[med-svn] [Git][med-team/mummer][master] 5 commits: removing csh dependency
Andreas Tille
gitlab at salsa.debian.org
Fri Jul 24 08:22:30 BST 2020
Andreas Tille pushed to branch master at Debian Med / mummer
Commits:
b6721086 by Étienne Mollier at 2020-07-23T20:32:33+02:00
removing csh dependency
- - - - -
087f106e by Étienne Mollier at 2020-07-23T21:49:18+02:00
Added patch to suppress csh related errors
While all is in place already to not depend on csh, there are still
a few checks that are done in two Makefiles and which are causing
error messages during package construction, such as "csh not found"
or an ugly ERROR message during the check (which actually is a
check for availability of build dependencies, and not a real test
suite after compilation.)
This patch removes the unnecessary checks on the now missing csh.
- - - - -
92c67297 by Andreas Tille at 2020-07-24T09:13:11+02:00
Remove csh from docs
- - - - -
1fa19975 by Andreas Tille at 2020-07-24T09:16:08+02:00
debhelper-compat (= 13)
- - - - -
c4c79444 by Andreas Tille at 2020-07-24T09:22:18+02:00
Upload to unstable
- - - - -
5 changed files:
- debian/changelog
- debian/control
- + debian/patches/remove-csh-dependency.patch
- + debian/patches/remove-csh-from-doc.patch
- debian/patches/series
Changes:
=====================================
debian/changelog
=====================================
@@ -1,3 +1,15 @@
+mummer (3.23+dfsg-6) unstable; urgency=medium
+
+ [ Étienne Mollier ]
+ * Team upload.
+ * Removed dependency to C-Shell.
+
+ [ Andreas Tille ]
+ * Remove csh from docs
+ * debhelper-compat (= 13)
+
+ -- Étienne Mollier <etienne.mollier at mailoo.org> Thu, 23 Jul 2020 20:31:54 +0200
+
mummer (3.23+dfsg-5) unstable; urgency=medium
[ Charles Plessy ]
=====================================
debian/control
=====================================
@@ -5,11 +5,10 @@ Uploaders: Steffen Moeller <moeller at debian.org>,
Charles Plessy <plessy at debian.org>
Section: science
Priority: optional
-Build-Depends: debhelper-compat (= 12),
+Build-Depends: debhelper-compat (= 13),
texlive-latex-base,
texlive-latex-recommended,
texlive-fonts-recommended,
- csh | c-shell <!nocheck>
Standards-Version: 4.5.0
Vcs-Browser: https://salsa.debian.org/med-team/mummer
Vcs-Git: https://salsa.debian.org/med-team/mummer.git
=====================================
debian/patches/remove-csh-dependency.patch
=====================================
@@ -0,0 +1,39 @@
+Description: remove checks for csh
+ While the package can safely be built without csh, there are still a few
+ checks that are causing various error messages at build time. This patch
+ removes them.
+Author: Étienne Mollier <etienne.mollier at mailoo.org>
+Forwarded: no
+Last-Update: 2020-07-23
+---
+This patch header follows DEP-3: http://dep.debian.net/deps/dep3/
+--- mummer.orig/Makefile
++++ mummer/Makefile
+@@ -38,7 +38,6 @@
+ CC := $(filter /%,$(shell /bin/sh -c 'type gcc'))
+ CXX := $(filter /%,$(shell /bin/sh -c 'type g++'))
+ SED := $(filter /%,$(shell /bin/sh -c 'type sed'))
+-CSH := $(filter /%,$(shell /bin/sh -c 'type csh'))
+ PERL := $(filter /%,$(shell /bin/sh -c 'type perl'))
+ AR := $(filter /%,$(shell /bin/sh -c 'type ar'))
+
+@@ -76,9 +75,6 @@
+ ifndef SED
+ @echo "ERROR: 'sed' StreamEDitor not found"
+ endif
+-ifndef CSH
+- @echo "ERROR: 'csh' C-shell not found"
+-endif
+ ifndef PERL
+ @echo "ERROR: 'perl' PERL not found"
+ endif
+--- mummer.orig/scripts/Makefile
++++ mummer/scripts/Makefile
+@@ -18,7 +18,6 @@
+ endif
+
+ SED := $(filter /%,$(shell /bin/sh -c 'type sed'))
+-CSH := $(filter /%,$(shell /bin/sh -c 'type csh'))
+ PERL := $(filter /%,$(shell /bin/sh -c 'type perl'))
+ VPATH := $(BIN_DIR)
+
=====================================
debian/patches/remove-csh-from-doc.patch
=====================================
@@ -0,0 +1,96 @@
+Author: Andreas Tille <tille at debian.org>
+Description: Remove csh from docs
+Last-Update: Thu, 23 Jul 2020 20:31:54 +0200
+
+--- a/README
++++ b/README
+@@ -68,7 +68,7 @@ format (qry.seq) type the following at t
+
+ or
+
+- './run-mummer3.csh ref.seq qry.seq <prefix>'
++ './run-mummer3 ref.seq qry.seq <prefix>'
+
+ To produce the following files:
+ <prefix>.out
+--- a/docs/run-mummer1.README
++++ b/docs/run-mummer1.README
+@@ -38,10 +38,10 @@ it crashes for that reason, that's not a
+ required.
+
+ To use this system, first compile it by typing 'make' at the
+-command line. There is a script, 'run-mummer1.csh', that runs all
++command line. There is a script, 'run-mummer1', that runs all
+ the steps of aligning two genomes. The script takes these arguments:
+
+- run-mummer1.csh <genome1> <genome2> <tag> [-r]
++ run-mummer1 <genome1> <genome2> <tag> [-r]
+
+ The two genomes must DNA sequences in FASTA format. Multi-FASTA
+ files don't work. The tag is used to create 4 output files,
+@@ -60,7 +60,7 @@ not performed.
+
+ IMPORTANT: the performance of the program can critically depend on the
+ minimum MUM length you use. The default is 20bp. If you want to
+-change it, do the following: edit the file run-mummer1.csh. Add a new
++change it, do the following: edit the file run-mummer1. Add a new
+ length switch to the 'mummer' call.
+
+ The other file - one that we often spend lots of time analyzing - is
+@@ -90,8 +90,8 @@ Files in this directory:
+ gaps.cc Finds longest consistent set of matches in list
+ produced by mummer1 program.
+
+- run-mummer1.csh Script to run alignment programs. Format is:
+- run-mummer1.csh <genome1> <genome2> <tag> [-flip]
++ run-mummer1 Script to run alignment programs. Format is:
++ run-mummer1 <genome1> <genome2> <tag> [-flip]
+ <tag> will be used to make output files: <tag>.out , <tag>.gaps
+ and <tag>.align . -r will reverse complement <genome2>
+
+--- a/docs/web/manual/index.html
++++ b/docs/web/manual/index.html
+@@ -516,7 +516,6 @@ td {
+ <li><code>make (GNU make 3.79.1)</code></li>
+ <li><code>perl (PERL 5.6.0)</code></li>
+ <li><code>sh (GNU sh 1.14.7)</code></li>
+- <li><code>csh (tcsh 6.10.00)</code></li>
+ <li><code>g++ (GNU gcc 2.95.3)</code></li>
+ <li><code>sed (GNU sed 3.02)</code></li>
+ <li><code>awk (GNU awk 3.0.4)</code></li>
+@@ -647,7 +646,7 @@ td {
+ can also be viewed with the same utility programs (see above). Refer to the
+ <a href="#promer">PROmer</a> section for a list of options and output descriptions.</p>
+ <h5>run-mummer1 and run-mummer3</h5>
+-<p><code>run-mummer1</code> and <code>run-mummer3</code> are cshell script pipelines
++<p><code>run-mummer1</code> and <code>run-mummer3</code> are shell script pipelines
+ for the general alignment of two sequences. They follow the same three steps
+ of NUCmer and PROmer, in that they match, cluster and extend, however they handle
+ any input sequence, not just nucleotide. This non-discrimination can be useful,
+@@ -1192,7 +1191,7 @@ Long Exact Matches:
+ repeat positions are denoted by an <code>'r'</code> following the Start2 position,
+ and are relative to the forward strand of the sequence.</p>
+ <h4><a name="exact"></a>5.1.3. exact-tandems</h4>
+-<p><code>exact-tandems</code> is a wrapper cshell script for the <code>repeat-match</code>
++<p><code>exact-tandems</code> is a wrapper shell script for the <code>repeat-match</code>
+ program. It provides a list of exact tandem repeats within a single input sequence.</p>
+ <h5>Command line syntax</h5>
+ <p><code>exact-tandems <sequence file> <min length></code></p>
+@@ -1910,7 +1909,7 @@ PROMER
+ and the reverse strand of the query.</p>
+ <h5>Program options</h5>
+ <p>There are no available command line options for <code>run-mummer1</code>. Instead,
+- the user must directly edit the <code>csh</code> script to alter the command
++ the user must directly edit the <code>sh</code> script to alter the command
+ line values passed to the individual pipeline programs. The only available tweak
+ is changing the minimum match length value for <code>mummer</code>, set with
+ the <code>-l</code> option within the script. Decreasing this value may increase
+@@ -2008,7 +2007,7 @@ S: tagctgtcggggcgatcccctcggtagtga
+ requires hand editing the script.</p>
+ <h5>Program options</h5>
+ <p>There are no available command line options for <code>run-mummer3</code>. Instead,
+- the user must directly edit the <code>csh</code> script to alter the command
++ the user must directly edit the <code>sh</code> script to alter the command
+ line values passed to the individual pipeline programs. Altering these parameters
+ is suggested for most applications, as the default values may not always produce
+ the best output. Parameter values may be added or changed for <code>mummer</code>,
=====================================
debian/patches/series
=====================================
@@ -9,3 +9,5 @@ addition_from_mugsy.patch
# most probably broken see bug #843621
# addition_from_report_duplicates.patch
mummerplot.patch
+remove-csh-dependency.patch
+remove-csh-from-doc.patch
View it on GitLab: https://salsa.debian.org/med-team/mummer/-/compare/72fbe1757b4933638964f60a947372b2eecb6774...c4c79444f140f59f27e623866e49ccecffcb9b3e
--
View it on GitLab: https://salsa.debian.org/med-team/mummer/-/compare/72fbe1757b4933638964f60a947372b2eecb6774...c4c79444f140f59f27e623866e49ccecffcb9b3e
You're receiving this email because of your account on salsa.debian.org.
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://alioth-lists.debian.net/pipermail/debian-med-commit/attachments/20200724/35d69b03/attachment-0001.html>
More information about the debian-med-commit
mailing list