[med-svn] [Git][med-team/libhmsbeagle][upstream] New upstream version 2.1.2+git20180307
Andreas Tille
gitlab at salsa.debian.org
Wed Apr 11 13:19:19 BST 2018
Andreas Tille pushed to branch upstream at Debian Med / libhmsbeagle
Commits:
e4b0fabf by Andreas Tille at 2018-04-11T13:47:28+02:00
New upstream version 2.1.2+git20180307
- - - - -
20 changed files:
- − .gitignore
- .travis.yml
- .travis/amd_sdk.sh
- configure.ac
- − examples/standalone/epochtest/.config/depcomp
- − examples/standalone/epochtest/.config/install-sh
- − examples/standalone/epochtest/.config/missing
- − examples/standalone/epochtest/AUTHORS
- − examples/standalone/epochtest/COPYING
- − examples/standalone/epochtest/ChangeLog
- − examples/standalone/epochtest/INSTALL
- − examples/standalone/epochtest/Makefile.am
- − examples/standalone/epochtest/NEWS
- − examples/standalone/epochtest/README
- − examples/standalone/epochtest/autogen.sh
- − examples/standalone/epochtest/check_lnL_using_BEAST.xml
- − examples/standalone/epochtest/configure.ac
- − examples/standalone/epochtest/src/.deps/epochtest-epochtest.Po
- − examples/standalone/epochtest/src/epochtest.cpp
- libhmsbeagle/GPU/kernels/kernels4.cu
Changes:
=====================================
.gitignore deleted
=====================================
--- a/.gitignore
+++ /dev/null
@@ -1,175 +0,0 @@
-
-# /
-/beagle-lib-1.0.pc
-/configure
-/Makefile.in
-/config.log
-/INSTALL
-/COPYING
-/Makefile
-/.config
-/config.status
-/libtool
-/autom4te.cache
-/aclocal.m4
-/hmsbeagle-1.0.pc
-/doc
-/.idea
-/Beagle-lib.iml
-/hmsbeagle-1.pc
-
-# /examples/
-/examples/Makefile.in
-/examples/Makefile
-/examples/extensivetest
-
-# /examples/complextest/
-/examples/complextest/Makefile.in
-/examples/complextest/Makefile
-/examples/complextest/complextest
-/examples/complextest/.deps
-
-# /examples/fourtaxon/
-/examples/fourtaxon/check_lnL_using_paup.nex
-/examples/fourtaxon/fourtaxon.o
-/examples/fourtaxon/fourtaxon
-/examples/fourtaxon/Makefile.in
-/examples/fourtaxon/.deps
-/examples/fourtaxon/Makefile
-/examples/fourtaxon/fourtaxonrun.sh
-
-# /examples/genomictest/
-/examples/genomictest/Makefile.in
-/examples/genomictest/.deps
-/examples/genomictest/Makefile
-/examples/genomictest/genomictest
-/examples/genomictest/genomictest.sh
-
-# /examples/matrixtest/
-/examples/matrixtest/Makefile.in
-/examples/matrixtest/matrixtest
-/examples/matrixtest/.deps
-/examples/matrixtest/Makefile
-
-# /examples/oddstatetest/
-/examples/oddstatetest/Makefile.in
-/examples/oddstatetest/.deps
-/examples/oddstatetest/Makefile
-/examples/oddstatetest/oddstatetest
-
-# /examples/tinytest/
-/examples/tinytest/Makefile.in
-/examples/tinytest/.deps
-/examples/tinytest/Makefile
-/examples/tinytest/tinytest
-
-# /libhmsbeagle/
-/libhmsbeagle/config.h.in
-/libhmsbeagle/Makefile.in
-/libhmsbeagle/.deps
-/libhmsbeagle/stamp-h1
-/libhmsbeagle/config.h
-/libhmsbeagle/Makefile
-
-# /libhmsbeagle/CPU/
-/libhmsbeagle/CPU/Makefile.in
-/libhmsbeagle/CPU/.deps
-/libhmsbeagle/CPU/Makefile
-
-# /libhmsbeagle/GPU/
-/libhmsbeagle/GPU/Makefile.in
-/libhmsbeagle/GPU/PeelingFunctions.linkinfo
-/libhmsbeagle/GPU/.deps
-/libhmsbeagle/GPU/TransitionFunctions.linkinfo
-/libhmsbeagle/GPU/Makefile
-/libhmsbeagle/GPU/BeagleCUDA_kernels.h
-/libhmsbeagle/GPU/BeagleCUDA_kernels.ptx
-
-# /libhmsbeagle/GPU/kernels/
-/libhmsbeagle/GPU/kernels/BeagleCUDA_kernels_64.ptx
-/libhmsbeagle/GPU/kernels/Makefile.in
-/libhmsbeagle/GPU/kernels/BeagleCUDA_kernels_48.ptx
-/libhmsbeagle/GPU/kernels/BeagleCUDA_kernels.h
-/libhmsbeagle/GPU/kernels/BeagleCUDA_kernels.ptx
-/libhmsbeagle/GPU/kernels/BeagleCUDA_kernels_4.ptx
-/libhmsbeagle/GPU/kernels/BeagleCUDA_kernels_32.ptx
-/libhmsbeagle/GPU/kernels/Makefile
-/libhmsbeagle/GPU/kernels/BeagleCUDA_kernels_xcode.h
-/libhmsbeagle/GPU/kernels/BeagleCUDA_kernels_xcode.ptx
-
-# /libhmsbeagle/JNI/
-/libhmsbeagle/JNI/Makefile.in
-/libhmsbeagle/JNI/.deps
-/libhmsbeagle/JNI/Makefile
-
-# /libhmsbeagle/plugin/
-/libhmsbeagle/plugin/Makefile.in
-/libhmsbeagle/plugin/.deps
-/libhmsbeagle/plugin/Makefile
-
-# /m4/
-/m4/libtool.m4
-/m4/lt~obsolete.m4
-/m4/ltsugar.m4
-/m4/ltversion.m4
-/m4/ltoptions.m4
-
-# /project/beagle-xcode/
-/project/beagle-xcode/build
-
-# /project/beagle-xcode/beagle-xcode.xcodeproj/
-/project/beagle-xcode/beagle-xcode.xcodeproj/*.pbxuser
-/project/beagle-xcode/beagle-xcode.xcodeproj/*.perspectivev3
-/project/beagle-xcode/beagle-xcode.xcodeproj/xcuserdata
-/project/beagle-xcode/beagle-xcode.xcodeproj/project.xcworkspace
-
-# other
-.DS_Store
-installed/
-libhmsbeagle/.libs/
-libhmsbeagle/CPU/.libs/
-libhmsbeagle/CPU/libhmsbeagle-cpu-sse.la
-libhmsbeagle/CPU/libhmsbeagle-cpu.la
-libhmsbeagle/CPU/libhmsbeagle_cpu_la-BeagleCPUPlugin.lo
-libhmsbeagle/CPU/libhmsbeagle_cpu_sse_la-BeagleCPUSSEPlugin.lo
-libhmsbeagle/GPU/.libs/
-libhmsbeagle/GPU/libhmsbeagle-cuda.la
-libhmsbeagle/GPU/libhmsbeagle_cuda_la-CUDAPlugin.lo
-libhmsbeagle/GPU/libhmsbeagle_cuda_la-GPUImplHelper.lo
-libhmsbeagle/GPU/libhmsbeagle_cuda_la-GPUInterfaceCUDA.lo
-libhmsbeagle/GPU/libhmsbeagle_cuda_la-KernelLauncher.lo
-libhmsbeagle/GPU/libhmsbeagle_cuda_la-KernelResource.lo
-libhmsbeagle/libhmsbeagle-jni.la
-libhmsbeagle/libhmsbeagle.la
-libhmsbeagle/libhmsbeagle_jni_la-beagle_BeagleJNIWrapper.lo
-libhmsbeagle/libhmsbeagle_la-beagle.lo
-libhmsbeagle/plugin/.libs/
-libhmsbeagle/plugin/libplugin.la
-libhmsbeagle/plugin/libplugin_la-Plugin.lo
-libhmsbeagle/plugin/libplugin_la-UnixSharedLibrary.lo
-project/.DS_Store
-project/beagle-xcode/.DS_Store
-project/beagle-xcode/BEAGLEv1.0.pkg
-examples/complextest/.libs/
-examples/complextest/complextest.o
-examples/fourtaxon/.libs/
-examples/genomictest/.libs/
-examples/genomictest/genomictest.o
-examples/genomictest/linalg.o
-examples/matrixtest/.libs/
-examples/matrixtest/matrixtest.o
-examples/oddstatetest/.libs/
-examples/oddstatetest/oddstatetest.o
-examples/tinytest/.libs/
-examples/tinytest/tinytest.o
-libhmsbeagle/GPU/kernels/BeagleOpenCL_kernels.h
-libhmsbeagle/GPU/kernels/BeagleOpenCL_kernels_xcode.h
-libhmsbeagle/GPU/libhmsbeagle-opencl.la
-libhmsbeagle/GPU/libhmsbeagle_opencl_la-GPUImplHelper.lo
-libhmsbeagle/GPU/libhmsbeagle_opencl_la-GPUInterfaceOpenCL.lo
-libhmsbeagle/GPU/libhmsbeagle_opencl_la-KernelLauncher.lo
-libhmsbeagle/GPU/libhmsbeagle_opencl_la-KernelResource.lo
-libhmsbeagle/GPU/libhmsbeagle_opencl_la-OpenCLPlugin.lo
-libhmsbeagle/config.h.in~
-project/beagle-xcode/BEAGLE-1.0.pkg
-
=====================================
.travis.yml
=====================================
--- a/.travis.yml
+++ b/.travis.yml
@@ -3,23 +3,24 @@ language: cpp
# Compiler selection
matrix:
- include:
+ include:
- compiler: gcc
addons:
apt:
sources:
- ubuntu-toolchain-r-test
- packages:
+ packages:
- gdb
- apport
-
+ - nvidia-opencl-dev
+
#cache:
# directories:
# - ${OPENCL_ROOT}
-
+
before_install:
- |
- if [[ "linux" == "linux" ]]; then
+ if [[ "linux" == "linux" ]]; then
mkdir -p ${OPENCL_ROOT}
bash .travis/amd_sdk.sh ${AMDAPPSDK_VERSION}
tar -xjf AMD-SDK.tar.bz2
@@ -28,45 +29,45 @@ before_install:
sh AMD-APP-SDK*.sh --tar -xf -C ${AMDAPPSDKROOT}
echo libamdocl64.so > ${OPENCL_VENDOR_PATH}/amdocl64.icd
export LD_LIBRARY_PATH=${AMDAPPSDKROOT}/lib/x86_64:${LD_LIBRARY_PATH}
- export CMAKE_LIBRARY_PATH=${AMDAPPSDKROOT}/lib/x86_64;
+ export CMAKE_LIBRARY_PATH=${AMDAPPSDKROOT}/lib/x86_64;
chmod +x ${AMDAPPSDKROOT}/bin/x86_64/clinfo
${AMDAPPSDKROOT}/bin/x86_64/clinfo
rm AMD-APP-SDK*.sh
rm AMD-SDK.tar.bz2
- fi
-
+ fi
+
install:
- export CPLUS_INCLUDE_PATH=${AMDAPPSDKROOT}/include
- export LD_LIBRARY_PATH=${AMDAPPSDKROOT}/lib/x86_64:${LD_LIBRARY_PATH}
- - export LIBRARY_PATH=${AMDAPPSDKROOT}/lib/x86_64:${LIBRARY_PATH}
-
+ - export LIBRARY_PATH=${AMDAPPSDKROOT}/lib/x86_64:${LIBRARY_PATH}
+
before_script:
- ulimit -c unlimited -S # Enable core dumps
-
+
# Build steps
script:
- ./autogen.sh
- ./configure --with-opencl=${AMDAPPSDKROOT}
- make
- make check
-
+
# after_failure:
# - ls
# - COREFILE=$(find . -maxdepth 1 -name "core*" | head -n 1) # find core file
# - if [[ -f "$COREFILE" ]]; then gdb -c "$COREFILE" ./benchmark -ex "thread apply all bt" -ex "set pagination 0" -batch; fi
-
+
notifications:
recipients:
- msuchard at gmail.com
- daniel at kotim.me
email:
on_success: change
- on_failure: always
-
+ on_failure: always
+
env:
global:
- OPENCL_ROOT=$HOME/opencl
- OPENCL_LIB=amdappsdk
- OPENCL_VERSION="12"
- - AMDAPPSDK_VERSION=291 # OpenCL 1.2
- - AMDAPPSDKROOT=${OPENCL_ROOT}/AMDAPPSDK
+ - AMDAPPSDK_VERSION=291 # OpenCL 1.2
+ - AMDAPPSDKROOT=${OPENCL_ROOT}/AMDAPPSDK
=====================================
.travis/amd_sdk.sh
=====================================
--- a/.travis/amd_sdk.sh
+++ b/.travis/amd_sdk.sh
@@ -2,44 +2,53 @@
# Original script from https://github.com/gregvw/amd_sdk/
-# Location from which get nonce and file name from
-URL="http://developer.amd.com/tools-and-sdks/opencl-zone/opencl-tools-sdks/amd-accelerated-parallel-processing-app-sdk/"
-URLDOWN="http://developer.amd.com/amd-license-agreement-appsdk/"
-
-NONCE1_STRING='name="amd_developer_central_downloads_page_nonce"'
-FILE_STRING='name="f"'
-POSTID_STRING='name="post_id"'
-NONCE2_STRING='name="amd_developer_central_nonce"'
-
-#AMD APP SDK v3.0:
-if [[ $1 == "300" ]]; then
- echo "AMD APP SDK v3.0"
- FORM=`wget -qO - $URL | sed -n '/download-2/,/64-bit/p'`
-else
-#AMD APP SDK v2.9.1:
- echo "AMD APP SDK v2.9.1"
- FORM=`wget -qO - $URL | sed -n '/download-5/,/64-bit/p'`
+export OPENCL_VENDOR_PATH=${AMDAPPSDKROOT}/etc/OpenCL/vendors
+export LD_LIBRARY_PATH=${AMDAPPSDKROOT}/lib/x86_64:${LD_LIBRARY_PATH}
+export CMAKE_LIBRARY_PATH=${AMDAPPSDKROOT}/lib/x86_64
+
+if [ ! -e ${AMDAPPSDKROOT}/bin/x86_64/clinfo ]; then
+ # Location from which get nonce and file name from
+ URL="http://developer.amd.com/amd-accelerated-parallel-processing-app-sdk/"
+ URLDOWN="http://developer.amd.com/amd-license-agreement-appsdk/"
+
+ NONCE1_STRING='name="amd_developer_central_downloads_page_nonce"'
+ FILE_STRING='name="f"'
+ POSTID_STRING='name="post_id"'
+ NONCE2_STRING='name="amd_developer_central_nonce"'
+
+ # This gets the second latest (2.9.1 ATM, latest is 3.0)
+ # For newest: FORM=`wget -qO - $URL | sed -n '/download-2/,/64-bit/p'`
+ FORM=`wget -qO - $URL | sed -n '/download-5/,/64-bit/p'`
+
+ # Get nonce from form
+ NONCE1=`echo $FORM | awk -F ${NONCE1_STRING} '{print $2}'`
+ NONCE1=`echo $NONCE1 | awk -F'"' '{print $2}'`
+ echo $NONCE1
+
+ # get the postid
+ POSTID=`echo $FORM | awk -F ${POSTID_STRING} '{print $2}'`
+ POSTID=`echo $POSTID | awk -F'"' '{print $2}'`
+ echo $POSTID
+
+ # get file name
+ FILE=`echo $FORM | awk -F ${FILE_STRING} '{print $2}'`
+ FILE=`echo $FILE | awk -F'"' '{print $2}'`
+ echo $FILE
+
+ FORM=`wget -qO - $URLDOWN --post-data "amd_developer_central_downloads_page_nonce=${NONCE1}&f=${FILE}&post_id=${POSTID}"`
+
+ NONCE2=`echo $FORM | awk -F ${NONCE2_STRING} '{print $2}'`
+ NONCE2=`echo $NONCE2 | awk -F'"' '{print $2}'`
+ echo $NONCE2
+
+ wget --content-disposition --trust-server-names $URLDOWN --post-data "amd_developer_central_nonce=${NONCE2}&f=${FILE}" -O AMD-SDK.tar.bz2;
+
+ # Unpack and install
+ tar -xjf AMD-SDK.tar.bz2;
+ mkdir -p ${OPENCL_VENDOR_PATH};
+ sh AMD-APP-SDK*.sh --tar -xf -C ${AMDAPPSDKROOT};
+ echo libamdocl64.so > ${OPENCL_VENDOR_PATH}/amdocl64.icd;
+ chmod +x ${AMDAPPSDKROOT}/bin/x86_64/clinfo;
fi
-# Get nonce from form
-NONCE1=`echo $FORM | awk -F ${NONCE1_STRING} '{print $2}'`
-NONCE1=`echo $NONCE1 | awk -F'"' '{print $2}'`
-echo $NONCE1
-
-# get the postid
-POSTID=`echo $FORM | awk -F ${POSTID_STRING} '{print $2}'`
-POSTID=`echo $POSTID | awk -F'"' '{print $2}'`
-echo $POSTID
-
-# get file name
-FILE=`echo $FORM | awk -F ${FILE_STRING} '{print $2}'`
-FILE=`echo $FILE | awk -F'"' '{print $2}'`
-echo $FILE
-
-FORM=`wget -qO - $URLDOWN --post-data "amd_developer_central_downloads_page_nonce=${NONCE1}&f=${FILE}&post_id=${POSTID}"`
-
-NONCE2=`echo $FORM | awk -F ${NONCE2_STRING} '{print $2}'`
-NONCE2=`echo $NONCE2 | awk -F'"' '{print $2}'`
-echo $NONCE2
-
-wget --content-disposition --trust-server-names $URLDOWN --post-data "amd_developer_central_nonce=${NONCE2}&f=${FILE}" -O AMD-SDK.tar.bz2;
+${AMDAPPSDKROOT}/bin/x86_64/clinfo
=====================================
configure.ac
=====================================
--- a/configure.ac
+++ b/configure.ac
@@ -94,7 +94,7 @@ else
fi
# ------------------------------------------------------------------------------
-# Setup OPENMP
+# Setup OPENMP
# ------------------------------------------------------------------------------
dnl Check for OpenMP
if test x$GCC = xyes
@@ -105,12 +105,12 @@ fi
AC_ARG_ENABLE([openmp],
[AS_HELP_STRING([--enable-openmp],[enable automatic building of openmp version])])
-# if we're on gcc, then make sure the version is at least 4.2.0 because apple ships a
+# if we're on gcc, then make sure the version is at least 4.2.0 because apple ships a
# 4.1.x that has broken openmp support
AS_IF([test "$enable_openmp" = "yes"], [
- if test x$GCC = xyes
- then
- AX_COMPARE_VERSION([$GCC_VERSION], [ge], [4.2.0], [
+ if test x$GCC = xyes
+ then
+ AX_COMPARE_VERSION([$GCC_VERSION], [ge], [4.2.0], [
AX_OPENMP([AM_CONDITIONAL(HAVE_OPENMP,true)],
[AM_CONDITIONAL(HAVE_OPENMP,false)])
],[])
@@ -247,10 +247,10 @@ AM_CONDITIONAL(HAVE_AVX,false)
if test "$enable_avx" = yes; then
AX_EXT
AC_CHECK_HEADERS([cpuid.h])
- if test "$ax_cv_have_avx_ext" = yes; then
- AM_CONDITIONAL(HAVE_AVX,true)
+ if test "$ax_cv_have_avx_ext" = yes; then
+ AM_CONDITIONAL(HAVE_AVX,true)
else
- AC_MSG_ERROR(AVX instructions not supported on this system. AVX support will not be built)
+ AC_MSG_ERROR(AVX instructions not supported on this system. AVX support will not be built)
fi
fi
@@ -261,7 +261,7 @@ AC_ARG_ENABLE(phi,
AC_HELP_STRING([--enable-phi],[build with Intel Phi implementation enabled EXPERIMENTAL]), , [enable_phi=no])
if test "$enable_phi" = yes; then
- AC_MSG_ERROR(Intel Phi not supported on this system. Phi support will not be built)
+ AC_MSG_ERROR(Intel Phi not supported on this system. Phi support will not be built)
fi
# ------------------------------------------------------------------------------
@@ -272,8 +272,8 @@ AC_ARG_ENABLE(march_native,
AC_HELP_STRING([--disable-march-native],[disable native architecture optimization]), , [enable_march_native=yes])
if test "$enable_march_native" = yes; then
- if test x$GCC = xyes
- then
+ if test x$GCC = xyes
+ then
AX_COMPARE_VERSION([$GCC_VERSION], [ge], [4.2.3], [AM_CXXFLAGS="$AM_CXXFLAGS -march=native"],[])
fi
fi
@@ -286,7 +286,7 @@ fi
case $host_os in
*darwin*)
AM_CXXFLAGS="$AM_CXXFLAGS -DDLS_MACOS"
-
+
if( test ! x$NVCC = xno )
then
NVCCFLAGS+=" -m64"
@@ -294,7 +294,7 @@ case $host_os in
NVCCFLAGS+=" -D_POSIX_C_SOURCE -ccbin /usr/bin/clang"
CUDA_LIBS+=" -F/Library/Frameworks -framework CUDA"
fi
-
+
if test "x$with_opencl" != "xno"
then
@@ -304,9 +304,9 @@ case $host_os in
if test "$CXX" = "clang"
then
- CXX="clang++"
+ CXX="clang++"
fi
-
+
AC_ARG_ENABLE(osx_snowleopard,
AC_HELP_STRING([--enable-osx-snowleopard],[build with OS X v10.6 Snow Leopard backwards compatibility]), , [enable_osx_snowleopard=no])
if test "$enable_osx_snowleopard" = yes; then
@@ -332,9 +332,10 @@ jnilibext=no
if test "x$with_jdk" != "xno"
then
+ JAVAC=javac
AC_PROG_JAVAC
if test "x$JAVAC" != "x"
- then
+ then
AC_JNI_INCLUDE_DIR
for JNI_INCLUDE_DIR in $JNI_INCLUDE_DIRS
do
@@ -342,8 +343,8 @@ then
done
dnl Older versions of OS X require .jnilib extension for java libs
- case $host_os in
- *darwin*)
+ case $host_os in
+ *darwin*)
JNI_EXTRA_LDFLAGS="-shrext .jnilib"
esac
else
@@ -368,7 +369,7 @@ AC_SUBST(LDFLAGS)
AC_SUBST(LIBS)
# ------------------------------------------------------------------------------
-# Doxygen support
+# Doxygen support
# ------------------------------------------------------------------------------
DX_HTML_FEATURE(ON)
=====================================
examples/standalone/epochtest/.config/depcomp deleted
=====================================
--- a/examples/standalone/epochtest/.config/depcomp
+++ /dev/null
@@ -1,630 +0,0 @@
-#! /bin/sh
-# depcomp - compile a program generating dependencies as side-effects
-
-scriptversion=2009-04-28.21; # UTC
-
-# Copyright (C) 1999, 2000, 2003, 2004, 2005, 2006, 2007, 2009 Free
-# Software Foundation, Inc.
-
-# This program is free software; you can redistribute it and/or modify
-# it under the terms of the GNU General Public License as published by
-# the Free Software Foundation; either version 2, or (at your option)
-# any later version.
-
-# This program is distributed in the hope that it will be useful,
-# but WITHOUT ANY WARRANTY; without even the implied warranty of
-# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
-# GNU General Public License for more details.
-
-# You should have received a copy of the GNU General Public License
-# along with this program. If not, see <http://www.gnu.org/licenses/>.
-
-# As a special exception to the GNU General Public License, if you
-# distribute this file as part of a program that contains a
-# configuration script generated by Autoconf, you may include it under
-# the same distribution terms that you use for the rest of that program.
-
-# Originally written by Alexandre Oliva <oliva at dcc.unicamp.br>.
-
-case $1 in
- '')
- echo "$0: No command. Try \`$0 --help' for more information." 1>&2
- exit 1;
- ;;
- -h | --h*)
- cat <<\EOF
-Usage: depcomp [--help] [--version] PROGRAM [ARGS]
-
-Run PROGRAMS ARGS to compile a file, generating dependencies
-as side-effects.
-
-Environment variables:
- depmode Dependency tracking mode.
- source Source file read by `PROGRAMS ARGS'.
- object Object file output by `PROGRAMS ARGS'.
- DEPDIR directory where to store dependencies.
- depfile Dependency file to output.
- tmpdepfile Temporary file to use when outputing dependencies.
- libtool Whether libtool is used (yes/no).
-
-Report bugs to <bug-automake at gnu.org>.
-EOF
- exit $?
- ;;
- -v | --v*)
- echo "depcomp $scriptversion"
- exit $?
- ;;
-esac
-
-if test -z "$depmode" || test -z "$source" || test -z "$object"; then
- echo "depcomp: Variables source, object and depmode must be set" 1>&2
- exit 1
-fi
-
-# Dependencies for sub/bar.o or sub/bar.obj go into sub/.deps/bar.Po.
-depfile=${depfile-`echo "$object" |
- sed 's|[^\\/]*$|'${DEPDIR-.deps}'/&|;s|\.\([^.]*\)$|.P\1|;s|Pobj$|Po|'`}
-tmpdepfile=${tmpdepfile-`echo "$depfile" | sed 's/\.\([^.]*\)$/.T\1/'`}
-
-rm -f "$tmpdepfile"
-
-# Some modes work just like other modes, but use different flags. We
-# parameterize here, but still list the modes in the big case below,
-# to make depend.m4 easier to write. Note that we *cannot* use a case
-# here, because this file can only contain one case statement.
-if test "$depmode" = hp; then
- # HP compiler uses -M and no extra arg.
- gccflag=-M
- depmode=gcc
-fi
-
-if test "$depmode" = dashXmstdout; then
- # This is just like dashmstdout with a different argument.
- dashmflag=-xM
- depmode=dashmstdout
-fi
-
-cygpath_u="cygpath -u -f -"
-if test "$depmode" = msvcmsys; then
- # This is just like msvisualcpp but w/o cygpath translation.
- # Just convert the backslash-escaped backslashes to single forward
- # slashes to satisfy depend.m4
- cygpath_u="sed s,\\\\\\\\,/,g"
- depmode=msvisualcpp
-fi
-
-case "$depmode" in
-gcc3)
-## gcc 3 implements dependency tracking that does exactly what
-## we want. Yay! Note: for some reason libtool 1.4 doesn't like
-## it if -MD -MP comes after the -MF stuff. Hmm.
-## Unfortunately, FreeBSD c89 acceptance of flags depends upon
-## the command line argument order; so add the flags where they
-## appear in depend2.am. Note that the slowdown incurred here
-## affects only configure: in makefiles, %FASTDEP% shortcuts this.
- for arg
- do
- case $arg in
- -c) set fnord "$@" -MT "$object" -MD -MP -MF "$tmpdepfile" "$arg" ;;
- *) set fnord "$@" "$arg" ;;
- esac
- shift # fnord
- shift # $arg
- done
- "$@"
- stat=$?
- if test $stat -eq 0; then :
- else
- rm -f "$tmpdepfile"
- exit $stat
- fi
- mv "$tmpdepfile" "$depfile"
- ;;
-
-gcc)
-## There are various ways to get dependency output from gcc. Here's
-## why we pick this rather obscure method:
-## - Don't want to use -MD because we'd like the dependencies to end
-## up in a subdir. Having to rename by hand is ugly.
-## (We might end up doing this anyway to support other compilers.)
-## - The DEPENDENCIES_OUTPUT environment variable makes gcc act like
-## -MM, not -M (despite what the docs say).
-## - Using -M directly means running the compiler twice (even worse
-## than renaming).
- if test -z "$gccflag"; then
- gccflag=-MD,
- fi
- "$@" -Wp,"$gccflag$tmpdepfile"
- stat=$?
- if test $stat -eq 0; then :
- else
- rm -f "$tmpdepfile"
- exit $stat
- fi
- rm -f "$depfile"
- echo "$object : \\" > "$depfile"
- alpha=ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz
-## The second -e expression handles DOS-style file names with drive letters.
- sed -e 's/^[^:]*: / /' \
- -e 's/^['$alpha']:\/[^:]*: / /' < "$tmpdepfile" >> "$depfile"
-## This next piece of magic avoids the `deleted header file' problem.
-## The problem is that when a header file which appears in a .P file
-## is deleted, the dependency causes make to die (because there is
-## typically no way to rebuild the header). We avoid this by adding
-## dummy dependencies for each header file. Too bad gcc doesn't do
-## this for us directly.
- tr ' ' '
-' < "$tmpdepfile" |
-## Some versions of gcc put a space before the `:'. On the theory
-## that the space means something, we add a space to the output as
-## well.
-## Some versions of the HPUX 10.20 sed can't process this invocation
-## correctly. Breaking it into two sed invocations is a workaround.
- sed -e 's/^\\$//' -e '/^$/d' -e '/:$/d' | sed -e 's/$/ :/' >> "$depfile"
- rm -f "$tmpdepfile"
- ;;
-
-hp)
- # This case exists only to let depend.m4 do its work. It works by
- # looking at the text of this script. This case will never be run,
- # since it is checked for above.
- exit 1
- ;;
-
-sgi)
- if test "$libtool" = yes; then
- "$@" "-Wp,-MDupdate,$tmpdepfile"
- else
- "$@" -MDupdate "$tmpdepfile"
- fi
- stat=$?
- if test $stat -eq 0; then :
- else
- rm -f "$tmpdepfile"
- exit $stat
- fi
- rm -f "$depfile"
-
- if test -f "$tmpdepfile"; then # yes, the sourcefile depend on other files
- echo "$object : \\" > "$depfile"
-
- # Clip off the initial element (the dependent). Don't try to be
- # clever and replace this with sed code, as IRIX sed won't handle
- # lines with more than a fixed number of characters (4096 in
- # IRIX 6.2 sed, 8192 in IRIX 6.5). We also remove comment lines;
- # the IRIX cc adds comments like `#:fec' to the end of the
- # dependency line.
- tr ' ' '
-' < "$tmpdepfile" \
- | sed -e 's/^.*\.o://' -e 's/#.*$//' -e '/^$/ d' | \
- tr '
-' ' ' >> "$depfile"
- echo >> "$depfile"
-
- # The second pass generates a dummy entry for each header file.
- tr ' ' '
-' < "$tmpdepfile" \
- | sed -e 's/^.*\.o://' -e 's/#.*$//' -e '/^$/ d' -e 's/$/:/' \
- >> "$depfile"
- else
- # The sourcefile does not contain any dependencies, so just
- # store a dummy comment line, to avoid errors with the Makefile
- # "include basename.Plo" scheme.
- echo "#dummy" > "$depfile"
- fi
- rm -f "$tmpdepfile"
- ;;
-
-aix)
- # The C for AIX Compiler uses -M and outputs the dependencies
- # in a .u file. In older versions, this file always lives in the
- # current directory. Also, the AIX compiler puts `$object:' at the
- # start of each line; $object doesn't have directory information.
- # Version 6 uses the directory in both cases.
- dir=`echo "$object" | sed -e 's|/[^/]*$|/|'`
- test "x$dir" = "x$object" && dir=
- base=`echo "$object" | sed -e 's|^.*/||' -e 's/\.o$//' -e 's/\.lo$//'`
- if test "$libtool" = yes; then
- tmpdepfile1=$dir$base.u
- tmpdepfile2=$base.u
- tmpdepfile3=$dir.libs/$base.u
- "$@" -Wc,-M
- else
- tmpdepfile1=$dir$base.u
- tmpdepfile2=$dir$base.u
- tmpdepfile3=$dir$base.u
- "$@" -M
- fi
- stat=$?
-
- if test $stat -eq 0; then :
- else
- rm -f "$tmpdepfile1" "$tmpdepfile2" "$tmpdepfile3"
- exit $stat
- fi
-
- for tmpdepfile in "$tmpdepfile1" "$tmpdepfile2" "$tmpdepfile3"
- do
- test -f "$tmpdepfile" && break
- done
- if test -f "$tmpdepfile"; then
- # Each line is of the form `foo.o: dependent.h'.
- # Do two passes, one to just change these to
- # `$object: dependent.h' and one to simply `dependent.h:'.
- sed -e "s,^.*\.[a-z]*:,$object:," < "$tmpdepfile" > "$depfile"
- # That's a tab and a space in the [].
- sed -e 's,^.*\.[a-z]*:[ ]*,,' -e 's,$,:,' < "$tmpdepfile" >> "$depfile"
- else
- # The sourcefile does not contain any dependencies, so just
- # store a dummy comment line, to avoid errors with the Makefile
- # "include basename.Plo" scheme.
- echo "#dummy" > "$depfile"
- fi
- rm -f "$tmpdepfile"
- ;;
-
-icc)
- # Intel's C compiler understands `-MD -MF file'. However on
- # icc -MD -MF foo.d -c -o sub/foo.o sub/foo.c
- # ICC 7.0 will fill foo.d with something like
- # foo.o: sub/foo.c
- # foo.o: sub/foo.h
- # which is wrong. We want:
- # sub/foo.o: sub/foo.c
- # sub/foo.o: sub/foo.h
- # sub/foo.c:
- # sub/foo.h:
- # ICC 7.1 will output
- # foo.o: sub/foo.c sub/foo.h
- # and will wrap long lines using \ :
- # foo.o: sub/foo.c ... \
- # sub/foo.h ... \
- # ...
-
- "$@" -MD -MF "$tmpdepfile"
- stat=$?
- if test $stat -eq 0; then :
- else
- rm -f "$tmpdepfile"
- exit $stat
- fi
- rm -f "$depfile"
- # Each line is of the form `foo.o: dependent.h',
- # or `foo.o: dep1.h dep2.h \', or ` dep3.h dep4.h \'.
- # Do two passes, one to just change these to
- # `$object: dependent.h' and one to simply `dependent.h:'.
- sed "s,^[^:]*:,$object :," < "$tmpdepfile" > "$depfile"
- # Some versions of the HPUX 10.20 sed can't process this invocation
- # correctly. Breaking it into two sed invocations is a workaround.
- sed 's,^[^:]*: \(.*\)$,\1,;s/^\\$//;/^$/d;/:$/d' < "$tmpdepfile" |
- sed -e 's/$/ :/' >> "$depfile"
- rm -f "$tmpdepfile"
- ;;
-
-hp2)
- # The "hp" stanza above does not work with aCC (C++) and HP's ia64
- # compilers, which have integrated preprocessors. The correct option
- # to use with these is +Maked; it writes dependencies to a file named
- # 'foo.d', which lands next to the object file, wherever that
- # happens to be.
- # Much of this is similar to the tru64 case; see comments there.
- dir=`echo "$object" | sed -e 's|/[^/]*$|/|'`
- test "x$dir" = "x$object" && dir=
- base=`echo "$object" | sed -e 's|^.*/||' -e 's/\.o$//' -e 's/\.lo$//'`
- if test "$libtool" = yes; then
- tmpdepfile1=$dir$base.d
- tmpdepfile2=$dir.libs/$base.d
- "$@" -Wc,+Maked
- else
- tmpdepfile1=$dir$base.d
- tmpdepfile2=$dir$base.d
- "$@" +Maked
- fi
- stat=$?
- if test $stat -eq 0; then :
- else
- rm -f "$tmpdepfile1" "$tmpdepfile2"
- exit $stat
- fi
-
- for tmpdepfile in "$tmpdepfile1" "$tmpdepfile2"
- do
- test -f "$tmpdepfile" && break
- done
- if test -f "$tmpdepfile"; then
- sed -e "s,^.*\.[a-z]*:,$object:," "$tmpdepfile" > "$depfile"
- # Add `dependent.h:' lines.
- sed -ne '2,${
- s/^ *//
- s/ \\*$//
- s/$/:/
- p
- }' "$tmpdepfile" >> "$depfile"
- else
- echo "#dummy" > "$depfile"
- fi
- rm -f "$tmpdepfile" "$tmpdepfile2"
- ;;
-
-tru64)
- # The Tru64 compiler uses -MD to generate dependencies as a side
- # effect. `cc -MD -o foo.o ...' puts the dependencies into `foo.o.d'.
- # At least on Alpha/Redhat 6.1, Compaq CCC V6.2-504 seems to put
- # dependencies in `foo.d' instead, so we check for that too.
- # Subdirectories are respected.
- dir=`echo "$object" | sed -e 's|/[^/]*$|/|'`
- test "x$dir" = "x$object" && dir=
- base=`echo "$object" | sed -e 's|^.*/||' -e 's/\.o$//' -e 's/\.lo$//'`
-
- if test "$libtool" = yes; then
- # With Tru64 cc, shared objects can also be used to make a
- # static library. This mechanism is used in libtool 1.4 series to
- # handle both shared and static libraries in a single compilation.
- # With libtool 1.4, dependencies were output in $dir.libs/$base.lo.d.
- #
- # With libtool 1.5 this exception was removed, and libtool now
- # generates 2 separate objects for the 2 libraries. These two
- # compilations output dependencies in $dir.libs/$base.o.d and
- # in $dir$base.o.d. We have to check for both files, because
- # one of the two compilations can be disabled. We should prefer
- # $dir$base.o.d over $dir.libs/$base.o.d because the latter is
- # automatically cleaned when .libs/ is deleted, while ignoring
- # the former would cause a distcleancheck panic.
- tmpdepfile1=$dir.libs/$base.lo.d # libtool 1.4
- tmpdepfile2=$dir$base.o.d # libtool 1.5
- tmpdepfile3=$dir.libs/$base.o.d # libtool 1.5
- tmpdepfile4=$dir.libs/$base.d # Compaq CCC V6.2-504
- "$@" -Wc,-MD
- else
- tmpdepfile1=$dir$base.o.d
- tmpdepfile2=$dir$base.d
- tmpdepfile3=$dir$base.d
- tmpdepfile4=$dir$base.d
- "$@" -MD
- fi
-
- stat=$?
- if test $stat -eq 0; then :
- else
- rm -f "$tmpdepfile1" "$tmpdepfile2" "$tmpdepfile3" "$tmpdepfile4"
- exit $stat
- fi
-
- for tmpdepfile in "$tmpdepfile1" "$tmpdepfile2" "$tmpdepfile3" "$tmpdepfile4"
- do
- test -f "$tmpdepfile" && break
- done
- if test -f "$tmpdepfile"; then
- sed -e "s,^.*\.[a-z]*:,$object:," < "$tmpdepfile" > "$depfile"
- # That's a tab and a space in the [].
- sed -e 's,^.*\.[a-z]*:[ ]*,,' -e 's,$,:,' < "$tmpdepfile" >> "$depfile"
- else
- echo "#dummy" > "$depfile"
- fi
- rm -f "$tmpdepfile"
- ;;
-
-#nosideeffect)
- # This comment above is used by automake to tell side-effect
- # dependency tracking mechanisms from slower ones.
-
-dashmstdout)
- # Important note: in order to support this mode, a compiler *must*
- # always write the preprocessed file to stdout, regardless of -o.
- "$@" || exit $?
-
- # Remove the call to Libtool.
- if test "$libtool" = yes; then
- while test "X$1" != 'X--mode=compile'; do
- shift
- done
- shift
- fi
-
- # Remove `-o $object'.
- IFS=" "
- for arg
- do
- case $arg in
- -o)
- shift
- ;;
- $object)
- shift
- ;;
- *)
- set fnord "$@" "$arg"
- shift # fnord
- shift # $arg
- ;;
- esac
- done
-
- test -z "$dashmflag" && dashmflag=-M
- # Require at least two characters before searching for `:'
- # in the target name. This is to cope with DOS-style filenames:
- # a dependency such as `c:/foo/bar' could be seen as target `c' otherwise.
- "$@" $dashmflag |
- sed 's:^[ ]*[^: ][^:][^:]*\:[ ]*:'"$object"'\: :' > "$tmpdepfile"
- rm -f "$depfile"
- cat < "$tmpdepfile" > "$depfile"
- tr ' ' '
-' < "$tmpdepfile" | \
-## Some versions of the HPUX 10.20 sed can't process this invocation
-## correctly. Breaking it into two sed invocations is a workaround.
- sed -e 's/^\\$//' -e '/^$/d' -e '/:$/d' | sed -e 's/$/ :/' >> "$depfile"
- rm -f "$tmpdepfile"
- ;;
-
-dashXmstdout)
- # This case only exists to satisfy depend.m4. It is never actually
- # run, as this mode is specially recognized in the preamble.
- exit 1
- ;;
-
-makedepend)
- "$@" || exit $?
- # Remove any Libtool call
- if test "$libtool" = yes; then
- while test "X$1" != 'X--mode=compile'; do
- shift
- done
- shift
- fi
- # X makedepend
- shift
- cleared=no eat=no
- for arg
- do
- case $cleared in
- no)
- set ""; shift
- cleared=yes ;;
- esac
- if test $eat = yes; then
- eat=no
- continue
- fi
- case "$arg" in
- -D*|-I*)
- set fnord "$@" "$arg"; shift ;;
- # Strip any option that makedepend may not understand. Remove
- # the object too, otherwise makedepend will parse it as a source file.
- -arch)
- eat=yes ;;
- -*|$object)
- ;;
- *)
- set fnord "$@" "$arg"; shift ;;
- esac
- done
- obj_suffix=`echo "$object" | sed 's/^.*\././'`
- touch "$tmpdepfile"
- ${MAKEDEPEND-makedepend} -o"$obj_suffix" -f"$tmpdepfile" "$@"
- rm -f "$depfile"
- cat < "$tmpdepfile" > "$depfile"
- sed '1,2d' "$tmpdepfile" | tr ' ' '
-' | \
-## Some versions of the HPUX 10.20 sed can't process this invocation
-## correctly. Breaking it into two sed invocations is a workaround.
- sed -e 's/^\\$//' -e '/^$/d' -e '/:$/d' | sed -e 's/$/ :/' >> "$depfile"
- rm -f "$tmpdepfile" "$tmpdepfile".bak
- ;;
-
-cpp)
- # Important note: in order to support this mode, a compiler *must*
- # always write the preprocessed file to stdout.
- "$@" || exit $?
-
- # Remove the call to Libtool.
- if test "$libtool" = yes; then
- while test "X$1" != 'X--mode=compile'; do
- shift
- done
- shift
- fi
-
- # Remove `-o $object'.
- IFS=" "
- for arg
- do
- case $arg in
- -o)
- shift
- ;;
- $object)
- shift
- ;;
- *)
- set fnord "$@" "$arg"
- shift # fnord
- shift # $arg
- ;;
- esac
- done
-
- "$@" -E |
- sed -n -e '/^# [0-9][0-9]* "\([^"]*\)".*/ s:: \1 \\:p' \
- -e '/^#line [0-9][0-9]* "\([^"]*\)".*/ s:: \1 \\:p' |
- sed '$ s: \\$::' > "$tmpdepfile"
- rm -f "$depfile"
- echo "$object : \\" > "$depfile"
- cat < "$tmpdepfile" >> "$depfile"
- sed < "$tmpdepfile" '/^$/d;s/^ //;s/ \\$//;s/$/ :/' >> "$depfile"
- rm -f "$tmpdepfile"
- ;;
-
-msvisualcpp)
- # Important note: in order to support this mode, a compiler *must*
- # always write the preprocessed file to stdout.
- "$@" || exit $?
-
- # Remove the call to Libtool.
- if test "$libtool" = yes; then
- while test "X$1" != 'X--mode=compile'; do
- shift
- done
- shift
- fi
-
- IFS=" "
- for arg
- do
- case "$arg" in
- -o)
- shift
- ;;
- $object)
- shift
- ;;
- "-Gm"|"/Gm"|"-Gi"|"/Gi"|"-ZI"|"/ZI")
- set fnord "$@"
- shift
- shift
- ;;
- *)
- set fnord "$@" "$arg"
- shift
- shift
- ;;
- esac
- done
- "$@" -E 2>/dev/null |
- sed -n '/^#line [0-9][0-9]* "\([^"]*\)"/ s::\1:p' | $cygpath_u | sort -u > "$tmpdepfile"
- rm -f "$depfile"
- echo "$object : \\" > "$depfile"
- sed < "$tmpdepfile" -n -e 's% %\\ %g' -e '/^\(.*\)$/ s:: \1 \\:p' >> "$depfile"
- echo " " >> "$depfile"
- sed < "$tmpdepfile" -n -e 's% %\\ %g' -e '/^\(.*\)$/ s::\1\::p' >> "$depfile"
- rm -f "$tmpdepfile"
- ;;
-
-msvcmsys)
- # This case exists only to let depend.m4 do its work. It works by
- # looking at the text of this script. This case will never be run,
- # since it is checked for above.
- exit 1
- ;;
-
-none)
- exec "$@"
- ;;
-
-*)
- echo "Unknown depmode $depmode" 1>&2
- exit 1
- ;;
-esac
-
-exit 0
-
-# Local Variables:
-# mode: shell-script
-# sh-indentation: 2
-# eval: (add-hook 'write-file-hooks 'time-stamp)
-# time-stamp-start: "scriptversion="
-# time-stamp-format: "%:y-%02m-%02d.%02H"
-# time-stamp-time-zone: "UTC"
-# time-stamp-end: "; # UTC"
-# End:
=====================================
examples/standalone/epochtest/.config/install-sh deleted
=====================================
--- a/examples/standalone/epochtest/.config/install-sh
+++ /dev/null
@@ -1,520 +0,0 @@
-#!/bin/sh
-# install - install a program, script, or datafile
-
-scriptversion=2009-04-28.21; # UTC
-
-# This originates from X11R5 (mit/util/scripts/install.sh), which was
-# later released in X11R6 (xc/config/util/install.sh) with the
-# following copyright and license.
-#
-# Copyright (C) 1994 X Consortium
-#
-# Permission is hereby granted, free of charge, to any person obtaining a copy
-# of this software and associated documentation files (the "Software"), to
-# deal in the Software without restriction, including without limitation the
-# rights to use, copy, modify, merge, publish, distribute, sublicense, and/or
-# sell copies of the Software, and to permit persons to whom the Software is
-# furnished to do so, subject to the following conditions:
-#
-# The above copyright notice and this permission notice shall be included in
-# all copies or substantial portions of the Software.
-#
-# THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
-# IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
-# FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
-# X CONSORTIUM BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN
-# AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNEC-
-# TION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
-#
-# Except as contained in this notice, the name of the X Consortium shall not
-# be used in advertising or otherwise to promote the sale, use or other deal-
-# ings in this Software without prior written authorization from the X Consor-
-# tium.
-#
-#
-# FSF changes to this file are in the public domain.
-#
-# Calling this script install-sh is preferred over install.sh, to prevent
-# `make' implicit rules from creating a file called install from it
-# when there is no Makefile.
-#
-# This script is compatible with the BSD install script, but was written
-# from scratch.
-
-nl='
-'
-IFS=" "" $nl"
-
-# set DOITPROG to echo to test this script
-
-# Don't use :- since 4.3BSD and earlier shells don't like it.
-doit=${DOITPROG-}
-if test -z "$doit"; then
- doit_exec=exec
-else
- doit_exec=$doit
-fi
-
-# Put in absolute file names if you don't have them in your path;
-# or use environment vars.
-
-chgrpprog=${CHGRPPROG-chgrp}
-chmodprog=${CHMODPROG-chmod}
-chownprog=${CHOWNPROG-chown}
-cmpprog=${CMPPROG-cmp}
-cpprog=${CPPROG-cp}
-mkdirprog=${MKDIRPROG-mkdir}
-mvprog=${MVPROG-mv}
-rmprog=${RMPROG-rm}
-stripprog=${STRIPPROG-strip}
-
-posix_glob='?'
-initialize_posix_glob='
- test "$posix_glob" != "?" || {
- if (set -f) 2>/dev/null; then
- posix_glob=
- else
- posix_glob=:
- fi
- }
-'
-
-posix_mkdir=
-
-# Desired mode of installed file.
-mode=0755
-
-chgrpcmd=
-chmodcmd=$chmodprog
-chowncmd=
-mvcmd=$mvprog
-rmcmd="$rmprog -f"
-stripcmd=
-
-src=
-dst=
-dir_arg=
-dst_arg=
-
-copy_on_change=false
-no_target_directory=
-
-usage="\
-Usage: $0 [OPTION]... [-T] SRCFILE DSTFILE
- or: $0 [OPTION]... SRCFILES... DIRECTORY
- or: $0 [OPTION]... -t DIRECTORY SRCFILES...
- or: $0 [OPTION]... -d DIRECTORIES...
-
-In the 1st form, copy SRCFILE to DSTFILE.
-In the 2nd and 3rd, copy all SRCFILES to DIRECTORY.
-In the 4th, create DIRECTORIES.
-
-Options:
- --help display this help and exit.
- --version display version info and exit.
-
- -c (ignored)
- -C install only if different (preserve the last data modification time)
- -d create directories instead of installing files.
- -g GROUP $chgrpprog installed files to GROUP.
- -m MODE $chmodprog installed files to MODE.
- -o USER $chownprog installed files to USER.
- -s $stripprog installed files.
- -t DIRECTORY install into DIRECTORY.
- -T report an error if DSTFILE is a directory.
-
-Environment variables override the default commands:
- CHGRPPROG CHMODPROG CHOWNPROG CMPPROG CPPROG MKDIRPROG MVPROG
- RMPROG STRIPPROG
-"
-
-while test $# -ne 0; do
- case $1 in
- -c) ;;
-
- -C) copy_on_change=true;;
-
- -d) dir_arg=true;;
-
- -g) chgrpcmd="$chgrpprog $2"
- shift;;
-
- --help) echo "$usage"; exit $?;;
-
- -m) mode=$2
- case $mode in
- *' '* | *' '* | *'
-'* | *'*'* | *'?'* | *'['*)
- echo "$0: invalid mode: $mode" >&2
- exit 1;;
- esac
- shift;;
-
- -o) chowncmd="$chownprog $2"
- shift;;
-
- -s) stripcmd=$stripprog;;
-
- -t) dst_arg=$2
- shift;;
-
- -T) no_target_directory=true;;
-
- --version) echo "$0 $scriptversion"; exit $?;;
-
- --) shift
- break;;
-
- -*) echo "$0: invalid option: $1" >&2
- exit 1;;
-
- *) break;;
- esac
- shift
-done
-
-if test $# -ne 0 && test -z "$dir_arg$dst_arg"; then
- # When -d is used, all remaining arguments are directories to create.
- # When -t is used, the destination is already specified.
- # Otherwise, the last argument is the destination. Remove it from $@.
- for arg
- do
- if test -n "$dst_arg"; then
- # $@ is not empty: it contains at least $arg.
- set fnord "$@" "$dst_arg"
- shift # fnord
- fi
- shift # arg
- dst_arg=$arg
- done
-fi
-
-if test $# -eq 0; then
- if test -z "$dir_arg"; then
- echo "$0: no input file specified." >&2
- exit 1
- fi
- # It's OK to call `install-sh -d' without argument.
- # This can happen when creating conditional directories.
- exit 0
-fi
-
-if test -z "$dir_arg"; then
- trap '(exit $?); exit' 1 2 13 15
-
- # Set umask so as not to create temps with too-generous modes.
- # However, 'strip' requires both read and write access to temps.
- case $mode in
- # Optimize common cases.
- *644) cp_umask=133;;
- *755) cp_umask=22;;
-
- *[0-7])
- if test -z "$stripcmd"; then
- u_plus_rw=
- else
- u_plus_rw='% 200'
- fi
- cp_umask=`expr '(' 777 - $mode % 1000 ')' $u_plus_rw`;;
- *)
- if test -z "$stripcmd"; then
- u_plus_rw=
- else
- u_plus_rw=,u+rw
- fi
- cp_umask=$mode$u_plus_rw;;
- esac
-fi
-
-for src
-do
- # Protect names starting with `-'.
- case $src in
- -*) src=./$src;;
- esac
-
- if test -n "$dir_arg"; then
- dst=$src
- dstdir=$dst
- test -d "$dstdir"
- dstdir_status=$?
- else
-
- # Waiting for this to be detected by the "$cpprog $src $dsttmp" command
- # might cause directories to be created, which would be especially bad
- # if $src (and thus $dsttmp) contains '*'.
- if test ! -f "$src" && test ! -d "$src"; then
- echo "$0: $src does not exist." >&2
- exit 1
- fi
-
- if test -z "$dst_arg"; then
- echo "$0: no destination specified." >&2
- exit 1
- fi
-
- dst=$dst_arg
- # Protect names starting with `-'.
- case $dst in
- -*) dst=./$dst;;
- esac
-
- # If destination is a directory, append the input filename; won't work
- # if double slashes aren't ignored.
- if test -d "$dst"; then
- if test -n "$no_target_directory"; then
- echo "$0: $dst_arg: Is a directory" >&2
- exit 1
- fi
- dstdir=$dst
- dst=$dstdir/`basename "$src"`
- dstdir_status=0
- else
- # Prefer dirname, but fall back on a substitute if dirname fails.
- dstdir=`
- (dirname "$dst") 2>/dev/null ||
- expr X"$dst" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \
- X"$dst" : 'X\(//\)[^/]' \| \
- X"$dst" : 'X\(//\)$' \| \
- X"$dst" : 'X\(/\)' \| . 2>/dev/null ||
- echo X"$dst" |
- sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{
- s//\1/
- q
- }
- /^X\(\/\/\)[^/].*/{
- s//\1/
- q
- }
- /^X\(\/\/\)$/{
- s//\1/
- q
- }
- /^X\(\/\).*/{
- s//\1/
- q
- }
- s/.*/./; q'
- `
-
- test -d "$dstdir"
- dstdir_status=$?
- fi
- fi
-
- obsolete_mkdir_used=false
-
- if test $dstdir_status != 0; then
- case $posix_mkdir in
- '')
- # Create intermediate dirs using mode 755 as modified by the umask.
- # This is like FreeBSD 'install' as of 1997-10-28.
- umask=`umask`
- case $stripcmd.$umask in
- # Optimize common cases.
- *[2367][2367]) mkdir_umask=$umask;;
- .*0[02][02] | .[02][02] | .[02]) mkdir_umask=22;;
-
- *[0-7])
- mkdir_umask=`expr $umask + 22 \
- - $umask % 100 % 40 + $umask % 20 \
- - $umask % 10 % 4 + $umask % 2
- `;;
- *) mkdir_umask=$umask,go-w;;
- esac
-
- # With -d, create the new directory with the user-specified mode.
- # Otherwise, rely on $mkdir_umask.
- if test -n "$dir_arg"; then
- mkdir_mode=-m$mode
- else
- mkdir_mode=
- fi
-
- posix_mkdir=false
- case $umask in
- *[123567][0-7][0-7])
- # POSIX mkdir -p sets u+wx bits regardless of umask, which
- # is incompatible with FreeBSD 'install' when (umask & 300) != 0.
- ;;
- *)
- tmpdir=${TMPDIR-/tmp}/ins$RANDOM-$$
- trap 'ret=$?; rmdir "$tmpdir/d" "$tmpdir" 2>/dev/null; exit $ret' 0
-
- if (umask $mkdir_umask &&
- exec $mkdirprog $mkdir_mode -p -- "$tmpdir/d") >/dev/null 2>&1
- then
- if test -z "$dir_arg" || {
- # Check for POSIX incompatibilities with -m.
- # HP-UX 11.23 and IRIX 6.5 mkdir -m -p sets group- or
- # other-writeable bit of parent directory when it shouldn't.
- # FreeBSD 6.1 mkdir -m -p sets mode of existing directory.
- ls_ld_tmpdir=`ls -ld "$tmpdir"`
- case $ls_ld_tmpdir in
- d????-?r-*) different_mode=700;;
- d????-?--*) different_mode=755;;
- *) false;;
- esac &&
- $mkdirprog -m$different_mode -p -- "$tmpdir" && {
- ls_ld_tmpdir_1=`ls -ld "$tmpdir"`
- test "$ls_ld_tmpdir" = "$ls_ld_tmpdir_1"
- }
- }
- then posix_mkdir=:
- fi
- rmdir "$tmpdir/d" "$tmpdir"
- else
- # Remove any dirs left behind by ancient mkdir implementations.
- rmdir ./$mkdir_mode ./-p ./-- 2>/dev/null
- fi
- trap '' 0;;
- esac;;
- esac
-
- if
- $posix_mkdir && (
- umask $mkdir_umask &&
- $doit_exec $mkdirprog $mkdir_mode -p -- "$dstdir"
- )
- then :
- else
-
- # The umask is ridiculous, or mkdir does not conform to POSIX,
- # or it failed possibly due to a race condition. Create the
- # directory the slow way, step by step, checking for races as we go.
-
- case $dstdir in
- /*) prefix='/';;
- -*) prefix='./';;
- *) prefix='';;
- esac
-
- eval "$initialize_posix_glob"
-
- oIFS=$IFS
- IFS=/
- $posix_glob set -f
- set fnord $dstdir
- shift
- $posix_glob set +f
- IFS=$oIFS
-
- prefixes=
-
- for d
- do
- test -z "$d" && continue
-
- prefix=$prefix$d
- if test -d "$prefix"; then
- prefixes=
- else
- if $posix_mkdir; then
- (umask=$mkdir_umask &&
- $doit_exec $mkdirprog $mkdir_mode -p -- "$dstdir") && break
- # Don't fail if two instances are running concurrently.
- test -d "$prefix" || exit 1
- else
- case $prefix in
- *\'*) qprefix=`echo "$prefix" | sed "s/'/'\\\\\\\\''/g"`;;
- *) qprefix=$prefix;;
- esac
- prefixes="$prefixes '$qprefix'"
- fi
- fi
- prefix=$prefix/
- done
-
- if test -n "$prefixes"; then
- # Don't fail if two instances are running concurrently.
- (umask $mkdir_umask &&
- eval "\$doit_exec \$mkdirprog $prefixes") ||
- test -d "$dstdir" || exit 1
- obsolete_mkdir_used=true
- fi
- fi
- fi
-
- if test -n "$dir_arg"; then
- { test -z "$chowncmd" || $doit $chowncmd "$dst"; } &&
- { test -z "$chgrpcmd" || $doit $chgrpcmd "$dst"; } &&
- { test "$obsolete_mkdir_used$chowncmd$chgrpcmd" = false ||
- test -z "$chmodcmd" || $doit $chmodcmd $mode "$dst"; } || exit 1
- else
-
- # Make a couple of temp file names in the proper directory.
- dsttmp=$dstdir/_inst.$$_
- rmtmp=$dstdir/_rm.$$_
-
- # Trap to clean up those temp files at exit.
- trap 'ret=$?; rm -f "$dsttmp" "$rmtmp" && exit $ret' 0
-
- # Copy the file name to the temp name.
- (umask $cp_umask && $doit_exec $cpprog "$src" "$dsttmp") &&
-
- # and set any options; do chmod last to preserve setuid bits.
- #
- # If any of these fail, we abort the whole thing. If we want to
- # ignore errors from any of these, just make sure not to ignore
- # errors from the above "$doit $cpprog $src $dsttmp" command.
- #
- { test -z "$chowncmd" || $doit $chowncmd "$dsttmp"; } &&
- { test -z "$chgrpcmd" || $doit $chgrpcmd "$dsttmp"; } &&
- { test -z "$stripcmd" || $doit $stripcmd "$dsttmp"; } &&
- { test -z "$chmodcmd" || $doit $chmodcmd $mode "$dsttmp"; } &&
-
- # If -C, don't bother to copy if it wouldn't change the file.
- if $copy_on_change &&
- old=`LC_ALL=C ls -dlL "$dst" 2>/dev/null` &&
- new=`LC_ALL=C ls -dlL "$dsttmp" 2>/dev/null` &&
-
- eval "$initialize_posix_glob" &&
- $posix_glob set -f &&
- set X $old && old=:$2:$4:$5:$6 &&
- set X $new && new=:$2:$4:$5:$6 &&
- $posix_glob set +f &&
-
- test "$old" = "$new" &&
- $cmpprog "$dst" "$dsttmp" >/dev/null 2>&1
- then
- rm -f "$dsttmp"
- else
- # Rename the file to the real destination.
- $doit $mvcmd -f "$dsttmp" "$dst" 2>/dev/null ||
-
- # The rename failed, perhaps because mv can't rename something else
- # to itself, or perhaps because mv is so ancient that it does not
- # support -f.
- {
- # Now remove or move aside any old file at destination location.
- # We try this two ways since rm can't unlink itself on some
- # systems and the destination file might be busy for other
- # reasons. In this case, the final cleanup might fail but the new
- # file should still install successfully.
- {
- test ! -f "$dst" ||
- $doit $rmcmd -f "$dst" 2>/dev/null ||
- { $doit $mvcmd -f "$dst" "$rmtmp" 2>/dev/null &&
- { $doit $rmcmd -f "$rmtmp" 2>/dev/null; :; }
- } ||
- { echo "$0: cannot unlink or rename $dst" >&2
- (exit 1); exit 1
- }
- } &&
-
- # Now rename the file to the real destination.
- $doit $mvcmd "$dsttmp" "$dst"
- }
- fi || exit 1
-
- trap '' 0
- fi
-done
-
-# Local variables:
-# eval: (add-hook 'write-file-hooks 'time-stamp)
-# time-stamp-start: "scriptversion="
-# time-stamp-format: "%:y-%02m-%02d.%02H"
-# time-stamp-time-zone: "UTC"
-# time-stamp-end: "; # UTC"
-# End:
=====================================
examples/standalone/epochtest/.config/missing deleted
=====================================
--- a/examples/standalone/epochtest/.config/missing
+++ /dev/null
@@ -1,376 +0,0 @@
-#! /bin/sh
-# Common stub for a few missing GNU programs while installing.
-
-scriptversion=2009-04-28.21; # UTC
-
-# Copyright (C) 1996, 1997, 1999, 2000, 2002, 2003, 2004, 2005, 2006,
-# 2008, 2009 Free Software Foundation, Inc.
-# Originally by Fran,cois Pinard <pinard at iro.umontreal.ca>, 1996.
-
-# This program is free software; you can redistribute it and/or modify
-# it under the terms of the GNU General Public License as published by
-# the Free Software Foundation; either version 2, or (at your option)
-# any later version.
-
-# This program is distributed in the hope that it will be useful,
-# but WITHOUT ANY WARRANTY; without even the implied warranty of
-# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
-# GNU General Public License for more details.
-
-# You should have received a copy of the GNU General Public License
-# along with this program. If not, see <http://www.gnu.org/licenses/>.
-
-# As a special exception to the GNU General Public License, if you
-# distribute this file as part of a program that contains a
-# configuration script generated by Autoconf, you may include it under
-# the same distribution terms that you use for the rest of that program.
-
-if test $# -eq 0; then
- echo 1>&2 "Try \`$0 --help' for more information"
- exit 1
-fi
-
-run=:
-sed_output='s/.* --output[ =]\([^ ]*\).*/\1/p'
-sed_minuso='s/.* -o \([^ ]*\).*/\1/p'
-
-# In the cases where this matters, `missing' is being run in the
-# srcdir already.
-if test -f configure.ac; then
- configure_ac=configure.ac
-else
- configure_ac=configure.in
-fi
-
-msg="missing on your system"
-
-case $1 in
---run)
- # Try to run requested program, and just exit if it succeeds.
- run=
- shift
- "$@" && exit 0
- # Exit code 63 means version mismatch. This often happens
- # when the user try to use an ancient version of a tool on
- # a file that requires a minimum version. In this case we
- # we should proceed has if the program had been absent, or
- # if --run hadn't been passed.
- if test $? = 63; then
- run=:
- msg="probably too old"
- fi
- ;;
-
- -h|--h|--he|--hel|--help)
- echo "\
-$0 [OPTION]... PROGRAM [ARGUMENT]...
-
-Handle \`PROGRAM [ARGUMENT]...' for when PROGRAM is missing, or return an
-error status if there is no known handling for PROGRAM.
-
-Options:
- -h, --help display this help and exit
- -v, --version output version information and exit
- --run try to run the given command, and emulate it if it fails
-
-Supported PROGRAM values:
- aclocal touch file \`aclocal.m4'
- autoconf touch file \`configure'
- autoheader touch file \`config.h.in'
- autom4te touch the output file, or create a stub one
- automake touch all \`Makefile.in' files
- bison create \`y.tab.[ch]', if possible, from existing .[ch]
- flex create \`lex.yy.c', if possible, from existing .c
- help2man touch the output file
- lex create \`lex.yy.c', if possible, from existing .c
- makeinfo touch the output file
- tar try tar, gnutar, gtar, then tar without non-portable flags
- yacc create \`y.tab.[ch]', if possible, from existing .[ch]
-
-Version suffixes to PROGRAM as well as the prefixes \`gnu-', \`gnu', and
-\`g' are ignored when checking the name.
-
-Send bug reports to <bug-automake at gnu.org>."
- exit $?
- ;;
-
- -v|--v|--ve|--ver|--vers|--versi|--versio|--version)
- echo "missing $scriptversion (GNU Automake)"
- exit $?
- ;;
-
- -*)
- echo 1>&2 "$0: Unknown \`$1' option"
- echo 1>&2 "Try \`$0 --help' for more information"
- exit 1
- ;;
-
-esac
-
-# normalize program name to check for.
-program=`echo "$1" | sed '
- s/^gnu-//; t
- s/^gnu//; t
- s/^g//; t'`
-
-# Now exit if we have it, but it failed. Also exit now if we
-# don't have it and --version was passed (most likely to detect
-# the program). This is about non-GNU programs, so use $1 not
-# $program.
-case $1 in
- lex*|yacc*)
- # Not GNU programs, they don't have --version.
- ;;
-
- tar*)
- if test -n "$run"; then
- echo 1>&2 "ERROR: \`tar' requires --run"
- exit 1
- elif test "x$2" = "x--version" || test "x$2" = "x--help"; then
- exit 1
- fi
- ;;
-
- *)
- if test -z "$run" && ($1 --version) > /dev/null 2>&1; then
- # We have it, but it failed.
- exit 1
- elif test "x$2" = "x--version" || test "x$2" = "x--help"; then
- # Could not run --version or --help. This is probably someone
- # running `$TOOL --version' or `$TOOL --help' to check whether
- # $TOOL exists and not knowing $TOOL uses missing.
- exit 1
- fi
- ;;
-esac
-
-# If it does not exist, or fails to run (possibly an outdated version),
-# try to emulate it.
-case $program in
- aclocal*)
- echo 1>&2 "\
-WARNING: \`$1' is $msg. You should only need it if
- you modified \`acinclude.m4' or \`${configure_ac}'. You might want
- to install the \`Automake' and \`Perl' packages. Grab them from
- any GNU archive site."
- touch aclocal.m4
- ;;
-
- autoconf*)
- echo 1>&2 "\
-WARNING: \`$1' is $msg. You should only need it if
- you modified \`${configure_ac}'. You might want to install the
- \`Autoconf' and \`GNU m4' packages. Grab them from any GNU
- archive site."
- touch configure
- ;;
-
- autoheader*)
- echo 1>&2 "\
-WARNING: \`$1' is $msg. You should only need it if
- you modified \`acconfig.h' or \`${configure_ac}'. You might want
- to install the \`Autoconf' and \`GNU m4' packages. Grab them
- from any GNU archive site."
- files=`sed -n 's/^[ ]*A[CM]_CONFIG_HEADER(\([^)]*\)).*/\1/p' ${configure_ac}`
- test -z "$files" && files="config.h"
- touch_files=
- for f in $files; do
- case $f in
- *:*) touch_files="$touch_files "`echo "$f" |
- sed -e 's/^[^:]*://' -e 's/:.*//'`;;
- *) touch_files="$touch_files $f.in";;
- esac
- done
- touch $touch_files
- ;;
-
- automake*)
- echo 1>&2 "\
-WARNING: \`$1' is $msg. You should only need it if
- you modified \`Makefile.am', \`acinclude.m4' or \`${configure_ac}'.
- You might want to install the \`Automake' and \`Perl' packages.
- Grab them from any GNU archive site."
- find . -type f -name Makefile.am -print |
- sed 's/\.am$/.in/' |
- while read f; do touch "$f"; done
- ;;
-
- autom4te*)
- echo 1>&2 "\
-WARNING: \`$1' is needed, but is $msg.
- You might have modified some files without having the
- proper tools for further handling them.
- You can get \`$1' as part of \`Autoconf' from any GNU
- archive site."
-
- file=`echo "$*" | sed -n "$sed_output"`
- test -z "$file" && file=`echo "$*" | sed -n "$sed_minuso"`
- if test -f "$file"; then
- touch $file
- else
- test -z "$file" || exec >$file
- echo "#! /bin/sh"
- echo "# Created by GNU Automake missing as a replacement of"
- echo "# $ $@"
- echo "exit 0"
- chmod +x $file
- exit 1
- fi
- ;;
-
- bison*|yacc*)
- echo 1>&2 "\
-WARNING: \`$1' $msg. You should only need it if
- you modified a \`.y' file. You may need the \`Bison' package
- in order for those modifications to take effect. You can get
- \`Bison' from any GNU archive site."
- rm -f y.tab.c y.tab.h
- if test $# -ne 1; then
- eval LASTARG="\${$#}"
- case $LASTARG in
- *.y)
- SRCFILE=`echo "$LASTARG" | sed 's/y$/c/'`
- if test -f "$SRCFILE"; then
- cp "$SRCFILE" y.tab.c
- fi
- SRCFILE=`echo "$LASTARG" | sed 's/y$/h/'`
- if test -f "$SRCFILE"; then
- cp "$SRCFILE" y.tab.h
- fi
- ;;
- esac
- fi
- if test ! -f y.tab.h; then
- echo >y.tab.h
- fi
- if test ! -f y.tab.c; then
- echo 'main() { return 0; }' >y.tab.c
- fi
- ;;
-
- lex*|flex*)
- echo 1>&2 "\
-WARNING: \`$1' is $msg. You should only need it if
- you modified a \`.l' file. You may need the \`Flex' package
- in order for those modifications to take effect. You can get
- \`Flex' from any GNU archive site."
- rm -f lex.yy.c
- if test $# -ne 1; then
- eval LASTARG="\${$#}"
- case $LASTARG in
- *.l)
- SRCFILE=`echo "$LASTARG" | sed 's/l$/c/'`
- if test -f "$SRCFILE"; then
- cp "$SRCFILE" lex.yy.c
- fi
- ;;
- esac
- fi
- if test ! -f lex.yy.c; then
- echo 'main() { return 0; }' >lex.yy.c
- fi
- ;;
-
- help2man*)
- echo 1>&2 "\
-WARNING: \`$1' is $msg. You should only need it if
- you modified a dependency of a manual page. You may need the
- \`Help2man' package in order for those modifications to take
- effect. You can get \`Help2man' from any GNU archive site."
-
- file=`echo "$*" | sed -n "$sed_output"`
- test -z "$file" && file=`echo "$*" | sed -n "$sed_minuso"`
- if test -f "$file"; then
- touch $file
- else
- test -z "$file" || exec >$file
- echo ".ab help2man is required to generate this page"
- exit $?
- fi
- ;;
-
- makeinfo*)
- echo 1>&2 "\
-WARNING: \`$1' is $msg. You should only need it if
- you modified a \`.texi' or \`.texinfo' file, or any other file
- indirectly affecting the aspect of the manual. The spurious
- call might also be the consequence of using a buggy \`make' (AIX,
- DU, IRIX). You might want to install the \`Texinfo' package or
- the \`GNU make' package. Grab either from any GNU archive site."
- # The file to touch is that specified with -o ...
- file=`echo "$*" | sed -n "$sed_output"`
- test -z "$file" && file=`echo "$*" | sed -n "$sed_minuso"`
- if test -z "$file"; then
- # ... or it is the one specified with @setfilename ...
- infile=`echo "$*" | sed 's/.* \([^ ]*\) *$/\1/'`
- file=`sed -n '
- /^@setfilename/{
- s/.* \([^ ]*\) *$/\1/
- p
- q
- }' $infile`
- # ... or it is derived from the source name (dir/f.texi becomes f.info)
- test -z "$file" && file=`echo "$infile" | sed 's,.*/,,;s,.[^.]*$,,'`.info
- fi
- # If the file does not exist, the user really needs makeinfo;
- # let's fail without touching anything.
- test -f $file || exit 1
- touch $file
- ;;
-
- tar*)
- shift
-
- # We have already tried tar in the generic part.
- # Look for gnutar/gtar before invocation to avoid ugly error
- # messages.
- if (gnutar --version > /dev/null 2>&1); then
- gnutar "$@" && exit 0
- fi
- if (gtar --version > /dev/null 2>&1); then
- gtar "$@" && exit 0
- fi
- firstarg="$1"
- if shift; then
- case $firstarg in
- *o*)
- firstarg=`echo "$firstarg" | sed s/o//`
- tar "$firstarg" "$@" && exit 0
- ;;
- esac
- case $firstarg in
- *h*)
- firstarg=`echo "$firstarg" | sed s/h//`
- tar "$firstarg" "$@" && exit 0
- ;;
- esac
- fi
-
- echo 1>&2 "\
-WARNING: I can't seem to be able to run \`tar' with the given arguments.
- You may want to install GNU tar or Free paxutils, or check the
- command line arguments."
- exit 1
- ;;
-
- *)
- echo 1>&2 "\
-WARNING: \`$1' is needed, and is $msg.
- You might have modified some files without having the
- proper tools for further handling them. Check the \`README' file,
- it often tells you about the needed prerequisites for installing
- this package. You may also peek at any GNU archive site, in case
- some other package would contain this missing \`$1' program."
- exit 1
- ;;
-esac
-
-exit 0
-
-# Local variables:
-# eval: (add-hook 'write-file-hooks 'time-stamp)
-# time-stamp-start: "scriptversion="
-# time-stamp-format: "%:y-%02m-%02d.%02H"
-# time-stamp-time-zone: "UTC"
-# time-stamp-end: "; # UTC"
-# End:
=====================================
examples/standalone/epochtest/AUTHORS deleted
=====================================
--- a/examples/standalone/epochtest/AUTHORS
+++ /dev/null
=====================================
examples/standalone/epochtest/COPYING deleted
=====================================
--- a/examples/standalone/epochtest/COPYING
+++ /dev/null
@@ -1,674 +0,0 @@
- GNU GENERAL PUBLIC LICENSE
- Version 3, 29 June 2007
-
- Copyright (C) 2007 Free Software Foundation, Inc. <http://fsf.org/>
- Everyone is permitted to copy and distribute verbatim copies
- of this license document, but changing it is not allowed.
-
- Preamble
-
- The GNU General Public License is a free, copyleft license for
-software and other kinds of works.
-
- The licenses for most software and other practical works are designed
-to take away your freedom to share and change the works. By contrast,
-the GNU General Public License is intended to guarantee your freedom to
-share and change all versions of a program--to make sure it remains free
-software for all its users. We, the Free Software Foundation, use the
-GNU General Public License for most of our software; it applies also to
-any other work released this way by its authors. You can apply it to
-your programs, too.
-
- When we speak of free software, we are referring to freedom, not
-price. Our General Public Licenses are designed to make sure that you
-have the freedom to distribute copies of free software (and charge for
-them if you wish), that you receive source code or can get it if you
-want it, that you can change the software or use pieces of it in new
-free programs, and that you know you can do these things.
-
- To protect your rights, we need to prevent others from denying you
-these rights or asking you to surrender the rights. Therefore, you have
-certain responsibilities if you distribute copies of the software, or if
-you modify it: responsibilities to respect the freedom of others.
-
- For example, if you distribute copies of such a program, whether
-gratis or for a fee, you must pass on to the recipients the same
-freedoms that you received. You must make sure that they, too, receive
-or can get the source code. And you must show them these terms so they
-know their rights.
-
- Developers that use the GNU GPL protect your rights with two steps:
-(1) assert copyright on the software, and (2) offer you this License
-giving you legal permission to copy, distribute and/or modify it.
-
- For the developers' and authors' protection, the GPL clearly explains
-that there is no warranty for this free software. For both users' and
-authors' sake, the GPL requires that modified versions be marked as
-changed, so that their problems will not be attributed erroneously to
-authors of previous versions.
-
- Some devices are designed to deny users access to install or run
-modified versions of the software inside them, although the manufacturer
-can do so. This is fundamentally incompatible with the aim of
-protecting users' freedom to change the software. The systematic
-pattern of such abuse occurs in the area of products for individuals to
-use, which is precisely where it is most unacceptable. Therefore, we
-have designed this version of the GPL to prohibit the practice for those
-products. If such problems arise substantially in other domains, we
-stand ready to extend this provision to those domains in future versions
-of the GPL, as needed to protect the freedom of users.
-
- Finally, every program is threatened constantly by software patents.
-States should not allow patents to restrict development and use of
-software on general-purpose computers, but in those that do, we wish to
-avoid the special danger that patents applied to a free program could
-make it effectively proprietary. To prevent this, the GPL assures that
-patents cannot be used to render the program non-free.
-
- The precise terms and conditions for copying, distribution and
-modification follow.
-
- TERMS AND CONDITIONS
-
- 0. Definitions.
-
- "This License" refers to version 3 of the GNU General Public License.
-
- "Copyright" also means copyright-like laws that apply to other kinds of
-works, such as semiconductor masks.
-
- "The Program" refers to any copyrightable work licensed under this
-License. Each licensee is addressed as "you". "Licensees" and
-"recipients" may be individuals or organizations.
-
- To "modify" a work means to copy from or adapt all or part of the work
-in a fashion requiring copyright permission, other than the making of an
-exact copy. The resulting work is called a "modified version" of the
-earlier work or a work "based on" the earlier work.
-
- A "covered work" means either the unmodified Program or a work based
-on the Program.
-
- To "propagate" a work means to do anything with it that, without
-permission, would make you directly or secondarily liable for
-infringement under applicable copyright law, except executing it on a
-computer or modifying a private copy. Propagation includes copying,
-distribution (with or without modification), making available to the
-public, and in some countries other activities as well.
-
- To "convey" a work means any kind of propagation that enables other
-parties to make or receive copies. Mere interaction with a user through
-a computer network, with no transfer of a copy, is not conveying.
-
- An interactive user interface displays "Appropriate Legal Notices"
-to the extent that it includes a convenient and prominently visible
-feature that (1) displays an appropriate copyright notice, and (2)
-tells the user that there is no warranty for the work (except to the
-extent that warranties are provided), that licensees may convey the
-work under this License, and how to view a copy of this License. If
-the interface presents a list of user commands or options, such as a
-menu, a prominent item in the list meets this criterion.
-
- 1. Source Code.
-
- The "source code" for a work means the preferred form of the work
-for making modifications to it. "Object code" means any non-source
-form of a work.
-
- A "Standard Interface" means an interface that either is an official
-standard defined by a recognized standards body, or, in the case of
-interfaces specified for a particular programming language, one that
-is widely used among developers working in that language.
-
- The "System Libraries" of an executable work include anything, other
-than the work as a whole, that (a) is included in the normal form of
-packaging a Major Component, but which is not part of that Major
-Component, and (b) serves only to enable use of the work with that
-Major Component, or to implement a Standard Interface for which an
-implementation is available to the public in source code form. A
-"Major Component", in this context, means a major essential component
-(kernel, window system, and so on) of the specific operating system
-(if any) on which the executable work runs, or a compiler used to
-produce the work, or an object code interpreter used to run it.
-
- The "Corresponding Source" for a work in object code form means all
-the source code needed to generate, install, and (for an executable
-work) run the object code and to modify the work, including scripts to
-control those activities. However, it does not include the work's
-System Libraries, or general-purpose tools or generally available free
-programs which are used unmodified in performing those activities but
-which are not part of the work. For example, Corresponding Source
-includes interface definition files associated with source files for
-the work, and the source code for shared libraries and dynamically
-linked subprograms that the work is specifically designed to require,
-such as by intimate data communication or control flow between those
-subprograms and other parts of the work.
-
- The Corresponding Source need not include anything that users
-can regenerate automatically from other parts of the Corresponding
-Source.
-
- The Corresponding Source for a work in source code form is that
-same work.
-
- 2. Basic Permissions.
-
- All rights granted under this License are granted for the term of
-copyright on the Program, and are irrevocable provided the stated
-conditions are met. This License explicitly affirms your unlimited
-permission to run the unmodified Program. The output from running a
-covered work is covered by this License only if the output, given its
-content, constitutes a covered work. This License acknowledges your
-rights of fair use or other equivalent, as provided by copyright law.
-
- You may make, run and propagate covered works that you do not
-convey, without conditions so long as your license otherwise remains
-in force. You may convey covered works to others for the sole purpose
-of having them make modifications exclusively for you, or provide you
-with facilities for running those works, provided that you comply with
-the terms of this License in conveying all material for which you do
-not control copyright. Those thus making or running the covered works
-for you must do so exclusively on your behalf, under your direction
-and control, on terms that prohibit them from making any copies of
-your copyrighted material outside their relationship with you.
-
- Conveying under any other circumstances is permitted solely under
-the conditions stated below. Sublicensing is not allowed; section 10
-makes it unnecessary.
-
- 3. Protecting Users' Legal Rights From Anti-Circumvention Law.
-
- No covered work shall be deemed part of an effective technological
-measure under any applicable law fulfilling obligations under article
-11 of the WIPO copyright treaty adopted on 20 December 1996, or
-similar laws prohibiting or restricting circumvention of such
-measures.
-
- When you convey a covered work, you waive any legal power to forbid
-circumvention of technological measures to the extent such circumvention
-is effected by exercising rights under this License with respect to
-the covered work, and you disclaim any intention to limit operation or
-modification of the work as a means of enforcing, against the work's
-users, your or third parties' legal rights to forbid circumvention of
-technological measures.
-
- 4. Conveying Verbatim Copies.
-
- You may convey verbatim copies of the Program's source code as you
-receive it, in any medium, provided that you conspicuously and
-appropriately publish on each copy an appropriate copyright notice;
-keep intact all notices stating that this License and any
-non-permissive terms added in accord with section 7 apply to the code;
-keep intact all notices of the absence of any warranty; and give all
-recipients a copy of this License along with the Program.
-
- You may charge any price or no price for each copy that you convey,
-and you may offer support or warranty protection for a fee.
-
- 5. Conveying Modified Source Versions.
-
- You may convey a work based on the Program, or the modifications to
-produce it from the Program, in the form of source code under the
-terms of section 4, provided that you also meet all of these conditions:
-
- a) The work must carry prominent notices stating that you modified
- it, and giving a relevant date.
-
- b) The work must carry prominent notices stating that it is
- released under this License and any conditions added under section
- 7. This requirement modifies the requirement in section 4 to
- "keep intact all notices".
-
- c) You must license the entire work, as a whole, under this
- License to anyone who comes into possession of a copy. This
- License will therefore apply, along with any applicable section 7
- additional terms, to the whole of the work, and all its parts,
- regardless of how they are packaged. This License gives no
- permission to license the work in any other way, but it does not
- invalidate such permission if you have separately received it.
-
- d) If the work has interactive user interfaces, each must display
- Appropriate Legal Notices; however, if the Program has interactive
- interfaces that do not display Appropriate Legal Notices, your
- work need not make them do so.
-
- A compilation of a covered work with other separate and independent
-works, which are not by their nature extensions of the covered work,
-and which are not combined with it such as to form a larger program,
-in or on a volume of a storage or distribution medium, is called an
-"aggregate" if the compilation and its resulting copyright are not
-used to limit the access or legal rights of the compilation's users
-beyond what the individual works permit. Inclusion of a covered work
-in an aggregate does not cause this License to apply to the other
-parts of the aggregate.
-
- 6. Conveying Non-Source Forms.
-
- You may convey a covered work in object code form under the terms
-of sections 4 and 5, provided that you also convey the
-machine-readable Corresponding Source under the terms of this License,
-in one of these ways:
-
- a) Convey the object code in, or embodied in, a physical product
- (including a physical distribution medium), accompanied by the
- Corresponding Source fixed on a durable physical medium
- customarily used for software interchange.
-
- b) Convey the object code in, or embodied in, a physical product
- (including a physical distribution medium), accompanied by a
- written offer, valid for at least three years and valid for as
- long as you offer spare parts or customer support for that product
- model, to give anyone who possesses the object code either (1) a
- copy of the Corresponding Source for all the software in the
- product that is covered by this License, on a durable physical
- medium customarily used for software interchange, for a price no
- more than your reasonable cost of physically performing this
- conveying of source, or (2) access to copy the
- Corresponding Source from a network server at no charge.
-
- c) Convey individual copies of the object code with a copy of the
- written offer to provide the Corresponding Source. This
- alternative is allowed only occasionally and noncommercially, and
- only if you received the object code with such an offer, in accord
- with subsection 6b.
-
- d) Convey the object code by offering access from a designated
- place (gratis or for a charge), and offer equivalent access to the
- Corresponding Source in the same way through the same place at no
- further charge. You need not require recipients to copy the
- Corresponding Source along with the object code. If the place to
- copy the object code is a network server, the Corresponding Source
- may be on a different server (operated by you or a third party)
- that supports equivalent copying facilities, provided you maintain
- clear directions next to the object code saying where to find the
- Corresponding Source. Regardless of what server hosts the
- Corresponding Source, you remain obligated to ensure that it is
- available for as long as needed to satisfy these requirements.
-
- e) Convey the object code using peer-to-peer transmission, provided
- you inform other peers where the object code and Corresponding
- Source of the work are being offered to the general public at no
- charge under subsection 6d.
-
- A separable portion of the object code, whose source code is excluded
-from the Corresponding Source as a System Library, need not be
-included in conveying the object code work.
-
- A "User Product" is either (1) a "consumer product", which means any
-tangible personal property which is normally used for personal, family,
-or household purposes, or (2) anything designed or sold for incorporation
-into a dwelling. In determining whether a product is a consumer product,
-doubtful cases shall be resolved in favor of coverage. For a particular
-product received by a particular user, "normally used" refers to a
-typical or common use of that class of product, regardless of the status
-of the particular user or of the way in which the particular user
-actually uses, or expects or is expected to use, the product. A product
-is a consumer product regardless of whether the product has substantial
-commercial, industrial or non-consumer uses, unless such uses represent
-the only significant mode of use of the product.
-
- "Installation Information" for a User Product means any methods,
-procedures, authorization keys, or other information required to install
-and execute modified versions of a covered work in that User Product from
-a modified version of its Corresponding Source. The information must
-suffice to ensure that the continued functioning of the modified object
-code is in no case prevented or interfered with solely because
-modification has been made.
-
- If you convey an object code work under this section in, or with, or
-specifically for use in, a User Product, and the conveying occurs as
-part of a transaction in which the right of possession and use of the
-User Product is transferred to the recipient in perpetuity or for a
-fixed term (regardless of how the transaction is characterized), the
-Corresponding Source conveyed under this section must be accompanied
-by the Installation Information. But this requirement does not apply
-if neither you nor any third party retains the ability to install
-modified object code on the User Product (for example, the work has
-been installed in ROM).
-
- The requirement to provide Installation Information does not include a
-requirement to continue to provide support service, warranty, or updates
-for a work that has been modified or installed by the recipient, or for
-the User Product in which it has been modified or installed. Access to a
-network may be denied when the modification itself materially and
-adversely affects the operation of the network or violates the rules and
-protocols for communication across the network.
-
- Corresponding Source conveyed, and Installation Information provided,
-in accord with this section must be in a format that is publicly
-documented (and with an implementation available to the public in
-source code form), and must require no special password or key for
-unpacking, reading or copying.
-
- 7. Additional Terms.
-
- "Additional permissions" are terms that supplement the terms of this
-License by making exceptions from one or more of its conditions.
-Additional permissions that are applicable to the entire Program shall
-be treated as though they were included in this License, to the extent
-that they are valid under applicable law. If additional permissions
-apply only to part of the Program, that part may be used separately
-under those permissions, but the entire Program remains governed by
-this License without regard to the additional permissions.
-
- When you convey a copy of a covered work, you may at your option
-remove any additional permissions from that copy, or from any part of
-it. (Additional permissions may be written to require their own
-removal in certain cases when you modify the work.) You may place
-additional permissions on material, added by you to a covered work,
-for which you have or can give appropriate copyright permission.
-
- Notwithstanding any other provision of this License, for material you
-add to a covered work, you may (if authorized by the copyright holders of
-that material) supplement the terms of this License with terms:
-
- a) Disclaiming warranty or limiting liability differently from the
- terms of sections 15 and 16 of this License; or
-
- b) Requiring preservation of specified reasonable legal notices or
- author attributions in that material or in the Appropriate Legal
- Notices displayed by works containing it; or
-
- c) Prohibiting misrepresentation of the origin of that material, or
- requiring that modified versions of such material be marked in
- reasonable ways as different from the original version; or
-
- d) Limiting the use for publicity purposes of names of licensors or
- authors of the material; or
-
- e) Declining to grant rights under trademark law for use of some
- trade names, trademarks, or service marks; or
-
- f) Requiring indemnification of licensors and authors of that
- material by anyone who conveys the material (or modified versions of
- it) with contractual assumptions of liability to the recipient, for
- any liability that these contractual assumptions directly impose on
- those licensors and authors.
-
- All other non-permissive additional terms are considered "further
-restrictions" within the meaning of section 10. If the Program as you
-received it, or any part of it, contains a notice stating that it is
-governed by this License along with a term that is a further
-restriction, you may remove that term. If a license document contains
-a further restriction but permits relicensing or conveying under this
-License, you may add to a covered work material governed by the terms
-of that license document, provided that the further restriction does
-not survive such relicensing or conveying.
-
- If you add terms to a covered work in accord with this section, you
-must place, in the relevant source files, a statement of the
-additional terms that apply to those files, or a notice indicating
-where to find the applicable terms.
-
- Additional terms, permissive or non-permissive, may be stated in the
-form of a separately written license, or stated as exceptions;
-the above requirements apply either way.
-
- 8. Termination.
-
- You may not propagate or modify a covered work except as expressly
-provided under this License. Any attempt otherwise to propagate or
-modify it is void, and will automatically terminate your rights under
-this License (including any patent licenses granted under the third
-paragraph of section 11).
-
- However, if you cease all violation of this License, then your
-license from a particular copyright holder is reinstated (a)
-provisionally, unless and until the copyright holder explicitly and
-finally terminates your license, and (b) permanently, if the copyright
-holder fails to notify you of the violation by some reasonable means
-prior to 60 days after the cessation.
-
- Moreover, your license from a particular copyright holder is
-reinstated permanently if the copyright holder notifies you of the
-violation by some reasonable means, this is the first time you have
-received notice of violation of this License (for any work) from that
-copyright holder, and you cure the violation prior to 30 days after
-your receipt of the notice.
-
- Termination of your rights under this section does not terminate the
-licenses of parties who have received copies or rights from you under
-this License. If your rights have been terminated and not permanently
-reinstated, you do not qualify to receive new licenses for the same
-material under section 10.
-
- 9. Acceptance Not Required for Having Copies.
-
- You are not required to accept this License in order to receive or
-run a copy of the Program. Ancillary propagation of a covered work
-occurring solely as a consequence of using peer-to-peer transmission
-to receive a copy likewise does not require acceptance. However,
-nothing other than this License grants you permission to propagate or
-modify any covered work. These actions infringe copyright if you do
-not accept this License. Therefore, by modifying or propagating a
-covered work, you indicate your acceptance of this License to do so.
-
- 10. Automatic Licensing of Downstream Recipients.
-
- Each time you convey a covered work, the recipient automatically
-receives a license from the original licensors, to run, modify and
-propagate that work, subject to this License. You are not responsible
-for enforcing compliance by third parties with this License.
-
- An "entity transaction" is a transaction transferring control of an
-organization, or substantially all assets of one, or subdividing an
-organization, or merging organizations. If propagation of a covered
-work results from an entity transaction, each party to that
-transaction who receives a copy of the work also receives whatever
-licenses to the work the party's predecessor in interest had or could
-give under the previous paragraph, plus a right to possession of the
-Corresponding Source of the work from the predecessor in interest, if
-the predecessor has it or can get it with reasonable efforts.
-
- You may not impose any further restrictions on the exercise of the
-rights granted or affirmed under this License. For example, you may
-not impose a license fee, royalty, or other charge for exercise of
-rights granted under this License, and you may not initiate litigation
-(including a cross-claim or counterclaim in a lawsuit) alleging that
-any patent claim is infringed by making, using, selling, offering for
-sale, or importing the Program or any portion of it.
-
- 11. Patents.
-
- A "contributor" is a copyright holder who authorizes use under this
-License of the Program or a work on which the Program is based. The
-work thus licensed is called the contributor's "contributor version".
-
- A contributor's "essential patent claims" are all patent claims
-owned or controlled by the contributor, whether already acquired or
-hereafter acquired, that would be infringed by some manner, permitted
-by this License, of making, using, or selling its contributor version,
-but do not include claims that would be infringed only as a
-consequence of further modification of the contributor version. For
-purposes of this definition, "control" includes the right to grant
-patent sublicenses in a manner consistent with the requirements of
-this License.
-
- Each contributor grants you a non-exclusive, worldwide, royalty-free
-patent license under the contributor's essential patent claims, to
-make, use, sell, offer for sale, import and otherwise run, modify and
-propagate the contents of its contributor version.
-
- In the following three paragraphs, a "patent license" is any express
-agreement or commitment, however denominated, not to enforce a patent
-(such as an express permission to practice a patent or covenant not to
-sue for patent infringement). To "grant" such a patent license to a
-party means to make such an agreement or commitment not to enforce a
-patent against the party.
-
- If you convey a covered work, knowingly relying on a patent license,
-and the Corresponding Source of the work is not available for anyone
-to copy, free of charge and under the terms of this License, through a
-publicly available network server or other readily accessible means,
-then you must either (1) cause the Corresponding Source to be so
-available, or (2) arrange to deprive yourself of the benefit of the
-patent license for this particular work, or (3) arrange, in a manner
-consistent with the requirements of this License, to extend the patent
-license to downstream recipients. "Knowingly relying" means you have
-actual knowledge that, but for the patent license, your conveying the
-covered work in a country, or your recipient's use of the covered work
-in a country, would infringe one or more identifiable patents in that
-country that you have reason to believe are valid.
-
- If, pursuant to or in connection with a single transaction or
-arrangement, you convey, or propagate by procuring conveyance of, a
-covered work, and grant a patent license to some of the parties
-receiving the covered work authorizing them to use, propagate, modify
-or convey a specific copy of the covered work, then the patent license
-you grant is automatically extended to all recipients of the covered
-work and works based on it.
-
- A patent license is "discriminatory" if it does not include within
-the scope of its coverage, prohibits the exercise of, or is
-conditioned on the non-exercise of one or more of the rights that are
-specifically granted under this License. You may not convey a covered
-work if you are a party to an arrangement with a third party that is
-in the business of distributing software, under which you make payment
-to the third party based on the extent of your activity of conveying
-the work, and under which the third party grants, to any of the
-parties who would receive the covered work from you, a discriminatory
-patent license (a) in connection with copies of the covered work
-conveyed by you (or copies made from those copies), or (b) primarily
-for and in connection with specific products or compilations that
-contain the covered work, unless you entered into that arrangement,
-or that patent license was granted, prior to 28 March 2007.
-
- Nothing in this License shall be construed as excluding or limiting
-any implied license or other defenses to infringement that may
-otherwise be available to you under applicable patent law.
-
- 12. No Surrender of Others' Freedom.
-
- If conditions are imposed on you (whether by court order, agreement or
-otherwise) that contradict the conditions of this License, they do not
-excuse you from the conditions of this License. If you cannot convey a
-covered work so as to satisfy simultaneously your obligations under this
-License and any other pertinent obligations, then as a consequence you may
-not convey it at all. For example, if you agree to terms that obligate you
-to collect a royalty for further conveying from those to whom you convey
-the Program, the only way you could satisfy both those terms and this
-License would be to refrain entirely from conveying the Program.
-
- 13. Use with the GNU Affero General Public License.
-
- Notwithstanding any other provision of this License, you have
-permission to link or combine any covered work with a work licensed
-under version 3 of the GNU Affero General Public License into a single
-combined work, and to convey the resulting work. The terms of this
-License will continue to apply to the part which is the covered work,
-but the special requirements of the GNU Affero General Public License,
-section 13, concerning interaction through a network will apply to the
-combination as such.
-
- 14. Revised Versions of this License.
-
- The Free Software Foundation may publish revised and/or new versions of
-the GNU General Public License from time to time. Such new versions will
-be similar in spirit to the present version, but may differ in detail to
-address new problems or concerns.
-
- Each version is given a distinguishing version number. If the
-Program specifies that a certain numbered version of the GNU General
-Public License "or any later version" applies to it, you have the
-option of following the terms and conditions either of that numbered
-version or of any later version published by the Free Software
-Foundation. If the Program does not specify a version number of the
-GNU General Public License, you may choose any version ever published
-by the Free Software Foundation.
-
- If the Program specifies that a proxy can decide which future
-versions of the GNU General Public License can be used, that proxy's
-public statement of acceptance of a version permanently authorizes you
-to choose that version for the Program.
-
- Later license versions may give you additional or different
-permissions. However, no additional obligations are imposed on any
-author or copyright holder as a result of your choosing to follow a
-later version.
-
- 15. Disclaimer of Warranty.
-
- THERE IS NO WARRANTY FOR THE PROGRAM, TO THE EXTENT PERMITTED BY
-APPLICABLE LAW. EXCEPT WHEN OTHERWISE STATED IN WRITING THE COPYRIGHT
-HOLDERS AND/OR OTHER PARTIES PROVIDE THE PROGRAM "AS IS" WITHOUT WARRANTY
-OF ANY KIND, EITHER EXPRESSED OR IMPLIED, INCLUDING, BUT NOT LIMITED TO,
-THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
-PURPOSE. THE ENTIRE RISK AS TO THE QUALITY AND PERFORMANCE OF THE PROGRAM
-IS WITH YOU. SHOULD THE PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF
-ALL NECESSARY SERVICING, REPAIR OR CORRECTION.
-
- 16. Limitation of Liability.
-
- IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN WRITING
-WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MODIFIES AND/OR CONVEYS
-THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU FOR DAMAGES, INCLUDING ANY
-GENERAL, SPECIAL, INCIDENTAL OR CONSEQUENTIAL DAMAGES ARISING OUT OF THE
-USE OR INABILITY TO USE THE PROGRAM (INCLUDING BUT NOT LIMITED TO LOSS OF
-DATA OR DATA BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY YOU OR THIRD
-PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER PROGRAMS),
-EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE POSSIBILITY OF
-SUCH DAMAGES.
-
- 17. Interpretation of Sections 15 and 16.
-
- If the disclaimer of warranty and limitation of liability provided
-above cannot be given local legal effect according to their terms,
-reviewing courts shall apply local law that most closely approximates
-an absolute waiver of all civil liability in connection with the
-Program, unless a warranty or assumption of liability accompanies a
-copy of the Program in return for a fee.
-
- END OF TERMS AND CONDITIONS
-
- How to Apply These Terms to Your New Programs
-
- If you develop a new program, and you want it to be of the greatest
-possible use to the public, the best way to achieve this is to make it
-free software which everyone can redistribute and change under these terms.
-
- To do so, attach the following notices to the program. It is safest
-to attach them to the start of each source file to most effectively
-state the exclusion of warranty; and each file should have at least
-the "copyright" line and a pointer to where the full notice is found.
-
- <one line to give the program's name and a brief idea of what it does.>
- Copyright (C) <year> <name of author>
-
- This program is free software: you can redistribute it and/or modify
- it under the terms of the GNU General Public License as published by
- the Free Software Foundation, either version 3 of the License, or
- (at your option) any later version.
-
- This program is distributed in the hope that it will be useful,
- but WITHOUT ANY WARRANTY; without even the implied warranty of
- MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
- GNU General Public License for more details.
-
- You should have received a copy of the GNU General Public License
- along with this program. If not, see <http://www.gnu.org/licenses/>.
-
-Also add information on how to contact you by electronic and paper mail.
-
- If the program does terminal interaction, make it output a short
-notice like this when it starts in an interactive mode:
-
- <program> Copyright (C) <year> <name of author>
- This program comes with ABSOLUTELY NO WARRANTY; for details type `show w'.
- This is free software, and you are welcome to redistribute it
- under certain conditions; type `show c' for details.
-
-The hypothetical commands `show w' and `show c' should show the appropriate
-parts of the General Public License. Of course, your program's commands
-might be different; for a GUI interface, you would use an "about box".
-
- You should also get your employer (if you work as a programmer) or school,
-if any, to sign a "copyright disclaimer" for the program, if necessary.
-For more information on this, and how to apply and follow the GNU GPL, see
-<http://www.gnu.org/licenses/>.
-
- The GNU General Public License does not permit incorporating your program
-into proprietary programs. If your program is a subroutine library, you
-may consider it more useful to permit linking proprietary applications with
-the library. If this is what you want to do, use the GNU Lesser General
-Public License instead of this License. But first, please read
-<http://www.gnu.org/philosophy/why-not-lgpl.html>.
=====================================
examples/standalone/epochtest/ChangeLog deleted
=====================================
--- a/examples/standalone/epochtest/ChangeLog
+++ /dev/null
=====================================
examples/standalone/epochtest/INSTALL deleted
=====================================
--- a/examples/standalone/epochtest/INSTALL
+++ /dev/null
@@ -1,365 +0,0 @@
-Installation Instructions
-*************************
-
-Copyright (C) 1994, 1995, 1996, 1999, 2000, 2001, 2002, 2004, 2005,
-2006, 2007, 2008, 2009 Free Software Foundation, Inc.
-
- Copying and distribution of this file, with or without modification,
-are permitted in any medium without royalty provided the copyright
-notice and this notice are preserved. This file is offered as-is,
-without warranty of any kind.
-
-Basic Installation
-==================
-
- Briefly, the shell commands `./configure; make; make install' should
-configure, build, and install this package. The following
-more-detailed instructions are generic; see the `README' file for
-instructions specific to this package. Some packages provide this
-`INSTALL' file but do not implement all of the features documented
-below. The lack of an optional feature in a given package is not
-necessarily a bug. More recommendations for GNU packages can be found
-in *note Makefile Conventions: (standards)Makefile Conventions.
-
- The `configure' shell script attempts to guess correct values for
-various system-dependent variables used during compilation. It uses
-those values to create a `Makefile' in each directory of the package.
-It may also create one or more `.h' files containing system-dependent
-definitions. Finally, it creates a shell script `config.status' that
-you can run in the future to recreate the current configuration, and a
-file `config.log' containing compiler output (useful mainly for
-debugging `configure').
-
- It can also use an optional file (typically called `config.cache'
-and enabled with `--cache-file=config.cache' or simply `-C') that saves
-the results of its tests to speed up reconfiguring. Caching is
-disabled by default to prevent problems with accidental use of stale
-cache files.
-
- If you need to do unusual things to compile the package, please try
-to figure out how `configure' could check whether to do them, and mail
-diffs or instructions to the address given in the `README' so they can
-be considered for the next release. If you are using the cache, and at
-some point `config.cache' contains results you don't want to keep, you
-may remove or edit it.
-
- The file `configure.ac' (or `configure.in') is used to create
-`configure' by a program called `autoconf'. You need `configure.ac' if
-you want to change it or regenerate `configure' using a newer version
-of `autoconf'.
-
- The simplest way to compile this package is:
-
- 1. `cd' to the directory containing the package's source code and type
- `./configure' to configure the package for your system.
-
- Running `configure' might take a while. While running, it prints
- some messages telling which features it is checking for.
-
- 2. Type `make' to compile the package.
-
- 3. Optionally, type `make check' to run any self-tests that come with
- the package, generally using the just-built uninstalled binaries.
-
- 4. Type `make install' to install the programs and any data files and
- documentation. When installing into a prefix owned by root, it is
- recommended that the package be configured and built as a regular
- user, and only the `make install' phase executed with root
- privileges.
-
- 5. Optionally, type `make installcheck' to repeat any self-tests, but
- this time using the binaries in their final installed location.
- This target does not install anything. Running this target as a
- regular user, particularly if the prior `make install' required
- root privileges, verifies that the installation completed
- correctly.
-
- 6. You can remove the program binaries and object files from the
- source code directory by typing `make clean'. To also remove the
- files that `configure' created (so you can compile the package for
- a different kind of computer), type `make distclean'. There is
- also a `make maintainer-clean' target, but that is intended mainly
- for the package's developers. If you use it, you may have to get
- all sorts of other programs in order to regenerate files that came
- with the distribution.
-
- 7. Often, you can also type `make uninstall' to remove the installed
- files again. In practice, not all packages have tested that
- uninstallation works correctly, even though it is required by the
- GNU Coding Standards.
-
- 8. Some packages, particularly those that use Automake, provide `make
- distcheck', which can by used by developers to test that all other
- targets like `make install' and `make uninstall' work correctly.
- This target is generally not run by end users.
-
-Compilers and Options
-=====================
-
- Some systems require unusual options for compilation or linking that
-the `configure' script does not know about. Run `./configure --help'
-for details on some of the pertinent environment variables.
-
- You can give `configure' initial values for configuration parameters
-by setting variables in the command line or in the environment. Here
-is an example:
-
- ./configure CC=c99 CFLAGS=-g LIBS=-lposix
-
- *Note Defining Variables::, for more details.
-
-Compiling For Multiple Architectures
-====================================
-
- You can compile the package for more than one kind of computer at the
-same time, by placing the object files for each architecture in their
-own directory. To do this, you can use GNU `make'. `cd' to the
-directory where you want the object files and executables to go and run
-the `configure' script. `configure' automatically checks for the
-source code in the directory that `configure' is in and in `..'. This
-is known as a "VPATH" build.
-
- With a non-GNU `make', it is safer to compile the package for one
-architecture at a time in the source code directory. After you have
-installed the package for one architecture, use `make distclean' before
-reconfiguring for another architecture.
-
- On MacOS X 10.5 and later systems, you can create libraries and
-executables that work on multiple system types--known as "fat" or
-"universal" binaries--by specifying multiple `-arch' options to the
-compiler but only a single `-arch' option to the preprocessor. Like
-this:
-
- ./configure CC="gcc -arch i386 -arch x86_64 -arch ppc -arch ppc64" \
- CXX="g++ -arch i386 -arch x86_64 -arch ppc -arch ppc64" \
- CPP="gcc -E" CXXCPP="g++ -E"
-
- This is not guaranteed to produce working output in all cases, you
-may have to build one architecture at a time and combine the results
-using the `lipo' tool if you have problems.
-
-Installation Names
-==================
-
- By default, `make install' installs the package's commands under
-`/usr/local/bin', include files under `/usr/local/include', etc. You
-can specify an installation prefix other than `/usr/local' by giving
-`configure' the option `--prefix=PREFIX', where PREFIX must be an
-absolute file name.
-
- You can specify separate installation prefixes for
-architecture-specific files and architecture-independent files. If you
-pass the option `--exec-prefix=PREFIX' to `configure', the package uses
-PREFIX as the prefix for installing programs and libraries.
-Documentation and other data files still use the regular prefix.
-
- In addition, if you use an unusual directory layout you can give
-options like `--bindir=DIR' to specify different values for particular
-kinds of files. Run `configure --help' for a list of the directories
-you can set and what kinds of files go in them. In general, the
-default for these options is expressed in terms of `${prefix}', so that
-specifying just `--prefix' will affect all of the other directory
-specifications that were not explicitly provided.
-
- The most portable way to affect installation locations is to pass the
-correct locations to `configure'; however, many packages provide one or
-both of the following shortcuts of passing variable assignments to the
-`make install' command line to change installation locations without
-having to reconfigure or recompile.
-
- The first method involves providing an override variable for each
-affected directory. For example, `make install
-prefix=/alternate/directory' will choose an alternate location for all
-directory configuration variables that were expressed in terms of
-`${prefix}'. Any directories that were specified during `configure',
-but not in terms of `${prefix}', must each be overridden at install
-time for the entire installation to be relocated. The approach of
-makefile variable overrides for each directory variable is required by
-the GNU Coding Standards, and ideally causes no recompilation.
-However, some platforms have known limitations with the semantics of
-shared libraries that end up requiring recompilation when using this
-method, particularly noticeable in packages that use GNU Libtool.
-
- The second method involves providing the `DESTDIR' variable. For
-example, `make install DESTDIR=/alternate/directory' will prepend
-`/alternate/directory' before all installation names. The approach of
-`DESTDIR' overrides is not required by the GNU Coding Standards, and
-does not work on platforms that have drive letters. On the other hand,
-it does better at avoiding recompilation issues, and works well even
-when some directory options were not specified in terms of `${prefix}'
-at `configure' time.
-
-Optional Features
-=================
-
- If the package supports it, you can cause programs to be installed
-with an extra prefix or suffix on their names by giving `configure' the
-option `--program-prefix=PREFIX' or `--program-suffix=SUFFIX'.
-
- Some packages pay attention to `--enable-FEATURE' options to
-`configure', where FEATURE indicates an optional part of the package.
-They may also pay attention to `--with-PACKAGE' options, where PACKAGE
-is something like `gnu-as' or `x' (for the X Window System). The
-`README' should mention any `--enable-' and `--with-' options that the
-package recognizes.
-
- For packages that use the X Window System, `configure' can usually
-find the X include and library files automatically, but if it doesn't,
-you can use the `configure' options `--x-includes=DIR' and
-`--x-libraries=DIR' to specify their locations.
-
- Some packages offer the ability to configure how verbose the
-execution of `make' will be. For these packages, running `./configure
---enable-silent-rules' sets the default to minimal output, which can be
-overridden with `make V=1'; while running `./configure
---disable-silent-rules' sets the default to verbose, which can be
-overridden with `make V=0'.
-
-Particular systems
-==================
-
- On HP-UX, the default C compiler is not ANSI C compatible. If GNU
-CC is not installed, it is recommended to use the following options in
-order to use an ANSI C compiler:
-
- ./configure CC="cc -Ae -D_XOPEN_SOURCE=500"
-
-and if that doesn't work, install pre-built binaries of GCC for HP-UX.
-
- On OSF/1 a.k.a. Tru64, some versions of the default C compiler cannot
-parse its `<wchar.h>' header file. The option `-nodtk' can be used as
-a workaround. If GNU CC is not installed, it is therefore recommended
-to try
-
- ./configure CC="cc"
-
-and if that doesn't work, try
-
- ./configure CC="cc -nodtk"
-
- On Solaris, don't put `/usr/ucb' early in your `PATH'. This
-directory contains several dysfunctional programs; working variants of
-these programs are available in `/usr/bin'. So, if you need `/usr/ucb'
-in your `PATH', put it _after_ `/usr/bin'.
-
- On Haiku, software installed for all users goes in `/boot/common',
-not `/usr/local'. It is recommended to use the following options:
-
- ./configure --prefix=/boot/common
-
-Specifying the System Type
-==========================
-
- There may be some features `configure' cannot figure out
-automatically, but needs to determine by the type of machine the package
-will run on. Usually, assuming the package is built to be run on the
-_same_ architectures, `configure' can figure that out, but if it prints
-a message saying it cannot guess the machine type, give it the
-`--build=TYPE' option. TYPE can either be a short name for the system
-type, such as `sun4', or a canonical name which has the form:
-
- CPU-COMPANY-SYSTEM
-
-where SYSTEM can have one of these forms:
-
- OS
- KERNEL-OS
-
- See the file `config.sub' for the possible values of each field. If
-`config.sub' isn't included in this package, then this package doesn't
-need to know the machine type.
-
- If you are _building_ compiler tools for cross-compiling, you should
-use the option `--target=TYPE' to select the type of system they will
-produce code for.
-
- If you want to _use_ a cross compiler, that generates code for a
-platform different from the build platform, you should specify the
-"host" platform (i.e., that on which the generated programs will
-eventually be run) with `--host=TYPE'.
-
-Sharing Defaults
-================
-
- If you want to set default values for `configure' scripts to share,
-you can create a site shell script called `config.site' that gives
-default values for variables like `CC', `cache_file', and `prefix'.
-`configure' looks for `PREFIX/share/config.site' if it exists, then
-`PREFIX/etc/config.site' if it exists. Or, you can set the
-`CONFIG_SITE' environment variable to the location of the site script.
-A warning: not all `configure' scripts look for a site script.
-
-Defining Variables
-==================
-
- Variables not defined in a site shell script can be set in the
-environment passed to `configure'. However, some packages may run
-configure again during the build, and the customized values of these
-variables may be lost. In order to avoid this problem, you should set
-them in the `configure' command line, using `VAR=value'. For example:
-
- ./configure CC=/usr/local2/bin/gcc
-
-causes the specified `gcc' to be used as the C compiler (unless it is
-overridden in the site shell script).
-
-Unfortunately, this technique does not work for `CONFIG_SHELL' due to
-an Autoconf bug. Until the bug is fixed you can use this workaround:
-
- CONFIG_SHELL=/bin/bash /bin/bash ./configure CONFIG_SHELL=/bin/bash
-
-`configure' Invocation
-======================
-
- `configure' recognizes the following options to control how it
-operates.
-
-`--help'
-`-h'
- Print a summary of all of the options to `configure', and exit.
-
-`--help=short'
-`--help=recursive'
- Print a summary of the options unique to this package's
- `configure', and exit. The `short' variant lists options used
- only in the top level, while the `recursive' variant lists options
- also present in any nested packages.
-
-`--version'
-`-V'
- Print the version of Autoconf used to generate the `configure'
- script, and exit.
-
-`--cache-file=FILE'
- Enable the cache: use and save the results of the tests in FILE,
- traditionally `config.cache'. FILE defaults to `/dev/null' to
- disable caching.
-
-`--config-cache'
-`-C'
- Alias for `--cache-file=config.cache'.
-
-`--quiet'
-`--silent'
-`-q'
- Do not print messages saying which checks are being made. To
- suppress all normal output, redirect it to `/dev/null' (any error
- messages will still be shown).
-
-`--srcdir=DIR'
- Look for the package's source code in directory DIR. Usually
- `configure' can determine that directory automatically.
-
-`--prefix=DIR'
- Use DIR as the installation prefix. *note Installation Names::
- for more details, including other options available for fine-tuning
- the installation locations.
-
-`--no-create'
-`-n'
- Run the configure checks, but stop before creating any output
- files.
-
-`configure' also accepts some other, not widely useful, options. Run
-`configure --help' for more details.
-
=====================================
examples/standalone/epochtest/Makefile.am deleted
=====================================
--- a/examples/standalone/epochtest/Makefile.am
+++ /dev/null
@@ -1,9 +0,0 @@
-AUTOMAKE_OPTIONS = subdir-objects
-ACLOCAL_AMFLAGS = ${ACLOCAL_FLAGS}
-
-bin_PROGRAMS = epochtest
-epochtest_SOURCES = src/epochtest.cpp
-epochtest_CXXFLAGS = $(DEPS_CFLAGS)
-epochtest_LDADD = $(DEPS_LIBS)
-
-dist_noinst_SCRIPTS = autogen.sh
=====================================
examples/standalone/epochtest/NEWS deleted
=====================================
--- a/examples/standalone/epochtest/NEWS
+++ /dev/null
=====================================
examples/standalone/epochtest/README deleted
=====================================
--- a/examples/standalone/epochtest/README
+++ /dev/null
@@ -1,7 +0,0 @@
-To start editing as Eclipse project:
-
-(1)./autoconf.sh
-(2)./configure
-(3) Import to Your workspace as an existing Eclipse project
-
-
=====================================
examples/standalone/epochtest/autogen.sh deleted
=====================================
--- a/examples/standalone/epochtest/autogen.sh
+++ /dev/null
@@ -1,3 +0,0 @@
-#!/bin/sh
-mkdir -p .config
-autoreconf --force --install -I .config
=====================================
examples/standalone/epochtest/check_lnL_using_BEAST.xml deleted
=====================================
--- a/examples/standalone/epochtest/check_lnL_using_BEAST.xml
+++ /dev/null
@@ -1,143 +0,0 @@
-<?xml version="1.0" standalone="yes"?>
-<!-- Tests the tree likelihood -->
-
-<beast>
-
- <!-- The list of taxa analyse (can also include dates/ages). -->
- <!-- ntax=3 -->
- <taxa id="taxa1">
- <taxon id="SimSeq1">
- <date value="1994" direction="forwards" units="years"/>
- </taxon>
-
- <taxon id="SimSeq2">
- <date value="1964" direction="forwards" units="years"/>
- </taxon>
-
- <taxon id="SimSeq3">
- <date value="1984" direction="forwards" units="years"/>
- </taxon>
- </taxa>
-
- <!-- The sequence alignment (each sequence refers to a taxon above). -->
- <!-- ntax=3 nchar=1000 -->
- <alignment id="alignment" dataType="nucleotide">
-
- <sequence>
- <taxon idref="SimSeq1"/>
- TCAAGTGAGGTACACACGATTCATAAGATACCGAGAGGGACGTGGGATCATGTCCGTTGGAGGCATGCTCAACTGGCGTAAGTGGTAAACTGGATGTCTCTAGTAGTGGGCAAGCGTCGTGAGGCGCAAAAGTACTTGTGGTAAGGACCAGAGATGCACAGGCTATCTTCTTTAATCTAATGCGATACTCGTTGAAGTCTATCTTTGAGATAGCTAAGATCACATAGGGACTTTGATAGCCAACAGTGTGCATGGCACTGTAATAATTTTTTGGCAGACCACACTTGGGTGGGGAGAGTAGAGAAAGTGAATCGATGAGCAGGTTCCGCGGCTGGGGGGGTTAGGGATATCACAAGATTGTCTCTTAAACACGGGGTTTAGGGTTACTTACAAGAAGATGAATGCCGGAGCAGGGGGTCATCTTAAGGAATCGGGGAATTTGTCCTCGGGCAAGAATTGACACCTGCCTCATTATTATTCATGAGACTACAAAAAGGGGATAGTTGAATTACATTAGCGCGCGGTCGAACTCCGACTGAAAATAATAAGCGTAAATGGAACCCAGCCACAGTGACTGGTAAGCAAATGTTTAGTTTAAACAACCAGGGTAATGGTGCATTTCAGAAACTGGGGACAAGTCGATTACGGCGGTTGATTACCGGGTCCTGTTAGGTGTAGGGAGCCCATCTACTGGCACATTTTTTTGTGCGTATCGACGGGGACCCAGTGAAAAGGAGTAACTGATAAAGTACAGTGAATGAATAATGTAAAAGCGGGACGAGTAAAAGCATACATAGTGCGTGAAAGGTGTCAGTTTACCTACCTGGGACAATCTCTGTACGTGAGTAAGTTTGGATCCAGCGGAAAACCACAGGTGAGAGGGCTTCTGAAACGCATGCCCGATTAGATAACTGATAATGTAAACCAGGACGCTTCAGCTGTGAATGCCTGTATAAAATCCCTGGGTTTTCAGGAATGGAAATAACGCTGACCAGCTATT
- </sequence>
-
- <sequence>
- <taxon idref="SimSeq2"/>
- ATAAAAAAGGGGTGCAAAAGAACACGTGCAATTAAAATAAGGCCGGTCGATGTATAAGGTTACATCGCCAGTGAGTTATCTGGATCAATCTTGTTTCTTCTTAGAAAACGAAACATCTAAAGAGTTCATTGAGGAGTATGGCGGAGTTTATGGGATGGTTCTCGATCTTCTGCAGACACGAGAAGCAGCAGCAAAACTATATGATCAAGCGAATGAAGATAAAATTGGGGATTGATCAATGGGGGCTGCATACGGACTTGCACCATAGTAAGCAGCTAACGTGTCATAATAATGGTGATTAGAAGAGTAGGTTAGTGAGAATTAATAATCGGCGGAAATTGGGATTATACCTTATGCTGGCGCCGATAAGAGGTAATGAGTGACACAAATAAAGGGTAAATATAATCGGACGGAGCGTAATTCGGAGAGACTAATGGACGGGATGTAAAGTTCACACTAGGACTGTAACTGTTGGAACGTAAGAAAAAATCGAGAAGGAGCAAATGGGGTATAGGATGTACCGCAAGGTCTTACATTAAAAAGACGAAGTGGATGGCGGGTCTGAGTGAACAGGTTGTTCATTTGGGACGATGACCAGGTTATGGAACCAATAAGAAGTTATAGTAGAACAGGATAAATCCACAGAATTTCATCATGAGAGAGTTAAAATGACTATGGCGGCCCTATCTGTGGCAGAGAAACCATTAACTCGCCAGTGAATTCTCCTTGCGAGGCTGGGAGCATCAGCGTGAGACGAACAAAGATTGCATCGGTTAGATAAAACCAGTAATGCGTATCAGACCAAGTGTGTCAAAGAGTTTATTCAGAGGGCGGGACACATGGATCTAAGATCAGCTCGACCGGCGGATTCCAGTTAGTGGAGATATGCGGGGCTCTTATTGAATGGGTCCATCAGTGGTTATGGAGAAATTCGATTAACAGTAATCTTCAGGCGAGATGTGTGATCCTTTCAAACGGACAGAAGCGCGAGGTAAAATCC
- </sequence>
-
- <sequence>
- <taxon idref="SimSeq3"/>
- ACAGGGTGCGAACCCGAGAGAATTGATAAAATCCAAATGGGTATGGTGGGTATGAACAAATGAATCATAAATAAATCGTCTGCATCGAGTTTATCCCTCGTTTGATGGCGCGGAGTTCAACAACTTATTGATCAGAAAAGGGAGAATTTGTGAGACCGCAGTTCTCTTCCTACCAGAGCAGAATGCATTGACCAAGCTCCATACGCACACAAACCCCTTTGTGATCGGGAATTGATCACAAAACGTCATACAGGAAGTAGCCTCGTCATCGGCAATCAATAGAAAAAGACCACAAGGAACGGAAGGGAAGTTCAAGGAAGAATAAGAGTAGTAAGGAACGATGTGTATATTGGTAAATTACGGCAACCAGAAGCGATGAGCCGTGCGTTCATAAGACAGACGCTATGGAACGGGGCATGACCTGGAGAGACTAATGATTAGTATATAGAATCCGACCAAGCGTGGTGGCCATTCTAATATGAGGAGACGTTGAGAAAAATGAGCCAGGAAGGGTAGCATGCCAGAAAACTCTATGCAGGAAGTAATTTAGACATATCCCTTCTGGTGCAGTAATTTGCTTATCCAAGACATTGATTCGACTCTGGGGGTCACATGGTGGTCTCATGGAATGACGAGGACTCACCGGACTATACTTGAACATAGGTGAGACAATCATGACGAATTCGCCCAAGGCGGTGCTGTTATTAGTATTGGACCGGTATCGCTGCACAAATTCAAGTAGATCGTTTGGGGGAGGATTAGGGTCACCCGGAATGAGCAATTGCGTGAATAAGAAACCCACTGAACTCGGAAGATTGATAGTTTAGTGGGTCGGATCTGTACGCTCTGGCAGAGCTCAGTTAGGAGACTTCAAAAGGAAGAATCCTACGCTTCGCCTGCGAGGTTAGGCAGATATGGGGAATGAGATGTTTCAGGTGATAATAGCTTGATGACACAAAATTAAGTCATCCCAAATCAGCAGGCAAACAGAGCAGAGCAC
- </sequence>
-
- </alignment>
-
- <!-- The unique patterns for all positions -->
- <patterns id="patterns" from="1">
- <alignment idref="alignment"/>
- </patterns>
-
-<newick id="treeML" units="years">
-(SimSeq1:73.7468,(SimSeq2:25.256989999999995,SimSeq3:45.256989999999995):18.48981);
-</newick>
-
-<!-- <tree id="treeML" units="years">-->
-<!-- <node height="73.7468">-->
-<!-- <node height="0.000000">-->
-<!-- <taxon idref="SimSeq1"/>-->
-<!-- </node>-->
-<!-- <node height="55.257">-->
-<!-- <node height="30.0">-->
-<!-- <taxon idref="SimSeq2"/>-->
-<!-- </node>-->
-<!-- <node height="10.0">-->
-<!-- <taxon idref="SimSeq3"/>-->
-<!-- </node>-->
-<!-- </node>-->
-<!-- </node>-->
-<!-- </tree>-->
-
- <treeModel id="treeModel">
- <tree idref="treeML"/>
- <rootHeight>
- <parameter id="treeModel.rootHeight"/>
- </rootHeight>
- <nodeHeights internalNodes="true">
- <parameter id="treeModel.internalNodeHeights"/>
- </nodeHeights>
- <nodeHeights internalNodes="true" rootNode="true">
- <parameter id="treeModel.allInternalNodeHeights"/>
- </nodeHeights>
- </treeModel>
-
- <report>
- Newick Tree: <tree idref="treeML"/>
- </report>
-
- <frequencyModel id="freqModel" dataType="nucleotide">
-<!-- <alignment idref="alignment"/>-->
- <frequencies>
- <parameter dimension="4" value="0.25 0.25 0.25 0.25"/>
- </frequencies>
- </frequencyModel>
-
-<gtrModel id="gtr">
-<frequencies>
- <frequencyModel idref="freqModel"/>
-</frequencies>
-<rateAC>
-<parameter id="ac" value="1.0" lower="0.0" upper="Infinity"/>
-</rateAC>
-<rateAG>
-<parameter id="ag" value="1.0" lower="0.0" upper="Infinity"/>
-</rateAG>
-<rateAT>
-<parameter id="at" value="1.0" lower="0.0" upper="Infinity"/>
-</rateAT>
-<rateCG>
-<parameter id="cg" value="1.0" lower="0.0" upper="Infinity"/>
-</rateCG>
-<rateGT>
-<parameter id="gt" value="1.0" lower="0.0" upper="Infinity"/>
-</rateGT>
-</gtrModel>
-
- <hkyModel id="hky.1">
- <frequencies>
- <frequencyModel idref="freqModel"/>
- </frequencies>
- <kappa>
- <parameter id="hky.kappa.1" value="1.0" lower="0.0" upper="100.0"/>
- </kappa>
- </hkyModel>
-
- <siteModel id="siteModel">
- <substitutionModel>
- <hkyModel idref="hky.1"/>
-<!-- <gtrModel idref="gtr"/>-->
- </substitutionModel>
- <gammaShape gammaCategories="1">
- <parameter id="siteModel.alpha" value="0.5" lower="0.0" upper="1000.0"/>
- </gammaShape>
- </siteModel>
-
- <treeLikelihood id="treeLikelihood">
- <patterns idref="patterns"/>
- <treeModel idref="treeModel"/>
- <siteModel idref="siteModel"/>
- </treeLikelihood>
-
- <report>
- ln L = <likelihood idref="treeLikelihood"/>
- </report>
-
-</beast>
-
=====================================
examples/standalone/epochtest/configure.ac deleted
=====================================
--- a/examples/standalone/epochtest/configure.ac
+++ /dev/null
@@ -1,15 +0,0 @@
-# this is a very basic configuration example
-AC_INIT([EpochTest C++], [0.1], [bug-report at hello.beagle-gpu.com],
- [hellobeagle], [http://hello.beagle-gpu.com/])
-AC_PREREQ([2.59])
-AC_CONFIG_AUX_DIR(.config)
-AM_INIT_AUTOMAKE([1.10 -Wall no-define])
-AC_CONFIG_HEADERS([config.h])
-AC_PROG_CXX
-
-PKG_CHECK_MODULES(DEPS, hmsbeagle-1 >= 1.0.0)
-AC_SUBST(DEPS_CFLAGS)
-AC_SUBST(DEPS_LIBS)
-
-AC_CONFIG_FILES([Makefile])
-AC_OUTPUT
=====================================
examples/standalone/epochtest/src/.deps/epochtest-epochtest.Po deleted
=====================================
--- a/examples/standalone/epochtest/src/.deps/epochtest-epochtest.Po
+++ /dev/null
@@ -1,328 +0,0 @@
-src/epochtest-epochtest.o: src/epochtest.cpp \
- /usr/local/include/libhmsbeagle-1/libhmsbeagle/beagle.h \
- /usr/local/include/libhmsbeagle-1/libhmsbeagle/platform.h \
- /usr/include/c++/4.4/iostream \
- /usr/include/c++/4.4/x86_64-linux-gnu/bits/c++config.h \
- /usr/include/c++/4.4/x86_64-linux-gnu/bits/os_defines.h \
- /usr/include/features.h /usr/include/x86_64-linux-gnu/bits/predefs.h \
- /usr/include/x86_64-linux-gnu/sys/cdefs.h \
- /usr/include/x86_64-linux-gnu/bits/wordsize.h \
- /usr/include/x86_64-linux-gnu/gnu/stubs.h \
- /usr/include/x86_64-linux-gnu/gnu/stubs-64.h \
- /usr/include/c++/4.4/x86_64-linux-gnu/bits/cpu_defines.h \
- /usr/include/c++/4.4/ostream /usr/include/c++/4.4/ios \
- /usr/include/c++/4.4/iosfwd /usr/include/c++/4.4/bits/stringfwd.h \
- /usr/include/c++/4.4/bits/postypes.h /usr/include/c++/4.4/cwchar \
- /usr/include/c++/4.4/cstddef \
- /usr/lib/x86_64-linux-gnu/gcc/x86_64-linux-gnu/4.4.6/include/stddef.h \
- /usr/include/wchar.h /usr/include/stdio.h \
- /usr/lib/x86_64-linux-gnu/gcc/x86_64-linux-gnu/4.4.6/include/stdarg.h \
- /usr/include/x86_64-linux-gnu/bits/wchar.h /usr/include/xlocale.h \
- /usr/include/c++/4.4/exception /usr/include/c++/4.4/bits/char_traits.h \
- /usr/include/c++/4.4/bits/stl_algobase.h \
- /usr/include/c++/4.4/bits/functexcept.h \
- /usr/include/c++/4.4/exception_defines.h \
- /usr/include/c++/4.4/bits/cpp_type_traits.h \
- /usr/include/c++/4.4/ext/type_traits.h \
- /usr/include/c++/4.4/ext/numeric_traits.h \
- /usr/include/c++/4.4/bits/stl_pair.h /usr/include/c++/4.4/bits/move.h \
- /usr/include/c++/4.4/bits/concept_check.h \
- /usr/include/c++/4.4/bits/stl_iterator_base_types.h \
- /usr/include/c++/4.4/bits/stl_iterator_base_funcs.h \
- /usr/include/c++/4.4/bits/stl_iterator.h \
- /usr/include/c++/4.4/debug/debug.h /usr/include/c++/4.4/bits/localefwd.h \
- /usr/include/c++/4.4/x86_64-linux-gnu/bits/c++locale.h \
- /usr/include/c++/4.4/clocale /usr/include/locale.h \
- /usr/include/x86_64-linux-gnu/bits/locale.h /usr/include/c++/4.4/cctype \
- /usr/include/ctype.h /usr/include/x86_64-linux-gnu/bits/types.h \
- /usr/include/x86_64-linux-gnu/bits/typesizes.h /usr/include/endian.h \
- /usr/include/x86_64-linux-gnu/bits/endian.h \
- /usr/include/x86_64-linux-gnu/bits/byteswap.h \
- /usr/include/c++/4.4/bits/ios_base.h \
- /usr/include/c++/4.4/ext/atomicity.h \
- /usr/include/c++/4.4/x86_64-linux-gnu/bits/gthr.h \
- /usr/include/c++/4.4/x86_64-linux-gnu/bits/gthr-default.h \
- /usr/include/pthread.h /usr/include/sched.h /usr/include/time.h \
- /usr/include/x86_64-linux-gnu/bits/sched.h \
- /usr/include/x86_64-linux-gnu/bits/time.h \
- /usr/include/x86_64-linux-gnu/bits/pthreadtypes.h \
- /usr/include/x86_64-linux-gnu/bits/setjmp.h /usr/include/unistd.h \
- /usr/include/x86_64-linux-gnu/bits/posix_opt.h \
- /usr/include/x86_64-linux-gnu/bits/environments.h \
- /usr/include/x86_64-linux-gnu/bits/confname.h /usr/include/getopt.h \
- /usr/include/c++/4.4/x86_64-linux-gnu/bits/atomic_word.h \
- /usr/include/c++/4.4/bits/locale_classes.h /usr/include/c++/4.4/string \
- /usr/include/c++/4.4/bits/allocator.h \
- /usr/include/c++/4.4/x86_64-linux-gnu/bits/c++allocator.h \
- /usr/include/c++/4.4/ext/new_allocator.h /usr/include/c++/4.4/new \
- /usr/include/c++/4.4/bits/ostream_insert.h \
- /usr/include/c++/4.4/cxxabi-forced.h \
- /usr/include/c++/4.4/bits/stl_function.h \
- /usr/include/c++/4.4/backward/binders.h \
- /usr/include/c++/4.4/bits/basic_string.h \
- /usr/include/c++/4.4/initializer_list \
- /usr/include/c++/4.4/bits/basic_string.tcc \
- /usr/include/c++/4.4/bits/locale_classes.tcc \
- /usr/include/c++/4.4/streambuf /usr/include/c++/4.4/bits/streambuf.tcc \
- /usr/include/c++/4.4/bits/basic_ios.h \
- /usr/include/c++/4.4/bits/locale_facets.h /usr/include/c++/4.4/cwctype \
- /usr/include/wctype.h \
- /usr/include/c++/4.4/x86_64-linux-gnu/bits/ctype_base.h \
- /usr/include/c++/4.4/bits/streambuf_iterator.h \
- /usr/include/c++/4.4/x86_64-linux-gnu/bits/ctype_inline.h \
- /usr/include/c++/4.4/bits/locale_facets.tcc \
- /usr/include/c++/4.4/bits/basic_ios.tcc \
- /usr/include/c++/4.4/bits/ostream.tcc /usr/include/c++/4.4/istream \
- /usr/include/c++/4.4/bits/istream.tcc /usr/include/c++/4.4/vector \
- /usr/include/c++/4.4/bits/stl_construct.h \
- /usr/include/c++/4.4/bits/stl_uninitialized.h \
- /usr/include/c++/4.4/bits/stl_vector.h \
- /usr/include/c++/4.4/bits/stl_bvector.h \
- /usr/include/c++/4.4/bits/vector.tcc /usr/include/string.h \
- /usr/include/libio.h /usr/include/_G_config.h \
- /usr/include/x86_64-linux-gnu/bits/stdio_lim.h \
- /usr/include/x86_64-linux-gnu/bits/sys_errlist.h \
- /usr/include/x86_64-linux-gnu/bits/stdio.h /usr/include/stdlib.h \
- /usr/include/x86_64-linux-gnu/bits/waitflags.h \
- /usr/include/x86_64-linux-gnu/bits/waitstatus.h \
- /usr/include/x86_64-linux-gnu/sys/types.h \
- /usr/include/x86_64-linux-gnu/sys/select.h \
- /usr/include/x86_64-linux-gnu/bits/select.h \
- /usr/include/x86_64-linux-gnu/bits/sigset.h \
- /usr/include/x86_64-linux-gnu/sys/sysmacros.h /usr/include/alloca.h
-
-/usr/local/include/libhmsbeagle-1/libhmsbeagle/beagle.h:
-
-/usr/local/include/libhmsbeagle-1/libhmsbeagle/platform.h:
-
-/usr/include/c++/4.4/iostream:
-
-/usr/include/c++/4.4/x86_64-linux-gnu/bits/c++config.h:
-
-/usr/include/c++/4.4/x86_64-linux-gnu/bits/os_defines.h:
-
-/usr/include/features.h:
-
-/usr/include/x86_64-linux-gnu/bits/predefs.h:
-
-/usr/include/x86_64-linux-gnu/sys/cdefs.h:
-
-/usr/include/x86_64-linux-gnu/bits/wordsize.h:
-
-/usr/include/x86_64-linux-gnu/gnu/stubs.h:
-
-/usr/include/x86_64-linux-gnu/gnu/stubs-64.h:
-
-/usr/include/c++/4.4/x86_64-linux-gnu/bits/cpu_defines.h:
-
-/usr/include/c++/4.4/ostream:
-
-/usr/include/c++/4.4/ios:
-
-/usr/include/c++/4.4/iosfwd:
-
-/usr/include/c++/4.4/bits/stringfwd.h:
-
-/usr/include/c++/4.4/bits/postypes.h:
-
-/usr/include/c++/4.4/cwchar:
-
-/usr/include/c++/4.4/cstddef:
-
-/usr/lib/x86_64-linux-gnu/gcc/x86_64-linux-gnu/4.4.6/include/stddef.h:
-
-/usr/include/wchar.h:
-
-/usr/include/stdio.h:
-
-/usr/lib/x86_64-linux-gnu/gcc/x86_64-linux-gnu/4.4.6/include/stdarg.h:
-
-/usr/include/x86_64-linux-gnu/bits/wchar.h:
-
-/usr/include/xlocale.h:
-
-/usr/include/c++/4.4/exception:
-
-/usr/include/c++/4.4/bits/char_traits.h:
-
-/usr/include/c++/4.4/bits/stl_algobase.h:
-
-/usr/include/c++/4.4/bits/functexcept.h:
-
-/usr/include/c++/4.4/exception_defines.h:
-
-/usr/include/c++/4.4/bits/cpp_type_traits.h:
-
-/usr/include/c++/4.4/ext/type_traits.h:
-
-/usr/include/c++/4.4/ext/numeric_traits.h:
-
-/usr/include/c++/4.4/bits/stl_pair.h:
-
-/usr/include/c++/4.4/bits/move.h:
-
-/usr/include/c++/4.4/bits/concept_check.h:
-
-/usr/include/c++/4.4/bits/stl_iterator_base_types.h:
-
-/usr/include/c++/4.4/bits/stl_iterator_base_funcs.h:
-
-/usr/include/c++/4.4/bits/stl_iterator.h:
-
-/usr/include/c++/4.4/debug/debug.h:
-
-/usr/include/c++/4.4/bits/localefwd.h:
-
-/usr/include/c++/4.4/x86_64-linux-gnu/bits/c++locale.h:
-
-/usr/include/c++/4.4/clocale:
-
-/usr/include/locale.h:
-
-/usr/include/x86_64-linux-gnu/bits/locale.h:
-
-/usr/include/c++/4.4/cctype:
-
-/usr/include/ctype.h:
-
-/usr/include/x86_64-linux-gnu/bits/types.h:
-
-/usr/include/x86_64-linux-gnu/bits/typesizes.h:
-
-/usr/include/endian.h:
-
-/usr/include/x86_64-linux-gnu/bits/endian.h:
-
-/usr/include/x86_64-linux-gnu/bits/byteswap.h:
-
-/usr/include/c++/4.4/bits/ios_base.h:
-
-/usr/include/c++/4.4/ext/atomicity.h:
-
-/usr/include/c++/4.4/x86_64-linux-gnu/bits/gthr.h:
-
-/usr/include/c++/4.4/x86_64-linux-gnu/bits/gthr-default.h:
-
-/usr/include/pthread.h:
-
-/usr/include/sched.h:
-
-/usr/include/time.h:
-
-/usr/include/x86_64-linux-gnu/bits/sched.h:
-
-/usr/include/x86_64-linux-gnu/bits/time.h:
-
-/usr/include/x86_64-linux-gnu/bits/pthreadtypes.h:
-
-/usr/include/x86_64-linux-gnu/bits/setjmp.h:
-
-/usr/include/unistd.h:
-
-/usr/include/x86_64-linux-gnu/bits/posix_opt.h:
-
-/usr/include/x86_64-linux-gnu/bits/environments.h:
-
-/usr/include/x86_64-linux-gnu/bits/confname.h:
-
-/usr/include/getopt.h:
-
-/usr/include/c++/4.4/x86_64-linux-gnu/bits/atomic_word.h:
-
-/usr/include/c++/4.4/bits/locale_classes.h:
-
-/usr/include/c++/4.4/string:
-
-/usr/include/c++/4.4/bits/allocator.h:
-
-/usr/include/c++/4.4/x86_64-linux-gnu/bits/c++allocator.h:
-
-/usr/include/c++/4.4/ext/new_allocator.h:
-
-/usr/include/c++/4.4/new:
-
-/usr/include/c++/4.4/bits/ostream_insert.h:
-
-/usr/include/c++/4.4/cxxabi-forced.h:
-
-/usr/include/c++/4.4/bits/stl_function.h:
-
-/usr/include/c++/4.4/backward/binders.h:
-
-/usr/include/c++/4.4/bits/basic_string.h:
-
-/usr/include/c++/4.4/initializer_list:
-
-/usr/include/c++/4.4/bits/basic_string.tcc:
-
-/usr/include/c++/4.4/bits/locale_classes.tcc:
-
-/usr/include/c++/4.4/streambuf:
-
-/usr/include/c++/4.4/bits/streambuf.tcc:
-
-/usr/include/c++/4.4/bits/basic_ios.h:
-
-/usr/include/c++/4.4/bits/locale_facets.h:
-
-/usr/include/c++/4.4/cwctype:
-
-/usr/include/wctype.h:
-
-/usr/include/c++/4.4/x86_64-linux-gnu/bits/ctype_base.h:
-
-/usr/include/c++/4.4/bits/streambuf_iterator.h:
-
-/usr/include/c++/4.4/x86_64-linux-gnu/bits/ctype_inline.h:
-
-/usr/include/c++/4.4/bits/locale_facets.tcc:
-
-/usr/include/c++/4.4/bits/basic_ios.tcc:
-
-/usr/include/c++/4.4/bits/ostream.tcc:
-
-/usr/include/c++/4.4/istream:
-
-/usr/include/c++/4.4/bits/istream.tcc:
-
-/usr/include/c++/4.4/vector:
-
-/usr/include/c++/4.4/bits/stl_construct.h:
-
-/usr/include/c++/4.4/bits/stl_uninitialized.h:
-
-/usr/include/c++/4.4/bits/stl_vector.h:
-
-/usr/include/c++/4.4/bits/stl_bvector.h:
-
-/usr/include/c++/4.4/bits/vector.tcc:
-
-/usr/include/string.h:
-
-/usr/include/libio.h:
-
-/usr/include/_G_config.h:
-
-/usr/include/x86_64-linux-gnu/bits/stdio_lim.h:
-
-/usr/include/x86_64-linux-gnu/bits/sys_errlist.h:
-
-/usr/include/x86_64-linux-gnu/bits/stdio.h:
-
-/usr/include/stdlib.h:
-
-/usr/include/x86_64-linux-gnu/bits/waitflags.h:
-
-/usr/include/x86_64-linux-gnu/bits/waitstatus.h:
-
-/usr/include/x86_64-linux-gnu/sys/types.h:
-
-/usr/include/x86_64-linux-gnu/sys/select.h:
-
-/usr/include/x86_64-linux-gnu/bits/select.h:
-
-/usr/include/x86_64-linux-gnu/bits/sigset.h:
-
-/usr/include/x86_64-linux-gnu/sys/sysmacros.h:
-
-/usr/include/alloca.h:
=====================================
examples/standalone/epochtest/src/epochtest.cpp deleted
=====================================
--- a/examples/standalone/epochtest/src/epochtest.cpp
+++ /dev/null
@@ -1,358 +0,0 @@
-#include <libhmsbeagle-1/libhmsbeagle/beagle.h>
-#include <iostream>
-#include <vector>
-#include <string.h>
-#include <stdio.h>
-#include <stdlib.h>
-
-using namespace std;
-
-char
- *SimSeq1 =
- (char*) "TCAAGTGAGGTACACACGATTCATAAGATACCGAGAGGGACGTGGGATCATGTCCGTTGGAGGCATGCTCAACTGGCGTAAGTGGTAAACTGGATGTCTCTAGTAGTGGGCAAGCGTCGTGAGGCGCAAAAGTACTTGTGGTAAGGACCAGAGATGCACAGGCTATCTTCTTTAATCTAATGCGATACTCGTTGAAGTCTATCTTTGAGATAGCTAAGATCACATAGGGACTTTGATAGCCAACAGTGTGCATGGCACTGTAATAATTTTTTGGCAGACCACACTTGGGTGGGGAGAGTAGAGAAAGTGAATCGATGAGCAGGTTCCGCGGCTGGGGGGGTTAGGGATATCACAAGATTGTCTCTTAAACACGGGGTTTAGGGTTACTTACAAGAAGATGAATGCCGGAGCAGGGGGTCATCTTAAGGAATCGGGGAATTTGTCCTCGGGCAAGAATTGACACCTGCCTCATTATTATTCATGAGACTACAAAAAGGGGATAGTTGAATTACATTAGCGCGCGGTCGAACTCCGACTGAAAATAATAAGCGTAAATGGAACCCAGCCACAGTGACTGGTAAGCAAATGTTTAGTTTAAACAACCAGGGTAATGGTGCATTTCAGAAACTGGGGACAAGTCGATTACGGCGGTTGATTACCGGGTCCTGTTAGGTGTAGGGAGCCCATCTACTGGCACATTTTTTTGTGCGTATCGACGGGGACCCAGTGAAAAGGAGTAACTGATAAAGTACAGTGAATGAATAATGTAAAAGCGGGACGAGTAAAAGCATACATAGTGCGTGAAAGGTGTCAGTTTACCTACCTGGGACAATCTCTGTACGTGAGTAAGTTTGGATCCAGCGGAAAACCACAGGTGAGAGGGCTTCTGAAACGCATGCCCGATTAGATAACTGATAATGTAAACCAGGACGCTTCAGCTGTGAATGCCTGTATAAAATCCCTGGGTTTTCAGGAATGGAAATAACGCTGACCAGCTATT";
-
-char
- *SimSeq2 =
- (char*) "ATAAAAAAGGGGTGCAAAAGAACACGTGCAATTAAAATAAGGCCGGTCGATGTATAAGGTTACATCGCCAGTGAGTTATCTGGATCAATCTTGTTTCTTCTTAGAAAACGAAACATCTAAAGAGTTCATTGAGGAGTATGGCGGAGTTTATGGGATGGTTCTCGATCTTCTGCAGACACGAGAAGCAGCAGCAAAACTATATGATCAAGCGAATGAAGATAAAATTGGGGATTGATCAATGGGGGCTGCATACGGACTTGCACCATAGTAAGCAGCTAACGTGTCATAATAATGGTGATTAGAAGAGTAGGTTAGTGAGAATTAATAATCGGCGGAAATTGGGATTATACCTTATGCTGGCGCCGATAAGAGGTAATGAGTGACACAAATAAAGGGTAAATATAATCGGACGGAGCGTAATTCGGAGAGACTAATGGACGGGATGTAAAGTTCACACTAGGACTGTAACTGTTGGAACGTAAGAAAAAATCGAGAAGGAGCAAATGGGGTATAGGATGTACCGCAAGGTCTTACATTAAAAAGACGAAGTGGATGGCGGGTCTGAGTGAACAGGTTGTTCATTTGGGACGATGACCAGGTTATGGAACCAATAAGAAGTTATAGTAGAACAGGATAAATCCACAGAATTTCATCATGAGAGAGTTAAAATGACTATGGCGGCCCTATCTGTGGCAGAGAAACCATTAACTCGCCAGTGAATTCTCCTTGCGAGGCTGGGAGCATCAGCGTGAGACGAACAAAGATTGCATCGGTTAGATAAAACCAGTAATGCGTATCAGACCAAGTGTGTCAAAGAGTTTATTCAGAGGGCGGGACACATGGATCTAAGATCAGCTCGACCGGCGGATTCCAGTTAGTGGAGATATGCGGGGCTCTTATTGAATGGGTCCATCAGTGGTTATGGAGAAATTCGATTAACAGTAATCTTCAGGCGAGATGTGTGATCCTTTCAAACGGACAGAAGCGCGAGGTAAAATCC";
-
-char
- *SimSeq3 =
- (char*) "ACAGGGTGCGAACCCGAGAGAATTGATAAAATCCAAATGGGTATGGTGGGTATGAACAAATGAATCATAAATAAATCGTCTGCATCGAGTTTATCCCTCGTTTGATGGCGCGGAGTTCAACAACTTATTGATCAGAAAAGGGAGAATTTGTGAGACCGCAGTTCTCTTCCTACCAGAGCAGAATGCATTGACCAAGCTCCATACGCACACAAACCCCTTTGTGATCGGGAATTGATCACAAAACGTCATACAGGAAGTAGCCTCGTCATCGGCAATCAATAGAAAAAGACCACAAGGAACGGAAGGGAAGTTCAAGGAAGAATAAGAGTAGTAAGGAACGATGTGTATATTGGTAAATTACGGCAACCAGAAGCGATGAGCCGTGCGTTCATAAGACAGACGCTATGGAACGGGGCATGACCTGGAGAGACTAATGATTAGTATATAGAATCCGACCAAGCGTGGTGGCCATTCTAATATGAGGAGACGTTGAGAAAAATGAGCCAGGAAGGGTAGCATGCCAGAAAACTCTATGCAGGAAGTAATTTAGACATATCCCTTCTGGTGCAGTAATTTGCTTATCCAAGACATTGATTCGACTCTGGGGGTCACATGGTGGTCTCATGGAATGACGAGGACTCACCGGACTATACTTGAACATAGGTGAGACAATCATGACGAATTCGCCCAAGGCGGTGCTGTTATTAGTATTGGACCGGTATCGCTGCACAAATTCAAGTAGATCGTTTGGGGGAGGATTAGGGTCACCCGGAATGAGCAATTGCGTGAATAAGAAACCCACTGAACTCGGAAGATTGATAGTTTAGTGGGTCGGATCTGTACGCTCTGGCAGAGCTCAGTTAGGAGACTTCAAAAGGAAGAATCCTACGCTTCGCCTGCGAGGTTAGGCAGATATGGGGAATGAGATGTTTCAGGTGATAATAGCTTGATGACACAAAATTAAGTCATCCCAAATCAGCAGGCAAACAGAGCAGAGCAC";
-
-void printMatrix(int matrixIndex, int stateCount, int nRateCats, int instance) {
-
- double* outMatrix = (double*) malloc(sizeof(double) * stateCount
- * stateCount * nRateCats);
-
- beagleGetTransitionMatrix(instance, // instance,
- matrixIndex, // matrixIndex
- outMatrix // outMatrix
- );
-
- for (int row = 0; row < stateCount; row++) {
- printf("| ");
- for (int col = 0; col < stateCount; col++)
- printf("%f ", outMatrix[col + row * stateCount]);
- printf("|\n");
- }
- printf("\n");
-
- memset(outMatrix, 0, sizeof(double) * stateCount * stateCount * nRateCats);
- free(outMatrix);
-}//END: printMatrix
-
-int* getStates(char *sequence) {
- int n = strlen(sequence);
- int *states = (int*) malloc(sizeof(int) * n);
-
- for (int i = 0; i < n; i++) {
- switch (sequence[i]) {
- case 'A':
- states[i] = 0;
- break;
- case 'C':
- states[i] = 1;
- break;
- case 'G':
- states[i] = 2;
- break;
- case 'T':
- states[i] = 3;
- break;
- default:
- states[i] = 4;
- break;
- }
- }
- return states;
-}//END: getStates
-
-double* getPartials(char *sequence) {
- int n = strlen(sequence);
- double *partials = (double*) malloc(sizeof(double) * n * 4);
-
- int k = 0;
- for (int i = 0; i < n; i++) {
- switch (sequence[i]) {
- case 'A':
- partials[k++] = 1;
- partials[k++] = 0;
- partials[k++] = 0;
- partials[k++] = 0;
- break;
- case 'C':
- partials[k++] = 0;
- partials[k++] = 1;
- partials[k++] = 0;
- partials[k++] = 0;
- break;
- case 'G':
- partials[k++] = 0;
- partials[k++] = 0;
- partials[k++] = 1;
- partials[k++] = 0;
- break;
- case 'T':
- partials[k++] = 0;
- partials[k++] = 0;
- partials[k++] = 0;
- partials[k++] = 1;
- break;
- default:
- partials[k++] = 1;
- partials[k++] = 1;
- partials[k++] = 1;
- partials[k++] = 1;
- break;
- }
- }
- return partials;
-}//END: getPartials
-
-int main(int argc, const char* argv[]) {
-
- // is nucleotides
- int stateCount = 4;
-
- // get the number of site patterns
- int nPatterns = strlen(SimSeq1);
-
- int rateCategoryCount = 4;
-
- int nRateCats = rateCategoryCount;
- int nRootCount = 1;
- int nPartBuffs = 4 + nRootCount;
- int scaleCount = 0;
- int nConvMatBuff = 2; // number of extra transition probability matrices buffers to create
- int nRateMatBuff = 6 + nConvMatBuff;
- int nRateMatEigDecBuf = 2;
-
- // initialize the instance
- BeagleInstanceDetails instDetails;
-
- // create an instance of the BEAGLE library
- int instance = beagleCreateInstance(3, // Number of tip data elements
- nPartBuffs, // Number of partials buffers to create
- 0, // Number of compact state representation buffers to create
- stateCount, // Number of states in the continuous-time Markov chain
- nPatterns, // Number of site patterns to be handled by the instance
- nRateMatEigDecBuf, // Number of rate matrix eigen-decomposition buffers to allocate
- nRateMatBuff, // Number of rate matrix buffers
- nRateCats, // Number of rate categories
- scaleCount, // Number of scaling buffers
- NULL, // List of potential resource on which this instance is allowed (NULL implies no restriction
- 0, // Length of resourceList list
- BEAGLE_FLAG_PROCESSOR_CPU, // Bit-flags indicating preferred implementation charactertistics, see BeagleFlags
- BEAGLE_FLAG_PRECISION_DOUBLE, // Bit-flags indicating required implementation characteristics, see BeagleFlags
- &instDetails);
-
- if (instance < 0) {
-
- fprintf(stderr, "Failed to obtain BEAGLE instance \n \n");
- exit(BEAGLE_ERROR_UNINITIALIZED_INSTANCE);
-
- } else {
-
- fprintf(stdout, "Using resource %i: \n", instDetails.resourceNumber);
- fprintf(stdout, "\t Rsrc Name : %s \n", instDetails.resourceName);
- fprintf(stdout, "\t Impl Name : %s \n", instDetails.implName);
- fprintf(stdout, "\n");
-
- }
-
- // set the sequences for each tip using partial likelihood arrays
- double *SimSeq1Partials = getPartials(SimSeq1);
- double *SimSeq2Partials = getPartials(SimSeq2);
- double *SimSeq3Partials = getPartials(SimSeq3);
-
- beagleSetTipPartials(instance, 0, SimSeq3Partials);
- beagleSetTipPartials(instance, 1, SimSeq2Partials);
- beagleSetTipPartials(instance, 2, SimSeq1Partials);
-
- // alpha = 0.5
- double rates[4] = { 0.02907775442778477, 0.2807145339257214,
- 0.9247730548197041, 2.76543465682679 };
-
- // create base frequency array
- double freqs[4] = { 0.25, 0.25, 0.25, 0.25 };
-
- // create an array containing site category weights
- double* weights = (double*) malloc(sizeof(double) * rateCategoryCount);
-
- for (int i = 0; i < rateCategoryCount; i++) {
- weights[i] = 1.0 / rateCategoryCount;
- }
-
- double* patternWeights = (double*) malloc(sizeof(double) * nPatterns);
-
- for (int i = 0; i < nPatterns; i++) {
- patternWeights[i] = 1.0;
- }
-
- // an eigen decomposition for the HKY kappa=1 subst model
- double evecHKY1[4 * 4] = { 1.0, 2.0, 0.0, 0.5, 1.0, -2.0, 0.5, 0.0, 1.0,
- 2.0, 0.0, -0.5, 1.0, -2.0, -0.5, 0.0 };
-
- double ivecHKY1[4 * 4] = { 0.25, 0.25, 0.25, 0.25, 0.125, -0.125, 0.125,
- -0.125, 0.0, 1.0, 0.0, -1.0, 1.0, 0.0, -1.0, 0.0 };
-
- double evalHKY1[4] = { 0.0, -1.3333333333333333, -1.3333333333333333,
- -1.3333333333333333 };
-
- // set the Eigen decomposition for buffer 0
- beagleSetEigenDecomposition(instance, 0, evecHKY1, ivecHKY1, evalHKY1);
-
- // an eigen decomposition for the HKY kappa=20 subst model
- double evecHKY20[4 * 4] = { 1.0, 2.0, 0.0, 0.5, 1.0, -2.0, 0.5, 0.0, 1.0,
- 2.0, 0.0, -0.5, 1.0, -2.0, -0.5, 0.0 };
-
- double ivecHKY20[4 * 4] = { 0.25, 0.25, 0.25, 0.25, 0.125, -0.125, 0.125,
- -0.125, 0.0, 1.0, 0.0, -1.0, 1.0, 0.0, -1.0, 0.0 };
-
- double evalHKY20[4] = { 0.0, -0.18181818181818182, -1.9090909084,
- -1.9090909097818183 };
-
- // set the Eigen decomposition for buffer 1
- beagleSetEigenDecomposition(instance, 1, evecHKY20, ivecHKY20, evalHKY20);
-
- beagleSetStateFrequencies(instance, 0, freqs);
-
- beagleSetCategoryWeights(instance, 0, weights);
-
- beagleSetPatternWeights(instance, patternWeights);
-
- double epochTransitionTimes[1] = { 20 };
-
- // a list of matrix indices and edge lengths for eigen buffer 0
- int probabilityIndicesEigenBuffer0[2] = { 4, 6 };
- double edgeLengthsEigenBuffer0[2] = { epochTransitionTimes[0] - 10.0083,
- epochTransitionTimes[0] };
- int listLengthEigenBuffer0 = 2;
-
- // a list of matrix indices and edge lengths for eigen buffer 1
- int probabilityIndicesEigenBuffer1[4] = { 1, 3, 5, 7 };
- double edgeLengthsEigenBuffer1[4] = { 25.2487, 18.48981, 45.2487
- - epochTransitionTimes[0] + 10.0083, 73.7468
- - epochTransitionTimes[0] };
- int listLengthEigenBuffer1 = 4;
-
- int* rootIndices = (int*) malloc(sizeof(int) * nRootCount);
- int* categoryWeightsIndices = (int*) malloc(sizeof(int) * nRootCount);
- int* stateFrequencyIndices = (int*) malloc(sizeof(int) * nRootCount);
- int* cumulativeScalingIndices = (int*) malloc(sizeof(int) * nRootCount);
-
- for (int i = 0; i < nRootCount; i++) {
-
- rootIndices[i] = 4 + i;
- categoryWeightsIndices[i] = 0;
- stateFrequencyIndices[i] = 0;
- cumulativeScalingIndices[i] = BEAGLE_OP_NONE;
-
- beagleSetCategoryRates(instance, &rates[i]);
-
- // tell BEAGLE to populate the transition matrices for the above edge lengths
- beagleUpdateTransitionMatrices(instance, // instance
- 0, // eigenIndex
- probabilityIndicesEigenBuffer0, // probabilityIndices
- NULL, // firstDerivativeIndices
- NULL, // secondDerivativeIndices
- edgeLengthsEigenBuffer0, // edgeLengths
- listLengthEigenBuffer0); // count
-
- beagleUpdateTransitionMatrices(instance, // instance
- 1, // eigenIndex
- probabilityIndicesEigenBuffer1, // probabilityIndices
- NULL, // firstDerivativeIndices
- NULL, // secondDerivativeIndices
- edgeLengthsEigenBuffer1, // edgeLengths
- listLengthEigenBuffer1); // count
-
- int firstIndices[2] = { 4, 6 };
- int secondIndices[2] = { 5, 7 };
- int resultIndices[2] = { 0, 2 };
-
- beagleConvolveTransitionMatrices(instance, // instance
- firstIndices, // first indices
- secondIndices, // second indices
- resultIndices, // result indices
- 2 // matrixCount
- );
-
- // for (int j = 0; j <= (6 + 1); j++) {
- // printf("Matrix index %i: \n", j);
- // printMatrix(j, stateCount, nRateCats, instance);
- // }
-
- // create a list of partial likelihood update operations
- // the order is [dest, destScaling, source1, matrix1, source2, matrix2]
- BeagleOperation operations[2] = {
-
- { 3, // destination or parent partials buffer
- BEAGLE_OP_NONE, // scaling buffer to write to
- BEAGLE_OP_NONE, // scaling buffer to read from
- 0, // first child partials buffer
- 0, // transition matrix of first partials child buffer
- 1, // second child partials buffer
- 1 // transition matrix of second partials child buffer
- },
-
- { rootIndices[i], // destination or parent partials buffer
- BEAGLE_OP_NONE, // scaling buffer to write to
- BEAGLE_OP_NONE, // scaling buffer to read from
- 2, // first child partials buffer
- 2, // transition matrix of first partials child buffer
- 3, // second child partials buffer
- 3 // transition matrix of second partials child buffer
- }
-
- };
-
- // update the partials
- beagleUpdatePartials(instance, // instance
- operations, // eigenIndex
- 2, // operationCount
- cumulativeScalingIndices[i]); // cumulative scaling index
-
- }//END: nRootCount loop
-
- double *patternLogLik = (double*) malloc(sizeof(double) * nPatterns);
- double logL = 0.0;
- int returnCode = 0;
-
- // calculate the site likelihoods at the root node
- returnCode = beagleCalculateRootLogLikelihoods(instance, // instance
- (const int *) rootIndices, // bufferIndices
- (const int *) categoryWeightsIndices, // weights
- (const int *) stateFrequencyIndices, // stateFrequencies
- cumulativeScalingIndices, // cumulative scaling index
- nRootCount, // count
- &logL); // outLogLikelihoods
-
- beagleGetSiteLogLikelihoods(instance, patternLogLik);
-
- double sumLogL = 0.0;
- for (int i = 0; i < nPatterns; i++) {
- sumLogL += patternLogLik[i] * patternWeights[i];
- }
-
- fprintf(stdout, "logL = %.5f \n", logL);
- fprintf(stdout, "sumLogL = %.5f \n", sumLogL);
-
- free(weights);
- free(patternWeights);
- free(rootIndices);
- free(categoryWeightsIndices);
- free(stateFrequencyIndices);
- free(cumulativeScalingIndices);
-
- free(patternLogLik);
-
- free(SimSeq1Partials);
- free(SimSeq2Partials);
- free(SimSeq3Partials);
-
- beagleFinalizeInstance(instance);
-
- return (EXIT_SUCCESS);
-}//END: main
-
=====================================
libhmsbeagle/GPU/kernels/kernels4.cu
=====================================
--- a/libhmsbeagle/GPU/kernels/kernels4.cu
+++ b/libhmsbeagle/GPU/kernels/kernels4.cu
@@ -321,13 +321,13 @@
int patIdx16pat4 = multBy16(patIdx) | (tx & 0xC);\
sum1 = sMatrix1[multBy4(i) | state] * sPartials1[patIdx16pat4 | i];\
sum2 = sMatrix2[multBy4(i) | state] * sPartials2[patIdx16pat4 | i];\
- i = (++i) & 0x3;\
+ i = (i + 1) & 0x3;\
FMA( sMatrix1[multBy4(i) | state], sPartials1[patIdx16pat4 | i], sum1);\
FMA( sMatrix2[multBy4(i) | state], sPartials2[patIdx16pat4 | i], sum2);\
- i = (++i) & 0x3;\
+ i = (i + 1) & 0x3;\
FMA( sMatrix1[multBy4(i) | state], sPartials1[patIdx16pat4 | i], sum1);\
FMA( sMatrix2[multBy4(i) | state], sPartials2[patIdx16pat4 | i], sum2);\
- i = (++i) & 0x3;\
+ i = (i + 1) & 0x3;\
FMA( sMatrix1[multBy4(i) | state], sPartials1[patIdx16pat4 | i], sum1);\
FMA( sMatrix2[multBy4(i) | state], sPartials2[patIdx16pat4 | i], sum2);
@@ -339,11 +339,11 @@
int i = pat;\
int patIdx16pat4 = multBy16(patIdx) | (tx & 0xC);\
sum2 = sMatrix2[multBy4(i) | state] * sPartials2[patIdx16pat4 | i];\
- i = (++i) & 0x3;\
+ i = (i + 1) & 0x3;\
FMA( sMatrix2[multBy4(i) | state], sPartials2[patIdx16pat4 | i], sum2);\
- i = (++i) & 0x3;\
+ i = (i + 1) & 0x3;\
FMA( sMatrix2[multBy4(i) | state], sPartials2[patIdx16pat4 | i], sum2);\
- i = (++i) & 0x3;\
+ i = (i + 1) & 0x3;\
FMA( sMatrix2[multBy4(i) | state], sPartials2[patIdx16pat4 | i], sum2);
#define SUM_PARTIALS_SINGLE_4_GPU()\
@@ -351,11 +351,11 @@
int i = pat;\
int patIdx16pat4 = multBy16(patIdx) | (tx & 0xC);\
sum1 = sMatrix1[multBy4(i) | state] * sPartials1[patIdx16pat4 | i];\
- i = (++i) & 0x3;\
+ i = (i + 1) & 0x3;\
FMA( sMatrix1[multBy4(i) | state], sPartials1[patIdx16pat4 | i], sum1);\
- i = (++i) & 0x3;\
+ i = (i + 1) & 0x3;\
FMA( sMatrix1[multBy4(i) | state], sPartials1[patIdx16pat4 | i], sum1);\
- i = (++i) & 0x3;\
+ i = (i + 1) & 0x3;\
FMA( sMatrix1[multBy4(i) | state], sPartials1[patIdx16pat4 | i], sum1);
#define SUM_STATES_SINGLE_4_GPU()\
@@ -373,15 +373,15 @@
sum1 = sMatrix1[ multBy4(i) | state] * sPartials1[patIdx16pat4 | i];\
sumFirstDeriv = sMatrixFirstDeriv[ multBy4(i) | state] * sPartials1[patIdx16pat4 | i];\
sumSecondDeriv = sMatrixSecondDeriv[multBy4(i) | state] * sPartials1[patIdx16pat4 | i];\
- i = (++i) & 0x3;\
+ i = (i + 1) & 0x3;\
FMA(sMatrix1[ multBy4(i) | state], sPartials1[patIdx16pat4 | i], sum1);\
FMA(sMatrixFirstDeriv[ multBy4(i) | state], sPartials1[patIdx16pat4 | i], sumFirstDeriv);\
FMA(sMatrixSecondDeriv[multBy4(i) | state], sPartials1[patIdx16pat4 | i], sumSecondDeriv);\
- i = (++i) & 0x3;\
+ i = (i + 1) & 0x3;\
FMA(sMatrix1[ multBy4(i) | state], sPartials1[patIdx16pat4 | i], sum1);\
FMA(sMatrixFirstDeriv[ multBy4(i) | state], sPartials1[patIdx16pat4 | i], sumFirstDeriv);\
FMA(sMatrixSecondDeriv[multBy4(i) | state], sPartials1[patIdx16pat4 | i], sumSecondDeriv);\
- i = (++i) & 0x3;\
+ i = (i + 1) & 0x3;\
FMA(sMatrix1[ multBy4(i) | state], sPartials1[patIdx16pat4 | i], sum1);\
FMA(sMatrixFirstDeriv[ multBy4(i) | state], sPartials1[patIdx16pat4 | i], sumFirstDeriv);\
FMA(sMatrixSecondDeriv[multBy4(i) | state], sPartials1[patIdx16pat4 | i], sumSecondDeriv);
@@ -1194,15 +1194,15 @@ KW_GLOBAL_KERNEL void kernelPartialsPartialsCheckScale(KW_GLOBAL_VAR REAL* parti
sum1 = sMatrix1[multBy4(i) | state] * sPartials1[patIdx16pat4 | i];
sum2 = sMatrix2[multBy4(i) | state] * sPartials2[patIdx16pat4 | i];
- i = (++i) & 0x3;
+ i = (i + 1) & 0x3;
sum1 += sMatrix1[multBy4(i) | state] * sPartials1[patIdx16pat4 | i];
sum2 += sMatrix2[multBy4(i) | state] * sPartials2[patIdx16pat4 | i];
- i = (++i) & 0x3;
+ i = (i + 1) & 0x3;
sum1 += sMatrix1[multBy4(i) | state] * sPartials1[patIdx16pat4 | i];
sum2 += sMatrix2[multBy4(i) | state] * sPartials2[patIdx16pat4 | i];
- i = (++i) & 0x3;
+ i = (i + 1) & 0x3;
sum1 += sMatrix1[multBy4(i) | state] * sPartials1[patIdx16pat4 | i];
sum2 += sMatrix2[multBy4(i) | state] * sPartials2[patIdx16pat4 | i];
@@ -1283,15 +1283,15 @@ KW_GLOBAL_KERNEL void kernelPartialsPartialsFixedCheckScale(KW_GLOBAL_VAR REAL*
sum1 = sMatrix1[i * 4 + state] * sPartials1[patIdx * 16 + pat * 4 + i];
sum2 = sMatrix2[i * 4 + state] * sPartials2[patIdx * 16 + pat * 4 + i];
- i = (++i) & 0x3;
+ i = (i + 1) & 0x3;
sum1 += sMatrix1[i * 4 + state] * sPartials1[patIdx * 16 + pat * 4 + i];
sum2 += sMatrix2[i * 4 + state] * sPartials2[patIdx * 16 + pat * 4 + i];
- i = (++i) & 0x3;
+ i = (i + 1) & 0x3;
sum1 += sMatrix1[i * 4 + state] * sPartials1[patIdx * 16 + pat * 4 + i];
sum2 += sMatrix2[i * 4 + state] * sPartials2[patIdx * 16 + pat * 4 + i];
- i = (++i) & 0x3;
+ i = (i + 1) & 0x3;
sum1 += sMatrix1[i * 4 + state] * sPartials1[patIdx * 16 + pat * 4 + i];
sum2 += sMatrix2[i * 4 + state] * sPartials2[patIdx * 16 + pat * 4 + i];
@@ -1358,15 +1358,15 @@ KW_GLOBAL_KERNEL void kernelPartialsPartialsAutoScale(KW_GLOBAL_VAR REAL* partia
sum1 = sMatrix1[multBy4(i) | state] * sPartials1[patIdx16pat4 | i];
sum2 = sMatrix2[multBy4(i) | state] * sPartials2[patIdx16pat4 | i];
- i = (++i) & 0x3;
+ i = (i + 1) & 0x3;
sum1 += sMatrix1[multBy4(i) | state] * sPartials1[patIdx16pat4 | i];
sum2 += sMatrix2[multBy4(i) | state] * sPartials2[patIdx16pat4 | i];
- i = (++i) & 0x3;
+ i = (i + 1) & 0x3;
sum1 += sMatrix1[multBy4(i) | state] * sPartials1[patIdx16pat4 | i];
sum2 += sMatrix2[multBy4(i) | state] * sPartials2[patIdx16pat4 | i];
- i = (++i) & 0x3;
+ i = (i + 1) & 0x3;
sum1 += sMatrix1[multBy4(i) | state] * sPartials1[patIdx16pat4 | i];
sum2 += sMatrix2[multBy4(i) | state] * sPartials2[patIdx16pat4 | i];
View it on GitLab: https://salsa.debian.org/med-team/libhmsbeagle/commit/e4b0fabf9379a5aeae7061c44470a62df5ff10ba
---
View it on GitLab: https://salsa.debian.org/med-team/libhmsbeagle/commit/e4b0fabf9379a5aeae7061c44470a62df5ff10ba
You're receiving this email because of your account on salsa.debian.org.
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://lists.alioth.debian.org/pipermail/debian-med-commit/attachments/20180411/d6795566/attachment-0001.html>
More information about the debian-med-commit
mailing list