[med-svn] [Git][med-team/mapdamage][upstream] New upstream version 2.1.1+dfsg

Steffen Möller gitlab at salsa.debian.org
Sat Nov 30 18:07:55 GMT 2019 


Steffen Möller pushed to branch upstream at Debian Med / mapdamage


Commits:
e01d28dc by Steffen Moeller at 2019-11-30T17:52:20Z
New upstream version 2.1.1+dfsg
- - - - -


15 changed files:

- README.md
- bin/mapDamage
- mapdamage/Rscripts/stats/function.R
- + mapdamage/mp_test.py
- − mapdamage/rescale_test.py
- − mapdamage/rescale_test/long_align/pe.sam
- − mapdamage/rescale_test/long_align/pe_output/Stats_out_MCMC_correct_prob.csv
- − mapdamage/rescale_test/long_align/ref.fa
- − mapdamage/rescale_test/pe_test/pe.sam
- − mapdamage/rescale_test/pe_test/pe_output/Stats_out_MCMC_correct_prob.csv
- − mapdamage/rescale_test/pe_test/pe_rescaled_correct.sam
- − mapdamage/rescale_test/pe_test/ref.fa
- + mapdamage/tests/dnacomp.txt
- + mapdamage/tests/fake1.fasta
- + mapdamage/tests/test.bam


Changes:

=====================================
README.md
=====================================
@@ -1,18 +1,19 @@
+## mapDamage
+
+[![install with bioconda](https://img.shields.io/badge/install%20with-bioconda-brightgreen.svg?style=flat)](http://bioconda.github.io/recipes/mapdamage2/README.html) [![Conda](https://img.shields.io/conda/dn/bioconda/mapdamage2.svg)](https://anaconda.org/bioconda/mapdamage2/files)
+
+---
+
 ### Important
 Users with versions dating prior to June 12 2013 please update. A nasty bug that caused the statistical part of `mapDamage` to use half of the data for estimation of the damage parameters, sorry for the inconvenience.
 
 ### Introduction
 Complete documentation, instructions, examples, screenshots and FAQ are available at [this address](http://ginolhac.github.io/mapDamage/).
 
-[mapDamage2](http://geogenetics.ku.dk/publications/mapdamage2.0/) is a computational framework written in Python and R, which tracks and quantifies DNA damage patterns
+[mapDamage2](http://geogenetics.ku.dk/publications/mapdamage2.0/) is a computational framework written in **Python3** and **R**, which tracks and quantifies DNA damage patterns
 among ancient DNA sequencing reads generated by Next-Generation Sequencing platforms.
 
-`mapDamage` is developed at the [Centre for GeoGenetics](http://geogenetics.ku.dk/) by the [Orlando Group ](http://geogenetics.ku.dk/research/research_groups/palaeomix_group/).
-
-### Web interface
-
-Anna Kostikova from [insideDNA](https://insidedna.me) implemented a web interface for mapDamage.  
-Users can adjust the cloud resources in terms of RAM/CPU to perform their analysis. She wrote a [tutorial](https://insidedna.me/tutorials/view/Analysis-ancient-DNA-samples-using-mapDamage) explaining how to use this [web interface (sign up required)](https://insidedna.me/app#/tools/100648/)
+`mapDamage` was developed at the [Centre for GeoGenetics](http://geogenetics.ku.dk/) by the [Orlando Group ](http://geogenetics.ku.dk/research/research_groups/palaeomix_group/).
 
 
 ### Citation
@@ -22,12 +23,21 @@ Jónsson H, Ginolhac A, Schubert M, Johnson P, Orlando L.
 _Bioinformatics_ 23rd April 2013. doi: 10.1093/bioinformatics/btt193](http://bioinformatics.oxfordjournals.org/content/early/2013/05/17/bioinformatics.btt193)
 
 
-The original mapDamage1 is described in the following article:  
+The original `mapDamage1` was published in the following article:  
 Ginolhac A, Rasmussen M, Gilbert MT, Willerslev E, Orlando L.
 [mapDamage: testing for damage patterns in ancient DNA sequences. _Bioinformatics_ 2011 **27**(15):2153-5
 http://bioinformatics.oxfordjournals.org/content/27/15/2153](http://bioinformatics.oxfordjournals.org/content/27/15/2153)
 
 
+### Test
+
+in the package, you can test `mapDamage` by running:
+
+```
+cd mapDamage/mapdamage/
+python3 mp_test.py
+```
+
 
 ### Contact
 Please report bugs and suggest possible improvements to Aurélien Ginolhac, Mikkel Schubert or Hákon Jónsson by email:


=====================================
bin/mapDamage
=====================================
@@ -139,6 +139,20 @@ def _check_mm_option():
             raise SystemExit("The --mapdamage-modules path (path=%s) must contain the mapdamage module" % path_to_mm)
     return path_to_mm
 
+def is_paired(alignfile):
+    """
+    check if an alignment file contains paired end data by
+    looking at the first 100 reads
+    """
+
+    n = 0
+    for read in alignfile:
+        if read.is_paired:
+            return True
+        n += 1
+        if n == 100:
+            return False
+
 
 def main():
     start_time = time.time()
@@ -227,6 +241,13 @@ def main():
     else:
         in_bam = pysam.Samfile(options.filename)
 
+    # exit SAM/BAM is paired (look at top 100 reads)
+    if is_paired(in_bam):
+        logger.error("alignment file must be single-ended")
+        sys.stderr.write("alignment file must be single-ended\n")
+        sys.exit(1)
+    # reset SAM/BAM to the begining
+    in_bam = pysam.Samfile(options.filename)
 
     reflengths = dict(list(zip(in_bam.references, in_bam.lengths)))
     # check if references in SAM/BAM are the same in the fasta reference file


=====================================
mapdamage/Rscripts/stats/function.R
=====================================
@@ -595,8 +595,8 @@ calcSampleStats <- function(da,X){
                       pos=da[,"Pos"],
                       mea=apply(X,1,mean),
                       med=apply(X,1,median),
-                      loCI=apply(X,1,quantile,c(0.025)),
-                      hiCI=apply(X,1,quantile,c(0.975))
+                      loCI=apply(X,1,quantile,c(0.025), na.rm = TRUE),
+                      hiCI=apply(X,1,quantile,c(0.975), na.rm = TRUE)
                       ))
 }
 


=====================================
mapdamage/mp_test.py
=====================================
@@ -0,0 +1,18 @@
+import unittest
+import subprocess
+
+
+def read_nocomment(dnacomp):
+    with open(dnacomp, 'r') as f:
+        a = f.readlines()
+        return [x for x in a if not x.startswith('#')]
+
+class testCases(unittest.TestCase):
+
+    def test_no_stats(self):
+        """regular mapDamage"""
+        subprocess.run(["mapDamage",  "-i",  "tests/test.bam", "-r", "tests/fake1.fasta", "-d", "tests/results", "--no-stats"], check = True)
+        self.assertTrue(read_nocomment("tests/dnacomp.txt") == read_nocomment("tests/results/dnacomp.txt"))
+
+if  __name__=='__main__':
+    unittest.main()


=====================================
mapdamage/rescale_test.py deleted
=====================================
@@ -1,57 +0,0 @@
-import unittest
-import optparse
-from . import rescale
-import pysam
-import filecmp
-
-def mock_options(filename,rescale_out,folder):
-    """Make the options object with nice values for testing"""
-    return optparse.Values({
-        "filename":filename,
-        "rescale_out":rescale_out,
-        "verbose":True,
-        "folder":folder,
-        "quiet":True
-        })
-
-
-class testPairedFile(unittest.TestCase):
-    """Tests if rescaling of a paired end file"""
-    def test_paired_end_file(self):
-        """Test, paired end SAM file"""
-        # here is the example
-        # >ref
-        # 5p CGA AAA CGA 3p
-        # 3p GCT TTT GCT 5p
-        # >r001/1
-        # CGA
-        # >r001/2
-        # GCA
-        # The sam file looks like this
-        #@HD VN:1.5 SO:coordinate
-        #@SQ SN:ref LN:9
-        #r001 163 ref 1 30 3M = 7 9 CGA III MR:f:0 #the normal ones
-        #r001 83 ref 7 30 3M = 1 -9 TCG III MR:f:0
-        #r002 163 ref 1 30 3M = 7 9 TGA III MR:f:0.9 #With one dam subs
-        #r002 83 ref 7 30 3M = 1 -9 CAA III MR:f:0.009
-        #r003 83 ref 1 30 3M = 7 9 TGA III #The reverse complement, should not rescale (thus no flags)
-        #r003 163 ref 7 30 3M = 1 -9 CAA III
-        # 
-        #hand calculated the correct rescaled sam file in pe_rescaled_correct.sam
-        options = mock_options("rescale_test/pe_test/pe.sam","rescale_test/pe_test/pe_rescaled.sam","rescale_test/pe_test/pe_output/")
-        ref = pysam.Fastafile("rescale_test/pe_test/ref.fa")
-        rescale.rescale_qual(ref,options,debug=True)
-        self.assertTrue(filecmp.cmp("rescale_test/pe_test/pe_rescaled.sam","rescale_test/pe_test/pe_rescaled_correct.sam"))
-
-class testCases(unittest.TestCase):
-    """Various cases that failed"""
-    def test_longalignshortread(self):
-        """Check if fails on an aligment longer than the read"""
-        prefix="rescale_test/long_align/"
-        options = mock_options(prefix+"pe.sam",prefix+"pe_out.sam",prefix+"pe_output/")
-        ref = pysam.Fastafile("rescale_test/pe_test/ref.fa")
-        rescale.rescale_qual(ref,options,debug=True)
-        #Should run without an error
-
-if  __name__=='__main__':
-    unittest.main()


=====================================
mapdamage/rescale_test/long_align/pe.sam deleted
=====================================
@@ -1,3 +0,0 @@
- at HD	VN:1.5	SO:coordinate
- at SQ	SN:ref	LN:9
-r001	163	ref	1	30	3M2D	=	7	9	CGA	III


=====================================
mapdamage/rescale_test/long_align/pe_output/Stats_out_MCMC_correct_prob.csv deleted
=====================================
@@ -1,5 +0,0 @@
-"","Position","C.T","G.A"
-"1",1,0.9,0
-"2",2,0.009,0
-"3",-2,0,0.09
-"4",-1,0,0.9


=====================================
mapdamage/rescale_test/long_align/ref.fa deleted
=====================================
@@ -1,2 +0,0 @@
->ref
-CGAAAACGA


=====================================
mapdamage/rescale_test/pe_test/pe.sam deleted
=====================================
@@ -1,8 +0,0 @@
- at HD	VN:1.5	SO:coordinate
- at SQ	SN:ref	LN:9
-r001	163	ref	1	30	3M	=	7	9	CGA	III
-r001	83	ref	7	30	3M	=	1	-9	CGA	III
-r002	163	ref	1	30	3M	=	7	9	TGA	III
-r002	83	ref	7	30	3M	=	1	-9	CAA	III
-r003	83	ref	1	30	3M	=	7	9	TGA	III
-r003	163	ref	7	30	3M	=	1	-9	CAA	III


=====================================
mapdamage/rescale_test/pe_test/pe_output/Stats_out_MCMC_correct_prob.csv deleted
=====================================
@@ -1,5 +0,0 @@
-"","Position","C.T","G.A"
-"1",1,0.9,0
-"2",2,0.009,0
-"3",-2,0,0.09
-"4",-1,0,0.9


=====================================
mapdamage/rescale_test/pe_test/pe_rescaled_correct.sam deleted
=====================================
@@ -1,8 +0,0 @@
- at HD	VN:1.5	SO:coordinate
- at SQ	SN:ref	LN:9
-r001	163	ref	1	30	3M	=	7	9	CGA	III	MR:f:0
-r001	83	ref	7	30	3M	=	1	-9	CGA	III	MR:f:0
-r002	163	ref	1	30	3M	=	7	9	TGA	!II	MR:f:0.9
-r002	83	ref	7	30	3M	=	1	-9	CAA	I5I	MR:f:0.009
-r003	83	ref	1	30	3M	=	7	9	TGA	III
-r003	163	ref	7	30	3M	=	1	-9	CAA	III


=====================================
mapdamage/rescale_test/pe_test/ref.fa deleted
=====================================
@@ -1,2 +0,0 @@
->ref
-CGAAAACGA


=====================================
mapdamage/tests/dnacomp.txt
=====================================
@@ -0,0 +1,324 @@
+# table produced by mapDamage version b'2.1.0-dirty'
+# using mapped file input.sam and fake1.fasta as reference file
+# Chr: reference from sam/bam header, End: from which termini of DNA sequences, Std: strand of reads
+Chr	End	Std	Pos	A	C	G	T	Total
+fake1	3p	+	-70	0	0	0	0	0
+fake1	3p	+	-69	0	0	0	0	0
+fake1	3p	+	-68	0	0	0	0	0
+fake1	3p	+	-67	0	0	0	0	0
+fake1	3p	+	-66	0	0	0	0	0
+fake1	3p	+	-65	0	0	0	0	0
+fake1	3p	+	-64	0	0	0	0	0
+fake1	3p	+	-63	0	0	0	0	0
+fake1	3p	+	-62	0	0	0	0	0
+fake1	3p	+	-61	0	0	0	0	0
+fake1	3p	+	-60	0	0	0	0	0
+fake1	3p	+	-59	0	0	0	0	0
+fake1	3p	+	-58	0	0	0	0	0
+fake1	3p	+	-57	0	0	0	0	0
+fake1	3p	+	-56	0	0	0	0	0
+fake1	3p	+	-55	0	0	0	0	0
+fake1	3p	+	-54	0	0	0	0	0
+fake1	3p	+	-53	0	0	0	0	0
+fake1	3p	+	-52	0	0	0	0	0
+fake1	3p	+	-51	0	0	0	0	0
+fake1	3p	+	-50	0	0	0	0	0
+fake1	3p	+	-49	0	0	0	0	0
+fake1	3p	+	-48	0	0	0	0	0
+fake1	3p	+	-47	0	0	0	0	0
+fake1	3p	+	-46	0	0	0	0	0
+fake1	3p	+	-45	0	0	0	0	0
+fake1	3p	+	-44	0	0	0	0	0
+fake1	3p	+	-43	0	0	0	0	0
+fake1	3p	+	-42	0	0	0	0	0
+fake1	3p	+	-41	0	0	0	0	0
+fake1	3p	+	-40	0	0	0	0	0
+fake1	3p	+	-39	0	0	0	0	0
+fake1	3p	+	-38	0	0	0	1	1
+fake1	3p	+	-37	1	0	0	0	1
+fake1	3p	+	-36	0	0	0	1	1
+fake1	3p	+	-35	0	0	1	0	1
+fake1	3p	+	-34	0	0	0	1	1
+fake1	3p	+	-33	0	1	0	0	1
+fake1	3p	+	-32	0	0	1	0	1
+fake1	3p	+	-31	0	2	1	0	3
+fake1	3p	+	-30	0	1	1	1	3
+fake1	3p	+	-29	2	1	0	0	3
+fake1	3p	+	-28	1	0	0	2	3
+fake1	3p	+	-27	0	0	3	0	3
+fake1	3p	+	-26	0	0	1	2	3
+fake1	3p	+	-25	0	3	0	0	3
+fake1	3p	+	-24	0	0	2	1	3
+fake1	3p	+	-23	0	0	3	0	3
+fake1	3p	+	-22	0	0	3	0	3
+fake1	3p	+	-21	0	2	0	1	3
+fake1	3p	+	-20	2	1	0	0	3
+fake1	3p	+	-19	0	0	2	1	3
+fake1	3p	+	-18	0	1	2	0	3
+fake1	3p	+	-17	0	2	1	0	3
+fake1	3p	+	-16	1	0	0	2	3
+fake1	3p	+	-15	1	0	2	0	3
+fake1	3p	+	-14	0	1	2	0	3
+fake1	3p	+	-13	0	0	0	3	3
+fake1	3p	+	-12	0	3	0	0	3
+fake1	3p	+	-11	0	1	0	2	3
+fake1	3p	+	-10	0	2	0	1	3
+fake1	3p	+	-9	0	0	3	0	3
+fake1	3p	+	-8	3	0	0	0	3
+fake1	3p	+	-7	2	1	0	0	3
+fake1	3p	+	-6	0	3	0	0	3
+fake1	3p	+	-5	0	0	0	3	3
+fake1	3p	+	-4	0	3	0	0	3
+fake1	3p	+	-3	1	2	0	0	3
+fake1	3p	+	-2	0	0	1	2	3
+fake1	3p	+	-1	1	0	2	0	3
+fake1	3p	+	1	2	1	0	0	3
+fake1	3p	+	2	0	2	1	0	3
+fake1	3p	+	3	1	2	0	0	3
+fake1	3p	+	4	0	0	0	3	3
+fake1	3p	+	5	0	3	0	0	3
+fake1	3p	+	6	2	0	0	1	3
+fake1	3p	+	7	0	0	3	0	3
+fake1	3p	+	8	0	1	2	0	3
+fake1	3p	+	9	0	3	0	0	3
+fake1	3p	+	10	0	0	2	1	3
+fake1	3p	-	-70	0	0	0	0	0
+fake1	3p	-	-69	0	0	0	0	0
+fake1	3p	-	-68	0	0	0	0	0
+fake1	3p	-	-67	0	0	0	0	0
+fake1	3p	-	-66	0	0	0	0	0
+fake1	3p	-	-65	0	0	0	0	0
+fake1	3p	-	-64	0	0	0	0	0
+fake1	3p	-	-63	0	0	0	0	0
+fake1	3p	-	-62	0	0	0	0	0
+fake1	3p	-	-61	0	0	0	0	0
+fake1	3p	-	-60	0	0	0	0	0
+fake1	3p	-	-59	0	0	0	0	0
+fake1	3p	-	-58	0	0	0	0	0
+fake1	3p	-	-57	0	0	0	0	0
+fake1	3p	-	-56	0	0	0	0	0
+fake1	3p	-	-55	0	0	0	0	0
+fake1	3p	-	-54	0	0	0	0	0
+fake1	3p	-	-53	0	0	0	0	0
+fake1	3p	-	-52	0	0	0	0	0
+fake1	3p	-	-51	0	0	3	0	3
+fake1	3p	-	-50	0	0	3	0	3
+fake1	3p	-	-49	0	0	3	0	3
+fake1	3p	-	-48	1	0	2	0	3
+fake1	3p	-	-47	0	0	3	0	3
+fake1	3p	-	-46	0	0	3	0	3
+fake1	3p	-	-45	0	2	0	1	3
+fake1	3p	-	-44	0	0	0	3	3
+fake1	3p	-	-43	3	0	0	0	3
+fake1	3p	-	-42	3	0	0	0	3
+fake1	3p	-	-41	0	0	4	0	4
+fake1	3p	-	-40	1	0	3	0	4
+fake1	3p	-	-39	0	4	0	0	4
+fake1	3p	-	-38	4	0	0	0	4
+fake1	3p	-	-37	0	0	4	0	4
+fake1	3p	-	-36	0	0	4	0	4
+fake1	3p	-	-35	0	4	0	0	4
+fake1	3p	-	-34	4	0	0	0	4
+fake1	3p	-	-33	0	0	4	0	4
+fake1	3p	-	-32	4	0	0	0	4
+fake1	3p	-	-31	0	0	0	4	4
+fake1	3p	-	-30	0	4	0	0	4
+fake1	3p	-	-29	0	0	4	0	4
+fake1	3p	-	-28	0	3	0	1	4
+fake1	3p	-	-27	0	4	0	0	4
+fake1	3p	-	-26	0	0	0	4	4
+fake1	3p	-	-25	0	0	4	0	4
+fake1	3p	-	-24	4	0	0	0	4
+fake1	3p	-	-23	0	0	4	0	4
+fake1	3p	-	-22	0	0	4	0	4
+fake1	3p	-	-21	0	0	0	4	4
+fake1	3p	-	-20	0	4	0	0	4
+fake1	3p	-	-19	4	0	0	0	4
+fake1	3p	-	-18	0	0	4	0	4
+fake1	3p	-	-17	0	0	4	0	4
+fake1	3p	-	-16	4	0	0	0	4
+fake1	3p	-	-15	0	0	4	0	4
+fake1	3p	-	-14	0	0	0	4	4
+fake1	3p	-	-13	0	0	0	4	4
+fake1	3p	-	-12	0	4	0	0	4
+fake1	3p	-	-11	0	0	4	0	4
+fake1	3p	-	-10	4	0	0	0	4
+fake1	3p	-	-9	0	0	4	0	4
+fake1	3p	-	-8	4	0	0	0	4
+fake1	3p	-	-7	0	4	0	0	4
+fake1	3p	-	-6	0	4	0	0	4
+fake1	3p	-	-5	3	0	1	0	4
+fake1	3p	-	-4	0	0	4	0	4
+fake1	3p	-	-3	0	4	0	0	4
+fake1	3p	-	-2	0	3	0	1	4
+fake1	3p	-	-1	0	1	0	3	4
+fake1	3p	-	1	0	0	4	0	4
+fake1	3p	-	2	0	4	0	0	4
+fake1	3p	-	3	0	4	0	0	4
+fake1	3p	-	4	0	4	0	0	4
+fake1	3p	-	5	0	0	4	0	4
+fake1	3p	-	6	4	0	0	0	4
+fake1	3p	-	7	0	4	0	0	4
+fake1	3p	-	8	4	0	0	0	4
+fake1	3p	-	9	0	0	0	4	4
+fake1	3p	-	10	0	0	4	0	4
+fake1	5p	+	-10	0	0	1	2	3
+fake1	5p	+	-9	0	0	3	0	3
+fake1	5p	+	-8	1	0	2	0	3
+fake1	5p	+	-7	2	0	1	0	3
+fake1	5p	+	-6	0	0	2	1	3
+fake1	5p	+	-5	0	0	0	3	3
+fake1	5p	+	-4	0	0	0	3	3
+fake1	5p	+	-3	0	1	0	2	3
+fake1	5p	+	-2	1	2	0	0	3
+fake1	5p	+	-1	2	1	0	0	3
+fake1	5p	+	1	0	2	0	1	3
+fake1	5p	+	2	1	1	0	1	3
+fake1	5p	+	3	2	0	0	1	3
+fake1	5p	+	4	0	0	1	2	3
+fake1	5p	+	5	0	0	2	1	3
+fake1	5p	+	6	0	1	0	2	3
+fake1	5p	+	7	0	2	1	0	3
+fake1	5p	+	8	0	0	3	0	3
+fake1	5p	+	9	0	0	3	0	3
+fake1	5p	+	10	0	1	2	0	3
+fake1	5p	+	11	1	2	0	0	3
+fake1	5p	+	12	2	0	1	0	3
+fake1	5p	+	13	0	0	3	0	3
+fake1	5p	+	14	0	1	2	0	3
+fake1	5p	+	15	0	2	0	1	3
+fake1	5p	+	16	0	0	1	2	3
+fake1	5p	+	17	0	0	3	0	3
+fake1	5p	+	18	0	0	2	1	3
+fake1	5p	+	19	0	1	0	2	3
+fake1	5p	+	20	0	2	0	1	3
+fake1	5p	+	21	0	1	0	2	3
+fake1	5p	+	22	0	2	1	0	3
+fake1	5p	+	23	1	0	2	0	3
+fake1	5p	+	24	3	0	0	0	3
+fake1	5p	+	25	2	1	0	0	3
+fake1	5p	+	26	0	2	0	1	3
+fake1	5p	+	27	0	1	0	2	3
+fake1	5p	+	28	0	3	0	0	3
+fake1	5p	+	29	0	2	0	1	3
+fake1	5p	+	30	0	0	1	2	3
+fake1	5p	+	31	1	0	2	0	3
+fake1	5p	+	32	0	1	0	0	1
+fake1	5p	+	33	0	1	0	0	1
+fake1	5p	+	34	0	0	0	1	1
+fake1	5p	+	35	0	1	0	0	1
+fake1	5p	+	36	1	0	0	0	1
+fake1	5p	+	37	0	0	1	0	1
+fake1	5p	+	38	1	0	0	0	1
+fake1	5p	+	39	0	0	0	0	0
+fake1	5p	+	40	0	0	0	0	0
+fake1	5p	+	41	0	0	0	0	0
+fake1	5p	+	42	0	0	0	0	0
+fake1	5p	+	43	0	0	0	0	0
+fake1	5p	+	44	0	0	0	0	0
+fake1	5p	+	45	0	0	0	0	0
+fake1	5p	+	46	0	0	0	0	0
+fake1	5p	+	47	0	0	0	0	0
+fake1	5p	+	48	0	0	0	0	0
+fake1	5p	+	49	0	0	0	0	0
+fake1	5p	+	50	0	0	0	0	0
+fake1	5p	+	51	0	0	0	0	0
+fake1	5p	+	52	0	0	0	0	0
+fake1	5p	+	53	0	0	0	0	0
+fake1	5p	+	54	0	0	0	0	0
+fake1	5p	+	55	0	0	0	0	0
+fake1	5p	+	56	0	0	0	0	0
+fake1	5p	+	57	0	0	0	0	0
+fake1	5p	+	58	0	0	0	0	0
+fake1	5p	+	59	0	0	0	0	0
+fake1	5p	+	60	0	0	0	0	0
+fake1	5p	+	61	0	0	0	0	0
+fake1	5p	+	62	0	0	0	0	0
+fake1	5p	+	63	0	0	0	0	0
+fake1	5p	+	64	0	0	0	0	0
+fake1	5p	+	65	0	0	0	0	0
+fake1	5p	+	66	0	0	0	0	0
+fake1	5p	+	67	0	0	0	0	0
+fake1	5p	+	68	0	0	0	0	0
+fake1	5p	+	69	0	0	0	0	0
+fake1	5p	+	70	0	0	0	0	0
+fake1	5p	-	-10	0	3	1	0	4
+fake1	5p	-	-9	0	3	1	0	4
+fake1	5p	-	-8	3	0	1	0	4
+fake1	5p	-	-7	1	0	3	0	4
+fake1	5p	-	-6	0	3	1	0	4
+fake1	5p	-	-5	3	0	1	0	4
+fake1	5p	-	-4	0	4	0	0	4
+fake1	5p	-	-3	0	0	0	4	4
+fake1	5p	-	-2	0	0	1	3	4
+fake1	5p	-	-1	1	0	0	3	4
+fake1	5p	-	1	0	0	4	0	4
+fake1	5p	-	2	1	0	3	0	4
+fake1	5p	-	3	0	1	3	0	4
+fake1	5p	-	4	2	0	2	0	4
+fake1	5p	-	5	0	0	4	0	4
+fake1	5p	-	6	0	0	4	0	4
+fake1	5p	-	7	0	3	0	1	4
+fake1	5p	-	8	1	0	0	3	4
+fake1	5p	-	9	3	0	1	0	4
+fake1	5p	-	10	4	0	0	0	4
+fake1	5p	-	11	0	0	3	1	4
+fake1	5p	-	12	0	1	3	0	4
+fake1	5p	-	13	0	3	1	0	4
+fake1	5p	-	14	3	1	0	0	4
+fake1	5p	-	15	0	1	3	0	4
+fake1	5p	-	16	0	0	3	1	4
+fake1	5p	-	17	0	3	1	0	4
+fake1	5p	-	18	4	0	0	0	4
+fake1	5p	-	19	0	0	4	0	4
+fake1	5p	-	20	3	0	1	0	4
+fake1	5p	-	21	0	0	0	4	4
+fake1	5p	-	22	0	4	0	0	4
+fake1	5p	-	23	1	0	3	0	4
+fake1	5p	-	24	0	2	1	1	4
+fake1	5p	-	25	0	3	1	0	4
+fake1	5p	-	26	1	0	0	3	4
+fake1	5p	-	27	0	0	4	0	4
+fake1	5p	-	28	3	0	0	1	4
+fake1	5p	-	29	0	0	3	1	4
+fake1	5p	-	30	0	1	3	0	4
+fake1	5p	-	31	0	0	1	3	4
+fake1	5p	-	32	1	3	0	0	4
+fake1	5p	-	33	3	0	1	0	4
+fake1	5p	-	34	1	0	3	0	4
+fake1	5p	-	35	0	1	3	0	4
+fake1	5p	-	36	3	1	0	0	4
+fake1	5p	-	37	1	0	3	0	4
+fake1	5p	-	38	0	0	1	3	4
+fake1	5p	-	39	0	1	0	3	4
+fake1	5p	-	40	0	3	0	1	4
+fake1	5p	-	41	0	1	3	0	4
+fake1	5p	-	42	3	0	0	0	3
+fake1	5p	-	43	0	0	3	0	3
+fake1	5p	-	44	3	0	0	0	3
+fake1	5p	-	45	0	3	0	0	3
+fake1	5p	-	46	0	3	0	0	3
+fake1	5p	-	47	2	0	1	0	3
+fake1	5p	-	48	0	0	3	0	3
+fake1	5p	-	49	0	3	0	0	3
+fake1	5p	-	50	0	3	0	0	3
+fake1	5p	-	51	0	0	0	3	3
+fake1	5p	-	52	0	0	0	0	0
+fake1	5p	-	53	0	0	0	0	0
+fake1	5p	-	54	0	0	0	0	0
+fake1	5p	-	55	0	0	0	0	0
+fake1	5p	-	56	0	0	0	0	0
+fake1	5p	-	57	0	0	0	0	0
+fake1	5p	-	58	0	0	0	0	0
+fake1	5p	-	59	0	0	0	0	0
+fake1	5p	-	60	0	0	0	0	0
+fake1	5p	-	61	0	0	0	0	0
+fake1	5p	-	62	0	0	0	0	0
+fake1	5p	-	63	0	0	0	0	0
+fake1	5p	-	64	0	0	0	0	0
+fake1	5p	-	65	0	0	0	0	0
+fake1	5p	-	66	0	0	0	0	0
+fake1	5p	-	67	0	0	0	0	0
+fake1	5p	-	68	0	0	0	0	0
+fake1	5p	-	69	0	0	0	0	0
+fake1	5p	-	70	0	0	0	0	0


=====================================
mapdamage/tests/fake1.fasta
=====================================
@@ -0,0 +1,5 @@
+>fake1
+GCTGGGATTACAGGTGCCTGCCACCACACCCAGCTAATTTTTGTATTTTTAGTAGAGATG
+GAGTTTCACCATGTCGGGCAGGCTGGTCTCGAACTCCTGACCTCAGGCGATCTGCCTGCC
+TCAGCCTCCCAAAGTGCTGGGATTACAGGCATGAGCTACCACGCCCGGTTCGCCAGTTGT
+TTTTTGATAGTATATAGAAAC


=====================================
mapdamage/tests/test.bam
=====================================
Binary files /dev/null and b/mapdamage/tests/test.bam differ



View it on GitLab: https://salsa.debian.org/med-team/mapdamage/commit/e01d28dc68c20c971e7276f244706607f932ae59

-- 
View it on GitLab: https://salsa.debian.org/med-team/mapdamage/commit/e01d28dc68c20c971e7276f244706607f932ae59
You're receiving this email because of your account on salsa.debian.org.


-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://alioth-lists.debian.net/pipermail/debian-med-commit/attachments/20191130/45f1c649/attachment-0001.html>

More information about the debian-med-commit mailing list