[med-svn] [Git][med-team/pychopper][master] 4 commits: routine-update: New upstream version
Nilesh Patra
gitlab at salsa.debian.org
Mon Oct 26 13:51:14 GMT 2020
Nilesh Patra pushed to branch master at Debian Med / pychopper
Commits:
c4b58bab by Nilesh Patra at 2020-10-26T19:04:10+05:30
routine-update: New upstream version
- - - - -
fd92042d by Nilesh Patra at 2020-10-26T19:04:12+05:30
New upstream version 2.5.0
- - - - -
c6c884c8 by Nilesh Patra at 2020-10-26T19:07:15+05:30
Update upstream source from tag 'upstream/2.5.0'
Update to upstream version '2.5.0'
with Debian dir 3fa326612b8aaa63364edcbcc629a888dbee8ebb
- - - - -
005a84c7 by Nilesh Patra at 2020-10-26T19:07:36+05:30
routine-update: Ready to upload to unstable
- - - - -
12 changed files:
- README.md
- debian/changelog
- pychopper/__init__.py
- + pychopper/phmm_data/PCS110_primers.hmm
- + pychopper/phmm_data/PCS110_primers.hmm.h3f
- + pychopper/phmm_data/PCS110_primers.hmm.h3i
- + pychopper/phmm_data/PCS110_primers.hmm.h3m
- + pychopper/phmm_data/PCS110_primers.hmm.h3p
- + pychopper/primer_data/PCS110_primers.fas
- scripts/cdna_classifier.py
- setup.cfg
- setup.py
Changes:
=====================================
README.md
=====================================
@@ -58,11 +58,13 @@ Issue `make help` to get a list of `make` targets.
```
usage: cdna_classifier.py [-h] [-b primers] [-g phmm_file] [-c config_file]
- [-q cutoff] [-r report_pdf] [-u unclass_output]
- [-w rescue_output] [-S stats_output]
+ [-k kit] [-q cutoff] [-Q min_qual] [-z min_len]
+ [-r report_pdf] [-u unclass_output]
+ [-l len_fail_output] [-w rescue_output]
+ [-S stats_output] [-K qc_fail_output]
[-Y autotune_nr] [-L autotune_samples]
[-A scores_output] [-m method] [-x rescue] [-p]
- [-t threads] [-B batch_size]
+ [-t threads] [-B batch_size] [-D read stats]
input_fastx output_fastx
Tool to identify, orient and rescue full-length cDNA reads.
@@ -77,11 +79,16 @@ optional arguments:
-g phmm_file File with custom profile HMMs (None).
-c config_file File to specify primer configurations for each
direction (None).
+ -k kit Use primer sequences from this kit (PCS109).
-q cutoff Cutoff parameter (autotuned).
+ -Q min_qual Minimum mean base quality (7.0).
+ -z min_len Minimum segment length (50).
-r report_pdf Report PDF (cdna_classifier_report.pdf).
-u unclass_output Write unclassified reads to this file.
+ -l len_fail_output Write fragments failing the length filter in this file.
-w rescue_output Write rescued reads to this file.
-S stats_output Write statistics to this file.
+ -K qc_fail_output Write reads failing mean quality filter to this file.
-Y autotune_nr Approximate number of reads used for tuning the cutoff
parameter (10000).
-L autotune_samples Number of samples taken when tuning cutoff parameter
=====================================
debian/changelog
=====================================
@@ -1,3 +1,10 @@
+pychopper (2.5.0-1) unstable; urgency=medium
+
+ * Team upload.
+ * New upstream version
+
+ -- Nilesh Patra <npatra974 at gmail.com> Mon, 26 Oct 2020 19:07:36 +0530
+
pychopper (2.4.0-3) unstable; urgency=medium
* Team Upload.
=====================================
pychopper/__init__.py
=====================================
@@ -2,4 +2,4 @@
__author__ = 'ONT Applications Group'
__email__ = 'Apps at nanoporetech.com'
-__version__ = '2.4.0'
+__version__ = '2.5.0'
=====================================
pychopper/phmm_data/PCS110_primers.hmm
=====================================
@@ -0,0 +1,1022 @@
+HMMER3/f [3.3 | Nov 2019]
+NAME VNP
+LENG 76
+MAXL 146
+ALPH DNA
+RF no
+MM no
+CONS yes
+CS no
+MAP yes
+DATE Wed Jun 24 11:28:32 2020
+NSEQ 424519
+EFFN 10.478731
+CKSUM 3349094354
+STATS LOCAL MSV -8.6004 0.71863
+STATS LOCAL VITERBI -10.9200 0.71863
+STATS LOCAL FORWARD -3.1820 0.71863
+HMM A C G T
+ m->m m->i m->d i->m i->i d->m d->d
+ COMPO 1.72639 1.42168 1.36475 1.12294
+ 1.38629 1.38629 1.38629 1.38629
+ 0.01589 4.84307 4.84307 1.46634 0.26236 0.00000 *
+ 1 2.57846 3.02484 0.17323 3.36383 1 g - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.09072 4.84298 2.54033 1.46634 0.26236 1.09861 0.40547
+ 2 0.10027 3.35989 3.64669 3.36427 2 A - - -
+ 0.53681 1.87712 2.01576 2.04684
+ 0.44040 1.05885 4.67030 0.09311 2.42017 0.64252 0.74648
+ 3 0.13743 2.95662 3.35557 3.18159 5 a - - -
+ 2.16349 3.03264 0.84675 0.89629
+ 0.55142 0.88061 4.67344 1.24980 0.33766 0.94204 0.49402
+ 4 0.84457 2.39966 2.07037 1.04024 11 a - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.02669 4.84142 3.99320 1.46634 0.26236 1.07655 0.41668
+ 5 2.15161 1.27606 0.70082 2.22201 12 g - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.06951 4.83230 2.82715 1.46634 0.26236 1.03272 0.44012
+ 6 2.25826 2.35713 1.27651 0.65053 13 t - - -
+ 1.73012 1.73299 0.75594 1.73494
+ 0.32438 1.91355 2.04429 0.20183 1.69955 0.76226 0.62850
+ 7 2.52447 2.07023 2.45137 0.34592 16 t - - -
+ 1.44333 1.45324 1.18013 1.50144
+ 0.08829 3.01648 3.33740 0.58492 0.81453 0.44693 1.02050
+ 8 2.37685 3.66137 0.16732 3.33738 19 g - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.02268 4.80964 4.24910 1.46634 0.26236 0.74560 0.64331
+ 9 2.99057 2.80501 3.30520 0.15953 20 t - - -
+ 2.37146 1.16848 1.19858 1.22352
+ 0.58393 0.88757 3.48529 0.59837 0.79785 1.08821 0.41071
+ 10 2.25888 0.92356 1.84812 1.07618 25 c - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.07988 4.81628 2.67841 1.46634 0.26236 0.87292 0.54082
+ 11 1.96839 1.62516 0.74143 1.67663 26 g - - -
+ 1.73955 1.76304 1.76304 0.73115
+ 0.20910 1.82802 3.57719 0.19830 1.71549 0.57129 0.83194
+ 12 2.32331 2.55121 0.61639 1.25816 29 g - - -
+ 1.39239 1.37623 1.39239 1.38425
+ 0.04548 4.60522 3.36778 1.32677 0.30834 0.92846 0.50280
+ 13 2.91194 2.65801 2.13900 0.27738 31 t - - -
+ 1.40876 1.31058 1.40647 1.42343
+ 0.09434 3.08483 3.11700 0.66227 0.72501 0.76997 0.62181
+ 14 1.89644 2.32335 0.37801 2.70712 35 g - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.22646 4.80646 1.63747 1.46634 0.26236 0.77315 0.61907
+ 15 3.55710 3.49398 4.10778 0.07834 36 T - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.27466 4.63967 1.46748 1.46634 0.26236 0.54040 0.87351
+ 16 3.01168 0.26614 3.25143 1.92595 37 c - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.02960 4.58485 3.96561 1.46634 0.26236 0.27582 1.42274
+ 17 2.03617 2.48670 1.42226 0.60675 38 t - - -
+ 1.54117 1.35637 1.89557 0.97275
+ 0.46302 1.01449 4.82429 0.59110 0.80680 1.01982 0.44732
+ 18 2.35732 2.23981 1.70099 0.48395 44 t - - -
+ 1.80316 1.01432 1.29325 1.61849
+ 0.14556 2.12852 4.10776 0.52998 0.88824 1.03483 0.43895
+ 19 2.10827 2.23252 2.17132 0.41966 48 t - - -
+ 1.47004 1.28188 1.17981 1.68615
+ 0.15028 2.04515 4.58763 0.21740 1.63274 0.97279 0.47486
+ 20 2.16700 2.02671 0.49841 1.92268 50 g - - -
+ 2.22204 0.79326 1.77946 1.30743
+ 0.53938 0.92700 3.85607 0.86147 0.54912 1.06261 0.42397
+ 21 2.53853 2.06866 1.92933 0.43168 58 t - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.22758 4.82975 1.63194 1.46634 0.26236 0.95701 0.48457
+ 22 2.61707 3.44290 0.22313 2.35386 59 g - - -
+ 1.35734 1.42009 1.40863 1.36069
+ 0.12922 3.99560 2.27477 1.14299 0.38399 0.85463 0.55416
+ 23 0.65343 2.07960 1.87615 1.60157 62 a - - -
+ 1.64151 1.14279 1.27403 1.57174
+ 0.19059 2.10559 2.96118 0.26859 1.44586 1.38693 0.28747
+ 24 3.24175 0.13701 3.59162 2.79057 64 c - - -
+ 1.62984 1.62984 1.50530 0.95158
+ 0.44487 2.27869 1.35996 0.39575 1.11832 1.52751 0.24472
+ 25 2.69035 2.01340 2.44984 0.33925 67 t - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.03205 4.40560 3.94573 1.46634 0.26236 0.44761 1.01930
+ 26 3.29672 2.20858 3.41409 0.19817 68 t - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.03924 4.74196 3.51454 1.46634 0.26236 0.49022 0.94802
+ 27 1.74324 1.84865 0.55784 2.35226 69 g - - -
+ 1.67420 0.84174 1.67420 1.63924
+ 0.23046 2.19949 2.35419 0.28581 1.39193 1.04310 0.43442
+ 28 2.31297 0.74753 1.46014 1.63324 73 c - - -
+ 1.38680 1.38680 1.38476 1.38680
+ 0.03612 4.72015 3.62833 1.45338 0.26628 0.47452 0.97335
+ 29 3.98813 0.17842 3.94341 2.07553 75 c - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.25150 4.82395 1.54022 1.46634 0.26236 0.92097 0.50772
+ 30 2.52529 1.97373 2.84632 0.32439 76 t - - -
+ 1.38548 1.38657 1.38657 1.38657
+ 0.04303 4.60140 3.43942 1.45943 0.26445 1.43666 0.27144
+ 31 1.67511 2.81687 0.45048 2.15767 78 g - - -
+ 1.39116 1.38899 1.39000 1.37512
+ 0.04816 4.45509 3.34108 1.35518 0.29827 0.32396 1.28475
+ 32 3.37632 2.76525 3.06291 0.15535 83 t - - -
+ 2.20920 0.81177 1.31371 1.72982
+ 0.36369 1.24860 4.01831 0.50111 0.93104 0.94179 0.49418
+ 33 2.23868 0.42741 2.98424 1.65745 87 c - - -
+ 1.13398 1.51017 1.44277 1.50912
+ 0.18255 2.98732 2.15039 0.48104 0.96269 1.04462 0.43360
+ 34 1.48009 2.59813 0.77365 1.44120 89 g - - -
+ 1.38833 1.38833 1.38833 1.38022
+ 0.23843 4.64085 1.59708 1.41627 0.27789 0.51569 0.90904
+ 35 3.32438 0.25635 3.39652 1.85378 91 c - - -
+ 1.36520 1.39343 1.39343 1.39343
+ 0.04781 4.38461 3.37500 1.30599 0.31595 0.35034 1.21890
+ 36 2.83362 2.92010 2.55760 0.21099 93 t - - -
+ 1.60563 0.92125 1.62555 1.58761
+ 0.18018 2.37812 2.62896 0.32279 1.28782 0.78843 0.60616
+ 37 1.23531 0.56088 2.84166 2.52293 97 c - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.10877 4.77617 2.35769 1.46634 0.26236 0.72131 0.66576
+ 38 3.52325 3.31474 2.27049 0.18526 98 t - - -
+ 1.51484 1.32024 1.22676 1.51484
+ 0.21541 2.87241 1.98614 0.46887 0.98272 0.48972 0.94880
+ 39 0.71726 1.43972 1.85902 2.12783 100 a - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.13912 4.71486 2.11269 1.46634 0.26236 0.40130 1.10700
+ 40 2.39590 2.82269 2.14108 0.31206 101 t - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.15439 4.73933 2.00754 1.46634 0.26236 0.45213 1.01135
+ 41 1.64074 0.52874 2.11906 2.33641 102 c - - -
+ 1.40095 1.40095 1.34358 1.40095
+ 0.04881 4.25900 3.39619 1.17375 0.36991 0.41642 1.07706
+ 42 1.55408 2.43703 1.70228 0.65599 104 t - - -
+ 1.32609 1.42964 1.42964 1.36376
+ 0.40163 4.05729 1.16004 1.08937 0.41012 1.01468 0.45023
+ 43 2.46783 1.90073 2.60429 0.36843 107 t - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.04089 4.47286 3.55262 1.46634 0.26236 0.46882 0.98280
+ 44 2.37309 0.65912 1.29088 2.16744 108 c - - -
+ 0.79762 2.08072 1.20794 2.07190
+ 0.51448 1.16367 2.40962 0.38962 1.13107 1.46116 0.26392
+ 45 0.39489 2.92511 1.54564 2.82320 111 a - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.04064 4.67233 3.49100 1.46634 0.26236 0.40937 1.09084
+ 46 3.19512 1.95907 0.23820 3.50634 112 g - - -
+ 1.16118 1.49182 1.43988 1.49182
+ 0.15033 3.11523 2.35169 0.53519 0.88083 0.95474 0.48599
+ 47 0.28021 2.89065 3.28182 1.88868 114 a - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.49570 4.74007 0.96203 1.46634 0.26236 0.64421 0.74460
+ 48 2.71670 3.57514 0.14870 3.12210 115 g - - -
+ 1.39254 1.39254 1.39254 1.36778
+ 0.03781 4.17182 3.83115 1.32367 0.30946 0.23517 1.56273
+ 49 2.51773 1.99603 0.33755 2.65975 117 g - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.16122 4.81517 1.96048 1.46634 0.26236 1.04644 0.43261
+ 50 0.38625 1.50409 3.17712 2.87394 118 a - - -
+ 1.49228 1.49228 1.12264 1.49228
+ 0.07137 2.98697 3.99299 0.53369 0.88295 0.44550 1.02305
+ 51 2.54233 3.02382 0.21699 2.69167 120 g - - -
+ 1.09165 1.23101 1.67609 1.68611
+ 0.20649 1.95109 3.11348 0.23787 1.55261 0.81336 0.58585
+ 52 0.55754 1.55588 2.42754 2.05472 123 a - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.10931 4.80683 2.34998 1.46634 0.26236 0.72212 0.66499
+ 53 2.39367 1.87400 0.34837 3.00856 124 g - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.11342 4.75488 2.31652 1.46634 0.26236 0.70782 0.67869
+ 54 2.35349 2.69348 1.65462 0.43672 125 t - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.17093 4.73049 1.90856 1.46634 0.26236 0.46177 0.99471
+ 55 3.32751 0.14955 3.93209 2.48383 126 c - - -
+ 1.39246 1.19083 1.44288 1.55438
+ 0.09594 2.58624 4.12419 0.38486 1.14114 1.11092 0.39937
+ 56 3.20977 0.09870 4.26866 3.22855 128 C - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.08654 4.74533 2.60083 1.46634 0.26236 0.99883 0.45936
+ 57 2.24051 3.16918 0.24149 2.71659 129 g - - -
+ 1.38929 1.38929 1.37736 1.38929
+ 0.16665 4.60848 1.94117 1.39385 0.28517 0.90046 0.52152
+ 58 2.86131 0.17924 3.43407 2.59496 131 c - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.06809 4.64653 2.87839 1.46634 0.26236 0.32199 1.28992
+ 59 2.82903 0.17278 3.42310 2.70310 132 c - - -
+ 1.24488 1.38665 1.41402 1.51892
+ 0.11923 2.46920 3.58486 0.49951 0.93351 1.23982 0.34170
+ 60 2.14018 3.21235 0.22503 3.13247 136 g - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.28326 4.78830 1.43401 1.46634 0.26236 0.65145 0.73666
+ 61 3.17388 0.20652 2.99586 2.35643 137 c - - -
+ 1.40044 1.44361 1.32721 1.37744
+ 0.05967 3.35074 3.77823 0.73796 0.65025 0.56997 0.83366
+ 62 2.36627 0.27749 3.00582 2.31274 139 c - - -
+ 1.32314 1.40827 1.40827 1.40827
+ 0.07596 4.12556 2.86485 1.06993 0.42012 0.62003 0.77204
+ 63 2.83408 0.29435 2.65110 2.07438 141 c - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.03459 4.78481 3.66357 1.46634 0.26236 0.70278 0.68360
+ 64 1.96735 2.25758 0.39660 2.48928 142 g - - -
+ 1.61388 0.96888 1.61388 1.50389
+ 0.11274 2.39908 4.14651 0.30024 1.34954 0.96002 0.48270
+ 65 1.98901 0.44164 2.77916 1.84453 144 c - - -
+ 1.38566 1.41872 1.32503 1.41872
+ 0.06737 3.98452 3.06729 0.95099 0.48834 1.06245 0.42405
+ 66 0.56340 2.07906 2.00443 1.76641 146 a - - -
+ 1.49816 1.27226 1.21770 1.60768
+ 0.11102 2.40301 4.22464 0.44991 1.01524 0.76566 0.62554
+ 67 0.56515 1.93159 1.90422 1.98146 151 a - - -
+ 1.69527 1.58609 1.42155 0.99321
+ 0.14036 2.24606 3.68338 0.47559 0.97159 0.88370 0.53316
+ 68 2.46283 2.77257 0.25402 2.56876 155 g - - -
+ 1.49088 1.70542 1.73935 0.87349
+ 0.36298 1.85854 1.90715 0.20123 1.70221 0.87925 0.53631
+ 69 2.55212 2.16784 2.83227 0.28931 160 t - - -
+ 1.15156 1.36645 1.51441 1.56585
+ 0.14768 2.29019 3.32297 0.54759 0.86357 1.15483 0.37850
+ 70 1.94903 2.49221 2.58774 0.35714 166 t - - -
+ 1.38876 1.38876 1.38609 1.38159
+ 0.04969 4.62116 3.25361 1.40614 0.28115 0.61622 0.77649
+ 71 2.33478 1.96208 2.20101 0.42785 168 t - - -
+ 1.18307 1.47542 1.47095 1.44700
+ 0.05177 3.21547 4.57434 0.58757 0.81120 1.17252 0.37046
+ 72 2.12942 2.14540 2.38160 0.39799 171 t - - -
+ 1.50519 1.51597 1.04619 1.57428
+ 0.10189 2.57114 3.89125 0.35226 1.21436 1.29123 0.32149
+ 73 3.08598 2.30137 2.94553 0.22112 174 t - - -
+ 1.43760 1.53361 1.44874 1.16513
+ 0.13543 2.18830 4.22990 0.69036 0.69594 0.97939 0.47087
+ 74 2.32820 2.21922 2.20547 0.38033 183 t - - -
+ 1.38754 1.38754 1.38258 1.38754
+ 0.01915 4.76174 4.56397 1.43527 0.27188 0.79457 0.60107
+ 75 2.53326 2.51525 2.81550 0.24861 185 t - - -
+ 1.40974 1.40974 1.35348 1.37339
+ 0.02270 4.23268 4.83698 1.10826 0.40068 1.00683 0.45472
+ 76 4.01877 3.80239 4.14994 0.05769 190 T - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.00798 4.83507 * 1.46634 0.26236 0.00000 *
+//
+HMMER3/f [3.3 | Nov 2019]
+NAME -VNP
+LENG 78
+MAXL 146
+ALPH DNA
+RF no
+MM no
+CONS yes
+CS no
+MAP yes
+DATE Wed Jun 24 11:28:40 2020
+NSEQ 362960
+EFFN 10.598005
+CKSUM 2301423966
+STATS LOCAL MSV -8.4629 0.71859
+STATS LOCAL VITERBI -10.7340 0.71859
+STATS LOCAL FORWARD -2.9419 0.71859
+HMM A C G T
+ m->m m->i m->d i->m i->i d->m d->d
+ COMPO 1.18951 1.35593 1.40242 1.65069
+ 1.38629 1.38629 1.38629 1.38629
+ 0.01579 4.84957 4.84957 1.46634 0.26236 0.00000 *
+ 1 0.20951 2.79675 2.93358 2.59289 1 a - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.42455 4.84994 1.08439 1.46634 0.26236 1.09861 0.40547
+ 2 0.29063 2.37160 2.78226 2.33325 2 a - - -
+ 0.48077 2.08334 2.04850 2.05374
+ 0.86129 0.59920 3.57088 0.08125 2.55054 0.23189 1.57519
+ 3 0.21209 2.99098 2.54392 2.77556 4 a - - -
+ 1.47022 1.30585 1.45271 1.32709
+ 0.07987 2.69005 4.72357 0.39470 1.12050 0.79963 0.59692
+ 4 0.27420 2.78402 2.81536 2.13584 7 a - - -
+ 0.60885 1.85002 1.86485 1.93882
+ 0.45748 1.04764 4.11288 0.25199 1.50172 1.08506 0.41231
+ 5 0.47654 2.23268 1.90295 2.09801 11 a - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.06776 4.84273 2.85369 1.46634 0.26236 1.05645 0.42723
+ 6 0.27482 2.26612 3.12363 2.37968 12 a - - -
+ 1.61758 0.90421 1.61758 1.61758
+ 0.15533 2.36241 3.00225 0.29608 1.36153 0.66317 0.72405
+ 7 0.56541 2.33007 1.95513 1.64488 14 a - - -
+ 1.76580 0.73095 1.75682 1.74352
+ 0.18425 1.83834 4.68932 0.18518 1.77759 0.67356 0.71313
+ 8 0.80242 1.80431 2.36910 1.22553 16 a - - -
+ 2.14306 1.36362 1.25467 1.07353
+ 0.63255 0.82225 3.52936 0.88532 0.53202 1.08174 0.41401
+ 9 0.89961 1.66119 1.53989 1.66626 28 a - - -
+ 1.78422 1.79201 0.69551 1.79201
+ 0.85416 1.78439 0.90027 0.17273 1.84113 0.90877 0.51587
+ 10 2.26598 2.67899 0.45868 1.63209 31 g - - -
+ 1.41306 1.40078 1.32125 1.41306
+ 0.04314 3.61495 4.17967 1.01175 0.45190 0.17764 1.81553
+ 11 2.34163 0.50906 1.61752 2.25970 33 c - - -
+ 2.25997 1.67887 0.72018 1.50329
+ 0.73655 0.92073 2.09550 0.62318 0.76839 1.07807 0.41590
+ 12 2.10315 1.37307 1.64058 0.84227 40 t - - -
+ 1.38006 1.38838 1.38838 1.38838
+ 0.36391 4.64586 1.21926 1.41492 0.27832 1.27311 0.32845
+ 13 1.80488 2.10504 2.46512 0.46415 42 t - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.04656 4.43011 3.39380 1.46634 0.26236 0.19114 1.74878
+ 14 2.81146 3.01581 0.16897 3.07168 43 g - - -
+ 1.61570 1.11762 0.91940 2.58454
+ 0.68464 0.73841 4.02540 0.61410 0.77898 0.91731 0.51015
+ 15 2.16997 0.59771 1.59983 2.01128 48 c - - -
+ 1.40427 1.35522 1.39510 1.39129
+ 0.22866 4.29424 1.65679 1.12409 0.39297 1.04131 0.43540
+ 16 2.39263 3.01334 0.28526 2.22872 50 g - - -
+ 1.57396 0.96048 1.58658 1.58258
+ 0.11812 2.35363 4.11125 0.33374 1.25964 0.37177 1.16962
+ 17 1.75548 2.92317 0.43064 2.09296 53 g - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.17719 4.82983 1.86829 1.46634 0.26236 0.84649 0.56022
+ 18 1.80810 1.27122 0.78468 2.30978 54 g - - -
+ 1.38448 1.38690 1.38690 1.38690
+ 0.03282 4.67176 3.77539 1.45099 0.26701 1.87607 0.16628
+ 19 2.60540 0.51052 2.44094 1.43185 56 c - - -
+ 1.38377 1.38714 1.38714 1.38714
+ 0.20935 4.64996 1.71856 1.44512 0.26882 0.36394 1.18722
+ 20 2.28563 2.94199 0.33669 2.02953 58 g - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.13960 4.69070 2.11105 1.46634 0.26236 1.54529 0.23984
+ 21 1.35359 2.98188 0.47288 2.69144 59 g - - -
+ 1.33642 1.41002 1.39054 1.41002
+ 0.03469 3.92185 4.24800 1.04783 0.43186 0.25839 1.47969
+ 22 3.31690 0.13046 3.44617 2.91553 62 c - - -
+ 1.69840 2.25303 1.31463 0.81335
+ 1.58804 0.89781 0.94620 0.44252 1.02839 1.11150 0.39908
+ 23 1.74256 0.57066 2.34267 1.80968 68 c - - -
+ 1.37700 1.38941 1.38941 1.38941
+ 0.48175 4.25314 0.99946 1.39108 0.28609 0.18779 1.76487
+ 24 2.39799 2.67978 0.56274 1.30609 71 g - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.28750 4.59422 1.42814 1.46634 0.26236 1.30252 0.31724
+ 25 2.75751 3.90598 0.11455 3.70241 72 g - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.08388 4.42089 2.68184 1.46634 0.26236 2.00260 0.14501
+ 26 0.04917 4.28533 3.98422 4.16009 73 A - - -
+ 1.41188 1.41188 1.41188 1.31326
+ 0.22306 3.69020 1.74318 1.02553 0.44411 0.22126 1.61699
+ 27 3.67051 0.11807 3.49313 2.89137 75 c - - -
+ 1.48242 1.25414 1.63174 1.23100
+ 0.28877 2.42904 1.81589 0.47903 0.96596 1.13782 0.38642
+ 28 3.11007 2.36296 3.13433 0.20122 79 t - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.02884 4.60465 3.99422 1.46634 0.26236 0.37606 1.16016
+ 29 2.48393 0.15831 3.76506 3.22299 80 c - - -
+ 1.34988 1.39873 1.39873 1.39873
+ 0.04318 4.41132 3.50262 1.20959 0.35428 0.85483 0.55401
+ 30 3.09390 2.81008 2.17959 0.24668 82 t - - -
+ 2.15979 0.62300 1.36417 2.37815
+ 0.79931 0.62450 4.21090 0.09107 2.44136 0.76612 0.62514
+ 31 1.44785 0.55629 2.27142 2.42556 86 c - - -
+ 0.86080 2.03361 1.30091 1.74853
+ 0.31631 1.33468 4.83765 0.84336 0.56258 1.11369 0.39801
+ 32 1.92171 2.26319 2.25569 0.43878 91 t - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.15401 4.84610 2.00339 1.46634 0.26236 1.01618 0.44938
+ 33 2.73141 0.58435 1.19669 2.58740 92 c - - -
+ 0.89317 1.62515 1.62515 1.62515
+ 0.22659 2.24904 2.33047 0.28785 1.38580 0.38750 1.13554
+ 34 1.10267 2.41234 2.52389 0.69663 94 t - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.03621 4.77112 3.60845 1.46634 0.26236 0.56660 0.83805
+ 35 2.27135 3.47476 0.18576 3.34144 95 g - - -
+ 0.60021 1.97509 1.74984 1.97509
+ 0.44749 1.34531 2.29949 0.12918 2.11041 1.24617 0.33912
+ 36 0.82633 2.28559 1.24110 1.76279 98 a - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.25044 4.73281 1.54769 1.46634 0.26236 0.66526 0.72184
+ 37 0.26117 2.44957 3.14355 2.29869 99 a - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.02593 4.61038 4.15730 1.46634 0.26236 0.51688 0.90728
+ 38 2.47408 1.69170 0.51949 1.98975 100 g - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.15519 4.78954 1.99931 1.46634 0.26236 0.63715 0.75246
+ 39 0.59309 2.27810 1.38121 2.36840 101 a - - -
+ 1.01564 1.68632 1.33947 1.65735
+ 0.32747 2.12044 1.83710 0.34728 1.22625 1.16691 0.37299
+ 40 1.64892 1.67145 1.99021 0.72753 104 t - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.19724 4.60301 1.77793 1.46634 0.26236 0.26523 1.45685
+ 41 0.62202 2.55231 1.22675 2.38600 105 a - - -
+ 1.16672 1.66175 1.11380 1.76904
+ 0.27811 1.74061 2.69753 0.18356 1.78558 0.42766 1.05565
+ 42 2.35335 2.34013 0.36047 2.19562 107 g - - -
+ 1.63732 0.87588 1.63732 1.63732
+ 0.12110 2.27398 4.49622 0.27545 1.42392 0.65446 0.73339
+ 43 0.53413 1.76688 2.13444 2.08228 109 a - - -
+ 2.16876 1.94482 0.46353 2.17498
+ 0.61887 0.95969 2.54547 0.09520 2.39900 0.97848 0.47142
+ 44 1.39871 3.22045 0.40650 3.05405 112 g - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.06934 4.77881 2.83731 1.46634 0.26236 1.03076 0.44120
+ 45 2.59307 0.33211 2.16065 2.37998 113 c - - -
+ 1.23776 1.59566 1.55038 1.22069
+ 0.19333 2.42468 2.43858 0.32236 1.28895 0.47625 0.97051
+ 46 1.62912 2.60851 0.44359 2.42449 116 g - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.16846 4.77719 1.91992 1.46634 0.26236 0.70174 0.68462
+ 47 0.37143 2.81240 1.93608 2.24503 117 a - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.08405 4.69446 2.63852 1.46634 0.26236 0.96927 0.47700
+ 48 2.84651 0.36321 2.00644 2.18883 118 c - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.10181 4.70297 2.43350 1.46634 0.26236 0.38415 1.14265
+ 49 0.47976 2.02926 1.97008 2.20555 119 a - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.13841 4.77784 2.11324 1.46634 0.26236 0.62335 0.76819
+ 50 2.33984 3.15993 0.24154 2.57950 120 g - - -
+ 1.25750 1.24138 1.48320 1.61072
+ 0.10564 2.48844 4.06226 0.46198 0.99435 0.50153 0.93039
+ 51 1.56258 2.25526 0.53601 2.29781 123 g - - -
+ 1.41324 1.41324 1.31053 1.41216
+ 0.07665 4.09261 2.86318 1.00971 0.45307 0.88587 0.53163
+ 52 2.61790 0.22244 3.26090 2.42894 125 c - - -
+ 0.72927 1.73119 1.75739 1.78279
+ 0.32256 1.79083 2.21742 0.18683 1.76953 0.72073 0.66630
+ 53 0.26433 2.52765 2.48109 2.67678 128 a - - -
+ 1.48381 1.58859 1.00840 1.58859
+ 0.11429 2.47602 3.73280 0.36438 1.18622 0.58444 0.81513
+ 54 0.23596 4.11061 1.75131 3.89979 132 a - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.18855 4.81777 1.80937 1.46634 0.26236 1.07078 0.41967
+ 55 2.34818 3.24264 0.30047 2.08005 133 g - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.09153 4.66378 2.55062 1.46634 0.26236 0.96898 0.47718
+ 56 3.44842 1.47641 3.62033 0.33831 134 t - - -
+ 1.59703 0.94372 1.59703 1.58071
+ 0.13721 2.33981 3.44629 0.32060 1.29358 0.49076 0.94717
+ 57 1.78998 0.46229 2.39085 2.19240 136 c - - -
+ 1.41253 1.31147 1.41253 1.41253
+ 0.13171 4.07851 2.23990 1.01783 0.44844 0.66822 0.71872
+ 58 0.41971 2.03277 2.33306 2.16461 138 a - - -
+ 1.67853 1.65913 1.09173 1.24684
+ 0.09247 2.57482 4.40985 0.73407 0.65384 0.47186 0.97774
+ 59 2.02241 0.37730 2.69553 2.16762 141 c - - -
+ 0.68624 1.80760 1.77462 1.81437
+ 0.46758 1.74685 1.61365 0.17114 1.84963 1.03417 0.43931
+ 60 0.49174 2.11725 2.26781 1.80460 144 a - - -
+ 1.52286 1.52286 1.06208 1.52286
+ 0.15719 2.71498 2.53514 0.44924 1.01642 0.66242 0.72485
+ 61 0.38240 2.52577 2.03474 2.23433 146 a - - -
+ 1.38682 1.38682 1.38682 1.38472
+ 0.02501 4.69436 4.16352 1.45298 0.26641 0.52635 0.89344
+ 62 0.53892 1.85126 1.87933 2.23596 148 a - - -
+ 1.50932 1.09613 1.50932 1.49736
+ 0.06352 2.99295 4.47399 0.48331 0.95904 0.82726 0.57491
+ 63 1.54525 2.78530 0.43275 2.57295 151 g - - -
+ 0.85515 1.34146 1.95914 1.75831
+ 0.34942 1.32348 3.55085 0.16942 1.85889 1.00824 0.45391
+ 64 0.51152 1.98244 2.03964 2.02034 157 a - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.12993 4.82990 2.17283 1.46634 0.26236 0.90383 0.51922
+ 65 3.47177 0.21146 3.68250 2.00709 158 c - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.08337 4.73727 2.64192 1.46634 0.26236 0.53385 0.88271
+ 66 0.40576 2.39156 2.32206 1.93816 159 a - - -
+ 1.48640 1.11350 1.44196 1.56570
+ 0.20239 2.92579 2.04328 0.71633 0.67049 1.43294 0.27260
+ 67 2.48709 0.32322 2.95702 1.95857 163 c - - -
+ 1.35363 1.39559 1.44555 1.35326
+ 0.05266 3.60475 3.72525 0.91486 0.51178 0.72493 0.66235
+ 68 3.11499 0.12234 3.57523 3.15200 167 c - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.06184 4.76162 2.96775 1.46634 0.26236 1.02349 0.44526
+ 69 1.98376 3.44778 0.24312 3.06928 168 g - - -
+ 0.92007 1.47446 1.71809 1.64404
+ 0.15516 2.07165 4.03186 0.40833 1.09290 0.96062 0.48233
+ 70 0.48731 2.08599 2.32928 1.80681 172 a - - -
+ 1.38700 1.38700 1.38418 1.38700
+ 0.08755 4.76279 2.58652 1.44850 0.26778 1.49802 0.25305
+ 71 2.70939 0.19934 3.23153 2.59487 174 c - - -
+ 1.39655 1.39655 1.39655 1.35613
+ 0.03086 4.37627 4.02771 1.24722 0.33870 1.41834 0.27722
+ 72 0.13277 3.47494 2.88206 3.28746 176 a - - -
+ 1.42260 1.28466 1.42260 1.42260
+ 0.04307 3.82607 3.89417 0.91351 0.51268 1.66510 0.20970
+ 73 0.25761 2.86257 2.33884 2.60987 178 a - - -
+ 1.34454 1.39579 1.38726 1.41904
+ 0.03537 3.98574 4.12418 1.04446 0.43368 0.57587 0.82602
+ 74 3.86721 0.07542 4.16721 3.31769 181 C - - -
+ 1.54711 1.55009 1.54970 1.01446
+ 0.16698 2.72622 2.42686 0.39307 1.12388 1.12267 0.39365
+ 75 3.98821 3.16723 3.88813 0.08462 184 T - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.02103 4.74641 4.41245 1.46634 0.26236 0.93184 0.50059
+ 76 3.18815 3.39257 3.13780 0.12585 185 t - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.01701 4.79322 4.75885 1.46634 0.26236 0.74163 0.64691
+ 77 3.49723 3.27282 3.37635 0.10798 186 t - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.01607 4.83190 4.83190 1.46634 0.26236 0.91677 0.51051
+ 78 3.66483 0.15142 3.99318 2.33857 187 c - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.00796 4.83715 * 1.46634 0.26236 0.00000 *
+//
+HMMER3/f [3.3 | Nov 2019]
+NAME SSP
+LENG 81
+MAXL 144
+ALPH DNA
+RF no
+MM no
+CONS yes
+CS no
+MAP yes
+DATE Wed Jun 24 11:28:48 2020
+NSEQ 481718
+EFFN 12.909916
+CKSUM 3873051367
+STATS LOCAL MSV -9.0254 0.71855
+STATS LOCAL VITERBI -11.0714 0.71855
+STATS LOCAL FORWARD -3.4486 0.71855
+HMM A C G T
+ m->m m->i m->d i->m i->i d->m d->d
+ COMPO 1.73658 1.91341 1.22265 0.96272
+ 1.38629 1.38629 1.38629 1.38629
+ 0.01332 5.01793 5.01793 1.46634 0.26236 0.00000 *
+ 1 2.58385 3.05257 0.16612 3.49539 1 g - - -
+ 0.38828 2.22071 2.25231 2.22483
+ 0.54381 0.99085 3.03227 0.06864 2.71299 1.09861 0.40547
+ 2 0.04470 4.29834 4.29507 4.10503 3 A - - -
+ 1.22168 1.29409 1.45890 1.61635
+ 0.08391 2.63530 4.73464 0.43799 1.03658 0.75057 0.63884
+ 3 0.08192 3.57138 3.78475 3.58183 6 A - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.47374 5.00791 0.99251 1.46634 0.26236 1.00719 0.45451
+ 4 1.87800 3.27192 0.27333 3.02964 7 g - - -
+ 1.32615 1.38707 1.41738 1.41738
+ 0.05078 3.74950 3.65050 0.96472 0.47980 2.56184 0.08030
+ 5 2.25249 2.41693 1.62632 0.49591 9 t - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.05059 4.55464 3.24907 1.46634 0.26236 0.15692 1.92946
+ 6 0.89024 2.82336 3.14596 0.71947 10 t - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.05313 4.99785 3.10128 1.46634 0.26236 0.81187 0.58703
+ 7 2.82512 3.60552 0.17015 2.65947 11 g - - -
+ 1.35901 1.41446 1.41446 1.35879
+ 0.08565 4.21767 2.69782 0.99604 0.46099 0.70176 0.68461
+ 8 2.77985 2.74207 2.40337 0.24449 13 t - - -
+ 1.37956 1.39531 1.37516 1.39531
+ 0.02990 4.64580 3.91947 1.26985 0.32972 0.56130 0.84505
+ 9 3.21047 0.99551 3.28709 0.59282 15 t - - -
+ 1.35861 0.93466 1.70713 1.77858
+ 0.12918 2.31217 3.81035 0.49073 0.94722 0.94756 0.49051
+ 10 2.78158 3.37836 0.13153 3.60444 18 g - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.53948 4.99896 0.89110 1.46634 0.26236 1.07873 0.41556
+ 11 2.35369 2.72755 0.39718 1.78741 19 g - - -
+ 1.48709 1.27459 1.31365 1.48905
+ 0.08786 2.82124 3.70593 0.54436 0.86801 2.14442 0.12458
+ 12 2.58558 1.92155 2.46513 0.36634 21 t - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.03168 4.52483 3.89459 1.46634 0.26236 1.96765 0.15057
+ 13 2.02285 2.88520 0.26527 3.10379 22 g - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.04351 4.57184 3.43465 1.46634 0.26236 0.15885 1.91818
+ 14 3.71675 3.08271 2.45934 0.16918 23 t - - -
+ 2.07589 0.47214 2.07589 2.07589
+ 0.58441 1.29592 1.77832 0.09327 2.41850 0.98199 0.46931
+ 15 2.58092 0.84295 2.27351 0.93929 25 c - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.64543 4.83740 0.76006 1.46634 0.26236 0.43644 1.03940
+ 16 1.84321 1.36272 1.58986 0.96293 26 t - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.05957 4.48840 3.06641 1.46634 0.26236 2.18216 0.11968
+ 17 3.74440 3.37236 3.95206 0.08031 27 T - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.49016 4.49461 0.97737 1.46634 0.26236 0.19767 1.71836
+ 18 2.16090 2.19560 0.32686 2.95070 28 g - - -
+ 1.53699 1.53634 1.55751 1.02402
+ 0.09528 2.60560 4.07327 0.37937 1.15293 0.24656 1.52089
+ 19 2.40688 2.56756 0.86107 0.89044 30 g - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.03133 5.00335 3.72436 1.46634 0.26236 0.92199 0.50704
+ 20 3.12573 2.73974 1.78024 0.32447 31 t - - -
+ 1.77790 1.87215 1.52816 0.77593
+ 0.25872 1.73929 2.95042 0.14197 2.02229 0.83599 0.56818
+ 21 2.17567 2.75352 0.45120 1.68255 33 g - - -
+ 1.39622 1.35026 1.39979 1.39979
+ 0.03016 4.53702 3.96318 1.19217 0.36178 0.60963 0.78428
+ 22 4.06896 3.20472 3.49762 0.09204 35 T - - -
+ 1.41710 1.43546 1.26736 1.43546
+ 0.04111 3.90243 3.90800 0.80818 0.59000 0.94077 0.49483
+ 23 2.71143 0.59312 1.28660 2.25619 37 c - - -
+ 2.40689 2.44494 2.44494 0.30593
+ 0.42888 1.19599 3.07143 0.57659 0.82511 0.87079 0.54236
+ 24 3.64646 3.05907 3.68254 0.10333 40 T - - -
+ 1.84327 1.85644 0.68532 1.70624
+ 0.20756 1.75883 4.18698 0.14728 1.98818 1.08241 0.41367
+ 25 2.41340 1.42366 2.04053 0.61675 42 t - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.02871 4.98409 3.84195 1.46634 0.26236 0.71751 0.66936
+ 26 3.51409 2.30865 4.18616 0.15592 43 t - - -
+ 1.53784 1.72606 0.86119 1.69004
+ 0.18733 2.15796 2.89551 0.20708 1.67639 0.91690 0.51042
+ 27 2.51885 3.10217 0.34096 1.81150 45 g - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.16889 4.96593 1.90768 1.46634 0.26236 0.68356 0.70283
+ 28 3.60351 3.16846 3.96761 0.09235 46 T - - -
+ 1.35082 1.34570 1.42233 1.42935
+ 0.03004 3.84919 4.79215 0.85502 0.55387 0.32458 1.28313
+ 29 2.27343 2.50851 0.45186 1.71921 48 g - - -
+ 2.08797 2.08168 0.95049 1.00844
+ 0.68936 1.14439 1.71655 0.44176 1.02974 1.07994 0.41493
+ 30 2.45942 2.37796 1.21340 0.64514 55 t - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.08794 4.82791 2.57459 1.46634 0.26236 0.36518 1.18440
+ 31 3.46980 2.31044 3.34565 0.18102 56 t - - -
+ 1.66200 1.66200 1.10993 1.23479
+ 0.13209 2.32432 3.65389 0.25294 1.49841 1.03255 0.44021
+ 32 2.26238 2.66655 1.04693 0.74362 58 t - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.13885 4.95346 2.09895 1.46634 0.26236 0.62463 0.76671
+ 33 2.82829 0.11919 4.04364 3.33228 59 c - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.16816 4.89322 1.91541 1.46634 0.26236 0.63985 0.74944
+ 34 4.28472 3.83061 3.72375 0.06147 60 T - - -
+ 1.38723 1.38449 1.38624 1.38723
+ 0.01619 4.80748 4.84256 1.44286 0.26952 0.45125 1.01289
+ 35 2.14091 3.44083 0.27160 2.42749 62 g - - -
+ 1.23854 2.72638 1.46747 0.88134
+ 0.58736 0.83178 4.71764 0.74293 0.64573 1.21343 0.35265
+ 36 1.14638 1.97459 2.08107 0.87084 70 t - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.08145 4.99240 2.63907 1.46634 0.26236 0.75851 0.63179
+ 37 3.84804 3.19745 3.82457 0.08776 71 T - - -
+ 1.39114 1.37189 1.39114 1.39114
+ 0.46035 4.77522 1.02026 1.35290 0.29907 1.44622 0.26848
+ 38 2.19903 3.24397 0.22018 3.04277 73 g - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.03261 4.52519 3.85112 1.46634 0.26236 1.36885 0.29357
+ 39 1.93074 3.08025 0.31023 2.58050 74 g - - -
+ 1.63423 1.37502 1.71249 0.98981
+ 0.19105 1.85618 4.03754 0.21557 1.64032 0.19604 1.72584
+ 40 2.18753 2.58809 3.56278 0.24299 76 t - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.14449 5.00656 2.05696 1.46634 0.26236 0.91242 0.51341
+ 41 2.08502 4.14576 0.17439 3.91729 77 g - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.10850 4.89035 2.35074 1.46634 0.26236 0.42257 1.06526
+ 42 4.19400 0.17933 4.38959 1.99011 78 c - - -
+ 1.96974 1.90711 1.65645 0.65165
+ 0.40236 1.72195 1.88029 0.39639 1.11702 0.45735 1.00229
+ 43 2.39367 2.93455 2.85098 0.22594 81 t - - -
+ 1.45666 1.45666 1.39537 1.25096
+ 0.20606 3.57687 1.84356 0.74423 0.64455 1.48994 0.25539
+ 44 2.42240 3.04231 0.27769 2.24400 84 g - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.14996 4.73636 2.03645 1.46634 0.26236 2.07120 0.13471
+ 45 0.46324 1.88298 2.47513 2.00643 85 a - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.07606 4.62207 2.75825 1.46634 0.26236 0.33037 1.26820
+ 46 3.79359 2.20682 3.51472 0.17712 86 t - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.36498 4.92387 1.20893 1.46634 0.26236 0.43090 1.04960
+ 47 0.39909 2.41358 1.92453 2.36838 87 a - - -
+ 1.39424 1.39424 1.36744 1.38951
+ 0.20871 4.43298 1.73447 1.29010 0.32192 0.24742 1.51782
+ 48 2.84048 2.19360 1.81684 0.40414 90 t - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.07073 4.87086 2.80310 1.46634 0.26236 0.67409 0.71258
+ 49 2.85817 2.13985 2.81929 0.26748 91 t - - -
+ 1.26766 1.31006 1.35481 1.65700
+ 0.25604 2.31991 2.05881 0.25724 1.48362 0.42632 1.05815
+ 50 1.79888 3.33404 0.26332 3.49422 93 g - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.19342 4.90120 1.78123 1.46634 0.26236 0.38682 1.13699
+ 51 2.34559 0.37683 2.41415 2.04999 94 c - - -
+ 1.69423 1.93215 1.95915 0.63404
+ 0.47563 1.71906 1.61307 0.43552 1.04109 1.33809 0.30428
+ 52 1.70332 2.31080 1.96520 0.54712 97 t - - -
+ 1.41953 1.32191 1.43320 1.37436
+ 0.07285 3.48146 3.23162 0.75327 0.63644 0.99190 0.46342
+ 53 1.74668 2.03643 2.08546 0.56053 99 t - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.07995 4.80388 2.67888 1.46634 0.26236 0.73183 0.65590
+ 54 1.76608 2.28746 1.78203 0.58129 100 t - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.19286 4.87391 1.78523 1.46634 0.26236 0.36452 1.18591
+ 55 1.28244 1.50122 1.04615 1.90720 101 g - - -
+ 1.61750 1.87505 1.87460 0.70352
+ 0.16835 1.99205 3.98846 0.54473 0.86750 0.66010 0.72733
+ 56 1.28043 1.64851 1.35291 1.30468 107 a - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.15647 4.95553 1.98195 1.46634 0.26236 0.96882 0.47728
+ 57 1.27388 1.59987 1.05629 1.76850 108 g - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.02298 4.84857 4.20810 1.46634 0.26236 0.51819 0.90535
+ 58 1.25970 1.49080 1.12977 1.78402 109 g - - -
+ 1.71520 1.78677 1.74796 0.73722
+ 0.46737 1.94696 1.46689 0.17814 1.81293 1.23602 0.34325
+ 59 2.10504 2.60672 2.95913 0.28433 113 t - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.10809 4.73183 2.36826 1.46634 0.26236 1.05004 0.43066
+ 60 1.81618 1.97960 1.51222 0.73645 114 t - - -
+ 1.39411 1.37795 1.37914 1.39411
+ 0.13313 4.49174 2.17641 1.29270 0.32093 0.31351 1.31257
+ 61 0.88692 1.60829 1.24379 2.30699 116 a - - -
+ 1.58643 1.05294 1.18783 1.95507
+ 0.29359 1.44350 4.00003 0.12251 2.16021 0.51827 0.90522
+ 62 1.14314 1.78771 0.83961 2.50151 120 g - - -
+ 1.51417 1.22023 1.91676 1.08541
+ 0.28012 1.60830 3.12177 0.12650 2.13012 0.77298 0.61922
+ 63 1.25688 1.75053 1.34132 1.27197 123 a - - -
+ 1.40189 1.34118 1.40160 1.40189
+ 0.04030 4.49217 3.56482 1.15911 0.37654 0.68507 0.70129
+ 64 1.88275 2.30699 1.64619 0.58791 125 t - - -
+ 1.44274 1.34369 1.44549 1.31973
+ 0.19656 3.76032 1.86323 0.74152 0.64700 0.78799 0.60652
+ 65 2.19650 1.90119 2.31594 0.44512 127 t - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.02281 4.86114 4.21212 1.46634 0.26236 0.31581 1.30637
+ 66 1.16322 1.65606 1.08010 1.85106 128 g - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.06144 5.01188 2.93880 1.46634 0.26236 0.98991 0.46459
+ 67 1.05635 1.45767 1.17810 2.19250 129 a - - -
+ 1.40167 1.46442 1.27591 1.41294
+ 0.19198 1.79048 4.85385 0.54581 0.86601 0.64510 0.74362
+ 68 1.28137 1.59715 1.10883 1.66112 136 g - - -
+ 1.66283 1.66198 1.66283 0.84157
+ 0.17303 2.39375 2.69416 0.25223 1.50087 1.02984 0.44171
+ 69 1.25978 1.55111 1.17133 1.63826 138 g - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.18047 4.95526 1.84467 1.46634 0.26236 1.31176 0.31382
+ 70 2.23300 2.27887 2.71208 0.32297 139 t - - -
+ 1.38699 1.38699 1.38420 1.38699
+ 0.11587 4.77637 2.29277 1.44863 0.26774 0.96002 0.48270
+ 71 2.27089 2.85164 2.80967 0.24999 141 t - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.04170 4.80863 3.42085 1.46634 0.26236 0.36138 1.19308
+ 72 1.02921 1.68910 1.19032 1.87144 142 a - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.11905 4.97597 2.25060 1.46634 0.26236 0.86661 0.54537
+ 73 1.38380 1.44349 0.96667 2.01798 143 g - - -
+ 1.41291 1.41278 1.41291 1.31057
+ 0.05228 4.17000 3.33878 1.01347 0.45092 0.45636 1.00399
+ 74 1.27935 1.52390 0.94053 2.17596 145 g - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.05661 4.98199 3.03284 1.46634 0.26236 0.82683 0.57525
+ 75 1.23087 1.44843 1.14072 1.87448 146 g - - -
+ 1.37452 1.46011 1.44252 1.27835
+ 0.08738 3.48999 2.93429 0.63157 0.75877 1.13816 0.38626
+ 76 2.62178 2.77001 2.44178 0.25147 149 t - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.01614 4.93589 4.73021 1.46634 0.26236 0.58943 0.80888
+ 77 3.08973 2.24334 3.24330 0.21153 150 t - - -
+ 1.38591 1.62896 1.51818 1.09464
+ 0.11601 2.52756 3.51729 0.30422 1.33827 0.96553 0.47930
+ 78 2.17396 2.77157 2.60910 0.28754 153 t - - -
+ 1.36935 1.32393 1.42237 1.43340
+ 0.02517 4.08036 4.83435 0.97678 0.47244 0.84399 0.56210
+ 79 2.35579 3.49493 0.19560 2.94707 158 g - - -
+ 1.21596 1.53404 1.53252 1.30225
+ 0.10589 2.45875 4.20377 0.32742 1.27576 0.98998 0.46455
+ 80 2.39283 3.73882 0.17301 3.13002 162 g - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.01347 5.00743 5.00743 1.46634 0.26236 0.94878 0.48974
+ 81 3.35739 3.95267 0.08452 3.61138 163 G - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.00670 5.00956 * 1.46634 0.26236 0.00000 *
+//
+HMMER3/f [3.3 | Nov 2019]
+NAME -SSP
+LENG 75
+MAXL 143
+ALPH DNA
+RF no
+MM no
+CONS yes
+CS no
+MAP yes
+DATE Wed Jun 24 11:28:56 2020
+NSEQ 430975
+EFFN 11.209650
+CKSUM 4049756316
+STATS LOCAL MSV -8.4366 0.71865
+STATS LOCAL VITERBI -10.0288 0.71865
+STATS LOCAL FORWARD -3.2265 0.71865
+HMM A C G T
+ m->m m->i m->d i->m i->i d->m d->d
+ COMPO 0.98441 1.21923 1.90285 1.70516
+ 1.38629 1.38629 1.38629 1.38629
+ 0.01505 4.89848 4.89527 1.46634 0.26236 0.00000 *
+ 1 2.99615 0.20191 2.68605 2.73790 1 c - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.43372 4.89846 1.06581 1.46634 0.26236 1.09862 0.40546
+ 2 2.92324 0.21755 3.01303 2.37934 2 c - - -
+ 1.40359 1.33401 1.41286 1.39665
+ 0.06204 3.10362 4.18223 0.67015 0.71668 0.19472 1.73199
+ 3 3.07746 0.19433 3.02246 2.50276 5 c - - -
+ 0.42168 2.16785 2.16785 2.16099
+ 0.50079 1.01162 3.49592 0.07910 2.57632 0.99811 0.45978
+ 4 0.78508 1.06680 2.50211 2.13795 8 a - - -
+ 0.56373 2.10889 1.73430 2.01727
+ 0.35590 1.33657 3.30470 0.41596 1.07794 1.24135 0.34108
+ 5 0.57484 1.97440 2.01339 1.80287 11 a - - -
+ 2.26494 1.00393 1.49329 1.18713
+ 0.59215 0.83431 4.36704 1.10377 0.40289 0.90202 0.52045
+ 6 0.62907 1.90208 1.79953 1.88203 17 a - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.13722 4.87199 2.11556 1.46634 0.26236 0.95424 0.48630
+ 7 0.20059 2.25284 3.63494 2.99037 18 a - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.28673 4.77042 1.42375 1.46634 0.26236 0.44385 1.02599
+ 8 1.65836 1.29788 1.59666 1.09701 19 t - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.17887 4.65901 1.86882 1.46634 0.26236 0.69373 0.69257
+ 9 2.09280 1.23183 1.17946 1.28210 20 g - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.14835 4.67299 2.05164 1.46634 0.26236 0.29673 1.35962
+ 10 1.94618 1.20781 1.51931 1.08038 21 t - - -
+ 0.77683 1.49804 1.97736 1.72519
+ 0.59003 0.88525 3.40893 0.73838 0.64987 0.44127 1.03064
+ 11 1.83821 1.10815 1.63382 1.15345 26 c - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.12690 4.87459 2.19338 1.46634 0.26236 0.95519 0.48571
+ 12 0.91173 1.62636 1.66645 1.54830 27 a - - -
+ 1.54707 1.49736 1.14738 1.40266
+ 0.13796 2.70520 2.78046 0.39823 1.11323 0.65856 0.72897
+ 13 0.74120 1.74389 1.99093 1.55092 29 a - - -
+ 1.66961 1.66961 1.31020 1.03961
+ 0.25949 2.16862 2.16960 0.24663 1.52066 0.57569 0.82626
+ 14 0.99098 1.32393 2.02281 1.46787 32 a - - -
+ 1.03298 1.97768 1.35030 1.40039
+ 0.37372 1.67410 2.08461 0.50323 0.92780 1.22864 0.34629
+ 15 1.81195 1.18252 1.46830 1.20450 36 c - - -
+ 1.33080 1.40550 1.40550 1.40550
+ 0.12285 4.12124 2.30882 1.10683 0.40138 0.71487 0.67188
+ 16 1.79138 1.26356 1.49585 1.11912 38 t - - -
+ 1.47226 1.47226 1.16546 1.47226
+ 0.07621 3.21187 3.40818 0.60702 0.78739 0.34372 1.23486
+ 17 1.80255 1.13177 1.66422 1.12911 40 t - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.36581 4.87600 1.20818 1.46634 0.26236 0.81153 0.58731
+ 18 0.47092 2.27717 2.12375 1.87462 41 a - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.02107 4.56362 4.56362 1.46634 0.26236 0.51165 0.91506
+ 19 0.60641 2.07295 1.71390 1.90568 42 a - - -
+ 2.06411 0.94310 1.49798 1.34681
+ 0.44994 1.12253 3.30006 0.11285 2.23760 0.47857 0.96671
+ 20 1.46929 1.23468 1.90151 1.10975 46 t - - -
+ 1.15623 1.79554 1.16117 1.57904
+ 0.33365 1.29189 4.71668 0.11049 2.25761 0.77586 0.61676
+ 21 1.81867 1.21856 1.41006 1.21075 49 t - - -
+ 1.74446 1.42132 1.66418 0.93009
+ 0.32781 1.32483 4.29371 0.10591 2.29769 1.07817 0.41584
+ 22 1.11997 1.23595 1.49233 1.84324 52 a - - -
+ 0.94047 1.73275 2.01534 1.20570
+ 0.38996 1.20014 3.82762 0.09456 2.40541 0.99822 0.45971
+ 23 0.56844 1.99945 2.32060 1.60959 55 a - - -
+ 1.61085 1.55782 0.94169 1.61085
+ 0.19815 2.47999 2.34331 0.30373 1.33964 0.90104 0.52113
+ 24 0.46139 2.04318 1.92308 2.36637 57 a - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.16893 4.80703 1.91554 1.46634 0.26236 0.48781 0.95184
+ 25 1.77064 1.51854 1.46400 0.96907 58 t - - -
+ 1.42963 1.27517 1.42963 1.41956
+ 0.21242 3.74071 1.78596 0.85276 0.55554 0.93659 0.49752
+ 26 1.63772 0.99525 1.56996 1.47888 60 c - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.01909 4.66212 4.66069 1.46634 0.26236 0.27517 1.42480
+ 27 1.59730 1.25370 1.79233 1.06265 61 t - - -
+ 0.85251 1.71094 1.53247 1.73186
+ 0.27233 1.76197 2.70766 0.15934 1.91531 1.08043 0.41468
+ 28 1.81777 1.32800 1.53563 1.02922 63 t - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.18248 4.83633 1.83969 1.46634 0.26236 1.29552 0.31987
+ 29 0.44697 2.02051 2.18758 2.15709 64 a - - -
+ 0.97439 1.57891 1.57053 1.56809
+ 0.11049 2.42938 4.10354 0.34412 1.23390 0.80261 0.59449
+ 30 0.54318 2.15415 1.84238 1.93336 69 a - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.01742 4.79413 4.71123 1.46634 0.26236 0.47422 0.97385
+ 31 0.30233 1.78666 3.30044 2.87316 70 a - - -
+ 0.82610 1.66155 1.53781 1.84801
+ 0.25491 1.69538 3.18249 0.18444 1.78121 1.02314 0.44545
+ 32 1.78368 2.20368 0.52934 2.02048 73 g - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.02739 4.86340 3.94807 1.46634 0.26236 1.05883 0.42597
+ 33 3.55010 0.13500 3.98820 2.53791 74 c - - -
+ 1.33469 1.41486 1.41486 1.38294
+ 0.14565 4.09619 2.12941 0.99165 0.46357 0.85309 0.55529
+ 34 0.06594 4.19387 3.97359 3.50936 76 A - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.02048 4.77556 4.43637 1.46634 0.26236 0.44060 1.03185
+ 35 0.37785 2.33412 1.95518 2.57395 77 a - - -
+ 1.39659 1.35603 1.39659 1.39659
+ 0.05015 4.54258 3.26327 1.24656 0.33896 0.95263 0.48731
+ 36 2.39474 1.66850 2.92878 0.40525 79 t - - -
+ 1.45935 1.10587 1.52168 1.52168
+ 0.08200 2.95086 3.63305 0.45204 1.01151 0.79027 0.60463
+ 37 0.09195 3.52887 3.24613 3.93273 81 A - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.05266 4.87699 3.13097 1.46634 0.26236 0.83436 0.56943
+ 38 2.20769 2.01799 2.12463 0.44997 82 t - - -
+ 1.39137 1.17341 1.29814 1.77834
+ 0.14081 2.32465 3.39546 0.64737 0.74112 0.76691 0.62445
+ 39 2.18733 0.24917 3.06625 2.78474 86 c - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.13308 4.86859 2.14629 1.46634 0.26236 1.03244 0.44027
+ 40 0.08700 4.55796 2.80468 4.39673 87 A - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.14144 4.76792 2.09236 1.46634 0.26236 0.51095 0.91611
+ 41 1.80517 3.08241 0.28543 3.26975 88 g - - -
+ 1.43974 1.43974 1.43667 1.24375
+ 0.10032 3.60887 2.68282 0.77836 0.61463 1.36212 0.29587
+ 42 2.80917 0.16858 3.94185 2.58407 90 c - - -
+ 1.39085 1.39085 1.39085 1.37274
+ 0.08701 4.65771 2.60584 1.43579 0.27171 0.64910 0.73923
+ 43 0.18206 3.01875 3.16970 2.58270 94 a - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.16859 4.78649 1.91865 1.46634 0.26236 0.48754 0.95227
+ 44 2.80329 0.34929 1.97561 2.34836 95 c - - -
+ 1.36961 1.38068 1.39759 1.39759
+ 0.03373 4.38107 3.87978 1.22908 0.34610 0.39053 1.12916
+ 45 2.54581 0.17693 4.07145 2.70756 97 c - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.11916 4.88332 2.25607 1.46634 0.26236 1.00566 0.45540
+ 46 0.05455 4.39132 3.95756 3.83516 98 A - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.02073 4.79133 4.40469 1.46634 0.26236 0.45480 1.00670
+ 47 0.31753 2.46245 2.14767 2.65825 99 a - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.01660 4.89155 4.71552 1.46634 0.26236 0.98755 0.46599
+ 48 2.58539 0.16176 3.85306 2.94167 100 c - - -
+ 0.76684 1.80302 1.50586 1.90451
+ 0.41626 1.54151 2.06806 0.49990 0.93291 1.10865 0.40048
+ 49 0.23401 2.59651 2.75720 2.65011 106 a - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.16439 4.77058 1.94410 1.46634 0.26236 0.88047 0.53544
+ 50 2.83320 2.26983 0.22051 3.33157 107 g - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.19605 4.70047 1.77824 1.46634 0.26236 0.31761 1.30154
+ 51 0.04888 4.40248 4.41332 3.75728 108 A - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.01783 4.75251 4.70564 1.46634 0.26236 0.46861 0.98316
+ 52 0.13102 2.85899 3.61045 3.25892 109 a - - -
+ 1.62654 0.89337 1.62654 1.62198
+ 0.11454 2.40654 4.01210 0.28639 1.39019 0.85411 0.55454
+ 53 0.34494 2.54959 2.00688 2.53553 111 a - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.16802 4.88792 1.91646 1.46634 0.26236 0.94739 0.49062
+ 54 3.97012 0.13338 3.86005 2.46595 112 c - - -
+ 1.39599 1.39224 1.39599 1.36138
+ 0.06239 4.44778 3.02053 1.28129 0.32529 0.35437 1.20938
+ 55 0.14936 3.79538 2.50194 3.37146 116 a - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.05637 4.86325 3.05570 1.46634 0.26236 0.84629 0.56038
+ 56 2.43968 0.17911 4.03727 2.82768 117 c - - -
+ 0.80891 1.68634 1.74115 1.63917
+ 0.29076 1.95896 2.19551 0.19947 1.71017 0.96419 0.48012
+ 57 0.45227 2.07511 2.09866 2.15716 120 a - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.08545 4.76801 2.61180 1.46634 0.26236 0.59225 0.80538
+ 58 0.10679 3.98891 2.94743 3.49679 121 a - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.05813 4.80745 3.03017 1.46634 0.26236 0.61416 0.77891
+ 59 0.49095 1.96280 1.88388 2.34870 122 a - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.01949 4.84372 4.47224 1.46634 0.26236 0.67197 0.71479
+ 60 1.94388 2.87403 0.28975 2.95783 123 g - - -
+ 1.21913 1.00194 1.75515 1.80506
+ 0.20165 1.82854 3.81819 0.24589 1.52331 0.95226 0.48755
+ 61 0.21263 2.93742 2.72766 2.61495 126 a - - -
+ 1.47422 1.16115 1.47422 1.47422
+ 0.15486 3.33614 2.22665 0.59901 0.79707 0.97727 0.47214
+ 62 4.10622 0.11783 4.34539 2.50454 128 c - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.07250 4.78444 2.78754 1.46634 0.26236 1.16075 0.37579
+ 63 0.31081 2.72642 2.31520 2.27351 129 a - - -
+ 1.32594 1.37215 1.40896 1.44187
+ 0.04894 3.80365 3.67022 0.97847 0.47142 1.00311 0.45687
+ 64 2.99526 0.23430 3.16007 2.15046 133 c - - -
+ 1.33071 1.39144 1.40407 1.42132
+ 0.06601 3.91527 3.12476 0.92557 0.50469 0.57378 0.82872
+ 65 2.25261 0.22159 3.24497 2.90653 135 c - - -
+ 1.31188 1.54830 1.11802 1.65468
+ 0.09010 2.61374 4.35086 0.61652 0.77614 1.01896 0.44780
+ 66 1.89262 2.80560 0.30766 2.92458 139 g - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.05620 4.86221 3.05931 1.46634 0.26236 1.23398 0.34409
+ 67 0.28044 2.51853 2.53590 2.46772 140 a - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.04867 4.82665 3.23168 1.46634 0.26236 0.82685 0.57523
+ 68 4.18395 0.11259 4.42668 2.53466 141 c - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.10987 4.83769 2.34215 1.46634 0.26236 0.81263 0.58643
+ 69 0.17238 3.20896 2.75339 2.91453 142 a - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.01888 4.78662 4.56946 1.46634 0.26236 0.82618 0.57575
+ 70 0.11019 3.26011 3.45595 3.36993 143 a - - -
+ 1.46671 1.30495 1.18683 1.64535
+ 0.14495 2.29817 3.36706 0.40691 1.09572 0.97310 0.47467
+ 71 4.19340 0.09882 4.27032 2.73305 148 C - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.07726 4.84233 2.71115 1.46634 0.26236 0.87777 0.53736
+ 72 3.52362 3.60640 3.73844 0.08385 149 T - - -
+ 1.38587 1.38857 1.38219 1.38857
+ 0.01936 4.72768 4.57314 1.41058 0.27972 0.64947 0.73882
+ 73 3.18192 2.90268 3.70235 0.12902 151 t - - -
+ 1.53244 1.41314 1.34830 1.26964
+ 0.07014 2.88758 4.42071 0.42770 1.05557 1.15418 0.37880
+ 74 3.60344 3.61026 3.26078 0.09721 153 T - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.01569 4.86940 4.84234 1.46634 0.26236 0.85674 0.55259
+ 75 3.83254 0.11846 4.10277 2.61001 154 c - - -
+ 1.38629 1.38629 1.38629 1.38629
+ 0.00763 4.87971 * 1.46634 0.26236 0.00000 *
+//
=====================================
pychopper/phmm_data/PCS110_primers.hmm.h3f
=====================================
Binary files /dev/null and b/pychopper/phmm_data/PCS110_primers.hmm.h3f differ
=====================================
pychopper/phmm_data/PCS110_primers.hmm.h3i
=====================================
Binary files /dev/null and b/pychopper/phmm_data/PCS110_primers.hmm.h3i differ
=====================================
pychopper/phmm_data/PCS110_primers.hmm.h3m
=====================================
Binary files /dev/null and b/pychopper/phmm_data/PCS110_primers.hmm.h3m differ
=====================================
pychopper/phmm_data/PCS110_primers.hmm.h3p
=====================================
Binary files /dev/null and b/pychopper/phmm_data/PCS110_primers.hmm.h3p differ
=====================================
pychopper/primer_data/PCS110_primers.fas
=====================================
@@ -0,0 +1,4 @@
+>VNP
+ACTTGCCTGTCGCTCTATCTTCGAGGAGAGTCCGCCGCCCGCAAGTTT
+>SSP
+TTTCTGTTGGTGCTGATATTGCTTT
=====================================
scripts/cdna_classifier.py
=====================================
@@ -28,6 +28,8 @@ parser.add_argument(
'-g', metavar='phmm_file', type=str, default=None, help="File with custom profile HMMs (None).", required=False)
parser.add_argument(
'-c', metavar='config_file', type=str, default=None, help="File to specify primer configurations for each direction (None).")
+parser.add_argument(
+ '-k', metavar='kit', type=str, default="PCS109", help="Use primer sequences from this kit (PCS109).")
parser.add_argument(
'-q', metavar='cutoff', type=float, default=None, help="Cutoff parameter (autotuned).")
parser.add_argument(
@@ -174,7 +176,7 @@ def _detect_anomalies(st, config):
anom = []
for tmp in raw_anom:
pc = tmp[1] * 100.0 / total
- if pc >= 1:
+ if pc >= 3.0:
anom.append((tmp[0], tmp[1], pc))
if len(anom) > 0:
sys.stderr.write("Detected {} potential artefactual primer configurations:\n".format(len(anom)))
@@ -219,14 +221,23 @@ def _plot_pd_line(df, title, report, alpha=0.7, xrot=0, vline=None):
def _plot_stats(st, pdf):
"Generate plots and save to report PDF"
R = report.Report(pdf)
- _plot_pd_bars(st.loc[st.Category == "Classification", ].copy(), "Classification of output reads", R, ann=True)
+ rs = st.loc[st.Category == "Classification", ]
+ _plot_pd_bars(rs.copy(), "Classification of output reads", R, ann=True)
+ found, rescue, unusable = float(rs.loc[rs.Name == "Primers_found", ].Value), float(rs.loc[rs.Name == "Rescue", ].Value), float(rs.loc[rs.Name == "Unusable", ].Value)
+ total = found + rescue + unusable
+ found = found / total * 100
+ rescue = rescue / total * 100
+ unusable = unusable / total * 100
+ sys.stderr.write("-----------------------------------\n")
+ sys.stderr.write("Reads with two primers:\t{:.2f}%\nRescued reads:\t\t{:.2f}%\nUnusable reads:\t\t{:.2f}%\n".format(found, rescue, unusable))
+ sys.stderr.write("-----------------------------------\n")
_plot_pd_bars(st.loc[st.Category == "Strand", ].copy(), "Strand of oriented reads", R, ann=True)
_plot_pd_bars(st.loc[st.Category == "RescueStrand", ].copy(), "Strand of rescued reads", R, ann=True)
_plot_pd_bars(st.loc[st.Category == "UnclassHitNr", ].copy(), "Number of hits in unclassified reads", R)
_plot_pd_bars(st.loc[st.Category == "RescueHitNr", ].copy(), "Number of hits in rescued reads", R)
_plot_pd_bars(st.loc[st.Category == "RescueSegmentNr", ].copy(), "Number of usable segments per rescued read", R)
- if args.q is None:
- _plot_pd_line(st.loc[st.Category == "AutotuneSample", ].copy(), "Usable bases as function of cutoff(q). Best q={:.4f}".format(args.q), R, vline=args.q)
+ if q_bak is None:
+ _plot_pd_line(st.loc[st.Category == "AutotuneSample", ].copy(), "Usable bases as function of cutoff(q). Best q={:.4g}".format(args.q), R, vline=args.q)
udf = st.loc[st.Category == "Unusable", ].copy()
udf.Name = np.log10(1.0 + np.array(udf.Name, dtype=float))
_plot_pd_line(udf, "Log10 length distribution of trimmed away sequences.", R)
@@ -244,17 +255,21 @@ if __name__ == '__main__':
if args.c is not None:
CONFIG = open(args.c, "r").readline().strip()
+ kits = {"PCS109": {"HMM": os.path.join(os.path.dirname(phmm_data.__file__), "cDNA_SSP_VNP.hmm"), "FAS": os.path.join(os.path.dirname(primer_data.__file__), "cDNA_SSP_VNP.fas"), }, "PCS110": {
+ "HMM": os.path.join(os.path.dirname(phmm_data.__file__), "PCS110_primers.hmm"), "FAS": os.path.join(os.path.dirname(primer_data.__file__), "PCS110_primers.fas")}}
+
if args.g is None:
- args.g = os.path.join(os.path.dirname(phmm_data.__file__), "cDNA_SSP_VNP.hmm")
+ args.g = kits[args.k]["HMM"]
if args.b is None:
- args.b = os.path.join(os.path.dirname(primer_data.__file__), "cDNA_SSP_VNP.fas")
+ args.b = kits[args.k]["FAS"]
if args.x is not None and args.x in ('DCS109'):
if args.x == "DCS109":
CONFIG = "-:VNP,-VNP"
config = utils.parse_config_string(CONFIG)
+ sys.stderr.write("Using kit: {}\n".format(args.k))
sys.stderr.write("Configurations to consider: \"{}\"\n".format(CONFIG))
in_fh = sys.stdin
@@ -306,9 +321,10 @@ if __name__ == '__main__':
else:
raise Exception("Invalid backend!")
- # Pick the -q maximizing the number of classified reads using frid search:
+ # Pick the -q maximizing the number of classified reads using grid search:
nr_records = None
tune_df = None
+ q_bak = args.q
if args.q is None:
nr_cutoffs = args.L
cutoffs = np.linspace(0.0, 1.0, num=nr_cutoffs)
@@ -356,7 +372,7 @@ if __name__ == '__main__':
tune_df["Value"] += [args.q]
if best_qi == (len(class_reads) - 1):
sys.stderr.write("Best cuttoff value is at the edge of the search interval! Using tuned value is not safe! Please pick a q value manually and QC your data!\n")
- sys.stderr.write("Best cutoff (q) value is {:.4f} with {:.0f}% of the reads classified.\n".format(args.q, class_reads[best_qi] * 100 / len(read_sample)))
+ sys.stderr.write("Best cutoff (q) value is {:.4g} with {:.0f}% of the reads classified.\n".format(args.q, class_reads[best_qi] * 100 / len(read_sample)))
if nr_records is not None:
input_size = nr_records
@@ -380,7 +396,7 @@ if __name__ == '__main__':
for trim_read in chopper.segments_to_reads(read, segments, args.p):
if args.l is not None and len(trim_read.Seq) < args.z:
st["LenFail"] += 1
- seu.writefq(read, l_fh)
+ seu.writefq(trim_read, l_fh)
continue
if len(segments) == 1:
seu.writefq(trim_read, out_fh)
=====================================
setup.cfg
=====================================
@@ -1,5 +1,5 @@
[bumpversion]
-current_version = 2.4.0
+current_version = 2.5.0
commit = True
tag = True
=====================================
setup.py
=====================================
@@ -26,7 +26,7 @@ test_requirements = [
setup(
name='pychopper',
- version='2.4.0',
+ version='2.5.0',
description="A tool to identify full length cDNA reads.",
long_description=readme,
author="ONT Applications Group",
View it on GitLab: https://salsa.debian.org/med-team/pychopper/-/compare/4eb8495f9969f4793c464c46820f916ee2efd337...005a84c7525f52250379cdfc8a9d7a97672b1bf5
--
View it on GitLab: https://salsa.debian.org/med-team/pychopper/-/compare/4eb8495f9969f4793c464c46820f916ee2efd337...005a84c7525f52250379cdfc8a9d7a97672b1bf5
You're receiving this email because of your account on salsa.debian.org.
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://alioth-lists.debian.net/pipermail/debian-med-commit/attachments/20201026/e71b6872/attachment-0001.html>
More information about the debian-med-commit
mailing list