[med-svn] [Git][med-team/hyphy][master] Remove superfluous files

Saira Hussain gitlab at salsa.debian.org
Fri Jul 5 16:34:37 BST 2019



Saira Hussain pushed to branch master at Debian Med / hyphy


Commits:
81847a39 by Saira Hussain at 2019-07-05T15:34:31Z
Remove superfluous files

- - - - -


10 changed files:

- − debian/tests/SimpleAnalyses/F81.bf
- − debian/tests/SimpleAnalyses/HKY85.bf
- − debian/tests/SimpleAnalyses/HKY85shared.bf
- − debian/tests/SimpleAnalyses/JC69.bf
- − debian/tests/SimpleAnalyses/K2P.bf
- − debian/tests/SimpleAnalyses/K2Pshared.bf
- − debian/tests/SimpleAnalyses/Non-Rev.bf
- − debian/tests/SimpleAnalyses/REV.bf
- − debian/tests/SimpleAnalyses/REVshared.bf
- − debian/tests/SimpleAnalyses/data/hiv.nuc


Changes:

=====================================
debian/tests/SimpleAnalyses/F81.bf deleted
=====================================
@@ -1 +0,0 @@
-/* This is an example HY-PHY Batch File.



   It reads in a '#' nucleotide dataset data/hiv.nuc and estimates

   maximum ln-likelihood based on the tree contained in the data file,

   using Felsenstein 81 model.

   

   Output is printed out as a Newick Style tree with branch lengths

   representing the number of expected substitutions per branch (which

   is the default setting for nucleotide models w/o rate variation).

   

   

   Sergei L. Kosakovsky Pond and Spencer V. Muse 

   December 1999. 

*/

/* 1. Read in the data and store the result in a DataSet variable.*/

DataSet 		nucleotideSequences = ReadDataFile ("data/hiv.nuc");


/* 2. Filter the data, specifying that all of the data is to be used
	  and that it is to be treated as nucleotides.*/
	 
DataSetFilter	filteredData = CreateFilter (nucleotideSequences,1);

/* 3. Collect observed nucleotide frequencies from the filtered data. observedFreqs will
	  store the vector of frequencies. */

HarvestFrequencies (observedFreqs, filteredData, 1, 1, 1);

/* 4. Define the F81 substitution matrix. '*' is defined to be -(sum of off-diag row elements) */

F81RateMatrix = 
		{{*,mu,mu,mu}
		 {mu,*,mu,mu}
		 {mu,mu,*,mu}
		 {mu,mu,mu,*}};

/*5.  Define the F81 models, by combining the substitution matrix with the vector of observed (equilibrium)
	  frequencies. */
	  

Model 	F81 = (F81RateMatrix, observedFreqs);

/*6.  Now we can define the tree variable, using the tree string read from the data file,
	  and, by default, assigning the last defined model (F81) to all tree branches. */

Tree	givenTree = DATAFILE_TREE;


/*7.  Since all the likelihood function ingredients (data, tree, equilibrium frequencies)
	  have been defined we are ready to construct the likelihood function. */

LikelihoodFunction  theLnLik = (filteredData, givenTree);

/*8.  Maximize the likelihood function, storing parameter values in the matrix paramValues */

Optimize (paramValues, theLnLik);

/*9.  Print the tree with optimal branch lengths to the console. */

fprintf  (stdout, theLnLik);

\ No newline at end of file


=====================================
debian/tests/SimpleAnalyses/HKY85.bf deleted
=====================================
@@ -1 +0,0 @@
-/* This is an example HY-PHY Batch File.

   It reads in a '#' nucleotide dataset data/hiv.nuc and estimates
   maximum ln-likelihood based on the tree contained in the data file,
   using Hasegawa et all 85 (HKY 85) model with transition/transversion ratio
   estimated independently for all branches.

   

   Output is printed out as a Newick Style tree with branch lengths
   representing the number of expected substitutions per branch (which
   is the default setting for nucleotide models w/o rate variation).

   Sergei L. Kosakovsky Pond and Spencer V. Muse 
   December 1999. 
*/


/* 1. Read in the data and store the result in a DataSet variable.*/

DataSet 		nucleotideSequences = ReadDataFile ("data/hiv.nuc");

/* 2. Filter the data, specifying that all of the data is to be used
	  and that it is to be treated as nucleotides.*/

DataSetFilter	filteredData = CreateFilter (nucleotideSequences,1);

/* 3. Collect observed nucleotide frequencies from the filtered data. observedFreqs will
	  store the vector of frequencies. */

HarvestFrequencies (observedFreqs, filteredData, 1, 1, 1);

/* 4. Define the KHY substitution matrix. '*' is defined to be -(sum of off-diag row elements) */

HKY85RateMatrix = 

		{{*,trvs,trst,trvs}
		 {trvs,*,trvs,trst}
		 {trst,trvs,*,trvs}
		 {trvs,trst,trvs,*}};

/*5.  Define the HKY85 model, by combining the substitution matrix with the vector of observed (equilibrium)
	  frequencies. */

Model HKY85	 = (HKY85RateMatrix, observedFreqs);

/*6.  Now we can define the tree variable, using the tree string read from the data file,
	  and, by default, assigning the last defined model (HKY85) to all tree branches. */

Tree	givenTree = DATAFILE_TREE;

/*7.  Since all the likelihood function ingredients (data, tree, equilibrium frequencies)
	  have been defined we are ready to construct the likelihood function. */

LikelihoodFunction  theLnLik = (filteredData, givenTree);

/*8.  Maximize the likelihood function, storing parameter values in the matrix paramValues */

Optimize (paramValues, theLnLik);

/*9.  Print the tree with optimal branch lengths to the console. */

fprintf  (stdout, theLnLik);


   

\ No newline at end of file


=====================================
debian/tests/SimpleAnalyses/HKY85shared.bf deleted
=====================================
@@ -1 +0,0 @@
-/* This is an example HY-PHY Batch File.



   It reads in a '#' nucleotide dataset data/hiv.nuc and estimates

   maximum ln-likelihood based on the tree contained in the data file,

   using Hasegawa et all 85 (HKY 85) model with transition/transversion ratio

   shared by all branches.

   

   Output is printed out as a Newick Style tree with branch lengths

   representing the number of expected substitutions per branch (which

   is the default setting for nucleotide models w/o rate variation).

   

   

   Sergei L. Kosakovsky Pond and Spencer V. Muse 

   December 1999. 

*/



/* 1. Read in the data and store the result in a DataSet variable.*/



DataSet 		nucleotideSequences = ReadDataFile ("data/hiv.nuc");

   

/* 2. Filter the data, specifying that all of the data is to be used

	  and that it is to be treated as nucleotides.*/

	  

DataSetFilter	filteredData = CreateFilter (nucleotideSequences,1);



/* 3. Collect observed nucleotide frequencies from the filtered data. observedFreqs will

	  store the vector of frequencies. */



HarvestFrequencies (observedFreqs, filteredData, 1, 1, 1);



/* 4. Define the KHY substitution matrix. '*' is defined to be -(sum of off-diag row elements).

	  The variable R is the global transition/transversion ratio.  */



global   R;



HKY85RateMatrix = 

		{{*,trvs,R*trvs,trvs}

		 {trvs,*,trvs,R*trvs}

		 {R*trvs,trvs,*,trvs}

		 {trvs,R*trvs,trvs,*}};

		 

/*5.  Define the HKY85 model, by combining the substitution matrix with the vector of observed (equilibrium)

	  frequencies. */

	  

Model HKY85	 = (HKY85RateMatrix, observedFreqs);



/*6.  Now we can define the tree variable, using the tree string read from the data file,

	  and, by default, assigning the last defined model (HKY85) to all tree branches. */

	  

Tree	givenTree = DATAFILE_TREE;



/*7.  Since all the likelihood function ingredients (data, tree, equilibrium frequencies)

	  have been defined we are ready to construct the likelihood function. */

	  

LikelihoodFunction  theLnLik = (filteredData, givenTree);



/*8.  Maximize the likelihood function, storing parameter values in the matrix paramValues */



Optimize (paramValues, theLnLik);



/*9.  Print the tree with optimal branch lengths to the console. */



fprintf  (stdout, theLnLik);

		 

   

\ No newline at end of file


=====================================
debian/tests/SimpleAnalyses/JC69.bf deleted
=====================================
@@ -1 +0,0 @@
-/* This is an example HY-PHY Batch File.



   It reads in a '#' nucleotide dataset data/hiv.nuc and estimates

   maximum ln-likelihood based on the tree contained in the data file,

   using Jukes Cantor 69 model.

   

   Output is printed out as a Newick Style tree with branch lengths

   representing the number of expected substitutions per branch (which

   is the default setting for nucleotide models w/o rate variation).

   

   

   Sergei L. Kosakovsky Pond and Spencer V. Muse 

   December 1999. 

*/



/* 1. Read in the data and store the result in a DataSet variable.*/



DataSet 		nucleotideSequences = ReadDataFile ("data/hiv.nuc");

   

/* 2. Filter the data, specifying that all of the data is to be used

	  and that it is to be treated as nucleotides.*/

	  

DataSetFilter	filteredData = CreateFilter (nucleotideSequences,1);



/* 3. Define the F81 substitution matrix. '*' is defined to be -(sum of off-diag row elements) */



JC69RateMatrix = 

		{{*,mu,mu,mu}

		 {mu,*,mu,mu}

		 {mu,mu,*,mu}

		 {mu,mu,mu,*}};

		 

/*4.  Define the F81 models, by combining the substitution matrix with the vector of equal equilibrim

	  frequencies. */



equalFreqs = {{.25}{.25}{.25}{.25}};



Model 	F81 = (JC69RateMatrix, equalFreqs);



/*5.  Now we can define the tree variable, using the tree string read from the data file,

	  and, by default, assigning the last defined model (JC69) to all tree branches. */

	  

Tree	givenTree = DATAFILE_TREE;



/*6.  Since all the likelihood function ingredients (data, tree, equilibrium frequencies)

	  have been defined we are ready to construct the likelihood function. */

	  

LikelihoodFunction  theLnLik = (filteredData, givenTree);



/*7.  Maximize the likelihood function, storing parameter values in the matrix paramValues */



Optimize (paramValues, theLnLik);



/*8.  Print the tree with optimal branch lengths to the console. */



fprintf  (stdout, theLnLik);

		 

   

\ No newline at end of file


=====================================
debian/tests/SimpleAnalyses/K2P.bf deleted
=====================================
@@ -1 +0,0 @@
-/* This is an example HY-PHY Batch File.



   It reads in a '#' nucleotide dataset data/hiv.nuc and estimates

   maximum ln-likelihood based on the tree contained in the data file,

   using Kimura 2 parameter model with transition/transversion ratio

   estimated independently for all branches.

   

   Output is printed out as a Newick Style tree with branch lengths

   representing the number of expected substitutions per branch (which

   is the default setting for nucleotide models w/o rate variation).

   

   

   Sergei L. Kosakovsky Pond and Spencer V. Muse 

   December 1999. 

*/



/* 1. Read in the data and store the result in a DataSet variable.*/



DataSet 		nucleotideSequences = ReadDataFile ("data/hiv.nuc");

   

/* 2. Filter the data, specifying that all of the data is to be used

	  and that it is to be treated as nucleotides.*/

	  

DataSetFilter	filteredData = CreateFilter (nucleotideSequences,1);



/* 3. Define the K2P substitution matrix. '*' is defined to be -(sum of off-diag row elements) */



K2PRateMatrix = 

		{{*,trvs,trst,trvs}

		 {trvs,*,trvs,trst}

		 {trst,trvs,*,trvs}

		 {trvs,trst,trvs,*}};

		 

/*4.  Define the K2P model, by combining the substitution matrix with the vector of equal equilibrium

	  frequencies. */

	  

equalFreqs = {{.25}{.25}{.25}{.25}}; 



Model K2P	 = (K2PRateMatrix, equalFreqs);



/*5.  Now we can define the tree variable, using the tree string read from the data file,

	  and, by default, assigning the last defined model (K2P) to all tree branches. */

	  

Tree	givenTree = DATAFILE_TREE;



/*6.  Since all the likelihood function ingredients (data, tree, equilibrium frequencies)

	  have been defined we are ready to construct the likelihood function. */

	  

LikelihoodFunction  theLnLik = (filteredData, givenTree);



/*7.  Maximize the likelihood function, storing parameter values in the matrix paramValues */



Optimize (paramValues, theLnLik);



/*8.  Print the tree with optimal branch lengths to the console. */



fprintf  (stdout, theLnLik);

		 

   

\ No newline at end of file


=====================================
debian/tests/SimpleAnalyses/K2Pshared.bf deleted
=====================================
@@ -1 +0,0 @@
-/* This is an example HY-PHY Batch File.



   It reads in a '#' nucleotide dataset data/hiv.nuc and estimates

   maximum ln-likelihood based on the tree contained in the data file,

   using Kimura 2 parameter model with shared transition/transversion ratio

   accross all branches.

   

   Output is printed out as a Newick Style tree with branch lengths

   representing the number of expected substitutions per branch (which

   is the default setting for nucleotide models w/o rate variation).

   

   

   Sergei L. Kosakovsky Pond and Spencer V. Muse 

   December 1999. 

*/



/* 1. Read in the data and store the result in a DataSet variable.*/



DataSet 		nucleotideSequences = ReadDataFile ("data/hiv.nuc");

   

/* 2. Filter the data, specifying that all of the data is to be used

	  and that it is to be treated as nucleotides.*/

	  

DataSetFilter	filteredData = CreateFilter (nucleotideSequences,1);



/* 3. Define the K2P substitution matrix. '*' is defined to be -(sum of off-diag row elements)

	  The variable R is the global transition/transversion ratio.  */



global	R;



K2PRateMatrix = 

		{{*,mu,R*mu,mu}

		 {mu,*,mu,R*mu}

		 {R*mu,mu,*,mu}

		 {mu,R*mu,mu,*}};

		 

/*4.  Define the K2P model, by combining the substitution matrix with the vector of equal equilibrium

	  frequencies. */

	  

equalFreqs = {{.25}{.25}{.25}{.25}}; 



Model K2P	 = (K2PRateMatrix, equalFreqs);



/*5.  Now we can define the tree variable, using the tree string read from the data file,

	  and, by default, assigning the last defined model (K2P) to all tree branches. */

	  

Tree	givenTree = DATAFILE_TREE;



/*6.  Since all the likelihood function ingredients (data, tree, equilibrium frequencies)

	  have been defined we are ready to construct the likelihood function. */

	  

LikelihoodFunction  theLnLik = (filteredData, givenTree);



/*7.  Maximize the likelihood function, storing parameter values in the matrix paramValues */



Optimize (paramValues, theLnLik);



/*8.  Print the tree with optimal branch lengths to the console. */



fprintf  (stdout, theLnLik);

		 

   

\ No newline at end of file


=====================================
debian/tests/SimpleAnalyses/Non-Rev.bf deleted
=====================================
@@ -1 +0,0 @@
-/* This is an example HY-PHY Batch File.



   It reads in a '#' nucleotide dataset data/hiv.nuc and estimates
   maximum ln-likelihood based on the tree contained in the data file,
   using the general non-reversible 12 parameter (with 3 constraints)
   model. The tree from the data file is unrooted. 

   

   Output is printed out as a Newick Style tree with branch lengths
   representing the number of expected substitutions per branch (which
   is the default setting for nucleotide models w/o rate variation).


   Sergei L. Kosakovsky Pond and Spencer V. Muse 

   November 2002. 

*/

/* 1. Read in the data and store the result in a DataSet variable.*/

DataSet 		nucleotideSequences = ReadDataFile ("data/hiv.nuc");

/* 2. Filter the data, specifying that all of the data is to be used
	  and that it is to be treated as nucleotides.*/
	 
DataSetFilter	filteredData = CreateFilter (nucleotideSequences,1);

/* 3. Collect observed nucleotide frequencies from the filtered data. observedFreqs will
	  store the vector of frequencies. */

HarvestFrequencies (observedFreqs, filteredData, 1, 1, 1);

/* 4. Define the 12 parameter non-reversible substitution matrix. 
The constraints on some of the substitution rates are necessary to
ensure that observed nucleotide frequencies are equilibrium 
frequencies for the model.

'*' is defined to be -(sum of off-diag row elements) */

/* frequency ratios */
	 
r0 = observedFreqs[0]/observedFreqs[3];
r1 = observedFreqs[1]/observedFreqs[3];
r2 = observedFreqs[2]/observedFreqs[3];

/* All the global rate parameters are defined relative to 
the rate for A->C. For instance, CG represents the ratio
of the rates C->G/A->C. */

global AG;
global AT;
global CA;
global CG;
global CT;
global GA;
global GC;
global GT;

/* note that these constraints are 
satisfied if we restrict the model to the
general reversible case */

global TA:=AT+(1-CA)*r1__+(AG-GA)*r2__;
global TC:=CT+(CA-1)*r0__+(CG-GC)*r2__;
global TG:=GT+(GA-AG)*r0__+(GC-CG)*r1__;


NRRateMatrix = 
		{{*,t,t*AG,t*AT}
		 {t*CA,*,t*CG,t*CT}
		 {t*GA,t*GC,*,t*GT}
		 {t*TA,t*TC,t*TG,*}};

/*5.  Define the Non-Rev model, by combining the substitution matrix with the vector of observed (equilibrium)
	  frequencies. */
	  
Model 	NRM = (NRRateMatrix, observedFreqs);

/*6.  Now we can define the tree variable, using the tree string read from the data file,
	  and, by default, assigning the last defined model (NRM) to all tree branches. */

Tree	givenTree = DATAFILE_TREE;

/*7.  Since all the likelihood function ingredients (data, tree, equilibrium frequencies)
	  have been defined we are ready to construct the likelihood function. */

LikelihoodFunction  theLnLik = (filteredData, givenTree);

/*8.  Maximize the likelihood function, storing parameter values in the matrix paramValues */

Optimize (paramValues, theLnLik);

/*9.  Print the tree with optimal branch lengths to the console. */

fprintf  (stdout, theLnLik);

\ No newline at end of file


=====================================
debian/tests/SimpleAnalyses/REV.bf deleted
=====================================
@@ -1 +0,0 @@
-/* This is an example HY-PHY Batch File.



   It reads in a '#' nucleotide dataset data/hiv.nuc and estimates

   maximum ln-likelihood based on the tree contained in the data file,

   using the General Reversible model with all 6 parameters

   estimated independently for all branches.

   

   Output is printed out as a Newick Style tree with branch lengths

   representing the number of expected substitutions per branch (which

   is the default setting for nucleotide models w/o rate variation).

   

   

   Sergei L. Kosakovsky Pond and Spencer V. Muse 

   December 1999. 

*/



/* 1. Read in the data and store the result in a DataSet variable.*/



DataSet 		nucleotideSequences = ReadDataFile ("data/hiv.nuc");

   

/* 2. Filter the data, specifying that all of the data is to be used

	  and that it is to be treated as nucleotides.*/

	  

DataSetFilter	filteredData = CreateFilter (nucleotideSequences,1);



/* 3. Collect observed nucleotide frequencies from the filtered data. observedFreqs will

	  store the vector of frequencies. */



HarvestFrequencies (observedFreqs, filteredData, 1, 1, 1);



/* 4. Define the KHY substitution matrix. '*' is defined to be -(sum of off-diag row elements) */



REVRateMatrix = 

		{{*,a,b,c}

		 {a,*,d,e}

		 {b,d,*,f}

		 {c,e,f,*}};

		 

/*5.  Define the REV model, by combining the substitution matrix with the vector of observed (equilibrium)

	  frequencies. */

	  

Model REV	 = (REVRateMatrix, observedFreqs);



/*6.  Now we can define the tree variable, using the tree string read from the data file,

	  and, by default, assigning the last defined model (REV) to all tree branches. */

	  

Tree	givenTree = DATAFILE_TREE;



/*7.  Since all the likelihood function ingredients (data, tree, equilibrium frequencies)

	  have been defined we are ready to construct the likelihood function. */

	  

LikelihoodFunction  theLnLik = (filteredData, givenTree);



/*8.  Maximize the likelihood function, storing parameter values in the matrix paramValues */



Optimize (paramValues, theLnLik);



/*9.  Print the tree with optimal branch lengths to the console. */



fprintf  (stdout, theLnLik);

		 

   

\ No newline at end of file


=====================================
debian/tests/SimpleAnalyses/REVshared.bf deleted
=====================================
@@ -1 +0,0 @@
-/* This is an example HY-PHY Batch File.



   It reads in a '#' nucleotide dataset data/hiv.nuc and estimates

   maximum ln-likelihood based on the tree contained in the data file,

   using the General Reversible model with the parameters

   shared by all branches.

   

   Output is printed out as a Newick Style tree with branch lengths

   representing the number of expected substitutions per branch (which

   is the default setting for nucleotide models w/o rate variation).

   

   

   Sergei L. Kosakovsky Pond and Spencer V. Muse 

   December 1999. 

*/



/* 1. Read in the data and store the result in a DataSet variable.*/



DataSet 		nucleotideSequences = ReadDataFile ("data/hiv.nuc");

   

/* 2. Filter the data, specifying that all of the data is to be used

	  and that it is to be treated as nucleotides.*/

	  

DataSetFilter	filteredData = CreateFilter (nucleotideSequences,1);



/* 3. Collect observed nucleotide frequencies from the filtered data. observedFreqs will

	  store the vector of frequencies. */



HarvestFrequencies (observedFreqs, filteredData, 1, 1, 1);



/* 4. Define the KHY substitution matrix. '*' is defined to be -(sum of off-diag row elements).

	  AG,AT,CG,CT,GT are the shared parameters, representing the ratio
	  of corresponding substitution rates to the AC rate.
	  t is the "branch length"*/



global AG;

global AT;

global CG;

global CT;

global GT;



REVRateMatrix = 

		{{*,t,AG*t,AT*t}

		 {t,*,CG*t,CT*t}

		 {AG*t,CG*t,*,GT*t}

		 {AT*t,CT*t,GT*t,*}};

		 

/*5.  Define the REV model, by combining the substitution matrix with the vector of observed (equilibrium)

	  frequencies. */

	  

Model REV	 = (REVRateMatrix, observedFreqs);



/*6.  Now we can define the tree variable, using the tree string read from the data file,

	  and, by default, assigning the last defined model (REV) to all tree branches. */

	  

Tree	givenTree = DATAFILE_TREE;



/*7.  Since all the likelihood function ingredients (data, tree, equilibrium frequencies)

	  have been defined we are ready to construct the likelihood function. */

	  

LikelihoodFunction  theLnLik = (filteredData, givenTree);



/*8.  Maximize the likelihood function, storing parameter values in the matrix paramValues */



Optimize (paramValues, theLnLik);



/*9.  Print the tree with optimal branch lengths to the console. */



fprintf  (stdout, theLnLik);

		 

   

\ No newline at end of file


=====================================
debian/tests/SimpleAnalyses/data/hiv.nuc deleted
=====================================
@@ -1 +0,0 @@
-#719
ATAGTAATTAGATCTGAAAACTTCTCGAACAATGCTAAAACCATAATAGTACAGCTAAAT
AAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAGTATACAT
TTCGGACCAGGGAAAGCATTTTATGCAGGAGAAATAATAGGAGATATAAGACAAGCA
TATTGTACTCTTAATGGAGCAGAATGGAATAACACTGTAAAACAGGTAGCTGCAAAATTA
AGAGAAAAATTTAATAAAACAATAATCTTTAATCAATCC
#136
GTAGTAATTAGATCTGAAAACTTCTCGAACAATGCTAAAACCATAATAGTACAGCTAAAT
AAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAGTATACAT
TTTGGACCAGGGAAAGCATTTTATGCAGGAGAAATAATAGGAGATATAAGACAAGCA
TATTGTACCCTTAATGGAACAGAATGGAATAACACTTTAAAACAGGTAGCTGAAAAATTA
AGAGAACAATTTATTAAAACAATAGTTTTTAATCAATCC
#135
GTAGTAATTAGATCTGAAAACTTCACGAACAATGCTAAAACCATAATAGTACAGCTAAAT
AAATCTGTAGAAATTAATTGTGTAAGACCCGGCAACAATACAAGAAGAAGTATACAT
ATAGGACCAGGGAGAGCATATTATACAGGAGAAGTAATAGGAGATATAAGACAAGCA
CATTGTAACCTTAGTAGAACAGACTGGAATAAAACTTTAAAACAGGTAGCTGAAAAATTA
AGAGAACAATTTAATACAACAATAGTCTTTAATCAATCC
#105r
ATAGTAATTAGATCTGAAAACTTCACGAACAATGCTAAAACCATAATAGTACAGCTAAAT
AAATCTGTAGAAATTAAGTGTGAAAGACCCAACAACAATACAAGAAAAAGTGTACAT
ATAGGACCAGGGAAAGCATATTATACAGGAGAAATAATAGGAGATATAAGACAAGCA
CATTGTAACCTTAGTGGAACAGAATGGAGGGAAACTTTAAAACAGGTAGCTGAAAAATTA
AGAGAACAATTTAATAAAACAATAGTCTTTAATCAATCC
#529
ATAGTAATTAGATCTGAAAACTTCACGAACAATGCTAAAACCATAATAGTACATCTAAAT
GAATCTGTAGAAATTATTTGTGAAAGACCCAACAACAATACAAGAAAAAGTGTACAT
ATGGGACCAGGGAGAGCATATTACACAGGAGAAATAATAGGAGATATAAGACAAGCA
CATTGTAACATTAGTAGAACAAATTGGACGGAAACTTTAAAACAGGTAGCTGAAAAATTA
AGAGAACAATTTAATAAAACAATAGTCTTTAATCAATCC
#317
GTAGTAATTAGATCTGAAAACTTCACGAACAATGCTAAGACCATAATAGTACAGCTAAAT
AAACCTGTAAAAATTAATTGTACAAGACCCAACAACAATGCAAAAATAAGAATACAT
ATAGGACCAGGGAGACCATTTTATACAGCAGGAGAAATAGGAAATATAAGACAAGCA
CATTGTAACCTTAGTAGAACAGACTGGAATAACACTTTAAAACTGGTAGCTGAAAAATTA
AGAGAACAATTTAATAAAACAATAGTCTTTAATCAATCC
#6767
GTAGTAATTAGATCTGAAAACTTCACGAACAATGCTAAGACCATAATAGTACAGCTAAAT
AACTCTGTAACAATTAAGTGTGAAAGACCCAACAACAATACAAGAAAAAGTATACCT
ATAGGACCAGGGAGAGCCTTTTATACAACAGGAGACATAGGAGATATAAGACAAGCA
CATTGTAACCTTAGTAGAAAAGACTGGAATGACACTTTAAGACAGGTAGTTGGAAAGTTA
AGAGAACAATTTGGAAGAACAATAATCTTTAATCAATCC
#6760
ATAGTAATTAGATCTGAAAACTTCACGAACAATGCTAAAACCATAATAGTACAGCTAAAG
GAACCTGTAAACATTACTTGTGAAAGACCCAGCAACAATACAAGAAAAAGTATACAT
ATAGGACCAGGAAAAGCATTTTATGCAACAGGAGAAATAGGAGATATAAGACGAGCA
CATTGTAACCTTAATAGAACAGCATGGAATAAAACTTTAAAACAGGTAGTTGAAAAATTA
AGAGAACAATTTAAGAAAACAATAACCTTTAACCAATCC
#9939
ATAGTAATCAGATCTGAAAACTTCTCGGACAATGCTAAAACCATAATAGTACAGCTAAAC
AACACTGTAAACATTACTTGTGAAAGACCCAACAACAATACAAGAAAAAGGATACAT
ATAGGACCAGGGAGAGCAGTTTATACAACAGGACAAATAGGAGATATAAGAAAAGCA
CATTGTAACCTTAGTAGAACAAATTGGACTGAAACTTTAAGACAAGTAGCTGAAAAATTA
AAAGAACAATTTAATAAAACAATAATCTTTAATAATTCC
#113
GTAGTAATTCGATCTGAAAACTTCACGGACAATGCTAAAACCATAATAGTACAGCTAAAC
AAATCTGTAGAAATTACTTGTGTAAGACCCAACAACAATACAAGAAAAAGTATAAAT
ATAAGACCAGGGAGAGCATTTTATACAACAGGAGAAATAGGAGATATAAGACAAGCA
CATTGTAACCTTAGTAGAACAGCATGGAATGAAGCTTTAAGACAAGTAGCTAAAAAATTA
AAAGAACAATTTAATAGAACAATAGTCTTTAATCAATCC
#822
ATAGTAATTAGATCTGAAAACTTCACAGACAATGCTAAAACCATAATAGTACAGCTAAAC
AAATCTGTAGAAATTAATTGTATAAGACCCAACAACAATACAAGAAAAAGTATACAT
ATAGGACCAGGGAGAGCATTTTATACAACAGGAGACATAGGAGATATAAGACAAGCA
TATTGTAACCTTAGTAGAACAGCATGGAATGAAACTTTAAGACAAGTAGCTCAAAAATTA
AAAGAACAATTTAATAGAACAATAGTCTTTAATCAATCC
#159
ATAGTAATTAGATCTGAAAACTTCACAGACAATGCTAAAACCATAATAGTACAGCTAAAT
AAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
ATAGGACCAGGGAGAGCTTTTTATACAACAGGTGAAATAGGAGATTTAAGACAAGCA
CATTGTAACCTTAGTAGAACAGCATGGAATGAAACTTTAAGACAAGTAGCTAAAAAATTA
AAAGAACAATTTAATAGAACAATAGTTTTTAATCAATCC
#256
ATAGTAATTAGATCTGAAAACTTCACGGACAATGCTAAAACCATAATAGTACAGCTAAAT
AAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
ATAGGACCAGGGAGAGCATTTTATACAACAGGTGAAATAGGAAATTTAAGACAAGCA
CATTGTAACCTTAGTAGAACAGCATGGAATGAAACTTTAAGACAAGTAGCTAAAAAACTA
AAAGAACAATTTAATAGAACAATAGTTTTTAATCAATCC

(((317,6767),((135,(529,105r)),(719,136))),6760,((113,9939),(256,(822,159))))
\ No newline at end of file



View it on GitLab: https://salsa.debian.org/med-team/hyphy/commit/81847a3989b039559dddcfbd43f13fc9c2269a26

-- 
View it on GitLab: https://salsa.debian.org/med-team/hyphy/commit/81847a3989b039559dddcfbd43f13fc9c2269a26
You're receiving this email because of your account on salsa.debian.org.


-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://alioth-lists.debian.net/pipermail/debian-med-commit/attachments/20190705/de6d10bb/attachment-0001.html>


More information about the debian-med-commit mailing list