[med-svn] [bedops] 01/03: New upstream version 2.4.28+dfsg
Steffen Möller
moeller at moszumanska.debian.org
Fri Oct 20 21:58:30 UTC 2017
This is an automated email from the git hooks/post-receive script.
moeller pushed a commit to branch master
in repository bedops.
commit 2763b0f4eabe7c60665d1c70579b2fd2a475b48c
Author: Steffen Moeller <moeller at debian.org>
Date: Mon Sep 11 14:23:30 2017 +0200
New upstream version 2.4.28+dfsg
---
.gitignore | 8 +
.travis.yml | 4 +-
Makefile | 368 +++-
README.md | 19 +-
applications/bed/bedextract/src/ExtractRows.cpp | 51 +-
applications/bed/bedextract/src/Makefile | 24 +-
applications/bed/bedextract/src/Makefile.darwin | 28 +-
applications/bed/bedmap/doc/known.issues | 33 -
applications/bed/bedmap/src/Bedmap.cpp | 465 +++--
applications/bed/bedmap/src/Input.hpp | 6 +-
applications/bed/bedmap/src/Makefile | 21 +-
applications/bed/bedmap/src/Makefile.darwin | 27 +-
applications/bed/bedmap/src/TDefs.hpp | 2 +-
.../bed/bedops/doc/Usage.Statement.Version1.2 | 35 -
applications/bed/bedops/src/BedPadReader.hpp | 18 +-
applications/bed/bedops/src/Bedops.cpp | 315 ++--
applications/bed/bedops/src/Makefile | 21 +-
applications/bed/bedops/src/Makefile.darwin | 29 +-
applications/bed/closestfeats/src/BedReader.hpp | 17 +-
.../bed/closestfeats/src/ClosestFeature.cpp | 89 +-
applications/bed/closestfeats/src/Makefile | 21 +-
applications/bed/closestfeats/src/Makefile.darwin | 29 +-
applications/bed/conversion/src/Makefile | 42 +-
applications/bed/conversion/src/Makefile.darwin | 32 +-
applications/bed/conversion/src/convert2bed.c | 1812 ++++++++++++++------
applications/bed/conversion/src/convert2bed.h | 686 ++++----
.../bed/conversion/src/tests/bam/split2.bam | Bin 0 -> 1388 bytes
.../bed/conversion/src/tests/bam/split2.sam | 29 +
applications/bed/conversion/src/wrappers/bam2bed | 18 +-
.../bed/conversion/src/wrappers/bam2starch | 18 +-
applications/bed/conversion/src/wrappers/sam2bed | 18 +-
.../bed/conversion/src/wrappers/sam2starch | 18 +-
applications/bed/sort-bed/src/CheckSort.cpp | 10 +-
applications/bed/sort-bed/src/Makefile | 68 +-
applications/bed/sort-bed/src/Makefile.darwin | 101 +-
applications/bed/sort-bed/src/Sort.cpp | 33 +-
applications/bed/sort-bed/src/SortDetails.cpp | 8 +-
applications/bed/sort-bed/src/Structures.hpp | 3 -
.../src/update-sort-bed-migrate-candidates.py | 2 +-
.../bed/sort-bed/src/update-sort-bed-slurm.py | 2 +-
.../sort-bed/src/update-sort-bed-starch-slurm.py | 4 +-
applications/bed/starch/src/Makefile | 70 +-
applications/bed/starch/src/Makefile.darwin | 93 +-
applications/bed/starch/src/starch-diff.py | 11 +-
applications/bed/starch/src/starch.c | 40 +-
applications/bed/starch/src/starch.h | 10 +
applications/bed/starch/src/starchcat.c | 704 +++++---
applications/bed/starch/src/starchcat.h | 13 +
.../bed/starch/src/starchcluster_gnuParallel.tcsh | 2 +-
applications/bed/starch/src/starchcluster_sge.tcsh | 2 +-
.../bed/starch/src/starchcluster_slurm.tcsh | 2 +-
applications/bed/starch/src/starchstrip.c | 184 +-
applications/bed/starch/src/starchstrip.h | 10 +
applications/bed/starch/src/unstarch.c | 364 ++--
applications/bed/starch/src/unstarch.h | 19 +-
applications/other/switch-BEDOPS-binary-type | 76 +
docs/conf.py | 2 +-
docs/content/installation.rst | 56 +-
.../reference/file-management/compression.rst | 2 +-
.../file-management/compression/starch-diff.rst | 2 +-
.../file-management/compression/starch.rst | 2 +-
.../file-management/compression/starchcat.rst | 2 +-
.../file-management/compression/starchstrip.rst | 4 +-
.../file-management/compression/unstarch.rst | 2 +-
.../file-management/conversion/gtf2bed.rst | 12 +-
.../file-management/conversion/psl2bed.rst | 2 +-
.../file-management/conversion/vcf2bed.rst | 2 +-
.../reference/file-management/sorting/sort-bed.rst | 2 +-
.../reference/set-operations/bedextract.rst | 2 +-
docs/content/reference/set-operations/bedops.rst | 2 +-
.../reference/set-operations/closest-features.rst | 2 +-
docs/content/reference/statistics/bedmap.rst | 11 +-
docs/content/release.rst | 20 +-
docs/content/revision-history.rst | 120 +-
docs/content/usage-examples/snps-within-dhses.rst | 2 +-
docs/index.rst | 18 +-
.../general-headers/algorithm/bed/FindBedRange.hpp | 59 +-
.../algorithm/visitors/Visitors.hpp | 4 +-
.../algorithm/visitors/bed/BedBaseVisitor.hpp | 8 +-
.../visitors/helpers/ProcessBedVisitorRow.hpp | 21 +-
.../visitors/numerical/ExtremeVisitor.hpp | 2 +-
.../algorithm/visitors/other/MultiVisitor.hpp | 12 +-
.../data/bed/AllocateIterator_BED_starch.hpp | 73 +-
....hpp => AllocateIterator_BED_starch_minmem.hpp} | 42 +-
interfaces/general-headers/data/bed/Bed.hpp | 556 +++---
.../general-headers/data/bed/BedCheckIterator.hpp | 134 +-
...eckIterator.hpp => BedCheckIterator_minmem.hpp} | 60 +-
interfaces/general-headers/data/bed/BedCompare.hpp | 109 +-
interfaces/general-headers/data/bed/BedTypes.hpp | 39 +-
interfaces/general-headers/data/bed/Bed_minmem.hpp | 917 ++++++++++
.../general-headers/data/starch/starchApi.hpp | 38 +-
.../general-headers/data/starch/starchHelpers.h | 4 +-
.../general-headers/suite/BEDOPS.Constants.hpp | 51 +-
.../general-headers/suite/BEDOPS.Version.hpp | 4 +-
.../utility/{PooledMemory.hpp => BitMonitor.hpp} | 381 ++--
.../general-headers/utility/CharPooledMemory.hpp | 521 ++++++
.../{SingletonType.hpp => CompilerMath.hpp} | 41 +-
.../general-headers/utility/PooledMemory.hpp | 365 +---
interfaces/general-headers/utility/PrintTypes.hpp | 24 +-
.../general-headers/utility/SingletonType.hpp | 18 +-
interfaces/general-headers/utility/Typify.hpp | 24 +-
interfaces/src/algorithm/sweep/WindowSweepImpl.cpp | 79 +-
.../algorithm/sweep/WindowSweepImpl.specialize.cpp | 24 +-
interfaces/src/data/starch/starchHelpers.c | 177 +-
interfaces/src/data/starch/starchMetadataHelpers.c | 17 +-
interfaces/src/data/starch/starchSha1Digest.c | 342 ++--
interfaces/src/data/starch/unstarchHelpers.c | 52 +-
interfaces/src/utility/SingletonType.cpp | 14 +
packaging/deb/Dockerfile | 8 +-
packaging/deb/control | 2 +-
packaging/os_x/BEDOPS.pkgproj | 1197 ++++++++++++-
packaging/rpm/Dockerfile | 12 +-
packaging/rpm/bedops.spec | 2 +-
system.mk/Makefile.darwin | 303 +---
system.mk/Makefile.linux | 149 +-
115 files changed, 8235 insertions(+), 4051 deletions(-)
diff --git a/.gitignore b/.gitignore
index 3398ce1..7b357b1 100644
--- a/.gitignore
+++ b/.gitignore
@@ -61,3 +61,11 @@ tramp
# OS X stuff
.DS_Store
__MACOSX
+
+applications/bed/bedextract/bin/
+applications/bed/bedmap/bin/
+applications/bed/bedops/bin/
+applications/bed/closestfeats/bin/
+applications/bed/conversion/bin/
+applications/bed/sort-bed/bin/
+applications/bed/starch/bin/
\ No newline at end of file
diff --git a/.travis.yml b/.travis.yml
index ec53eeb..b7ddbd7 100644
--- a/.travis.yml
+++ b/.travis.yml
@@ -15,5 +15,5 @@ install:
- if [[ "$CXX" == "g++" ]]; then if [[ "$TRAVIS_OS_NAME" == "linux" ]]; then sudo apt-get install -qq g++-4.8; fi; fi
- if [[ "$CXX" == "g++" ]]; then if [[ "$TRAVIS_OS_NAME" == "linux" ]]; then sudo update-alternatives --install /usr/bin/g++ g++ /usr/bin/g++-4.8 50; fi; fi
script:
- - if [[ "$CC" == "gcc" ]]; then if [[ "$TRAVIS_OS_NAME" == "linux" ]]; then make -j4; fi; fi
- - if [[ "$CC" == "clang" ]]; then if [[ "$TRAVIS_OS_NAME" == "osx" ]]; then make -j4; fi; fi
\ No newline at end of file
+ - if [[ "$CC" == "gcc" ]]; then if [[ "$TRAVIS_OS_NAME" == "linux" ]]; then make all; fi; fi
+ - if [[ "$CC" == "clang" ]]; then if [[ "$TRAVIS_OS_NAME" == "osx" ]]; then make all; fi; fi
\ No newline at end of file
diff --git a/Makefile b/Makefile
index cc0d879..b5fb8fb 100644
--- a/Makefile
+++ b/Makefile
@@ -1,17 +1,30 @@
-export KERNEL := ${shell uname -a | cut -f1 -d' '}
-APPDIR = applications/bed
-BINDIR = bin
-OSXPKGROOT = packaging/os_x
-OSXBUILDDIR = ${OSXPKGROOT}/build
-OSXPKGDIR = ${OSXPKGROOT}/resources/bin
-OSXLIBDIR = ${OSXPKGROOT}/resources/lib
-
+export KERNEL := ${shell uname -a | cut -f1 -d' '}
+APPDIR = applications/bed
+OTHERDIR = applications/other
+OSXPKGROOT = packaging/os_x
+OSXBUILDDIR = ${OSXPKGROOT}/build
+OSXPKGDIR = ${OSXPKGROOT}/resources/bin
+OSXLIBDIR = ${OSXPKGROOT}/resources/lib
+SELF = ${shell pwd}/Makefile
+MASSIVE_REST_EXP = 22
+MASSIVE_ID_EXP = 14
+MASSIVE_CHROM_EXP = 8
+JPARALLEL = 8
+MEGAROW = megarow
+TYPICAL = typical
+DEFAULT_BINARY_TYPE = ${TYPICAL}
+WRAPPERS = $(wildcard ${APPDIR}/conversion/src/wrappers/*)
+CWD := $(shell pwd)
+BINDIR = bin
+BINDIR_MODULE = modules
+BINDIR_MODULE_TYPICAL = ${BINDIR_MODULE}/${TYPICAL}
+BINDIR_MODULE_MEGAROW = ${BINDIR_MODULE}/${MEGAROW}
default:
ifeq ($(KERNEL), Darwin)
- $(MAKE) $(MAKECMDGOALS) -f system.mk/Makefile.darwin
+ $(MAKE) $(MAKECMDGOALS) -j $(JPARALLEL) -f system.mk/Makefile.darwin
else
- $(MAKE) $(MAKECMDGOALS) -f system.mk/Makefile.linux
+ $(MAKE) $(MAKECMDGOALS) -j $(JPARALLEL) -f system.mk/Makefile.linux
endif
clean: default
@@ -22,23 +35,173 @@ debug: default
gprof: default
-install: prep_c install_conversion_scripts install_starch_scripts
- -cp ${APPDIR}/sort-bed/bin/sort-bed ${BINDIR}/
- -cp ${APPDIR}/sort-bed/bin/update-sort-bed-slurm ${BINDIR}/
- -cp ${APPDIR}/sort-bed/bin/update-sort-bed-starch-slurm ${BINDIR}/
- -cp ${APPDIR}/sort-bed/bin/update-sort-bed-migrate-candidates ${BINDIR}/
- -cp ${APPDIR}/bedops/bin/bedops ${BINDIR}/
- -cp ${APPDIR}/closestfeats/bin/closest-features ${BINDIR}/
- -cp ${APPDIR}/bedmap/bin/bedmap ${BINDIR}/
- -cp ${APPDIR}/bedextract/bin/bedextract ${BINDIR}/
- -cp ${APPDIR}/starch/bin/starch ${BINDIR}/
- -cp ${APPDIR}/starch/bin/unstarch ${BINDIR}/
- -cp ${APPDIR}/starch/bin/starchcat ${BINDIR}/
- -cp ${APPDIR}/starch/bin/starchstrip ${BINDIR}/
- -cp ${APPDIR}/conversion/bin/convert2bed ${BINDIR}/
+all:
+ $(MAKE) support -f ${SELF}
+ $(MAKE) typical -f ${SELF}
+ $(MAKE) megarow -f ${SELF}
+ $(MAKE) install_all -f ${SELF}
+ $(MAKE) symlink_typical -f ${SELF}
+
+module_all:
+ $(MAKE) support -f ${SELF}
+ $(MAKE) typical -f ${SELF}
+ $(MAKE) megarow -f ${SELF}
+ $(MAKE) install_all -f ${SELF}
+ $(MAKE) module_binaries -f ${SELF}
+
+megarow:
+ $(MAKE) BINARY_TYPE=$(MEGAROW) BINARY_TYPE_NUM=1 POSTFIX=-$(MEGAROW) MEGAFLAGS="-DREST_EXPONENT=${MASSIVE_REST_EXP} -DID_EXPONENT=${MASSIVE_ID_EXP} -DCHROM_EXPONENT=${MASSIVE_CHROM_EXP}" -f ${SELF}
+
+typical:
+ $(MAKE) BINARY_TYPE=$(TYPICAL) BINARY_TYPE_NUM=0 POSTFIX=-$(TYPICAL) -f ${SELF}
+
+symlink_typical:
+ $(eval variablename=`find $(BINDIR)/ -maxdepth 1 -mindepth 1 -type f -name '*$(TYPICAL)' -print0 | xargs -L1 -0 -I{} sh -c 'basename {}'`)
+ for i in ${variablename}; do \
+ fooname=`echo $$i | sed 's/-$(TYPICAL)//'`; \
+ echo $${fooname}; \
+ ln -sf $$i $(BINDIR)/$${fooname}; \
+ done
+symlink_megarow:
+ $(eval variablename=`find $(BINDIR)/ -maxdepth 1 -mindepth 1 -type f -name '*$(MEGAROW)' -print0 | xargs -L1 -0 -I{} sh -c 'basename {}'`)
+ for i in ${variablename}; do \
+ fooname=`echo $$i | sed 's/-$(MEGAROW)//'`; \
+ echo $${fooname}; \
+ ln -sf $$i $(BINDIR)/$${fooname}; \
+ done
+install: prep_c install_conversion_scripts install_starch_scripts
+ -cp ${APPDIR}/sort-bed/bin/sort-bed- ${BINDIR}/sort-bed
+ -cp ${APPDIR}/sort-bed/bin/update-sort-bed-slurm- ${BINDIR}/update-sort-bed-slurm
+ -cp ${APPDIR}/sort-bed/bin/update-sort-bed-starch-slurm- ${BINDIR}/update-sort-bed-starch-slurm
+ -cp ${APPDIR}/sort-bed/bin/update-sort-bed-migrate-candidates- ${BINDIR}/update-sort-bed-migrate-candidates
+ -cp ${APPDIR}/bedops/bin/bedops- ${BINDIR}/bedops
+ -cp ${APPDIR}/closestfeats/bin/closest-features- ${BINDIR}/closest-features
+ -cp ${APPDIR}/bedmap/bin/bedmap- ${BINDIR}/bedmap
+ -cp ${APPDIR}/bedextract/bin/bedextract- ${BINDIR}/bedextract
+ -cp ${APPDIR}/starch/bin/starch- ${BINDIR}/starch
+ -cp ${APPDIR}/starch/bin/unstarch- ${BINDIR}/unstarch
+ -cp ${APPDIR}/starch/bin/starchcat- ${BINDIR}/starchcat
+ -cp ${APPDIR}/starch/bin/starchstrip- ${BINDIR}/starchstrip
+ -cp ${APPDIR}/conversion/bin/convert2bed- ${BINDIR}/convert2bed
+
+install_all: install_conversion_scripts_with_suffix install_starch_scripts_with_suffix
+ -cp ${APPDIR}/sort-bed/bin/sort-bed-$(MEGAROW) ${BINDIR}/sort-bed-$(MEGAROW)
+ -cp ${APPDIR}/sort-bed/bin/update-sort-bed-slurm-$(MEGAROW) ${BINDIR}/update-sort-bed-slurm-$(MEGAROW)
+ -cp ${APPDIR}/sort-bed/bin/update-sort-bed-starch-slurm-$(MEGAROW) ${BINDIR}/update-sort-bed-starch-slurm-$(MEGAROW)
+ -cp ${APPDIR}/sort-bed/bin/update-sort-bed-migrate-candidates-$(MEGAROW) ${BINDIR}/update-sort-bed-migrate-candidates-$(MEGAROW)
+ -cp ${APPDIR}/bedops/bin/bedops-$(MEGAROW) ${BINDIR}/bedops-$(MEGAROW)
+ -cp ${APPDIR}/closestfeats/bin/closest-features-$(MEGAROW) ${BINDIR}/closest-features-$(MEGAROW)
+ -cp ${APPDIR}/bedmap/bin/bedmap-$(MEGAROW) ${BINDIR}/bedmap-$(MEGAROW)
+ -cp ${APPDIR}/bedextract/bin/bedextract-$(MEGAROW) ${BINDIR}/bedextract-$(MEGAROW)
+ -cp ${APPDIR}/starch/bin/starch-$(MEGAROW) ${BINDIR}/starch-$(MEGAROW)
+ -cp ${APPDIR}/starch/bin/unstarch-$(MEGAROW) ${BINDIR}/unstarch-$(MEGAROW)
+ -cp ${APPDIR}/starch/bin/starchcat-$(MEGAROW) ${BINDIR}/starchcat-$(MEGAROW)
+ -cp ${APPDIR}/starch/bin/starchstrip-$(MEGAROW) ${BINDIR}/starchstrip-$(MEGAROW)
+ -cp ${APPDIR}/conversion/bin/convert2bed-$(MEGAROW) ${BINDIR}/convert2bed-$(MEGAROW)
+ -cp ${APPDIR}/sort-bed/bin/sort-bed-$(TYPICAL) ${BINDIR}/sort-bed-$(TYPICAL)
+ -cp ${APPDIR}/sort-bed/bin/update-sort-bed-slurm-$(TYPICAL) ${BINDIR}/update-sort-bed-slurm-$(TYPICAL)
+ -cp ${APPDIR}/sort-bed/bin/update-sort-bed-starch-slurm-$(TYPICAL) ${BINDIR}/update-sort-bed-starch-slurm-$(TYPICAL)
+ -cp ${APPDIR}/sort-bed/bin/update-sort-bed-migrate-candidates-$(TYPICAL) ${BINDIR}/update-sort-bed-migrate-candidates-$(TYPICAL)
+ -cp ${APPDIR}/bedops/bin/bedops-$(TYPICAL) ${BINDIR}/bedops-$(TYPICAL)
+ -cp ${APPDIR}/closestfeats/bin/closest-features-$(TYPICAL) ${BINDIR}/closest-features-$(TYPICAL)
+ -cp ${APPDIR}/bedmap/bin/bedmap-$(TYPICAL) ${BINDIR}/bedmap-$(TYPICAL)
+ -cp ${APPDIR}/bedextract/bin/bedextract-$(TYPICAL) ${BINDIR}/bedextract-$(TYPICAL)
+ -cp ${APPDIR}/starch/bin/starch-$(TYPICAL) ${BINDIR}/starch-$(TYPICAL)
+ -cp ${APPDIR}/starch/bin/unstarch-$(TYPICAL) ${BINDIR}/unstarch-$(TYPICAL)
+ -cp ${APPDIR}/starch/bin/starchcat-$(TYPICAL) ${BINDIR}/starchcat-$(TYPICAL)
+ -cp ${APPDIR}/starch/bin/starchstrip-$(TYPICAL) ${BINDIR}/starchstrip-$(TYPICAL)
+ -cp ${APPDIR}/conversion/bin/convert2bed-$(TYPICAL) ${BINDIR}/convert2bed-$(TYPICAL)
+ -cp ${OTHERDIR}/switch-BEDOPS-binary-type ${BINDIR}/switch-BEDOPS-binary-type
+module_binaries:
+ mkdir -p ${BINDIR_MODULE_TYPICAL}
+ -cp ${BINDIR}/sort-bed-$(TYPICAL) ${BINDIR_MODULE_TYPICAL}/sort-bed
+ -cp ${BINDIR}/update-sort-bed-slurm-$(TYPICAL) ${BINDIR_MODULE_TYPICAL}/update-sort-bed-slurm
+ -cp ${BINDIR}/update-sort-bed-starch-slurm-$(TYPICAL) ${BINDIR_MODULE_TYPICAL}/update-sort-bed-starch-slurm
+ -cp ${BINDIR}/update-sort-bed-migrate-candidates-$(TYPICAL) ${BINDIR_MODULE_TYPICAL}/update-sort-bed-migrate-candidates
+ -cp ${BINDIR}/bedops-$(TYPICAL) ${BINDIR_MODULE_TYPICAL}/bedops
+ -cp ${BINDIR}/closest-features-$(TYPICAL) ${BINDIR_MODULE_TYPICAL}/closest-features
+ -cp ${BINDIR}/bedmap-$(TYPICAL) ${BINDIR_MODULE_TYPICAL}/bedmap
+ -cp ${BINDIR}/bedextract-$(TYPICAL) ${BINDIR_MODULE_TYPICAL}/bedextract
+ -cp ${BINDIR}/starch-$(TYPICAL) ${BINDIR_MODULE_TYPICAL}/starch
+ -cp ${BINDIR}/unstarch-$(TYPICAL) ${BINDIR_MODULE_TYPICAL}/unstarch
+ -cp ${BINDIR}/starchcat-$(TYPICAL) ${BINDIR_MODULE_TYPICAL}/starchcat
+ -cp ${BINDIR}/starchstrip-$(TYPICAL) ${BINDIR_MODULE_TYPICAL}/starchstrip
+ -cp ${BINDIR}/starch-diff-$(TYPICAL) ${BINDIR_MODULE_TYPICAL}/starch-diff
+ -cp ${BINDIR}/convert2bed-$(TYPICAL) ${BINDIR_MODULE_TYPICAL}/convert2bed
+ -cp ${BINDIR}/bam2bed-$(TYPICAL) ${BINDIR_MODULE_TYPICAL}/bam2bed
+ -cp ${BINDIR}/gff2bed-$(TYPICAL) ${BINDIR_MODULE_TYPICAL}/gff2bed
+ -cp ${BINDIR}/gtf2bed-$(TYPICAL) ${BINDIR_MODULE_TYPICAL}/gtf2bed
+ -cp ${BINDIR}/gvf2bed-$(TYPICAL) ${BINDIR_MODULE_TYPICAL}/gvf2bed
+ -cp ${BINDIR}/psl2bed-$(TYPICAL) ${BINDIR_MODULE_TYPICAL}/psl2bed
+ -cp ${BINDIR}/rmsk2bed-$(TYPICAL) ${BINDIR_MODULE_TYPICAL}/rmsk2bed
+ -cp ${BINDIR}/sam2bed-$(TYPICAL) ${BINDIR_MODULE_TYPICAL}/sam2bed
+ -cp ${BINDIR}/vcf2bed-$(TYPICAL) ${BINDIR_MODULE_TYPICAL}/vcf2bed
+ -cp ${BINDIR}/wig2bed-$(TYPICAL) ${BINDIR_MODULE_TYPICAL}/wig2bed
+ -cp ${BINDIR}/bam2starch-$(TYPICAL) ${BINDIR_MODULE_TYPICAL}/bam2starch
+ -cp ${BINDIR}/gff2starch-$(TYPICAL) ${BINDIR_MODULE_TYPICAL}/gff2starch
+ -cp ${BINDIR}/gtf2starch-$(TYPICAL) ${BINDIR_MODULE_TYPICAL}/gtf2starch
+ -cp ${BINDIR}/gvf2starch-$(TYPICAL) ${BINDIR_MODULE_TYPICAL}/gvf2starch
+ -cp ${BINDIR}/psl2starch-$(TYPICAL) ${BINDIR_MODULE_TYPICAL}/psl2starch
+ -cp ${BINDIR}/rmsk2starch-$(TYPICAL) ${BINDIR_MODULE_TYPICAL}/rmsk2starch
+ -cp ${BINDIR}/sam2starch-$(TYPICAL) ${BINDIR_MODULE_TYPICAL}/sam2starch
+ -cp ${BINDIR}/vcf2starch-$(TYPICAL) ${BINDIR_MODULE_TYPICAL}/vcf2starch
+ -cp ${BINDIR}/wig2starch-$(TYPICAL) ${BINDIR_MODULE_TYPICAL}/wig2starch
+ -cp ${BINDIR}/bam2bed_sge-$(TYPICAL) ${BINDIR_MODULE_TYPICAL}/bam2bed_sge
+ -cp ${BINDIR}/bam2bed_slurm-$(TYPICAL) ${BINDIR_MODULE_TYPICAL}/bam2bed_slurm
+ -cp ${BINDIR}/bam2bed_gnuParallel-$(TYPICAL) ${BINDIR_MODULE_TYPICAL}/bam2bed_gnuParallel
+ -cp ${BINDIR}/bam2starch_sge-$(TYPICAL) ${BINDIR_MODULE_TYPICAL}/bam2starch_sge
+ -cp ${BINDIR}/bam2starch_slurm-$(TYPICAL) ${BINDIR_MODULE_TYPICAL}/bam2starch_slurm
+ -cp ${BINDIR}/bam2starch_gnuParallel-$(TYPICAL) ${BINDIR_MODULE_TYPICAL}/bam2starch_gnuParallel
+ -cp ${BINDIR}/starchcluster_sge-$(TYPICAL) ${BINDIR_MODULE_TYPICAL}/starchcluster_sge
+ -cp ${BINDIR}/starchcluster_gnuParallel-$(TYPICAL) ${BINDIR_MODULE_TYPICAL}/starchcluster_gnuParallel
+ -cp ${BINDIR}/starchcluster_slurm-$(TYPICAL) ${BINDIR_MODULE_TYPICAL}/starchcluster_slurm
+ -cp ${BINDIR}/starch-diff-$(TYPICAL) ${BINDIR_MODULE_TYPICAL}/starch-diff
+ mkdir -p ${BINDIR_MODULE_MEGAROW}
+ -cp ${BINDIR}/sort-bed-$(MEGAROW) ${BINDIR_MODULE_MEGAROW}/sort-bed
+ -cp ${BINDIR}/update-sort-bed-slurm-$(MEGAROW) ${BINDIR_MODULE_MEGAROW}/update-sort-bed-slurm
+ -cp ${BINDIR}/update-sort-bed-starch-slurm-$(MEGAROW) ${BINDIR_MODULE_MEGAROW}/update-sort-bed-starch-slurm
+ -cp ${BINDIR}/update-sort-bed-migrate-candidates-$(MEGAROW) ${BINDIR_MODULE_MEGAROW}/update-sort-bed-migrate-candidates
+ -cp ${BINDIR}/bedops-$(MEGAROW) ${BINDIR_MODULE_MEGAROW}/bedops
+ -cp ${BINDIR}/closest-features-$(MEGAROW) ${BINDIR_MODULE_MEGAROW}/closest-features
+ -cp ${BINDIR}/bedmap-$(MEGAROW) ${BINDIR_MODULE_MEGAROW}/bedmap
+ -cp ${BINDIR}/bedextract-$(MEGAROW) ${BINDIR_MODULE_MEGAROW}/bedextract
+ -cp ${BINDIR}/starch-$(MEGAROW) ${BINDIR_MODULE_MEGAROW}/starch
+ -cp ${BINDIR}/unstarch-$(MEGAROW) ${BINDIR_MODULE_MEGAROW}/unstarch
+ -cp ${BINDIR}/starchcat-$(MEGAROW) ${BINDIR_MODULE_MEGAROW}/starchcat
+ -cp ${BINDIR}/starchstrip-$(MEGAROW) ${BINDIR_MODULE_MEGAROW}/starchstrip
+ -cp ${BINDIR}/starch-diff-$(MEGAROW) ${BINDIR_MODULE_MEGAROW}/starch-diff
+ -cp ${BINDIR}/convert2bed-$(MEGAROW) ${BINDIR_MODULE_MEGAROW}/convert2bed
+ -cp ${BINDIR}/bam2bed-$(MEGAROW) ${BINDIR_MODULE_MEGAROW}/bam2bed
+ -cp ${BINDIR}/gff2bed-$(MEGAROW) ${BINDIR_MODULE_MEGAROW}/gff2bed
+ -cp ${BINDIR}/gtf2bed-$(MEGAROW) ${BINDIR_MODULE_MEGAROW}/gtf2bed
+ -cp ${BINDIR}/gvf2bed-$(MEGAROW) ${BINDIR_MODULE_MEGAROW}/gvf2bed
+ -cp ${BINDIR}/psl2bed-$(MEGAROW) ${BINDIR_MODULE_MEGAROW}/psl2bed
+ -cp ${BINDIR}/rmsk2bed-$(MEGAROW) ${BINDIR_MODULE_MEGAROW}/rmsk2bed
+ -cp ${BINDIR}/sam2bed-$(MEGAROW) ${BINDIR_MODULE_MEGAROW}/sam2bed
+ -cp ${BINDIR}/vcf2bed-$(MEGAROW) ${BINDIR_MODULE_MEGAROW}/vcf2bed
+ -cp ${BINDIR}/wig2bed-$(MEGAROW) ${BINDIR_MODULE_MEGAROW}/wig2bed
+ -cp ${BINDIR}/bam2starch-$(MEGAROW) ${BINDIR_MODULE_MEGAROW}/bam2starch
+ -cp ${BINDIR}/gff2starch-$(MEGAROW) ${BINDIR_MODULE_MEGAROW}/gff2starch
+ -cp ${BINDIR}/gtf2starch-$(MEGAROW) ${BINDIR_MODULE_MEGAROW}/gtf2starch
+ -cp ${BINDIR}/gvf2starch-$(MEGAROW) ${BINDIR_MODULE_MEGAROW}/gvf2starch
+ -cp ${BINDIR}/psl2starch-$(MEGAROW) ${BINDIR_MODULE_MEGAROW}/psl2starch
+ -cp ${BINDIR}/rmsk2starch-$(MEGAROW) ${BINDIR_MODULE_MEGAROW}/rmsk2starch
+ -cp ${BINDIR}/sam2starch-$(MEGAROW) ${BINDIR_MODULE_MEGAROW}/sam2starch
+ -cp ${BINDIR}/vcf2starch-$(MEGAROW) ${BINDIR_MODULE_MEGAROW}/vcf2starch
+ -cp ${BINDIR}/wig2starch-$(MEGAROW) ${BINDIR_MODULE_MEGAROW}/wig2starch
+ -cp ${BINDIR}/bam2bed_sge-$(MEGAROW) ${BINDIR_MODULE_MEGAROW}/bam2bed_sge
+ -cp ${BINDIR}/bam2bed_slurm-$(MEGAROW) ${BINDIR_MODULE_MEGAROW}/bam2bed_slurm
+ -cp ${BINDIR}/bam2bed_gnuParallel-$(MEGAROW) ${BINDIR_MODULE_MEGAROW}/bam2bed_gnuParallel
+ -cp ${BINDIR}/bam2starch_sge-$(MEGAROW) ${BINDIR_MODULE_MEGAROW}/bam2starch_sge
+ -cp ${BINDIR}/bam2starch_slurm-$(MEGAROW) ${BINDIR_MODULE_MEGAROW}/bam2starch_slurm
+ -cp ${BINDIR}/bam2starch_gnuParallel-$(MEGAROW) ${BINDIR_MODULE_MEGAROW}/bam2starch_gnuParallel
+ -cp ${BINDIR}/starchcluster_sge-$(MEGAROW) ${BINDIR_MODULE_MEGAROW}/starchcluster_sge
+ -cp ${BINDIR}/starchcluster_gnuParallel-$(MEGAROW) ${BINDIR_MODULE_MEGAROW}/starchcluster_gnuParallel
+ -cp ${BINDIR}/starchcluster_slurm-$(MEGAROW) ${BINDIR_MODULE_MEGAROW}/starchcluster_slurm
+ -cp ${BINDIR}/starch-diff-$(MEGAROW) ${BINDIR_MODULE_MEGAROW}/starch-diff
#######################
# install details
@@ -47,40 +210,50 @@ prep_c:
mkdir -p ${BINDIR}
install_debug: prep_c install_conversion_scripts install_starch_scripts
- -cp ${APPDIR}/sort-bed/bin/debug.sort-bed ${BINDIR}/
- -cp ${APPDIR}/sort-bed/bin/update-sort-bed-slurm ${BINDIR}/
- -cp ${APPDIR}/sort-bed/bin/update-sort-bed-starch-slurm ${BINDIR}/
- -cp ${APPDIR}/sort-bed/bin/update-sort-bed-migrate-candidates ${BINDIR}/
- -cp ${APPDIR}/bedops/bin/debug.bedops ${BINDIR}/
- -cp ${APPDIR}/closestfeats/bin/debug.closest-features ${BINDIR}/
- -cp ${APPDIR}/bedmap/bin/debug.bedmap ${BINDIR}/
- -cp ${APPDIR}/bedextract/bin/debug.bedextract ${BINDIR}/
- -cp ${APPDIR}/starch/bin/debug.starch ${BINDIR}/
- -cp ${APPDIR}/starch/bin/debug.unstarch ${BINDIR}/
- -cp ${APPDIR}/starch/bin/debug.starchcat ${BINDIR}/
- -cp ${APPDIR}/starch/bin/debug.starchstrip ${BINDIR}/
- -cp ${APPDIR}/conversion/bin/debug.convert2bed ${BINDIR}/
+ -cp ${APPDIR}/sort-bed/bin/debug.sort-bed- ${BINDIR}/debug.sort-bed
+ -cp ${APPDIR}/sort-bed/bin/update-sort-bed-slurm- ${BINDIR}/update-sort-bed-slurm
+ -cp ${APPDIR}/sort-bed/bin/update-sort-bed-starch-slurm- ${BINDIR}/update-sort-bed-starch-slurm
+ -cp ${APPDIR}/sort-bed/bin/update-sort-bed-migrate-candidates- ${BINDIR}/update-sort-bed-migrate-candidates
+ -cp ${APPDIR}/bedops/bin/debug.bedops- ${BINDIR}/debug.bedops
+ -cp ${APPDIR}/closestfeats/bin/debug.closest-features- ${BINDIR}/debug.closest-features
+ -cp ${APPDIR}/bedmap/bin/debug.bedmap- ${BINDIR}/debug.bedmap
+ -cp ${APPDIR}/bedextract/bin/debug.bedextract- ${BINDIR}/debug.bedextract
+ -cp ${APPDIR}/starch/bin/debug.starch- ${BINDIR}/debug.starch
+ -cp ${APPDIR}/starch/bin/debug.unstarch- ${BINDIR}/debug.unstarch
+ -cp ${APPDIR}/starch/bin/debug.starchcat- ${BINDIR}/debug.starchcat
+ -cp ${APPDIR}/starch/bin/debug.starchstrip- ${BINDIR}/debug.starchstrip
+ -cp ${APPDIR}/conversion/bin/debug.convert2bed- ${BINDIR}/debug.convert2bed
install_gprof: prep_c install_conversion_scripts install_starch_scripts
- -cp ${APPDIR}/sort-bed/bin/gprof.sort-bed ${BINDIR}/
- -cp ${APPDIR}/sort-bed/bin/update-sort-bed-slurm ${BINDIR}/
- -cp ${APPDIR}/sort-bed/bin/update-sort-bed-starch-slurm ${BINDIR}/
- -cp ${APPDIR}/sort-bed/bin/update-sort-bed-migrate-candidates ${BINDIR}/
- -cp ${APPDIR}/bedops/bin/gprof.bedops ${BINDIR}/
- -cp ${APPDIR}/closestfeats/bin/gprof.closest-features ${BINDIR}/
- -cp ${APPDIR}/bedmap/bin/gprof.bedmap ${BINDIR}/
- -cp ${APPDIR}/bedextract/bin/gprof.bedextract ${BINDIR}/
- -cp ${APPDIR}/starch/bin/gprof.starch ${BINDIR}/
- -cp ${APPDIR}/starch/bin/gprof.unstarch ${BINDIR}/
- -cp ${APPDIR}/starch/bin/gprof.starchcat ${BINDIR}/
- -cp ${APPDIR}/starch/bin/gprof.starchstrip ${BINDIR}/
- -cp ${APPDIR}/conversion/bin/gprof.convert2bed ${BINDIR}/
+ -cp ${APPDIR}/sort-bed/bin/gprof.sort-bed- ${BINDIR}/gprof.sort-bed
+ -cp ${APPDIR}/sort-bed/bin/update-sort-bed-slurm- ${BINDIR}/update-sort-bed-slurm
+ -cp ${APPDIR}/sort-bed/bin/update-sort-bed-starch-slurm- ${BINDIR}/update-sort-bed-starch-slurm
+ -cp ${APPDIR}/sort-bed/bin/update-sort-bed-migrate-candidates- ${BINDIR}/update-sort-bed-migrate-candidates
+ -cp ${APPDIR}/bedops/bin/gprof.bedops- ${BINDIR}/gprof.bedops
+ -cp ${APPDIR}/closestfeats/bin/gprof.closest-features- ${BINDIR}/gprof.closest-features
+ -cp ${APPDIR}/bedmap/bin/gprof.bedmap- ${BINDIR}/gprof.bedmap
+ -cp ${APPDIR}/bedextract/bin/gprof.bedextract- ${BINDIR}/gprof.bedextract
+ -cp ${APPDIR}/starch/bin/gprof.starch- ${BINDIR}/gprof.starch
+ -cp ${APPDIR}/starch/bin/gprof.unstarch- ${BINDIR}/gprof.unstarch
+ -cp ${APPDIR}/starch/bin/gprof.starchcat- ${BINDIR}/gprof.starchcat
+ -cp ${APPDIR}/starch/bin/gprof.starchstrip- ${BINDIR}/gprof.starchstrip
+ -cp ${APPDIR}/conversion/bin/gprof.convert2bed- ${BINDIR}/gprof.convert2bed
install_starch_scripts: prep_c
- -cp ${APPDIR}/starch/bin/starchcluster_sge ${BINDIR}/
- -cp ${APPDIR}/starch/bin/starchcluster_gnuParallel ${BINDIR}/
- -cp ${APPDIR}/starch/bin/starchcluster_slurm ${BINDIR}/
- -cp ${APPDIR}/starch/bin/starch-diff ${BINDIR}/
+ -cp ${APPDIR}/starch/bin/starchcluster_sge- ${BINDIR}/starchcluster_sge
+ -cp ${APPDIR}/starch/bin/starchcluster_gnuParallel- ${BINDIR}/starchcluster_gnuParallel
+ -cp ${APPDIR}/starch/bin/starchcluster_slurm- ${BINDIR}/starchcluster_slurm
+ -cp ${APPDIR}/starch/bin/starch-diff- ${BINDIR}/starch-diff
+
+install_starch_scripts_with_suffix: prep_c
+ -cp ${APPDIR}/starch/bin/starchcluster_sge-$(TYPICAL) ${BINDIR}/starchcluster_sge-$(TYPICAL)
+ -cp ${APPDIR}/starch/bin/starchcluster_gnuParallel-$(TYPICAL) ${BINDIR}/starchcluster_gnuParallel-$(TYPICAL)
+ -cp ${APPDIR}/starch/bin/starchcluster_slurm-$(TYPICAL) ${BINDIR}/starchcluster_slurm-$(TYPICAL)
+ -cp ${APPDIR}/starch/bin/starch-diff-$(TYPICAL) ${BINDIR}/starch-diff-$(TYPICAL)
+ -cp ${APPDIR}/starch/bin/starchcluster_sge-$(MEGAROW) ${BINDIR}/starchcluster_sge-$(MEGAROW)
+ -cp ${APPDIR}/starch/bin/starchcluster_gnuParallel-$(MEGAROW) ${BINDIR}/starchcluster_gnuParallel-$(MEGAROW)
+ -cp ${APPDIR}/starch/bin/starchcluster_slurm-$(MEGAROW) ${BINDIR}/starchcluster_slurm-$(MEGAROW)
+ -cp ${APPDIR}/starch/bin/starch-diff-$(MEGAROW) ${BINDIR}/starch-diff-$(MEGAROW)
install_conversion_scripts: prep_c
-cp ${APPDIR}/conversion/src/wrappers/bam2bed ${BINDIR}/bam2bed
@@ -108,25 +281,50 @@ install_conversion_scripts: prep_c
-cp ${APPDIR}/conversion/src/wrappers/bam2starch_slurm ${BINDIR}/bam2starch_slurm
-cp ${APPDIR}/conversion/src/wrappers/bam2starch_gnuParallel ${BINDIR}/bam2starch_gnuParallel
-install_osx_packaging_bins: prep_c
+.PHONY: $(WRAPPERS)
+
+install_conversion_scripts_with_suffix: $(WRAPPERS)
+
+$(WRAPPERS): prep_c
+ cp $@ $(patsubst %,$(BINDIR)/%-$(TYPICAL), $(notdir $@))
+ cp $@ $(patsubst %,$(BINDIR)/%-$(MEGAROW), $(notdir $@))
+
+install_osx_packaging_bins: prep_c all
mkdir -p ${OSXPKGDIR}
- -cp ${APPDIR}/sort-bed/bin/sort-bed ${OSXPKGDIR}/
- -cp ${APPDIR}/sort-bed/bin/update-sort-bed-slurm ${OSXPKGDIR}/
- -cp ${APPDIR}/sort-bed/bin/update-sort-bed-starch-slurm ${OSXPKGDIR}/
- -cp ${APPDIR}/sort-bed/bin/update-sort-bed-migrate-candidates ${OSXPKGDIR}/
- -cp ${APPDIR}/bedops/bin/bedops ${OSXPKGDIR}/
- -cp ${APPDIR}/closestfeats/bin/closest-features ${OSXPKGDIR}/
- -cp ${APPDIR}/bedmap/bin/bedmap ${OSXPKGDIR}/
- -cp ${APPDIR}/bedextract/bin/bedextract ${OSXPKGDIR}/
- -cp ${APPDIR}/starch/bin/starch ${OSXPKGDIR}/
- -cp ${APPDIR}/starch/bin/unstarch ${OSXPKGDIR}/
- -cp ${APPDIR}/starch/bin/starchcat ${OSXPKGDIR}/
- -cp ${APPDIR}/starch/bin/starchstrip ${OSXPKGDIR}/
- -cp ${APPDIR}/starch/bin/starchcluster_sge ${OSXPKGDIR}/starchcluster_sge
- -cp ${APPDIR}/starch/bin/starchcluster_gnuParallel ${OSXPKGDIR}/starchcluster_gnuParallel
- -cp ${APPDIR}/starch/bin/starchcluster_slurm ${OSXPKGDIR}/starchcluster_slurm
- -cp ${APPDIR}/starch/bin/starch-diff ${OSXPKGDIR}/starch-diff
- -cp ${APPDIR}/conversion/bin/convert2bed ${OSXPKGDIR}/
+ -cp ${APPDIR}/sort-bed/bin/sort-bed-typical ${OSXPKGDIR}/sort-bed-typical
+ -cp ${APPDIR}/sort-bed/bin/sort-bed-megarow ${OSXPKGDIR}/sort-bed-megarow
+ -cp ${APPDIR}/sort-bed/bin/update-sort-bed-slurm-typical ${OSXPKGDIR}/update-sort-bed-slurm-typical
+ -cp ${APPDIR}/sort-bed/bin/update-sort-bed-slurm-megarow ${OSXPKGDIR}/update-sort-bed-slurm-megarow
+ -cp ${APPDIR}/sort-bed/bin/update-sort-bed-starch-slurm-typical ${OSXPKGDIR}/update-sort-bed-starch-slurm-typical
+ -cp ${APPDIR}/sort-bed/bin/update-sort-bed-starch-slurm-megarow ${OSXPKGDIR}/update-sort-bed-starch-slurm-megarow
+ -cp ${APPDIR}/sort-bed/bin/update-sort-bed-migrate-candidates-typical ${OSXPKGDIR}/update-sort-bed-migrate-candidates-typical
+ -cp ${APPDIR}/sort-bed/bin/update-sort-bed-migrate-candidates-megarow ${OSXPKGDIR}/update-sort-bed-migrate-candidates-megarow
+ -cp ${APPDIR}/bedops/bin/bedops-typical ${OSXPKGDIR}/bedops-typical
+ -cp ${APPDIR}/bedops/bin/bedops-megarow ${OSXPKGDIR}/bedops-megarow
+ -cp ${APPDIR}/closestfeats/bin/closest-features-typical ${OSXPKGDIR}/closest-features-typical
+ -cp ${APPDIR}/closestfeats/bin/closest-features-megarow ${OSXPKGDIR}/closest-features-megarow
+ -cp ${APPDIR}/bedmap/bin/bedmap-typical ${OSXPKGDIR}/bedmap-typical
+ -cp ${APPDIR}/bedmap/bin/bedmap-megarow ${OSXPKGDIR}/bedmap-megarow
+ -cp ${APPDIR}/bedextract/bin/bedextract-typical ${OSXPKGDIR}/bedextract-typical
+ -cp ${APPDIR}/bedextract/bin/bedextract-megarow ${OSXPKGDIR}/bedextract-megarow
+ -cp ${APPDIR}/starch/bin/starch-typical ${OSXPKGDIR}/starch-typical
+ -cp ${APPDIR}/starch/bin/starch-megarow ${OSXPKGDIR}/starch-megarow
+ -cp ${APPDIR}/starch/bin/unstarch-typical ${OSXPKGDIR}/unstarch-typical
+ -cp ${APPDIR}/starch/bin/unstarch-megarow ${OSXPKGDIR}/unstarch-megarow
+ -cp ${APPDIR}/starch/bin/starchcat-typical ${OSXPKGDIR}/starchcat-typical
+ -cp ${APPDIR}/starch/bin/starchcat-megarow ${OSXPKGDIR}/starchcat-megarow
+ -cp ${APPDIR}/starch/bin/starchstrip-typical ${OSXPKGDIR}/starchstrip-typical
+ -cp ${APPDIR}/starch/bin/starchstrip-megarow ${OSXPKGDIR}/starchstrip-megarow
+ -cp ${APPDIR}/starch/bin/starchcluster_sge-typical ${OSXPKGDIR}/starchcluster_sge-typical
+ -cp ${APPDIR}/starch/bin/starchcluster_sge-megarow ${OSXPKGDIR}/starchcluster_sge-megarow
+ -cp ${APPDIR}/starch/bin/starchcluster_gnuParallel-typical ${OSXPKGDIR}/starchcluster_gnuParallel-typical
+ -cp ${APPDIR}/starch/bin/starchcluster_gnuParallel-megarow ${OSXPKGDIR}/starchcluster_gnuParallel-megarow
+ -cp ${APPDIR}/starch/bin/starchcluster_slurm-typical ${OSXPKGDIR}/starchcluster_slurm-typical
+ -cp ${APPDIR}/starch/bin/starchcluster_slurm-megarow ${OSXPKGDIR}/starchcluster_slurm-megarow
+ -cp ${APPDIR}/starch/bin/starch-diff-typical ${OSXPKGDIR}/starch-diff-typical
+ -cp ${APPDIR}/starch/bin/starch-diff-megarow ${OSXPKGDIR}/starch-diff-megarow
+ -cp ${APPDIR}/conversion/bin/convert2bed-typical ${OSXPKGDIR}/convert2bed-typical
+ -cp ${APPDIR}/conversion/bin/convert2bed-megarow ${OSXPKGDIR}/convert2bed-megarow
-cp ${APPDIR}/conversion/src/wrappers/bam2bed ${OSXPKGDIR}/bam2bed
-cp ${APPDIR}/conversion/src/wrappers/gff2bed ${OSXPKGDIR}/gff2bed
-cp ${APPDIR}/conversion/src/wrappers/gtf2bed ${OSXPKGDIR}/gtf2bed
@@ -151,14 +349,34 @@ install_osx_packaging_bins: prep_c
-cp ${APPDIR}/conversion/src/wrappers/bam2starch_sge ${OSXPKGDIR}/bam2starch_sge
-cp ${APPDIR}/conversion/src/wrappers/bam2starch_slurm ${OSXPKGDIR}/bam2starch_slurm
-cp ${APPDIR}/conversion/src/wrappers/bam2starch_gnuParallel ${OSXPKGDIR}/bam2starch_gnuParallel
- mkdir -p ${OSXLIBDIR}
+ -cp ${OTHERDIR}/switch-BEDOPS-binary-type ${OSXPKGDIR}
+ -cd ${OSXPKGDIR}; \
+ ln -sf ./sort-bed-typical ./sort-bed; \
+ ln -sf ./update-sort-bed-slurm-typical ./update-sort-bed-slurm; \
+ ln -sf ./update-sort-bed-starch-slurm-typical ./update-sort-bed-starch-slurm; \
+ ln -sf ./update-sort-bed-migrate-candidates-typical ./update-sort-bed-migrate-candidates; \
+ ln -sf ./bedops-typical ./bedops; \
+ ln -sf ./closest-features-typical ./closest-features; \
+ ln -sf ./bedmap-typical ./bedmap; \
+ ln -sf ./bedextract-typical ./bedextract; \
+ ln -sf ./starch-typical ./starch; \
+ ln -sf ./unstarch-typical ./unstarch; \
+ ln -sf ./starchcat-typical ./starchcat; \
+ ln -sf ./starchstrip-typical ./starchstrip; \
+ ln -sf ./starchcluster_sge-typical ./starchcluster_sge; \
+ ln -sf ./starchcluster_gnuParallel-typical ./starchcluster_gnuParallel; \
+ ln -sf ./starchcluster_slurm-typical ./starchcluster_slurm; \
+ ln -sf ./starch-diff-typical ./starch-diff; \
+ ln -sf ./convert2bed-typical ./convert2bed; \
+ cd ${CWD}; \
+ mkdir -p ${OSXLIBDIR}; \
update_bedops_version:
ifndef OLD_VER
- $(error Old version variable OLD_VER is undefined (e.g., 2.4.25))
+ $(error Old version variable OLD_VER is undefined (e.g., 2.4.26))
endif
ifndef NEW_VER
- $(error New version variable NEW_VER is undefined (e.g., 2.4.26))
+ $(error New version variable NEW_VER is undefined (e.g., 2.4.27))
endif
ifeq ($(KERNEL), Darwin)
sed -i "" -e "s/"$$OLD_VER"/"$$NEW_VER"/g" README.md
diff --git a/README.md b/README.md
index 3197176..2a67f2f 100644
--- a/README.md
+++ b/README.md
@@ -1,4 +1,4 @@
-## BEDOPS v2.4.26: high-performance genomic feature operations ##
+## BEDOPS v2.4.28: high-performance genomic feature operations ##
[](https://travis-ci.org/bedops/bedops) [](https://github.com/bedops/bedops/stargazers) [](https://github.com/bedops/bedops/blob/master/LICENSE) [](https://readthedocs.org/projects/bedops/?badge=latest)
@@ -6,9 +6,9 @@
### About ###
-**BEDOPS v2.4.26** is a suite of tools to address common questions raised in genomic studies — mostly with regard to overlap and proximity relationships between data sets. It aims to be scalable and flexible, facilitating the efficient and accurate analysis and management of large-scale genomic data.
+**BEDOPS v2.4.28** is a suite of tools to address common questions raised in genomic studies — mostly with regard to overlap and proximity relationships between data sets. It aims to be scalable and flexible, facilitating the efficient and accurate analysis and management of large-scale genomic data.
-The <a href="https://bedops.readthedocs.io/en/latest/content/overview.html#overview">overview</a> section of the **BEDOPS v2.4.26** documentation summarizes the toolkit, functionality and performance enhancements. The <a href="https://bedops.readthedocs.io/en/latest/index.html#reference">reference</a> table offers documentation for all applications and scripts.
+The <a href="https://bedops.readthedocs.io/en/latest/content/overview.html#overview">overview</a> section of the **BEDOPS v2.4.28** documentation summarizes the toolkit, functionality and performance enhancements. The <a href="https://bedops.readthedocs.io/en/latest/index.html#reference">reference</a> table offers documentation for all applications and scripts.
### Downloads ###
@@ -28,21 +28,20 @@ The <a href="https://bedops.readthedocs.io/en/latest/content/overview.html#overv
<tr>
<td valign="top">
<ul style="list-style-type:square; font-size:smaller; margin-left:0; margin-right:0px; padding-right:0px; padding-left:20px;">
-<li><a href="https://github.com/bedops/bedops/releases/download/v2.4.26/bedops_linux_x86_64-v2.4.26.tar.bz2">x86-64 (64-bit)</a> binaries</li>
-<li><a href="https://github.com/bedops/bedops/releases/download/v2.4.26/bedops_linux_i386-v2.4.26.tar.bz2">i386 (32-bit)</a> binaries</li>
+<li><a href="https://github.com/bedops/bedops/releases/download/v2.4.28/bedops_linux_x86_64-v2.4.28.tar.bz2">x86-64 (64-bit)</a> binaries</li>
<li><a href="http://bedops.readthedocs.io/en/latest/content/installation.html#linux">Installation instructions</a> for Linux hosts</li>
</ul>
</td>
<td valign="top">
<ul style="list-style-type:square; font-size:smaller; margin-left:0; margin-right:0px; padding-right:0px; padding-left:20px;">
-<li><a href="https://github.com/bedops/bedops/releases/download/v2.4.26/BEDOPS.2.4.26.pkg.zip">Intel (32-/64-bit, 10.7-10.12)</a> installer package</li>
+<li><a href="https://github.com/bedops/bedops/releases/download/v2.4.28/BEDOPS.2.4.28.pkg.zip">Intel (64-bit, 10.10-10.12)</a> installer package</li>
<li><a href="http://bedops.readthedocs.io/en/latest/content/installation.html#mac-os-x">Installation instructions</a> for Mac OS X hosts</li>
</ul>
</td>
<td valign="top">
<ul style="list-style-type:square; font-size:smaller; margin-left:0; margin-right:0px; padding-right:0px; padding-left:20px;">
-<li><a href="https://github.com/bedops/bedops/archive/v2.4.26.tar.gz">Source code</a> (tar.gz)</li>
-<li><a href="https://github.com/bedops/bedops/archive/v2.4.26.zip">Source code</a> (zip)</li>
+<li><a href="https://github.com/bedops/bedops/archive/v2.4.28.tar.gz">Source code</a> (tar.gz)</li>
+<li><a href="https://github.com/bedops/bedops/archive/v2.4.28.zip">Source code</a> (zip)</li>
<li><a href="http://bedops.readthedocs.io/en/latest/content/installation.html#installation-via-source-code">Compilation instructions</a></li>
</ul>
</td>
@@ -51,11 +50,11 @@ The <a href="https://bedops.readthedocs.io/en/latest/content/overview.html#overv
### Documentation ###
-Complete documentation for **BEDOPS v2.4.26** tools is available at: <a href="https://bedops.readthedocs.io/en/latest/index.html">https://bedops.readthedocs.io/</a>
+Complete documentation for **BEDOPS v2.4.28** tools is available at: <a href="https://bedops.readthedocs.io/en/latest/index.html">https://bedops.readthedocs.io/</a>
### Citation ###
-If you use **BEDOPS v2.4.26** in your research, please cite the following manuscript:
+If you use **BEDOPS v2.4.28** in your research, please cite the following manuscript:
> Shane Neph, M. Scott Kuehn, Alex P. Reynolds, et al.
> [**BEDOPS: high-performance genomic feature operations**
diff --git a/applications/bed/bedextract/src/ExtractRows.cpp b/applications/bed/bedextract/src/ExtractRows.cpp
index 7d9456f..837f6ca 100644
--- a/applications/bed/bedextract/src/ExtractRows.cpp
+++ b/applications/bed/bedextract/src/ExtractRows.cpp
@@ -33,12 +33,13 @@
#include <map>
#include <numeric>
#include <string>
+#include <type_traits>
#include <utility>
#include <vector>
#include "algorithm/bed/FindBedRange.hpp"
#include "algorithm/visitors/helpers/ProcessBedVisitorRow.hpp"
-#include "data/bed/BedTypes.hpp"
+//#include "data/bed/BedTypes.hpp"
#include "data/bed/BedCheckIterator.hpp"
#include "suite/BEDOPS.Constants.hpp"
#include "suite/BEDOPS.Version.hpp"
@@ -50,6 +51,17 @@ namespace {
const std::string citation = BEDOPS::citation();
const std::string version = BEDOPS::revision();
const std::string authors = "Shane Neph & Alex Reynolds";
+ constexpr std::size_t PoolSz = 2*8;
+
+#if BEDOPS_BINARY_TYPE == 0
+ const std::string application_type = "typical";
+#else
+#if BEDOPS_BINARY_TYPE == 1
+ const std::string application_type = "megarow";
+#else
+ const std::string application_type = "typical";
+#endif
+#endif
//======
// Help
@@ -66,12 +78,11 @@ namespace {
//=======
template <typename ValueType>
struct Cache {
- Cache() : empty_(true), value_()
+ Cache() : empty_(true)
{ }
template <typename T>
void operator()(const T* t) {
- value_ = static_cast<ValueType>(*t);
empty_ = false;
}
@@ -80,7 +91,6 @@ namespace {
private:
bool empty_;
- ValueType value_;
};
using Bed::extract_details::TargetBedType;
@@ -156,8 +166,8 @@ namespace {
}
OpMode Mode() const { return m_; }
- FILE* File1() { return f1_; }
- FILE* File2() { return f2_; }
+ FILE* File1() const { return f1_; }
+ FILE* File2() const { return f2_; }
std::string File2Name() const { return f2Name_; }
std::string Chrome() const { return(chrom_); }
@@ -238,10 +248,20 @@ namespace {
return(c == EOF);
}
+ //=============
+ // get_pool()
+ //============
+ template <typename BedTypePtr>
+ Ext::PooledMemory<typename std::remove_pointer<BedTypePtr>::type, PoolSz>&
+ get_pool() {
+ static Ext::PooledMemory<typename std::remove_pointer<BedTypePtr>::type, PoolSz> pool;
+ return pool;
+ }
+
//==========
// doWork()
//==========
- void doWork(Input& input) {
+ void doWork(const Input& input) {
// execute the mode requested by the user
Input::OpMode mode = input.Mode();
FILE* f = input.File1();
@@ -253,11 +273,13 @@ namespace {
if ( mode == Input::TWOFILE ) { // find elements of file1 that overlap specified ranges of file2
Visitors::BedHelpers::Println printer;
if ( input.File2Name() == "stdin" ) {
- Bed::bed_check_iterator<TargetBedType*> titer(std::cin, input.File2Name()), teof;
+ auto& mem = get_pool<TargetBedType*>();
+ Bed::bed_check_iterator<TargetBedType*, PoolSz> titer(std::cin, input.File2Name(), mem), teof;
find_bed_range(f, titer, teof, printer);
} else {
std::ifstream* infile = new std::ifstream(input.File2Name().c_str());
- Bed::bed_check_iterator<TargetBedType*> titer(*infile, input.File2Name()), teof;
+ auto& mem = get_pool<TargetBedType*>();
+ Bed::bed_check_iterator<TargetBedType*, PoolSz> titer(*infile, input.File2Name(), mem), teof;
find_bed_range(f, titer, teof, printer);
delete infile;
}
@@ -289,8 +311,9 @@ namespace {
if ( lbound.first && lbound.second != at_end ) {
std::fseek(f, lbound.second, SEEK_SET);
ByteOffset b = std::ftell(f);
- QueryBedType q(f);
- printf("%s\n", q.chrom());
+ auto q = new QueryBedType(f);
+ printf("%s\n", q->chrom());
+ delete q;
std::fseek(f, b, SEEK_SET);
}
else
@@ -325,20 +348,20 @@ int main(int argc, char** argv) {
} catch(const Help& h) {
std::cout << prognm << std::endl;
std::cout << " citation: " + citation << std::endl;
- std::cout << " version: " + version << std::endl;
+ std::cout << " version: " + version + " (" + application_type + ")" << std::endl;
std::cout << " authors: " + authors << std::endl;
std::cout << usage() << std::endl;
isok = true;
} catch(const Version& v) {
std::cout << prognm << std::endl;
std::cout << " citation: " + citation << std::endl;
- std::cout << " version: " + version << std::endl;
+ std::cout << " version: " + version + " (" + application_type + ")" << std::endl;
std::cout << " authors: " + authors << std::endl;
isok = true;
} catch(std::string& msg) {
std::cerr << prognm << std::endl;
std::cerr << " citation: " + citation << std::endl;
- std::cerr << " version: " + version << std::endl;
+ std::cerr << " version: " + version + " (" + application_type + ")" << std::endl;
std::cerr << " authors: " + authors << std::endl;
std::cerr << usage() << std::endl;
std::cerr << msg << std::endl;
diff --git a/applications/bed/bedextract/src/Makefile b/applications/bed/bedextract/src/Makefile
index 11f935d..9cc2e67 100644
--- a/applications/bed/bedextract/src/Makefile
+++ b/applications/bed/bedextract/src/Makefile
@@ -6,7 +6,7 @@ LIB2 = $(MAIN)/interfaces/src/utility
LIB3 = $(MAIN)/interfaces/src/data/starch
THISDIR = ${shell pwd}
PARTY3 = ${THISDIR}/$(MAIN)/third-party
-OBJDIR = objects
+OBJDIR = objects_${BINARY_TYPE}
LIBJANSSON = libjansson.a
LIBBZIP2 = libbz2.a
LIBZLIB = libz.a
@@ -25,23 +25,31 @@ INCLUDES = -iquote$(HEAD) -I${LOCALJANSSONINCDIR} -I${LOCALBZIP2I
LIBLOCATION = -L${LOCALJANSSONLIBDIR} -L${LOCALBZIP2LIBDIR} -L${LOCALZLIBDIR}
LIBRARIES = ${LOCALJANSSONLIB} ${LOCALBZIP2LIB} ${LOCALZLIBLIB}
BLDFLAGS = -Wall -pedantic -O3 -std=c++11
-SFLAGS = -static
+SFLAGS = -static ${MEGAFLAGS}
+
+ifeq ($(BINARY_TYPE),)
+ TFLAG = -DBEDOPS_BINARY_TYPE=0
+else
+ TFLAG = -DBEDOPS_BINARY_TYPE=$(BINARY_TYPE_NUM)
+endif
dependency_names = NaN starchConstants starchFileHelpers starchHelpers starchMetadataHelpers unstarchHelpers starchSha1Digest starchBase64Coding
dependencies = $(addprefix $(OBJDIR)/, $(addsuffix .o, $(dependency_names)))
-FLAGS = $(SFLAGS) -s $(BLDFLAGS) $(dependencies) ${LIBLOCATION} ${INCLUDES}
-DFLAGS = $(SFLAGS) -g -O0 -std=c++11 -Wall -fno-inline -pedantic $(dependencies) ${LIBLOCATION} ${INCLUDES}
-GPROFFLAGS = $(SFLAGS) -O -std=c++11 -Wall -pedantic -pg $(dependencies) ${LIBLOCATION} ${INCLUDES}
+FLAGS = $(SFLAGS) -s $(TFLAG) $(BLDFLAGS) $(dependencies) ${LIBLOCATION} ${INCLUDES}
+DFLAGS = $(SFLAGS) -g -O0 -std=c++11 -Wall -fno-inline -pedantic $(dependencies) $(TFLAG) ${LIBLOCATION} ${INCLUDES}
+GPROFFLAGS = $(SFLAGS) -O -std=c++11 -Wall -pedantic -pg $(dependencies) $(TFLAG) ${LIBLOCATION} ${INCLUDES}
SOURCE1 = ExtractRows.cpp
BINDIR = ../bin
-PROG = bedextract
+PROG = bedextract-${BINARY_TYPE}
build: $(BINDIR)/$(PROG)
+ rm -rf ${OBJDIR}
build_gprof: $(BINDIR)/gprof.$(PROG)
build_debug: $(BINDIR)/debug.$(PROG)
+ rm -rf ${OBJDIR}
dependencies: $(dependencies)
@@ -62,6 +70,4 @@ $(OBJDIR)/%.o : $(LIB3)/%.c
clean:
rm -rf $(OBJDIR)
- rm -f $(BINDIR)/$(PROG)
- rm -f $(BINDIR)/*.$(PROG)
- rm -rf $(BINDIR)
\ No newline at end of file
+ rm -rf $(BINDIR)
diff --git a/applications/bed/bedextract/src/Makefile.darwin b/applications/bed/bedextract/src/Makefile.darwin
index 819622d..a7f67af 100644
--- a/applications/bed/bedextract/src/Makefile.darwin
+++ b/applications/bed/bedextract/src/Makefile.darwin
@@ -1,5 +1,3 @@
-MIN_OSX_VERSION = 10.7
-
MAIN = ../../../..
MAINAPPDIR = ../..
HEAD = $(MAIN)/interfaces/general-headers
@@ -8,7 +6,7 @@ LIB2 = $(MAIN)/interfaces/src/utility
LIB3 = $(MAIN)/interfaces/src/data/starch
THISDIR = ${shell pwd}
PARTY3 = ${THISDIR}/$(MAIN)/third-party
-OBJDIR = objects_$(ARCH)
+OBJDIR = objects_$(ARCH)_${BINARY_TYPE}
LIBJANSSON = libjansson.a
LIBBZIP2 = libbz2.a
LIBZLIB = libz.a
@@ -30,25 +28,33 @@ LIBRARIES = ${LOCALJANSSONLIB} ${LOCALBZIP2LIB} ${LOCALZLIBLIB}
STDFLAGS = -Wall -pedantic -std=c++11 -stdlib=libc++
BLDFLAGS = -O3 ${STDFLAGS}
+ifeq ($(BINARY_TYPE),)
+ TFLAG = -DBEDOPS_BINARY_TYPE=0
+else
+ TFLAG = -DBEDOPS_BINARY_TYPE=$(BINARY_TYPE_NUM)
+endif
-FLAGS = $(BLDFLAGS) $(OBJDIR)/NaN.o $(OBJDIR)/starchConstants.o $(OBJDIR)/starchFileHelpers.o $(OBJDIR)/starchHelpers.o $(OBJDIR)/starchMetadataHelpers.o $(OBJDIR)/unstarchHelpers.o $(OBJDIR)/starchSha1Digest.o $(OBJDIR)/starchBase64Coding.o ${LIBLOCATION} ${INCLUDES}
+FLAGS = $(BLDFLAGS) $(TFLAG) $(OBJDIR)/NaN.o $(OBJDIR)/starchConstants.o $(OBJDIR)/starchFileHelpers.o $(OBJDIR)/starchHelpers.o $(OBJDIR)/starchMetadataHelpers.o $(OBJDIR)/unstarchHelpers.o $(OBJDIR)/starchSha1Digest.o $(OBJDIR)/starchBase64Coding.o ${LIBLOCATION} ${INCLUDES}
-DFLAGS = -g -O0 ${STDFLAGS} $(OBJDIR)/NaN.o $(OBJDIR)/starchConstants.o $(OBJDIR)/starchFileHelpers.o $(OBJDIR)/starchHelpers.o $(OBJDIR)/starchMetadataHelpers.o $(OBJDIR)/unstarchHelpers.o $(OBJDIR)/starchSha1Digest.o $(OBJDIR)/starchBase64Coding.o ${LIBLOCATION} ${INCLUDES}
+DFLAGS = -g -O0 ${STDFLAGS} $(TFLAG) $(OBJDIR)/NaN.o $(OBJDIR)/starchConstants.o $(OBJDIR)/starchFileHelpers.o $(OBJDIR)/starchHelpers.o $(OBJDIR)/starchMetadataHelpers.o $(OBJDIR)/unstarchHelpers.o $(OBJDIR)/starchSha1Digest.o $(OBJDIR)/starchBase64Coding.o ${LIBLOCATION} ${INCLUDES}
-GPROFFLAGS = -O -pg ${STDFLAGS} $(OBJDIR)/NaN.o $(OBJDIR)/starchConstants.o $(OBJDIR)/starchFileHelpers.o $(OBJDIR)/starchHelpers.o $(OBJDIR)/starchMetadataHelpers.o $(OBJDIR)/unstarchHelpers.o $(OBJDIR)/starchSha1Digest.o $(OBJDIR)/starchBase64Coding.o ${LIBLOCATION} ${INCLUDES}
+GPROFFLAGS = -O -pg ${STDFLAGS} $(TFLAG) $(OBJDIR)/NaN.o $(OBJDIR)/starchConstants.o $(OBJDIR)/starchFileHelpers.o $(OBJDIR)/starchHelpers.o $(OBJDIR)/starchMetadataHelpers.o $(OBJDIR)/unstarchHelpers.o $(OBJDIR)/starchSha1Digest.o $(OBJDIR)/starchBase64Coding.o ${LIBLOCATION} ${INCLUDES}
SOURCE1 = ExtractRows.cpp
BINDIR = ../bin
-PROG = bedextract
+PROG = bedextract-${BINARY_TYPE}
build: dependencies
- $(CXX) -o $(BINDIR)/$(PROG)_$(ARCH) $(FLAGS) -mmacosx-version-min=$(MIN_OSX_VERSION) -arch $(ARCH) ${LIBRARIES} $(SOURCE1)
+ $(CXX) -o $(BINDIR)/$(PROG) $(FLAGS) -mmacosx-version-min=$(MIN_OSX_VERSION) -arch $(ARCH) ${LIBRARIES} $(SOURCE1)
+ rm -rf $(OBJDIR)
build_debug: dependencies
- $(CXX) -o $(BINDIR)/debug.$(PROG)_$(ARCH) $(DFLAGS) -mmacosx-version-min=$(MIN_OSX_VERSION) -arch $(ARCH) ${LIBRARIES} $(SOURCE1)
+ $(CXX) -o $(BINDIR)/debug.$(PROG) $(DFLAGS) -mmacosx-version-min=$(MIN_OSX_VERSION) -arch $(ARCH) ${LIBRARIES} $(SOURCE1)
+ rm -rf $(OBJDIR)
build_gprof: dependencies
- $(CXX) -o $(BINDIR)/gprof.$(PROG)_$(ARCH) $(GPROFFLAGS) -mmacosx-version-min=$(MIN_OSX_VERSION) -arch $(ARCH) ${LIBRARIES} $(SOURCE1)
+ $(CXX) -o $(BINDIR)/gprof.$(PROG) $(GPROFFLAGS) -mmacosx-version-min=$(MIN_OSX_VERSION) -arch $(ARCH) ${LIBRARIES} $(SOURCE1)
+ rm -rf $(OBJDIR)
dependencies:
rm -rf $(OBJDIR)
@@ -64,6 +70,4 @@ dependencies:
clean:
rm -rf $(OBJDIR)
- rm -rf $(BINDIR)/$(PROG)*
- rm -rf $(BINDIR)/*.$(PROG)*
rm -rf $(BINDIR)
diff --git a/applications/bed/bedmap/doc/known.issues b/applications/bed/bedmap/doc/known.issues
deleted file mode 100644
index a3283ff..0000000
--- a/applications/bed/bedmap/doc/known.issues
+++ /dev/null
@@ -1,33 +0,0 @@
-Shane Neph
-Create Date : Dec. 18, 2009
-
-sort-bed cannot sort output from bedmap --echo --[otherops] with multi-column outputs separated by '|', for example, when the ref file has 3 columns:
-chr1 1 10|something. bedops/bedmap/closest-features wouldn't be able to work on it either.
-
-
----------------------------------------------------------------------------------------------------
-Non-issues, but 'gotchas'
-
-
-=========
-Gotcha-1:
-=========
-File1:
-chr1 1 2 i 1
-chr1 7 15 j 2
-chr1 12 20 k 3
-
-File2:
-chr1 1 4
-chr1 3 6
-chr1 10 30
-
-You use:
-bedmap --fraction-map 1 --echo-mapRange --echo-mapScore File2 File1
-
-You receive:
-chr1 1 2|1
-<blank line>
-chr1 7 20|2;3
-
-It's a good idea to use --indicator or --echo to ensure there are no blank lines in the output, or use --skip-unmapped to exclude those on the output.
diff --git a/applications/bed/bedmap/src/Bedmap.cpp b/applications/bed/bedmap/src/Bedmap.cpp
index 4692a33..c9a1870 100644
--- a/applications/bed/bedmap/src/Bedmap.cpp
+++ b/applications/bed/bedmap/src/Bedmap.cpp
@@ -28,6 +28,7 @@
#include <map>
#include <sstream>
#include <string>
+#include <type_traits>
#include <utility>
#include <vector>
@@ -36,7 +37,9 @@
#include "algorithm/visitors/helpers/ProcessVisitorRow.hpp"
#include "algorithm/WindowSweep.hpp"
#include "data/bed/AllocateIterator_BED_starch.hpp"
+#include "data/bed/AllocateIterator_BED_starch_minmem.hpp"
#include "data/bed/BedCheckIterator.hpp"
+#include "data/bed/BedCheckIterator_minmem.hpp"
#include "data/bed/BedDistances.hpp"
#include "data/bed/BedTypes.hpp"
#include "suite/BEDOPS.Version.hpp"
@@ -55,6 +58,18 @@ namespace BedMap {
const std::string version = BEDOPS::revision();
const std::string authors = "Shane Neph & Scott Kuehn";
const std::string citation = BEDOPS::citation();
+ constexpr std::size_t PoolSz = 8*8*8;
+ bool minimumMemory = false;
+
+#if BEDOPS_BINARY_TYPE == 0
+ const std::string application_type = "typical";
+#else
+#if BEDOPS_BINARY_TYPE == 1
+ const std::string application_type = "megarow";
+#else
+ const std::string application_type = "typical";
+#endif
+#endif
//======
// Help
@@ -84,6 +99,8 @@ namespace BedMap {
const std::vector<std::string>& visitorNames,
const std::vector <std::vector<std::string> >& visitorArgs);
+ bool checkStarchNesting(const std::string&, const std::string&);
+
} // namespace BedMap
@@ -101,9 +118,14 @@ int main(int argc, char **argv) {
std::vector<std::string> visitorNames = input.visitorNames_;
std::vector< std::vector<std::string> > visitorArgs = input.visitorArgs_;
- int prec = input.precision_;
- bool sci = input.useScientific_;
-
+ const int prec = input.precision_;
+ const bool sci = input.useScientific_;
+ BedMap::minimumMemory = input.useMinMemory_;
+
+ // if all Starch inputs and no nested elements, then can use --faster if the
+ // overlap criterion allows it.
+ const bool starchFast = !BedMap::checkStarchNesting(input.refFileName_, input.mapFileName_);
+
if ( input.isPercMap_ ) { // % overlap relative to MapType's size (signalmapish)
Bed::PercentOverlapMapping bedDist(input.percOvr_);
Bed::Overlapping sweepDist(0); // dist type for sweep different from BedBaseVisitor's
@@ -125,12 +147,13 @@ int main(int argc, char **argv) {
input.minRefFields_, input.minMapFields_, input.errorCheck_,
input.outDelim_, input.multiDelim_, prec, sci, input.fastMode_,
input.sweepAll_, input.chrom_, input.skipUnmappedRows_, visitorNames, visitorArgs);
- } else if ( input.isExact_ ) { // must be identical coordinates
+ } else if ( input.isExact_ ) { // must be identical coordinates; should work fine with fully-nested elements
Bed::Exact bedDist;
Bed::Overlapping sweepDist(0); // dist type for sweep different from BedBaseVisitor's
+ const bool fastMode = true;
BedMap::selectSweep(sweepDist, bedDist, input.refFileName_, input.mapFileName_,
input.minRefFields_, input.minMapFields_, input.errorCheck_,
- input.outDelim_, input.multiDelim_, prec, sci, input.fastMode_,
+ input.outDelim_, input.multiDelim_, prec, sci, fastMode,
input.sweepAll_, input.chrom_, input.skipUnmappedRows_, visitorNames, visitorArgs);
} else if ( input.isPercEither_ ) { // % overlap relative to either MapType's or RefType's size
Bed::PercentOverlapEither bedDist(input.percOvr_);
@@ -144,34 +167,34 @@ int main(int argc, char **argv) {
Bed::RangedDist sweepDist(input.rangeBP_); // same as bedDist in this case
BedMap::selectSweep(sweepDist, bedDist, input.refFileName_, input.mapFileName_,
input.minRefFields_, input.minMapFields_, input.errorCheck_,
- input.outDelim_, input.multiDelim_, prec, sci, input.fastMode_,
+ input.outDelim_, input.multiDelim_, prec, sci, (input.fastMode_ || starchFast),
input.sweepAll_, input.chrom_, input.skipUnmappedRows_, visitorNames, visitorArgs);
} else { // require a certain amount of bp overlap
Bed::Overlapping bedDist(input.overlapBP_);
Bed::Overlapping sweepDist(0); // dist type for sweep different from BedBaseVisitor's
BedMap::selectSweep(sweepDist, bedDist, input.refFileName_, input.mapFileName_,
input.minRefFields_, input.minMapFields_, input.errorCheck_,
- input.outDelim_, input.multiDelim_, prec, sci, input.fastMode_,
+ input.outDelim_, input.multiDelim_, prec, sci, (input.fastMode_ || starchFast),
input.sweepAll_, input.chrom_, input.skipUnmappedRows_, visitorNames, visitorArgs);
}
- return(EXIT_SUCCESS);
+ return EXIT_SUCCESS;
} catch(const BedMap::Help& h) { // show usage and exit success
std::cout << BedMap::prognm << std::endl;
std::cout << " citation: " << BedMap::citation << std::endl;
- std::cout << " version: " << BedMap::version << std::endl;
+ std::cout << " version: " << BedMap::version + " (" + BedMap::application_type + ")" << std::endl;
std::cout << " authors: " << BedMap::authors << std::endl;
std::cout << BedMap::Usage() << std::endl;
- return(EXIT_SUCCESS);
+ return EXIT_SUCCESS;
} catch(const BedMap::Version& v) { // show version and exit success
std::cout << BedMap::prognm << std::endl;
std::cout << " citation: " << BedMap::citation << std::endl;
- std::cout << " version: " << BedMap::version << std::endl;
+ std::cout << " version: " << BedMap::version + " (" + BedMap::application_type + ")" << std::endl;
std::cout << " authors: " << BedMap::authors << std::endl;
} catch(const BedMap::NoInput& ni) { // show usage and exit failure
std::cerr << BedMap::prognm << std::endl;
std::cerr << " citation: " << BedMap::citation << std::endl;
- std::cerr << " version: " << BedMap::version << std::endl;
+ std::cerr << " version: " << BedMap::version + " (" + BedMap::application_type + ")" << std::endl;
std::cerr << " authors: " << BedMap::authors << std::endl;
std::cerr << BedMap::Usage() << std::endl;
} catch(std::string& s) {
@@ -183,12 +206,22 @@ int main(int argc, char **argv) {
} catch(...) {
std::cerr << "Unknown Error. Aborting" << std::endl;
}
- return(EXIT_FAILURE);
+ return EXIT_FAILURE;
}
namespace BedMap {
+ //=============
+ // get_pool()
+ //============
+ template <typename BedTypePtr>
+ Ext::PooledMemory<typename std::remove_pointer<BedTypePtr>::type, PoolSz>&
+ get_pool() {
+ static Ext::PooledMemory<typename std::remove_pointer<BedTypePtr>::type, PoolSz> pool;
+ return pool;
+ }
+
//============
// runSweep(): single-file mode
//============
@@ -204,7 +237,7 @@ namespace BedMap {
bool skipUnmappedRows,
std::vector<BaseClass*>& visitorGroup) {
- typedef typename BaseClass::RefType RefType;
+ typedef typename std::remove_const<typename BaseClass::RefType>::type RefType;
typedef Visitors::Helpers::PrintDelim PrintType;
// Set up visitors
@@ -216,34 +249,65 @@ namespace BedMap {
if ( !errorCheck ) { // faster iterators
// Create file handle iterators
Ext::FPWrap<Ext::InvalidFile> refFile(refFileName);
- Bed::allocate_iterator_starch_bed<RefType*> refFileI(refFile, chrom), refFileEnd;
+ if ( !minimumMemory ) {
+ auto& mem1 = get_pool<RefType*>();
+ Bed::allocate_iterator_starch_bed<RefType*, PoolSz> refFileI(refFile, mem1, chrom), refFileEnd;
- // Do work
- if ( !fastMode )
- WindowSweep::sweep(refFileI, refFileEnd, st, multiv);
- else // no nested elements
- WindowSweep::sweep(refFileI, refFileEnd, dt, multiv);
- } else {
- // Create file handle iterators
- bool isStdin = (refFileName == "-");
- std::ifstream infile(refFileName.c_str());
- if ( !isStdin && !infile )
- throw(Ext::UserError("Unable to find: " + refFileName));
- if ( isStdin ) {
- Bed::bed_check_iterator<RefType*> refFileI(std::cin, refFileName, chrom, nestCheck);
- Bed::bed_check_iterator<RefType*> refFileEnd;
+ // Do work
if ( !fastMode )
WindowSweep::sweep(refFileI, refFileEnd, st, multiv);
else // no nested elements
WindowSweep::sweep(refFileI, refFileEnd, dt, multiv);
- } else {
- Bed::bed_check_iterator<RefType*> refFileI(infile, refFileName, chrom, nestCheck);
- Bed::bed_check_iterator<RefType*> refFileEnd;
+ } else { // old school minimal memory iterator
+ Bed::allocate_iterator_starch_bed_mm<RefType*> refFileI(refFile, chrom), refFileEnd;
+
+ // Do work
if ( !fastMode )
WindowSweep::sweep(refFileI, refFileEnd, st, multiv);
else // no nested elements
WindowSweep::sweep(refFileI, refFileEnd, dt, multiv);
}
+ } else {
+ // Create file handle iterators
+ bool isStdin = (refFileName == "-");
+ std::ifstream infile(refFileName.c_str());
+ if ( !isStdin && !infile )
+ throw(Ext::UserError("Unable to find: " + refFileName));
+ if ( isStdin ) {
+ if ( !minimumMemory ) {
+ auto& mem1 = get_pool<RefType*>();
+ Bed::bed_check_iterator<RefType*, PoolSz> refFileI(std::cin, refFileName, mem1, chrom, nestCheck);
+ Bed::bed_check_iterator<RefType*, PoolSz> refFileEnd;
+ if ( !fastMode )
+ WindowSweep::sweep(refFileI, refFileEnd, st, multiv);
+ else // no nested elements
+ WindowSweep::sweep(refFileI, refFileEnd, dt, multiv);
+ } else { // old school minimum memory iterator
+ Bed::bed_check_iterator_mm<RefType*> refFileI(std::cin, refFileName, chrom, nestCheck);
+ Bed::bed_check_iterator_mm<RefType*> refFileEnd;
+ if ( !fastMode )
+ WindowSweep::sweep(refFileI, refFileEnd, st, multiv);
+ else // no nested elements
+ WindowSweep::sweep(refFileI, refFileEnd, dt, multiv);
+ }
+ } else {
+ if ( !minimumMemory ) {
+ auto& mem1 = get_pool<RefType*>();
+ Bed::bed_check_iterator<RefType*, PoolSz> refFileI(infile, refFileName, mem1, chrom, nestCheck);
+ Bed::bed_check_iterator<RefType*, PoolSz> refFileEnd;
+ if ( !fastMode )
+ WindowSweep::sweep(refFileI, refFileEnd, st, multiv);
+ else // no nested elements
+ WindowSweep::sweep(refFileI, refFileEnd, dt, multiv);
+ } else { // old school minimum memory iterator
+ Bed::bed_check_iterator_mm<RefType*> refFileI(infile, refFileName, chrom, nestCheck);
+ Bed::bed_check_iterator_mm<RefType*> refFileEnd;
+ if ( !fastMode )
+ WindowSweep::sweep(refFileI, refFileEnd, st, multiv);
+ else // no nested elements
+ WindowSweep::sweep(refFileI, refFileEnd, dt, multiv);
+ }
+ }
}
// multiv does cleanup
@@ -266,8 +330,8 @@ namespace BedMap {
bool skipUnmappedRows,
std::vector<BaseClass*>& visitorGroup) {
- typedef typename BaseClass::RefType RefType;
- typedef typename BaseClass::MapType MapType;
+ typedef typename std::remove_const<typename BaseClass::RefType>::type RefType;
+ typedef typename std::remove_const<typename BaseClass::MapType>::type MapType;
typedef Visitors::Helpers::PrintDelim PrintType;
// Set up visitors
@@ -279,15 +343,29 @@ namespace BedMap {
if ( !errorCheck ) { // faster iterators
// Create file handle iterators
Ext::FPWrap<Ext::InvalidFile> refFile(refFileName);
- Bed::allocate_iterator_starch_bed<RefType*> refFileI(refFile, chrom), refFileEnd;
- Ext::FPWrap<Ext::InvalidFile> mapFile(mapFileName);
- Bed::allocate_iterator_starch_bed<MapType*> mapFileI(mapFile, chrom), mapFileEnd;
+ if ( !minimumMemory ) {
+ auto& mem1 = get_pool<RefType*>();
+ Bed::allocate_iterator_starch_bed<RefType*, PoolSz> refFileI(refFile, mem1, chrom), refFileEnd;
+ Ext::FPWrap<Ext::InvalidFile> mapFile(mapFileName);
+ auto& mem2 = get_pool<MapType*>();
+ Bed::allocate_iterator_starch_bed<MapType*, PoolSz> mapFileI(mapFile, mem2, chrom), mapFileEnd;
+
+ // Do work
+ if ( !fastMode )
+ WindowSweep::sweep(refFileI, refFileEnd, mapFileI, mapFileEnd, st, multiv, sweepAll);
+ else // no nested elements
+ WindowSweep::sweep(refFileI, refFileEnd, mapFileI, mapFileEnd, dt, multiv, sweepAll);
+ } else { // old school minimal memory iterator
+ Bed::allocate_iterator_starch_bed_mm<RefType*> refFileI(refFile, chrom), refFileEnd;
+ Ext::FPWrap<Ext::InvalidFile> mapFile(mapFileName);
+ Bed::allocate_iterator_starch_bed_mm<MapType*> mapFileI(mapFile, chrom), mapFileEnd;
- // Do work
- if ( !fastMode )
- WindowSweep::sweep(refFileI, refFileEnd, mapFileI, mapFileEnd, st, multiv, sweepAll);
- else // no nested elements
- WindowSweep::sweep(refFileI, refFileEnd, mapFileI, mapFileEnd, dt, multiv, sweepAll);
+ // Do work
+ if ( !fastMode )
+ WindowSweep::sweep(refFileI, refFileEnd, mapFileI, mapFileEnd, st, multiv, sweepAll);
+ else // no nested elements
+ WindowSweep::sweep(refFileI, refFileEnd, mapFileI, mapFileEnd, dt, multiv, sweepAll);
+ }
} else {
// Create file handle iterators
typedef Ext::UserError EType;
@@ -302,27 +380,55 @@ namespace BedMap {
throw(EType("Unable to find: " + mapFileName));
// Do work
- if ( isStdinRef ) {
- Bed::bed_check_iterator<RefType*> refFileI(std::cin, refFileName, chrom, nestCheck), refFileEnd;
- Bed::bed_check_iterator<MapType*> mapFileI(mfin, mapFileName, chrom, nestCheck), mapFileEnd;
- if ( !fastMode )
- WindowSweep::sweep(refFileI, refFileEnd, mapFileI, mapFileEnd, st, multiv, sweepAll);
- else // no nested elements
- WindowSweep::sweep(refFileI, refFileEnd, mapFileI, mapFileEnd, dt, multiv, sweepAll);
- } else {
- Bed::bed_check_iterator<RefType*> refFileI(rfin, refFileName, chrom, nestCheck), refFileEnd;
- if ( isStdinMap ) {
- Bed::bed_check_iterator<MapType*> mapFileI(std::cin, mapFileName, chrom, nestCheck), mapFileEnd;
+ if ( !minimumMemory ) {
+ auto& mem1 = get_pool<RefType*>();
+ auto& mem2 = get_pool<MapType*>();
+ if ( isStdinRef ) {
+ Bed::bed_check_iterator<RefType*, PoolSz> refFileI(std::cin, refFileName, mem1, chrom, nestCheck), refFileEnd;
+ Bed::bed_check_iterator<MapType*, PoolSz> mapFileI(mfin, mapFileName, mem2, chrom, nestCheck), mapFileEnd;
if ( !fastMode )
WindowSweep::sweep(refFileI, refFileEnd, mapFileI, mapFileEnd, st, multiv, sweepAll);
else // no nested elements
WindowSweep::sweep(refFileI, refFileEnd, mapFileI, mapFileEnd, dt, multiv, sweepAll);
} else {
- Bed::bed_check_iterator<MapType*> mapFileI(mfin, mapFileName, chrom, nestCheck), mapFileEnd;
+ Bed::bed_check_iterator<RefType*, PoolSz> refFileI(rfin, refFileName, mem1, chrom, nestCheck), refFileEnd;
+ if ( isStdinMap ) {
+ Bed::bed_check_iterator<MapType*, PoolSz> mapFileI(std::cin, mapFileName, mem2, chrom, nestCheck), mapFileEnd;
+ if ( !fastMode )
+ WindowSweep::sweep(refFileI, refFileEnd, mapFileI, mapFileEnd, st, multiv, sweepAll);
+ else // no nested elements
+ WindowSweep::sweep(refFileI, refFileEnd, mapFileI, mapFileEnd, dt, multiv, sweepAll);
+ } else {
+ Bed::bed_check_iterator<MapType*, PoolSz> mapFileI(mfin, mapFileName, mem2, chrom, nestCheck), mapFileEnd;
+ if ( !fastMode )
+ WindowSweep::sweep(refFileI, refFileEnd, mapFileI, mapFileEnd, st, multiv, sweepAll);
+ else // no nested elements
+ WindowSweep::sweep(refFileI, refFileEnd, mapFileI, mapFileEnd, dt, multiv, sweepAll);
+ }
+ }
+ } else { // old school minimal memory iterator
+ if ( isStdinRef ) {
+ Bed::bed_check_iterator_mm<RefType*> refFileI(std::cin, refFileName, chrom, nestCheck), refFileEnd;
+ Bed::bed_check_iterator_mm<MapType*> mapFileI(mfin, mapFileName, chrom, nestCheck), mapFileEnd;
if ( !fastMode )
WindowSweep::sweep(refFileI, refFileEnd, mapFileI, mapFileEnd, st, multiv, sweepAll);
else // no nested elements
WindowSweep::sweep(refFileI, refFileEnd, mapFileI, mapFileEnd, dt, multiv, sweepAll);
+ } else {
+ Bed::bed_check_iterator_mm<RefType*> refFileI(rfin, refFileName, chrom, nestCheck), refFileEnd;
+ if ( isStdinMap ) {
+ Bed::bed_check_iterator_mm<MapType*> mapFileI(std::cin, mapFileName, chrom, nestCheck), mapFileEnd;
+ if ( !fastMode )
+ WindowSweep::sweep(refFileI, refFileEnd, mapFileI, mapFileEnd, st, multiv, sweepAll);
+ else // no nested elements
+ WindowSweep::sweep(refFileI, refFileEnd, mapFileI, mapFileEnd, dt, multiv, sweepAll);
+ } else {
+ Bed::bed_check_iterator_mm<MapType*> mapFileI(mfin, mapFileName, chrom, nestCheck), mapFileEnd;
+ if ( !fastMode )
+ WindowSweep::sweep(refFileI, refFileEnd, mapFileI, mapFileEnd, st, multiv, sweepAll);
+ else // no nested elements
+ WindowSweep::sweep(refFileI, refFileEnd, mapFileI, mapFileEnd, dt, multiv, sweepAll);
+ }
}
}
}
@@ -338,7 +444,7 @@ namespace BedMap {
std::string t = s;
for ( std::size_t i = 0; i < t.size(); ++i )
t[i] = std::toupper(t[i]);
- return(t);
+ return t;
}
@@ -368,13 +474,12 @@ namespace BedMap {
const std::vector<std::string>&,
const std::string& multivalColSep,
int precision, bool useScientific) {
-
+
typedef VisitorTypes<BaseVisitor> VTypes;
BaseVisitor* rtn = 0;
-
+
// Create an instance associated with each name in classNames
std::string nm = upper(className);
-
if ( nm == visName<typename VTypes::Count>() )
rtn = new typename VTypes::Count;
@@ -412,8 +517,7 @@ namespace BedMap {
PT pt(precision, useScientific);
rtn = new typename VTypes::OvrUniqFract(pt);
}
-
- return(rtn);
+ return rtn;
}
};
@@ -432,11 +536,11 @@ namespace BedMap {
const std::vector<std::string>& args,
const std::string& multivalColSep,
int precision, bool useScientific) {
-
+
typedef VisitorTypes<BaseVisitor> VTypes;
BaseVisitor* rtn = SuperClass::generate(d, className, args, multivalColSep, precision, useScientific);
if ( rtn )
- return(rtn);
+ return rtn;
// Create an instance associated with className
std::string nm = upper(className);
@@ -449,7 +553,7 @@ namespace BedMap {
rtn = new typename VTypes::EchoMapUniqueID(PT(multivalColSep));
}
- return(rtn);
+ return rtn;
}
};
@@ -468,11 +572,11 @@ namespace BedMap {
const std::vector<std::string>& args,
const std::string& multivalColSep,
int precision, bool useScientific) {
-
+
typedef VisitorTypes<BaseVisitor> VTypes;
BaseVisitor* rtn = SuperClass::generate(d, className, args, multivalColSep, precision, useScientific);
if ( rtn )
- return(rtn);
+ return rtn;
// Create an instance associated with className
std::string nm = upper(className);
@@ -549,7 +653,7 @@ namespace BedMap {
else if ( nm == visName<typename VTypes::WMean>() )
rtn = new typename VTypes::WMean(pt);
- return(rtn);
+ return rtn;
}
};
@@ -573,7 +677,63 @@ namespace BedMap {
visitorGroup.push_back(bc);
++iter;
} // while
- return(visitorGroup);
+ return visitorGroup;
+ }
+
+ //==============
+ // SelectBED<>
+ //==============
+ template <int NFields, bool UseMemPool = true>
+ struct SelectBED;
+
+ template <>
+ struct SelectBED<3, true> {
+ typedef Bed::BTAllRest::Bed3Type BType;
+ };
+
+ template <>
+ struct SelectBED<4, true> {
+ typedef Bed::BTAllRest::Bed4Type BType;
+ };
+
+ template <>
+ struct SelectBED<5, true> {
+ typedef Bed::BTAllRest::Bed5Type BType;
+ };
+
+
+ template <>
+ struct SelectBED<3, false> {
+ typedef Bed::BTAllRestNoPool::Bed3Type BType;
+ };
+
+ template <>
+ struct SelectBED<4, false> {
+ typedef Bed::BTAllRestNoPool::Bed4Type BType;
+ };
+
+ template <>
+ struct SelectBED<5, false> {
+ typedef Bed::BTAllRestNoPool::Bed5Type BType;
+ };
+
+ //======================
+ // checkStarchNesting()
+ //======================
+ bool checkStarchNesting(const std::string& f1, const std::string& f2) {
+ constexpr bool NoUseMemPool = false;
+ typedef SelectBED<3, NoUseMemPool>::BType BedType;
+ if ( f1 == "-" || f2 == "-" )
+ return true; // not applicable
+ Ext::FPWrap<Ext::InvalidFile> file1(f1);
+ Bed::allocate_iterator_starch_bed_mm<BedType*> a(file1);
+ bool rtn = a.has_nested();
+ if ( !rtn && f2 != "" ) {
+ Ext::FPWrap<Ext::InvalidFile> file2(f2);
+ Bed::allocate_iterator_starch_bed_mm<BedType*> b(file2);
+ rtn = b.has_nested();
+ }
+ return rtn;
}
//==============
@@ -619,38 +779,77 @@ namespace BedMap {
Ext::Assert<Ext::ProgramError>(minRefFields <= minMapFields,
"BedMap::callSweep() minimum fields program error detected");
+ constexpr bool UseMemPool = true;
+ constexpr bool NoUseMemPool = !UseMemPool;
const bool nestCheck = ProcessMode;
if ( minMapFields < 4 ) { // just need Bed3
- typedef Bed::B3Rest RefType;
- typedef Bed::B3Rest MapType;
- typedef typename SelectBase<ProcessMode, BedDistType, RefType, MapType>::BaseClass BaseClass;
- BedMap::GenerateVisitors<BaseClass, 3> gv;
- std::vector<BaseClass*> visitorGroup = getVisitors(gv, dt, multivalColSep, precision,
- useScientific, visitorNames, visitorArgs);
- runSweep<BaseClass>(st, dt, refFileName, mapFileName, errorCheck, nestCheck,
- ProcessMode, sweepAll, colSep, chrom, skipUnmappedRows, visitorGroup);
+ if ( !BedMap::minimumMemory ) {
+ typedef typename SelectBED<3, UseMemPool>::BType RefType;
+ typedef RefType MapType;
+ typedef typename SelectBase<ProcessMode, BedDistType, RefType, MapType>::BaseClass BaseClass;
+ BedMap::GenerateVisitors<BaseClass, 3> gv;
+ std::vector<BaseClass*> visitorGroup = getVisitors(gv, dt, multivalColSep, precision,
+ useScientific, visitorNames, visitorArgs);
+ runSweep<BaseClass>(st, dt, refFileName, mapFileName, errorCheck, nestCheck,
+ ProcessMode, sweepAll, colSep, chrom, skipUnmappedRows, visitorGroup);
+ } else { // v2p4p26 and earlier mode
+ typedef typename SelectBED<3, NoUseMemPool>::BType RefType;
+ typedef RefType MapType;
+ typedef typename SelectBase<ProcessMode, BedDistType, RefType, MapType>::BaseClass BaseClass;
+ BedMap::GenerateVisitors<BaseClass, 3> gv;
+ std::vector<BaseClass*> visitorGroup = getVisitors(gv, dt, multivalColSep, precision,
+ useScientific, visitorNames, visitorArgs);
+ runSweep<BaseClass>(st, dt, refFileName, mapFileName, errorCheck, nestCheck,
+ ProcessMode, sweepAll, colSep, chrom, skipUnmappedRows, visitorGroup);
+ }
} else if ( minMapFields < 5 ) { // just need Bed4 for Map and Bed3 for Ref
- Ext::Assert<Ext::ProgramError>(minRefFields < minMapFields,
- "BedMap::callSweep()-2 minimum fields program error detected");
- typedef Bed::B3Rest RefType;
- typedef Bed::B4Rest MapType;
- typedef typename SelectBase<ProcessMode, BedDistType, RefType, MapType>::BaseClass BaseClass;
- BedMap::GenerateVisitors<BaseClass, 4> gv;
- std::vector<BaseClass*> visitorGroup = getVisitors(gv, dt, multivalColSep, precision,
- useScientific, visitorNames, visitorArgs);
- runSweep<BaseClass>(st, dt, refFileName, mapFileName, errorCheck, nestCheck,
- ProcessMode, sweepAll, colSep, chrom, skipUnmappedRows, visitorGroup);
+ if ( !BedMap::minimumMemory ) {
+ Ext::Assert<Ext::ProgramError>(minRefFields < minMapFields,
+ "BedMap::callSweep()-2 minimum fields program error detected");
+ typedef typename SelectBED<3, UseMemPool>::BType RefType;
+ typedef typename SelectBED<4, UseMemPool>::BType MapType;
+ typedef typename SelectBase<ProcessMode, BedDistType, RefType, MapType>::BaseClass BaseClass;
+ BedMap::GenerateVisitors<BaseClass, 4> gv;
+ std::vector<BaseClass*> visitorGroup = getVisitors(gv, dt, multivalColSep, precision,
+ useScientific, visitorNames, visitorArgs);
+ runSweep<BaseClass>(st, dt, refFileName, mapFileName, errorCheck, nestCheck,
+ ProcessMode, sweepAll, colSep, chrom, skipUnmappedRows, visitorGroup);
+ } else { // v2p4p26 and earlier mode
+ Ext::Assert<Ext::ProgramError>(minRefFields < minMapFields,
+ "BedMap::callSweep()-2 minimum fields program error detected");
+ typedef typename SelectBED<3, NoUseMemPool>::BType RefType;
+ typedef typename SelectBED<4, NoUseMemPool>::BType MapType;
+ typedef typename SelectBase<ProcessMode, BedDistType, RefType, MapType>::BaseClass BaseClass;
+ BedMap::GenerateVisitors<BaseClass, 4> gv;
+ std::vector<BaseClass*> visitorGroup = getVisitors(gv, dt, multivalColSep, precision,
+ useScientific, visitorNames, visitorArgs);
+ runSweep<BaseClass>(st, dt, refFileName, mapFileName, errorCheck, nestCheck,
+ ProcessMode, sweepAll, colSep, chrom, skipUnmappedRows, visitorGroup);
+ }
} else { // need Bed5 for Map and Bed3 for Ref
- Ext::Assert<Ext::ProgramError>(minRefFields == 3,
- "BedMap::callSweep()-2 minimum fields program error detected");
- typedef Bed::B3Rest RefType;
- typedef Bed::B5Rest MapType;
- typedef typename SelectBase<ProcessMode, BedDistType, RefType, MapType>::BaseClass BaseClass;
- BedMap::GenerateVisitors<BaseClass, 5> gv;
- std::vector<BaseClass*> visitorGroup = getVisitors(gv, dt, multivalColSep, precision,
- useScientific, visitorNames, visitorArgs);
- runSweep<BaseClass>(st, dt, refFileName, mapFileName, errorCheck, nestCheck,
- ProcessMode, sweepAll, colSep, chrom, skipUnmappedRows, visitorGroup);
+ if ( !BedMap::minimumMemory ) {
+ Ext::Assert<Ext::ProgramError>(minRefFields == 3,
+ "BedMap::callSweep()-2 minimum fields program error detected");
+ typedef typename SelectBED<3, UseMemPool>::BType RefType;
+ typedef typename SelectBED<5, UseMemPool>::BType MapType;
+ typedef typename SelectBase<ProcessMode, BedDistType, RefType, MapType>::BaseClass BaseClass;
+ BedMap::GenerateVisitors<BaseClass, 5> gv;
+ std::vector<BaseClass*> visitorGroup = getVisitors(gv, dt, multivalColSep, precision,
+ useScientific, visitorNames, visitorArgs);
+ runSweep<BaseClass>(st, dt, refFileName, mapFileName, errorCheck, nestCheck,
+ ProcessMode, sweepAll, colSep, chrom, skipUnmappedRows, visitorGroup);
+ } else { // v2p4p26 and earlier mode
+ Ext::Assert<Ext::ProgramError>(minRefFields == 3,
+ "BedMap::callSweep()-2 minimum fields program error detected");
+ typedef typename SelectBED<3, NoUseMemPool>::BType RefType;
+ typedef typename SelectBED<5, NoUseMemPool>::BType MapType;
+ typedef typename SelectBase<ProcessMode, BedDistType, RefType, MapType>::BaseClass BaseClass;
+ BedMap::GenerateVisitors<BaseClass, 5> gv;
+ std::vector<BaseClass*> visitorGroup = getVisitors(gv, dt, multivalColSep, precision,
+ useScientific, visitorNames, visitorArgs);
+ runSweep<BaseClass>(st, dt, refFileName, mapFileName, errorCheck, nestCheck,
+ ProcessMode, sweepAll, colSep, chrom, skipUnmappedRows, visitorGroup);
+ }
}
}
@@ -672,31 +871,63 @@ namespace BedMap {
const std::vector<std::string>& visitorNames,
const std::vector< std::vector<std::string> >& visitorArgs) {
- const bool nestCheck = ProcessMode;
+ constexpr bool nestCheck = ProcessMode;
+ constexpr bool UseMemPool = true;
+ constexpr bool NoUseMemPool = !UseMemPool;
if ( minRefFields < 4 ) { // just need Bed3
- typedef Bed::B3Rest RefType;
- typedef typename SelectBase<ProcessMode, BedDistType, RefType, RefType>::BaseClass BaseClass;
- BedMap::GenerateVisitors<BaseClass, 3> gv;
- std::vector<BaseClass*> visitorGroup = getVisitors(gv, dt, multivalColSep, precision,
- useScientific, visitorNames, visitorArgs);
- runSweep<BaseClass>(st, dt, refFileName, errorCheck, nestCheck,
- ProcessMode, colSep, chrom, skipUnmappedRows, visitorGroup);
+ if ( !BedMap::minimumMemory ) {
+ typedef typename SelectBED<3, UseMemPool>::BType RefType;
+ typedef typename SelectBase<ProcessMode, BedDistType, RefType, RefType>::BaseClass BaseClass;
+ BedMap::GenerateVisitors<BaseClass, 3> gv;
+ std::vector<BaseClass*> visitorGroup = getVisitors(gv, dt, multivalColSep, precision,
+ useScientific, visitorNames, visitorArgs);
+ runSweep<BaseClass>(st, dt, refFileName, errorCheck, nestCheck,
+ ProcessMode, colSep, chrom, skipUnmappedRows, visitorGroup);
+ } else { // v2p4p26 and earlier mode
+ typedef typename SelectBED<3, NoUseMemPool>::BType RefType;
+ typedef typename SelectBase<ProcessMode, BedDistType, RefType, RefType>::BaseClass BaseClass;
+ BedMap::GenerateVisitors<BaseClass, 3> gv;
+ std::vector<BaseClass*> visitorGroup = getVisitors(gv, dt, multivalColSep, precision,
+ useScientific, visitorNames, visitorArgs);
+ runSweep<BaseClass>(st, dt, refFileName, errorCheck, nestCheck,
+ ProcessMode, colSep, chrom, skipUnmappedRows, visitorGroup);
+ }
} else if ( minRefFields < 5 ) { // need Bed4
- typedef Bed::B4Rest RefType;
- typedef typename SelectBase<ProcessMode, BedDistType, RefType, RefType>::BaseClass BaseClass;
- BedMap::GenerateVisitors<BaseClass, 4> gv;
- std::vector<BaseClass*> visitorGroup = getVisitors(gv, dt, multivalColSep, precision,
- useScientific, visitorNames, visitorArgs);
- runSweep<BaseClass>(st, dt, refFileName, errorCheck, nestCheck,
- ProcessMode, colSep, chrom, skipUnmappedRows, visitorGroup);
+ if ( !BedMap::minimumMemory ) {
+ typedef typename SelectBED<4, UseMemPool>::BType RefType;
+ typedef typename SelectBase<ProcessMode, BedDistType, RefType, RefType>::BaseClass BaseClass;
+ BedMap::GenerateVisitors<BaseClass, 4> gv;
+ std::vector<BaseClass*> visitorGroup = getVisitors(gv, dt, multivalColSep, precision,
+ useScientific, visitorNames, visitorArgs);
+ runSweep<BaseClass>(st, dt, refFileName, errorCheck, nestCheck,
+ ProcessMode, colSep, chrom, skipUnmappedRows, visitorGroup);
+ } else { // v2p4p26 and earlier mode
+ typedef typename SelectBED<4, NoUseMemPool>::BType RefType;
+ typedef typename SelectBase<ProcessMode, BedDistType, RefType, RefType>::BaseClass BaseClass;
+ BedMap::GenerateVisitors<BaseClass, 4> gv;
+ std::vector<BaseClass*> visitorGroup = getVisitors(gv, dt, multivalColSep, precision,
+ useScientific, visitorNames, visitorArgs);
+ runSweep<BaseClass>(st, dt, refFileName, errorCheck, nestCheck,
+ ProcessMode, colSep, chrom, skipUnmappedRows, visitorGroup);
+ }
} else { // need Bed5
- typedef Bed::B5Rest RefType;
- typedef typename SelectBase<ProcessMode, BedDistType, RefType, RefType>::BaseClass BaseClass;
- BedMap::GenerateVisitors<BaseClass, 5> gv;
- std::vector<BaseClass*> visitorGroup = getVisitors(gv, dt, multivalColSep, precision,
- useScientific, visitorNames, visitorArgs);
- runSweep<BaseClass>(st, dt, refFileName, errorCheck, nestCheck,
- ProcessMode, colSep, chrom, skipUnmappedRows, visitorGroup);
+ if ( !BedMap::minimumMemory ) {
+ typedef typename SelectBED<5, UseMemPool>::BType RefType;
+ typedef typename SelectBase<ProcessMode, BedDistType, RefType, RefType>::BaseClass BaseClass;
+ BedMap::GenerateVisitors<BaseClass, 5> gv;
+ std::vector<BaseClass*> visitorGroup = getVisitors(gv, dt, multivalColSep, precision,
+ useScientific, visitorNames, visitorArgs);
+ runSweep<BaseClass>(st, dt, refFileName, errorCheck, nestCheck,
+ ProcessMode, colSep, chrom, skipUnmappedRows, visitorGroup);
+ } else { // v2p4p26 and earlier mode
+ typedef typename SelectBED<5, NoUseMemPool>::BType RefType;
+ typedef typename SelectBase<ProcessMode, BedDistType, RefType, RefType>::BaseClass BaseClass;
+ BedMap::GenerateVisitors<BaseClass, 5> gv;
+ std::vector<BaseClass*> visitorGroup = getVisitors(gv, dt, multivalColSep, precision,
+ useScientific, visitorNames, visitorArgs);
+ runSweep<BaseClass>(st, dt, refFileName, errorCheck, nestCheck,
+ ProcessMode, colSep, chrom, skipUnmappedRows, visitorGroup);
+ }
}
}
diff --git a/applications/bed/bedmap/src/Input.hpp b/applications/bed/bedmap/src/Input.hpp
index 9432798..d658f5d 100644
--- a/applications/bed/bedmap/src/Input.hpp
+++ b/applications/bed/bedmap/src/Input.hpp
@@ -76,7 +76,7 @@ namespace BedMap {
: refFileName_(""), mapFileName_(""), rangeBP_(0), overlapBP_(0),
percOvr_(0.0), isPercMap_(false), isPercRef_(false), isPercEither_(false),
isPercBoth_(false), isRangeBP_(false), isOverlapBP_(false), isExact_(false),
- precision_(6), useScientific_(false), setPrec_(false), numFiles_(0),
+ precision_(6), useScientific_(false), useMinMemory_(false), setPrec_(false), numFiles_(0),
minRefFields_(0), minMapFields_(0), errorCheck_(false), sweepAll_(false),
outDelim_("|"), multiDelim_(";"), fastMode_(false), rangeAlias_(false),
chrom_("all"), skipUnmappedRows_(false) {
@@ -130,6 +130,8 @@ namespace BedMap {
skipUnmappedRows_ = true;
} else if ( next == "sci" ) {
useScientific_ = true;
+ } else if ( next == "min-memory" ) {
+ useMinMemory_ = true;
} else if ( next == "prec" ) {
Ext::Assert<ArgError>(argcntr < argc, "No precision value given");
Ext::Assert<ArgError>(!setPrec_, "--prec specified multiple times.");
@@ -384,6 +386,7 @@ namespace BedMap {
bool isExact_;
int precision_;
bool useScientific_;
+ bool useMinMemory_;
bool setPrec_;
unsigned int numFiles_;
unsigned int minRefFields_;
@@ -471,6 +474,7 @@ namespace BedMap {
usage << " --bp-ovr, --range, --fraction-both, and --exact overlap options only. \n";
usage << " --header Accept headers (VCF, GFF, SAM, BED, WIG) in any input file. \n";
usage << " --help Print this message and exit successfully. \n";
+ usage << " --min-memory Minimize memory usage (slower). \n";
usage << " --multidelim <delim> Change delimiter of multi-value output columns from ';' to <delim>. \n";
usage << " --prec <int> Change the post-decimal precision of scores to <int>. 0 <= <int>. \n";
usage << " --sci Use scientific notation for score outputs. \n";
diff --git a/applications/bed/bedmap/src/Makefile b/applications/bed/bedmap/src/Makefile
index a006b24..6c63449 100644
--- a/applications/bed/bedmap/src/Makefile
+++ b/applications/bed/bedmap/src/Makefile
@@ -19,28 +19,37 @@ LOCALBZIP2INCDIR = ${LOCALBZIP2DIR}
LOCALZLIBDIR = ${PARTY3}/zlib
LOCALZLIBLIB = ${LOCALZLIBDIR}/${LIBZLIB}
LOCALZLIBINCDIR = ${LOCALZLIBDIR}
-OBJDIR = objects
+OBJDIR = objects_${BINARY_TYPE}
INCLUDES = -iquote${HEAD} -I${PARTY3} -I${LOCALJANSSONINCDIR} -I${LOCALBZIP2INCDIR} -I${LOCALZLIBINCDIR}
LIBLOCATION = -L${LOCALJANSSONLIBDIR} -L${LOCALBZIP2LIBDIR} -L${LOCALZLIBDIR}
LIBRARIES = ${LOCALJANSSONLIB} ${LOCALBZIP2LIB} ${LOCALZLIBLIB}
BLDFLAGS = -Wall -pedantic -O3 -std=c++11
SFLAGS = -static
+ifeq ($(BINARY_TYPE),)
+ TFLAG = -DBEDOPS_BINARY_TYPE=0
+else
+ TFLAG = -DBEDOPS_BINARY_TYPE=$(BINARY_TYPE_NUM)
+endif
+
dependency_names = NaN starchConstants starchFileHelpers starchHelpers starchMetadataHelpers unstarchHelpers starchSha1Digest starchBase64Coding
dependencies = $(addprefix $(OBJDIR)/, $(addsuffix .o, $(dependency_names)))
-FLAGS = ${SFLAGS} -s ${BLDFLAGS} $(dependencies) ${LIBLOCATION} ${INCLUDES}
-DFLAGS = ${SFLAGS} -g -O0 -std=c++11 -DDEBUG=1 -fno-inline -Wall -pedantic $(dependencies) ${LIBLOCATION} ${INCLUDES}
-GPROFFLAGS = ${SFLAGS} -pg -O -std=c++11 -Wall -pedantic $(dependencies) ${LIBLOCATION} ${INCLUDES}
+FLAGS = ${TFLAG} ${SFLAGS} ${MEGAFLAGS} -s ${BLDFLAGS} $(dependencies) ${LIBLOCATION} ${INCLUDES}
+DFLAGS = ${TFLAG} ${SFLAGS} ${MEGAFLAGS} -g -O0 -std=c++11 -DDEBUG=1 -fno-inline -Wall -pedantic $(dependencies) ${LIBLOCATION} ${INCLUDES}
+GPROFFLAGS = ${TFLAG} ${SFLAGS} ${MEGAFLAGS} -pg -O -std=c++11 -Wall -pedantic $(dependencies) ${LIBLOCATION} ${INCLUDES}
SOURCE1 = Bedmap.cpp
BINDIR = ../bin
-PROG = bedmap
+PROG = bedmap-${BINARY_TYPE}
build: $(BINDIR)/$(PROG)
+ rm -rf ${OBJDIR}
build_gprof: $(BINDIR)/gprof.$(PROG)
+ rm -rf ${OBJDIR}
build_debug: $(BINDIR)/debug.$(PROG)
+ rm -rf ${OBJDIR}
dependencies: $(dependencies)
@@ -60,7 +69,5 @@ $(OBJDIR)/%.o : $(LIB3)/%.c
mkdir -p $(OBJDIR) && $(CXX) -c ${BLDFLAGS} $^ -o $@ ${INCLUDES}
clean:
- rm -f ${BINDIR}/${PROG}
- rm -f ${BINDIR}/*.${PROG}
rm -rf ${OBJDIR}
rm -rf ${BINDIR}
diff --git a/applications/bed/bedmap/src/Makefile.darwin b/applications/bed/bedmap/src/Makefile.darwin
index 8faa142..9be3a08 100644
--- a/applications/bed/bedmap/src/Makefile.darwin
+++ b/applications/bed/bedmap/src/Makefile.darwin
@@ -1,5 +1,3 @@
-MIN_OSX_VERSION = 10.7
-
MAIN = ../../../..
MAINAPPDIR = ../..
HEAD = $(MAIN)/interfaces/general-headers
@@ -8,7 +6,7 @@ LIB2 = $(MAIN)/interfaces/src/utility
LIB3 = $(MAIN)/interfaces/src/data/starch
THISDIR = ${shell pwd}
PARTY3 = ${THISDIR}/$(MAIN)/third-party
-OBJDIR = objects_$(ARCH)
+OBJDIR = objects_$(ARCH)_${BINARY_TYPE}
LIBJANSSON = libjansson.a
LIBBZIP2 = libbz2.a
LIBZLIB = libz.a
@@ -30,24 +28,33 @@ LIBRARIES = ${LOCALJANSSONLIB} ${LOCALBZIP2LIB} ${LOCALZLIBLIB}
STDFLAGS = -Wall -pedantic -std=c++11 -stdlib=libc++
BLDFLAGS = -O3 ${STDFLAGS}
-FLAGS = $(BLDFLAGS) $(OBJDIR)/NaN.o $(OBJDIR)/starchConstants.o $(OBJDIR)/starchFileHelpers.o $(OBJDIR)/starchHelpers.o $(OBJDIR)/starchMetadataHelpers.o $(OBJDIR)/unstarchHelpers.o $(OBJDIR)/starchSha1Digest.o $(OBJDIR)/starchBase64Coding.o ${LIBLOCATION} ${INCLUDES}
+ifeq ($(BINARY_TYPE),)
+ TFLAG = -DBEDOPS_BINARY_TYPE=0
+else
+ TFLAG = -DBEDOPS_BINARY_TYPE=$(BINARY_TYPE_NUM)
+endif
+
+FLAGS = $(TFLAG) $(BLDFLAGS) $(OBJDIR)/NaN.o $(OBJDIR)/starchConstants.o $(OBJDIR)/starchFileHelpers.o $(OBJDIR)/starchHelpers.o $(OBJDIR)/starchMetadataHelpers.o $(OBJDIR)/unstarchHelpers.o $(OBJDIR)/starchSha1Digest.o $(OBJDIR)/starchBase64Coding.o ${LIBLOCATION} ${INCLUDES}
-DFLAGS = -g -O0 -DDEBUG=1 ${STDFLAGS} $(OBJDIR)/NaN.o $(OBJDIR)/starchConstants.o $(OBJDIR)/starchFileHelpers.o $(OBJDIR)/starchHelpers.o $(OBJDIR)/starchMetadataHelpers.o $(OBJDIR)/unstarchHelpers.o $(OBJDIR)/starchSha1Digest.o $(OBJDIR)/starchBase64Coding.o ${LIBLOCATION} ${INCLUDES}
+DFLAGS = -g -O0 -DDEBUG=1 $(TFLAG) ${STDFLAGS} $(OBJDIR)/NaN.o $(OBJDIR)/starchConstants.o $(OBJDIR)/starchFileHelpers.o $(OBJDIR)/starchHelpers.o $(OBJDIR)/starchMetadataHelpers.o $(OBJDIR)/unstarchHelpers.o $(OBJDIR)/starchSha1Digest.o $(OBJDIR)/starchBase64Coding.o ${LIBLOCATION} ${INCLUDES}
-GPROFFLAGS = -O -pg ${STDFLAGS} $(OBJDIR)/NaN.o $(OBJDIR)/starchConstants.o $(OBJDIR)/starchFileHelpers.o $(OBJDIR)/starchHelpers.o $(OBJDIR)/starchMetadataHelpers.o $(OBJDIR)/unstarchHelpers.o $(OBJDIR)/starchSha1Digest.o $(OBJDIR)/starchBase64Coding.o ${LIBLOCATION} ${INCLUDES}
+GPROFFLAGS = -O -pg $(TFLAG) ${STDFLAGS} $(OBJDIR)/NaN.o $(OBJDIR)/starchConstants.o $(OBJDIR)/starchFileHelpers.o $(OBJDIR)/starchHelpers.o $(OBJDIR)/starchMetadataHelpers.o $(OBJDIR)/unstarchHelpers.o $(OBJDIR)/starchSha1Digest.o $(OBJDIR)/starchBase64Coding.o ${LIBLOCATION} ${INCLUDES}
SOURCE1 = Bedmap.cpp
BINDIR = ../bin
-PROG = bedmap
+PROG = bedmap-${BINARY_TYPE}
build: dependencies
- $(CXX) -o $(BINDIR)/$(PROG)_$(ARCH) $(FLAGS) -mmacosx-version-min=$(MIN_OSX_VERSION) -arch $(ARCH) ${LIBRARIES} $(SOURCE1)
+ $(CXX) -o $(BINDIR)/$(PROG) $(FLAGS) -mmacosx-version-min=$(MIN_OSX_VERSION) -arch $(ARCH) ${LIBRARIES} $(SOURCE1)
+ rm -rf $(OBJDIR)
build_debug: dependencies
- $(CXX) -o $(BINDIR)/debug.$(PROG)_$(ARCH) $(DFLAGS) -mmacosx-version-min=$(MIN_OSX_VERSION) -arch $(ARCH) ${LIBRARIES} $(SOURCE1)
+ $(CXX) -o $(BINDIR)/debug.$(PROG) $(DFLAGS) -mmacosx-version-min=$(MIN_OSX_VERSION) -arch $(ARCH) ${LIBRARIES} $(SOURCE1)
+ rm -rf $(OBJDIR)
build_gprof: dependencies
- $(CXX) -o $(BINDIR)/gprof.$(PROG)_$(ARCH) $(GPROFFLAGS) -mmacosx-version-min=$(MIN_OSX_VERSION) -arch $(ARCH) ${LIBRARIES} $(SOURCE1)
+ $(CXX) -o $(BINDIR)/gprof.$(PROG) $(GPROFFLAGS) -mmacosx-version-min=$(MIN_OSX_VERSION) -arch $(ARCH) ${LIBRARIES} $(SOURCE1)
+ rm -rf $(OBJDIR)
dependencies:
rm -rf $(OBJDIR)
diff --git a/applications/bed/bedmap/src/TDefs.hpp b/applications/bed/bedmap/src/TDefs.hpp
index b7c8202..6711c57 100644
--- a/applications/bed/bedmap/src/TDefs.hpp
+++ b/applications/bed/bedmap/src/TDefs.hpp
@@ -70,9 +70,9 @@ namespace BedMap {
typedef Visitors::Average<ProcessScorePrecision, BaseClass> Average;
typedef Visitors::CoeffVariation<ProcessScorePrecision, BaseClass> CoeffVariation;
typedef Visitors::Count<ProcessScore, BaseClass> Count;
+ typedef Visitors::Indicator<ProcessScore, BaseClass> Indicator;
typedef Visitors::RollingKthAverage<ProcessScorePrecision, BaseClass, Ext::ArgumentError> KthAverage;
typedef Visitors::Extreme<ProcessScorePrecision, BaseClass, MaxOrderArb> Max;
- typedef Visitors::Indicator<ProcessScore, BaseClass> Indicator;
typedef Visitors::Median<ProcessScorePrecision, BaseClass> Median;
typedef Visitors::MedianAbsoluteDeviation<ProcessScorePrecision, BaseClass> MedianAbsoluteDeviation;
typedef Visitors::Extreme<ProcessScorePrecision, BaseClass, MinOrderArb> Min;
diff --git a/applications/bed/bedops/doc/Usage.Statement.Version1.2 b/applications/bed/bedops/doc/Usage.Statement.Version1.2
deleted file mode 100644
index 29d6575..0000000
--- a/applications/bed/bedops/doc/Usage.Statement.Version1.2
+++ /dev/null
@@ -1,35 +0,0 @@
- bedops version: 1.2
- authors: Shane Neph & Scott Kuehn
-
- USAGE: bedops [process-flags] <operation> <File(s)>*
- Every input file must be sorted per the sort-bed utility.
- May use '-' for a file to indicate reading from standard input.
- Each operation requires a minimum number of files as shown below.
- There is no fixed maximum number of files that may be used.
- Input files must have at least the first 3 columns of the BED specification,
- and every end coordinate must be 1 bp beyond the end of its interval.
-
- Process Flags:
- --ec Error check input files (slower).
- --help Print this message and exit successfully.
- --help-<operation> Detailed help on <operation>.
- An example is --help-c or --help--complement
- --range <val> Pad input file(s) symmetrically by <val> which may be
- negative to shrink or remove regions. With -e/-n
- operations, the first/reference file is not padded.
-
- Operations: (choose one of)
- -c, --complement [-L] File1 [File]*
- -d, --difference ReferenceFile File2 [File]*
- -e, --element-of [-number% | -number (in bp)] ReferenceFile File2 [File]*
- by default, -e -100% is used.
- -i, --intersect File1 File2 [File]*
- -m, --merge File1 [File]*
- -n, --not-element-of [-number% | -number (in bp)] ReferenceFile File2 [File]*
- by default, -n -100% is used.
- -s, --symmdiff File1 File2 [File]*
- -u, --everything File1 [File]*
-
- NOTE: Only operations -e|n|u preserve all columns (no flattening)
- Example: bedops --range 10 -u file1.bed
-
diff --git a/applications/bed/bedops/src/BedPadReader.hpp b/applications/bed/bedops/src/BedPadReader.hpp
index 7995181..39d658c 100644
--- a/applications/bed/bedops/src/BedPadReader.hpp
+++ b/applications/bed/bedops/src/BedPadReader.hpp
@@ -113,6 +113,10 @@ struct BedPadReader {
cache_.push_back(bt);
}
+ inline void Remove(BedType* bt) {
+ iter_.get_pool().release(bt);
+ }
+
inline BedType* ReadLine() {
static const bool done = false;
static BedType* tmp = static_cast<BedType*>(0);
@@ -140,7 +144,7 @@ struct BedPadReader {
return(tmp);
}
else // tmp vaporized by padding
- delete tmp;
+ Remove(tmp);
} else if ( lpad_ < 0 ) {
if ( tmp->chrom() != lastChr_ ) { // cache_ is empty && iter_ != end
getFirst(); // iter_ increments dealt with in getFirst()
@@ -168,7 +172,7 @@ struct BedPadReader {
void Clean() {
while ( !cache_.empty() ) {
- delete cache_.back();
+ Remove(cache_.back());
cache_.pop_back();
}
}
@@ -177,12 +181,12 @@ struct BedPadReader {
Clean();
BedType* tmp = static_cast<BedType*>(0);
while ( (tmp = ReadLine()) )
- delete tmp;
+ Remove(tmp);
}
~BedPadReader() {
while ( !cache_.empty() ) {
- delete cache_.back();
+ Remove(cache_.back());
cache_.pop_back();
}
}
@@ -204,7 +208,7 @@ private:
MType mset;
SType sset;
TieType tmap;
- BedType* const zero = static_cast<BedType*>(0);
+ static BedType* const zero = static_cast<BedType*>(0);
BedType* tmp = zero;
static const IterType end;
const Bed::CoordType lpd = static_cast<Bed::CoordType>(std::abs(lpad_));
@@ -217,12 +221,12 @@ private:
mset.insert(tmp);
break; // all others meet the invariant condition: tmp->start() > lpd
} else { // lpad_ < 0 and rpad_ < lpad_
- delete tmp;
+ Remove(tmp);
continue;
}
}
if ( static_cast<double>(tmp->end()) + rpad_ <= 0 ) {
- delete tmp;
+ Remove(tmp);
continue;
}
tmp->start(0);
diff --git a/applications/bed/bedops/src/Bedops.cpp b/applications/bed/bedops/src/Bedops.cpp
index 9fb741f..a8a4e05 100644
--- a/applications/bed/bedops/src/Bedops.cpp
+++ b/applications/bed/bedops/src/Bedops.cpp
@@ -46,6 +46,8 @@
#include "suite/BEDOPS.Version.hpp"
#include "utility/Exception.hpp"
#include "utility/FPWrap.hpp"
+#include "utility/PooledMemory.hpp"
+#include "utility/Typify.hpp"
#include "BedPadReader.hpp"
#include "Input.hpp"
@@ -59,6 +61,43 @@ namespace { // unnamed
// not a valid coordinate range
static const PType NADA_NOTHING = std::make_pair(1, 0);
+ constexpr std::size_t PoolSz = 512; // could be many input files though all will share through get_pool()
+ constexpr bool NODESTRUCT = false;
+ Ext::PooledMemory<Bed::B3Rest, PoolSz, NODESTRUCT> memRest;
+ Ext::PooledMemory<Bed::B3NoRest, PoolSz, NODESTRUCT> memNoRest;
+
+ inline
+ void Remove(Bed::B3Rest* p) {
+ memRest.release(p);
+ }
+
+ inline
+ Bed::B3Rest* CopyCreate(Bed::B3Rest const* p) {
+ return memRest.construct(*p);
+ }
+
+ inline
+ void Remove(Bed::B3NoRest* p) {
+ memNoRest.release(p);
+ }
+
+ inline
+ Bed::B3NoRest* CopyCreate(Bed::B3NoRest const* p) {
+ return memNoRest.construct(*p);
+ }
+
+ auto
+ get_pool_details(Ext::Type2Type<Bed::B3Rest*>) -> decltype(memRest)&
+ { return memRest; }
+
+ auto
+ get_pool_details(Ext::Type2Type<Bed::B3NoRest*>) -> decltype(memNoRest)&
+ { return memNoRest; }
+
+ template <typename BedTypePtr>
+ auto
+ get_pool() -> decltype( get_pool_details(Ext::Type2Type<BedTypePtr>()) )
+ { return get_pool_details(Ext::Type2Type<BedTypePtr>()); }
} // unnamed
@@ -70,6 +109,16 @@ namespace BedOperations {
const std::string version = BEDOPS::revision();
const std::string authors = "Shane Neph & Scott Kuehn";
+#if BEDOPS_BINARY_TYPE == 0
+ const std::string application_type = "typical";
+#else
+#if BEDOPS_BINARY_TYPE == 1
+ const std::string application_type = "megarow";
+#else
+ const std::string application_type = "typical";
+#endif
+#endif
+
void doWork(const Input& input);
} // namespace BedOperations
@@ -87,7 +136,7 @@ int main(int argc, char** argv) {
} catch(BedOperations::HelpException& h) {
std::cout << BedOperations::prognm << std::endl;
std::cout << " citation: " + BedOperations::citation << std::endl;
- std::cout << " version: " + BedOperations::version << std::endl;
+ std::cout << " version: " + BedOperations::version + " (" + BedOperations::application_type + ")" << std::endl;
std::cout << " authors: " + BedOperations::authors << std::endl;
std::cout << BedOperations::Usage() << std::endl;
return(EXIT_SUCCESS);
@@ -95,7 +144,7 @@ int main(int argc, char** argv) {
try {
std::cout << BedOperations::prognm << std::endl;
std::cout << " citation: " + BedOperations::citation << std::endl;
- std::cout << " version: " + BedOperations::version << std::endl;
+ std::cout << " version: " + BedOperations::version + " (" + BedOperations::application_type + ")" << std::endl;
std::cout << " authors: " + BedOperations::authors << std::endl;
std::cout << BedOperations::DetailedUsage(e.m_) << std::endl;
} catch(const std::exception& s) {
@@ -105,13 +154,13 @@ int main(int argc, char** argv) {
} catch(BedOperations::Version& v) {
std::cout << BedOperations::prognm << std::endl;
std::cout << " citation: " + BedOperations::citation << std::endl;
- std::cout << " version: " + BedOperations::version << std::endl;
+ std::cout << " version: " + BedOperations::version + " (" + BedOperations::application_type + ")" << std::endl;
std::cout << " authors: " + BedOperations::authors << std::endl;
return(EXIT_SUCCESS);
} catch(BedOperations::NoInput& ni) {
std::cout << BedOperations::prognm << std::endl;
std::cout << " citation: " + BedOperations::citation << std::endl;
- std::cout << " version: " + BedOperations::version << std::endl;
+ std::cout << " version: " + BedOperations::version + " (" + BedOperations::application_type + ")" << std::endl;
std::cout << " authors: " + BedOperations::authors << std::endl;
std::cerr << BedOperations::Usage() << std::endl;
} catch(std::string& s) {
@@ -159,7 +208,7 @@ struct GetType {
typedef typename NoPtr<typename BedFiles::value_type>::Type::BedType BedType;
/*
- A c++ priority queue return the greatest element first. This is done, by default
+ A c++ priority queue returns the greatest element first. This is done, by default
using std::less<>. If you want the least element, you have to use std::greater<>.
In our case, the analogs are Bed::GenomicAddressCompare for std::less<> (max element
first), and Bed::InvertGenomicAddressCompare for std::greater<> (min element first).
@@ -173,6 +222,20 @@ struct GetType {
BedType*, std::vector<BedType*>,
Bed::GenomicAddressCompare<BedType, BedType>
> PQ;
+
+ template <typename BedType>
+ struct InvertedBedWithFileIdx : public Bed::InvertGenomicRestAddressCompare<BedType, BedType> {
+ typedef Bed::InvertGenomicRestAddressCompare<BedType, BedType> Base;
+ inline bool operator()(std::pair<BedType*, int>& p1, std::pair<BedType*, int>& p2) {
+ return Base::operator()(p1.first, p2.first);
+ }
+ };
+
+ // use when BedType has full_rest() and you need to keep track of which file it came from
+ typedef std::priority_queue<
+ std::pair<BedType*, int>, std::vector<std::pair<BedType*, int>>,
+ InvertedBedWithFileIdx<BedType>
+ > IPQ_Rest;
};
//=============
@@ -225,14 +288,17 @@ struct createWork {
std::vector<FPType*> filePointers;
BedReaderType1* refFile = static_cast<BedReaderType1*>(0);
BedReaderContainer bedFiles;
+ auto& mem1 = get_pool<typename IterType1::value_type>();
+ auto& mem2 = get_pool<typename IterType2::value_type>();
+
for ( int i = 0; i < input.NumberFiles(); ++i ) {
nextFilePtr = new FPType(input.GetFileName(i));
filePointers.push_back(nextFilePtr);
if ( 0 == i ) {
- IterType1 fileI(*nextFilePtr, input.Chrom());
+ IterType1 fileI(*nextFilePtr, mem1, input.Chrom());
refFile = new BedReaderType1(fileI, 0, 0); // never pad sole reference file
} else {
- IterType2 t(*nextFilePtr, input.Chrom());
+ IterType2 t(*nextFilePtr, mem2, input.Chrom());
bedFiles.push_back(new BedReaderType2(t, input.GetLeftPad(), input.GetRightPad()));
}
} // for
@@ -266,10 +332,11 @@ struct createWork<IterType, IterType> {
FPType* nextFilePtr = static_cast<FPType*>(0);
std::vector<FPType*> filePointers;
BedReaderContainer bedFiles;
+ auto& mem = get_pool<typename IterType::value_type>();
for ( int i = 0; i < input.NumberFiles(); ++i ) {
nextFilePtr = new FPType(input.GetFileName(i));
filePointers.push_back(nextFilePtr);
- IterType t(*nextFilePtr, input.Chrom());
+ IterType t(*nextFilePtr, mem, input.Chrom());
bedFiles.push_back(new BedReaderType(t, input.GetLeftPad(), input.GetRightPad()));
} // for
@@ -288,21 +355,24 @@ struct createWork<IterType, IterType> {
//=================
// createWork<T,U> : specialization for error checking
//=================
-template <typename BedType1, typename BedType2>
-struct createWork< Bed::bed_check_iterator<BedType1*>, Bed::bed_check_iterator<BedType2*> > {
+template <typename BedType1, typename BedType2, std::size_t Sz>
+struct createWork< Bed::bed_check_iterator<BedType1*, Sz>, Bed::bed_check_iterator<BedType2*, Sz> > {
static void run(const Input& input) {
typedef std::ifstream* StreamPtr;
- typedef Bed::bed_check_iterator<BedType1*> IterType1;
- typedef Bed::bed_check_iterator<BedType2*> IterType2;
+ typedef Bed::bed_check_iterator<BedType1*, Sz> IterType1;
+ typedef Bed::bed_check_iterator<BedType2*, Sz> IterType2;
typedef BedPadReader<IterType1> BedReaderType1;
typedef BedPadReader<IterType2> BedReaderType2;
typedef std::vector<BedReaderType2*> BedReaderContainer;
- typedef typename Bed::bed_check_iterator<BedType1*>::Exception Error;
+ typedef typename Bed::bed_check_iterator<BedType1*, Sz>::Exception Error;
StreamPtr nextFilePtr = static_cast<StreamPtr>(0);
std::vector<StreamPtr> filePointers;
BedReaderType1* refFile = static_cast<BedReaderType1*>(0);
BedReaderContainer bedFiles;
+ auto& mem1 = get_pool<BedType1*>();
+ auto& mem2 = get_pool<BedType2*>();
+
for ( int i = 0; i < input.NumberFiles(); ++i ) {
// Create file handle iterators
bool isStdin = (input.GetFileName(i) == "-");
@@ -313,22 +383,22 @@ struct createWork< Bed::bed_check_iterator<BedType1*>, Bed::bed_check_iterator<B
if ( 0 == i ) {
if ( isStdin ) {
- IterType1 fileI(std::cin, "stdin", input.Chrom());
+ IterType1 fileI(std::cin, "stdin", mem1, input.Chrom());
refFile = new BedReaderType1(fileI, 0, 0); // never pad sole Reference File
} else {
if ( !nextFilePtr || !(*nextFilePtr) )
throw(Error("Unable to find file: " + input.GetFileName(i)));
- IterType1 fileI(*nextFilePtr, input.GetFileName(i), input.Chrom());
+ IterType1 fileI(*nextFilePtr, input.GetFileName(i), mem1, input.Chrom());
refFile = new BedReaderType1(fileI, 0, 0); // never pad sole Reference File
}
} else {
if ( isStdin ) {
- IterType2 fileI(std::cin, "stdin", input.Chrom());
+ IterType2 fileI(std::cin, "stdin", mem2, input.Chrom());
bedFiles.push_back(new BedReaderType2(fileI, input.GetLeftPad(), input.GetRightPad()));
} else {
if ( !nextFilePtr || !(*nextFilePtr) )
throw(Error("Unable to find file: " + input.GetFileName(i)));
- IterType2 fileI(*nextFilePtr, input.GetFileName(i), input.Chrom());
+ IterType2 fileI(*nextFilePtr, input.GetFileName(i), mem2, input.Chrom());
bedFiles.push_back(new BedReaderType2(fileI, input.GetLeftPad(), input.GetRightPad()));
}
}
@@ -354,30 +424,32 @@ struct createWork< Bed::bed_check_iterator<BedType1*>, Bed::bed_check_iterator<B
//=================
// createWork<T,T> : specialization for error checking
//=================
-template <typename BedType>
-struct createWork< Bed::bed_check_iterator<BedType*>, Bed::bed_check_iterator<BedType*> > {
+template <typename BedType, std::size_t Sz>
+struct createWork< Bed::bed_check_iterator<BedType*, Sz>, Bed::bed_check_iterator<BedType*, Sz> > {
static void run(const Input& input) {
typedef std::ifstream* StreamPtr;
- typedef Bed::bed_check_iterator<BedType*> IterType;
+ typedef Bed::bed_check_iterator<BedType*, Sz> IterType;
typedef BedPadReader<IterType> BedReaderType;
typedef std::vector<BedReaderType*> BedReaderContainer;
- typedef typename Bed::bed_check_iterator<BedType*>::Exception Error;
+ typedef typename Bed::bed_check_iterator<BedType*, Sz>::Exception Error;
StreamPtr nextFilePtr = static_cast<StreamPtr>(0);
std::vector<StreamPtr> filePointers;
BedReaderContainer bedFiles;
+ auto& mem = get_pool<BedType*>();
+
for ( int i = 0; i < input.NumberFiles(); ++i ) {
// Create file handle iterators
bool isStdin = (input.GetFileName(i) == "-");
if ( isStdin ) {
- IterType fileI(std::cin, "stdin", input.Chrom());
+ IterType fileI(std::cin, "stdin", mem, input.Chrom());
bedFiles.push_back(new BedReaderType(fileI, input.GetLeftPad(), input.GetRightPad()));
} else {
nextFilePtr = new std::ifstream(input.GetFileName(i).c_str());
filePointers.push_back(nextFilePtr);
if ( !nextFilePtr || !(*nextFilePtr) )
throw(Error("Unable to find file: " + input.GetFileName(i)));
- IterType fileI(*nextFilePtr, input.GetFileName(i), input.Chrom());
+ IterType fileI(*nextFilePtr, input.GetFileName(i), mem, input.Chrom());
bedFiles.push_back(new BedReaderType(fileI, input.GetLeftPad(), input.GetRightPad()));
}
} // for
@@ -405,26 +477,26 @@ void doWork(const Input& input) {
if ( mode == UNIONALL ) { // Keep all columns in all files
typedef Bed::B3Rest BedType;
if ( errorCheck )
- createWork< Bed::bed_check_iterator<BedType*> >::run(input);
+ createWork< Bed::bed_check_iterator<BedType*, PoolSz> >::run(input);
else
- createWork< Bed::allocate_iterator_starch_bed<BedType*> >::run(input);
+ createWork< Bed::allocate_iterator_starch_bed<BedType*, PoolSz> >::run(input);
}
else if ( mode == ELEMENTOF || mode == NOTELEMENTOF ) { // Keep all columns only in first file
typedef Bed::B3Rest BedType1;
typedef Bed::B3NoRest BedType2;
if ( errorCheck )
- createWork< Bed::bed_check_iterator<BedType1*>,
- Bed::bed_check_iterator<BedType2*> >::run(input);
+ createWork< Bed::bed_check_iterator<BedType1*, PoolSz>,
+ Bed::bed_check_iterator<BedType2*, PoolSz> >::run(input);
else
- createWork< Bed::allocate_iterator_starch_bed<BedType1*>,
- Bed::allocate_iterator_starch_bed<BedType2*> >::run(input);
+ createWork< Bed::allocate_iterator_starch_bed<BedType1*, PoolSz>,
+ Bed::allocate_iterator_starch_bed<BedType2*, PoolSz> >::run(input);
}
else { // Only use 3 columns
typedef Bed::B3NoRest BedType;
if ( errorCheck )
- createWork< Bed::bed_check_iterator<BedType*> >::run(input);
+ createWork< Bed::bed_check_iterator<BedType*, PoolSz> >::run(input);
else
- createWork< Bed::allocate_iterator_starch_bed<BedType*> >::run(input);
+ createWork< Bed::allocate_iterator_starch_bed<BedType*, PoolSz> >::run(input);
}
}
@@ -462,7 +534,7 @@ void doChop(BedFiles& bedFiles, Bed::CoordType chunkSize, Bed::CoordType stagger
else
i += stagger;
} // for
- delete r;
+ Remove(r);
} // while
}
@@ -483,7 +555,7 @@ void doComplement(BedFiles& bedFiles, bool fullLeft) {
break;
else if ( !nextline.first ) {
record(nextline.second);
- delete nextline.second;
+ Remove(nextline.second);
}
} // while
}
@@ -494,19 +566,20 @@ void doComplement(BedFiles& bedFiles, bool fullLeft) {
template <typename BedFiles>
std::pair<bool, typename GetType<BedFiles>::BedType*>
nextDifferenceLine(BedFiles&,
- typename GetType<BedFiles>::BedType*& nextRefMerge,
+ typename GetType<BedFiles>::BedType*&,
typename GetType<BedFiles>::BedType*&);
template <typename BedFiles>
void doDifference(BedFiles& bedFiles) {
typedef typename GetType<BedFiles>::BedType BedType;
static BedType* const zero = static_cast<BedType*>(0);
- const int noRef = 1; // 0 is master index
+ const int refIdx = 0;
+ const int noRefIdx = 1;
bool done = false;
std::pair<bool, BedType*> nextline = std::make_pair(false, zero);
BedType* nextRefMerge = zero;
- BedType* nextNonRefMerge = nextMergeAllLines(noRef, bedFiles.size(), bedFiles);
+ BedType* nextNonRefMerge = nextMergeAllLines(noRefIdx, bedFiles.size(), bedFiles);
while ( !done ) {
nextline = nextDifferenceLine(bedFiles, nextRefMerge, nextNonRefMerge);
if ( !nextline.second )
@@ -514,11 +587,11 @@ void doDifference(BedFiles& bedFiles) {
else if ( !nextline.first ) {
record(nextline.second);
if ( nextRefMerge == nextline.second ) {
- delete nextRefMerge;
+ bedFiles[refIdx]->Remove(nextRefMerge);
nextRefMerge = zero;
}
- else
- delete nextline.second;
+ else // begotten from CopyCreate() in nextDifferenceLine
+ Remove(nextline.second);
}
} // while
}
@@ -555,12 +628,12 @@ void doElementOf(RefFile& refFile, NonRefFiles& nonRefBedFiles, double thres, bo
else if ( !r.first && r.second )
record(nextRef);
- delete nextRef;
+ Remove(nextRef);
nextRef = getNextFileLine(refFile); // unmerged; may be zero
} // while
while ( !q.empty() ) {
- delete q.front();
+ Remove(q.front());
q.pop_front();
} // while
}
@@ -582,7 +655,7 @@ void doIntersection(BedFiles& bedFiles) {
if ( !next )
break;
record(next);
- delete next;
+ Remove(next);
} // while
}
@@ -600,7 +673,7 @@ void doMerge(BedFiles& bedFiles) {
if ( !r )
break;
record(r);
- delete r;
+ Remove(r);
r = zero;
} // while
}
@@ -627,20 +700,20 @@ void doPartitions(BedFiles& bedFiles) {
pq.pop();
if ( pq.empty() ) {
record(mn);
- delete mn;
+ Remove(mn);
} else {
- BedType lcl = *mn;
+ BedType* lcl = CopyCreate(mn);
BedType* curr = mn;
while ( !pq.empty() ) {
BedType* ct = pq.top(); // guaranteed to overlap mn, and not extend beyond mn
pq.pop();
if ( curr->end() <= ct->start() ) {
record(curr);
- delete curr;
+ Remove(curr);
curr = ct;
} else if ( ct->start() == curr->start() ) {
if ( ct->end() == curr->end() ) { // dups
- delete ct;
+ Remove(ct);
} else { // ct->end() > curr->end()
ct->start(curr->end());
pq.push(ct);
@@ -651,9 +724,9 @@ void doPartitions(BedFiles& bedFiles) {
} // while
ct = pq.top(); // may not be an element whose start() we just redefined
// not popping on purpose
- lcl.start(curr->start());
- lcl.end(ct->start());
- record(&lcl);
+ lcl->start(curr->start());
+ lcl->end(ct->start());
+ record(lcl);
if ( curr->end() != ct->start() ) {
// ct could be fully nested in curr
@@ -661,15 +734,15 @@ void doPartitions(BedFiles& bedFiles) {
curr->start(ct->start());
pq.push(curr);
} else { // curr is no longer useful
- delete curr;
+ Remove(curr);
}
curr = pq.top();
pq.pop();
}
} else { // overlap and curr->start() < ct->start()
- lcl.start(curr->start());
- lcl.end(ct->start());
- record(&lcl);
+ lcl->start(curr->start());
+ lcl->end(ct->start());
+ record(lcl);
// ct could be fully nested in curr, and
// order could change after next modification.
curr->start(ct->start());
@@ -679,8 +752,9 @@ void doPartitions(BedFiles& bedFiles) {
pq.pop();
}
} // while
+ Remove(lcl);
record(curr);
- delete curr;
+ Remove(curr);
}
} // while
}
@@ -708,7 +782,7 @@ void doSymmetricDifference(BedFiles& bedFiles) {
if ( !nextDiff.second ) {
if ( !first ) {
record(toRecord);
- delete toRecord;
+ Remove(toRecord);
toRecord = zero;
}
break;
@@ -719,7 +793,7 @@ void doSymmetricDifference(BedFiles& bedFiles) {
if ( !toRecord || std::strcmp(toRecord->chrom(), nextDiff.second->chrom()) != 0 ) {
if ( !first && toRecord ) {
record(toRecord);
- delete toRecord;
+ Remove(toRecord);
}
toRecord = nextDiff.second;
}
@@ -728,13 +802,13 @@ void doSymmetricDifference(BedFiles& bedFiles) {
if ( !overlap ) {
if ( !first ) {
record(toRecord);
- delete toRecord;
+ Remove(toRecord);
}
toRecord = nextDiff.second;
}
else {
- delete toRecord;
- delete nextDiff.second;
+ Remove(toRecord);
+ Remove(nextDiff.second);
toRecord = overlap;
}
}
@@ -743,12 +817,12 @@ void doSymmetricDifference(BedFiles& bedFiles) {
} // while
if ( toRecord )
- delete toRecord;
+ Remove(toRecord);
}
-//==============
-// doUnionAll()
-//==============
+//=================================
+// doUnionAll() and doUnionAllPQ()
+//=================================
template <typename BedFiles>
typename std::enable_if<GetType<BedFiles>::BedType::UseRest, typename GetType<BedFiles>::BedType>::type*
nextUnionAllLine(BedFiles&); /* requires BedType::UseRest to be true */
@@ -770,7 +844,7 @@ void doUnionAll(BedFiles& bedFiles) {
while ( bedFiles[0]->HasNext() ) {
r = bedFiles[0]->ReadLine();
record(r);
- delete r;
+ bedFiles[0]->Remove(r);
} // while
return;
}
@@ -781,7 +855,42 @@ void doUnionAll(BedFiles& bedFiles) {
if ( !r )
break;
record(r);
- delete r;
+ Remove(r);
+ } // while
+}
+
+template <typename BedFiles>
+void doUnionAllPQ(BedFiles& bedFiles) {
+ /* meant for cases with large numbers of input files (50+ maybe) */
+ /* If inputs have duplicate entries, output will too */
+ typedef typename GetType<BedFiles>::BedType BedType;
+ typename GetType<BedFiles>::IPQ_Rest pq; // union uses full_rest()
+ static BedType* const zero = static_cast<BedType*>(0);
+
+ BedType* r = zero;
+ if ( 1 == bedFiles.size() ) {
+ /* a simple cat command, possibly post-padded as
+ dealt with in BedPadReader. */
+ while ( bedFiles[0]->HasNext() ) {
+ r = bedFiles[0]->ReadLine();
+ record(r);
+ bedFiles[0]->Remove(r);
+ } // while
+ return;
+ }
+
+ for ( std::size_t i = 0; i < bedFiles.size(); ++i ) {
+ if ( bedFiles[i]->HasNext() )
+ pq.push(std::make_pair(bedFiles[i]->ReadLine(), i));
+ } // for
+
+ while ( !pq.empty() ) {
+ const std::pair<BedType*, int> val = pq.top();
+ pq.pop();
+ record(val.first);
+ bedFiles[val.second]->Remove(val.first);
+ if ( bedFiles[val.second]->HasNext() )
+ pq.push(std::make_pair(bedFiles[val.second]->ReadLine(), val.second));
} // while
}
@@ -801,8 +910,8 @@ typename BedFile::BedType* getNextFileMergedCoords(BedFile& bedFile) {
BedType* next = bedFile.ReadLine();
BedType* merged = mergeOverlap(next, toRtn);
if ( merged ) {
- delete toRtn;
- delete next;
+ bedFile.Remove(toRtn);
+ bedFile.Remove(next);
toRtn = merged;
next = zero;
} else {
@@ -870,16 +979,16 @@ BedType* mergeOverlap(const BedType* p1, const BedType* p2) {
return(toRtn);
} else if ( p1->start() < p2->start() ) {
if ( p1->end() >= p2->start() ) {
- toRtn = new BedType(*p1);
+ toRtn = CopyCreate(p1);
toRtn->end(std::max(p1->end(), p2->end()));
}
} else if ( p1->start() > p2->start() ) {
if ( p2->end() >= p1->start() ) {
- toRtn = new BedType(*p2);
+ toRtn = CopyCreate(p2);
toRtn->end(std::max(p1->end(), p2->end()));
}
} else { // p1->start() == p2->start()
- toRtn = new BedType(*p1);
+ toRtn = CopyCreate(p1);
toRtn->end(std::max(p1->end(), p2->end()));
}
return(toRtn);
@@ -900,35 +1009,35 @@ std::pair<bool, typename GetType<BedFiles>::BedType*> nextComplementLine(BedFile
return(std::make_pair(false, zero));
else if ( fullLeft ) {
// new chromosome -> first complement starts at base 0
- BedType* tmp = new BedType(*last);
+ BedType* tmp = CopyCreate(last);
tmp->start(0);
tmp->end(last->start());
if ( tmp->start() != tmp->end() )
return(std::make_pair(false, tmp));
else { // input coordinates include base 0 -> not part of complement
- delete tmp;
+ Remove(tmp);
return(std::make_pair(true, last));
}
}
}
BedType* nextline = nextMergeAllLines(0, bedFiles.size(), bedFiles);
if ( nextline == zero ) { // stop condition
- delete last;
+ Remove(last);
last = zero;
return(std::make_pair(false, zero));
}
if ( 0 != std::strcmp(nextline->chrom(), last->chrom()) ) {
- delete last;
+ Remove(last);
last = nextline;
if ( fullLeft ) { // chrom change -> first complement starts at base 0
- BedType* tmp = new BedType(*last);
+ BedType* tmp = CopyCreate(last);
tmp->start(0);
tmp->end(last->start());
if ( tmp->start() != tmp->end() )
return(std::make_pair(false, tmp));
else { // input coordinates include base 0 -> not part of complement
- delete tmp;
+ Remove(tmp);
return(std::make_pair(true, last));
}
}
@@ -952,6 +1061,7 @@ std::pair<bool, typename GetType<BedFiles>::BedType*>
nextDifferenceLine(BedFiles& bedFiles,
typename GetType<BedFiles>::BedType*& nextRefMerge,
typename GetType<BedFiles>::BedType*& nextNonRefMerge) {
+
// Index 0 is the reference file
typedef typename GetType<BedFiles>::BedType BedType;
static BedType* const zero = static_cast<BedType*>(0);
@@ -976,7 +1086,7 @@ std::pair<bool, typename GetType<BedFiles>::BedType*>
// Increment nextNonRefMerge until its back within range of nextRefMerge
int cmp = std::strcmp(nextNonRefMerge->chrom(), nextRefMerge->chrom());
while ( cmp < 0 || (0 == cmp && nextNonRefMerge->end() <= nextRefMerge->start()) ) {
- delete nextNonRefMerge;
+ Remove(nextNonRefMerge);
nextNonRefMerge = nextMergeAllLines(noRef, bedFiles.size(), bedFiles);
if ( !nextNonRefMerge ) // always true after first true
return(std::make_pair(noRecurse, nextRefMerge));
@@ -989,19 +1099,19 @@ std::pair<bool, typename GetType<BedFiles>::BedType*>
return(std::make_pair(noRecurse, nextRefMerge));
} else if ( nextNonRefMerge->start() <= nextRefMerge->start() && nextNonRefMerge->end() >= nextRefMerge->end() ) {
/* complete reference overlap */
- delete nextRefMerge;
+ bedFiles[ref]->Remove(nextRefMerge);
nextRefMerge = getNextFileMergedCoords(*bedFiles[ref]);
return(std::make_pair(callAgain, nextRefMerge)); // possible for nextRefMerge to be zero
// direct recursion removed to prevent any possible stack overflow
// return(nextDifferenceLine(bedFiles, nextRefMerge, nextNonRefMerge)); // curse some more
} else if ( nextNonRefMerge->start() > nextRefMerge->start() ) {
/* difference found up to nextNonRefMerge->start() */
- BedType* toRtn = new BedType(*nextRefMerge);
+ BedType* toRtn = CopyCreate(nextRefMerge);
toRtn->end(nextNonRefMerge->start());
cmp = 0;
nextRefMerge->start(nextNonRefMerge->end()); // safe if > nextRefMerge->end() momentarily
while ( 0 == cmp && nextNonRefMerge->end() >= nextRefMerge->end() ) {
- delete nextRefMerge;
+ bedFiles[ref]->Remove(nextRefMerge);
nextRefMerge = getNextFileMergedCoords(*bedFiles[ref]);
if ( !nextRefMerge )
break;
@@ -1050,7 +1160,7 @@ std::pair<bool, typename RefFile::BedType*>
// Increment nextMerge until its back within range of nextRef
int cmp = std::strcmp(nextMerge->chrom(), nextRef->chrom());
while ( cmp < 0 || (0 == cmp && nextMerge->end() <= nextRef->start()) ) {
- delete nextMerge;
+ Remove(nextMerge);
nextMerge = getNextMerge(mergeList, 0, nonRefBedFiles.size(), nonRefBedFiles);
if ( !nextMerge ) {
if ( !invert ) // ref cannot be an element of nothing
@@ -1134,13 +1244,13 @@ typename GetType<BedFiles>::BedType* nextIntersectLine(BedFiles& bedFiles) {
} // for
- toRtn = new BedType(*toRtn);
+ toRtn = CopyCreate(toRtn);
int marker = -1;
Bed::CoordType maxVal = std::numeric_limits<Bed::CoordType>::max();
for ( int i = 0; i < static_cast<int>(bedFiles.size()); ++i ) { // find next intersection
if ( !bedFiles[i]->HasNext() ) { // no more intersections
if ( toRtn )
- delete toRtn;
+ Remove(toRtn);
return(zero);
}
@@ -1148,10 +1258,10 @@ typename GetType<BedFiles>::BedType* nextIntersectLine(BedFiles& bedFiles) {
int val = std::strcmp(next->chrom(), toRtn->chrom());
while ( val < 0 || (val == 0 && next->end() <= toRtn->start()) ) {
- delete next;
+ Remove(next);
next = getNextFileMergedCoords(*bedFiles[i]);
if ( !next ) { // no more intersections
- delete toRtn;
+ Remove(toRtn);
return(zero);
}
val = std::strcmp(next->chrom(), toRtn->chrom());
@@ -1159,8 +1269,8 @@ typename GetType<BedFiles>::BedType* nextIntersectLine(BedFiles& bedFiles) {
bedFiles[i]->PushBack(next);
if ( val > 0 || next->start() >= toRtn->end() ) {
- delete toRtn;
- toRtn = new BedType(*next);
+ Remove(toRtn);
+ toRtn = CopyCreate(next);
i = -1;
marker = -1;
maxVal = std::numeric_limits<Bed::CoordType>::max();
@@ -1176,7 +1286,7 @@ typename GetType<BedFiles>::BedType* nextIntersectLine(BedFiles& bedFiles) {
}
} // for
next = getNextFileMergedCoords(*bedFiles[marker]); // at least one file increment
- delete next;
+ Remove(next);
return(toRtn);
}
@@ -1184,7 +1294,8 @@ typename GetType<BedFiles>::BedType* nextIntersectLine(BedFiles& bedFiles) {
// nextMergeAllLines()
//====================
template <typename BedFiles>
-typename GetType<BedFiles>::BedType* nextMergeAllLines(int start, int end, BedFiles& bedFiles) {
+typename GetType<BedFiles>::BedType*
+nextMergeAllLines(int start, int end, BedFiles& bedFiles) {
// Merge coordinates between files
typedef typename GetType<BedFiles>::BedType BedType;
@@ -1221,7 +1332,7 @@ typename GetType<BedFiles>::BedType* nextMergeAllLines(int start, int end, BedFi
continue;
bt = bedFiles[i]->ReadLine();
while ( 0 == (val = std::strcmp(bt->chrom(), toRtn->chrom())) && bt->end() <= toRtn->end() ) {
- delete bt;
+ bedFiles[i]->Remove(bt);
bt = bedFiles[i]->ReadLine();
if ( !bt )
break;
@@ -1233,7 +1344,7 @@ typename GetType<BedFiles>::BedType* nextMergeAllLines(int start, int end, BedFi
bt->start() <= toRtn->end() &&
bt->end() > toRtn->end() ) {
toRtn->end(bt->end());
- delete bt;
+ bedFiles[i]->Remove(bt);
i = (start - 1); // start over on next iteration
} else if ( bt ) {
bedFiles[i]->PushBack(bt);
@@ -1302,7 +1413,7 @@ void nextPartitionGroup(BedFiles& bedFiles, PQueue& pq) {
if ( bt->start() == minelem->start() ) {
if ( bt->end() == minelem->end() ) // duplicate
- delete bt;
+ bedFiles[i]->Remove(bt);
else { // bt->end() > minelem->end(), no new info for pq
bt->start(minelem->end());
lclQ.push(bt);
@@ -1320,7 +1431,7 @@ void nextPartitionGroup(BedFiles& bedFiles, PQueue& pq) {
if ( bt->end() <= minelem->end() ) // fully-nested or shared-end coord
pq.push(bt);
else { // bt->end() > minelem->end()
- BedType* cpy = new BedType(*bt);
+ BedType* cpy = CopyCreate(bt);
cpy->start(minelem->end());
lclQ.push(cpy);
bt->end(minelem->end());
@@ -1427,7 +1538,7 @@ std::pair<bool, typename GetType<BedFiles>::BedType*>
b->start(minSecond);
bedFiles[allMins[x]]->PushBack(b);
} else {
- delete b;
+ bedFiles[allMins[x]]->Remove(b);
}
} // for
return(std::make_pair(callAgain, min)); // min just has to be nonzero; not used
@@ -1436,7 +1547,7 @@ std::pair<bool, typename GetType<BedFiles>::BedType*>
} else if ( allMins.size() == 1 ) { // case 3
BedType* b = bedFiles[allMins[0]]->ReadLine();
if ( minSecond > nextFirst ) {
- BedType* c = new BedType(*b);
+ BedType* c = CopyCreate(b);
c->end(nextFirst);
b->start(nextFirst); // multiple new mins for next time
bedFiles[allMins[0]]->PushBack(b);
@@ -1458,7 +1569,7 @@ std::pair<bool, typename GetType<BedFiles>::BedType*>
b->start(minSecond);
bedFiles[allMins[x]]->PushBack(b);
} else {
- delete b;
+ bedFiles[allMins[x]]->Remove(b);
}
} // for
}
@@ -1502,7 +1613,7 @@ nextUnionAllLine(BedFiles& bedFiles) {
first = next;
marker = i;
} else if ( next->end() == first->end() ) {
- if ( strcmp(next->rest(), first->rest()) < 0 ) {
+ if ( strcmp(next->full_rest(), first->full_rest()) < 0 ) {
first = next;
marker = i;
}
@@ -1548,8 +1659,12 @@ void selectWork(const Input& input, BedFiles& bedFiles) {
doSymmetricDifference(bedFiles);
break;
case UNIONALL:
- if ( GetType<BedFiles>::BedType::UseRest )
- doUnionAll(bedFiles);
+ if ( GetType<BedFiles>::BedType::UseRest ) {
+ if ( bedFiles.size() < 10 )
+ doUnionAll(bedFiles);
+ else
+ doUnionAllPQ(bedFiles);
+ } // else linker will fail
break;
default:
throw(Ext::ProgramError("Unsupported mode"));
diff --git a/applications/bed/bedops/src/Makefile b/applications/bed/bedops/src/Makefile
index 30f187c..3e80d1f 100644
--- a/applications/bed/bedops/src/Makefile
+++ b/applications/bed/bedops/src/Makefile
@@ -21,27 +21,36 @@ LOCALBZIP2INCDIR = ${LOCALBZIP2DIR}
LOCALZLIBDIR = ${PARTY3}/zlib
LOCALZLIBLIB = ${LOCALZLIBDIR}/${LIBZLIB}
LOCALZLIBINCDIR = ${LOCALZLIBDIR}
-OBJDIR = objects
+OBJDIR = objects_${BINARY_TYPE}
INCLUDES = -iquote$(HEAD) -I${LOCALJANSSONINCDIR} -I${LOCALBZIP2INCDIR} -I${LOCALZLIBINCDIR}
LIBLOCATION = -L${LOCALJANSSONLIBDIR} -L${LOCALBZIP2LIBDIR} -L${LOCALZLIBDIR}
LIBRARIES = ${LOCALJANSSONLIB} ${LOCALBZIP2LIB} ${LOCALZLIBLIB}
BLDFLAGS = -Wall -pedantic -O3 -std=c++11
SFLAGS = -static
+ifeq ($(BINARY_TYPE),)
+ TFLAG = -DBEDOPS_BINARY_TYPE=0
+else
+ TFLAG = -DBEDOPS_BINARY_TYPE=$(BINARY_TYPE_NUM)
+endif
+
dependency_names = NaN starchConstants starchFileHelpers starchHelpers starchMetadataHelpers unstarchHelpers starchSha1Digest starchBase64Coding
dependencies = $(addprefix $(OBJDIR)/, $(addsuffix .o, $(dependency_names)))
-FLAGS = $(SFLAGS) -s $(BLDFLAGS) $(dependencies) ${LIBLOCATION} ${INCLUDES}
-DFLAGS = $(SFLAGS) -g -O0 -DDEBUG_VERBOSE=1 -std=c++11 -Wall -fno-inline -pedantic -DDEBUG=1 $(dependencies) ${LIBLOCATION} ${INCLUDES}
-GPROFFLAGS = $(SFLAGS) -O -std=c++11 -Wall -pedantic -pg $(dependencies) ${LIBLOCATION} ${INCLUDES}
+FLAGS = $(SFLAGS) $(TFLAG) ${MEGAFLAGS} -s $(BLDFLAGS) $(dependencies) ${LIBLOCATION} ${INCLUDES}
+DFLAGS = $(SFLAGS) $(TFLAG) ${MEGAFLAGS} -g -O0 -DDEBUG_VERBOSE=1 -std=c++11 -Wall -fno-inline -pedantic -DDEBUG=1 $(dependencies) ${LIBLOCATION} ${INCLUDES}
+GPROFFLAGS = $(SFLAGS) $(TFLAG) ${MEGAFLAGS} -O -std=c++11 -Wall -pedantic -pg $(dependencies) ${LIBLOCATION} ${INCLUDES}
SOURCE1 = Bedops.cpp
BINDIR = ../bin
-PROG = bedops
+PROG = bedops-${BINARY_TYPE}
build: $(BINDIR)/$(PROG)
+ rm -rf $(OBJDIR)
build_gprof: $(BINDIR)/gprof.$(PROG)
+ rm -rf $(OBJDIR)
build_debug: $(BINDIR)/debug.$(PROG)
+ rm -rf $(OBJDIR)
dependencies: $(dependencies)
@@ -67,8 +76,6 @@ test:
printf "\n\nTo run regression tests:\n cd $(TMPTESTDIR) && java Regression TestPlan.xml\n"
clean:
- rm -f $(BINDIR)/$(PROG)
- rm -f $(BINDIR)/*.$(PROG)
rm -rf $(OBJDIR)
rm -rf $(BINDIR)
diff --git a/applications/bed/bedops/src/Makefile.darwin b/applications/bed/bedops/src/Makefile.darwin
index 4a564f7..116a7b9 100644
--- a/applications/bed/bedops/src/Makefile.darwin
+++ b/applications/bed/bedops/src/Makefile.darwin
@@ -1,5 +1,3 @@
-MIN_OSX_VERSION = 10.7
-
MAIN = ../../../..
MAINAPPDIR = ../..
HEAD = $(MAIN)/interfaces/general-headers
@@ -22,31 +20,40 @@ LOCALBZIP2INCDIR = ${LOCALBZIP2DIR}
LOCALZLIBDIR = ${PARTY3}/darwin_intel_${ARCH}/zlib
LOCALZLIBLIB = ${LOCALZLIBDIR}/${LIBZLIB}
LOCALZLIBINCDIR = ${LOCALZLIBDIR}
-OBJDIR = objects_$(ARCH)
+OBJDIR = objects_$(ARCH)_${BINARY_TYPE}
INCLUDES = -iquote$(HEAD) -I${LOCALJANSSONINCDIR} -I${LOCALBZIP2INCDIR} -I${LOCALZLIBINCDIR}
LIBLOCATION = -L${LOCALJANSSONLIBDIR} -L${LOCALBZIP2LIBDIR} -L${LOCALZLIBDIR}
LIBRARIES = ${LOCALJANSSONLIB} ${LOCALBZIP2LIB} ${LOCALZLIBLIB}
STDFLAGS = -Wall -pedantic -std=c++11 -stdlib=libc++
BLDFLAGS = -O3 ${STDFLAGS}
-FLAGS = $(BLDFLAGS) $(OBJDIR)/NaN.o $(OBJDIR)/starchConstants.o $(OBJDIR)/starchFileHelpers.o $(OBJDIR)/starchHelpers.o $(OBJDIR)/starchMetadataHelpers.o $(OBJDIR)/unstarchHelpers.o $(OBJDIR)/starchSha1Digest.o $(OBJDIR)/starchBase64Coding.o ${LIBLOCATION} ${INCLUDES}
+ifeq ($(BINARY_TYPE),)
+ TFLAG = -DBEDOPS_BINARY_TYPE=0
+else
+ TFLAG = -DBEDOPS_BINARY_TYPE=$(BINARY_TYPE_NUM)
+endif
+
+FLAGS = ${TFLAG} ${MEGAFLAGS} $(BLDFLAGS) $(OBJDIR)/NaN.o $(OBJDIR)/starchConstants.o $(OBJDIR)/starchFileHelpers.o $(OBJDIR)/starchHelpers.o $(OBJDIR)/starchMetadataHelpers.o $(OBJDIR)/unstarchHelpers.o $(OBJDIR)/starchSha1Digest.o $(OBJDIR)/starchBase64Coding.o ${LIBLOCATION} ${INCLUDES}
-DFLAGS = -g -O0 -DDEBUG_VERBOSE=1 -DDEBUG=1 ${STDFLAGS} $(OBJDIR)/NaN.o $(OBJDIR)/starchConstants.o $(OBJDIR)/starchFileHelpers.o $(OBJDIR)/starchHelpers.o $(OBJDIR)/starchMetadataHelpers.o $(OBJDIR)/unstarchHelpers.o $(OBJDIR)/starchSha1Digest.o $(OBJDIR)/starchBase64Coding.o ${LIBLOCATION} ${INCLUDES}
+DFLAGS = ${TFLAG} ${MEGAFLAGS} -g -O0 -DDEBUG_VERBOSE=1 -DDEBUG=1 ${STDFLAGS} $(OBJDIR)/NaN.o $(OBJDIR)/starchConstants.o $(OBJDIR)/starchFileHelpers.o $(OBJDIR)/starchHelpers.o $(OBJDIR)/starchMetadataHelpers.o $(OBJDIR)/unstarchHelpers.o $(OBJDIR)/starchSha1Digest.o $(OBJDIR)/starchBase64Coding.o ${LIBLOCATION} ${INCLUDES}
-GPROFFLAGS = -O -pg ${STDFLAGS} $(OBJDIR)/NaN.o $(OBJDIR)/starchConstants.o $(OBJDIR)/starchFileHelpers.o $(OBJDIR)/starchHelpers.o $(OBJDIR)/starchMetadataHelpers.o $(OBJDIR)/unstarchHelpers.o $(OBJDIR)/starchSha1Digest.o $(OBJDIR)/starchBase64Coding.o ${LIBLOCATION} ${INCLUDES}
+GPROFFLAGS = ${TFLAG} ${MEGAFLAGS} -O -pg ${STDFLAGS} $(OBJDIR)/NaN.o $(OBJDIR)/starchConstants.o $(OBJDIR)/starchFileHelpers.o $(OBJDIR)/starchHelpers.o $(OBJDIR)/starchMetadataHelpers.o $(OBJDIR)/unstarchHelpers.o $(OBJDIR)/starchSha1Digest.o $(OBJDIR)/starchBase64Coding.o ${LIBLOCATION} ${INCLUDES}
SOURCE1 = Bedops.cpp
BINDIR = ../bin
-PROG = bedops
+PROG = bedops-${BINARY_TYPE}
build: dependencies
- $(CXX) -o $(BINDIR)/$(PROG)_$(ARCH) $(FLAGS) -mmacosx-version-min=$(MIN_OSX_VERSION) -arch $(ARCH) ${LIBRARIES} $(SOURCE1)
+ $(CXX) -o $(BINDIR)/$(PROG) $(FLAGS) -mmacosx-version-min=$(MIN_OSX_VERSION) -arch $(ARCH) ${LIBRARIES} $(SOURCE1)
+ rm -rf $(OBJDIR)
build_debug: dependencies
- $(CXX) -o $(BINDIR)/debug.$(PROG)_$(ARCH) $(DFLAGS) -mmacosx-version-min=$(MIN_OSX_VERSION) -arch $(ARCH) ${LIBRARIES} $(SOURCE1)
+ $(CXX) -o $(BINDIR)/debug.$(PROG) $(DFLAGS) -mmacosx-version-min=$(MIN_OSX_VERSION) -arch $(ARCH) ${LIBRARIES} $(SOURCE1)
+ rm -rf $(OBJDIR)
build_gprof: dependencies
- $(CXX) -o $(BINDIR)/gprof.$(PROG)_$(ARCH) $(FLAGS) -mmacosx-version-min=$(MIN_OSX_VERSION) -arch $(ARCH) ${LIBRARIES} $(SOURCE1)
+ $(CXX) -o $(BINDIR)/gprof.$(PROG) $(FLAGS) -mmacosx-version-min=$(MIN_OSX_VERSION) -arch $(ARCH) ${LIBRARIES} $(SOURCE1)
+ rm -rf $(OBJDIR)
dependencies:
rm -rf $(OBJDIR)
@@ -68,8 +75,6 @@ test:
clean:
rm -rf $(OBJDIR)
- rm -rf $(BINDIR)/$(PROG)*
- rm -rf $(BINDIR)/*.$(PROG)*
rm -rf $(BINDIR)
clean_test:
diff --git a/applications/bed/closestfeats/src/BedReader.hpp b/applications/bed/closestfeats/src/BedReader.hpp
index 25ce6bb..cf8cb52 100644
--- a/applications/bed/closestfeats/src/BedReader.hpp
+++ b/applications/bed/closestfeats/src/BedReader.hpp
@@ -46,7 +46,7 @@ template <typename IterType>
struct BedReader {
typedef typename NoPtr<typename IterType::value_type>::Type BedType;
- explicit BedReader(IterType iter) : iter_(iter), cache_()
+ explicit BedReader(IterType iter) : iter_(iter), orig_(iter), cache_()
{ /* */ }
BedReader(const BedReader& b); // not safe to copy due to iterators in some cases
@@ -80,8 +80,9 @@ struct BedReader {
}
void Clean() {
+ auto& mem = orig_.get_pool();
while ( !cache_.empty() ) {
- delete cache_.back();
+ mem.release(cache_.back());
cache_.pop_back();
}
}
@@ -89,19 +90,13 @@ struct BedReader {
void CleanAll() {
Clean();
BedType* tmp = static_cast<BedType*>(0);
+ auto& mem = orig_.get_pool();
while ( (tmp = ReadLine()) )
- delete tmp;
- }
-
- ~BedReader() {
- while ( !cache_.empty() ) {
- delete cache_.back();
- cache_.pop_back();
- }
+ mem.release(tmp);
}
private:
- IterType iter_;
+ IterType iter_, orig_;
std::vector<BedType*> cache_;
};
diff --git a/applications/bed/closestfeats/src/ClosestFeature.cpp b/applications/bed/closestfeats/src/ClosestFeature.cpp
index 7e08a00..d4f497e 100644
--- a/applications/bed/closestfeats/src/ClosestFeature.cpp
+++ b/applications/bed/closestfeats/src/ClosestFeature.cpp
@@ -56,6 +56,17 @@ namespace FeatDist {
const char* none = "NA";
const Bed::SignedCoordType plus_infinite = std::numeric_limits<Bed::SignedCoordType>::max();
const Bed::SignedCoordType minus_infinite = std::numeric_limits<Bed::SignedCoordType>::min();
+ const std::size_t PoolSz = 8*8*8; // only 2 file inputs
+
+#if BEDOPS_BINARY_TYPE == 0
+ const std::string application_type = "typical";
+#else
+#if BEDOPS_BINARY_TYPE == 1
+ const std::string application_type = "megarow";
+#else
+ const std::string application_type = "typical";
+#endif
+#endif
void doWork(const Input&);
} // namespace FeatDist
@@ -74,20 +85,20 @@ int main(int argc, char** argv) {
} catch(FeatDist::HelpException& h) {
std::cout << FeatDist::prognm << std::endl;
std::cout << " citation: " + FeatDist::citation << std::endl;
- std::cout << " version: " + FeatDist::version << std::endl;
+ std::cout << " version: " + FeatDist::version + " (" + FeatDist::application_type + ")" << std::endl;
std::cout << " authors: " + FeatDist::authors << std::endl;
std::cout << FeatDist::Usage() << std::endl;
return(EXIT_SUCCESS);
} catch(FeatDist::VersionException& v) {
std::cout << FeatDist::prognm << std::endl;
std::cout << " citation: " + FeatDist::citation << std::endl;
- std::cout << " version: " + FeatDist::version << std::endl;
+ std::cout << " version: " + FeatDist::version + " (" + FeatDist::application_type + ")" << std::endl;
std::cout << " authors: " + FeatDist::authors << std::endl;
return(EXIT_SUCCESS);
} catch(FeatDist::NoInput& ni) {
std::cerr << FeatDist::prognm << std::endl;
std::cerr << " citation: " + FeatDist::citation << std::endl;
- std::cerr << " version: " + FeatDist::version << std::endl;
+ std::cerr << " version: " + FeatDist::version + " (" + FeatDist::application_type + ")" << std::endl;
std::cerr << " authors: " + FeatDist::authors << std::endl;
std::cerr << FeatDist::Usage() << std::endl;
} catch(const std::exception& stx) {
@@ -121,46 +132,68 @@ void runDistances(BedFile1& refFile, BedFile2& nonRefFile, const Input& input) {
findDistances(refFile, nonRefFile, input.AllowOverlaps(), PrintAll(input.Delimiter(), printDistances, suppressRefField));
}
+//=============
+// get_pool()
+//============
+template <typename BedTypePtr>
+Ext::PooledMemory<typename std::remove_pointer<BedTypePtr>::type, PoolSz>&
+get_pool() {
+ static Ext::PooledMemory<typename std::remove_pointer<BedTypePtr>::type, PoolSz> pool;
+ return pool;
+}
+
+//==========
+// remove()
+//==========
+template <typename BedType>
+inline
+void remove(BedType* b) {
+ static auto& p = get_pool<BedType*>();
+ p.release(b);
+}
+
//=================
// createWork<T,U>
//=================
template <typename BedType1, typename BedType2>
struct createWork {
static void run(const Input& input) {
+ auto& mem1 = get_pool<BedType1*>();
+ auto& mem2 = get_pool<BedType2*>();
if ( input.ErrorCheck() ) {
typedef Ext::UserError UE;
typedef std::ifstream* StreamPtr;
- typedef Bed::bed_check_iterator<BedType1*> IterType1;
- typedef Bed::bed_check_iterator<BedType2*> IterType2;
+ typedef Bed::bed_check_iterator<BedType1*, PoolSz> IterType1;
+ typedef Bed::bed_check_iterator<BedType2*, PoolSz> IterType2;
typedef BedReader<IterType1> BedReaderType1;
typedef BedReader<IterType2> BedReaderType2;
-
+
StreamPtr refFilePtr = static_cast<StreamPtr>(0);
StreamPtr nonRefFilePtr = static_cast<StreamPtr>(0);
BedReaderType1* refFile = static_cast<BedReaderType1*>(0);
BedReaderType2* nonRefFile = static_cast<BedReaderType2*>(0);
-
+
bool isStdin = (input.GetReferenceFileName() == "-");
refFilePtr = new std::ifstream(input.GetReferenceFileName().c_str());
if ( isStdin ) {
- IterType1 fileI(std::cin, "stdin", input.Chrome());
+ IterType1 fileI(std::cin, "stdin", mem1, input.Chrome());
refFile = new BedReaderType1(fileI);
} else {
if ( !refFilePtr || !(*refFilePtr) )
throw(UE("Unable to find file: " + input.GetReferenceFileName()));
- IterType1 fileI(*refFilePtr, input.GetReferenceFileName(), input.Chrome());
+ IterType1 fileI(*refFilePtr, input.GetReferenceFileName(), mem1, input.Chrome());
refFile = new BedReaderType1(fileI);
}
-
+
isStdin = (input.GetNonReferenceFileName() == "-");
nonRefFilePtr = new std::ifstream(input.GetNonReferenceFileName().c_str());
if ( isStdin ) {
- IterType2 fileJ(std::cin, input.GetNonReferenceFileName(), input.Chrome());
+ IterType2 fileJ(std::cin, input.GetNonReferenceFileName(), mem2, input.Chrome());
nonRefFile = new BedReaderType2(fileJ);
} else {
if ( !nonRefFilePtr || !(*nonRefFilePtr) )
throw(UE("Unable to find file: " + input.GetNonReferenceFileName()));
- IterType2 fileJ(*nonRefFilePtr, input.GetNonReferenceFileName(), input.Chrome());
+ IterType2 fileJ(*nonRefFilePtr, input.GetNonReferenceFileName(), mem2, input.Chrome());
nonRefFile = new BedReaderType2(fileJ);
}
@@ -178,24 +211,24 @@ struct createWork {
delete refFilePtr;
if ( nonRefFilePtr )
delete nonRefFilePtr;
-
+
} else { // fast-mode
typedef Ext::FPWrap<Ext::InvalidFile> FPType;
- typedef Bed::allocate_iterator_starch_bed<BedType1*> IterType1;
- typedef Bed::allocate_iterator_starch_bed<BedType2*> IterType2;
+ typedef Bed::allocate_iterator_starch_bed<BedType1*, PoolSz> IterType1;
+ typedef Bed::allocate_iterator_starch_bed<BedType2*, PoolSz> IterType2;
typedef BedReader<IterType1> BedReaderType1;
typedef BedReader<IterType2> BedReaderType2;
-
+
FPType* refFilePtr = static_cast<FPType*>(0);
FPType* nonRefFilePtr = static_cast<FPType*>(0);
BedReaderType1* refFile = static_cast<BedReaderType1*>(0);
BedReaderType2* nonRefFile = static_cast<BedReaderType2*>(0);
-
+
refFilePtr = new FPType(input.GetReferenceFileName());
- refFile = new BedReaderType1(IterType1(*refFilePtr, input.Chrome()));
-
+ refFile = new BedReaderType1(IterType1(*refFilePtr, mem1, input.Chrome()));
+
nonRefFilePtr = new FPType(input.GetNonReferenceFileName());
- nonRefFile = new BedReaderType2(IterType2(*nonRefFilePtr, input.Chrome()));
+ nonRefFile = new BedReaderType2(IterType2(*nonRefFilePtr, mem2, input.Chrome()));
runDistances(*refFile, *nonRefFile, input);
@@ -284,7 +317,7 @@ void findDistances(BedFile1& ref, BedFile2& nonRef, bool allowOverlaps, const Pr
while ( (c = nonRef.ReadLine()) ) {
dist = getDistance(c, b);
if ( dist == minus_infinite ) { // different chromosomes; catch nonref up
- delete c;
+ remove(c);
continue;
} else if ( dist == plus_infinite ) { // different chromosomes; catch ref up
if ( left && !leftCached )
@@ -299,18 +332,18 @@ void findDistances(BedFile1& ref, BedFile2& nonRef, bool allowOverlaps, const Pr
// Deal with left and right closest elements
if ( dist < 0 && dist >= leftDist ) {
while ( !read.empty() ) { // new best left makes all others obsolete
- delete read.front();
+ remove(read.front());
read.pop_front();
} // while
if ( left && !leftCached )
- delete left; // never closest left element again
+ remove(left); // never closest left element again
leftDist = dist;
left = c;
leftCached = false;
} else if ( dist < 0 ) { // happens if previous element starts sooner and stops later
if ( !leftCached ) // must keep things in sort order; left is not zero if here
read.push_back(left);
- delete c;
+ remove(c);
leftCached = true;
} else if ( dist > 0 && dist < rightDist ) {
// right must be zero (overlap sets rightDist to 0); done processing left
@@ -334,7 +367,7 @@ void findDistances(BedFile1& ref, BedFile2& nonRef, bool allowOverlaps, const Pr
// Remember start coordinates only increase or stay the same.
if ( c->start() <= b->start() ) { // hanging over left edge of ref
if ( left && left->end() <= c->end() && !leftCached )
- delete left; // never closest left element again
+ remove(left); // never closest left element again
else if ( left && !leftCached ) // current left has end coordinate greater than c
read.push_back(left);
left = c;
@@ -368,11 +401,11 @@ void findDistances(BedFile1& ref, BedFile2& nonRef, bool allowOverlaps, const Pr
}
} else if ( proportion >= 0.5 ) { // new left element
while ( !read.empty() ) { // new best left makes all others obsolete
- delete read.front();
+ remove(read.front());
read.pop_front();
} // while
if ( left && !leftCached ) // non-overlapping, current left element
- delete left; // never closest left element again
+ remove(left); // never closest left element again
leftCached = false;
left = c;
leftDist = 0;
@@ -408,7 +441,7 @@ void findDistances(BedFile1& ref, BedFile2& nonRef, bool allowOverlaps, const Pr
read.clear();
printer(b, left, right);
- delete b;
+ remove(b);
} // while more in ref
}
diff --git a/applications/bed/closestfeats/src/Makefile b/applications/bed/closestfeats/src/Makefile
index 4811138..a219550 100755
--- a/applications/bed/closestfeats/src/Makefile
+++ b/applications/bed/closestfeats/src/Makefile
@@ -19,27 +19,36 @@ LOCALBZIP2INCDIR = ${LOCALBZIP2DIR}
LOCALZLIBDIR = ${PARTY3}/zlib
LOCALZLIBLIB = ${LOCALZLIBDIR}/${LIBZLIB}
LOCALZLIBINCDIR = ${LOCALZLIBDIR}
-OBJDIR = objects
+OBJDIR = objects_${BINARY_TYPE}
INCLUDES = -iquote$(HEAD) -I${LOCALJANSSONINCDIR} -I${LOCALBZIP2INCDIR} -I${LOCALZLIBINCDIR}
LIBLOCATION = -L${LOCALJANSSONLIBDIR} -L${LOCALBZIP2LIBDIR} -L${LOCALZLIBDIR}
LIBRARIES = ${LOCALJANSSONLIB} ${LOCALBZIP2LIB} ${LOCALZLIBLIB}
BLDFLAGS = -Wall -pedantic -O3 -std=c++11
SFLAGS = -static
+ifeq ($(BINARY_TYPE),)
+ TFLAG = -DBEDOPS_BINARY_TYPE=0
+else
+ TFLAG = -DBEDOPS_BINARY_TYPE=$(BINARY_TYPE_NUM)
+endif
+
dependency_names = NaN starchConstants starchFileHelpers starchHelpers starchMetadataHelpers unstarchHelpers starchSha1Digest starchBase64Coding
dependencies = $(addprefix $(OBJDIR)/, $(addsuffix .o, $(dependency_names)))
-FLAGS = $(SFLAGS) -s $(BLDFLAGS) $(dependencies) ${LIBLOCATION} ${INCLUDES}
-DFLAGS = $(SFLAGS) -g -O0 -std=c++11 -Wall -fno-inline -pedantic $(dependencies) ${LIBLOCATION} ${INCLUDES}
-GPROFFLAGS = $(SFLAGS) -O -std=c++11 -Wall -pedantic -pg $(dependencies) ${LIBLOCATION} ${INCLUDES}
+FLAGS = $(SFLAGS) $(TFLAG) ${MEGAFLAGS} -s $(BLDFLAGS) $(dependencies) ${LIBLOCATION} ${INCLUDES}
+DFLAGS = $(SFLAGS) $(TFLAG) ${MEGAFLAGS} -g -O0 -std=c++11 -Wall -fno-inline -pedantic $(dependencies) ${LIBLOCATION} ${INCLUDES}
+GPROFFLAGS = $(SFLAGS) $(TFLAG) ${MEGAFLAGS} -O -std=c++11 -Wall -pedantic -pg $(dependencies) ${LIBLOCATION} ${INCLUDES}
SOURCE1 = ClosestFeature.cpp
BINDIR = ../bin
-PROG = closest-features
+PROG = closest-features-${BINARY_TYPE}
build: $(BINDIR)/$(PROG)
+ rm -rf $(OBJDIR)
build_gprof: $(BINDIR)/gprof.$(PROG)
+ rm -rf $(OBJDIR)
build_debug: $(BINDIR)/debug.$(PROG)
+ rm -rf $(OBJDIR)
dependencies: $(dependencies)
@@ -59,7 +68,5 @@ $(OBJDIR)/%.o : $(LIB3)/%.c
mkdir -p $(OBJDIR) && $(CXX) -c ${BLDFLAGS} $^ -o $@ ${INCLUDES}
clean:
- rm -f $(BINDIR)/$(PROG)
- rm -f $(BINDIR)/*.$(PROG)
rm -rf $(OBJDIR)
rm -rf $(BINDIR)
diff --git a/applications/bed/closestfeats/src/Makefile.darwin b/applications/bed/closestfeats/src/Makefile.darwin
index 324dd19..8d6eae3 100755
--- a/applications/bed/closestfeats/src/Makefile.darwin
+++ b/applications/bed/closestfeats/src/Makefile.darwin
@@ -1,5 +1,3 @@
-MIN_OSX_VERSION = 10.7
-
MAIN = ../../../..
MAINAPPDIR = ../..
HEAD = $(MAIN)/interfaces/general-headers
@@ -8,7 +6,7 @@ LIB2 = $(MAIN)/interfaces/src/utility
LIB3 = $(MAIN)/interfaces/src/data/starch
THISDIR = ${shell pwd}
PARTY3 = ${THISDIR}/$(MAIN)/third-party
-OBJDIR = objects_$(ARCH)
+OBJDIR = objects_$(ARCH)_${BINARY_TYPE}
LIBJANSSON = libjansson.a
LIBBZIP2 = libbz2.a
LIBZLIB = libz.a
@@ -30,24 +28,33 @@ LIBRARIES = ${LOCALJANSSONLIB} ${LOCALBZIP2LIB} ${LOCALZLIBLIB}
STDFLAGS = -Wall -pedantic -std=c++11 -stdlib=libc++
BLDFLAGS = -O3 ${STDFLAGS}
-FLAGS = $(BLDFLAGS) $(OBJDIR)/NaN.o $(OBJDIR)/starchConstants.o $(OBJDIR)/starchFileHelpers.o $(OBJDIR)/starchHelpers.o $(OBJDIR)/starchMetadataHelpers.o $(OBJDIR)/unstarchHelpers.o $(OBJDIR)/starchSha1Digest.o $(OBJDIR)/starchBase64Coding.o ${LIBLOCATION} ${INCLUDES}
+ifeq ($(BINARY_TYPE),)
+ TFLAG = -DBEDOPS_BINARY_TYPE=0
+else
+ TFLAG = -DBEDOPS_BINARY_TYPE=$(BINARY_TYPE_NUM)
+endif
+
+FLAGS = ${TFLAG} ${MEGAFLAGS} $(BLDFLAGS) $(OBJDIR)/NaN.o $(OBJDIR)/starchConstants.o $(OBJDIR)/starchFileHelpers.o $(OBJDIR)/starchHelpers.o $(OBJDIR)/starchMetadataHelpers.o $(OBJDIR)/unstarchHelpers.o $(OBJDIR)/starchSha1Digest.o $(OBJDIR)/starchBase64Coding.o ${LIBLOCATION} ${INCLUDES}
-DFLAGS = -g -O0 ${STDFLAGS} $(OBJDIR)/NaN.o $(OBJDIR)/starchConstants.o $(OBJDIR)/starchFileHelpers.o $(OBJDIR)/starchHelpers.o $(OBJDIR)/starchMetadataHelpers.o $(OBJDIR)/unstarchHelpers.o $(OBJDIR)/starchSha1Digest.o $(OBJDIR)/starchBase64Coding.o ${LIBLOCATION} ${INCLUDES}
+DFLAGS = ${TFLAG} ${MEGAFLAGS} -g -O0 ${STDFLAGS} $(OBJDIR)/NaN.o $(OBJDIR)/starchConstants.o $(OBJDIR)/starchFileHelpers.o $(OBJDIR)/starchHelpers.o $(OBJDIR)/starchMetadataHelpers.o $(OBJDIR)/unstarchHelpers.o $(OBJDIR)/starchSha1Digest.o $(OBJDIR)/starchBase64Coding.o ${LIBLOCATION} ${INCLUDES}
-GPROFFLAGS = -O -pg ${STDFLAGS} $(OBJDIR)/NaN.o $(OBJDIR)/starchConstants.o $(OBJDIR)/starchFileHelpers.o $(OBJDIR)/starchHelpers.o $(OBJDIR)/starchMetadataHelpers.o $(OBJDIR)/unstarchHelpers.o $(OBJDIR)/starchSha1Digest.o $(OBJDIR)/starchBase64Coding.o ${LIBLOCATION} ${INCLUDES}
+GPROFFLAGS = ${TFLAG} ${MEGAFLAGS} -O -pg ${STDFLAGS} $(OBJDIR)/NaN.o $(OBJDIR)/starchConstants.o $(OBJDIR)/starchFileHelpers.o $(OBJDIR)/starchHelpers.o $(OBJDIR)/starchMetadataHelpers.o $(OBJDIR)/unstarchHelpers.o $(OBJDIR)/starchSha1Digest.o $(OBJDIR)/starchBase64Coding.o ${LIBLOCATION} ${INCLUDES}
SOURCE1 = ClosestFeature.cpp
BINDIR = ../bin
-PROG = closest-features
+PROG = closest-features-${BINARY_TYPE}
build: dependencies
- $(CXX) -o $(BINDIR)/$(PROG)_$(ARCH) $(FLAGS) -mmacosx-version-min=$(MIN_OSX_VERSION) -arch $(ARCH) ${LIBRARIES} $(SOURCE1)
+ $(CXX) -o $(BINDIR)/$(PROG) $(FLAGS) -mmacosx-version-min=$(MIN_OSX_VERSION) -arch $(ARCH) ${LIBRARIES} $(SOURCE1)
+ rm -rf $(OBJDIR)
build_debug: dependencies
- $(CXX) -o $(BINDIR)/debug.$(PROG)_$(ARCH) $(DFLAGS) -mmacosx-version-min=$(MIN_OSX_VERSION) -arch $(ARCH) ${LIBRARIES} $(SOURCE1)
+ $(CXX) -o $(BINDIR)/debug.$(PROG) $(DFLAGS) -mmacosx-version-min=$(MIN_OSX_VERSION) -arch $(ARCH) ${LIBRARIES} $(SOURCE1)
+ rm -rf $(OBJDIR)
build_gprof: dependencies
- $(CXX) -o $(BINDIR)/gprof.$(PROG)_$(ARCH) $(FLAGS) -mmacosx-version-min=$(MIN_OSX_VERSION) -arch $(ARCH) ${LIBRARIES} $(SOURCE1)
+ $(CXX) -o $(BINDIR)/gprof.$(PROG) $(FLAGS) -mmacosx-version-min=$(MIN_OSX_VERSION) -arch $(ARCH) ${LIBRARIES} $(SOURCE1)
+ rm -rf $(OBJDIR)
dependencies:
rm -rf $(OBJDIR)
@@ -63,6 +70,4 @@ dependencies:
clean:
rm -rf $(OBJDIR)
- rm -rf $(BINDIR)/$(PROG)*
- rm -rf $(BINDIR)/*.$(PROG)*
rm -rf ${BINDIR}
diff --git a/applications/bed/conversion/src/Makefile b/applications/bed/conversion/src/Makefile
index eb22afa..7266c43 100644
--- a/applications/bed/conversion/src/Makefile
+++ b/applications/bed/conversion/src/Makefile
@@ -4,30 +4,52 @@ CFLAGS = -O3
CDFLAGS = -DDEBUG=1 -g -O0 -fno-inline
CPFLAGS = -pg
LIBS = -lpthread
-INCLUDES := -iquote"${CURDIR}"
+MAIN = ../../../..
+INTERFACES = $(MAIN)/interfaces
+HEAD = ${INTERFACES}/general-headers
+INCLUDES := -iquote"${CURDIR}" -iquote"${HEAD}"
DISTDIR = ../bin
-OBJDIR = objects
+OBJDIR = objects${POSTFIX}
WRAPPERDIR = wrappers
PROG = convert2bed
SOURCE = convert2bed.c
SFLAGS = -static
+ifeq ($(BINARY_TYPE),)
+ TFLAG = -DBEDOPS_BINARY_TYPE=0
+else
+ TFLAG = -DBEDOPS_BINARY_TYPE=$(BINARY_TYPE_NUM)
+endif
+
all: build
.PHONY: build build_debug build_gprof clean
-build: $(DISTDIR)/$(PROG)
-build_debug: $(DISTDIR)/debug.$(PROG)
-build_gprof: $(DISTDIR)/gprof.$(PROG)
+build: $(DISTDIR)/$(PROG)-${BINARY_TYPE}
+ rm -rf $(OBJDIR)
+build_debug: $(DISTDIR)/debug.$(PROG)-${BINARY_TYPE}
+ rm -rf $(OBJDIR)
+build_gprof: $(DISTDIR)/gprof.$(PROG)-${BINARY_TYPE}
+ rm -rf $(OBJDIR)
+
+$(DISTDIR)/$(PROG)-${BINARY_TYPE}: $(PROG).c
+ mkdir -p $(DISTDIR) && $(CC) $(TFLAG) $(BLDFLAGS) ${MEGAFLAGS} $(COMMONFLAGS) $(CFLAGS) $(SFLAGS) $(INCLUDES) $^ -o $@ $(LIBS)
-$(DISTDIR)/$(PROG): $(PROG).c
- mkdir -p $(DISTDIR) && $(CC) $(BLDFLAGS) $(COMMONFLAGS) $(CFLAGS) $(SFLAGS) $(INCLUDES) $^ -o $@ $(LIBS)
+$(DISTDIR)/%-${BINARY_TYPE}: %.c
+ mkdir -p $(DISTDIR) && $(CC) $(TFLAG) $(BLDFLAGS) ${MEGAFLAGS} $(COMMONFLAGS) $(CFLAGS) $(SFLAGS) $(INCLUDES) $^ -o $@ $(LIBS)
$(DISTDIR)/debug.$(PROG): $(PROG).c
- mkdir -p $(DISTDIR) && $(CC) $(BLDFLAGS) $(COMMONFLAGS) $(CDFLAGS) $(SFLAGS) $(INCLUDES) $^ -o $@ $(LIBS)
+ mkdir -p $(DISTDIR) && $(CC) $(TFLAG) $(BLDFLAGS) ${MEGAFLAGS} $(COMMONFLAGS) $(CDFLAGS) $(SFLAGS) $(INCLUDES) $^ -o $@ $(LIBS)
+
+$(DISTDIR)/debug.%-${BINARY_TYPE}: %.c
+ mkdir -p $(DISTDIR) && $(CC) $(TFLAG) $(BLDFLAGS) ${MEGAFLAGS} $(COMMONFLAGS) $(CDFLAGS) $(SFLAGS) $(INCLUDES) $^ -o $@ $(LIBS)
$(DISTDIR)/gprof.$(PROG): $(PROG).c gprof-helper.so
- mkdir -p $(DISTDIR) && $(CC) $(BLDFLAGS) $(COMMONFLAGS) $(CPFLAGS) $(SFLAGS) $(INCLUDES) $< -o $@ $(LIBS)
+ mkdir -p $(DISTDIR) && $(CC) $(TFLAG) $(BLDFLAGS) ${MEGAFLAGS} $(COMMONFLAGS) $(CPFLAGS) $(SFLAGS) $(INCLUDES) $< -o $@ $(LIBS)
+ @echo -e "\nNote: To profile convert2bed with gprof/pthreads, run:\n\t$$ LD_PRELOAD=/path/to/gprof-helper.so convert2bed"
+
+$(DISTDIR)/gprof.%-${BINARY_TYPE}: %.c gprof-helper.so
+ mkdir -p $(DISTDIR) && $(CC) $(TFLAG) $(BLDFLAGS) ${MEGAFLAGS} $(COMMONFLAGS) $(CPFLAGS) $(SFLAGS) $(INCLUDES) $< -o $@ $(LIBS)
@echo -e "\nNote: To profile convert2bed with gprof/pthreads, run:\n\t$$ LD_PRELOAD=/path/to/gprof-helper.so convert2bed"
%.so: %.c
@@ -36,4 +58,4 @@ $(DISTDIR)/gprof.$(PROG): $(PROG).c gprof-helper.so
clean:
rm -rf $(DISTDIR)
rm -rf $(OBJDIR)
- rm -rf *.so *~
+ rm -rf *.so *~
\ No newline at end of file
diff --git a/applications/bed/conversion/src/Makefile.darwin b/applications/bed/conversion/src/Makefile.darwin
index 4fee388..7d31835 100644
--- a/applications/bed/conversion/src/Makefile.darwin
+++ b/applications/bed/conversion/src/Makefile.darwin
@@ -1,38 +1,50 @@
-MIN_OSX_VERSION = 10.7
BLDFLAGS = -Wall -Wextra -pedantic -std=c99
-COMMONFLAGS = -D__STDC_CONSTANT_MACROS -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE=1
+COMMONFLAGS = -D__STDC_CONSTANT_MACROS -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE=1 ${MEGAFLAGS}
CFLAGS = -O3
CDFLAGS = -DDEBUG=1 -g -O0 -fno-inline
CPFLAGS = -pg
LIBS = -lpthread
-INCLUDES := -iquote"${CURDIR}"
+MAIN = ../../../..
+INTERFACES = $(MAIN)/interfaces
+HEAD = ${INTERFACES}/general-headers
+INCLUDES := -iquote"${CURDIR}" -iquote"${HEAD}"
DISTDIR = ../bin
-OBJDIR = objects
+OBJDIR = objects_${BINARY_TYPE}
WRAPPERDIR = wrappers
PROG = convert2bed
SOURCE = convert2bed.c
+ifeq ($(BINARY_TYPE),)
+ TFLAG = -DBEDOPS_BINARY_TYPE=0
+else
+ TFLAG = -DBEDOPS_BINARY_TYPE=$(BINARY_TYPE_NUM)
+endif
+
all: setup build
.PHONY: setup build build_debug build_gprof clean
setup:
+ rm -rf $(OBJDIR)
mkdir -p $(DISTDIR)
mkdir -p $(OBJDIR)
build: setup
- $(CC) -mmacosx-version-min=$(MIN_OSX_VERSION) -arch $(ARCH) $(BLDFLAGS) $(COMMONFLAGS) $(CFLAGS) -c $(SOURCE) -o $(OBJDIR)/$(PROG).o $(INCLUDES)
- $(CC) -mmacosx-version-min=$(MIN_OSX_VERSION) -arch $(ARCH) $(BLDFLAGS) $(COMMONFLAGS) $(CFLAGS) $(OBJDIR)/$(PROG).o -o $(DISTDIR)/$(PROG)_$(ARCH) $(LIBS)
+ $(CC) -mmacosx-version-min=$(MIN_OSX_VERSION) -arch $(ARCH) $(TFLAG) $(BLDFLAGS) $(COMMONFLAGS) $(CFLAGS) -c $(SOURCE) -o $(OBJDIR)/$(PROG).o $(INCLUDES)
+ $(CC) -mmacosx-version-min=$(MIN_OSX_VERSION) -arch $(ARCH) $(TFLAG) $(BLDFLAGS) $(COMMONFLAGS) $(CFLAGS) $(OBJDIR)/$(PROG).o -o $(DISTDIR)/$(PROG)-${BINARY_TYPE} $(LIBS)
+ rm -rf $(OBJDIR)
build_debug: setup
- $(CC) -mmacosx-version-min=$(MIN_OSX_VERSION) -arch $(ARCH) $(BLDFLAGS) $(COMMONFLAGS) $(CDFLAGS) -c $(SOURCE) -o $(OBJDIR)/$(PROG).o $(INCLUDES)
- $(CC) -mmacosx-version-min=$(MIN_OSX_VERSION) -arch $(ARCH) $(BLDFLAGS) $(COMMONFLAGS) $(CDFLAGS) $(OBJDIR)/$(PROG).o -o $(DISTDIR)/debug.$(PROG)_$(ARCH) $(LIBS)
+ $(CC) -mmacosx-version-min=$(MIN_OSX_VERSION) -arch $(ARCH) $(TFLAG) $(BLDFLAGS) $(COMMONFLAGS) $(CDFLAGS) -c $(SOURCE) -o $(OBJDIR)/$(PROG).o $(INCLUDES)
+ $(CC) -mmacosx-version-min=$(MIN_OSX_VERSION) -arch $(ARCH) $(TFLAG) $(BLDFLAGS) $(COMMONFLAGS) $(CDFLAGS) $(OBJDIR)/$(PROG).o -o $(DISTDIR)/debug.$(PROG)-${BINARY_TYPE} $(LIBS)
+ rm -rf $(OBJDIR)
build_gprof: setup
$(CC) -mmacosx-version-min=$(MIN_OSX_VERSION) -arch $(ARCH) -shared -fPIC gprof-helper.c -o gprof-helper.so $(LIBS) -ldl
- $(CC) -mmacosx-version-min=$(MIN_OSX_VERSION) -arch $(ARCH) $(BLDFLAGS) $(COMMONFLAGS) $(CPFLAGS) -c $(SOURCE) -o $(OBJDIR)/$(PROG).o $(INCLUDES)
- $(CC) -mmacosx-version-min=$(MIN_OSX_VERSION) -arch $(ARCH) $(BLDFLAGS) $(COMMONFLAGS) $(CPFLAGS) $(OBJDIR)/$(PROG).o -o $(DISTDIR)/$(PROG)_$(ARCH) $(LIBS)
+ $(CC) -mmacosx-version-min=$(MIN_OSX_VERSION) -arch $(ARCH) $(TFLAG) $(BLDFLAGS) $(COMMONFLAGS) $(CPFLAGS) -c $(SOURCE) -o $(OBJDIR)/$(PROG).o $(INCLUDES)
+ $(CC) -mmacosx-version-min=$(MIN_OSX_VERSION) -arch $(ARCH) $(TFLAG) $(BLDFLAGS) $(COMMONFLAGS) $(CPFLAGS) $(OBJDIR)/$(PROG).o -o $(DISTDIR)/$(PROG)-${BINARY_TYPE} $(LIBS)
@echo "\nNote: To profile convert2bed with gprof/pthreads, run:\n\t$$ LD_PRELOAD=/path/to/gprof-helper.so convert2bed"
+ rm -rf $(OBJDIR)
clean:
rm -rf $(OBJDIR)
diff --git a/applications/bed/conversion/src/convert2bed.c b/applications/bed/conversion/src/convert2bed.c
index b3d7bfe..45ec5be 100644
--- a/applications/bed/conversion/src/convert2bed.c
+++ b/applications/bed/conversion/src/convert2bed.c
@@ -23,7 +23,7 @@
#include "convert2bed.h"
int
-main(int argc, char **argv)
+main(int argc, char** argv)
{
#ifdef DEBUG
fprintf (stderr, "--- convert2bed main() - enter ---\n");
@@ -65,7 +65,7 @@ main(int argc, char **argv)
}
static void
-c2b_init_conversion(c2b_pipeset_t *p)
+c2b_init_conversion(c2b_pipeset_t* p)
{
#ifdef DEBUG
fprintf(stderr, "--- c2b_init_conversion() - enter ---\n");
@@ -112,38 +112,38 @@ c2b_init_conversion(c2b_pipeset_t *p)
}
static void
-c2b_init_gff_conversion(c2b_pipeset_t *p)
+c2b_init_gff_conversion(c2b_pipeset_t* p)
{
c2b_init_generic_conversion(p, &c2b_line_convert_gff_to_bed_unsorted);
}
static void
-c2b_init_gtf_conversion(c2b_pipeset_t *p)
+c2b_init_gtf_conversion(c2b_pipeset_t* p)
{
c2b_init_generic_conversion(p, &c2b_line_convert_gtf_to_bed_unsorted);
}
static void
-c2b_init_gvf_conversion(c2b_pipeset_t *p)
+c2b_init_gvf_conversion(c2b_pipeset_t* p)
{
/* GVF format conversion uses the GFF functor */
c2b_init_generic_conversion(p, &c2b_line_convert_gff_to_bed_unsorted);
}
static void
-c2b_init_psl_conversion(c2b_pipeset_t *p)
+c2b_init_psl_conversion(c2b_pipeset_t* p)
{
c2b_init_generic_conversion(p, &c2b_line_convert_psl_to_bed_unsorted);
}
static void
-c2b_init_rmsk_conversion(c2b_pipeset_t *p)
+c2b_init_rmsk_conversion(c2b_pipeset_t* p)
{
c2b_init_generic_conversion(p, &c2b_line_convert_rmsk_to_bed_unsorted);
}
static void
-c2b_init_sam_conversion(c2b_pipeset_t *p)
+c2b_init_sam_conversion(c2b_pipeset_t* p)
{
c2b_init_generic_conversion(p, (!c2b_globals.split_flag ?
&c2b_line_convert_sam_to_bed_unsorted_without_split_operation :
@@ -151,19 +151,19 @@ c2b_init_sam_conversion(c2b_pipeset_t *p)
}
static void
-c2b_init_vcf_conversion(c2b_pipeset_t *p)
+c2b_init_vcf_conversion(c2b_pipeset_t* p)
{
c2b_init_generic_conversion(p, &c2b_line_convert_vcf_to_bed_unsorted);
}
static void
-c2b_init_wig_conversion(c2b_pipeset_t *p)
+c2b_init_wig_conversion(c2b_pipeset_t* p)
{
c2b_init_generic_conversion(p, &c2b_line_convert_wig_to_bed_unsorted);
}
static void
-c2b_init_generic_conversion(c2b_pipeset_t *p, void(*to_bed_line_functor)(char *, ssize_t *, char *, ssize_t))
+c2b_init_generic_conversion(c2b_pipeset_t* p, void(*to_bed_line_functor)(char **, ssize_t *, ssize_t *, char *, ssize_t))
{
#ifdef DEBUG
fprintf(stderr, "--- c2b_init_generic_conversion() - enter ---\n");
@@ -183,10 +183,10 @@ c2b_init_generic_conversion(c2b_pipeset_t *p, void(*to_bed_line_functor)(char *,
c2b_pipeline_stage_t bed_sorted2stdout_stage;
c2b_pipeline_stage_t bed_sorted2starch_stage;
c2b_pipeline_stage_t starch2stdout_stage;
- char cat2generic_cmd[C2B_MAX_LINE_LENGTH_VALUE];
- char bed_unsorted2bed_sorted_cmd[C2B_MAX_LINE_LENGTH_VALUE];
- char bed_sorted2starch_cmd[C2B_MAX_LINE_LENGTH_VALUE];
- void (*generic2bed_unsorted_line_functor)(char *, ssize_t *, char *, ssize_t) = to_bed_line_functor;
+ char cat2generic_cmd[C2B_MAX_COMMAND_LINE_LENGTH_VALUE];
+ char bed_unsorted2bed_sorted_cmd[C2B_MAX_COMMAND_LINE_LENGTH_VALUE];
+ char bed_sorted2starch_cmd[C2B_MAX_COMMAND_LINE_LENGTH_VALUE];
+ void (*generic2bed_unsorted_line_functor)(char **, ssize_t *, ssize_t *, char *, ssize_t) = to_bed_line_functor;
ssize_t buffer_size = C2B_THREAD_IO_BUFFER_SIZE;
int errsv = 0;
@@ -461,7 +461,7 @@ c2b_init_generic_conversion(c2b_pipeset_t *p, void(*to_bed_line_functor)(char *,
}
static void
-c2b_init_bam_conversion(c2b_pipeset_t *p)
+c2b_init_bam_conversion(c2b_pipeset_t* p)
{
#ifdef DEBUG
fprintf(stderr, "--- c2b_init_bam_conversion() - enter ---\n");
@@ -481,10 +481,10 @@ c2b_init_bam_conversion(c2b_pipeset_t *p)
c2b_pipeline_stage_t bed_sorted2stdout_stage;
c2b_pipeline_stage_t bed_sorted2starch_stage;
c2b_pipeline_stage_t starch2stdout_stage;
- char bam2sam_cmd[C2B_MAX_LINE_LENGTH_VALUE];
- char bed_unsorted2bed_sorted_cmd[C2B_MAX_LINE_LENGTH_VALUE];
- char bed_sorted2starch_cmd[C2B_MAX_LINE_LENGTH_VALUE];
- void (*sam2bed_unsorted_line_functor)(char *, ssize_t *, char *, ssize_t) = NULL;
+ char bam2sam_cmd[C2B_MAX_COMMAND_LINE_LENGTH_VALUE];
+ char bed_unsorted2bed_sorted_cmd[C2B_MAX_COMMAND_LINE_LENGTH_VALUE];
+ char bed_sorted2starch_cmd[C2B_MAX_COMMAND_LINE_LENGTH_VALUE];
+ void (*sam2bed_unsorted_line_functor)(char **, ssize_t *, ssize_t *, char *, ssize_t) = NULL;
ssize_t buffer_size = C2B_THREAD_IO_BUFFER_SIZE;
int errsv = errno;
@@ -763,9 +763,9 @@ c2b_init_bam_conversion(c2b_pipeset_t *p)
}
static inline void
-c2b_cmd_cat_stdin(char *cmd)
+c2b_cmd_cat_stdin(char* cmd)
{
- const char *cat_args = " - ";
+ const char* cat_args = " - ";
/* /path/to/cat - */
memcpy(cmd,
@@ -778,9 +778,9 @@ c2b_cmd_cat_stdin(char *cmd)
}
static inline void
-c2b_cmd_bam_to_sam(char *cmd)
+c2b_cmd_bam_to_sam(char* cmd)
{
- const char *bam2sam_args = " view -h -";
+ const char* bam2sam_args = " view -h -";
/* /path/to/samtools view -h - */
memcpy(cmd,
@@ -793,10 +793,10 @@ c2b_cmd_bam_to_sam(char *cmd)
}
static inline void
-c2b_cmd_sort_bed(char *cmd)
+c2b_cmd_sort_bed(char* cmd)
{
- char sort_bed_args[C2B_MAX_LINE_LENGTH_VALUE];
- memset(sort_bed_args, 0, C2B_MAX_LINE_LENGTH_VALUE);
+ char sort_bed_args[C2B_MAX_COMMAND_LINE_LENGTH_VALUE];
+ memset(sort_bed_args, 0, C2B_MAX_COMMAND_LINE_LENGTH_VALUE);
/* /path/to/sort-bed [--max-mem <val>] [--tmpdir <path>] - */
if (c2b_globals.sort->max_mem_value) {
@@ -839,10 +839,10 @@ c2b_cmd_sort_bed(char *cmd)
}
static inline void
-c2b_cmd_starch_bed(char *cmd)
+c2b_cmd_starch_bed(char* cmd)
{
- char starch_args[C2B_MAX_LINE_LENGTH_VALUE];
- memset(starch_args, 0, C2B_MAX_LINE_LENGTH_VALUE);
+ char starch_args[C2B_MAX_COMMAND_LINE_LENGTH_VALUE];
+ memset(starch_args, 0, C2B_MAX_COMMAND_LINE_LENGTH_VALUE);
/* /path/to/starch [--bzip2 | --gzip] [--note="xyz..."] - */
if (c2b_globals.starch->bzip2) {
@@ -896,7 +896,7 @@ c2b_cmd_starch_bed(char *cmd)
}
static void
-c2b_gtf_init_element(c2b_gtf_t **e)
+c2b_gtf_init_element(c2b_gtf_t** e)
{
*e = malloc(sizeof(c2b_gtf_t));
if (!*e) {
@@ -982,7 +982,7 @@ c2b_gtf_init_element(c2b_gtf_t **e)
}
static void
-c2b_gtf_delete_element(c2b_gtf_t *e)
+c2b_gtf_delete_element(c2b_gtf_t* e)
{
if (e->seqname) { free(e->seqname), e->seqname = NULL; }
if (e->source) { free(e->source), e->source = NULL; }
@@ -997,7 +997,7 @@ c2b_gtf_delete_element(c2b_gtf_t *e)
}
static void
-c2b_line_convert_gtf_to_bed_unsorted(char *dest, ssize_t *dest_size, char *src, ssize_t src_size)
+c2b_line_convert_gtf_to_bed_unsorted(char** dest, ssize_t* dest_size, ssize_t* dest_capacity, char* src, ssize_t src_size)
{
ssize_t gtf_field_offsets[C2B_MAX_FIELD_COUNT_VALUE];
int gtf_field_idx = 0;
@@ -1027,14 +1027,27 @@ c2b_line_convert_gtf_to_bed_unsorted(char *dest, ssize_t *dest_size, char *src,
return;
}
else {
+ /* set up temporary header stream buffers */
+ if (!c2b_globals.src_line_str) {
+ c2b_globals.src_line_str = malloc(C2B_MAX_LINE_LENGTH_VALUE + 1);
+ if (!c2b_globals.src_line_str) {
+ fprintf(stderr, "Error: Could not allocate space for globals source line buffer\n");
+ exit(ENOMEM);
+ }
+ }
+ if (!c2b_globals.dest_line_str) {
+ c2b_globals.dest_line_str = malloc(C2B_MAX_LINE_LENGTH_VALUE + 1);
+ if (!c2b_globals.dest_line_str) {
+ fprintf(stderr, "Error: Could not allocate space for globals destination line buffer\n");
+ exit(ENOMEM);
+ }
+ }
/* copy header line to destination stream buffer */
- char src_header_line_str[C2B_MAX_LINE_LENGTH_VALUE];
- char dest_header_line_str[C2B_MAX_LINE_LENGTH_VALUE];
- memcpy(src_header_line_str, src, src_size);
- src_header_line_str[src_size] = '\0';
- sprintf(dest_header_line_str, "%s\t%u\t%u\t%s\n", c2b_header_chr_name, c2b_globals.header_line_idx, (c2b_globals.header_line_idx + 1), src_header_line_str);
- memcpy(dest + *dest_size, dest_header_line_str, strlen(dest_header_line_str));
- *dest_size += strlen(dest_header_line_str);
+ memcpy(c2b_globals.src_line_str, src, src_size);
+ c2b_globals.src_line_str[src_size] = '\0';
+ sprintf(c2b_globals.dest_line_str, "%s\t%u\t%u\t%s\n", c2b_header_chr_name, c2b_globals.header_line_idx, (c2b_globals.header_line_idx + 1), c2b_globals.src_line_str);
+ memcpy(*dest + *dest_size, c2b_globals.dest_line_str, strlen(c2b_globals.dest_line_str));
+ *dest_size += strlen(c2b_globals.dest_line_str);
c2b_globals.header_line_idx++;
return;
}
@@ -1294,12 +1307,12 @@ c2b_line_convert_gtf_to_bed_unsorted(char *dest, ssize_t *dest_size, char *src,
Convert GTF struct to BED string and copy it to destination
*/
- c2b_line_convert_gtf_ptr_to_bed(c2b_globals.gtf->element, dest, dest_size);
+ c2b_line_convert_gtf_ptr_to_bed(c2b_globals.gtf->element, dest, dest_size, dest_capacity);
c2b_globals.gtf->line_count++;
}
static inline void
-c2b_line_convert_gtf_ptr_to_bed(c2b_gtf_t *g, char *dest_line, ssize_t *dest_size)
+c2b_line_convert_gtf_ptr_to_bed(c2b_gtf_t* g, char** dest_line_ptr, ssize_t* dest_size, ssize_t* dest_capacity)
{
/*
For GTF-formatted data, we use the mapping provided by BEDOPS convention described at:
@@ -1331,8 +1344,21 @@ c2b_line_convert_gtf_ptr_to_bed(c2b_gtf_t *g, char *dest_line, ssize_t *dest_siz
comments 11 -
*/
+ if ((ssize_t)(*dest_size + C2B_MAX_LINE_LENGTH_VALUE) > *dest_capacity) {
+ char *dest_line_resized = NULL;
+ dest_line_resized = realloc(*dest_line_ptr, *dest_capacity * 2);
+ if (dest_line_resized) {
+ *dest_capacity *= 2;
+ *dest_line_ptr = dest_line_resized;
+ }
+ else {
+ fprintf(stderr, "Error: Could not resize dest_line_ptr string in GTF pointer conversion fn\n");
+ exit(ENOMEM);
+ }
+ }
+
if (strlen(g->comments) == 0) {
- *dest_size += sprintf(dest_line + *dest_size,
+ *dest_size += sprintf(*dest_line_ptr + *dest_size,
"%s\t" \
"%" PRIu64 "\t" \
"%" PRIu64 "\t" \
@@ -1355,7 +1381,7 @@ c2b_line_convert_gtf_ptr_to_bed(c2b_gtf_t *g, char *dest_line, ssize_t *dest_siz
g->attributes);
}
else {
- *dest_size += sprintf(dest_line + *dest_size,
+ *dest_size += sprintf(*dest_line_ptr + *dest_size,
"%s\t" \
"%" PRIu64 "\t" \
"%" PRIu64 "\t" \
@@ -1382,7 +1408,7 @@ c2b_line_convert_gtf_ptr_to_bed(c2b_gtf_t *g, char *dest_line, ssize_t *dest_siz
}
static void
-c2b_gff_init_element(c2b_gff_t **e)
+c2b_gff_init_element(c2b_gff_t** e)
{
*e = malloc(sizeof(c2b_gff_t));
if (!*e) {
@@ -1460,7 +1486,7 @@ c2b_gff_init_element(c2b_gff_t **e)
}
static void
-c2b_gff_delete_element(c2b_gff_t *e)
+c2b_gff_delete_element(c2b_gff_t* e)
{
if (e->seqid) { free(e->seqid), e->seqid = NULL; }
if (e->source) { free(e->source), e->source = NULL; }
@@ -1474,7 +1500,7 @@ c2b_gff_delete_element(c2b_gff_t *e)
}
static void
-c2b_line_convert_gff_to_bed_unsorted(char *dest, ssize_t *dest_size, char *src, ssize_t src_size)
+c2b_line_convert_gff_to_bed_unsorted(char** dest, ssize_t* dest_size, ssize_t* dest_capacity, char* src, ssize_t src_size)
{
ssize_t gff_field_offsets[C2B_MAX_FIELD_COUNT_VALUE];
int gff_field_idx = 0;
@@ -1498,44 +1524,48 @@ c2b_line_convert_gff_to_bed_unsorted(char *dest, ssize_t *dest_size, char *src,
*/
if (((gff_field_idx + 1) < c2b_gff_field_min) || ((gff_field_idx + 1) > c2b_gff_field_max)) {
- if (gff_field_idx == 0) {
- char non_interval_str[C2B_MAX_FIELD_LENGTH_VALUE];
- memcpy(non_interval_str, src, current_src_posn);
- non_interval_str[current_src_posn] = '\0';
- char non_int_prefix[C2B_MAX_FIELD_LENGTH_VALUE];
- strncpy(non_int_prefix, non_interval_str, 2);
- non_int_prefix[2] = '\0';
- /* We compare against either of two standard GFF3 or GVF header pragmas */
- if ((strcmp(non_interval_str, c2b_gff_header) == 0) ||
- (strcmp(non_interval_str, c2b_gvf_header) == 0) ||
- (strcmp(non_int_prefix, c2b_gvf_generic_header) == 0)) {
- if (!c2b_globals.keep_header_flag) {
- return;
- }
- else {
- /* copy header line to destination stream buffer */
- char src_header_line_str[C2B_MAX_LINE_LENGTH_VALUE];
- char dest_header_line_str[C2B_MAX_LINE_LENGTH_VALUE];
- memcpy(src_header_line_str, src, src_size);
- src_header_line_str[src_size] = '\0';
- sprintf(dest_header_line_str, "%s\t%u\t%u\t%s\n", c2b_header_chr_name, c2b_globals.header_line_idx, (c2b_globals.header_line_idx + 1), src_header_line_str);
- memcpy(dest + *dest_size, dest_header_line_str, strlen(dest_header_line_str));
- *dest_size += strlen(dest_header_line_str);
- c2b_globals.header_line_idx++;
- return;
- }
- }
- else if (strcmp(non_interval_str, c2b_gff_fasta) == 0) {
+ char header_str[C2B_MAX_FIELD_LENGTH_VALUE];
+ memcpy(header_str, src, gff_field_offsets[0]);
+ header_str[gff_field_offsets[0]] = '\0';
+ char non_int_prefix[C2B_MAX_FIELD_LENGTH_VALUE];
+ strncpy(non_int_prefix, header_str, 2);
+ non_int_prefix[2] = '\0';
+ /* We compare against either of two standard GFF3 or GVF header pragmas */
+ if ((strcmp(header_str, c2b_gff_header) == 0) ||
+ (strcmp(header_str, c2b_gff_fasta) == 0) ||
+ (strcmp(header_str, c2b_gvf_header) == 0) ||
+ (strcmp(non_int_prefix, c2b_gvf_generic_header) == 0)) {
+ if (!c2b_globals.keep_header_flag) {
return;
}
else {
+ /* set up temporary header stream buffers */
+ if (!c2b_globals.src_line_str) {
+ c2b_globals.src_line_str = malloc(C2B_MAX_LINE_LENGTH_VALUE + 1);
+ if (!c2b_globals.src_line_str) {
+ fprintf(stderr, "Error: Could not allocate space for globals source line buffer\n");
+ exit(ENOMEM);
+ }
+ }
+ if (!c2b_globals.dest_line_str) {
+ c2b_globals.dest_line_str = malloc(C2B_MAX_LINE_LENGTH_VALUE + 1);
+ if (!c2b_globals.dest_line_str) {
+ fprintf(stderr, "Error: Could not allocate space for globals destination line buffer\n");
+ exit(ENOMEM);
+ }
+ }
+ /* copy header line to destination stream buffer */
+ memcpy(c2b_globals.src_line_str, src, src_size);
+ c2b_globals.src_line_str[src_size] = '\0';
+ sprintf(c2b_globals.dest_line_str, "%s\t%u\t%u\t%s\n", c2b_header_chr_name, c2b_globals.header_line_idx, (c2b_globals.header_line_idx + 1), c2b_globals.src_line_str);
+ memcpy(*dest + *dest_size, c2b_globals.dest_line_str, strlen(c2b_globals.dest_line_str));
+ *dest_size += strlen(c2b_globals.dest_line_str);
+ c2b_globals.header_line_idx++;
return;
}
}
else {
- fprintf(stderr, "Error: Invalid field count (%d) -- input file may not match input format\n", gff_field_idx);
- c2b_print_usage(stderr);
- exit(EINVAL); /* Invalid argument (POSIX.1) */
+ return;
}
}
@@ -1744,11 +1774,11 @@ c2b_line_convert_gff_to_bed_unsorted(char *dest, ssize_t *dest_size, char *src,
Convert GFF struct to BED string and copy it to destination
*/
- c2b_line_convert_gff_ptr_to_bed(c2b_globals.gff->element, dest, dest_size);
+ c2b_line_convert_gff_ptr_to_bed(c2b_globals.gff->element, dest, dest_size, dest_capacity);
}
static inline void
-c2b_line_convert_gff_ptr_to_bed(c2b_gff_t *g, char *dest_line, ssize_t *dest_size)
+c2b_line_convert_gff_ptr_to_bed(c2b_gff_t* g, char** dest_line_ptr, ssize_t* dest_size, ssize_t* dest_capacity)
{
/*
For GFF- and GVF-formatted data, we use the mapping provided by BEDOPS convention described at:
@@ -1774,7 +1804,20 @@ c2b_line_convert_gff_ptr_to_bed(c2b_gff_t *g, char *dest_line, ssize_t *dest_siz
attributes 10 -
*/
- *dest_size += sprintf(dest_line + *dest_size,
+ if ((ssize_t)(*dest_size + C2B_MAX_LINE_LENGTH_VALUE) > *dest_capacity) {
+ char *dest_line_resized = NULL;
+ dest_line_resized = realloc(*dest_line_ptr, *dest_capacity * 2);
+ if (dest_line_resized) {
+ *dest_capacity *= 2;
+ *dest_line_ptr = dest_line_resized;
+ }
+ else {
+ fprintf(stderr, "Error: Could not resize dest_line_ptr string in GFF pointer conversion fn\n");
+ exit(ENOMEM);
+ }
+ }
+
+ *dest_size += sprintf(*dest_line_ptr + *dest_size,
"%s\t" \
"%" PRIu64 "\t" \
"%" PRIu64 "\t" \
@@ -1798,7 +1841,229 @@ c2b_line_convert_gff_ptr_to_bed(c2b_gff_t *g, char *dest_line, ssize_t *dest_siz
}
static void
-c2b_line_convert_psl_to_bed_unsorted(char *dest, ssize_t *dest_size, char *src, ssize_t src_size)
+c2b_psl_init_element(c2b_psl_t** e)
+{
+ *e = malloc(sizeof(c2b_psl_t));
+ if (!*e) {
+ fprintf(stderr, "Error: Could not allocate space for PSL element pointer\n");
+ c2b_print_usage(stderr);
+ exit(ENOMEM); /* Not enough space (POSIX.1) */
+ }
+
+ (*e)->matchesStr = NULL, (*e)->matchesStr = malloc(C2B_PSL_ELEMENT_FIELD_LENGTH_VALUE_INITIAL * sizeof(*((*e)->matchesStr)));
+ if (!(*e)->matchesStr) {
+ fprintf(stderr, "Error: Could not allocate space for PSL element matchesStr malloc operation\n");
+ c2b_print_usage(stderr);
+ exit(ENOMEM); /* Not enough space (POSIX.1) */
+ }
+ (*e)->matchesStr_capacity = C2B_PSL_ELEMENT_FIELD_LENGTH_VALUE_INITIAL;
+
+ (*e)->misMatchesStr = NULL, (*e)->misMatchesStr = malloc(C2B_PSL_ELEMENT_FIELD_LENGTH_VALUE_INITIAL * sizeof(*((*e)->misMatchesStr)));
+ if (!(*e)->misMatchesStr) {
+ fprintf(stderr, "Error: Could not allocate space for PSL element misMatchesStr malloc operation\n");
+ c2b_print_usage(stderr);
+ exit(ENOMEM); /* Not enough space (POSIX.1) */
+ }
+ (*e)->misMatchesStr_capacity = C2B_PSL_ELEMENT_FIELD_LENGTH_VALUE_INITIAL;
+
+ (*e)->repMatchesStr = NULL, (*e)->repMatchesStr = malloc(C2B_PSL_ELEMENT_FIELD_LENGTH_VALUE_INITIAL * sizeof(*((*e)->repMatchesStr)));
+ if (!(*e)->repMatchesStr) {
+ fprintf(stderr, "Error: Could not allocate space for PSL element repMatchesStr malloc operation\n");
+ c2b_print_usage(stderr);
+ exit(ENOMEM); /* Not enough space (POSIX.1) */
+ }
+ (*e)->repMatchesStr_capacity = C2B_PSL_ELEMENT_FIELD_LENGTH_VALUE_INITIAL;
+
+ (*e)->nCountStr = NULL, (*e)->nCountStr = malloc(C2B_PSL_ELEMENT_FIELD_LENGTH_VALUE_INITIAL * sizeof(*((*e)->nCountStr)));
+ if (!(*e)->nCountStr) {
+ fprintf(stderr, "Error: Could not allocate space for PSL element nCountStr malloc operation\n");
+ c2b_print_usage(stderr);
+ exit(ENOMEM); /* Not enough space (POSIX.1) */
+ }
+ (*e)->nCountStr_capacity = C2B_PSL_ELEMENT_FIELD_LENGTH_VALUE_INITIAL;
+
+ (*e)->qNumInsertStr = NULL, (*e)->qNumInsertStr = malloc(C2B_PSL_ELEMENT_FIELD_LENGTH_VALUE_INITIAL * sizeof(*((*e)->qNumInsertStr)));
+ if (!(*e)->qNumInsertStr) {
+ fprintf(stderr, "Error: Could not allocate space for PSL element qNumInsertStr malloc operation\n");
+ c2b_print_usage(stderr);
+ exit(ENOMEM); /* Not enough space (POSIX.1) */
+ }
+ (*e)->qNumInsertStr_capacity = C2B_PSL_ELEMENT_FIELD_LENGTH_VALUE_INITIAL;
+
+ (*e)->qBaseInsertStr = NULL, (*e)->qBaseInsertStr = malloc(C2B_PSL_ELEMENT_FIELD_LENGTH_VALUE_INITIAL * sizeof(*((*e)->qBaseInsertStr)));
+ if (!(*e)->qBaseInsertStr) {
+ fprintf(stderr, "Error: Could not allocate space for PSL element qBaseInsertStr malloc operation\n");
+ c2b_print_usage(stderr);
+ exit(ENOMEM); /* Not enough space (POSIX.1) */
+ }
+ (*e)->qBaseInsertStr_capacity = C2B_PSL_ELEMENT_FIELD_LENGTH_VALUE_INITIAL;
+
+ (*e)->tNumInsertStr = NULL, (*e)->tNumInsertStr = malloc(C2B_PSL_ELEMENT_FIELD_LENGTH_VALUE_INITIAL * sizeof(*((*e)->tNumInsertStr)));
+ if (!(*e)->tNumInsertStr) {
+ fprintf(stderr, "Error: Could not allocate space for PSL element tNumInsertStr malloc operation\n");
+ c2b_print_usage(stderr);
+ exit(ENOMEM); /* Not enough space (POSIX.1) */
+ }
+ (*e)->tNumInsertStr_capacity = C2B_PSL_ELEMENT_FIELD_LENGTH_VALUE_INITIAL;
+
+ (*e)->tBaseInsertStr = NULL, (*e)->tBaseInsertStr = malloc(C2B_PSL_ELEMENT_FIELD_LENGTH_VALUE_INITIAL * sizeof(*((*e)->tBaseInsertStr)));
+ if (!(*e)->tBaseInsertStr) {
+ fprintf(stderr, "Error: Could not allocate space for PSL element tBaseInsertStr malloc operation\n");
+ c2b_print_usage(stderr);
+ exit(ENOMEM); /* Not enough space (POSIX.1) */
+ }
+ (*e)->tBaseInsertStr_capacity = C2B_PSL_ELEMENT_FIELD_LENGTH_VALUE_INITIAL;
+
+ (*e)->strand = NULL, (*e)->strand = malloc(C2B_PSL_ELEMENT_FIELD_LENGTH_VALUE_INITIAL * sizeof(*((*e)->strand)));
+ if (!(*e)->strand) {
+ fprintf(stderr, "Error: Could not allocate space for PSL element strand malloc operation\n");
+ c2b_print_usage(stderr);
+ exit(ENOMEM); /* Not enough space (POSIX.1) */
+ }
+ (*e)->strand_capacity = C2B_PSL_ELEMENT_FIELD_LENGTH_VALUE_INITIAL;
+
+ (*e)->qName = NULL, (*e)->qName = malloc(C2B_PSL_ELEMENT_FIELD_LENGTH_VALUE_INITIAL * sizeof(*((*e)->qName)));
+ if (!(*e)->qName) {
+ fprintf(stderr, "Error: Could not allocate space for PSL element qName malloc operation\n");
+ c2b_print_usage(stderr);
+ exit(ENOMEM); /* Not enough space (POSIX.1) */
+ }
+ (*e)->qName_capacity = C2B_PSL_ELEMENT_FIELD_LENGTH_VALUE_INITIAL;
+
+ (*e)->qSizeStr = NULL, (*e)->qSizeStr = malloc(C2B_PSL_ELEMENT_FIELD_LENGTH_VALUE_INITIAL * sizeof(*((*e)->qSizeStr)));
+ if (!(*e)->qSizeStr) {
+ fprintf(stderr, "Error: Could not allocate space for PSL element qSizeStr malloc operation\n");
+ c2b_print_usage(stderr);
+ exit(ENOMEM); /* Not enough space (POSIX.1) */
+ }
+ (*e)->qSizeStr_capacity = C2B_PSL_ELEMENT_FIELD_LENGTH_VALUE_INITIAL;
+
+ (*e)->qStartStr = NULL, (*e)->qStartStr = malloc(C2B_PSL_ELEMENT_FIELD_LENGTH_VALUE_INITIAL * sizeof(*((*e)->qStartStr)));
+ if (!(*e)->qStartStr) {
+ fprintf(stderr, "Error: Could not allocate space for PSL element qStartStr malloc operation\n");
+ c2b_print_usage(stderr);
+ exit(ENOMEM); /* Not enough space (POSIX.1) */
+ }
+ (*e)->qStartStr_capacity = C2B_PSL_ELEMENT_FIELD_LENGTH_VALUE_INITIAL;
+
+ (*e)->qEndStr = NULL, (*e)->qEndStr = malloc(C2B_PSL_ELEMENT_FIELD_LENGTH_VALUE_INITIAL * sizeof(*((*e)->qEndStr)));
+ if (!(*e)->qEndStr) {
+ fprintf(stderr, "Error: Could not allocate space for PSL element qEndStr malloc operation\n");
+ c2b_print_usage(stderr);
+ exit(ENOMEM); /* Not enough space (POSIX.1) */
+ }
+ (*e)->qEndStr_capacity = C2B_PSL_ELEMENT_FIELD_LENGTH_VALUE_INITIAL;
+
+ (*e)->tName = NULL, (*e)->tName = malloc(C2B_PSL_ELEMENT_FIELD_LENGTH_VALUE_INITIAL * sizeof(*((*e)->tName)));
+ if (!(*e)->tName) {
+ fprintf(stderr, "Error: Could not allocate space for PSL element tName malloc operation\n");
+ c2b_print_usage(stderr);
+ exit(ENOMEM); /* Not enough space (POSIX.1) */
+ }
+ (*e)->tName_capacity = C2B_PSL_ELEMENT_FIELD_LENGTH_VALUE_INITIAL;
+
+ (*e)->tSizeStr = NULL, (*e)->tSizeStr = malloc(C2B_PSL_ELEMENT_FIELD_LENGTH_VALUE_INITIAL * sizeof(*((*e)->tSizeStr)));
+ if (!(*e)->tSizeStr) {
+ fprintf(stderr, "Error: Could not allocate space for PSL element tSizeStr malloc operation\n");
+ c2b_print_usage(stderr);
+ exit(ENOMEM); /* Not enough space (POSIX.1) */
+ }
+ (*e)->tSizeStr_capacity = C2B_PSL_ELEMENT_FIELD_LENGTH_VALUE_INITIAL;
+
+ (*e)->tStartStr = NULL, (*e)->tStartStr = malloc(C2B_PSL_ELEMENT_FIELD_LENGTH_VALUE_INITIAL * sizeof(*((*e)->tStartStr)));
+ if (!(*e)->tStartStr) {
+ fprintf(stderr, "Error: Could not allocate space for PSL element tStartStr malloc operation\n");
+ c2b_print_usage(stderr);
+ exit(ENOMEM); /* Not enough space (POSIX.1) */
+ }
+ (*e)->tStartStr_capacity = C2B_PSL_ELEMENT_FIELD_LENGTH_VALUE_INITIAL;
+
+ (*e)->tEndStr = NULL, (*e)->tEndStr = malloc(C2B_PSL_ELEMENT_FIELD_LENGTH_VALUE_INITIAL * sizeof(*((*e)->tEndStr)));
+ if (!(*e)->tEndStr) {
+ fprintf(stderr, "Error: Could not allocate space for PSL element tEndStr malloc operation\n");
+ c2b_print_usage(stderr);
+ exit(ENOMEM); /* Not enough space (POSIX.1) */
+ }
+ (*e)->tEndStr_capacity = C2B_PSL_ELEMENT_FIELD_LENGTH_VALUE_INITIAL;
+
+ (*e)->blockCountStr = NULL, (*e)->blockCountStr = malloc(C2B_PSL_ELEMENT_FIELD_LENGTH_VALUE_INITIAL * sizeof(*((*e)->blockCountStr)));
+ if (!(*e)->blockCountStr) {
+ fprintf(stderr, "Error: Could not allocate space for PSL element blockCountStr malloc operation\n");
+ c2b_print_usage(stderr);
+ exit(ENOMEM); /* Not enough space (POSIX.1) */
+ }
+ (*e)->blockCountStr_capacity = C2B_PSL_ELEMENT_FIELD_LENGTH_VALUE_INITIAL;
+
+ (*e)->blockSizes = NULL, (*e)->blockSizes = malloc(C2B_PSL_ELEMENT_FIELD_LENGTH_VALUE_INITIAL * sizeof(*((*e)->blockSizes)));
+ if (!(*e)->blockSizes) {
+ fprintf(stderr, "Error: Could not allocate space for PSL element blockSizes malloc operation\n");
+ c2b_print_usage(stderr);
+ exit(ENOMEM); /* Not enough space (POSIX.1) */
+ }
+ (*e)->blockSizes_capacity = C2B_PSL_ELEMENT_FIELD_LENGTH_VALUE_INITIAL;
+
+ (*e)->qStarts = NULL, (*e)->qStarts = malloc(C2B_PSL_ELEMENT_FIELD_LENGTH_VALUE_INITIAL * sizeof(*((*e)->qStarts)));
+ if (!(*e)->qStarts) {
+ fprintf(stderr, "Error: Could not allocate space for PSL element qStarts malloc operation\n");
+ c2b_print_usage(stderr);
+ exit(ENOMEM); /* Not enough space (POSIX.1) */
+ }
+ (*e)->qStarts_capacity = C2B_PSL_ELEMENT_FIELD_LENGTH_VALUE_INITIAL;
+
+ (*e)->tStarts = NULL, (*e)->tStarts = malloc(C2B_PSL_ELEMENT_FIELD_LENGTH_VALUE_INITIAL * sizeof(*((*e)->tStarts)));
+ if (!(*e)->tStarts) {
+ fprintf(stderr, "Error: Could not allocate space for PSL element tStarts malloc operation\n");
+ c2b_print_usage(stderr);
+ exit(ENOMEM); /* Not enough space (POSIX.1) */
+ }
+ (*e)->tStarts_capacity = C2B_PSL_ELEMENT_FIELD_LENGTH_VALUE_INITIAL;
+
+ (*e)->matches = 0;
+ (*e)->misMatches = 0;
+ (*e)->repMatches = 0;
+ (*e)->nCount = 0;
+ (*e)->qNumInsert = 0;
+ (*e)->qBaseInsert = 0;
+ (*e)->tNumInsert = 0;
+ (*e)->tBaseInsert = 0;
+ (*e)->qSize = 0;
+ (*e)->qStart = 0;
+ (*e)->qEnd = 0;
+ (*e)->tSize = 0;
+ (*e)->tStart = 0;
+ (*e)->tEnd = 0;
+ (*e)->blockCount = 0;
+}
+
+static void
+c2b_psl_delete_element(c2b_psl_t* e)
+{
+ if (e->matchesStr) { free(e->matchesStr), e->matchesStr = NULL; }
+ if (e->misMatchesStr) { free(e->misMatchesStr), e->misMatchesStr = NULL; }
+ if (e->repMatchesStr) { free(e->repMatchesStr), e->repMatchesStr = NULL; }
+ if (e->nCountStr) { free(e->nCountStr), e->nCountStr = NULL; }
+ if (e->qNumInsertStr) { free(e->qNumInsertStr), e->qNumInsertStr = NULL; }
+ if (e->qBaseInsertStr) { free(e->qBaseInsertStr), e->qBaseInsertStr = NULL; }
+ if (e->tNumInsertStr) { free(e->tNumInsertStr), e->tNumInsertStr = NULL; }
+ if (e->tBaseInsertStr) { free(e->tBaseInsertStr), e->tBaseInsertStr = NULL; }
+ if (e->strand) { free(e->strand), e->strand = NULL; }
+ if (e->qName) { free(e->qName), e->qName = NULL; }
+ if (e->qSizeStr) { free(e->qSizeStr), e->qSizeStr = NULL; }
+ if (e->qStartStr) { free(e->qStartStr), e->qStartStr = NULL; }
+ if (e->qEndStr) { free(e->qEndStr), e->qEndStr = NULL; }
+ if (e->tName) { free(e->tName), e->tName = NULL; }
+ if (e->tSizeStr) { free(e->tSizeStr), e->tSizeStr = NULL; }
+ if (e->tStartStr) { free(e->tStartStr), e->tStartStr = NULL; }
+ if (e->tEndStr) { free(e->tEndStr), e->tEndStr = NULL; }
+ if (e->blockCountStr) { free(e->blockCountStr), e->blockCountStr = NULL; }
+ if (e->blockSizes) { free(e->blockSizes), e->blockSizes = NULL; }
+ if (e->qStarts) { free(e->qStarts), e->qStarts = NULL; }
+ if (e->tStarts) { free(e->tStarts), e->tStarts = NULL; }
+ if (e) { free(e), e = NULL; }
+}
+
+static void
+c2b_line_convert_psl_to_bed_unsorted(char** dest, ssize_t* dest_size, ssize_t* dest_capacity, char* src, ssize_t src_size)
{
ssize_t psl_field_offsets[C2B_MAX_FIELD_COUNT_VALUE];
int psl_field_idx = 0;
@@ -1824,14 +2089,27 @@ c2b_line_convert_psl_to_bed_unsorted(char *dest, ssize_t *dest_size, char *src,
if (((psl_field_idx + 1) < c2b_psl_field_min) || ((psl_field_idx + 1) > c2b_psl_field_max)) {
if ((psl_field_idx == 0) || (psl_field_idx == 17)) {
if ((c2b_globals.psl->is_headered) && (c2b_globals.keep_header_flag) && (c2b_globals.header_line_idx <= 5)) {
+ /* set up temporary header stream buffers */
+ if (!c2b_globals.src_line_str) {
+ c2b_globals.src_line_str = malloc(C2B_MAX_LINE_LENGTH_VALUE + 1);
+ if (!c2b_globals.src_line_str) {
+ fprintf(stderr, "Error: Could not allocate space for globals source line buffer\n");
+ exit(ENOMEM);
+ }
+ }
+ if (!c2b_globals.dest_line_str) {
+ c2b_globals.dest_line_str = malloc(C2B_MAX_LINE_LENGTH_VALUE + 1);
+ if (!c2b_globals.dest_line_str) {
+ fprintf(stderr, "Error: Could not allocate space for globals destination line buffer\n");
+ exit(ENOMEM);
+ }
+ }
/* copy header line to destination stream buffer */
- char src_header_line_str[C2B_MAX_LINE_LENGTH_VALUE];
- char dest_header_line_str[C2B_MAX_LINE_LENGTH_VALUE];
- memcpy(src_header_line_str, src, src_size);
- src_header_line_str[src_size] = '\0';
- sprintf(dest_header_line_str, "%s\t%u\t%u\t%s\n", c2b_header_chr_name, c2b_globals.header_line_idx, (c2b_globals.header_line_idx + 1), src_header_line_str);
- memcpy(dest + *dest_size, dest_header_line_str, strlen(dest_header_line_str));
- *dest_size += strlen(dest_header_line_str);
+ memcpy(c2b_globals.src_line_str, src, src_size);
+ c2b_globals.src_line_str[src_size] = '\0';
+ sprintf(c2b_globals.dest_line_str, "%s\t%u\t%u\t%s\n", c2b_header_chr_name, c2b_globals.header_line_idx, (c2b_globals.header_line_idx + 1), c2b_globals.src_line_str);
+ memcpy(*dest + *dest_size, c2b_globals.dest_line_str, strlen(c2b_globals.dest_line_str));
+ *dest_size += strlen(c2b_globals.dest_line_str);
c2b_globals.header_line_idx++;
return;
}
@@ -1853,14 +2131,25 @@ c2b_line_convert_psl_to_bed_unsorted(char *dest, ssize_t *dest_size, char *src,
}
/* 0 - matches */
- char matches_str[C2B_MAX_FIELD_LENGTH_VALUE];
- ssize_t matches_size = psl_field_offsets[0];
- memcpy(matches_str, src, matches_size);
- matches_str[matches_size] = '\0';
- uint64_t matches_val = strtoull(matches_str, NULL, 10);
+ ssize_t matchesStr_size = psl_field_offsets[0];
+ if (matchesStr_size >= c2b_globals.psl->element->matchesStr_capacity) {
+ char *matchesStr_resized = NULL;
+ matchesStr_resized = realloc(c2b_globals.psl->element->matchesStr, matchesStr_size + 1);
+ if (matchesStr_resized) {
+ c2b_globals.psl->element->matchesStr = matchesStr_resized;
+ c2b_globals.psl->element->matchesStr_capacity = matchesStr_size + 1;
+ }
+ else {
+ fprintf(stderr, "Error: Could not resize matchesStr in PSL element struct\n");
+ exit(ENOMEM);
+ }
+ }
+ memcpy(c2b_globals.psl->element->matchesStr, src, matchesStr_size);
+ c2b_globals.psl->element->matchesStr[matchesStr_size] = '\0';
+ c2b_globals.psl->element->matches = strtoull(c2b_globals.psl->element->matchesStr, NULL, 10);
#ifdef DEBUG
- fprintf(stderr, "matches_str: [%s]\n", matches_str);
+ fprintf(stderr, "matchesStr: [%s]\n", c2b_globals.psl->element->matchesStr);
#endif
/*
@@ -1868,278 +2157,488 @@ c2b_line_convert_psl_to_bed_unsorted(char *dest, ssize_t *dest_size, char *src,
lines can mimic a genomic element
*/
- if ((matches_val == 0) && (!isdigit(matches_str[0]))) {
+ if ((c2b_globals.psl->element->matches == 0) && (!isdigit(c2b_globals.psl->element->matchesStr[0]))) {
if ((c2b_globals.psl->is_headered) && (c2b_globals.keep_header_flag) && (c2b_globals.header_line_idx <= 5)) {
+ /* set up temporary header stream buffers */
+ if (!c2b_globals.src_line_str) {
+ c2b_globals.src_line_str = malloc(C2B_MAX_LINE_LENGTH_VALUE + 1);
+ if (!c2b_globals.src_line_str) {
+ fprintf(stderr, "Error: Could not allocate space for globals source line buffer\n");
+ exit(ENOMEM);
+ }
+ }
+ if (!c2b_globals.dest_line_str) {
+ c2b_globals.dest_line_str = malloc(C2B_MAX_LINE_LENGTH_VALUE + 1);
+ if (!c2b_globals.dest_line_str) {
+ fprintf(stderr, "Error: Could not allocate space for globals destination line buffer\n");
+ exit(ENOMEM);
+ }
+ }
/* copy header line to destination stream buffer */
- char src_header_line_str[C2B_MAX_LINE_LENGTH_VALUE];
- char dest_header_line_str[C2B_MAX_LINE_LENGTH_VALUE];
- memcpy(src_header_line_str, src, src_size);
- src_header_line_str[src_size] = '\0';
- sprintf(dest_header_line_str, "%s\t%u\t%u\t%s\n", c2b_header_chr_name, c2b_globals.header_line_idx, (c2b_globals.header_line_idx + 1), src_header_line_str);
- memcpy(dest + *dest_size, dest_header_line_str, strlen(dest_header_line_str));
- *dest_size += strlen(dest_header_line_str);
+ memcpy(c2b_globals.src_line_str, src, src_size);
+ c2b_globals.src_line_str[src_size] = '\0';
+ sprintf(c2b_globals.dest_line_str, "%s\t%u\t%u\t%s\n", c2b_header_chr_name, c2b_globals.header_line_idx, (c2b_globals.header_line_idx + 1), c2b_globals.src_line_str);
+ memcpy(*dest + *dest_size, c2b_globals.dest_line_str, strlen(c2b_globals.dest_line_str));
+ *dest_size += strlen(c2b_globals.dest_line_str);
c2b_globals.header_line_idx++;
}
return;
}
/* 1 - misMatches */
- char misMatches_str[C2B_MAX_FIELD_LENGTH_VALUE];
- ssize_t misMatches_size = psl_field_offsets[1] - psl_field_offsets[0] - 1;
- memcpy(misMatches_str, src + psl_field_offsets[0] + 1, misMatches_size);
- misMatches_str[misMatches_size] = '\0';
- uint64_t misMatches_val = strtoull(misMatches_str, NULL, 10);
+ ssize_t misMatchesStr_size = psl_field_offsets[1] - psl_field_offsets[0] - 1;
+ if (misMatchesStr_size >= c2b_globals.psl->element->misMatchesStr_capacity) {
+ char *misMatchesStr_resized = NULL;
+ misMatchesStr_resized = realloc(c2b_globals.psl->element->misMatchesStr, misMatchesStr_size + 1);
+ if (misMatchesStr_resized) {
+ c2b_globals.psl->element->misMatchesStr = misMatchesStr_resized;
+ c2b_globals.psl->element->misMatchesStr_capacity = misMatchesStr_size + 1;
+ }
+ else {
+ fprintf(stderr, "Error: Could not resize misMatchesStr in PSL element struct\n");
+ exit(ENOMEM);
+ }
+ }
+ memcpy(c2b_globals.psl->element->misMatchesStr, src + psl_field_offsets[0] + 1, misMatchesStr_size);
+ c2b_globals.psl->element->misMatchesStr[misMatchesStr_size] = '\0';
+ c2b_globals.psl->element->misMatches = strtoull(c2b_globals.psl->element->misMatchesStr, NULL, 10);
#ifdef DEBUG
- fprintf(stderr, "misMatches_str: [%s]\n", misMatches_str);
+ fprintf(stderr, "misMatchesStr: [%s]\n", c2b_globals.psl->element->misMatchesStr);
#endif
/* 2 - repMatches */
- char repMatches_str[C2B_MAX_FIELD_LENGTH_VALUE];
- ssize_t repMatches_size = psl_field_offsets[2] - psl_field_offsets[1] - 1;
- memcpy(repMatches_str, src + psl_field_offsets[1] + 1, repMatches_size);
- repMatches_str[repMatches_size] = '\0';
- uint64_t repMatches_val = strtoull(repMatches_str, NULL, 10);
+ ssize_t repMatchesStr_size = psl_field_offsets[2] - psl_field_offsets[1] - 1;
+ if (repMatchesStr_size >= c2b_globals.psl->element->repMatchesStr_capacity) {
+ char *repMatchesStr_resized = NULL;
+ repMatchesStr_resized = realloc(c2b_globals.psl->element->repMatchesStr, repMatchesStr_size + 1);
+ if (repMatchesStr_resized) {
+ c2b_globals.psl->element->repMatchesStr = repMatchesStr_resized;
+ c2b_globals.psl->element->repMatchesStr_capacity = repMatchesStr_size + 1;
+ }
+ else {
+ fprintf(stderr, "Error: Could not resize repMatchesStr in PSL element struct\n");
+ exit(ENOMEM);
+ }
+ }
+ memcpy(c2b_globals.psl->element->repMatchesStr, src + psl_field_offsets[1] + 1, repMatchesStr_size);
+ c2b_globals.psl->element->repMatchesStr[repMatchesStr_size] = '\0';
+ c2b_globals.psl->element->repMatches = strtoull(c2b_globals.psl->element->repMatchesStr, NULL, 10);
#ifdef DEBUG
- fprintf(stderr, "repMatches_str: [%s]\n", repMatches_str);
+ fprintf(stderr, "repMatchesStr: [%s]\n", c2b_globals.psl->element->repMatchesStr);
#endif
/* 3 - nCount */
- char nCount_str[C2B_MAX_FIELD_LENGTH_VALUE];
- ssize_t nCount_size = psl_field_offsets[3] - psl_field_offsets[2] - 1;
- memcpy(nCount_str, src + psl_field_offsets[2] + 1, nCount_size);
- nCount_str[nCount_size] = '\0';
- uint64_t nCount_val = strtoull(nCount_str, NULL, 10);
+ ssize_t nCountStr_size = psl_field_offsets[3] - psl_field_offsets[2] - 1;
+ if (nCountStr_size >= c2b_globals.psl->element->nCountStr_capacity) {
+ char *nCountStr_resized = NULL;
+ nCountStr_resized = realloc(c2b_globals.psl->element->nCountStr, nCountStr_size + 1);
+ if (nCountStr_resized) {
+ c2b_globals.psl->element->nCountStr = nCountStr_resized;
+ c2b_globals.psl->element->nCountStr_capacity = nCountStr_size + 1;
+ }
+ else {
+ fprintf(stderr, "Error: Could not resize nCountStr in PSL element struct\n");
+ exit(ENOMEM);
+ }
+ }
+ memcpy(c2b_globals.psl->element->nCountStr, src + psl_field_offsets[2] + 1, nCountStr_size);
+ c2b_globals.psl->element->nCountStr[nCountStr_size] = '\0';
+ c2b_globals.psl->element->nCount = strtoull(c2b_globals.psl->element->nCountStr, NULL, 10);
#ifdef DEBUG
- fprintf(stderr, "nCount_str: [%s]\n", nCount_str);
+ fprintf(stderr, "nCountStr: [%s]\n", c2b_globals.psl->element->nCountStr);
#endif
/* 4 - qNumInsert */
- char qNumInsert_str[C2B_MAX_FIELD_LENGTH_VALUE];
- ssize_t qNumInsert_size = psl_field_offsets[4] - psl_field_offsets[3] - 1;
- memcpy(qNumInsert_str, src + psl_field_offsets[3] + 1, qNumInsert_size);
- qNumInsert_str[qNumInsert_size] = '\0';
- uint64_t qNumInsert_val = strtoull(qNumInsert_str, NULL, 10);
+ ssize_t qNumInsertStr_size = psl_field_offsets[4] - psl_field_offsets[3] - 1;
+ if (qNumInsertStr_size >= c2b_globals.psl->element->qNumInsertStr_capacity) {
+ char *qNumInsertStr_resized = NULL;
+ qNumInsertStr_resized = realloc(c2b_globals.psl->element->qNumInsertStr, qNumInsertStr_size + 1);
+ if (qNumInsertStr_resized) {
+ c2b_globals.psl->element->qNumInsertStr = qNumInsertStr_resized;
+ c2b_globals.psl->element->qNumInsertStr_capacity = qNumInsertStr_size + 1;
+ }
+ else {
+ fprintf(stderr, "Error: Could not resize qNumInsertStr in PSL element struct\n");
+ exit(ENOMEM);
+ }
+ }
+ memcpy(c2b_globals.psl->element->qNumInsertStr, src + psl_field_offsets[3] + 1, qNumInsertStr_size);
+ c2b_globals.psl->element->qNumInsertStr[qNumInsertStr_size] = '\0';
+ c2b_globals.psl->element->qNumInsert = strtoull(c2b_globals.psl->element->qNumInsertStr, NULL, 10);
#ifdef DEBUG
- fprintf(stderr, "qNumInsert_str: [%s]\n", qNumInsert_str);
+ fprintf(stderr, "qNumInsertStr: [%s]\n", c2b_globals.psl->element->qNumInsertStr);
#endif
/* 5 - qBaseInsert */
- char qBaseInsert_str[C2B_MAX_FIELD_LENGTH_VALUE];
- ssize_t qBaseInsert_size = psl_field_offsets[5] - psl_field_offsets[4] - 1;
- memcpy(qBaseInsert_str, src + psl_field_offsets[4] + 1, qBaseInsert_size);
- qBaseInsert_str[qBaseInsert_size] = '\0';
- uint64_t qBaseInsert_val = strtoull(qBaseInsert_str, NULL, 10);
+ ssize_t qBaseInsertStr_size = psl_field_offsets[5] - psl_field_offsets[4] - 1;
+ if (qBaseInsertStr_size >= c2b_globals.psl->element->qBaseInsertStr_capacity) {
+ char *qBaseInsertStr_resized = NULL;
+ qBaseInsertStr_resized = realloc(c2b_globals.psl->element->qBaseInsertStr, qBaseInsertStr_size + 1);
+ if (qBaseInsertStr_resized) {
+ c2b_globals.psl->element->qBaseInsertStr = qBaseInsertStr_resized;
+ c2b_globals.psl->element->qBaseInsertStr_capacity = qBaseInsertStr_size + 1;
+ }
+ else {
+ fprintf(stderr, "Error: Could not resize qBaseInsertStr in PSL element struct\n");
+ exit(ENOMEM);
+ }
+ }
+ memcpy(c2b_globals.psl->element->qBaseInsertStr, src + psl_field_offsets[4] + 1, qBaseInsertStr_size);
+ c2b_globals.psl->element->qBaseInsertStr[qBaseInsertStr_size] = '\0';
+ c2b_globals.psl->element->qBaseInsert = strtoull(c2b_globals.psl->element->qBaseInsertStr, NULL, 10);
#ifdef DEBUG
- fprintf(stderr, "qBaseInsert_str: [%s]\n", qBaseInsert_str);
+ fprintf(stderr, "qBaseInsertStr: [%s]\n", c2b_globals.psl->element->qBaseInsertStr);
#endif
/* 6 - tNumInsert */
- char tNumInsert_str[C2B_MAX_FIELD_LENGTH_VALUE];
- ssize_t tNumInsert_size = psl_field_offsets[6] - psl_field_offsets[5] - 1;
- memcpy(tNumInsert_str, src + psl_field_offsets[5] + 1, tNumInsert_size);
- tNumInsert_str[tNumInsert_size] = '\0';
- uint64_t tNumInsert_val = strtoull(tNumInsert_str, NULL, 10);
+ ssize_t tNumInsertStr_size = psl_field_offsets[6] - psl_field_offsets[5] - 1;
+ if (tNumInsertStr_size >= c2b_globals.psl->element->tNumInsertStr_capacity) {
+ char *tNumInsertStr_resized = NULL;
+ tNumInsertStr_resized = realloc(c2b_globals.psl->element->tNumInsertStr, tNumInsertStr_size + 1);
+ if (tNumInsertStr_resized) {
+ c2b_globals.psl->element->tNumInsertStr = tNumInsertStr_resized;
+ c2b_globals.psl->element->tNumInsertStr_capacity = tNumInsertStr_size + 1;
+ }
+ else {
+ fprintf(stderr, "Error: Could not resize tNumInsertStr in PSL element struct\n");
+ exit(ENOMEM);
+ }
+ }
+ memcpy(c2b_globals.psl->element->tNumInsertStr, src + psl_field_offsets[5] + 1, tNumInsertStr_size);
+ c2b_globals.psl->element->tNumInsertStr[tNumInsertStr_size] = '\0';
+ c2b_globals.psl->element->tNumInsert = strtoull(c2b_globals.psl->element->tNumInsertStr, NULL, 10);
#ifdef DEBUG
- fprintf(stderr, "tNumInsert_str: [%s]\n", tNumInsert_str);
+ fprintf(stderr, "tNumInsertStr: [%s]\n", c2b_globals.psl->element->tNumInsertStr);
#endif
/* 7 - tBaseInsert */
- char tBaseInsert_str[C2B_MAX_FIELD_LENGTH_VALUE];
- ssize_t tBaseInsert_size = psl_field_offsets[7] - psl_field_offsets[6] - 1;
- memcpy(tBaseInsert_str, src + psl_field_offsets[6] + 1, tBaseInsert_size);
- tBaseInsert_str[tBaseInsert_size] = '\0';
- uint64_t tBaseInsert_val = strtoull(tBaseInsert_str, NULL, 10);
+ ssize_t tBaseInsertStr_size = psl_field_offsets[7] - psl_field_offsets[6] - 1;
+ if (tBaseInsertStr_size >= c2b_globals.psl->element->tBaseInsertStr_capacity) {
+ char *tBaseInsertStr_resized = NULL;
+ tBaseInsertStr_resized = realloc(c2b_globals.psl->element->tBaseInsertStr, tBaseInsertStr_size + 1);
+ if (tBaseInsertStr_resized) {
+ c2b_globals.psl->element->tBaseInsertStr = tBaseInsertStr_resized;
+ c2b_globals.psl->element->tBaseInsertStr_capacity = tBaseInsertStr_size + 1;
+ }
+ else {
+ fprintf(stderr, "Error: Could not resize tBaseInsertStr in PSL element struct\n");
+ exit(ENOMEM);
+ }
+ }
+ memcpy(c2b_globals.psl->element->tBaseInsertStr, src + psl_field_offsets[6] + 1, tBaseInsertStr_size);
+ c2b_globals.psl->element->tBaseInsertStr[tBaseInsertStr_size] = '\0';
+ c2b_globals.psl->element->tBaseInsert = strtoull(c2b_globals.psl->element->tBaseInsertStr, NULL, 10);
#ifdef DEBUG
- fprintf(stderr, "tBaseInsert_str: [%s]\n", tBaseInsert_str);
+ fprintf(stderr, "tBaseInsertStr: [%s]\n", c2b_globals.psl->element->tBaseInsertStr);
#endif
/* 8 - strand */
- char strand_str[C2B_MAX_FIELD_LENGTH_VALUE];
ssize_t strand_size = psl_field_offsets[8] - psl_field_offsets[7] - 1;
- memcpy(strand_str, src + psl_field_offsets[7] + 1, strand_size);
- strand_str[strand_size] = '\0';
+ if (strand_size >= c2b_globals.psl->element->strand_capacity) {
+ char *strand_resized = NULL;
+ strand_resized = realloc(c2b_globals.psl->element->strand, strand_size + 1);
+ if (strand_resized) {
+ c2b_globals.psl->element->strand = strand_resized;
+ c2b_globals.psl->element->strand_capacity = strand_size + 1;
+ }
+ else {
+ fprintf(stderr, "Error: Could not resize strand in PSL element struct\n");
+ exit(ENOMEM);
+ }
+ }
+ memcpy(c2b_globals.psl->element->strand, src + psl_field_offsets[7] + 1, strand_size);
+ c2b_globals.psl->element->strand[strand_size] = '\0';
#ifdef DEBUG
- fprintf(stderr, "strand_str: [%s]\n", strand_str);
+ fprintf(stderr, "strand: [%s]\n", c2b_globals.psl->element->strand);
#endif
/* 9 - qName */
- char qName_str[C2B_MAX_FIELD_LENGTH_VALUE];
ssize_t qName_size = psl_field_offsets[9] - psl_field_offsets[8] - 1;
- memcpy(qName_str, src + psl_field_offsets[8] + 1, qName_size);
- qName_str[qName_size] = '\0';
+ if (qName_size >= c2b_globals.psl->element->qName_capacity) {
+ char *qName_resized = NULL;
+ qName_resized = realloc(c2b_globals.psl->element->qName, qName_size + 1);
+ if (qName_resized) {
+ c2b_globals.psl->element->qName = qName_resized;
+ c2b_globals.psl->element->qName_capacity = qName_size + 1;
+ }
+ else {
+ fprintf(stderr, "Error: Could not resize qName in PSL element struct\n");
+ exit(ENOMEM);
+ }
+ }
+ memcpy(c2b_globals.psl->element->qName, src + psl_field_offsets[8] + 1, qName_size);
+ c2b_globals.psl->element->qName[qName_size] = '\0';
#ifdef DEBUG
- fprintf(stderr, "qName_str: [%s]\n", qName_str);
+ fprintf(stderr, "qName: [%s]\n", c2b_globals.psl->element->qName);
#endif
/* 10 - qSize */
- char qSize_str[C2B_MAX_FIELD_LENGTH_VALUE];
- ssize_t qSize_size = psl_field_offsets[10] - psl_field_offsets[9] - 1;
- memcpy(qSize_str, src + psl_field_offsets[9] + 1, qSize_size);
- qSize_str[qSize_size] = '\0';
- uint64_t qSize_val = strtoull(qSize_str, NULL, 10);
+ ssize_t qSizeStr_size = psl_field_offsets[10] - psl_field_offsets[9] - 1;
+ if (qSizeStr_size >= c2b_globals.psl->element->qSizeStr_capacity) {
+ char *qSizeStr_resized = NULL;
+ qSizeStr_resized = realloc(c2b_globals.psl->element->qSizeStr, qSizeStr_size + 1);
+ if (qSizeStr_resized) {
+ c2b_globals.psl->element->qSizeStr = qSizeStr_resized;
+ c2b_globals.psl->element->qSizeStr_capacity = qSizeStr_size + 1;
+ }
+ else {
+ fprintf(stderr, "Error: Could not resize qSizeStr in PSL element struct\n");
+ exit(ENOMEM);
+ }
+ }
+ memcpy(c2b_globals.psl->element->qSizeStr, src + psl_field_offsets[9] + 1, qSizeStr_size);
+ c2b_globals.psl->element->qSizeStr[qSizeStr_size] = '\0';
+ c2b_globals.psl->element->qSize = strtoull(c2b_globals.psl->element->qSizeStr, NULL, 10);
#ifdef DEBUG
- fprintf(stderr, "qSize_str: [%s]\n", qSize_str);
+ fprintf(stderr, "qSizeStr: [%s]\n", c2b_globals.psl->element->qSizeStr);
#endif
/* 11 - qStart */
- char qStart_str[C2B_MAX_FIELD_LENGTH_VALUE];
- ssize_t qStart_size = psl_field_offsets[11] - psl_field_offsets[10] - 1;
- memcpy(qStart_str, src + psl_field_offsets[10] + 1, qStart_size);
- qStart_str[qStart_size] = '\0';
- uint64_t qStart_val = strtoull(qStart_str, NULL, 10);
+ ssize_t qStartStr_size = psl_field_offsets[11] - psl_field_offsets[10] - 1;
+ if (qStartStr_size >= c2b_globals.psl->element->qStartStr_capacity) {
+ char *qStartStr_resized = NULL;
+ qStartStr_resized = realloc(c2b_globals.psl->element->qStartStr, qStartStr_size + 1);
+ if (qStartStr_resized) {
+ c2b_globals.psl->element->qStartStr = qStartStr_resized;
+ c2b_globals.psl->element->qStartStr_capacity = qStartStr_size + 1;
+ }
+ else {
+ fprintf(stderr, "Error: Could not resize qStartStr in PSL element struct\n");
+ exit(ENOMEM);
+ }
+ }
+ memcpy(c2b_globals.psl->element->qStartStr, src + psl_field_offsets[10] + 1, qStartStr_size);
+ c2b_globals.psl->element->qStartStr[qStartStr_size] = '\0';
+ c2b_globals.psl->element->qStart = strtoull(c2b_globals.psl->element->qStartStr, NULL, 10);
#ifdef DEBUG
- fprintf(stderr, "qStart_str: [%s]\n", qStart_str);
+ fprintf(stderr, "qStartStr: [%s]\n", c2b_globals.psl->element->qStartStr);
#endif
/* 12 - qEnd */
- char qEnd_str[C2B_MAX_FIELD_LENGTH_VALUE];
- ssize_t qEnd_size = psl_field_offsets[12] - psl_field_offsets[11] - 1;
- memcpy(qEnd_str, src + psl_field_offsets[11] + 1, qEnd_size);
- qEnd_str[qEnd_size] = '\0';
- uint64_t qEnd_val = strtoull(qEnd_str, NULL, 10);
+ ssize_t qEndStr_size = psl_field_offsets[12] - psl_field_offsets[11] - 1;
+ if (qEndStr_size >= c2b_globals.psl->element->qEndStr_capacity) {
+ char *qEndStr_resized = NULL;
+ qEndStr_resized = realloc(c2b_globals.psl->element->qEndStr, qEndStr_size + 1);
+ if (qEndStr_resized) {
+ c2b_globals.psl->element->qEndStr = qEndStr_resized;
+ c2b_globals.psl->element->qEndStr_capacity = qEndStr_size + 1;
+ }
+ else {
+ fprintf(stderr, "Error: Could not resize qEndStr in PSL element struct\n");
+ exit(ENOMEM);
+ }
+ }
+ memcpy(c2b_globals.psl->element->qEndStr, src + psl_field_offsets[11] + 1, qEndStr_size);
+ c2b_globals.psl->element->qEndStr[qEndStr_size] = '\0';
+ c2b_globals.psl->element->qEnd = strtoull(c2b_globals.psl->element->qEndStr, NULL, 10);
#ifdef DEBUG
- fprintf(stderr, "qEnd_str: [%s]\n", qEnd_str);
+ fprintf(stderr, "qEndStr: [%s]\n", c2b_globals.psl->element->qEndStr);
#endif
/* 13 - tName */
- char tName_str[C2B_MAX_FIELD_LENGTH_VALUE];
ssize_t tName_size = psl_field_offsets[13] - psl_field_offsets[12] - 1;
- memcpy(tName_str, src + psl_field_offsets[12] + 1, tName_size);
- tName_str[tName_size] = '\0';
+ if (tName_size >= c2b_globals.psl->element->tName_capacity) {
+ char *tName_resized = NULL;
+ tName_resized = realloc(c2b_globals.psl->element->tName, tName_size + 1);
+ if (tName_resized) {
+ c2b_globals.psl->element->tName = tName_resized;
+ c2b_globals.psl->element->tName_capacity = tName_size + 1;
+ }
+ else {
+ fprintf(stderr, "Error: Could not resize tName in PSL element struct\n");
+ exit(ENOMEM);
+ }
+ }
+ memcpy(c2b_globals.psl->element->tName, src + psl_field_offsets[12] + 1, tName_size);
+ c2b_globals.psl->element->tName[tName_size] = '\0';
#ifdef DEBUG
- fprintf(stderr, "tName_str: [%s]\n", tName_str);
+ fprintf(stderr, "tName: [%s]\n", c2b_globals.psl->element->tName);
#endif
/* 14 - tSize */
- char tSize_str[C2B_MAX_FIELD_LENGTH_VALUE];
- ssize_t tSize_size = psl_field_offsets[14] - psl_field_offsets[13] - 1;
- memcpy(tSize_str, src + psl_field_offsets[13] + 1, tSize_size);
- tSize_str[tSize_size] = '\0';
- uint64_t tSize_val = strtoull(tSize_str, NULL, 10);
+ ssize_t tSizeStr_size = psl_field_offsets[14] - psl_field_offsets[13] - 1;
+ if (tSizeStr_size >= c2b_globals.psl->element->tSizeStr_capacity) {
+ char *tSizeStr_resized = NULL;
+ tSizeStr_resized = realloc(c2b_globals.psl->element->tSizeStr, tSizeStr_size + 1);
+ if (tSizeStr_resized) {
+ c2b_globals.psl->element->tSizeStr = tSizeStr_resized;
+ c2b_globals.psl->element->tSizeStr_capacity = tSizeStr_size + 1;
+ }
+ else {
+ fprintf(stderr, "Error: Could not resize tSizeStr in PSL element struct\n");
+ exit(ENOMEM);
+ }
+ }
+ memcpy(c2b_globals.psl->element->tSizeStr, src + psl_field_offsets[13] + 1, tSizeStr_size);
+ c2b_globals.psl->element->tSizeStr[tSizeStr_size] = '\0';
+ c2b_globals.psl->element->tSize = strtoull(c2b_globals.psl->element->tSizeStr, NULL, 10);
#ifdef DEBUG
- fprintf(stderr, "tSize_str: [%s]\n", tSize_str);
+ fprintf(stderr, "tSizeStr: [%s]\n", c2b_globals.psl->element->tSizeStr);
#endif
/* 15 - tStart */
- char tStart_str[C2B_MAX_FIELD_LENGTH_VALUE];
- ssize_t tStart_size = psl_field_offsets[15] - psl_field_offsets[14] - 1;
- memcpy(tStart_str, src + psl_field_offsets[14] + 1, tStart_size);
- tStart_str[tStart_size] = '\0';
- uint64_t tStart_val = strtoull(tStart_str, NULL, 10);
+ ssize_t tStartStr_size = psl_field_offsets[15] - psl_field_offsets[14] - 1;
+ if (tStartStr_size >= c2b_globals.psl->element->tStartStr_capacity) {
+ char *tStartStr_resized = NULL;
+ tStartStr_resized = realloc(c2b_globals.psl->element->tStartStr, tStartStr_size + 1);
+ if (tStartStr_resized) {
+ c2b_globals.psl->element->tStartStr = tStartStr_resized;
+ c2b_globals.psl->element->tStartStr_capacity = tStartStr_size + 1;
+ }
+ else {
+ fprintf(stderr, "Error: Could not resize tStartStr in PSL element struct\n");
+ exit(ENOMEM);
+ }
+ }
+ memcpy(c2b_globals.psl->element->tStartStr, src + psl_field_offsets[14] + 1, tStartStr_size);
+ c2b_globals.psl->element->tStartStr[tStartStr_size] = '\0';
+ c2b_globals.psl->element->tStart = strtoull(c2b_globals.psl->element->tStartStr, NULL, 10);
#ifdef DEBUG
- fprintf(stderr, "tStart_str: [%s]\n", tStart_str);
+ fprintf(stderr, "tStartStr: [%s]\n", c2b_globals.psl->element->tStartStr);
#endif
/* 16 - tEnd */
- char tEnd_str[C2B_MAX_FIELD_LENGTH_VALUE];
- ssize_t tEnd_size = psl_field_offsets[16] - psl_field_offsets[15] - 1;
- memcpy(tEnd_str, src + psl_field_offsets[15] + 1, tEnd_size);
- tEnd_str[tEnd_size] = '\0';
- uint64_t tEnd_val = strtoull(tEnd_str, NULL, 10);
+ ssize_t tEndStr_size = psl_field_offsets[16] - psl_field_offsets[15] - 1;
+ if (tEndStr_size >= c2b_globals.psl->element->tEndStr_capacity) {
+ char *tEndStr_resized = NULL;
+ tEndStr_resized = realloc(c2b_globals.psl->element->tEndStr, tEndStr_size + 1);
+ if (tEndStr_resized) {
+ c2b_globals.psl->element->tEndStr = tEndStr_resized;
+ c2b_globals.psl->element->tEndStr_capacity = tEndStr_size + 1;
+ }
+ else {
+ fprintf(stderr, "Error: Could not resize tEndStr in PSL element struct\n");
+ exit(ENOMEM);
+ }
+ }
+ memcpy(c2b_globals.psl->element->tEndStr, src + psl_field_offsets[15] + 1, tEndStr_size);
+ c2b_globals.psl->element->tEndStr[tEndStr_size] = '\0';
+ c2b_globals.psl->element->tEnd = strtoull(c2b_globals.psl->element->tEndStr, NULL, 10);
#ifdef DEBUG
- fprintf(stderr, "tEnd_str: [%s]\n", tEnd_str);
+ fprintf(stderr, "tEndStr: [%s]\n", c2b_globals.psl->element->tEndStr);
#endif
/* 17 - blockCount */
- char blockCount_str[C2B_MAX_FIELD_LENGTH_VALUE];
- ssize_t blockCount_size = psl_field_offsets[17] - psl_field_offsets[16] - 1;
- memcpy(blockCount_str, src + psl_field_offsets[16] + 1, blockCount_size);
- blockCount_str[blockCount_size] = '\0';
- uint64_t blockCount_val = strtoull(blockCount_str, NULL, 10);
+ ssize_t blockCountStr_size = psl_field_offsets[17] - psl_field_offsets[16] - 1;
+ if (blockCountStr_size >= c2b_globals.psl->element->blockCountStr_capacity) {
+ char *blockCountStr_resized = NULL;
+ blockCountStr_resized = realloc(c2b_globals.psl->element->blockCountStr, blockCountStr_size + 1);
+ if (blockCountStr_resized) {
+ c2b_globals.psl->element->blockCountStr = blockCountStr_resized;
+ c2b_globals.psl->element->blockCountStr_capacity = blockCountStr_size + 1;
+ }
+ else {
+ fprintf(stderr, "Error: Could not resize blockCountStr in PSL element struct\n");
+ exit(ENOMEM);
+ }
+ }
+ memcpy(c2b_globals.psl->element->blockCountStr, src + psl_field_offsets[16] + 1, blockCountStr_size);
+ c2b_globals.psl->element->blockCountStr[blockCountStr_size] = '\0';
+ c2b_globals.psl->element->blockCount = strtoull(c2b_globals.psl->element->blockCountStr, NULL, 10);
#ifdef DEBUG
- fprintf(stderr, "blockCount_str: [%s]\n", blockCount_str);
+ fprintf(stderr, "blockCountStr: [%s]\n", c2b_globals.psl->element->blockCountStr);
#endif
/* 18 - blockSizes */
- char blockSizes_str[C2B_MAX_FIELD_LENGTH_VALUE];
ssize_t blockSizes_size = psl_field_offsets[18] - psl_field_offsets[17] - 1;
- memcpy(blockSizes_str, src + psl_field_offsets[17] + 1, blockSizes_size);
- blockSizes_str[blockSizes_size] = '\0';
+ if (blockSizes_size >= c2b_globals.psl->element->blockSizes_capacity) {
+ char *blockSizes_resized = NULL;
+ blockSizes_resized = realloc(c2b_globals.psl->element->blockSizes, blockSizes_size + 1);
+ if (blockSizes_resized) {
+ c2b_globals.psl->element->blockSizes = blockSizes_resized;
+ c2b_globals.psl->element->blockSizes_capacity = blockSizes_size + 1;
+ }
+ else {
+ fprintf(stderr, "Error: Could not resize blockSizes in PSL element struct\n");
+ exit(ENOMEM);
+ }
+ }
+ memcpy(c2b_globals.psl->element->blockSizes, src + psl_field_offsets[17] + 1, blockSizes_size);
+ c2b_globals.psl->element->blockSizes[blockSizes_size] = '\0';
#ifdef DEBUG
- fprintf(stderr, "blockSizes_str: [%s]\n", blockSizes_str);
+ fprintf(stderr, "blockSizes: [%s]\n", c2b_globals.psl->element->blockSizes);
#endif
/* 19 - qStarts */
- char qStarts_str[C2B_MAX_FIELD_LENGTH_VALUE];
ssize_t qStarts_size = psl_field_offsets[19] - psl_field_offsets[18] - 1;
- memcpy(qStarts_str, src + psl_field_offsets[18] + 1, qStarts_size);
- qStarts_str[qStarts_size] = '\0';
+ if (qStarts_size >= c2b_globals.psl->element->qStarts_capacity) {
+ char *qStarts_resized = NULL;
+ qStarts_resized = realloc(c2b_globals.psl->element->qStarts, qStarts_size + 1);
+ if (qStarts_resized) {
+ c2b_globals.psl->element->qStarts = qStarts_resized;
+ c2b_globals.psl->element->qStarts_capacity = qStarts_size + 1;
+ }
+ else {
+ fprintf(stderr, "Error: Could not resize qStarts in PSL element struct\n");
+ exit(ENOMEM);
+ }
+ }
+ memcpy(c2b_globals.psl->element->qStarts, src + psl_field_offsets[18] + 1, qStarts_size);
+ c2b_globals.psl->element->qStarts[qStarts_size] = '\0';
#ifdef DEBUG
- fprintf(stderr, "qStarts_str: [%s]\n", qStarts_str);
+ fprintf(stderr, "qStarts: [%s]\n", c2b_globals.psl->element->qStarts);
#endif
/* 20 - tStarts */
- char tStarts_str[C2B_MAX_FIELD_LENGTH_VALUE];
ssize_t tStarts_size = psl_field_offsets[20] - psl_field_offsets[19] - 1;
- memcpy(tStarts_str, src + psl_field_offsets[19] + 1, tStarts_size);
- tStarts_str[tStarts_size] = '\0';
-
-#ifdef DEBUG
- fprintf(stderr, "tStarts_str: [%s]\n", tStarts_str);
-#endif
-
- c2b_psl_t psl;
- psl.matches = matches_val;
- psl.misMatches = misMatches_val;
- psl.repMatches = repMatches_val;
- psl.nCount = nCount_val;
- psl.qNumInsert = qNumInsert_val;
- psl.qBaseInsert = qBaseInsert_val;
- psl.tNumInsert = tNumInsert_val;
- psl.tBaseInsert = tBaseInsert_val;
- psl.strand = strand_str;
- psl.qName = qName_str;
- psl.qSize = qSize_val;
- psl.qStart = qStart_val;
- psl.qEnd = qEnd_val;
- psl.tName = tName_str;
- psl.tSize = tSize_val;
- psl.tStart = tStart_val;
- psl.tEnd = tEnd_val;
- psl.blockCount = blockCount_val;
- psl.blockSizes = blockSizes_str;
- psl.qStarts = qStarts_str;
- psl.tStarts = tStarts_str;
+ if (tStarts_size >= c2b_globals.psl->element->tStarts_capacity) {
+ char *tStarts_resized = NULL;
+ tStarts_resized = realloc(c2b_globals.psl->element->tStarts, tStarts_size + 1);
+ if (tStarts_resized) {
+ c2b_globals.psl->element->tStarts = tStarts_resized;
+ c2b_globals.psl->element->tStarts_capacity = tStarts_size + 1;
+ }
+ else {
+ fprintf(stderr, "Error: Could not resize tStarts in PSL element struct\n");
+ exit(ENOMEM);
+ }
+ }
+ memcpy(c2b_globals.psl->element->tStarts, src + psl_field_offsets[19] + 1, tStarts_size);
+ c2b_globals.psl->element->tStarts[tStarts_size] = '\0';
+
+#ifdef DEBUG
+ fprintf(stderr, "tStarts: [%s]\n", c2b_globals.psl->element->tStarts);
+#endif
/*
Convert PSL struct to BED string and copy it to destination
*/
- if ((c2b_globals.split_flag) && (blockCount_val > 1)) {
- if (c2b_globals.psl->block->max_count < blockCount_val) {
+ if ((c2b_globals.split_flag) && (c2b_globals.psl->element->blockCount > 1)) {
+ if (c2b_globals.psl->block->max_count < c2b_globals.psl->element->blockCount) {
fprintf(stderr, "Error: Insufficent PSL block state global size\n");
exit(ENOMEM); /* Not enough space (POSIX.1) */
}
- /* parse tStarts_str and blockSizes_str to write per-block elements */
- c2b_psl_blockSizes_to_ptr(blockSizes_str, blockCount_val);
- c2b_psl_tStarts_to_ptr(tStarts_str, blockCount_val);
- for (uint64_t bc_idx = 0; bc_idx < blockCount_val; bc_idx++) {
- psl.tStart = c2b_globals.psl->block->starts[bc_idx];
- psl.tEnd = c2b_globals.psl->block->starts[bc_idx] + c2b_globals.psl->block->sizes[bc_idx];
- c2b_line_convert_psl_to_bed(psl, dest, dest_size);
+ /* parse tStarts and blockSizes strings to write per-block elements */
+ c2b_psl_blockSizes_to_ptr(c2b_globals.psl->element->blockSizes, c2b_globals.psl->element->blockCount);
+ c2b_psl_tStarts_to_ptr(c2b_globals.psl->element->tStarts, c2b_globals.psl->element->blockCount);
+ for (uint64_t bc_idx = 0; bc_idx < c2b_globals.psl->element->blockCount; bc_idx++) {
+ c2b_globals.psl->element->tStart = c2b_globals.psl->block->starts[bc_idx];
+ c2b_globals.psl->element->tEnd = c2b_globals.psl->block->starts[bc_idx] + c2b_globals.psl->block->sizes[bc_idx];
+ c2b_line_convert_psl_ptr_to_bed(c2b_globals.psl->element, dest, dest_size, dest_capacity);
}
}
else {
- c2b_line_convert_psl_to_bed(psl, dest, dest_size);
+ c2b_line_convert_psl_ptr_to_bed(c2b_globals.psl->element, dest, dest_size, dest_capacity);
}
}
@@ -2220,7 +2719,7 @@ c2b_psl_tStarts_to_ptr(char *s, uint64_t bc)
}
static inline void
-c2b_line_convert_psl_to_bed(c2b_psl_t p, char *dest_line, ssize_t *dest_size)
+c2b_line_convert_psl_ptr_to_bed(c2b_psl_t* p, char** dest_line_ptr, ssize_t* dest_size, ssize_t* dest_capacity)
{
/*
For PSL-formatted data, we use the mapping provided by BEDOPS convention described at:
@@ -2257,7 +2756,20 @@ c2b_line_convert_psl_to_bed(c2b_psl_t p, char *dest_line, ssize_t *dest_size)
tStarts 21 -
*/
- *dest_size += sprintf(dest_line + *dest_size,
+ if ((ssize_t)(*dest_size + C2B_MAX_LINE_LENGTH_VALUE) > *dest_capacity) {
+ char *dest_line_resized = NULL;
+ dest_line_resized = realloc(*dest_line_ptr, *dest_capacity * 2);
+ if (dest_line_resized) {
+ *dest_capacity *= 2;
+ *dest_line_ptr = dest_line_resized;
+ }
+ else {
+ fprintf(stderr, "Error: Could not resize dest_line_ptr string in PSL pointer conversion fn\n");
+ exit(ENOMEM);
+ }
+ }
+
+ *dest_size += sprintf(*dest_line_ptr + *dest_size,
"%s\t" \
"%" PRIu64 "\t" \
"%" PRIu64 "\t" \
@@ -2279,31 +2791,31 @@ c2b_line_convert_psl_to_bed(c2b_psl_t p, char *dest_line, ssize_t *dest_size)
"%s\t" \
"%s\t" \
"%s\n",
- p.tName,
- p.tStart,
- p.tEnd,
- p.qName,
- p.matches,
- p.strand,
- p.qSize,
- p.misMatches,
- p.repMatches,
- p.nCount,
- p.qNumInsert,
- p.qBaseInsert,
- p.tNumInsert,
- p.tBaseInsert,
- p.qStart,
- p.qEnd,
- p.tSize,
- p.blockCount,
- p.blockSizes,
- p.qStarts,
- p.tStarts);
+ p->tName,
+ p->tStart,
+ p->tEnd,
+ p->qName,
+ p->matches,
+ p->strand,
+ p->qSize,
+ p->misMatches,
+ p->repMatches,
+ p->nCount,
+ p->qNumInsert,
+ p->qBaseInsert,
+ p->tNumInsert,
+ p->tBaseInsert,
+ p->qStart,
+ p->qEnd,
+ p->tSize,
+ p->blockCount,
+ p->blockSizes,
+ p->qStarts,
+ p->tStarts);
}
static void
-c2b_rmsk_init_element(c2b_rmsk_t **e)
+c2b_rmsk_init_element(c2b_rmsk_t** e)
{
*e = malloc(sizeof(c2b_rmsk_t));
if (!*e) {
@@ -2426,7 +2938,7 @@ c2b_rmsk_init_element(c2b_rmsk_t **e)
}
static void
-c2b_rmsk_delete_element(c2b_rmsk_t *e)
+c2b_rmsk_delete_element(c2b_rmsk_t* e)
{
if (e->sw_score) { free(e->sw_score), e->sw_score = NULL; }
if (e->perc_div) { free(e->perc_div), e->perc_div = NULL; }
@@ -2446,7 +2958,7 @@ c2b_rmsk_delete_element(c2b_rmsk_t *e)
}
static void
-c2b_line_convert_rmsk_to_bed_unsorted(char *dest, ssize_t *dest_size, char *src, ssize_t src_size)
+c2b_line_convert_rmsk_to_bed_unsorted(char** dest, ssize_t* dest_size, ssize_t* dest_capacity, char* src, ssize_t src_size)
{
/*
RepeatMasker annotation output is space-delimited and can have multiple spaces. We also need to walk
@@ -2517,13 +3029,26 @@ c2b_line_convert_rmsk_to_bed_unsorted(char *dest, ssize_t *dest_size, char *src,
c2b_globals.rmsk->is_start_of_gap = kFalse;
if (c2b_globals.rmsk->line <= c2b_rmsk_header_line_count) {
if (c2b_globals.keep_header_flag) {
- char src_header_line_str[C2B_MAX_LINE_LENGTH_VALUE];
- char dest_header_line_str[C2B_MAX_LINE_LENGTH_VALUE];
- memcpy(src_header_line_str, src, src_size);
- src_header_line_str[src_size] = '\0';
- sprintf(dest_header_line_str, "%s\t%u\t%u\t%s\n", c2b_header_chr_name, c2b_globals.header_line_idx, (c2b_globals.header_line_idx + 1), src_header_line_str);
- memcpy(dest + *dest_size, dest_header_line_str, strlen(dest_header_line_str));
- *dest_size += strlen(dest_header_line_str);
+ /* set up temporary header stream buffers */
+ if (!c2b_globals.src_line_str) {
+ c2b_globals.src_line_str = malloc(C2B_MAX_LINE_LENGTH_VALUE + 1);
+ if (!c2b_globals.src_line_str) {
+ fprintf(stderr, "Error: Could not allocate space for globals source line buffer\n");
+ exit(ENOMEM);
+ }
+ }
+ if (!c2b_globals.dest_line_str) {
+ c2b_globals.dest_line_str = malloc(C2B_MAX_LINE_LENGTH_VALUE + 1);
+ if (!c2b_globals.dest_line_str) {
+ fprintf(stderr, "Error: Could not allocate space for globals destination line buffer\n");
+ exit(ENOMEM);
+ }
+ }
+ memcpy(c2b_globals.src_line_str, src, src_size);
+ c2b_globals.src_line_str[src_size] = '\0';
+ sprintf(c2b_globals.dest_line_str, "%s\t%u\t%u\t%s\n", c2b_header_chr_name, c2b_globals.header_line_idx, (c2b_globals.header_line_idx + 1), c2b_globals.src_line_str);
+ memcpy(*dest + *dest_size, c2b_globals.dest_line_str, strlen(c2b_globals.dest_line_str));
+ *dest_size += strlen(c2b_globals.dest_line_str);
c2b_globals.header_line_idx++;
}
return;
@@ -2924,14 +3449,14 @@ c2b_line_convert_rmsk_to_bed_unsorted(char *dest, ssize_t *dest_size, char *src,
#endif
}
- c2b_line_convert_rmsk_ptr_to_bed(c2b_globals.rmsk->element, dest, dest_size);
+ c2b_line_convert_rmsk_ptr_to_bed(c2b_globals.rmsk->element, dest, dest_size, dest_capacity);
/* after writing a line, reset length of element higher_score_match string */
c2b_globals.rmsk->element->higher_score_match[0] = '\0';
}
static inline void
-c2b_line_convert_rmsk_ptr_to_bed(c2b_rmsk_t *r, char *dest_line, ssize_t *dest_size)
+c2b_line_convert_rmsk_ptr_to_bed(c2b_rmsk_t* r, char** dest_line_ptr, ssize_t* dest_size, ssize_t* dest_capacity)
{
/*
For RepeatMasker annotation-formatted data, we use the mapping provided by BEDOPS
@@ -2964,8 +3489,21 @@ c2b_line_convert_rmsk_ptr_to_bed(c2b_rmsk_t *r, char *dest_line, ssize_t *dest_s
higher_score_match 16 -
*/
+ if ((ssize_t)(*dest_size + C2B_MAX_LINE_LENGTH_VALUE) > *dest_capacity) {
+ char *dest_line_resized = NULL;
+ dest_line_resized = realloc(*dest_line_ptr, *dest_capacity * 2);
+ if (dest_line_resized) {
+ *dest_capacity *= 2;
+ *dest_line_ptr = dest_line_resized;
+ }
+ else {
+ fprintf(stderr, "Error: Could not resize dest_line_ptr string in RMSK pointer conversion fn\n");
+ exit(ENOMEM);
+ }
+ }
+
if (strlen(r->higher_score_match) == 0) {
- *dest_size += sprintf(dest_line + *dest_size,
+ *dest_size += sprintf(*dest_line_ptr + *dest_size,
"%s\t" \
"%" PRIu64 "\t" \
"%" PRIu64 "\t" \
@@ -2998,7 +3536,7 @@ c2b_line_convert_rmsk_ptr_to_bed(c2b_rmsk_t *r, char *dest_line, ssize_t *dest_s
r->unique_id);
}
else {
- *dest_size += sprintf(dest_line + *dest_size,
+ *dest_size += sprintf(*dest_line_ptr + *dest_size,
"%s\t" \
"%" PRIu64 "\t" \
"%" PRIu64 "\t" \
@@ -3035,7 +3573,7 @@ c2b_line_convert_rmsk_ptr_to_bed(c2b_rmsk_t *r, char *dest_line, ssize_t *dest_s
}
static void
-c2b_line_convert_sam_to_bed_unsorted_without_split_operation(char *dest, ssize_t *dest_size, char *src, ssize_t src_size)
+c2b_line_convert_sam_to_bed_unsorted_without_split_operation(char** dest, ssize_t* dest_size, ssize_t* dest_capacity, char* src, ssize_t src_size)
{
/*
This functor builds a list of tab delimiters, but first reads in the CIGAR string (6th field) and
@@ -3056,14 +3594,27 @@ c2b_line_convert_sam_to_bed_unsorted_without_split_operation(char *dest, ssize_t
return;
}
else {
+ /* set up temporary header stream buffers */
+ if (!c2b_globals.src_line_str) {
+ c2b_globals.src_line_str = malloc(C2B_MAX_LINE_LENGTH_VALUE + 1);
+ if (!c2b_globals.src_line_str) {
+ fprintf(stderr, "Error: Could not allocate space for globals source line buffer\n");
+ exit(ENOMEM);
+ }
+ }
+ if (!c2b_globals.dest_line_str) {
+ c2b_globals.dest_line_str = malloc(C2B_MAX_LINE_LENGTH_VALUE + 1);
+ if (!c2b_globals.dest_line_str) {
+ fprintf(stderr, "Error: Could not allocate space for globals destination line buffer\n");
+ exit(ENOMEM);
+ }
+ }
/* copy header line to destination stream buffer */
- char src_header_line_str[C2B_MAX_LINE_LENGTH_VALUE] = {0};
- char dest_header_line_str[C2B_MAX_LINE_LENGTH_VALUE] = {0};
- memcpy(src_header_line_str, src, src_size);
- src_header_line_str[src_size] = '\0';
- sprintf(dest_header_line_str, "%s\t%u\t%u\t%s\n", c2b_header_chr_name, c2b_globals.header_line_idx, (c2b_globals.header_line_idx + 1), src_header_line_str);
- memcpy(dest + *dest_size, dest_header_line_str, strlen(dest_header_line_str));
- *dest_size += strlen(dest_header_line_str);
+ memcpy(c2b_globals.src_line_str, src, src_size);
+ c2b_globals.src_line_str[src_size] = '\0';
+ sprintf(c2b_globals.dest_line_str, "%s\t%u\t%u\t%s\n", c2b_header_chr_name, c2b_globals.header_line_idx, (c2b_globals.header_line_idx + 1), c2b_globals.src_line_str);
+ memcpy(*dest + *dest_size, c2b_globals.dest_line_str, strlen(c2b_globals.dest_line_str));
+ *dest_size += strlen(c2b_globals.dest_line_str);
c2b_globals.header_line_idx++;
return;
}
@@ -3373,11 +3924,11 @@ c2b_line_convert_sam_to_bed_unsorted_without_split_operation(char *dest, ssize_t
}
}
- c2b_line_convert_sam_ptr_to_bed(c2b_globals.sam->element, dest, dest_size, kFalse);
+ c2b_line_convert_sam_ptr_to_bed(c2b_globals.sam->element, dest, dest_size, dest_capacity, kFalse);
}
static void
-c2b_line_convert_sam_to_bed_unsorted_with_split_operation(char *dest, ssize_t *dest_size, char *src, ssize_t src_size)
+c2b_line_convert_sam_to_bed_unsorted_with_split_operation(char** dest, ssize_t* dest_size, ssize_t* dest_capacity, char* src, ssize_t src_size)
{
/*
This functor builds a list of tab delimiters, but first reads in the CIGAR string (6th field) and
@@ -3398,14 +3949,27 @@ c2b_line_convert_sam_to_bed_unsorted_with_split_operation(char *dest, ssize_t *d
return;
}
else {
+ /* set up temporary header stream buffers */
+ if (!c2b_globals.src_line_str) {
+ c2b_globals.src_line_str = malloc(C2B_MAX_LINE_LENGTH_VALUE + 1);
+ if (!c2b_globals.src_line_str) {
+ fprintf(stderr, "Error: Could not allocate space for globals source line buffer\n");
+ exit(ENOMEM);
+ }
+ }
+ if (!c2b_globals.dest_line_str) {
+ c2b_globals.dest_line_str = malloc(C2B_MAX_LINE_LENGTH_VALUE + 1);
+ if (!c2b_globals.dest_line_str) {
+ fprintf(stderr, "Error: Could not allocate space for globals destination line buffer\n");
+ exit(ENOMEM);
+ }
+ }
/* copy header line to destination stream buffer */
- char src_header_line_str[C2B_MAX_LINE_LENGTH_VALUE] = {0};
- char dest_header_line_str[C2B_MAX_LINE_LENGTH_VALUE] = {0};
- memcpy(src_header_line_str, src, src_size);
+ memcpy(c2b_globals.src_line_str, src, src_size);
//src_header_line_str[src_size] = '\0';
- sprintf(dest_header_line_str, "%s\t%u\t%u\t%s\n", c2b_header_chr_name, c2b_globals.header_line_idx, (c2b_globals.header_line_idx + 1), src_header_line_str);
- memcpy(dest + *dest_size, dest_header_line_str, strlen(dest_header_line_str));
- *dest_size += strlen(dest_header_line_str);
+ sprintf(c2b_globals.dest_line_str, "%s\t%u\t%u\t%s\n", c2b_header_chr_name, c2b_globals.header_line_idx, (c2b_globals.header_line_idx + 1), c2b_globals.src_line_str);
+ memcpy(*dest + *dest_size, c2b_globals.dest_line_str, strlen(c2b_globals.dest_line_str));
+ *dest_size += strlen(c2b_globals.dest_line_str);
c2b_globals.header_line_idx++;
return;
}
@@ -3698,44 +4262,94 @@ c2b_line_convert_sam_to_bed_unsorted_with_split_operation(char *dest, ssize_t *d
for (op_idx = 0, block_idx = 1; op_idx < c2b_globals.sam->cigar->length; ++op_idx) {
char current_op = c2b_globals.sam->cigar->ops[op_idx].operation;
+ char next_op = '\0';
+ if (op_idx != (c2b_globals.sam->cigar->length - 1)) {
+ next_op = c2b_globals.sam->cigar->ops[op_idx + 1].operation;
+ }
unsigned int bases = c2b_globals.sam->cigar->ops[op_idx].bases;
- switch (current_op)
- {
- case 'M':
- c2b_globals.sam->element->stop += bases;
- if ((previous_op == default_cigar_op_operation) || (previous_op == 'D') || (previous_op == 'N')) {
- ssize_t desired_modified_qname_capacity = c2b_globals.sam->element->qname_capacity + C2B_SAM_ELEMENT_FIELD_LENGTH_VALUE_EXTENSION;
- if (c2b_globals.sam->element->modified_qname_capacity <= desired_modified_qname_capacity) {
- // resize modified qname capacity to fit
- char *modified_qname_resized = NULL;
- modified_qname_resized = realloc(c2b_globals.sam->element->modified_qname, desired_modified_qname_capacity + 1);
- if (modified_qname_resized) {
- c2b_globals.sam->element->modified_qname = modified_qname_resized;
- c2b_globals.sam->element->modified_qname_capacity = desired_modified_qname_capacity + 1;
+ if (c2b_globals.split_with_deletions_flag) {
+ switch (current_op)
+ {
+ case 'M':
+ c2b_globals.sam->element->stop += bases;
+ if ((previous_op == default_cigar_op_operation) || (previous_op == 'D') || (previous_op == 'N')) {
+ ssize_t desired_modified_qname_capacity = c2b_globals.sam->element->qname_capacity + C2B_SAM_ELEMENT_FIELD_LENGTH_VALUE_EXTENSION;
+ if (c2b_globals.sam->element->modified_qname_capacity <= desired_modified_qname_capacity) {
+ // resize modified qname capacity to fit
+ char *modified_qname_resized = NULL;
+ modified_qname_resized = realloc(c2b_globals.sam->element->modified_qname, desired_modified_qname_capacity + 1);
+ if (modified_qname_resized) {
+ c2b_globals.sam->element->modified_qname = modified_qname_resized;
+ c2b_globals.sam->element->modified_qname_capacity = desired_modified_qname_capacity + 1;
+ }
+ else {
+ fprintf(stderr, "Error: Could not resize modified QNAME string in SAM element struct\n");
+ exit(ENOMEM);
+ }
}
- else {
- fprintf(stderr, "Error: Could not resize modified QNAME string in SAM element struct\n");
- exit(ENOMEM);
+ // block_idx string can be up to (C2B_SAM_ELEMENT_FIELD_LENGTH_VALUE_EXTENSION-1) characters long
+ sprintf(c2b_globals.sam->element->modified_qname, "%s/%zu", c2b_globals.sam->element->qname, block_idx++);
+ c2b_line_convert_sam_ptr_to_bed(c2b_globals.sam->element, dest, dest_size, dest_capacity, kTrue);
+ c2b_globals.sam->element->start = c2b_globals.sam->element->stop;
+ }
+ break;
+ case 'N':
+ case 'D':
+ c2b_globals.sam->element->stop += bases;
+ c2b_globals.sam->element->start = c2b_globals.sam->element->stop;
+ case 'H':
+ case 'I':
+ case 'P':
+ case 'S':
+ break;
+ default:
+ break;
+ }
+ }
+ else {
+ switch (current_op)
+ {
+ case 'M':
+ c2b_globals.sam->element->stop += bases;
+ if ((previous_op == default_cigar_op_operation) || (previous_op == 'D') || (previous_op == 'N')) {
+ ssize_t desired_modified_qname_capacity = c2b_globals.sam->element->qname_capacity + C2B_SAM_ELEMENT_FIELD_LENGTH_VALUE_EXTENSION;
+ if (c2b_globals.sam->element->modified_qname_capacity <= desired_modified_qname_capacity) {
+ // resize modified qname capacity to fit
+ char *modified_qname_resized = NULL;
+ modified_qname_resized = realloc(c2b_globals.sam->element->modified_qname, desired_modified_qname_capacity + 1);
+ if (modified_qname_resized) {
+ c2b_globals.sam->element->modified_qname = modified_qname_resized;
+ c2b_globals.sam->element->modified_qname_capacity = desired_modified_qname_capacity + 1;
+ }
+ else {
+ fprintf(stderr, "Error: Could not resize modified QNAME string in SAM element struct\n");
+ exit(ENOMEM);
+ }
+ }
+ if ((next_op == 'N') || (next_op == '\0')) {
+ // block_idx string can be up to (C2B_SAM_ELEMENT_FIELD_LENGTH_VALUE_EXTENSION-1) characters long
+ sprintf(c2b_globals.sam->element->modified_qname, "%s/%zu", c2b_globals.sam->element->qname, block_idx++);
+ c2b_line_convert_sam_ptr_to_bed(c2b_globals.sam->element, dest, dest_size, dest_capacity, kTrue);
+ c2b_globals.sam->element->start = c2b_globals.sam->element->stop;
}
}
- // block_idx string can be up to (C2B_SAM_ELEMENT_FIELD_LENGTH_VALUE_EXTENSION-1) characters long
- sprintf(c2b_globals.sam->element->modified_qname, "%s/%zu", c2b_globals.sam->element->qname, block_idx++);
- c2b_line_convert_sam_ptr_to_bed(c2b_globals.sam->element, dest, dest_size, kTrue);
+ break;
+ case 'N':
+ c2b_globals.sam->element->stop += bases;
c2b_globals.sam->element->start = c2b_globals.sam->element->stop;
+ break;
+ case 'D':
+ c2b_globals.sam->element->stop += bases;
+ break;
+ case 'H':
+ case 'I':
+ case 'P':
+ case 'S':
+ break;
+ default:
+ break;
}
- break;
- case 'N':
- case 'D':
- c2b_globals.sam->element->stop += bases;
- c2b_globals.sam->element->start = c2b_globals.sam->element->stop;
- case 'H':
- case 'I':
- case 'P':
- case 'S':
- break;
- default:
- break;
- }
+ }
previous_op = current_op;
}
@@ -3746,19 +4360,19 @@ c2b_line_convert_sam_to_bed_unsorted_with_split_operation(char *dest, ssize_t *d
*/
if (block_idx == 1) {
- c2b_line_convert_sam_ptr_to_bed(c2b_globals.sam->element, dest, dest_size, kFalse);
+ c2b_line_convert_sam_ptr_to_bed(c2b_globals.sam->element, dest, dest_size, dest_capacity, kFalse);
}
}
static inline void
-c2b_sam_cigar_str_to_ops(char *s)
+c2b_sam_cigar_str_to_ops(char* s)
{
size_t s_idx;
size_t s_len = strlen(s);
size_t bases_idx = 0;
boolean bases_flag = kTrue;
boolean operation_flag = kFalse;
- char curr_bases_field[C2B_MAX_OPERATION_FIELD_LENGTH_VALUE];
+ char curr_bases_field[C2B_MAX_OPERATION_FIELD_LENGTH_VALUE + 1];
char curr_char = default_cigar_op_operation;
unsigned int curr_bases = 0;
ssize_t op_idx = 0;
@@ -3801,7 +4415,7 @@ c2b_sam_cigar_str_to_ops(char *s)
}
static void
-c2b_sam_init_element(c2b_sam_t **e)
+c2b_sam_init_element(c2b_sam_t** e)
{
*e = malloc(sizeof(c2b_sam_t));
if (!*e) {
@@ -3913,7 +4527,7 @@ c2b_sam_init_element(c2b_sam_t **e)
}
static void
-c2b_sam_delete_element(c2b_sam_t *e)
+c2b_sam_delete_element(c2b_sam_t* e)
{
if (e->qname) { free(e->qname), e->qname = NULL; }
if (e->modified_qname) { free(e->modified_qname), e->modified_qname = NULL; }
@@ -3931,7 +4545,7 @@ c2b_sam_delete_element(c2b_sam_t *e)
}
static void
-c2b_sam_init_cigar_ops(c2b_cigar_t **c, const ssize_t size)
+c2b_sam_init_cigar_ops(c2b_cigar_t** c, const ssize_t size)
{
*c = malloc(sizeof(c2b_cigar_t));
if (!*c) {
@@ -3954,7 +4568,7 @@ c2b_sam_init_cigar_ops(c2b_cigar_t **c, const ssize_t size)
}
static void
-c2b_sam_resize_cigar_ops(c2b_cigar_t **new_c, c2b_cigar_t *old_c)
+c2b_sam_resize_cigar_ops(c2b_cigar_t** new_c, c2b_cigar_t* old_c)
{
*new_c = malloc(sizeof(c2b_cigar_t));
if (!*new_c) {
@@ -3994,7 +4608,7 @@ static void c2b_sam_debug_cigar_ops() __attribute__ ((unused));
#endif
static void
-c2b_sam_debug_cigar_ops(c2b_cigar_t *c)
+c2b_sam_debug_cigar_ops(c2b_cigar_t* c)
{
ssize_t idx = 0;
ssize_t length = c->length;
@@ -4004,7 +4618,7 @@ c2b_sam_debug_cigar_ops(c2b_cigar_t *c)
}
static void
-c2b_sam_delete_cigar_ops(c2b_cigar_t *c)
+c2b_sam_delete_cigar_ops(c2b_cigar_t* c)
{
if (c) {
if (c->ops) {
@@ -4017,8 +4631,9 @@ c2b_sam_delete_cigar_ops(c2b_cigar_t *c)
}
static inline void
-c2b_line_convert_sam_ptr_to_bed(c2b_sam_t *s, char *dest_line, ssize_t *dest_size, boolean print_modified_qname)
+c2b_line_convert_sam_ptr_to_bed(c2b_sam_t* s, char** dest_line_ptr, ssize_t* dest_size, ssize_t* dest_capacity, boolean print_modified_qname)
{
+
/*
For SAM-formatted data, we use the mapping provided by BEDOPS convention described at:
@@ -4035,7 +4650,8 @@ c2b_line_convert_sam_ptr_to_bed(c2b_sam_t *s, char *dest_line, ssize_t *dest_siz
If NOT (4 & FLAG) is true, then the read is mapped.
- The remaining SAM columns are mapped as-is, in same order, to adjacent BED columns:
+ If the --reduced option is not specified, the remaining SAM columns are mapped as-is,
+ in same order, to adjacent BED columns:
SAM field BED column index BED field
-------------------------------------------------------------------------
@@ -4052,10 +4668,25 @@ c2b_line_convert_sam_ptr_to_bed(c2b_sam_t *s, char *dest_line, ssize_t *dest_siz
SAM field BED column index BED field
-------------------------------------------------------------------------
Alignment fields 14+ -
+
+ If the --reduced option is specified, only the first six columns are printed.
*/
- if (s->opt_length > 0) {
- *dest_size += sprintf(dest_line + *dest_size,
+ if ((ssize_t)(*dest_size + C2B_MAX_LINE_LENGTH_VALUE) > *dest_capacity) {
+ char *dest_line_resized = NULL;
+ dest_line_resized = realloc(*dest_line_ptr, *dest_capacity * 2);
+ if (dest_line_resized) {
+ *dest_capacity *= 2;
+ *dest_line_ptr = dest_line_resized;
+ }
+ else {
+ fprintf(stderr, "Error: Could not resize dest_line_ptr string in SAM pointer conversion fn\n");
+ exit(ENOMEM);
+ }
+ }
+
+ if ((!c2b_globals.reduced_flag) && (s->opt_length > 0)) {
+ *dest_size += sprintf(*dest_line_ptr + *dest_size,
"%s\t" \
"%" PRIu64 "\t" \
"%" PRIu64 "\t" \
@@ -4085,8 +4716,8 @@ c2b_line_convert_sam_ptr_to_bed(c2b_sam_t *s, char *dest_line, ssize_t *dest_siz
s->qual,
s->opt);
}
- else {
- *dest_size += sprintf(dest_line + *dest_size,
+ else if ((!c2b_globals.reduced_flag) && (s->opt_length == 0)) {
+ *dest_size += sprintf(*dest_line_ptr + *dest_size,
"%s\t" \
"%" PRIu64 "\t" \
"%" PRIu64 "\t" \
@@ -4114,10 +4745,25 @@ c2b_line_convert_sam_ptr_to_bed(c2b_sam_t *s, char *dest_line, ssize_t *dest_siz
s->seq,
s->qual);
}
+ else if (c2b_globals.reduced_flag) {
+ *dest_size += sprintf(*dest_line_ptr + *dest_size,
+ "%s\t" \
+ "%" PRIu64 "\t" \
+ "%" PRIu64 "\t" \
+ "%s\t" \
+ "%s\t" \
+ "%s\n",
+ s->rname,
+ s->start,
+ s->stop,
+ (print_modified_qname ? s->modified_qname : s->qname),
+ s->mapq,
+ s->strand);
+ }
}
static void
-c2b_line_convert_vcf_to_bed_unsorted(char *dest, ssize_t *dest_size, char *src, ssize_t src_size)
+c2b_line_convert_vcf_to_bed_unsorted(char** dest, ssize_t* dest_size, ssize_t* dest_capacity, char* src, ssize_t src_size)
{
ssize_t vcf_field_offsets[C2B_MAX_VCF_FIELD_COUNT_VALUE];
int vcf_field_idx = 0;
@@ -4158,27 +4804,26 @@ c2b_line_convert_vcf_to_bed_unsorted(char *dest, ssize_t *dest_size, char *src,
c2b_globals.vcf->element->chrom[chrom_size] = '\0';
if ((c2b_globals.vcf->element->chrom[0] == c2b_vcf_header_prefix) && (c2b_globals.keep_header_flag)) {
- char *src_header_line_str = NULL;
- src_header_line_str = malloc(C2B_MAX_LONGER_LINE_LENGTH_VALUE);
- if (!src_header_line_str) {
- fprintf(stderr, "Error: Could not allocate space for VCF source header line string\n");
- exit(ENOMEM); /* Not enough space (POSIX.1) */
- }
-
- char *dest_header_line_str = NULL;
- dest_header_line_str = malloc(C2B_MAX_LONGER_LINE_LENGTH_VALUE);
- if (!dest_header_line_str) {
- fprintf(stderr, "Error: Could not allocate space for VCF destination header line string\n");
- exit(ENOMEM); /* Not enough space (POSIX.1) */
- }
- memcpy(src_header_line_str, src, src_size);
- src_header_line_str[src_size] = '\0';
- sprintf(dest_header_line_str, "%s\t%u\t%u\t%s\n", c2b_header_chr_name, c2b_globals.header_line_idx, (c2b_globals.header_line_idx + 1), src_header_line_str);
- memcpy(dest + *dest_size, dest_header_line_str, strlen(dest_header_line_str));
- *dest_size += strlen(dest_header_line_str);
+ if (!c2b_globals.src_line_str) {
+ c2b_globals.src_line_str = malloc(C2B_MAX_LINE_LENGTH_VALUE + 1);
+ if (!c2b_globals.src_line_str) {
+ fprintf(stderr, "Error: Could not allocate space for globals source line buffer\n");
+ exit(ENOMEM);
+ }
+ }
+ if (!c2b_globals.dest_line_str) {
+ c2b_globals.dest_line_str = malloc(C2B_MAX_LINE_LENGTH_VALUE + 1);
+ if (!c2b_globals.dest_line_str) {
+ fprintf(stderr, "Error: Could not allocate space for globals destination line buffer\n");
+ exit(ENOMEM);
+ }
+ }
+ memcpy(c2b_globals.src_line_str, src, src_size);
+ c2b_globals.src_line_str[src_size] = '\0';
+ sprintf(c2b_globals.dest_line_str, "%s\t%u\t%u\t%s\n", c2b_header_chr_name, c2b_globals.header_line_idx, (c2b_globals.header_line_idx + 1), c2b_globals.src_line_str);
+ memcpy(*dest + *dest_size, c2b_globals.dest_line_str, strlen(c2b_globals.dest_line_str));
+ *dest_size += strlen(c2b_globals.dest_line_str);
c2b_globals.header_line_idx++;
- free(src_header_line_str);
- free(dest_header_line_str);
return;
}
else if (c2b_globals.vcf->element->chrom[0] == c2b_vcf_header_prefix) {
@@ -4188,7 +4833,7 @@ c2b_line_convert_vcf_to_bed_unsorted(char *dest, ssize_t *dest_size, char *src,
/* 1 - POS */
char pos_str[C2B_MAX_FIELD_LENGTH_VALUE];
ssize_t pos_size = vcf_field_offsets[1] - vcf_field_offsets[0] - 1;
- if (pos_size >= C2B_MAX_FIELD_LENGTH_VALUE) {
+ if (pos_size >= (ssize_t)(C2B_MAX_FIELD_LENGTH_VALUE)) {
fprintf(stderr, "Error: Intermediate POS string too long to store in stack variable\n");
exit(ENOMEM);
}
@@ -4359,7 +5004,7 @@ c2b_line_convert_vcf_to_bed_unsorted(char *dest, ssize_t *dest_size, char *src,
((c2b_globals.vcf->only_insertions) && (c2b_vcf_record_is_insertion(c2b_globals.vcf->element->ref, c2b_globals.vcf->element->alt))) ||
((c2b_globals.vcf->only_deletions) && (c2b_vcf_record_is_deletion(c2b_globals.vcf->element->ref, c2b_globals.vcf->element->alt))) )
{
- c2b_line_convert_vcf_ptr_to_bed(c2b_globals.vcf->element, dest, dest_size);
+ c2b_line_convert_vcf_ptr_to_bed(c2b_globals.vcf->element, dest, dest_size, dest_capacity);
}
}
free(alt_alleles_copy), alt_alleles_copy = NULL;
@@ -4376,37 +5021,37 @@ c2b_line_convert_vcf_to_bed_unsorted(char *dest, ssize_t *dest_size, char *src,
((c2b_globals.vcf->only_insertions) && (c2b_vcf_record_is_insertion(c2b_globals.vcf->element->ref, c2b_globals.vcf->element->alt))) ||
((c2b_globals.vcf->only_deletions) && (c2b_vcf_record_is_deletion(c2b_globals.vcf->element->ref, c2b_globals.vcf->element->alt))) )
{
- c2b_line_convert_vcf_ptr_to_bed(c2b_globals.vcf->element, dest, dest_size);
+ c2b_line_convert_vcf_ptr_to_bed(c2b_globals.vcf->element, dest, dest_size, dest_capacity);
}
}
}
static inline boolean
-c2b_vcf_allele_is_id(char *s)
+c2b_vcf_allele_is_id(char* s)
{
return ((s[0] == c2b_vcf_id_prefix) && (s[strlen(s)-1] == c2b_vcf_id_suffix)) ? kTrue : kFalse;
}
static inline boolean
-c2b_vcf_record_is_snv(char *ref, char *alt)
+c2b_vcf_record_is_snv(char* ref, char* alt)
{
return ((!c2b_vcf_allele_is_id(alt)) && (((int) strlen(ref) - (int) strlen(alt)) == 0)) ? kTrue : kFalse;
}
static inline boolean
-c2b_vcf_record_is_insertion(char *ref, char *alt)
+c2b_vcf_record_is_insertion(char* ref, char* alt)
{
return ((!c2b_vcf_allele_is_id(alt)) && (((int) strlen(ref) - (int) strlen(alt)) < 0)) ? kTrue : kFalse;
}
static inline boolean
-c2b_vcf_record_is_deletion(char *ref, char *alt)
+c2b_vcf_record_is_deletion(char* ref, char* alt)
{
return ((!c2b_vcf_allele_is_id(alt)) && (((int) strlen(ref) - (int) strlen(alt)) > 0)) ? kTrue : kFalse;
}
static void
-c2b_vcf_init_element(c2b_vcf_t **e)
+c2b_vcf_init_element(c2b_vcf_t** e)
{
*e = malloc(sizeof(c2b_vcf_t));
if (!*e) {
@@ -4493,7 +5138,7 @@ c2b_vcf_init_element(c2b_vcf_t **e)
}
static void
-c2b_vcf_delete_element(c2b_vcf_t *e)
+c2b_vcf_delete_element(c2b_vcf_t* e)
{
if (e->chrom) { free(e->chrom), e->chrom = NULL; }
if (e->id) { free(e->id), e->id = NULL; }
@@ -4508,7 +5153,7 @@ c2b_vcf_delete_element(c2b_vcf_t *e)
}
static inline void
-c2b_line_convert_vcf_ptr_to_bed(c2b_vcf_t *v, char *dest_line, ssize_t *dest_size)
+c2b_line_convert_vcf_ptr_to_bed(c2b_vcf_t* v, char** dest_line_ptr, ssize_t* dest_size, ssize_t* dest_capacity)
{
/*
For VCF v4.2-formatted data, we use the mapping provided by BEDOPS convention described at:
@@ -4545,8 +5190,21 @@ c2b_line_convert_vcf_ptr_to_bed(c2b_vcf_t *v, char *dest_line, ssize_t *dest_siz
...
*/
+ if ((ssize_t)(*dest_size + C2B_MAX_LINE_LENGTH_VALUE) > *dest_capacity) {
+ char *dest_line_resized = NULL;
+ dest_line_resized = realloc(*dest_line_ptr, *dest_capacity * 2);
+ if (dest_line_resized) {
+ *dest_capacity *= 2;
+ *dest_line_ptr = dest_line_resized;
+ }
+ else {
+ fprintf(stderr, "Error: Could not resize dest_line_ptr string in VCF pointer conversion fn\n");
+ exit(ENOMEM);
+ }
+ }
+
if (strlen(v->format) > 0) {
- *dest_size += sprintf(dest_line + *dest_size,
+ *dest_size += sprintf(*dest_line_ptr + *dest_size,
"%s\t" \
"%" PRIu64 "\t" \
"%" PRIu64 "\t" \
@@ -4571,7 +5229,7 @@ c2b_line_convert_vcf_ptr_to_bed(c2b_vcf_t *v, char *dest_line, ssize_t *dest_siz
v->samples);
}
else {
- *dest_size += sprintf(dest_line + *dest_size,
+ *dest_size += sprintf(*dest_line_ptr + *dest_size,
"%s\t" \
"%" PRIu64 "\t" \
"%" PRIu64 "\t" \
@@ -4594,10 +5252,22 @@ c2b_line_convert_vcf_ptr_to_bed(c2b_vcf_t *v, char *dest_line, ssize_t *dest_siz
}
static void
-c2b_line_convert_wig_to_bed_unsorted(char *dest, ssize_t *dest_size, char *src, ssize_t src_size)
+c2b_line_convert_wig_to_bed_unsorted(char** dest, ssize_t* dest_size, ssize_t* dest_capacity, char* src, ssize_t src_size)
{
- char src_line_str[C2B_MAX_LINE_LENGTH_VALUE];
- char dest_line_str[C2B_MAX_LINE_LENGTH_VALUE];
+ if (!c2b_globals.src_line_str) {
+ c2b_globals.src_line_str = malloc(C2B_MAX_LINE_LENGTH_VALUE + 1);
+ if (!c2b_globals.src_line_str) {
+ fprintf(stderr, "Error: Could not allocate space for globals source line buffer\n");
+ exit(ENOMEM);
+ }
+ }
+ if (!c2b_globals.dest_line_str) {
+ c2b_globals.dest_line_str = malloc(C2B_MAX_LINE_LENGTH_VALUE + 1);
+ if (!c2b_globals.dest_line_str) {
+ fprintf(stderr, "Error: Could not allocate space for globals destination line buffer\n");
+ exit(ENOMEM);
+ }
+ }
/*
Initialize and increment parameters
@@ -4623,29 +5293,42 @@ c2b_line_convert_wig_to_bed_unsorted(char *dest, ssize_t *dest_size, char *src,
c2b_globals.wig->basename,
++c2b_globals.wig->section);
}
- if (c2b_globals.keep_header_flag) {
+ if (c2b_globals.keep_header_flag) {
/* copy header line to destination stream buffer */
- memcpy(src_line_str, src, src_size);
- src_line_str[src_size] = '\0';
+ memcpy(c2b_globals.src_line_str, src, src_size);
+ c2b_globals.src_line_str[src_size] = '\0';
if (!c2b_globals.wig->basename) {
- sprintf(dest_line_str,
+ sprintf(c2b_globals.dest_line_str,
"%s\t%u\t%u\t%s\n",
c2b_header_chr_name,
c2b_globals.header_line_idx,
c2b_globals.header_line_idx + 1,
- src_line_str);
+ c2b_globals.src_line_str);
}
else {
- sprintf(dest_line_str,
+ sprintf(c2b_globals.dest_line_str,
"%s\t%u\t%u\t%s\t%s\n",
c2b_header_chr_name,
c2b_globals.header_line_idx,
c2b_globals.header_line_idx + 1,
c2b_globals.wig->id,
- src_line_str);
+ c2b_globals.src_line_str);
}
- memcpy(dest + *dest_size, dest_line_str, strlen(dest_line_str));
- *dest_size += strlen(dest_line_str);
+ /* resize destination buffer, if necessary */
+ if ((ssize_t)(*dest_size + C2B_MAX_LINE_LENGTH_VALUE) > *dest_capacity) {
+ char *dest_line_resized = NULL;
+ dest_line_resized = realloc(*dest, *dest_capacity * 2);
+ if (dest_line_resized) {
+ *dest_capacity *= 2;
+ *dest = dest_line_resized;
+ }
+ else {
+ fprintf(stderr, "Error: Could not resize dest string in WIG pointer conversion fn\n");
+ exit(ENOMEM);
+ }
+ }
+ memcpy(*dest + *dest_size, c2b_globals.dest_line_str, strlen(c2b_globals.dest_line_str));
+ *dest_size += strlen(c2b_globals.dest_line_str);
c2b_globals.header_line_idx++;
return;
}
@@ -4664,27 +5347,40 @@ c2b_line_convert_wig_to_bed_unsorted(char *dest, ssize_t *dest_size, char *src,
}
if (c2b_globals.keep_header_flag) {
/* copy header line to destination stream buffer */
- memcpy(src_line_str, src, src_size);
- src_line_str[src_size] = '\0';
+ memcpy(c2b_globals.src_line_str, src, src_size);
+ c2b_globals.src_line_str[src_size] = '\0';
if (!c2b_globals.wig->basename) {
- sprintf(dest_line_str,
+ sprintf(c2b_globals.dest_line_str,
"%s\t%u\t%u\t%s\n",
c2b_header_chr_name,
c2b_globals.header_line_idx,
c2b_globals.header_line_idx + 1,
- src_line_str);
+ c2b_globals.src_line_str);
}
else {
- sprintf(dest_line_str,
+ sprintf(c2b_globals.dest_line_str,
"%s\t%u\t%u\t%s\t%s\n",
c2b_header_chr_name,
c2b_globals.header_line_idx,
c2b_globals.header_line_idx + 1,
c2b_globals.wig->id,
- src_line_str);
+ c2b_globals.src_line_str);
}
- memcpy(dest + *dest_size, dest_line_str, strlen(dest_line_str));
- *dest_size += strlen(dest_line_str);
+ /* resize destination buffer, if necessary */
+ if ((ssize_t)(*dest_size + C2B_MAX_LINE_LENGTH_VALUE) > *dest_capacity) {
+ char *dest_line_resized = NULL;
+ dest_line_resized = realloc(*dest, *dest_capacity * 2);
+ if (dest_line_resized) {
+ *dest_capacity *= 2;
+ *dest = dest_line_resized;
+ }
+ else {
+ fprintf(stderr, "Error: Could not resize dest string in WIG pointer conversion fn\n");
+ exit(ENOMEM);
+ }
+ }
+ memcpy(*dest + *dest_size, c2b_globals.dest_line_str, strlen(c2b_globals.dest_line_str));
+ *dest_size += strlen(c2b_globals.dest_line_str);
c2b_globals.header_line_idx++;
return;
}
@@ -4693,9 +5389,9 @@ c2b_line_convert_wig_to_bed_unsorted(char *dest, ssize_t *dest_size, char *src,
}
}
else if (strncmp(src, c2b_wig_variable_step_prefix, strlen(c2b_wig_variable_step_prefix)) == 0) {
- memcpy(src_line_str, src, src_size);
- src_line_str[src_size] = '\0';
- int variable_step_fields = sscanf(src_line_str,
+ memcpy(c2b_globals.src_line_str, src, src_size);
+ c2b_globals.src_line_str[src_size] = '\0';
+ int variable_step_fields = sscanf(c2b_globals.src_line_str,
"variableStep chrom=%s span=%" SCNu64 "\n",
c2b_globals.wig->chr,
&(c2b_globals.wig->span));
@@ -4716,24 +5412,37 @@ c2b_line_convert_wig_to_bed_unsorted(char *dest, ssize_t *dest_size, char *src,
if (c2b_globals.keep_header_flag) {
/* copy header line to destination stream buffer */
if (!c2b_globals.wig->basename) {
- sprintf(dest_line_str,
+ sprintf(c2b_globals.dest_line_str,
"%s\t%u\t%u\t%s\n",
c2b_header_chr_name,
c2b_globals.header_line_idx,
c2b_globals.header_line_idx + 1,
- src_line_str);
+ c2b_globals.src_line_str);
}
else {
- sprintf(dest_line_str,
+ sprintf(c2b_globals.dest_line_str,
"%s\t%u\t%u\t%s\t%s\n",
c2b_header_chr_name,
c2b_globals.header_line_idx,
c2b_globals.header_line_idx + 1,
c2b_globals.wig->id,
- src_line_str);
+ c2b_globals.src_line_str);
+ }
+ /* resize destination buffer, if necessary */
+ if ((ssize_t)(*dest_size + C2B_MAX_LINE_LENGTH_VALUE) > *dest_capacity) {
+ char *dest_line_resized = NULL;
+ dest_line_resized = realloc(*dest, *dest_capacity * 2);
+ if (dest_line_resized) {
+ *dest_capacity *= 2;
+ *dest = dest_line_resized;
+ }
+ else {
+ fprintf(stderr, "Error: Could not resize dest string in WIG pointer conversion fn\n");
+ exit(ENOMEM);
+ }
}
- memcpy(dest + *dest_size, dest_line_str, strlen(dest_line_str));
- *dest_size += strlen(dest_line_str);
+ memcpy(*dest + *dest_size, c2b_globals.dest_line_str, strlen(c2b_globals.dest_line_str));
+ *dest_size += strlen(c2b_globals.dest_line_str);
c2b_globals.header_line_idx++;
return;
}
@@ -4742,9 +5451,9 @@ c2b_line_convert_wig_to_bed_unsorted(char *dest, ssize_t *dest_size, char *src,
}
}
else if (strncmp(src, c2b_wig_fixed_step_prefix, strlen(c2b_wig_fixed_step_prefix)) == 0) {
- memcpy(src_line_str, src, src_size);
- src_line_str[src_size] = '\0';
- int fixed_step_fields = sscanf(src_line_str,
+ memcpy(c2b_globals.src_line_str, src, src_size);
+ c2b_globals.src_line_str[src_size] = '\0';
+ int fixed_step_fields = sscanf(c2b_globals.src_line_str,
"fixedStep chrom=%s start=%" SCNu64 " step=%" SCNu64 " span=%" SCNu64 "\n",
c2b_globals.wig->chr,
&(c2b_globals.wig->start_pos),
@@ -4761,24 +5470,37 @@ c2b_line_convert_wig_to_bed_unsorted(char *dest, ssize_t *dest_size, char *src,
if (c2b_globals.keep_header_flag) {
/* copy header line to destination stream buffer */
if (!c2b_globals.wig->basename) {
- sprintf(dest_line_str,
+ sprintf(c2b_globals.dest_line_str,
"%s\t%u\t%u\t%s\n",
c2b_header_chr_name,
c2b_globals.header_line_idx,
c2b_globals.header_line_idx + 1,
- src_line_str);
+ c2b_globals.src_line_str);
}
else {
- sprintf(dest_line_str,
+ sprintf(c2b_globals.dest_line_str,
"%s\t%u\t%u\t%s\t%s\n",
c2b_header_chr_name,
c2b_globals.header_line_idx,
c2b_globals.header_line_idx + 1,
c2b_globals.wig->id,
- src_line_str);
+ c2b_globals.src_line_str);
+ }
+ /* resize destination buffer, if necessary */
+ if ((ssize_t)(*dest_size + C2B_MAX_LINE_LENGTH_VALUE) > *dest_capacity) {
+ char *dest_line_resized = NULL;
+ dest_line_resized = realloc(*dest, *dest_capacity * 2);
+ if (dest_line_resized) {
+ *dest_capacity *= 2;
+ *dest = dest_line_resized;
+ }
+ else {
+ fprintf(stderr, "Error: Could not resize dest string in WIG pointer conversion fn\n");
+ exit(ENOMEM);
+ }
}
- memcpy(dest + *dest_size, dest_line_str, strlen(dest_line_str));
- *dest_size += strlen(dest_line_str);
+ memcpy(*dest + *dest_size, c2b_globals.dest_line_str, strlen(c2b_globals.dest_line_str));
+ *dest_size += strlen(c2b_globals.dest_line_str);
c2b_globals.header_line_idx++;
return;
}
@@ -4787,9 +5509,9 @@ c2b_line_convert_wig_to_bed_unsorted(char *dest, ssize_t *dest_size, char *src,
}
}
else if (strncmp(src, c2b_wig_chr_prefix, strlen(c2b_wig_chr_prefix)) == 0) {
- memcpy(src_line_str, src, src_size);
- src_line_str[src_size] = '\0';
- int bed_fields = sscanf(src_line_str,
+ memcpy(c2b_globals.src_line_str, src, src_size);
+ c2b_globals.src_line_str[src_size] = '\0';
+ int bed_fields = sscanf(c2b_globals.src_line_str,
"%s\t%" SCNu64 "\t%" SCNu64 "\t%lf\n",
c2b_globals.wig->chr,
&(c2b_globals.wig->start_pos),
@@ -4806,7 +5528,7 @@ c2b_line_convert_wig_to_bed_unsorted(char *dest, ssize_t *dest_size, char *src,
exit(EINVAL); /* Invalid argument (POSIX.1) */
}
if (!c2b_globals.wig->basename) {
- sprintf(dest_line_str,
+ sprintf(c2b_globals.dest_line_str,
"%s\t" \
"%" PRIu64 "\t" \
"%" PRIu64 "\t" \
@@ -4819,7 +5541,7 @@ c2b_line_convert_wig_to_bed_unsorted(char *dest, ssize_t *dest_size, char *src,
c2b_globals.wig->score);
}
else {
- sprintf(dest_line_str,
+ sprintf(c2b_globals.dest_line_str,
"%s\t" \
"%" PRIu64 "\t" \
"%" PRIu64 "\t" \
@@ -4833,16 +5555,29 @@ c2b_line_convert_wig_to_bed_unsorted(char *dest, ssize_t *dest_size, char *src,
c2b_globals.wig->score);
}
c2b_globals.wig->start_write = kTrue;
- memcpy(dest + *dest_size, dest_line_str, strlen(dest_line_str));
- *dest_size += strlen(dest_line_str);
+ /* resize destination buffer, if necessary */
+ if ((ssize_t)(*dest_size + C2B_MAX_LINE_LENGTH_VALUE) > *dest_capacity) {
+ char *dest_line_resized = NULL;
+ dest_line_resized = realloc(*dest, *dest_capacity * 2);
+ if (dest_line_resized) {
+ *dest_capacity *= 2;
+ *dest = dest_line_resized;
+ }
+ else {
+ fprintf(stderr, "Error: Could not resize dest string in WIG pointer conversion fn\n");
+ exit(ENOMEM);
+ }
+ }
+ memcpy(*dest + *dest_size, c2b_globals.dest_line_str, strlen(c2b_globals.dest_line_str));
+ *dest_size += strlen(c2b_globals.dest_line_str);
}
else {
- memcpy(src_line_str, src, src_size);
- src_line_str[src_size] = '\0';
+ memcpy(c2b_globals.src_line_str, src, src_size);
+ c2b_globals.src_line_str[src_size] = '\0';
if (c2b_globals.wig->is_fixed_step) {
- int fixed_step_column_fields = sscanf(src_line_str, "%lf\n", &(c2b_globals.wig->score));
+ int fixed_step_column_fields = sscanf(c2b_globals.src_line_str, "%lf\n", &(c2b_globals.wig->score));
if (fixed_step_column_fields != 1) {
fprintf(stderr, "Error: Invalid WIG line %u\n", c2b_globals.wig->line);
exit(EINVAL); /* Invalid argument (POSIX.1) */
@@ -4854,7 +5589,7 @@ c2b_line_convert_wig_to_bed_unsorted(char *dest, ssize_t *dest_size, char *src,
exit(EINVAL); /* Invalid argument (POSIX.1) */
}
if (!c2b_globals.wig->basename) {
- sprintf(dest_line_str,
+ sprintf(c2b_globals.dest_line_str,
"%s\t" \
"%" PRIu64 "\t" \
"%" PRIu64 "\t" \
@@ -4867,7 +5602,7 @@ c2b_line_convert_wig_to_bed_unsorted(char *dest, ssize_t *dest_size, char *src,
c2b_globals.wig->score);
}
else {
- sprintf(dest_line_str,
+ sprintf(c2b_globals.dest_line_str,
"%s\t" \
"%" PRIu64 "\t" \
"%" PRIu64 "\t" \
@@ -4882,11 +5617,24 @@ c2b_line_convert_wig_to_bed_unsorted(char *dest, ssize_t *dest_size, char *src,
}
c2b_globals.wig->start_pos += c2b_globals.wig->step;
c2b_globals.wig->start_write = kTrue;
- memcpy(dest + *dest_size, dest_line_str, strlen(dest_line_str));
- *dest_size += strlen(dest_line_str);
+ /* resize destination buffer, if necessary */
+ if ((ssize_t)(*dest_size + C2B_MAX_LINE_LENGTH_VALUE) > *dest_capacity) {
+ char *dest_line_resized = NULL;
+ dest_line_resized = realloc(*dest, *dest_capacity * 2);
+ if (dest_line_resized) {
+ *dest_capacity *= 2;
+ *dest = dest_line_resized;
+ }
+ else {
+ fprintf(stderr, "Error: Could not resize dest string in WIG pointer conversion fn\n");
+ exit(ENOMEM);
+ }
+ }
+ memcpy(*dest + *dest_size, c2b_globals.dest_line_str, strlen(c2b_globals.dest_line_str));
+ *dest_size += strlen(c2b_globals.dest_line_str);
}
else {
- int variable_step_column_fields = sscanf(src_line_str,
+ int variable_step_column_fields = sscanf(c2b_globals.src_line_str,
"%" SCNu64 "\t%lf\n",
&(c2b_globals.wig->start_pos),
&(c2b_globals.wig->score));
@@ -4901,7 +5649,7 @@ c2b_line_convert_wig_to_bed_unsorted(char *dest, ssize_t *dest_size, char *src,
exit(EINVAL); /* Invalid argument (POSIX.1) */
}
if (!c2b_globals.wig->basename) {
- sprintf(dest_line_str,
+ sprintf(c2b_globals.dest_line_str,
"%s\t" \
"%" PRIu64 "\t" \
"%" PRIu64 "\t" \
@@ -4914,7 +5662,7 @@ c2b_line_convert_wig_to_bed_unsorted(char *dest, ssize_t *dest_size, char *src,
c2b_globals.wig->score);
}
else {
- sprintf(dest_line_str,
+ sprintf(c2b_globals.dest_line_str,
"%s\t" \
"%" PRIu64 "\t" \
"%" PRIu64 "\t" \
@@ -4929,18 +5677,31 @@ c2b_line_convert_wig_to_bed_unsorted(char *dest, ssize_t *dest_size, char *src,
}
c2b_globals.wig->start_pos += c2b_globals.wig->step;
c2b_globals.wig->start_write = kTrue;
- memcpy(dest + *dest_size, dest_line_str, strlen(dest_line_str));
- *dest_size += strlen(dest_line_str);
+ /* resize destination buffer, if necessary */
+ if ((ssize_t)(*dest_size + C2B_MAX_LINE_LENGTH_VALUE) > *dest_capacity) {
+ char *dest_line_resized = NULL;
+ dest_line_resized = realloc(*dest, *dest_capacity * 2);
+ if (dest_line_resized) {
+ *dest_capacity *= 2;
+ *dest = dest_line_resized;
+ }
+ else {
+ fprintf(stderr, "Error: Could not resize dest string in WIG pointer conversion fn\n");
+ exit(ENOMEM);
+ }
+ }
+ memcpy(*dest + *dest_size, c2b_globals.dest_line_str, strlen(c2b_globals.dest_line_str));
+ *dest_size += strlen(c2b_globals.dest_line_str);
}
}
}
static void *
-c2b_read_bytes_from_stdin(void *arg)
+c2b_read_bytes_from_stdin(void* arg)
{
- c2b_pipeline_stage_t *stage = (c2b_pipeline_stage_t *) arg;
- c2b_pipeset_t *pipes = stage->pipeset;
- char *buffer = NULL;
+ c2b_pipeline_stage_t* stage = (c2b_pipeline_stage_t *) arg;
+ c2b_pipeset_t* pipes = stage->pipeset;
+ char* buffer = NULL;
ssize_t buffer_size = stage->buffer_size;
ssize_t bytes_read;
int exit_status = 0;
@@ -4980,12 +5741,12 @@ c2b_read_bytes_from_stdin(void *arg)
}
static void *
-c2b_process_intermediate_bytes_by_lines(void *arg)
+c2b_process_intermediate_bytes_by_lines(void* arg)
{
- c2b_pipeline_stage_t *stage = (c2b_pipeline_stage_t *) arg;
- c2b_pipeset_t *pipes = stage->pipeset;
- char *src_buffer = NULL;
- ssize_t src_buffer_size = C2B_MAX_LONGER_LINE_LENGTH_VALUE;
+ c2b_pipeline_stage_t* stage = (c2b_pipeline_stage_t *) arg;
+ c2b_pipeset_t* pipes = stage->pipeset;
+ char* src_buffer = NULL;
+ ssize_t src_buffer_capacity = C2B_THREAD_IO_BUFFER_SIZE;
ssize_t src_bytes_read = 0;
ssize_t remainder_length = 0;
ssize_t remainder_offset = 0;
@@ -4993,24 +5754,24 @@ c2b_process_intermediate_bytes_by_lines(void *arg)
ssize_t lines_offset = 0;
ssize_t start_offset = 0;
ssize_t end_offset = 0;
- char *dest_buffer = NULL;
- ssize_t dest_buffer_size = C2B_MAX_LONGER_LINE_LENGTH_VALUE * C2B_MAX_LINES_VALUE;
+ char* dest_buffer = NULL;
+ ssize_t dest_buffer_capacity = C2B_THREAD_IO_BUFFER_SIZE;
ssize_t dest_bytes_written = 0;
- void (*line_functor)(char *, ssize_t *, char *, ssize_t) = stage->line_functor;
+ void (*line_functor)(char **, ssize_t *, ssize_t *, char *, ssize_t) = stage->line_functor;
int exit_status = 0;
/*
We read from the src out pipe, then write to the dest in pipe
*/
- src_buffer = malloc(src_buffer_size);
+ src_buffer = malloc(src_buffer_capacity);
if (!src_buffer) {
fprintf(stderr, "Error: Could not allocate space for intermediate source buffer.\n");
c2b_print_usage(stderr);
exit(ENOMEM); /* Not enough space (POSIX.1) */
}
- dest_buffer = malloc(dest_buffer_size);
+ dest_buffer = malloc(dest_buffer_capacity);
if (!dest_buffer) {
fprintf(stderr, "Error: Could not allocate space for intermediate destination buffer.\n");
c2b_print_usage(stderr);
@@ -5020,7 +5781,7 @@ c2b_process_intermediate_bytes_by_lines(void *arg)
while ((src_bytes_read = read(pipes->out[stage->src][PIPE_READ],
src_buffer + remainder_length,
- src_buffer_size - remainder_length)) > 0) {
+ src_buffer_capacity - remainder_length)) > 0) {
/*
So here's what src_buffer looks like initially; basically, some stuff separated by
@@ -5074,11 +5835,11 @@ c2b_process_intermediate_bytes_by_lines(void *arg)
src_buffer_size to something smaller.
*/
- c2b_memrchr_offset(&remainder_offset, src_buffer, src_buffer_size, src_bytes_read + remainder_length, line_delim);
+ c2b_memrchr_offset(&remainder_offset, src_buffer, src_buffer_capacity, src_bytes_read + remainder_length, line_delim);
if (remainder_offset == -1) {
- if (src_bytes_read + remainder_length == src_buffer_size) {
- fprintf(stderr, "Error: Could not find newline in intermediate buffer; check input\n");
+ if (src_bytes_read + remainder_length == src_buffer_capacity) {
+ fprintf(stderr, "Error: Could not find newline in intermediate buffer; check input [%zu | %zu | %zu]\n", (unsigned long) src_bytes_read, (unsigned long) remainder_length, (unsigned long) src_buffer_capacity);
c2b_print_usage(stderr);
exit(EINVAL); /* Invalid argument (POSIX.1) */
}
@@ -5098,7 +5859,7 @@ c2b_process_intermediate_bytes_by_lines(void *arg)
if (src_buffer[lines_offset] == line_delim) {
end_offset = lines_offset;
/* for a given line from src, we write dest_bytes_written number of bytes to dest_buffer (plus written offset) */
- (*line_functor)(dest_buffer, &dest_bytes_written, src_buffer + start_offset, end_offset - start_offset);
+ (*line_functor)(&dest_buffer, &dest_bytes_written, &dest_buffer_capacity, src_buffer + start_offset, end_offset - start_offset);
start_offset = end_offset + 1;
}
lines_offset++;
@@ -5112,7 +5873,7 @@ c2b_process_intermediate_bytes_by_lines(void *arg)
#pragma GCC diagnostic push
#pragma GCC diagnostic ignored "-Wunused-result"
write(pipes->in[stage->dest][PIPE_WRITE], dest_buffer, dest_bytes_written);
- //fprintf(stderr, "dest_bytes_written [%zu]\n", dest_bytes_written);
+ //fprintf(stderr, "dest_bytes_written [%zu] of dest_buffer_size [%zu] (diff [%zu])\n", dest_bytes_written, dest_buffer_capacity, dest_buffer_capacity - dest_bytes_written);
#pragma GCC diagnostic pop
remainder_length = src_bytes_read + remainder_length - remainder_offset;
@@ -5142,11 +5903,11 @@ c2b_process_intermediate_bytes_by_lines(void *arg)
}
static void *
-c2b_write_in_bytes_to_in_process(void *arg)
+c2b_write_in_bytes_to_in_process(void* arg)
{
- c2b_pipeline_stage_t *stage = (c2b_pipeline_stage_t *) arg;
- c2b_pipeset_t *pipes = stage->pipeset;
- char *buffer = NULL;
+ c2b_pipeline_stage_t* stage = (c2b_pipeline_stage_t *) arg;
+ c2b_pipeset_t* pipes = stage->pipeset;
+ char* buffer = NULL;
ssize_t buffer_size = stage->buffer_size;
ssize_t bytes_read;
int exit_status = 0;
@@ -5184,11 +5945,11 @@ c2b_write_in_bytes_to_in_process(void *arg)
}
static void *
-c2b_write_out_bytes_to_in_process(void *arg)
+c2b_write_out_bytes_to_in_process(void* arg)
{
- c2b_pipeline_stage_t *stage = (c2b_pipeline_stage_t *) arg;
- c2b_pipeset_t *pipes = stage->pipeset;
- char *buffer = NULL;
+ c2b_pipeline_stage_t* stage = (c2b_pipeline_stage_t *) arg;
+ c2b_pipeset_t* pipes = stage->pipeset;
+ char* buffer = NULL;
ssize_t buffer_size = stage->buffer_size;
ssize_t bytes_read;
int exit_status = 0;
@@ -5226,11 +5987,11 @@ c2b_write_out_bytes_to_in_process(void *arg)
}
static void *
-c2b_write_in_bytes_to_stdout(void *arg)
+c2b_write_in_bytes_to_stdout(void* arg)
{
- c2b_pipeline_stage_t *stage = (c2b_pipeline_stage_t *) arg;
- c2b_pipeset_t *pipes = stage->pipeset;
- char *buffer = NULL;
+ c2b_pipeline_stage_t* stage = (c2b_pipeline_stage_t *) arg;
+ c2b_pipeset_t* pipes = stage->pipeset;
+ char* buffer = NULL;
ssize_t buffer_size = stage->buffer_size;
ssize_t bytes_read;
int exit_status = 0;
@@ -5265,11 +6026,11 @@ c2b_write_in_bytes_to_stdout(void *arg)
}
static void *
-c2b_write_out_bytes_to_stdout(void *arg)
+c2b_write_out_bytes_to_stdout(void* arg)
{
- c2b_pipeline_stage_t *stage = (c2b_pipeline_stage_t *) arg;
- c2b_pipeset_t *pipes = stage->pipeset;
- char *buffer = NULL;
+ c2b_pipeline_stage_t* stage = (c2b_pipeline_stage_t *) arg;
+ c2b_pipeset_t* pipes = stage->pipeset;
+ char* buffer = NULL;
ssize_t buffer_size = stage->buffer_size;
ssize_t bytes_read;
int exit_status = 0;
@@ -5304,7 +6065,7 @@ c2b_write_out_bytes_to_stdout(void *arg)
}
static void
-c2b_memrchr_offset(ssize_t *offset, char *buf, ssize_t buf_size, ssize_t len, char delim)
+c2b_memrchr_offset(ssize_t* offset, char* buf, ssize_t buf_size, ssize_t len, char delim)
{
ssize_t left = len;
@@ -5322,15 +6083,15 @@ c2b_memrchr_offset(ssize_t *offset, char *buf, ssize_t buf_size, ssize_t len, ch
}
static void
-c2b_init_pipeset(c2b_pipeset_t *p, const size_t num)
+c2b_init_pipeset(c2b_pipeset_t* p, const size_t num)
{
#ifdef DEBUG
fprintf(stderr, "--- c2b_init_pipeset() - enter ---\n");
#endif
- int **ins = NULL;
- int **outs = NULL;
- int **errs = NULL;
+ int** ins = NULL;
+ int** outs = NULL;
+ int** errs = NULL;
size_t n;
ins = malloc(num * sizeof(int *));
@@ -5396,7 +6157,7 @@ static void c2b_debug_pipeset() __attribute__ ((unused));
#endif
static void
-c2b_debug_pipeset(c2b_pipeset_t *p, const size_t num)
+c2b_debug_pipeset(c2b_pipeset_t* p, const size_t num)
{
size_t n;
size_t s;
@@ -5415,7 +6176,7 @@ c2b_debug_pipeset(c2b_pipeset_t *p, const size_t num)
}
static void
-c2b_delete_pipeset(c2b_pipeset_t *p)
+c2b_delete_pipeset(c2b_pipeset_t* p)
{
size_t n;
size_t s;
@@ -5531,8 +6292,8 @@ c2b_test_dependencies()
fprintf(stderr, "--- c2b_test_dependencies() - enter ---\n");
#endif
- char *p = NULL;
- char *path = NULL;
+ char* p = NULL;
+ char* path = NULL;
if ((p = getenv("PATH")) == NULL) {
fprintf(stderr, "Error: Cannot retrieve environment PATH variable\n");
@@ -5548,7 +6309,7 @@ c2b_test_dependencies()
memcpy(path, p, strlen(p) + 1);
if ((c2b_globals.input_format_idx == BAM_FORMAT) || (c2b_globals.input_format_idx == SAM_FORMAT)) {
- char *samtools = NULL;
+ char* samtools = NULL;
samtools = malloc(strlen(c2b_samtools) + 1);
if (!samtools) {
fprintf(stderr, "Error: Cannot allocate space for samtools variable copy\n");
@@ -5557,7 +6318,7 @@ c2b_test_dependencies()
}
memcpy(samtools, c2b_samtools, strlen(c2b_samtools) + 1);
- char *path_samtools = NULL;
+ char* path_samtools = NULL;
path_samtools = malloc(strlen(path) + 1);
if (!path_samtools) {
fprintf(stderr, "Error: Cannot allocate space for path (samtools) copy\n");
@@ -5580,7 +6341,7 @@ c2b_test_dependencies()
}
if (c2b_globals.sort->is_enabled) {
- char *sort_bed = NULL;
+ char* sort_bed = NULL;
sort_bed = malloc(strlen(c2b_sort_bed) + 1);
if (!sort_bed) {
fprintf(stderr, "Error: Cannot allocate space for sort-bed variable copy\n");
@@ -5589,7 +6350,7 @@ c2b_test_dependencies()
}
memcpy(sort_bed, c2b_sort_bed, strlen(c2b_sort_bed) + 1);
- char *path_sort_bed = NULL;
+ char* path_sort_bed = NULL;
path_sort_bed = malloc(strlen(path) + 1);
if (!path_sort_bed) {
fprintf(stderr, "Error: Cannot allocate space for path (samtools) copy\n");
@@ -5612,7 +6373,7 @@ c2b_test_dependencies()
}
if (c2b_globals.output_format_idx == STARCH_FORMAT) {
- char *starch = NULL;
+ char* starch = NULL;
starch = malloc(strlen(c2b_starch) + 1);
if (!starch) {
fprintf(stderr, "Error: Cannot allocate space for starch variable copy\n");
@@ -5621,7 +6382,7 @@ c2b_test_dependencies()
}
memcpy(starch, c2b_starch, strlen(c2b_starch) + 1);
- char *path_starch = NULL;
+ char* path_starch = NULL;
path_starch = malloc(strlen(path) + 1);
if (!path_starch) {
fprintf(stderr, "Error: Cannot allocate space for path (starch) copy\n");
@@ -5644,7 +6405,7 @@ c2b_test_dependencies()
}
if (c2b_globals.input_format_idx != BAM_FORMAT) {
- char *cat = NULL;
+ char* cat = NULL;
cat = malloc(strlen(c2b_cat) + 1);
if (!cat) {
fprintf(stderr, "Error: Cannot allocate space for cat variable copy\n");
@@ -5653,7 +6414,7 @@ c2b_test_dependencies()
}
memcpy(cat, c2b_cat, strlen(c2b_cat) + 1);
- char *path_cat = NULL;
+ char* path_cat = NULL;
path_cat = malloc(strlen(path) + 1);
if (!path_cat) {
fprintf(stderr, "Error: Cannot allocate space for path (cat) copy\n");
@@ -5683,14 +6444,14 @@ c2b_test_dependencies()
}
static boolean
-c2b_print_matches(char *path, char *fn)
+c2b_print_matches(char* path, char* fn)
{
#ifdef DEBUG
fprintf(stderr, "--- c2b_print_matches() - enter ---\n");
#endif
char candidate[PATH_MAX];
- const char *d;
+ const char* d;
boolean found = kFalse;
if (strchr(fn, '/') != NULL) {
@@ -5756,12 +6517,12 @@ c2b_print_matches(char *path, char *fn)
}
static char *
-c2b_strsep(char **stringp, const char *delim)
+c2b_strsep(char** stringp, const char* delim)
{
- char *s;
- const char *spanp;
+ char* s;
+ const char* spanp;
int c, sc;
- char *tok;
+ char* tok;
if ((s = *stringp) == NULL)
return NULL;
@@ -5785,7 +6546,7 @@ c2b_strsep(char **stringp, const char *delim)
}
static boolean
-c2b_is_there(char *candidate)
+c2b_is_there(char* candidate)
{
#ifdef DEBUG
fprintf(stderr, "--- c2b_is_there() - enter ---\n");
@@ -5825,7 +6586,9 @@ c2b_init_globals()
c2b_globals.all_reads_flag = kFalse;
c2b_globals.keep_header_flag = kFalse;
c2b_globals.split_flag = kFalse;
+ c2b_globals.split_with_deletions_flag = kFalse;
c2b_globals.zero_indexed_flag = kFalse;
+ c2b_globals.reduced_flag = kFalse;
c2b_globals.header_line_idx = 0U;
c2b_globals.gff = NULL;
c2b_init_global_gff_state();
@@ -5847,6 +6610,8 @@ c2b_init_globals()
c2b_init_global_sort_params();
c2b_globals.starch = NULL;
c2b_init_global_starch_params();
+ c2b_globals.src_line_str = NULL;
+ c2b_globals.dest_line_str = NULL;
#ifdef DEBUG
fprintf(stderr, "--- c2b_init_globals() - exit ---\n");
@@ -5866,6 +6631,8 @@ c2b_delete_globals()
c2b_globals.all_reads_flag = kFalse;
c2b_globals.keep_header_flag = kFalse;
c2b_globals.split_flag = kFalse;
+ c2b_globals.split_with_deletions_flag = kFalse;
+ c2b_globals.reduced_flag = kFalse;
c2b_globals.header_line_idx = 0U;
if (c2b_globals.gff) c2b_delete_global_gff_state();
if (c2b_globals.gtf) c2b_delete_global_gtf_state();
@@ -5877,6 +6644,8 @@ c2b_delete_globals()
if (c2b_globals.cat) c2b_delete_global_cat_params();
if (c2b_globals.sort) c2b_delete_global_sort_params();
if (c2b_globals.starch) c2b_delete_global_starch_params();
+ if (c2b_globals.src_line_str) free(c2b_globals.src_line_str), c2b_globals.src_line_str = NULL;
+ if (c2b_globals.dest_line_str) free(c2b_globals.dest_line_str), c2b_globals.dest_line_str = NULL;
#ifdef DEBUG
fprintf(stderr, "--- c2b_delete_globals() - exit ---\n");
@@ -5976,6 +6745,8 @@ c2b_init_global_psl_state()
exit(ENOMEM); /* Not enough space (POSIX.1) */
}
+ c2b_globals.psl->element = NULL, c2b_psl_init_element(&(c2b_globals.psl->element));
+
c2b_globals.psl->is_headered = kTrue;
c2b_globals.psl->block = NULL;
@@ -6015,6 +6786,10 @@ c2b_delete_global_psl_state()
fprintf(stderr, "--- c2b_delete_global_psl_state() - enter ---\n");
#endif
+ if (c2b_globals.psl->element) {
+ c2b_psl_delete_element(c2b_globals.psl->element);
+ c2b_globals.psl->element = NULL;
+ }
free(c2b_globals.psl->block->starts), c2b_globals.psl->block->starts = NULL;
free(c2b_globals.psl->block->sizes), c2b_globals.psl->block->sizes = NULL;
c2b_globals.psl->block->max_count = 0;
@@ -6435,10 +7210,18 @@ c2b_init_command_line_options(int argc, char **argv)
break;
case 's':
c2b_globals.split_flag = kTrue;
+ c2b_globals.split_with_deletions_flag = kFalse;
+ break;
+ case 'S':
+ c2b_globals.split_flag = kTrue;
+ c2b_globals.split_with_deletions_flag = kTrue;
break;
case 'p':
c2b_globals.vcf->do_not_split = kTrue;
break;
+ case 'R':
+ c2b_globals.reduced_flag = kTrue;
+ break;
case 'v':
c2b_globals.vcf->filter_count++;
c2b_globals.vcf->only_snvs = kTrue;
@@ -6569,7 +7352,7 @@ c2b_init_command_line_options(int argc, char **argv)
}
static void
-c2b_print_version(FILE *stream)
+c2b_print_version(FILE* stream)
{
#ifdef DEBUG
fprintf(stderr, "--- c2b_print_version() - enter ---\n");
@@ -6577,10 +7360,11 @@ c2b_print_version(FILE *stream)
fprintf(stream,
"%s\n" \
- " version: %s\n" \
+ " version: %s (%s)\n" \
" author: %s\n",
application_name,
application_version,
+ application_type,
application_authors);
#ifdef DEBUG
@@ -6589,22 +7373,23 @@ c2b_print_version(FILE *stream)
}
static void
-c2b_print_usage(FILE *stream)
+c2b_print_usage(FILE* stream)
{
#ifdef DEBUG
fprintf(stderr, "--- c2b_print_usage() - enter ---\n");
#endif
fprintf(stream,
- "%s\n" \
- " version: %s\n" \
- " author: %s\n" \
- "%s\n" \
- "%s\n" \
- "%s\n" \
+ "%s\n" \
+ " version: %s (%s)\n" \
+ " author: %s\n" \
+ "%s\n" \
+ "%s\n" \
+ "%s\n" \
"%s\n",
application_name,
application_version,
+ application_type,
application_authors,
general_usage,
general_description,
@@ -6617,7 +7402,7 @@ c2b_print_usage(FILE *stream)
}
static void
-c2b_print_format_usage(FILE *stream)
+c2b_print_format_usage(FILE* stream)
{
#ifdef DEBUG
fprintf(stderr, "--- c2b_print_format_usage() - enter ---\n");
@@ -6693,7 +7478,7 @@ c2b_print_format_usage(FILE *stream)
if (format_options) {
fprintf(stream,
"%s\n" \
- " version: %s\n" \
+ " version: %s (%s)\n" \
" author: %s\n\n" \
"%s\n" \
"%s\n" \
@@ -6701,6 +7486,7 @@ c2b_print_format_usage(FILE *stream)
"%s\n",
format_name,
application_version,
+ application_type,
application_authors,
format_usage,
format_description,
@@ -6710,13 +7496,14 @@ c2b_print_format_usage(FILE *stream)
else {
fprintf(stream,
"%s\n" \
- " version: %s\n" \
+ " version: %s (%s)\n" \
" author: %s\n\n" \
"%s\n" \
"%s\n" \
"%s\n",
format_name,
application_version,
+ application_type,
application_authors,
format_usage,
format_description,
@@ -6729,7 +7516,7 @@ c2b_print_format_usage(FILE *stream)
}
static char *
-c2b_to_lowercase(const char *src)
+c2b_to_lowercase(const char* src)
{
#ifdef DEBUG
fprintf(stderr, "--- c2b_to_lowercase() - enter ---\n");
@@ -6759,7 +7546,7 @@ c2b_to_lowercase(const char *src)
}
static c2b_format_t
-c2b_to_input_format(const char *input_format)
+c2b_to_input_format(const char* input_format)
{
#ifdef DEBUG
fprintf(stderr, "--- c2b_to_input_format() - enter ---\n");
@@ -6780,7 +7567,7 @@ c2b_to_input_format(const char *input_format)
}
static c2b_format_t
-c2b_to_output_format(const char *output_format)
+c2b_to_output_format(const char* output_format)
{
#ifdef DEBUG
fprintf(stderr, "--- c2b_to_output_format() - enter ---\n");
@@ -6792,4 +7579,3 @@ c2b_to_output_format(const char *output_format)
(strcmp(output_format, "starch") == 0) ? STARCH_FORMAT :
UNDEFINED_FORMAT;
}
-
diff --git a/applications/bed/conversion/src/convert2bed.h b/applications/bed/conversion/src/convert2bed.h
index bfd2d22..6237af2 100644
--- a/applications/bed/conversion/src/convert2bed.h
+++ b/applications/bed/conversion/src/convert2bed.h
@@ -51,7 +51,9 @@
#include <sys/param.h>
#include <sys/wait.h>
-#define C2B_VERSION "2.4.26"
+#include "suite/BEDOPS.Constants.hpp"
+
+#define C2B_VERSION "2.4.28"
typedef int boolean;
extern const boolean kTrue;
@@ -60,11 +62,11 @@ const boolean kTrue = 1;
const boolean kFalse = 0;
#define C2B_MAX_FIELD_COUNT_VALUE 64
-#define C2B_MAX_FIELD_LENGTH_VALUE 24576
-#define C2B_MAX_OPERATION_FIELD_LENGTH_VALUE 32
+#define C2B_MAX_FIELD_LENGTH_VALUE TOKEN_REST_MAX_LENGTH
+#define C2B_MAX_OPERATION_FIELD_LENGTH_VALUE MAX_DEC_INTEGERS
#define C2B_MAX_STRAND_LENGTH_VALUE 4
-#define C2B_MAX_LINE_LENGTH_VALUE 131072
-#define C2B_MAX_LONGER_LINE_LENGTH_VALUE 1048576
+#define C2B_MAX_LINE_LENGTH_VALUE 24 * TOKENS_MAX_LENGTH
+#define C2B_MAX_COMMAND_LINE_LENGTH_VALUE 65536
#define C2B_MAX_LINES_VALUE 32
#define C2B_MAX_CHROMOSOME_LENGTH 32
#define C2B_MAX_PSL_BLOCKS 1024
@@ -79,44 +81,45 @@ const boolean kFalse = 0;
#define C2B_GFF_ELEMENT_FIELD_LENGTH_VALUE_INITIAL 32
#define C2B_GTF_ELEMENT_FIELD_LENGTH_VALUE_INITIAL 32
#define C2B_RMSK_ELEMENT_FIELD_LENGTH_VALUE_INITIAL 32
+#define C2B_PSL_ELEMENT_FIELD_LENGTH_VALUE_INITIAL 32
#define C2B_THREAD_IO_BUFFER_SIZE 5000000
-extern const char *c2b_samtools;
-extern const char *c2b_sort_bed;
-extern const char *c2b_starch;
-extern const char *c2b_cat;
-extern const char *c2b_default_output_format;
-extern const char *c2b_unmapped_read_chr_name;
-extern const char *c2b_header_chr_name;
-extern const char *sort_bed_max_mem_arg;
-extern const char *sort_bed_max_mem_default_arg;
-extern const char *sort_bed_tmpdir_arg;
-extern const char *sort_bed_stdin;
-extern const char *starch_bzip2_arg;
-extern const char *starch_gzip_arg;
-extern const char *starch_note_prefix_arg;
-extern const char *starch_note_suffix_arg;
-extern const char *starch_stdin_arg;
+extern const char* c2b_samtools;
+extern const char* c2b_sort_bed;
+extern const char* c2b_starch;
+extern const char* c2b_cat;
+extern const char* c2b_default_output_format;
+extern const char* c2b_unmapped_read_chr_name;
+extern const char* c2b_header_chr_name;
+extern const char* sort_bed_max_mem_arg;
+extern const char* sort_bed_max_mem_default_arg;
+extern const char* sort_bed_tmpdir_arg;
+extern const char* sort_bed_stdin;
+extern const char* starch_bzip2_arg;
+extern const char* starch_gzip_arg;
+extern const char* starch_note_prefix_arg;
+extern const char* starch_note_suffix_arg;
+extern const char* starch_stdin_arg;
extern const char c2b_tab_delim;
extern const char c2b_line_delim;
extern const char c2b_space_delim;
extern const char c2b_sam_header_prefix;
-extern const char *c2b_gff_header;
-extern const char *c2b_gff_fasta;
+extern const char* c2b_gff_header;
+extern const char* c2b_gff_fasta;
extern const int c2b_gff_field_min;
extern const int c2b_gff_field_max;
-extern const char *c2b_gff_zero_length_insertion_attribute;
+extern const char* c2b_gff_zero_length_insertion_attribute;
extern const int c2b_gtf_field_min;
extern const int c2b_gtf_field_max;
-extern const char *c2b_gtf_gene_id_prefix;
-extern const char *c2b_gtf_transcript_id_prefix;
+extern const char* c2b_gtf_gene_id_prefix;
+extern const char* c2b_gtf_transcript_id_prefix;
extern const char c2b_gtf_id_delimiter;
-extern const char *c2b_gtf_field_delimiter;
-extern const char *c2b_gtf_field_placeholder;
+extern const char* c2b_gtf_field_delimiter;
+extern const char* c2b_gtf_field_placeholder;
extern const char c2b_gtf_comment;
-extern const char *c2b_gtf_zero_length_insertion_attribute;
-extern const char *c2b_gvf_header;
-extern const char *c2b_gvf_generic_header;
+extern const char* c2b_gtf_zero_length_insertion_attribute;
+extern const char* c2b_gvf_header;
+extern const char* c2b_gvf_generic_header;
extern const int c2b_psl_field_min;
extern const int c2b_psl_field_max;
extern const char c2b_psl_blockSizes_delimiter;
@@ -124,56 +127,56 @@ extern const char c2b_psl_tStarts_delimiter;
extern const uint64_t c2b_rmsk_header_line_count;
extern const int c2b_rmsk_field_min;
extern const int c2b_rmsk_field_max;
-extern const char *c2b_rmsk_strand_complement;
-extern const char *c2b_rmsk_strand_complement_replacement;
+extern const char* c2b_rmsk_strand_complement;
+extern const char* c2b_rmsk_strand_complement_replacement;
extern const int c2b_vcf_field_min;
extern const char c2b_vcf_header_prefix;
extern const char c2b_vcf_alt_allele_delim;
extern const char c2b_vcf_id_prefix;
extern const char c2b_vcf_id_suffix;
extern const char c2b_wig_header_prefix;
-extern const char *c2b_wig_track_prefix;
-extern const char *c2b_wig_browser_prefix;
-extern const char *c2b_wig_variable_step_prefix;
-extern const char *c2b_wig_fixed_step_prefix;
-extern const char *c2b_wig_chr_prefix;
-
-const char *c2b_samtools = "samtools";
-const char *c2b_sort_bed = "sort-bed";
-const char *c2b_starch = "starch";
-const char *c2b_cat = "cat";
-const char *c2b_default_output_format = "bed";
-const char *c2b_unmapped_read_chr_name = "_unmapped";
-const char *c2b_header_chr_name = "_header";
-const char *sort_bed_max_mem_arg = " --max-mem ";
-const char *sort_bed_max_mem_default_arg = " --max-mem 2G ";
-const char *sort_bed_tmpdir_arg = " --tmpdir ";
-const char *sort_bed_stdin = " - ";
-const char *starch_bzip2_arg = " --bzip2 ";
-const char *starch_gzip_arg = " --gzip ";
-const char *starch_note_prefix_arg = " --note=\"";
-const char *starch_note_suffix_arg = "\" ";
-const char *starch_stdin_arg = " - ";
+extern const char* c2b_wig_track_prefix;
+extern const char* c2b_wig_browser_prefix;
+extern const char* c2b_wig_variable_step_prefix;
+extern const char* c2b_wig_fixed_step_prefix;
+extern const char* c2b_wig_chr_prefix;
+
+const char* c2b_samtools = "samtools";
+const char* c2b_sort_bed = "sort-bed";
+const char* c2b_starch = "starch";
+const char* c2b_cat = "cat";
+const char* c2b_default_output_format = "bed";
+const char* c2b_unmapped_read_chr_name = "_unmapped";
+const char* c2b_header_chr_name = "_header";
+const char* sort_bed_max_mem_arg = " --max-mem ";
+const char* sort_bed_max_mem_default_arg = " --max-mem 2G ";
+const char* sort_bed_tmpdir_arg = " --tmpdir ";
+const char* sort_bed_stdin = " - ";
+const char* starch_bzip2_arg = " --bzip2 ";
+const char* starch_gzip_arg = " --gzip ";
+const char* starch_note_prefix_arg = " --note=\"";
+const char* starch_note_suffix_arg = "\" ";
+const char* starch_stdin_arg = " - ";
const char c2b_tab_delim = '\t';
const char c2b_line_delim = '\n';
const char c2b_space_delim = 0x20;
const char c2b_sam_header_prefix = '@';
-const char *c2b_gff_header = "##gff-version 3";
-const char *c2b_gff_fasta = "##FASTA";
+const char* c2b_gff_header = "##gff-version 3";
+const char* c2b_gff_fasta = "##FASTA";
const int c2b_gff_field_min = 9;
const int c2b_gff_field_max = 9;
-const char *c2b_gff_zero_length_insertion_attribute = ";zero_length_insertion=True";
+const char* c2b_gff_zero_length_insertion_attribute = ";zero_length_insertion=True";
const int c2b_gtf_field_min = 9;
const int c2b_gtf_field_max = 10;
-const char *c2b_gtf_gene_id_prefix = "gene_id ";
-const char *c2b_gtf_transcript_id_prefix = "transcript_id ";
+const char* c2b_gtf_gene_id_prefix = "gene_id ";
+const char* c2b_gtf_transcript_id_prefix = "transcript_id ";
const char c2b_gtf_id_delimiter = '"';
-const char *c2b_gtf_field_delimiter = ";";
-const char *c2b_gtf_field_placeholder = ".";
+const char* c2b_gtf_field_delimiter = ";";
+const char* c2b_gtf_field_placeholder = ".";
const char c2b_gtf_comment = '#';
-const char *c2b_gtf_zero_length_insertion_attribute = "; zero_length_insertion=True";
-const char *c2b_gvf_header = "##gvf-version 1.07";
-const char *c2b_gvf_generic_header = "##";
+const char* c2b_gtf_zero_length_insertion_attribute = "; zero_length_insertion=True";
+const char* c2b_gvf_header = "##gvf-version 1.07";
+const char* c2b_gvf_generic_header = "##";
const int c2b_psl_field_min = 21;
const int c2b_psl_field_max = 21;
const char c2b_psl_blockSizes_delimiter = ',';
@@ -181,19 +184,19 @@ const char c2b_psl_tStarts_delimiter = ',';
const uint64_t c2b_rmsk_header_line_count = 3;
const int c2b_rmsk_field_min = 15;
const int c2b_rmsk_field_max = 16;
-const char *c2b_rmsk_strand_complement = "C";
-const char *c2b_rmsk_strand_complement_replacement = "-";
+const char* c2b_rmsk_strand_complement = "C";
+const char* c2b_rmsk_strand_complement_replacement = "-";
const int c2b_vcf_field_min = 8;
const char c2b_vcf_header_prefix = '#';
const char c2b_vcf_alt_allele_delim = ',';
const char c2b_vcf_id_prefix = '<';
const char c2b_vcf_id_suffix = '>';
const char c2b_wig_header_prefix = '#';
-const char *c2b_wig_track_prefix = "track";
-const char *c2b_wig_browser_prefix = "browser";
-const char *c2b_wig_variable_step_prefix = "variableStep";
-const char *c2b_wig_fixed_step_prefix = "fixedStep";
-const char *c2b_wig_chr_prefix = "chr";
+const char* c2b_wig_track_prefix = "track";
+const char* c2b_wig_browser_prefix = "browser";
+const char* c2b_wig_variable_step_prefix = "variableStep";
+const char* c2b_wig_fixed_step_prefix = "fixedStep";
+const char* c2b_wig_chr_prefix = "chr";
/*
Allowed input and output formats
@@ -261,32 +264,32 @@ const char default_cigar_op_operation = '-';
*/
typedef struct sam {
- char *qname;
+ char* qname;
ssize_t qname_capacity;
- char *modified_qname;
+ char* modified_qname;
ssize_t modified_qname_capacity;
int flag;
- char *strand;
+ char* strand;
ssize_t strand_capacity;
- char *rname;
+ char* rname;
ssize_t rname_capacity;
uint64_t start;
uint64_t stop;
- char *mapq;
+ char* mapq;
ssize_t mapq_capacity;
- char *cigar;
+ char* cigar;
ssize_t cigar_capacity;
- char *rnext;
+ char* rnext;
ssize_t rnext_capacity;
- char *pnext;
+ char* pnext;
ssize_t pnext_capacity;
- char *tlen;
+ char* tlen;
ssize_t tlen_capacity;
- char *seq;
+ char* seq;
ssize_t seq_capacity;
- char *qual;
+ char* qual;
ssize_t qual_capacity;
- char *opt;
+ char* opt;
ssize_t opt_length;
ssize_t opt_capacity;
} c2b_sam_t;
@@ -312,23 +315,23 @@ typedef struct sam {
*/
typedef struct gff {
- char *seqid;
+ char* seqid;
ssize_t seqid_capacity;
- char *source;
+ char* source;
ssize_t source_capacity;
- char *type;
+ char* type;
ssize_t type_capacity;
uint64_t start;
uint64_t end;
- char *score;
+ char* score;
ssize_t score_capacity;
- char *strand;
+ char* strand;
ssize_t strand_capacity;
- char *phase;
+ char* phase;
ssize_t phase_capacity;
- char *attributes;
+ char* attributes;
ssize_t attributes_capacity;
- char *id;
+ char* id;
ssize_t id_capacity;
} c2b_gff_t;
@@ -354,25 +357,25 @@ typedef struct gff {
*/
typedef struct gtf {
- char *seqname;
+ char* seqname;
ssize_t seqname_capacity;
- char *source;
+ char* source;
ssize_t source_capacity;
- char *feature;
+ char* feature;
ssize_t feature_capacity;
uint64_t start;
uint64_t end;
- char *score;
+ char* score;
ssize_t score_capacity;
- char *strand;
+ char* strand;
ssize_t strand_capacity;
- char *frame;
+ char* frame;
ssize_t frame_capacity;
- char *attributes;
+ char* attributes;
ssize_t attributes_capacity;
- char *id;
+ char* id;
ssize_t id_capacity;
- char *comments;
+ char* comments;
ssize_t comments_capacity;
} c2b_gtf_t;
@@ -409,27 +412,63 @@ typedef struct gtf {
*/
typedef struct psl {
+ char* matchesStr;
+ ssize_t matchesStr_capacity;
uint64_t matches;
+ char* misMatchesStr;
+ ssize_t misMatchesStr_capacity;
uint64_t misMatches;
+ char* repMatchesStr;
+ ssize_t repMatchesStr_capacity;
uint64_t repMatches;
+ char* nCountStr;
+ ssize_t nCountStr_capacity;
uint64_t nCount;
+ char* qNumInsertStr;
+ ssize_t qNumInsertStr_capacity;
uint64_t qNumInsert;
+ char* qBaseInsertStr;
+ ssize_t qBaseInsertStr_capacity;
uint64_t qBaseInsert;
+ char* tNumInsertStr;
+ ssize_t tNumInsertStr_capacity;
uint64_t tNumInsert;
+ char* tBaseInsertStr;
+ ssize_t tBaseInsertStr_capacity;
uint64_t tBaseInsert;
- char *strand;
- char *qName;
+ char* strand;
+ ssize_t strand_capacity;
+ char* qName;
+ ssize_t qName_capacity;
+ char* qSizeStr;
+ ssize_t qSizeStr_capacity;
uint64_t qSize;
+ char* qStartStr;
+ ssize_t qStartStr_capacity;
uint64_t qStart;
+ char* qEndStr;
+ ssize_t qEndStr_capacity;
uint64_t qEnd;
- char *tName;
+ char* tName;
+ ssize_t tName_capacity;
+ char* tSizeStr;
+ ssize_t tSizeStr_capacity;
uint64_t tSize;
+ char* tStartStr;
+ ssize_t tStartStr_capacity;
uint64_t tStart;
+ char* tEndStr;
+ ssize_t tEndStr_capacity;
uint64_t tEnd;
+ char* blockCountStr;
+ ssize_t blockCountStr_capacity;
uint64_t blockCount;
- char *blockSizes;
- char *qStarts;
- char *tStarts;
+ char* blockSizes;
+ ssize_t blockSizes_capacity;
+ char* qStarts;
+ ssize_t qStarts_capacity;
+ char* tStarts;
+ ssize_t tStarts_capacity;
} c2b_psl_t;
typedef struct block {
@@ -471,35 +510,35 @@ typedef struct block {
*/
typedef struct rmsk {
- char *sw_score;
+ char* sw_score;
ssize_t sw_score_capacity;
- char *perc_div;
+ char* perc_div;
ssize_t perc_div_capacity;
- char *perc_deleted;
+ char* perc_deleted;
ssize_t perc_deleted_capacity;
- char *perc_inserted;
+ char* perc_inserted;
ssize_t perc_inserted_capacity;
- char *query_seq;
+ char* query_seq;
ssize_t query_seq_capacity;
uint64_t query_start;
uint64_t query_end;
- char *bases_past_match;
+ char* bases_past_match;
ssize_t bases_past_match_capacity;
- char *strand;
+ char* strand;
ssize_t strand_capacity;
- char *repeat_name;
+ char* repeat_name;
ssize_t repeat_name_capacity;
- char *repeat_class;
+ char* repeat_class;
ssize_t repeat_class_capacity;
- char *bases_before_match_comp;
+ char* bases_before_match_comp;
ssize_t bases_before_match_comp_capacity;
- char *match_start;
+ char* match_start;
ssize_t match_start_capacity;
- char *match_end;
+ char* match_end;
ssize_t match_end_capacity;
- char *unique_id;
+ char* unique_id;
ssize_t unique_id_capacity;
- char *higher_score_match;
+ char* higher_score_match;
ssize_t higher_score_match_capacity;
} c2b_rmsk_t;
@@ -534,26 +573,26 @@ typedef struct rmsk {
*/
typedef struct vcf {
- char *chrom;
+ char* chrom;
ssize_t chrom_capacity;
uint64_t pos;
uint64_t start;
uint64_t end;
- char *id;
+ char* id;
ssize_t id_capacity;
- char *ref;
+ char* ref;
ssize_t ref_capacity;
- char *alt;
+ char* alt;
ssize_t alt_capacity;
- char *qual;
+ char* qual;
ssize_t qual_capacity;
- char *filter;
+ char* filter;
ssize_t filter_capacity;
- char *info;
+ char* info;
ssize_t info_capacity;
- char *format;
+ char* format;
ssize_t format_capacity;
- char *samples;
+ char* samples;
ssize_t samples_capacity;
} c2b_vcf_t;
@@ -592,9 +631,9 @@ typedef struct vcf {
#define MAX_PIPES 4
typedef struct pipeset {
- int **in;
- int **out;
- int **err;
+ int** in;
+ int** out;
+ int** err;
size_t num;
} c2b_pipeset_t;
@@ -607,12 +646,12 @@ typedef struct pipeset {
*/
typedef struct pipeline_stage {
- c2b_pipeset_t *pipeset;
+ c2b_pipeset_t* pipeset;
unsigned int src;
unsigned int dest;
void (*line_functor)();
int status;
- char *description;
+ char* description;
pid_t pid;
ssize_t buffer_size;
} c2b_pipeline_stage_t;
@@ -631,18 +670,28 @@ typedef struct pipeline_stage {
#define POPEN4_FLAG_CLOSE_CHILD_STDOUT (1U << 4)
#define POPEN4_FLAG_CLOSE_CHILD_STDERR (1U << 5)
-static const char *application_name = "convert2bed";
+static const char* application_name = "convert2bed";
-static const char *application_version = C2B_VERSION;
+static const char* application_version = C2B_VERSION;
+
+#if BEDOPS_BINARY_TYPE == 0
+static const char* application_type = "typical";
+#else
+#if BEDOPS_BINARY_TYPE == 1
+static const char* application_type = "megarow";
+#else
+static const char* application_type = "typical";
+#endif
+#endif
-static const char *application_authors = "Alex Reynolds";
+static const char* application_authors = "Alex Reynolds";
-static const char *general_usage = "\n" \
+static const char* general_usage = "\n" \
" Usage:\n" \
"\n" \
" $ convert2bed --input=fmt [--output=fmt] [options] < input > output\n";
-static const char *general_description = \
+static const char* general_description = \
" Convert BAM, GFF, GTF, GVF, PSL, RepeatMasker (OUT), SAM, VCF\n" \
" and WIG genomic formats to BED or BEDOPS Starch (compressed BED)\n" \
"\n" \
@@ -651,7 +700,7 @@ static const char *general_description = \
"\n" \
" $ some_upstream_process ... | convert2bed --input=fmt - > output\n";
-static const char *general_io_options = \
+static const char* general_io_options = \
" Input (required):\n\n" \
" --input=[bam|gff|gtf|gvf|psl|rmsk|sam|vcf|wig] (-i <fmt>)\n" \
" Genomic format of input file (required)\n\n" \
@@ -659,7 +708,7 @@ static const char *general_io_options = \
" --output=[bed|starch] (-o <fmt>)\n" \
" Format of output file, either BED or BEDOPS Starch (optional, default is BED)\n";
-static const char *general_options = \
+static const char* general_options = \
" Other processing options:\n\n" \
" --do-not-sort (-d)\n" \
" Do not sort BED output with sort-bed (not compatible with --output=starch)\n" \
@@ -683,9 +732,9 @@ static const char *general_options = \
" --version (-w)\n" \
" Show application version\n";
-static const char *bam_name = "convert2bed -i bam";
+static const char* bam_name = "convert2bed -i bam";
-static const char *bam_description = \
+static const char* bam_description = \
" The BAM format is an indexed, binary representation of a SAM (Sequence\n" \
" Alignment/Map) file. Internally, it is a 0-based, half-open [a-1,b)\n" \
" file, but printing it to text via samtools turns it into a SAM file, which\n" \
@@ -729,7 +778,7 @@ static const char *bam_description = \
" --keep-header option to preserve the header data from the SAM input as\n" \
" pseudo-BED elements that use the \"_header\" chromosome name.\n";
-static const char *bam_options = \
+static const char* bam_options = \
" BAM conversion options:\n\n" \
" --all-reads (-a)\n" \
" Include both unmapped and mapped reads in output\n" \
@@ -737,9 +786,14 @@ static const char *bam_options = \
" Preserve header section as pseudo-BED elements\n" \
" --split (-s)\n" \
" Split reads with 'N' CIGAR operations into separate BED\n" \
- " elements\n";
-
-static const char *bam_usage = \
+ " elements\n" \
+ " --split-with-deletions (-S)\n" \
+ " Split reads with 'N' and 'D' CIGAR operations into\n" \
+ " separate elements\n" \
+ " --reduced (-R)\n" \
+ " Only print first six columns of output\n";
+
+static const char* bam_usage = \
" Converts 0-based, half-open [a-1,b) headered or headerless BAM input\n" \
" into 0-based, half-open [a-1,b) extended BED or BEDOPS Starch\n\n" \
" Usage:\n" \
@@ -760,9 +814,9 @@ static const char *bam_usage = \
"\n" \
" $ bam2bed --do-not-sort < foo.bam > unsorted-foo.bam.bed\n";
-static const char *gff_name = "convert2bed -i gff";
+static const char* gff_name = "convert2bed -i gff";
-static const char *gff_description = \
+static const char* gff_description = \
" The GFF3 specification (http://www.sequenceontology.org/gff3.shtml) \n" \
" contains columns that do not map directly to common or UCSC BED columns.\n" \
" Therefore, we add the following columns to preserve the ability to\n" \
@@ -792,12 +846,12 @@ static const char *gff_description = \
" option to preserve these data as pseudo-BED elements that use the \"_header\"\n" \
" chromosome name.\n";
-static const char *gff_options = \
+static const char* gff_options = \
" GFF conversion options:\n\n" \
" --keep-header (-k)\n" \
" Preserve header section as pseudo-BED elements\n";
-static const char *gff_usage = \
+static const char* gff_usage = \
" Converts 1-based, closed [a, b] GFF3 input into 0-based, half-\n" \
" open [a-1, b) six-column extended BED or BEDOPS Starch\n" \
"\n" \
@@ -819,9 +873,9 @@ static const char *gff_usage = \
"\n" \
" $ gff2bed --do-not-sort < foo.gff > unsorted-foo.gff.bed\n";
-static const char *gtf_name = "convert2bed -i gtf";
+static const char* gtf_name = "convert2bed -i gtf";
-static const char *gtf_usage = \
+static const char* gtf_usage = \
" Converts 1-based, closed [a, b] GTF2.2 input into 0-based, half-\n" \
" open [a-1, b) six-column extended BED and BEDOPS Starch\n" \
"\n" \
@@ -843,7 +897,7 @@ static const char *gtf_usage = \
"\n" \
" $ gtf2bed --do-not-sort < foo.gtf > unsorted-foo.gtf.bed\n";
-static const char *gtf_description = \
+static const char* gtf_description = \
" The GTF2.2 specification (http://mblab.wustl.edu/GTF22.html)\n" \
" contains columns that do not map directly to common or UCSC BED columns.\n" \
" Therefore, we add the following columns to preserve the ability to\n" \
@@ -870,11 +924,11 @@ static const char *gtf_description = \
" and a 'zero_length_insertion' attribute is added to the 'attributes' GTF\n" \
" column data.\n";
-static const char *gtf_options = NULL;
+static const char* gtf_options = NULL;
-static const char *gvf_name = "convert2bed -i gvf";
+static const char* gvf_name = "convert2bed -i gvf";
-static const char *gvf_description = \
+static const char* gvf_description = \
" GVF is a type of GFF3 file with additional pragmas and attributes \n" \
" specified (http://www.sequenceontology.org/resources/gvf.html).\n" \
" The GVF format has the same nine-column tab-delimited format as \n" \
@@ -910,12 +964,12 @@ static const char *gvf_description = \
" option to preserve these data as pseudo-BED elements that use the \"_header\"\n" \
" chromosome name.\n";
-static const char *gvf_options = \
+static const char* gvf_options = \
" GVF conversion options:\n\n" \
" --keep-header (-k)\n" \
" Preserve header section as pseudo-BED elements\n";
-static const char *gvf_usage = \
+static const char* gvf_usage = \
" Converts 1-based, closed [a, b] GVF (GFF3) input into 0-based,\n" \
" half-open [a-1, b) six-column extended BED or BEDOPS Starch\n" \
"\n" \
@@ -937,9 +991,9 @@ static const char *gvf_usage = \
"\n" \
" $ gvf2bed --do-not-sort < foo.gvf > unsorted-foo.gvf.bed\n";
-static const char *psl_name = "convert2bed -i psl";
+static const char* psl_name = "convert2bed -i psl";
-static const char *psl_usage = \
+static const char* psl_usage = \
" Converts 0-based, half-open [a-1, b) headered or headerless PSL\n" \
" input into 0-based, half-open [a-1, b) extended BED or BEDOPS Starch\n" \
"\n" \
@@ -959,7 +1013,7 @@ static const char *psl_usage = \
"\n" \
" $ psl2bed --do-not-sort < foo.psl > unsorted-foo.psl.bed\n";
-static const char *psl_description = \
+static const char* psl_description = \
" The PSL specification (http://genome.ucsc.edu/goldenPath/help/blatSpec.html)\n" \
" contains 21 columns, some which map to UCSC BED columns and some which do not.\n" \
"\n" \
@@ -1004,16 +1058,16 @@ static const char *psl_description = \
" - qStarts\n" \
" - tStarts\n";
-static const char *psl_options = \
+static const char* psl_options = \
" PSL conversion options:\n\n" \
" --keep-header (-k)\n" \
" Preserve header section as pseudo-BED elements (requires --headered)\n" \
" --split (-s)\n" \
" Split record into multiple BED elements, based on tStarts field value\n";
-static const char *rmsk_name = "convert2bed -i rmsk";
+static const char* rmsk_name = "convert2bed -i rmsk";
-static const char *rmsk_usage = \
+static const char* rmsk_usage = \
" Converts 1-base, closed [a, b] RepeatMasker annotation input\n" \
" into 0-based, half-open [a-1, b) extended BED or BEDOPS Starch\n" \
"\n" \
@@ -1035,7 +1089,7 @@ static const char *rmsk_usage = \
"\n" \
" $ rmsk2bed --do-not-sort < foo.out > unsorted-foo.out.bed\n";
-static const char *rmsk_description = \
+static const char* rmsk_description = \
" The RepeatMasker annotation format is 1-based and closed [a, b]\n" \
" which is converted to 0-based, half-closed [a-1, b) when creating\n" \
" BED output.\n" \
@@ -1068,14 +1122,14 @@ static const char *rmsk_description = \
" to RepeatMasker annotation output with a simple awk statement or other script\n" \
" that calculates 1-based coordinates and permutes columns.\n";
-static const char *rmsk_options = \
+static const char* rmsk_options = \
" RepeatMasker annotation conversion options:\n\n" \
" --keep-header (-k)\n" \
" Preserve header section as pseudo-BED elements\n";
-static const char *sam_name = "convert2bed -i sam";
+static const char* sam_name = "convert2bed -i sam";
-static const char *sam_usage = \
+static const char* sam_usage = \
" Converts 1-based, closed [a, b] headered or headerless SAM input\n" \
" into 0-based, half-open [a-1, b) extended BED or BEDOPS Starch\n" \
"\n" \
@@ -1097,7 +1151,7 @@ static const char *sam_usage = \
"\n" \
" $ sam2bed --do-not-sort < foo.sam > unsorted-foo.sam.bed\n";
-static const char *sam_description = \
+static const char* sam_description = \
" The SAM (Sequence Alignment/Map) format is 1-based and closed [a, b]\n" \
" which is converted to 0-based, half-closed [a-1, b) when creating\n" \
" BED output.\n" \
@@ -1139,7 +1193,7 @@ static const char *sam_description = \
" --keep-header option to preserve the header data from the SAM input as\n" \
" pseudo-BED elements.\n";
-static const char *sam_options = \
+static const char* sam_options = \
" SAM conversion options:\n\n" \
" --all-reads (-a)\n" \
" Include both unmapped and mapped reads in output\n" \
@@ -1147,11 +1201,16 @@ static const char *sam_options = \
" Preserve header section as pseudo-BED elements\n" \
" --split (-s)\n" \
" Split reads with 'N' CIGAR operations into separate BED\n" \
- " elements\n";
+ " elements\n" \
+ " --split-with-deletions (-S)\n" \
+ " Split reads with 'N' and 'D' CIGAR operations into\n" \
+ " separate elements\n" \
+ " --reduced (-R)\n" \
+ " Only print first six columns of output\n";
-static const char *vcf_name = "convert2bed -i vcf";
+static const char* vcf_name = "convert2bed -i vcf";
-static const char *vcf_usage = \
+static const char* vcf_usage = \
" Converts 1-based, closed [a, b] VCF v4 input into 0-based,\n" \
" half-open [a-1, b) extended BED or BEDOPS Starch\n" \
"\n" \
@@ -1173,7 +1232,7 @@ static const char *vcf_usage = \
"\n" \
" $ vcf2bed --do-not-sort < foo.vcf > unsorted-foo.vcf.bed\n";
-static const char *vcf_description = \
+static const char* vcf_description = \
" This conversion utility relies on the VCF v4.2 format, with its\n" \
" specifications outlined here by the 1000 Genomes and Samtools projects:\n" \
"\n" \
@@ -1207,7 +1266,7 @@ static const char *vcf_description = \
" problems. It may be useful to validate the VCF v4.2 input\n" \
" before conversion.\n";
-static const char *vcf_options = \
+static const char* vcf_options = \
" VCF conversion options:\n\n" \
" --do-not-split (-p)\n" \
" By default, this application prints multiple BED elements for each alternate\n" \
@@ -1221,9 +1280,9 @@ static const char *vcf_options = \
" --keep-header (-k)\n" \
" Preserve header section as pseudo-BED elements\n";
-static const char *wig_name = "convert2bed -i wig";
+static const char* wig_name = "convert2bed -i wig";
-static const char *wig_usage = \
+static const char* wig_usage = \
" Convert UCSC Wiggle to extended BED or BEDOPS Starch\n" \
"\n" \
" Usage:\n" \
@@ -1244,7 +1303,7 @@ static const char *wig_usage = \
"\n" \
" $ wig2bed --do-not-sort < foo.wig > unsorted-foo.wig.bed\n";
-static const char *wig_description = \
+static const char* wig_description = \
" The UCSC Wiggle format (http://genome.ucsc.edu/goldenPath/help/wiggle.html)\n" \
" is 1-based, closed [a, b] and is offered in variable or fixed step varieties.\n" \
" We convert either variety to 0-based, half-open [a-1, b) indexing when creating\n" \
@@ -1253,7 +1312,7 @@ static const char *wig_description = \
" By default, data are passed internally to BEDOPS sort-bed to provide sorted\n" \
" output ready for use with other BEDOPS utilities.\n";
-static const char *wig_options = \
+static const char* wig_options = \
" WIG conversion options:\n\n" \
" --keep-header (-k)\n" \
" Preserve header section as pseudo-BED elements\n" \
@@ -1266,35 +1325,36 @@ static const char *wig_options = \
" with input derived from bigWigToWig, for example, where the bigWig\n" \
" data are originally zero-indexed.\n";
-static const char *format_undefined_usage = \
+static const char* format_undefined_usage = \
" Note: Please specify format to get detailed usage parameters:\n\n" \
" --help[-bam|-gff|-gtf|-gvf|-psl|-rmsk|-sam|-vcf|-wig] (-h <fmt>)\n";
typedef struct gff_state {
- c2b_gff_t *element;
+ c2b_gff_t* element;
} c2b_gff_state_t;
typedef struct gtf_state {
- c2b_gtf_t *element;
+ c2b_gtf_t* element;
uint64_t line_count;
} c2b_gtf_state_t;
typedef struct psl_state {
+ c2b_psl_t* element;
boolean is_headered;
- c2b_psl_block_t *block;
+ c2b_psl_block_t* block;
} c2b_psl_state_t;
typedef struct rmsk_state {
- c2b_rmsk_t *element;
+ c2b_rmsk_t* element;
uint64_t line;
boolean is_start_of_line;
boolean is_start_of_gap;
} c2b_rmsk_state_t;
typedef struct sam_state {
- char *samtools_path;
- c2b_cigar_t *cigar;
- c2b_sam_t *element;
+ char* samtools_path;
+ c2b_cigar_t* cigar;
+ c2b_sam_t* element;
} c2b_sam_state_t;
typedef struct vcf_state {
@@ -1315,162 +1375,170 @@ typedef struct wig_state {
uint64_t start_pos;
uint64_t end_pos;
double score;
- char *chr;
- char *id;
+ char* chr;
+ char* id;
boolean is_fixed_step;
boolean start_write;
- char *basename;
+ char* basename;
int start_shift;
int end_shift;
} c2b_wig_state_t;
typedef struct cat_params {
- char *path;
+ char* path;
} c2b_cat_params_t;
typedef struct sort_params {
boolean is_enabled;
- char *sort_bed_path;
- char *max_mem_value;
- char *sort_tmpdir_path;
+ char* sort_bed_path;
+ char* max_mem_value;
+ char* sort_tmpdir_path;
} c2b_sort_params_t;
typedef struct starch_params {
- char *path;
+ char* path;
boolean bzip2;
boolean gzip;
- char *note;
+ char* note;
} c2b_starch_params_t;
static struct globals {
c2b_format_t help_format_idx;
- char *input_format;
+ char* input_format;
c2b_format_t input_format_idx;
- char *output_format;
+ char* output_format;
c2b_format_t output_format_idx;
unsigned int header_line_idx;
boolean all_reads_flag;
boolean keep_header_flag;
boolean split_flag;
+ boolean split_with_deletions_flag;
+ boolean reduced_flag;
boolean zero_indexed_flag;
- c2b_gff_state_t *gff;
- c2b_gtf_state_t *gtf;
- c2b_psl_state_t *psl;
- c2b_rmsk_state_t *rmsk;
- c2b_sam_state_t *sam;
- c2b_vcf_state_t *vcf;
- c2b_wig_state_t *wig;
- c2b_cat_params_t *cat;
- c2b_sort_params_t *sort;
- c2b_starch_params_t *starch;
+ c2b_gff_state_t* gff;
+ c2b_gtf_state_t* gtf;
+ c2b_psl_state_t* psl;
+ c2b_rmsk_state_t* rmsk;
+ c2b_sam_state_t* sam;
+ c2b_vcf_state_t* vcf;
+ c2b_wig_state_t* wig;
+ c2b_cat_params_t* cat;
+ c2b_sort_params_t* sort;
+ c2b_starch_params_t* starch;
+ char* src_line_str;
+ char* dest_line_str;
} c2b_globals;
static struct option c2b_client_long_options[] = {
- { "input", required_argument, NULL, 'i' },
- { "output", required_argument, NULL, 'o' },
- { "do-not-sort", no_argument, NULL, 'd' },
- { "all-reads", no_argument, NULL, 'a' },
- { "keep-header", no_argument, NULL, 'k' },
- { "split", no_argument, NULL, 's' },
- { "do-not-split", no_argument, NULL, 'p' },
- { "snvs", no_argument, NULL, 'v' },
- { "insertions", no_argument, NULL, 't' },
- { "deletions", no_argument, NULL, 'n' },
- { "starch-bzip2", no_argument, NULL, 'z' },
- { "starch-gzip", no_argument, NULL, 'g' },
- { "starch-note", required_argument, NULL, 'e' },
- { "max-mem", required_argument, NULL, 'm' },
- { "sort-tmpdir", required_argument, NULL, 'r' },
- { "multisplit", required_argument, NULL, 'b' },
- { "zero-indexed", no_argument, NULL, 'x' },
- { "help", no_argument, NULL, 'h' },
- { "version", no_argument, NULL, 'w' },
- { "help-bam", no_argument, NULL, '1' },
- { "help-gff", no_argument, NULL, '2' },
- { "help-gtf", no_argument, NULL, '3' },
- { "help-gvf", no_argument, NULL, '4' },
- { "help-psl", no_argument, NULL, '5' },
- { "help-rmsk", no_argument, NULL, '6' },
- { "help-sam", no_argument, NULL, '7' },
- { "help-vcf", no_argument, NULL, '8' },
- { "help-wig", no_argument, NULL, '9' },
- { NULL, no_argument, NULL, 0 }
+ { "input", required_argument, NULL, 'i' },
+ { "output", required_argument, NULL, 'o' },
+ { "do-not-sort", no_argument, NULL, 'd' },
+ { "all-reads", no_argument, NULL, 'a' },
+ { "keep-header", no_argument, NULL, 'k' },
+ { "split", no_argument, NULL, 's' },
+ { "split-with-deletions", no_argument, NULL, 'S' },
+ { "do-not-split", no_argument, NULL, 'p' },
+ { "reduced", no_argument, NULL, 'R' },
+ { "snvs", no_argument, NULL, 'v' },
+ { "insertions", no_argument, NULL, 't' },
+ { "deletions", no_argument, NULL, 'n' },
+ { "starch-bzip2", no_argument, NULL, 'z' },
+ { "starch-gzip", no_argument, NULL, 'g' },
+ { "starch-note", required_argument, NULL, 'e' },
+ { "max-mem", required_argument, NULL, 'm' },
+ { "sort-tmpdir", required_argument, NULL, 'r' },
+ { "multisplit", required_argument, NULL, 'b' },
+ { "zero-indexed", no_argument, NULL, 'x' },
+ { "help", no_argument, NULL, 'h' },
+ { "version", no_argument, NULL, 'w' },
+ { "help-bam", no_argument, NULL, '1' },
+ { "help-gff", no_argument, NULL, '2' },
+ { "help-gtf", no_argument, NULL, '3' },
+ { "help-gvf", no_argument, NULL, '4' },
+ { "help-psl", no_argument, NULL, '5' },
+ { "help-rmsk", no_argument, NULL, '6' },
+ { "help-sam", no_argument, NULL, '7' },
+ { "help-vcf", no_argument, NULL, '8' },
+ { "help-wig", no_argument, NULL, '9' },
+ { NULL, no_argument, NULL, 0 }
};
-static const char *c2b_client_opt_string = "i:o:dakspvtnzge:m:r:b:xhw12345678?";
+static const char* c2b_client_opt_string = "i:o:daksSpRvtnzge:m:r:b:xhw12345678?";
#ifdef __cplusplus
extern "C" {
#endif
- static void c2b_init_conversion(c2b_pipeset_t *p);
- static void c2b_init_gff_conversion(c2b_pipeset_t *p);
- static void c2b_init_gtf_conversion(c2b_pipeset_t *p);
- static void c2b_init_gvf_conversion(c2b_pipeset_t *p);
- static void c2b_init_psl_conversion(c2b_pipeset_t *p);
- static void c2b_init_rmsk_conversion(c2b_pipeset_t *p);
- static void c2b_init_sam_conversion(c2b_pipeset_t *p);
- static void c2b_init_vcf_conversion(c2b_pipeset_t *p);
- static void c2b_init_wig_conversion(c2b_pipeset_t *p);
- static void c2b_init_generic_conversion(c2b_pipeset_t *p, void(*to_bed_line_functor)(char *, ssize_t *, char *, ssize_t));
- static void c2b_init_bam_conversion(c2b_pipeset_t *p);
- static inline void c2b_cmd_cat_stdin(char *cmd);
- static inline void c2b_cmd_bam_to_sam(char *cmd);
- static inline void c2b_cmd_sort_bed(char *cmd);
- static inline void c2b_cmd_starch_bed(char *cmd);
- static void c2b_gtf_init_element(c2b_gtf_t **e);
- static void c2b_gtf_delete_element(c2b_gtf_t *e);
- static void c2b_line_convert_gtf_to_bed_unsorted(char *dest, ssize_t *dest_size, char *src, ssize_t src_size);
- static inline void c2b_line_convert_gtf_ptr_to_bed(c2b_gtf_t *g, char *dest_line, ssize_t *dest_size);
- static void c2b_gff_init_element(c2b_gff_t **e);
- static void c2b_gff_delete_element(c2b_gff_t *e);
- static void c2b_line_convert_gff_to_bed_unsorted(char *dest, ssize_t *dest_size, char *src, ssize_t src_size);
- static inline void c2b_line_convert_gff_ptr_to_bed(c2b_gff_t *g, char *dest_line, ssize_t *dest_size);
- static void c2b_line_convert_psl_to_bed_unsorted(char *dest, ssize_t *dest_size, char *src, ssize_t src_size);
- static inline void c2b_psl_blockSizes_to_ptr(char *s, uint64_t bc);
- static inline void c2b_psl_tStarts_to_ptr(char *s, uint64_t bc);
- static inline void c2b_line_convert_psl_to_bed(c2b_psl_t p, char *dest_line, ssize_t *dest_size);
- static void c2b_rmsk_init_element(c2b_rmsk_t **e);
- static void c2b_rmsk_delete_element(c2b_rmsk_t *e);
- static void c2b_line_convert_rmsk_to_bed_unsorted(char *dest, ssize_t *dest_size, char *src, ssize_t src_size);
- static inline void c2b_line_convert_rmsk_ptr_to_bed(c2b_rmsk_t *r, char *dest_line, ssize_t *dest_size);
- static void c2b_line_convert_sam_to_bed_unsorted_without_split_operation(char *dest, ssize_t *dest_size, char *src, ssize_t src_size);
- static void c2b_line_convert_sam_to_bed_unsorted_with_split_operation(char *dest, ssize_t *dest_size, char *src, ssize_t src_size);
- static inline void c2b_sam_cigar_str_to_ops(char *s);
- static void c2b_sam_init_element(c2b_sam_t **e);
- static void c2b_sam_delete_element(c2b_sam_t *e);
- static void c2b_sam_init_cigar_ops(c2b_cigar_t **c, const ssize_t size);
- static void c2b_sam_resize_cigar_ops(c2b_cigar_t **new_c, c2b_cigar_t *old_c);
- static void c2b_sam_debug_cigar_ops(c2b_cigar_t *c);
- static void c2b_sam_delete_cigar_ops(c2b_cigar_t *c);
- static inline void c2b_line_convert_sam_ptr_to_bed(c2b_sam_t *s, char *dest_line, ssize_t *dest_size, boolean print_modified_qname);
- static void c2b_line_convert_vcf_to_bed_unsorted(char *dest, ssize_t *dest_size, char *src, ssize_t src_size);
- static inline boolean c2b_vcf_allele_is_id(char *s);
- static inline boolean c2b_vcf_record_is_snv(char *ref, char *alt);
- static inline boolean c2b_vcf_record_is_insertion(char *ref, char *alt);
- static inline boolean c2b_vcf_record_is_deletion(char *ref, char *alt);
- static void c2b_vcf_init_element(c2b_vcf_t **e);
- static void c2b_vcf_delete_element(c2b_vcf_t *e);
- static inline void c2b_line_convert_vcf_ptr_to_bed(c2b_vcf_t *v, char *dest_line, ssize_t *dest_size);
- static void c2b_line_convert_wig_to_bed_unsorted(char *dest, ssize_t *dest_size, char *src, ssize_t src_size);
+ static void c2b_init_conversion(c2b_pipeset_t* p);
+ static void c2b_init_gff_conversion(c2b_pipeset_t* p);
+ static void c2b_init_gtf_conversion(c2b_pipeset_t* p);
+ static void c2b_init_gvf_conversion(c2b_pipeset_t* p);
+ static void c2b_init_psl_conversion(c2b_pipeset_t* p);
+ static void c2b_init_rmsk_conversion(c2b_pipeset_t* p);
+ static void c2b_init_sam_conversion(c2b_pipeset_t* p);
+ static void c2b_init_vcf_conversion(c2b_pipeset_t* p);
+ static void c2b_init_wig_conversion(c2b_pipeset_t* p);
+ static void c2b_init_generic_conversion(c2b_pipeset_t* p, void(*to_bed_line_functor)(char**, ssize_t*, ssize_t*, char*, ssize_t));
+ static void c2b_init_bam_conversion(c2b_pipeset_t* p);
+ static inline void c2b_cmd_cat_stdin(char* cmd);
+ static inline void c2b_cmd_bam_to_sam(char* cmd);
+ static inline void c2b_cmd_sort_bed(char* cmd);
+ static inline void c2b_cmd_starch_bed(char* cmd);
+ static void c2b_gtf_init_element(c2b_gtf_t** e);
+ static void c2b_gtf_delete_element(c2b_gtf_t* e);
+ static void c2b_line_convert_gtf_to_bed_unsorted(char** dest, ssize_t* dest_size, ssize_t* dest_capacity, char* src, ssize_t src_size);
+ static inline void c2b_line_convert_gtf_ptr_to_bed(c2b_gtf_t* g, char** dest_line_ptr, ssize_t* dest_size, ssize_t* dest_capacity);
+ static void c2b_gff_init_element(c2b_gff_t** e);
+ static void c2b_gff_delete_element(c2b_gff_t* e);
+ static void c2b_line_convert_gff_to_bed_unsorted(char** dest, ssize_t* dest_size, ssize_t* dest_capacity, char* src, ssize_t src_size);
+ static inline void c2b_line_convert_gff_ptr_to_bed(c2b_gff_t* g, char** dest_line_ptr, ssize_t* dest_size, ssize_t* dest_capacity);
+ static void c2b_psl_init_element(c2b_psl_t** e);
+ static void c2b_psl_delete_element(c2b_psl_t* e);
+ static void c2b_line_convert_psl_to_bed_unsorted(char** dest, ssize_t* dest_size, ssize_t* dest_capacity, char* src, ssize_t src_size);
+ static inline void c2b_psl_blockSizes_to_ptr(char* s, uint64_t bc);
+ static inline void c2b_psl_tStarts_to_ptr(char* s, uint64_t bc);
+ static inline void c2b_line_convert_psl_ptr_to_bed(c2b_psl_t* p, char** dest_line_ptr, ssize_t* dest_size, ssize_t* dest_capacity);
+ static void c2b_rmsk_init_element(c2b_rmsk_t** e);
+ static void c2b_rmsk_delete_element(c2b_rmsk_t* e);
+ static void c2b_line_convert_rmsk_to_bed_unsorted(char** dest, ssize_t* dest_size, ssize_t* dest_capacity, char* src, ssize_t src_size);
+ static inline void c2b_line_convert_rmsk_ptr_to_bed(c2b_rmsk_t* r, char** dest_line_ptr, ssize_t* dest_size, ssize_t* dest_capacity);
+ static void c2b_line_convert_sam_to_bed_unsorted_without_split_operation(char** dest, ssize_t* dest_size, ssize_t* dest_capacity, char* src, ssize_t src_size);
+ static void c2b_line_convert_sam_to_bed_unsorted_with_split_operation(char** dest, ssize_t* dest_size, ssize_t* dest_capacity, char* src, ssize_t src_size);
+ static inline void c2b_sam_cigar_str_to_ops(char* s);
+ static void c2b_sam_init_element(c2b_sam_t** e);
+ static void c2b_sam_delete_element(c2b_sam_t* e);
+ static void c2b_sam_init_cigar_ops(c2b_cigar_t** c, const ssize_t size);
+ static void c2b_sam_resize_cigar_ops(c2b_cigar_t** new_c, c2b_cigar_t* old_c);
+ static void c2b_sam_debug_cigar_ops(c2b_cigar_t* c);
+ static void c2b_sam_delete_cigar_ops(c2b_cigar_t* c);
+ static inline void c2b_line_convert_sam_ptr_to_bed(c2b_sam_t* s, char** dest_line_ptr, ssize_t* dest_size, ssize_t* dest_capacity, boolean print_modified_qname);
+ static void c2b_line_convert_vcf_to_bed_unsorted(char** dest, ssize_t* dest_size, ssize_t* dest_capacity, char* src, ssize_t src_size);
+ static inline boolean c2b_vcf_allele_is_id(char* s);
+ static inline boolean c2b_vcf_record_is_snv(char* ref, char* alt);
+ static inline boolean c2b_vcf_record_is_insertion(char* ref, char* alt);
+ static inline boolean c2b_vcf_record_is_deletion(char* ref, char* alt);
+ static void c2b_vcf_init_element(c2b_vcf_t** e);
+ static void c2b_vcf_delete_element(c2b_vcf_t* e);
+ static inline void c2b_line_convert_vcf_ptr_to_bed(c2b_vcf_t* v, char** dest_line_ptr, ssize_t* dest_size, ssize_t* dest_capacity);
+ static void c2b_line_convert_wig_to_bed_unsorted(char** dest, ssize_t* dest_size, ssize_t* dest_capacity, char* src, ssize_t src_size);
static void * c2b_read_bytes_from_stdin(void *arg);
- static void * c2b_process_intermediate_bytes_by_lines(void *arg);
- static void * c2b_write_in_bytes_to_in_process(void *arg);
- static void * c2b_write_out_bytes_to_in_process(void *arg);
- static void * c2b_write_in_bytes_to_stdout(void *arg);
- static void * c2b_write_out_bytes_to_stdout(void *arg);
- static void c2b_memrchr_offset(ssize_t *offset, char *buf, ssize_t buf_size, ssize_t len, char delim);
- static void c2b_init_pipeset(c2b_pipeset_t *p, const size_t num);
- static void c2b_debug_pipeset(c2b_pipeset_t *p, const size_t num);
- static void c2b_delete_pipeset(c2b_pipeset_t *p);
+ static void * c2b_process_intermediate_bytes_by_lines(void* arg);
+ static void * c2b_write_in_bytes_to_in_process(void* arg);
+ static void * c2b_write_out_bytes_to_in_process(void* arg);
+ static void * c2b_write_in_bytes_to_stdout(void* arg);
+ static void * c2b_write_out_bytes_to_stdout(void* arg);
+ static void c2b_memrchr_offset(ssize_t* offset, char* buf, ssize_t buf_size, ssize_t len, char delim);
+ static void c2b_init_pipeset(c2b_pipeset_t* p, const size_t num);
+ static void c2b_debug_pipeset(c2b_pipeset_t* p, const size_t num);
+ static void c2b_delete_pipeset(c2b_pipeset_t* p);
static void c2b_set_close_exec_flag(int fd);
static void c2b_unset_close_exec_flag(int fd);
static int c2b_pipe4(int fd[2], int flags);
static pid_t c2b_popen4(const char* cmd, int pin[2], int pout[2], int perr[2], int flags);
static void c2b_test_dependencies();
- static boolean c2b_print_matches(char *path, char *fn);
- static char * c2b_strsep(char **stringp, const char *delim);
- static boolean c2b_is_there(char *candidate);
+ static boolean c2b_print_matches(char* path, char* fn);
+ static char * c2b_strsep(char** stringp, const char* delim);
+ static boolean c2b_is_there(char* candidate);
static void c2b_init_globals();
static void c2b_delete_globals();
static void c2b_init_global_gff_state();
@@ -1493,13 +1561,13 @@ extern "C" {
static void c2b_delete_global_sort_params();
static void c2b_init_global_starch_params();
static void c2b_delete_global_starch_params();
- static void c2b_init_command_line_options(int argc, char **argv);
- static void c2b_print_version(FILE *stream);
- static void c2b_print_usage(FILE *stream);
- static void c2b_print_format_usage(FILE *stream);
- static char * c2b_to_lowercase(const char *src);
- static c2b_format_t c2b_to_input_format(const char *input_format);
- static c2b_format_t c2b_to_output_format(const char *output_format);
+ static void c2b_init_command_line_options(int argc, char** argv);
+ static void c2b_print_version(FILE* stream);
+ static void c2b_print_usage(FILE* stream);
+ static void c2b_print_format_usage(FILE* stream);
+ static char* c2b_to_lowercase(const char* src);
+ static c2b_format_t c2b_to_input_format(const char* input_format);
+ static c2b_format_t c2b_to_output_format(const char* output_format);
#ifdef __cplusplus
}
diff --git a/applications/bed/conversion/src/tests/bam/split2.bam b/applications/bed/conversion/src/tests/bam/split2.bam
new file mode 100644
index 0000000..8806fa3
Binary files /dev/null and b/applications/bed/conversion/src/tests/bam/split2.bam differ
diff --git a/applications/bed/conversion/src/tests/bam/split2.sam b/applications/bed/conversion/src/tests/bam/split2.sam
new file mode 100644
index 0000000..650bb00
--- /dev/null
+++ b/applications/bed/conversion/src/tests/bam/split2.sam
@@ -0,0 +1,29 @@
+ at HD VN:1.4 SO:coordinate
+ at SQ SN:chr1 LN:249250621
+ at SQ SN:chr10 LN:135534747
+ at SQ SN:chr11 LN:135006516
+ at SQ SN:chr12 LN:133851895
+ at SQ SN:chr13 LN:115169878
+ at SQ SN:chr14 LN:107349540
+ at SQ SN:chr15 LN:102531392
+ at SQ SN:chr16 LN:90354753
+ at SQ SN:chr17 LN:81195210
+ at SQ SN:chr18 LN:78077248
+ at SQ SN:chr19 LN:59128983
+ at SQ SN:chr2 LN:243199373
+ at SQ SN:chr20 LN:63025520
+ at SQ SN:chr21 LN:48129895
+ at SQ SN:chr22 LN:51304566
+ at SQ SN:chr3 LN:198022430
+ at SQ SN:chr4 LN:191154276
+ at SQ SN:chr5 LN:180915260
+ at SQ SN:chr6 LN:171115067
+ at SQ SN:chr7 LN:159138663
+ at SQ SN:chr8 LN:146364022
+ at SQ SN:chr9 LN:141213431
+ at SQ SN:chrM LN:16571
+ at SQ SN:chrX LN:155270560
+ at SQ SN:chrY LN:59373566
+ at PG ID:TopHat VN:2.0.13 CL:/net/lebowski/vol1/sw/tophat/2.0.13/tophat --GTF /home/nelsonjs/code/stampipes/data/tophat/refseq/hg19/genes.gtf -r 200 --mate-std-dev 300 --library-type fr-unstranded -p 8 -o DS27050_TCCGGAGA-TCAGAGCC_L001_tophat_001 /home/nelsonjs/code/stampipes/data/tophat/refseq/hg19/hg19 trimmed/DS27050_TCCGGAGA-TCAGAGCC_L001_R1_001.fastq.gz trimmed/DS27050_TCCGGAGA-TCAGAGCC_L001_R2_001.fastq.gz
+ at PG ID:MarkDuplicates PN:MarkDuplicates VN:1.118(2329276ea55d31ab6b19bab55b9ee7b51e4a446e_1406559781) CL:picard.sam.MarkDuplicates INPUT=[DS27050_TCCGGAGA-TCAGAGCC_L001.tophat_merged.bam] OUTPUT=DS27050_TCCGGAGA-TCAGAGCC_L001.hg19.bam METRICS_FILE=DS27050_TCCGGAGA-TCAGAGCC_L001.spotdups.txt REMOVE_DUPLICATES=false ASSUME_SORTED=true PROGRAM_RECORD_ID=MarkDuplicates PROGRAM_GROUP_NAME=MarkDuplicates MAX_SEQUENCES_FOR_DISK_READ_ENDS_MAP=50000 MAX_FILE_HANDLES_FOR_READ_ENDS_MAP=8000 SORT [...]
+NS500372:42:H2JWJBGXX:2:12207:2947:19765 81 chr19 7695545 50 1M163N23M1D1M626N11M = 7694707 -1663 GAGGGAGCTGTGGCCACCTGAGAAGCTTCAAGAGAT FFFFFFFFFF<FFFFFFFFFFFFFFF.7FFFAAAA< XA:i:0 MD:Z:36 PG:Z:MarkDuplicates NH:i:1 NM:i:0 XS:A:+
diff --git a/applications/bed/conversion/src/wrappers/bam2bed b/applications/bed/conversion/src/wrappers/bam2bed
index feb4d8c..67c2bcb 100755
--- a/applications/bed/conversion/src/wrappers/bam2bed
+++ b/applications/bed/conversion/src/wrappers/bam2bed
@@ -36,6 +36,8 @@ sort_tmpdir="/tmp"
all_reads=false
keep_header=false
split=false
+split_with_deletions=false
+reduced=false
help()
{
@@ -43,7 +45,7 @@ help()
exit $1
}
-optspec=":r:m:dhaks-:"
+optspec=":r:m:dhaksSR-:"
while getopts "$optspec" optchar; do
case "${optchar}" in
-)
@@ -94,6 +96,12 @@ while getopts "$optspec" optchar; do
split)
split=true
;;
+ split-with-deletions)
+ split_with_deletions=true
+ ;;
+ reduced)
+ reduced=true
+ ;;
*)
help 1
#if [ "$OPTERR" = 1 ] && [ "${optspec:0:1}" != ":" ]; then echo "Unknown option --${OPTARG}" >&2; fi
@@ -122,6 +130,12 @@ while getopts "$optspec" optchar; do
s)
split=true
;;
+ S)
+ split_with_deletions=true
+ ;;
+ R)
+ reduced=true
+ ;;
*)
help 1
#if [ "$OPTERR" != 1 ] || [ "${optspec:0:1}" = ":" ]; then echo "Non-option argument: '-${OPTARG}'" >&2; fi
@@ -144,5 +158,7 @@ if [ "${do_not_sort}" = true ]; then options="${options} --do-not-sort"; fi
if [ "${all_reads}" = true ]; then options="${options} --all-reads"; fi
if [ "${keep_header}" = true ]; then options="${options} --keep-header"; fi
if [ "${split}" = true ]; then options="${options} --split"; fi
+if [ "${split_with_deletions}" = true ]; then options="${options} --split-with-deletions"; fi
+if [ "${reduced}" = true ]; then options="${options} --reduced"; fi
${cmd} ${options} - <&0
diff --git a/applications/bed/conversion/src/wrappers/bam2starch b/applications/bed/conversion/src/wrappers/bam2starch
index 7a01673..113b47a 100755
--- a/applications/bed/conversion/src/wrappers/bam2starch
+++ b/applications/bed/conversion/src/wrappers/bam2starch
@@ -40,6 +40,8 @@ starch_not_set=false
all_reads=false
keep_header=false
split=false
+split_with_deletions=false
+reduced=false
help()
{
@@ -47,7 +49,7 @@ help()
exit $1
}
-optspec=":e:zgr:m:dhaks-:"
+optspec=":e:zgr:m:dhaksSR-:"
while getopts "$optspec" optchar; do
case "${optchar}" in
-)
@@ -114,6 +116,12 @@ while getopts "$optspec" optchar; do
split)
split=true
;;
+ split-with-deletions)
+ split_with_deletions=true
+ ;;
+ reduced)
+ reduced=true
+ ;;
*)
help 1
#if [ "$OPTERR" = 1 ] && [ "${optspec:0:1}" != ":" ]; then echo "Unknown option --${OPTARG}" >&2; fi
@@ -152,6 +160,12 @@ while getopts "$optspec" optchar; do
s)
split=true
;;
+ S)
+ split_with_deletions=true
+ ;;
+ R)
+ reduced=true
+ ;;
*)
help 1
#if [ "$OPTERR" != 1 ] || [ "${optspec:0:1}" = ":" ]; then echo "Non-option argument: '-${OPTARG}'" >&2; fi
@@ -177,5 +191,7 @@ if [ "${starch_note_set}" = true ]; then options="${options} --starch-note=\"${s
if [ "${all_reads}" = true ]; then options="${options} --all-reads"; fi
if [ "${keep_header}" = true ]; then options="${options} --keep-header"; fi
if [ "${split}" = true ]; then options="${options} --split"; fi
+if [ "${split_with_deletions}" = true ]; then options="${options} --split-with-deletions"; fi
+if [ "${reduced}" = true ]; then options="${options} --reduced"; fi
${cmd} ${options} - <&0
diff --git a/applications/bed/conversion/src/wrappers/sam2bed b/applications/bed/conversion/src/wrappers/sam2bed
index 69e49b9..3dee14e 100755
--- a/applications/bed/conversion/src/wrappers/sam2bed
+++ b/applications/bed/conversion/src/wrappers/sam2bed
@@ -36,6 +36,8 @@ sort_tmpdir="/tmp"
all_reads=false
keep_header=false
split=false
+split_with_deletions=false
+reduced=false
help()
{
@@ -43,7 +45,7 @@ help()
exit $1
}
-optspec=":r:m:dhaks-:"
+optspec=":r:m:dhaksSR-:"
while getopts "$optspec" optchar; do
case "${optchar}" in
-)
@@ -94,6 +96,12 @@ while getopts "$optspec" optchar; do
split)
split=true
;;
+ split-with-deletions)
+ split_with_deletions=true
+ ;;
+ reduced)
+ reduced=true
+ ;;
*)
help 1
#if [ "$OPTERR" = 1 ] && [ "${optspec:0:1}" != ":" ]; then echo "Unknown option --${OPTARG}" >&2; fi
@@ -122,6 +130,12 @@ while getopts "$optspec" optchar; do
s)
split=true
;;
+ S)
+ split_with_deletions=true
+ ;;
+ R)
+ reduced=true
+ ;;
*)
help 1
#if [ "$OPTERR" != 1 ] || [ "${optspec:0:1}" = ":" ]; then echo "Non-option argument: '-${OPTARG}'" >&2; fi
@@ -144,5 +158,7 @@ if [ "${do_not_sort}" = true ]; then options="${options} --do-not-sort"; fi
if [ "${all_reads}" = true ]; then options="${options} --all-reads"; fi
if [ "${keep_header}" = true ]; then options="${options} --keep-header"; fi
if [ "${split}" = true ]; then options="${options} --split"; fi
+if [ "${split_with_deletions}" = true ]; then options="${options} --split-with-deletions"; fi
+if [ "${reduced}" = true ]; then options="${options} --reduced"; fi
${cmd} ${options} - <&0
diff --git a/applications/bed/conversion/src/wrappers/sam2starch b/applications/bed/conversion/src/wrappers/sam2starch
index 12a38c6..3674372 100755
--- a/applications/bed/conversion/src/wrappers/sam2starch
+++ b/applications/bed/conversion/src/wrappers/sam2starch
@@ -40,6 +40,8 @@ starch_not_set=false
all_reads=false
keep_header=false
split=false
+split_with_deletions=false
+reduced=false
help()
{
@@ -47,7 +49,7 @@ help()
exit $1
}
-optspec=":e:zgr:m:dhaks-:"
+optspec=":e:zgr:m:dhaksSR-:"
while getopts "$optspec" optchar; do
case "${optchar}" in
-)
@@ -114,6 +116,12 @@ while getopts "$optspec" optchar; do
split)
split=true
;;
+ split-with-deletions)
+ split_with_deletions=true
+ ;;
+ reduced)
+ reduced=true
+ ;;
*)
help 1
#if [ "$OPTERR" = 1 ] && [ "${optspec:0:1}" != ":" ]; then echo "Unknown option --${OPTARG}" >&2; fi
@@ -152,6 +160,12 @@ while getopts "$optspec" optchar; do
s)
split=true
;;
+ S)
+ split_with_deletions=true
+ ;;
+ R)
+ reduced=true
+ ;;
*)
help 1
#if [ "$OPTERR" != 1 ] || [ "${optspec:0:1}" = ":" ]; then echo "Non-option argument: '-${OPTARG}'" >&2; fi
@@ -177,5 +191,7 @@ if [ "${starch_note_set}" = true ]; then options="${options} --starch-note=\"${s
if [ "${all_reads}" = true ]; then options="${options} --all-reads"; fi
if [ "${keep_header}" = true ]; then options="${options} --keep-header"; fi
if [ "${split}" = true ]; then options="${options} --split"; fi
+if [ "${split_with_deletions}" = true ]; then options="${options} --split-with-deletions"; fi
+if [ "${reduced}" = true ]; then options="${options} --reduced"; fi
${cmd} ${options} - <&0
diff --git a/applications/bed/sort-bed/src/CheckSort.cpp b/applications/bed/sort-bed/src/CheckSort.cpp
index 09a9d77..f469b19 100644
--- a/applications/bed/sort-bed/src/CheckSort.cpp
+++ b/applications/bed/sort-bed/src/CheckSort.cpp
@@ -27,24 +27,28 @@
#include "data/bed/BedCheckIterator.hpp"
#include "data/bed/BedTypes.hpp"
+#include "suite/BEDOPS.Constants.hpp"
#include "utility/Exception.hpp"
+#include "utility/PooledMemory.hpp"
#include "Structures.hpp"
int
checkSort(char const **bedFileNames, unsigned int numFiles)
{
- typedef Bed::bed_check_iterator<Bed::B3Rest*> IterType;
+ constexpr std::size_t PoolSz = 8*2;
+ typedef Bed::bed_check_iterator<Bed::B3Rest*, PoolSz> IterType;
int rtnval = EXIT_FAILURE;
try {
+ Ext::PooledMemory<Bed::B3Rest, PoolSz> pool;
for ( unsigned int i = 0; i < numFiles; ++i ) {
std::ifstream infile(bedFileNames[i]);
if ( 0 != std::strcmp(bedFileNames[i], "-") && !infile )
throw(Ext::UserError("Unable to find: " + std::string(bedFileNames[i])));
IterType start((std::strcmp(bedFileNames[i], "-") == 0) ? std::cin : infile,
- bedFileNames[i]), end;
+ bedFileNames[i], pool), end;
while ( start != end )
- delete *start++;
+ pool.release(*start++);
} // for each file
rtnval = EXIT_SUCCESS;
} catch(std::exception& s) {
diff --git a/applications/bed/sort-bed/src/Makefile b/applications/bed/sort-bed/src/Makefile
index 699a0b6..4a3a6ee 100644
--- a/applications/bed/sort-bed/src/Makefile
+++ b/applications/bed/sort-bed/src/Makefile
@@ -25,19 +25,26 @@ LOCALZLIBINCDIR = ${LOCALZLIBDIR}
LIBLOCATION = -L${LOCALJANSSONLIBDIR} -L${LOCALBZIP2LIBDIR} -L${LOCALZLIBDIR}
LIBRARIES = ${LOCALJANSSONLIB} ${LOCALBZIP2LIB} ${LOCALZLIBLIB}
-PROG = sort-bed
+PROG = sort-bed-${BINARY_TYPE}
BINDIR = ../bin
-OBJDIR = objects
+OBJDIR = objects-${BINARY_TYPE}
WARNINGS = -Wall -Wextra -pedantic
-BLDFLAGS = ${WARNINGS} -O3 -std=c++11
+BLDFLAGS = ${WARNINGS} -O3 -std=c++11 ${MEGAFLAGS}
SFLAGS = -static
+ifeq ($(BINARY_TYPE),)
+ TFLAG = -DBEDOPS_BINARY_TYPE=0
+else
+ TFLAG = -DBEDOPS_BINARY_TYPE=$(BINARY_TYPE_NUM)
+endif
+
dependency_names = starchConstants starchFileHelpers starchHelpers starchMetadataHelpers unstarchHelpers starchSha1Digest starchBase64Coding SortDetails Sort CheckSort
dependencies = $(addprefix $(OBJDIR)/, $(addsuffix .o, $(dependency_names)))
+debug_dependencies = $(addprefix $(OBJDIR)/, $(addsuffix .do, $(dependency_names)))
-FLAGS = $(SFLAGS) -s ${BLDFLAGS} ${LIBLOCATION} ${INCLUDES}
-DFLAGS = $(SFLAGS) -g -O0 -std=c++11 -Wall -fno-inline -pedantic ${LIBLOCATION} ${INCLUDES}
-GPROFFLAGS = $(SFLAGS) -O -std=c++11 -Wall -pedantic -pg ${LIBLOCATION} ${INCLUDES}
+FLAGS = $(SFLAGS) ${MEGAFLAGS} -s ${BLDFLAGS} ${LIBLOCATION} ${INCLUDES}
+DFLAGS = $(SFLAGS) ${MEGAFLAGS} -g -O0 -std=c++11 -Wall -fno-inline -pedantic ${LIBLOCATION} ${INCLUDES}
+GPROFFLAGS = $(SFLAGS) ${MEGAFLAGS} -O -std=c++11 -Wall -pedantic -pg ${LIBLOCATION} ${INCLUDES}
ifneq ($(shell uname -s),CYGWIN_NT-6.1)
WARNINGS += -ansi
@@ -45,45 +52,56 @@ else
WARNINGS += -U__STRICT_ANSI__
endif
-build: $(BINDIR)/$(PROG) $(dependencies) update-sort-bed-slurm update-sort-bed-starch-slurm update-sort-bed-migrate-candidates
+build: $(dependencies) $(BINDIR)/$(PROG) update-sort-bed-slurm-${BINARY_TYPE} update-sort-bed-starch-slurm-${BINARY_TYPE} update-sort-bed-migrate-candidates-${BINARY_TYPE}
+ rm -rf ${OBJDIR}
build_gprof: $(BINDIR)/gprof.$(PROG)
+ rm -rf ${OBJDIR}
build_debug: $(BINDIR)/debug.$(PROG)
+ rm -rf ${OBJDIR}
dependencies: $(dependencies)
-update-sort-bed-slurm:
- mkdir -p $(BINDIR) && cp update-sort-bed-slurm.py $(BINDIR)/update-sort-bed-slurm
+debug_dependencies: $(debug_dependencies)
-update-sort-bed-starch-slurm:
- mkdir -p $(BINDIR) && cp update-sort-bed-starch-slurm.py $(BINDIR)/update-sort-bed-starch-slurm
+update-sort-bed-slurm-${BINARY_TYPE}:
+ mkdir -p $(BINDIR) && cp update-sort-bed-slurm.py $(BINDIR)/update-sort-bed-slurm-${BINARY_TYPE}
-update-sort-bed-migrate-candidates:
- mkdir -p $(BINDIR) && cp update-sort-bed-migrate-candidates.py $(BINDIR)/update-sort-bed-migrate-candidates
+update-sort-bed-starch-slurm-${BINARY_TYPE}:
+ mkdir -p $(BINDIR) && cp update-sort-bed-starch-slurm.py $(BINDIR)/update-sort-bed-starch-slurm-${BINARY_TYPE}
+
+update-sort-bed-migrate-candidates-${BINARY_TYPE}:
+ mkdir -p $(BINDIR) && cp update-sort-bed-migrate-candidates.py $(BINDIR)/update-sort-bed-migrate-candidates-${BINARY_TYPE}
$(BINDIR)/$(PROG) : $(dependencies)
- mkdir -p $(BINDIR) && $(CXX) -o $@ $(FLAGS) $^ ${LIBRARIES}
+ mkdir -p $(BINDIR) && $(CXX) -o $@ ${TFLAG} $(FLAGS) $^ ${LIBRARIES}
$(BINDIR)/gprof.$(PROG) : $(dependencies)
- mkdir -p $(BINDIR) && $(CXX) -o $@ $(GPROFFLAGS) $^ ${LIBRARIES}
+ mkdir -p $(BINDIR) && $(CXX) -o $@ ${TFLAG} $(GPROFFLAGS) $^ ${LIBRARIES}
-$(BINDIR)/debug.$(PROG) : $(dependencies)
- mkdir -p $(BINDIR) && $(CXX) -o $@ $(DFLAGS) $^ ${LIBRARIES}
+$(BINDIR)/debug.$(PROG) : $(debug_dependencies)
+ mkdir -p $(BINDIR) && $(CXX) -o $@ ${TFLAG} $(DFLAGS) $^ ${LIBRARIES}
+ rm -rf ${OBJDIR}
$(OBJDIR)/%.o : $(LIB1)/%.cpp
- mkdir -p $(OBJDIR) && $(CXX) -c $(BLDFLAGS) $^ -o $@ ${INCLUDES}
+ mkdir -p $(OBJDIR) && $(CXX) -c ${TFLAG} $(BLDFLAGS) $^ -o $@ ${INCLUDES}
$(OBJDIR)/%.o : $(LIB3)/%.c
- mkdir -p $(OBJDIR) && $(CXX) -c ${BLDFLAGS} $^ -o $@ ${INCLUDES}
+ mkdir -p $(OBJDIR) && $(CXX) -c ${TFLAG} ${BLDFLAGS} $^ -o $@ ${INCLUDES}
$(OBJDIR)/%.o : %.cpp
- mkdir -p $(OBJDIR) && $(CXX) -c ${BLDFLAGS} $^ -o $@ ${INCLUDES}
+ mkdir -p $(OBJDIR) && $(CXX) -c ${TFLAG} ${BLDFLAGS} $^ -o $@ ${INCLUDES}
+
+$(OBJDIR)/%.do : $(LIB1)/%.cpp
+ mkdir -p $(OBJDIR) && $(CXX) -c ${TFLAG} $(DFLAGS) $^ -o $@ ${INCLUDES}
+
+$(OBJDIR)/%.do : $(LIB3)/%.c
+ mkdir -p $(OBJDIR) && $(CXX) -c ${TFLAG} ${DFLAGS} $^ -o $@ ${INCLUDES}
+
+$(OBJDIR)/%.do : %.cpp
+ mkdir -p $(OBJDIR) && $(CXX) -c ${TFLAG} ${DFLAGS} $^ -o $@ ${INCLUDES}
clean:
rm -rf ${OBJDIR}
- rm -f $(BINDIR)/$(PROG)
- rm -f $(BINDIR)/*.$(PROG)
- rm -f $(BINDIR)/update-sort-bed-slurm
- rm -f $(BINDIR)/update-sort-bed-starch-slurm
- rm -f $(BINDIR)/update-sort-bed-migrate-candidates
+ rm -rf $(BINDIR)
diff --git a/applications/bed/sort-bed/src/Makefile.darwin b/applications/bed/sort-bed/src/Makefile.darwin
index 6717c8a..766b876 100644
--- a/applications/bed/sort-bed/src/Makefile.darwin
+++ b/applications/bed/sort-bed/src/Makefile.darwin
@@ -1,12 +1,10 @@
-MIN_OSX_VERSION = 10.7
-
MAIN = ../../../..
MAINAPPDIR = ../..
HEAD = $(MAIN)/interfaces/general-headers
LIB3 = $(MAIN)/interfaces/src/data/starch
-PROG = sort-bed
+PROG = sort-bed-${BINARY_TYPE}
DIST_DIR = ../bin
-OBJ_DIR = objects_${ARCH}
+OBJ_DIR = objects_${ARCH}_${BINARY_TYPE}
OPTIMIZE = -O3 -std=c++11 -stdlib=libc++
WARNINGS = -Wall
MAIN = ../../../..
@@ -34,65 +32,76 @@ LIBRARIES = ${LOCALJANSSONLIB} ${LOCALBZIP2LIB} ${LOCALZLIBLIB}
BLDFLAGS = ${WARNINGS} ${OPTIMIZE}
INCLUDES = -iquote$(HEAD) -I${LOCALJANSSONINCDIR} -I${LOCALBZIP2INCDIR} -I${LOCALZLIBINCDIR}
STARCHOBJS = $(OBJ_DIR)/starchConstants.o $(OBJ_DIR)/starchFileHelpers.o $(OBJ_DIR)/starchHelpers.o $(OBJ_DIR)/starchMetadataHelpers.o $(OBJ_DIR)/unstarchHelpers.o $(OBJ_DIR)/starchSha1Digest.o $(OBJ_DIR)/starchBase64Coding.o
+SELF = ${shell pwd}/Makefile.darwin
+
+ifeq ($(BINARY_TYPE),)
+ TFLAG = -DBEDOPS_BINARY_TYPE=0
+else
+ TFLAG = -DBEDOPS_BINARY_TYPE=$(BINARY_TYPE_NUM)
+endif
-build: sort update-sort-bed-slurm update-sort-bed-starch-slurm update-sort-bed-migrate-candidates
+build: sort check-cp
+ rm -rf ${OBJ_DIR}
update-sort-bed-slurm:
- cp update-sort-bed-slurm.py ${DIST_DIR}/update-sort-bed-slurm
+ cp update-sort-bed-slurm.py ${DIST_DIR}/update-sort-bed-slurm-${BINARY_TYPE}
update-sort-bed-starch-slurm:
- cp update-sort-bed-starch-slurm.py ${DIST_DIR}/update-sort-bed-starch-slurm
+ cp update-sort-bed-starch-slurm.py ${DIST_DIR}/update-sort-bed-starch-slurm-${BINARY_TYPE}
update-sort-bed-migrate-candidates:
- cp update-sort-bed-migrate-candidates.py ${DIST_DIR}/update-sort-bed-migrate-candidates
+ cp update-sort-bed-migrate-candidates.py ${DIST_DIR}/update-sort-bed-migrate-candidates-${BINARY_TYPE}
+
+check-cp:
+ make -f ${SELF} update-sort-bed-slurm
+ make -f ${SELF} update-sort-bed-starch-slurm
+ make -f ${SELF} update-sort-bed-migrate-candidates
sort: sortbuild
- ${CXX} -o ${DIST_DIR}/${PROG}_${ARCH} ${BLDFLAGS} ${LIBLOCATION} ${INCLUDES} -mmacosx-version-min=$(MIN_OSX_VERSION) -arch $(ARCH) -lc++ ${STARCHOBJS} ${OBJ_DIR}/SortDetails.o ${OBJ_DIR}/Sort.o ${OBJ_DIR}/CheckSort.o ${LIBRARIES}
+ ${CXX} -o ${DIST_DIR}/${PROG} ${MEGAFLAGS} ${BLDFLAGS} ${LIBLOCATION} ${INCLUDES} -mmacosx-version-min=$(MIN_OSX_VERSION) -arch $(ARCH) -lc++ ${STARCHOBJS} ${OBJ_DIR}/SortDetails.o ${OBJ_DIR}/Sort.o ${OBJ_DIR}/CheckSort.o ${LIBRARIES}
sortbuild: prep
- $(CXX) -x c++ -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} -c ${BLDFLAGS} ${LIB3}/starchConstants.c -o ${OBJ_DIR}/starchConstants.o ${INCLUDES}
- $(CXX) -x c++ -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} -c ${BLDFLAGS} ${LIB3}/starchFileHelpers.c -o ${OBJ_DIR}/starchFileHelpers.o ${INCLUDES}
- $(CXX) -x c++ -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} -c ${BLDFLAGS} ${LIB3}/starchHelpers.c -o ${OBJ_DIR}/starchHelpers.o -iquote${HEAD} ${INCLUDES}
- $(CXX) -x c++ -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} -c ${BLDFLAGS} ${LIB3}/starchMetadataHelpers.c -o ${OBJ_DIR}/starchMetadataHelpers.o ${INCLUDES}
- $(CXX) -x c++ -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} -c ${BLDFLAGS} ${LIB3}/unstarchHelpers.c -o ${OBJ_DIR}/unstarchHelpers.o ${INCLUDES}
- $(CXX) -x c++ -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} -c ${BLDFLAGS} ${LIB3}/starchSha1Digest.c -o ${OBJ_DIR}/starchSha1Digest.o ${INCLUDES}
- $(CXX) -x c++ -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} -c ${BLDFLAGS} ${LIB3}/starchBase64Coding.c -o ${OBJ_DIR}/starchBase64Coding.o ${INCLUDES}
- ${CXX} -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} -c ${BLDFLAGS} SortDetails.cpp -o ${OBJ_DIR}/SortDetails.o -I${HEAD}
- ${CXX} -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} -c ${BLDFLAGS} Sort.cpp -o ${OBJ_DIR}/Sort.o -I${HEAD}
- ${CXX} -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} -c ${BLDFLAGS} CheckSort.cpp -o ${OBJ_DIR}/CheckSort.o ${INCLUDES}
+ $(CXX) -x c++ -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} -c ${BLDFLAGS} ${TFLAG} ${MEGAFLAGS} ${LIB3}/starchConstants.c -o ${OBJ_DIR}/starchConstants.o ${INCLUDES}
+ $(CXX) -x c++ -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} -c ${BLDFLAGS} ${TFLAG} ${MEGAFLAGS} ${LIB3}/starchFileHelpers.c -o ${OBJ_DIR}/starchFileHelpers.o ${INCLUDES}
+ $(CXX) -x c++ -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} -c ${BLDFLAGS} ${TFLAG} ${MEGAFLAGS} ${LIB3}/starchHelpers.c -o ${OBJ_DIR}/starchHelpers.o -iquote${HEAD} ${INCLUDES}
+ $(CXX) -x c++ -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} -c ${BLDFLAGS} ${TFLAG} ${MEGAFLAGS} ${LIB3}/starchMetadataHelpers.c -o ${OBJ_DIR}/starchMetadataHelpers.o ${INCLUDES}
+ $(CXX) -x c++ -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} -c ${BLDFLAGS} ${TFLAG} ${MEGAFLAGS} ${LIB3}/unstarchHelpers.c -o ${OBJ_DIR}/unstarchHelpers.o ${INCLUDES}
+ $(CXX) -x c++ -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} -c ${BLDFLAGS} ${TFLAG} ${MEGAFLAGS} ${LIB3}/starchSha1Digest.c -o ${OBJ_DIR}/starchSha1Digest.o ${INCLUDES}
+ $(CXX) -x c++ -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} -c ${BLDFLAGS} ${TFLAG} ${MEGAFLAGS} ${LIB3}/starchBase64Coding.c -o ${OBJ_DIR}/starchBase64Coding.o ${INCLUDES}
+ ${CXX} -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} -c ${BLDFLAGS} ${TFLAG} ${MEGAFLAGS} SortDetails.cpp -o ${OBJ_DIR}/SortDetails.o -I${HEAD}
+ ${CXX} -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} -c ${BLDFLAGS} ${TFLAG} ${MEGAFLAGS} Sort.cpp -o ${OBJ_DIR}/Sort.o -I${HEAD}
+ ${CXX} -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} -c ${BLDFLAGS} ${TFLAG} ${MEGAFLAGS} CheckSort.cpp -o ${OBJ_DIR}/CheckSort.o ${INCLUDES}
-build_debug: prep
- $(CXX) -x c++ -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} -g -O0 -std=c++11 -stdlib=libc++ -c ${LIB3}/starchConstants.c -o ${OBJ_DIR}/starchConstants.o ${INCLUDES}
- $(CXX) -x c++ -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} -g -O0 -std=c++11 -stdlib=libc++ -c ${LIB3}/starchFileHelpers.c -o ${OBJ_DIR}/starchFileHelpers.o ${INCLUDES}
- $(CXX) -x c++ -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} -g -O0 -std=c++11 -stdlib=libc++ -c ${LIB3}/starchHelpers.c -o ${OBJ_DIR}/starchHelpers.o -iquote${HEAD} ${INCLUDES}
- $(CXX) -x c++ -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} -g -O0 -std=c++11 -stdlib=libc++ -c ${LIB3}/starchMetadataHelpers.c -o ${OBJ_DIR}/starchMetadataHelpers.o ${INCLUDES}
- $(CXX) -x c++ -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} -g -O0 -std=c++11 -stdlib=libc++ -c ${LIB3}/unstarchHelpers.c -o ${OBJ_DIR}/unstarchHelpers.o ${INCLUDES}
- $(CXX) -x c++ -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} -g -O0 -std=c++11 -stdlib=libc++ -c ${LIB3}/starchSha1Digest.c -o ${OBJ_DIR}/starchSha1Digest.o ${INCLUDES}
- $(CXX) -x c++ -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} -g -O0 -std=c++11 -stdlib=libc++ -c ${LIB3}/starchBase64Coding.c -o ${OBJ_DIR}/starchBase64Coding.o ${INCLUDES}
- ${CXX} -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} -g -O0 -std=c++11 -stdlib=libc++ -c SortDetails.cpp -o ${OBJ_DIR}/SortDetails.o -I${HEAD}
- ${CXX} -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} -g -O0 -std=c++11 -stdlib=libc++ -c Sort.cpp -o ${OBJ_DIR}/Sort.o -I${HEAD}
- ${CXX} -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} -g -O0 -std=c++11 -stdlib=libc++ -c CheckSort.cpp -o ${OBJ_DIR}/CheckSort.o ${INCLUDES}
- ${CXX} -o ${DIST_DIR}/debug.${PROG}_${ARCH} ${LIBLOCATION} ${INCLUDES} -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} -g -lc++ ${STARCHOBJS} ${OBJ_DIR}/SortDetails.o ${OBJ_DIR}/Sort.o ${OBJ_DIR}/CheckSort.o ${LIBRARIES}
+build_debug: prep check-cp
+ $(CXX) -x c++ -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} ${TFLAG} ${MEGAFLAGS} -g -O0 -std=c++11 -stdlib=libc++ -c ${LIB3}/starchConstants.c -o ${OBJ_DIR}/starchConstants.o ${INCLUDES}
+ $(CXX) -x c++ -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} ${TFLAG} ${MEGAFLAGS} -g -O0 -std=c++11 -stdlib=libc++ -c ${LIB3}/starchFileHelpers.c -o ${OBJ_DIR}/starchFileHelpers.o ${INCLUDES}
+ $(CXX) -x c++ -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} ${TFLAG} ${MEGAFLAGS} -g -O0 -std=c++11 -stdlib=libc++ -c ${LIB3}/starchHelpers.c -o ${OBJ_DIR}/starchHelpers.o -iquote${HEAD} ${INCLUDES}
+ $(CXX) -x c++ -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} ${TFLAG} ${MEGAFLAGS} -g -O0 -std=c++11 -stdlib=libc++ -c ${LIB3}/starchMetadataHelpers.c -o ${OBJ_DIR}/starchMetadataHelpers.o ${INCLUDES}
+ $(CXX) -x c++ -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} ${TFLAG} ${MEGAFLAGS} -g -O0 -std=c++11 -stdlib=libc++ -c ${LIB3}/unstarchHelpers.c -o ${OBJ_DIR}/unstarchHelpers.o ${INCLUDES}
+ $(CXX) -x c++ -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} ${TFLAG} ${MEGAFLAGS} -g -O0 -std=c++11 -stdlib=libc++ -c ${LIB3}/starchSha1Digest.c -o ${OBJ_DIR}/starchSha1Digest.o ${INCLUDES}
+ $(CXX) -x c++ -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} ${TFLAG} ${MEGAFLAGS} -g -O0 -std=c++11 -stdlib=libc++ -c ${LIB3}/starchBase64Coding.c -o ${OBJ_DIR}/starchBase64Coding.o ${INCLUDES}
+ ${CXX} -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} ${TFLAG} ${MEGAFLAGS} -g -O0 -std=c++11 -stdlib=libc++ -c SortDetails.cpp -o ${OBJ_DIR}/SortDetails.o -I${HEAD}
+ ${CXX} -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} ${TFLAG} ${MEGAFLAGS} -g -O0 -std=c++11 -stdlib=libc++ -c Sort.cpp -o ${OBJ_DIR}/Sort.o -I${HEAD}
+ ${CXX} -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} ${TFLAG} ${MEGAFLAGS} -g -O0 -std=c++11 -stdlib=libc++ -c CheckSort.cpp -o ${OBJ_DIR}/CheckSort.o ${INCLUDES}
+ ${CXX} -o ${DIST_DIR}/debug.${PROG} ${TFLAG} ${MEGAFLAGS} ${LIBLOCATION} ${INCLUDES} -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} -g -lc++ ${STARCHOBJS} ${OBJ_DIR}/SortDetails.o ${OBJ_DIR}/Sort.o ${OBJ_DIR}/CheckSort.o ${LIBRARIES}
-build_gprof: prep
- $(CXX) -x c++ -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} -pg -O -std=c++11 -stdlib=libc++ -c ${LIB3}/starchConstants.c -o ${OBJ_DIR}/starchConstants.o ${INCLUDES}
- $(CXX) -x c++ -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} -pg -O -std=c++11 -stdlib=libc++ -c ${LIB3}/starchFileHelpers.c -o ${OBJ_DIR}/starchFileHelpers.o ${INCLUDES}
- $(CXX) -x c++ -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} -pg -O -std=c++11 -stdlib=libc++ -c ${LIB3}/starchHelpers.c -o ${OBJ_DIR}/starchHelpers.o -iquote${HEAD} ${INCLUDES}
- $(CXX) -x c++ -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} -pg -O -std=c++11 -stdlib=libc++ -c ${LIB3}/starchMetadataHelpers.c -o ${OBJ_DIR}/starchMetadataHelpers.o ${INCLUDES}
- $(CXX) -x c++ -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} -pg -O -std=c++11 -stdlib=libc++ -c ${LIB3}/unstarchHelpers.c -o ${OBJ_DIR}/unstarchHelpers.o ${INCLUDES}
- $(CXX) -x c++ -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} -pg -O -std=c++11 -stdlib=libc++ -c ${LIB3}/starchSha1Digest.c -o ${OBJ_DIR}/starchSha1Digest.o ${INCLUDES}
- $(CXX) -x c++ -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} -pg -O -std=c++11 -stdlib=libc++ -c ${LIB3}/starchBase64Coding.c -o ${OBJ_DIR}/starchBase64Coding.o ${INCLUDES}
- ${CXX} -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} -pg -O -std=c++11 -stdlib=libc++ -c SortDetails.cpp -o ${OBJ_DIR}/SortDetails.o -I${HEAD}
- ${CXX} -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} -pg -O -std=c++11 -stdlib=libc++ -c Sort.cpp -o ${OBJ_DIR}/Sort.o -I${HEAD}
- ${CXX} -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} -pg -O -std=c++11 -stdlib=libc++ -c CheckSort.cpp -o ${OBJ_DIR}/CheckSort.o ${INCLUDES}
- ${CXX} -o ${DIST_DIR}/gprof.${PROG}_${ARCH} ${LIBLOCATION} ${INCLUDES} -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} -g -lc++ ${STARCHOBJS} ${OBJ_DIR}/SortDetails.o ${OBJ_DIR}/Sort.o ${OBJ_DIR}/CheckSort.o ${LIBRARIES}
+build_gprof: prep check-cp
+ $(CXX) -x c++ -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} ${TFLAG} ${MEGAFLAGS} -pg -O -std=c++11 -stdlib=libc++ -c ${LIB3}/starchConstants.c -o ${OBJ_DIR}/starchConstants.o ${INCLUDES}
+ $(CXX) -x c++ -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} ${TFLAG} ${MEGAFLAGS} -pg -O -std=c++11 -stdlib=libc++ -c ${LIB3}/starchFileHelpers.c -o ${OBJ_DIR}/starchFileHelpers.o ${INCLUDES}
+ $(CXX) -x c++ -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} ${TFLAG} ${MEGAFLAGS} -pg -O -std=c++11 -stdlib=libc++ -c ${LIB3}/starchHelpers.c -o ${OBJ_DIR}/starchHelpers.o -iquote${HEAD} ${INCLUDES}
+ $(CXX) -x c++ -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} ${TFLAG} ${MEGAFLAGS} -pg -O -std=c++11 -stdlib=libc++ -c ${LIB3}/starchMetadataHelpers.c -o ${OBJ_DIR}/starchMetadataHelpers.o ${INCLUDES}
+ $(CXX) -x c++ -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} ${TFLAG} ${MEGAFLAGS} -pg -O -std=c++11 -stdlib=libc++ -c ${LIB3}/unstarchHelpers.c -o ${OBJ_DIR}/unstarchHelpers.o ${INCLUDES}
+ $(CXX) -x c++ -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} ${TFLAG} ${MEGAFLAGS} -pg -O -std=c++11 -stdlib=libc++ -c ${LIB3}/starchSha1Digest.c -o ${OBJ_DIR}/starchSha1Digest.o ${INCLUDES}
+ $(CXX) -x c++ -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} ${TFLAG} ${MEGAFLAGS}-pg -O -std=c++11 -stdlib=libc++ -c ${LIB3}/starchBase64Coding.c -o ${OBJ_DIR}/starchBase64Coding.o ${INCLUDES}
+ ${CXX} -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} -pg -O ${TFLAG} ${MEGAFLAGS} -std=c++11 -stdlib=libc++ -c SortDetails.cpp -o ${OBJ_DIR}/SortDetails.o -I${HEAD}
+ ${CXX} -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} -pg -O ${TFLAG} ${MEGAFLAGS} -std=c++11 -stdlib=libc++ -c Sort.cpp -o ${OBJ_DIR}/Sort.o -I${HEAD}
+ ${CXX} -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} -pg -O ${TFLAG} ${MEGAFLAGS} -std=c++11 -stdlib=libc++ -c CheckSort.cpp -o ${OBJ_DIR}/CheckSort.o ${INCLUDES}
+ ${CXX} -o ${DIST_DIR}/gprof.${PROG}_${ARCH} ${LIBLOCATION} ${INCLUDES} ${TFLAG} ${MEGAFLAGS} -mmacosx-version-min=${MIN_OSX_VERSION} -arch ${ARCH} -g -lc++ ${STARCHOBJS} ${OBJ_DIR}/SortDetails.o ${OBJ_DIR}/Sort.o ${OBJ_DIR}/CheckSort.o ${LIBRARIES}
prep:
rm -rf ${OBJ_DIR}
mkdir -p ${OBJ_DIR}
clean:
- rm -rf ${OBJ_DIR}*
- rm -rf ${DIST_DIR}/${PROG}*
- rm -rf ${DIST_DIR}/*.${PROG}*
+ rm -rf ${OBJ_DIR}
rm -rf ${DIST_DIR}
diff --git a/applications/bed/sort-bed/src/Sort.cpp b/applications/bed/sort-bed/src/Sort.cpp
index 5fb4805..659d3f3 100644
--- a/applications/bed/sort-bed/src/Sort.cpp
+++ b/applications/bed/sort-bed/src/Sort.cpp
@@ -39,8 +39,17 @@ using namespace std;
static const char *name = "sort-bed";
static const char *authors = "Scott Kuehn";
static const char *usage = "\nUSAGE: sort-bed [--help] [--version] [--check-sort] [--max-mem <val>] [--tmpdir <path>] <file1.bed> <file2.bed> <...>\n Sort BED file(s).\n May use '-' to indicate stdin.\n Results are sent to stdout.\n\n <val> for --max-mem may be 8G, 8000M, or 8000000000 to specify 8 GB of memory.\n --tmpdir is useful only with --max-mem.\n";
+#if BEDOPS_BINARY_TYPE == 0
+static const char *application_type = "typical";
+#else
+#if BEDOPS_BINARY_TYPE == 1
+static const char *application_type = "megarow";
+#else
+static const char *application_type = "typical";
+#endif
+#endif
-static void
+static void
getArgs(int argc, char **argv, const char **inFiles, unsigned int *numInFiles, int *justCheck, double* maxMem, char **tmpPath)
{
int numFiles, i, j, stdincnt = 0, changeMem = 0, units = 0, changeTDir = 0;
@@ -51,14 +60,14 @@ getArgs(int argc, char **argv, const char **inFiles, unsigned int *numInFiles, i
numFiles = argc - 1;
if(numFiles < 1)
{
- fprintf(stderr, "%s\n citation: %s\n version: %s\n authors: %s\n%s\n",
- name, BEDOPS::citation(), BEDOPS::revision(), authors, usage);
+ fprintf(stderr, "%s\n citation: %s\n version: %s (%s)\n authors: %s\n%s\n",
+ name, BEDOPS::citation(), BEDOPS::revision(), application_type, authors, usage);
exit(EXIT_FAILURE);
}
else if (numFiles > MAX_INFILES)
{
- fprintf(stderr, "%s\n citation: %s\n version: %s\n authors: %s\n%s\nToo Many Files\n",
- name, BEDOPS::citation(), BEDOPS::revision(), authors, usage);
+ fprintf(stderr, "%s\n citation: %s\n version: %s (%s)\n authors: %s\n%s\nToo Many Files\n",
+ name, BEDOPS::citation(), BEDOPS::revision(), application_type, authors, usage);
exit(EXIT_FAILURE);
}
else
@@ -68,14 +77,14 @@ getArgs(int argc, char **argv, const char **inFiles, unsigned int *numInFiles, i
/* Check for --help */
if(strcmp(argv[i], "--help") == 0)
{
- fprintf(stdout, "%s\n citation: %s\n version: %s\n authors: %s\n%s\n",
- name, BEDOPS::citation(), BEDOPS::revision(), authors, usage);
+ fprintf(stdout, "%s\n citation: %s\n version: %s (%s)\n authors: %s\n%s\n",
+ name, BEDOPS::citation(), BEDOPS::revision(), application_type, authors, usage);
exit(EXIT_SUCCESS);
}
else if (strcmp(argv[i], "--version") == 0)
{
- fprintf(stdout, "%s\n citation: %s\n version: %s\n authors: %s\n",
- name, BEDOPS::citation(), BEDOPS::revision(), authors);
+ fprintf(stdout, "%s\n citation: %s\n version: %s (%s)\n authors: %s\n",
+ name, BEDOPS::citation(), BEDOPS::revision(), application_type, authors);
exit(EXIT_SUCCESS);
}
/* Check for max memory before merge-sort */
@@ -183,8 +192,8 @@ getArgs(int argc, char **argv, const char **inFiles, unsigned int *numInFiles, i
}
else if(numFiles < 1) /* can be different from before if --max-mem was used, for example*/
{
- fprintf(stderr, "%s\n citation: %s\n version: %s\n authors: %s\n%s\n%s\n",
- name, BEDOPS::citation(), BEDOPS::revision(), authors, usage, "No file given.");
+ fprintf(stderr, "%s\n citation: %s\n version: %s (%s)\n authors: %s\n%s\n%s\n",
+ name, BEDOPS::citation(), BEDOPS::revision(), application_type, authors, usage, "No file given.");
exit(EXIT_FAILURE);
}
return;
@@ -222,7 +231,7 @@ main(int argc, char **argv)
{
tmpPath = getenv("TMPDIR");
}
-
+
// sort
rval = processData(inFiles, numInFiles, maxMemory, tmpPath);
diff --git a/applications/bed/sort-bed/src/SortDetails.cpp b/applications/bed/sort-bed/src/SortDetails.cpp
index 18fb94b..0766ff5 100644
--- a/applications/bed/sort-bed/src/SortDetails.cpp
+++ b/applications/bed/sort-bed/src/SortDetails.cpp
@@ -357,7 +357,7 @@ appendChromBedEntry(ChromBedData *chrom, Bed::SignedCoordType startPos, Bed::Sig
}
int
-checkfiles(const char **bedFileNames, unsigned int numFiles)
+checkFiles(const char **bedFileNames, unsigned int numFiles)
{
FILE* bedFile;
int notStdin = 0, stdinCount = 0;
@@ -450,9 +450,9 @@ mergeSort(FILE* output, FILE **tmpFiles, unsigned int numFiles)
else if(0 == val)
{
if(starts[i] < starts[currMin])
- currMin = static_cast<int>(i);
+ currMin = static_cast<int>(i), currRest = rests[i];
else if(starts[i] == starts[currMin] && ends[i] < ends[currMin])
- currMin = static_cast<int>(i);
+ currMin = static_cast<int>(i), currRest = rests[i];
else if(starts[i] == starts[currMin] && ends[i] == ends[currMin])
{
if (currRest == NULL)
@@ -574,7 +574,7 @@ processData(char const **bedFileNames, unsigned int numFiles, const double maxMe
chromBuf[0] = '\0';
/* check input files */
- if(0 != checkfiles(bedFileNames, numFiles))
+ if(0 != checkFiles(bedFileNames, numFiles))
{
return EXIT_FAILURE;
}
diff --git a/applications/bed/sort-bed/src/Structures.hpp b/applications/bed/sort-bed/src/Structures.hpp
index 7d6c1f2..8cf8398 100644
--- a/applications/bed/sort-bed/src/Structures.hpp
+++ b/applications/bed/sort-bed/src/Structures.hpp
@@ -98,9 +98,6 @@ typedef struct {
/* Function Prototypes */
int
-checkfiles(const char **bedFileNames, unsigned int numFiles);
-
-int
checkSort(char const **bedFileNames, unsigned int numFiles);
int
diff --git a/applications/bed/sort-bed/src/update-sort-bed-migrate-candidates.py b/applications/bed/sort-bed/src/update-sort-bed-migrate-candidates.py
index 9b1ad28..33db1d5 100755
--- a/applications/bed/sort-bed/src/update-sort-bed-migrate-candidates.py
+++ b/applications/bed/sort-bed/src/update-sort-bed-migrate-candidates.py
@@ -32,7 +32,7 @@ import logging
name = "update-sort-bed-migrate-candidates"
citation = " citation: http://bioinformatics.oxfordjournals.org/content/28/14/1919.abstract"
authors = " authors: Alex Reynolds and Shane Neph"
-version = " version: 2.4.26"
+version = " version: 2.4.28"
usage = """ $ update-sort-bed-migrate-candidates [ --dry-run ] [ --debug ]
[ --write-list |
--resort-immediately |
diff --git a/applications/bed/sort-bed/src/update-sort-bed-slurm.py b/applications/bed/sort-bed/src/update-sort-bed-slurm.py
index cb92e17..f1403c8 100755
--- a/applications/bed/sort-bed/src/update-sort-bed-slurm.py
+++ b/applications/bed/sort-bed/src/update-sort-bed-slurm.py
@@ -33,7 +33,7 @@ import logging
name = "update-sort-bed-slurm"
citation = " citation: http://bioinformatics.oxfordjournals.org/content/28/14/1919.abstract"
authors = " authors: Alex Reynolds and Shane Neph"
-version = " version: 2.4.26"
+version = " version: 2.4.28"
usage = """ $ update-sort-bed-slurm [ --slurm-memory <MB> ]
[ --slurm-partition <SLURM partition> ]
[ --slurm-workdir <working directory> ]
diff --git a/applications/bed/sort-bed/src/update-sort-bed-starch-slurm.py b/applications/bed/sort-bed/src/update-sort-bed-starch-slurm.py
index 038a858..d2ce7fd 100755
--- a/applications/bed/sort-bed/src/update-sort-bed-starch-slurm.py
+++ b/applications/bed/sort-bed/src/update-sort-bed-starch-slurm.py
@@ -33,7 +33,7 @@ import logging
name = "update-sort-bed-starch-slurm"
citation = " citation: http://bioinformatics.oxfordjournals.org/content/28/14/1919.abstract"
authors = " authors: Alex Reynolds and Shane Neph"
-version = " version: 2.4.26"
+version = " version: 2.4.28"
usage = """ $ update-sort-bed-starch-slurm [ --slurm-memory <MB> ]
[ --slurm-partition <SLURM partition> ]
[ --slurm-workdir <working directory> ]
@@ -288,7 +288,7 @@ def main():
'--partition',
slurm_partition,
'--wrap',
- '"srun ' + unstarch_path + ' ' + chromosome + ' ' + args.input_fn + ' | ' + sort_bed_path + ' - | ' + starch_path + ' - > ' + temp_dest + '"'
+ '"srun ' + unstarch_path + ' ' + chromosome + ' ' + args.input_original_fn + ' | ' + sort_bed_path + ' - | ' + starch_path + ' - > ' + temp_dest + '"'
]
if logger: logger.info('Submitting job via [%s]' % (' '.join(per_chromosome_sort_cmd_components)))
try:
diff --git a/applications/bed/starch/src/Makefile b/applications/bed/starch/src/Makefile
index fc81548..6f930ca 100644
--- a/applications/bed/starch/src/Makefile
+++ b/applications/bed/starch/src/Makefile
@@ -5,9 +5,9 @@ MAINAPPDIR = ../..
PARTY3 = $(HEAD)/third-party
BINDIR = ../bin
THISDIR = ${shell pwd}
-LIBSTARCH = libstarch.a
-LIBSTARCHDEBUG = libstarch_debug.a
-LIBSTARCHGPROF = libstarch_gprof.a
+LIBSTARCH = libstarch${POSTFIX}.a
+LIBSTARCHDEBUG = libstarch_debug${POSTFIX}.a
+LIBSTARCHGPROF = libstarch_gprof${POSTFIX}.a
LIBJANSSON = libjansson.a
LIBBZIP2 = libbz2.a
LIBZLIB = libz.a
@@ -28,63 +28,80 @@ LOCALZLIBLIBDIR = ${LOCALZLIBDIR}
LOCALZLIBLIB = ${LOCALZLIBLIBDIR}/${LIBZLIB}
LOCALZLIBINCDIR = ${LOCALZLIBDIR}
OBJDIR = ${INTERFACES}/src/data/starch
-LOCALOBJDIR = objects
+LOCALOBJDIR = objects${POSTFIX}
INCLUDES = -iquote${MAIN} -iquote${HEAD} -iquote${PARTY3} -I${LOCALJANSSONINCDIR} -I${LOCALBZIP2INCDIR} -I${LOCALZLIBINCDIR}
LIBRARIES = ${LOCALJANSSONLIB} ${LOCALBZIP2LIB} ${LOCALZLIBLIB}
-ARCH_VERSION = v2.1
-BIN_VERSION = v2.4.16
+ARCH_VERSION = v2.2
+BIN_VERSION = v2.4.27
TEST = ../test
TEST_LINUX_BINDIR = ${TEST}/binaries/linux/${ARCH_VERSION}/bin
TEST_OSX_BINDIR = ${TEST}/binaries/osx/${ARCH_VERSION}/bin
AR = ar
SFLAGS = -static
CXXFLAGS = -D__STDC_CONSTANT_MACROS -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE=1 -DUSE_ZLIB -DUSE_BZLIB -O2 -Wformat -Wall -Wextra -Wswitch-enum -std=c++11 ${SFLAGS} -s
-CXXDFLAGS = -D__STDC_CONSTANT_MACROS -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE=1 -DUSE_ZLIB -DUSE_BZLIB -O0 -g -Wformat -Wall -Wextra -Wswitch-enum -std=c++11 -DDEBUG_VERBOSE=1 ${SFLAGS}
-CXXGFLAGS = -D__STDC_CONSTANT_MACROS -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE=1 -DUSE_ZLIB -DUSE_BZLIB -O -Wformat -Wall -Wextra -Wswitch-enum -std=c++11 -DDEBUG_VERBOSE=1 ${SFLAGS} -pg
+CXXDFLAGS = -D__STDC_CONSTANT_MACROS -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE=1 -DUSE_ZLIB -DUSE_BZLIB -O0 -g -Wformat -Wall -Wextra -Wswitch-enum -std=c++11 -DDEBUG_VERBOSE=1 ${SFLAGS} -DDEBUG=1
+CXXGFLAGS = -D__STDC_CONSTANT_MACROS -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE=1 -DUSE_ZLIB -DUSE_BZLIB -O -Wformat -Wall -Wextra -Wswitch-enum -std=c++11 -DDEBUG_VERBOSE=1 ${SFLAGS} -DDEBUG=1 -pg
STARCH_NAMES = starchConstants unstarchHelpers starchHelpers starchMetadataHelpers starchFileHelpers starchSha1Digest starchBase64Coding
STARCH_OBJECTS = $(addprefix $(LOCALOBJDIR)/, $(addsuffix .o, $(STARCH_NAMES)))
+ifeq ($(BINARY_TYPE),)
+ TFLAG = -DBEDOPS_BINARY_TYPE=0
+else
+ TFLAG = -DBEDOPS_BINARY_TYPE=$(BINARY_TYPE_NUM)
+endif
+
.PHONY: starchcluster starch unstarch starchcat build build_debug build_gprof starch-diff starchstrip
build: starch unstarch starchcat starchcluster starch-diff starchstrip
+ rm -rf ${LOCALOBJDIR}
build_debug: $(BINDIR)/debug.starch $(BINDIR)/debug.unstarch $(BINDIR)/debug.starchcat $(BINDIR)/debug.starchstrip
+ rm -rf ${LOCALOBJDIR}
build_gprof: $(BINDIR)/gprof.starch $(BINDIR)/gprof.unstarch $(BINDIR)/gprof.starchcat $(BINDIR)/gprof.starchstrip
+ rm -rf ${LOCALOBJDIR}
# Cancel implicit compilation rules
% : %.o
% : %.c
-starch: $(BINDIR)/starch
-unstarch: $(BINDIR)/unstarch
-starchcat: $(BINDIR)/starchcat
-starchcluster: $(BINDIR)/starchcluster_gnuParallel $(BINDIR)/starchcluster_sge $(BINDIR)/starchcluster_slurm
-starch-diff: $(BINDIR)/starch-diff
-starchstrip: $(BINDIR)/starchstrip
+starch: $(BINDIR)/starch-$(BINARY_TYPE)
+unstarch: $(BINDIR)/unstarch-$(BINARY_TYPE)
+starchcat: $(BINDIR)/starchcat-$(BINARY_TYPE)
+starchcluster: $(BINDIR)/starchcluster_gnuParallel-$(BINARY_TYPE) $(BINDIR)/starchcluster_sge-$(BINARY_TYPE) $(BINDIR)/starchcluster_slurm-$(BINARY_TYPE)
+starch-diff: $(BINDIR)/starch-diff-$(BINARY_TYPE)
+starchstrip: $(BINDIR)/starchstrip-$(BINARY_TYPE)
-$(BINDIR)/% : %.c $(LOCALSTARCHLIB) $(LIBRARIES)
+$(BINDIR)/%-$(BINARY_TYPE) : %.c $(LOCALSTARCHLIB) $(LIBRARIES)
mkdir -p $(BINDIR)
- ${CXX} ${CXXFLAGS} -c $*.c -o $(LOCALOBJDIR)/$*.o ${INCLUDES}
- ${CXX} ${CXXFLAGS} $(LOCALOBJDIR)/$*.o -o $@ ${LOCALSTARCHLIB} ${LIBRARIES}
+ ${CXX} ${CXXFLAGS} ${TFLAG} ${MEGAFLAGS} -c $*.c -o $(LOCALOBJDIR)/$*.o ${INCLUDES}
+ ${CXX} ${CXXFLAGS} ${TFLAG} ${MEGAFLAGS} $(LOCALOBJDIR)/$*.o -o $@ ${LOCALSTARCHLIB} ${LIBRARIES}
$(BINDIR)/debug.% : %.c $(LOCALSTARCHLIB) $(LIBRARIES)
mkdir -p $(BINDIR)
- ${CXX} ${CXXDFLAGS} -c $*.c -o $(LOCALOBJDIR)/$*.o ${INCLUDES}
- ${CXX} ${CXXDFLAGS} $(LOCALOBJDIR)/$*.o -o $@ ${LOCALSTARCHLIB} ${LIBRARIES}
+ ${CXX} ${CXXDFLAGS} ${TFLAG} ${MEGAFLAGS} -c $*.c -o $(LOCALOBJDIR)/$*.o ${INCLUDES}
+ ${CXX} ${CXXDFLAGS} ${TFLAG} ${MEGAFLAGS} $(LOCALOBJDIR)/$*.o -o $@ ${LOCALSTARCHLIB} ${LIBRARIES}
$(BINDIR)/gprof.% : %.c $(LOCALSTARCHLIB) $(LIBRARIES)
mkdir -p $(BINDIR)
- ${CXX} ${CXXGFLAGS} -c $*.c -o $(LOCALOBJDIR)/$*.o ${INCLUDES}
- ${CXX} ${CXXGFLAGS} $(LOCALOBJDIR)/$*.o -o $@ ${LOCALSTARCHLIB} ${LIBRARIES}
+ ${CXX} ${CXXGFLAGS} ${TFLAG} ${MEGAFLAGS} -c $*.c -o $(LOCALOBJDIR)/$*.o ${INCLUDES}
+ ${CXX} ${CXXGFLAGS} ${TFLAG} ${MEGAFLAGS} $(LOCALOBJDIR)/$*.o -o $@ ${LOCALSTARCHLIB} ${LIBRARIES}
$(BINDIR)/% : %.tcsh
mkdir -p $(BINDIR)
cp $< $@
+$(BINDIR)/%-$(BINARY_TYPE) : %.tcsh
+ mkdir -p $(BINDIR)
+ cp $< $@
+
$(BINDIR)/% : %.py
mkdir -p $(BINDIR)
cp $< $@
+$(BINDIR)/%-$(BINARY_TYPE) : %.py
+ mkdir -p $(BINDIR)
+ cp $< $@
+
starchLibrary: $(LOCALSTARCHLIB)
$(LOCALSTARCHLIB) : $(STARCH_OBJECTS)
@@ -93,18 +110,17 @@ $(LOCALSTARCHLIB) : $(STARCH_OBJECTS)
$(LOCALOBJDIR)/%.o : $(OBJDIR)/%.c $(LIBRARIES)
mkdir -p $(LOCALOBJDIR)
- ${CXX} ${CXXFLAGS} -c $< -o $@ ${INCLUDES}
+ ${CXX} ${CXXFLAGS} ${TFLAG} -c $< -o $@ ${INCLUDES}
test: starch unstarch starchcat
- cp ${BINDIR}/starch ${TEST_LINUX_BINDIR}/starch
- cp ${BINDIR}/unstarch ${TEST_LINUX_BINDIR}/unstarch
- cp ${BINDIR}/starchcat ${TEST_LINUX_BINDIR}/starchcat
+ cp ${BINDIR}/starch-${BINARY_TYPE} ${TEST_LINUX_BINDIR}/starch-${BINARY_TYPE}
+ cp ${BINDIR}/unstarch-${BINARY_TYPE} ${TEST_LINUX_BINDIR}/unstarch-${BINARY_TYPE}
+ cp ${BINDIR}/starchcat-${BINARY_TYPE} ${TEST_LINUX_BINDIR}/starchcat-${BINARY_TYPE}
make -C ${TEST} all
clean:
- rm -f $(LOCALSTARCHLIB)
+ rm -rf $(LOCALSTARCHLIBDIR)
rm -f ${LOCALSTARCHLIBDEBUG}
rm -f ${LOCALSTARCHLIBGPROF}
- rm -f ${BINDIR}/*starch*
rm -rf ${LOCALOBJDIR}
rm -rf ${BINDIR}
diff --git a/applications/bed/starch/src/Makefile.darwin b/applications/bed/starch/src/Makefile.darwin
index eac99a8..24c4496 100644
--- a/applications/bed/starch/src/Makefile.darwin
+++ b/applications/bed/starch/src/Makefile.darwin
@@ -1,5 +1,3 @@
-MIN_OSX_VERSION = 10.7
-
MAIN = ../../../..
MAINAPPDIR = ../..
INTERFACES = $(MAIN)/interfaces
@@ -11,7 +9,7 @@ LIBSTARCHDEBUG = libstarch_debug.a
LIBJANSSON = libjansson.a
LIBBZIP2 = libbz2.a
LIBZLIB = libz.a
-LOCALSTARCHLIBDIR = ../lib_${ARCH}
+LOCALSTARCHLIBDIR = ../lib
LOCALSTARCHLIB = ${LOCALSTARCHLIBDIR}/${LIBSTARCH}
LOCALSTARCHLIBDEBUG = ${LOCALSTARCHLIBDIR}/${LIBSTARCHDEBUG}
LOCALJANSSONDIR = ${PARTY3}/darwin_intel_${ARCH}/jansson
@@ -27,37 +25,44 @@ LOCALZLIBLIBDIR = ${LOCALZLIBDIR}
LOCALZLIBLIB = ${LOCALZLIBLIBDIR}/${LIBZLIB}
LOCALZLIBINCDIR = ${LOCALZLIBDIR}
OBJDIR = ${INTERFACES}/src/data/starch
-LOCALOBJDIR = objects_${ARCH}
+LOCALOBJDIR = objects_${BINARY_TYPE}
INCLUDES = -iquote${MAIN} -iquote${HEAD} -iquote${PARTY3} -I${LOCALJANSSONINCDIR} -I${LOCALBZIP2INCDIR} -I${LOCALZLIBINCDIR}
LIBRARIES = ${LOCALJANSSONLIB} ${LOCALBZIP2LIB} ${LOCALZLIBLIB}
-BINDIR = ../bin_${ARCH}
+BINDIR = ../bin
WARNINGS = -Weverything -Wno-c++98-compat-pedantic -Wno-padded
ARCH_VERSION = v2.2
-BIN_VERSION = v2.4.26
+BIN_VERSION = v2.4.28
TEST = ../test
TEST_OSX_BINDIR = ${TEST}/binaries/osx/${ARCH_VERSION}/bin
-CFLAGS = -D__STDC_CONSTANT_MACROS -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE=1 -DUSE_ZLIB -DUSE_BZLIB -O2 ${WARNINGS} -std=c99 -mmacosx-version-min=$(MIN_OSX_VERSION) -arch ${ARCH} -x c++ -v -stdlib=libc++ -std=c++11
-CXXFLAGS = -D__STDC_CONSTANT_MACROS -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE=1 -DUSE_ZLIB -DUSE_BZLIB -O2 ${WARNINGS} -std=c++11 -stdlib=libc++ -mmacosx-version-min=$(MIN_OSX_VERSION) -arch ${ARCH}
-CDFLAGS = -D__STDC_CONSTANT_MACROS -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE=1 -DUSE_ZLIB -DUSE_BZLIB -O0 -g ${WARNINGS} -std=c99 -DDEBUG=1 -mmacosx-version-min=$(MIN_OSX_VERSION) -arch ${ARCH} -x c++ -v -stdlib=libc++ -std=c++11
-CXXDFLAGS = -D__STDC_CONSTANT_MACROS -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE=1 -DUSE_ZLIB -DUSE_BZLIB -O0 -g ${WARNINGS} -std=c++11 -stdlib=libc++ -DDEBUG=1 -mmacosx-version-min=$(MIN_OSX_VERSION) -arch ${ARCH}
+ifeq ($(BINARY_TYPE),)
+ TFLAG = -DBEDOPS_BINARY_TYPE=0
+else
+ TFLAG = -DBEDOPS_BINARY_TYPE=$(BINARY_TYPE_NUM)
+endif
+
+CCFLAGS = ${MEGAFLAGS} ${TFLAG} -D__STDC_CONSTANT_MACROS -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE=1 -DUSE_ZLIB -DUSE_BZLIB -O2 ${WARNINGS} -std=c99 -mmacosx-version-min=$(MIN_OSX_VERSION) -arch ${ARCH} -x c++ -v -stdlib=libc++ -std=c++11
+CXXFLAGS = ${MEGAFLAGS} ${TFLAG} -D__STDC_CONSTANT_MACROS -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE=1 -DUSE_ZLIB -DUSE_BZLIB -O2 ${WARNINGS} -std=c++11 -stdlib=libc++ -mmacosx-version-min=$(MIN_OSX_VERSION) -arch ${ARCH}
+CDFLAGS = ${MEGAFLAGS} ${TFLAG} -D__STDC_CONSTANT_MACROS -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE=1 -DUSE_ZLIB -DUSE_BZLIB -O0 -g ${WARNINGS} -std=c99 -DDEBUG=1 -mmacosx-version-min=$(MIN_OSX_VERSION) -arch ${ARCH} -x c++ -v -stdlib=libc++ -std=c++11
+CXXDFLAGS = ${MEGAFLAGS} ${TFLAG} -D__STDC_CONSTANT_MACROS -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE=1 -DUSE_ZLIB -DUSE_BZLIB -O0 -g ${WARNINGS} -std=c++11 -stdlib=libc++ -DDEBUG=1 -mmacosx-version-min=$(MIN_OSX_VERSION) -arch ${ARCH}
build: dependencies starchLibrary starch unstarch starchcat starchcluster starch-diff starchstrip
rm -f *~
+ rm -Rf ${LOCALOBJDIR}
# dependencies-related recipes all have mkdirs prereqs
# and pretty much everything else has dependencies-related prereqs at some level
# -> let make figure out hierarchy and eliminate mkdir/rm race conditions
dependencies: mkdirs
- ${CC} ${CFLAGS} -c ${OBJDIR}/starchConstants.c -o ${LOCALOBJDIR}/starchConstants.o ${INCLUDES}
- ${CC} ${CFLAGS} -c ${OBJDIR}/starchMetadataHelpers.c -o ${LOCALOBJDIR}/starchMetadataHelpers.o ${INCLUDES}
- ${CC} ${CFLAGS} -c ${OBJDIR}/unstarchHelpers.c -o ${LOCALOBJDIR}/unstarchHelpers.o ${INCLUDES}
- ${CC} ${CFLAGS} -c ${OBJDIR}/starchHelpers.c -o ${LOCALOBJDIR}/starchHelpers.o ${INCLUDES}
- ${CC} ${CFLAGS} -c ${OBJDIR}/starchFileHelpers.c -o ${LOCALOBJDIR}/starchFileHelpers.o ${INCLUDES}
- ${CC} ${CFLAGS} -c ${OBJDIR}/starchSha1Digest.c -o ${LOCALOBJDIR}/starchSha1Digest.o ${INCLUDES}
- ${CC} ${CFLAGS} -c ${OBJDIR}/starchBase64Coding.c -o ${LOCALOBJDIR}/starchBase64Coding.o ${INCLUDES}
-
-build_debug: dependencies_debug starchLibrary_debug starch_debug unstarch_debug starchcat_debug starchstrip_debug
+ ${CC} ${CCFLAGS} -c ${OBJDIR}/starchConstants.c -o ${LOCALOBJDIR}/starchConstants.o ${INCLUDES}
+ ${CC} ${CCFLAGS} -c ${OBJDIR}/starchMetadataHelpers.c -o ${LOCALOBJDIR}/starchMetadataHelpers.o ${INCLUDES}
+ ${CC} ${CCFLAGS} -c ${OBJDIR}/unstarchHelpers.c -o ${LOCALOBJDIR}/unstarchHelpers.o ${INCLUDES}
+ ${CC} ${CCFLAGS} -c ${OBJDIR}/starchHelpers.c -o ${LOCALOBJDIR}/starchHelpers.o ${INCLUDES}
+ ${CC} ${CCFLAGS} -c ${OBJDIR}/starchFileHelpers.c -o ${LOCALOBJDIR}/starchFileHelpers.o ${INCLUDES}
+ ${CC} ${CCFLAGS} -c ${OBJDIR}/starchSha1Digest.c -o ${LOCALOBJDIR}/starchSha1Digest.o ${INCLUDES}
+ ${CC} ${CCFLAGS} -c ${OBJDIR}/starchBase64Coding.c -o ${LOCALOBJDIR}/starchBase64Coding.o ${INCLUDES}
+
+build_debug: dependencies_debug starchLibrary_debug starch_debug unstarch_debug starchcat_debug starchstrip_debug starchcluster starch-diff
rm -f *~
dependencies_debug: mkdirs
@@ -76,61 +81,61 @@ starchLibrary_debug: dependencies_debug
${AR} rcs ${LOCALSTARCHLIBDEBUG} ${LOCALOBJDIR}/starchConstants.o ${LOCALOBJDIR}/unstarchHelpers.o ${LOCALOBJDIR}/starchHelpers.o ${LOCALOBJDIR}/starchMetadataHelpers.o ${LOCALOBJDIR}/starchFileHelpers.o ${LOCALOBJDIR}/starchSha1Digest.o ${LOCALOBJDIR}/starchBase64Coding.o
starch: starchLibrary
- ${CC} ${CFLAGS} -c starch.c -o $(LOCALOBJDIR)/starch.o ${INCLUDES}
- ${CXX} ${CXXFLAGS} -lc++ $(LOCALOBJDIR)/starch.o -o ${BINDIR}/starch ${LOCALSTARCHLIB} ${LIBRARIES}
+ ${CC} ${CCFLAGS} -c starch.c -o $(LOCALOBJDIR)/starch.o ${INCLUDES}
+ ${CXX} ${CXXFLAGS} -lc++ $(LOCALOBJDIR)/starch.o -o ${BINDIR}/starch-${BINARY_TYPE} ${LOCALSTARCHLIB} ${LIBRARIES}
starch_debug: starchLibrary_debug
${CC} ${CDFLAGS} -c starch.c -o $(LOCALOBJDIR)/debug.starch.o ${INCLUDES}
- ${CXX} ${CXXDFLAGS} -lc++ $(LOCALOBJDIR)/debug.starch.o -o ${BINDIR}/debug.starch ${LOCALSTARCHLIBDEBUG} ${LIBRARIES}
+ ${CXX} ${CXXDFLAGS} -lc++ $(LOCALOBJDIR)/debug.starch.o -o ${BINDIR}/debug.starch-${BINARY_TYPE} ${LOCALSTARCHLIBDEBUG} ${LIBRARIES}
unstarch: starchLibrary
- ${CC} ${CFLAGS} -c unstarch.c -o $(LOCALOBJDIR)/unstarch.o ${INCLUDES}
- ${CXX} ${CXXFLAGS} -lc++ $(LOCALOBJDIR)/unstarch.o -o ${BINDIR}/unstarch ${LOCALSTARCHLIB} ${LIBRARIES}
+ ${CC} ${CCFLAGS} -c unstarch.c -o $(LOCALOBJDIR)/unstarch.o ${INCLUDES}
+ ${CXX} ${CXXFLAGS} -lc++ $(LOCALOBJDIR)/unstarch.o -o ${BINDIR}/unstarch-${BINARY_TYPE} ${LOCALSTARCHLIB} ${LIBRARIES}
unstarch_debug: starchLibrary_debug
${CC} ${CDFLAGS} -c unstarch.c -o $(LOCALOBJDIR)/debug.unstarch.o ${INCLUDES}
- ${CXX} ${CXXDFLAGS} -lc++ $(LOCALOBJDIR)/debug.unstarch.o -o ${BINDIR}/debug.unstarch ${LOCALSTARCHLIBDEBUG} ${LIBRARIES}
+ ${CXX} ${CXXDFLAGS} -lc++ $(LOCALOBJDIR)/debug.unstarch.o -o ${BINDIR}/debug.unstarch-${BINARY_TYPE} ${LOCALSTARCHLIBDEBUG} ${LIBRARIES}
starchcluster: starchcat
- cp starchcluster_sge.tcsh ${BINDIR}/starchcluster_sge
- cp starchcluster_gnuParallel.tcsh ${BINDIR}/starchcluster_gnuParallel
- cp starchcluster_slurm.tcsh ${BINDIR}/starchcluster_slurm
+ cp starchcluster_sge.tcsh ${BINDIR}/starchcluster_sge-${BINARY_TYPE}
+ cp starchcluster_gnuParallel.tcsh ${BINDIR}/starchcluster_gnuParallel-${BINARY_TYPE}
+ cp starchcluster_slurm.tcsh ${BINDIR}/starchcluster_slurm-${BINARY_TYPE}
starch-diff: unstarch
- cp starch-diff.py ${BINDIR}/starch-diff
+ cp starch-diff.py ${BINDIR}/starch-diff-${BINARY_TYPE}
starchcat: starchLibrary
- ${CC} ${CFLAGS} -c starchcat.c -o $(LOCALOBJDIR)/starchcat.o ${INCLUDES}
- ${CXX} ${CXXFLAGS} -lc++ $(LOCALOBJDIR)/starchcat.o -o ${BINDIR}/starchcat ${LOCALSTARCHLIB} ${LIBRARIES}
+ ${CC} ${CCFLAGS} -c starchcat.c -o $(LOCALOBJDIR)/starchcat.o ${INCLUDES}
+ ${CXX} ${CXXFLAGS} -lc++ $(LOCALOBJDIR)/starchcat.o -o ${BINDIR}/starchcat-${BINARY_TYPE} ${LOCALSTARCHLIB} ${LIBRARIES}
starchcat_debug: starchLibrary_debug
${CC} ${CDFLAGS} -c starchcat.c -o $(LOCALOBJDIR)/starchcat.o ${INCLUDES}
- ${CXX} ${CXXDFLAGS} -lc++ $(LOCALOBJDIR)/starchcat.o -o ${BINDIR}/debug.starchcat ${LOCALSTARCHLIBDEBUG} ${LIBRARIES}
+ ${CXX} ${CXXDFLAGS} -lc++ $(LOCALOBJDIR)/starchcat.o -o ${BINDIR}/debug.starchcat-${BINARY_TYPE} ${LOCALSTARCHLIBDEBUG} ${LIBRARIES}
starchstrip: starchLibrary
- ${CC} ${CFLAGS} -c starchstrip.c -o $(LOCALOBJDIR)/starchstrip.o ${INCLUDES}
- ${CXX} ${CXXFLAGS} -lc++ $(LOCALOBJDIR)/starchstrip.o -o ${BINDIR}/starchstrip ${LOCALSTARCHLIB} ${LIBRARIES}
+ ${CC} ${CCFLAGS} -c starchstrip.c -o $(LOCALOBJDIR)/starchstrip.o ${INCLUDES}
+ ${CXX} ${CXXFLAGS} -lc++ $(LOCALOBJDIR)/starchstrip.o -o ${BINDIR}/starchstrip-${BINARY_TYPE} ${LOCALSTARCHLIB} ${LIBRARIES}
starchstrip_debug: starchLibrary_debug
${CC} ${CDFLAGS} -c starchstrip.c -o $(LOCALOBJDIR)/debug.starchstrip.o ${INCLUDES}
- ${CXX} ${CXXDFLAGS} -lc++ $(LOCALOBJDIR)/debug.starchstrip.o -o ${BINDIR}/debug.starchstrip ${LOCALSTARCHLIBDEBUG} ${LIBRARIES}
+ ${CXX} ${CXXDFLAGS} -lc++ $(LOCALOBJDIR)/debug.starchstrip.o -o ${BINDIR}/debug.starchstrip-${BINARY_TYPE} ${LOCALSTARCHLIBDEBUG} ${LIBRARIES}
test: starch unstarch starchcat
- cp ${BINDIR}/starch ${TEST_OSX_BINDIR}/starch
- cp ${BINDIR}/unstarch ${TEST_OSX_BINDIR}/unstarch
- cp ${BINDIR}/starchcat ${TEST_OSX_BINDIR}/starchcat
+ cp ${BINDIR}/starch-${BINARY_TYPE} ${TEST_OSX_BINDIR}/starch-${BINARY_TYPE}
+ cp ${BINDIR}/unstarch-${BINARY_TYPE} ${TEST_OSX_BINDIR}/unstarch-${BINARY_TYPE}
+ cp ${BINDIR}/starchcat-${BINARY_TYPE} ${TEST_OSX_BINDIR}/starchcat-${BINARY_TYPE}
make -C ${TEST} all
mkdirs:
+ rm -rf ${LOCALOBJDIR}
+ rm -rf ${LOCALSTARCHLIBDIR}
mkdir -p ${LOCALOBJDIR}
mkdir -p ${LOCALSTARCHLIBDIR}
mkdir -p ${BINDIR}
clean:
- rm -f $(LOCALSTARCHLIB)
+ rm -rf $(LOCALSTARCHLIBDIR)
rm -f ${LOCALSTARCHLIBDEBUG}
- rm -Rf ${LOCALOBJDIR}
- rm -Rf ${LOCALSTARCHLIBDIR}
- rm -rf ${BINDIR}/*starch*
- rm -Rf ${BINDIR}
- rm -Rf ${THISDIR}/../bin
+ rm -rf ${LOCALOBJDIR}
+ rm -rf ${LOCALSTARCHLIBDIR}
+ rm -rf ${BINDIR}
diff --git a/applications/bed/starch/src/starch-diff.py b/applications/bed/starch/src/starch-diff.py
index e989c1f..1c25ecc 100755
--- a/applications/bed/starch/src/starch-diff.py
+++ b/applications/bed/starch/src/starch-diff.py
@@ -32,11 +32,20 @@ import logging
name = "starch-diff"
citation = " citation: http://bioinformatics.oxfordjournals.org/content/28/14/1919.abstract"
authors = " authors: Alex Reynolds and Shane Neph"
-version = " version: 2.4.26"
+version = " version: 2.4.28"
usage = " $ starch-diff [ --chr <chr> ] starch-file-1 starch-file-2 [ starch-file-3 ... ]"
help = """
The 'starch-diff' utility compares the signatures of two or more specified
Starch v2.2+ archives for all chromosomes, or for a specified chromosome.
+
+ The typical output of 'starch-diff' is a message indicating that the
+ archives' chromosome(s) are identical or dissimilar, written to the standard
+ error stream.
+
+ In addition, if all chromosomes are identical, 'starch-diff' exits with a
+ zero status code. Likewise, if any chromosomes are dissimilar, 'starch-diff'
+ exits with a non-zero status code. This facilitates testing in a scripting
+ environment.
"""
default_chromosome = "all"
diff --git a/applications/bed/starch/src/starch.c b/applications/bed/starch/src/starch.c
index 3e793ab..6c904f0 100644
--- a/applications/bed/starch/src/starch.c
+++ b/applications/bed/starch/src/starch.c
@@ -41,7 +41,7 @@ namespace {
#endif
int
-main (int argc, char **argv)
+main(int argc, char **argv)
{
#ifdef DEBUG
fprintf (stderr, "\n--- starch main() - enter ---\n");
@@ -64,15 +64,15 @@ main (int argc, char **argv)
parseValue = STARCH_parseCommandLineOptions (argc, argv);
switch (parseValue) {
case STARCH_HELP_ERROR: {
- STARCH_printUsage (STARCH_HELP_ERROR);
+ STARCH_printUsage(STARCH_HELP_ERROR);
return EXIT_SUCCESS;
}
case STARCH_VERSION_ERROR: {
- STARCH_printRevision ();
+ STARCH_printRevision();
return EXIT_SUCCESS;
}
case STARCH_FATAL_ERROR: {
- STARCH_printUsage (STARCH_FATAL_ERROR);
+ STARCH_printUsage(STARCH_FATAL_ERROR);
return EXIT_FAILURE;
}
}
@@ -205,21 +205,27 @@ main (int argc, char **argv)
}
#endif
}
-
+
else if (STARCH_MAJOR_VERSION > 2) {
fprintf (stderr, "ERROR: Starch does not yet support making archives in this major version release (built as: %d.%d.%d)\n", STARCH_MAJOR_VERSION, STARCH_MINOR_VERSION, STARCH_REVISION_VERSION); // this condition is preserved in case of test-builds of future-proofed Starch binaries
exit (EXIT_FAILURE);
}
/* cleanup */
- if (bedFnPtr != NULL)
- fclose (bedFnPtr), bedFnPtr = NULL;
+ if (bedFnPtr != NULL) {
+ fclose (bedFnPtr);
+ bedFnPtr = NULL;
+ }
if (metadata != NULL)
STARCH_freeMetadata (&metadata);
- if (starchHeader)
- free (starchHeader), starchHeader = NULL;
- if (starch_client_global_args.uniqueTag)
- free (starch_client_global_args.uniqueTag), starch_client_global_args.uniqueTag = NULL;
+ if (starchHeader) {
+ free (starchHeader);
+ starchHeader = NULL;
+ }
+ if (starch_client_global_args.uniqueTag) {
+ free (starch_client_global_args.uniqueTag);
+ starch_client_global_args.uniqueTag = NULL;
+ }
#ifdef DEBUG
fprintf (stderr, "\n--- starch main() - exit ---\n");
@@ -233,7 +239,7 @@ namespace starch {
#endif
void
-STARCH_initializeGlobals ()
+STARCH_initializeGlobals()
{
#ifdef DEBUG
fprintf (stderr, "\n--- STARCH_initializeGlobals() ---\n");
@@ -251,7 +257,7 @@ STARCH_initializeGlobals ()
}
int
-STARCH_parseCommandLineOptions (int argc, char **argv)
+STARCH_parseCommandLineOptions(int argc, char **argv)
{
#ifdef DEBUG
fprintf (stderr, "\n--- STARCH_parseCommandLineOptions() ---\n");
@@ -342,7 +348,7 @@ STARCH_parseCommandLineOptions (int argc, char **argv)
}
void
-STARCH_printUsage (int errorType)
+STARCH_printUsage(int errorType)
{
#ifdef DEBUG
fprintf (stderr, "\n--- STARCH_printUsage() ---\n");
@@ -360,7 +366,7 @@ STARCH_printUsage (int errorType)
case STARCH_FATAL_ERROR:
case STARCH_HELP_ERROR:
default: {
- fprintf(stderr, "%s\n citation: %s\n binary version: %s (creates archive version: %s)\n authors: %s\n%s\n\n", name, BEDOPS::citation(), BEDOPS::revision(), avStr, authors, usage);
+ fprintf(stderr, "%s\n citation: %s\n binary version: %s (%s) (creates archive version: %s)\n authors: %s\n%s\n\n", name, BEDOPS::citation(), BEDOPS::revision(), application_type, avStr, authors, usage);
break;
}
}
@@ -370,7 +376,7 @@ STARCH_printUsage (int errorType)
}
void
-STARCH_printRevision ()
+STARCH_printRevision()
{
#ifdef DEBUG
fprintf (stderr, "\n--- STARCH_printRevision() ---\n");
@@ -384,7 +390,7 @@ STARCH_printRevision ()
if (avStr != NULL) {
int result = sprintf (avStr, "%d.%d.%d", STARCH_MAJOR_VERSION, STARCH_MINOR_VERSION, STARCH_REVISION_VERSION);
if (result != -1)
- fprintf (stderr, "%s\n binary version: %s (creates archive version: %s)\n", name, BEDOPS::revision(), avStr);
+ fprintf (stderr, "%s\n binary version: %s (%s) (creates archive version: %s)\n", name, BEDOPS::revision(), application_type, avStr);
free (avStr);
}
}
diff --git a/applications/bed/starch/src/starch.h b/applications/bed/starch/src/starch.h
index 79e213f..8166bf3 100644
--- a/applications/bed/starch/src/starch.h
+++ b/applications/bed/starch/src/starch.h
@@ -69,6 +69,16 @@ static const char *usage = "\n" \
" --version Show binary version.\n\n" \
" --help Show this usage message.\n";
+#if BEDOPS_BINARY_TYPE == 0
+static const char* application_type = "typical";
+#else
+#if BEDOPS_BINARY_TYPE == 1
+static const char* application_type = "megarow";
+#else
+static const char* application_type = "typical";
+#endif
+#endif
+
static struct starch_client_global_args_t {
char *note;
CompressionType compressionType;
diff --git a/applications/bed/starch/src/starchcat.c b/applications/bed/starch/src/starchcat.c
index 4f86292..6de4eef 100644
--- a/applications/bed/starch/src/starchcat.c
+++ b/applications/bed/starch/src/starchcat.c
@@ -63,8 +63,8 @@ namespace {
} // unnamed namespace
#endif
-int
-main (int argc, char **argv)
+int
+main (int argc, char **argv)
{
#ifdef DEBUG
fprintf (stderr, "\n--- starchcat main() - enter ---\n");
@@ -236,8 +236,8 @@ main (int argc, char **argv)
namespace starch {
#endif
-void
-STARCHCAT_initializeGlobals()
+void
+STARCHCAT_initializeGlobals()
{
#ifdef DEBUG
fprintf (stderr, "\n--- STARCHCAT_initializeGlobals() ---\n");
@@ -286,7 +286,7 @@ STARCHCAT_parseCommandLineOptions(int argc, char **argv)
fprintf (stderr, "ERROR: Numerical value is outside of range.\n");
return STARCHCAT_FATAL_ERROR;
}
- break;
+ break;
case 'h':
return STARCHCAT_HELP_ERROR;
case '?':
@@ -308,8 +308,8 @@ STARCHCAT_parseCommandLineOptions(int argc, char **argv)
return STARCHCAT_EXIT_SUCCESS;
}
-int
-STARCHCAT2_copyInputRecordToOutput (Metadata **outMd, const char *outTag, const CompressionType outType, const char *inChr, const MetadataRecord *inRec, size_t *cumulativeOutputSize, const Boolean reportProgressFlag)
+int
+STARCHCAT2_copyInputRecordToOutput(Metadata **outMd, const char *outTag, const CompressionType outType, const char *inChr, const MetadataRecord *inRec, size_t *cumulativeOutputSize, const Boolean reportProgressFlag)
{
#ifdef DEBUG
fprintf (stderr, "\n--- STARCHCAT2_copyInputRecordToOutput() ---\n");
@@ -380,7 +380,7 @@ STARCHCAT2_copyInputRecordToOutput (Metadata **outMd, const char *outTag, const
#endif
/* determine the offsets of the stream-of-interest */
- if (av->major == 2)
+ if (av->major == 2)
startOffset += STARCH2_MD_HEADER_BYTE_LENGTH;
else
startOffset += inRec->mdOffset;
@@ -532,12 +532,12 @@ STARCHCAT2_copyInputRecordToOutput (Metadata **outMd, const char *outTag, const
outSignature,
outFileLineMaxStringLength );
}
-
+
return STARCHCAT_EXIT_SUCCESS;
}
-int
-STARCHCAT_copyInputRecordToOutput (Metadata **outMd, const char *outTag, const CompressionType outType, const char *inChr, const MetadataRecord *inRec)
+int
+STARCHCAT_copyInputRecordToOutput(Metadata **outMd, const char *outTag, const CompressionType outType, const char *inChr, const MetadataRecord *inRec)
{
/*
This function copies the bytes of a single record (chromosome)
@@ -748,8 +748,8 @@ STARCHCAT_copyInputRecordToOutput (Metadata **outMd, const char *outTag, const C
return STARCHCAT_EXIT_SUCCESS;
}
-int
-STARCHCAT2_rewriteInputRecordToOutput (Metadata **outMd, const char *outTag, const CompressionType outType, const char *inChr, const MetadataRecord *inRec, size_t *cumulativeOutputSize, const Boolean generatePerChrSignatureFlag, const Boolean reportProgressFlag, const LineCountType reportProgressN)
+int
+STARCHCAT2_rewriteInputRecordToOutput(Metadata **outMd, const char *outTag, const CompressionType outType, const char *inChr, const MetadataRecord *inRec, size_t *cumulativeOutputSize, const Boolean generatePerChrSignatureFlag, const Boolean reportProgressFlag, const LineCountType reportProgressN)
{
/*
This function extracts a single record (chromosome) of data
@@ -777,17 +777,25 @@ STARCHCAT2_rewriteInputRecordToOutput (Metadata **outMd, const char *outTag, con
int64_t nRetransformBuf = 0;
/* allocate memory for intermediate buffer variables */
+#ifdef __cplusplus
+ retransformLineBuf = static_cast<unsigned char *>( calloc(TOKENS_MAX_LENGTH, sizeof(unsigned char)) );
+#else
retransformLineBuf = (unsigned char *) calloc(TOKENS_MAX_LENGTH, sizeof(unsigned char));
+#endif
if (!retransformLineBuf) {
fprintf(stderr, "ERROR: Insufficient memory for intermediate buffer variable [retransformLineBuf].\n");
exit(ENOMEM);
}
+#ifdef __cplusplus
+ retransformBuf = static_cast<unsigned char *>( calloc(STARCH_BUFFER_MAX_LENGTH, sizeof(unsigned char)) );
+#else
retransformBuf = (unsigned char *) calloc(STARCH_BUFFER_MAX_LENGTH, sizeof(unsigned char));
+#endif
if (!retransformBuf) {
fprintf(stderr, "ERROR: Insufficient memory for intermediate buffer variable [retransformBuf].\n");
exit(ENOMEM);
}
-
+
/* bzip2 variables */
BZFILE *bzInFp = NULL;
BZFILE *bzOutFp = NULL;
@@ -804,17 +812,29 @@ STARCHCAT2_rewriteInputRecordToOutput (Metadata **outMd, const char *outTag, con
unsigned int bzOutBytesWritten = 0U;
/* allocate memory for bzip2 variables */
+#ifdef __cplusplus
+ bzReadBuf = static_cast<unsigned char *>( calloc(STARCH_BZ_BUFFER_MAX_LENGTH, sizeof(unsigned char)) );
+#else
bzReadBuf = (unsigned char *) calloc(STARCH_BZ_BUFFER_MAX_LENGTH, sizeof(unsigned char));
+#endif
if (!bzReadBuf) {
fprintf(stderr, "ERROR: Insufficient memory for bzip2 variable [bzReadBuf].\n");
exit(ENOMEM);
}
+#ifdef __cplusplus
+ bzRemainderBuf = static_cast<unsigned char *>( calloc(STARCH_BZ_BUFFER_MAX_LENGTH, sizeof(unsigned char)) );
+#else
bzRemainderBuf = (unsigned char *) calloc(STARCH_BZ_BUFFER_MAX_LENGTH, sizeof(unsigned char));
+#endif
if (!bzRemainderBuf) {
fprintf(stderr, "ERROR: Insufficient memory for bzip2 variable [bzRemainderBuf].\n");
exit(ENOMEM);
}
+#ifdef __cplusplus
+ bzLineBuf = static_cast<unsigned char *>( calloc(STARCH_BZ_BUFFER_MAX_LENGTH, sizeof(unsigned char)) );
+#else
bzLineBuf = (unsigned char *) calloc(STARCH_BZ_BUFFER_MAX_LENGTH, sizeof(unsigned char));
+#endif
if (!bzLineBuf) {
fprintf(stderr, "ERROR: Insufficient memory for bzip2 variable [bzLineBuf].\n");
exit(ENOMEM);
@@ -836,27 +856,47 @@ STARCHCAT2_rewriteInputRecordToOutput (Metadata **outMd, const char *outTag, con
unsigned char *zLineBuf = NULL;
/* allocate memory for gzip variables */
+#ifdef __cplusplus
+ zOutBuffer = static_cast<unsigned char *>( calloc(STARCH_Z_BUFFER_MAX_LENGTH, sizeof(unsigned char)) );
+#else
zOutBuffer = (unsigned char *) calloc(STARCH_Z_BUFFER_MAX_LENGTH, sizeof(unsigned char));
+#endif
if (!zOutBuffer) {
fprintf(stderr, "ERROR: Insufficient memory for gzip variable [zOutBuffer].\n");
exit(ENOMEM);
}
+#ifdef __cplusplus
+ zReadBuf = static_cast<unsigned char *>( calloc(STARCH_Z_CHUNK/1024, sizeof(unsigned char)) );
+#else
zReadBuf = (unsigned char *) calloc(STARCH_Z_CHUNK/1024, sizeof(unsigned char));
+#endif
if (!zReadBuf) {
fprintf(stderr, "ERROR: Insufficient memory for gzip variable [zReadBuf].\n");
exit(ENOMEM);
}
+#ifdef __cplusplus
+ zOutBuf = static_cast<unsigned char *>( calloc(STARCH_Z_CHUNK, sizeof(unsigned char)) );
+#else
zOutBuf = (unsigned char *) calloc(STARCH_Z_CHUNK, sizeof(unsigned char));
+#endif
if (!zOutBuf) {
fprintf(stderr, "ERROR: Insufficient memory for gzip variable [zOutBuf].\n");
exit(ENOMEM);
}
+#ifdef __cplusplus
+ zRemainderBuf = static_cast<unsigned char *>( calloc(STARCH_Z_BUFFER_MAX_LENGTH, sizeof(unsigned char)) );
+#else
zRemainderBuf = (unsigned char *) calloc(STARCH_Z_BUFFER_MAX_LENGTH, sizeof(unsigned char));
+#endif
if (!zRemainderBuf) {
fprintf(stderr, "ERROR: Insufficient memory for gzip variable [zRemainderBuf].\n");
exit(ENOMEM);
}
+#ifdef __cplusplus
+ zLineBuf = static_cast<unsigned char *>( calloc(STARCH_Z_BUFFER_MAX_LENGTH, sizeof(unsigned char)) );
+#else
zLineBuf = (unsigned char *) calloc(STARCH_Z_BUFFER_MAX_LENGTH, sizeof(unsigned char));
+#endif
if (!zLineBuf) {
fprintf(stderr, "ERROR: Insufficient memory for gzip variable [zLineBuf].\n");
exit(ENOMEM);
@@ -891,12 +931,20 @@ STARCHCAT2_rewriteInputRecordToOutput (Metadata **outMd, const char *outTag, con
LineLengthType t_lineMaxStringLength = STARCH_DEFAULT_LINE_STRING_LENGTH;
/* allocate memory for transformation variables */
+#ifdef __cplusplus
+ t_firstInputToken = static_cast<char *>( calloc(UNSTARCH_FIRST_TOKEN_MAX_LENGTH, sizeof(char)) );
+#else
t_firstInputToken = (char *) calloc(UNSTARCH_FIRST_TOKEN_MAX_LENGTH, sizeof(char));
+#endif
if (!t_firstInputToken) {
fprintf(stderr, "ERROR: Insufficient memory for transformation variable [t_firstInputToken].\n");
exit(ENOMEM);
}
+#ifdef __cplusplus
+ t_secondInputToken = static_cast<char *>( calloc(UNSTARCH_SECOND_TOKEN_MAX_LENGTH, sizeof(char)) );
+#else
t_secondInputToken = (char *) calloc(UNSTARCH_SECOND_TOKEN_MAX_LENGTH, sizeof(char));
+#endif
if (!t_secondInputToken) {
fprintf(stderr, "ERROR: Insufficient memory for transformation variable [t_secondInputToken].\n");
exit(ENOMEM);
@@ -947,7 +995,7 @@ STARCHCAT2_rewriteInputRecordToOutput (Metadata **outMd, const char *outTag, con
/*
Use fseek() to ensure we are at the correct file offset before reading bytes
*/
- if (av->major == 2)
+ if (av->major == 2)
startOffset += STARCH2_MD_HEADER_BYTE_LENGTH;
else if (av->major == 1)
startOffset += inRec->mdOffset;
@@ -1049,7 +1097,7 @@ STARCHCAT2_rewriteInputRecordToOutput (Metadata **outMd, const char *outTag, con
return STARCHCAT_EXIT_FAILURE;
}
}
- }
+ }
break;
}
case kUndefined: {
@@ -1140,7 +1188,7 @@ STARCHCAT2_rewriteInputRecordToOutput (Metadata **outMd, const char *outTag, con
nBzRemainderBuf = 0;
}
bzBufIndex = 0;
- while (bzBufIndex < nBzRead) {
+ while (bzBufIndex < nBzRead) {
bufChar = bzReadBuf[bzBufIndex];
bzLineBuf[bufCharIndex++] = bufChar;
#ifdef DEBUG
@@ -1249,7 +1297,7 @@ STARCHCAT2_rewriteInputRecordToOutput (Metadata **outMd, const char *outTag, con
/* test for duplicate element */
if ((t_pStart == t_currStart) && (t_pStop == t_currStop))
t_duplicateElementExists = kStarchTrue;
-
+
/* test for nested element */
if ((t_pStart < t_currStart) && (t_pStop > t_currStop))
t_nestedElementExists = kStarchTrue;
@@ -1546,7 +1594,7 @@ STARCHCAT2_rewriteInputRecordToOutput (Metadata **outMd, const char *outTag, con
if (bzInError != BZ_OK) {
fprintf(stderr, "ERROR: Bzip2 error after closing read stream: %d\n", bzInError);
return STARCHCAT_EXIT_FAILURE;
- }
+ }
break;
}
@@ -1557,7 +1605,7 @@ STARCHCAT2_rewriteInputRecordToOutput (Metadata **outMd, const char *outTag, con
*/
case kGzip: {
#ifdef DEBUG
- fprintf (stderr, "\tsetting up gzip read stream...\n");
+ fprintf (stderr, "\tsetting up gzip read stream...\n");
#endif
zInStream.zalloc = Z_NULL;
zInStream.zfree = Z_NULL;
@@ -1570,7 +1618,7 @@ STARCHCAT2_rewriteInputRecordToOutput (Metadata **outMd, const char *outTag, con
fprintf(stderr, "ERROR: Could not initialize z-stream\n");
return STARCHCAT_EXIT_FAILURE;
}
-
+
do {
#ifdef DEBUG
fprintf (stderr, "\treading from stream... (%s)\n", inChr);
@@ -1629,7 +1677,7 @@ STARCHCAT2_rewriteInputRecordToOutput (Metadata **outMd, const char *outTag, con
buffer as is done for bzip2 streams.
*/
bufCharIndex = 0;
-
+
if (nZRemainderBuf > 0) {
#ifdef DEBUG
fprintf(stderr, "\tADDING FROM REMAINDER [%zd] [%s]\n", nZRemainderBuf, zRemainderBuf);
@@ -1649,7 +1697,7 @@ STARCHCAT2_rewriteInputRecordToOutput (Metadata **outMd, const char *outTag, con
/* zRemainderBuf[nZRemainderBuf] = '\0'; */
nZRemainderBuf = 0;
}
-
+
zBufIndex = 0;
while (zBufIndex < zInHave) {
@@ -1721,7 +1769,7 @@ STARCHCAT2_rewriteInputRecordToOutput (Metadata **outMd, const char *outTag, con
/* test for duplicate element */
if ((t_pStart == t_currStart) && (t_pStop == t_currStop))
t_duplicateElementExists = kStarchTrue;
-
+
/* test for nested element */
if ((t_pStart < t_currStart) && (t_pStop > t_currStop))
t_nestedElementExists = kStarchTrue;
@@ -1849,11 +1897,11 @@ STARCHCAT2_rewriteInputRecordToOutput (Metadata **outMd, const char *outTag, con
#ifdef DEBUG
if ((zBufIndex + 1) == zInHave) {
- fprintf(stderr, "\tNEWLINE FOUND AT END OF Z-STREAM BUFFER! zLineBuf: [%s]\n", zLineBuf);
+ fprintf(stderr, "\tNEWLINE FOUND AT END OF Z-STREAM BUFFER! zLineBuf: [%s]\n", zLineBuf);
}
#endif
}
-
+
else if ((zBufIndex + 1) == zInHave) {
/* add to remainder if we're at the end of zInHave */
memset(zRemainderBuf, 0, nZRemainderBuf);
@@ -2024,7 +2072,7 @@ STARCHCAT2_rewriteInputRecordToOutput (Metadata **outMd, const char *outTag, con
}
default: {
fprintf(stderr, "ERROR: Unknown error with deflateEnd() (err: %d)\n", zOutError);
- return STARCHCAT_EXIT_FAILURE;
+ return STARCHCAT_EXIT_FAILURE;
}
}
}
@@ -2054,7 +2102,7 @@ STARCHCAT2_rewriteInputRecordToOutput (Metadata **outMd, const char *outTag, con
t_duplicateElementExists,
t_nestedElementExists,
t_base64EncodedSha1Digest,
- t_lineMaxStringLength );
+ t_lineMaxStringLength );
else
*outMd = STARCH_addMetadata( *outMd,
#ifdef __cplusplus
@@ -2073,26 +2121,40 @@ STARCHCAT2_rewriteInputRecordToOutput (Metadata **outMd, const char *outTag, con
t_lineMaxStringLength );
/* cleanup */
- free(outTagFn), outTagFn = NULL;
- free(t_base64EncodedSha1Digest), t_base64EncodedSha1Digest = NULL;
- free(retransformLineBuf), retransformLineBuf = NULL;
- free(retransformBuf), retransformBuf = NULL;
- free(bzReadBuf), bzReadBuf = NULL;
- free(bzRemainderBuf), bzRemainderBuf = NULL;
- free(bzLineBuf), bzLineBuf = NULL;
- free(zOutBuffer), zOutBuffer = NULL;
- free(zReadBuf), zReadBuf = NULL;
- free(zOutBuf), zOutBuf = NULL;
- free(zRemainderBuf), zRemainderBuf = NULL;
- free(zLineBuf), zLineBuf = NULL;
- free(t_firstInputToken), t_firstInputToken = NULL;
- free(t_secondInputToken), t_secondInputToken = NULL;
+ free(outTagFn);
+ outTagFn = NULL;
+ free(t_base64EncodedSha1Digest);
+ t_base64EncodedSha1Digest = NULL;
+ free(retransformLineBuf);
+ retransformLineBuf = NULL;
+ free(retransformBuf);
+ retransformBuf = NULL;
+ free(bzReadBuf);
+ bzReadBuf = NULL;
+ free(bzRemainderBuf);
+ bzRemainderBuf = NULL;
+ free(bzLineBuf);
+ bzLineBuf = NULL;
+ free(zOutBuffer);
+ zOutBuffer = NULL;
+ free(zReadBuf);
+ zReadBuf = NULL;
+ free(zOutBuf);
+ zOutBuf = NULL;
+ free(zRemainderBuf);
+ zRemainderBuf = NULL;
+ free(zLineBuf);
+ zLineBuf = NULL;
+ free(t_firstInputToken);
+ t_firstInputToken = NULL;
+ free(t_secondInputToken);
+ t_secondInputToken = NULL;
return STARCHCAT_EXIT_SUCCESS;
}
-int
-STARCHCAT_rewriteInputRecordToOutput (Metadata **outMd, const char *outTag, const CompressionType outType, const char *inChr, const MetadataRecord *inRec)
+int
+STARCHCAT_rewriteInputRecordToOutput(Metadata **outMd, const char *outTag, const CompressionType outType, const char *inChr, const MetadataRecord *inRec)
{
/*
This function extracts a single record (chromosome) of
@@ -2131,7 +2193,7 @@ STARCHCAT_rewriteInputRecordToOutput (Metadata **outMd, const char *outTag, cons
fprintf(stderr, "ERROR: Could not open an uncompressed output file handle to %s\n", uncomprOutFn);
return STARCHCAT_EXIT_FAILURE;
}
-
+
switch (inType) {
case kBzip2: {
#ifdef __cplusplus
@@ -2299,8 +2361,8 @@ STARCHCAT2_parseCoordinatesFromBedLine(const char *lineBuf, const size_t inRecId
return STARCHCAT_EXIT_SUCCESS;
}
-int
-STARCHCAT2_identifyLowestBedElement (const Boolean *eobFlags, const SignedCoordType *starts, const SignedCoordType *stops, const size_t numRecords, size_t *lowestIdx)
+int
+STARCHCAT2_identifyLowestBedElement(const Boolean *eobFlags, const SignedCoordType *starts, const SignedCoordType *stops, const size_t numRecords, size_t *lowestIdx)
{
#ifdef DEBUG
fprintf (stderr, "\n--- STARCHCAT2_identifyLowestBedElement() ---\n");
@@ -2375,8 +2437,8 @@ STARCHCAT2_identifyLowestBedElement (const Boolean *eobFlags, const SignedCoordT
return STARCHCAT_EXIT_SUCCESS;
}
-int
-STARCHCAT2_identifyLowestBedElementV2p2 (const Boolean *eobFlags, const SignedCoordType *starts, const SignedCoordType *stops, const char **remainders, const size_t numRecords, size_t *lowestIdx)
+int
+STARCHCAT2_identifyLowestBedElementV2p2(const Boolean *eobFlags, const SignedCoordType *starts, const SignedCoordType *stops, const char **remainders, const size_t numRecords, size_t *lowestIdx)
{
#ifdef DEBUG
fprintf (stderr, "\n--- STARCHCAT2_identifyLowestBedElementV2p2() ---\n");
@@ -2429,7 +2491,7 @@ STARCHCAT2_identifyLowestBedElementV2p2 (const Boolean *eobFlags, const SignedCo
*/
if (checkStopFlag == kStarchTrue) {
-
+
size_t *lowestStopMatches = NULL;
size_t lowestStopMatchesCapacity = 0;
#ifdef __cplusplus
@@ -2458,7 +2520,7 @@ STARCHCAT2_identifyLowestBedElementV2p2 (const Boolean *eobFlags, const SignedCo
}
}
}
-
+
/*
process remainders when there are two or more lowestStopMatches entries
(the lowestStopMatches array points to record indices, so we dereference
@@ -2475,7 +2537,8 @@ STARCHCAT2_identifyLowestBedElementV2p2 (const Boolean *eobFlags, const SignedCo
}
}
- free(lowestStopMatches), lowestStopMatches = NULL;
+ free(lowestStopMatches);
+ lowestStopMatches = NULL;
}
#ifdef DEBUG
@@ -2493,8 +2556,8 @@ STARCHCAT2_identifyLowestBedElementV2p2 (const Boolean *eobFlags, const SignedCo
return STARCHCAT_EXIT_SUCCESS;
}
-int
-STARCHCAT2_pullNextBedElement (const size_t recIdx, const char **inLinesBuf, const LineCountType *nInLinesBuf, char **outLineBuf, uint64_t **inBufNewlineOffsets)
+int
+STARCHCAT2_pullNextBedElement(const size_t recIdx, const char **inLinesBuf, const LineCountType *nInLinesBuf, char **outLineBuf, uint64_t **inBufNewlineOffsets)
{
#ifdef DEBUG
fprintf(stderr, "\n--- STARCHCAT2_pullNextBedElement() ---\n");
@@ -2546,7 +2609,7 @@ STARCHCAT2_pullNextBedElement (const size_t recIdx, const char **inLinesBuf, con
}
int
-STARCHCAT2_mergeInputRecordsToOutput (const char *inChr, Metadata **outMd, const char *outTag, const CompressionType outType, const ChromosomeSummary *summary, size_t *cumulativeOutputSize)
+STARCHCAT2_mergeInputRecordsToOutput(const char *inChr, Metadata **outMd, const char *outTag, const CompressionType outType, const ChromosomeSummary *summary, size_t *cumulativeOutputSize)
{
#ifdef DEBUG
fprintf (stderr, "\n--- STARCHCAT2_mergeInputRecordsToOutput() ---\n");
@@ -2568,7 +2631,7 @@ STARCHCAT2_mergeInputRecordsToOutput (const char *inChr, Metadata **outMd, const
char **extractionBuffers = NULL;
size_t *nExtractionBuffers = NULL;
int *extractionBufferOffsets = NULL;
- char **extractionRemainderBufs = NULL;
+ char **extractionRemainderBufs = NULL;
size_t *nExtractionRemainderBufs = NULL;
char *compressionBuffer = NULL;
LineCountType compressionLineCount = 0;
@@ -2652,7 +2715,7 @@ STARCHCAT2_mergeInputRecordsToOutput (const char *inChr, Metadata **outMd, const
stops = malloc(sizeof(SignedCoordType) * summary->numRecords);
remainders = malloc(sizeof(char *) * summary->numRecords);
transformStates = malloc(sizeof(TransformState *) * summary->numRecords);
- extractionRemainderBufs = malloc(sizeof(char *) * summary->numRecords);
+ extractionRemainderBufs = malloc(sizeof(char *) * summary->numRecords);
nExtractionRemainderBufs = malloc(sizeof(size_t) * summary->numRecords);
bzInFps = malloc(sizeof(BZFILE *) * summary->numRecords);
nBzReads = malloc(sizeof(size_t) * summary->numRecords);
@@ -2697,7 +2760,7 @@ STARCHCAT2_mergeInputRecordsToOutput (const char *inChr, Metadata **outMd, const
}
/* 1 -- initialize and fill input (extraction) buffers on first pass */
- for (inRecIdx = 0U; inRecIdx < summary->numRecords; inRecIdx++)
+ for (inRecIdx = 0U; inRecIdx < summary->numRecords; inRecIdx++)
{
eofFlags[inRecIdx] = kStarchFalse;
eobFlags[inRecIdx] = kStarchFalse;
@@ -2846,7 +2909,7 @@ STARCHCAT2_mergeInputRecordsToOutput (const char *inChr, Metadata **outMd, const
&extractionBufferOffsets[inRecIdx],
&extractedElements[inRecIdx]);
extractedLineCounts[inRecIdx]--;
-
+
/* memset(outputRetransformState->r_chromosome, 0, TOKEN_CHR_MAX_LENGTH); */
memset(outputRetransformState->r_remainder, 0, UNSTARCH_SECOND_TOKEN_MAX_LENGTH);
@@ -2895,7 +2958,7 @@ STARCHCAT2_mergeInputRecordsToOutput (const char *inChr, Metadata **outMd, const
if ((eobFlags[inRecIdx] == kStarchFalse) || (eofFlags[inRecIdx] == kStarchFalse)) {
allEOF = kStarchFalse;
continue;
- }
+ }
}
/* 2, 3 -- parse coordinates for each record's current bed element (this gets us the start and stop coords) */
@@ -3026,7 +3089,7 @@ STARCHCAT2_mergeInputRecordsToOutput (const char *inChr, Metadata **outMd, const
}
extractedLineCounts[lowestStartElementIdx] = transformStates[lowestStartElementIdx]->t_lineIdx;
-
+
/*
reset the extraction buffer offset and try to pull something from
the extraction buffer into the extracted elements buffer
@@ -3053,11 +3116,11 @@ STARCHCAT2_mergeInputRecordsToOutput (const char *inChr, Metadata **outMd, const
#ifdef DEBUG
fprintf(stderr, "STEP 5 - COMP BUFFER [%s] -->\nCOMPRESS RETRANSFORMATION BUFFER (FULL)\n[%s]\n", compressionBuffer, retransformedOutputBuffer);
#endif
-
+
/* hash the transformed buffer */
sha1_process_bytes (retransformedOutputBuffer, strlen(retransformedOutputBuffer), &r_perChromosomeHashCtx);
- STARCHCAT2_resetCompressionBuffer(compressionBuffer, &compressionLineCount);
+ STARCHCAT2_resetCompressionBuffer(compressionBuffer, &compressionLineCount);
switch (outType) {
case kBzip2: {
STARCHCAT2_squeezeRetransformedOutputBufferToBzip2Stream(&bzOutFp,
@@ -3173,14 +3236,22 @@ STARCHCAT2_mergeInputRecordsToOutput (const char *inChr, Metadata **outMd, const
/* breakdown */
for (inRecIdx = 0U; inRecIdx < summary->numRecords; inRecIdx++) {
if (STARCHCAT2_testSummaryForChromosomeExistence(inChr, summary, inRecIdx) == STARCHCAT_EXIT_SUCCESS) {
- if (extractionBuffers[inRecIdx])
- free(extractionBuffers[inRecIdx]), extractionBuffers[inRecIdx] = NULL;
- if (extractedElements[inRecIdx])
- free(extractedElements[inRecIdx]), extractedElements[inRecIdx] = NULL;
- if (extractionRemainderBufs[inRecIdx])
- free(extractionRemainderBufs[inRecIdx]), extractionRemainderBufs[inRecIdx] = NULL;
- if (remainders[inRecIdx])
- free(remainders[inRecIdx]), remainders[inRecIdx] = NULL;
+ if (extractionBuffers[inRecIdx]) {
+ free(extractionBuffers[inRecIdx]);
+ extractionBuffers[inRecIdx] = NULL;
+ }
+ if (extractedElements[inRecIdx]) {
+ free(extractedElements[inRecIdx]);
+ extractedElements[inRecIdx] = NULL;
+ }
+ if (extractionRemainderBufs[inRecIdx]) {
+ free(extractionRemainderBufs[inRecIdx]);
+ extractionRemainderBufs[inRecIdx] = NULL;
+ }
+ if (remainders[inRecIdx]) {
+ free(remainders[inRecIdx]);
+ remainders[inRecIdx] = NULL;
+ }
inRecord = *(summary->records) + inRecIdx;
inType = inRecord->type; /* get record type of input stream */
switch (inType) {
@@ -3205,58 +3276,104 @@ STARCHCAT2_mergeInputRecordsToOutput (const char *inChr, Metadata **outMd, const
}
}
}
- if (extractionBuffers)
- free(extractionBuffers), extractionBuffers = NULL;
- if (nExtractionBuffers)
- free(nExtractionBuffers), nExtractionBuffers = NULL;
- if (extractionBufferOffsets)
- free(extractionBufferOffsets), extractionBufferOffsets = NULL;
- if (compressionBuffer)
- free(compressionBuffer), compressionBuffer = NULL;
- if (zInFps)
- free(zInFps), zInFps = NULL;
- if (extractedLineCounts)
- free(extractedLineCounts), extractedLineCounts = NULL;
- if (extractedElements)
- free(extractedElements), extractedElements = NULL;
- if (eobFlags)
- free(eobFlags), eobFlags = NULL;
- if (eofFlags)
- free(eofFlags), eofFlags = NULL;
- if (starts)
- free(starts), starts = NULL;
- if (stops)
- free(stops), stops = NULL;
- if (remainders)
- free(remainders), remainders = NULL;
- if (transformStates)
- free(transformStates), transformStates = NULL;
- if (extractionRemainderBufs)
- free(extractionRemainderBufs), extractionRemainderBufs = NULL;
- if (nExtractionRemainderBufs)
- free(nExtractionRemainderBufs), nExtractionRemainderBufs = NULL;
- if (bzInFps)
- free(bzInFps), bzInFps = NULL;
- if (nBzReads)
- free(nBzReads), nBzReads = NULL;
- if (zInStreams)
- free(zInStreams), zInStreams = NULL;
- if (nZReads)
- free(nZReads), nZReads = NULL;
- if (retransformedOutputBuffer)
- free(retransformedOutputBuffer), retransformedOutputBuffer = NULL;
- if (outputRetransformState)
- free(outputRetransformState), outputRetransformState = NULL;
- if (finalOutTagFn)
- free(finalOutTagFn), finalOutTagFn = NULL;
- if (r_base64EncodedSha1Digest)
- free(r_base64EncodedSha1Digest), r_base64EncodedSha1Digest = NULL;
-
+ if (extractionBuffers) {
+ free(extractionBuffers);
+ extractionBuffers = NULL;
+ }
+ if (nExtractionBuffers) {
+ free(nExtractionBuffers);
+ nExtractionBuffers = NULL;
+ }
+ if (extractionBufferOffsets) {
+ free(extractionBufferOffsets);
+ extractionBufferOffsets = NULL;
+ }
+ if (compressionBuffer) {
+ free(compressionBuffer);
+ compressionBuffer = NULL;
+ }
+ if (zInFps) {
+ free(zInFps);
+ zInFps = NULL;
+ }
+ if (extractedLineCounts) {
+ free(extractedLineCounts);
+ extractedLineCounts = NULL;
+ }
+ if (extractedElements) {
+ free(extractedElements);
+ extractedElements = NULL;
+ }
+ if (eobFlags) {
+ free(eobFlags);
+ eobFlags = NULL;
+ }
+ if (eofFlags) {
+ free(eofFlags);
+ eofFlags = NULL;
+ }
+ if (starts) {
+ free(starts);
+ starts = NULL;
+ }
+ if (stops) {
+ free(stops);
+ stops = NULL;
+ }
+ if (remainders) {
+ free(remainders);
+ remainders = NULL;
+ }
+ if (transformStates) {
+ free(transformStates);
+ transformStates = NULL;
+ }
+ if (extractionRemainderBufs) {
+ free(extractionRemainderBufs);
+ extractionRemainderBufs = NULL;
+ }
+ if (nExtractionRemainderBufs) {
+ free(nExtractionRemainderBufs);
+ nExtractionRemainderBufs = NULL;
+ }
+ if (bzInFps) {
+ free(bzInFps);
+ bzInFps = NULL;
+ }
+ if (nBzReads) {
+ free(nBzReads);
+ nBzReads = NULL;
+ }
+ if (zInStreams) {
+ free(zInStreams);
+ zInStreams = NULL;
+ }
+ if (nZReads) {
+ free(nZReads);
+ nZReads = NULL;
+ }
+ if (retransformedOutputBuffer) {
+ free(retransformedOutputBuffer);
+ retransformedOutputBuffer = NULL;
+ }
+ if (outputRetransformState) {
+ free(outputRetransformState);
+ outputRetransformState = NULL;
+ }
+ if (finalOutTagFn) {
+ free(finalOutTagFn);
+ finalOutTagFn = NULL;
+ }
+ if (r_base64EncodedSha1Digest) {
+ free(r_base64EncodedSha1Digest);
+ r_base64EncodedSha1Digest = NULL;
+ }
+
return STARCHCAT_EXIT_SUCCESS;
}
-int
-STARCHCAT_mergeInputRecordsToOutput (Metadata **outMd, const char *outTag, const CompressionType outType, const ChromosomeSummary *summary)
+int
+STARCHCAT_mergeInputRecordsToOutput(Metadata **outMd, const char *outTag, const CompressionType outType, const ChromosomeSummary *summary)
{
/*
This function will grab a buffer-ful of each file's chromosomal data, read
@@ -3435,7 +3552,7 @@ STARCHCAT_mergeInputRecordsToOutput (Metadata **outMd, const char *outTag, const
#else
lineBuffers[inRecIdx] = malloc (STARCH_BUFFER_MAX_LENGTH);
#endif
- bufferIdx = 0U;
+ bufferIdx = 0U;
while ( (c = fgetc(tempOutFps[inRecIdx])) ) {
if (c == EOF) {
fprintf(stderr, "ERROR: Could not retrieve data from archive (is it empty or corrupt?). Could not merge.\n");
@@ -3580,10 +3697,10 @@ STARCHCAT_mergeInputRecordsToOutput (Metadata **outMd, const char *outTag, const
lineBuffers[lsiIdx][(bufferIdx-1)] = '\0';
break;
}
- }
+ }
}
else {
- for (lsiTestIdx = 0; lsiTestIdx < lsiIdx; lsiTestIdx++) {
+ for (lsiTestIdx = 0; lsiTestIdx < lsiIdx; lsiTestIdx++) {
if (stops[lowestStartIdxs[lsiTestIdx]] < lowestStop) {
lowestStop = stops[lowestStartIdxs[lsiTestIdx]];
#ifdef __cplusplus
@@ -3638,7 +3755,7 @@ STARCHCAT_mergeInputRecordsToOutput (Metadata **outMd, const char *outTag, const
if (remove(tempOutFns[inRecIdx]) != 0) {
fprintf(stderr, "ERROR: Could not delete temporary output file. Could not merge.\n");
return STARCHCAT_EXIT_FAILURE;
- }
+ }
free(tempOutFns[inRecIdx]);
}
if (tempOutFns)
@@ -3725,7 +3842,7 @@ STARCHCAT_mergeInputRecordsToOutput (Metadata **outMd, const char *outTag, const
}
int
-STARCHCAT_mergeChromosomeStreams (const ChromosomeSummaries *chrSums, const CompressionType outputType, const char *note)
+STARCHCAT_mergeChromosomeStreams(const ChromosomeSummaries *chrSums, const CompressionType outputType, const char *note)
{
#ifdef DEBUG
fprintf (stderr, "\n--- STARCHCAT_mergeChromosomeStreams() ---\n");
@@ -3774,7 +3891,7 @@ STARCHCAT_mergeChromosomeStreams (const ChromosomeSummaries *chrSums, const Comp
STARCH_buildProcessIDTag( &outputTag );
- for (chrIdx = 0U; chrIdx < chrSums->numChromosomes; chrIdx++)
+ for (chrIdx = 0U; chrIdx < chrSums->numChromosomes; chrIdx++)
{
summary = chrSums->summary + chrIdx;
@@ -3902,7 +4019,7 @@ STARCHCAT_mergeChromosomeStreams (const ChromosomeSummaries *chrSums, const Comp
}
int
-STARCHCAT_freeChromosomeNames (char ***chrs, unsigned int numChromosomes)
+STARCHCAT_freeChromosomeNames(char ***chrs, unsigned int numChromosomes)
{
#ifdef DEBUG
fprintf (stderr, "\n--- STARCHCAT_freeChromosomeNames() ---\n");
@@ -3918,7 +4035,7 @@ STARCHCAT_freeChromosomeNames (char ***chrs, unsigned int numChromosomes)
#endif
free( *(*chrs + chrIdx) );
}
-
+
free(*chrs);
*chrs = NULL;
@@ -3947,12 +4064,12 @@ STARCHCAT_freeChromosomeSummaries (ChromosomeSummaries **chrSums)
}
int
-STARCHCAT_allocChromosomeSummaries (ChromosomeSummaries **chrSums, const unsigned int numChromosomes)
+STARCHCAT_allocChromosomeSummaries(ChromosomeSummaries **chrSums, const unsigned int numChromosomes)
{
#ifdef DEBUG
fprintf(stderr, "\n--- STARCHCAT_allocChromosomeSummaries() ---\n");
#endif
-
+
if (numChromosomes == 0)
return STARCHCAT_EXIT_SUCCESS;
@@ -3974,7 +4091,7 @@ STARCHCAT_allocChromosomeSummaries (ChromosomeSummaries **chrSums, const unsigne
}
int
-STARCHCAT_buildChromosomeSummaries (ChromosomeSummaries **chrSums, const ChromosomeSummary *summary, const unsigned int numChromosomes)
+STARCHCAT_buildChromosomeSummaries(ChromosomeSummaries **chrSums, const ChromosomeSummary *summary, const unsigned int numChromosomes)
{
#ifdef DEBUG
fprintf(stderr, "\n--- STARCHCAT_buildChromosomeSummaries() ---\n");
@@ -3996,7 +4113,7 @@ STARCHCAT_buildChromosomeSummaries (ChromosomeSummaries **chrSums, const Chromos
}
int
-STARCHCAT_printChromosomeSummaries (const ChromosomeSummaries *chrSums)
+STARCHCAT_printChromosomeSummaries(const ChromosomeSummaries *chrSums)
{
#ifdef DEBUG
fprintf (stderr, "\n--- STARCHCAT_printChromosomeSummaries() ---\n");
@@ -4017,7 +4134,7 @@ STARCHCAT_printChromosomeSummaries (const ChromosomeSummaries *chrSums)
#ifdef DEBUG
fprintf(stderr, "\t[chrIdx: %02u]\n\t\tchromosome: %s\n\t\tnumRecords: %u\n", chrIdx, summary->chromosome, summary->numRecords);
#endif
- for (recIdx = 0U; recIdx < summary->numRecords; recIdx++) {
+ for (recIdx = 0U; recIdx < summary->numRecords; recIdx++) {
mdRecord = recs[recIdx];
#ifdef __cplusplus
md = static_cast<Metadata *>( mdRecord->metadata );
@@ -4081,7 +4198,7 @@ STARCHCAT_printChromosomeSummaries (const ChromosomeSummaries *chrSums)
}
int
-STARCHCAT_freeChromosomeSummary (ChromosomeSummary **summary, const unsigned int numChromosomes)
+STARCHCAT_freeChromosomeSummary(ChromosomeSummary **summary, const unsigned int numChromosomes)
{
#ifdef DEBUG
fprintf (stderr, "\n--- STARCHCAT_freeChromosomeSummary() ---\n");
@@ -4092,13 +4209,13 @@ STARCHCAT_freeChromosomeSummary (ChromosomeSummary **summary, const unsigned int
if (*summary == NULL)
return STARCHCAT_EXIT_SUCCESS;
- for (chrIdx = 0U; chrIdx < numChromosomes; chrIdx++) {
+ for (chrIdx = 0U; chrIdx < numChromosomes; chrIdx++) {
summaryInstance = *summary + chrIdx;
#ifdef DEBUG
fprintf(stderr, "\tfreeing chromosome [%s] %u (of %u)...\n", summaryInstance->chromosome, (chrIdx + 1), numChromosomes);
#endif
if (summaryInstance->chromosome) {
- free( summaryInstance->chromosome );
+ free( summaryInstance->chromosome );
summaryInstance->chromosome = NULL;
}
if (summaryInstance->records)
@@ -4110,7 +4227,7 @@ STARCHCAT_freeChromosomeSummary (ChromosomeSummary **summary, const unsigned int
}
int
-STARCHCAT_allocChromosomeSummary (ChromosomeSummary **summary, const unsigned int numChromosomes)
+STARCHCAT_allocChromosomeSummary(ChromosomeSummary **summary, const unsigned int numChromosomes)
{
#ifdef DEBUG
fprintf (stderr, "\n--- STARCHCAT_allocChromosomeSummary() ---\n");
@@ -4148,7 +4265,7 @@ STARCHCAT_allocChromosomeSummary (ChromosomeSummary **summary, const unsigned in
}
int
-STARCHCAT_buildChromosomeSummary (ChromosomeSummary **summary, const MetadataRecord *mdRecords, const unsigned int numRecords, const char **chromosomes, const unsigned int numChromosomes)
+STARCHCAT_buildChromosomeSummary(ChromosomeSummary **summary, const MetadataRecord *mdRecords, const unsigned int numRecords, const char **chromosomes, const unsigned int numChromosomes)
{
#ifdef DEBUG
fprintf (stderr, "\n--- STARCHCAT_buildChromosomeSummary() ---\n");
@@ -4217,12 +4334,12 @@ STARCHCAT_buildChromosomeSummary (ChromosomeSummary **summary, const MetadataRec
return STARCHCAT_EXIT_FAILURE;
}
}
-
+
return STARCHCAT_EXIT_SUCCESS;
}
MetadataRecord *
-STARCHCAT_copyMetadataRecord (const MetadataRecord *mdRec)
+STARCHCAT_copyMetadataRecord(const MetadataRecord *mdRec)
{
#ifdef DEBUG
fprintf (stderr, "\n--- STARCHCAT_copyMetadataRecord() ---\n");
@@ -4248,7 +4365,7 @@ STARCHCAT_copyMetadataRecord (const MetadataRecord *mdRec)
}
int
-STARCHCAT_buildUniqueChromosomeList (char ***chromosomes, unsigned int *numChr, const MetadataRecord *mdRecords, const unsigned int numRecords)
+STARCHCAT_buildUniqueChromosomeList(char ***chromosomes, unsigned int *numChr, const MetadataRecord *mdRecords, const unsigned int numRecords)
{
#ifdef DEBUG
fprintf (stderr, "\n--- STARCHCAT_buildUniqueChromosomeList() ---\n");
@@ -4355,9 +4472,9 @@ STARCHCAT_buildUniqueChromosomeList (char ***chromosomes, unsigned int *numChr,
return STARCHCAT_EXIT_SUCCESS;
}
-int
-STARCHCAT_compareCStrings (const void *a, const void *b)
-{
+int
+STARCHCAT_compareCStrings(const void *a, const void *b)
+{
#ifdef DEBUG
fprintf (stderr, "\n--- STARCHCAT_compareCStrings() ---\n");
#endif
@@ -4369,10 +4486,10 @@ STARCHCAT_compareCStrings (const void *a, const void *b)
#else
return strcmp(*(const char **)a, *(const char **)b);
#endif
-}
+}
int
-STARCHCAT_allocMetadataRecords (MetadataRecord **mdRecords, const unsigned int numRecords)
+STARCHCAT_allocMetadataRecords(MetadataRecord **mdRecords, const unsigned int numRecords)
{
#ifdef DEBUG
fprintf (stderr, "\n--- STARCHCAT_allocMetadataRecords() ---\n");
@@ -4413,7 +4530,7 @@ STARCHCAT_allocMetadataRecords (MetadataRecord **mdRecords, const unsigned int n
}
int
-STARCHCAT_freeMetadataRecords (MetadataRecord **mdRecords, const unsigned int numRecords)
+STARCHCAT_freeMetadataRecords(MetadataRecord **mdRecords, const unsigned int numRecords)
{
#ifdef DEBUG
fprintf (stderr, "\n--- STARCHCAT_freeMetadataRecords() ---\n");
@@ -4421,25 +4538,36 @@ STARCHCAT_freeMetadataRecords (MetadataRecord **mdRecords, const unsigned int nu
unsigned int recIdx = 0U;
MetadataRecord *instance = NULL;
- if (! *mdRecords)
+ if (! *mdRecords) {
return STARCHCAT_EXIT_SUCCESS;
+ }
for (recIdx = 0U; recIdx < numRecords; recIdx++) {
#ifdef DEBUG
fprintf(stderr, "\tattempting to free record %u (of %u)...\n", (recIdx + 1), numRecords);
#endif
if (mdRecords[recIdx]) {
- instance = *mdRecords + recIdx;
- if (instance->filename)
- free(instance->filename), instance->filename = NULL;
- if (instance->metadata)
- STARCH_freeMetadata( &(instance->metadata) ), instance->metadata = NULL;
- if (instance->fp)
- fclose(instance->fp), instance->fp = NULL;
- if (instance->av)
- free(instance->av), instance->av = NULL;
- if (instance->cTime)
- free(instance->cTime), instance->cTime = NULL;
+ instance = *mdRecords + recIdx;
+ if (instance->filename) {
+ free(instance->filename);
+ instance->filename = NULL;
+ }
+ if (instance->metadata) {
+ STARCH_freeMetadata( &(instance->metadata) );
+ instance->metadata = NULL;
+ }
+ if (instance->fp) {
+ fclose(instance->fp);
+ instance->fp = NULL;
+ }
+ if (instance->av) {
+ free(instance->av);
+ instance->av = NULL;
+ }
+ if (instance->cTime) {
+ free(instance->cTime);
+ instance->cTime = NULL;
+ }
}
}
@@ -4451,7 +4579,7 @@ STARCHCAT_freeMetadataRecords (MetadataRecord **mdRecords, const unsigned int nu
}
int
-STARCHCAT_buildMetadataRecords (json_t ***metadataJSONs, MetadataRecord **mdRecords, const unsigned int firstArgc, const int argc, const char **argv)
+STARCHCAT_buildMetadataRecords(json_t ***metadataJSONs, MetadataRecord **mdRecords, const unsigned int firstArgc, const int argc, const char **argv)
{
#ifdef DEBUG
fprintf (stderr, "\n--- STARCHCAT_buildMetadataRecords() ---\n");
@@ -4469,11 +4597,11 @@ STARCHCAT_buildMetadataRecords (json_t ***metadataJSONs, MetadataRecord **mdReco
uint64_t mdOffset = 0;
Boolean hFlag = kStarchFalse;
MetadataRecord *mdRecord = NULL;
- const Boolean suppressErrorMsgs = kStarchFalse; /* i.e., we want to see error messages */
+ const Boolean suppressErrorMsgs = kStarchFalse; /* i.e., we want to see error messages */
const Boolean preserveJSONRef = kStarchTrue;
json_t *mdJSON = NULL;
time_t creationTime;
- struct tm *creationTimeInformation = NULL;
+ struct tm *creationTimeInformation = NULL;
size_t creationTimestampLength = STARCH_CREATION_TIMESTAMP_LENGTH;
unsigned int numGzipRecs = 0U;
@@ -4502,7 +4630,7 @@ STARCHCAT_buildMetadataRecords (json_t ***metadataJSONs, MetadataRecord **mdReco
fprintf(stderr, "\tidx/realIdx: %d/%d\n", idx, realIdx);
fprintf(stderr, "\topening file: %s\n", inFile);
#endif
-
+
/* parse the archive file's metadata */
if ( STARCH_readJSONMetadata( &mdJSON,
&inFilePtr,
@@ -4600,7 +4728,7 @@ STARCHCAT_buildMetadataRecords (json_t ***metadataJSONs, MetadataRecord **mdReco
}
strncpy(cTime, creationTimestamp, strlen(creationTimestamp) + 1);
free(creationTimestamp);
- creationTimestamp = NULL;
+ creationTimestamp = NULL;
}
mdRecord->cTime = cTime;
@@ -4646,19 +4774,19 @@ STARCHCAT_buildMetadataRecords (json_t ***metadataJSONs, MetadataRecord **mdReco
version = NULL;
}
}
-
+
return STARCHCAT_EXIT_SUCCESS;
}
-Boolean
-STARCHCAT_fileExists (const char *fn)
+Boolean
+STARCHCAT_fileExists(const char *fn)
{
#ifdef DEBUG
fprintf (stderr, "\n--- STARCHCAT_fileExists() ---\n");
#endif
struct stat buf;
int i = stat (fn, &buf);
-
+
/*
Regarding 64-bit support
cf. http://www.gnu.org/s/libc/manual/html_node/Reading-Attributes.html
@@ -4674,8 +4802,8 @@ STARCHCAT_fileExists (const char *fn)
return kStarchFalse;
}
-void
-STARCHCAT_printUsage (int errorType)
+void
+STARCHCAT_printUsage(int errorType)
{
#ifdef DEBUG
fprintf (stderr, "\n--- STARCHCAT_printUsage() ---\n");
@@ -4693,12 +4821,12 @@ STARCHCAT_printUsage (int errorType)
if (result != -1) {
switch (errorType) {
case STARCHCAT_VERSION_ERROR:
- fprintf(stdout, "%s\n binary version: %s (creates archive version: %s)\n", name, BEDOPS::revision(), avStr);
+ fprintf(stdout, "%s\n binary version: %s (%s) (creates archive version: %s)\n", name, BEDOPS::revision(), application_type, avStr);
break;
case STARCHCAT_FATAL_ERROR:
case STARCHCAT_HELP_ERROR:
default:
- fprintf(stderr, "%s\n citation: %s\n version: %s\n authors: %s\n%s\n", name, BEDOPS::citation(), BEDOPS::revision(), authors, usage);
+ fprintf(stderr, "%s\n citation: %s\n version: %s (%s)\n authors: %s\n%s\n", name, BEDOPS::citation(), BEDOPS::revision(), application_type, authors, usage);
break;
}
}
@@ -4706,8 +4834,8 @@ STARCHCAT_printUsage (int errorType)
}
}
-void
-STARCHCAT_printRevision ()
+void
+STARCHCAT_printRevision()
{
#ifdef DEBUG
fprintf (stderr, "\n--- STARCHCAT_printRevision() ---\n");
@@ -4722,15 +4850,15 @@ STARCHCAT_printRevision ()
if (avStr != NULL) {
int result = sprintf (avStr, "%d.%d.%d", STARCH_MAJOR_VERSION, STARCH_MINOR_VERSION, STARCH_REVISION_VERSION);
- if (result != -1) {
- fprintf(stderr, "%s\n binary version: %s (creates archive version: %s)\n", name, BEDOPS::revision(), avStr);
+ if (result != -1) {
+ fprintf(stderr, "%s\n binary version: %s (%s) (creates archive version: %s)\n", name, BEDOPS::revision(), application_type, avStr);
free(avStr);
}
}
}
Boolean
-STARCHCAT_isArchiveConcurrent (const ArchiveVersion *av)
+STARCHCAT_isArchiveConcurrent(const ArchiveVersion *av)
{
#ifdef DEBUG
fprintf (stderr, "\n--- STARCHCAT_isArchiveConcurrent() ---\n");
@@ -4740,12 +4868,12 @@ STARCHCAT_isArchiveConcurrent (const ArchiveVersion *av)
(av->minor == STARCH_MINOR_VERSION) &&
(av->revision == STARCH_REVISION_VERSION))
return kStarchTrue;
-
+
return kStarchFalse;
}
Boolean
-STARCHCAT_isArchiveNewerThan (const ArchiveVersion *av, const ArchiveVersion *comp)
+STARCHCAT_isArchiveNewerThan(const ArchiveVersion *av, const ArchiveVersion *comp)
{
#ifdef DEBUG
fprintf (stderr, "\n--- STARCHCAT_isArchiveNewerThan() ---\n");
@@ -4760,13 +4888,13 @@ STARCHCAT_isArchiveNewerThan (const ArchiveVersion *av, const ArchiveVersion *co
(av->minor == comp->minor) &&
(av->revision > comp->revision) )
)
- return kStarchTrue;
-
+ return kStarchTrue;
+
return kStarchFalse;
}
Boolean
-STARCHCAT_isArchiveConcurrentOrOlder (const ArchiveVersion *av)
+STARCHCAT_isArchiveConcurrentOrOlder(const ArchiveVersion *av)
{
#ifdef DEBUG
fprintf (stderr, "\n--- STARCHCAT_isArchiveConcurrentOrOlder() ---\n");
@@ -4778,12 +4906,12 @@ STARCHCAT_isArchiveConcurrentOrOlder (const ArchiveVersion *av)
(av->revision <= STARCH_REVISION_VERSION) )
)
return kStarchTrue;
-
+
return kStarchFalse;
}
Boolean
-STARCHCAT_isArchiveOlder (const ArchiveVersion *av)
+STARCHCAT_isArchiveOlder(const ArchiveVersion *av)
{
#ifdef DEBUG
fprintf (stderr, "\n--- STARCHCAT_isArchiveOlder() ---\n");
@@ -4795,12 +4923,12 @@ STARCHCAT_isArchiveOlder (const ArchiveVersion *av)
(av->revision <= STARCH_REVISION_VERSION) )
)
return kStarchTrue;
-
+
return kStarchFalse;
}
Boolean
-STARCHCAT_isArchiveNewer (const ArchiveVersion *av)
+STARCHCAT_isArchiveNewer(const ArchiveVersion *av)
{
#ifdef DEBUG
fprintf (stderr, "\n--- STARCHCAT_isArchiveNewer() ---\n");
@@ -4810,12 +4938,12 @@ STARCHCAT_isArchiveNewer (const ArchiveVersion *av)
if (((av->major == STARCH_MAJOR_VERSION) && (av->minor > STARCH_MINOR_VERSION) && (av->revision >= STARCH_REVISION_VERSION)) ||
(av->major > STARCH_MAJOR_VERSION))
return kStarchTrue;
-
+
return kStarchFalse;
}
Boolean
-STARCHCAT_allocMetadataJSONObjects (json_t ***mdJSONs, const unsigned int numRecs)
+STARCHCAT_allocMetadataJSONObjects(json_t ***mdJSONs, const unsigned int numRecs)
{
#ifdef DEBUG
fprintf(stderr, "\n--- STARCHCAT_allocMetadataJSONObjects() ---\n");
@@ -4839,7 +4967,7 @@ STARCHCAT_allocMetadataJSONObjects (json_t ***mdJSONs, const unsigned int numRec
}
Boolean
-STARCHCAT_freeMetadataJSONObjects (json_t ***mdJSONs, const unsigned int numRecs)
+STARCHCAT_freeMetadataJSONObjects(json_t ***mdJSONs, const unsigned int numRecs)
{
#ifdef DEBUG
fprintf(stderr, "\n--- STARCHCAT_freeMetadataJSONObjects() ---\n");
@@ -4848,12 +4976,12 @@ STARCHCAT_freeMetadataJSONObjects (json_t ***mdJSONs, const unsigned int numRecs
for (idx = 0U; idx < numRecs; idx++)
json_decref(*(*mdJSONs + idx));
-
+
return kStarchTrue;
}
Boolean
-STARCHCAT_checkMetadataJSONVersions (json_t ***mdJSONs, const unsigned int numRecs)
+STARCHCAT_checkMetadataJSONVersions(json_t ***mdJSONs, const unsigned int numRecs)
{
#ifdef DEBUG
fprintf(stderr, "\n--- STARCHCAT_checkMetadataJSONVersions() ---\n");
@@ -4911,7 +5039,7 @@ STARCHCAT_checkMetadataJSONVersions (json_t ***mdJSONs, const unsigned int numRe
#endif
}
streamArchiveVersion = NULL;
- }
+ }
}
streamArchive = NULL;
}
@@ -4936,7 +5064,7 @@ STARCHCAT_checkMetadataJSONVersions (json_t ***mdJSONs, const unsigned int numRe
}
int
-STARCHCAT2_mergeChromosomeStreams (const ChromosomeSummaries *chrSums, const CompressionType outputType, const char *note, size_t *cumulativeOutputSize, const Boolean generatePerChrSignatureFlag, const Boolean reportProgressFlag, const LineCountType reportProgressN)
+STARCHCAT2_mergeChromosomeStreams(const ChromosomeSummaries *chrSums, const CompressionType outputType, const char *note, size_t *cumulativeOutputSize, const Boolean generatePerChrSignatureFlag, const Boolean reportProgressFlag, const LineCountType reportProgressN)
{
#ifdef DEBUG
fprintf(stderr, "\n--- STARCHCAT2_mergeChromosomeStreams() ---\n");
@@ -4947,7 +5075,7 @@ STARCHCAT2_mergeChromosomeStreams (const ChromosomeSummaries *chrSums, const Com
CompressionType inputType;
MetadataRecord *inputRecord = NULL;
char *inputChr = NULL;
- Metadata *outputMd = NULL;
+ Metadata *outputMd = NULL;
Metadata *headOutputMd = NULL;
Boolean firstOutputMdFlag = kStarchTrue;
Boolean hFlag = kStarchFalse; /* starchcat does not currently support headers */
@@ -4976,7 +5104,9 @@ STARCHCAT2_mergeChromosomeStreams (const ChromosomeSummaries *chrSums, const Com
fprintf(stderr, "ERROR: Could not allocate space to archive version test struct.\n");
return STARCHCAT_EXIT_FAILURE;
}
- av120->major = 1, av120->minor = 2, av120->revision = 0;
+ av120->major = 1;
+ av120->minor = 2;
+ av120->revision = 0;
/*
When we initially built the chromosome list, we applied a
@@ -5251,18 +5381,24 @@ STARCHCAT2_mergeChromosomeStreams (const ChromosomeSummaries *chrSums, const Com
fflush(stdout);
/* cleanup */
- if (dynamicMdBuffer)
- free(dynamicMdBuffer), dynamicMdBuffer = NULL;
- if (base64EncodedSha1Digest)
- free(base64EncodedSha1Digest), base64EncodedSha1Digest = NULL;
- if (av120)
- free(av120), av120 = NULL;
+ if (dynamicMdBuffer) {
+ free(dynamicMdBuffer);
+ dynamicMdBuffer = NULL;
+ }
+ if (base64EncodedSha1Digest) {
+ free(base64EncodedSha1Digest);
+ base64EncodedSha1Digest = NULL;
+ }
+ if (av120) {
+ free(av120);
+ av120 = NULL;
+ }
return STARCHCAT_EXIT_SUCCESS;
}
-int
-STARCHCAT2_setupBzip2OutputStream (BZFILE **bzStream, FILE *outStream)
+int
+STARCHCAT2_setupBzip2OutputStream(BZFILE **bzStream, FILE *outStream)
{
#ifdef DEBUG
fprintf(stderr, "\n--- STARCHCAT2_setupBzip2OutputStream() ---\n");
@@ -5305,7 +5441,7 @@ STARCHCAT2_setupBzip2OutputStream (BZFILE **bzStream, FILE *outStream)
}
int
-STARCHCAT2_setupGzipOutputStream (z_stream *zStream)
+STARCHCAT2_setupGzipOutputStream(z_stream *zStream)
{
#ifdef DEBUG
fprintf(stderr, "\n--- STARCHCAT2_setupGzipOutputStream() ---\n");
@@ -5342,7 +5478,7 @@ STARCHCAT2_setupGzipOutputStream (z_stream *zStream)
default: {
fprintf(stderr, "ERROR: Unknown error with deflateInit() (err: %d)\n", zError);
break;
- }
+ }
}
return STARCHCAT_EXIT_FAILURE;
}
@@ -5350,8 +5486,8 @@ STARCHCAT2_setupGzipOutputStream (z_stream *zStream)
return STARCHCAT_EXIT_SUCCESS;
}
-int
-STARCHCAT2_testSummaryForChromosomeExistence (const char *chrName, const ChromosomeSummary *chrSummary, const size_t recIndex)
+int
+STARCHCAT2_testSummaryForChromosomeExistence(const char *chrName, const ChromosomeSummary *chrSummary, const size_t recIndex)
{
#ifdef DEBUG
fprintf(stderr, "\n--- STARCHCAT2_testSummaryForChromosomeExistence() ---\n");
@@ -5374,8 +5510,8 @@ STARCHCAT2_testSummaryForChromosomeExistence (const char *chrName, const Chromos
return STARCHCAT_EXIT_FAILURE;
}
-int
-STARCHCAT2_setupInitialFileOffsets (const char *chrName, const ChromosomeSummary *chrSummary, const size_t recIndex)
+int
+STARCHCAT2_setupInitialFileOffsets(const char *chrName, const ChromosomeSummary *chrSummary, const size_t recIndex)
{
#ifdef DEBUG
fprintf(stderr, "\n--- STARCHCAT2_setupInitialFileOffsets() ---\n");
@@ -5411,8 +5547,8 @@ STARCHCAT2_setupInitialFileOffsets (const char *chrName, const ChromosomeSummary
return STARCHCAT_EXIT_SUCCESS;
}
-int
-STARCHCAT2_setupBzip2InputStream (const size_t recIdx, const ChromosomeSummary *chrSummary, BZFILE **bzStream)
+int
+STARCHCAT2_setupBzip2InputStream(const size_t recIdx, const ChromosomeSummary *chrSummary, BZFILE **bzStream)
{
#ifdef DEBUG
fprintf(stderr, "\n--- STARCHCAT2_setupBzip2InputStream() ---\n");
@@ -5422,11 +5558,11 @@ STARCHCAT2_setupBzip2InputStream (const size_t recIdx, const ChromosomeSummary *
MetadataRecord *inRec = NULL;
FILE *inFp = NULL;
int bzError = BZ_OK;
-
+
inRecs = chrSummary->records;
- inRec = inRecs[recIdx];
+ inRec = inRecs[recIdx];
inFp = inRec->fp;
-
+
*bzStream = BZ2_bzReadOpen(&bzError, inFp, STARCH_BZ_VERBOSITY, STARCH_BZ_SMALL, NULL, 0);
if (!*bzStream) {
@@ -5462,13 +5598,13 @@ STARCHCAT2_setupBzip2InputStream (const size_t recIdx, const ChromosomeSummary *
return STARCHCAT_EXIT_SUCCESS;
}
-int
-STARCHCAT2_setupGzipInputStream (z_stream *zStream)
+int
+STARCHCAT2_setupGzipInputStream(z_stream *zStream)
{
#ifdef DEBUG
fprintf(stderr, "\n--- STARCHCAT2_setupGzipInputStream() ---\n");
#endif
-
+
int zError = Z_OK;
zStream->zalloc = Z_NULL;
@@ -5488,7 +5624,7 @@ STARCHCAT2_setupGzipInputStream (z_stream *zStream)
}
int
-STARCHCAT2_breakdownBzip2InputStream (BZFILE **bzStream)
+STARCHCAT2_breakdownBzip2InputStream(BZFILE **bzStream)
{
#ifdef DEBUG
fprintf(stderr, "\n--- STARCHCAT2_breakdownBzip2InputStream() ---\n");
@@ -5507,7 +5643,7 @@ STARCHCAT2_breakdownBzip2InputStream (BZFILE **bzStream)
}
int
-STARCHCAT2_breakdownGzipInputStream (z_stream *zStream)
+STARCHCAT2_breakdownGzipInputStream(z_stream *zStream)
{
#ifdef DEBUG
fprintf(stderr, "\n--- STARCHCAT2_breakdownGzipInputStream() ---\n");
@@ -5525,8 +5661,8 @@ STARCHCAT2_breakdownGzipInputStream (z_stream *zStream)
return STARCHCAT_EXIT_SUCCESS;
}
-int
-STARCHCAT2_breakdownBzip2OutputStream (BZFILE **bzStream, uint64_t *bzOutBytesConsumed, uint64_t *bzOutBytesWritten)
+int
+STARCHCAT2_breakdownBzip2OutputStream(BZFILE **bzStream, uint64_t *bzOutBytesConsumed, uint64_t *bzOutBytesWritten)
{
#ifdef DEBUG
fprintf(stderr, "\n--- STARCHCAT2_breakdownBzip2OutputStream() ---\n");
@@ -5570,12 +5706,12 @@ STARCHCAT2_breakdownBzip2OutputStream (BZFILE **bzStream, uint64_t *bzOutBytesCo
}
int
-STARCHCAT2_breakdownGzipOutputStream (z_stream *zStream)
+STARCHCAT2_breakdownGzipOutputStream(z_stream *zStream)
{
#ifdef DEBUG
fprintf(stderr, "\n--- STARCHCAT2_breakdownGzipOutputStream() ---\n");
#endif
-
+
z_stream *zStreamPtr = zStream;
int zError = Z_OK;
@@ -5606,8 +5742,8 @@ STARCHCAT2_breakdownGzipOutputStream (z_stream *zStream)
return STARCHCAT_EXIT_SUCCESS;
}
-int
-STARCHCAT2_fillExtractionBufferFromBzip2Stream (Boolean *eofFlag, char *recordChromosome, char *extractionBuffer, size_t *nExtractionBuffer, BZFILE **bzStream, size_t *nBzRead, char *bzRemainderBuf, size_t *nBzRemainderBuf, TransformState *t_state)
+int
+STARCHCAT2_fillExtractionBufferFromBzip2Stream(Boolean *eofFlag, char *recordChromosome, char *extractionBuffer, size_t *nExtractionBuffer, BZFILE **bzStream, size_t *nBzRead, char *bzRemainderBuf, size_t *nBzRemainderBuf, TransformState *t_state)
{
#ifdef DEBUG
fprintf(stderr, "\n--- STARCHCAT2_fillExtractionBufferFromBzip2Stream() (%s) ---\n", recordChromosome);
@@ -5800,7 +5936,7 @@ STARCHCAT2_fillExtractionBufferFromBzip2Stream (Boolean *eofFlag, char *recordCh
retransformedLineBuffer,
&nRetransformedLineBuffer,
&nRetransformedLineBufferPosition );
-
+
/* resize the extraction buffer, if we're getting too close to the maximum size of a line */
#ifdef __cplusplus
if (static_cast<unsigned int>( *nExtractionBuffer - *t_nExtractionBufferPos ) < TOKENS_MAX_LENGTH) {
@@ -5866,20 +6002,26 @@ STARCHCAT2_fillExtractionBufferFromBzip2Stream (Boolean *eofFlag, char *recordCh
*nBzRemainderBuf = bzCharIndex;
/* cleanup */
- if (bzReadBuf)
- free(bzReadBuf), bzReadBuf = NULL;
-
- if (bzLineBuf)
- free(bzLineBuf), bzLineBuf = NULL;
-
- if (retransformedLineBuffer)
- free(retransformedLineBuffer), retransformedLineBuffer = NULL;
+ if (bzReadBuf) {
+ free(bzReadBuf);
+ bzReadBuf = NULL;
+ }
+
+ if (bzLineBuf) {
+ free(bzLineBuf);
+ bzLineBuf = NULL;
+ }
+
+ if (retransformedLineBuffer) {
+ free(retransformedLineBuffer);
+ retransformedLineBuffer = NULL;
+ }
return STARCHCAT_EXIT_SUCCESS;
}
-int
-STARCHCAT2_fillExtractionBufferFromGzipStream (Boolean *eofFlag, FILE **inputFp, char *recordChromosome, char *extractionBuffer, size_t *nExtractionBuffer, z_stream *zStream, size_t *nZRead, char **zRemainderBuf, size_t *nZRemainderBuf, TransformState *t_state)
+int
+STARCHCAT2_fillExtractionBufferFromGzipStream(Boolean *eofFlag, FILE **inputFp, char *recordChromosome, char *extractionBuffer, size_t *nExtractionBuffer, z_stream *zStream, size_t *nZRead, char **zRemainderBuf, size_t *nZRemainderBuf, TransformState *t_state)
{
#ifdef DEBUG
fprintf(stderr, "\n--- STARCHCAT2_fillExtractionBufferFromGzipStream() ---\n");
@@ -5994,8 +6136,10 @@ STARCHCAT2_fillExtractionBufferFromGzipStream (Boolean *eofFlag, FILE **inputFp,
#endif
if (zStream->avail_in == 0) {
- free(zInBuf), zInBuf = NULL;
- free(zReadBuf), zReadBuf = NULL;
+ free(zInBuf);
+ zInBuf = NULL;
+ free(zReadBuf);
+ zReadBuf = NULL;
*eofFlag = kStarchTrue;
return STARCHCAT_EXIT_SUCCESS;
}
@@ -6058,7 +6202,7 @@ STARCHCAT2_fillExtractionBufferFromGzipStream (Boolean *eofFlag, FILE **inputFp,
memset(*zRemainderBuf, 0, *nZRemainderBuf);
*nZRemainderBuf = 0;
}
-
+
*t_nExtractionBuffer = 0;
*t_nExtractionBufferPos = 0;
@@ -6176,25 +6320,31 @@ STARCHCAT2_fillExtractionBufferFromGzipStream (Boolean *eofFlag, FILE **inputFp,
#endif
/* cleanup */
- if (zInBuf)
- free(zInBuf), zInBuf = NULL;
+ if (zInBuf) {
+ free(zInBuf);
+ zInBuf = NULL;
+ }
- if (zReadBuf)
- free(zReadBuf), zReadBuf = NULL;
+ if (zReadBuf) {
+ free(zReadBuf);
+ zReadBuf = NULL;
+ }
- if (retransformedLineBuffer)
- free(retransformedLineBuffer), retransformedLineBuffer = NULL;
+ if (retransformedLineBuffer) {
+ free(retransformedLineBuffer);
+ retransformedLineBuffer = NULL;
+ }
return STARCHCAT_EXIT_SUCCESS;
}
-int
-STARCHCAT2_extractBedLine (Boolean *eobFlag, char *extractionBuffer, int *extractionBufferOffset, char **extractedElement)
+int
+STARCHCAT2_extractBedLine(Boolean *eobFlag, char *extractionBuffer, int *extractionBufferOffset, char **extractedElement)
{
#ifdef DEBUG
fprintf(stderr, "\n--- STARCHCAT2_extractBedLine() ---\n");
#endif
-
+
#ifdef __cplusplus
size_t previousOffset = static_cast<size_t>( *extractionBufferOffset );
#else
@@ -6224,8 +6374,8 @@ STARCHCAT2_extractBedLine (Boolean *eobFlag, char *extractionBuffer, int *extrac
return STARCHCAT_EXIT_SUCCESS;
}
-int
-STARCHCAT2_parseCoordinatesFromBedLineV2 (Boolean *eobFlag, const char *extractedElement, SignedCoordType *start, SignedCoordType *stop)
+int
+STARCHCAT2_parseCoordinatesFromBedLineV2(Boolean *eobFlag, const char *extractedElement, SignedCoordType *start, SignedCoordType *stop)
{
#ifdef DEBUG
fprintf(stderr, "\n--- STARCHCAT2_parseCoordinatesFromBedLineV2() ---\n");
@@ -6238,7 +6388,7 @@ STARCHCAT2_parseCoordinatesFromBedLineV2 (Boolean *eobFlag, const char *extracte
*eobFlag = kStarchTrue;
return STARCHCAT_EXIT_SUCCESS;
}
-
+
errno = 0;
int fieldIdx = 0;
int charIdx = 0;
@@ -6251,7 +6401,8 @@ STARCHCAT2_parseCoordinatesFromBedLineV2 (Boolean *eobFlag, const char *extracte
while (extractedElement[charIdx] != '\0') {
if (extractedElement[charIdx] == tab) {
withinFieldIdx = 0;
- fieldIdx++, charIdx++;
+ fieldIdx++;
+ charIdx++;
continue;
}
switch (fieldIdx) {
@@ -6270,7 +6421,7 @@ STARCHCAT2_parseCoordinatesFromBedLineV2 (Boolean *eobFlag, const char *extracte
}
charIdx++;
}
-
+
#ifdef __cplusplus
result = static_cast<SignedCoordType>( strtoll(startStr, NULL, STARCH_RADIX) );
#else
@@ -6310,8 +6461,8 @@ STARCHCAT2_parseCoordinatesFromBedLineV2 (Boolean *eobFlag, const char *extracte
return STARCH_EXIT_SUCCESS;
}
-int
-STARCHCAT2_parseCoordinatesFromBedLineV2p2 (Boolean *eobFlag, const char *extractedElement, SignedCoordType *start, SignedCoordType *stop, char **remainder)
+int
+STARCHCAT2_parseCoordinatesFromBedLineV2p2(Boolean *eobFlag, const char *extractedElement, SignedCoordType *start, SignedCoordType *stop, char **remainder)
{
#ifdef DEBUG
fprintf(stderr, "\n--- STARCHCAT2_parseCoordinatesFromBedLineV2p2() ---\n");
@@ -6324,7 +6475,7 @@ STARCHCAT2_parseCoordinatesFromBedLineV2p2 (Boolean *eobFlag, const char *extrac
*eobFlag = kStarchTrue;
return STARCHCAT_EXIT_SUCCESS;
}
-
+
errno = 0;
int fieldIdx = 0;
int charIdx = 0;
@@ -6364,7 +6515,7 @@ STARCHCAT2_parseCoordinatesFromBedLineV2p2 (Boolean *eobFlag, const char *extrac
}
charIdx++;
}
-
+
#ifdef __cplusplus
result = static_cast<SignedCoordType>( strtoll(startStr, NULL, STARCH_RADIX) );
#else
@@ -6404,7 +6555,7 @@ STARCHCAT2_parseCoordinatesFromBedLineV2p2 (Boolean *eobFlag, const char *extrac
return STARCH_EXIT_SUCCESS;
}
-int
+int
STARCHCAT2_addLowestBedElementToCompressionBuffer (char *compressionBuffer, const char *extractedElement, LineCountType *compressionLineCount)
{
#ifdef DEBUG
@@ -6421,15 +6572,22 @@ STARCHCAT2_addLowestBedElementToCompressionBuffer (char *compressionBuffer, cons
return STARCH_EXIT_SUCCESS;
}
-int
+int
STARCHCAT2_transformCompressionBuffer (const char *compBuf, char *retransBuf, TransformState *retransState)
{
#ifdef DEBUG
fprintf(stderr, "\n--- STARCHCAT2_transformCompressionBuffer() ---\n");
#endif
+#if CLANG_COMPILER
+#pragma clang diagnostic push
+#pragma clang diagnostic ignored "-Wpointer-bool-conversion"
+#endif
if ((!retransState->r_chromosome) || (strlen(retransState->r_chromosome) == 0))
return STARCH_EXIT_FAILURE;
+#if CLANG_COMPILER
+#pragma clang diagnostic pop
+#endif
static const char tab = '\t';
size_t nCompBuf = strlen(compBuf);
@@ -6539,7 +6697,7 @@ STARCHCAT2_transformCompressionBuffer (const char *compBuf, char *retransBuf, Tr
}
}
*nRetransBuf = strlen(retransBuf);
-
+
/* statistics */
*retransLastPosition = *retransStop;
#ifdef __cplusplus
@@ -6575,16 +6733,20 @@ STARCHCAT2_transformCompressionBuffer (const char *compBuf, char *retransBuf, Tr
}
}
- if (retransChromosome)
- free(retransChromosome), retransChromosome = NULL;
- if (retransRemainder)
- free(retransRemainder), retransRemainder = NULL;
+ if (retransChromosome) {
+ free(retransChromosome);
+ retransChromosome = NULL;
+ }
+ if (retransRemainder) {
+ free(retransRemainder);
+ retransRemainder = NULL;
+ }
return STARCH_EXIT_SUCCESS;
}
int
-STARCHCAT2_squeezeRetransformedOutputBufferToBzip2Stream (BZFILE **bzStream, char *transformedBuffer)
+STARCHCAT2_squeezeRetransformedOutputBufferToBzip2Stream(BZFILE **bzStream, char *transformedBuffer)
{
#ifdef DEBUG
fprintf(stderr, "\n--- STARCHCAT2_squeezeRetransformedOutputBufferToBzip2Stream() ---\n");
@@ -6592,8 +6754,8 @@ STARCHCAT2_squeezeRetransformedOutputBufferToBzip2Stream (BZFILE **bzStream, cha
int bzError = BZ_OK;
size_t nTransformedBuffer = 0;
-
- if (transformedBuffer)
+
+ if (transformedBuffer)
nTransformedBuffer = strlen(transformedBuffer);
if ((transformedBuffer) && (*bzStream) && (nTransformedBuffer > 0)) {
@@ -6683,8 +6845,8 @@ STARCHCAT2_squeezeRetransformedOutputBufferToGzipStream (z_stream *zStream, cons
return STARCH_EXIT_SUCCESS;
}
-int
-STARCHCAT2_resetCompressionBuffer (char *compressionBuffer, LineCountType *compressionLineCount)
+int
+STARCHCAT2_resetCompressionBuffer(char *compressionBuffer, LineCountType *compressionLineCount)
{
#ifdef DEBUG
fprintf(stderr, "\n--- STARCHCAT2_resetCompressionBuffer() ---\n");
@@ -6696,8 +6858,8 @@ STARCHCAT2_resetCompressionBuffer (char *compressionBuffer, LineCountType *compr
return STARCH_EXIT_SUCCESS;
}
-int
-STARCHCAT2_finalizeMetadata (Metadata **outMd, char *finalChromosome, char *finalOutTagFn, uint64_t finalStreamSize, LineCountType finalLineCount, uint64_t finalTotalNonUniqueBases, uint64_t finalTotalUniqueBases, Boolean finalDuplicateElementExists, Boolean finalNestedElementExists, char *finalSignature, LineLengthType finalLineMaxStringLength)
+int
+STARCHCAT2_finalizeMetadata(Metadata **outMd, char *finalChromosome, char *finalOutTagFn, uint64_t finalStreamSize, LineCountType finalLineCount, uint64_t finalTotalNonUniqueBases, uint64_t finalTotalUniqueBases, Boolean finalDuplicateElementExists, Boolean finalNestedElementExists, char *finalSignature, LineLengthType finalLineMaxStringLength)
{
#ifdef DEBUG
fprintf(stderr, "\n--- STARCHCAT2_finalizeMetadata() ---\n");
diff --git a/applications/bed/starch/src/starchcat.h b/applications/bed/starch/src/starchcat.h
index 3d1076e..762cefe 100644
--- a/applications/bed/starch/src/starchcat.h
+++ b/applications/bed/starch/src/starchcat.h
@@ -47,6 +47,16 @@ namespace starch {
using namespace Bed;
#endif
+#if BEDOPS_BINARY_TYPE == 0
+static const char* application_type = "typical";
+#else
+#if BEDOPS_BINARY_TYPE == 1
+static const char* application_type = "megarow";
+#else
+static const char* application_type = "typical";
+#endif
+#endif
+
#define STARCHCAT_EXIT_FAILURE 0
#define STARCHCAT_EXIT_SUCCESS 1
#define STARCHCAT_FATAL_ERROR -1
@@ -57,6 +67,9 @@ namespace starch {
#define STARCHCAT_RETRANSFORM_BUFFER_SIZE 1024*1024
#define STARCHCAT_FIELD_BUFFER_MAX_LENGTH 16
+#define GCC_COMPILER (defined(__GNUC__) && !defined(__clang__))
+#define CLANG_COMPILER defined(__clang__)
+
/*
This is simply a struct containing a starch file's
metadata, pathname and other data useful for our
diff --git a/applications/bed/starch/src/starchcluster_gnuParallel.tcsh b/applications/bed/starch/src/starchcluster_gnuParallel.tcsh
index 4e36f13..613f22a 100755
--- a/applications/bed/starch/src/starchcluster_gnuParallel.tcsh
+++ b/applications/bed/starch/src/starchcluster_gnuParallel.tcsh
@@ -2,7 +2,7 @@
# author : sjn and apr
# date : Feb 2012
-# version : v2.4.26
+# version : v2.4.28
#
# BEDOPS
diff --git a/applications/bed/starch/src/starchcluster_sge.tcsh b/applications/bed/starch/src/starchcluster_sge.tcsh
index 9ffb750..62c0700 100755
--- a/applications/bed/starch/src/starchcluster_sge.tcsh
+++ b/applications/bed/starch/src/starchcluster_sge.tcsh
@@ -2,7 +2,7 @@
# author : sjn and apr
# date : Feb 2012
-# version : v2.4.26
+# version : v2.4.28
#
# BEDOPS
diff --git a/applications/bed/starch/src/starchcluster_slurm.tcsh b/applications/bed/starch/src/starchcluster_slurm.tcsh
index e8a955f..7503da2 100755
--- a/applications/bed/starch/src/starchcluster_slurm.tcsh
+++ b/applications/bed/starch/src/starchcluster_slurm.tcsh
@@ -2,7 +2,7 @@
# author : sjn and apr
# date : 13 Sep 2016
-# version : v2.4.26
+# version : v2.4.28
#
# BEDOPS
diff --git a/applications/bed/starch/src/starchstrip.c b/applications/bed/starch/src/starchstrip.c
index 4650900..9a7cb8d 100644
--- a/applications/bed/starch/src/starchstrip.c
+++ b/applications/bed/starch/src/starchstrip.c
@@ -44,12 +44,12 @@ namespace {
#endif
int
-main (int argc, char** argv)
+main(int argc, char** argv)
{
#ifdef DEBUG
fprintf(stderr, "\n--- starchstrip main() - enter ---\n");
#endif
-
+
setlocale(LC_ALL, "POSIX");
STARCHSTRIP_init_globals();
STARCHSTRIP_init_command_line_options(argc, argv);
@@ -97,11 +97,11 @@ STARCHSTRIP_write_updated_metadata(FILE* os)
}
/* archive version and creation timestamp are NULL, in order to write default values */
- md_json_buffer = STARCH_generateJSONMetadata(starchstrip_globals.output_records,
- starchstrip_globals.archive_type,
- starchstrip_globals.archive_version,
- NULL,
- starchstrip_globals.archive_note,
+ md_json_buffer = STARCH_generateJSONMetadata(starchstrip_globals.output_records,
+ starchstrip_globals.archive_type,
+ starchstrip_globals.archive_version,
+ NULL,
+ starchstrip_globals.archive_note,
starchstrip_globals.archive_header_flag);
if (!md_json_buffer) {
fprintf(stderr, "Error: Could not write JSON-formatted metadata to buffer\n");
@@ -112,18 +112,18 @@ STARCHSTRIP_write_updated_metadata(FILE* os)
#ifdef __cplusplus
STARCH_SHA1_All(reinterpret_cast<const unsigned char *>( md_json_buffer ), strlen(md_json_buffer), sha1_digest);
- STARCH_encodeBase64(&base64_encoded_sha1_digest,
- static_cast<const size_t>( STARCH2_MD_FOOTER_BASE64_ENCODED_SHA1_LENGTH ),
- reinterpret_cast<const unsigned char *>( sha1_digest ),
+ STARCH_encodeBase64(&base64_encoded_sha1_digest,
+ static_cast<const size_t>( STARCH2_MD_FOOTER_BASE64_ENCODED_SHA1_LENGTH ),
+ reinterpret_cast<const unsigned char *>( sha1_digest ),
static_cast<const size_t>( STARCH2_MD_FOOTER_SHA1_LENGTH ));
- sprintf(footer_cumulative_record_size_buffer, "%020llu", static_cast<unsigned long long>( starchstrip_globals.cumulative_output_size ));
+ sprintf(footer_cumulative_record_size_buffer, "%020llu", static_cast<unsigned long long>( starchstrip_globals.cumulative_output_size ));
#else
STARCH_SHA1_All((const unsigned char *) md_json_buffer, strlen(md_json_buffer), sha1_digest);
- STARCH_encodeBase64(&base64_encoded_sha1_digest,
- (const size_t) STARCH2_MD_FOOTER_BASE64_ENCODED_SHA1_LENGTH,
- (const unsigned char *) sha1_digest,
+ STARCH_encodeBase64(&base64_encoded_sha1_digest,
+ (const size_t) STARCH2_MD_FOOTER_BASE64_ENCODED_SHA1_LENGTH,
+ (const unsigned char *) sha1_digest,
(const size_t) STARCH2_MD_FOOTER_SHA1_LENGTH);
- sprintf(footer_cumulative_record_size_buffer, "%020llu", (unsigned long long) starchstrip_globals.cumulative_output_size);
+ sprintf(footer_cumulative_record_size_buffer, "%020llu", (unsigned long long) starchstrip_globals.cumulative_output_size);
#endif
memcpy(footer_buffer, footer_cumulative_record_size_buffer, strlen(footer_cumulative_record_size_buffer));
@@ -141,8 +141,10 @@ STARCHSTRIP_write_updated_metadata(FILE* os)
fflush(os);
/* cleanup */
- free(md_json_buffer), md_json_buffer = NULL;
- free(base64_encoded_sha1_digest), base64_encoded_sha1_digest = NULL;
+ free(md_json_buffer);
+ md_json_buffer = NULL;
+ free(base64_encoded_sha1_digest);
+ base64_encoded_sha1_digest = NULL;
#ifdef DEBUG
fprintf(stderr, "--- STARCHSTRIP_write_updated_metadata() - exit ---\n");
@@ -213,11 +215,11 @@ STARCHSTRIP_write_chromosome_streams(FILE* os)
#ifdef __cplusplus
if (records_added == 0) {
- output_records_tail = STARCH_createMetadata( const_cast<char *>( iter->chromosome ),
- iter->filename,
- iter->size,
- iter->lineCount,
- iter->totalNonUniqueBases,
+ output_records_tail = STARCH_createMetadata( const_cast<char *>( iter->chromosome ),
+ iter->filename,
+ iter->size,
+ iter->lineCount,
+ iter->totalNonUniqueBases,
iter->totalUniqueBases,
iter->duplicateElementExists,
iter->nestedElementExists,
@@ -226,12 +228,12 @@ STARCHSTRIP_write_chromosome_streams(FILE* os)
starchstrip_globals.output_records = output_records_tail;
}
else {
- output_records_tail = STARCH_addMetadata( output_records_tail,
- const_cast<char *>( iter->chromosome ),
- iter->filename,
- iter->size,
- iter->lineCount,
- iter->totalNonUniqueBases,
+ output_records_tail = STARCH_addMetadata( output_records_tail,
+ const_cast<char *>( iter->chromosome ),
+ iter->filename,
+ iter->size,
+ iter->lineCount,
+ iter->totalNonUniqueBases,
iter->totalUniqueBases,
iter->duplicateElementExists,
iter->nestedElementExists,
@@ -240,11 +242,11 @@ STARCHSTRIP_write_chromosome_streams(FILE* os)
}
#else
if (records_added == 0) {
- output_records_tail = STARCH_createMetadata( (char *) iter->chromosome,
- iter->filename,
- iter->size,
- iter->lineCount,
- iter->totalNonUniqueBases,
+ output_records_tail = STARCH_createMetadata( (char *) iter->chromosome,
+ iter->filename,
+ iter->size,
+ iter->lineCount,
+ iter->totalNonUniqueBases,
iter->totalUniqueBases,
iter->duplicateElementExists,
iter->nestedElementExists,
@@ -253,12 +255,12 @@ STARCHSTRIP_write_chromosome_streams(FILE* os)
starchstrip_globals.output_records = output_records_tail;
}
else {
- output_records_tail = STARCH_addMetadata( output_records_tail,
- (char *) iter->chromosome,
- iter->filename,
- iter->size,
- iter->lineCount,
- iter->totalNonUniqueBases,
+ output_records_tail = STARCH_addMetadata( output_records_tail,
+ (char *) iter->chromosome,
+ iter->filename,
+ iter->size,
+ iter->lineCount,
+ iter->totalNonUniqueBases,
iter->totalUniqueBases,
iter->duplicateElementExists,
iter->nestedElementExists,
@@ -300,7 +302,8 @@ STARCHSTRIP_write_header(FILE* os)
fprintf(stderr, "Error: Could not write archive header to output file stream\n");
exit(EIO); /* Input/output error (POSIX.1) */
}
- free(archive_header), archive_header = NULL;
+ free(archive_header);
+ archive_header = NULL;
starchstrip_globals.cumulative_output_size += STARCH2_MD_HEADER_BYTE_LENGTH;
}
else {
@@ -475,7 +478,6 @@ STARCHSTRIP_check_chromosome_stream_names()
}
}
}
-
#ifdef DEBUG
fprintf(stderr, "--- STARCHSTRIP_check_chromosome_stream_names() - exit ---\n");
@@ -489,7 +491,7 @@ STARCHSTRIP_check_archive_version()
fprintf(stderr, "--- STARCHSTRIP_check_archive_version() - enter ---\n");
#endif
- if ((starchstrip_globals.archive_version->major < starchstrip_archive_version_major_minimum)
+ if ((starchstrip_globals.archive_version->major < starchstrip_archive_version_major_minimum)
||
((starchstrip_globals.archive_version->major == starchstrip_archive_version_major_minimum) && (starchstrip_globals.archive_version->minor < starchstrip_archive_version_minor_minimum))) {
fprintf(stderr, "Error: Archive must be v2.1 or greater -- use 'starchcat' to update archive, if needed\n");
@@ -508,21 +510,21 @@ STARCHSTRIP_init_archive_metadata()
fprintf(stderr, "--- STARCHSTRIP_init_archive_metadata() - enter ---\n");
#endif
- if (STARCH_readJSONMetadata( &starchstrip_globals.archive_metadata_json,
- &starchstrip_globals.archive_fp,
+ if (STARCH_readJSONMetadata( &starchstrip_globals.archive_metadata_json,
+ &starchstrip_globals.archive_fp,
#ifdef __cplusplus
- reinterpret_cast<const char *>( starchstrip_globals.archive_fn ),
+ reinterpret_cast<const char *>( starchstrip_globals.archive_fn ),
#else
- (const char *) starchstrip_globals.archive_fn,
-#endif
- &starchstrip_globals.archive_records,
- &starchstrip_globals.archive_type,
- &starchstrip_globals.archive_version,
- &starchstrip_globals.archive_timestamp,
- &starchstrip_globals.archive_note,
- &starchstrip_globals.archive_metadata_offset,
- &starchstrip_globals.archive_header_flag,
- starchstrip_globals.archive_suppress_error_msgs,
+ (const char *) starchstrip_globals.archive_fn,
+#endif
+ &starchstrip_globals.archive_records,
+ &starchstrip_globals.archive_type,
+ &starchstrip_globals.archive_version,
+ &starchstrip_globals.archive_timestamp,
+ &starchstrip_globals.archive_note,
+ &starchstrip_globals.archive_metadata_offset,
+ &starchstrip_globals.archive_header_flag,
+ starchstrip_globals.archive_suppress_error_msgs,
starchstrip_globals.archive_preserve_json_ref) != STARCH_EXIT_SUCCESS) {
fprintf(stderr, "Error: Could not read metadata from archive -- use 'unstarch --is-starch' to test if archive is valid\n");
exit(EINVAL); /* Invalid argument (POSIX.1) */
@@ -648,11 +650,11 @@ STARCHSTRIP_init_chromosomes_list()
#endif
}
-static int
+static int
STARCHSTRIP_compare_chromosome_names(const void* a, const void* b)
{
#ifdef __cplusplus
- return strcmp(*(const char**) a, *(const char**) b);
+ return strcmp((static_cast<const char*>(a)), (static_cast<const char*>(b)));
#else
return strcmp(*(const char**) a, *(const char**) b);
#endif
@@ -701,26 +703,50 @@ STARCHSTRIP_delete_globals()
#endif
for (size_t idx = 0; idx < starchstrip_globals.chromosomes_num; ++idx) {
- free(starchstrip_globals.chromosomes[idx]), starchstrip_globals.chromosomes[idx] = NULL;
+ free(starchstrip_globals.chromosomes[idx]);
+ starchstrip_globals.chromosomes[idx] = NULL;
}
- free(starchstrip_globals.chromosomes), starchstrip_globals.chromosomes = NULL;
+ free(starchstrip_globals.chromosomes);
+ starchstrip_globals.chromosomes = NULL;
starchstrip_globals.chromosomes_num = 0;
-
- free(starchstrip_globals.chromosomes_str), starchstrip_globals.chromosomes_str = NULL;
+
+ free(starchstrip_globals.chromosomes_str);
+ starchstrip_globals.chromosomes_str = NULL;
for (size_t idx = 0; idx < starchstrip_globals.chromosomes_to_process_num; ++idx) {
- free(starchstrip_globals.chromosomes_to_process[idx]), starchstrip_globals.chromosomes_to_process[idx] = NULL;
+ free(starchstrip_globals.chromosomes_to_process[idx]);
+ starchstrip_globals.chromosomes_to_process[idx] = NULL;
}
- free(starchstrip_globals.chromosomes_to_process), starchstrip_globals.chromosomes_to_process = NULL;
+ free(starchstrip_globals.chromosomes_to_process);
+ starchstrip_globals.chromosomes_to_process = NULL;
starchstrip_globals.chromosomes_to_process_num = 0;
- free(starchstrip_globals.archive_fn), starchstrip_globals.archive_fn = NULL;
- if (starchstrip_globals.archive_metadata_json) { json_decref(starchstrip_globals.archive_metadata_json), starchstrip_globals.archive_metadata_json = NULL; }
- if (starchstrip_globals.archive_fp) { fclose(starchstrip_globals.archive_fp), starchstrip_globals.archive_fp = NULL; }
- if (starchstrip_globals.archive_records) { STARCH_freeMetadata(&starchstrip_globals.archive_records), starchstrip_globals.archive_records = NULL; }
- if (starchstrip_globals.archive_version) { free(starchstrip_globals.archive_version), starchstrip_globals.archive_version = NULL; }
- if (starchstrip_globals.archive_timestamp) { free(starchstrip_globals.archive_timestamp), starchstrip_globals.archive_timestamp = NULL; }
- if (starchstrip_globals.archive_note) { free(starchstrip_globals.archive_note), starchstrip_globals.archive_note = NULL; }
+ free(starchstrip_globals.archive_fn);
+ starchstrip_globals.archive_fn = NULL;
+ if (starchstrip_globals.archive_metadata_json) {
+ json_decref(starchstrip_globals.archive_metadata_json);
+ starchstrip_globals.archive_metadata_json = NULL;
+ }
+ if (starchstrip_globals.archive_fp) {
+ fclose(starchstrip_globals.archive_fp);
+ starchstrip_globals.archive_fp = NULL;
+ }
+ if (starchstrip_globals.archive_records) {
+ STARCH_freeMetadata(&starchstrip_globals.archive_records);
+ starchstrip_globals.archive_records = NULL;
+ }
+ if (starchstrip_globals.archive_version) {
+ free(starchstrip_globals.archive_version);
+ starchstrip_globals.archive_version = NULL;
+ }
+ if (starchstrip_globals.archive_timestamp) {
+ free(starchstrip_globals.archive_timestamp);
+ starchstrip_globals.archive_timestamp = NULL;
+ }
+ if (starchstrip_globals.archive_note) {
+ free(starchstrip_globals.archive_note);
+ starchstrip_globals.archive_note = NULL;
+ }
STARCH_freeMetadata(&starchstrip_globals.output_records);
@@ -848,13 +874,14 @@ STARCHSTRIP_print_version(FILE* os)
#endif
fprintf(os,
- "%s\n" \
- " citation: %s\n" \
- " version: %s\n" \
+ "%s\n" \
+ " citation: %s\n" \
+ " version: %s (%s)\n" \
" authors: %s\n",
name,
BEDOPS::citation(),
BEDOPS::revision(),
+ application_type,
authors);
#ifdef DEBUG
@@ -870,14 +897,15 @@ STARCHSTRIP_print_usage(FILE* os)
#endif
fprintf(os,
- "%s\n" \
- " citation: %s\n" \
- " version: %s\n" \
- " authors: %s\n" \
+ "%s\n" \
+ " citation: %s\n" \
+ " version: %s (%s)\n" \
+ " authors: %s\n" \
"%s\n",
name,
BEDOPS::citation(),
BEDOPS::revision(),
+ application_type,
authors,
usage);
@@ -886,7 +914,7 @@ STARCHSTRIP_print_usage(FILE* os)
#endif
}
-static Boolean
+static Boolean
STARCHSTRIP_file_exists(char* fn)
{
struct stat buf;
diff --git a/applications/bed/starch/src/starchstrip.h b/applications/bed/starch/src/starchstrip.h
index 6ed19a1..34f36b2 100644
--- a/applications/bed/starch/src/starchstrip.h
+++ b/applications/bed/starch/src/starchstrip.h
@@ -68,6 +68,16 @@ static const char *usage = "\n" \
" --version Show binary version.\n\n" \
" --help Show this usage message.\n";
+#if BEDOPS_BINARY_TYPE == 0
+static const char* application_type = "typical";
+#else
+#if BEDOPS_BINARY_TYPE == 1
+static const char* application_type = "megarow";
+#else
+static const char* application_type = "typical";
+#endif
+#endif
+
static struct globals {
char* chromosomes_str;
char** chromosomes;
diff --git a/applications/bed/starch/src/unstarch.c b/applications/bed/starch/src/unstarch.c
index 1bf649e..d10811a 100644
--- a/applications/bed/starch/src/unstarch.c
+++ b/applications/bed/starch/src/unstarch.c
@@ -54,8 +54,8 @@ namespace {
} // unnamed
#endif
-int
-main(int argc, char **argv)
+int
+main(int argc, char **argv)
{
#ifdef DEBUG
fprintf(stderr, "\n--- unstarch main() enter ---\n");
@@ -93,7 +93,7 @@ main(int argc, char **argv)
setlocale(LC_ALL, "POSIX");
if (UNSTARCH_parseCommandLineInputs( argc, argv, &whichChromosome, &inFile, &option, &parseValue ) != 0) {
- switch (parseValue) {
+ switch (parseValue) {
case 0: {
resultValue = EXIT_FAILURE;
break;
@@ -209,15 +209,15 @@ main(int argc, char **argv)
}
}
- if ((resultValue == 0) ||
- (resultValue == UNSTARCH_ARCHIVE_VERSION_ERROR) ||
+ if ((resultValue == 0) ||
+ (resultValue == UNSTARCH_ARCHIVE_VERSION_ERROR) ||
(resultValue == UNSTARCH_ARCHIVE_CREATION_TIMESTAMP_ERROR) ||
- (resultValue == UNSTARCH_ELEMENT_COUNT_ALL_ERROR) ||
- (resultValue == UNSTARCH_ELEMENT_COUNT_CHR_ERROR) ||
- (resultValue == UNSTARCH_BASES_COUNT_ALL_ERROR) ||
- (resultValue == UNSTARCH_BASES_COUNT_CHR_ERROR) ||
- (resultValue == UNSTARCH_BASES_UNIQUE_COUNT_ALL_ERROR) ||
- (resultValue == UNSTARCH_BASES_UNIQUE_COUNT_CHR_ERROR) ||
+ (resultValue == UNSTARCH_ELEMENT_COUNT_ALL_ERROR) ||
+ (resultValue == UNSTARCH_ELEMENT_COUNT_CHR_ERROR) ||
+ (resultValue == UNSTARCH_BASES_COUNT_ALL_ERROR) ||
+ (resultValue == UNSTARCH_BASES_COUNT_CHR_ERROR) ||
+ (resultValue == UNSTARCH_BASES_UNIQUE_COUNT_ALL_ERROR) ||
+ (resultValue == UNSTARCH_BASES_UNIQUE_COUNT_CHR_ERROR) ||
(resultValue == UNSTARCH_LIST_CHROMOSOMES_ERROR) ||
(resultValue == UNSTARCH_ARCHIVE_NOTE_ERROR) ||
(resultValue == UNSTARCH_ARCHIVE_COMPRESSION_TYPE_ERROR) ||
@@ -232,21 +232,21 @@ main(int argc, char **argv)
(resultValue == UNSTARCH_ELEMENT_MAX_STRING_LENGTH_CHR_ERROR) ||
(resultValue == UNSTARCH_ELEMENT_MAX_STRING_LENGTH_ALL_ERROR))
{
- if (STARCH_readJSONMetadata( &metadataJSON,
- &inFilePtr,
+ if (STARCH_readJSONMetadata( &metadataJSON,
+ &inFilePtr,
#ifdef __cplusplus
- reinterpret_cast<const char *>( inFile ),
+ reinterpret_cast<const char *>( inFile ),
#else
- (const char *) inFile,
+ (const char *) inFile,
#endif
- &records,
- &type,
- &archiveVersion,
- &archiveTimestamp,
- ¬e,
- &metadataOffset,
- &headerFlag,
- suppressErrorMsgs,
+ &records,
+ &type,
+ &archiveVersion,
+ &archiveTimestamp,
+ ¬e,
+ &metadataOffset,
+ &headerFlag,
+ suppressErrorMsgs,
preserveJSONRef) != STARCH_EXIT_SUCCESS) {
fprintf(stderr, "ERROR: Could not read metadata\n");
resultValue = EXIT_FAILURE;
@@ -255,21 +255,21 @@ main(int argc, char **argv)
else if (resultValue == UNSTARCH_IS_STARCH_ARCHIVE_ERROR)
{
/* we suppress warnings from STARCH_readJSONMetadata() */
- if (STARCH_readJSONMetadata( &metadataJSON,
- &inFilePtr,
+ if (STARCH_readJSONMetadata( &metadataJSON,
+ &inFilePtr,
#ifdef __cplusplus
- reinterpret_cast<const char *>( inFile ),
+ reinterpret_cast<const char *>( inFile ),
#else
- (const char *) inFile,
+ (const char *) inFile,
#endif
- &records,
- &type,
- &archiveVersion,
- &archiveTimestamp,
- ¬e,
- &metadataOffset,
- &headerFlag,
- kStarchTrue,
+ &records,
+ &type,
+ &archiveVersion,
+ &archiveTimestamp,
+ ¬e,
+ &metadataOffset,
+ &headerFlag,
+ kStarchTrue,
kStarchTrue) != STARCH_EXIT_SUCCESS) {
fprintf(stdout, "0\n"); /* false -- no valid metadata, therefore not a starch archive */
return EXIT_FAILURE;
@@ -281,21 +281,21 @@ main(int argc, char **argv)
}
else if ( (resultValue == UNSTARCH_METADATA_SHA1_SIGNATURE_ERROR) || (resultValue == UNSTARCH_SIGNATURE_ERROR) || (resultValue == UNSTARCH_SIGNATURE_VERIFY_ERROR) )
{
- if (STARCH_readJSONMetadata( &metadataJSON,
- &inFilePtr,
+ if (STARCH_readJSONMetadata( &metadataJSON,
+ &inFilePtr,
#ifdef __cplusplus
- reinterpret_cast<const char *>( inFile ),
+ reinterpret_cast<const char *>( inFile ),
#else
- (const char *) inFile,
+ (const char *) inFile,
#endif
- &records,
- &type,
- &archiveVersion,
- &archiveTimestamp,
- ¬e,
- &metadataOffset,
- &headerFlag,
- suppressErrorMsgs,
+ &records,
+ &type,
+ &archiveVersion,
+ &archiveTimestamp,
+ ¬e,
+ &metadataOffset,
+ &headerFlag,
+ suppressErrorMsgs,
kStarchTrue) != STARCH_EXIT_SUCCESS) {
fprintf(stderr, "ERROR: Could not read metadata\n");
resultValue = EXIT_FAILURE;
@@ -312,17 +312,19 @@ main(int argc, char **argv)
#endif
if (jsonString) {
#ifdef __cplusplus
- STARCH_SHA1_All(reinterpret_cast<const unsigned char *>( reinterpret_cast<unsigned char *>( jsonString ) ),
- strlen(jsonString),
- mdHashBuffer);
+ STARCH_SHA1_All(reinterpret_cast<const unsigned char *>( reinterpret_cast<unsigned char *>( jsonString ) ),
+ strlen(jsonString),
+ mdHashBuffer);
#else
- STARCH_SHA1_All((const unsigned char *) jsonString,
+ STARCH_SHA1_All((const unsigned char *) jsonString,
strlen(jsonString),
- mdHashBuffer);
+ mdHashBuffer);
#endif
- free(jsonString), jsonString = NULL;
- json_decref(metadataJSON), metadataJSON = NULL;
- }
+ free(jsonString);
+ jsonString = NULL;
+ json_decref(metadataJSON);
+ metadataJSON = NULL;
+ }
else {
fprintf(stderr, "ERROR: Could not encode JSON structure into string representation\n");
resultValue = EXIT_FAILURE;
@@ -358,24 +360,24 @@ main(int argc, char **argv)
else if (option && (strcmp(option, "version") == 0))
resultValue = UNSTARCH_VERSION_ERROR;
else if (option && ((strcmp(option, "archiveVersion") == 0) || (strcmp(option, "archive-version") == 0)))
- resultValue = UNSTARCH_ARCHIVE_VERSION_ERROR;
+ resultValue = UNSTARCH_ARCHIVE_VERSION_ERROR;
else {
if ((STARCH_MAJOR_VERSION == 1) || (archiveVersion->major == 1)) {
switch (type) {
case kBzip2: {
#ifdef __cplusplus
- if (UNSTARCH_extractDataWithBzip2(&inFilePtr,
- NULL,
- whichChromosome,
- reinterpret_cast<const Metadata *>( records ),
- static_cast<const unsigned long long>( metadataOffset ),
+ if (UNSTARCH_extractDataWithBzip2(&inFilePtr,
+ NULL,
+ whichChromosome,
+ reinterpret_cast<const Metadata *>( records ),
+ static_cast<const unsigned long long>( metadataOffset ),
static_cast<const Boolean>( headerFlag )) != 0) {
#else
- if (UNSTARCH_extractDataWithBzip2(&inFilePtr,
- NULL,
- whichChromosome,
- (const Metadata *) records,
- (const unsigned long long) metadataOffset,
+ if (UNSTARCH_extractDataWithBzip2(&inFilePtr,
+ NULL,
+ whichChromosome,
+ (const Metadata *) records,
+ (const unsigned long long) metadataOffset,
(const Boolean) headerFlag) != 0) {
#endif
fprintf(stderr, "ERROR: Backend extraction failed (bzip2)\n");
@@ -385,18 +387,18 @@ main(int argc, char **argv)
}
case kGzip: {
#ifdef __cplusplus
- if (UNSTARCH_extractDataWithGzip(&inFilePtr,
- NULL,
- whichChromosome,
- reinterpret_cast<const Metadata *>( records ),
- static_cast<const unsigned long long>( metadataOffset ),
+ if (UNSTARCH_extractDataWithGzip(&inFilePtr,
+ NULL,
+ whichChromosome,
+ reinterpret_cast<const Metadata *>( records ),
+ static_cast<const unsigned long long>( metadataOffset ),
static_cast<const Boolean>( headerFlag )) != 0) {
#else
- if (UNSTARCH_extractDataWithGzip(&inFilePtr,
- NULL,
- whichChromosome,
- (const Metadata *) records,
- (const unsigned long long) metadataOffset,
+ if (UNSTARCH_extractDataWithGzip(&inFilePtr,
+ NULL,
+ whichChromosome,
+ (const Metadata *) records,
+ (const unsigned long long) metadataOffset,
(const Boolean) headerFlag) != 0) {
#endif
fprintf(stderr, "ERROR: Backend extraction failed (gzip)\n");
@@ -415,18 +417,18 @@ main(int argc, char **argv)
switch (type) {
case kBzip2: {
#ifdef __cplusplus
- if (UNSTARCH_extractDataWithBzip2(&inFilePtr,
- NULL,
- whichChromosome,
- reinterpret_cast<const Metadata *>( records ),
- static_cast<const unsigned long long>( sizeof(starchRevision2HeaderBytes) ),
+ if (UNSTARCH_extractDataWithBzip2(&inFilePtr,
+ NULL,
+ whichChromosome,
+ reinterpret_cast<const Metadata *>( records ),
+ static_cast<const unsigned long long>( sizeof(starchRevision2HeaderBytes) ),
static_cast<const Boolean>( headerFlag )) != 0) {
#else
- if (UNSTARCH_extractDataWithBzip2(&inFilePtr,
- NULL,
- whichChromosome,
- (const Metadata *) records,
- (const unsigned long long) sizeof(starchRevision2HeaderBytes),
+ if (UNSTARCH_extractDataWithBzip2(&inFilePtr,
+ NULL,
+ whichChromosome,
+ (const Metadata *) records,
+ (const unsigned long long) sizeof(starchRevision2HeaderBytes),
(const Boolean) headerFlag) != 0) {
#endif
fprintf(stderr, "ERROR: Backend extraction failed (bzip2)\n");
@@ -436,18 +438,18 @@ main(int argc, char **argv)
}
case kGzip: {
#ifdef __cplusplus
- if (UNSTARCH_extractDataWithGzip(&inFilePtr,
- NULL,
- whichChromosome,
- reinterpret_cast<const Metadata *>( records ),
- static_cast<const unsigned long long>( sizeof(starchRevision2HeaderBytes) ),
+ if (UNSTARCH_extractDataWithGzip(&inFilePtr,
+ NULL,
+ whichChromosome,
+ reinterpret_cast<const Metadata *>( records ),
+ static_cast<const unsigned long long>( sizeof(starchRevision2HeaderBytes) ),
static_cast<const Boolean>( headerFlag )) != 0) {
#else
- if (UNSTARCH_extractDataWithGzip(&inFilePtr,
- NULL,
- whichChromosome,
- (const Metadata *) records,
- (const unsigned long long) sizeof(starchRevision2HeaderBytes),
+ if (UNSTARCH_extractDataWithGzip(&inFilePtr,
+ NULL,
+ whichChromosome,
+ (const Metadata *) records,
+ (const unsigned long long) sizeof(starchRevision2HeaderBytes),
(const Boolean) headerFlag) != 0) {
#endif
fprintf(stderr, "ERROR: Backend extraction failed (gzip)\n");
@@ -464,12 +466,12 @@ main(int argc, char **argv)
}
else if (STARCH_MAJOR_VERSION > 2) {
fprintf(stderr, "ERROR: Unstarch does not support extracting archives in this major version release (built as: %d.%d.%d)\n", STARCH_MAJOR_VERSION, STARCH_MINOR_VERSION, STARCH_REVISION_VERSION); // this is preserved for future-proofing test builds of Starch binaries
- exit(EXIT_FAILURE);
+ exit(EXIT_FAILURE);
}
}
}
- else if (resultValue == EXIT_FAILURE)
+ else if (resultValue == EXIT_FAILURE)
UNSTARCH_printUsage(EXIT_FAILURE);
else if (resultValue == UNSTARCH_HELP_ERROR) {
@@ -549,7 +551,7 @@ main(int argc, char **argv)
UNSTARCH_printLineCountForChromosome(records, whichChromosome);
else {
fprintf(stderr, "ERROR: Archive version (%d.%d.%d) does not support element counting (starchcat the archive to bring its version to v1.3.0 or greater)\n", archiveVersion->major, archiveVersion->minor, archiveVersion->revision);
- resultValue = EXIT_FAILURE;
+ resultValue = EXIT_FAILURE;
}
break;
}
@@ -559,8 +561,8 @@ main(int argc, char **argv)
UNSTARCH_printLineCountForAllChromosomes(records);
else {
fprintf(stderr, "ERROR: Archive version (%d.%d.%d) does not support element counting (starchcat the archive to bring its version to v1.3.0 or greater)\n", archiveVersion->major, archiveVersion->minor, archiveVersion->revision);
- resultValue = EXIT_FAILURE;
- }
+ resultValue = EXIT_FAILURE;
+ }
break;
}
case UNSTARCH_BASES_COUNT_CHR_ERROR: {
@@ -569,7 +571,7 @@ main(int argc, char **argv)
UNSTARCH_printNonUniqueBaseCountForChromosome(records, whichChromosome);
else {
fprintf(stderr, "ERROR: Archive version (%d.%d.%d) does not support base counting (starchcat the archive to bring its version to v1.4.0 or greater)\n", archiveVersion->major, archiveVersion->minor, archiveVersion->revision);
- resultValue = EXIT_FAILURE;
+ resultValue = EXIT_FAILURE;
}
break;
}
@@ -579,7 +581,7 @@ main(int argc, char **argv)
UNSTARCH_printNonUniqueBaseCountForAllChromosomes(records);
else {
fprintf(stderr, "ERROR: Archive version (%d.%d.%d) does not support base counting (starchcat the archive to bring its version to v1.4.0 or greater)\n", archiveVersion->major, archiveVersion->minor, archiveVersion->revision);
- resultValue = EXIT_FAILURE;
+ resultValue = EXIT_FAILURE;
}
break;
}
@@ -589,7 +591,7 @@ main(int argc, char **argv)
UNSTARCH_printUniqueBaseCountForChromosome(records, whichChromosome);
else {
fprintf(stderr, "ERROR: Archive version (%d.%d.%d) does not support base counting (starchcat the archive to bring its version to v1.4.0 or greater)\n", archiveVersion->major, archiveVersion->minor, archiveVersion->revision);
- resultValue = EXIT_FAILURE;
+ resultValue = EXIT_FAILURE;
}
break;
}
@@ -599,10 +601,10 @@ main(int argc, char **argv)
UNSTARCH_printUniqueBaseCountForAllChromosomes(records);
else {
fprintf(stderr, "ERROR: Archive version (%d.%d.%d) does not support base counting (starchcat the archive to bring its version to v1.4.0 or greater)\n", archiveVersion->major, archiveVersion->minor, archiveVersion->revision);
- resultValue = EXIT_FAILURE;
+ resultValue = EXIT_FAILURE;
}
break;
- }
+ }
case UNSTARCH_ARCHIVE_CREATION_TIMESTAMP_ERROR: {
if (((archiveVersion->major == 1) && (archiveVersion->minor >= 5)) ||
((archiveVersion->major == 2) && (archiveVersion->minor >= 0))) {
@@ -612,9 +614,9 @@ main(int argc, char **argv)
return EXIT_FAILURE;
}
#ifdef __cplusplus
- UNSTARCH_printArchiveTimestamp(const_cast<const char *>( archiveTimestamp ));
+ UNSTARCH_printArchiveTimestamp(const_cast<const char *>( archiveTimestamp ));
#else
- UNSTARCH_printArchiveTimestamp((const char *)archiveTimestamp);
+ UNSTARCH_printArchiveTimestamp((const char *)archiveTimestamp);
#endif
}
else {
@@ -762,23 +764,23 @@ main(int argc, char **argv)
case UNSTARCH_SIGNATURE_VERIFY_ERROR: {
if ((archiveVersion->major == 2) && (archiveVersion->minor >= 2)) {
if (whichChromosome) {
- signatureVerificationFlag = UNSTARCH_verifySignature(&inFilePtr,
+ signatureVerificationFlag = UNSTARCH_verifySignature(&inFilePtr,
records,
#ifdef __cplusplus
- static_cast<const unsigned long long>( sizeof(starchRevision2HeaderBytes) ),
+ static_cast<const unsigned long long>( sizeof(starchRevision2HeaderBytes) ),
#else
- (const unsigned long long) sizeof(starchRevision2HeaderBytes),
+ (const unsigned long long) sizeof(starchRevision2HeaderBytes),
#endif
whichChromosome,
type);
}
else {
- signatureVerificationFlag = UNSTARCH_verifyAllSignatures(&inFilePtr,
- records,
+ signatureVerificationFlag = UNSTARCH_verifyAllSignatures(&inFilePtr,
+ records,
#ifdef __cplusplus
- static_cast<const unsigned long long>( sizeof(starchRevision2HeaderBytes) ),
+ static_cast<const unsigned long long>( sizeof(starchRevision2HeaderBytes) ),
#else
- (const unsigned long long) sizeof(starchRevision2HeaderBytes),
+ (const unsigned long long) sizeof(starchRevision2HeaderBytes),
#endif
type);
}
@@ -815,8 +817,8 @@ main(int argc, char **argv)
if ((resultValue == UNSTARCH_SIGNATURE_VERIFY_ERROR) && (signatureVerificationFlag == kStarchFalse)) {
resultValue = EXIT_FAILURE;
}
- else if ((resultValue == UNSTARCH_HELP_ERROR) ||
- (resultValue == UNSTARCH_VERSION_ERROR) ||
+ else if ((resultValue == UNSTARCH_HELP_ERROR) ||
+ (resultValue == UNSTARCH_VERSION_ERROR) ||
(resultValue == UNSTARCH_ARCHIVE_VERSION_ERROR) ||
(resultValue == UNSTARCH_ARCHIVE_CREATION_TIMESTAMP_ERROR) ||
(resultValue == UNSTARCH_ELEMENT_COUNT_CHR_ERROR) ||
@@ -839,26 +841,25 @@ main(int argc, char **argv)
(resultValue == UNSTARCH_SIGNATURE_ERROR) ||
(resultValue == UNSTARCH_SIGNATURE_VERIFY_ERROR) ||
(resultValue == UNSTARCH_ELEMENT_MAX_STRING_LENGTH_CHR_ERROR) ||
- (resultValue == UNSTARCH_ELEMENT_MAX_STRING_LENGTH_ALL_ERROR) )
+ (resultValue == UNSTARCH_ELEMENT_MAX_STRING_LENGTH_ALL_ERROR) )
{
resultValue = EXIT_SUCCESS;
}
-
/* cleanup */
if (option)
free(option);
if (whichChromosome)
- free(whichChromosome);
+ free(whichChromosome);
if (inFile)
- free(inFile);
+ free(inFile);
if (inFilePtr)
- fclose(inFilePtr);
+ fclose(inFilePtr);
if (records)
STARCH_freeMetadata(&records);
if (archiveVersion)
free(archiveVersion);
- if (archiveTimestamp)
+ if (archiveTimestamp)
free(archiveTimestamp);
#ifdef DEBUG
@@ -1032,21 +1033,21 @@ UNSTARCH_parseCommandLineInputs(int argc, char **argv, char **chr, char **fn, ch
#endif
- if ( (! *fn) ||
- (! *chr) ||
- (strcmp(*fn, "-") == 0) ||
- (strcmp(*fn, "--list") == 0) ||
- (strcmp(*fn, "--listJSON") == 0) ||
- (strcmp(*fn, "--list-json") == 0) ||
- (strcmp(*fn, "--list-json-no-trailing-newline") == 0) ||
- (strcmp(*fn, "--note") == 0) ||
- (strcmp(*fn, "--archive-type") == 0) ||
- (strcmp(*fn, "--archive-version") == 0) ||
- (strcmp(*fn, "--archive-timestamp") == 0) ||
- (strcmp(*fn, "--sha1-signature") == 0) ||
- (strcmp(*fn, "--signature") == 0) ||
- (strcmp(*fn, "--verify-signature") == 0) ||
- (strcmp(*fn, "--is-starch") == 0) )
+ if ( (! *fn) ||
+ (! *chr) ||
+ (strcmp(*fn, "-") == 0) ||
+ (strcmp(*fn, "--list") == 0) ||
+ (strcmp(*fn, "--listJSON") == 0) ||
+ (strcmp(*fn, "--list-json") == 0) ||
+ (strcmp(*fn, "--list-json-no-trailing-newline") == 0) ||
+ (strcmp(*fn, "--note") == 0) ||
+ (strcmp(*fn, "--archive-type") == 0) ||
+ (strcmp(*fn, "--archive-version") == 0) ||
+ (strcmp(*fn, "--archive-timestamp") == 0) ||
+ (strcmp(*fn, "--sha1-signature") == 0) ||
+ (strcmp(*fn, "--signature") == 0) ||
+ (strcmp(*fn, "--verify-signature") == 0) ||
+ (strcmp(*fn, "--is-starch") == 0) )
{
if (ftr1)
free(ftr1);
@@ -1062,7 +1063,7 @@ UNSTARCH_parseCommandLineInputs(int argc, char **argv, char **chr, char **fn, ch
*optn = (ftr1) ? STARCH_strdup(ftr1) : ((ftr2) ? STARCH_strdup(ftr2) : NULL);
- if (*optn) {
+ if (*optn) {
if (strcmp(*optn, "help") == 0) {
*pval = UNSTARCH_HELP_ERROR;
return *pval;
@@ -1070,7 +1071,7 @@ UNSTARCH_parseCommandLineInputs(int argc, char **argv, char **chr, char **fn, ch
else if (strcmp(*optn, "version") == 0) {
*pval = UNSTARCH_VERSION_ERROR;
return *pval;
- }
+ }
else if (strcmp(*optn, "is-starch") == 0) {
*pval = UNSTARCH_IS_STARCH_ARCHIVE_ERROR;
return *pval;
@@ -1118,7 +1119,7 @@ UNSTARCH_parseCommandLineInputs(int argc, char **argv, char **chr, char **fn, ch
else if (strcmp(*optn, "bases") == 0) {
*pval = (strcmp(*chr, "--bases") == 0) ? UNSTARCH_BASES_COUNT_ALL_ERROR : UNSTARCH_BASES_COUNT_CHR_ERROR;
return *pval;
- }
+ }
else if (strcmp(*optn, "bases-uniq") == 0) {
*pval = (strcmp(*chr, "--bases-uniq") == 0) ? UNSTARCH_BASES_UNIQUE_COUNT_ALL_ERROR : UNSTARCH_BASES_UNIQUE_COUNT_CHR_ERROR;
return *pval;
@@ -1139,9 +1140,9 @@ UNSTARCH_parseCommandLineInputs(int argc, char **argv, char **chr, char **fn, ch
*pval = (strcmp(*chr, "--has-nested") == 0) ? UNSTARCH_ELEMENT_NESTED_ALL_INT_ERROR : UNSTARCH_ELEMENT_NESTED_CHR_INT_ERROR;
return *pval;
}
- else if ((strcmp(*optn, "list") != 0) &&
- (strcmp(*optn, "listJSON") != 0) &&
- (strcmp(*optn, "list-json") != 0) &&
+ else if ((strcmp(*optn, "list") != 0) &&
+ (strcmp(*optn, "listJSON") != 0) &&
+ (strcmp(*optn, "list-json") != 0) &&
(strcmp(*optn, "list-json-no-trailing-newline") != 0) ) {
fprintf(stderr, "ERROR: Wrong option specified\n");
return UNSTARCH_FATAL_ERROR;
@@ -1151,8 +1152,8 @@ UNSTARCH_parseCommandLineInputs(int argc, char **argv, char **chr, char **fn, ch
return EXIT_SUCCESS;
}
-void
-UNSTARCH_printUsage(int errorType)
+void
+UNSTARCH_printUsage(int errorType)
{
#ifdef DEBUG
fprintf(stderr, "\n--- UNSTARCH_printUsage() ---\n");
@@ -1170,13 +1171,14 @@ UNSTARCH_printUsage(int errorType)
case EXIT_FAILURE:
case UNSTARCH_HELP_ERROR:
default:
- fprintf(stderr,
- "%s\n citation: %s\n binary version: %s (extracts archive version: %s or older)\n authors: %s\n%s\n",
- name,
- BEDOPS::citation(),
- BEDOPS::revision(),
- avStr,
- authors,
+ fprintf(stderr,
+ "%s\n citation: %s\n binary version: %s (%s) (extracts archive version: %s or older)\n authors: %s\n%s\n",
+ name,
+ BEDOPS::citation(),
+ BEDOPS::revision(),
+ application_type,
+ avStr,
+ authors,
usage);
break;
}
@@ -1185,8 +1187,8 @@ UNSTARCH_printUsage(int errorType)
}
}
-void
-UNSTARCH_printRevision()
+void
+UNSTARCH_printRevision()
{
#ifdef DEBUG
fprintf(stderr, "\n--- UNSTARCH_printRevision() ---\n");
@@ -1200,27 +1202,28 @@ UNSTARCH_printRevision()
if (avStr != NULL) {
int result = sprintf(avStr, "%d.%d.%d", STARCH_MAJOR_VERSION, STARCH_MINOR_VERSION, STARCH_REVISION_VERSION);
if (result != -1)
- fprintf(stdout,
- "%s\n binary version: %s (extracts archive version: %s or older)\n",
- name,
- BEDOPS::revision(),
+ fprintf(stdout,
+ "%s\n binary version: %s (%s) (extracts archive version: %s or older)\n",
+ name,
+ BEDOPS::revision(),
+ application_type,
avStr);
free(avStr);
}
}
-void
-UNSTARCH_printArchiveVersion(const ArchiveVersion *av)
+void
+UNSTARCH_printArchiveVersion(const ArchiveVersion *av)
{
#ifdef DEBUG
fprintf(stderr, "\n--- UNSTARCH_printArchiveVersion() ---\n");
#endif
if (av)
- fprintf(stdout,
- "%s\n archive version: %d.%d.%d\n",
- name,
- av->major,
- av->minor,
+ fprintf(stdout,
+ "%s\n archive version: %d.%d.%d\n",
+ name,
+ av->major,
+ av->minor,
av->revision);
}
@@ -1231,8 +1234,8 @@ UNSTARCH_printArchiveTimestamp(const char *at)
fprintf(stderr, "\n--- UNSTARCH_printArchiveTimestamp() ---\n");
#endif
if (at)
- fprintf(stdout,
- "%s\n",
+ fprintf(stdout,
+ "%s\n",
at);
}
@@ -1243,23 +1246,23 @@ UNSTARCH_printNote(const char *note)
fprintf(stderr, "\n--- UNSTARCH_printNote() ---\n");
#endif
if (note)
- fprintf(stdout,
- "%s\n",
+ fprintf(stdout,
+ "%s\n",
note);
}
void
-UNSTARCH_printCompressionType(const CompressionType t)
+UNSTARCH_printCompressionType(const CompressionType t)
{
#ifdef DEBUG
fprintf(stderr, "\n--- UNSTARCH_printCompressionType() ---\n");
#endif
switch (t) {
case kBzip2:
- fprintf(stdout, "%s\n archive compression type: bzip2\n", name);
+ fprintf(stdout, "%s\n archive compression type: bzip2\n", name);
break;
case kGzip:
- fprintf(stdout, "%s\n archive compression type: gzip\n", name);
+ fprintf(stdout, "%s\n archive compression type: gzip\n", name);
break;
case kUndefined:
fprintf(stdout, "ERROR: compression type is undefined\n");
@@ -1282,14 +1285,14 @@ UNSTARCH_printMetadataSha1Signature(unsigned char *sha1Buffer)
#endif
#ifdef __cplusplus
- STARCH_encodeBase64(&jsonBase64String,
- static_cast<const size_t>( STARCH2_MD_FOOTER_BASE64_ENCODED_SHA1_LENGTH ),
- const_cast<const unsigned char *>( sha1Buffer ),
+ STARCH_encodeBase64(&jsonBase64String,
+ static_cast<const size_t>( STARCH2_MD_FOOTER_BASE64_ENCODED_SHA1_LENGTH ),
+ const_cast<const unsigned char *>( sha1Buffer ),
static_cast<const size_t>( sha1BufferLength ));
#else
- STARCH_encodeBase64(&jsonBase64String,
- (const size_t) STARCH2_MD_FOOTER_BASE64_ENCODED_SHA1_LENGTH,
- (const unsigned char *) sha1Buffer,
+ STARCH_encodeBase64(&jsonBase64String,
+ (const size_t) STARCH2_MD_FOOTER_BASE64_ENCODED_SHA1_LENGTH,
+ (const unsigned char *) sha1Buffer,
(const size_t) sha1BufferLength);
#endif
@@ -1298,7 +1301,8 @@ UNSTARCH_printMetadataSha1Signature(unsigned char *sha1Buffer)
exit(-1);
}
fprintf(stdout, "%s\n", jsonBase64String);
- free(jsonBase64String), jsonBase64String = NULL;
+ free(jsonBase64String);
+ jsonBase64String = NULL;
}
#ifdef __cplusplus
diff --git a/applications/bed/starch/src/unstarch.h b/applications/bed/starch/src/unstarch.h
index 24fac49..470771e 100644
--- a/applications/bed/starch/src/unstarch.h
+++ b/applications/bed/starch/src/unstarch.h
@@ -94,7 +94,6 @@ static const char *usage = "\n" \
" chr\"). If <chromosome> is specified but\n" \
" is not in the output list, nothing is\n" \
" returned.\n\n" \
-
" --note Show descriptive note, if available.\n\n" \
" --signature Display the Base64-encoded SHA-1 data\n" \
" integrity signature for specified\n" \
@@ -117,14 +116,24 @@ static const char *usage = "\n" \
" --version Show binary version.\n\n" \
" --help Show this usage message.\n";
+#if BEDOPS_BINARY_TYPE == 0
+static const char* application_type = "typical";
+#else
+#if BEDOPS_BINARY_TYPE == 1
+static const char* application_type = "megarow";
+#else
+static const char* application_type = "typical";
+#endif
+#endif
+
#ifdef __cplusplus
namespace starch {
#endif
-int UNSTARCH_parseCommandLineInputs(int argc,
- char **argv,
- char **chr,
- char **fn,
+int UNSTARCH_parseCommandLineInputs(int argc,
+ char **argv,
+ char **chr,
+ char **fn,
char **optn,
int *pval);
void UNSTARCH_printUsage(int t);
diff --git a/applications/other/switch-BEDOPS-binary-type b/applications/other/switch-BEDOPS-binary-type
new file mode 100755
index 0000000..e5b33ae
--- /dev/null
+++ b/applications/other/switch-BEDOPS-binary-type
@@ -0,0 +1,76 @@
+#!/bin/bash
+# author : sjn + apr
+# date : July.2017
+
+BINDIR=$(dirname $0)
+
+CMD="switch-BEDOPS-binary-type"
+
+help()
+{
+ echo "Switch the BEDOPS binary build from typical to megarow, or vice versa"
+ echo "Usage: ${CMD} [ --help ] [ --typical | --megarow ]" >&2
+ exit $1
+}
+
+TYPICAL=false
+MEGAROW=false
+EXTENSION="null"
+
+OPTSPEC=":tmh-:"
+while getopts "$OPTSPEC" OPTCHAR; do
+ case "${OPTCHAR}" in
+ -)
+ case "${OPTARG}" in
+ typical)
+ TYPICAL=true
+ EXTENSION="-typical"
+ ;;
+ megarow)
+ MEGAROW=true
+ EXTENSION="-megarow"
+ ;;
+ help)
+ help 0
+ ;;
+ *)
+ help 1
+ ;;
+ esac;;
+ t)
+ TYPICAL=true
+ EXTENSION="-typical"
+ ;;
+ m)
+ MEGAROW=true
+ EXTENSION="-megarow"
+ ;;
+ h)
+ help 0
+ ;;
+ *)
+ help 1
+ ;;
+ esac
+done
+
+if [[ $# -eq 0 ]]
+then
+ help 1
+fi
+
+# XOR
+if [[ ("${TYPICAL}" && !"${MEGAROW}") || (!"${TYPICAL}" && "${MEGAROW}") ]]
+then
+ VARNAME=$(find ${BINDIR}/ -maxdepth 1 -mindepth 1 -type f -name \*${EXTENSION})
+ for V in ${VARNAME}
+ do
+ BV=$(basename "$V")
+ NAME=`echo $BV | sed "s/${EXTENSION}//"`
+ ln -sf ${V} ${BINDIR}/${NAME}
+ done
+else
+ help 1
+fi
+
+exit 0
\ No newline at end of file
diff --git a/docs/conf.py b/docs/conf.py
index 5273a2a..dab9187 100644
--- a/docs/conf.py
+++ b/docs/conf.py
@@ -52,7 +52,7 @@ copyright = u'2011-2017, Shane Neph, Alex Reynolds'
# The short X.Y version.
version = '2.4'
# The full version, including alpha/beta/rc tags.
-release = '2.4.26'
+release = '2.4.28'
# The language for content autogenerated by Sphinx. Refer to documentation
# for a list of supported languages.
diff --git a/docs/content/installation.rst b/docs/content/installation.rst
index 7bea093..478773f 100644
--- a/docs/content/installation.rst
+++ b/docs/content/installation.rst
@@ -11,19 +11,14 @@ BEDOPS is available to users as :ref:`pre-built binaries <installation_via_packa
Via pre-built packages
======================
-Pre-built binaries offer the easiest and fastest installation option for users of BEDOPS. At this time, we offer binaries for 32- and 64-bit versions of Linux and OS X (Intel) platforms.
+Pre-built binaries offer the easiest and fastest installation option for users of BEDOPS. At this time, we offer binaries for 64-bit versions of Linux and OS X (Intel) platforms. 32-bit binaries can be built via source code by adjusting compile-time variables.
-----
Linux
-----
-1. Download the current 32- or 64-bit package for Linux from `Github BEDOPS Releases <https://github.com/bedops/bedops/releases>`_.
-2. Extract the package to a location of your choice.
- In the case of 32-bit Linux: ::
-
- $ tar jxvf bedops_linux_i386-vx.y.z.tar.bz2
-
- In the case of 64-bit Linux: ::
+1. Download the current 64-bit package for Linux from `Github BEDOPS Releases <https://github.com/bedops/bedops/releases>`_.
+2. Extract the package to a location of your choice. In the case of 64-bit Linux: ::
$ tar jxvf bedops_linux_x86_64-vx.y.z.tar.bz2
@@ -124,7 +119,7 @@ Compilation of BEDOPS on Linux requires GCC 4.8.2 (both ``gcc`` and ``g++`` and
$ cd bedops
$ make
-.. tip:: BEDOPS now supports parallel builds. If you are compiling on a multicore or multiprocessor workstation, use ``make -j N`` where ``N`` is ``2``, ``4`` or however many cores or processors you have, in order to parallelize and speed up the build process.
+.. tip:: BEDOPS supports parallel builds, which speeds up compilation considerably. If you are compiling on a multicore or multiprocessor workstation, edit the ``JPARALLEL`` variable in the top-level Makefile, or override it, specifying the number of cores or processors you wish to use to compile.
5. Once the build is complete, install compiled binaries and scripts to a local ``bin`` folder:
@@ -146,9 +141,9 @@ Compilation of BEDOPS on Linux requires GCC 4.8.2 (both ``gcc`` and ``g++`` and
Mac OS X
--------
-In Mac OS X, you have two options to install BEDOPS via source code: Compile the code manually, or use the Homebrew package manager to manage installation of a prebuilt pacakge.
+In Mac OS X, you have a few options to install BEDOPS via source code: Compile the code manually, or use the Bioconda or Homebrew package manager to manage installation.
-Compilation of BEDOPS on Mac OS X via either procedure requires Clang/LLVM 3.5 or greater, which includes support for `C++11 <http://en.wikipedia.org/wiki/C%2B%2B11>`_ features required by core BEDOPS tools. Other tools may be required as described in the installation documentation that follows. GNU GCC is no longer required for compilation on OS X hosts.
+Compilation of BEDOPS on Mac OS X requires Clang/LLVM 3.5 or greater, which includes support for `C++11 <http://en.wikipedia.org/wiki/C%2B%2B11>`_ features required by core BEDOPS tools. Other tools may be required as described in the installation documentation that follows. GNU GCC is no longer required for compilation on OS X hosts.
^^^^^^^^^^^^^^^^^^
Manual compilation
@@ -159,10 +154,10 @@ Manual compilation
::
$ clang -v
- Apple LLVM version 6.0 (clang-600.0.56) (based on LLVM 3.5svn)
+ Apple LLVM version 8.0.0 (clang-800.0.42.1)
...
- For Mac OS X users, we recommend installing `Apple Xcode <https://developer.apple.com/xcode/>`_ and its Command Line Tools, via the ``Preferences > Downloads`` option within Xcode. At the time of this writing, Xcode 6.1.1 includes the necessary command-line tools to compile BEDOPS.
+ For Mac OS X users, we recommend installing `Apple Xcode <https://developer.apple.com/xcode/>`_ and its Command Line Tools, via the ``Preferences > Downloads`` option within Xcode. At the time of this writing, Xcode 8.2.1 (8C1002) includes the necessary command-line tools to compile BEDOPS.
2. Install a ``git`` client of your choice, if you do not already have one installed. Github offers an `installation guide <https://help.github.com/articles/set-up-git#platform-all>`_.
@@ -179,7 +174,7 @@ Manual compilation
$ cd bedops
$ make
-.. tip:: BEDOPS now supports parallel builds. If you are compiling on a multicore or multiprocessor workstation, use ``make -j N`` where ``N`` is ``2``, ``4`` or however many cores or processors you have, in order to parallelize and speed up the build process.
+.. tip:: BEDOPS supports parallel builds, which speeds up compilation considerably. If you are compiling on a multicore or multiprocessor workstation, edit the ``JPARALLEL`` variable in the top-level Makefile, or override it, specifying the number of cores or processors you wish to use to compile.
5. Once the build is complete, install compiled binaries and scripts to a local ``bin`` folder:
@@ -196,6 +191,33 @@ Manual compilation
Change this destination folder, as needed.
^^^^^^^^^^^^^^^^^^^^^^^^^
+Installation via Bioconda
+^^^^^^^^^^^^^^^^^^^^^^^^^
+
+Bioconda is a bioinformatics resource that extends the Conda package manager with scientific software packages, including BEDOPS. We aim to keep the recipe concurrent with the present release; occasionally, it may be a minor version behind.
+
+What follows are steps taken from the `Bioconda installation page <https://bioconda.github.io/>`_. Use this guide for the most current set of instructions, which we briefly cover here:
+
+1. Follow the instructions on `Conda's website <http://conda.pydata.org/miniconda.html>`_ to install the Miniconda package, which installs the ``conda`` command-line tool.
+
+2. If you have not already done so, add the Conda channels that Bioconda depends upon:
+
+ ::
+
+ $ (conda config --add channels r)
+ $ conda config --add channels defaults
+ $ conda config --add channels conda-forge
+ $ conda config --add channels bioconda
+
+3. Install the BEDOPS package:
+
+ ::
+
+ $ conda install bedops
+
+`Other recipes <https://bioconda.github.io/recipes.html#recipes>`_ are available for installation, as well.
+
+^^^^^^^^^^^^^^^^^^^^^^^^^
Installation via Homebrew
^^^^^^^^^^^^^^^^^^^^^^^^^
@@ -206,10 +228,10 @@ Homebrew is a popular package management toolkit for Mac OS X. It facilitates ea
::
$ clang -v
- Apple LLVM version 6.0 (clang-600.0.56) (based on LLVM 3.5svn)
+ Apple LLVM version 8.0.0 (clang-800.0.42.1)
...
- For Mac OS X users, we recommend installing `Apple Xcode <https://developer.apple.com/xcode/>`_ and its Command Line Tools, via the ``Preferences > Downloads`` option within Xcode. At the time of this writing, Xcode 6.1.1 includes the necessary command-line tools to compile BEDOPS.
+ For Mac OS X users, we recommend installing `Apple Xcode <https://developer.apple.com/xcode/>`_ and its Command Line Tools, via the ``Preferences > Downloads`` option within Xcode. At the time of this writing, Xcode 8.2.1 (8C1002) includes the necessary command-line tools to compile BEDOPS.
2. Follow the instructions listed on the `Homebrew site <http://brew.sh>`_ to install the basic package manager components.
@@ -370,7 +392,7 @@ Building an OS X installer package for redistribution
$ productsign --timestamp --sign "Developer ID Installer: Foo B. Baz" /tmp/BEDOPS.X.Y.Z.unsigned.pkg /tmp/BEDOPS.X.Y.Z.signed.pkg
-9. Compress the signed ``pkg`` file and publish via GitHub releases (see :ref:`release preparation <release>` for information about publishing the installer).
+9. Compress the signed ``pkg`` file (via OS X zip, for instance) and publish via GitHub releases (see :ref:`release preparation <release>` for information about publishing the installer).
.. |--| unicode:: U+2013 .. en dash
.. |---| unicode:: U+2014 .. em dash, trimming surrounding whitespace
diff --git a/docs/content/reference/file-management/compression.rst b/docs/content/reference/file-management/compression.rst
index 1519e13..07fd68b 100644
--- a/docs/content/reference/file-management/compression.rst
+++ b/docs/content/reference/file-management/compression.rst
@@ -9,4 +9,4 @@ Compression
compression/starchsplit
compression/starch-specification
compression/starch-diff
-
\ No newline at end of file
+
diff --git a/docs/content/reference/file-management/compression/starch-diff.rst b/docs/content/reference/file-management/compression/starch-diff.rst
index 03bba1f..fe2b4d7 100644
--- a/docs/content/reference/file-management/compression/starch-diff.rst
+++ b/docs/content/reference/file-management/compression/starch-diff.rst
@@ -39,7 +39,7 @@ Use the ``--help`` option to list all options:
starch-diff
citation: http://bioinformatics.oxfordjournals.org/content/28/14/1919.abstract
- version: 2.4.26
+ version: 2.4.28
authors: Alex Reynolds and Shane Neph
$ starch-diff [ --chr <chr> ] starch-file-1 starch-file-2 [ starch-file-3 ... ]
diff --git a/docs/content/reference/file-management/compression/starch.rst b/docs/content/reference/file-management/compression/starch.rst
index 6e1a6ab..860cf07 100644
--- a/docs/content/reference/file-management/compression/starch.rst
+++ b/docs/content/reference/file-management/compression/starch.rst
@@ -49,7 +49,7 @@ Use the ``--help`` option to list all options:
starch
citation: http://bioinformatics.oxfordjournals.org/content/28/14/1919.abstract
- binary version: 2.4.26 (creates archive version: 2.2.0)
+ binary version: 2.4.28 (creates archive version: 2.2.0)
authors: Alex Reynolds and Shane Neph
USAGE: starch [ --note="foo bar..." ]
diff --git a/docs/content/reference/file-management/compression/starchcat.rst b/docs/content/reference/file-management/compression/starchcat.rst
index bdfcb29..f3f6906 100644
--- a/docs/content/reference/file-management/compression/starchcat.rst
+++ b/docs/content/reference/file-management/compression/starchcat.rst
@@ -57,7 +57,7 @@ Use the ``--help`` option to list all options:
starchcat
citation: http://bioinformatics.oxfordjournals.org/content/28/14/1919.abstract
- version: 2.4.26
+ version: 2.4.28
authors: Alex Reynolds and Shane Neph
USAGE: starchcat [ --note="..." ]
diff --git a/docs/content/reference/file-management/compression/starchstrip.rst b/docs/content/reference/file-management/compression/starchstrip.rst
index 5113f98..0a134c2 100644
--- a/docs/content/reference/file-management/compression/starchstrip.rst
+++ b/docs/content/reference/file-management/compression/starchstrip.rst
@@ -39,7 +39,7 @@ Use the ``--help`` option to list all options:
starchstrip
citation: http://bioinformatics.oxfordjournals.org/content/28/14/1919.abstract
- version: 2.4.26
+ version: 2.4.28
authors: Alex Reynolds and Shane Neph
USAGE: starchstrip [ --include | --exclude ] <chromosome-list> <starch-file>
@@ -98,4 +98,4 @@ As a second example, we can instead use the ``--exclude`` operand to copy over a
.. |--| unicode:: U+2013 .. en dash
.. |---| unicode:: U+2014 .. em dash, trimming surrounding whitespace
- :trim:
\ No newline at end of file
+ :trim:
diff --git a/docs/content/reference/file-management/compression/unstarch.rst b/docs/content/reference/file-management/compression/unstarch.rst
index 294f359..d551328 100644
--- a/docs/content/reference/file-management/compression/unstarch.rst
+++ b/docs/content/reference/file-management/compression/unstarch.rst
@@ -43,7 +43,7 @@ Use the ``--help`` option to list all options:
unstarch
citation: http://bioinformatics.oxfordjournals.org/content/28/14/1919.abstract
- binary version: 2.4.26 (extracts archive version: 2.2.0 or older)
+ binary version: 2.4.28 (extracts archive version: 2.2.0 or older)
authors: Alex Reynolds and Shane Neph
USAGE: unstarch [ <chromosome> ] [ --elements |
diff --git a/docs/content/reference/file-management/conversion/gtf2bed.rst b/docs/content/reference/file-management/conversion/gtf2bed.rst
index f0c2bf1..51f7ad4 100644
--- a/docs/content/reference/file-management/conversion/gtf2bed.rst
+++ b/docs/content/reference/file-management/conversion/gtf2bed.rst
@@ -41,18 +41,18 @@ To demonstrate these scripts, we use a sample GTF input called ``foo.gtf`` (see
::
- chr20 protein_coding exon 9874841 9874841 . + . gene_id "ENSBTAG00000020601"; transcript_id "ENSBTAT0000002.4.26"; gene_name "ZNF366";
- chr20 protein_coding CDS 9873504 9874841 . + 0 gene_id "ENSBTAG00000020601"; transcript_id "ENSBTAT0000002.4.26"; gene_name "ZNF366";
- chr20 protein_coding exon 9877488 9877679 . + . gene_id "ENSBTAG00000020601"; transcript_id "ENSBTAT0000002.4.26";
+ chr20 protein_coding exon 9874841 9874841 . + . gene_id "ENSBTAG00000020601"; transcript_id "ENSBTAT0000002.4.28"; gene_name "ZNF366";
+ chr20 protein_coding CDS 9873504 9874841 . + 0 gene_id "ENSBTAG00000020601"; transcript_id "ENSBTAT0000002.4.28"; gene_name "ZNF366";
+ chr20 protein_coding exon 9877488 9877679 . + . gene_id "ENSBTAG00000020601"; transcript_id "ENSBTAT0000002.4.28";
We can convert it to sorted BED data in the following manner:
::
$ gtf2bed < foo.gtf
- chr20 9874840 9874841 ZNF366 . + protein_coding exon . gene_id "ENSBTAG00000020601"; transcript_id "ENSBTAT0000002.4.26"; gene_name "ZNF366"; zero_length_insertion "True";
- chr20 9873503 9874841 ZNF366 . + protein_coding CDS 0 gene_id "ENSBTAG00000020601"; transcript_id "ENSBTAT0000002.4.26"; gene_name "ZNF366";
- chr20 9877487 9877679 ENSBTAG00000020601 . + protein_coding exon . gene_id "ENSBTAG00000020601"; transcript_id "ENSBTAT0000002.4.26";
+ chr20 9874840 9874841 ZNF366 . + protein_coding exon . gene_id "ENSBTAG00000020601"; transcript_id "ENSBTAT0000002.4.28"; gene_name "ZNF366"; zero_length_insertion "True";
+ chr20 9873503 9874841 ZNF366 . + protein_coding CDS 0 gene_id "ENSBTAG00000020601"; transcript_id "ENSBTAT0000002.4.28"; gene_name "ZNF366";
+ chr20 9877487 9877679 ENSBTAG00000020601 . + protein_coding exon . gene_id "ENSBTAG00000020601"; transcript_id "ENSBTAT0000002.4.28";
.. tip:: After, say, performing set or statistical operations with :ref:`bedops`, :ref:`bedmap` etc., converting data back to GTF is accomplished through an ``awk`` statement that re-orders columns and shifts the coordinate index:
diff --git a/docs/content/reference/file-management/conversion/psl2bed.rst b/docs/content/reference/file-management/conversion/psl2bed.rst
index 0e4763d..4999bb5 100644
--- a/docs/content/reference/file-management/conversion/psl2bed.rst
+++ b/docs/content/reference/file-management/conversion/psl2bed.rst
@@ -57,7 +57,7 @@ To demonstrate these scripts, we use a sample PSL input called ``foo.psl`` (see
30 0 0 0 0 0 0 0 + foo 50 14 44 chr6 171115067 127685756 127685786 1 30, 14, 127685756,
30 0 0 0 0 0 0 0 + foo 50 14 44 chr6 171115067 93161871 93161901 1 30, 14, 93161871,
31 0 0 0 0 0 0 0 + foo 50 13 44 chr5 180915260 119897315 119897346 1 31, 13, 119897315,
- 30 0 0 0 0 0 0 0 + foo 50 14 44 chr5 180915260 1232.4.26 1232.4.265 1 30, 14, 1232.4.26,
+ 30 0 0 0 0 0 0 0 + foo 50 14 44 chr5 180915260 1232.4.28 1232.4.285 1 30, 14, 1232.4.28,
...
We can convert it to sorted BED data in the following manner:
diff --git a/docs/content/reference/file-management/conversion/vcf2bed.rst b/docs/content/reference/file-management/conversion/vcf2bed.rst
index 342f393..382c162 100644
--- a/docs/content/reference/file-management/conversion/vcf2bed.rst
+++ b/docs/content/reference/file-management/conversion/vcf2bed.rst
@@ -54,7 +54,7 @@ In addition, using any of these three custom options automatically results in pr
::
#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT NA00001 NA00002 NA00003
- 20 12.4.267 microsat1 GTC G,GTCT 50 PASS NS=3;DP=9;AA=G GT:GQ:DP 0/1:35:4 0/2:17:2 1/1:40:3
+ 20 12.4.287 microsat1 GTC G,GTCT 50 PASS NS=3;DP=9;AA=G GT:GQ:DP 0/1:35:4 0/2:17:2 1/1:40:3
When using ``--snvs``, ``--insertions`` or ``--deletions``, this record is split into two distinct BED records and filtered depending on which custom option was chosen. The ``--insertions`` option would only export the single-base position of the insertion in this mixed variant, while ``--deletions`` would show the deletion.
diff --git a/docs/content/reference/file-management/sorting/sort-bed.rst b/docs/content/reference/file-management/sorting/sort-bed.rst
index 2ae6be6..7dc3b4c 100644
--- a/docs/content/reference/file-management/sorting/sort-bed.rst
+++ b/docs/content/reference/file-management/sorting/sort-bed.rst
@@ -43,7 +43,7 @@ The ``--help`` option is fairly basic, but describes the usage:
sort-bed
citation: http://bioinformatics.oxfordjournals.org/content/28/14/1919.abstract
- version: 2.4.26
+ version: 2.4.28
authors: Scott Kuehn
USAGE: sort-bed [--help] [--version] [--check-sort] [--max-mem <val>] [--tmpdir <path>] <file1.bed> <file2.bed> <...>
diff --git a/docs/content/reference/set-operations/bedextract.rst b/docs/content/reference/set-operations/bedextract.rst
index 625c972..3736c93 100644
--- a/docs/content/reference/set-operations/bedextract.rst
+++ b/docs/content/reference/set-operations/bedextract.rst
@@ -60,7 +60,7 @@ The ``--help`` option describes the functionality available to the end user:
bedextract
citation: http://bioinformatics.oxfordjournals.org/content/28/14/1919.abstract
- version: 2.4.20
+ version: 2.4.27 (typical)
authors: Shane Neph & Alex Reynolds
Every input file must be sorted per sort-bed.
diff --git a/docs/content/reference/set-operations/bedops.rst b/docs/content/reference/set-operations/bedops.rst
index c1c3abd..1f5cea8 100644
--- a/docs/content/reference/set-operations/bedops.rst
+++ b/docs/content/reference/set-operations/bedops.rst
@@ -53,7 +53,7 @@ The ``--help`` option describes the set operation and other options available to
bedops
citation: http://bioinformatics.oxfordjournals.org/content/28/14/1919.abstract
- version: 2.4.26
+ version: 2.4.28
authors: Shane Neph & Scott Kuehn
USAGE: bedops [process-flags] <operation> <File(s)>*
diff --git a/docs/content/reference/set-operations/closest-features.rst b/docs/content/reference/set-operations/closest-features.rst
index 6ea27ef..ddf906c 100644
--- a/docs/content/reference/set-operations/closest-features.rst
+++ b/docs/content/reference/set-operations/closest-features.rst
@@ -45,7 +45,7 @@ The ``--help`` option describes the various operations and options available to
closest-features
citation: http://bioinformatics.oxfordjournals.org/content/28/14/1919.abstract
- version: 2.4.26
+ version: 2.4.28
authors: Shane Neph & Scott Kuehn
USAGE: closest-features [Process-Flags] <input-file> <query-file>
diff --git a/docs/content/reference/statistics/bedmap.rst b/docs/content/reference/statistics/bedmap.rst
index 7ea7fad..986d2a4 100644
--- a/docs/content/reference/statistics/bedmap.rst
+++ b/docs/content/reference/statistics/bedmap.rst
@@ -48,7 +48,7 @@ The ``--help`` option describes the various mapping and analytical operations an
bedmap
citation: http://bioinformatics.oxfordjournals.org/content/28/14/1919.abstract
- version: 2.4.26
+ version: 2.4.28
authors: Shane Neph & Scott Kuehn
USAGE: bedmap [process-flags] [overlap-option] <operation(s)...> <ref-file> [map-file]
@@ -72,6 +72,7 @@ The ``--help`` option describes the various mapping and analytical operations an
--bp-ovr, --range, --fraction-both, and --exact overlap options only.
--header Accept headers (VCF, GFF, SAM, BED, WIG) in any input file.
--help Print this message and exit successfully.
+ --min-memory Minimize memory usage (slower).
--multidelim <delim> Change delimiter of multi-value output columns from ';' to <delim>.
--prec <int> Change the post-decimal precision of scores to <int>. 0 <= <int>.
--sci Use scientific notation for score outputs.
@@ -420,9 +421,9 @@ As an example of using the ``--echo-map-id`` operator in a biological context, w
::
chr1 4534161 4534177 -V_GRE_C 4.20586e-06 - CGTACACACAGTTCTT
- chr1 4534192.4.264205 -V_STAT_Q6 2.21622e-06 - AGCACTTCTGGGA
+ chr1 4534192.4.284205 -V_STAT_Q6 2.21622e-06 - AGCACTTCTGGGA
chr1 4534209 4534223 +V_HNF4_Q6_01 6.93604e-06 + GGACCAGAGTCCAC
- chr1 4962522.4.262540 -V_GCNF_01 9.4497e-06 - CCCAAGGTCAAGATAAAG
+ chr1 4962522.4.282540 -V_GCNF_01 9.4497e-06 - CCCAAGGTCAAGATAAAG
chr1 4962529 4962539 +V_NUR77_Q5 8.43564e-06 + TTGACCTTGG
...
@@ -674,9 +675,9 @@ To demonstrate their use, we revisit the ``Motifs`` dataset, which includes *p*-
::
chr1 4534161 4534177 -V_GRE_C 4.20586e-06 - CGTACACACAGTTCTT
- chr1 4534192.4.264205 -V_STAT_Q6 2.21622e-06 - AGCACTTCTGGGA
+ chr1 4534192.4.284205 -V_STAT_Q6 2.21622e-06 - AGCACTTCTGGGA
chr1 4534209 4534223 +V_HNF4_Q6_01 6.93604e-06 + GGACCAGAGTCCAC
- chr1 4962522.4.262540 -V_GCNF_01 9.4497e-06 - CCCAAGGTCAAGATAAAG
+ chr1 4962522.4.282540 -V_GCNF_01 9.4497e-06 - CCCAAGGTCAAGATAAAG
chr1 4962529 4962539 +V_NUR77_Q5 8.43564e-06 + TTGACCTTGG
...
diff --git a/docs/content/release.rst b/docs/content/release.rst
index 812d498..93b7436 100644
--- a/docs/content/release.rst
+++ b/docs/content/release.rst
@@ -15,15 +15,15 @@ Preparing a major, minor or maintenance release of BEDOPS from a development bra
a. Close out open documentation or feature issues, making necessary pushes to the current development branch.
- b. If any issues can't be closed out, rename the assigned version tag to the next anticipated release version (*e.g.*, *v2.4.26* to *v2p5p0*, etc.)
+ b. If any issues can't be closed out, rename the assigned version tag to the next anticipated release version (*e.g.*, *v2.4.28* to *v2p5p0*, etc.)
2. Pull the most recent commit for the development branch to a local folder on build hosts (Linux with sufficiently old kernel, current OS X, etc.).
a. Follow the :ref:`Installation (via source code) <installation_via_source_code>` documentation to build BEDOPS for the given platform.
- 1) For Linux, we build two versions, one 64-bit and one 32-bit. It may help to use `VirtualBox <https://www.virtualbox.org>`_ or a similar virtualization host to set up and run different (and consistent) versions of Linux build hosts.
+ 1) For Linux, we build a 64-bit version. It may help to use `VirtualBox <https://www.virtualbox.org>`_ or a similar virtualization host to set up and run different (and consistent) versions of Linux build hosts.
- 2) For Mac OS X, we currently build the Mac target with whatever the modern Xcode and current OS X release happens to be (currently, command-line tools that ship with Xcode 7 and OS X El Capitan/10.11). If things work correctly, build flags generate "fat" binaries that should run on 10.7 and newer OS releases.
+ 2) For Mac OS X, we currently build the Mac target with whatever the modern Xcode and current OS X release happens to be (currently, command-line tools that ship with Xcode 8 and OS X Sierra/10.12). If things work correctly, build flags generate 64-bit binaries that should run on 10.10 and newer OS releases.
b. For all platforms, run test suites for various tools and conversion scripts; tests should pass on supported platforms. If not, add an Issue ticket, fix it, close it and start over with the build/test process.
@@ -34,9 +34,8 @@ Preparing a major, minor or maintenance release of BEDOPS from a development bra
::
bedops_linux_x86_64-vX.Y.Z.tar.bz2 (64-bit)
- bedops_linux_i386-vX.Y.Z.tar.bz2 (32-bit)
- Run ``shasum -a 256`` on each tarball to get its SHA256 hash (store this SHA256 hash in a file for later retrieval).
+ Run ``shasum -a 256`` on the tarball to get its SHA256 hash (store this SHA256 hash in a file for later retrieval).
For the OS X Installer, use ``productsign`` per :ref:`OS X Installer <installation_os_x_installer_construction>` documentation to digitally sign the package. Compress the Installer with the Finder or `zip`:
@@ -44,7 +43,7 @@ Preparing a major, minor or maintenance release of BEDOPS from a development bra
BEDOPS.X.Y.Z.pkg.zip
- The *X.Y.Z* scheme should follow the development branch name, *e.g.* 2.4.26, etc.
+ The *X.Y.Z* scheme should follow the development branch name, *e.g.* 2.4.28, etc.
3. Collect tarballs and zipped Installer in one location for later addition with web browser, via BEDOPS Github web site.
@@ -63,7 +62,7 @@ Release
Ideally, whatever steps are used to merge the development branch into the master branch should preserve the overall commit history.
- As before, the *X.Y.Z* scheme should follow the development branch name, *e.g.* 2.4.26, etc.
+ As before, the *X.Y.Z* scheme should follow the development branch name, *e.g.* 2.4.28, etc.
2. Add a `new release <https://github.com/bedops/bedops/releases/new>`_ via the Github site. Or click on the `Draft a new release <https://github.com/bedops/bedops/releases>`_ button from the Github Releases page.
@@ -85,8 +84,7 @@ Release
### Linux
**bedops_linux_x86_64-vX.Y.Z.tar.bz2** (64-bit, SHA256: ``abcd1234``)
- **bedops_linux_i386-vX.Y.Z.tar.bz2** (32-bit, SHA256: ``abcd1234``)
- This package of BEDOPS vX.Y.Z binaries is for Linux 64- and 32-bit hosts. Pick the installer that matches your host architecture. If your host can run 64-bit binaries, we recommend downloading the 64-bit package.
+ This package of BEDOPS vX.Y.Z binaries is for Linux 64-bit hosts. Those who require 32-bit binaries will need to build them from source code.
For installation instructions, please read [§2.1.1. Linux] (http://bedops.readthedocs.io/en/latest/content/installation.html#linux) of the BEDOPS Installation document.
@@ -94,11 +92,11 @@ Release
### Mac OS X
**BEDOPS.X.Y.Z.pkg.zip**
- This package of BEDOPS vX.Y.Z binaries is a digitally-signed installer for OS X (10.7 - 10.12) running on Intel-based Macs.
+ This package of BEDOPS vX.Y.Z is a digitally-signed installer for 64-bit binaries that run under OS X (10.10 - 10.12) on Intel-based Macs.
For installation instructions, please read [§2.1.2. Mac OS X] (http://bedops.readthedocs.io/en/latest/content/installation.html#mac-os-x) of the BEDOPS Installation document.
- d. Attach per-platform binaries to this release by dragging each of them into the field underneath the description text. It can take a few moments for the web browser to upload each binary into the release page, so be patient. There should be at least three binaries: two for Linux 64- and 32-bit, and one for (fat) Mac OS X.
+ d. Attach per-platform binaries to this release by dragging each of them into the field underneath the description text. It can take a few moments for the web browser to upload each binary into the release page, so be patient. There should be at least two binary packages: one for Linux 64-bit, and one for Mac OS X.
e. Click the *Publish Release* button.
diff --git a/docs/content/revision-history.rst b/docs/content/revision-history.rst
index 3d70388..ef7ff80 100644
--- a/docs/content/revision-history.rst
+++ b/docs/content/revision-history.rst
@@ -12,6 +12,122 @@ Current version
===============
-------
+v2.4.28
+-------
+
+Released: **August 18, 2017**
+
+* :ref:`bedmap <bedmap>`
+
+ * Patched `issue 191 <https://github.com/bedops/bedops/issues/191>`_ where :code:`--wmean` option was not recognized.
+
+* :ref:`bedextract <bedextract>`
+
+ * Updated documentation with fixed usage statement.
+
+* :ref:`sort-bed <sort-bed>`
+
+ * Patched typo in :code:`update-sort-bed-starch-slurm.py` script.
+
+ * Fixed bug with :code:`--max-mem` on properly ordering things on fourth and subsequent columns, when the genomic intervals are the same.
+
+* :ref:`starch <starch>`
+
+ * Updated Makefiles to remove `lib` on `clean` target and to help prevent :code:`ARCH` variable from getting clobbered by third-party package managers.
+
+* Build process
+
+ * Updated the OS X installer XML to resolve missing asset links.
+
+ * Updated the :code:`module_binaries` target to copy over :code:`starchcluster_*` and :code:`starch-diff` assets for :code:`modules` distributions.
+
+=================
+Previous versions
+=================
+
+-------
+v2.4.27
+-------
+
+Released: **July 17, 2017**
+
+This revision of BEDOPS includes significant performance improvements for core tools: :code:`bedops`, :code:`bedmap`, and :code:`closest-features`. Performance tests were done with whole-genome TRANSFAC FIMO scans, with cache purges in between trials.
+
+Pre-built binaries for Darwin and GNU/Linux targets include both the default :code:`typical` and :code:`megarow` builds of BEDOPS. The program names that you are accustomed to will remain as-is, but the binaries will exist as symbolic links pointing to the :code:`typical` builds. These links can be repointed to the :code:`megarow` builds by calling :code:`switch-BEDOPS-binary-type --megarow`, which will set the usual BEDOPS binaries to link to the :code:`megarow` builds. One can run :cod [...]
+
+The top-level Makefile includes some new variables for those who choose to build from source. The :code:`JPARALLEL` variable sets the number of CPUs to use in parallel when compiling BEDOPS, which can speed compilation time dramatically. The :code:`MASSIVE_REST_EXP`, :code:`MASSIVE_ID_EXP`, and :code:`MASSIVE_CHROM_EXP` are used when building the :code:`megarow` to support any required row lengths (build using :code:`make megarow`). These are the exponents (the *n* in 2:sup:n) for holdi [...]
+
+To simplify distribution and support, we have removed pre-built 32-bit program versions in this release. These can be built from source by specifying the correct :code:`ARCH` value in the top-level Makefile. For OS X, our package installer now requires OS X version 10.10 or greater.
+
+Application-level notes follow:
+
+* :ref:`bedops <bedops>`
+
+ * Performance of :code:`bedops` tool improved, doing typical work in **76.5%** of the time of all previous versions.
+
+ * Performance of :code:`-u`/:code:`--everything` has improved, doing the same work in only **55.6%** of the time of previous versions when given a large number of input files.
+
+ * The :code:`megarow` build of this application handles input files with very long rows (4M+ characters). Such input might arise from conversion of very-long-read BAM files to BED via :code:`bam2bed`, such as those that may come from Nanopore or PacBio MinION platforms. This build requires more runtime memory than the default (:code:`typical`) build. Pertinent variables for :code:`megarow` execution can be modified through the make system without changing source.
+
+* :ref:`bedmap <bedmap>`
+
+ * Performance of :code:`bedmap` tool improved, doing the same work in **86.7%** of the time of all previous versions.
+
+ * Automatically use :code:`--faster` option when :code:`--exact` is used as the overlap criterion, or if the input files are formatted as Starch archives, no fully-nested elements exist in the archives, and the overlap criterion supports :code:`--faster` (such as :code:`--bp-ovr`, :code:`--exact`, and :code:`--range`).
+
+ * The :code:`megarow` build target handles input files with very long rows (4M+ characters). Such input might arise from conversion of very-long-read BAM files to BED via :code:`bam2bed`, such as those that may come from Nanopore or PacBio MinION platforms. This build requires more runtime memory than the default (:code:`typical`) build. Pertinent variables for :code:`megarow` execution can be modified through the make system without changing source.
+
+ * New :code:`--min-memory` option for use when the reference file has very large regions, and the map file has many small regions that fall within those larger regions. One example is when :code:`--range 100000` is used and the map file consists of whole-genome motif scan hits. Memory overhead can be reduced to that used by all previous versions, up to and including v2.4.26.
+
+ * Added :code:`--faster` automatically when :code:`--exact` is used, which is robust even when nested elements exist in inputs. Similarly, :code:`--faster` is used automatically when inputs are Starch-formatted archives, none of which have nested elements (see :code:`unstarch --has-nested`) when the overlap criterion allows for :code:`--faster`.
+
+* :ref:`closest-features <closest-features>`
+
+ * Performance of :code:`closest-features` tool has been improved, doing the same work in **87.7%** of the time of all previous versions.
+
+ * The :code:`megarow` build target is available to compile a version of the program that can handle input files with very long rows (4M+ characters). This requires more runtime memory than the default build. Pertinent variables can be modified through the make system without editing source.
+
+* :ref:`convert2bed <convert2bed>`
+
+ Numerous internal changes, including giving line functors the ability to resize the destination (write) buffer in mid-stream, along with increased integration with BEDOPS-wide constants. Destination buffer resizing is particularly useful when converting very-long-read BAM files containing numerous D (deletion) operations, such as when used with the new :code:`--split-with-deletions` option.
+
+ * :ref:`psl2bed <psl2bed>`
+
+ * Migrated storage of PSL conversion state from stack to heap, which helps address segmentation faults on OS X (thanks to rmartson at Biostars for the bug report).
+
+ * :ref:`bam2bed <bam2bed>` and :ref:`sam2bed <sam2bed>`
+
+ * Increased thread I/O heap buffer size to reduce likelihood of overflows while parsing reads from Nanopore and PacBio platforms.
+
+ * Added :code:`--split-with-deletions` option to split spliced junctions by :code:`N` and :code:`D` CIGAR operations. The :code:`--split` option now splits only on :code:`N` operations.
+
+ * Added :code:`--reduced` option to print first six columns of BED data to standard output.
+
+ * :ref:`gff2bed <gff2bed>`
+
+ * Resolved issue parsing GFF input with :code:`##FASTA` directive.
+
+* :ref:`sort-bed <sort-bed>`
+
+ * The :code:`megarow` build target is available to compile a version of the program that can handle input files with very long rows (4M+ characters). This requires more runtime memory than the default build. The pertinent variables can be modified through the make system without changing source. This is useful for converting ultra-long reads from Nanopore and PacBio sequencing platforms to BED via :code:`bam2bed` / :code:`convert2bed`.
+
+* :ref:`starch <starch>`
+
+ * Fixed a potential segmentation fault result with :code:`--header` usage.
+
+* Starch C++ API
+
+ * Fixed output from :code:`bedops -u` (:code:`--everything`, or multiset union) on two or more Starch archives, where the remainder string was not being cleared correctly.
+
+* :ref:`starch-diff <starch_diff>`
+
+ * Improved usage statement to clarify output (cf. `Issue 180 <https://github.com/bedops/bedops/issues/180>`_).
+
+* Clang warnings
+
+ * Resolved compilation warnings for several binaries.
+
+-------
v2.4.26
-------
@@ -49,10 +165,6 @@ Released: **March 14, 2017**
* Resolved segmentation fault with certain inputs, in follow-up to `this BEDOPS Forum post <http://bedops.uwencode.org/forum/index.php?topic=136.0>`_. Thanks to zebasilio for the report and feedback.
-=================
-Previous versions
-=================
-
-------
v2.4.25
-------
diff --git a/docs/content/usage-examples/snps-within-dhses.rst b/docs/content/usage-examples/snps-within-dhses.rst
index ae741ac..4ffec47 100644
--- a/docs/content/usage-examples/snps-within-dhses.rst
+++ b/docs/content/usage-examples/snps-within-dhses.rst
@@ -30,7 +30,7 @@ The output of this :ref:`bedmap` statement might look something like this:
::
- chr1 10799576 10799577 rs12046278 Systolic_blood_pressure Cardiovascular|chr1 10799460 10799610 MCV-1 9.18063
+ chr1 10799576 10799577 rs12.4.288 Systolic_blood_pressure Cardiovascular|chr1 10799460 10799610 MCV-1 9.18063
The output is delimited by pipe symbols (``|``), showing the reference element (SNP) and the mapped element (DHS).
diff --git a/docs/index.rst b/docs/index.rst
index 151b8a8..8dcaa62 100644
--- a/docs/index.rst
+++ b/docs/index.rst
@@ -57,23 +57,22 @@ Contents
<div class="col_element">
<img src="_images/linux_v2.png" style="height:26px; width: auto !important; margin-bottom:10px;">
<ul style="list-style-type:square; font-size:smaller; margin-left:0; margin-right:0px; padding-right:0px; padding-left:20px;">
- <li><a href="https://github.com/bedops/bedops/releases/download/v2.4.26/bedops_linux_x86_64-v2.4.26.tar.bz2">x86-64 (64-bit)</a> binaries</li>
- <li><a href="https://github.com/bedops/bedops/releases/download/v2.4.26/bedops_linux_i386-v2.4.26.tar.bz2">i386 (32-bit)</a> binaries</li>
+ <li><a href="https://github.com/bedops/bedops/releases/download/v2.4.28/bedops_linux_x86_64-v2.4.28.tar.bz2">x86-64 (64-bit)</a> binaries</li>
<li><a href="content/installation.html#linux">Installation instructions</a> for Linux hosts</li>
</ul>
</div>
<div class="col_element">
<img src="_images/macosx_v2.png" style="height:26px; width: auto !important; margin-bottom:10px;">
<ul style="list-style-type:square; font-size:smaller; margin-left:0; margin-right:0px; padding-right:0px; padding-left:20px;">
- <li><a href="https://github.com/bedops/bedops/releases/download/v2.4.26/BEDOPS.2.4.26.pkg.zip">Intel (32-/64-bit, 10.7-10.12)</a> installer package</li>
+ <li><a href="https://github.com/bedops/bedops/releases/download/v2.4.28/BEDOPS.2.4.28.pkg.zip">Intel (64-bit, 10.10-10.12)</a> installer package</li>
<li><a href="content/installation.html#mac-os-x">Installation instructions</a> for Mac OS X hosts</li>
</ul>
</div>
<div class="col_element">
<img src="_images/source_v2.png" style="height:26px; width: auto !important; margin-bottom:10px;">
<ul style="list-style-type:square; font-size:smaller; margin-left:0; margin-right:0px; padding-right:0px; padding-left:20px;">
- <li><a href="https://github.com/bedops/bedops/archive/v2.4.26.tar.gz">Source code</a> (tar.gz)</li>
- <li><a href="https://github.com/bedops/bedops/archive/v2.4.26.zip">Source code</a> (zip)</li>
+ <li><a href="https://github.com/bedops/bedops/archive/v2.4.28.tar.gz">Source code</a> (tar.gz)</li>
+ <li><a href="https://github.com/bedops/bedops/archive/v2.4.28.zip">Source code</a> (zip)</li>
<li><a href="content/installation.html#installation-via-source-code">Compilation instructions</a></li>
</ul>
</div>
@@ -96,8 +95,7 @@ Contents
.. |linux_downloads| raw:: html
<ul style="list-style-type:square; font-size:smaller; margin:10px; padding:0;">
- <li><a href="https://github.com/bedops/bedops/releases/download/v2.4.26/bedops_linux_x86_64-v2.4.26.tar.bz2">x86-64 (64-bit)</a> binaries</li>
- <li><a href="https://github.com/bedops/bedops/releases/download/v2.4.26/bedops_linux_i386-v2.4.26.tar.bz2">i386 (32-bit)</a> binaries</li>
+ <li><a href="https://github.com/bedops/bedops/releases/download/v2.4.28/bedops_linux_x86_64-v2.4.28.tar.bz2">x86-64 (64-bit)</a> binaries</li>
<li><a href="content/installation.html#linux">Installation instructions</a> for Linux hosts</li>
</ul>
@@ -111,7 +109,7 @@ Contents
.. |macosx_downloads| raw:: html
<ul style="list-style-type:square; font-size:smaller; margin:10px; padding:0;">
- <li><a href="https://github.com/bedops/bedops/releases/download/v2.4.26/BEDOPS.2.4.26.pkg.zip">Intel (32-/64-bit, 10.7-10.10)</a> installer package</li>
+ <li><a href="https://github.com/bedops/bedops/releases/download/v2.4.28/BEDOPS.2.4.28.pkg.zip">Intel (64-bit, 10.10-10.12)</a> installer package</li>
<li><a href="content/installation.html#mac-os-x">Installation instructions</a> for Mac OS X hosts</li>
</ul>
@@ -125,8 +123,8 @@ Contents
.. |source_downloads| raw:: html
<ul style="list-style-type:square; font-size:smaller; margin:10px; padding:0;">
- <li><a href="https://github.com/bedops/bedops/archive/v2.4.26.tar.gz">Source code</a> (tar.gz)</li>
- <li><a href="https://github.com/bedops/bedops/archive/v2.4.26.zip">Source code</a> (zip)</li>
+ <li><a href="https://github.com/bedops/bedops/archive/v2.4.28.tar.gz">Source code</a> (tar.gz)</li>
+ <li><a href="https://github.com/bedops/bedops/archive/v2.4.28.zip">Source code</a> (zip)</li>
<li><a href="content/installation.html#installation-via-source-code">Compilation instructions</a></li>
</ul>
diff --git a/interfaces/general-headers/algorithm/bed/FindBedRange.hpp b/interfaces/general-headers/algorithm/bed/FindBedRange.hpp
index 3b9ea5c..3d84acb 100644
--- a/interfaces/general-headers/algorithm/bed/FindBedRange.hpp
+++ b/interfaces/general-headers/algorithm/bed/FindBedRange.hpp
@@ -33,11 +33,15 @@
#include "data/bed/BedDistances.hpp"
#include "data/bed/BedTypes.hpp"
#include "suite/BEDOPS.Constants.hpp"
+#include "utility/PooledMemory.hpp"
namespace Bed {
typedef Bed::SignedCoordType ByteOffset;
+ template <class BedType, std::size_t SZ>
+ class bed_check_iterator;
+
namespace extract_details {
template <typename BedType>
@@ -56,7 +60,17 @@ namespace Bed {
typedef Bed::B3Rest QueryBedType; // file 1
typedef QueryBedType TargetBedType; // file 2 -> must be same type as QueryBedType
- typedef std::map< QueryBedType, ByteOffset, CompBed<QueryBedType> > MType;
+ typedef std::map<QueryBedType, ByteOffset, CompBed<QueryBedType>> MType;
+
+ template <typename BedType, std::size_t Sz>
+ inline
+ void remove(Bed::bed_check_iterator<BedType*, Sz>& b, BedType* p)
+ { b.get_pool().release(p); }
+
+ template <typename Iter, typename BedType>
+ inline
+ void remove(Iter, BedType* b)
+ { delete b; }
} // namespace extract_details
@@ -67,8 +81,10 @@ namespace Bed {
template <typename TargetIter, typename Op>
std::pair<bool, ByteOffset> find_bed_range(FILE* qfile, TargetIter titer, TargetIter teof, Op op) {
- extract_details::TargetBedType reference;
- extract_details::QueryBedType last, current;
+ TargetIter orig = titer;
+ auto reference = new extract_details::TargetBedType;
+ auto last = new extract_details::QueryBedType;
+ auto current = new extract_details::QueryBedType;
Bed::Overlapping overlap, lessthan, greaterthan; // any overlap
ByteOffset prev_pos = 0, cur_pos = 0, start_pos = 0, end_pos = 0;
extract_details::MType bounds;
@@ -85,16 +101,16 @@ namespace Bed {
while ( titer != teof ) {
extract_details::TargetBedType* const refelement = *titer++;
if ( donequery ) { // read through and delete items in [titer,teof) for posterity
- delete refelement;
+ extract_details::remove(orig, refelement);
continue;
- } else if ( !first && (greaterthan(&last, refelement) > 0) ) { // last lower_bound is still applicable
- delete refelement;
+ } else if ( !first && (greaterthan(last, refelement) > 0) ) { // last lower_bound is still applicable
+ extract_details::remove(orig, refelement);
continue;
}
// only use reference where you need to compare to starting base. Otherwise, use refelement.
- reference = *refelement;
- reference.end(reference.start()+1);
+ *reference = *refelement;
+ reference->end(reference->start()+1);
start_pos = std::ftell(qfile);
while ( true ) {
@@ -137,21 +153,21 @@ namespace Bed {
// read in the line; incrementing to start of next QueryBedType element.
prev_pos = std::ftell(qfile);
- current.readline(qfile);
+ current->readline(qfile);
cur_pos = std::ftell(qfile);
- bounds.insert(std::make_pair(current, prev_pos));
+ bounds.insert(std::make_pair(*current, prev_pos));
// compare 'current' to starting base
- if ( lessthan(¤t, &reference) < 0 ) {
+ if ( lessthan(current, reference) < 0 ) {
count = (end_pos - cur_pos);
start_pos = cur_pos;
if ( 0 == count ) {
if ( end_pos != at_end ) {
prev_pos = cur_pos;
- current.readline(qfile);
+ current->readline(qfile);
cur_pos = std::ftell(qfile);
- bounds.insert(std::make_pair(current, prev_pos));
+ bounds.insert(std::make_pair(*current, prev_pos));
} else {
prev_pos = at_end;
}
@@ -166,24 +182,31 @@ namespace Bed {
// spit elements in range
if ( didWork ) {
- while ( prev_pos != at_end && extract_details::check_overlap(¤t, refelement) ) {
- op(¤t);
+ while ( prev_pos != at_end && extract_details::check_overlap(current, refelement) ) {
+ op(current);
prev_pos = std::ftell(qfile);
if ( prev_pos != at_end )
- current.readline(qfile);
+ current->readline(qfile);
} // while
}
if ( refelement )
- delete refelement;
+ extract_details::remove(orig, refelement);
std::fseek(qfile, prev_pos, SEEK_SET); // because start_pos = std::ftell(qfile); on next go-around
if ( prev_pos == at_end )
donequery = true;
- last = current;
+ *last = *current;
first = false;
} // while
+ if ( reference )
+ delete reference;
+ if ( last )
+ delete last;
+ if ( current )
+ delete current;
+
return std::make_pair(!first, prev_pos);
}
diff --git a/interfaces/general-headers/algorithm/visitors/Visitors.hpp b/interfaces/general-headers/algorithm/visitors/Visitors.hpp
index ab43927..7eeff32 100644
--- a/interfaces/general-headers/algorithm/visitors/Visitors.hpp
+++ b/interfaces/general-headers/algorithm/visitors/Visitors.hpp
@@ -31,8 +31,8 @@ namespace Visitors {
// Visitor that should be inherited when using sweep() algorithm.
template <typename Ref, typename Map = Ref>
struct Visitor {
- typedef const Ref RefType;
- typedef const Map MapType;
+ typedef Ref RefType;
+ typedef Map MapType;
// interface for sweep()
inline bool ManagesOwnMemory() const { return(false); }
diff --git a/interfaces/general-headers/algorithm/visitors/bed/BedBaseVisitor.hpp b/interfaces/general-headers/algorithm/visitors/bed/BedBaseVisitor.hpp
index 23b62b5..bfb8aa2 100644
--- a/interfaces/general-headers/algorithm/visitors/bed/BedBaseVisitor.hpp
+++ b/interfaces/general-headers/algorithm/visitors/bed/BedBaseVisitor.hpp
@@ -118,8 +118,8 @@ namespace Visitors {
template <typename BedDist, typename Ref, typename Map = Ref>
struct BedBaseVisitor {
typedef BedDist DistType;
- typedef const Ref RefType;
- typedef const Map MapType;
+ typedef Ref RefType;
+ typedef Map MapType;
protected:
// typedefs
@@ -133,8 +133,8 @@ namespace Visitors {
inline void OnStart(RefType* t) {
// Give derived class the new reference
- SetReference(t);
ref_ = t;
+ SetReference(t);
}
inline void OnAdd(MapType* u) {
@@ -198,7 +198,7 @@ namespace Visitors {
++winIter;
}
} // while
-
+
auto cacheIter = cache_.begin();
while ( cacheIter != cache_.end() ) {
if ( 0 == dist_.Map2Ref(*cacheIter, ref_) ) {
diff --git a/interfaces/general-headers/algorithm/visitors/helpers/ProcessBedVisitorRow.hpp b/interfaces/general-headers/algorithm/visitors/helpers/ProcessBedVisitorRow.hpp
index f73c628..93e784a 100644
--- a/interfaces/general-headers/algorithm/visitors/helpers/ProcessBedVisitorRow.hpp
+++ b/interfaces/general-headers/algorithm/visitors/helpers/ProcessBedVisitorRow.hpp
@@ -29,6 +29,7 @@
#include <type_traits>
#include "algorithm/visitors/helpers/ProcessVisitorRow.hpp"
+#include "data/bed/Bed.hpp"
#include "data/bed/BedCompare.hpp"
#include "data/measurement/NaN.hpp"
#include "utility/Formats.hpp"
@@ -204,13 +205,16 @@ namespace Visitors {
}
void operator()(const Signal::NaN& s) const {
- throw(std::string("Unable to process a 'NAN' with PrintAllScorePrecision."));
+ PrintTypes::Print("");
}
protected:
template <typename T>
typename std::enable_if<T::UseRest, void>::type printRest(T* t) const {
- PrintTypes::Print(t->rest()); // already includes '\t' out front
+ // PrintTypes::Print(t->rest()); // already includes '\t' out front
+ // t->full_rest() now includes t->id() and t->measurement(), exclude here
+ if ( t->full_rest()[0] != '\0' && t->rest_offset() >= 0 )
+ PrintTypes::Print(t->full_rest() + t->rest_offset());
}
template <typename T>
@@ -349,8 +353,21 @@ namespace Visitors {
void operator()(T* t) const {
static char const* id = "id-";
static unsigned long rowID = 0;
+ static unsigned long subRowID = 0;
+ static T last;
+ static Bed::GenomicRestCompare<T> grc;
+ if ( !grc(&last, t) && !grc(t, &last) ) { // equal
+ static constexpr unsigned long sz = 1000;
+ static char formatted[sz+1];
+ formatted[0] = '\0';
+ std::snprintf(formatted, sz, "%s%lu.%06lu", id, rowID, ++subRowID);
+ PrintTypes::Print(formatted);
+ return;
+ }
+ last = *t;
PrintTypes::Print(id);
PrintTypes::Print(++rowID);
+ subRowID = 0;
}
};
diff --git a/interfaces/general-headers/algorithm/visitors/numerical/ExtremeVisitor.hpp b/interfaces/general-headers/algorithm/visitors/numerical/ExtremeVisitor.hpp
index f9c0fdc..f84e9c3 100644
--- a/interfaces/general-headers/algorithm/visitors/numerical/ExtremeVisitor.hpp
+++ b/interfaces/general-headers/algorithm/visitors/numerical/ExtremeVisitor.hpp
@@ -114,7 +114,7 @@ namespace Visitors {
if ( !m_.empty() )
pt_.operator()(onTies.breakTie(m_));
else
- pt_.operator()(nan);
+ pt_.operator()(nan);
}
diff --git a/interfaces/general-headers/algorithm/visitors/other/MultiVisitor.hpp b/interfaces/general-headers/algorithm/visitors/other/MultiVisitor.hpp
index d32b68e..e3f5683 100644
--- a/interfaces/general-headers/algorithm/visitors/other/MultiVisitor.hpp
+++ b/interfaces/general-headers/algorithm/visitors/other/MultiVisitor.hpp
@@ -68,14 +68,14 @@ namespace Visitors {
pAll_(processAll), cnt_(0)
{ /* */ }
- void Add(MapType const* u) {
- void (BaseClass::*memberFuncPtr)(MapType const*) = &BaseClass::Add;
+ void Add(MapType* u) {
+ void (BaseClass::*memberFuncPtr)(MapType*) = &BaseClass::Add;
std::for_each(t_.begin(), t_.end(), std::bind2nd(std::mem_fun(memberFuncPtr), u));
++cnt_;
}
- void Delete(MapType const* u) {
- void (BaseClass::*memberFuncPtr)(MapType const*) = &BaseClass::Delete;
+ void Delete(MapType* u) {
+ void (BaseClass::*memberFuncPtr)(MapType*) = &BaseClass::Delete;
std::for_each(t_.begin(), t_.end(), std::bind2nd(std::mem_fun(memberFuncPtr), u));
--cnt_;
}
@@ -97,8 +97,8 @@ namespace Visitors {
pRows_.operator()();
}
- void SetReference(RefType const* t) {
- void (BaseClass::*memberFuncPtr)(RefType const*) = &BaseClass::SetReference;
+ void SetReference(RefType* t) {
+ void (BaseClass::*memberFuncPtr)(RefType*) = &BaseClass::SetReference;
std::for_each(t_.begin(), t_.end(), std::bind2nd(std::mem_fun(memberFuncPtr), t));
}
diff --git a/interfaces/general-headers/data/bed/AllocateIterator_BED_starch.hpp b/interfaces/general-headers/data/bed/AllocateIterator_BED_starch.hpp
index 8b87a53..dd0be33 100644
--- a/interfaces/general-headers/data/bed/AllocateIterator_BED_starch.hpp
+++ b/interfaces/general-headers/data/bed/AllocateIterator_BED_starch.hpp
@@ -21,8 +21,8 @@
// 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA.
//
-#ifndef SPECIAL_STARCH_ALLOCATE_NEW_ITERATOR_CHR_SPECIFIC_HPP
-#define SPECIAL_STARCH_ALLOCATE_NEW_ITERATOR_CHR_SPECIFIC_HPP
+#ifndef SPECIAL_STARCH_ALLOCATE_NEW_ITERATOR_CHR_SPECIFIC_POOL_HPP
+#define SPECIAL_STARCH_ALLOCATE_NEW_ITERATOR_CHR_SPECIFIC_POOL_HPP
#include <algorithm>
#include <cstddef>
@@ -30,37 +30,43 @@
#include <cstdlib>
#include <cstring>
#include <iterator>
+#include <type_traits>
#include <sys/stat.h>
+#include "utility/PooledMemory.hpp"
+
#include "algorithm/bed/FindBedRange.hpp"
#include "algorithm/visitors/helpers/ProcessVisitorRow.hpp"
#include "data/bed/Bed.hpp"
#include "data/starch/starchApi.hpp"
+#include "suite/BEDOPS.Constants.hpp"
#include "utility/FPWrap.hpp"
namespace Bed {
- template <class BedType>
+ template <class BedType, std::size_t SZ=Bed::CHUNKSZ>
class allocate_iterator_starch_bed;
-
- template <class BedType>
- class allocate_iterator_starch_bed<BedType*> {
-
+
+ template <class BedType, std::size_t SZ>
+ class allocate_iterator_starch_bed<BedType*, SZ> {
+
public:
typedef std::forward_iterator_tag iterator_category;
typedef BedType* value_type;
typedef std::ptrdiff_t difference_type;
typedef BedType** pointer;
typedef BedType*& reference;
-
- allocate_iterator_starch_bed() : fp_(NULL), _M_ok(false), _M_value(0), is_starch_(false), all_(false), archive_(NULL) { chr_[0] = '\0'; }
+
+ allocate_iterator_starch_bed() : fp_(NULL), _M_ok(false), _M_value(0), is_starch_(false),
+ all_(false), archive_(NULL), pool_(NULL) { chr_[0] = '\0'; }
template <typename ErrorType>
- allocate_iterator_starch_bed(Ext::FPWrap<ErrorType>& fp, const std::string& chr = "all") /* this ASSUMES fp is open and meaningful */
+ allocate_iterator_starch_bed(Ext::FPWrap<ErrorType>& fp, Ext::PooledMemory<BedType, SZ>& p,
+ const std::string& chr = "all") /* this ASSUMES fp is open and meaningful */
: fp_(fp), _M_ok(fp_ && !std::feof(fp_)), _M_value(0),
is_starch_(_M_ok && (fp_ != stdin) && starch::Starch::isStarch(fp_)),
- all_(0 == std::strcmp(chr.c_str(), "all")), archive_(NULL) {
+ all_(0 == std::strcmp(chr.c_str(), "all")), archive_(NULL), pool_(&p) {
chr_[0] = '\0';
std::size_t sz = std::min(chr.size(), static_cast<std::size_t>(Bed::MAXCHROMSIZE));
@@ -85,18 +91,18 @@ namespace Bed {
if ( (fp_ == stdin || is_namedpipe) && !all_ ) { // BED, chrom-specific, using stdin
// stream through until we find what we want
while ( (_M_ok = (fp_ && !std::feof(fp_))) ) {
- _M_value = new BedType(fp_);
+ _M_value = pool_->construct(fp_);
if ( 0 == std::strcmp(_M_value->chrom(), chr_) ) {
_M_ok = (fp_ && !std::feof(fp_));
break;
}
- delete _M_value;
+ pool_->release(_M_value);
} // while
if ( !_M_ok && fp_ )
fp_ = NULL;
return;
}
-
+
if ( is_starch_ ) { // starch archive can deal with all or specific chromosomes
const bool perLineUsage = true;
archive_ = new starch::Starch(fp_, chr_, perLineUsage);
@@ -120,7 +126,7 @@ namespace Bed {
if ( 0 == std::strcmp(bt->chrom(), chr_) ) {
delete bt;
std::rewind(fp_);
- _M_value = new BedType(fp_);
+ _M_value = pool_->construct(fp_);
_M_ok = (_M_ok && fp_ && !std::feof(fp_));
if ( !_M_ok && fp_ )
fp_ = NULL;
@@ -144,7 +150,7 @@ namespace Bed {
Bed::extract_details::QueryBedType q(fp_);
std::fseek(fp_, b, SEEK_SET);
if ( 0 == std::strcmp(q.chrom(), chr_) ) {
- _M_value = new BedType(fp_);
+ _M_value = pool_->construct(fp_);
_M_ok = (_M_ok && fp_ && !std::feof(fp_));
if ( !_M_ok && fp_ )
fp_ = NULL;
@@ -159,7 +165,7 @@ namespace Bed {
} // while
}
} else { // BED, process everything
- _M_value = new BedType(fp_);
+ _M_value = pool_->construct(fp_);
_M_ok = (_M_ok && fp_ && !std::feof(fp_));
if ( !_M_ok && fp_ )
fp_ = NULL;
@@ -172,7 +178,7 @@ namespace Bed {
allocate_iterator_starch_bed& operator++() {
if ( _M_ok ) {
if ( !is_starch_ ) {
- _M_value = new BedType(fp_);
+ _M_value = pool_->construct(fp_);
_M_ok = !std::feof(fp_) && (all_ || 0 == std::strcmp(_M_value->chrom(), chr_));
// very small leak in event that !all_ and _M_value->chrom() is not chr_
// too expensive to check
@@ -187,10 +193,10 @@ namespace Bed {
}
allocate_iterator_starch_bed operator++(int) {
- allocate_iterator_starch_bed __tmp = *this;
+ auto __tmp = *this;
if ( _M_ok ) {
if ( !is_starch_ ) {
- _M_value = new BedType(fp_);
+ _M_value = pool_->construct(fp_);
_M_ok = !std::feof(fp_) && (all_ || 0 == std::strcmp(_M_value->chrom(), chr_));
// very small leak in event that !all_ and _M_value->chrom() is not chr_
// too expensive to check
@@ -210,13 +216,21 @@ namespace Bed {
(!_M_ok || fp_ == __x.fp_)
);
}
-
+
+ bool has_nested() const { /* only known for Starch archives */
+ if ( is_starch_ )
+ return archive_->getAllChromosomesHaveNestedElement();
+ return true; // assumption for BED
+ }
+
+ Ext::PooledMemory<BedType, SZ>& get_pool() { return *pool_; }
+
private:
inline BedType* get_starch() {
static std::string line;
if ( archive_ == NULL || !archive_->extractBEDLine(line) )
return(0);
- return(new BedType(line.c_str()));
+ return(pool_->construct(line.c_str()));
}
private:
@@ -227,22 +241,23 @@ namespace Bed {
bool is_starch_;
const bool all_;
starch::Starch* archive_;
+ Ext::PooledMemory<BedType, SZ>* pool_;
};
- template <class BedType>
+ template <class BedType, std::size_t sz>
inline bool
- operator==(const allocate_iterator_starch_bed<BedType>& __x,
- const allocate_iterator_starch_bed<BedType>& __y) {
+ operator==(const allocate_iterator_starch_bed<BedType, sz>& __x,
+ const allocate_iterator_starch_bed<BedType, sz>& __y) {
return __x._M_equal(__y);
}
- template <class BedType>
+ template <class BedType, std::size_t sz>
inline bool
- operator!=(const allocate_iterator_starch_bed<BedType>& __x,
- const allocate_iterator_starch_bed<BedType>& __y) {
+ operator!=(const allocate_iterator_starch_bed<BedType, sz>& __x,
+ const allocate_iterator_starch_bed<BedType, sz>& __y) {
return !__x._M_equal(__y);
}
} // namespace Bed
-#endif // SPECIAL_STARCH_ALLOCATE_NEW_ITERATOR_CHR_SPECIFIC_HPP
+#endif // SPECIAL_STARCH_ALLOCATE_NEW_ITERATOR_CHR_SPECIFIC_POOL_HPP
diff --git a/interfaces/general-headers/data/bed/AllocateIterator_BED_starch.hpp b/interfaces/general-headers/data/bed/AllocateIterator_BED_starch_minmem.hpp
similarity index 85%
copy from interfaces/general-headers/data/bed/AllocateIterator_BED_starch.hpp
copy to interfaces/general-headers/data/bed/AllocateIterator_BED_starch_minmem.hpp
index 8b87a53..d1d781d 100644
--- a/interfaces/general-headers/data/bed/AllocateIterator_BED_starch.hpp
+++ b/interfaces/general-headers/data/bed/AllocateIterator_BED_starch_minmem.hpp
@@ -21,8 +21,8 @@
// 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA.
//
-#ifndef SPECIAL_STARCH_ALLOCATE_NEW_ITERATOR_CHR_SPECIFIC_HPP
-#define SPECIAL_STARCH_ALLOCATE_NEW_ITERATOR_CHR_SPECIFIC_HPP
+#ifndef SPECIAL_STARCH_ALLOCATE_NEW_ITERATOR_CHR_SPECIFIC_MINMEM_HPP
+#define SPECIAL_STARCH_ALLOCATE_NEW_ITERATOR_CHR_SPECIFIC_MINMEM_HPP
#include <algorithm>
#include <cstddef>
@@ -35,18 +35,18 @@
#include "algorithm/bed/FindBedRange.hpp"
#include "algorithm/visitors/helpers/ProcessVisitorRow.hpp"
-#include "data/bed/Bed.hpp"
+#include "data/bed/Bed_minmem.hpp"
#include "data/starch/starchApi.hpp"
#include "utility/FPWrap.hpp"
namespace Bed {
template <class BedType>
- class allocate_iterator_starch_bed;
-
+ class allocate_iterator_starch_bed_mm;
+
template <class BedType>
- class allocate_iterator_starch_bed<BedType*> {
-
+ class allocate_iterator_starch_bed_mm<BedType*> {
+
public:
typedef std::forward_iterator_tag iterator_category;
typedef BedType* value_type;
@@ -54,10 +54,10 @@ namespace Bed {
typedef BedType** pointer;
typedef BedType*& reference;
- allocate_iterator_starch_bed() : fp_(NULL), _M_ok(false), _M_value(0), is_starch_(false), all_(false), archive_(NULL) { chr_[0] = '\0'; }
+ allocate_iterator_starch_bed_mm() : fp_(NULL), _M_ok(false), _M_value(0), is_starch_(false), all_(false), archive_(NULL) { chr_[0] = '\0'; }
template <typename ErrorType>
- allocate_iterator_starch_bed(Ext::FPWrap<ErrorType>& fp, const std::string& chr = "all") /* this ASSUMES fp is open and meaningful */
+ allocate_iterator_starch_bed_mm(Ext::FPWrap<ErrorType>& fp, const std::string& chr = "all") /* this ASSUMES fp is open and meaningful */
: fp_(fp), _M_ok(fp_ && !std::feof(fp_)), _M_value(0),
is_starch_(_M_ok && (fp_ != stdin) && starch::Starch::isStarch(fp_)),
all_(0 == std::strcmp(chr.c_str(), "all")), archive_(NULL) {
@@ -169,7 +169,7 @@ namespace Bed {
reference operator*() { return _M_value; }
pointer operator->() { return &(operator*()); }
- allocate_iterator_starch_bed& operator++() {
+ allocate_iterator_starch_bed_mm& operator++() {
if ( _M_ok ) {
if ( !is_starch_ ) {
_M_value = new BedType(fp_);
@@ -186,8 +186,8 @@ namespace Bed {
return *this;
}
- allocate_iterator_starch_bed operator++(int) {
- allocate_iterator_starch_bed __tmp = *this;
+ allocate_iterator_starch_bed_mm operator++(int) {
+ allocate_iterator_starch_bed_mm __tmp = *this;
if ( _M_ok ) {
if ( !is_starch_ ) {
_M_value = new BedType(fp_);
@@ -204,12 +204,18 @@ namespace Bed {
return __tmp;
}
- bool _M_equal(const allocate_iterator_starch_bed& __x) const {
+ bool _M_equal(const allocate_iterator_starch_bed_mm& __x) const {
return (
(_M_ok == __x._M_ok) &&
(!_M_ok || fp_ == __x.fp_)
);
}
+
+ bool has_nested() const { /* only known for Starch archives */
+ if ( is_starch_ )
+ return archive_->getAllChromosomesHaveNestedElement();
+ return true; // assumption for BED
+ }
private:
inline BedType* get_starch() {
@@ -231,18 +237,18 @@ namespace Bed {
template <class BedType>
inline bool
- operator==(const allocate_iterator_starch_bed<BedType>& __x,
- const allocate_iterator_starch_bed<BedType>& __y) {
+ operator==(const allocate_iterator_starch_bed_mm<BedType>& __x,
+ const allocate_iterator_starch_bed_mm<BedType>& __y) {
return __x._M_equal(__y);
}
template <class BedType>
inline bool
- operator!=(const allocate_iterator_starch_bed<BedType>& __x,
- const allocate_iterator_starch_bed<BedType>& __y) {
+ operator!=(const allocate_iterator_starch_bed_mm<BedType>& __x,
+ const allocate_iterator_starch_bed_mm<BedType>& __y) {
return !__x._M_equal(__y);
}
} // namespace Bed
-#endif // SPECIAL_STARCH_ALLOCATE_NEW_ITERATOR_CHR_SPECIFIC_HPP
+#endif // SPECIAL_STARCH_ALLOCATE_NEW_ITERATOR_CHR_SPECIFIC_MINMEM_HPP
diff --git a/interfaces/general-headers/data/bed/Bed.hpp b/interfaces/general-headers/data/bed/Bed.hpp
index 809d204..8c83e9e 100644
--- a/interfaces/general-headers/data/bed/Bed.hpp
+++ b/interfaces/general-headers/data/bed/Bed.hpp
@@ -21,8 +21,8 @@
// 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA.
//
-#ifndef BED_HPP
-#define BED_HPP
+#ifndef BED_NONEW_HPP
+#define BED_NONEW_HPP
#include <cstddef>
#include <cstdio>
@@ -50,12 +50,9 @@
namespace Bed {
- // For Bed6<> items, but much easier to use if directly in Bed namespace
- enum Strand { PLUS = '+', MINUS = '-' };
-
- const CoordType MAXCHROMSIZE = TOKEN_CHR_MAX_LENGTH;
- const CoordType MAXIDSIZE = TOKEN_ID_MAX_LENGTH;
- const CoordType MAXRESTSIZE = TOKEN_REST_MAX_LENGTH;
+ constexpr CoordType MAXCHROMSIZE = TOKEN_CHR_MAX_LENGTH;
+ constexpr CoordType MAXIDSIZE = TOKEN_ID_MAX_LENGTH;
+ constexpr CoordType MAXRESTSIZE = TOKEN_REST_MAX_LENGTH;
/*****************************************/
@@ -63,48 +60,26 @@ namespace Bed {
/*****************************************/
// ChromInfo non-specialized declaration
- template <bool IsNonStatic>
+ template <bool isNonStatic>
struct ChromInfo {
+ static constexpr bool IsNonStatic = isNonStatic;
- ChromInfo() : chrom_(new char[1]) { chrom_[0] = '\0'; }
- ChromInfo(const ChromInfo& c)
- : chrom_(new char[(c.chrom_ != NULL) ? (std::strlen(c.chrom_) + 1) : 1])
- { *chrom_ = '\0'; if ( c.chrom_ != NULL ) std::strcpy(chrom_, c.chrom_); }
- explicit ChromInfo(char const* c)
- : chrom_(new char[(c != NULL) ? (std::strlen(c)+1) : 1])
- { *chrom_ = '\0'; if ( c != NULL ) std::strcpy(chrom_, c); }
+ ChromInfo() { chrom_[0] = '\0'; }
+ ChromInfo(const ChromInfo& c) { std::strcpy(chrom_, c.chrom_); }
+ explicit ChromInfo(char const* c) { std::strcpy(chrom_, c); }
// Properties
- char const* chrom() const { return chrom_; }
- void chrom(char const* chrom) {
- if ( chrom_ )
- delete [] chrom_;
- if ( chrom != NULL ) {
- chrom_ = new char[std::strlen(chrom) + 1];
- std::strcpy(chrom_, chrom);
- } else {
- chrom_ = new char[1];
- *chrom_ = '\0';
- }
- }
+ inline char const* chrom() const { return chrom_; }
+ inline void chrom(char const* chrom) { std::strcpy(chrom_, chrom); }
// Operators
ChromInfo& operator=(const ChromInfo& c) {
- if ( chrom_ )
- delete [] chrom_;
- chrom_ = new char[(c.chrom_ != NULL) ? (std::strlen(c.chrom_) + 1) : 1];
- *chrom_ = '\0'; if ( c.chrom_ != NULL ) std::strcpy(chrom_, c.chrom_);
+ std::strcpy(chrom_, c.chrom_);
return *this;
}
- ~ChromInfo() {
- if ( chrom_ )
- delete [] chrom_;
- chrom_ = NULL;
- }
-
protected:
- char* chrom_;
+ char chrom_[MAXCHROMSIZE+1];
};
@@ -151,8 +126,8 @@ namespace Bed {
{ this->readline(inS); }
// Properties
- CoordType length() const { return end_ - start_; }
- CoordType median() const { return start_ + ((end_ - start_) / 2); }
+ inline CoordType length() const { return end_ - start_; }
+ inline CoordType median() const { return start_ + ((end_ - start_) / 2); }
inline CoordType distance(const BasicCoords& a) const {
if ( 0 == std::strcmp(chrom_, a.chrom_) )
return start_ - a.start_;
@@ -163,10 +138,10 @@ namespace Bed {
return end_ - a.start_;
return std::numeric_limits<CoordType>::max();
}
- void start(CoordType start) { start_ = start; }
- CoordType start() const { return start_; }
- void end(CoordType end) { end_ = end; }
- CoordType end() const { return end_; }
+ inline void start(CoordType start) { start_ = start; }
+ inline CoordType start() const { return start_; }
+ inline void end(CoordType end) { end_ = end; }
+ inline CoordType end() const { return end_; }
// Comparison utilities
inline CoordType overlap(const BasicCoords& a) const {
@@ -230,27 +205,27 @@ namespace Bed {
static char const* format = heapFormat.c_str();
std::printf(format, chrom_, start_, end_);
}
+ inline std::string printstr() const {
+ static const std::string tab = "\t";
+ return std::string(chrom_) + tab + std::to_string(start_) + tab + std::to_string(end_);
+ }
inline int readline(const std::string& inputLine) {
- static char chrBuf[MAXCHROMSIZE + 1];
- chrBuf[0] = '\0';
static const std::string lclStatic = inFormatter();
static char const* format = lclStatic.c_str();
+ *chrom_ = '\0';
int numScan = std::sscanf(inputLine.c_str(),
- format, chrBuf,
+ format, chrom_,
&start_, &end_);
- this->chrom(chrBuf);
return numScan;
}
inline int readline(FILE* inputFile) {
- static char chrBuf[MAXCHROMSIZE + 1];
- chrBuf[0] = '\0';
static std::string lclstatic = inFormatter();
static char const* format = lclstatic.c_str();
+ *chrom_ = '\0';
int numScan = std::fscanf(inputFile,
- format, chrBuf,
+ format, chrom_,
&start_, &end_);
std::fgetc(inputFile); // chomp newline
- this->chrom(chrBuf);
return numScan;
}
@@ -278,37 +253,22 @@ namespace Bed {
struct BasicCoords
: public BasicCoords<IsNonStaticChrom, false> {
- BasicCoords() : BaseClass(), rest_(new char[1]) { *rest_ = '\0'; }
- BasicCoords(char const* chrom, CoordType start, CoordType end, char const* rest = NULL)
- : BaseClass(chrom, start, end), rest_(new char[(rest != NULL) ? (std::strlen(rest)+1) : 1]) {
- *rest_ = '\0';
- if ( rest && std::strcmp(rest, "") != 0 ) {
- if ( rest[0] != '\t' )
- rest_[0] = '\t';
- std::strcat(rest_, rest);
- }
- }
+ BasicCoords() : BaseClass() { fullrest_[0] = '\0'; }
BasicCoords(const BasicCoords& c)
- : BaseClass(c), rest_(new char[(c.rest_ != NULL) ? (std::strlen(c.rest_) + 1) : 1])
- { *rest_ = '\0'; if ( c.rest_ != NULL ) std::strcpy(rest_, c.rest_); }
- explicit BasicCoords(FILE* inF) : BaseClass(), rest_(0)
+ : BaseClass(c)
+ { std::strcpy(fullrest_, c.fullrest_); }
+ explicit BasicCoords(FILE* inF) : BaseClass()
{ this->readline(inF); }
- explicit BasicCoords(const std::string& inS) : BaseClass(), rest_(0)
+ explicit BasicCoords(const std::string& inS) : BaseClass()
{ this->readline(inS); }
// Properties
- char const* rest() const { return rest_; }
- char const* full_rest() const { return rest(); }
+ inline char const* full_rest() const { return fullrest_; }
// Operators
BasicCoords& operator=(const BasicCoords& c) {
BaseClass::operator=(c);
- if ( rest_ )
- delete [] rest_;
- rest_ = new char[(c.rest_ != NULL) ? (std::strlen(c.rest_) + 1) : 1];
- *rest_ = '\0';
- if ( c.rest_ != NULL )
- std::strcpy(rest_, c.rest_);
+ std::strcpy(fullrest_, c.fullrest_);
return *this;
}
@@ -316,54 +276,40 @@ namespace Bed {
inline void print() const {
static const std::string lclStatic = outFormatter();
static char const* format = lclStatic.c_str();
- std::printf(format, chrom_, start_, end_, rest_);
+ std::printf(format, chrom_, start_, end_, fullrest_);
}
inline void println() const {
static const std::string heapFormat = (outFormatter() + "\n");
static char const* format = heapFormat.c_str();
- std::printf(format, chrom_, start_, end_, rest_);
+ std::printf(format, chrom_, start_, end_, fullrest_);
+ }
+ inline std::string printstr() const {
+ static const std::string tab = "\t";
+ return std::string(chrom_) + tab + std::to_string(start_) + tab + std::to_string(end_)
+ + std::string(fullrest_); /* fullrest_ has a starting tab if applicable */
}
inline int readline(const std::string& inputLine) {
- static char chrBuf[MAXCHROMSIZE + 1];
- chrBuf[0] = '\0';
- static char restBuf[MAXRESTSIZE + 1];
- restBuf[0] = '\0';
static const std::string lclStatic = inFormatter();
static char const* format = lclStatic.c_str();
+ chrom_[0] = '\0';
+ fullrest_[0] = '\0';
int numScan = std::sscanf(inputLine.c_str(),
- format, chrBuf, &start_,
- &end_, restBuf);
- this->chrom(chrBuf);
- if ( rest_ )
- delete [] rest_;
- rest_ = new char[std::strlen(restBuf) + 1];
- std::strcpy(rest_, restBuf);
+ format, chrom_, &start_,
+ &end_, fullrest_);
return numScan;
}
inline int readline(FILE* inputFile) {
- static char chrBuf[MAXCHROMSIZE + 1];
- chrBuf[0] = '\0';
- static char restBuf[MAXRESTSIZE + 1];
- restBuf[0] = '\0';
static const std::string lclStatic = inFormatter();
static char const* format = lclStatic.c_str();
+ chrom_[0] = '\0';
+ fullrest_[0] = '\0';
int numScan = std::fscanf(inputFile, format,
- chrBuf, &start_,
- &end_, restBuf);
+ chrom_, &start_,
+ &end_, fullrest_);
std::fgetc(inputFile); // chomp newline
- this->chrom(chrBuf);
- if ( rest_ )
- delete [] rest_;
- rest_ = new char[std::strlen(restBuf) + 1];
- std::strcpy(rest_, restBuf);
return numScan;
}
- ~BasicCoords() {
- if ( rest_ )
- delete [] rest_;
- }
-
static const bool UseRest = true;
protected:
@@ -371,7 +317,7 @@ namespace Bed {
using BaseClass::chrom_;
using BaseClass::start_;
using BaseClass::end_;
- char* rest_;
+ char fullrest_[MAXRESTSIZE + 1];
static std::string outFormatter() {
return(std::string("%s\t%" PRIu64 "\t%" PRIu64 "%s"));
@@ -381,7 +327,7 @@ namespace Bed {
return(std::string("%s\t%" SCNu64 "\t%" SCNu64 "%[^\n]s\n"));
}
};
-
+
/*****************************************/
/* Bed4 Classes */
@@ -396,52 +342,35 @@ namespace Bed {
struct Bed4<BasicCoords<IsNonStaticChrom, B3HasRest>, false>
: public BasicCoords<IsNonStaticChrom, false> {
- Bed4() : BaseClass(), id_(new char[1]) { *id_ = '\0'; }
+ Bed4() : BaseClass() { *id_ = '\0'; }
Bed4(char const* chrom, CoordType start, CoordType end, char const* id)
- : BaseClass(chrom, start, end), id_(new char[(id != NULL) ? (std::strlen(id)+1) : 1])
- { *id_ = '\0'; if ( id != NULL ) std::strcpy(id_, id); }
+ : BaseClass(chrom, start, end)
+ { *id_ = '\0'; if ( id != nullptr ) std::strcpy(id_, id); }
Bed4(const Bed4& c)
- : BaseClass(c), id_(new char[(c.id_ != NULL) ? (std::strlen(c.id_) + 1) : 1])
- { *id_ = '\0'; if ( c.id_ != NULL ) std::strcpy(id_, c.id_); }
- explicit Bed4(FILE* inF) : BaseClass(), id_(0)
+ : BaseClass(c)
+ { *id_ = '\0'; std::strcpy(id_, c.id_); }
+ explicit Bed4(FILE* inF) : BaseClass()
{ this->readline(inF); }
- explicit Bed4(const std::string& inS) : BaseClass(), id_(0)
+ explicit Bed4(const std::string& inS) : BaseClass()
{ this->readline(inS); }
// IO
inline int readline(const std::string& inputLine) {
- static char chrBuf[MAXCHROMSIZE + 1];
- chrBuf[0] = '\0';
- static char idBuf[MAXIDSIZE + 1];
- idBuf[0] = '\0';
-
static const std::string lclStatic = inFormatter();
static char const* format = lclStatic.c_str();
- int numScanned = std::sscanf(inputLine.c_str(), format,
- chrBuf,
- &start_,
- &end_,
- idBuf);
- this->chrom(chrBuf);
- this->id(idBuf);
- return numScanned;
+ *chrom_ = '\0';
+ *id_ = '\0';
+ return std::sscanf(inputLine.c_str(), format,
+ chrom_, &start_, &end_, id_);
}
inline int readline(FILE* inputFile) {
- static char chrBuf[MAXCHROMSIZE + 1];
- chrBuf[0] = '\0';
- static char idBuf[MAXIDSIZE + 1];
- idBuf[0] = '\0';
-
static const std::string lclStatic = inFormatter();
static char const* format = lclStatic.c_str();
+ *chrom_ = '\0';
+ *id_ = '\0';
int numScanned = std::fscanf(inputFile, format,
- chrBuf,
- &start_,
- &end_,
- idBuf);
+ chrom_, &start_, &end_, id_);
std::fgetc(inputFile); // read and discard newline
- this->chrom(chrBuf);
- this->id(idBuf);
return numScanned;
}
inline void print() const {
@@ -454,32 +383,24 @@ namespace Bed {
static char const* format = heapFormat.c_str();
printf(format, chrom_, start_, end_, id_);
}
+ inline std::string printstr() const {
- // Properties
- void id(char const* id) {
- if ( id_ )
- delete [] id_;
- id_ = new char[(id != NULL) ? (std::strlen(id) + 1) : 1];
- *id_ = '\0'; if ( id != NULL ) std::strcpy(id_, id);
+ static const std::string tab = "\t";
+ return std::string(chrom_) + tab + std::to_string(start_) + tab + std::to_string(end_) + tab
+ + std::string(id_);
}
- char const* id() const { return id_; }
+
+ // Properties
+ inline void id(char const* id) { *id_ = '\0'; if ( id != nullptr ) std::strcpy(id_, id); }
+ inline char const* id() const { return id_; }
// Operators
Bed4& operator=(const Bed4& c) {
BaseClass::operator=(c);
- if ( id_ )
- delete [] id_;
- id_ = new char[(c.id_ != NULL) ? (std::strlen(c.id_) + 1) : 1];
- *id_ = '\0'; if ( c.id_ != NULL ) std::strcpy(id_, c.id_);
+ std::strcpy(id_, c.id_);
return *this;
}
- ~Bed4() {
- if ( id_ )
- delete [] id_;
- id_ = NULL;
- }
-
static const int NumFields = 4;
static const bool UseRest = false;
@@ -489,7 +410,7 @@ namespace Bed {
using BaseClass::start_;
using BaseClass::end_;
- char* id_;
+ char id_[MAXIDSIZE+1];
static std::string outFormatter() {
return(BaseClass::outFormatter() + "\t%s");
@@ -505,127 +426,81 @@ namespace Bed {
struct Bed4
: public Bed4<BedType, false> {
- Bed4() : BaseClass(), rest_(new char[1]), fullrest_(new char[1]) { *rest_ = '\0'; *fullrest_ = '\0'; }
+ Bed4() : BaseClass() { *fullrest_ = '\0'; }
Bed4(const Bed4& c)
- : BaseClass(c), rest_(new char[(c.rest_ != NULL) ? (std::strlen(c.rest_)+1) : 1]),
- fullrest_(new char[(c.fullrest_ != NULL) ? (std::strlen(c.fullrest_)+1) : 1])
- { *rest_ = '\0'; *fullrest_ = '\0';
- if ( c.rest_ != NULL ) std::strcpy(rest_, c.rest_);
- if ( c.fullrest_ != NULL ) std::strcpy(fullrest_, c.fullrest_);
+ : BaseClass(c)
+ {
+ *fullrest_ = '\0';
+ std::strcpy(fullrest_, c.fullrest_);
}
- Bed4(char const* chrom, CoordType start, CoordType end, char const* id, char const* rest = NULL)
- : BaseClass(chrom, start, end, id), rest_(new char[(rest != NULL) ? (std::strlen(rest)+1) : 1]),
- fullrest_(new char[((rest != NULL) ? (std::strlen(rest)+1) : 1) + ((id != NULL) ? (std::strlen(id)+1) : 1)]) {
- *rest_ = '\0'; *fullrest_ = '\0';
- if ( id && std::strcmp(id, "") != 0 )
- std::strcpy(fullrest_, id);
-
- if ( rest && std::strcmp(rest, "") != 0 ) {
- if ( rest[0] != '\t' )
- rest_[0] = '\t';
- std::strcat(rest_, rest);
- std::strcat(fullrest_, rest_);
- }
- }
- explicit Bed4(FILE* inF) : BaseClass(), rest_(0), fullrest_(0)
+ explicit Bed4(FILE* inF) : BaseClass()
{ this->readline(inF); }
- explicit Bed4(const std::string& inS) : BaseClass(), rest_(0), fullrest_(0)
+ explicit Bed4(const std::string& inS) : BaseClass()
{ this->readline(inS); }
// Properties
- char const* rest() const { return rest_; }
- char const* full_rest() const { return fullrest_; }
+ inline char const* full_rest() const { return fullrest_; }
// IO
inline void print() const {
static const std::string lclStatic = outFormatter();
static char const* format = lclStatic.c_str();
- std::printf(format, chrom_, start_, end_, id_, rest_);
+ std::printf(format, chrom_, start_, end_, fullrest_);
}
inline void println() const {
static const std::string heapFormat = (outFormatter() + "\n");
static char const* format = heapFormat.c_str();
- std::printf(format, chrom_, start_, end_, id_, rest_);
+ std::printf(format, chrom_, start_, end_, fullrest_);
+ }
+ inline std::string printstr() const {
+ static const std::string tab = "\t";
+ return std::string(chrom_) + tab + std::to_string(start_) + tab + std::to_string(end_)
+ + std::string(fullrest_); // fullrest_ has whitespace out front if needed
}
inline int readline(const std::string& inputLine) {
- static char chrBuf[MAXCHROMSIZE + 1];
- chrBuf[0] = '\0';
- static char idBuf[MAXIDSIZE + 1];
- idBuf[0] = '\0';
- static char restBuf[MAXRESTSIZE + 1];
- restBuf[0] = '\0';
static const std::string lclStatic = inFormatter();
static char const* format = lclStatic.c_str();
+ static char other[MAXRESTSIZE+1];
+ other[0] = '\0';
+ chrom_[0] = '\0';
+ id_[0] = '\0';
+ fullrest_[0] = '\0';
int numScanned = std::sscanf(inputLine.c_str(),
- format, chrBuf,
- &start_, &end_, idBuf,
- restBuf);
- this->chrom(chrBuf);
- this->id(idBuf);
- if ( rest_ )
- delete [] rest_;
- rest_ = new char[std::strlen(restBuf) + 1];
- std::strcpy(rest_, restBuf);
- if ( fullrest_ )
- delete [] fullrest_;
- std::size_t sz = (std::strlen(restBuf)+1) + (std::strlen(idBuf) + 1);
- fullrest_ = new char[sz];
- std::strcpy(fullrest_, idBuf);
- std::strcat(fullrest_, restBuf);
+ format, chrom_,
+ &start_, &end_, id_,
+ other);
+ const int numWritten = std::snprintf(fullrest_, MAXRESTSIZE+1, "\t%s", id_);
+ if ( other[0] != '\0' && static_cast<CoordType>(numWritten) < MAXRESTSIZE )
+ std::snprintf(fullrest_ + numWritten, MAXRESTSIZE+1-numWritten, "%s", other);
return numScanned;
}
inline int readline(FILE* inputFile) {
- static char chrBuf[MAXCHROMSIZE + 1];
- chrBuf[0] = '\0';
- static char idBuf[MAXIDSIZE + 1];
- idBuf[0] = '\0';
- static char restBuf[MAXRESTSIZE + 1];
- restBuf[0] = '\0';
-
static const std::string lclStatic = inFormatter();
static char const* format = lclStatic.c_str();
+ static char other[MAXRESTSIZE+1];
+ other[0] = '\0';
+ chrom_[0] = '\0';
+ id_[0] = '\0';
+ fullrest_[0] = '\0';
int numScanned = std::fscanf(inputFile,
- format, chrBuf,
- &start_, &end_, idBuf,
- restBuf);
+ format, chrom_,
+ &start_, &end_, id_,
+ other);
std::fgetc(inputFile); // Read and discard trailing newline
- this->chrom(chrBuf);
- this->id(idBuf);
- if ( rest_ )
- delete [] rest_;
- rest_ = new char[std::strlen(restBuf) + 1];
- std::strcpy(rest_, restBuf);
- std::size_t sz = (std::strlen(restBuf)+1) + (std::strlen(idBuf) + 1);
- if ( fullrest_ )
- delete [] fullrest_;
- fullrest_ = new char[sz];
- std::strcpy(fullrest_, idBuf);
- std::strcat(fullrest_, restBuf);
+ const int numWritten = std::snprintf(fullrest_, MAXRESTSIZE+1, "\t%s", id_);
+ if ( other[0] != '\0' && static_cast<CoordType>(numWritten) < MAXRESTSIZE )
+ std::snprintf(fullrest_ + numWritten, MAXRESTSIZE+1-numWritten, "%s", other);
return numScanned;
}
// Operators
Bed4& operator=(const Bed4& c) {
BaseClass::operator=(c);
- if ( rest_ )
- delete [] rest_;
- if ( fullrest_ )
- delete [] fullrest_;
- rest_ = new char[(c.rest_ != NULL) ? (std::strlen(c.rest_) + 1) : 1];
- *rest_ = '\0'; if ( c.rest_ != NULL ) std::strcpy(rest_, c.rest_);
- fullrest_ = new char[(c.fullrest_ != NULL) ? (std::strlen(c.fullrest_) + 1) : 1];
- *fullrest_ = '\0'; if ( c.fullrest_ != NULL ) std::strcpy(fullrest_, c.fullrest_);
+ std::strcpy(fullrest_, c.fullrest_);
return *this;
}
- ~Bed4() {
- if ( rest_ )
- delete [] rest_;
- if ( fullrest_ )
- delete [] fullrest_;
- }
-
static const bool UseRest = true;
protected:
@@ -635,13 +510,13 @@ namespace Bed {
using BaseClass::end_;
using BaseClass::id_;
- char* rest_;
- char* fullrest_;
- static std::string outFormatter() {
- return(BaseClass::outFormatter() + "%s");
+ char fullrest_[MAXRESTSIZE + 1];
+
+ static std::string outFormatter() { /* BC::BC --> output 3 columns and fullrest_ */
+ return(BaseClass::BaseClass::outFormatter() + "%s");
}
- static std::string inFormatter() {
+ static std::string inFormatter() { /* BC --> include ID field */
return(BaseClass::outFormatter() + "%[^\n]s\n");
}
};
@@ -679,35 +554,25 @@ namespace Bed {
// IO
inline int readline(const std::string& inputLine) {
- static char chrBuf[MAXCHROMSIZE + 1];
- chrBuf[0] = '\0';
- static char idBuf[MAXIDSIZE + 1];
- idBuf[0] = '\0';
static const std::string lclStatic = inFormatter();
static char const* format = lclStatic.c_str();
- int numScanned = std::sscanf(inputLine.c_str(),
- format, chrBuf,
- &start_, &end_, idBuf,
- &measurement_);
- this->chrom(chrBuf);
- this->id(idBuf);
- return numScanned;
+ *chrom_ = '\0';
+ *id_ = '\0';
+ return std::sscanf(inputLine.c_str(),
+ format, chrom_,
+ &start_, &end_, id_,
+ &measurement_);
}
inline int readline(FILE* inputFile) {
- static char chrBuf[MAXCHROMSIZE + 1];
- chrBuf[0] = '\0';
- static char idBuf[MAXIDSIZE + 1];
- idBuf[0] = '\0';
static const std::string lclStatic = inFormatter();
static char const* format = lclStatic.c_str();
+ *chrom_ = '\0';
+ *id_ = '\0';
int numScanned = std::fscanf(inputFile,
- format, chrBuf,
- &start_, &end_, idBuf,
+ format, chrom_,
+ &start_, &end_, id_,
&measurement_);
-
std::fgetc(inputFile); // Read and discard trailing newline
- this->chrom(chrBuf);
- this->id(idBuf);
return numScanned;
}
inline void print() const {
@@ -720,6 +585,11 @@ namespace Bed {
static char const* format = heapFormat.c_str();
std::printf(format, chrom_, start_, end_, id_, measurement_);
}
+ inline std::string printstr() const {
+ static const std::string tab = "\t";
+ return std::string(chrom_) + tab + std::to_string(start_) + tab + std::to_string(end_) + tab
+ + std::string(id_) + tab + std::to_string(measurement_);
+ }
// Operators
Bed5& operator=(const Bed5& c) {
@@ -737,9 +607,11 @@ namespace Bed {
using BaseClass::id_;
MeasureType measurement_;
+ typedef typename std::remove_cv<MeasureType>::type MType;
+ static constexpr char const* MFormat = Formats::Format(MType());
+
static std::string outFormatter() {
- typedef typename std::remove_cv<MeasureType>::type MType;
- return(BaseClass::outFormatter() + "\t" + Formats::Format(MType()));
+ return(BaseClass::outFormatter() + "\t" + std::string(MFormat));
}
static std::string inFormatter() {
@@ -753,133 +625,89 @@ namespace Bed {
struct Bed5
: public Bed5<Bed4Type, MeasureType, false> { /* Bed4Type is forced to be Bed4<> specialization above */
- Bed5() : BaseClass(), rest_(new char[1]) { *rest_ = '\0'; }
- Bed5(const Bed5& c)
- : BaseClass(c), rest_(new char[(c.rest_ != NULL) ? (std::strlen(c.rest_+1)) : 1]),
- fullrest_(new char[(c.fullrest_ != NULL) ? (std::strlen(c.fullrest_+1)) : 1])
+ Bed5() : BaseClass() { *chrom_ = '\0'; *id_ = '\0'; *fullrest_ = '\0'; restOffset_ = -1; }
+ Bed5(const Bed5& c) : BaseClass(c), restOffset_(c.restOffset_)
{
- *rest_ = '\0'; if ( c.rest_ != NULL ) std::strcpy(rest_, c.rest_);
- *fullrest_ = '\0'; if ( c.fullrest_ != NULL ) std::strcpy(fullrest_, c.fullrest_);
+ *fullrest_ = '\0'; std::strcpy(fullrest_, c.fullrest_);
}
- Bed5(char const* chrom, CoordType start, CoordType end,
- char const* id, MeasureType measurement, char const* rest = NULL)
- : BaseClass(chrom, start, end, id, measurement),
- rest_(new char[(rest != NULL) ? (std::strlen(rest)+1) : 1]),
- fullrest_(new char[((rest != NULL) ? (std::strlen(rest)+1) : 1) + ((id != NULL) ? (std::strlen(id)+1) : 1)])
- {
- *rest_ = '\0'; *fullrest_ = '\0';
- if ( id && std::strcmp(id, "") != 0 )
- std::strcpy(fullrest_, id);
-
- if ( rest && 0 != std::strcmp(rest, "") ) {
- if ( rest[0] != '\t' )
- rest_[0] = '\t';
- std::strcat(rest_, rest);
- std::strcat(fullrest_, rest_);
- }
- }
- explicit Bed5(FILE* inF) : BaseClass(), rest_(0), fullrest_(0)
- { this->readline(inF); }
- explicit Bed5(const std::string& inS) : BaseClass(), rest_(0), fullrest_(0)
- { this->readline(inS); }
+ explicit Bed5(FILE* inF) : BaseClass()
+ { *fullrest_ = '\0'; this->readline(inF); }
+ explicit Bed5(const std::string& inS) : BaseClass()
+ { *fullrest_ = '\0'; this->readline(inS); }
// Properties
- char const* rest() const { return rest_; }
- char const* full_rest() const { return fullrest_; }
+ inline char const* full_rest() const { return fullrest_; }
+ inline int rest_offset() const { return restOffset_; }
// IO
inline void print() const {
static const std::string lclStatic = outFormatter();
static char const* format = lclStatic.c_str();
- std::printf(format, chrom_, start_, end_, id_, measurement_, rest_);
+ std::printf(format, chrom_, start_, end_, fullrest_);
}
inline void println() const {
static const std::string heapFormat = outFormatter() + "\n";
static char const* format = heapFormat.c_str();
- std::printf(format, chrom_, start_, end_, id_, measurement_, rest_);
+ std::printf(format, chrom_, start_, end_, fullrest_);
+ }
+ inline std::string printstr() const {
+ static const std::string tab = "\t";
+ return std::string(chrom_) + tab + std::to_string(start_) + tab + std::to_string(end_)
+ + std::string(fullrest_); // fullrest_ has whitespace out front if needed
}
inline int readline(const std::string& inputLine) {
- static char chrBuf[MAXCHROMSIZE + 1];
- chrBuf[0] = '\0';
- static char idBuf[MAXIDSIZE + 1];
- idBuf[0] = '\0';
- static char restBuf[MAXRESTSIZE + 1];
- restBuf[0] = '\0';
static const std::string lclStatic = inFormatter();
static char const* format = lclStatic.c_str();
- int numScanned = std::sscanf(inputLine.c_str(),
- format, chrBuf,
- &start_, &end_, idBuf,
- &measurement_, restBuf);
-
- this->chrom(chrBuf);
- this->id(idBuf);
- if ( rest_ )
- delete [] rest_;
- rest_ = new char[std::strlen(restBuf) + 1];
- std::strcpy(rest_, restBuf);
- if ( fullrest_ )
- delete [] fullrest_;
- std::size_t sz = (std::strlen(restBuf)+1) + (std::strlen(idBuf) + 1);
- fullrest_ = new char[sz];
- std::strcpy(fullrest_, idBuf);
- std::strcat(fullrest_, restBuf);
+ static char other[MAXRESTSIZE+1];
+ other[0] = '\0';
+ *chrom_ = '\0';
+ *id_ = '\0';
+ *fullrest_ = '\0';
+ restOffset_ = -1;
+ const int numScanned = std::sscanf(inputLine.c_str(),
+ format, chrom_,
+ &start_, &end_, id_,
+ &measurement_, other);
+
+ const int numWritten = std::snprintf(fullrest_, MAXRESTSIZE+1, (std::string("\t%s\t") + BaseClass::MFormat).c_str(), id_, measurement_);
+ if ( other[0] != '\0' && static_cast<CoordType>(numWritten) < MAXRESTSIZE ) {
+ restOffset_ = numWritten;
+ std::snprintf(fullrest_ + numWritten, MAXRESTSIZE+1-numWritten, "%s", other);
+ }
return numScanned;
}
inline int readline(FILE* inputFile) {
- static char chrBuf[MAXCHROMSIZE + 1];
- chrBuf[0] = '\0';
- static char idBuf[MAXIDSIZE + 1];
- idBuf[0] = '\0';
- static char restBuf[MAXRESTSIZE + 1];
- restBuf[0] = '\0';
-
static const std::string lclStatic = inFormatter();
static char const* format = lclStatic.c_str();
- int numScanned = std::fscanf(inputFile,
- format, chrBuf,
- &start_, &end_, idBuf,
- &measurement_, restBuf);
+ static char other[MAXRESTSIZE+1];
+ other[0] = '\0';
+ *chrom_ = '\0';
+ *id_ = '\0';
+ *fullrest_ = '\0';
+ restOffset_ = -1;
+ const int numScanned = std::fscanf(inputFile,
+ format, chrom_,
+ &start_, &end_, id_,
+ &measurement_, other);
std::fgetc(inputFile); // Read and discard trailing newline
- this->chrom(chrBuf);
- this->id(idBuf);
- if ( rest_ )
- delete [] rest_;
- rest_ = new char[std::strlen(restBuf) + 1];
- std::strcpy(rest_, restBuf);
-
- if ( fullrest_ )
- delete [] fullrest_;
- std::size_t sz = (std::strlen(restBuf)+1) + (std::strlen(idBuf) + 1);
- fullrest_ = new char[sz];
- std::strcpy(fullrest_, idBuf);
- std::strcat(fullrest_, restBuf);
+ static const char* f = (std::string("\t%s\t") + BaseClass::MFormat).c_str();
+ const int numWritten = std::snprintf(fullrest_, MAXRESTSIZE+1, f, id_, measurement_);
+ if ( other[0] != '\0' && static_cast<CoordType>(numWritten) < MAXRESTSIZE ) {
+ restOffset_ = numWritten;
+ std::snprintf(fullrest_ + numWritten, MAXRESTSIZE+1-numWritten, "%s", other);
+ }
return numScanned;
}
// Operators
Bed5& operator=(const Bed5& c) {
BaseClass::operator=(c);
- if ( rest_ )
- delete [] rest_;
- if ( fullrest_ )
- delete [] fullrest_;
- rest_ = new char[(c.rest_ != NULL) ? (std::strlen(c.rest_) + 1) : 1];
- *rest_ = '\0'; if ( c.rest_ != NULL ) std::strcpy(rest_, c.rest_);
- fullrest_ = new char[(c.fullrest_ != NULL) ? (std::strlen(c.fullrest_) + 1) : 1];
- *fullrest_ = '\0'; if ( c.fullrest_ != NULL ) std::strcpy(fullrest_, c.fullrest_);
+ std::strcpy(fullrest_, c.fullrest_);
return *this;
}
- ~Bed5() {
- if ( rest_ )
- delete [] rest_;
- if ( fullrest_ )
- delete [] fullrest_;
- }
-
// Parameters
static const bool UseRest = true;
@@ -891,11 +719,11 @@ namespace Bed {
using BaseClass::id_;
using BaseClass::measurement_;
- char* rest_;
- char* fullrest_;
+ int restOffset_; // marks spot after id_/measurement_ in fullrest_
+ char fullrest_[MAXRESTSIZE+1];
- static std::string outFormatter() {
- return(BaseClass::outFormatter() + "%s");
+ static std::string outFormatter() { /* BC::BC::BC --> output 3 columns and fullrest_ */
+ return BaseClass::BaseClass::BaseClass::outFormatter() + "%s";
}
static std::string inFormatter() {
@@ -905,4 +733,4 @@ namespace Bed {
} // namespace Bed
-#endif // BED_HPP
+#endif // BED_NONEW_HPP
diff --git a/interfaces/general-headers/data/bed/BedCheckIterator.hpp b/interfaces/general-headers/data/bed/BedCheckIterator.hpp
index c927ed9..ce4df62 100644
--- a/interfaces/general-headers/data/bed/BedCheckIterator.hpp
+++ b/interfaces/general-headers/data/bed/BedCheckIterator.hpp
@@ -21,8 +21,8 @@
// 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA.
//
-#ifndef SPECIAL_BED_ITERATOR_HEADERS_STARCH_CHR_SPECIFIC_HPP
-#define SPECIAL_BED_ITERATOR_HEADERS_STARCH_CHR_SPECIFIC_HPP
+#ifndef SPECIAL_BED_ITERATOR_HEADERS_STARCH_CHR_SPECIFIC_POOL_HPP
+#define SPECIAL_BED_ITERATOR_HEADERS_STARCH_CHR_SPECIFIC_POOL_HPP
#include <cctype>
#include <cstddef>
@@ -45,15 +45,16 @@
#include "suite/BEDOPS.Constants.hpp"
#include "utility/ByLine.hpp"
#include "utility/Exception.hpp"
+#include "utility/PooledMemory.hpp"
namespace Bed {
- template <class BedType>
+ template <class BedType, std::size_t SZ=Bed::CHUNKSZ>
class bed_check_iterator;
-
- template <class BedType>
- class bed_check_iterator<BedType*> {
-
+
+ template <class BedType, std::size_t SZ>
+ class bed_check_iterator<BedType*, SZ> {
+
public:
typedef Ext::UserError Exception;
typedef std::forward_iterator_tag iterator_category;
@@ -61,21 +62,22 @@ namespace Bed {
typedef std::ptrdiff_t difference_type;
typedef BedType** pointer;
typedef BedType*& reference;
-
+
static constexpr int nFields_ = BedType::NumFields;
static constexpr bool hasRest_ = BedType::UseRest;
-
+
bed_check_iterator() : fp_(std::cin), _M_ok(false), _M_value(0), fn_(""), cnt_(0),
lastChr_(""), lastRest_(""), lastStart_(1), lastEnd_(0), nestCheck_(false),
- maxEnd_(0), chr_(""), isStarch_(false), all_(true), archive_(0)
+ maxEnd_(0), chr_(""), isStarch_(false), all_(true), archive_(0), pool_(0)
{ /* */ }
- bed_check_iterator(std::istream& is, const std::string& filename, const std::string& chr = "all", bool nestCheck = false)
+ bed_check_iterator(std::istream& is, const std::string& filename, Ext::PooledMemory<BedType, SZ>& p,
+ const std::string& chr = "all", bool nestCheck = false)
: fp_(is), _M_ok(fp_), _M_value(0), fn_(filename), cnt_(0), lastChr_(""), lastRest_(""), lastStart_(1),
lastEnd_(0), nestCheck_(nestCheck), maxEnd_(0), chr_(chr),
isStarch_(false), all_(chr_ == "all"),
- archive_(0) {
-
+ archive_(0), pool_(&p) {
+
if ( !_M_ok )
return;
@@ -108,7 +110,7 @@ namespace Bed {
} // while
if ( _M_value->chrom() == chr_ )
return;
- delete _M_value;
+ pool_->release(_M_value);
_M_value = static_cast<BedType*>(0);
} // while
_M_value = static_cast<BedType*>(0);
@@ -141,13 +143,13 @@ namespace Bed {
std::fseek(tmpf, 0, SEEK_END); // apparently dangerous on some platforms in binary mode -> padded nulls;
const Bed::ByteOffset at_end = std::ftell(tmpf); // I'll assume msft is the problem until I know better
std::rewind(tmpf);
-
+
Bed::extract_details::TargetBedType* bt = new Bed::extract_details::TargetBedType(tmpf);
if ( bt->chrom() == chr_ ) { // first entry is correct chromosome
delete bt;
std::rewind(tmpf);
fp_.seekg(0, std::ios::beg);
-
+
Ext::ByLine bl;
if ( !(_M_ok && fp_ >> bl) )
_M_ok = false;
@@ -183,7 +185,6 @@ namespace Bed {
Bed::extract_details::QueryBedType q(tmpf);
std::fseek(tmpf, b, SEEK_SET);
if ( q.chrom() == chr_ ) {
-
fp_.seekg(b, std::ios::beg);
Ext::ByLine bl;
if ( !(_M_ok && fp_ >> bl) )
@@ -229,10 +230,10 @@ namespace Bed {
}
}
}
-
+
reference operator*() { return _M_value; }
pointer operator->() { return &(operator*()); }
-
+
bed_check_iterator& operator++() {
static Ext::ByLine bl;
if ( _M_ok ) {
@@ -244,7 +245,7 @@ namespace Bed {
s << cnt_;
throw(Exception("in " + fn_ + "\nHeader found but should be at top of file.\nSee row: " + s.str()));
} else if ( !all_ && (_M_value->chrom() != chr_) ) {
- delete _M_value;
+ pool_->release(_M_value);
_M_value = static_cast<BedType*>(0);
_M_ok = false;
}
@@ -262,9 +263,9 @@ namespace Bed {
}
return *this;
}
-
+
bed_check_iterator operator++(int) {
- bed_check_iterator __tmp = *this;
+ auto __tmp = *this;
static Ext::ByLine bl;
if ( _M_ok ) {
if ( !isStarch_ ) { // bed
@@ -275,7 +276,7 @@ namespace Bed {
s << cnt_;
throw(Exception("in " + fn_ + "\nHeader found but should be at top of file.\nSee row: " + s.str()));
} else if ( !all_ && (_M_value->chrom() != chr_ ) ) {
- delete _M_value;
+ pool_->release(_M_value);
_M_value = static_cast<BedType*>(0);
_M_ok = false;
}
@@ -293,17 +294,25 @@ namespace Bed {
}
return __tmp;
}
-
+
+ Ext::PooledMemory<BedType, SZ>& get_pool() { return *pool_; }
+
void clean() {
if ( archive_ )
delete archive_;
}
-
+
bool _M_equal(const bed_check_iterator& __x) const
{ return ( (_M_ok == __x._M_ok) && (!_M_ok || &fp_ == &__x.fp_) ); }
-
+
bool operator=(const bed_check_iterator& b);
-
+
+ bool has_nested() const { /* only known for Starch archives */
+ if ( isStarch_ )
+ return archive_->getAllChromosomesHaveNestedElement();
+ return true; // assumption for BED
+ }
+
protected:
std::string lowerstr(const std::string& s) {
std::string t(s);
@@ -311,28 +320,28 @@ namespace Bed {
t[i] = static_cast<char>(std::tolower(t[i]));
return t;
}
-
+
bool isUCSCheader(const std::string& bl) {
std::string tmp = lowerstr(bl);
return (tmp == "browser" || tmp == "track");
}
-
+
bool get_starch(std::string& line) {
if ( archive_ == NULL || !archive_->extractBEDLine(line) )
return false;
return !line.empty();
}
-
+
bool check(const std::string& bl) {
static std::string msg = "";
static int cmp = 0;
-
+
msg.clear();
if ( bl.empty() )
msg = "Empty line found.";
else if ( isUCSCheader(bl) )
return false;
-
+
// Check chromosome
std::string::size_type marker = 0, sz = bl.size();
while ( msg.empty() && marker < sz ) {
@@ -358,7 +367,7 @@ namespace Bed {
}
++marker;
} // while
-
+
if ( msg.empty() ) {
if ( sz <= marker )
msg = "No tabs found in BED row.";
@@ -373,8 +382,8 @@ namespace Bed {
else
++marker; // increment passed tab
}
-
-
+
+
// Check start coordinate
static std::string::size_type pos = marker;
pos = marker;
@@ -449,6 +458,7 @@ namespace Bed {
}
}
+ std::size_t idsz = 0, measurementsz = 0;
if ( nFields_ > 3 ) { // check ID field
pos = marker;
while ( msg.empty() && marker < sz ) {
@@ -458,7 +468,7 @@ namespace Bed {
msg += "Two or more consecutive tabs. No ID field.";
else if ( bl[marker] == ' ' )
msg += "ID field may not contain a space.";
-
+
++marker;
} // while
@@ -477,8 +487,10 @@ namespace Bed {
msg += "\nMAXIDSIZE = " + a.str();
msg += "; Size given = " + b.str();
}
- else
+ else {
++marker; // increment passed tab
+ idsz = (marker-pos); // include tab
+ }
}
if ( nFields_ > 4 ) { // check measurement column
@@ -530,7 +542,7 @@ namespace Bed {
}
++marker;
} // while
-
+
if ( msg.empty() ) {
if ( sz <= marker && nFields_ > 5 ) {
std::stringstream con; con << nFields_;
@@ -540,11 +552,12 @@ namespace Bed {
msg = "Fifth (measure) column is empty.";
else if ( minusPos > 0 && minusPos + 1 == marker )
msg = "Measurement value ends with a '-'.";
- else
+ else {
++marker; // increment passed tab
+ measurementsz = (marker-pos); // include tab
+ }
}
-
-
+
if ( nFields_ > 5 ) { // check strand column
pos = marker;
while ( msg.empty() && marker < sz ) {
@@ -564,7 +577,7 @@ namespace Bed {
++marker;
} // while
}
-
+
if ( msg.empty() ) {
if ( pos == marker )
msg = "Sixth (strand) column is empty.";
@@ -573,26 +586,24 @@ namespace Bed {
}
}
}
-
- if ( msg.empty() && hasRest_ && marker < sz && sz - marker > Bed::MAXRESTSIZE ) {
- msg = "The 'rest' of the input row (everything beyond the first ";
- std::stringstream a, b, c;
+
+ if ( msg.empty() && hasRest_ && marker <= sz && (sz - marker + idsz + measurementsz) > Bed::MAXRESTSIZE ) { // idsz/measurementsz for fullrest_
+ msg = "The 'rest' of the input row (everything beyond the first 3";
+ std::stringstream a, b;
a << Bed::MAXRESTSIZE;
b << bl.substr(marker).size();
- c << nFields_;
- msg += c.str();
msg += " fields) cannot fit into MAXRESTSIZE chars.\nIncrease TOKEN_REST_MAX_LENGTH in BEDOPS.Constants.hpp and recompile BEDOPS.";
msg += "\nMAXRESTSIZE = " + a.str();
msg += "; Size given = " + b.str();
}
-
+
if ( !msg.empty() ) {
std::stringstream s;
s << cnt_;
throw(Exception("in " + fn_ + "\n" + msg + "\nSee row: " + s.str()));
}
- _M_value = new BedType(bl);
+ _M_value = pool_->construct(bl);
if ( msg.empty() && !lastChr_.empty() ) {
cmp = std::strcmp(_M_value->chrom(), lastChr_.c_str());
if ( cmp < 0 )
@@ -618,13 +629,13 @@ namespace Bed {
if ( msg.empty() && _M_value->end() <= _M_value->start() )
msg = "End coordinates must be greater than start coordinates.";
-
+
if ( !msg.empty() ) {
std::stringstream s;
s << cnt_;
throw(Exception("in " + fn_ + "\n" + msg + "\nSee row: " + s.str()));
}
-
+
lastChr_ = _M_value->chrom();
lastStart_ = _M_value->start();
lastEnd_ = _M_value->end();
@@ -648,22 +659,23 @@ namespace Bed {
bool isStarch_;
const bool all_;
starch::Starch* archive_;
+ Ext::PooledMemory<BedType, SZ>* pool_;
};
-
- template <class BedType>
+
+ template <class BedType, std::size_t Sz>
inline bool
- operator==(const bed_check_iterator<BedType>& __x,
- const bed_check_iterator<BedType>& __y) {
+ operator==(const bed_check_iterator<BedType, Sz>& __x,
+ const bed_check_iterator<BedType, Sz>& __y) {
return __x._M_equal(__y);
}
-
- template <class BedType>
+
+ template <class BedType, std::size_t Sz>
inline bool
- operator!=(const bed_check_iterator<BedType>& __x,
- const bed_check_iterator<BedType>& __y) {
+ operator!=(const bed_check_iterator<BedType, Sz>& __x,
+ const bed_check_iterator<BedType, Sz>& __y) {
return !__x._M_equal(__y);
}
} // namespace Bed
-#endif // SPECIAL_BED_ITERATOR_HEADERS_STARCH_CHR_SPECIFIC_HPP
+#endif // SPECIAL_BED_ITERATOR_HEADERS_STARCH_CHR_SPECIFIC_POOL_HPP
diff --git a/interfaces/general-headers/data/bed/BedCheckIterator.hpp b/interfaces/general-headers/data/bed/BedCheckIterator_minmem.hpp
similarity index 94%
copy from interfaces/general-headers/data/bed/BedCheckIterator.hpp
copy to interfaces/general-headers/data/bed/BedCheckIterator_minmem.hpp
index c927ed9..0c77399 100644
--- a/interfaces/general-headers/data/bed/BedCheckIterator.hpp
+++ b/interfaces/general-headers/data/bed/BedCheckIterator_minmem.hpp
@@ -21,8 +21,8 @@
// 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA.
//
-#ifndef SPECIAL_BED_ITERATOR_HEADERS_STARCH_CHR_SPECIFIC_HPP
-#define SPECIAL_BED_ITERATOR_HEADERS_STARCH_CHR_SPECIFIC_HPP
+#ifndef SPECIAL_BED_ITERATOR_HEADERS_STARCH_CHR_SPECIFIC_MINMEM_HPP
+#define SPECIAL_BED_ITERATOR_HEADERS_STARCH_CHR_SPECIFIC_MINMEM_HPP
#include <cctype>
#include <cstddef>
@@ -49,11 +49,11 @@
namespace Bed {
template <class BedType>
- class bed_check_iterator;
-
+ class bed_check_iterator_mm;
+
template <class BedType>
- class bed_check_iterator<BedType*> {
-
+ class bed_check_iterator_mm<BedType*> {
+
public:
typedef Ext::UserError Exception;
typedef std::forward_iterator_tag iterator_category;
@@ -65,12 +65,12 @@ namespace Bed {
static constexpr int nFields_ = BedType::NumFields;
static constexpr bool hasRest_ = BedType::UseRest;
- bed_check_iterator() : fp_(std::cin), _M_ok(false), _M_value(0), fn_(""), cnt_(0),
- lastChr_(""), lastRest_(""), lastStart_(1), lastEnd_(0), nestCheck_(false),
- maxEnd_(0), chr_(""), isStarch_(false), all_(true), archive_(0)
+ bed_check_iterator_mm() : fp_(std::cin), _M_ok(false), _M_value(0), fn_(""), cnt_(0),
+ lastChr_(""), lastRest_(""), lastStart_(1), lastEnd_(0), nestCheck_(false),
+ maxEnd_(0), chr_(""), isStarch_(false), all_(true), archive_(0)
{ /* */ }
- bed_check_iterator(std::istream& is, const std::string& filename, const std::string& chr = "all", bool nestCheck = false)
+ bed_check_iterator_mm(std::istream& is, const std::string& filename, const std::string& chr = "all", bool nestCheck = false)
: fp_(is), _M_ok(fp_), _M_value(0), fn_(filename), cnt_(0), lastChr_(""), lastRest_(""), lastStart_(1),
lastEnd_(0), nestCheck_(nestCheck), maxEnd_(0), chr_(chr),
isStarch_(false), all_(chr_ == "all"),
@@ -229,11 +229,11 @@ namespace Bed {
}
}
}
-
+
reference operator*() { return _M_value; }
pointer operator->() { return &(operator*()); }
-
- bed_check_iterator& operator++() {
+
+ bed_check_iterator_mm& operator++() {
static Ext::ByLine bl;
if ( _M_ok ) {
if ( !isStarch_ ) { // bed
@@ -262,9 +262,9 @@ namespace Bed {
}
return *this;
}
-
- bed_check_iterator operator++(int) {
- bed_check_iterator __tmp = *this;
+
+ bed_check_iterator_mm operator++(int) {
+ bed_check_iterator_mm __tmp = *this;
static Ext::ByLine bl;
if ( _M_ok ) {
if ( !isStarch_ ) { // bed
@@ -293,17 +293,23 @@ namespace Bed {
}
return __tmp;
}
-
+
void clean() {
if ( archive_ )
delete archive_;
}
-
- bool _M_equal(const bed_check_iterator& __x) const
+
+ bool _M_equal(const bed_check_iterator_mm& __x) const
{ return ( (_M_ok == __x._M_ok) && (!_M_ok || &fp_ == &__x.fp_) ); }
-
- bool operator=(const bed_check_iterator& b);
-
+
+ bool operator=(const bed_check_iterator_mm& b);
+
+ bool has_nested() const { /* only known for Starch archives */
+ if ( isStarch_ )
+ return archive_->getAllChromosomesHaveNestedElement();
+ return true; // assumption for BED
+ }
+
protected:
std::string lowerstr(const std::string& s) {
std::string t(s);
@@ -652,18 +658,18 @@ namespace Bed {
template <class BedType>
inline bool
- operator==(const bed_check_iterator<BedType>& __x,
- const bed_check_iterator<BedType>& __y) {
+ operator==(const bed_check_iterator_mm<BedType>& __x,
+ const bed_check_iterator_mm<BedType>& __y) {
return __x._M_equal(__y);
}
template <class BedType>
inline bool
- operator!=(const bed_check_iterator<BedType>& __x,
- const bed_check_iterator<BedType>& __y) {
+ operator!=(const bed_check_iterator_mm<BedType>& __x,
+ const bed_check_iterator_mm<BedType>& __y) {
return !__x._M_equal(__y);
}
} // namespace Bed
-#endif // SPECIAL_BED_ITERATOR_HEADERS_STARCH_CHR_SPECIFIC_HPP
+#endif // SPECIAL_BED_ITERATOR_HEADERS_STARCH_CHR_SPECIFIC_MINMEM_HPP
diff --git a/interfaces/general-headers/data/bed/BedCompare.hpp b/interfaces/general-headers/data/bed/BedCompare.hpp
index 8963e7c..85b9481 100644
--- a/interfaces/general-headers/data/bed/BedCompare.hpp
+++ b/interfaces/general-headers/data/bed/BedCompare.hpp
@@ -51,7 +51,7 @@ namespace Bed {
struct GenomicAddressCompare
: public std::binary_function<BedType1 const*, BedType2 const*, bool> {
- bool operator()(BedType1 const* ptr1, BedType2 const* ptr2) const {
+ inline bool operator()(BedType1 const* ptr1, BedType2 const* ptr2) const {
static int v = 0;
if ( (v = std::strcmp(ptr1->chrom(), ptr2->chrom())) != 0 )
return v < 0;
@@ -67,7 +67,7 @@ namespace Bed {
struct InvertGenomicAddressCompare
: private GenomicAddressCompare<BedType1, BedType2> {
typedef GenomicAddressCompare<BedType1, BedType2> Base;
- bool operator()(BedType1 const* ptr1, BedType2 const* ptr2) const {
+ inline bool operator()(BedType1 const* ptr1, BedType2 const* ptr2) const {
return Base::operator()(ptr2, ptr1);
}
};
@@ -76,7 +76,7 @@ namespace Bed {
struct CoordCompare // ignoring chrom here
: public std::binary_function<BedType1 const*, BedType2 const*, bool> {
- bool operator()(BedType1 const* one, BedType2 const* two) const {
+ inline bool operator()(BedType1 const* one, BedType2 const* two) const {
if ( one->start() != two->start() )
return one->start() < two->start();
return one->end() < two->end();
@@ -87,7 +87,7 @@ namespace Bed {
struct CoordAddressCompare // not caring about chrom here
: public std::binary_function<BedType1 const*, BedType2 const*, bool> {
- bool operator()(BedType1 const* one, BedType2 const* two) const {
+ inline bool operator()(BedType1 const* one, BedType2 const* two) const {
if ( one->start() != two->start() )
return one->start() < two->start();
if ( one->end() != two->end() )
@@ -101,7 +101,7 @@ namespace Bed {
: public std::binary_function<BedType1 const*, BedType2 const*, bool> {
template <typename T=BedType1, typename U=BedType2>
- typename std::enable_if<T::UseRest && U::UseRest, bool>::type
+ inline typename std::enable_if<T::UseRest && U::UseRest, bool>::type
operator()(BedType1 const* one, BedType2 const* two) const {
if ( one->start() != two->start() )
return one->start() < two->start();
@@ -111,32 +111,53 @@ namespace Bed {
}
template <typename T=BedType1, typename U=BedType2>
- typename std::enable_if<T::UseRest && !U::UseRest, bool>::type
+ inline typename std::enable_if<T::UseRest && !U::UseRest, bool>::type
operator()(BedType1 const* one, BedType2 const* two) const {
if ( one->start() != two->start() )
return one->start() < two->start();
if ( one->end() != two->end() )
return one->end() < two->end();
- return std::strlen(one->full_rest()) == 0;
+ return false; // one may be equal to two, but still one is not less than two
}
template <typename T=BedType1, typename U=BedType2>
- typename std::enable_if<!T::UseRest && U::UseRest, bool>::type
+ inline typename std::enable_if<!T::UseRest && U::UseRest, bool>::type
operator()(BedType1 const* one, BedType2 const* two) const {
if ( one->start() != two->start() )
return one->start() < two->start();
if ( one->end() != two->end() )
return one->end() < two->end();
- std::strlen(two->full_rest()) != 0;
+ return std::strlen(two->full_rest()) != 0;
}
template <typename T=BedType1, typename U=BedType2>
- typename std::enable_if<!T::UseRest && !U::UseRest, bool>::type
+ inline typename std::enable_if<!T::UseRest && !U::UseRest && T::NumFields == 3 && U::NumFields == 3, bool>::type
operator()(BedType1 const* one, BedType2 const* two) const {
if ( one->start() != two->start() )
return one->start() < two->start();
return one->end() < two->end();
}
+
+ template <typename T=BedType1, typename U=BedType2>
+ inline typename std::enable_if<!T::UseRest && !U::UseRest && (T::NumFields != 3 || U::NumFields != 3), bool>::type
+ operator()(BedType1 const* one, BedType2 const* two) const {
+ if ( one->start() != two->start() )
+ return one->start() < two->start();
+ if ( one->end() != two->end() )
+ return one->end() < two->end();
+ return one->printstr() < two->printstr(); // compares chrom info too...not ideal but it's assumed by caller anyway
+ }
+ };
+
+ template <typename BedType1, typename BedType2 = BedType1>
+ struct GenomicRestCompare : CoordRestCompare<BedType1, BedType2> {
+ typedef CoordRestCompare<BedType1, BedType2> BaseT;
+ inline bool operator()(BedType1 const* ptr1, BedType2 const* ptr2) const {
+ static int v = 0;
+ if ( (v = std::strcmp(ptr1->chrom(), ptr2->chrom())) != 0 )
+ return v < 0;
+ return BaseT::operator()(ptr1, ptr2);
+ }
};
template <typename BedType1, typename BedType2 = BedType1>
@@ -144,7 +165,7 @@ namespace Bed {
: public std::binary_function<BedType1 const*, BedType2 const*, bool> {
template <typename T=BedType1, typename U=BedType2>
- typename std::enable_if<T::UseRest && U::UseRest, bool>::type
+ inline typename std::enable_if<T::UseRest && U::UseRest, bool>::type
operator()(BedType1 const* one, BedType2 const* two) const {
if ( one->start() != two->start() )
return one->start() < two->start();
@@ -157,7 +178,7 @@ namespace Bed {
}
template <typename T=BedType1, typename U=BedType2>
- typename std::enable_if<T::UseRest && !U::UseRest, bool>::type
+ inline typename std::enable_if<T::UseRest && !U::UseRest, bool>::type
operator()(BedType1 const* one, BedType2 const* two) const {
if ( one->start() != two->start() )
return one->start() < two->start();
@@ -170,7 +191,7 @@ namespace Bed {
}
template <typename T=BedType1, typename U=BedType2>
- typename std::enable_if<!T::UseRest && U::UseRest, bool>::type
+ inline typename std::enable_if<!T::UseRest && U::UseRest, bool>::type
operator()(BedType1 const* one, BedType2 const* two) const {
if ( one->start() != two->start() )
return one->start() < two->start();
@@ -183,21 +204,43 @@ namespace Bed {
}
template <typename T=BedType1, typename U=BedType2>
- typename std::enable_if<!T::UseRest && !U::UseRest, bool>::type
+ inline typename std::enable_if<!T::UseRest && !U::UseRest, bool>::type
operator()(BedType1 const* one, BedType2 const* two) const {
- if ( one->start() != two->start() )
- return one->start() < two->start();
- if ( one->end() != two->end() )
- return one->end() < two->end();
- return one < two;
+ static CoordRestCompare<T, U> crc; // deals with ID fields and such
+ bool check = crc(one, two);
+ if ( check ) // *one < *two
+ return true;
+ check = crc(two, one);
+ if ( check ) // *two < *one
+ return false;
+ return one < two; // one == two; compare addresses
+ }
+ };
+
+ template <typename BedType1, typename BedType2 = BedType1>
+ struct GenomicRestAddressCompare : CoordRestAddressCompare<BedType1, BedType2> {
+ typedef CoordRestAddressCompare<BedType1, BedType2> BaseT;
+ inline bool operator()(BedType1 const* ptr1, BedType2 const* ptr2) const {
+ static int v = 0;
+ if ( (v = std::strcmp(ptr1->chrom(), ptr2->chrom())) != 0 )
+ return v < 0;
+ return BaseT::operator()(ptr1, ptr2);
+ }
+ };
+
+ template <typename BedType1, typename BedType2 = BedType1>
+ struct InvertGenomicRestAddressCompare
+ : private GenomicRestAddressCompare<BedType1, BedType2> {
+ typedef GenomicRestAddressCompare<BedType1, BedType2> Base;
+ inline bool operator()(BedType1 const* ptr1, BedType2 const* ptr2) const {
+ return Base::operator()(ptr2, ptr1);
}
};
template <typename BedType1, typename BedType2 = BedType1>
struct RevCoordAddressCompare // not caring about chrom here
: public std::binary_function<BedType1 const*, BedType2 const*, bool> {
-
- bool operator()(BedType1 const* one, BedType2 const* two) const {
+ inline bool operator()(BedType1 const* one, BedType2 const* two) const {
if ( one->end() != two->end() )
return one->end() < two->end();
if ( one->start() != two->start() )
@@ -209,8 +252,7 @@ namespace Bed {
template <typename BedType1, typename BedType2 = BedType1>
struct EndCoordAddressCompareLesser
: public std::binary_function<BedType1 const*, BedType2 const*, bool> {
-
- bool operator()(BedType1 const* one, BedType2 const* two) const {
+ inline bool operator()(BedType1 const* one, BedType2 const* two) const {
if ( one->end() != two->end() )
return one->end() < two->end();
return one < two;
@@ -220,8 +262,7 @@ namespace Bed {
template <typename BedType1, typename BedType2 = BedType1>
struct EndCoordAddressCompareGreater
: public std::binary_function<BedType1 const*, BedType2 const*, bool> {
-
- bool operator()(BedType1 const* one, BedType2 const* two) const {
+ inline bool operator()(BedType1 const* one, BedType2 const* two) const {
if ( one->end() != two->end() )
return one->end() > two->end();
return one > two;
@@ -231,8 +272,7 @@ namespace Bed {
template <typename BedType1, typename BedType2 = BedType1>
struct StartCoordAddressCompareLesser
: public std::binary_function<BedType1 const*, BedType2 const*, bool> {
-
- bool operator()(BedType1 const* one, BedType2 const* two) const {
+ inline bool operator()(BedType1 const* one, BedType2 const* two) const {
if ( one->start() != two->start() )
return one->start() < two->start();
return one < two;
@@ -242,8 +282,7 @@ namespace Bed {
template <typename BedType1, typename BedType2 = BedType1>
struct StartCoordAddressCompareGreater
: public std::binary_function<BedType1 const*, BedType2 const*, bool> {
-
- bool operator()(BedType1 const* one, BedType2 const* two) const {
+ inline bool operator()(BedType1 const* one, BedType2 const* two) const {
if ( one->start() != two->start() )
return one->start() > two->start();
return one > two;
@@ -253,8 +292,7 @@ namespace Bed {
template <typename BedType1, typename BedType2 = BedType1>
struct ScoreCompare
: public std::binary_function<BedType1 const*, BedType2 const*, bool> {
-
- bool operator()(BedType1 const* one, BedType2 const* two) const {
+ inline bool operator()(BedType1 const* one, BedType2 const* two) const {
return one->measurement() < two->measurement();
}
};
@@ -262,9 +300,7 @@ namespace Bed {
template <typename BedType1, typename BedType2 = BedType1>
struct ScoreThenGenomicCompareLesser
: public std::binary_function<BedType1 const*, BedType2 const*, bool> {
-
- inline
- bool operator()(BedType1 const* one, BedType2 const* two) const {
+ inline bool operator()(BedType1 const* one, BedType2 const* two) const {
if ( one->measurement() != two->measurement() )
return one->measurement() < two->measurement();
@@ -281,14 +317,11 @@ namespace Bed {
struct ScoreThenGenomicCompareGreater
: private ScoreThenGenomicCompareLesser<BedType1, BedType2> {
typedef ScoreThenGenomicCompareLesser<BedType1, BedType2> Base;
- inline
- bool operator()(BedType1 const* ptr1, BedType2 const* ptr2) const {
+ inline bool operator()(BedType1 const* ptr1, BedType2 const* ptr2) const {
return Base::operator()(ptr2, ptr1);
}
};
} // namespace Bed
-
-
#endif // BED_DATA_COMPARE_H
diff --git a/interfaces/general-headers/data/bed/BedTypes.hpp b/interfaces/general-headers/data/bed/BedTypes.hpp
index 9d6fd40..ce7054b 100644
--- a/interfaces/general-headers/data/bed/BedTypes.hpp
+++ b/interfaces/general-headers/data/bed/BedTypes.hpp
@@ -26,21 +26,30 @@
#define BEDTYPES_HPP
#include "data/bed/Bed.hpp"
+#include "data/bed/Bed_minmem.hpp"
namespace Bed {
/***********************************************/
/* Typedef helper for user applications */
/***********************************************/
- template <bool UseNonStaticChrom, bool UseRest, typename MType = double>
+ template <bool UseNonStaticChrom, bool UseRest, typename MType = double, bool MemPool = true>
struct BedTypes {
typedef MType MeasureType;
typedef BasicCoords<UseNonStaticChrom, UseRest> Bed3Type;
- typedef Bed4< Bed3Type, UseRest > Bed4Type;
- typedef Bed5< Bed4Type, MeasureType, UseRest > Bed5Type;
+ typedef Bed4<Bed3Type, UseRest> Bed4Type;
+ typedef Bed5<Bed4Type, MeasureType, UseRest> Bed5Type;
};
- enum { Rest = true, NoRest = false, OneChrom = false, AllChrom = true };
+ template <bool UseNonStaticChrom, bool UseRest, typename MType>
+ struct BedTypes<UseNonStaticChrom, UseRest, MType, false> {
+ typedef MType MeasureType;
+ typedef NoPool::BasicCoords<UseNonStaticChrom, UseRest> Bed3Type;
+ typedef NoPool::Bed4<Bed3Type, UseRest> Bed4Type;
+ typedef NoPool::Bed5<Bed4Type, MeasureType, UseRest> Bed5Type;
+ };
+
+ enum { Rest = true, NoRest = false, OneChrom = false, AllChrom = true, NoPooling = false };
/***********************************************/
@@ -48,23 +57,27 @@ namespace Bed {
/***********************************************/
typedef BedTypes<AllChrom, Rest, double> BTAllRest;
typedef BedTypes<AllChrom, NoRest, double> BTAllNoRest;
- typedef BedTypes<OneChrom, Rest, double> BTOneRest;
- typedef BedTypes<OneChrom, NoRest, double> BTOneNoRest;
-
typedef BTAllRest::Bed3Type B3Rest;
typedef BTAllNoRest::Bed3Type B3NoRest;
- typedef BTOneRest::Bed3Type B3OneChromRest;
- typedef BTOneNoRest::Bed3Type B3OneChromNoRest;
typedef BTAllRest::Bed4Type B4Rest;
typedef BTAllNoRest::Bed4Type B4NoRest;
- typedef BTOneRest::Bed4Type B4OneChromRest;
- typedef BTOneNoRest::Bed4Type B4OneChromNoRest;
typedef BTAllRest::Bed5Type B5Rest;
typedef BTAllNoRest::Bed5Type B5NoRest;
- typedef BTOneRest::Bed5Type B5OneChromRest;
- typedef BTOneNoRest::Bed5Type B5OneChromNoRest;
+
+
+ typedef BedTypes<AllChrom, Rest, double, NoPooling> BTAllRestNoPool;
+ typedef BedTypes<AllChrom, NoRest, double, NoPooling> BTAllNoRestNoPool;
+
+ typedef BTAllRestNoPool::Bed3Type B3RestNoPool;
+ typedef BTAllNoRestNoPool::Bed3Type B3NoRestNoPool;
+
+ typedef BTAllRestNoPool::Bed4Type B4RestNoPool;
+ typedef BTAllNoRestNoPool::Bed4Type B4NoRestNoPool;
+
+ typedef BTAllRestNoPool::Bed5Type B5RestNoPool;
+ typedef BTAllNoRestNoPool::Bed5Type B5NoRestNoPool;
} // namespace Bed
#endif // BEDTYPES_HPP
diff --git a/interfaces/general-headers/data/bed/Bed_minmem.hpp b/interfaces/general-headers/data/bed/Bed_minmem.hpp
new file mode 100644
index 0000000..b94ca7a
--- /dev/null
+++ b/interfaces/general-headers/data/bed/Bed_minmem.hpp
@@ -0,0 +1,917 @@
+/*
+ Author: Scott Kuehn, Shane Neph
+ Date: Fri Jul 27 11:49:03 PDT 2007
+*/
+//
+// BEDOPS
+// Copyright (C) 2011-2017 Shane Neph, Scott Kuehn and Alex Reynolds
+//
+// This program is free software; you can redistribute it and/or modify
+// it under the terms of the GNU General Public License as published by
+// the Free Software Foundation; either version 2 of the License, or
+// (at your option) any later version.
+//
+// This program is distributed in the hope that it will be useful,
+// but WITHOUT ANY WARRANTY; without even the implied warranty of
+// MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+// GNU General Public License for more details.
+//
+// You should have received a copy of the GNU General Public License along
+// with this program; if not, write to the Free Software Foundation, Inc.,
+// 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA.
+//
+
+#ifndef BED_MINMEM_HPP
+#define BED_MINMEM_HPP
+
+#include <cstddef>
+#include <cstdio>
+#include <cstring>
+#include <cstdlib>
+#include <limits>
+#include <string>
+#include <type_traits>
+
+#include "suite/BEDOPS.Constants.hpp"
+#include "utility/Formats.hpp"
+
+/*
+ sjn
+ This set of classes is designed to be flexible and efficient. I use non-virtual public inheritence, which
+ most everyone will tell you is a horrible thing to do. I disagree. Power over safety is the bread and
+ butter of the class of C languages. If you try using derived classes through pointer to base class, then
+ you are using these classes incorrectly. You can allocate dynamically, of course, but the pointer type
+ must be to the class of interest. Not every problem should be solved through virtual tools, which carry
+ some real overhead. Why throw out power offered by the language by sticking to simple rules of thumb?
+ Instead, use all tools wisely.
+ There is no automated way (that I know of) to prevent improper base pointer to derived class. Using these
+ in that way leads to memory leaks (and is the reason for that rule of thumb).
+*/
+
+namespace Bed {
+
+ namespace NoPool {
+
+ const CoordType MAXCHROMSIZE = TOKEN_CHR_MAX_LENGTH;
+ const CoordType MAXIDSIZE = TOKEN_ID_MAX_LENGTH;
+ const CoordType MAXRESTSIZE = TOKEN_REST_MAX_LENGTH;
+
+
+ /*****************************************/
+ /* ChromInfo Classes */
+ /*****************************************/
+
+ // ChromInfo non-specialized declaration
+ template <bool IsNonStatic>
+ struct ChromInfo {
+
+ ChromInfo() : chrom_(new char[1]) { chrom_[0] = '\0'; }
+ ChromInfo(const ChromInfo& c)
+ : chrom_(new char[(c.chrom_ != NULL) ? (std::strlen(c.chrom_) + 1) : 1])
+ { *chrom_ = '\0'; if ( c.chrom_ != NULL ) std::strcpy(chrom_, c.chrom_); }
+ explicit ChromInfo(char const* c)
+ : chrom_(new char[(c != NULL) ? (std::strlen(c)+1) : 1])
+ { *chrom_ = '\0'; if ( c != NULL ) std::strcpy(chrom_, c); }
+
+ // Properties
+ char const* chrom() const { return chrom_; }
+ void chrom(char const* chrom) {
+ if ( chrom_ )
+ delete [] chrom_;
+ if ( chrom != NULL ) {
+ chrom_ = new char[std::strlen(chrom) + 1];
+ std::strcpy(chrom_, chrom);
+ } else {
+ chrom_ = new char[1];
+ *chrom_ = '\0';
+ }
+ }
+
+ // Operators
+ ChromInfo& operator=(const ChromInfo& c) {
+ if ( chrom_ )
+ delete [] chrom_;
+ chrom_ = new char[(c.chrom_ != NULL) ? (std::strlen(c.chrom_) + 1) : 1];
+ *chrom_ = '\0'; if ( c.chrom_ != NULL ) std::strcpy(chrom_, c.chrom_);
+ return *this;
+ }
+
+ ~ChromInfo() {
+ if ( chrom_ )
+ delete [] chrom_;
+ chrom_ = NULL;
+ }
+
+ protected:
+ char* chrom_;
+ };
+
+
+ // ChromInfo specialization : uses static chromosome info
+ template <>
+ struct ChromInfo<false> {
+
+ ChromInfo() { chrom_[0] = '\0'; }
+ explicit ChromInfo(char const* chr) { std::strcpy(chrom_, chr); }
+ /* Desire default-shallow copy-construction & copy-assignment */
+
+ // Properties
+ char const* chrom() const { return chrom_; }
+ void chrom(char const* chrom) { std::strcpy(chrom_, chrom); }
+
+ protected:
+ static char chrom_[MAXCHROMSIZE+1];
+ };
+
+ char ChromInfo<false>::chrom_[MAXCHROMSIZE+1];
+
+
+ /*****************************************/
+ /* BasicCoords Classes */
+ /*****************************************/
+
+ // Forward declaration
+ template <bool IsNonStaticChrom = true, bool HasRest = false>
+ struct BasicCoords;
+
+
+ // BasicCoords specialization 1: vanilla (default) information
+ template <bool IsNonStaticChrom>
+ struct BasicCoords<IsNonStaticChrom, false> : public ChromInfo<IsNonStaticChrom> {
+
+ BasicCoords() : BaseClass(), start_(1), end_(0) { /* invalid coords by default */ }
+ BasicCoords(char const* chrom, CoordType start, CoordType end)
+ : BaseClass(chrom), start_(start), end_(end) {}
+ BasicCoords(const BasicCoords& c)
+ : BaseClass(c.chrom_), start_(c.start_), end_(c.end_) {}
+ explicit BasicCoords(FILE* inF) : BaseClass()
+ { this->readline(inF); }
+ explicit BasicCoords(const std::string& inS) : BaseClass()
+ { this->readline(inS); }
+
+ // Properties
+ CoordType length() const { return end_ - start_; }
+ CoordType median() const { return start_ + ((end_ - start_) / 2); }
+ inline CoordType distance(const BasicCoords& a) const {
+ if ( 0 == std::strcmp(chrom_, a.chrom_) )
+ return start_ - a.start_;
+ return std::numeric_limits<CoordType>::max();
+ }
+ inline SignedCoordType sepDistance(const BasicCoords& a) const {
+ if( 0 == std::strcmp(chrom_, a.chrom_) )
+ return end_ - a.start_;
+ return std::numeric_limits<CoordType>::max();
+ }
+ void start(CoordType start) { start_ = start; }
+ CoordType start() const { return start_; }
+ void end(CoordType end) { end_ = end; }
+ CoordType end() const { return end_; }
+
+ // Comparison utilities
+ inline CoordType overlap(const BasicCoords& a) const {
+ if ( 0 != std::strcmp(chrom_, a.chrom_) )
+ return 0;
+ if ( start_ >= a.start_ ) {
+ if ( a.end_ > start_ ) {
+ if ( a.end_ > end_ )
+ return end_ - start_;
+ return a.end_ - start_;
+ }
+ else
+ return 0;
+ } else {
+ if ( end_ > a.start_ ) {
+ if ( a.end_ < end_ )
+ return a.end_ - a.start_;
+ return end_ - a.start_;
+ }
+ else
+ return 0;
+ }
+ }
+ BasicCoords& intersection(const BasicCoords& a) {
+ if ( overlap(a) ) {
+ start_ = std::max(start_, a.start_);
+ end_ = std::min(end_, a.end_);
+ }
+ else
+ start_ = end_ = 0;
+ return *this;
+ }
+ BasicCoords& eunion(const BasicCoords& a) {
+ if ( overlap(a) ) {
+ start_ = std::min(start_, a.start_);
+ end_ = std::max(end_, a.end_);
+ }
+ else
+ start_ = end_ = 0;
+ return *this;
+ }
+ static bool lengthCompare(const BasicCoords& a, const BasicCoords& b)
+ { return a.length() < b.length(); }
+
+ // Operators
+ BasicCoords& operator=(const BasicCoords& c) {
+ BaseClass::operator=(c);
+ start_ = c.start_;
+ end_ = c.end_;
+ return *this;
+ }
+
+ // IO
+ inline void print() const {
+ static const std::string lclStatic = outFormatter();
+ static char const* format = lclStatic.c_str();
+ std::printf(format, chrom_, start_, end_);
+ }
+ inline void println() const {
+ static const std::string heapFormat = (outFormatter() + "\n");
+ static char const* format = heapFormat.c_str();
+ std::printf(format, chrom_, start_, end_);
+ }
+ inline int readline(const std::string& inputLine) {
+ static char chrBuf[MAXCHROMSIZE + 1];
+ chrBuf[0] = '\0';
+ static const std::string lclStatic = inFormatter();
+ static char const* format = lclStatic.c_str();
+ int numScan = std::sscanf(inputLine.c_str(),
+ format, chrBuf,
+ &start_, &end_);
+ this->chrom(chrBuf);
+ return numScan;
+ }
+ inline int readline(FILE* inputFile) {
+ static char chrBuf[MAXCHROMSIZE + 1];
+ chrBuf[0] = '\0';
+ static std::string lclstatic = inFormatter();
+ static char const* format = lclstatic.c_str();
+ int numScan = std::fscanf(inputFile,
+ format, chrBuf,
+ &start_, &end_);
+ std::fgetc(inputFile); // chomp newline
+ this->chrom(chrBuf);
+ return numScan;
+ }
+
+ static const int NumFields = 3;
+ static const bool UseRest = false;
+
+ protected:
+ typedef ChromInfo<IsNonStaticChrom> BaseClass;
+ using BaseClass::chrom_;
+ CoordType start_;
+ CoordType end_;
+
+ static std::string outFormatter() {
+ return(std::string("%s\t%" PRIu64 "\t%" PRIu64));
+ }
+
+ static std::string inFormatter() {
+ return(std::string("%s\t%" SCNu64 "\t%" SCNu64 "%*[^\n]s\n"));
+ }
+ };
+
+
+ // Non-Specialization: Extend partial specialization with "rest-size" information
+ template <bool IsNonStaticChrom, bool HasRest>
+ struct BasicCoords
+ : public BasicCoords<IsNonStaticChrom, false> {
+
+ BasicCoords() : BaseClass(), rest_(new char[1]) { *rest_ = '\0'; }
+ BasicCoords(char const* chrom, CoordType start, CoordType end, char const* rest = NULL)
+ : BaseClass(chrom, start, end), rest_(new char[(rest != NULL) ? (std::strlen(rest)+1) : 1]) {
+ *rest_ = '\0';
+ if ( rest && std::strcmp(rest, "") != 0 ) {
+ if ( rest[0] != '\t' )
+ rest_[0] = '\t';
+ std::strcat(rest_, rest);
+ }
+ }
+ BasicCoords(const BasicCoords& c)
+ : BaseClass(c), rest_(new char[(c.rest_ != NULL) ? (std::strlen(c.rest_) + 1) : 1])
+ { *rest_ = '\0'; if ( c.rest_ != NULL ) std::strcpy(rest_, c.rest_); }
+ explicit BasicCoords(FILE* inF) : BaseClass(), rest_(0)
+ { this->readline(inF); }
+ explicit BasicCoords(const std::string& inS) : BaseClass(), rest_(0)
+ { this->readline(inS); }
+
+ // Properties
+ char const* rest() const { return rest_; }
+ char const* full_rest() const { return rest(); }
+
+ // Operators
+ BasicCoords& operator=(const BasicCoords& c) {
+ BaseClass::operator=(c);
+ if ( rest_ )
+ delete [] rest_;
+ rest_ = new char[(c.rest_ != NULL) ? (std::strlen(c.rest_) + 1) : 1];
+ *rest_ = '\0';
+ if ( c.rest_ != NULL )
+ std::strcpy(rest_, c.rest_);
+ return *this;
+ }
+
+ // IO
+ inline void print() const {
+ static const std::string lclStatic = outFormatter();
+ static char const* format = lclStatic.c_str();
+ std::printf(format, chrom_, start_, end_, rest_);
+ }
+ inline void println() const {
+ static const std::string heapFormat = (outFormatter() + "\n");
+ static char const* format = heapFormat.c_str();
+ std::printf(format, chrom_, start_, end_, rest_);
+ }
+ inline int readline(const std::string& inputLine) {
+ static char chrBuf[MAXCHROMSIZE + 1];
+ chrBuf[0] = '\0';
+ static char restBuf[MAXRESTSIZE + 1];
+ restBuf[0] = '\0';
+ static const std::string lclStatic = inFormatter();
+ static char const* format = lclStatic.c_str();
+ int numScan = std::sscanf(inputLine.c_str(),
+ format, chrBuf, &start_,
+ &end_, restBuf);
+ this->chrom(chrBuf);
+ if ( rest_ )
+ delete [] rest_;
+ rest_ = new char[std::strlen(restBuf) + 1];
+ std::strcpy(rest_, restBuf);
+ return numScan;
+ }
+ inline int readline(FILE* inputFile) {
+ static char chrBuf[MAXCHROMSIZE + 1];
+ chrBuf[0] = '\0';
+ static char restBuf[MAXRESTSIZE + 1];
+ restBuf[0] = '\0';
+ static const std::string lclStatic = inFormatter();
+ static char const* format = lclStatic.c_str();
+ int numScan = std::fscanf(inputFile, format,
+ chrBuf, &start_,
+ &end_, restBuf);
+ std::fgetc(inputFile); // chomp newline
+ this->chrom(chrBuf);
+ if ( rest_ )
+ delete [] rest_;
+ rest_ = new char[std::strlen(restBuf) + 1];
+ std::strcpy(rest_, restBuf);
+ return numScan;
+ }
+
+ ~BasicCoords() {
+ if ( rest_ )
+ delete [] rest_;
+ }
+
+ static const bool UseRest = true;
+
+ protected:
+ typedef BasicCoords<IsNonStaticChrom, false> BaseClass;
+ using BaseClass::chrom_;
+ using BaseClass::start_;
+ using BaseClass::end_;
+ char* rest_;
+
+ static std::string outFormatter() {
+ return(std::string("%s\t%" PRIu64 "\t%" PRIu64 "%s"));
+ }
+
+ static std::string inFormatter() {
+ return(std::string("%s\t%" SCNu64 "\t%" SCNu64 "%[^\n]s\n"));
+ }
+ };
+
+
+ /*****************************************/
+ /* Bed4 Classes */
+ /*****************************************/
+
+ // Forward declaration, forcing specialization
+ template <typename BedType, bool HasRest = false>
+ struct Bed4;
+
+ // Bed4 specialization 1: vanilla (default) information
+ template <bool IsNonStaticChrom, bool B3HasRest>
+ struct Bed4<BasicCoords<IsNonStaticChrom, B3HasRest>, false>
+ : public BasicCoords<IsNonStaticChrom, false> {
+
+ Bed4() : BaseClass(), id_(new char[1]) { *id_ = '\0'; }
+ Bed4(char const* chrom, CoordType start, CoordType end, char const* id)
+ : BaseClass(chrom, start, end), id_(new char[(id != NULL) ? (std::strlen(id)+1) : 1])
+ { *id_ = '\0'; if ( id != NULL ) std::strcpy(id_, id); }
+ Bed4(const Bed4& c)
+ : BaseClass(c), id_(new char[(c.id_ != NULL) ? (std::strlen(c.id_) + 1) : 1])
+ { *id_ = '\0'; if ( c.id_ != NULL ) std::strcpy(id_, c.id_); }
+ explicit Bed4(FILE* inF) : BaseClass(), id_(0)
+ { this->readline(inF); }
+ explicit Bed4(const std::string& inS) : BaseClass(), id_(0)
+ { this->readline(inS); }
+
+ // IO
+ inline int readline(const std::string& inputLine) {
+ static char chrBuf[MAXCHROMSIZE + 1];
+ chrBuf[0] = '\0';
+ static char idBuf[MAXIDSIZE + 1];
+ idBuf[0] = '\0';
+
+ static const std::string lclStatic = inFormatter();
+ static char const* format = lclStatic.c_str();
+ int numScanned = std::sscanf(inputLine.c_str(), format,
+ chrBuf,
+ &start_,
+ &end_,
+ idBuf);
+ this->chrom(chrBuf);
+ this->id(idBuf);
+ return numScanned;
+ }
+ inline int readline(FILE* inputFile) {
+ static char chrBuf[MAXCHROMSIZE + 1];
+ chrBuf[0] = '\0';
+ static char idBuf[MAXIDSIZE + 1];
+ idBuf[0] = '\0';
+
+ static const std::string lclStatic = inFormatter();
+ static char const* format = lclStatic.c_str();
+ int numScanned = std::fscanf(inputFile, format,
+ chrBuf,
+ &start_,
+ &end_,
+ idBuf);
+ std::fgetc(inputFile); // read and discard newline
+ this->chrom(chrBuf);
+ this->id(idBuf);
+ return numScanned;
+ }
+ inline void print() const {
+ static const std::string lclStatic = outFormatter();
+ static char const* format = lclStatic.c_str();
+ std::printf(format, chrom_, start_, end_, id_);
+ }
+ inline void println() const {
+ static const std::string heapFormat = (outFormatter() + "\n");
+ static char const* format = heapFormat.c_str();
+ printf(format, chrom_, start_, end_, id_);
+ }
+
+ // Properties
+ void id(char const* id) {
+ if ( id_ )
+ delete [] id_;
+ id_ = new char[(id != NULL) ? (std::strlen(id) + 1) : 1];
+ *id_ = '\0'; if ( id != NULL ) std::strcpy(id_, id);
+ }
+ char const* id() const { return id_; }
+
+ // Operators
+ Bed4& operator=(const Bed4& c) {
+ BaseClass::operator=(c);
+ if ( id_ )
+ delete [] id_;
+ id_ = new char[(c.id_ != NULL) ? (std::strlen(c.id_) + 1) : 1];
+ *id_ = '\0'; if ( c.id_ != NULL ) std::strcpy(id_, c.id_);
+ return *this;
+ }
+
+ ~Bed4() {
+ if ( id_ )
+ delete [] id_;
+ id_ = NULL;
+ }
+
+ static const int NumFields = 4;
+ static const bool UseRest = false;
+
+ protected:
+ typedef BasicCoords<IsNonStaticChrom, false> BaseClass;
+ using BaseClass::chrom_;
+ using BaseClass::start_;
+ using BaseClass::end_;
+
+ char* id_;
+
+ static std::string outFormatter() {
+ return(BaseClass::outFormatter() + "\t%s");
+ }
+
+ static std::string inFormatter() {
+ return(outFormatter() + "%*[^\n]s\n");
+ }
+ };
+
+ // Specialization 2: Extend specialization 1 with "rest-size" information
+ template <typename BedType, bool HasRest>
+ struct Bed4
+ : public Bed4<BedType, false> {
+
+ Bed4() : BaseClass(), rest_(new char[1]), fullrest_(new char[1]) { *rest_ = '\0'; *fullrest_ = '\0'; }
+ Bed4(const Bed4& c)
+ : BaseClass(c), rest_(new char[(c.rest_ != NULL) ? (std::strlen(c.rest_)+1) : 1]),
+ fullrest_(new char[(c.fullrest_ != NULL) ? (std::strlen(c.fullrest_)+1) : 1])
+ { *rest_ = '\0'; *fullrest_ = '\0';
+ if ( c.rest_ != NULL ) std::strcpy(rest_, c.rest_);
+ if ( c.fullrest_ != NULL ) std::strcpy(fullrest_, c.fullrest_);
+ }
+ Bed4(char const* chrom, CoordType start, CoordType end, char const* id, char const* rest = NULL)
+ : BaseClass(chrom, start, end, id), rest_(new char[(rest != NULL) ? (std::strlen(rest)+1) : 1]),
+ fullrest_(new char[((rest != NULL) ? (std::strlen(rest)+1) : 1) + ((id != NULL) ? (std::strlen(id)+1) : 1)]) {
+ *rest_ = '\0'; *fullrest_ = '\0';
+ if ( id && std::strcmp(id, "") != 0 )
+ std::strcpy(fullrest_, id);
+
+ if ( rest && std::strcmp(rest, "") != 0 ) {
+ if ( rest[0] != '\t' )
+ rest_[0] = '\t';
+ std::strcat(rest_, rest);
+ std::strcat(fullrest_, rest_);
+ }
+ }
+ explicit Bed4(FILE* inF) : BaseClass(), rest_(0), fullrest_(0)
+ { this->readline(inF); }
+ explicit Bed4(const std::string& inS) : BaseClass(), rest_(0), fullrest_(0)
+ { this->readline(inS); }
+
+ // Properties
+ char const* rest() const { return rest_; }
+ char const* full_rest() const { return fullrest_; }
+
+ // IO
+ inline void print() const {
+ static const std::string lclStatic = outFormatter();
+ static char const* format = lclStatic.c_str();
+ std::printf(format, chrom_, start_, end_, id_, rest_);
+ }
+ inline void println() const {
+ static const std::string heapFormat = (outFormatter() + "\n");
+ static char const* format = heapFormat.c_str();
+ std::printf(format, chrom_, start_, end_, id_, rest_);
+ }
+ inline int readline(const std::string& inputLine) {
+ static char chrBuf[MAXCHROMSIZE + 1];
+ chrBuf[0] = '\0';
+ static char idBuf[MAXIDSIZE + 1];
+ idBuf[0] = '\0';
+ static char restBuf[MAXRESTSIZE + 1];
+ restBuf[0] = '\0';
+ static const std::string lclStatic = inFormatter();
+ static char const* format = lclStatic.c_str();
+ int numScanned = std::sscanf(inputLine.c_str(),
+ format, chrBuf,
+ &start_, &end_, idBuf,
+ restBuf);
+ this->chrom(chrBuf);
+ this->id(idBuf);
+ if ( rest_ )
+ delete [] rest_;
+ rest_ = new char[std::strlen(restBuf) + 1];
+ std::strcpy(rest_, restBuf);
+ if ( fullrest_ )
+ delete [] fullrest_;
+ std::size_t sz = (std::strlen(restBuf)+1) + (std::strlen(idBuf) + 1);
+ fullrest_ = new char[sz];
+ std::strcpy(fullrest_, idBuf);
+ std::strcat(fullrest_, restBuf);
+ return numScanned;
+ }
+ inline int readline(FILE* inputFile) {
+ static char chrBuf[MAXCHROMSIZE + 1];
+ chrBuf[0] = '\0';
+ static char idBuf[MAXIDSIZE + 1];
+ idBuf[0] = '\0';
+ static char restBuf[MAXRESTSIZE + 1];
+ restBuf[0] = '\0';
+
+ static const std::string lclStatic = inFormatter();
+ static char const* format = lclStatic.c_str();
+ int numScanned = std::fscanf(inputFile,
+ format, chrBuf,
+ &start_, &end_, idBuf,
+ restBuf);
+
+ std::fgetc(inputFile); // Read and discard trailing newline
+ this->chrom(chrBuf);
+ this->id(idBuf);
+ if ( rest_ )
+ delete [] rest_;
+ rest_ = new char[std::strlen(restBuf) + 1];
+ std::strcpy(rest_, restBuf);
+ std::size_t sz = (std::strlen(restBuf)+1) + (std::strlen(idBuf) + 1);
+ if ( fullrest_ )
+ delete [] fullrest_;
+ fullrest_ = new char[sz];
+ std::strcpy(fullrest_, idBuf);
+ std::strcat(fullrest_, restBuf);
+ return numScanned;
+ }
+
+ // Operators
+ Bed4& operator=(const Bed4& c) {
+ BaseClass::operator=(c);
+ if ( rest_ )
+ delete [] rest_;
+ if ( fullrest_ )
+ delete [] fullrest_;
+ rest_ = new char[(c.rest_ != NULL) ? (std::strlen(c.rest_) + 1) : 1];
+ *rest_ = '\0'; if ( c.rest_ != NULL ) std::strcpy(rest_, c.rest_);
+ fullrest_ = new char[(c.fullrest_ != NULL) ? (std::strlen(c.fullrest_) + 1) : 1];
+ *fullrest_ = '\0'; if ( c.fullrest_ != NULL ) std::strcpy(fullrest_, c.fullrest_);
+ return *this;
+ }
+
+ ~Bed4() {
+ if ( rest_ )
+ delete [] rest_;
+ if ( fullrest_ )
+ delete [] fullrest_;
+ }
+
+ static const bool UseRest = true;
+
+ protected:
+ typedef Bed4<BedType, false> BaseClass;
+ using BaseClass::chrom_;
+ using BaseClass::start_;
+ using BaseClass::end_;
+ using BaseClass::id_;
+
+ char* rest_;
+ char* fullrest_;
+ static std::string outFormatter() {
+ return(BaseClass::outFormatter() + "%s");
+ }
+
+ static std::string inFormatter() {
+ return(BaseClass::outFormatter() + "%[^\n]s\n");
+ }
+ };
+
+
+ /*****************************************/
+ /* Bed5 Classes */
+ /*****************************************/
+
+ // Forward declaration, forcing specialization
+ template <typename Bed4Type, typename MeasureType, bool HasRest = false>
+ struct Bed5;
+
+ // Bed5 specialization 1: vanilla (default) information
+ template <typename U, bool Bed4HasRest, typename MeasureType>
+ struct Bed5<Bed4<U, Bed4HasRest>, MeasureType, false>
+ : public Bed4<U, false> {
+
+ Bed5() : BaseClass() {}
+ Bed5(const Bed5& c) : BaseClass(c), measurement_(0) {}
+ Bed5(char const* chrom, CoordType start, CoordType end, char const* id, MeasureType measurement)
+ : BaseClass(chrom, start, end, id), measurement_(measurement) {}
+ explicit Bed5(const std::string& inS) : BaseClass(), measurement_(0)
+ { this->readline(inS); }
+ explicit Bed5(FILE* inF) : BaseClass(), measurement_(0)
+ { this->readline(inF); }
+
+ // Parameters
+ typedef MeasureType MeasurementType;
+ static const int NumFields = 5;
+ static const bool UseRest = false;
+
+ // Properties
+ inline MeasurementType measurement() const { return measurement_; }
+
+ // IO
+ inline int readline(const std::string& inputLine) {
+ static char chrBuf[MAXCHROMSIZE + 1];
+ chrBuf[0] = '\0';
+ static char idBuf[MAXIDSIZE + 1];
+ idBuf[0] = '\0';
+ static const std::string lclStatic = inFormatter();
+ static char const* format = lclStatic.c_str();
+ int numScanned = std::sscanf(inputLine.c_str(),
+ format, chrBuf,
+ &start_, &end_, idBuf,
+ &measurement_);
+ this->chrom(chrBuf);
+ this->id(idBuf);
+ return numScanned;
+ }
+ inline int readline(FILE* inputFile) {
+ static char chrBuf[MAXCHROMSIZE + 1];
+ chrBuf[0] = '\0';
+ static char idBuf[MAXIDSIZE + 1];
+ idBuf[0] = '\0';
+ static const std::string lclStatic = inFormatter();
+ static char const* format = lclStatic.c_str();
+ int numScanned = std::fscanf(inputFile,
+ format, chrBuf,
+ &start_, &end_, idBuf,
+ &measurement_);
+
+ std::fgetc(inputFile); // Read and discard trailing newline
+ this->chrom(chrBuf);
+ this->id(idBuf);
+ return numScanned;
+ }
+ inline void print() const {
+ static const std::string lclStatic = outFormatter();
+ static char const* format = lclStatic.c_str();
+ std::printf(format, chrom_, start_, end_, id_, measurement_);
+ }
+ inline void println() const {
+ static const std::string heapFormat = outFormatter() + "\n";
+ static char const* format = heapFormat.c_str();
+ std::printf(format, chrom_, start_, end_, id_, measurement_);
+ }
+
+ // Operators
+ Bed5& operator=(const Bed5& c) {
+ BaseClass::operator=(c);
+ this->measurement_ = c.measurement_;
+ return *this;
+ }
+ inline operator MeasurementType() const { return measurement_; }
+
+ protected:
+ typedef Bed4<U, false> BaseClass;
+ using BaseClass::chrom_;
+ using BaseClass::start_;
+ using BaseClass::end_;
+ using BaseClass::id_;
+ MeasureType measurement_;
+
+ static std::string outFormatter() {
+ typedef typename std::remove_cv<MeasureType>::type MType;
+ return(BaseClass::outFormatter() + "\t" + Formats::Format(MType()));
+ }
+
+ static std::string inFormatter() {
+ return(outFormatter() + "%*[^\n]s\n");
+ }
+ };
+
+
+ // Specialization 2: Extend specialization 1 with "rest-size" information
+ template <typename Bed4Type, typename MeasureType, bool HasRest>
+ struct Bed5
+ : public Bed5<Bed4Type, MeasureType, false> { /* Bed4Type is forced to be Bed4<> specialization above */
+
+ Bed5() : BaseClass(), rest_(new char[1]), fullrest_(new char[1]) { *rest_ = '\0'; *fullrest_ = '\0'; restOffset_ = -1; }
+ Bed5(const Bed5& c)
+ : BaseClass(c), restOffset_(c.restOffset_), rest_(new char[(c.rest_ != NULL) ? (std::strlen(c.rest_+1)) : 1]),
+ fullrest_(new char[(c.fullrest_ != NULL) ? (std::strlen(c.fullrest_+1)) : 1])
+ {
+ *rest_ = '\0'; if ( c.rest_ != NULL ) std::strcpy(rest_, c.rest_);
+ *fullrest_ = '\0'; if ( c.fullrest_ != NULL ) std::strcpy(fullrest_, c.fullrest_);
+ }
+ Bed5(char const* chrom, CoordType start, CoordType end,
+ char const* id, MeasureType measurement, char const* rest = NULL)
+ : BaseClass(chrom, start, end, id, measurement),
+ rest_(new char[(rest != NULL) ? (std::strlen(rest)+1) : 1]),
+ fullrest_(new char[((rest != NULL) ? (std::strlen(rest)+1) : 1) + ((id != NULL) ? (std::strlen(id)+1) : 1)])
+ {
+ *rest_ = '\0'; *fullrest_ = '\0';
+ if ( id && std::strcmp(id, "") != 0 )
+ std::strcpy(fullrest_, id);
+
+ if ( rest && 0 != std::strcmp(rest, "") ) {
+ if ( rest[0] != '\t' )
+ rest_[0] = '\t';
+ std::strcat(rest_, rest);
+ std::strcat(fullrest_, rest_);
+ }
+ }
+ explicit Bed5(FILE* inF) : BaseClass(), rest_(0), fullrest_(0)
+ { this->readline(inF); }
+ explicit Bed5(const std::string& inS) : BaseClass(), rest_(0), fullrest_(0)
+ { this->readline(inS); }
+
+ // Properties
+ char const* rest() const { return rest_; }
+ char const* full_rest() const { return fullrest_; }
+ int rest_offset() const { return restOffset_; }
+
+ // IO
+ inline void print() const {
+ static const std::string lclStatic = outFormatter();
+ static char const* format = lclStatic.c_str();
+ std::printf(format, chrom_, start_, end_, id_, measurement_, rest_);
+ }
+ inline void println() const {
+ static const std::string heapFormat = outFormatter() + "\n";
+ static char const* format = heapFormat.c_str();
+ std::printf(format, chrom_, start_, end_, id_, measurement_, rest_);
+ }
+ inline int readline(const std::string& inputLine) {
+ static char chrBuf[MAXCHROMSIZE + 1];
+ chrBuf[0] = '\0';
+ static char idBuf[MAXIDSIZE + 1];
+ idBuf[0] = '\0';
+ static char restBuf[MAXRESTSIZE + 1];
+ restBuf[0] = '\0';
+ static const std::string lclStatic = inFormatter();
+ static char const* format = lclStatic.c_str();
+ int numScanned = std::sscanf(inputLine.c_str(),
+ format, chrBuf,
+ &start_, &end_, idBuf,
+ &measurement_, restBuf);
+
+ this->chrom(chrBuf);
+ this->id(idBuf);
+ if ( rest_ )
+ delete [] rest_;
+ rest_ = new char[std::strlen(restBuf) + 1];
+ std::strcpy(rest_, restBuf);
+ if ( fullrest_ )
+ delete [] fullrest_;
+ std::size_t sz = (std::strlen(restBuf)+1) + (std::strlen(idBuf) + 1);
+ fullrest_ = new char[sz];
+ restOffset_ = -1;
+ std::strcpy(fullrest_, idBuf);
+ if ( restBuf[0] != '\0' )
+ restOffset_ = std::strlen(idBuf);
+ std::strcat(fullrest_, restBuf);
+ return numScanned;
+ }
+ inline int readline(FILE* inputFile) {
+ static char chrBuf[MAXCHROMSIZE + 1];
+ chrBuf[0] = '\0';
+ static char idBuf[MAXIDSIZE + 1];
+ idBuf[0] = '\0';
+ static char restBuf[MAXRESTSIZE + 1];
+ restBuf[0] = '\0';
+
+ static const std::string lclStatic = inFormatter();
+ static char const* format = lclStatic.c_str();
+ int numScanned = std::fscanf(inputFile,
+ format, chrBuf,
+ &start_, &end_, idBuf,
+ &measurement_, restBuf);
+
+ std::fgetc(inputFile); // Read and discard trailing newline
+ this->chrom(chrBuf);
+ this->id(idBuf);
+ if ( rest_ )
+ delete [] rest_;
+ rest_ = new char[std::strlen(restBuf) + 1];
+ std::strcpy(rest_, restBuf);
+
+ if ( fullrest_ )
+ delete [] fullrest_;
+
+ std::size_t sz = (std::strlen(restBuf)+1) + (std::strlen(idBuf) + 1);
+ fullrest_ = new char[sz];
+ restOffset_ = -1;
+ std::strcpy(fullrest_, idBuf);
+ if ( restBuf[0] != '\0' )
+ restOffset_ = std::strlen(idBuf);
+ std::strcat(fullrest_, restBuf);
+ return numScanned;
+ }
+
+ // Operators
+ Bed5& operator=(const Bed5& c) {
+ BaseClass::operator=(c);
+ if ( rest_ )
+ delete [] rest_;
+ if ( fullrest_ )
+ delete [] fullrest_;
+ rest_ = new char[(c.rest_ != NULL) ? (std::strlen(c.rest_) + 1) : 1];
+ *rest_ = '\0'; if ( c.rest_ != NULL ) std::strcpy(rest_, c.rest_);
+ fullrest_ = new char[(c.fullrest_ != NULL) ? (std::strlen(c.fullrest_) + 1) : 1];
+ *fullrest_ = '\0'; if ( c.fullrest_ != NULL ) std::strcpy(fullrest_, c.fullrest_);
+ return *this;
+ }
+
+ ~Bed5() {
+ if ( rest_ )
+ delete [] rest_;
+ if ( fullrest_ )
+ delete [] fullrest_;
+ }
+
+ // Parameters
+ static const bool UseRest = true;
+
+ protected:
+ typedef Bed5<Bed4Type, MeasureType, false> BaseClass;
+ using BaseClass::chrom_;
+ using BaseClass::start_;
+ using BaseClass::end_;
+ using BaseClass::id_;
+ using BaseClass::measurement_;
+
+ int restOffset_;
+ char* rest_;
+ char* fullrest_;
+
+ static std::string outFormatter() {
+ return(BaseClass::outFormatter() + "%s");
+ }
+
+ static std::string inFormatter() {
+ return(BaseClass::outFormatter() + "%[^\n]s\n");
+ }
+ };
+
+ } // namespace NoPool
+
+} // namespace Bed
+
+#endif // BED_MINMEM_HPP
diff --git a/interfaces/general-headers/data/starch/starchApi.hpp b/interfaces/general-headers/data/starch/starchApi.hpp
index 536f516..eb7eb01 100644
--- a/interfaces/general-headers/data/starch/starchApi.hpp
+++ b/interfaces/general-headers/data/starch/starchApi.hpp
@@ -865,8 +865,10 @@ namespace starch
archMdIter = archMdIter->next;
if (archMdIter)
setCurrentChromosome(archMdIter->chromosome);
- else
- free(currentChromosome), currentChromosome = NULL;
+ else {
+ free(currentChromosome);
+ currentChromosome = NULL;
+ }
}
void setCurrentChromosome(char *_cC) {
if (currentChromosome) {
@@ -880,7 +882,16 @@ namespace starch
}
void setCurrentStart(Bed::SignedCoordType _cS) { currentStart = _cS; }
void setCurrentStop(Bed::SignedCoordType _cS) { currentStop = _cS; }
- void setCurrentRemainder(char * _remainder) { currentRemainder = _remainder; }
+ void setCurrentRemainder(char * _remainder) {
+ if (currentRemainder) {
+ free(currentRemainder);
+ currentRemainder = NULL;
+ }
+ currentRemainder = static_cast<char *>( malloc (strlen(_remainder) + 1) );
+ if (currentRemainder) {
+ strncpy(currentRemainder, _remainder, strlen(_remainder) + 1);
+ }
+ }
void setSelectedChromosome(const std::string& _selChr) { selectedChromosome = _selChr; }
};
@@ -1462,7 +1473,7 @@ namespace starch
extractLine(line);
firstPass = false;
}
-
+
if ((t_firstInputToken[0] == 'p') && (archMdIter)) {
#ifdef DEBUG
std::fprintf(stderr, "--> prefix is 'p'\n");
@@ -1566,7 +1577,7 @@ namespace starch
&_currRemainder,
&_currRemainderLen);
#ifdef DEBUG
- std::fprintf(stderr,"t_ [ %s | %s] _curr [ %s | %" PRId64 " | %" PRId64 " ]\n", t_firstInputToken, t_secondInputToken, _currChr, _currStart, _currStop);
+ std::fprintf(stderr,"t_ [ %s | %s] _curr [ %s | %" PRId64 " | %" PRId64 " | remlen: %zu]\n", t_firstInputToken, t_secondInputToken, _currChr, _currStart, _currStop, _currRemainderLen);
#endif
if (res != 0)
break;
@@ -1772,7 +1783,7 @@ namespace starch
case kUndefined: {
throw(std::string("ERROR: backend compression type is undefined"));
}
- }
+ }
}
if ((_currChr && archType == kGzip && !postBreakdownZValuesIdentical) || (_currChr && archType == kBzip2)) {
@@ -1781,11 +1792,16 @@ namespace starch
#endif
setCurrentStart(_currStart);
setCurrentStop(_currStop);
- setCurrentRemainder(_currRemainder);
- if (_currRemainder)
+ if (_currRemainder) {
+ setCurrentRemainder(_currRemainder);
+ }
+
+ if (_currRemainder && (_currRemainderLen > 0)) {
std::sprintf(out, "%s\t%" PRId64 "\t%" PRId64 "\t%s", _currChr, _currStart, _currStop, _currRemainder);
- else
+ }
+ else {
std::sprintf(out, "%s\t%" PRId64 "\t%" PRId64, _currChr, _currStart, _currStop);
+ }
line = out;
if (archType == kGzip)
@@ -1896,14 +1912,14 @@ namespace starch
needToInflateZChunk = false;
}
- /* read through zOutBuf for newlines */
+ /* read through zOutBuf for newlines */
for (; zOutBufIdx < zHave; zBufIdx++) {
if (zOutBuf[zOutBufIdx++] == '\n') {
zLineBuf[zBufIdx] = '\0';
zBufIdx = 0;
#ifdef DEBUG
std::fprintf(stderr, "\n--> full line [ %s ]\n", zLineBuf);
-#endif
+#endif
return EXIT_SUCCESS;
}
else {
diff --git a/interfaces/general-headers/data/starch/starchHelpers.h b/interfaces/general-headers/data/starch/starchHelpers.h
index 8aebd03..d3b5b53 100644
--- a/interfaces/general-headers/data/starch/starchHelpers.h
+++ b/interfaces/general-headers/data/starch/starchHelpers.h
@@ -135,9 +135,9 @@ int STARCH2_transformHeaderlessBEDInput(const FILE *inFp,
const CompressionType compressionType,
const char *tag,
const char *note,
- const Boolean generatePerChrSignatureFlag,
+ const Boolean generatePerChrSignatureFlag,
const Boolean reportProgressFlag,
- const LineCountType reportProgressN);
+ const LineCountType reportProgressN);
int STARCH2_writeStarchHeaderToOutputFp(const unsigned char *header,
const FILE *fp);
diff --git a/interfaces/general-headers/suite/BEDOPS.Constants.hpp b/interfaces/general-headers/suite/BEDOPS.Constants.hpp
index 6dc7efd..1bc1c25 100644
--- a/interfaces/general-headers/suite/BEDOPS.Constants.hpp
+++ b/interfaces/general-headers/suite/BEDOPS.Constants.hpp
@@ -26,16 +26,45 @@
#ifndef CONSTANTS_BEDOPS_H
#define CONSTANTS_BEDOPS_H
-
+//
// Don't use these directly; they just synchronize C and C++'s uses below
// - just want to utilize C++'s type system explicitly
-#define INT_TOKEN_CHR_MAX_LENGTH 127
-#define INT_TOKEN_ID_MAX_LENGTH 16383
-#define INT_TOKEN_REST_MAX_LENGTH 8*131072
-#define INT_MAX_DEC_INTEGERS 12
-#define INT_MAX_COORD_VALUE 999999999999 /* MAX_DEC_INTEGERS decimal integers; we assume >= 64-bit systems */
-#define INT_TOKENS_MAX_LENGTH (TOKEN_CHR_MAX_LENGTH + TOKEN_ID_MAX_LENGTH + TOKEN_REST_MAX_LENGTH + 2*MAX_DEC_INTEGERS)
-#define INT_TOKENS_HEADER_MAX_LENGTH TOKENS_MAX_LENGTH
+//
+
+#ifndef REST_EXPONENT
+#define REST_EXPONENT 15
+#endif
+
+#ifndef ID_EXPONENT
+#define ID_EXPONENT 13
+#endif
+
+#ifndef CHROM_EXPONENT
+#define CHROM_EXPONENT 7
+#endif
+
+#ifdef __cplusplus
+
+#include "utility/CompilerMath.hpp"
+
+#define BASE_VALUE 2
+#define INT_TOKEN_CHR_MAX_LENGTH Ext::Pow<BASE_VALUE, CHROM_EXPONENT>::value-1
+#define INT_TOKEN_ID_MAX_LENGTH Ext::Pow<BASE_VALUE, ID_EXPONENT>::value-1
+#define INT_TOKEN_REST_MAX_LENGTH Ext::Pow<BASE_VALUE, REST_EXPONENT>::value-1
+
+#else
+
+#define pwrtwo(x) (1UL << (x))
+#define INT_TOKEN_CHR_MAX_LENGTH pwrtwo(CHROM_EXPONENT)-1
+#define INT_TOKEN_ID_MAX_LENGTH pwrtwo(ID_EXPONENT)-1
+#define INT_TOKEN_REST_MAX_LENGTH pwrtwo(REST_EXPONENT)-1
+
+#endif
+
+#define INT_MAX_DEC_INTEGERS 12L
+#define INT_MAX_COORD_VALUE 999999999999 /* INT_MAX_DEC_INTEGERS decimal integers; we assume >= 64-bit systems */
+#define INT_TOKENS_MAX_LENGTH (INT_TOKEN_CHR_MAX_LENGTH + INT_TOKEN_ID_MAX_LENGTH + INT_TOKEN_REST_MAX_LENGTH + 2*INT_MAX_DEC_INTEGERS)
+#define INT_TOKENS_HEADER_MAX_LENGTH INT_TOKENS_MAX_LENGTH
#define INT_TOKEN_CHR_FIELD_INDEX 0
#define INT_TOKEN_START_FIELD_INDEX 1
#define INT_TOKEN_STOP_FIELD_INDEX 2
@@ -52,8 +81,8 @@ namespace Bed {
typedef int64_t SignedCoordType;
typedef CoordType LineCountType;
typedef CoordType BaseCountType;
- typedef int LineLengthType;
-
+ typedef unsigned long LineLengthType;
+
static_assert(sizeof(SignedCoordType) >= sizeof(INT_MAX_COORD_VALUE), "INT_MAX_COORD_VALUE is too big!"); // expected-warning {{static_assert declarations are incompatible with C++98}}
constexpr LineLengthType TOKEN_CHR_MAX_LENGTH = INT_TOKEN_CHR_MAX_LENGTH;
@@ -78,7 +107,7 @@ namespace Bed {
typedef int64_t SignedCoordType;
typedef CoordType LineCountType;
typedef CoordType BaseCountType;
- typedef int LineLengthType;
+ typedef unsigned long LineLengthType;
#define TOKEN_CHR_MAX_LENGTH INT_TOKEN_CHR_MAX_LENGTH
#define TOKEN_ID_MAX_LENGTH INT_TOKEN_ID_MAX_LENGTH
diff --git a/interfaces/general-headers/suite/BEDOPS.Version.hpp b/interfaces/general-headers/suite/BEDOPS.Version.hpp
index b61da2b..c3812ab 100644
--- a/interfaces/general-headers/suite/BEDOPS.Version.hpp
+++ b/interfaces/general-headers/suite/BEDOPS.Version.hpp
@@ -34,11 +34,11 @@ namespace BEDOPS {
#endif
static const char* revision() {
- return("2.4.26");
+ return("2.4.28");
}
static const char* citation() {
- return("http://bioinformatics.oxfordjournals.org/content/28/14/1919.abstract");
+ return("http://bioinformatics.oxfordjournals.org/content/28/14/1919.abstract\n https://doi.org/10.1093/bioinformatics/bts277");
}
#ifdef __cplusplus
diff --git a/interfaces/general-headers/utility/PooledMemory.hpp b/interfaces/general-headers/utility/BitMonitor.hpp
similarity index 61%
copy from interfaces/general-headers/utility/PooledMemory.hpp
copy to interfaces/general-headers/utility/BitMonitor.hpp
index d094b55..9a61011 100644
--- a/interfaces/general-headers/utility/PooledMemory.hpp
+++ b/interfaces/general-headers/utility/BitMonitor.hpp
@@ -21,47 +21,152 @@
// 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA.
//
-
-#ifndef __UTILS_SIMPLE_SMALLOBJ_MEM__
-#define __UTILS_SIMPLE_SMALLOBJ_MEM__
+#ifndef UTILS_BITMONITOR
+#define UTILS_BITMONITOR
#include <algorithm>
#include <array>
#include <bitset>
+#include <iterator>
#include <limits>
-#include <map>
#include <ostream>
-#include <set>
#include <type_traits>
-#include <utility>
+
+#include "utility/CompilerMath.hpp"
namespace Ext {
- template <std::size_t Base, std::size_t L, bool b=(L<=Base)>
- struct IntLogN {
- static constexpr std::size_t value = 1 + IntLogN<Base, L/Base + (L%Base > 0)>::value;
- };
+ template <std::size_t Total>
+ struct BSet {
+ static constexpr std::size_t BITS = Total;
+ static constexpr std::size_t BASE = std::numeric_limits<unsigned char>::digits;
+ static constexpr std::size_t npos = std::numeric_limits<std::size_t>::max();
- template <std::size_t Base, std::size_t L>
- struct IntLogN<Base, L, true> {
- static constexpr std::size_t value = 1;
- };
+ BSet() : _count(0), _open(0) { for (std::size_t i=0; i<TBYTE; ++i) _charset[i]=CZERO; }
- template <std::size_t V, std::size_t W>
- struct Pow {
- static constexpr std::size_t value = V*Pow<V, W-1>::value;
- };
+ inline bool any() const { return _count < BITS; }
+ inline bool empty() const { return _count == 0; }
+ inline std::size_t size() const { return BITS; }
+ inline std::size_t get_open() { return (npos != _open) ? _open : find_first_unset(); }
- template <std::size_t V>
- struct Pow<V,1> {
- static constexpr std::size_t value = V;
- };
+ inline bool set(std::size_t bit) {
+ _charset[bit/BASE] |= (1 << (bit%BASE));
+ bool has_open = (++_count < BITS);
+ if ( bit == _open && has_open )
+ _open = (bit+1 < BITS) ? next_unset(bit) : find_first_unset(bit); // could still become npos
+ return has_open;
+ }
+
+ inline void set_all() {
+ for ( auto& c : _charset )
+ c = FULL;
+ _count = BITS;
+ _open = npos;
+ }
+
+ inline void unset(std::size_t bit) {
+ _charset[bit/BASE] &= ~(1 << (bit%BASE));
+ --_count;
+ if ( npos == _open )
+ _open = bit;
+ }
+
+ inline void unset_all() {
+ for ( auto& c : _charset )
+ c = CZERO;
+ _count = 0;
+ _open = 0;
+ }
+
+ inline std::size_t next_set(std::size_t start) const {
+ start += 1;
+ std::size_t bin = start/BASE;
+ if ( _charset[bin] ) {
+ for ( std::size_t i = start%BASE; i < BASE; ++i ) {
+ if (_charset[bin] & (1 << i))
+ return bin*BASE+i;
+ else if ( npos == _open )
+ _open = bin*BASE+i;
+ } // for
+ }
+
+ for ( std::size_t b = bin+1; b < TBYTE; ++b ) {
+ if ( _charset[b] ) {
+ for ( std::size_t i = 0; i < BASE; ++i ) {
+ if ( _charset[b] & (1 << i) )
+ return b*BASE+i;
+ else if ( npos == _open )
+ _open = bin*BASE+i;
+ } // for
+ }
+ } // for
+ return npos;
+ }
+
+ inline std::size_t find_first_set() {
+ if ( _charset[0] & (1 << 0) )
+ return 0;
+ else if ( npos == _open )
+ _open = 0;
+ return next_set(0);
+ }
+
+ inline std::size_t next_unset(std::size_t start) {
+ start += 1;
+ std::size_t bin = start/BASE;
+ for ( std::size_t i = start%BASE; i < BASE; ++i ) {
+ if ( !(_charset[bin] & (1 << i)) ) {
+ if ( npos == _open )
+ _open = bin*BASE+i;
+ return bin*BASE+i;
+ }
+ } // for
+
+ for ( std::size_t b = bin+1; b < TBYTE; ++b ) {
+ if ( _charset[b] != FULL ) {
+ for ( std::size_t i = 0; i < BASE; ++i ) {
+ if ( !(_charset[b] & (1 << i)) ) {
+ if ( npos == _open )
+ _open = b*BASE+i;
+ return b*BASE+i;
+ }
+ } // for
+ }
+ } // for
+ return npos;
+ }
+
+ inline std::size_t find_first_unset() {
+ if ( !(_charset[0] & (1 << 0) ) ) {
+ if ( npos == _open )
+ _open = 0;
+ return 0;
+ }
+ return next_unset(0);
+ }
- template <std::size_t V>
- struct Pow<V,0> {
- static constexpr std::size_t value = 0;
+ template <std::size_t A>
+ friend
+ std::ostream&
+ operator<<(std::ostream& os, const BSet<A>& r);
+
+ private:
+ static constexpr std::size_t TBYTE = BITS/BASE;
+ static constexpr unsigned char CZERO = (unsigned char)0;
+ static constexpr unsigned char FULL = std::numeric_limits<unsigned char>::max();
+
+ std::size_t _count, _open;
+ std::array<unsigned char, TBYTE> _charset;
};
+ template <std::size_t A>
+ std::ostream&
+ operator<<(std::ostream& os, const BSet<A>& r) {
+ std::copy(r._charset.begin(), r._charset.end(), std::ostream_iterator<std::bitset<8>>(os, " "));
+ os << std::endl;
+ return os;
+ }
+
template <std::size_t Base,
std::size_t Total, // undefined when Check==false
bool Check=(Base==std::numeric_limits<unsigned char>::digits) &&
@@ -125,6 +230,12 @@ namespace Ext {
return false;
}
+ inline void set_all() {
+ for ( auto& c : _charset )
+ c = FULL;
+ _nxt = npos;
+ }
+
inline void unset(std::size_t bit) {
std::size_t bin = bit/BASE;
bool pstatus = _charset[bin] != FULL;
@@ -150,6 +261,50 @@ namespace Ext {
} // while
}
+ inline void unset_all() {
+ for ( auto& c : _charset )
+ c = CZERO;
+ _nxt = 0;
+ }
+
+ inline std::size_t next_set(std::size_t start, std::size_t end = BITS, bool include_start = false) const {
+ std::size_t beg = (start + !include_start);
+ std::size_t bin = beg/BASE;
+ for ( std::size_t i = beg%BASE; i < BASE; ++i ) {
+ if (_charset[bin] & (1 << i))
+ return bin*BASE+i;
+ } // for
+
+ for ( std::size_t b = bin+1; b <= end/BASE; ++b ) {
+ if ( _charset[b] ) {
+ for ( std::size_t i = 0; i < BASE; ++i ) {
+ if ( _charset[b] & (1 << i) )
+ return b*BASE+i;
+ } // for
+ }
+ } // for
+ return npos;
+ }
+
+ inline std::size_t next_unset(std::size_t start, bool include_start = false) const {
+ std::size_t beg = (start + !include_start);
+ std::size_t bin = beg/BASE;
+ for ( std::size_t i = beg%BASE; i < BASE; ++i ) {
+ if ( !(_charset[bin] & (1 << i)) )
+ return bin*BASE+i;
+ } // for
+
+ for ( std::size_t b = bin+1; b <= BITS/BASE; ++b ) {
+ if ( _charset[b] != FULL ) {
+ for ( std::size_t i = 0; i < BASE; ++i ) {
+ if ( !(_charset[b] & (1 << i)) )
+ return b*BASE+i;
+ } // for
+ }
+ } // for
+ return npos;
+ }
+
private:
inline std::size_t find_open_child(std::size_t p) {
while ( BITS <= p ) {
@@ -213,15 +368,15 @@ namespace Ext {
/* forcing N to be a power of 8 as less than 8 with a bitset is not that great,
though it can be done by modifying Iter requirements.
*/
- template <std::size_t N,
+ template <std::size_t Base,
std::size_t StopLevel,
- std::size_t Iter=(N%std::numeric_limits<unsigned char>::digits==0) &&
- (StopLevel%N==0) &&
- (Pow<N, IntLogN<N, StopLevel>::value>::value==StopLevel)>
+ std::size_t Iter=(Base%std::numeric_limits<unsigned char>::digits==0) &&
+ (StopLevel%Base==0) &&
+ (Pow<Base, IntLogN<Base, StopLevel>::value>::value==StopLevel)>
struct BitMonitor {
- static constexpr std::size_t NVAL = N;
- static constexpr std::size_t MYSZ = Pow<NVAL,Iter>::value;
- static constexpr std::size_t PARENTSZ = Pow<NVAL,Iter-1>::value;
+ static constexpr std::size_t BASE = Base;
+ static constexpr std::size_t MYSZ = Pow<BASE,Iter>::value;
+ static constexpr std::size_t PARENTSZ = Pow<BASE,Iter-1>::value;
static constexpr std::size_t TOTALSZ = MYSZ+PARENTSZ;
static constexpr std::size_t LEVEL = Iter;
static constexpr bool STOP = false;
@@ -239,8 +394,8 @@ namespace Ext {
std::size_t find_open(std::size_t pbin) {
// don't call this - use get_open()
- pbin *= NVAL;
- for ( std::size_t idx = pbin; idx < pbin+NVAL; ++idx ) {
+ pbin *= BASE;
+ for ( std::size_t idx = pbin; idx < pbin+BASE; ++idx ) {
if ( !_bset[idx] ) {
_nxt = idx;
return _nxt;
@@ -254,10 +409,10 @@ namespace Ext {
std::size_t val = 0;
if ( !_children.set(bit, val) ) {
_bset[val] = true;
- cnt = val/NVAL;
- std::size_t pbin = cnt*NVAL;
+ cnt = val/BASE;
+ std::size_t pbin = cnt*BASE;
_nxt = npos;
- for ( std::size_t idx = pbin; idx < pbin+NVAL; ++idx ) {
+ for ( std::size_t idx = pbin; idx < pbin+BASE; ++idx ) {
if ( !_bset[idx] ) {
_nxt = idx;
break;
@@ -272,7 +427,7 @@ namespace Ext {
_children.unset(bit, cnt);
_bset[cnt] = false;
_nxt = cnt;
- cnt /= NVAL;
+ cnt /= BASE;
}
inline std::size_t size() const { return _children.size(); }
@@ -284,14 +439,14 @@ namespace Ext {
std::size_t _nxt;
std::bitset<MYSZ> _bset; // all zeroes by default
- BitMonitor<NVAL, StopLevel/NVAL, Iter+1> _children;
+ BitMonitor<BASE, StopLevel/BASE, Iter+1> _children;
};
- template <std::size_t N, std::size_t Iter>
- struct BitMonitor<N,N,Iter> {
- static constexpr std::size_t NVAL = N;
- static constexpr std::size_t MYSZ = Pow<NVAL,Iter>::value;
- static constexpr std::size_t PARENTSZ = Pow<NVAL,Iter-1>::value;
+ template <std::size_t Base, std::size_t Iter>
+ struct BitMonitor<Base,Base,Iter> {
+ static constexpr std::size_t BASE = Base;
+ static constexpr std::size_t MYSZ = Pow<BASE,Iter>::value;
+ static constexpr std::size_t PARENTSZ = Pow<BASE,Iter-1>::value;
static constexpr std::size_t TOTALSZ = MYSZ+PARENTSZ;
static constexpr std::size_t LEVEL = Iter;
static constexpr bool STOP = true;
@@ -306,8 +461,8 @@ namespace Ext {
}
std::size_t find_open(std::size_t pbin) {
- pbin *= NVAL;
- for ( std::size_t idx = pbin; idx < pbin+NVAL; ++idx ) {
+ pbin *= BASE;
+ for ( std::size_t idx = pbin; idx < pbin+BASE; ++idx ) {
if ( !_bset[idx] ) {
_nxt = idx;
return _nxt;
@@ -322,10 +477,10 @@ namespace Ext {
Zeros::NC_ZERO = Zeros::C_ZERO;
// make pbin the group that the parent class is monitoring
- cnt = bit/NVAL;
- std::size_t pbin = cnt*NVAL;
+ cnt = bit/BASE;
+ std::size_t pbin = cnt*BASE;
_nxt = npos;
- for ( std::size_t idx = bit+1; idx < pbin+NVAL; ++idx ) {
+ for ( std::size_t idx = bit+1; idx < pbin+BASE; ++idx ) {
if ( !_bset[idx] ) {
_nxt = idx;
return _nxt != npos;
@@ -343,7 +498,7 @@ namespace Ext {
inline void unset(std::size_t bit, std::size_t& cnt) {
_bset[bit] = false;
Zeros::NC_ZERO = Zeros::C_ZERO;
- cnt = bit/NVAL;
+ cnt = bit/BASE;
if ( _nxt == npos ) { _nxt = bit; }
}
@@ -379,130 +534,6 @@ namespace Ext {
return os;
}
-
- //==============
- // PooledMemory
- //==============
- template <typename DataType, std::size_t chunksz = 512, bool CallDestruct = false>
- struct PooledMemory; // atm, chunksz needs to be >=16 and divisible by 8
-
- template <typename DataType, std::size_t chunksz, bool CallDestruct>
- struct PooledMemory {
- typedef DataType type;
-
- PooledMemory() : _curr(new MemChunk()), _cache(nullptr)
- {
- _blocks.insert(_curr);
- _blockstarts.insert(_curr->_data);
- _r.insert(std::make_pair(_curr->_data, _curr));
- }
-
- template <typename... Args>
- inline
- type* construct(Args... parameters) {
- if ( !_curr->any() ) {
- if ( _cache )
- _curr = _cache;
- else
- _curr = new MemChunk();
-
- _cache = nullptr;
- _blocks.insert(_curr);
- _blockstarts.insert(_curr->_data);
- _r.insert(std::make_pair(_curr->_data, _curr));
- }
- return _curr->add(parameters...);
- }
-
- inline
- void release(type* b) {
- if ( 1 == _blockstarts.size() ) {
- _curr->remove(b);
- } else { // possible Chunk removal
- auto iter = _blockstarts.begin();
- MemChunk* m;
- if ( _blockstarts.size() < 10 ) {
- auto miter = _r.begin();
- while ( *iter > b ) { ++iter; ++miter; }
- m = miter->second;
- } else {
- iter = _blockstarts.lower_bound(b);
- m = _r[*iter];
- }
- m->remove(b);
- if ( m->empty() ) {
- _blocks.erase(m);
- _blockstarts.erase(iter);
- _r.erase(*iter);
- if ( !_cache )
- _cache = m;
- else
- delete m;
- }
- }
- }
-
- ~PooledMemory() {
- for ( auto b : _blocks )
- delete b;
- if ( _cache )
- delete _cache;
- }
-
- private:
- template <std::size_t basesz, std::size_t nelements>
- struct Chunk {
- Chunk() : _any(true), _cntr(0), _data{} { }
-
- inline bool any() const { return _any; } // any positions available?
- inline bool empty() const { return _cntr == 0; } // nothing set
-
- template <typename... Args>
- inline type* add(Args... parameters) {
- std::size_t trackpos = _tracker.get_open();
- type* address = static_cast<type*>(_data+trackpos);
- if ( CallDestruct && address ) { address->~type(); }
- _any &= _tracker.set(trackpos);
- ++_cntr;
- return new(address) type(parameters...);
- }
-
- inline void remove(type* bt) {
- // lazy deletion (see add())
- _tracker.unset(bt-_data);
- _any = true;
- --_cntr;
- }
-
- ~Chunk() {
- if ( CallDestruct ) {
- for ( std::size_t i = 0; i < _tracker.size(); ++i ) {
- type* address = static_cast<type*>(_data+i);
- if ( address ) { address->~type(); }
- } // for
- }
- }
-
- bool _any;
- std::size_t _cntr;
- type _data[nelements];
- //BitMonitor<basesz, nelements> _tracker; // nelements == nbits monitored
- BitMonitor2<basesz, nelements> _tracker; // nelements == nbits monitored
- };
-
- private:
- static constexpr std::size_t BaseSize = std::numeric_limits<unsigned char>::digits;
- static constexpr std::size_t NBits = Pow<BaseSize, IntLogN<BaseSize, chunksz>::value>::value;
- typedef Chunk<BaseSize, NBits> MemChunk;
-
- MemChunk* _curr;
- MemChunk* _cache;
- // Important to remember that _blocks, _blockstarts, _r all have the same #elements
- std::set<MemChunk*, std::greater<MemChunk*>> _blocks;
- std::set<type*, std::greater<type*>> _blockstarts;
- std::map<type*, MemChunk*, std::greater<type*>> _r;
- };
-
} // namespace Ext
-#endif // __UTILS_SIMPLE_SMALLOBJ_MEM__
+#endif // UTILS_BITMONITOR__
diff --git a/interfaces/general-headers/utility/CharPooledMemory.hpp b/interfaces/general-headers/utility/CharPooledMemory.hpp
new file mode 100644
index 0000000..267bb60
--- /dev/null
+++ b/interfaces/general-headers/utility/CharPooledMemory.hpp
@@ -0,0 +1,521 @@
+/*
+ Author: Shane Neph
+ Date: Thu Nov 24 20:16:29 PST 2016
+*/
+//
+// BEDOPS
+// Copyright (C) 2011-2016 Shane Neph, Scott Kuehn and Alex Reynolds
+//
+// This program is free software; you can redistribute it and/or modify
+// it under the terms of the GNU General Public License as published by
+// the Free Software Foundation; either version 2 of the License, or
+// (at your option) any later version.
+//
+// This program is distributed in the hope that it will be useful,
+// but WITHOUT ANY WARRANTY; without even the implied warranty of
+// MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+// GNU General Public License for more details.
+//
+// You should have received a copy of the GNU General Public License along
+// with this program; if not, write to the Free Software Foundation, Inc.,
+// 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA.
+
+#ifndef UTILS_SIMPLE_CHARARRAY_MEM
+#define UTILS_SIMPLE_CHARARRAY_MEM
+
+#include <cstring>
+#include <exception>
+#include <functional>
+#include <limits>
+#include <list>
+#include <map>
+#include <memory>
+#include <set>
+#include <utility>
+
+
+#include "utility/BitMonitor.hpp"
+
+namespace Ext {
+
+ template <std::size_t Sz>
+ struct PooledCharMemory2 {
+
+ PooledCharMemory2() : _curr(new MemChunk()), _cache(nullptr)
+ {
+ _blocks.insert(_curr);
+ _blockstarts.insert(_curr->_data);
+ _r.insert(std::make_pair(_curr->_data, _curr));
+ }
+
+ inline std::size_t
+ nblocks() const { return _blocks.size(); }
+
+ inline char*
+ construct(char const* val)
+ {
+ auto p = _curr->add(val);
+ if ( p )
+ return p;
+
+ /* current memory block is full */
+ if ( _cache ) {
+ _cache->clear();
+ _curr = _cache;
+ _cache = nullptr;
+ _blocks.insert(_curr);
+ _blockstarts.insert(_curr->_data);
+ _r.insert(std::make_pair(_curr->_data, _curr));
+ } else {
+ for ( auto& i : _blocks ) {
+ /* ensure no current block can accept val
+ before adding another MemChunk
+ */
+ if ( i != _curr ) {
+ auto q = i->add(val);
+ if ( q ) {
+ _curr = i;
+ return q;
+ }
+ }
+ } // for
+ if ( std::strlen(val) > Sz )
+ throw std::logic_error("Cannot store a string that large in PooledCharMemory2<Sz>");
+ _curr = new MemChunk();
+ _blocks.insert(_curr);
+ _blockstarts.insert(_curr->_data);
+ _r.insert(std::make_pair(_curr->_data, _curr));
+ }
+ return _curr->add(val);
+ }
+
+ inline void
+ release(char* b)
+ {
+ if ( 1 == _blockstarts.size() )
+ _curr->remove(b);
+ else { // possible Chunk removal
+ auto iter = _blockstarts.begin();
+ MemChunk* m;
+ if ( _blockstarts.size() < 10 ) {
+ auto miter = _r.begin();
+ while ( *iter > b ) { ++iter; ++miter; }
+ m = miter->second;
+ } else {
+ iter = _blockstarts.lower_bound(b);
+ m = _r[*iter];
+ }
+ m->remove(b);
+ if ( m->empty() ) {
+ _blocks.erase(m);
+ _blockstarts.erase(iter);
+ _r.erase(*iter);
+ if ( !_cache )
+ _cache = m;
+ else
+ delete m;
+ if ( m == _curr )
+ _curr = *(_blocks.begin()); // important if we drop back to 1 block
+ }
+ }
+ }
+
+ ~PooledCharMemory2()
+ {
+ for ( auto b : _blocks )
+ delete b;
+ if ( _cache )
+ delete _cache;
+ }
+
+ private:
+ template <std::size_t nelements>
+ struct CharChunk {
+ static constexpr std::size_t npos = std::numeric_limits<std::size_t>::max();
+
+ CharChunk() : _cc(0), _cntr(0), _data{} /*, _tracker(nelements), _dirty(nelements)*/
+ {
+ _data[nelements] = '\0';
+ /* leave _open empty until we've exhausted first pass of nelements */
+ }
+
+ inline bool
+ empty() const
+ {
+ return _cntr == 0;
+ }
+
+ inline char*
+ add(char const* c)
+ {
+ /* not protecting against c == nullptr in private, nested class */
+ if ( _cc == nelements ) {
+ auto a = find_open(c);
+ if ( a )
+ ++_cntr;
+ return a;
+ }
+
+ std::size_t i = 0, start = _cc;
+ bool ok = false;
+ while ( start < nelements ) {
+ _data[start++] = c[i];
+ if ( c[i++] == '\0' ) {
+ ok = true;
+ break;
+ }
+ } // while
+
+ if ( start == nelements && c[i] == '\0' ) {
+ _data[start] = '\0'; // _data has nelements+1
+ ok = true;
+ }
+
+ if ( ok ) {
+ std::swap(start, _cc);
+ ++_cntr;
+ _tracker.set(start);
+ return _data+start;
+ }
+ auto a = find_open(c);
+ if ( a )
+ ++_cntr;
+ return a;
+ }
+
+ inline void
+ remove(char const* c)
+ {
+ _dirty.set(c - _data);
+ _tracker.unset(c - _data);
+ --_cntr;
+ }
+
+ inline void
+ clear()
+ {
+ _cntr = 0;
+ _cc = 0;
+ _data[nelements] = '\0';
+ _tracker.unset_all();
+ _dirty.unset_all();
+ _open.clear();
+ }
+
+ private:
+ char*
+ find_open(char const* c)
+ {
+ std::size_t need = std::strlen(c);
+
+ auto nxt = _open.lower_bound(need);
+ if ( nxt != _open.end() ) {
+ std::strcpy(_data+nxt->second, c);
+ std::size_t newlength = (nxt->first-need);
+ if ( newlength > 1 ) { // if == 1, can only hold '\0'
+ _open.insert(std::make_pair(newlength-1, nxt->second+need+1));
+ _dirty.set(nxt->second+need+1);
+ }
+ _dirty.unset(nxt->second);
+ _tracker.set(nxt->second);
+ _open.erase(nxt);
+ return _data+nxt->second;
+ }
+
+ std::size_t f = _dirty.find_first_set(), f2 = 0, g;
+ while ( f != _dirty.npos ) {
+ g = _tracker.next_set(f);
+ if ( g == _tracker.npos )
+ g = nelements;
+
+ f2 = f;
+ while ( (f2 = _dirty.next_set(f2)) < g ) {
+ if ( f2 == _dirty.npos )
+ break;
+ _dirty.unset(f2);
+ } // while
+
+ if ( g-f > need ) {
+ std::strcpy(_data+f, c);
+ _dirty.unset(f);
+ _dirty.set(f+need);
+ _tracker.set(f);
+ return _data+f;
+ }
+
+ if ( _open.size()<MAXLOOKUP && (g-f)>1 )
+ _open.insert(std::make_pair(g-f-1, f));
+ else if ( _open.size() == MAXLOOKUP && (g-f)>(_open.begin()->first) ) {
+ _open.insert(std::make_pair(g-f-1, f));
+ _open.erase(_open.begin());
+ }
+
+ f = f2;
+ } // while
+ return nullptr;
+ }
+
+ friend struct PooledCharMemory2<nelements>;
+
+ static constexpr std::size_t MAXLOOKUP = 100;
+
+ std::size_t _cc;
+ std::size_t _cntr;
+ char _data[nelements+1];
+ BSet<nelements> _tracker, _dirty;
+ std::multimap<std::size_t, std::size_t> _open; // size, position
+ };
+
+ typedef CharChunk<Sz> MemChunk;
+
+ MemChunk* _curr;
+ MemChunk* _cache;
+ // Important to remember that _blocks, _blockstarts, _r all have the same #elements
+ std::set<MemChunk*, std::greater<MemChunk*>> _blocks;
+ std::set<char*, std::greater<char*>> _blockstarts;
+ std::map<char*, MemChunk*, std::greater<char*>> _r;
+ };
+
+ /*********************************************************
+ *********************************************************/
+ template <std::size_t Sz>
+ struct PooledCharMemory {
+
+ PooledCharMemory() : _curr(new MemChunk()), _cache(nullptr)
+ {
+ _blocks.insert(_curr);
+ _blockstarts.insert(_curr->_data);
+ _r.insert(std::make_pair(_curr->_data, _curr));
+ }
+
+ inline std::size_t
+ nblocks() const { return _blocks.size(); }
+
+ inline char*
+ construct(char const* val)
+ {
+ auto p = _curr->add(val);
+ if ( p )
+ return p;
+
+ /* current memory block is full */
+ if ( _cache ) {
+ _cache->clear();
+ _curr = _cache;
+ _cache = nullptr;
+ _blocks.insert(_curr);
+ _blockstarts.insert(_curr->_data);
+ _r.insert(std::make_pair(_curr->_data, _curr));
+ } else {
+ for ( auto& i : _blocks ) {
+ /* ensure no current block can accept val
+ before adding another MemChunk
+ */
+ if ( i != _curr ) {
+ auto q = i->add(val);
+ if ( q ) {
+ _curr = i;
+ return q;
+ }
+ }
+ } // for
+ if ( std::strlen(val) > Sz )
+ throw std::logic_error("Cannot store a string that large in PooledCharMemory<Sz>");
+ _curr = new MemChunk();
+ _blocks.insert(_curr);
+ _blockstarts.insert(_curr->_data);
+ _r.insert(std::make_pair(_curr->_data, _curr));
+ }
+ auto r = _curr->add(val);
+ return r;
+ }
+
+ inline void
+ release(char* b)
+ {
+ if ( 1 == _blockstarts.size() )
+ _curr->remove(b);
+ else { // possible Chunk removal
+ auto iter = _blockstarts.begin();
+ MemChunk* m;
+ if ( _blockstarts.size() < 10 ) {
+ auto miter = _r.begin();
+ while ( *iter > b ) { ++iter; ++miter; }
+ m = miter->second;
+ } else {
+ iter = _blockstarts.lower_bound(b);
+ m = _r[*iter];
+ }
+ m->remove(b);
+ if ( m->empty() ) {
+ _blocks.erase(m);
+ _blockstarts.erase(iter);
+ _r.erase(*iter);
+ if ( !_cache )
+ _cache = m;
+ else
+ delete m;
+ if ( m == _curr )
+ _curr = *(_blocks.begin()); // important if we drop back to 1 block
+ }
+ }
+ }
+
+ ~PooledCharMemory()
+ {
+ for ( auto b : _blocks )
+ delete b;
+ if ( _cache )
+ delete _cache;
+ }
+
+ private:
+ template <std::size_t nelements>
+ struct CharChunk {
+ static constexpr std::size_t npos = std::numeric_limits<std::size_t>::max();
+
+ CharChunk() : _cc(0), _cntr(0), _data{}
+ {
+ _data[nelements] = '\0';
+ /* leave _open empty until we've exhausted first pass of nelements */
+ }
+
+ inline bool
+ empty() const
+ {
+ return _cntr == 0;
+ }
+
+ inline char*
+ add(char const* c)
+ {
+ /* not protecting against c == nullptr in private, nested class */
+ if ( _cc == nelements ) {
+ auto a = find_open(c);
+ if ( a ) {
+ ++_cntr;
+ _tracker.set(a - _data);
+ }
+ return a;
+ }
+
+ std::size_t i = 0, start = _cc;
+ bool ok = false;
+ while ( start < nelements ) {
+ _data[start++] = c[i];
+ if ( c[i++] == '\0' ) {
+ ok = true;
+ break;
+ }
+ } // while
+
+ if ( start == nelements && c[i] == '\0' ) {
+ _data[start] = '\0'; // _data has nelements+1
+ ok = true;
+ }
+
+ if ( ok ) {
+ std::swap(start, _cc);
+ ++_cntr;
+ _tracker.set(start);
+ return _data+start;
+ }
+
+ auto a = find_open(c);
+ if ( a ) {
+ ++_cntr;
+ _tracker.set(a - _data);
+ }
+ return a;
+ }
+
+ inline void
+ remove(char const* c)
+ {
+ _dirty.push_back(c - _data);
+ _tracker.unset(c - _data);
+ --_cntr;
+ }
+
+ inline void
+ clear()
+ {
+ _cntr = 0;
+ _cc = 0;
+ _open.clear(); // leave empty until we've exhausted first pass of nelements
+ _dirty.clear();
+ _tracker.unset_all();
+ _data[nelements] = '\0';
+ }
+
+ private:
+ inline char*
+ find_open(char const* c)
+ {
+ std::size_t sz = std::strlen(c);
+ auto nxt = _open.lower_bound(sz);
+ if ( nxt != _open.end() ) {
+ std::strcpy(_data+nxt->second, c);
+ std::size_t newlength = (nxt->first-sz);
+ if ( newlength > 1 ) // if == 1, can only hold '\0'
+ _open.insert(std::make_pair(newlength-1, nxt->second+sz+1));
+ _tracker.set(nxt->second);
+ _open.erase(nxt);
+ return _data+nxt->second;
+ }
+ return clean(c, sz);
+ }
+
+ char*
+ clean(char const* c, std::size_t need)
+ {
+ // potentially very slow; try to find first location that fits c
+ for ( auto iter = _dirty.begin(); iter != _dirty.end(); iter = _dirty.erase(iter) ) {
+ std::size_t pos = *iter;
+ std::size_t lng = _tracker.next_set(pos, nelements);
+ if ( lng != _tracker.npos )
+ lng -= (pos+1); // +1 for '\0'; lng is at least 1 bigger than pos
+ else
+ lng = nelements + 1 - pos; // +1 b/c _data has nelements+1 elements with last == '\0'
+
+ if ( lng >= need ) {
+ std::strcpy(_data+pos, c);
+ _tracker.set(pos);
+ if ( lng-need > 1 ) // if == 1, can only hold '\0'
+ _open.insert(std::make_pair(lng-need-1, pos+need+1));
+ _dirty.erase(iter);
+ return _data+pos;
+ }
+ else
+ _open.insert(std::make_pair(lng, pos));
+ } // for
+ _dirty.clear();
+ return nullptr;
+ }
+
+ friend struct PooledCharMemory<nelements>;
+
+ static constexpr std::size_t BaseSize = std::numeric_limits<unsigned char>::digits;
+ static constexpr std::size_t NBits = Pow<BaseSize, IntLogN<BaseSize, nelements>::value>::value;
+
+ std::size_t _cc;
+ std::size_t _cntr;
+ char _data[nelements+1];
+ BitMonitor2<BaseSize, NBits> _tracker;
+ std::multimap<std::size_t, std::size_t> _open; // size, position
+ std::list<std::size_t> _dirty; // position
+ };
+
+ typedef CharChunk<Sz> MemChunk;
+
+ MemChunk* _curr;
+ MemChunk* _cache;
+ // Important to remember that _blocks, _blockstarts, _r all have the same #elements
+ std::set<MemChunk*, std::greater<MemChunk*>> _blocks;
+ std::set<char*, std::greater<char*>> _blockstarts;
+ std::map<char*, MemChunk*, std::greater<char*>> _r;
+ };
+
+} // namespace Ext
+
+#endif // UTILS_SIMPLE_CHARARRAY_MEM
diff --git a/interfaces/general-headers/utility/SingletonType.hpp b/interfaces/general-headers/utility/CompilerMath.hpp
old mode 100755
new mode 100644
similarity index 53%
copy from interfaces/general-headers/utility/SingletonType.hpp
copy to interfaces/general-headers/utility/CompilerMath.hpp
index a97c5a3..c8609a8
--- a/interfaces/general-headers/utility/SingletonType.hpp
+++ b/interfaces/general-headers/utility/CompilerMath.hpp
@@ -1,6 +1,6 @@
/*
- Author: Shane Neph & Scott Kuehn
- Date: Fri Aug 10 15:04:51 PDT 2007
+ Author: Shane Neph
+ Date: Mon Jun 5 13:34:58 PDT 2017
*/
//
// BEDOPS
@@ -21,17 +21,36 @@
// 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA.
//
-#ifndef SINGLETONTYPE_H
-#define SINGLETONTYPE_H
+#ifndef UTILS_COMPILERMATH
+#define UTILS_COMPILERMATH
+
+#include <cstddef>
namespace Ext {
- template <typename T>
- struct SingletonType {
- static T* Instance() {
- static T t;
- return(&t);
- }
+ template <std::size_t Base, std::size_t L, bool b=(L<=Base)>
+ struct IntLogN {
+ static constexpr std::size_t value = 1 + IntLogN<Base, L/Base + (L%Base > 0)>::value;
+ };
+
+ template <std::size_t Base, std::size_t L>
+ struct IntLogN<Base, L, true> {
+ static constexpr std::size_t value = 1;
+ };
+
+ template <std::size_t V, std::size_t W>
+ struct Pow {
+ static constexpr std::size_t value = V*Pow<V, W-1>::value;
+ };
+
+ template <std::size_t V>
+ struct Pow<V,1> {
+ static constexpr std::size_t value = V;
+ };
+
+ template <std::size_t V>
+ struct Pow<V,0> {
+ static constexpr std::size_t value = 0;
};
} // namespace Ext
-#endif // SINGLETONTYPE_H
+#endif // UTILS_COMPILERMATH
diff --git a/interfaces/general-headers/utility/PooledMemory.hpp b/interfaces/general-headers/utility/PooledMemory.hpp
index d094b55..4c6a03a 100644
--- a/interfaces/general-headers/utility/PooledMemory.hpp
+++ b/interfaces/general-headers/utility/PooledMemory.hpp
@@ -21,370 +21,24 @@
// 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA.
//
+#ifndef UTILS_SIMPLE_SMALLOBJ_MEM
+#define UTILS_SIMPLE_SMALLOBJ_MEM
-#ifndef __UTILS_SIMPLE_SMALLOBJ_MEM__
-#define __UTILS_SIMPLE_SMALLOBJ_MEM__
-
-#include <algorithm>
-#include <array>
-#include <bitset>
+#include <functional>
#include <limits>
#include <map>
-#include <ostream>
#include <set>
-#include <type_traits>
#include <utility>
-namespace Ext {
-
- template <std::size_t Base, std::size_t L, bool b=(L<=Base)>
- struct IntLogN {
- static constexpr std::size_t value = 1 + IntLogN<Base, L/Base + (L%Base > 0)>::value;
- };
-
- template <std::size_t Base, std::size_t L>
- struct IntLogN<Base, L, true> {
- static constexpr std::size_t value = 1;
- };
-
- template <std::size_t V, std::size_t W>
- struct Pow {
- static constexpr std::size_t value = V*Pow<V, W-1>::value;
- };
-
- template <std::size_t V>
- struct Pow<V,1> {
- static constexpr std::size_t value = V;
- };
-
- template <std::size_t V>
- struct Pow<V,0> {
- static constexpr std::size_t value = 0;
- };
-
- template <std::size_t Base,
- std::size_t Total, // undefined when Check==false
- bool Check=(Base==std::numeric_limits<unsigned char>::digits) &&
- (Total%Base==0) &&
- (Pow<Base, IntLogN<Base, Total>::value>::value==Total)>
- struct BitMonitor2;
-
- template <std::size_t Base,
- std::size_t Total>
- struct BitMonitor2<Base, Total, true> {
- static constexpr std::size_t BASE = std::numeric_limits<unsigned char>::digits;
- static constexpr std::size_t TOTAL = Total + BitMonitor2<Base, Total/Base>::TOTAL;
- static constexpr std::size_t BITS = Total;
- static constexpr std::size_t npos = std::numeric_limits<std::size_t>::max();
-
- BitMonitor2() : _nxt(0) { for( std::size_t i=0; i<TBYTE; ++i) _charset[i]=CZERO; }
- inline bool any() const { return _charset[LAST_BYTE] != FULL; }
- inline std::size_t get_open() const { return _nxt; }
- inline std::size_t size() const { return BITS; }
-
- inline bool set(std::size_t bit) {
- std::size_t bin = bit/BASE;
- _charset[bin] |= (1 << (bit%BASE));
- if ( _charset[bin] != FULL ) {
- if ( bit == _nxt ) {
- for ( std::size_t i = 0; i < BASE; ++i ) {
- if ( !(_charset[bin] & (1 << i)) ) {
- _nxt = BASE*bin+i;
- break;
- }
- } // for
- }
- return true;
- }
-
- std::size_t idx = BITS;
- std::size_t val = bin; // val == bit/BASE
- bin = BITS;
- std::size_t parent = (bin + val);
- std::size_t pbyte = parent/BASE;
- while ( parent < TOTAL ) {
- _charset[pbyte] |= (1 << (val%BASE));
- if ( _charset[pbyte] != FULL ) {
- if ( _nxt != bit )
- return true;
- _nxt = npos;
- for ( std::size_t i = 0; i < BASE; ++i ) {
- if ( !(_charset[pbyte] & (1 << i)) ) {
- _nxt = find_open_child(pbyte*BASE+i);
- break;
- }
- } // for
- return true;
- }
- idx /= BASE;
- bin += idx;
- val /= BASE;
- parent = bin + val;
- pbyte = parent/BASE;
- } // while
- return false;
- }
-
- inline void unset(std::size_t bit) {
- std::size_t bin = bit/BASE;
- bool pstatus = _charset[bin] != FULL;
- _charset[bin] &= ~(1 << (bit%BASE));
- _nxt = bit;
- if ( pstatus ) // parent wasn't FULL even before unsetting bit
- return;
-
- // unset parent from FULL
- std::size_t parent_bit = BITS + bin; // bin=bit/BASE
- _charset[parent_bit/BASE] &= ~(1 << (parent_bit%BASE));
-
- std::size_t val = BITS/BASE;
- std::size_t idx = BITS + val;
- bin /= BASE;
- while ( !pstatus && (parent_bit = idx + bin) < TOTAL ) {
- if ( _charset[parent_bit/BASE] != FULL )
- pstatus = true;
- _charset[parent_bit/BASE] &= ~(1 << (parent_bit%BASE));
- val /= BASE;
- idx += val;
- bin /= BASE;
- } // while
- }
-
- private:
- inline std::size_t find_open_child(std::size_t p) {
- while ( BITS <= p ) {
- std::size_t isum = BITS;
- std::size_t inow = BITS;
- std::size_t itrail = 0, ptrail = 0;
- while ( isum < p ) {
- inow /= BASE;
- ptrail = itrail;
- itrail = isum;
- isum += inow;
- } // while
- if ( isum > p ) { isum = itrail; itrail = ptrail; }
- p -= isum;
- p *= BASE;
- p += itrail;
- std::size_t pbyte = p/BASE;
- for ( std::size_t i = 0; i < BASE; ++i ) {
- if ( !(_charset[pbyte] & (1 << i)) ) {
- p += i;
- break;
- }
- } // for
- } // while
- return p;
- }
-
- template <std::size_t A, std::size_t B, bool C>
- friend
- typename std::enable_if<C, std::ostream&>::type
- operator<<(std::ostream& os, const BitMonitor2<A,B,C>& r);
-
- private:
- static constexpr unsigned char FULL = std::numeric_limits<unsigned char>::max();
- static constexpr unsigned char CZERO = (unsigned char)0;
- static constexpr std::size_t TBYTE = TOTAL/BASE;
- static constexpr std::size_t LAST_BYTE = TBYTE-1;
- std::size_t _nxt;
- std::array<unsigned char, TBYTE> _charset;
- };
-
- template <std::size_t Base>
- struct BitMonitor2<Base, Base, true> {
- static constexpr std::size_t BASE = Base;
- static constexpr std::size_t TOTAL = Base;
- };
-
- template <std::size_t A, std::size_t B, bool C>
- typename std::enable_if<C, std::ostream&>::type
- operator<<(std::ostream& os, const BitMonitor2<A,B,C>& r) {
- std::copy(r._charset.begin(), r._charset.end(), std::ostream_iterator<std::bitset<8>>(os, " "));
- os << std::endl;
- return os;
- }
-
- namespace Zeros {
- std::size_t NC_ZERO = 0;
- static constexpr std::size_t C_ZERO = 0;
- } // namespace Zeros
-
- /* forcing N to be a power of 8 as less than 8 with a bitset is not that great,
- though it can be done by modifying Iter requirements.
- */
- template <std::size_t N,
- std::size_t StopLevel,
- std::size_t Iter=(N%std::numeric_limits<unsigned char>::digits==0) &&
- (StopLevel%N==0) &&
- (Pow<N, IntLogN<N, StopLevel>::value>::value==StopLevel)>
- struct BitMonitor {
- static constexpr std::size_t NVAL = N;
- static constexpr std::size_t MYSZ = Pow<NVAL,Iter>::value;
- static constexpr std::size_t PARENTSZ = Pow<NVAL,Iter-1>::value;
- static constexpr std::size_t TOTALSZ = MYSZ+PARENTSZ;
- static constexpr std::size_t LEVEL = Iter;
- static constexpr bool STOP = false;
- static constexpr std::size_t npos = std::numeric_limits<std::size_t>::max();
-
- BitMonitor() : _nxt(0) {}
-
- inline bool any() const { return _nxt != npos; }
- inline std::size_t get_open() {
- // assume any() is true, but perhaps not _children.any()
- if ( !_children.any() )
- _children.find_open(_nxt); // ignore rtn value
- return _children.get_open();
- }
-
- std::size_t find_open(std::size_t pbin) {
- // don't call this - use get_open()
- pbin *= NVAL;
- for ( std::size_t idx = pbin; idx < pbin+NVAL; ++idx ) {
- if ( !_bset[idx] ) {
- _nxt = idx;
- return _nxt;
- }
- } // for
- return npos; // something bad just happened
- }
-
- // calling program can simply check return value here instead of any()
- inline bool set(std::size_t bit, std::size_t& cnt=Zeros::NC_ZERO) {
- std::size_t val = 0;
- if ( !_children.set(bit, val) ) {
- _bset[val] = true;
- cnt = val/NVAL;
- std::size_t pbin = cnt*NVAL;
- _nxt = npos;
- for ( std::size_t idx = pbin; idx < pbin+NVAL; ++idx ) {
- if ( !_bset[idx] ) {
- _nxt = idx;
- break;
- }
- } // for
- return _nxt != npos;
- }
- return true;
- }
-
- inline void unset(std::size_t bit, std::size_t& cnt=Zeros::NC_ZERO) {
- _children.unset(bit, cnt);
- _bset[cnt] = false;
- _nxt = cnt;
- cnt /= NVAL;
- }
-
- inline std::size_t size() const { return _children.size(); }
-
- template <std::size_t A, std::size_t B, std::size_t C>
- friend
- typename std::enable_if<!BitMonitor<A,B,C>::STOP, std::ostream&>::type
- operator<<(std::ostream& os, const BitMonitor<A,B,C>& r);
-
- std::size_t _nxt;
- std::bitset<MYSZ> _bset; // all zeroes by default
- BitMonitor<NVAL, StopLevel/NVAL, Iter+1> _children;
- };
-
- template <std::size_t N, std::size_t Iter>
- struct BitMonitor<N,N,Iter> {
- static constexpr std::size_t NVAL = N;
- static constexpr std::size_t MYSZ = Pow<NVAL,Iter>::value;
- static constexpr std::size_t PARENTSZ = Pow<NVAL,Iter-1>::value;
- static constexpr std::size_t TOTALSZ = MYSZ+PARENTSZ;
- static constexpr std::size_t LEVEL = Iter;
- static constexpr bool STOP = true;
- static constexpr std::size_t npos = std::numeric_limits<std::size_t>::max();
-
- BitMonitor() : _nxt(0) {}
-
- inline bool any() const { return _nxt != npos; }
-
- inline std::size_t get_open() {
- return _nxt;
- }
-
- std::size_t find_open(std::size_t pbin) {
- pbin *= NVAL;
- for ( std::size_t idx = pbin; idx < pbin+NVAL; ++idx ) {
- if ( !_bset[idx] ) {
- _nxt = idx;
- return _nxt;
- }
- } // for
- return npos; // something bad just happened
- }
-
- // calling program can simply check return value here instead of any()
- inline bool set(std::size_t bit, std::size_t& cnt) {
- _bset[bit] = true;
- Zeros::NC_ZERO = Zeros::C_ZERO;
-
- // make pbin the group that the parent class is monitoring
- cnt = bit/NVAL;
- std::size_t pbin = cnt*NVAL;
- _nxt = npos;
- for ( std::size_t idx = bit+1; idx < pbin+NVAL; ++idx ) {
- if ( !_bset[idx] ) {
- _nxt = idx;
- return _nxt != npos;
- }
- } // for
- for ( std::size_t idx = pbin; idx < bit; ++idx ) {
- if ( !_bset[idx] ) {
- _nxt = idx;
- return _nxt != npos;
- }
- }
- return _nxt != npos;
- }
-
- inline void unset(std::size_t bit, std::size_t& cnt) {
- _bset[bit] = false;
- Zeros::NC_ZERO = Zeros::C_ZERO;
- cnt = bit/NVAL;
- if ( _nxt == npos ) { _nxt = bit; }
- }
-
- inline std::size_t size() const { return _bset.size(); }
-
- template <std::size_t A, std::size_t B, std::size_t C>
- friend
- typename std::enable_if<BitMonitor<A,B,C>::STOP, std::ostream&>::type
- operator<<(std::ostream& os, const BitMonitor<A,B,C>& r);
-
- std::size_t _nxt;
- std::bitset<MYSZ> _bset; // initialized all-zeroes
- };
-
- template <std::size_t N, std::size_t M>
- struct BitMonitor<N,M,0>; // undefined
- template <std::size_t N>
- struct BitMonitor<N,N,0>; // undefined
-
-
- template <std::size_t A, std::size_t B, std::size_t C>
- typename std::enable_if<!BitMonitor<A,B,C>::STOP, std::ostream&>::type
- operator<<(std::ostream& os, const BitMonitor<A,B,C>& r) {
- os << r._bset << std::endl;
- os << r._children;
- return os;
- }
-
- template <std::size_t A, std::size_t B, std::size_t C>
- typename std::enable_if<BitMonitor<A,B,C>::STOP, std::ostream&>::type
- operator<<(std::ostream& os, const BitMonitor<A,B,C>& r) {
- os << r._bset;
- return os;
- }
+#include "utility/BitMonitor.hpp"
+namespace Ext {
//==============
// PooledMemory
//==============
template <typename DataType, std::size_t chunksz = 512, bool CallDestruct = false>
- struct PooledMemory; // atm, chunksz needs to be >=16 and divisible by 8
+ struct PooledMemory; // atm, chunksz needs to be a power of 8 and at least 64
template <typename DataType, std::size_t chunksz, bool CallDestruct>
struct PooledMemory {
@@ -438,6 +92,8 @@ namespace Ext {
_cache = m;
else
delete m;
+ if ( m == _curr )
+ _curr = *(_blocks.begin()); // important if we drop back to 1 block
}
}
}
@@ -474,6 +130,8 @@ namespace Ext {
--_cntr;
}
+ /* temporary disable -> double destruction is happening at times
+ for now, use with types that have trivial destructors
~Chunk() {
if ( CallDestruct ) {
for ( std::size_t i = 0; i < _tracker.size(); ++i ) {
@@ -482,6 +140,7 @@ namespace Ext {
} // for
}
}
+ */
bool _any;
std::size_t _cntr;
@@ -505,4 +164,4 @@ namespace Ext {
} // namespace Ext
-#endif // __UTILS_SIMPLE_SMALLOBJ_MEM__
+#endif // UTILS_SIMPLE_SMALLOBJ_MEM
diff --git a/interfaces/general-headers/utility/PrintTypes.hpp b/interfaces/general-headers/utility/PrintTypes.hpp
index fee58b7..e40ffe5 100644
--- a/interfaces/general-headers/utility/PrintTypes.hpp
+++ b/interfaces/general-headers/utility/PrintTypes.hpp
@@ -37,13 +37,13 @@ namespace PrintTypes {
struct check {
static const bool value =
std::is_arithmetic<T>::value ||
- std::is_same<typename std::remove_cv<T>::type, char*>::value ||
- std::is_same<typename std::remove_cv<T>::type, char const*>::value;
+ std::is_same<char const*, typename std::decay<T>::type>::value ||
+ std::is_same<char*, typename std::decay<T>::type>::value;
};
}
template <typename T>
- extern typename std::enable_if<Details::check<T>::value>::type
+ typename std::enable_if<Details::check<T>::value>::type
Print(T t) {
static std::string f = Formats::Format(t);
static char const* format = f.c_str();
@@ -51,7 +51,7 @@ namespace PrintTypes {
}
template <typename T>
- extern typename std::enable_if<Details::check<T>::value>::type
+ typename std::enable_if<Details::check<T>::value>::type
Println(T t) {
static std::string end = Formats::Format(t) + std::string("\n");
static char const* format = end.c_str();
@@ -59,7 +59,7 @@ namespace PrintTypes {
}
template <typename T>
- extern typename std::enable_if<std::is_arithmetic<T>::value>::type
+ typename std::enable_if<std::is_arithmetic<T>::value>::type
Print(T t, int precision, bool scientific) {
std::string f = Formats::Format(t, precision, scientific);
char const* format = f.c_str();
@@ -67,7 +67,7 @@ namespace PrintTypes {
}
template <typename T>
- extern typename std::enable_if<std::is_arithmetic<T>::value>::type
+ typename std::enable_if<std::is_arithmetic<T>::value>::type
Println(T t, int precision, bool scientific) {
std::string end = Formats::Format(t, precision, scientific) + std::string("\n");
char const* format = end.c_str();
@@ -75,7 +75,7 @@ namespace PrintTypes {
}
template <typename T>
- extern typename std::enable_if<Details::check<T>::value>::type
+ typename std::enable_if<Details::check<T>::value>::type
Print(FILE* out, T t) {
static std::string f = Formats::Format(t);
static char const* format = f.c_str();
@@ -83,7 +83,7 @@ namespace PrintTypes {
}
template <typename T>
- extern typename std::enable_if<Details::check<T>::value>::type
+ typename std::enable_if<Details::check<T>::value>::type
Println(FILE* out, T t) {
static std::string end = Formats::Format(t) + std::string("\n");
static char const* format = end.c_str();
@@ -92,22 +92,22 @@ namespace PrintTypes {
template <typename T>
- extern typename std::enable_if<!Details::check<T>::value>::type
+ typename std::enable_if<!Details::check<T>::value>::type
Print(const T& t)
{ t.print(); }
template <typename T>
- extern typename std::enable_if<!Details::check<T>::value>::type
+ typename std::enable_if<!Details::check<T>::value>::type
Println(const T& t)
{ t.println(); }
template <typename T>
- extern typename std::enable_if<!Details::check<T>::value>::type
+ typename std::enable_if<!Details::check<T>::value>::type
Print(FILE* out, const T& t)
{ t.print(out); }
template <typename T>
- extern typename std::enable_if<!Details::check<T>::value>::type
+ typename std::enable_if<!Details::check<T>::value>::type
Println(FILE* out, const T& t)
{ t.println(out); }
diff --git a/interfaces/general-headers/utility/SingletonType.hpp b/interfaces/general-headers/utility/SingletonType.hpp
index a97c5a3..0b2d0ad 100755
--- a/interfaces/general-headers/utility/SingletonType.hpp
+++ b/interfaces/general-headers/utility/SingletonType.hpp
@@ -27,11 +27,23 @@
namespace Ext {
template <typename T>
struct SingletonType {
- static T* Instance() {
- static T t;
- return(&t);
+ static T& Instance() {
+ if ( !_instance )
+ _instance = new T();
+ return *_instance;
}
+
+ private:
+ SingletonType();
+ ~SingletonType() {}
+ SingletonType(const SingletonType&); // undefined
+ SingletonType& operator=(const SingletonType&); // undefined
+
+ void Cleanup();
+ static T* _instance;
};
} // namespace Ext
+#include "../../src/utility/SingletonType.cpp"
+
#endif // SINGLETONTYPE_H
diff --git a/interfaces/general-headers/utility/Typify.hpp b/interfaces/general-headers/utility/Typify.hpp
index 435b6f8..a26d5eb 100755
--- a/interfaces/general-headers/utility/Typify.hpp
+++ b/interfaces/general-headers/utility/Typify.hpp
@@ -45,15 +45,23 @@ namespace Ext {
typedef T OriginalType;
};
+ //============
+ // has_type<T> : is there a T::type typedef?
+ // stolen and modified from
+ // http://stackoverflow.com/questions/25626293/has-type-template-returns-true-for-struct-type
+ //============
+ template <typename T>
+ struct has_type {
+
+ template <typename C>
+ static constexpr
+ char test_for_type(...) { return '0'; }
+
+ template <typename C>
+ static constexpr
+ double test_for_type(typename C::type const*) { return 0.0; }
- //===========
- // IdType<,> : differentiate multiple type T's by an ID
- // : this class requires T to be a user-defined type
- //===========
- template <typename T, int ID>
- struct IDType : public T {
- typedef T Type;
- enum { value = ID };
+ static const bool value = sizeof(test_for_type<T>(0)) == sizeof(double);
};
} // namespace Ext
diff --git a/interfaces/src/algorithm/sweep/WindowSweepImpl.cpp b/interfaces/src/algorithm/sweep/WindowSweepImpl.cpp
index 2c6e941..18f9c87 100644
--- a/interfaces/src/algorithm/sweep/WindowSweepImpl.cpp
+++ b/interfaces/src/algorithm/sweep/WindowSweepImpl.cpp
@@ -24,8 +24,10 @@
#include <cstdlib>
#include <deque>
-#include "data/bed/BedCheckIterator.hpp"
+#include "data/bed/AllocateIterator_BED_starch_minmem.hpp"
#include "data/bed/AllocateIterator_BED_starch.hpp"
+#include "data/bed/BedCheckIterator.hpp"
+#include "data/bed/BedCheckIterator_minmem.hpp"
#include "utility/AllocateIterator.hpp"
namespace WindowSweep {
@@ -34,30 +36,72 @@ namespace WindowSweep {
namespace Details {
- // get() function overloads allow sweep() to be written only twice.
+ // get() & clean() function overloads allow sweep() to be written only twice.
// New iterator ideas receive just another get(). For example,
// the speedy allocate_iterator<T> requires something special below.
template <typename IteratorType>
inline typename IteratorType::value_type* get(IteratorType& i)
{ return(new typename IteratorType::value_type(*i)); }
+ template <typename IteratorType>
+ inline void clean(IteratorType& i, typename IteratorType::value_type* p)
+ { delete p; }
+
+ // general fast iterator (non-BED)
template <typename T>
inline typename Ext::allocate_iterator<T*>::value_type
get(Ext::allocate_iterator<T*>& i)
{ return(*i); } /* no copy via operator new here */
template <typename T>
- inline typename Bed::allocate_iterator_starch_bed<T*>::value_type
- get(Bed::allocate_iterator_starch_bed<T*>& i)
+ inline void clean(Ext::allocate_iterator<T*>& i, T* p)
+ { delete p; }
+
+
+ // min memory fast iterator (v2p4p26 and older)
+ template <typename T>
+ inline typename Bed::allocate_iterator_starch_bed_mm<T*>::value_type
+ get(Bed::allocate_iterator_starch_bed_mm<T*>& i)
{ return(*i); } /* no copy via operator new here */
+ template <typename T>
+ inline void clean(Bed::allocate_iterator_starch_bed_mm<T*>& i, T* p)
+ { delete p; }
+
+ // fastest iterator (v2p4p27 and newer)
+ template <typename T, std::size_t PoolSz> // pooled memory
+ inline typename Bed::allocate_iterator_starch_bed<T*, PoolSz>::value_type
+ get(Bed::allocate_iterator_starch_bed<T*, PoolSz>& i)
+ { return(*i); } /* no copy via operator new here */
+
+ template <typename T, std::size_t PoolSz>
+ inline void clean(Bed::allocate_iterator_starch_bed<T*, PoolSz>& i, T* p)
+ { static auto& pool = i.get_pool(); pool.release(p); }
+
+
+ // min memory error checking iterator(v2p4p26 and older)
template <typename T>
- inline typename Bed::bed_check_iterator<T*>::value_type
- get(Bed::bed_check_iterator<T*>& i)
+ inline typename Bed::bed_check_iterator_mm<T*>::value_type
+ get(Bed::bed_check_iterator_mm<T*>& i)
{ return(*i); } /* no copy via operator new here */
+ template <typename T>
+ inline void clean(Bed::bed_check_iterator_mm<T*>& i, T* p)
+ { delete p; }
+
+
+ // pooled memory error checking iterator(v2p4p27 and newer)
+ template <typename T, std::size_t PoolSz>
+ inline typename Bed::bed_check_iterator<T*, PoolSz>::value_type
+ get(Bed::bed_check_iterator<T*, PoolSz>& i)
+ { return(*i); } /* no copy via operator new here */
+
+ template <typename T, std::size_t PoolSz>
+ inline void clean(Bed::bed_check_iterator<T*, PoolSz>& i, T* p)
+ { static auto& pool = i.get_pool(); pool.release(p); }
+
} // namespace Details
//===================
@@ -78,6 +122,7 @@ namespace WindowSweep {
// Local variables
// const bool cleanHere = !visitor.ManagesOwnMemory(); no longer useful with multivisitor
+ InputIterator orig = start;
const TypePtr zero = static_cast<TypePtr>(0);
TypePtr bPtr = zero;
std::size_t index = 0;
@@ -93,14 +138,14 @@ namespace WindowSweep {
visitor.OnStart(win[index]);
while ( !win.empty() && inRange.Map2Ref(win[0], win[index]) < 0 ) {
visitor.OnDelete(win[0]);
- delete win[0];
+ Details::clean(orig, win[0]);
win.pop_front(), --index;
} // while
} else { // last item in windowed buffer, reset buffer
if ( start == end && !cache ) { // stopping condition
visitor.OnEnd();
while ( !win.empty() ) { // deletions belonging to NO ref
- delete win[0];
+ Details::clean(orig, win[0]);
win.pop_front();
} // while
break;
@@ -138,7 +183,7 @@ namespace WindowSweep {
while ( !win.empty() ) { // deletions on behalf of new ref
visitor.OnDelete(win[0]);
- delete win[0];
+ Details::clean(orig, win[0]);
win.pop_front();
} // while
}
@@ -157,7 +202,7 @@ namespace WindowSweep {
} // while !done
if ( cache )
- delete cache; // never given to visitor
+ Details::clean(orig, cache); // never given to visitor
} // sweep() overload1
@@ -190,6 +235,8 @@ namespace WindowSweep {
WindowType win;
double value = 0;
bool willPurge = false;
+ InputIterator1 rorig = refStart;
+ InputIterator2 morig = mapFromStart;
// Loop through inputs
while ( refStart != refEnd ) {
@@ -206,7 +253,7 @@ namespace WindowSweep {
// Pop off items falling out of range 'to the left'
while ( !win.empty() && inRange.Map2Ref(win[0], rPtr) < 0 ) {
visitor.OnDelete(win[0]);
- delete win[0];
+ Details::clean(morig, win[0]);
win.pop_front();
} // while
@@ -230,26 +277,26 @@ namespace WindowSweep {
break;
}
else
- delete mPtr;
+ Details::clean(morig, mPtr);
} // while
visitor.OnDone(); // done processing current ref item
- delete rPtr;
+ Details::clean(rorig, rPtr);
} // while more ref data
visitor.OnEnd();
while ( !win.empty() ) { // deletions belonging to NO ref
- delete win[0];
+ Details::clean(morig, win[0]);
win.pop_front();
} // while
if ( cache ) // never given to visitor
- delete cache;
+ Details::clean(morig, cache);
if ( sweepMapAll ) { // read and clean remainder of map file
while ( mapFromStart != mapFromEnd ) {
mPtr = Details::get(mapFromStart); // don't do get(mapFromStart); in case allocate_iterator
++mapFromStart;
- delete mPtr; // never given to visitor
+ Details::clean(morig, mPtr); // never given to visitor
} // while
}
diff --git a/interfaces/src/algorithm/sweep/WindowSweepImpl.specialize.cpp b/interfaces/src/algorithm/sweep/WindowSweepImpl.specialize.cpp
index 16b1b25..0b39252 100644
--- a/interfaces/src/algorithm/sweep/WindowSweepImpl.specialize.cpp
+++ b/interfaces/src/algorithm/sweep/WindowSweepImpl.specialize.cpp
@@ -23,7 +23,6 @@
#include <cstdlib>
#include <deque>
-#include <type_traits>
#include "data/bed/BedCheckIterator.hpp"
#include "data/bed/BedDistances.hpp"
@@ -32,6 +31,20 @@
namespace WindowSweep {
+ /*
+ why the specialization? From BedBaseVisitor.hpp
+ chr1 1 200 a 1
+ chr1 10 20 b 3
+ chr1 50 150 c 4
+
+ when used with bedmap --bp-ovr 11 --count <one-file>
+
+ row 2 has no hits, but row 1 goes with row 3's output. Cannot assume that once
+ row 2 is out of range that everything to the left of it is out of range too,
+ even when looking at straight bp's. The main issue shown here is that the
+ --bp-ovr 11 is larger than row 2's range. It can never qualify but row 1 can.
+ */
+
// See WindowSweep.hpp for detailed assumptions of sweep()
//===================
@@ -58,6 +71,7 @@ namespace WindowSweep {
TypePtr cache = zero;
bool first = true;
bool reset = true;
+ InputIterator orig = start;
// Loop through inputs
while ( start != end || cache || !win.empty() ) {
@@ -67,14 +81,14 @@ namespace WindowSweep {
while ( !win.empty() && inRange.Map2Ref(win[0], win[index]) < 0 ) {
if ( win[0]->length() >= inRange.ovrRequired_ )
visitor.OnDelete(win[0]);
- delete win[0];
+ Details::clean(orig, win[0]);
win.pop_front(), --index;
} // while
} else { // last item in windowed buffer, reset buffer
if ( start == end && !cache ) { // stopping condition
visitor.OnEnd();
while ( !win.empty() ) { // deletions belonging to NO ref
- delete win[0];
+ Details::clean(orig, win[0]);
win.pop_front();
} // while
break;
@@ -113,7 +127,7 @@ namespace WindowSweep {
while ( !win.empty() ) { // deletions on behalf of new ref
if ( win[0]->length() >= inRange.ovrRequired_ )
visitor.OnDelete(win[0]);
- delete win[0];
+ Details::clean(orig, win[0]);
win.pop_front();
} // while
}
@@ -133,7 +147,7 @@ namespace WindowSweep {
} // while !done
if ( cache )
- delete cache; // never given to visitor
+ Details::clean(orig, cache); // never given to visitor
} // sweep() overload1
diff --git a/interfaces/src/data/starch/starchHelpers.c b/interfaces/src/data/starch/starchHelpers.c
index 8be5078..2164b2d 100644
--- a/interfaces/src/data/starch/starchHelpers.c
+++ b/interfaces/src/data/starch/starchHelpers.c
@@ -274,7 +274,7 @@ STARCH_createTransformTokens(const char *s, const char delim, char **chr, int64_
#ifdef __cplusplus
else if (strncmp(reinterpret_cast<const char *>( buffer ), kStarchBedHeaderBrowser, strlen(kStarchBedHeaderBrowser)) == 0) {
#else
- else if (strncmp((const char *) buffer, kStarchBedHeaderBrowser, strlen(kStarchBedHeaderBrowser)) == 0) {
+ else if (strncmp((const char *) buffer, kStarchBedHeaderBrowser, strlen(kStarchBedHeaderBrowser)) == 0) {
#endif
*lineType = kBedLineHeaderBrowser;
elemCnt = 3;
@@ -282,7 +282,7 @@ STARCH_createTransformTokens(const char *s, const char delim, char **chr, int64_
#ifdef __cplusplus
else if (strncmp(reinterpret_cast<const char *>( buffer ), kStarchBedHeaderSAM, strlen(kStarchBedHeaderSAM)) == 0) {
#else
- else if (strncmp((const char *) buffer, kStarchBedHeaderSAM, strlen(kStarchBedHeaderSAM)) == 0) {
+ else if (strncmp((const char *) buffer, kStarchBedHeaderSAM, strlen(kStarchBedHeaderSAM)) == 0) {
#endif
*lineType = kBedLineHeaderSAM;
elemCnt = 3;
@@ -298,7 +298,7 @@ STARCH_createTransformTokens(const char *s, const char delim, char **chr, int64_
#ifdef __cplusplus
else if (strncmp(reinterpret_cast<const char *>( buffer ), kStarchBedGenericComment, strlen(kStarchBedGenericComment)) == 0) {
#else
- else if (strncmp((const char *) buffer, kStarchBedGenericComment, strlen(kStarchBedGenericComment)) == 0) {
+ else if (strncmp((const char *) buffer, kStarchBedGenericComment, strlen(kStarchBedGenericComment)) == 0) {
#endif
*lineType = kBedLineGenericComment;
elemCnt = 3;
@@ -306,14 +306,14 @@ STARCH_createTransformTokens(const char *s, const char delim, char **chr, int64_
else {
*lineType = kBedLineCoordinates;
}
-
+
/* if line type is of kBedLineCoordinates type, then we test chromosome length */
if (*lineType == kBedLineCoordinates) {
#ifdef DEBUG
fprintf(stderr, "\t--- copying chromosome field ---\n");
#endif
if (strlen(buffer) > TOKEN_CHR_MAX_LENGTH) {
- fprintf(stderr, "ERROR: Chromosome field length is too long (must be no longer than %d characters)\n", TOKEN_CHR_MAX_LENGTH);
+ fprintf(stderr, "ERROR: Chromosome field length is too long (must be no longer than %lu characters)\n", TOKEN_CHR_MAX_LENGTH);
return STARCH_FATAL_ERROR;
}
/* copy element to chromosome variable, if memory is available */
@@ -338,7 +338,7 @@ STARCH_createTransformTokens(const char *s, const char delim, char **chr, int64_
fprintf(stderr, "\t--- copying whole line ---\n");
#endif
if (strlen(s) > TOKENS_HEADER_MAX_LENGTH) {
- fprintf(stderr, "ERROR: Comment line length is too long (must be no longer than %d characters)\n", TOKEN_CHR_MAX_LENGTH);
+ fprintf(stderr, "ERROR: Comment line length is too long (must be no longer than %lu characters)\n", TOKEN_CHR_MAX_LENGTH);
return STARCH_FATAL_ERROR;
}
/* copy whole line to chromosome variable, if memory is available */
@@ -420,19 +420,26 @@ STARCH_createTransformTokens(const char *s, const char delim, char **chr, int64_
}
} while (s[sCnt++] != '\0');
+#ifdef DEBUG
+ fprintf(stderr, "\t--- s [%s] buffer [%s], charCnt [%u], strlen(buffer) [%zu], sCnt [%u], strlen(s) [%zu], idIdx [%d]\n", s, buffer, charCnt, strlen(buffer), sCnt, strlen(s), idIdx);
+ fprintf(stderr, "\t (post create-transform-tokens: chr -> %s\n\tstart -> %" PRId64 "\n\tstop -> %" PRId64 "\n\tremainder -> %s\n", *chr, *start, *stop, *remainder);
+#endif
+
if (elemCnt > 3) {
- buffer[(charCnt - 1)] = '\0';
+ if (charCnt > 0) {
+ buffer[(charCnt - 1)] = '\0';
+ }
/* test id field length */
while ((buffer[idIdx] != delim) && (idIdx++ < TOKEN_ID_MAX_LENGTH)) {}
if (idIdx == TOKEN_ID_MAX_LENGTH) {
- fprintf(stderr, "ERROR: Id field is too long (must be less than %d characters long)\n", TOKEN_ID_MAX_LENGTH);
+ fprintf(stderr, "ERROR: Id field is too long (must be less than %lu characters long)\n", TOKEN_ID_MAX_LENGTH);
return STARCH_FATAL_ERROR;
}
/* test remnant of buffer, if there is more to look at */
if (charCnt > idIdx) {
while ((buffer[idIdx++] != '\0') && (restIdx++ < TOKEN_REST_MAX_LENGTH)) {}
if (restIdx == TOKEN_REST_MAX_LENGTH) {
- fprintf(stderr, "ERROR: Remainder of BED input after id field is too long (must be less than %d characters long)\n", TOKEN_REST_MAX_LENGTH);
+ fprintf(stderr, "ERROR: Remainder of BED input after id field is too long (must be less than %lu characters long)\n", TOKEN_REST_MAX_LENGTH);
return STARCH_FATAL_ERROR;
}
}
@@ -446,9 +453,9 @@ STARCH_createTransformTokens(const char *s, const char delim, char **chr, int64_
return STARCH_FATAL_ERROR;
}
#ifdef __cplusplus
- strncpy(*remainder, reinterpret_cast<const char *>( buffer ), strlen(buffer) + 1);
+ strncpy(*remainder, reinterpret_cast<const char *>( buffer ), strlen(buffer) + 1);
#else
- strncpy(*remainder, (const char *)buffer, strlen(buffer) + 1);
+ strncpy(*remainder, (const char *)buffer, strlen(buffer) + 1);
#endif
#ifdef DEBUG
fprintf(stderr, "\t--- resulting remainder [%s]\n", *remainder);
@@ -489,7 +496,7 @@ STARCH_createTransformTokensForHeaderlessInput(const char *s, const char delim,
#endif
/* test if element string is longer than allowed bounds */
if (strlen(buffer) > TOKEN_CHR_MAX_LENGTH) {
- fprintf(stderr, "ERROR: Chromosome field length is too long (must be no longer than %d characters)\n", TOKEN_CHR_MAX_LENGTH);
+ fprintf(stderr, "ERROR: Chromosome field length is too long (must be no longer than %lu characters)\n", TOKEN_CHR_MAX_LENGTH);
return STARCH_FATAL_ERROR;
}
/* copy element to chromosome variable, if memory is available */
@@ -596,14 +603,14 @@ STARCH_createTransformTokensForHeaderlessInput(const char *s, const char delim,
/* test id field length */
while ((buffer[idIdx] != delim) && (idIdx++ < TOKEN_ID_MAX_LENGTH)) {}
if (idIdx == TOKEN_ID_MAX_LENGTH) {
- fprintf(stderr, "ERROR: Id field is too long (must be less than %d characters long)\n", TOKEN_ID_MAX_LENGTH);
+ fprintf(stderr, "ERROR: Id field is too long (must be less than %lu characters long)\n", TOKEN_ID_MAX_LENGTH);
return STARCH_FATAL_ERROR;
}
/* test remnant ("rest") of buffer, if there is more to look at */
if (charCnt > idIdx) {
while ((buffer[idIdx++] != '\0') && (restIdx++ < TOKEN_REST_MAX_LENGTH)) {}
if (restIdx == TOKEN_REST_MAX_LENGTH) {
- fprintf(stderr, "ERROR: Remainder of BED input after id field is too long (must be less than %d characters long)\n", TOKEN_REST_MAX_LENGTH);
+ fprintf(stderr, "ERROR: Remainder of BED input after id field is too long (must be less than %lu characters long)\n", TOKEN_REST_MAX_LENGTH);
return STARCH_FATAL_ERROR;
}
}
@@ -683,7 +690,7 @@ STARCH_transformInput(Metadata **md, const FILE *fp, const CompressionType type,
Boolean withinChr = kStarchFalse;
unsigned long lineIdx = 0UL;
off_t outCompressedFnSize = 0;
- char *legacyMdBuf = NULL;
+ char *legacyMdBuf = NULL;
char *dynamicMdBuf = NULL;
BedLineType lineType = kBedLineTypeUndefined;
char nonCoordLineBuf[STARCH_BUFFER_MAX_LENGTH] = {0};
@@ -714,7 +721,7 @@ STARCH_transformInput(Metadata **md, const FILE *fp, const CompressionType type,
if ( (lineType == kBedLineCoordinates) && ((!prevChromosome) || (strcmp(chromosome, prevChromosome) != 0)) ) {
/* close old output file pointer */
if (outFnPtr != NULL) {
- fclose(outFnPtr);
+ fclose(outFnPtr);
outFnPtr = NULL;
if (type == kBzip2) {
@@ -1351,10 +1358,14 @@ STARCH_transformHeaderlessInput(Metadata **md, const FILE *fp, const Compression
previousStop = (stop > previousStop) ? stop : previousStop;
/* cleanup unused data */
- if (withinChr == kStarchTrue)
- free(chromosome), chromosome = NULL;
- if (remainder)
- free(remainder), remainder = NULL;
+ if (withinChr == kStarchTrue) {
+ free(chromosome);
+ chromosome = NULL;
+ }
+ if (remainder) {
+ free(remainder);
+ remainder = NULL;
+ }
cIdx = 0;
}
else {
@@ -1646,7 +1657,7 @@ STARCH2_transformInput(unsigned char **header, Metadata **md, const FILE *inFp,
fprintf(stderr, "ERROR: Could not initialize archive header.\n");
return STARCH_EXIT_FAILURE;
}
-
+
if (STARCH2_writeStarchHeaderToOutputFp(*header, stdout) != STARCH_EXIT_SUCCESS) {
fprintf(stderr, "ERROR: Could not write archive header to output file pointer.\n");
return STARCH_EXIT_FAILURE;
@@ -1693,7 +1704,7 @@ STARCH2_transformHeaderedBEDInput(const FILE *inFp, Metadata **md, const Compres
fprintf(stderr, "\n--- STARCH2_transformHeaderedBEDInput() ---\n");
#endif
int c;
- int cIdx = 0;
+ unsigned int cIdx = 0;
char untransformedBuffer[STARCH_BUFFER_MAX_LENGTH];
char intermediateBuffer[STARCH_BUFFER_MAX_LENGTH];
char transformedBuffer[STARCH_BUFFER_MAX_LENGTH];
@@ -1746,7 +1757,7 @@ STARCH2_transformHeaderedBEDInput(const FILE *inFp, Metadata **md, const Compres
char const *nullSig = "null";
struct sha1_ctx perChromosomeHashCtx;
LineLengthType maxStringLength = STARCH_DEFAULT_LINE_STRING_LENGTH;
-
+
/* increment total file size by header bytes */
#ifdef DEBUG
fprintf(stderr, "\tincrementing file size by sizeof(header)\n");
@@ -1852,7 +1863,8 @@ STARCH2_transformHeaderedBEDInput(const FILE *inFp, Metadata **md, const Compres
fprintf(stderr, "ERROR: Elements with same start and stop coordinates have remainders in wrong sort order.\nBe sure to first sort input with sort-bed or remove --do-not-sort option from conversion script.\n");
return STARCH_FATAL_ERROR;
}
- free(pRemainder), pRemainder = NULL;
+ free(pRemainder);
+ pRemainder = NULL;
}
if ((reportProgressFlag == kStarchTrue) && (lineIdx % reportProgressN == 0)) {
@@ -2123,8 +2135,10 @@ STARCH2_transformHeaderedBEDInput(const FILE *inFp, Metadata **md, const Compres
}
/* clean up per-chromosome hash digest */
- if (base64EncodedSha1Digest)
- free(base64EncodedSha1Digest), base64EncodedSha1Digest = NULL;
+ if (base64EncodedSha1Digest) {
+ free(base64EncodedSha1Digest);
+ base64EncodedSha1Digest = NULL;
+ }
}
/* create placeholder records at current chromosome */
@@ -2192,7 +2206,10 @@ STARCH2_transformHeaderedBEDInput(const FILE *inFp, Metadata **md, const Compres
lastPosition = 0;
pStart = -1;
pStop = -1;
- if (pRemainder) { free(pRemainder), pRemainder = NULL; }
+ if (pRemainder) {
+ free(pRemainder);
+ pRemainder = NULL;
+ }
previousStop = 0;
lcDiff = 0;
lineIdx = 0UL;
@@ -2430,10 +2447,14 @@ STARCH2_transformHeaderedBEDInput(const FILE *inFp, Metadata **md, const Compres
pRemainder = STARCH_strndup(remainder, strlen(remainder));
}
- if (withinChr == kStarchTrue)
- free(chromosome), chromosome = NULL;
- if (remainder)
- free(remainder), remainder = NULL;
+ if (withinChr == kStarchTrue) {
+ free(chromosome);
+ chromosome = NULL;
+ }
+ if (remainder) {
+ free(remainder);
+ remainder = NULL;
+ }
cIdx = 0;
}
else {
@@ -2539,7 +2560,8 @@ STARCH2_transformHeaderedBEDInput(const FILE *inFp, Metadata **md, const Compres
fprintf(stderr, "ERROR: Elements with same start and stop coordinates have remainders in wrong sort order.\nBe sure to first sort input with sort-bed or remove --do-not-sort option from conversion script.\n");
return STARCH_FATAL_ERROR;
}
- free(pRemainder), pRemainder = NULL;
+ free(pRemainder);
+ pRemainder = NULL;
}
}
else {
@@ -2731,8 +2753,10 @@ STARCH2_transformHeaderedBEDInput(const FILE *inFp, Metadata **md, const Compres
}
/* clean up per-chromosome hash digest */
- if (base64EncodedSha1Digest)
- free(base64EncodedSha1Digest), base64EncodedSha1Digest = NULL;
+ if (base64EncodedSha1Digest) {
+ free(base64EncodedSha1Digest);
+ base64EncodedSha1Digest = NULL;
+ }
/* reset metadata pointer */
*md = firstRecord;
@@ -2805,14 +2829,22 @@ STARCH2_transformHeaderedBEDInput(const FILE *inFp, Metadata **md, const Compres
fprintf(stdout, "%s", footerBuffer);
fflush(stdout);
- if (json)
- free(json), json = NULL;
- if (compressedFn)
- free(compressedFn), compressedFn = NULL;
- if (prevChromosome)
- free(prevChromosome), prevChromosome = NULL;
- if (base64EncodedSha1Digest)
- free(base64EncodedSha1Digest), base64EncodedSha1Digest = NULL;
+ if (json) {
+ free(json);
+ json = NULL;
+ }
+ if (compressedFn) {
+ free(compressedFn);
+ compressedFn = NULL;
+ }
+ if (prevChromosome) {
+ free(prevChromosome);
+ prevChromosome = NULL;
+ }
+ if (base64EncodedSha1Digest) {
+ free(base64EncodedSha1Digest);
+ base64EncodedSha1Digest = NULL;
+ }
return STARCH_EXIT_SUCCESS;
}
@@ -2824,7 +2856,7 @@ STARCH2_transformHeaderlessBEDInput(const FILE *inFp, Metadata **md, const Compr
fprintf(stderr, "\n--- STARCH2_transformHeaderlessBEDInput() ---\n");
#endif
int c;
- int cIdx = 0;
+ unsigned int cIdx = 0;
char untransformedBuffer[STARCH_BUFFER_MAX_LENGTH + 1] = {0};
char intermediateBuffer[STARCH_BUFFER_MAX_LENGTH + 1] = {0};
char transformedBuffer[STARCH_BUFFER_MAX_LENGTH + 1] = {0};
@@ -2981,7 +3013,8 @@ STARCH2_transformHeaderlessBEDInput(const FILE *inFp, Metadata **md, const Compr
fprintf(stderr, "ERROR: Elements with same start and stop coordinates have remainders in wrong sort order.\nBe sure to first sort input with sort-bed or remove --do-not-sort option from conversion script.\n");
return STARCH_FATAL_ERROR;
}
- free(pRemainder), pRemainder = NULL;
+ free(pRemainder);
+ pRemainder = NULL;
}
if ((reportProgressFlag == kStarchTrue) && (lineIdx % reportProgressN == 0)) {
@@ -3251,8 +3284,10 @@ STARCH2_transformHeaderlessBEDInput(const FILE *inFp, Metadata **md, const Compr
}
/* clean up per-chromosome hash digest */
- if (base64EncodedSha1Digest)
- free(base64EncodedSha1Digest), base64EncodedSha1Digest = NULL;
+ if (base64EncodedSha1Digest) {
+ free(base64EncodedSha1Digest);
+ base64EncodedSha1Digest = NULL;
+ }
}
/* create placeholder records at current chromosome */
@@ -3320,7 +3355,10 @@ STARCH2_transformHeaderlessBEDInput(const FILE *inFp, Metadata **md, const Compr
lastPosition = 0;
pStart = -1;
pStop = -1;
- if (pRemainder) { free(pRemainder), pRemainder = NULL; }
+ if (pRemainder) {
+ free(pRemainder);
+ pRemainder = NULL;
+ }
previousStop = 0;
lcDiff = 0;
lineIdx = 0UL;
@@ -3545,10 +3583,14 @@ STARCH2_transformHeaderlessBEDInput(const FILE *inFp, Metadata **md, const Compr
if (remainder)
pRemainder = STARCH_strndup(remainder, strlen(remainder));
- if (withinChr == kStarchTrue)
- free(chromosome), chromosome = NULL;
- if (remainder)
- free(remainder), remainder = NULL;
+ if (withinChr == kStarchTrue) {
+ free(chromosome);
+ chromosome = NULL;
+ }
+ if (remainder) {
+ free(remainder);
+ remainder = NULL;
+ }
cIdx = 0;
}
else {
@@ -3680,7 +3722,8 @@ STARCH2_transformHeaderlessBEDInput(const FILE *inFp, Metadata **md, const Compr
fprintf(stderr, "ERROR: Elements with same start and stop coordinates have remainders in wrong sort order.\nBe sure to first sort input with sort-bed or remove --do-not-sort option from conversion script.\n");
return STARCH_FATAL_ERROR;
}
- free(pRemainder), pRemainder = NULL;
+ free(pRemainder);
+ pRemainder = NULL;
}
}
else {
@@ -3882,8 +3925,10 @@ STARCH2_transformHeaderlessBEDInput(const FILE *inFp, Metadata **md, const Compr
}
/* clean up per-chromosome hash digest */
- if (base64EncodedSha1Digest)
- free(base64EncodedSha1Digest), base64EncodedSha1Digest = NULL;
+ if (base64EncodedSha1Digest) {
+ free(base64EncodedSha1Digest);
+ base64EncodedSha1Digest = NULL;
+ }
/* reset metadata pointer */
*md = firstRecord;
@@ -3958,14 +4003,22 @@ STARCH2_transformHeaderlessBEDInput(const FILE *inFp, Metadata **md, const Compr
fprintf(stdout, "%s", footerBuffer);
fflush(stdout);
- if (json)
- free(json), json = NULL;
- if (compressedFn)
- free(compressedFn), compressedFn = NULL;
- if (prevChromosome)
- free(prevChromosome), prevChromosome = NULL;
- if (base64EncodedSha1Digest)
- free(base64EncodedSha1Digest), base64EncodedSha1Digest = NULL;
+ if (json) {
+ free(json);
+ json = NULL;
+ }
+ if (compressedFn) {
+ free(compressedFn);
+ compressedFn = NULL;
+ }
+ if (prevChromosome) {
+ free(prevChromosome);
+ prevChromosome = NULL;
+ }
+ if (base64EncodedSha1Digest) {
+ free(base64EncodedSha1Digest);
+ base64EncodedSha1Digest = NULL;
+ }
return STARCH_EXIT_SUCCESS;
}
diff --git a/interfaces/src/data/starch/starchMetadataHelpers.c b/interfaces/src/data/starch/starchMetadataHelpers.c
index 69b07f8..a2b1d80 100644
--- a/interfaces/src/data/starch/starchMetadataHelpers.c
+++ b/interfaces/src/data/starch/starchMetadataHelpers.c
@@ -285,7 +285,8 @@ STARCH_updateMetadataForChromosome(Metadata **md,
return STARCH_EXIT_FAILURE;
}
if (iter->signature) {
- free(iter->signature), iter->signature = NULL;
+ free(iter->signature);
+ iter->signature = NULL;
}
if (signature) {
#ifdef __cplusplus
@@ -365,7 +366,7 @@ STARCH_listMetadata(const Metadata *md,
if ( (strcmp((const char *)iter->chromosome, chr) == 0) || (strcmp("all", chr) == 0) )
#endif
fprintf(stdout,
- "%-25s|%-65s|%-15" PRIu64 "|%-25" PRIu64 "|%-30d|%-20" PRIu64 "|%-20" PRIu64 "|%-25s|%-25s|%-25s\n",
+ "%-25s|%-65s|%-15" PRIu64 "|%-25" PRIu64 "|%-30lu|%-20" PRIu64 "|%-20" PRIu64 "|%-25s|%-25s|%-25s\n",
iter->chromosome,
iter->filename,
iter->size,
@@ -1911,10 +1912,14 @@ STARCH_readLegacyMetadata(const char *buf,
STARCH_DEFAULT_LINE_STRING_LENGTH);
/* cleanup */
- if (recFilename)
- free(recFilename), recFilename = NULL;
- if (recChromosome)
- free(recChromosome), recChromosome = NULL;
+ if (recFilename) {
+ free(recFilename);
+ recFilename = NULL;
+ }
+ if (recChromosome) {
+ free(recChromosome);
+ recChromosome = NULL;
+ }
}
else
break;
diff --git a/interfaces/src/data/starch/starchSha1Digest.c b/interfaces/src/data/starch/starchSha1Digest.c
index 52c5f2a..6538556 100644
--- a/interfaces/src/data/starch/starchSha1Digest.c
+++ b/interfaces/src/data/starch/starchSha1Digest.c
@@ -227,109 +227,109 @@ sha1_process_bytes (const void *buffer, size_t len, struct sha1_ctx *ctx)
/* When we already have some bits in our internal buffer concatenate
both inputs first. */
if (ctx->buflen != 0)
- {
- size_t left_over = ctx->buflen;
- size_t add = 128 - left_over > len ? len : 128 - left_over;
-
+ {
+ size_t left_over = ctx->buflen;
+ size_t add = 128 - left_over > len ? len : 128 - left_over;
+
#ifdef __cplusplus
- memcpy (&(reinterpret_cast<char *>( ctx->buffer ))[left_over], buffer, add);
+ memcpy (&(reinterpret_cast<char *>( ctx->buffer ))[left_over], buffer, add);
#else
- memcpy (&((char *) ctx->buffer)[left_over], buffer, add);
+ memcpy (&((char *) ctx->buffer)[left_over], buffer, add);
#endif
- ctx->buflen += add;
-
- if (ctx->buflen > 64)
- {
+ ctx->buflen += add;
+
+ if (ctx->buflen > 64)
+ {
#ifdef __cplusplus
- sha1_process_block (ctx->buffer, static_cast<size_t> (ctx->buflen & static_cast<sha1_uint32>( ~63 )), ctx);
+ sha1_process_block (ctx->buffer, static_cast<size_t> (ctx->buflen & static_cast<sha1_uint32>( ~63 )), ctx);
#else
- sha1_process_block (ctx->buffer, (size_t) (ctx->buflen & (sha1_uint32) ~63), ctx);
+ sha1_process_block (ctx->buffer, (size_t) (ctx->buflen & (sha1_uint32) ~63), ctx);
#endif
-
- ctx->buflen &= 63;
- /* The regions in the following copy operation cannot overlap. */
+
+ ctx->buflen &= 63;
+ /* The regions in the following copy operation cannot overlap. */
#ifdef __cplusplus
- memcpy (ctx->buffer,
- &(reinterpret_cast<char *>( ctx->buffer ))[(left_over + add) & static_cast<sha1_uint32>( ~63 )],
- ctx->buflen);
+ memcpy (ctx->buffer,
+ &(reinterpret_cast<char *>( ctx->buffer ))[(left_over + add) & static_cast<sha1_uint32>( ~63 )],
+ ctx->buflen);
#else
- memcpy (ctx->buffer,
- &((char *) ctx->buffer)[(left_over + add) & (sha1_uint32) ~63],
- ctx->buflen);
+ memcpy (ctx->buffer,
+ &((char *) ctx->buffer)[(left_over + add) & (sha1_uint32) ~63],
+ ctx->buflen);
#endif
- }
-
+ }
+
#ifdef __cplusplus
- buffer = reinterpret_cast<const char *>( buffer ) + add;
+ buffer = reinterpret_cast<const char *>( buffer ) + add;
#else
- buffer = (const char *) buffer + add;
+ buffer = (const char *) buffer + add;
#endif
- len -= add;
- }
+ len -= add;
+ }
/* Process available complete blocks. */
if (len >= 64)
- {
-
+ {
+
#ifndef __GLIBC__
#define _STRING_ARCH_unaligned 0
#endif
-
+
#if !_STRING_ARCH_unaligned
-# define alignof(type) offsetof (offset_test, x)
+# define alignof(type) offsetof (struct offset_test, x)
#ifdef __cplusplus
# define UNALIGNED_P(p) ((reinterpret_cast<size_t>( const_cast<void *>( p ) )) % alignof (sha1_uint32) != 0)
#else
# define UNALIGNED_P(p) (((size_t) p) % alignof (sha1_uint32) != 0)
#endif
- if (UNALIGNED_P (buffer))
- while (len > 64)
- {
- sha1_process_block (memcpy (ctx->buffer, buffer, 64), 64, ctx);
-#ifdef __cplusplus
- buffer = reinterpret_cast<const char *>( buffer ) + 64;
-#else
- buffer = (const char *) buffer + 64;
-#endif
- len -= 64;
- }
- else
+ if (UNALIGNED_P (buffer))
+ while (len > 64)
+ {
+ sha1_process_block (memcpy (ctx->buffer, buffer, 64), 64, ctx);
+ #ifdef __cplusplus
+ buffer = reinterpret_cast<const char *>( buffer ) + 64;
+ #else
+ buffer = (const char *) buffer + 64;
+ #endif
+ len -= 64;
+ }
+ else
#endif
- {
+ {
#ifdef __cplusplus
- sha1_process_block (buffer, len & static_cast<sha1_uint32>( ~63 ), ctx);
- buffer = reinterpret_cast<const char *>( buffer ) + (len & static_cast<sha1_uint32>( ~63 ));
+ sha1_process_block (buffer, len & static_cast<sha1_uint32>( ~63 ), ctx);
+ buffer = reinterpret_cast<const char *>( buffer ) + (len & static_cast<sha1_uint32>( ~63 ));
#else
- sha1_process_block (buffer, len & (sha1_uint32) ~63, ctx);
- buffer = (const char *) buffer + (len & (sha1_uint32) ~63);
+ sha1_process_block (buffer, len & (sha1_uint32) ~63, ctx);
+ buffer = (const char *) buffer + (len & (sha1_uint32) ~63);
#endif
- len &= 63;
- }
- }
+ len &= 63;
+ }
+ }
/* Move remaining bytes in internal buffer. */
if (len > 0)
- {
- size_t left_over = ctx->buflen;
-
+ {
+ size_t left_over = ctx->buflen;
+
#ifdef __cplusplus
- memcpy (&(reinterpret_cast<char *>( ctx->buffer ))[left_over], buffer, len);
+ memcpy (&(reinterpret_cast<char *>( ctx->buffer ))[left_over], buffer, len);
#else
- memcpy (&((char *) ctx->buffer)[left_over], buffer, len);
+ memcpy (&((char *) ctx->buffer)[left_over], buffer, len);
#endif
- left_over += len;
- if (left_over >= 64)
- {
- sha1_process_block (ctx->buffer, 64, ctx);
- left_over -= 64;
- memcpy (ctx->buffer, &ctx->buffer[16], left_over);
- }
+ left_over += len;
+ if (left_over >= 64)
+ {
+ sha1_process_block (ctx->buffer, 64, ctx);
+ left_over -= 64;
+ memcpy (ctx->buffer, &ctx->buffer[16], left_over);
+ }
#ifdef __cplusplus
- ctx->buflen = static_cast<sha1_uint32>( left_over );
+ ctx->buflen = static_cast<sha1_uint32>( left_over );
#else
- ctx->buflen = (sha1_uint32) left_over;
+ ctx->buflen = (sha1_uint32) left_over;
#endif
- }
+ }
}
/* --- Code below is the primary difference between md5.c and sha1.c --- */
@@ -372,7 +372,7 @@ sha1_process_block (const void *buffer, size_t len, struct sha1_ctx *ctx)
number of bytes. Do a double word increment. */
ctx->total[0] += len;
if (ctx->total[0] < len)
- ++ctx->total[1];
+ ++ctx->total[1];
#ifdef __cplusplus
#define rol(x, n) (((x) << (n)) | (static_cast<sha1_uint32>( x ) >> (32 - (n))))
@@ -380,114 +380,114 @@ sha1_process_block (const void *buffer, size_t len, struct sha1_ctx *ctx)
#define rol(x, n) (((x) << (n)) | ((sha1_uint32) (x) >> (32 - (n))))
#endif
-#define M(I) ( tm = x[I&0x0f] ^ x[(I-14)&0x0f] \
- ^ x[(I-8)&0x0f] ^ x[(I-3)&0x0f] \
- , (x[I&0x0f] = rol(tm, 1)) )
+#define M(I) ( tm = x[I&0x0f] ^ x[(I-14)&0x0f] \
+ ^ x[(I-8)&0x0f] ^ x[(I-3)&0x0f] \
+ , (x[I&0x0f] = rol(tm, 1)) )
-#define R(A,B,C,D,E,F,K,M) do { E += rol( A, 5 ) \
- + F( B, C, D ) \
- + K \
- + M; \
- B = rol( B, 30 ); \
+#define R(A,B,C,D,E,F,K,M) do { E += rol( A, 5 ) \
+ + F( B, C, D ) \
+ + K \
+ + M; \
+ B = rol( B, 30 ); \
} while(0)
while (words < endp)
- {
- sha1_uint32 tm;
- int t;
- for (t = 0; t < 16; t++)
- {
- x[t] = SWAP (*words);
- words++;
- }
-
- R( a, b, c, d, e, F1, K1, x[ 0] );
- R( e, a, b, c, d, F1, K1, x[ 1] );
- R( d, e, a, b, c, F1, K1, x[ 2] );
- R( c, d, e, a, b, F1, K1, x[ 3] );
- R( b, c, d, e, a, F1, K1, x[ 4] );
- R( a, b, c, d, e, F1, K1, x[ 5] );
- R( e, a, b, c, d, F1, K1, x[ 6] );
- R( d, e, a, b, c, F1, K1, x[ 7] );
- R( c, d, e, a, b, F1, K1, x[ 8] );
- R( b, c, d, e, a, F1, K1, x[ 9] );
- R( a, b, c, d, e, F1, K1, x[10] );
- R( e, a, b, c, d, F1, K1, x[11] );
- R( d, e, a, b, c, F1, K1, x[12] );
- R( c, d, e, a, b, F1, K1, x[13] );
- R( b, c, d, e, a, F1, K1, x[14] );
- R( a, b, c, d, e, F1, K1, x[15] );
- R( e, a, b, c, d, F1, K1, M(16) );
- R( d, e, a, b, c, F1, K1, M(17) );
- R( c, d, e, a, b, F1, K1, M(18) );
- R( b, c, d, e, a, F1, K1, M(19) );
- R( a, b, c, d, e, F2, K2, M(20) );
- R( e, a, b, c, d, F2, K2, M(21) );
- R( d, e, a, b, c, F2, K2, M(22) );
- R( c, d, e, a, b, F2, K2, M(23) );
- R( b, c, d, e, a, F2, K2, M(24) );
- R( a, b, c, d, e, F2, K2, M(25) );
- R( e, a, b, c, d, F2, K2, M(26) );
- R( d, e, a, b, c, F2, K2, M(27) );
- R( c, d, e, a, b, F2, K2, M(28) );
- R( b, c, d, e, a, F2, K2, M(29) );
- R( a, b, c, d, e, F2, K2, M(30) );
- R( e, a, b, c, d, F2, K2, M(31) );
- R( d, e, a, b, c, F2, K2, M(32) );
- R( c, d, e, a, b, F2, K2, M(33) );
- R( b, c, d, e, a, F2, K2, M(34) );
- R( a, b, c, d, e, F2, K2, M(35) );
- R( e, a, b, c, d, F2, K2, M(36) );
- R( d, e, a, b, c, F2, K2, M(37) );
- R( c, d, e, a, b, F2, K2, M(38) );
- R( b, c, d, e, a, F2, K2, M(39) );
- R( a, b, c, d, e, F3, K3, M(40) );
- R( e, a, b, c, d, F3, K3, M(41) );
- R( d, e, a, b, c, F3, K3, M(42) );
- R( c, d, e, a, b, F3, K3, M(43) );
- R( b, c, d, e, a, F3, K3, M(44) );
- R( a, b, c, d, e, F3, K3, M(45) );
- R( e, a, b, c, d, F3, K3, M(46) );
- R( d, e, a, b, c, F3, K3, M(47) );
- R( c, d, e, a, b, F3, K3, M(48) );
- R( b, c, d, e, a, F3, K3, M(49) );
- R( a, b, c, d, e, F3, K3, M(50) );
- R( e, a, b, c, d, F3, K3, M(51) );
- R( d, e, a, b, c, F3, K3, M(52) );
- R( c, d, e, a, b, F3, K3, M(53) );
- R( b, c, d, e, a, F3, K3, M(54) );
- R( a, b, c, d, e, F3, K3, M(55) );
- R( e, a, b, c, d, F3, K3, M(56) );
- R( d, e, a, b, c, F3, K3, M(57) );
- R( c, d, e, a, b, F3, K3, M(58) );
- R( b, c, d, e, a, F3, K3, M(59) );
- R( a, b, c, d, e, F4, K4, M(60) );
- R( e, a, b, c, d, F4, K4, M(61) );
- R( d, e, a, b, c, F4, K4, M(62) );
- R( c, d, e, a, b, F4, K4, M(63) );
- R( b, c, d, e, a, F4, K4, M(64) );
- R( a, b, c, d, e, F4, K4, M(65) );
- R( e, a, b, c, d, F4, K4, M(66) );
- R( d, e, a, b, c, F4, K4, M(67) );
- R( c, d, e, a, b, F4, K4, M(68) );
- R( b, c, d, e, a, F4, K4, M(69) );
- R( a, b, c, d, e, F4, K4, M(70) );
- R( e, a, b, c, d, F4, K4, M(71) );
- R( d, e, a, b, c, F4, K4, M(72) );
- R( c, d, e, a, b, F4, K4, M(73) );
- R( b, c, d, e, a, F4, K4, M(74) );
- R( a, b, c, d, e, F4, K4, M(75) );
- R( e, a, b, c, d, F4, K4, M(76) );
- R( d, e, a, b, c, F4, K4, M(77) );
- R( c, d, e, a, b, F4, K4, M(78) );
- R( b, c, d, e, a, F4, K4, M(79) );
-
- a = ctx->A += a;
- b = ctx->B += b;
- c = ctx->C += c;
- d = ctx->D += d;
- e = ctx->E += e;
- }
+ {
+ sha1_uint32 tm;
+ int t;
+ for (t = 0; t < 16; t++)
+ {
+ x[t] = SWAP (*words);
+ words++;
+ }
+
+ R( a, b, c, d, e, F1, K1, x[ 0] );
+ R( e, a, b, c, d, F1, K1, x[ 1] );
+ R( d, e, a, b, c, F1, K1, x[ 2] );
+ R( c, d, e, a, b, F1, K1, x[ 3] );
+ R( b, c, d, e, a, F1, K1, x[ 4] );
+ R( a, b, c, d, e, F1, K1, x[ 5] );
+ R( e, a, b, c, d, F1, K1, x[ 6] );
+ R( d, e, a, b, c, F1, K1, x[ 7] );
+ R( c, d, e, a, b, F1, K1, x[ 8] );
+ R( b, c, d, e, a, F1, K1, x[ 9] );
+ R( a, b, c, d, e, F1, K1, x[10] );
+ R( e, a, b, c, d, F1, K1, x[11] );
+ R( d, e, a, b, c, F1, K1, x[12] );
+ R( c, d, e, a, b, F1, K1, x[13] );
+ R( b, c, d, e, a, F1, K1, x[14] );
+ R( a, b, c, d, e, F1, K1, x[15] );
+ R( e, a, b, c, d, F1, K1, M(16) );
+ R( d, e, a, b, c, F1, K1, M(17) );
+ R( c, d, e, a, b, F1, K1, M(18) );
+ R( b, c, d, e, a, F1, K1, M(19) );
+ R( a, b, c, d, e, F2, K2, M(20) );
+ R( e, a, b, c, d, F2, K2, M(21) );
+ R( d, e, a, b, c, F2, K2, M(22) );
+ R( c, d, e, a, b, F2, K2, M(23) );
+ R( b, c, d, e, a, F2, K2, M(24) );
+ R( a, b, c, d, e, F2, K2, M(25) );
+ R( e, a, b, c, d, F2, K2, M(26) );
+ R( d, e, a, b, c, F2, K2, M(27) );
+ R( c, d, e, a, b, F2, K2, M(28) );
+ R( b, c, d, e, a, F2, K2, M(29) );
+ R( a, b, c, d, e, F2, K2, M(30) );
+ R( e, a, b, c, d, F2, K2, M(31) );
+ R( d, e, a, b, c, F2, K2, M(32) );
+ R( c, d, e, a, b, F2, K2, M(33) );
+ R( b, c, d, e, a, F2, K2, M(34) );
+ R( a, b, c, d, e, F2, K2, M(35) );
+ R( e, a, b, c, d, F2, K2, M(36) );
+ R( d, e, a, b, c, F2, K2, M(37) );
+ R( c, d, e, a, b, F2, K2, M(38) );
+ R( b, c, d, e, a, F2, K2, M(39) );
+ R( a, b, c, d, e, F3, K3, M(40) );
+ R( e, a, b, c, d, F3, K3, M(41) );
+ R( d, e, a, b, c, F3, K3, M(42) );
+ R( c, d, e, a, b, F3, K3, M(43) );
+ R( b, c, d, e, a, F3, K3, M(44) );
+ R( a, b, c, d, e, F3, K3, M(45) );
+ R( e, a, b, c, d, F3, K3, M(46) );
+ R( d, e, a, b, c, F3, K3, M(47) );
+ R( c, d, e, a, b, F3, K3, M(48) );
+ R( b, c, d, e, a, F3, K3, M(49) );
+ R( a, b, c, d, e, F3, K3, M(50) );
+ R( e, a, b, c, d, F3, K3, M(51) );
+ R( d, e, a, b, c, F3, K3, M(52) );
+ R( c, d, e, a, b, F3, K3, M(53) );
+ R( b, c, d, e, a, F3, K3, M(54) );
+ R( a, b, c, d, e, F3, K3, M(55) );
+ R( e, a, b, c, d, F3, K3, M(56) );
+ R( d, e, a, b, c, F3, K3, M(57) );
+ R( c, d, e, a, b, F3, K3, M(58) );
+ R( b, c, d, e, a, F3, K3, M(59) );
+ R( a, b, c, d, e, F4, K4, M(60) );
+ R( e, a, b, c, d, F4, K4, M(61) );
+ R( d, e, a, b, c, F4, K4, M(62) );
+ R( c, d, e, a, b, F4, K4, M(63) );
+ R( b, c, d, e, a, F4, K4, M(64) );
+ R( a, b, c, d, e, F4, K4, M(65) );
+ R( e, a, b, c, d, F4, K4, M(66) );
+ R( d, e, a, b, c, F4, K4, M(67) );
+ R( c, d, e, a, b, F4, K4, M(68) );
+ R( b, c, d, e, a, F4, K4, M(69) );
+ R( a, b, c, d, e, F4, K4, M(70) );
+ R( e, a, b, c, d, F4, K4, M(71) );
+ R( d, e, a, b, c, F4, K4, M(72) );
+ R( c, d, e, a, b, F4, K4, M(73) );
+ R( b, c, d, e, a, F4, K4, M(74) );
+ R( a, b, c, d, e, F4, K4, M(75) );
+ R( e, a, b, c, d, F4, K4, M(76) );
+ R( d, e, a, b, c, F4, K4, M(77) );
+ R( c, d, e, a, b, F4, K4, M(78) );
+ R( b, c, d, e, a, F4, K4, M(79) );
+
+ a = ctx->A += a;
+ b = ctx->B += b;
+ c = ctx->C += c;
+ d = ctx->D += d;
+ e = ctx->E += e;
+ }
}
/* We want to digest in one go, so we run everything at once */
diff --git a/interfaces/src/data/starch/unstarchHelpers.c b/interfaces/src/data/starch/unstarchHelpers.c
index 255bb5d..b79a8a5 100644
--- a/interfaces/src/data/starch/unstarchHelpers.c
+++ b/interfaces/src/data/starch/unstarchHelpers.c
@@ -971,13 +971,13 @@ UNSTARCH_sReverseTransformIgnoringHeaderedInput(const char *chr, const unsigned
*currentChr = currentChrCopy;
*currentChrLen = strlen(chr) * 2;
}
- strncpy(*currentChr, chr, strlen(chr) + 1);
+ strncpy(*currentChr, chr, strlen(chr) + 1);
if (!*currentChr) {
fprintf(stderr, "ERROR: Current chromosome name is not set\n");
- return UNSTARCH_FATAL_ERROR;
+ return UNSTARCH_FATAL_ERROR;
}
*currentStart = *start;
- *currentStop = *lastEnd;
+ *currentStop = *lastEnd;
if (! *currentRemainder) {
#ifdef __cplusplus
*currentRemainder = static_cast<char *>( malloc(strlen(elemTok2) + 1) );
@@ -1054,7 +1054,7 @@ UNSTARCH_sReverseTransformIgnoringHeaderedInput(const char *chr, const unsigned
/* strncpy(*currentChr, chr, strlen(chr) + 1); */
if (! *currentChr) {
fprintf(stderr, "ERROR: Current chromosome name could not be copied\n");
- return UNSTARCH_FATAL_ERROR;
+ return UNSTARCH_FATAL_ERROR;
}
#ifdef __cplusplus
*currentStart = static_cast<SignedCoordType>( strtoull(elemTok1, NULL, UNSTARCH_RADIX) );
@@ -1086,7 +1086,7 @@ UNSTARCH_sReverseTransformIgnoringHeaderedInput(const char *chr, const unsigned
strncpy(*currentRemainder, elemTok2, strlen(elemTok2) + 1);
if (!*currentRemainder) {
fprintf(stderr, "ERROR: Current remainder token could not be copied\n");
- return UNSTARCH_FATAL_ERROR;
+ return UNSTARCH_FATAL_ERROR;
}
}
}
@@ -1119,7 +1119,7 @@ UNSTARCH_sReverseTransformIgnoringHeaderedInput(const char *chr, const unsigned
strncpy(*currentChr, chr, strlen(chr) + 1);
if (! *currentChr) {
fprintf(stderr, "ERROR: Current chromosome name could not be copied\n");
- return UNSTARCH_FATAL_ERROR;
+ return UNSTARCH_FATAL_ERROR;
}
if (elemTok1[0] == 'p') {
@@ -1143,6 +1143,11 @@ UNSTARCH_sReverseTransformIgnoringHeaderedInput(const char *chr, const unsigned
*currentStart = *start;
*currentStop = *lastEnd;
}
+ if (*currentRemainder) {
+ free(*currentRemainder);
+ *currentRemainder = NULL;
+ *currentRemainderLen = 0;
+ }
}
}
else {
@@ -1458,7 +1463,7 @@ UNSTARCH_sReverseTransformHeaderlessInput(const char *chr, const unsigned char *
strncpy(*currentRemainder, elemTok2, strlen(elemTok2) + 1);
if (!*currentRemainder) {
fprintf(stderr, "ERROR: Current remainder token could not be copied\n");
- return UNSTARCH_FATAL_ERROR;
+ return UNSTARCH_FATAL_ERROR;
}
}
}
@@ -1519,7 +1524,7 @@ UNSTARCH_sReverseTransformHeaderlessInput(const char *chr, const unsigned char *
strncpy(*currentChr, chr, strlen(chr) + 1);
if (!*currentChr) {
fprintf(stderr, "ERROR: Current chromosome name could not be copied\n");
- return UNSTARCH_FATAL_ERROR;
+ return UNSTARCH_FATAL_ERROR;
}
*currentStart = *start;
*currentStop = *lastEnd;
@@ -1534,8 +1539,8 @@ UNSTARCH_sReverseTransformHeaderlessInput(const char *chr, const unsigned char *
return 0;
}
-int
-UNSTARCH_createInverseTransformTokens(const unsigned char *s, const char delim, char elemTok1[], char elemTok2[])
+int
+UNSTARCH_createInverseTransformTokens(const unsigned char *s, const char delim, char elemTok1[], char elemTok2[])
{
#ifdef DEBUG
fprintf(stderr, "\n--- UNSTARCH_createInverseTransformTokens() ---\n");
@@ -1546,18 +1551,21 @@ UNSTARCH_createInverseTransformTokens(const unsigned char *s, const char delim,
charCnt = 0;
sCnt = 0;
elemCnt = 0;
-
+
+ elemTok1[0] = '\0';
+ elemTok2[0] = '\0';
+
do {
buffer[charCnt++] = s[sCnt];
if (buffer[(charCnt - 1)] == delim) {
- if (elemCnt == 0) {
+ if (elemCnt == 0) {
buffer[(charCnt - 1)] = '\0';
#ifdef __cplusplus
- strncpy(elemTok1, reinterpret_cast<const char *>( buffer ), strlen(reinterpret_cast<const char *>( buffer )) + 1);
+ strncpy(elemTok1, reinterpret_cast<const char *>( buffer ), strlen(reinterpret_cast<const char *>( buffer )) + 1);
#else
- strncpy(elemTok1, (const char *) buffer, strlen((const char *) buffer) + 1);
+ strncpy(elemTok1, (const char *) buffer, strlen((const char *) buffer) + 1);
#endif
- elemCnt++;
+ elemCnt++;
charCnt = 0;
}
}
@@ -1593,7 +1601,7 @@ UNSTARCH_strnstr(const char *haystack, const char *needle, size_t haystackLen)
size_t pLen;
size_t len = strlen(needle);
- if (*needle == '\0') {
+ if (*needle == '\0') {
/* everything matches empty string */
#ifdef __cplusplus
return const_cast<char *>( haystack );
@@ -1732,7 +1740,7 @@ UNSTARCH_printLineMaxStringLengthForChromosome(const Metadata *md, const char *c
if (strcmp(chr, "all") == 0)
UNSTARCH_printLineMaxStringLengthForAllChromosomes(md);
else
- fprintf(stdout, "%d\n", UNSTARCH_lineMaxStringLengthForChromosome(md, chr));
+ fprintf(stdout, "%lu\n", UNSTARCH_lineMaxStringLengthForChromosome(md, chr));
}
void
@@ -1747,7 +1755,7 @@ UNSTARCH_printLineMaxStringLengthForAllChromosomes(const Metadata *md)
for (iter = md; iter != NULL; iter = iter->next)
lineMaxStringLength = (lineMaxStringLength >= iter->lineMaxStringLength) ? lineMaxStringLength : iter->lineMaxStringLength;
- fprintf(stdout, "%d\n", lineMaxStringLength);
+ fprintf(stdout, "%lu\n", lineMaxStringLength);
}
BaseCountType
@@ -2110,7 +2118,8 @@ UNSTARCH_printMetadataSignature(const unsigned char *mdSha1Buffer)
exit(-1);
}
fprintf(stdout, "metadata\t%s\n", jsonBase64String);
- free(jsonBase64String), jsonBase64String = NULL;
+ free(jsonBase64String);
+ jsonBase64String = NULL;
}
void
@@ -2162,7 +2171,10 @@ UNSTARCH_verifySignature(FILE **inFp, const Metadata *md, const uint64_t mdOffse
}
}
}
- if (observedSignature) { free(observedSignature), observedSignature = NULL; }
+ if (observedSignature) {
+ free(observedSignature);
+ observedSignature = NULL;
+ }
return signaturesVerifiedFlag;
}
diff --git a/interfaces/src/utility/SingletonType.cpp b/interfaces/src/utility/SingletonType.cpp
new file mode 100644
index 0000000..02c554f
--- /dev/null
+++ b/interfaces/src/utility/SingletonType.cpp
@@ -0,0 +1,14 @@
+#include <cstdlib>
+
+namespace Ext {
+
+template <typename T>
+T* SingletonType<T>::_instance = 0;
+
+template <typename T>
+void SingletonType<T>::Cleanup() { delete _instance; _instance = 0; }
+
+template <typename T>
+SingletonType<T>::SingletonType() { std::atexit(&Cleanup); }
+
+} // namespace Ext
diff --git a/packaging/deb/Dockerfile b/packaging/deb/Dockerfile
index d42f210..192c67a 100644
--- a/packaging/deb/Dockerfile
+++ b/packaging/deb/Dockerfile
@@ -10,16 +10,16 @@ RUN apt-get clean
ADD . /bedops
# populate base debian package tree
-RUN mkdir /bedops_2.4.26
-WORKDIR /bedops_2.4.26
+RUN mkdir /bedops_2.4.28
+WORKDIR /bedops_2.4.28
RUN mkdir -p DEBIAN usr/bin usr/share/doc/bedops
RUN cp /bedops/LICENSE /bedops/README.md usr/share/doc/bedops
RUN cp /bedops/packaging/deb/control DEBIAN
# build and install bedops into debian package tree
WORKDIR /bedops
-RUN make -j `nproc` && make install BINDIR=/bedops_2.4.26/usr/bin
+RUN make -j `nproc` && make install BINDIR=/bedops_2.4.28/usr/bin
WORKDIR /
-RUN dpkg-deb --build bedops_2.4.26
+RUN dpkg-deb --build bedops_2.4.28
# deb file should now be located in / directory
diff --git a/packaging/deb/control b/packaging/deb/control
index b9dc7a0..e209c38 100644
--- a/packaging/deb/control
+++ b/packaging/deb/control
@@ -1,5 +1,5 @@
Package: bedops
-Version: 2.4.26
+Version: 2.4.28
Section: base
Priority: optional
Architecture: amd64
diff --git a/packaging/os_x/BEDOPS.pkgproj b/packaging/os_x/BEDOPS.pkgproj
index c6edc43..9eed121 100755
--- a/packaging/os_x/BEDOPS.pkgproj
+++ b/packaging/os_x/BEDOPS.pkgproj
@@ -593,6 +593,38 @@
<key>GID</key>
<integer>0</integer>
<key>PATH</key>
+ <string>resources/bin/convert2bed-megarow</string>
+ <key>PATH_TYPE</key>
+ <integer>1</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>3</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>resources/bin/convert2bed-typical</string>
+ <key>PATH_TYPE</key>
+ <integer>1</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>3</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
<string>resources/bin/gff2bed</string>
<key>PATH_TYPE</key>
<integer>1</integer>
@@ -917,6 +949,8 @@
<integer>1</integer>
<key>CONCLUSION_ACTION</key>
<integer>0</integer>
+ <key>FOLLOW_SYMBOLIC_LINKS</key>
+ <true/>
<key>IDENTIFIER</key>
<string>org.uwencode.bedops.conversion</string>
<key>LOCATION</key>
@@ -1388,6 +1422,38 @@
<key>UID</key>
<integer>0</integer>
</dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>resources/bin/bedextract-megarow</string>
+ <key>PATH_TYPE</key>
+ <integer>1</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>3</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>resources/bin/bedextract-typical</string>
+ <key>PATH_TYPE</key>
+ <integer>1</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>3</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
</array>
<key>GID</key>
<integer>0</integer>
@@ -1462,6 +1528,8 @@
<integer>1</integer>
<key>CONCLUSION_ACTION</key>
<integer>0</integer>
+ <key>FOLLOW_SYMBOLIC_LINKS</key>
+ <true/>
<key>IDENTIFIER</key>
<string>org.uwencode.bedops.bedextract</string>
<key>LOCATION</key>
@@ -1933,6 +2001,38 @@
<key>UID</key>
<integer>0</integer>
</dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>resources/bin/bedmap-megarow</string>
+ <key>PATH_TYPE</key>
+ <integer>1</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>3</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>resources/bin/bedmap-typical</string>
+ <key>PATH_TYPE</key>
+ <integer>1</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>3</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
</array>
<key>GID</key>
<integer>0</integer>
@@ -2007,6 +2107,8 @@
<integer>1</integer>
<key>CONCLUSION_ACTION</key>
<integer>0</integer>
+ <key>FOLLOW_SYMBOLIC_LINKS</key>
+ <true/>
<key>IDENTIFIER</key>
<string>org.uwencode.bedops.bedmap</string>
<key>LOCATION</key>
@@ -2478,6 +2580,38 @@
<key>UID</key>
<integer>0</integer>
</dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>resources/bin/bedops-megarow</string>
+ <key>PATH_TYPE</key>
+ <integer>1</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>3</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>resources/bin/bedops-typical</string>
+ <key>PATH_TYPE</key>
+ <integer>1</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>3</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
</array>
<key>GID</key>
<integer>0</integer>
@@ -2552,6 +2686,8 @@
<integer>1</integer>
<key>CONCLUSION_ACTION</key>
<integer>0</integer>
+ <key>FOLLOW_SYMBOLIC_LINKS</key>
+ <true/>
<key>IDENTIFIER</key>
<string>org.uwencode.bedops.bedops</string>
<key>LOCATION</key>
@@ -3023,6 +3159,38 @@
<key>UID</key>
<integer>0</integer>
</dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>resources/bin/closest-features-megarow</string>
+ <key>PATH_TYPE</key>
+ <integer>1</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>3</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>resources/bin/closest-features-typical</string>
+ <key>PATH_TYPE</key>
+ <integer>1</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>3</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
</array>
<key>GID</key>
<integer>0</integer>
@@ -3097,6 +3265,8 @@
<integer>1</integer>
<key>CONCLUSION_ACTION</key>
<integer>0</integer>
+ <key>FOLLOW_SYMBOLIC_LINKS</key>
+ <true/>
<key>IDENTIFIER</key>
<string>org.uwencode.bedops.closest-features</string>
<key>LOCATION</key>
@@ -3574,6 +3744,38 @@
<key>GID</key>
<integer>0</integer>
<key>PATH</key>
+ <string>resources/bin/sort-bed-megarow</string>
+ <key>PATH_TYPE</key>
+ <integer>1</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>3</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>resources/bin/sort-bed-typical</string>
+ <key>PATH_TYPE</key>
+ <integer>1</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>3</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
<string>resources/bin/update-sort-bed-migrate-candidates</string>
<key>PATH_TYPE</key>
<integer>1</integer>
@@ -3590,6 +3792,38 @@
<key>GID</key>
<integer>0</integer>
<key>PATH</key>
+ <string>resources/bin/update-sort-bed-migrate-candidates-megarow</string>
+ <key>PATH_TYPE</key>
+ <integer>1</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>3</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>resources/bin/update-sort-bed-migrate-candidates-typical</string>
+ <key>PATH_TYPE</key>
+ <integer>1</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>3</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
<string>resources/bin/update-sort-bed-slurm</string>
<key>PATH_TYPE</key>
<integer>1</integer>
@@ -3606,6 +3840,38 @@
<key>GID</key>
<integer>0</integer>
<key>PATH</key>
+ <string>resources/bin/update-sort-bed-slurm-megarow</string>
+ <key>PATH_TYPE</key>
+ <integer>1</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>3</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>resources/bin/update-sort-bed-slurm-typical</string>
+ <key>PATH_TYPE</key>
+ <integer>1</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>3</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
<string>resources/bin/update-sort-bed-starch-slurm</string>
<key>PATH_TYPE</key>
<integer>1</integer>
@@ -3616,22 +3882,54 @@
<key>UID</key>
<integer>0</integer>
</dict>
- </array>
- <key>GID</key>
- <integer>0</integer>
- <key>PATH</key>
- <string>bin</string>
- <key>PATH_TYPE</key>
- <integer>0</integer>
- <key>PERMISSIONS</key>
- <integer>493</integer>
- <key>TYPE</key>
- <integer>2</integer>
- <key>UID</key>
- <integer>0</integer>
- </dict>
- </array>
- <key>GID</key>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>resources/bin/update-sort-bed-starch-slurm-megarow</string>
+ <key>PATH_TYPE</key>
+ <integer>1</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>3</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>resources/bin/update-sort-bed-starch-slurm-typical</string>
+ <key>PATH_TYPE</key>
+ <integer>1</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>3</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ </array>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>bin</string>
+ <key>PATH_TYPE</key>
+ <integer>0</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>2</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ </array>
+ <key>GID</key>
<integer>0</integer>
<key>PATH</key>
<string>local</string>
@@ -3690,6 +3988,8 @@
<integer>1</integer>
<key>CONCLUSION_ACTION</key>
<integer>0</integer>
+ <key>FOLLOW_SYMBOLIC_LINKS</key>
+ <true/>
<key>IDENTIFIER</key>
<string>org.uwencode.bedops.sort-bed</string>
<key>LOCATION</key>
@@ -4183,6 +4483,70 @@
<key>GID</key>
<integer>0</integer>
<key>PATH</key>
+ <string>resources/bin/starch-diff-megarow</string>
+ <key>PATH_TYPE</key>
+ <integer>1</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>3</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>resources/bin/starch-diff-typical</string>
+ <key>PATH_TYPE</key>
+ <integer>1</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>3</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>resources/bin/starch-megarow</string>
+ <key>PATH_TYPE</key>
+ <integer>1</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>3</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>resources/bin/starch-typical</string>
+ <key>PATH_TYPE</key>
+ <integer>1</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>3</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
<string>resources/bin/starchcat</string>
<key>PATH_TYPE</key>
<integer>1</integer>
@@ -4199,6 +4563,38 @@
<key>GID</key>
<integer>0</integer>
<key>PATH</key>
+ <string>resources/bin/starchcat-megarow</string>
+ <key>PATH_TYPE</key>
+ <integer>1</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>3</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>resources/bin/starchcat-typical</string>
+ <key>PATH_TYPE</key>
+ <integer>1</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>3</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
<string>resources/bin/starchstrip</string>
<key>PATH_TYPE</key>
<integer>1</integer>
@@ -4215,6 +4611,38 @@
<key>GID</key>
<integer>0</integer>
<key>PATH</key>
+ <string>resources/bin/starchstrip-megarow</string>
+ <key>PATH_TYPE</key>
+ <integer>1</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>3</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>resources/bin/starchstrip-typical</string>
+ <key>PATH_TYPE</key>
+ <integer>1</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>3</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
<string>resources/bin/unstarch</string>
<key>PATH_TYPE</key>
<integer>1</integer>
@@ -4225,6 +4653,38 @@
<key>UID</key>
<integer>0</integer>
</dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>resources/bin/unstarch-megarow</string>
+ <key>PATH_TYPE</key>
+ <integer>1</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>3</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>resources/bin/unstarch-typical</string>
+ <key>PATH_TYPE</key>
+ <integer>1</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>3</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
</array>
<key>GID</key>
<integer>0</integer>
@@ -4299,6 +4759,8 @@
<integer>1</integer>
<key>CONCLUSION_ACTION</key>
<integer>0</integer>
+ <key>FOLLOW_SYMBOLIC_LINKS</key>
+ <true/>
<key>IDENTIFIER</key>
<string>org.uwencode.bedops.starch</string>
<key>LOCATION</key>
@@ -4776,6 +5238,38 @@
<key>GID</key>
<integer>0</integer>
<key>PATH</key>
+ <string>resources/bin/starchcluster_gnuParallel-megarow</string>
+ <key>PATH_TYPE</key>
+ <integer>1</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>3</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>resources/bin/starchcluster_gnuParallel-typical</string>
+ <key>PATH_TYPE</key>
+ <integer>1</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>3</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
<string>resources/bin/starchcluster_sge</string>
<key>PATH_TYPE</key>
<integer>1</integer>
@@ -4792,6 +5286,38 @@
<key>GID</key>
<integer>0</integer>
<key>PATH</key>
+ <string>resources/bin/starchcluster_sge-megarow</string>
+ <key>PATH_TYPE</key>
+ <integer>1</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>3</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>resources/bin/starchcluster_sge-typical</string>
+ <key>PATH_TYPE</key>
+ <integer>1</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>3</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
<string>resources/bin/starchcluster_slurm</string>
<key>PATH_TYPE</key>
<integer>1</integer>
@@ -4802,6 +5328,552 @@
<key>UID</key>
<integer>0</integer>
</dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>resources/bin/starchcluster_slurm-megarow</string>
+ <key>PATH_TYPE</key>
+ <integer>1</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>3</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>resources/bin/starchcluster_slurm-typical</string>
+ <key>PATH_TYPE</key>
+ <integer>1</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>3</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ </array>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>bin</string>
+ <key>PATH_TYPE</key>
+ <integer>0</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>2</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ </array>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>local</string>
+ <key>PATH_TYPE</key>
+ <integer>0</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>2</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ </array>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>usr</string>
+ <key>PATH_TYPE</key>
+ <integer>0</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>2</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ </array>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>/</string>
+ <key>PATH_TYPE</key>
+ <integer>0</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>1</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ <key>PAYLOAD_TYPE</key>
+ <integer>0</integer>
+ <key>VERSION</key>
+ <integer>2</integer>
+ </dict>
+ <key>PACKAGE_SCRIPTS</key>
+ <dict>
+ <key>POSTINSTALL_PATH</key>
+ <dict/>
+ <key>PREINSTALL_PATH</key>
+ <dict/>
+ <key>RESOURCES</key>
+ <array/>
+ </dict>
+ <key>PACKAGE_SETTINGS</key>
+ <dict>
+ <key>AUTHENTICATION</key>
+ <integer>1</integer>
+ <key>CONCLUSION_ACTION</key>
+ <integer>0</integer>
+ <key>FOLLOW_SYMBOLIC_LINKS</key>
+ <true/>
+ <key>IDENTIFIER</key>
+ <string>org.uwencode.bedops.starchcluster</string>
+ <key>LOCATION</key>
+ <integer>0</integer>
+ <key>NAME</key>
+ <string>starchcluster</string>
+ <key>OVERWRITE_PERMISSIONS</key>
+ <false/>
+ <key>VERSION</key>
+ <string>1.0</string>
+ </dict>
+ <key>TYPE</key>
+ <integer>0</integer>
+ <key>UUID</key>
+ <string>F995F366-BC68-4AC7-B2AE-C7C05BAF635D</string>
+ </dict>
+ <dict>
+ <key>PACKAGE_FILES</key>
+ <dict>
+ <key>DEFAULT_INSTALL_LOCATION</key>
+ <string>/</string>
+ <key>HIERARCHY</key>
+ <dict>
+ <key>CHILDREN</key>
+ <array>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>80</integer>
+ <key>PATH</key>
+ <string>Applications</string>
+ <key>PATH_TYPE</key>
+ <integer>0</integer>
+ <key>PERMISSIONS</key>
+ <integer>509</integer>
+ <key>TYPE</key>
+ <integer>1</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>80</integer>
+ <key>PATH</key>
+ <string>Application Support</string>
+ <key>PATH_TYPE</key>
+ <integer>0</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>1</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>Automator</string>
+ <key>PATH_TYPE</key>
+ <integer>0</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>1</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>Documentation</string>
+ <key>PATH_TYPE</key>
+ <integer>0</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>1</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>Extensions</string>
+ <key>PATH_TYPE</key>
+ <integer>0</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>1</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>Filesystems</string>
+ <key>PATH_TYPE</key>
+ <integer>0</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>1</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>Frameworks</string>
+ <key>PATH_TYPE</key>
+ <integer>0</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>1</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>Input Methods</string>
+ <key>PATH_TYPE</key>
+ <integer>0</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>1</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>Internet Plug-Ins</string>
+ <key>PATH_TYPE</key>
+ <integer>0</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>1</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>LaunchAgents</string>
+ <key>PATH_TYPE</key>
+ <integer>0</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>1</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>LaunchDaemons</string>
+ <key>PATH_TYPE</key>
+ <integer>0</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>1</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>PreferencePanes</string>
+ <key>PATH_TYPE</key>
+ <integer>0</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>1</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>Preferences</string>
+ <key>PATH_TYPE</key>
+ <integer>0</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>1</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>80</integer>
+ <key>PATH</key>
+ <string>Printers</string>
+ <key>PATH_TYPE</key>
+ <integer>0</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>1</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>PrivilegedHelperTools</string>
+ <key>PATH_TYPE</key>
+ <integer>0</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>1</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>QuickLook</string>
+ <key>PATH_TYPE</key>
+ <integer>0</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>1</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>QuickTime</string>
+ <key>PATH_TYPE</key>
+ <integer>0</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>1</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>Screen Savers</string>
+ <key>PATH_TYPE</key>
+ <integer>0</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>1</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>Scripts</string>
+ <key>PATH_TYPE</key>
+ <integer>0</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>1</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>Services</string>
+ <key>PATH_TYPE</key>
+ <integer>0</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>1</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>Widgets</string>
+ <key>PATH_TYPE</key>
+ <integer>0</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>1</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ </array>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>Library</string>
+ <key>PATH_TYPE</key>
+ <integer>0</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>1</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>Shared</string>
+ <key>PATH_TYPE</key>
+ <integer>0</integer>
+ <key>PERMISSIONS</key>
+ <integer>1023</integer>
+ <key>TYPE</key>
+ <integer>1</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ </array>
+ <key>GID</key>
+ <integer>80</integer>
+ <key>PATH</key>
+ <string>Users</string>
+ <key>PATH_TYPE</key>
+ <integer>0</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>1</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>CHILDREN</key>
+ <array>
+ <dict>
+ <key>CHILDREN</key>
+ <array>
+ <dict>
+ <key>CHILDREN</key>
+ <array>
+ <dict>
+ <key>CHILDREN</key>
+ <array/>
+ <key>GID</key>
+ <integer>0</integer>
+ <key>PATH</key>
+ <string>resources/bin/switch-BEDOPS-binary-type</string>
+ <key>PATH_TYPE</key>
+ <integer>1</integer>
+ <key>PERMISSIONS</key>
+ <integer>493</integer>
+ <key>TYPE</key>
+ <integer>3</integer>
+ <key>UID</key>
+ <integer>0</integer>
+ </dict>
</array>
<key>GID</key>
<integer>0</integer>
@@ -4861,14 +5933,10 @@
<key>PAYLOAD_TYPE</key>
<integer>0</integer>
<key>VERSION</key>
- <integer>2</integer>
+ <integer>4</integer>
</dict>
<key>PACKAGE_SCRIPTS</key>
<dict>
- <key>POSTINSTALL_PATH</key>
- <dict/>
- <key>PREINSTALL_PATH</key>
- <dict/>
<key>RESOURCES</key>
<array/>
</dict>
@@ -4878,12 +5946,14 @@
<integer>1</integer>
<key>CONCLUSION_ACTION</key>
<integer>0</integer>
+ <key>FOLLOW_SYMBOLIC_LINKS</key>
+ <true/>
<key>IDENTIFIER</key>
- <string>org.uwencode.bedops.starchcluster</string>
+ <string>org.uwencode.bedops.switch-binary-type</string>
<key>LOCATION</key>
<integer>0</integer>
<key>NAME</key>
- <string>starchcluster</string>
+ <string>binary-type selection</string>
<key>OVERWRITE_PERMISSIONS</key>
<false/>
<key>VERSION</key>
@@ -4892,7 +5962,7 @@
<key>TYPE</key>
<integer>0</integer>
<key>UUID</key>
- <string>F995F366-BC68-4AC7-B2AE-C7C05BAF635D</string>
+ <string>A54C7634-8547-497B-8024-9E7FC4B8756D</string>
</dict>
</array>
<key>PROJECT</key>
@@ -5206,7 +6276,7 @@
<key>LANGUAGE</key>
<string>English</string>
<key>VALUE</key>
- <string>This package installs the SGE- (Sun Grid Engine) and GNU Parallels-based starchcluster scripts, which parallelize Starch v2 archive creation.</string>
+ <string>This package installs Slurm-, SGE- (Sun Grid Engine) and GNU Parallels-based starchcluster scripts, which parallelize Starch v2 archive creation.</string>
</dict>
</array>
<key>OPTIONS</key>
@@ -5236,6 +6306,43 @@
<key>UUID</key>
<string>BB83605B-AB9C-4E69-BF71-DA3A9A013506</string>
</dict>
+ <dict>
+ <key>DESCRIPTION</key>
+ <array>
+ <dict>
+ <key>LANGUAGE</key>
+ <string>English</string>
+ <key>VALUE</key>
+ <string>Allows easy switching between 'typical' and 'megarow' builds of BEDOPS binaries</string>
+ </dict>
+ </array>
+ <key>OPTIONS</key>
+ <dict>
+ <key>HIDDEN</key>
+ <false/>
+ <key>STATE</key>
+ <integer>1</integer>
+ </dict>
+ <key>PACKAGE_UUID</key>
+ <string>A54C7634-8547-497B-8024-9E7FC4B8756D</string>
+ <key>REQUIREMENTS</key>
+ <array/>
+ <key>TITLE</key>
+ <array>
+ <dict>
+ <key>LANGUAGE</key>
+ <string>English</string>
+ <key>VALUE</key>
+ <string>binary-type selection</string>
+ </dict>
+ </array>
+ <key>TOOLTIP</key>
+ <array/>
+ <key>TYPE</key>
+ <integer>0</integer>
+ <key>UUID</key>
+ <string>2FE0AE7E-84B4-4FD9-BAAF-A1B3D1A1D6C0</string>
+ </dict>
</array>
<key>REMOVED</key>
<dict/>
@@ -5359,7 +6466,7 @@
<key>LANGUAGE</key>
<string>English</string>
<key>VALUE</key>
- <string>BEDOPS 2.4.26</string>
+ <string>BEDOPS 2.4.28</string>
</dict>
</array>
</dict>
@@ -5378,7 +6485,7 @@
<key>IC_REQUIREMENT_OS_DISTRIBUTION_TYPE</key>
<integer>0</integer>
<key>IC_REQUIREMENT_OS_MINIMUM_VERSION</key>
- <integer>100700</integer>
+ <integer>101000</integer>
</dict>
<key>IC_REQUIREMENT_CHECK_TYPE</key>
<integer>1</integer>
@@ -5390,7 +6497,7 @@
<key>LANGUAGE</key>
<string>English</string>
<key>VALUE</key>
- <string>This installer requires at least Mac OS X 10.7</string>
+ <string>This installer requires at least Mac OS X 10.10</string>
</dict>
</array>
<key>NAME</key>
@@ -5398,38 +6505,6 @@
<key>STATE</key>
<true/>
</dict>
- <dict>
- <key>BEHAVIOR</key>
- <integer>3</integer>
- <key>DICTIONARY</key>
- <dict>
- <key>IC_REQUIREMENT_OS_DISK_TYPE</key>
- <integer>0</integer>
- <key>IC_REQUIREMENT_OS_DISTRIBUTION_TYPE</key>
- <integer>0</integer>
- <key>IC_REQUIREMENT_OS_MINIMUM_VERSION</key>
- <integer>100700</integer>
- </dict>
- <key>IC_REQUIREMENT_CHECK_TYPE</key>
- <integer>1</integer>
- <key>IDENTIFIER</key>
- <string>fr.whitebox.Packages.requirement.os</string>
- <key>MESSAGE</key>
- <array>
- <dict>
- <key>LANGUAGE</key>
- <string>English</string>
- <key>SECONDARY_VALUE</key>
- <string>BEDOPS for Mac OS X requires an Intel processor</string>
- <key>VALUE</key>
- <string>Processor requirement</string>
- </dict>
- </array>
- <key>NAME</key>
- <string>Processor</string>
- <key>STATE</key>
- <true/>
- </dict>
</array>
<key>POSTINSTALL_PATH</key>
<dict/>
@@ -5622,7 +6697,7 @@
</dict>
</array>
<key>NAME</key>
- <string>BEDOPS 2.4.26</string>
+ <string>BEDOPS 2.4.28</string>
</dict>
</dict>
<key>TYPE</key>
diff --git a/packaging/rpm/Dockerfile b/packaging/rpm/Dockerfile
index 604e049..9ed14f5 100644
--- a/packaging/rpm/Dockerfile
+++ b/packaging/rpm/Dockerfile
@@ -11,9 +11,9 @@ RUN yum -y install tar \
# copy the source context into the local image & build/install
# note: make sure .dockerignore is up to date
-RUN mkdir /bedops-2.4.26
-ADD . /bedops-2.4.26
-RUN tar zcf /bedops-2.4.26.tar.gz bedops-2.4.26
-RUN rm -rf /bedops-2.4.26
-RUN rpmbuild -ta bedops-2.4.26.tar.gz
-RUN rm /bedops-2.4.26.tar.gz
+RUN mkdir /bedops-2.4.28
+ADD . /bedops-2.4.28
+RUN tar zcf /bedops-2.4.28.tar.gz bedops-2.4.28
+RUN rm -rf /bedops-2.4.28
+RUN rpmbuild -ta bedops-2.4.28.tar.gz
+RUN rm /bedops-2.4.28.tar.gz
diff --git a/packaging/rpm/bedops.spec b/packaging/rpm/bedops.spec
index 1ec8295..7b67bae 100644
--- a/packaging/rpm/bedops.spec
+++ b/packaging/rpm/bedops.spec
@@ -1,5 +1,5 @@
Name: bedops
-Version: 2.4.26
+Version: 2.4.28
Release: 1
Summary: A suite of tools to address common questions raised in genomic studies.
Group: Applications/Productivity
diff --git a/system.mk/Makefile.darwin b/system.mk/Makefile.darwin
index 14979fe..ba21929 100644
--- a/system.mk/Makefile.darwin
+++ b/system.mk/Makefile.darwin
@@ -1,204 +1,82 @@
-PARTY3 = third-party
-BZIP2VERSION = bzip2-1.0.6
-WHICHBZIP2 := ${PARTY3}/${BZIP2VERSION}
-JANSSONVERSION = jansson-2.6
-WHICHJANSSON := ${PARTY3}/${JANSSONVERSION}
-ZLIBVERSION = zlib-1.2.7
-WHICHZLIB := ${PARTY3}/${ZLIBVERSION}
-APPDIR = applications/bed
-BINDIR = bin
-OSXPKGROOT = packaging/os_x
-OSXBUILDDIR = ${OSXPKGROOT}/build
-OSXPKGDIR = ${OSXPKGROOT}/resources/bin
-OSXLIBDIR = ${OSXPKGROOT}/resources/lib
-WDIR = ${shell pwd}
-export CC = clang
-export CXX = clang++
-SELF = ${WDIR}/system.mk/Makefile.darwin
-I386 = darwin_intel_i386
-X86_64 = darwin_intel_x86_64
-
+PARTY3 = third-party
+BZIP2VERSION = bzip2-1.0.6
+WHICHBZIP2 := ${PARTY3}/${BZIP2VERSION}
+JANSSONVERSION = jansson-2.6
+WHICHJANSSON := ${PARTY3}/${JANSSONVERSION}
+ZLIBVERSION = zlib-1.2.7
+WHICHZLIB := ${PARTY3}/${ZLIBVERSION}
+APPDIR = applications/bed
+OSXPKGROOT = packaging/os_x
+OSXBUILDDIR = ${OSXPKGROOT}/build
+OSXPKGDIR = ${OSXPKGROOT}/resources/bin
+OSXLIBDIR = ${OSXPKGROOT}/resources/lib
+WDIR = ${shell pwd}
+export CC = clang
+export CXX = clang++
+SELF = ${WDIR}/system.mk/Makefile.darwin
+I386 = darwin_intel_i386
+X86_64 = darwin_intel_x86_64
+MIN_OSX_VERSION = 10.10
+MEGAROW = megarow
+TYPICAL = typical
+BINDIR = bin
+BINDIR_MODULE = modules
+BINDIR_MODULE_TYPICAL = ${BINDIR_MODULE}/${TYPICAL}
+BINDIR_MODULE_MEGAROW = ${BINDIR_MODULE}/${MEGAROW}
+
+ifeq ($(BUILD_ARCH),)
+BUILD_ARCH := x86_64
+endif
default: support
$(MAKE) build -f $(SELF)
SUBDIRS = bedmap/src sort-bed/src bedops/src closestfeats/src bedextract/src starch/src conversion/src
SUBDIRS_FULL := $(patsubst %,${APPDIR}/%,$(SUBDIRS))
-SUBDIRS_I386 := $(patsubst %,%_i386,$(SUBDIRS))
-SUBDIRS_X86_64 := $(patsubst %,%_x86_64,$(SUBDIRS))
-.PHONY: $(SUBDIRS)
.PHONY: $(SUBDIRS_FULL)
-.PHONY: $(SUBDIRS_I386)
-.PHONY: $(SUBDIRS_X86_64)
-
-# $@ needs ${APPDIR}/ as a prefix
-$(SUBDIRS):
- export ARCH=i386 && $(MAKE) -C ${APPDIR}/$@ -f Makefile.darwin $(MAKECMDGOALS)
# $@ has full path info
$(SUBDIRS_FULL):
- export ARCH=x86_64 && $(MAKE) -C $@ -f Makefile.darwin $(MAKECMDGOALS)
-
-# prereq is $(SUBDIRS)
-.SECONDEXPANSION:
-$(SUBDIRS_I386): $$(patsubst %_i386,%,$$@)
-
-# prereq is $(SUBDIRS_FULL)
-.SECONDEXPANSION:
-$(SUBDIRS_X86_64): $$(patsubst %_x86_64,${APPDIR}/%,$$@)
+ export ARCH=${BUILD_ARCH} MIN_OSX_VERSION=${MIN_OSX_VERSION} && $(MAKE) -C $@ -f Makefile.darwin $(MAKECMDGOALS)
-all: $(SUBDIRS_I386) $(SUBDIRS_X86_64)
+all: $(SUBDIRS_FULL)
build: all
- $(MAKE) build_fat -f $(SELF)
-
-build_fat: sort_c_intel_fat bedops_c_intel_fat closestfeatures_c_intel_fat bedmap_c_intel_fat bedextract_c_intel_fat convert2bed_c_intel_fat starch_c_intel_fat
debug: support
$(MAKE) build_debug -f $(SELF)
build_debug: all
- $(MAKE) dbg_build_fat -f $(SELF)
-
-dbg_build_fat: dbg_sort_c_intel_fat dbg_bedops_c_intel_fat dbg_closestfeatures_c_intel_fat dbg_bedmap_c_intel_fat dbg_bedextract_c_intel_fat dbg_convert2bed_c_intel_fat dbg_starch_c_intel_fat
#
# clean ups
#
clean: clean_debug clean_gprof all
- rm -f ${BINDIR}/sort-bed
- rm -f ${BINDIR}/update-sort-bed-slurm
- rm -f ${BINDIR}/update-sort-bed-starch-slurm
- rm -f ${BINDIR}/update-sort-bed-migrate-candidates
- rm -f ${BINDIR}/bedops
- rm -f ${BINDIR}/closest-features
- rm -f ${BINDIR}/bedmap
- rm -f ${BINDIR}/bedextract
- rm -f ${BINDIR}/starch
- rm -f ${BINDIR}/unstarch
- rm -f ${BINDIR}/starchcat
- rm -f ${BINDIR}/starchstrip
- rm -f ${BINDIR}/starchcluster*
- rm -f ${BINDIR}/starch-diff
- rm -f ${BINDIR}/bam2bed
- rm -f ${BINDIR}/bam2bed*
- rm -f ${BINDIR}/gff2bed
- rm -f ${BINDIR}/gtf2bed
- rm -f ${BINDIR}/gvf2bed
- rm -f ${BINDIR}/psl2bed
- rm -f ${BINDIR}/rmsk2bed
- rm -f ${BINDIR}/sam2bed
- rm -f ${BINDIR}/vcf2bed
- rm -f ${BINDIR}/wig2bed
- rm -f ${BINDIR}/convert2bed
- rm -f ${BINDIR}/bam2starch
- rm -f ${BINDIR}/bam2starch*
- rm -f ${BINDIR}/gff2starch
- rm -f ${BINDIR}/gtf2starch
- rm -f ${BINDIR}/gvf2starch
- rm -f ${BINDIR}/psl2starch
- rm -f ${BINDIR}/rmsk2starch
- rm -f ${BINDIR}/sam2starch
- rm -f ${BINDIR}/vcf2starch
- rm -f ${BINDIR}/wig2starch
- rm -f ${OSXPKGDIR}/*
- rm -f ${OSXLIBDIR}/*
- rm -Rf ${OSXBUILDDIR}/*
+ rm -rf ${BINDIR}
+ rm -rf ${BINDIR_MODULE}
+ rm -rf ${OSXPKGDIR}
+ rm -rf ${OSXLIBDIR}
+ rm -rf ${OSXBUILDDIR}
rm -rf ${WHICHBZIP2}
rm -f ${PARTY3}/bzip2
rm -rf ${WHICHJANSSON}
rm -f ${PARTY3}/jansson
rm -rf ${WHICHZLIB}
rm -f ${PARTY3}/zlib
- rm -rf ${PARTY3}/$(I386)
- rm -rf ${PARTY3}/$(X86_64)
- rm -f ${APPDIR}/starch/bin/*starch*
- rm -Rf ${BINDIR}
+ rm -rf ${PARTY3}/darwin_intel_${BUILD_ARCH}
clean_debug:
- rm -f ${BINDIR}/debug.sort-bed
- rm -f ${BINDIR}/update-sort-bed-slurm
- rm -f ${BINDIR}/update-sort-bed-starch-slurm
- rm -f ${BINDIR}/update-sort-bed-migrate-candidates
- rm -f ${BINDIR}/debug.bedops
- rm -f ${BINDIR}/debug.closest-features
- rm -f ${BINDIR}/debug.bedmap
- rm -f ${BINDIR}/debug.bedextract
- rm -f ${BINDIR}/debug.starch
- rm -f ${BINDIR}/debug.unstarch
- rm -f ${BINDIR}/debug.starchcat
- rm -f ${BINDIR}/debug.starchstrip
- rm -f ${BINDIR}/starchcluster*
- rm -f ${BINDIR}/starch-diff
- rm -f ${BINDIR}/bam2bed
- rm -f ${BINDIR}/bam2bed*
- rm -f ${BINDIR}/gff2bed
- rm -f ${BINDIR}/gtf2bed
- rm -f ${BINDIR}/gvf2bed
- rm -f ${BINDIR}/psl2bed
- rm -f ${BINDIR}/rmsk2bed
- rm -f ${BINDIR}/sam2bed
- rm -f ${BINDIR}/vcf2bed
- rm -f ${BINDIR}/wig2bed
- rm -f ${BINDIR}/debug.convert2bed
- rm -f ${BINDIR}/bam2starch
- rm -f ${BINDIR}/bam2starch*
- rm -f ${BINDIR}/gff2starch
- rm -f ${BINDIR}/gtf2starch
- rm -f ${BINDIR}/gvf2starch
- rm -f ${BINDIR}/psl2starch
- rm -f ${BINDIR}/rmsk2starch
- rm -f ${BINDIR}/sam2starch
- rm -f ${BINDIR}/vcf2starch
- rm -f ${BINDIR}/wig2starch
- rm -Rf ${BINDIR}
+ rm -rf ${BINDIR}
clean_gprof:
- rm -f ${BINDIR}/gprof.sort-bed
- rm -f ${BINDIR}/update-sort-bed-slurm
- rm -f ${BINDIR}/update-sort-bed-starch-slurm
- rm -f ${BINDIR}/update-sort-bed-migrate-candidates
- rm -f ${BINDIR}/gprof.bedops
- rm -f ${BINDIR}/gprof.closest-features
- rm -f ${BINDIR}/gprof.bedmap
- rm -f ${BINDIR}/gprof.bedextract
- rm -f ${BINDIR}/gprof.starch
- rm -f ${BINDIR}/gprof.unstarch
- rm -f ${BINDIR}/gprof.starchcat
- rm -f ${BINDIR}/gprof.starchstrip
- rm -f ${BINDIR}/starchcluster*
- rm -f ${BINDIR}/starch-diff
- rm -f ${BINDIR}/bam2bed
- rm -f ${BINDIR}/bam2bed*
- rm -f ${BINDIR}/gff2bed
- rm -f ${BINDIR}/gtf2bed
- rm -f ${BINDIR}/gvf2bed
- rm -f ${BINDIR}/psl2bed
- rm -f ${BINDIR}/rmsk2bed
- rm -f ${BINDIR}/sam2bed
- rm -f ${BINDIR}/vcf2bed
- rm -f ${BINDIR}/wig2bed
- rm -f ${BINDIR}/gprof.convert2bed
- rm -f ${BINDIR}/bam2starch
- rm -f ${BINDIR}/bam2starch*
- rm -f ${BINDIR}/gff2starch
- rm -f ${BINDIR}/gtf2starch
- rm -f ${BINDIR}/gvf2starch
- rm -f ${BINDIR}/psl2starch
- rm -f ${BINDIR}/rmsk2starch
- rm -f ${BINDIR}/sam2starch
- rm -f ${BINDIR}/vcf2starch
- rm -f ${BINDIR}/wig2starch
- rm -Rf ${BINDIR}
-
+ rm -rf ${BINDIR}
#
# mkdir's
#
mkdirs:
- mkdir -p ${PARTY3}/$(I386)
- mkdir -p ${PARTY3}/$(X86_64)
+ mkdir -p ${PARTY3}/darwin_intel_${BUILD_ARCH}
mkdir -p ${APPDIR}/sort-bed/bin
mkdir -p ${APPDIR}/bedops/bin
mkdir -p ${APPDIR}/closestfeats/bin
@@ -211,101 +89,20 @@ mkdirs:
#
# third-party libraries
#
-support_intel_i386: jansson_support_intel_i386_c bzip2_support_intel_i386_c zlib_support_intel_i386_c
-
-support_intel_x86_64: jansson_support_intel_x86_64_c bzip2_support_intel_x86_64_c zlib_support_intel_x86_64_c
-
-support_intel: support_intel_i386 support_intel_x86_64
+support_intel: jansson_support_c bzip2_support_c zlib_support_intel_c
support: | mkdirs
$(MAKE) support_intel -f $(SELF)
-jansson_support_intel_i386_c:
- bzcat ${WHICHJANSSON}.tar.bz2 | tar -x -C ${PARTY3}/$(I386)/
- cd ${PARTY3}/$(I386)/${JANSSONVERSION} && export MACOSX_DEPLOYMENT_TARGET=10.7 && export ARCH=i386 && export CC=${CC} && export CXX=${CXX} && ./configure --prefix=${WDIR}/${PARTY3}/$(I386)/${JANSSONVERSION} CFLAGS="-arch i386" --build="i386" && $(MAKE) && $(MAKE) install && cd ../ && rm -f jansson && ln -sf ${JANSSONVERSION} jansson && cd ${WDIR}
-
-jansson_support_intel_x86_64_c:
- bzcat ${WHICHJANSSON}.tar.bz2 | tar -x -C ${PARTY3}/$(X86_64)/
- cd ${PARTY3}/$(X86_64)/${JANSSONVERSION} && export MACOSX_DEPLOYMENT_TARGET=10.7 && export ARCH=x86_64 && export CC=${CC} && export CXX=${CXX} && ./configure --prefix=${WDIR}/${PARTY3}/$(X86_64)/${JANSSONVERSION} CFLAGS="-arch x86_64" --build="x86_64" && $(MAKE) && $(MAKE) install && cd ../ && rm -f jansson && ln -sf ${JANSSONVERSION} jansson && cd ${WDIR}
-
-bzip2_support_intel_i386_c:
- bzcat ${WHICHBZIP2}.tar.bz2 | tar -x -C ${PARTY3}/$(I386)/
- cd ${PARTY3}/$(I386)/${BZIP2VERSION} && export MACOSX_DEPLOYMENT_TARGET=10.7 && export ARCH=i386 && export CC=${CC} && export CXX=${CXX} && $(MAKE) -f Makefile.darwin_i386 libbz2.a && cd ../ && rm -f bzip2 && ln -sf ${BZIP2VERSION} bzip2 && cd ${WDIR}
-
-bzip2_support_intel_x86_64_c:
- bzcat ${WHICHBZIP2}.tar.bz2 | tar -x -C ${PARTY3}/$(X86_64)/
- cd ${PARTY3}/$(X86_64)/${BZIP2VERSION} && export MACOSX_DEPLOYMENT_TARGET=10.7 && export ARCH=x86_64 && export CC=${CC} && export CXX=${CXX} && $(MAKE) -f Makefile.darwin_x86_64 libbz2.a && cd ../ && rm -f bzip2 && ln -sf ${BZIP2VERSION} bzip2 && cd ${WDIR}
-
-zlib_support_intel_i386_c:
- bzcat ${WHICHZLIB}.tar.bz2 | tar -x -C ${PARTY3}/$(I386)/
- cd ${PARTY3}/$(I386)/${ZLIBVERSION} && export MACOSX_DEPLOYMENT_TARGET=10.7 && export ARCH=i386 && export CC=${CC} && export CXX=${CXX} && ./configure --static --archs="-arch i386" && $(MAKE) && cd ../ && rm -f zlib && ln -sf ${ZLIBVERSION} zlib && cd ${WDIR}
-
-zlib_support_intel_x86_64_c:
- bzcat ${WHICHZLIB}.tar.bz2 | tar -x -C ${PARTY3}/$(X86_64)/
- cd ${PARTY3}/$(X86_64)/${ZLIBVERSION} && export MACOSX_DEPLOYMENT_TARGET=10.7 && export ARCH=x86_64 && export CC=${CC} && export CXX=${CXX} && ./configure --static --archs="-arch x86_64" && $(MAKE) && cd ../ && rm -f zlib && ln -sf ${ZLIBVERSION} zlib && cd ${WDIR}
-
-
-
-#
-# Darwin fat build targets
-#
-sort_c_intel_fat:
- -test -e ${APPDIR}/sort-bed/bin/sort-bed_i386 && test -e ${APPDIR}/sort-bed/bin/sort-bed_x86_64 && { lipo -create ${APPDIR}/sort-bed/bin/sort-bed_i386 ${APPDIR}/sort-bed/bin/sort-bed_x86_64 -output ${APPDIR}/sort-bed/bin/sort-bed; }
-
-bedops_c_intel_fat:
- -test -e ${APPDIR}/bedops/bin/bedops_i386 && test -e ${APPDIR}/bedops/bin/bedops_x86_64 && { lipo -create ${APPDIR}/bedops/bin/bedops_i386 ${APPDIR}/bedops/bin/bedops_x86_64 -output ${APPDIR}/bedops/bin/bedops; }
-
-closestfeatures_c_intel_fat:
- -test -e ${APPDIR}/closestfeats/bin/closest-features_i386 && test -e ${APPDIR}/closestfeats/bin/closest-features_x86_64 && { lipo -create ${APPDIR}/closestfeats/bin/closest-features_i386 ${APPDIR}/closestfeats/bin/closest-features_x86_64 -output ${APPDIR}/closestfeats/bin/closest-features; }
-
-bedmap_c_intel_fat:
- -test -e ${APPDIR}/bedmap/bin/bedmap_i386 && test -e ${APPDIR}/bedmap/bin/bedmap_x86_64 && { lipo -create ${APPDIR}/bedmap/bin/bedmap_i386 ${APPDIR}/bedmap/bin/bedmap_x86_64 -output ${APPDIR}/bedmap/bin/bedmap; }
-
-bedextract_c_intel_fat:
- -test -e ${APPDIR}/bedextract/bin/bedextract_i386 && test -e ${APPDIR}/bedextract/bin/bedextract_x86_64 && { lipo -create ${APPDIR}/bedextract/bin/bedextract_i386 ${APPDIR}/bedextract/bin/bedextract_x86_64 -output ${APPDIR}/bedextract/bin/bedextract; }
-
-convert2bed_c_intel_fat:
- -test -e ${APPDIR}/conversion/bin/convert2bed_i386 && test -e ${APPDIR}/conversion/bin/convert2bed_x86_64 && { lipo -create ${APPDIR}/conversion/bin/convert2bed_i386 ${APPDIR}/conversion/bin/convert2bed_x86_64 -output ${APPDIR}/conversion/bin/convert2bed; }
-
-starch_c_intel_fat:
- cp ${APPDIR}/starch/src/starchcluster_sge.tcsh ${APPDIR}/starch/bin/starchcluster_sge
- cp ${APPDIR}/starch/src/starchcluster_gnuParallel.tcsh ${APPDIR}/starch/bin/starchcluster_gnuParallel
- cp ${APPDIR}/starch/src/starchcluster_slurm.tcsh ${APPDIR}/starch/bin/starchcluster_slurm
- cp ${APPDIR}/starch/src/starch-diff.py ${APPDIR}/starch/bin/starch-diff
- -test -e ${APPDIR}/starch/bin_i386/starch && test -e ${APPDIR}/starch/bin_x86_64/starch && { lipo -create ${APPDIR}/starch/bin_i386/starch ${APPDIR}/starch/bin_x86_64/starch -output ${APPDIR}/starch/bin/starch; }
- -test -e ${APPDIR}/starch/bin_i386/unstarch && test -e ${APPDIR}/starch/bin_x86_64/unstarch && { lipo -create ${APPDIR}/starch/bin_i386/unstarch ${APPDIR}/starch/bin_x86_64/unstarch -output ${APPDIR}/starch/bin/unstarch; }
- -test -e ${APPDIR}/starch/bin_i386/starchcat && test -e ${APPDIR}/starch/bin_x86_64/starchcat && { lipo -create ${APPDIR}/starch/bin_i386/starchcat ${APPDIR}/starch/bin_x86_64/starchcat -output ${APPDIR}/starch/bin/starchcat; }
- -test -e ${APPDIR}/starch/bin_i386/starchstrip && test -e ${APPDIR}/starch/bin_x86_64/starchstrip && { lipo -create ${APPDIR}/starch/bin_i386/starchstrip ${APPDIR}/starch/bin_x86_64/starchstrip -output ${APPDIR}/starch/bin/starchstrip; }
-
-
-
-#
-# Debug: Darwin fat build targets
-#
-dbg_sort_c_intel_fat:
- -test -e ${APPDIR}/sort-bed/bin/debug.sort-bed_i386 && test -e ${APPDIR}/sort-bed/bin/debug.sort-bed_x86_64 && { lipo -create ${APPDIR}/sort-bed/bin/debug.sort-bed_i386 ${APPDIR}/sort-bed/bin/debug.sort-bed_x86_64 -output ${APPDIR}/sort-bed/bin/debug.sort-bed; }
-
-dbg_bedops_c_intel_fat:
- -test -e ${APPDIR}/bedops/bin/debug.bedops_i386 && test -e ${APPDIR}/bedops/bin/debug.bedops_x86_64 && { lipo -create ${APPDIR}/bedops/bin/debug.bedops_i386 ${APPDIR}/bedops/bin/debug.bedops_x86_64 -output ${APPDIR}/bedops/bin/debug.bedops; }
-
-dbg_closestfeatures_c_intel_fat:
- -test -e ${APPDIR}/closestfeats/bin/debug.closest-features_i386 && test -e ${APPDIR}/closestfeats/bin/debug.closest-features_x86_64 && { lipo -create ${APPDIR}/closestfeats/bin/debug.closest-features_i386 ${APPDIR}/closestfeats/bin/debug.closest-features_x86_64 -output ${APPDIR}/closestfeats/bin/debug.closest-features; }
-
-dbg_bedmap_c_intel_fat:
- -test -e ${APPDIR}/bedmap/bin/debug.bedmap_i386 && test -e ${APPDIR}/bedmap/bin/debug.bedmap_x86_64 && { lipo -create ${APPDIR}/bedmap/bin/debug.bedmap_i386 ${APPDIR}/bedmap/bin/debug.bedmap_x86_64 -output ${APPDIR}/bedmap/bin/debug.bedmap; }
+jansson_support_c:
+ bzcat ${WHICHJANSSON}.tar.bz2 | tar -x -C ${PARTY3}/darwin_intel_${BUILD_ARCH}/
+ cd ${PARTY3}/darwin_intel_${BUILD_ARCH}/${JANSSONVERSION} && export MACOSX_DEPLOYMENT_TARGET=${MIN_OSX_VERSION} && export ARCH=${BUILD_ARCH} && export CC=${CC} && export CXX=${CXX} && ./configure --prefix=${WDIR}/${PARTY3}/darwin_intel_${BUILD_ARCH}/${JANSSONVERSION} CFLAGS="-arch ${BUILD_ARCH}" --build="${BUILD_ARCH}" && $(MAKE) && $(MAKE) install && cd ../ && rm -f jansson && ln -sf ${JANSSONVERSION} jansson && cd ${WDIR}
-dbg_bedextract_c_intel_fat:
- -test -e ${APPDIR}/bedextract/bin/debug.bedextract_i386 && test -e ${APPDIR}/bedextract/bin/debug.bedextract_x86_64 && { lipo -create ${APPDIR}/bedextract/bin/debug.bedextract_i386 ${APPDIR}/bedextract/bin/debug.bedextract_x86_64 -output ${APPDIR}/bedextract/bin/debug.bedextract; }
+bzip2_support_c:
+ bzcat ${WHICHBZIP2}.tar.bz2 | tar -x -C ${PARTY3}/darwin_intel_${BUILD_ARCH}/
+ cd ${PARTY3}/darwin_intel_${BUILD_ARCH}/${BZIP2VERSION} && export MACOSX_DEPLOYMENT_TARGET=${MIN_OSX_VERSION} && export ARCH=${BUILD_ARCH} && export CC=${CC} && export CXX=${CXX} && $(MAKE) -f Makefile.darwin_${BUILD_ARCH} libbz2.a && cd ../ && rm -f bzip2 && ln -sf ${BZIP2VERSION} bzip2 && cd ${WDIR}
-dbg_convert2bed_c_intel_fat:
- -test -e ${APPDIR}/conversion/bin/debug.convert2bed_i386 && test -e ${APPDIR}/conversion/bin/debug.convert2bed_x86_64 && { lipo -create ${APPDIR}/conversion/bin/debug.convert2bed_i386 ${APPDIR}/conversion/bin/debug.convert2bed_x86_64 -output ${APPDIR}/conversion/bin/debug.convert2bed; }
+zlib_support_intel_c:
+ bzcat ${WHICHZLIB}.tar.bz2 | tar -x -C ${PARTY3}/darwin_intel_${BUILD_ARCH}/
+ cd ${PARTY3}/darwin_intel_${BUILD_ARCH}/${ZLIBVERSION} && export MACOSX_DEPLOYMENT_TARGET=${MIN_OSX_VERSION} && export ARCH=${BUILD_ARCH} && export CC=${CC} && export CXX=${CXX} && ./configure --static --archs="-arch ${BUILD_ARCH}" && $(MAKE) && cd ../ && rm -f zlib && ln -sf ${ZLIBVERSION} zlib && cd ${WDIR}
-dbg_starch_c_intel_fat:
- cp ${APPDIR}/starch/src/starchcluster_sge.tcsh ${APPDIR}/starch/bin/starchcluster_sge
- cp ${APPDIR}/starch/src/starchcluster_gnuParallel.tcsh ${APPDIR}/starch/bin/starchcluster_gnuParallel
- cp ${APPDIR}/starch/src/starchcluster_slurm.tcsh ${APPDIR}/starch/bin/starchcluster_slurm
- cp ${APPDIR}/starch/src/starch-diff.py ${APPDIR}/starch/bin/starch-diff
- -test -e ${APPDIR}/starch/bin_i386/debug.starch && test -e ${APPDIR}/starch/bin_x86_64/debug.starch && { lipo -create ${APPDIR}/starch/bin_i386/debug.starch ${APPDIR}/starch/bin_x86_64/debug.starch -output ${APPDIR}/starch/bin/debug.starch; }
- -test -e ${APPDIR}/starch/bin_i386/debug.unstarch && test -e ${APPDIR}/starch/bin_x86_64/debug.unstarch && { lipo -create ${APPDIR}/starch/bin_i386/debug.unstarch ${APPDIR}/starch/bin_x86_64/debug.unstarch -output ${APPDIR}/starch/bin/debug.unstarch; }
- -test -e ${APPDIR}/starch/bin_i386/debug.starchcat && test -e ${APPDIR}/starch/bin_x86_64/debug.starchcat && { lipo -create ${APPDIR}/starch/bin_i386/debug.starchcat ${APPDIR}/starch/bin_x86_64/debug.starchcat -output ${APPDIR}/starch/bin/debug.starchcat; }
- -test -e ${APPDIR}/starch/bin_i386/debug.starchstrip && test -e ${APPDIR}/starch/bin_x86_64/debug.starchstrip && { lipo -create ${APPDIR}/starch/bin_i386/debug.starchstrip ${APPDIR}/starch/bin_x86_64/debug.starchstrip -output ${APPDIR}/starch/bin/debug.starchstrip; }
diff --git a/system.mk/Makefile.linux b/system.mk/Makefile.linux
index 236ae0a..0c326a7 100644
--- a/system.mk/Makefile.linux
+++ b/system.mk/Makefile.linux
@@ -1,26 +1,26 @@
-PARTY3 = third-party
-BZIP2VERSION = bzip2-1.0.6
-WHICHBZIP2 := ${PARTY3}/${BZIP2VERSION}
-JANSSONVERSION = jansson-2.6
-WHICHJANSSON := ${PARTY3}/${JANSSONVERSION}
-ZLIBVERSION = zlib-1.2.7
-WHICHZLIB := ${PARTY3}/${ZLIBVERSION}
-APPDIR = applications/bed
-BINDIR = bin
-OSXPKGROOT = packaging/os_x
-OSXBUILDDIR = ${OSXPKGROOT}/build
-OSXPKGDIR = ${OSXPKGROOT}/resources/bin
-OSXLIBDIR = ${OSXPKGROOT}/resources/lib
-WDIR = ${shell pwd}
-export CC = gcc
-export CXX = g++
-SELF = ${WDIR}/system.mk/Makefile.linux
+PARTY3 = third-party
+BZIP2VERSION = bzip2-1.0.6
+WHICHBZIP2 := ${PARTY3}/${BZIP2VERSION}
+JANSSONVERSION = jansson-2.6
+WHICHJANSSON := ${PARTY3}/${JANSSONVERSION}
+ZLIBVERSION = zlib-1.2.7
+WHICHZLIB := ${PARTY3}/${ZLIBVERSION}
+APPDIR = applications/bed
+WDIR = ${shell pwd}
+export CC = gcc
+export CXX = g++
+SELF = ${WDIR}/system.mk/Makefile.linux
+MEGAROW = megarow
+TYPICAL = typical
+BINDIR = bin
+BINDIR_MODULE = modules
+BINDIR_MODULE_TYPICAL = ${BINDIR_MODULE}/${TYPICAL}
+BINDIR_MODULE_MEGAROW = ${BINDIR_MODULE}/${MEGAROW}
default: support
$(MAKE) build -f $(SELF)
SUBDIRS = ${APPDIR}/bedmap/src ${APPDIR}/sort-bed/src ${APPDIR}/bedops/src ${APPDIR}/closestfeats/src ${APPDIR}/bedextract/src ${APPDIR}/starch/src ${APPDIR}/conversion/src
-
.PHONY: $(SUBDIRS)
build: $(SUBDIRS)
@@ -38,45 +38,7 @@ gprof: support
build_gprof: $(SUBDIRS)
-clean: clean_debug clean_gprof $(SUBDIRS)
- rm -f ${BINDIR}/sort-bed
- rm -f ${BINDIR}/update-sort-bed-slurm
- rm -f ${BINDIR}/update-sort-bed-starch-slurm
- rm -f ${BINDIR}/update-sort-bed-migrate-candidates
- rm -f ${BINDIR}/bedops
- rm -f ${BINDIR}/closest-features
- rm -f ${BINDIR}/bedmap
- rm -f ${BINDIR}/bedextract
- rm -f ${BINDIR}/starch
- rm -f ${BINDIR}/unstarch
- rm -f ${BINDIR}/starchcat
- rm -f ${BINDIR}/starchstrip
- rm -f ${BINDIR}/starchcluster*
- rm -f ${BINDIR}/starch-diff
- rm -f ${BINDIR}/bam2bed
- rm -f ${BINDIR}/bam2bed*
- rm -f ${BINDIR}/gff2bed
- rm -f ${BINDIR}/gtf2bed
- rm -f ${BINDIR}/gvf2bed
- rm -f ${BINDIR}/psl2bed
- rm -f ${BINDIR}/rmsk2bed
- rm -f ${BINDIR}/sam2bed
- rm -f ${BINDIR}/vcf2bed
- rm -f ${BINDIR}/wig2bed
- rm -f ${BINDIR}/convert2bed
- rm -f ${BINDIR}/bam2starch
- rm -f ${BINDIR}/bam2starch*
- rm -f ${BINDIR}/gff2starch
- rm -f ${BINDIR}/gtf2starch
- rm -f ${BINDIR}/gvf2starch
- rm -f ${BINDIR}/psl2starch
- rm -f ${BINDIR}/rmsk2starch
- rm -f ${BINDIR}/sam2starch
- rm -f ${BINDIR}/vcf2starch
- rm -f ${BINDIR}/wig2starch
- rm -f ${OSXPKGDIR}/*
- rm -f ${OSXLIBDIR}/*
- rm -Rf ${OSXBUILDDIR}/*
+clean: clean_debug clean_gprof clean_postfix $(SUBDIRS)
rm -rf ${WHICHBZIP2}
rm -f ${PARTY3}/bzip2
rm -rf ${WHICHJANSSON}
@@ -86,81 +48,14 @@ clean: clean_debug clean_gprof $(SUBDIRS)
rm -rf ${BINDIR}
clean_debug:
- rm -f ${BINDIR}/debug.sort-bed
- rm -f ${BINDIR}/update-sort-bed-slurm
- rm -f ${BINDIR}/update-sort-bed-starch-slurm
- rm -f ${BINDIR}/update-sort-bed-migrate-candidates
- rm -f ${BINDIR}/debug.bedops
- rm -f ${BINDIR}/debug.closest-features
- rm -f ${BINDIR}/debug.bedmap
- rm -f ${BINDIR}/debug.bedextract
- rm -f ${BINDIR}/debug.starch
- rm -f ${BINDIR}/debug.unstarch
- rm -f ${BINDIR}/debug.starchcat
- rm -f ${BINDIR}/debug.starchstrip
- rm -f ${BINDIR}/starchcluster*
- rm -f ${BINDIR}/starch-diff
- rm -f ${BINDIR}/bam2bed
- rm -f ${BINDIR}/bam2bed*
- rm -f ${BINDIR}/gff2bed
- rm -f ${BINDIR}/gtf2bed
- rm -f ${BINDIR}/gvf2bed
- rm -f ${BINDIR}/psl2bed
- rm -f ${BINDIR}/rmsk2bed
- rm -f ${BINDIR}/sam2bed
- rm -f ${BINDIR}/vcf2bed
- rm -f ${BINDIR}/wig2bed
- rm -f ${BINDIR}/debug.convert2bed
- rm -f ${BINDIR}/bam2starch
- rm -f ${BINDIR}/bam2starch*
- rm -f ${BINDIR}/gff2starch
- rm -f ${BINDIR}/gtf2starch
- rm -f ${BINDIR}/gvf2starch
- rm -f ${BINDIR}/psl2starch
- rm -f ${BINDIR}/rmsk2starch
- rm -f ${BINDIR}/sam2starch
- rm -f ${BINDIR}/vcf2starch
- rm -f ${BINDIR}/wig2starch
rm -rf ${BINDIR}
clean_gprof:
- rm -f ${BINDIR}/gprof.sort-bed
- rm -f ${BINDIR}/update-sort-bed-slurm
- rm -f ${BINDIR}/update-sort-bed-starch-slurm
- rm -f ${BINDIR}/update-sort-bed-migrate-candidates
- rm -f ${BINDIR}/gprof.bedops
- rm -f ${BINDIR}/gprof.closest-features
- rm -f ${BINDIR}/gprof.bedmap
- rm -f ${BINDIR}/gprof.bedextract
- rm -f ${BINDIR}/gprof.starch
- rm -f ${BINDIR}/gprof.unstarch
- rm -f ${BINDIR}/gprof.starchcat
- rm -f ${BINDIR}/gprof.starchstrip
- rm -f ${BINDIR}/starchcluster*
- rm -f ${BINDIR}/starch-diff
- rm -f ${BINDIR}/bam2bed
- rm -f ${BINDIR}/bam2bed*
- rm -f ${BINDIR}/gff2bed
- rm -f ${BINDIR}/gtf2bed
- rm -f ${BINDIR}/gvf2bed
- rm -f ${BINDIR}/psl2bed
- rm -f ${BINDIR}/rmsk2bed
- rm -f ${BINDIR}/sam2bed
- rm -f ${BINDIR}/vcf2bed
- rm -f ${BINDIR}/wig2bed
- rm -f ${BINDIR}/gprof.convert2bed
- rm -f ${BINDIR}/bam2starch
- rm -f ${BINDIR}/bam2starch*
- rm -f ${BINDIR}/gff2starch
- rm -f ${BINDIR}/gtf2starch
- rm -f ${BINDIR}/gvf2starch
- rm -f ${BINDIR}/psl2starch
- rm -f ${BINDIR}/rmsk2starch
- rm -f ${BINDIR}/sam2starch
- rm -f ${BINDIR}/vcf2starch
- rm -f ${BINDIR}/wig2starch
rm -rf ${BINDIR}
+clean_postfix:
+ rm -rf ${BINDIR}
+ rm -rf ${BINDIR_MODULE}
#
# third-party libraries
--
Alioth's /usr/local/bin/git-commit-notice on /srv/git.debian.org/git/debian-med/bedops.git
More information about the debian-med-commit
mailing list