [dnl
+    func_split_short_opt_arg=${1#??}
+    func_split_short_opt_name=${1%"$func_split_short_opt_arg"}])
 
-# sed scripts:
-my_sed_long_opt='1s/^\(-[[^=]]*\)=.*/\1/;q'
-my_sed_long_arg='1s/^-[[^=]]*=//'
+  _LT_PROG_FUNCTION_REPLACE([func_lo2o], [dnl
+    case ${1} in
+      *.lo) func_lo2o_result=${1%.lo}.${objext} ;;
+      *)    func_lo2o_result=${1} ;;
+    esac])
 
-# func_opt_split
-func_opt_split ()
-{
-  func_opt_split_opt=`$ECHO "X${1}" | $Xsed -e "$my_sed_long_opt"`
-  func_opt_split_arg=`$ECHO "X${1}" | $Xsed -e "$my_sed_long_arg"`
-}
+  _LT_PROG_FUNCTION_REPLACE([func_xform], [    func_xform_result=${1%.*}.lo])
 
-# func_lo2o object
-func_lo2o ()
-{
-  func_lo2o_result=`$ECHO "X${1}" | $Xsed -e "$lo2o"`
-}
+  _LT_PROG_FUNCTION_REPLACE([func_arith], [    func_arith_result=$(( $[*] ))])
 
-# func_xform libobj-or-source
-func_xform ()
-{
-  func_xform_result=`$ECHO "X${1}" | $Xsed -e 's/\.[[^.]]*$/.lo/'`
-}
+  _LT_PROG_FUNCTION_REPLACE([func_len], [    func_len_result=${#1}])
+fi
 
-# func_arith arithmetic-term...
-func_arith ()
-{
-  func_arith_result=`expr "$[@]"`
-}
+if test x"$lt_shell_append" = xyes; then
+  _LT_PROG_FUNCTION_REPLACE([func_append], [    eval "${1}+=\\${2}"])
 
-# func_len string
-# STRING may not start with a hyphen.
-func_len ()
-{
-  func_len_result=`expr "$[1]" : ".*" 2>/dev/null || echo $max_cmd_len`
-}
+  _LT_PROG_FUNCTION_REPLACE([func_append_quoted], [dnl
+    func_quote_for_eval "${2}"
+dnl m4 expansion turns \\\\ into \\, and then the shell eval turns that into \
+    eval "${1}+=\\\\ \\$func_quote_for_eval_result"])
 
-_LT_EOF
-esac
+  # Save a `func_append' function call where possible by direct use of '+='
+  sed -e 's%func_append \([[a-zA-Z_]]\{1,\}\) "%\1+="%g' $cfgfile > $cfgfile.tmp \
+    && mv -f "$cfgfile.tmp" "$cfgfile" \
+      || (rm -f "$cfgfile" && cp "$cfgfile.tmp" "$cfgfile" && rm -f "$cfgfile.tmp")
+  test 0 -eq $? || _lt_function_replace_fail=:
+else
+  # Save a `func_append' function call even when '+=' is not available
+  sed -e 's%func_append \([[a-zA-Z_]]\{1,\}\) "%\1="$\1%g' $cfgfile > $cfgfile.tmp \
+    && mv -f "$cfgfile.tmp" "$cfgfile" \
+      || (rm -f "$cfgfile" && cp "$cfgfile.tmp" "$cfgfile" && rm -f "$cfgfile.tmp")
+  test 0 -eq $? || _lt_function_replace_fail=:
+fi
 
-case $lt_shell_append in
-  yes)
-    cat << \_LT_EOF >> "$cfgfile"
+if test x"$_lt_function_replace_fail" = x":"; then
+  AC_MSG_WARN([Unable to substitute extended shell functions in $ofile])
+fi
+])
 
-# func_append var value
-# Append VALUE to the end of shell variable VAR.
-func_append ()
-{
-  eval "$[1]+=\$[2]"
-}
-_LT_EOF
+# _LT_PATH_CONVERSION_FUNCTIONS
+# -----------------------------
+# Determine which file name conversion functions should be used by
+# func_to_host_file (and, implicitly, by func_to_host_path).  These are needed
+# for certain cross-compile configurations and native mingw.
+m4_defun([_LT_PATH_CONVERSION_FUNCTIONS],
+[AC_REQUIRE([AC_CANONICAL_HOST])dnl
+AC_REQUIRE([AC_CANONICAL_BUILD])dnl
+AC_MSG_CHECKING([how to convert $build file names to $host format])
+AC_CACHE_VAL(lt_cv_to_host_file_cmd,
+[case $host in
+  *-*-mingw* )
+    case $build in
+      *-*-mingw* ) # actually msys
+        lt_cv_to_host_file_cmd=func_convert_file_msys_to_w32
+        ;;
+      *-*-cygwin* )
+        lt_cv_to_host_file_cmd=func_convert_file_cygwin_to_w32
+        ;;
+      * ) # otherwise, assume *nix
+        lt_cv_to_host_file_cmd=func_convert_file_nix_to_w32
+        ;;
+    esac
     ;;
-  *)
-    cat << \_LT_EOF >> "$cfgfile"
-
-# func_append var value
-# Append VALUE to the end of shell variable VAR.
-func_append ()
-{
-  eval "$[1]=\$$[1]\$[2]"
-}
-
-_LT_EOF
+  *-*-cygwin* )
+    case $build in
+      *-*-mingw* ) # actually msys
+        lt_cv_to_host_file_cmd=func_convert_file_msys_to_cygwin
+        ;;
+      *-*-cygwin* )
+        lt_cv_to_host_file_cmd=func_convert_file_noop
+        ;;
+      * ) # otherwise, assume *nix
+        lt_cv_to_host_file_cmd=func_convert_file_nix_to_cygwin
+        ;;
+    esac
     ;;
-  esac
+  * ) # unhandled hosts (and "normal" native builds)
+    lt_cv_to_host_file_cmd=func_convert_file_noop
+    ;;
+esac
+])
+to_host_file_cmd=$lt_cv_to_host_file_cmd
+AC_MSG_RESULT([$lt_cv_to_host_file_cmd])
+_LT_DECL([to_host_file_cmd], [lt_cv_to_host_file_cmd],
+         [0], [convert $build file names to $host format])dnl
+
+AC_MSG_CHECKING([how to convert $build file names to toolchain format])
+AC_CACHE_VAL(lt_cv_to_tool_file_cmd,
+[#assume ordinary cross tools, or native build.
+lt_cv_to_tool_file_cmd=func_convert_file_noop
+case $host in
+  *-*-mingw* )
+    case $build in
+      *-*-mingw* ) # actually msys
+        lt_cv_to_tool_file_cmd=func_convert_file_msys_to_w32
+        ;;
+    esac
+    ;;
+esac
 ])
+to_tool_file_cmd=$lt_cv_to_tool_file_cmd
+AC_MSG_RESULT([$lt_cv_to_tool_file_cmd])
+_LT_DECL([to_tool_file_cmd], [lt_cv_to_tool_file_cmd],
+         [0], [convert $build files to toolchain format])dnl
+])# _LT_PATH_CONVERSION_FUNCTIONS
diff --git a/m4/ltoptions.m4 b/m4/ltoptions.m4
index 34151a3..5d9acd8 100644
--- a/m4/ltoptions.m4
+++ b/m4/ltoptions.m4
@@ -1,13 +1,14 @@
 # Helper functions for option handling.                    -*- Autoconf -*-
 #
-#   Copyright (C) 2004, 2005, 2007, 2008 Free Software Foundation, Inc.
+#   Copyright (C) 2004, 2005, 2007, 2008, 2009 Free Software Foundation,
+#   Inc.
 #   Written by Gary V. Vaughan, 2004
 #
 # This file is free software; the Free Software Foundation gives
 # unlimited permission to copy and/or distribute it, with or without
 # modifications, as long as this notice is preserved.
 
-# serial 6 ltoptions.m4
+# serial 7 ltoptions.m4
 
 # This is to help aclocal find these macros, as it can't see m4_define.
 AC_DEFUN([LTOPTIONS_VERSION], [m4_if([1])])
@@ -125,7 +126,7 @@ LT_OPTION_DEFINE([LT_INIT], [win32-dll],
 [enable_win32_dll=yes
 
 case $host in
-*-*-cygwin* | *-*-mingw* | *-*-pw32* | *-cegcc*)
+*-*-cygwin* | *-*-mingw* | *-*-pw32* | *-*-cegcc*)
   AC_CHECK_TOOL(AS, as, false)
   AC_CHECK_TOOL(DLLTOOL, dlltool, false)
   AC_CHECK_TOOL(OBJDUMP, objdump, false)
@@ -133,13 +134,13 @@ case $host in
 esac
 
 test -z "$AS" && AS=as
-_LT_DECL([], [AS],      [0], [Assembler program])dnl
+_LT_DECL([], [AS],      [1], [Assembler program])dnl
 
 test -z "$DLLTOOL" && DLLTOOL=dlltool
-_LT_DECL([], [DLLTOOL], [0], [DLL creation program])dnl
+_LT_DECL([], [DLLTOOL], [1], [DLL creation program])dnl
 
 test -z "$OBJDUMP" && OBJDUMP=objdump
-_LT_DECL([], [OBJDUMP], [0], [Object dumper program])dnl
+_LT_DECL([], [OBJDUMP], [1], [Object dumper program])dnl
 ])# win32-dll
 
 AU_DEFUN([AC_LIBTOOL_WIN32_DLL],
@@ -325,9 +326,24 @@ dnl AC_DEFUN([AM_DISABLE_FAST_INSTALL], [])
 # MODE is either `yes' or `no'.  If omitted, it defaults to `both'.
 m4_define([_LT_WITH_PIC],
 [AC_ARG_WITH([pic],
-    [AS_HELP_STRING([--with-pic],
+    [AS_HELP_STRING([--with-pic@<:@=PKGS@:>@],
 	[try to use only PIC/non-PIC objects @<:@default=use both@:>@])],
-    [pic_mode="$withval"],
+    [lt_p=${PACKAGE-default}
+    case $withval in
+    yes|no) pic_mode=$withval ;;
+    *)
+      pic_mode=default
+      # Look at the argument we got.  We use all the common list separators.
+      lt_save_ifs="$IFS"; IFS="${IFS}$PATH_SEPARATOR,"
+      for lt_pkg in $withval; do
+	IFS="$lt_save_ifs"
+	if test "X$lt_pkg" = "X$lt_p"; then
+	  pic_mode=yes
+	fi
+      done
+      IFS="$lt_save_ifs"
+      ;;
+    esac],
     [pic_mode=default])
 
 test -z "$pic_mode" && pic_mode=m4_default([$1], [default])
diff --git a/m4/ltversion.m4 b/m4/ltversion.m4
index f3c5309..07a8602 100644
--- a/m4/ltversion.m4
+++ b/m4/ltversion.m4
@@ -7,17 +7,17 @@
 # unlimited permission to copy and/or distribute it, with or without
 # modifications, as long as this notice is preserved.
 
-# Generated from ltversion.in.
+# @configure_input@
 
-# serial 3017 ltversion.m4
+# serial 3337 ltversion.m4
 # This file is part of GNU Libtool
 
-m4_define([LT_PACKAGE_VERSION], [2.2.6b])
-m4_define([LT_PACKAGE_REVISION], [1.3017])
+m4_define([LT_PACKAGE_VERSION], [2.4.2])
+m4_define([LT_PACKAGE_REVISION], [1.3337])
 
 AC_DEFUN([LTVERSION_VERSION],
-[macro_version='2.2.6b'
-macro_revision='1.3017'
+[macro_version='2.4.2'
+macro_revision='1.3337'
 _LT_DECL(, macro_version, 0, [Which release of libtool.m4 was used?])
 _LT_DECL(, macro_revision, 0)
 ])
diff --git a/m4/lt~obsolete.m4 b/m4/lt~obsolete.m4
index 637bb20..c573da9 100644
--- a/m4/lt~obsolete.m4
+++ b/m4/lt~obsolete.m4
@@ -1,13 +1,13 @@
 # lt~obsolete.m4 -- aclocal satisfying obsolete definitions.    -*-Autoconf-*-
 #
-#   Copyright (C) 2004, 2005, 2007 Free Software Foundation, Inc.
+#   Copyright (C) 2004, 2005, 2007, 2009 Free Software Foundation, Inc.
 #   Written by Scott James Remnant, 2004.
 #
 # This file is free software; the Free Software Foundation gives
 # unlimited permission to copy and/or distribute it, with or without
 # modifications, as long as this notice is preserved.
 
-# serial 4 lt~obsolete.m4
+# serial 5 lt~obsolete.m4
 
 # These exist entirely to fool aclocal when bootstrapping libtool.
 #
@@ -77,7 +77,6 @@ m4_ifndef([AC_DISABLE_FAST_INSTALL],	[AC_DEFUN([AC_DISABLE_FAST_INSTALL])])
 m4_ifndef([_LT_AC_LANG_CXX],		[AC_DEFUN([_LT_AC_LANG_CXX])])
 m4_ifndef([_LT_AC_LANG_F77],		[AC_DEFUN([_LT_AC_LANG_F77])])
 m4_ifndef([_LT_AC_LANG_GCJ],		[AC_DEFUN([_LT_AC_LANG_GCJ])])
-m4_ifndef([AC_LIBTOOL_RC],		[AC_DEFUN([AC_LIBTOOL_RC])])
 m4_ifndef([AC_LIBTOOL_LANG_C_CONFIG],	[AC_DEFUN([AC_LIBTOOL_LANG_C_CONFIG])])
 m4_ifndef([_LT_AC_LANG_C_CONFIG],	[AC_DEFUN([_LT_AC_LANG_C_CONFIG])])
 m4_ifndef([AC_LIBTOOL_LANG_CXX_CONFIG],	[AC_DEFUN([AC_LIBTOOL_LANG_CXX_CONFIG])])
@@ -90,3 +89,10 @@ m4_ifndef([AC_LIBTOOL_LANG_RC_CONFIG],	[AC_DEFUN([AC_LIBTOOL_LANG_RC_CONFIG])])
 m4_ifndef([_LT_AC_LANG_RC_CONFIG],	[AC_DEFUN([_LT_AC_LANG_RC_CONFIG])])
 m4_ifndef([AC_LIBTOOL_CONFIG],		[AC_DEFUN([AC_LIBTOOL_CONFIG])])
 m4_ifndef([_LT_AC_FILE_LTDLL_C],	[AC_DEFUN([_LT_AC_FILE_LTDLL_C])])
+m4_ifndef([_LT_REQUIRED_DARWIN_CHECKS],	[AC_DEFUN([_LT_REQUIRED_DARWIN_CHECKS])])
+m4_ifndef([_LT_AC_PROG_CXXCPP],		[AC_DEFUN([_LT_AC_PROG_CXXCPP])])
+m4_ifndef([_LT_PREPARE_SED_QUOTE_VARS],	[AC_DEFUN([_LT_PREPARE_SED_QUOTE_VARS])])
+m4_ifndef([_LT_PROG_ECHO_BACKSLASH],	[AC_DEFUN([_LT_PROG_ECHO_BACKSLASH])])
+m4_ifndef([_LT_PROG_F77],		[AC_DEFUN([_LT_PROG_F77])])
+m4_ifndef([_LT_PROG_FC],		[AC_DEFUN([_LT_PROG_FC])])
+m4_ifndef([_LT_PROG_CXX],		[AC_DEFUN([_LT_PROG_CXX])])
diff --git a/missing b/missing
index 28055d2..86a8fc3 100755
--- a/missing
+++ b/missing
@@ -1,10 +1,10 @@
 #! /bin/sh
 # Common stub for a few missing GNU programs while installing.
 
-scriptversion=2009-04-28.21; # UTC
+scriptversion=2012-01-06.13; # UTC
 
 # Copyright (C) 1996, 1997, 1999, 2000, 2002, 2003, 2004, 2005, 2006,
-# 2008, 2009 Free Software Foundation, Inc.
+# 2008, 2009, 2010, 2011, 2012 Free Software Foundation, Inc.
 # Originally by Fran,cois Pinard <pinard at iro.umontreal.ca>, 1996.
 
 # This program is free software; you can redistribute it and/or modify
@@ -84,7 +84,6 @@ Supported PROGRAM values:
   help2man     touch the output file
   lex          create \`lex.yy.c', if possible, from existing .c
   makeinfo     touch the output file
-  tar          try tar, gnutar, gtar, then tar without non-portable flags
   yacc         create \`y.tab.[ch]', if possible, from existing .[ch]
 
 Version suffixes to PROGRAM as well as the prefixes \`gnu-', \`gnu', and
@@ -122,15 +121,6 @@ case $1 in
     # Not GNU programs, they don't have --version.
     ;;
 
-  tar*)
-    if test -n "$run"; then
-       echo 1>&2 "ERROR: \`tar' requires --run"
-       exit 1
-    elif test "x$2" = "x--version" || test "x$2" = "x--help"; then
-       exit 1
-    fi
-    ;;
-
   *)
     if test -z "$run" && ($1 --version) > /dev/null 2>&1; then
        # We have it, but it failed.
@@ -226,7 +216,7 @@ WARNING: \`$1' $msg.  You should only need it if
          \`Bison' from any GNU archive site."
     rm -f y.tab.c y.tab.h
     if test $# -ne 1; then
-        eval LASTARG="\${$#}"
+        eval LASTARG=\${$#}
 	case $LASTARG in
 	*.y)
 	    SRCFILE=`echo "$LASTARG" | sed 's/y$/c/'`
@@ -256,7 +246,7 @@ WARNING: \`$1' is $msg.  You should only need it if
          \`Flex' from any GNU archive site."
     rm -f lex.yy.c
     if test $# -ne 1; then
-        eval LASTARG="\${$#}"
+        eval LASTARG=\${$#}
 	case $LASTARG in
 	*.l)
 	    SRCFILE=`echo "$LASTARG" | sed 's/l$/c/'`
@@ -318,41 +308,6 @@ WARNING: \`$1' is $msg.  You should only need it if
     touch $file
     ;;
 
-  tar*)
-    shift
-
-    # We have already tried tar in the generic part.
-    # Look for gnutar/gtar before invocation to avoid ugly error
-    # messages.
-    if (gnutar --version > /dev/null 2>&1); then
-       gnutar "$@" && exit 0
-    fi
-    if (gtar --version > /dev/null 2>&1); then
-       gtar "$@" && exit 0
-    fi
-    firstarg="$1"
-    if shift; then
-	case $firstarg in
-	*o*)
-	    firstarg=`echo "$firstarg" | sed s/o//`
-	    tar "$firstarg" "$@" && exit 0
-	    ;;
-	esac
-	case $firstarg in
-	*h*)
-	    firstarg=`echo "$firstarg" | sed s/h//`
-	    tar "$firstarg" "$@" && exit 0
-	    ;;
-	esac
-    fi
-
-    echo 1>&2 "\
-WARNING: I can't seem to be able to run \`tar' with the given arguments.
-         You may want to install GNU tar or Free paxutils, or check the
-         command line arguments."
-    exit 1
-    ;;
-
   *)
     echo 1>&2 "\
 WARNING: \`$1' is needed, and is $msg.
diff --git a/tests/compat.sh.in b/tests/compat.sh.in
index 90971bd..ee924d5 100644
--- a/tests/compat.sh.in
+++ b/tests/compat.sh.in
@@ -6,7 +6,7 @@ DIR=../bin
 JF=$DIR/jellyfish
 
 check () {
-    cut -d\  -f 2 $1 | xargs @MD5@ | sort | diff -w $1 -
+    cut -d\  -f 2 $1 | xargs @MD5@ | sed -e 's/ \*//' | sort | diff -w $1 -
 }
 
 if [ -n "$DEBUG" ]; then
diff --git a/tests/parallel_direct_indexing.sh b/tests/parallel_direct_indexing.sh
index e6d3bec..ef7e046 100755
--- a/tests/parallel_direct_indexing.sh
+++ b/tests/parallel_direct_indexing.sh
@@ -5,15 +5,26 @@ cd tests
 
 sort > ${pref}.md5sum <<EOF
 dcbb23c4a74a923c37a3b059f6a6d89a ${pref}_0
+7b7419dea9e3917c2e27b7a7a35f64ca ${pref}.histo
+7b7419dea9e3917c2e27b7a7a35f64ca ${pref}_S.histo
 8ac9533ccb34203fdac1f80b58774898 ${pref}.stats
+8c9400cd7064ea24374fe68817da9926 ${pref}_LU.histo
 EOF
-echo "Counting 10-mers on ${nCPUs} CPU" && \
-    $JF count --matrix seq10m_matrix_10 -m 10 -t $nCPUs \
+
+echo "Counting 10-mers on ${nCPUs} CPU"
+$JF count --matrix seq10m_matrix_10 -m 10 -t $nCPUs \
     -o $pref -s 10000000 --timing ${pref}.timing \
-    --stats ${pref}.stats seq10m.fa && \
-    check ${pref}.md5sum
-RET=$?
+    --stats ${pref}.stats seq10m.fa
+$JF count --matrix seq10m_matrix_10 -m 10 -t $nCPUs \
+    -o /dev/fd/1 -O -s 10M seq10m.fa | cat > ${pref}_S
+$JF count --matrix seq10m_matrix_10 -m 10 -t $nCPUs \
+    -o ${pref}_LU -s 10M -C -L 2 -U 4 seq1m_0.fa
+
+$JF histo ${pref}_0 > ${pref}.histo
+$JF histo ${pref}_S > ${pref}_S.histo
+$JF histo ${pref}_LU_0 > ${pref}_LU.histo
+
+check ${pref}.md5sum
 
 cat ${pref}.timing
 
-exit $RET
diff --git a/tests/parallel_fastq_direct_indexing.sh b/tests/parallel_fastq_direct_indexing.sh
new file mode 100644
index 0000000..d69aae5
--- /dev/null
+++ b/tests/parallel_fastq_direct_indexing.sh
@@ -0,0 +1,28 @@
+#! /bin/sh
+
+cd tests
+. ./compat.sh
+
+sort > ${pref}.md5sum <<EOF
+8bfdd1b137b73ebfed05d0496bbddd0c ${pref}.histo
+9418b1a2e05a2526a81ae9b1200ed5df ${pref}_Q.histo
+768e261fc7d7ede192f4a0eeae6e839f ${pref}_LU.histo
+EOF
+
+echo "Counting 10-mers on ${nCPUs} CPU"
+$JF count --matrix seq10m_matrix_10 -m 10 -t $nCPUs \
+    -o $pref -s 10M -C --timing ${pref}.timing seq1m_0.fq
+$JF count --matrix seq10m_matrix_10 -m 10 -t $nCPUs \
+    --quality-start 64 --min-quality 5 \
+    -o ${pref}_Q -s 10M -C seq1m_0.fq
+$JF count --matrix seq10m_matrix_10 -m 10 -t $nCPUs \
+    -L 2 -U 4 -o ${pref}_LU -s 10M -C seq1m_0.fq
+
+$JF histo ${pref}_0 > ${pref}.histo
+$JF histo ${pref}_Q_0 > ${pref}_Q.histo
+$JF histo ${pref}_LU_0 > ${pref}_LU.histo
+
+check ${pref}.md5sum
+
+cat ${pref}.timing
+
diff --git a/tests/parallel_fastq_hashing.sh b/tests/parallel_fastq_hashing.sh
index dcb02d1..e01b6fd 100644
--- a/tests/parallel_fastq_hashing.sh
+++ b/tests/parallel_fastq_hashing.sh
@@ -8,15 +8,13 @@ c448e173e5e18264ed00fad0008d5340 ${pref}.histo
 554c9c76fb1f54f2c7526dd1af5aa252 ${pref}_lines.dump
 174c7b3873c8aaa5ffee36d5d405bbce ${pref}.stats
 EOF
-echo "Counting 19-mers qmers, on ${nCPUs} CPU" && \
-    $JF count --quake --matrix seq10m_matrix_19 -m 19 -t $nCPUs \
-    -o $pref -s 10000000 --timing ${pref}.timing --stats ${pref}.stats \
-    seq10m.fq && \
-    $JF qhisto -f -h 3 -i 0.01 -l 0 ${pref}_0 > ${pref}.histo && \
-    $JF qdump -c -L 0.035 -U 0.905 ${pref}_0 | wc -l | awk '{ print $1 }' > ${pref}_lines.dump && \
-    check ${pref}.md5sum
-RET=$?
+
+echo "Counting 19-mers qmers, on ${nCPUs} CPU"
+$JF count --quake --matrix seq10m_matrix_19 -m 19 -t $nCPUs \
+    -o $pref -s 10000000 --timing ${pref}.timing --stats ${pref}.stats seq10m.fq
+$JF qhisto -f -h 3 -i 0.01 -l 0 ${pref}_0 > ${pref}.histo
+$JF qdump -c -L 0.035 -U 0.905 ${pref}_0 | wc -l | awk '{ print $1 }' > ${pref}_lines.dump
+check ${pref}.md5sum
 
 cat ${pref}.timing
 
-exit $RET
diff --git a/tests/parallel_hashing.sh b/tests/parallel_hashing.sh
index 7b30182..6ff008f 100755
--- a/tests/parallel_hashing.sh
+++ b/tests/parallel_hashing.sh
@@ -9,20 +9,33 @@ sort > ${pref}.md5sum <<EOF
 c3233e107bb6b42d0c979707f156264c ${pref}.query
 dbe881e4649406321d0e481da08eab5c ${pref}_L.dump
 dbe881e4649406321d0e481da08eab5c ${pref}.dump
+dbe881e4649406321d0e481da08eab5c ${pref}_stream.dump
+77054a9564aaf59fb330dfa6af92b428 ${pref}_all.dump
+77054a9564aaf59fb330dfa6af92b428 ${pref}_S_all.dump
 a210906960cf36c09eecad62a4c04973 ${pref}.stats
 EOF
-echo "Counting 22-mers on ${nCPUs} CPU" &&      \
-    $JF count --matrix seq10m_matrix_22 -m 22 -t $nCPUs -o $pref \
-    -s 10000000 --timing ${pref}.timing --stats ${pref}.stats seq10m.fa && \
-    $JF count --matrix seq10m_matrix_22 -m 22 -t $nCPUs -o ${pref}_L \
-    -s 10000000 --timing ${pref}.timing -L 2 seq10m.fa && \
-    $JF histo -f ${pref}_0 > ${pref}.histo &&      \
-    $JF dump -c ${pref}_L_0 > ${pref}_L.dump && \
-    $JF dump -c -L 2 ${pref}_0 > ${pref}.dump && \
-    echo "GCCATTTCGATTAAAGAATGAT TAGGCATGCAACGCTTCCCTTT" | $JF query ${pref}_0 > ${pref}.query && \
-    check ${pref}.md5sum
-RET=$?
+echo "Counting 22-mers on ${nCPUs} CPU"
+
+# Count all k-mers
+$JF count --matrix seq10m_matrix_22 -m 22 -t $nCPUs -o $pref \
+    -s 10000000 --timing ${pref}.timing --stats ${pref}.stats seq10m.fa
+# Output only counts >= 2
+$JF count --matrix seq10m_matrix_22 -m 22 -t $nCPUs -o ${pref}_L \
+    -s 10000000 --timing ${pref}.timing -L 2 seq10m.fa
+# Stream output
+$JF count --matrix seq10m_matrix_22 -m 22 -t $nCPUs -o /dev/fd/1 -O \
+    -s 10000000 --timing ${pref}.timing --stats ${pref}.stats seq10m.fa | \
+    cat > ${pref}_S
+
+$JF histo -f ${pref}_0 > ${pref}.histo
+$JF dump -c ${pref}_L_0 > ${pref}_L.dump
+$JF dump -c -L 2 ${pref}_0 > ${pref}.dump
+cat ${pref}_0 | $JF dump -c -L 2 /dev/fd/0 > ${pref}_stream.dump
+echo "GCCATTTCGATTAAAGAATGAT TAGGCATGCAACGCTTCCCTTT" | $JF query ${pref}_0 > ${pref}.query
+$JF dump -c ${pref}_0 > ${pref}_all.dump
+$JF dump -c ${pref}_S > ${pref}_S_all.dump
+
+check ${pref}.md5sum
 
 cat ${pref}.timing
 
-exit $RET
diff --git a/unit_tests/gtest/include/gtest/internal/gtest-internal.h b/unit_tests/gtest/include/gtest/internal/gtest-internal.h
index 7aa1197..7fb3f51 100644
--- a/unit_tests/gtest/include/gtest/internal/gtest-internal.h
+++ b/unit_tests/gtest/include/gtest/internal/gtest-internal.h
@@ -56,6 +56,11 @@
 #include "gtest/internal/gtest-filepath.h"
 #include "gtest/internal/gtest-type-util.h"
 
+#ifdef __ICC
+// Disable explicit warning on Intel compiler
+#pragma warning disable 2304
+#endif
+
 // Due to C++ preprocessor weirdness, we need double indirection to
 // concatenate two tokens when one of them is __LINE__.  Writing
 //
@@ -1223,4 +1228,9 @@ class GTEST_TEST_CLASS_NAME_(test_case_name, test_name) : public parent_class {\
             GTEST_TEST_CLASS_NAME_(test_case_name, test_name)>);\
 void GTEST_TEST_CLASS_NAME_(test_case_name, test_name)::TestBody()
 
+#ifdef __ICC
+// Disable explicit warning on Intel compiler
+#pragma warning enable 2304
+#endif
+
 #endif  // GTEST_INCLUDE_GTEST_INTERNAL_GTEST_INTERNAL_H_
diff --git a/unit_tests/gtest/include/gtest/internal/gtest-port.h b/unit_tests/gtest/include/gtest/internal/gtest-port.h
index 157b47f..02aa14b 100644
--- a/unit_tests/gtest/include/gtest/internal/gtest-port.h
+++ b/unit_tests/gtest/include/gtest/internal/gtest-port.h
@@ -36,6 +36,11 @@
 #ifndef GTEST_INCLUDE_GTEST_INTERNAL_GTEST_PORT_H_
 #define GTEST_INCLUDE_GTEST_INTERNAL_GTEST_PORT_H_
 
+#ifdef __ICC
+// Disable explicit warning on Intel compiler
+#pragma warning disable 2304
+#endif
+
 // The user can define the following macros in the build script to
 // control Google Test's behavior.  If the user doesn't define a macro
 // in this list, Google Test will define it.
@@ -1772,4 +1777,9 @@ const char* StringFromGTestEnv(const char* flag, const char* default_val);
 }  // namespace internal
 }  // namespace testing
 
+#ifdef __ICC
+#pragma warning enable 2304
+#endif
+
+
 #endif  // GTEST_INCLUDE_GTEST_INTERNAL_GTEST_PORT_H_
diff --git a/unit_tests/gtest/include/gtest/internal/gtest-string.h b/unit_tests/gtest/include/gtest/internal/gtest-string.h
index dc3a07b..9657ce5 100644
--- a/unit_tests/gtest/include/gtest/internal/gtest-string.h
+++ b/unit_tests/gtest/include/gtest/internal/gtest-string.h
@@ -41,6 +41,11 @@
 #ifndef GTEST_INCLUDE_GTEST_INTERNAL_GTEST_STRING_H_
 #define GTEST_INCLUDE_GTEST_INTERNAL_GTEST_STRING_H_
 
+#ifdef __ICC
+// Disable explicit warning on Intel compiler
+#pragma warning disable 2304
+#endif
+
 #ifdef __BORLANDC__
 // string.h is not guaranteed to provide strcpy on C++ Builder.
 # include <mem.h>
@@ -347,4 +352,9 @@ String StreamableToString(const T& streamable);
 }  // namespace internal
 }  // namespace testing
 
+#ifdef __ICC
+// Disable explicit warning on Intel compiler
+#pragma warning enable 2304
+#endif
+
 #endif  // GTEST_INCLUDE_GTEST_INTERNAL_GTEST_STRING_H_
diff --git a/unit_tests/gtest/src/gtest-port.cc b/unit_tests/gtest/src/gtest-port.cc
index b860d48..6cb716f 100644
--- a/unit_tests/gtest/src/gtest-port.cc
+++ b/unit_tests/gtest/src/gtest-port.cc
@@ -65,6 +65,12 @@
 #include "src/gtest-internal-inl.h"
 #undef GTEST_IMPLEMENTATION_
 
+#ifdef __ICC
+// Disable explicit warning on Intel compiler
+#pragma warning disable 2304
+#endif
+
+
 namespace testing {
 namespace internal {
 
diff --git a/unit_tests/test_offsets_key_value.cc b/unit_tests/test_offsets_key_value.cc
index d08d464..38b6d68 100644
--- a/unit_tests/test_offsets_key_value.cc
+++ b/unit_tests/test_offsets_key_value.cc
@@ -7,165 +7,167 @@
 #include <algorithm>
 #include <jellyfish/offsets_key_value.hpp>
 
+namespace {
 #ifndef UINT64_C
 #define UINT64_C(x) ((uint64_t)x)
 #endif
 
-using namespace jellyfish;
+  using namespace jellyfish;
 
-typedef struct {
-  uint_t        key_len, val_len;
-} offset_test_param;
+  typedef struct {
+    uint_t        key_len, val_len;
+  } offset_test_param;
 
-class ComputeOffsetsTest : public ::testing::TestWithParam<offset_test_param>
-{
-public:
-  Offsets<uint64_t> offsets;
+  class ComputeOffsetsTest : public ::testing::TestWithParam<offset_test_param>
+  {
+  public:
+    Offsets<uint64_t> offsets;
 
-  ComputeOffsetsTest() :
-    offsets(GetParam().key_len, GetParam().val_len, 15)
-  { }
+    ComputeOffsetsTest() :
+      offsets(GetParam().key_len, GetParam().val_len, 15)
+    { }
 
-  ~ComputeOffsetsTest() { }
-};
+    ~ComputeOffsetsTest() { }
+  };
 
-TEST_P(ComputeOffsetsTest, CheckCoherency) {
-  const Offsets<uint64_t>::offset_t *it     = NULL, *pit = NULL;
-  const Offsets<uint64_t>::offset_t *lit    = NULL, *lpit = NULL;
-  uint_t                             k_len  = GetParam().key_len;
-  uint_t                             v_len  = GetParam().val_len;
-  uint_t                             kv_len = k_len + v_len;
-  uint_t                             lk_len = 4;
-  uint_t                             lv_len = kv_len - lk_len;
-  uint_t                             i      = 0;
-  //  uint64_t                          *w, *pw;
+  TEST_P(ComputeOffsetsTest, CheckCoherency) {
+    const Offsets<uint64_t>::offset_t *it     = NULL, *pit = NULL;
+    const Offsets<uint64_t>::offset_t *lit    = NULL, *lpit = NULL;
+    uint_t                             k_len  = GetParam().key_len;
+    uint_t                             v_len  = GetParam().val_len;
+    uint_t                             kv_len = k_len + v_len;
+    uint_t                             lk_len = 4;
+    uint_t                             lv_len = kv_len - lk_len;
+    uint_t                             i      = 0;
+    //  uint64_t                          *w, *pw;
   
-  //   /* Still missing:
-  //    * - testing of value masks
-  //    */
-  EXPECT_EQ(lk_len, this->offsets.get_reprobe_len());
-  EXPECT_EQ(lv_len, this->offsets.get_lval_len());
+    //   /* Still missing:
+    //    * - testing of value masks
+    //    */
+    EXPECT_EQ(lk_len, this->offsets.get_reprobe_len());
+    EXPECT_EQ(lv_len, this->offsets.get_lval_len());
   
-  for(i = 0; true; i++) {
-    this->offsets.get_word_offset(i, &it, &lit, NULL);
-    if(i > 0) {
-      this->offsets.get_word_offset(i-1, &pit, &lpit, NULL);
+    for(i = 0; true; i++) {
+      this->offsets.get_word_offset(i, &it, &lit, NULL);
+      if(i > 0) {
+        this->offsets.get_word_offset(i-1, &pit, &lpit, NULL);
       
-      uint_t noff = pit->key.boff + kv_len;
-      if(noff > 64) {
-        EXPECT_EQ(pit->key.woff + 1, it->key.woff) <<
-          i << ": Word offset should go up";
+        uint_t noff = pit->key.boff + kv_len;
+        if(noff > 64) {
+          EXPECT_EQ(pit->key.woff + 1, it->key.woff) <<
+            i << ": Word offset should go up";
+        } else {
+          EXPECT_EQ(pit->key.woff, it->key.woff) <<
+            i << ": Word offset should NOT go up";
+        }
+
+        if(pit->key.mask2) { // key between two words
+          EXPECT_LT((uint_t)64, pit->key.boff + k_len) <<
+            i << ": Key not between words, should not have mask2";
+        } else {
+          EXPECT_GE((uint_t)64, pit->key.boff - 1 + k_len + 1) <<
+            i << ": Key between words, should have mask2";
+        } 
+        EXPECT_EQ((pit->key.boff + kv_len + 1 + (pit->key.mask2 ? 2 : 0)) % 64,
+                  it->key.boff) <<
+          i << ": Invalid jump of bit offset";
+        EXPECT_EQ((pit->key.boff + kv_len + 1 + (pit->key.mask2 ? 2 : 0)) % 64,
+                  lit->key.boff) <<
+          i << ": Invalid jump of bit offset large field";
+      } // if(i > 0)
+    
+      EXPECT_EQ((it->key.boff + k_len + (it->key.mask2 ? 2 : 0)) % 64, it->val.boff) <<
+        i << ": Invalid value offset";
+      EXPECT_EQ((lit->key.boff + lk_len + (lit->key.mask2 ? 2 : 0)) % 64, lit->val.boff) <<
+        i << ": Invalid value offset large field";
+      EXPECT_EQ(UINT64_C(1) << (it->key.boff - 1), it->key.lb_mask) <<
+        i << ": Invalid lb_mask";
+      EXPECT_EQ(UINT64_C(1) << (lit->key.boff - 1), lit->key.lb_mask) <<
+        i << ": Invalid lb_mask";
+      if(it->key.mask2) {
+        EXPECT_EQ(64 - it->key.boff - 1, it->key.shift) <<
+          i << ": invalid key shift";
+        EXPECT_EQ(UINT64_C(1) << (64 - it->key.boff + 1), 1 + (it->key.mask1 >> (it->key.boff - 1))) <<
+          i << ": invalid key mask";
+        EXPECT_EQ(UINT64_C(1) << (it->key.boff + k_len - 64 + 2), 1 + it->key.mask2) <<
+          i << ": invalid key mask2";
+        EXPECT_EQ(k_len, it->key.shift + it->key.cshift);
+        EXPECT_EQ(UINT64_C(1) << 63, it->key.sb_mask1) <<
+          i << ": invalid key key sb_mask1";
+        EXPECT_EQ(UINT64_C(1) << it->key.cshift, it->key.sb_mask2) <<
+          i << ": invalid key sb_mask2";
       } else {
-        EXPECT_EQ(pit->key.woff, it->key.woff) <<
-          i << ": Word offset should NOT go up";
+        EXPECT_EQ(0u, it->key.shift) <<
+          i << ": key shift should be zero, no mask";
+        EXPECT_EQ(UINT64_C(1) << (k_len + 1), 1 + (it->key.mask1 >> (it->key.boff - 1))) <<
+          i << ": invalid key mask " << it->key.boff;
+        EXPECT_EQ(0u, it->key.cshift);
+        EXPECT_EQ(0u, it->key.sb_mask1 | it->key.sb_mask2) <<
+          i << ": set bit masks should be 0";
       }
-
-      if(pit->key.mask2) { // key between two words
-        EXPECT_LT((uint_t)64, pit->key.boff + k_len) <<
-          i << ": Key not between words, should not have mask2";
+      if(lit->key.mask2) {
+        EXPECT_EQ(64 - lit->key.boff - 1, lit->key.shift) <<
+          i << ": invalid key shift large field";
+        EXPECT_EQ(UINT64_C(1) << (64 - lit->key.boff + 1), 1 + (lit->key.mask1 >> (lit->key.boff - 1))) <<
+          i << ": invalid key mask large field";
+        EXPECT_EQ(UINT64_C(1) << (lit->key.boff + lk_len - 64 + 2), 1 + lit->key.mask2) <<
+          i << ": invalid key mask2 large field";
+        EXPECT_EQ(lk_len, lit->key.shift + lit->key.cshift);
+        EXPECT_EQ(UINT64_C(1) << 63, lit->key.sb_mask1) <<
+          i << ": invalid key key sb_mask1";
+        EXPECT_EQ(UINT64_C(1) << lit->key.cshift, lit->key.sb_mask2) <<
+          i << ": invalid key sb_mask2";
       } else {
-        EXPECT_GE((uint_t)64, pit->key.boff - 1 + k_len + 1) <<
-          i << ": Key between words, should have mask2";
-      } 
-      EXPECT_EQ((pit->key.boff + kv_len + 1 + (pit->key.mask2 ? 2 : 0)) % 64,
-                it->key.boff) <<
-        i << ": Invalid jump of bit offset";
-      EXPECT_EQ((pit->key.boff + kv_len + 1 + (pit->key.mask2 ? 2 : 0)) % 64,
-                lit->key.boff) <<
-        i << ": Invalid jump of bit offset large field";
-    } // if(i > 0)
-    
-    EXPECT_EQ((it->key.boff + k_len + (it->key.mask2 ? 2 : 0)) % 64, it->val.boff) <<
-      i << ": Invalid value offset";
-    EXPECT_EQ((lit->key.boff + lk_len + (lit->key.mask2 ? 2 : 0)) % 64, lit->val.boff) <<
-      i << ": Invalid value offset large field";
-    EXPECT_EQ(UINT64_C(1) << (it->key.boff - 1), it->key.lb_mask) <<
-      i << ": Invalid lb_mask";
-    EXPECT_EQ(UINT64_C(1) << (lit->key.boff - 1), lit->key.lb_mask) <<
-      i << ": Invalid lb_mask";
-    if(it->key.mask2) {
-      EXPECT_EQ(64 - it->key.boff - 1, it->key.shift) <<
-        i << ": invalid key shift";
-      EXPECT_EQ(UINT64_C(1) << (64 - it->key.boff + 1), 1 + (it->key.mask1 >> (it->key.boff - 1))) <<
-        i << ": invalid key mask";
-      EXPECT_EQ(UINT64_C(1) << (it->key.boff + k_len - 64 + 2), 1 + it->key.mask2) <<
-        i << ": invalid key mask2";
-      EXPECT_EQ(k_len, it->key.shift + it->key.cshift);
-      EXPECT_EQ(UINT64_C(1) << 63, it->key.sb_mask1) <<
-        i << ": invalid key key sb_mask1";
-      EXPECT_EQ(UINT64_C(1) << it->key.cshift, it->key.sb_mask2) <<
-        i << ": invalid key sb_mask2";
-    } else {
-      EXPECT_EQ(0u, it->key.shift) <<
-        i << ": key shift should be zero, no mask";
-      EXPECT_EQ(UINT64_C(1) << (k_len + 1), 1 + (it->key.mask1 >> (it->key.boff - 1))) <<
-        i << ": invalid key mask " << it->key.boff;
-      EXPECT_EQ(0u, it->key.cshift);
-      EXPECT_EQ(0u, it->key.sb_mask1 | it->key.sb_mask2) <<
-        i << ": set bit masks should be 0";
-    }
-    if(lit->key.mask2) {
-      EXPECT_EQ(64 - lit->key.boff - 1, lit->key.shift) <<
-        i << ": invalid key shift large field";
-      EXPECT_EQ(UINT64_C(1) << (64 - lit->key.boff + 1), 1 + (lit->key.mask1 >> (lit->key.boff - 1))) <<
-        i << ": invalid key mask large field";
-      EXPECT_EQ(UINT64_C(1) << (lit->key.boff + lk_len - 64 + 2), 1 + lit->key.mask2) <<
-        i << ": invalid key mask2 large field";
-      EXPECT_EQ(lk_len, lit->key.shift + lit->key.cshift);
-      EXPECT_EQ(UINT64_C(1) << 63, lit->key.sb_mask1) <<
-        i << ": invalid key key sb_mask1";
-      EXPECT_EQ(UINT64_C(1) << lit->key.cshift, lit->key.sb_mask2) <<
-        i << ": invalid key sb_mask2";
-    } else {
-      EXPECT_EQ(0u, lit->key.shift) <<
-        i << ": key shift should be zero, no mask, large field";
-      EXPECT_EQ(0u, lit->key.cshift);
-      EXPECT_EQ(UINT64_C(1) << (lk_len + 1), 1 + (lit->key.mask1 >> (lit->key.boff - 1))) <<
-        i << ": invalid key mask large field " << lit->key.boff;
-    }
+        EXPECT_EQ(0u, lit->key.shift) <<
+          i << ": key shift should be zero, no mask, large field";
+        EXPECT_EQ(0u, lit->key.cshift);
+        EXPECT_EQ(UINT64_C(1) << (lk_len + 1), 1 + (lit->key.mask1 >> (lit->key.boff - 1))) <<
+          i << ": invalid key mask large field " << lit->key.boff;
+      }
 
-    if(it->val.mask2) {
-      EXPECT_LT((uint_t)64, it->val.boff + v_len) <<
-        i << ": val not between words, should not have mask2";
-      EXPECT_EQ(64 - it->val.boff, it->val.shift) <<
-        i << ": invalid val shift";
-      EXPECT_EQ(UINT64_C(1) << (64 - it->val.boff), 1 + (it->val.mask1 >> it->val.boff)) <<
-        i << ": invalid val mask1";
-      EXPECT_EQ(UINT64_C(1) << (it->val.boff + v_len - 64), 1 + it->val.mask2) <<
-        i << ": invalid val mask2";
-    } else {
-      EXPECT_GE((uint_t)64, it->val.boff + v_len) <<
-        i << ": val between words, should have mask2";
-      EXPECT_EQ(v_len, it->val.shift) <<
-        i << ": invalid val shift";
-      EXPECT_EQ(UINT64_C(1) << v_len, 1 + (it->val.mask1 >> it->val.boff)) <<
-        i << ": invalid val mask1";
-    }
-    EXPECT_EQ(v_len, it->val.shift + it->val.cshift);
-    if(lit->val.mask2) {
-      EXPECT_LT((uint_t)64, lit->val.boff + lv_len) <<
-        i << ": val not between words, should not have mask2 large field";
-      EXPECT_EQ(64 - lit->val.boff, lit->val.shift) <<
-        i << ": invalid val shift large field";
-      EXPECT_EQ(UINT64_C(1) << (64 - lit->val.boff), 1 + (lit->val.mask1 >> lit->val.boff)) <<
-        i << ": invalid val mask1 large field";
-      EXPECT_EQ(UINT64_C(1) << (lit->val.boff + lv_len - 64), 1 + lit->val.mask2) <<
-        i << ": invalid val mask2 large field";
-    } else {
-      EXPECT_GE((uint_t)64, lit->val.boff + lv_len) <<
-        i << ": val between words, should have mask2 large field " << lit->val.boff << " " << lv_len;
-      EXPECT_EQ(lv_len, lit->val.shift) <<
-        i << ": invalid val shift large field";
-      EXPECT_EQ(UINT64_C(1) << lv_len, 1 + (lit->val.mask1 >> lit->val.boff)) <<
-        i << ": invalid val mask1 large field";
-    }
-    EXPECT_EQ(lv_len, lit->val.shift + lit->val.cshift);
+      if(it->val.mask2) {
+        EXPECT_LT((uint_t)64, it->val.boff + v_len) <<
+          i << ": val not between words, should not have mask2";
+        EXPECT_EQ(64 - it->val.boff, it->val.shift) <<
+          i << ": invalid val shift";
+        EXPECT_EQ(UINT64_C(1) << (64 - it->val.boff), 1 + (it->val.mask1 >> it->val.boff)) <<
+          i << ": invalid val mask1";
+        EXPECT_EQ(UINT64_C(1) << (it->val.boff + v_len - 64), 1 + it->val.mask2) <<
+          i << ": invalid val mask2";
+      } else {
+        EXPECT_GE((uint_t)64, it->val.boff + v_len) <<
+          i << ": val between words, should have mask2";
+        EXPECT_EQ(v_len, it->val.shift) <<
+          i << ": invalid val shift";
+        EXPECT_EQ(UINT64_C(1) << v_len, 1 + (it->val.mask1 >> it->val.boff)) <<
+          i << ": invalid val mask1";
+      }
+      EXPECT_EQ(v_len, it->val.shift + it->val.cshift);
+      if(lit->val.mask2) {
+        EXPECT_LT((uint_t)64, lit->val.boff + lv_len) <<
+          i << ": val not between words, should not have mask2 large field";
+        EXPECT_EQ(64 - lit->val.boff, lit->val.shift) <<
+          i << ": invalid val shift large field";
+        EXPECT_EQ(UINT64_C(1) << (64 - lit->val.boff), 1 + (lit->val.mask1 >> lit->val.boff)) <<
+          i << ": invalid val mask1 large field";
+        EXPECT_EQ(UINT64_C(1) << (lit->val.boff + lv_len - 64), 1 + lit->val.mask2) <<
+          i << ": invalid val mask2 large field";
+      } else {
+        EXPECT_GE((uint_t)64, lit->val.boff + lv_len) <<
+          i << ": val between words, should have mask2 large field " << lit->val.boff << " " << lv_len;
+        EXPECT_EQ(lv_len, lit->val.shift) <<
+          i << ": invalid val shift large field";
+        EXPECT_EQ(UINT64_C(1) << lv_len, 1 + (lit->val.mask1 >> lit->val.boff)) <<
+          i << ": invalid val mask1 large field";
+      }
+      EXPECT_EQ(lv_len, lit->val.shift + lit->val.cshift);
       
-    uint_t noff = it->key.boff + kv_len;
-    if(noff == 62 || noff == 63 || noff == 64)
-      break;
+      uint_t noff = it->key.boff + kv_len;
+      if(noff == 62 || noff == 63 || noff == 64)
+        break;
+    }
   }
-}
 
-offset_test_param params[] = { {10, 10}, { 22, 5 }, {20, 5} };
-INSTANTIATE_TEST_CASE_P(OffsetsTest, ComputeOffsetsTest, ::testing::ValuesIn(params));
+  offset_test_param params[] = { {10, 10}, { 22, 5 }, {20, 5} };
+  INSTANTIATE_TEST_CASE_P(OffsetsTest, ComputeOffsetsTest, ::testing::ValuesIn(params));
+}
diff --git a/unit_tests/test_simple_circular_buffer.cc b/unit_tests/test_simple_circular_buffer.cc
new file mode 100644
index 0000000..a66e137
--- /dev/null
+++ b/unit_tests/test_simple_circular_buffer.cc
@@ -0,0 +1,71 @@
+#include <gtest/gtest.h>
+#include <jellyfish/simple_circular_buffer.hpp>
+
+namespace {
+  // template<typename T>
+  // class CircularBufferTest : public ::testing::Test { };
+
+  // typedef ::testing::Types<circular_buffer::fixed<int, 16>,
+  //                          circular_buffer::dyn<int> > CircularBufferTypes;
+  // TYPED_TEST_CASE(CircularBufferTest, CircularBufferTypes);
+  static const int capa = 16;
+
+  class test_simple_circular_buffer : 
+    public jellyfish::simple_circular_buffer::pre_alloc<int, capa> {
+  public:
+    typedef jellyfish::simple_circular_buffer::pre_alloc<int, capa> super;
+    explicit test_simple_circular_buffer(int* data) : super(data) { }
+
+    // int next_index(int i) const { return super::next_index(i); }
+    // int prev_index(int i) const { return super::prev_index(i); }
+    // int front_ptr() const { return front_; }
+    // int back_ptr() const { return back_; }
+  };
+
+  TEST(SimpleCircularBufferTest, FillEmpty) {
+    int ary[capa];
+    test_simple_circular_buffer buffer(ary);
+    EXPECT_EQ(capa, buffer.capacity());
+
+    EXPECT_TRUE(buffer.empty());
+    for(int i = 0; i < buffer.capacity(); ++i) {
+      SCOPED_TRACE(::testing::Message() << "i=" << i);
+      EXPECT_FALSE(buffer.full());
+      EXPECT_EQ(i, buffer.size());
+      buffer.push_back(i);
+      EXPECT_EQ(i, buffer.back());
+      EXPECT_FALSE(buffer.empty());
+    }
+    EXPECT_TRUE(buffer.full());
+
+    for(int i = 0; i < buffer.capacity(); ++i) {
+      SCOPED_TRACE(::testing::Message() << "i=" << i);
+      EXPECT_FALSE(buffer.empty());
+      EXPECT_EQ(i, buffer.front());
+      EXPECT_EQ(buffer.capacity() - i, buffer.size());
+      buffer.pop_front();
+      EXPECT_FALSE(buffer.full());
+    }
+    EXPECT_TRUE(buffer.empty());
+    EXPECT_EQ(0, buffer.size());
+  }
+
+  TEST(SimpleCircularBufferTest, Usefull) {
+    int ary[capa];
+    test_simple_circular_buffer buffer(ary);
+    EXPECT_EQ(capa, buffer.capacity());
+
+    int i = 0;
+    for( ; i < buffer.capacity(); ++i) {
+      EXPECT_TRUE(buffer.push_back());
+      buffer.back() = i;
+    }
+
+    for( ; i < 10 * buffer.capacity(); ++i) {
+      EXPECT_EQ(i - capa, buffer.front());
+      buffer.pop_front();
+      EXPECT_TRUE(buffer.push_back());
+      buffer.back() = i;
+    }
+  }
+}
diff --git a/unit_tests/test_square_binary_matrix.cc b/unit_tests/test_square_binary_matrix.cc
new file mode 100644
index 0000000..58008ad
--- /dev/null
+++ b/unit_tests/test_square_binary_matrix.cc
@@ -0,0 +1,133 @@
+#include <fstream>
+#include <gtest/gtest.h>
+#include <jellyfish/square_binary_matrix.hpp>
+#include <jellyfish/time.hpp>
+
+class RandomEnvironment : public ::testing::Environment {
+ public:
+  virtual void SetUp() {
+    std::ifstream dev_rand("/dev/urandom");
+    unsigned int seed;
+    dev_rand.read((char *)&seed, sizeof(seed));
+    std::cout << "Seed: " << seed << std::endl;
+    dev_rand.close();
+    srandom(seed);
+  }
+};
+//::testing::Environment* const foo_env = ::testing::AddGlobalTestEnvironment(new RandomEnvironment);
+
+uint64_t random_vector(int length) {
+  uint64_t _mask = (((uint64_t)1) << length) - 1;
+  uint64_t res = 0;
+  int lrm = floorLog2((unsigned long)RAND_MAX);
+  int i;
+  for(i = 0; i < length; i += lrm) 
+    res ^= (uint64_t)random() << i;
+  return res & _mask;
+}
+
+
+#define VECLEN 44
+TEST(SquareBinaryMatrix, Initialization) {
+  SquareBinaryMatrix small_id_m(8);
+
+  small_id_m.init_identity();
+  ASSERT_STREQ("8x8\n10000000\n01000000\n00100000\n00010000\n00001000\n00000100\n00000010\n00000001\n",
+               small_id_m.str().c_str());
+  SquareBinaryMatrix id_m(VECLEN);
+  SquareBinaryMatrix rand_m(VECLEN);
+
+  id_m.init_identity();
+  ASSERT_TRUE(id_m.is_identity());
+  ASSERT_EQ(VECLEN, id_m.get_size());
+
+  rand_m.init_random();
+  ASSERT_EQ(VECLEN, rand_m.get_size());
+
+  SquareBinaryMatrix rand2_m(5);
+  rand2_m = rand_m;
+  ASSERT_TRUE(rand_m == rand2_m);
+  ASSERT_FALSE(rand_m != rand2_m);
+
+  SquareBinaryMatrix rand3_m = rand_m;
+  ASSERT_TRUE(rand_m == rand3_m);
+  ASSERT_FALSE(rand_m != rand3_m);
+
+  uint64_t v = random_vector(VECLEN);
+  ASSERT_EQ(v, id_m.times(v));
+
+  ASSERT_TRUE(rand_m == rand_m.transpose().transpose());
+  ASSERT_TRUE(id_m == id_m.transpose());
+
+  SquareBinaryMatrix sym_m = rand_m.transpose() * rand_m;
+  ASSERT_TRUE(sym_m == sym_m.transpose());
+
+  ASSERT_FALSE(rand_m[0] == v); // Could fail with probability 2**-64!!
+  rand_m[0] = v;
+  ASSERT_TRUE(rand_m[0] == v);
+
+  ASSERT_TRUE(rand_m == (id_m * rand_m));
+
+  int i, regular = 0, singular = 0;
+  for(i = 0; i < 10; i++) {
+    SquareBinaryMatrix tmp_m(32);
+    tmp_m.init_random();
+    try {
+      SquareBinaryMatrix inv_m = tmp_m.inverse();
+      SquareBinaryMatrix sbi_m = inv_m * tmp_m;
+      regular++;
+      ASSERT_TRUE(sbi_m.is_identity())
+	<< "Not identity\n" << sbi_m.str() << std::endl;
+    } catch(SquareBinaryMatrix::SingularMatrix e) {
+      singular++;
+    }
+  }
+  ASSERT_EQ(10, regular + singular);
+
+  for(i = 0; i < 100; i++) {
+    v = random_vector(VECLEN);
+    ASSERT_EQ(rand_m.times_loop(v), rand_m.times_unrolled(v));
+#ifdef SSE
+    ASSERT_EQ(rand_m.times_loop(v), rand_m.times_sse(v));
+#endif
+  }
+
+  // speed tests
+  uint64_t v1 = random_vector(VECLEN);
+  uint64_t v2 = random_vector(VECLEN);
+  uint64_t v3 = random_vector(VECLEN);
+  uint64_t v4 = random_vector(VECLEN);
+  uint64_t v5 = random_vector(VECLEN);
+  uint64_t v6 = random_vector(VECLEN);
+  uint64_t v7 = random_vector(VECLEN);
+  uint64_t v8 = random_vector(VECLEN);
+  uint64_t res_unrolled = 0, res_sse = 0;
+  Time time1;
+  const int nb_loops = 2560000;
+  for(i = 0; i < nb_loops; i++) {
+    res_unrolled ^= rand_m.times_unrolled(v1);
+    res_unrolled ^= rand_m.times_unrolled(v2);
+    res_unrolled ^= rand_m.times_unrolled(v3);
+    res_unrolled ^= rand_m.times_unrolled(v4);
+    res_unrolled ^= rand_m.times_unrolled(v5);
+    res_unrolled ^= rand_m.times_unrolled(v6);
+    res_unrolled ^= rand_m.times_unrolled(v7);
+    res_unrolled ^= rand_m.times_unrolled(v8);
+  }
+  Time time2;
+  for(i = 0; i < nb_loops; i++) {
+    res_sse ^= rand_m.times_sse(v1);
+    res_sse ^= rand_m.times_sse(v2);
+    res_sse ^= rand_m.times_sse(v3);
+    res_sse ^= rand_m.times_sse(v4);
+    res_sse ^= rand_m.times_sse(v5);
+    res_sse ^= rand_m.times_sse(v6);
+    res_sse ^= rand_m.times_sse(v7);
+    res_sse ^= rand_m.times_sse(v8);
+  }
+  Time time3;
+  ASSERT_LT(time3 - time2, time2 - time1);
+  // std::cout << "unrolled timing " << (time2 - time1).str() <<
+  //   " sse timing " << (time3 - time2).str() << std::endl;
+  ASSERT_EQ(res_unrolled, res_sse);
+}
diff --git a/unit_tests/unit_tests.sh b/unit_tests/unit_tests.sh
index c9e1853..e173586 100644
--- a/unit_tests/unit_tests.sh
+++ b/unit_tests/unit_tests.sh
@@ -3,4 +3,4 @@
 cd tests
 . ./compat.sh
 
-${DIR}/test_offsets_key_value
+${DIR}/test_all
-- 
Alioth's /usr/local/bin/git-commit-notice on /srv/git.debian.org/git/debian-med/jellyfish1.git
    
    
More information about the debian-med-commit
mailing list