[med-svn] [Git][med-team/sortmerna][master] 11 commits: Use 2to3 to port from Python2 to Python3
Andreas Tille
gitlab at salsa.debian.org
Wed Dec 25 20:29:21 GMT 2019
Andreas Tille pushed to branch master at Debian Med / sortmerna
Commits:
0df21994 by Andreas Tille at 2019-12-25T16:34:07Z
Use 2to3 to port from Python2 to Python3
- - - - -
6b9d9ac2 by Andreas Tille at 2019-12-25T16:34:07Z
Python3 in packaging
- - - - -
57f7a93f by Andreas Tille at 2019-12-25T16:34:07Z
Add build time test
- - - - -
d96b7e90 by Andreas Tille at 2019-12-25T16:34:23Z
routine-update: debhelper-compat 12
- - - - -
43a7435a by Andreas Tille at 2019-12-25T16:34:29Z
routine-update: Standards-Version: 4.4.1
- - - - -
c0f62937 by Andreas Tille at 2019-12-25T16:34:29Z
routine-update: Secure URI in copyright format
- - - - -
c75f12a8 by Andreas Tille at 2019-12-25T16:34:33Z
Use secure URI in Homepage field.
Fixes lintian: homepage-field-uses-insecure-uri
See https://lintian.debian.org/tags/homepage-field-uses-insecure-uri.html for more details.
- - - - -
74e3b60f by Andreas Tille at 2019-12-25T16:34:36Z
Set upstream metadata fields: Bug-Database, Bug-Submit (from ./configure), Repository, Repository-Browse.
- - - - -
4766478d by Andreas Tille at 2019-12-25T20:16:35Z
Build-Depends / Recommends: python3-skbio
- - - - -
fc55fae4 by Andreas Tille at 2019-12-25T20:25:04Z
No build time test due to old skbio interface (see debian/README.source)
- - - - -
1b654559 by Andreas Tille at 2019-12-25T20:27:52Z
Upload to unstable
- - - - -
9 changed files:
- debian/README.source
- debian/changelog
- − debian/compat
- debian/control
- debian/copyright
- + debian/patches/2to3.patch
- + debian/patches/series
- debian/rules
- debian/upstream/metadata
Changes:
=====================================
debian/README.source
=====================================
@@ -4,16 +4,16 @@ which is 0.4.0.
You could try this by running
-$ python tests/test_sortmerna.py
+$ python3 tests/test_sortmerna.py
Traceback (most recent call last):
File "tests/test_sortmerna.py", line 16, in <module>
from skbio.parse.sequences import parse_fasta
ImportError: No module named parse.sequences
-The module interface was changed inbetween python-skbio version
+The module interface was changed inbetween python3-skbio version
0.2.3 and 0.4.0.
As a consequence the test is not run. If you might succeed in
-adapting the code please add the Build-Depends python-skbio and
-python-lockfile.
+adapting the code please add the Build-Depends python3-skbio and
+python3-lockfile.
=====================================
debian/changelog
=====================================
@@ -1,3 +1,16 @@
+sortmerna (2.1-4) unstable; urgency=medium
+
+ * Use 2to3 to port from Python2 to Python3
+ Closes: #945707
+ * debhelper-compat 12
+ * Standards-Version: 4.4.1
+ * Secure URI in copyright format
+ * Use secure URI in Homepage field.
+ * Set upstream metadata fields: Bug-Database, Bug-Submit (from
+ ./configure), Repository, Repository-Browse.
+
+ -- Andreas Tille <tille at debian.org> Wed, 25 Dec 2019 21:25:41 +0100
+
sortmerna (2.1-3) unstable; urgency=medium
[ Steffen Moeller ]
=====================================
debian/compat deleted
=====================================
@@ -1 +0,0 @@
-11
=====================================
debian/control
=====================================
@@ -4,18 +4,21 @@ Uploaders: Tim Booth <tbooth at ceh.ac.uk>,
Andreas Tille <tille at debian.org>
Section: science
Priority: optional
-Build-Depends: debhelper (>= 11~)
-Standards-Version: 4.2.1
+Build-Depends: debhelper-compat (= 12),
+# python3 <!nocheck>,
+# python3-skbio <!nocheck>,
+Standards-Version: 4.4.1
Vcs-Browser: https://salsa.debian.org/med-team/sortmerna
Vcs-Git: https://salsa.debian.org/med-team/sortmerna.git
-Homepage: http://bioinfo.lifl.fr/RNA/sortmerna/
+Homepage: https://bioinfo.lifl.fr/RNA/sortmerna/
Package: sortmerna
Architecture: any-amd64 any-i386 x32
Depends: ${shlibs:Depends},
${misc:Depends},
sse2-support [any-i386]
-Recommends: python
+Recommends: python3,
+# python3-skbio
Description: tool for filtering, mapping and OTU-picking NGS reads
SortMeRNA is a biological sequence analysis tool for filtering, mapping and
OTU-picking NGS reads. The core algorithm is based on approximate seeds and
=====================================
debian/copyright
=====================================
@@ -1,4 +1,4 @@
-Format: http://www.debian.org/doc/packaging-manuals/copyright-format/1.0/
+Format: https://www.debian.org/doc/packaging-manuals/copyright-format/1.0/
Upstream-Name: SortMeRNA
Upstream-Contact: jenya.kopylov at gmail.com, laurent.noe at lifl.fr, helene.touzet at lifl.fr
Source: https://github.com/biocore/sortmerna
=====================================
debian/patches/2to3.patch
=====================================
@@ -0,0 +1,170 @@
+Description: Use 2to3 to port from Python2 to Python3
+Bug-Debian: htts://bugs.debian.org/945707
+Author: Andreas Tille <tille at debian.org>
+Last-Update: Wed, 25 Dec 2019 17:25:58 +0100
+
+--- a/README.md
++++ b/README.md
+@@ -114,7 +114,7 @@ Tests
+
+ Usage tests can be run with the following command:
+ ```
+-python ./tests/test_sortmerna.py
++python3 ./tests/test_sortmerna.py
+ ```
+ Make sure the ```data``` folder is in the same directory as ```test_sortmerna.py```
+
+--- a/rRNA_databases/scripts/hmmer_clean.sh
++++ b/rRNA_databases/scripts/hmmer_clean.sh
+@@ -21,7 +21,7 @@ for db in "${!databases[@]}"
+ do
+ hmms=(${databases["$db"]//,/ })
+
+- echo "source /home/evko1434/.bashrc; $hmmer -o $outdir/${db}_vs_${hmms[0]}.txt --noali --tblout $outdir/${db}_vs_${hmms[0]}_table.txt --acc -E 1e-5 --cpu 20 ${rootdir}/HMM3/${hmms[0]}.hmm $rootdir/${db}.fasta; $hmmer -o $outdir/${db}_vs_${hmms[1]}.txt --noali --tblout $outdir/${db}_vs_${hmms[1]}_table.txt --acc -E 1e-5 --cpu 20 ${rootdir}/HMM3/${hmms[1]}.hmm $rootdir/${db}.fasta; python $rootdir/remove_partial_seqs.py $outdir/${db}_vs_${hmms[0]}_table.txt $outdir/${db}_partial_${hmms[0]}_to_remove.txt; python $rootdir/remove_partial_seqs.py $outdir/${db}_vs_${hmms[1]}_table.txt $outdir/${db}_partial_${hmms[1]}_to_remove.txt; cat $outdir/${db}_partial_${hmms[0]}_to_remove.txt $outdir/${db}_partial_${hmms[1]}_to_remove.txt > $outdir/${db}_partial_seqs_to_remove.txt; filter_fasta.py -f $rootdir/${db}.fasta -s $outdir/${db}_partial_seqs_to_remove.txt -n -o $rootdir/${db}_clean.fasta; python $rootdir/edit_U_to_T_rna.py $rootdir/${db}_clean.fasta $rootdir/${db}_clean-T.fasta" | qsub $qsub_param -N ${db}_clean; sleep 2
++ echo "source /home/evko1434/.bashrc; $hmmer -o $outdir/${db}_vs_${hmms[0]}.txt --noali --tblout $outdir/${db}_vs_${hmms[0]}_table.txt --acc -E 1e-5 --cpu 20 ${rootdir}/HMM3/${hmms[0]}.hmm $rootdir/${db}.fasta; $hmmer -o $outdir/${db}_vs_${hmms[1]}.txt --noali --tblout $outdir/${db}_vs_${hmms[1]}_table.txt --acc -E 1e-5 --cpu 20 ${rootdir}/HMM3/${hmms[1]}.hmm $rootdir/${db}.fasta; python3 $rootdir/remove_partial_seqs.py $outdir/${db}_vs_${hmms[0]}_table.txt $outdir/${db}_partial_${hmms[0]}_to_remove.txt; python3 $rootdir/remove_partial_seqs.py $outdir/${db}_vs_${hmms[1]}_table.txt $outdir/${db}_partial_${hmms[1]}_to_remove.txt; cat $outdir/${db}_partial_${hmms[0]}_to_remove.txt $outdir/${db}_partial_${hmms[1]}_to_remove.txt > $outdir/${db}_partial_seqs_to_remove.txt; filter_fasta.py -f $rootdir/${db}.fasta -s $outdir/${db}_partial_seqs_to_remove.txt -n -o $rootdir/${db}_clean.fasta; python3 $rootdir/edit_U_to_T_rna.py $rootdir/${db}_clean.fasta $rootdir/${db}_clean-T.fasta" | qsub $qsub_param -N ${db}_clean; sleep 2
+ done
+
+
+--- a/tests/test_sortmerna.py
++++ b/tests/test_sortmerna.py
+@@ -1,4 +1,4 @@
+-#!/usr/bin/env python
++#!/usr/bin/python3
+ """
+ Software tests for the SortMeRNA (development version)
+ ======================================================
+@@ -230,7 +230,7 @@ class SortmernaTests(TestCase):
+
+
+ def test_indexdb_default_param(self):
+- """ Test indexing a database using SortMeRNA
++ """ Test indexing a database using SortMeRNA
+ """
+ index_db = join(self.output_dir, "db_gg_13_8")
+ index_path = "%s,%s" % (self.db_gg_13_8, index_db)
+@@ -352,7 +352,7 @@ class SortmernaTests(TestCase):
+
+ stdout, stderr = proc.communicate()
+ if stderr:
+- print stderr
++ print(stderr)
+
+ f_log = open(aligned_basename + ".log", "U")
+ f_log_str = f_log.read()
+@@ -432,7 +432,7 @@ class SortmernaTests(TestCase):
+
+ stdout, stderr = proc.communicate()
+ if stderr:
+- print stderr
++ print(stderr)
+
+ f_log = open(aligned_basename + ".log", "U")
+ f_log_str = f_log.read()
+@@ -539,7 +539,7 @@ class SortmernaTests(TestCase):
+
+ stdout, stderr = proc.communicate()
+ if stderr:
+- print stderr
++ print(stderr)
+
+ f_log = open(aligned_basename + ".log", "U")
+ f_log_str = f_log.read()
+@@ -666,7 +666,7 @@ class SortmernaTests(TestCase):
+
+ stdout, stderr = proc.communicate()
+ if stderr:
+- print stderr
++ print(stderr)
+
+ f_log = open(aligned_basename + ".log", "U")
+ f_log_str = f_log.read()
+@@ -792,7 +792,7 @@ class SortmernaTests(TestCase):
+
+ stdout, stderr = proc.communicate()
+ if stderr:
+- print stderr
++ print(stderr)
+
+ f_log = open(aligned_basename + ".log", "U")
+ f_log_str = f_log.read()
+@@ -912,7 +912,7 @@ class SortmernaTests(TestCase):
+
+ stdout, stderr = proc.communicate()
+ if stderr:
+- print stderr
++ print(stderr)
+
+ f_log = open(aligned_basename + ".log", "U")
+ f_log_str = f_log.read()
+@@ -994,7 +994,7 @@ class SortmernaTests(TestCase):
+
+ stdout, stderr = proc.communicate()
+ if stderr:
+- print stderr
++ print(stderr)
+
+ # Correct number of clusters in OTU-map
+ with open(aligned_basename + ".log", 'U') as f_log:
+@@ -1059,7 +1059,7 @@ class SortmernaTests(TestCase):
+
+ stdout, stderr = proc.communicate()
+ if stderr:
+- print stderr
++ print(stderr)
+
+ f_log = open(aligned_basename + ".log", "U")
+ f_log_str = f_log.read()
+@@ -1118,7 +1118,7 @@ class SortmernaTests(TestCase):
+
+ stdout, stderr = proc.communicate()
+ if stderr:
+- print stderr
++ print(stderr)
+
+ f_log = open(aligned_basename + ".log", "U")
+ f_log_str = f_log.read()
+@@ -1177,7 +1177,7 @@ class SortmernaTests(TestCase):
+
+ stdout, stderr = proc.communicate()
+ if stderr:
+- print stderr
++ print(stderr)
+
+ f_log = open(aligned_basename + ".log", "U")
+ f_log_str = f_log.read()
+@@ -1251,7 +1251,7 @@ class SortmernaTests(TestCase):
+
+ stdout, stderr = proc.communicate()
+ if stderr:
+- print stderr
++ print(stderr)
+
+ sam_alignments_expected = [['GQ099317.1.1325_157_453_0:0:0_0:0:0_99/1',
+ '0',
+@@ -1335,7 +1335,7 @@ class SortmernaTests(TestCase):
+
+ stdout, stderr = proc.communicate()
+ if stderr:
+- print stderr
++ print(stderr)
+
+ expected_alignment = ["AB271211", "Unc49508", "93.4", "1412",
+ "64", "30", "59", "1470", "2", "1429", "0",
+@@ -1388,7 +1388,7 @@ class SortmernaTests(TestCase):
+
+ stdout, stderr = proc.communicate()
+ if stderr:
+- print stderr
++ print(stderr)
+
+ expected_alignment = """Sequence ID: Unc49508 count=1; cluster_weight=4; cluster=Unc49508; cluster_score=1.000000; cluster_center=True;
+ Query ID: AB271211 1487 residues
+@@ -1534,7 +1534,7 @@ Query: 1416 AGCTGGTCACGCCCGAAGTC
+
+ stdout, stderr = proc.communicate()
+ if stderr:
+- print stderr
++ print(stderr)
+
+ expected_alignment = ["AB271211", "Unc49508", "93.4", "1412", "64", "30", "59", "1470", "2", "1429", "0", "2041"]
+
=====================================
debian/patches/series
=====================================
@@ -0,0 +1 @@
+2to3.patch
=====================================
debian/rules
=====================================
@@ -23,6 +23,12 @@ override_dh_auto_build:
mkdir -p tmp
cat debian/README_scripts.txt rRNA_databases/README.txt > tmp/README.txt
+# Uses old interface of skbio (see README.source)
+#override_dh_auto_test:
+#ifeq (,$(filter nocheck,$(DEB_BUILD_OPTIONS)))
+# python3 ./tests/test_sortmerna.py
+#endif
+
override_dh_auto_install:
#Skip this - do it manually
true
=====================================
debian/upstream/metadata
=====================================
@@ -10,16 +10,18 @@ Reference:
Pages: 3211-3217
DOI: 10.1093/bioinformatics/bts611
PMID: 23071270
- URL: "http://bioinformatics.oxfordjournals.org/content/\
- 28/24/3211"
- eprint: "http://bioinformatics.oxfordjournals.org/content/\
- 28/24/3211.full.pdf+html"
+ URL: http://bioinformatics.oxfordjournals.org/content/28/24/3211
+ eprint: http://bioinformatics.oxfordjournals.org/content/28/24/3211.full.pdf+html
Registry:
- - Name: OMICtools
- Entry: OMICS_02619
- - Name: conda:bioconda
- Entry: sortmerna
- - Name: bio.tools
- Entry: sortmerna
- - Name: SciCrunch
- Entry: SCR_014402
+- Name: OMICtools
+ Entry: OMICS_02619
+- Name: conda:bioconda
+ Entry: sortmerna
+- Name: bio.tools
+ Entry: sortmerna
+- Name: SciCrunch
+ Entry: SCR_014402
+Bug-Database: https://github.com/biocore/sortmerna/issues
+Bug-Submit: jenya DT kopylov AT gmail DT fr
+Repository: https://github.com/biocore/sortmerna.git
+Repository-Browse: https://github.com/biocore/sortmerna
View it on GitLab: https://salsa.debian.org/med-team/sortmerna/compare/c54a24e0f3842a5959095dbfbcaa5f8d8fe2abcb...1b6545595e5c05e78c037ab527ca4a1bf32ee34c
--
View it on GitLab: https://salsa.debian.org/med-team/sortmerna/compare/c54a24e0f3842a5959095dbfbcaa5f8d8fe2abcb...1b6545595e5c05e78c037ab527ca4a1bf32ee34c
You're receiving this email because of your account on salsa.debian.org.
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://alioth-lists.debian.net/pipermail/debian-med-commit/attachments/20191225/abdb1a93/attachment-0001.html>
More information about the debian-med-commit
mailing list