[med-svn] [Git][med-team/trf][master] 2 commits: Fix installation

[Andreas Tille]

Andreas Tille pushed to branch master at Debian Med / trf


Commits:
fa336272 by Andreas Tille at 2020-06-29T08:03:47+02:00
Fix installation

- - - - -
717b57f8 by Andreas Tille at 2020-06-29T08:14:39+02:00
Add manpage

- - - - -


4 changed files:

- + debian/createmanpages
- + debian/manpages
- debian/rules
- + debian/trf.1


Changes:

=====================================
debian/createmanpages
=====================================
@@ -0,0 +1,28 @@
+#!/bin/sh
+MANDIR=debian
+mkdir -p $MANDIR
+
+VERSION=`dpkg-parsechangelog | awk '/^Version:/ {print $2}' | sed -e 's/^[0-9]*://' -e 's/-.*//' -e 's/[+~]dfsg$//'`
+NAME=`grep "^Description:" debian/control | sed 's/^Description: *//' | head -n1`
+PROGNAME=`grep "^Package:" debian/control | sed 's/^Package: *//' | head -n1`
+
+AUTHOR=".SH AUTHOR\n \
+This manpage was written by $DEBFULLNAME for the Debian distribution and\n \
+can be used for any other usage of the program.\
+"
+
+# If program name is different from package name or title should be
+# different from package short description change this here
+progname=${PROGNAME}
+help2man --no-info --no-discard-stderr --help-option=" --help" \
+         --name="$NAME" \
+            --version-string="$VERSION" ${progname} > $MANDIR/${progname}.1
+echo $AUTHOR >> $MANDIR/${progname}.1
+
+echo "$MANDIR/*.1" > debian/manpages
+
+cat <<EOT
+Please enhance the help2man output.
+The following web page might be helpful in doing so:
+    http://liw.fi/manpages/
+EOT


=====================================
debian/manpages
=====================================
@@ -0,0 +1 @@
+debian/*.1


=====================================
debian/rules
=====================================
@@ -1,31 +1,20 @@
 #!/usr/bin/make -f
 
 # DH_VERBOSE := 1
-export LC_ALL=C.UTF-8
 
 include /usr/share/dpkg/default.mk
-# this provides:
-# DEB_SOURCE: the source package name
-# DEB_VERSION: the full version of the package (epoch + upstream vers. + revision)
-# DEB_VERSION_EPOCH_UPSTREAM: the package's version without the Debian revision
-# DEB_VERSION_UPSTREAM_REVISION: the package's version without the Debian epoch
-# DEB_VERSION_UPSTREAM: the package's upstream version
-# DEB_DISTRIBUTION: the distribution(s) listed in the current entry of debian/changelog
-# SOURCE_DATE_EPOCH: the source release date as seconds since the epoch, as
-#                    specified by <https://reproducible-builds.org/specs/source-date-epoch/>
 
-# for hardening you might like to uncomment this:
-# export DEB_BUILD_MAINT_OPTIONS=hardening=+all
+export DEB_BUILD_MAINT_OPTIONS=hardening=+all
 
 %:
 	dh $@
 
+override_dh_install:
+	dh_install
+	find debian -name "*.exe" -delete
+
 ### When overriding auto_test make sure DEB_BUILD_OPTIONS will be respected
 #override_dh_auto_test:
 #ifeq (,$(filter nocheck,$(DEB_BUILD_OPTIONS)))
 #	do_stuff_for_testing
 #endif
-
-### If you **really** can not use uscan (even not with mode=git) use a debian/get-orig-script
-#get-orig-source:
-#	. debian/get-orig-source


=====================================
debian/trf.1
=====================================
@@ -0,0 +1,73 @@
+.\" DO NOT MODIFY THIS FILE!  It was generated by help2man 1.47.15.
+.TH TRF "1" "June 2020" "trf 4.09.1" "User Commands"
+.SH NAME
+trf \- locate and display tandem repeats in DNA sequences
+.SH SYNOPSIS
+.B trf
+(File|Match|Mismatch|Delta|PM|PI|Minscore|MaxPeriod) [options]
+.SH OPTIONS
+Where: (all weights, penalties, and scores are positive)
+.TP
+File
+sequences input file
+.TP
+Match
+matching weight
+.TP
+Mismatch
+mismatching penalty
+.TP
+Delta
+indel penalty
+.TP
+PM
+match probability (whole number)
+.TP
+PI
+indel probability (whole number)
+.TP
+Minscore
+minimum alignment score to report
+.TP
+MaxPeriod
+maximum period size to report
+.SS [options] = one or more of the following:
+.TP
+\fB\-m\fR
+masked sequence file
+.TP
+\fB\-f\fR
+flanking sequence
+.TP
+\fB\-d\fR
+data file
+.TP
+\fB\-h\fR
+suppress html output
+.TP
+\fB\-r\fR
+no redundancy elimination
+.TP
+\fB\-l\fR <n>
+maximum TR length expected (in millions) (eg, \fB\-l\fR 3 or \fB\-l\fR=\fI\,3\/\fR for 3 million)
+Human genome HG38 would need \fB\-l\fR 6
+.TP
+\fB\-ngs\fR
+more compact .dat output on multisequence files, returns 0 on success.
+Output is printed to the screen, not a file. You may pipe input in with
+this option using \- for file name. Short 50 flanks are appended to .dat
+output.
+.SH SEE ALSO
+See more information on the TRF Unix Help web page: https://tandem.bu.edu/trf/trf.unix.help.html
+.SH NOTE
+Note the sequence file should be in FASTA format:
+.PP
+>Name of sequence
+aggaaacctgccatggcctcctggtgagctgtcctcatccactgctcgctgcctctccag
+atactctgacccatggatcccctgggtgcagccaagccacaatggccatggcgccgctgt
+actcccacccgccccaccctcctgatcctgctatggacatggcctttccacatccctgtg
+.SH AUTHOR
+Copyright \(co 1999\-2020 Gary Benson
+.P
+This manpage was written by Andreas Tille for the Debian distribution and
+can be used for any other usage of the program.



View it on GitLab: https://salsa.debian.org/med-team/trf/-/compare/53d0b9aafd8e0d30678f169e2a53458c71809fa8...717b57f88b968895dc4084c65a6553b47139355e

-- 
View it on GitLab: https://salsa.debian.org/med-team/trf/-/compare/53d0b9aafd8e0d30678f169e2a53458c71809fa8...717b57f88b968895dc4084c65a6553b47139355e
You're receiving this email because of your account on salsa.debian.org.


-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://alioth-lists.debian.net/pipermail/debian-med-commit/attachments/20200629/90b39f4f/attachment-0001.html>