[med-svn] [Git][med-team/pychopper][master] 4 commits: routine-update: New upstream version

Nilesh Patra gitlab at salsa.debian.org
Mon Oct 26 13:51:14 GMT 2020



Nilesh Patra pushed to branch master at Debian Med / pychopper


Commits:
c4b58bab by Nilesh Patra at 2020-10-26T19:04:10+05:30
routine-update: New upstream version

- - - - -
fd92042d by Nilesh Patra at 2020-10-26T19:04:12+05:30
New upstream version 2.5.0
- - - - -
c6c884c8 by Nilesh Patra at 2020-10-26T19:07:15+05:30
Update upstream source from tag 'upstream/2.5.0'

Update to upstream version '2.5.0'
with Debian dir 3fa326612b8aaa63364edcbcc629a888dbee8ebb
- - - - -
005a84c7 by Nilesh Patra at 2020-10-26T19:07:36+05:30
routine-update: Ready to upload to unstable

- - - - -


12 changed files:

- README.md
- debian/changelog
- pychopper/__init__.py
- + pychopper/phmm_data/PCS110_primers.hmm
- + pychopper/phmm_data/PCS110_primers.hmm.h3f
- + pychopper/phmm_data/PCS110_primers.hmm.h3i
- + pychopper/phmm_data/PCS110_primers.hmm.h3m
- + pychopper/phmm_data/PCS110_primers.hmm.h3p
- + pychopper/primer_data/PCS110_primers.fas
- scripts/cdna_classifier.py
- setup.cfg
- setup.py


Changes:

=====================================
README.md
=====================================
@@ -58,11 +58,13 @@ Issue `make help` to get a list of `make` targets.
 
 ```
 usage: cdna_classifier.py [-h] [-b primers] [-g phmm_file] [-c config_file]
-                          [-q cutoff] [-r report_pdf] [-u unclass_output]
-                          [-w rescue_output] [-S stats_output]
+                          [-k kit] [-q cutoff] [-Q min_qual] [-z min_len]
+                          [-r report_pdf] [-u unclass_output]
+                          [-l len_fail_output] [-w rescue_output]
+                          [-S stats_output] [-K qc_fail_output]
                           [-Y autotune_nr] [-L autotune_samples]
                           [-A scores_output] [-m method] [-x rescue] [-p]
-                          [-t threads] [-B batch_size]
+                          [-t threads] [-B batch_size] [-D read stats]
                           input_fastx output_fastx
 
 Tool to identify, orient and rescue full-length cDNA reads.
@@ -77,11 +79,16 @@ optional arguments:
   -g phmm_file         File with custom profile HMMs (None).
   -c config_file       File to specify primer configurations for each
                        direction (None).
+  -k kit               Use primer sequences from this kit (PCS109).
   -q cutoff            Cutoff parameter (autotuned).
+  -Q min_qual          Minimum mean base quality (7.0).
+  -z min_len           Minimum segment length (50).
   -r report_pdf        Report PDF (cdna_classifier_report.pdf).
   -u unclass_output    Write unclassified reads to this file.
+  -l len_fail_output   Write fragments failing the length filter in this file.
   -w rescue_output     Write rescued reads to this file.
   -S stats_output      Write statistics to this file.
+  -K qc_fail_output    Write reads failing mean quality filter to this file.
   -Y autotune_nr       Approximate number of reads used for tuning the cutoff
                        parameter (10000).
   -L autotune_samples  Number of samples taken when tuning cutoff parameter


=====================================
debian/changelog
=====================================
@@ -1,3 +1,10 @@
+pychopper (2.5.0-1) unstable; urgency=medium
+
+  * Team upload.
+  * New upstream version
+
+ -- Nilesh Patra <npatra974 at gmail.com>  Mon, 26 Oct 2020 19:07:36 +0530
+
 pychopper (2.4.0-3) unstable; urgency=medium
 
   * Team Upload.


=====================================
pychopper/__init__.py
=====================================
@@ -2,4 +2,4 @@
 
 __author__ = 'ONT Applications Group'
 __email__ = 'Apps at nanoporetech.com'
-__version__ = '2.4.0'
+__version__ = '2.5.0'


=====================================
pychopper/phmm_data/PCS110_primers.hmm
=====================================
@@ -0,0 +1,1022 @@
+HMMER3/f [3.3 | Nov 2019]
+NAME  VNP
+LENG  76
+MAXL  146
+ALPH  DNA
+RF    no
+MM    no
+CONS  yes
+CS    no
+MAP   yes
+DATE  Wed Jun 24 11:28:32 2020
+NSEQ  424519
+EFFN  10.478731
+CKSUM 3349094354
+STATS LOCAL MSV       -8.6004  0.71863
+STATS LOCAL VITERBI  -10.9200  0.71863
+STATS LOCAL FORWARD   -3.1820  0.71863
+HMM          A        C        G        T   
+            m->m     m->i     m->d     i->m     i->i     d->m     d->d
+  COMPO   1.72639  1.42168  1.36475  1.12294
+          1.38629  1.38629  1.38629  1.38629
+          0.01589  4.84307  4.84307  1.46634  0.26236  0.00000        *
+      1   2.57846  3.02484  0.17323  3.36383      1 g - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.09072  4.84298  2.54033  1.46634  0.26236  1.09861  0.40547
+      2   0.10027  3.35989  3.64669  3.36427      2 A - - -
+          0.53681  1.87712  2.01576  2.04684
+          0.44040  1.05885  4.67030  0.09311  2.42017  0.64252  0.74648
+      3   0.13743  2.95662  3.35557  3.18159      5 a - - -
+          2.16349  3.03264  0.84675  0.89629
+          0.55142  0.88061  4.67344  1.24980  0.33766  0.94204  0.49402
+      4   0.84457  2.39966  2.07037  1.04024     11 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.02669  4.84142  3.99320  1.46634  0.26236  1.07655  0.41668
+      5   2.15161  1.27606  0.70082  2.22201     12 g - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.06951  4.83230  2.82715  1.46634  0.26236  1.03272  0.44012
+      6   2.25826  2.35713  1.27651  0.65053     13 t - - -
+          1.73012  1.73299  0.75594  1.73494
+          0.32438  1.91355  2.04429  0.20183  1.69955  0.76226  0.62850
+      7   2.52447  2.07023  2.45137  0.34592     16 t - - -
+          1.44333  1.45324  1.18013  1.50144
+          0.08829  3.01648  3.33740  0.58492  0.81453  0.44693  1.02050
+      8   2.37685  3.66137  0.16732  3.33738     19 g - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.02268  4.80964  4.24910  1.46634  0.26236  0.74560  0.64331
+      9   2.99057  2.80501  3.30520  0.15953     20 t - - -
+          2.37146  1.16848  1.19858  1.22352
+          0.58393  0.88757  3.48529  0.59837  0.79785  1.08821  0.41071
+     10   2.25888  0.92356  1.84812  1.07618     25 c - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.07988  4.81628  2.67841  1.46634  0.26236  0.87292  0.54082
+     11   1.96839  1.62516  0.74143  1.67663     26 g - - -
+          1.73955  1.76304  1.76304  0.73115
+          0.20910  1.82802  3.57719  0.19830  1.71549  0.57129  0.83194
+     12   2.32331  2.55121  0.61639  1.25816     29 g - - -
+          1.39239  1.37623  1.39239  1.38425
+          0.04548  4.60522  3.36778  1.32677  0.30834  0.92846  0.50280
+     13   2.91194  2.65801  2.13900  0.27738     31 t - - -
+          1.40876  1.31058  1.40647  1.42343
+          0.09434  3.08483  3.11700  0.66227  0.72501  0.76997  0.62181
+     14   1.89644  2.32335  0.37801  2.70712     35 g - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.22646  4.80646  1.63747  1.46634  0.26236  0.77315  0.61907
+     15   3.55710  3.49398  4.10778  0.07834     36 T - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.27466  4.63967  1.46748  1.46634  0.26236  0.54040  0.87351
+     16   3.01168  0.26614  3.25143  1.92595     37 c - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.02960  4.58485  3.96561  1.46634  0.26236  0.27582  1.42274
+     17   2.03617  2.48670  1.42226  0.60675     38 t - - -
+          1.54117  1.35637  1.89557  0.97275
+          0.46302  1.01449  4.82429  0.59110  0.80680  1.01982  0.44732
+     18   2.35732  2.23981  1.70099  0.48395     44 t - - -
+          1.80316  1.01432  1.29325  1.61849
+          0.14556  2.12852  4.10776  0.52998  0.88824  1.03483  0.43895
+     19   2.10827  2.23252  2.17132  0.41966     48 t - - -
+          1.47004  1.28188  1.17981  1.68615
+          0.15028  2.04515  4.58763  0.21740  1.63274  0.97279  0.47486
+     20   2.16700  2.02671  0.49841  1.92268     50 g - - -
+          2.22204  0.79326  1.77946  1.30743
+          0.53938  0.92700  3.85607  0.86147  0.54912  1.06261  0.42397
+     21   2.53853  2.06866  1.92933  0.43168     58 t - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.22758  4.82975  1.63194  1.46634  0.26236  0.95701  0.48457
+     22   2.61707  3.44290  0.22313  2.35386     59 g - - -
+          1.35734  1.42009  1.40863  1.36069
+          0.12922  3.99560  2.27477  1.14299  0.38399  0.85463  0.55416
+     23   0.65343  2.07960  1.87615  1.60157     62 a - - -
+          1.64151  1.14279  1.27403  1.57174
+          0.19059  2.10559  2.96118  0.26859  1.44586  1.38693  0.28747
+     24   3.24175  0.13701  3.59162  2.79057     64 c - - -
+          1.62984  1.62984  1.50530  0.95158
+          0.44487  2.27869  1.35996  0.39575  1.11832  1.52751  0.24472
+     25   2.69035  2.01340  2.44984  0.33925     67 t - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.03205  4.40560  3.94573  1.46634  0.26236  0.44761  1.01930
+     26   3.29672  2.20858  3.41409  0.19817     68 t - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.03924  4.74196  3.51454  1.46634  0.26236  0.49022  0.94802
+     27   1.74324  1.84865  0.55784  2.35226     69 g - - -
+          1.67420  0.84174  1.67420  1.63924
+          0.23046  2.19949  2.35419  0.28581  1.39193  1.04310  0.43442
+     28   2.31297  0.74753  1.46014  1.63324     73 c - - -
+          1.38680  1.38680  1.38476  1.38680
+          0.03612  4.72015  3.62833  1.45338  0.26628  0.47452  0.97335
+     29   3.98813  0.17842  3.94341  2.07553     75 c - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.25150  4.82395  1.54022  1.46634  0.26236  0.92097  0.50772
+     30   2.52529  1.97373  2.84632  0.32439     76 t - - -
+          1.38548  1.38657  1.38657  1.38657
+          0.04303  4.60140  3.43942  1.45943  0.26445  1.43666  0.27144
+     31   1.67511  2.81687  0.45048  2.15767     78 g - - -
+          1.39116  1.38899  1.39000  1.37512
+          0.04816  4.45509  3.34108  1.35518  0.29827  0.32396  1.28475
+     32   3.37632  2.76525  3.06291  0.15535     83 t - - -
+          2.20920  0.81177  1.31371  1.72982
+          0.36369  1.24860  4.01831  0.50111  0.93104  0.94179  0.49418
+     33   2.23868  0.42741  2.98424  1.65745     87 c - - -
+          1.13398  1.51017  1.44277  1.50912
+          0.18255  2.98732  2.15039  0.48104  0.96269  1.04462  0.43360
+     34   1.48009  2.59813  0.77365  1.44120     89 g - - -
+          1.38833  1.38833  1.38833  1.38022
+          0.23843  4.64085  1.59708  1.41627  0.27789  0.51569  0.90904
+     35   3.32438  0.25635  3.39652  1.85378     91 c - - -
+          1.36520  1.39343  1.39343  1.39343
+          0.04781  4.38461  3.37500  1.30599  0.31595  0.35034  1.21890
+     36   2.83362  2.92010  2.55760  0.21099     93 t - - -
+          1.60563  0.92125  1.62555  1.58761
+          0.18018  2.37812  2.62896  0.32279  1.28782  0.78843  0.60616
+     37   1.23531  0.56088  2.84166  2.52293     97 c - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.10877  4.77617  2.35769  1.46634  0.26236  0.72131  0.66576
+     38   3.52325  3.31474  2.27049  0.18526     98 t - - -
+          1.51484  1.32024  1.22676  1.51484
+          0.21541  2.87241  1.98614  0.46887  0.98272  0.48972  0.94880
+     39   0.71726  1.43972  1.85902  2.12783    100 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.13912  4.71486  2.11269  1.46634  0.26236  0.40130  1.10700
+     40   2.39590  2.82269  2.14108  0.31206    101 t - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.15439  4.73933  2.00754  1.46634  0.26236  0.45213  1.01135
+     41   1.64074  0.52874  2.11906  2.33641    102 c - - -
+          1.40095  1.40095  1.34358  1.40095
+          0.04881  4.25900  3.39619  1.17375  0.36991  0.41642  1.07706
+     42   1.55408  2.43703  1.70228  0.65599    104 t - - -
+          1.32609  1.42964  1.42964  1.36376
+          0.40163  4.05729  1.16004  1.08937  0.41012  1.01468  0.45023
+     43   2.46783  1.90073  2.60429  0.36843    107 t - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.04089  4.47286  3.55262  1.46634  0.26236  0.46882  0.98280
+     44   2.37309  0.65912  1.29088  2.16744    108 c - - -
+          0.79762  2.08072  1.20794  2.07190
+          0.51448  1.16367  2.40962  0.38962  1.13107  1.46116  0.26392
+     45   0.39489  2.92511  1.54564  2.82320    111 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.04064  4.67233  3.49100  1.46634  0.26236  0.40937  1.09084
+     46   3.19512  1.95907  0.23820  3.50634    112 g - - -
+          1.16118  1.49182  1.43988  1.49182
+          0.15033  3.11523  2.35169  0.53519  0.88083  0.95474  0.48599
+     47   0.28021  2.89065  3.28182  1.88868    114 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.49570  4.74007  0.96203  1.46634  0.26236  0.64421  0.74460
+     48   2.71670  3.57514  0.14870  3.12210    115 g - - -
+          1.39254  1.39254  1.39254  1.36778
+          0.03781  4.17182  3.83115  1.32367  0.30946  0.23517  1.56273
+     49   2.51773  1.99603  0.33755  2.65975    117 g - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.16122  4.81517  1.96048  1.46634  0.26236  1.04644  0.43261
+     50   0.38625  1.50409  3.17712  2.87394    118 a - - -
+          1.49228  1.49228  1.12264  1.49228
+          0.07137  2.98697  3.99299  0.53369  0.88295  0.44550  1.02305
+     51   2.54233  3.02382  0.21699  2.69167    120 g - - -
+          1.09165  1.23101  1.67609  1.68611
+          0.20649  1.95109  3.11348  0.23787  1.55261  0.81336  0.58585
+     52   0.55754  1.55588  2.42754  2.05472    123 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.10931  4.80683  2.34998  1.46634  0.26236  0.72212  0.66499
+     53   2.39367  1.87400  0.34837  3.00856    124 g - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.11342  4.75488  2.31652  1.46634  0.26236  0.70782  0.67869
+     54   2.35349  2.69348  1.65462  0.43672    125 t - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.17093  4.73049  1.90856  1.46634  0.26236  0.46177  0.99471
+     55   3.32751  0.14955  3.93209  2.48383    126 c - - -
+          1.39246  1.19083  1.44288  1.55438
+          0.09594  2.58624  4.12419  0.38486  1.14114  1.11092  0.39937
+     56   3.20977  0.09870  4.26866  3.22855    128 C - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.08654  4.74533  2.60083  1.46634  0.26236  0.99883  0.45936
+     57   2.24051  3.16918  0.24149  2.71659    129 g - - -
+          1.38929  1.38929  1.37736  1.38929
+          0.16665  4.60848  1.94117  1.39385  0.28517  0.90046  0.52152
+     58   2.86131  0.17924  3.43407  2.59496    131 c - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.06809  4.64653  2.87839  1.46634  0.26236  0.32199  1.28992
+     59   2.82903  0.17278  3.42310  2.70310    132 c - - -
+          1.24488  1.38665  1.41402  1.51892
+          0.11923  2.46920  3.58486  0.49951  0.93351  1.23982  0.34170
+     60   2.14018  3.21235  0.22503  3.13247    136 g - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.28326  4.78830  1.43401  1.46634  0.26236  0.65145  0.73666
+     61   3.17388  0.20652  2.99586  2.35643    137 c - - -
+          1.40044  1.44361  1.32721  1.37744
+          0.05967  3.35074  3.77823  0.73796  0.65025  0.56997  0.83366
+     62   2.36627  0.27749  3.00582  2.31274    139 c - - -
+          1.32314  1.40827  1.40827  1.40827
+          0.07596  4.12556  2.86485  1.06993  0.42012  0.62003  0.77204
+     63   2.83408  0.29435  2.65110  2.07438    141 c - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.03459  4.78481  3.66357  1.46634  0.26236  0.70278  0.68360
+     64   1.96735  2.25758  0.39660  2.48928    142 g - - -
+          1.61388  0.96888  1.61388  1.50389
+          0.11274  2.39908  4.14651  0.30024  1.34954  0.96002  0.48270
+     65   1.98901  0.44164  2.77916  1.84453    144 c - - -
+          1.38566  1.41872  1.32503  1.41872
+          0.06737  3.98452  3.06729  0.95099  0.48834  1.06245  0.42405
+     66   0.56340  2.07906  2.00443  1.76641    146 a - - -
+          1.49816  1.27226  1.21770  1.60768
+          0.11102  2.40301  4.22464  0.44991  1.01524  0.76566  0.62554
+     67   0.56515  1.93159  1.90422  1.98146    151 a - - -
+          1.69527  1.58609  1.42155  0.99321
+          0.14036  2.24606  3.68338  0.47559  0.97159  0.88370  0.53316
+     68   2.46283  2.77257  0.25402  2.56876    155 g - - -
+          1.49088  1.70542  1.73935  0.87349
+          0.36298  1.85854  1.90715  0.20123  1.70221  0.87925  0.53631
+     69   2.55212  2.16784  2.83227  0.28931    160 t - - -
+          1.15156  1.36645  1.51441  1.56585
+          0.14768  2.29019  3.32297  0.54759  0.86357  1.15483  0.37850
+     70   1.94903  2.49221  2.58774  0.35714    166 t - - -
+          1.38876  1.38876  1.38609  1.38159
+          0.04969  4.62116  3.25361  1.40614  0.28115  0.61622  0.77649
+     71   2.33478  1.96208  2.20101  0.42785    168 t - - -
+          1.18307  1.47542  1.47095  1.44700
+          0.05177  3.21547  4.57434  0.58757  0.81120  1.17252  0.37046
+     72   2.12942  2.14540  2.38160  0.39799    171 t - - -
+          1.50519  1.51597  1.04619  1.57428
+          0.10189  2.57114  3.89125  0.35226  1.21436  1.29123  0.32149
+     73   3.08598  2.30137  2.94553  0.22112    174 t - - -
+          1.43760  1.53361  1.44874  1.16513
+          0.13543  2.18830  4.22990  0.69036  0.69594  0.97939  0.47087
+     74   2.32820  2.21922  2.20547  0.38033    183 t - - -
+          1.38754  1.38754  1.38258  1.38754
+          0.01915  4.76174  4.56397  1.43527  0.27188  0.79457  0.60107
+     75   2.53326  2.51525  2.81550  0.24861    185 t - - -
+          1.40974  1.40974  1.35348  1.37339
+          0.02270  4.23268  4.83698  1.10826  0.40068  1.00683  0.45472
+     76   4.01877  3.80239  4.14994  0.05769    190 T - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.00798  4.83507        *  1.46634  0.26236  0.00000        *
+//
+HMMER3/f [3.3 | Nov 2019]
+NAME  -VNP
+LENG  78
+MAXL  146
+ALPH  DNA
+RF    no
+MM    no
+CONS  yes
+CS    no
+MAP   yes
+DATE  Wed Jun 24 11:28:40 2020
+NSEQ  362960
+EFFN  10.598005
+CKSUM 2301423966
+STATS LOCAL MSV       -8.4629  0.71859
+STATS LOCAL VITERBI  -10.7340  0.71859
+STATS LOCAL FORWARD   -2.9419  0.71859
+HMM          A        C        G        T   
+            m->m     m->i     m->d     i->m     i->i     d->m     d->d
+  COMPO   1.18951  1.35593  1.40242  1.65069
+          1.38629  1.38629  1.38629  1.38629
+          0.01579  4.84957  4.84957  1.46634  0.26236  0.00000        *
+      1   0.20951  2.79675  2.93358  2.59289      1 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.42455  4.84994  1.08439  1.46634  0.26236  1.09861  0.40547
+      2   0.29063  2.37160  2.78226  2.33325      2 a - - -
+          0.48077  2.08334  2.04850  2.05374
+          0.86129  0.59920  3.57088  0.08125  2.55054  0.23189  1.57519
+      3   0.21209  2.99098  2.54392  2.77556      4 a - - -
+          1.47022  1.30585  1.45271  1.32709
+          0.07987  2.69005  4.72357  0.39470  1.12050  0.79963  0.59692
+      4   0.27420  2.78402  2.81536  2.13584      7 a - - -
+          0.60885  1.85002  1.86485  1.93882
+          0.45748  1.04764  4.11288  0.25199  1.50172  1.08506  0.41231
+      5   0.47654  2.23268  1.90295  2.09801     11 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.06776  4.84273  2.85369  1.46634  0.26236  1.05645  0.42723
+      6   0.27482  2.26612  3.12363  2.37968     12 a - - -
+          1.61758  0.90421  1.61758  1.61758
+          0.15533  2.36241  3.00225  0.29608  1.36153  0.66317  0.72405
+      7   0.56541  2.33007  1.95513  1.64488     14 a - - -
+          1.76580  0.73095  1.75682  1.74352
+          0.18425  1.83834  4.68932  0.18518  1.77759  0.67356  0.71313
+      8   0.80242  1.80431  2.36910  1.22553     16 a - - -
+          2.14306  1.36362  1.25467  1.07353
+          0.63255  0.82225  3.52936  0.88532  0.53202  1.08174  0.41401
+      9   0.89961  1.66119  1.53989  1.66626     28 a - - -
+          1.78422  1.79201  0.69551  1.79201
+          0.85416  1.78439  0.90027  0.17273  1.84113  0.90877  0.51587
+     10   2.26598  2.67899  0.45868  1.63209     31 g - - -
+          1.41306  1.40078  1.32125  1.41306
+          0.04314  3.61495  4.17967  1.01175  0.45190  0.17764  1.81553
+     11   2.34163  0.50906  1.61752  2.25970     33 c - - -
+          2.25997  1.67887  0.72018  1.50329
+          0.73655  0.92073  2.09550  0.62318  0.76839  1.07807  0.41590
+     12   2.10315  1.37307  1.64058  0.84227     40 t - - -
+          1.38006  1.38838  1.38838  1.38838
+          0.36391  4.64586  1.21926  1.41492  0.27832  1.27311  0.32845
+     13   1.80488  2.10504  2.46512  0.46415     42 t - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.04656  4.43011  3.39380  1.46634  0.26236  0.19114  1.74878
+     14   2.81146  3.01581  0.16897  3.07168     43 g - - -
+          1.61570  1.11762  0.91940  2.58454
+          0.68464  0.73841  4.02540  0.61410  0.77898  0.91731  0.51015
+     15   2.16997  0.59771  1.59983  2.01128     48 c - - -
+          1.40427  1.35522  1.39510  1.39129
+          0.22866  4.29424  1.65679  1.12409  0.39297  1.04131  0.43540
+     16   2.39263  3.01334  0.28526  2.22872     50 g - - -
+          1.57396  0.96048  1.58658  1.58258
+          0.11812  2.35363  4.11125  0.33374  1.25964  0.37177  1.16962
+     17   1.75548  2.92317  0.43064  2.09296     53 g - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.17719  4.82983  1.86829  1.46634  0.26236  0.84649  0.56022
+     18   1.80810  1.27122  0.78468  2.30978     54 g - - -
+          1.38448  1.38690  1.38690  1.38690
+          0.03282  4.67176  3.77539  1.45099  0.26701  1.87607  0.16628
+     19   2.60540  0.51052  2.44094  1.43185     56 c - - -
+          1.38377  1.38714  1.38714  1.38714
+          0.20935  4.64996  1.71856  1.44512  0.26882  0.36394  1.18722
+     20   2.28563  2.94199  0.33669  2.02953     58 g - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.13960  4.69070  2.11105  1.46634  0.26236  1.54529  0.23984
+     21   1.35359  2.98188  0.47288  2.69144     59 g - - -
+          1.33642  1.41002  1.39054  1.41002
+          0.03469  3.92185  4.24800  1.04783  0.43186  0.25839  1.47969
+     22   3.31690  0.13046  3.44617  2.91553     62 c - - -
+          1.69840  2.25303  1.31463  0.81335
+          1.58804  0.89781  0.94620  0.44252  1.02839  1.11150  0.39908
+     23   1.74256  0.57066  2.34267  1.80968     68 c - - -
+          1.37700  1.38941  1.38941  1.38941
+          0.48175  4.25314  0.99946  1.39108  0.28609  0.18779  1.76487
+     24   2.39799  2.67978  0.56274  1.30609     71 g - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.28750  4.59422  1.42814  1.46634  0.26236  1.30252  0.31724
+     25   2.75751  3.90598  0.11455  3.70241     72 g - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.08388  4.42089  2.68184  1.46634  0.26236  2.00260  0.14501
+     26   0.04917  4.28533  3.98422  4.16009     73 A - - -
+          1.41188  1.41188  1.41188  1.31326
+          0.22306  3.69020  1.74318  1.02553  0.44411  0.22126  1.61699
+     27   3.67051  0.11807  3.49313  2.89137     75 c - - -
+          1.48242  1.25414  1.63174  1.23100
+          0.28877  2.42904  1.81589  0.47903  0.96596  1.13782  0.38642
+     28   3.11007  2.36296  3.13433  0.20122     79 t - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.02884  4.60465  3.99422  1.46634  0.26236  0.37606  1.16016
+     29   2.48393  0.15831  3.76506  3.22299     80 c - - -
+          1.34988  1.39873  1.39873  1.39873
+          0.04318  4.41132  3.50262  1.20959  0.35428  0.85483  0.55401
+     30   3.09390  2.81008  2.17959  0.24668     82 t - - -
+          2.15979  0.62300  1.36417  2.37815
+          0.79931  0.62450  4.21090  0.09107  2.44136  0.76612  0.62514
+     31   1.44785  0.55629  2.27142  2.42556     86 c - - -
+          0.86080  2.03361  1.30091  1.74853
+          0.31631  1.33468  4.83765  0.84336  0.56258  1.11369  0.39801
+     32   1.92171  2.26319  2.25569  0.43878     91 t - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.15401  4.84610  2.00339  1.46634  0.26236  1.01618  0.44938
+     33   2.73141  0.58435  1.19669  2.58740     92 c - - -
+          0.89317  1.62515  1.62515  1.62515
+          0.22659  2.24904  2.33047  0.28785  1.38580  0.38750  1.13554
+     34   1.10267  2.41234  2.52389  0.69663     94 t - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.03621  4.77112  3.60845  1.46634  0.26236  0.56660  0.83805
+     35   2.27135  3.47476  0.18576  3.34144     95 g - - -
+          0.60021  1.97509  1.74984  1.97509
+          0.44749  1.34531  2.29949  0.12918  2.11041  1.24617  0.33912
+     36   0.82633  2.28559  1.24110  1.76279     98 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.25044  4.73281  1.54769  1.46634  0.26236  0.66526  0.72184
+     37   0.26117  2.44957  3.14355  2.29869     99 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.02593  4.61038  4.15730  1.46634  0.26236  0.51688  0.90728
+     38   2.47408  1.69170  0.51949  1.98975    100 g - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.15519  4.78954  1.99931  1.46634  0.26236  0.63715  0.75246
+     39   0.59309  2.27810  1.38121  2.36840    101 a - - -
+          1.01564  1.68632  1.33947  1.65735
+          0.32747  2.12044  1.83710  0.34728  1.22625  1.16691  0.37299
+     40   1.64892  1.67145  1.99021  0.72753    104 t - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.19724  4.60301  1.77793  1.46634  0.26236  0.26523  1.45685
+     41   0.62202  2.55231  1.22675  2.38600    105 a - - -
+          1.16672  1.66175  1.11380  1.76904
+          0.27811  1.74061  2.69753  0.18356  1.78558  0.42766  1.05565
+     42   2.35335  2.34013  0.36047  2.19562    107 g - - -
+          1.63732  0.87588  1.63732  1.63732
+          0.12110  2.27398  4.49622  0.27545  1.42392  0.65446  0.73339
+     43   0.53413  1.76688  2.13444  2.08228    109 a - - -
+          2.16876  1.94482  0.46353  2.17498
+          0.61887  0.95969  2.54547  0.09520  2.39900  0.97848  0.47142
+     44   1.39871  3.22045  0.40650  3.05405    112 g - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.06934  4.77881  2.83731  1.46634  0.26236  1.03076  0.44120
+     45   2.59307  0.33211  2.16065  2.37998    113 c - - -
+          1.23776  1.59566  1.55038  1.22069
+          0.19333  2.42468  2.43858  0.32236  1.28895  0.47625  0.97051
+     46   1.62912  2.60851  0.44359  2.42449    116 g - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.16846  4.77719  1.91992  1.46634  0.26236  0.70174  0.68462
+     47   0.37143  2.81240  1.93608  2.24503    117 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.08405  4.69446  2.63852  1.46634  0.26236  0.96927  0.47700
+     48   2.84651  0.36321  2.00644  2.18883    118 c - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.10181  4.70297  2.43350  1.46634  0.26236  0.38415  1.14265
+     49   0.47976  2.02926  1.97008  2.20555    119 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.13841  4.77784  2.11324  1.46634  0.26236  0.62335  0.76819
+     50   2.33984  3.15993  0.24154  2.57950    120 g - - -
+          1.25750  1.24138  1.48320  1.61072
+          0.10564  2.48844  4.06226  0.46198  0.99435  0.50153  0.93039
+     51   1.56258  2.25526  0.53601  2.29781    123 g - - -
+          1.41324  1.41324  1.31053  1.41216
+          0.07665  4.09261  2.86318  1.00971  0.45307  0.88587  0.53163
+     52   2.61790  0.22244  3.26090  2.42894    125 c - - -
+          0.72927  1.73119  1.75739  1.78279
+          0.32256  1.79083  2.21742  0.18683  1.76953  0.72073  0.66630
+     53   0.26433  2.52765  2.48109  2.67678    128 a - - -
+          1.48381  1.58859  1.00840  1.58859
+          0.11429  2.47602  3.73280  0.36438  1.18622  0.58444  0.81513
+     54   0.23596  4.11061  1.75131  3.89979    132 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.18855  4.81777  1.80937  1.46634  0.26236  1.07078  0.41967
+     55   2.34818  3.24264  0.30047  2.08005    133 g - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.09153  4.66378  2.55062  1.46634  0.26236  0.96898  0.47718
+     56   3.44842  1.47641  3.62033  0.33831    134 t - - -
+          1.59703  0.94372  1.59703  1.58071
+          0.13721  2.33981  3.44629  0.32060  1.29358  0.49076  0.94717
+     57   1.78998  0.46229  2.39085  2.19240    136 c - - -
+          1.41253  1.31147  1.41253  1.41253
+          0.13171  4.07851  2.23990  1.01783  0.44844  0.66822  0.71872
+     58   0.41971  2.03277  2.33306  2.16461    138 a - - -
+          1.67853  1.65913  1.09173  1.24684
+          0.09247  2.57482  4.40985  0.73407  0.65384  0.47186  0.97774
+     59   2.02241  0.37730  2.69553  2.16762    141 c - - -
+          0.68624  1.80760  1.77462  1.81437
+          0.46758  1.74685  1.61365  0.17114  1.84963  1.03417  0.43931
+     60   0.49174  2.11725  2.26781  1.80460    144 a - - -
+          1.52286  1.52286  1.06208  1.52286
+          0.15719  2.71498  2.53514  0.44924  1.01642  0.66242  0.72485
+     61   0.38240  2.52577  2.03474  2.23433    146 a - - -
+          1.38682  1.38682  1.38682  1.38472
+          0.02501  4.69436  4.16352  1.45298  0.26641  0.52635  0.89344
+     62   0.53892  1.85126  1.87933  2.23596    148 a - - -
+          1.50932  1.09613  1.50932  1.49736
+          0.06352  2.99295  4.47399  0.48331  0.95904  0.82726  0.57491
+     63   1.54525  2.78530  0.43275  2.57295    151 g - - -
+          0.85515  1.34146  1.95914  1.75831
+          0.34942  1.32348  3.55085  0.16942  1.85889  1.00824  0.45391
+     64   0.51152  1.98244  2.03964  2.02034    157 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.12993  4.82990  2.17283  1.46634  0.26236  0.90383  0.51922
+     65   3.47177  0.21146  3.68250  2.00709    158 c - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.08337  4.73727  2.64192  1.46634  0.26236  0.53385  0.88271
+     66   0.40576  2.39156  2.32206  1.93816    159 a - - -
+          1.48640  1.11350  1.44196  1.56570
+          0.20239  2.92579  2.04328  0.71633  0.67049  1.43294  0.27260
+     67   2.48709  0.32322  2.95702  1.95857    163 c - - -
+          1.35363  1.39559  1.44555  1.35326
+          0.05266  3.60475  3.72525  0.91486  0.51178  0.72493  0.66235
+     68   3.11499  0.12234  3.57523  3.15200    167 c - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.06184  4.76162  2.96775  1.46634  0.26236  1.02349  0.44526
+     69   1.98376  3.44778  0.24312  3.06928    168 g - - -
+          0.92007  1.47446  1.71809  1.64404
+          0.15516  2.07165  4.03186  0.40833  1.09290  0.96062  0.48233
+     70   0.48731  2.08599  2.32928  1.80681    172 a - - -
+          1.38700  1.38700  1.38418  1.38700
+          0.08755  4.76279  2.58652  1.44850  0.26778  1.49802  0.25305
+     71   2.70939  0.19934  3.23153  2.59487    174 c - - -
+          1.39655  1.39655  1.39655  1.35613
+          0.03086  4.37627  4.02771  1.24722  0.33870  1.41834  0.27722
+     72   0.13277  3.47494  2.88206  3.28746    176 a - - -
+          1.42260  1.28466  1.42260  1.42260
+          0.04307  3.82607  3.89417  0.91351  0.51268  1.66510  0.20970
+     73   0.25761  2.86257  2.33884  2.60987    178 a - - -
+          1.34454  1.39579  1.38726  1.41904
+          0.03537  3.98574  4.12418  1.04446  0.43368  0.57587  0.82602
+     74   3.86721  0.07542  4.16721  3.31769    181 C - - -
+          1.54711  1.55009  1.54970  1.01446
+          0.16698  2.72622  2.42686  0.39307  1.12388  1.12267  0.39365
+     75   3.98821  3.16723  3.88813  0.08462    184 T - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.02103  4.74641  4.41245  1.46634  0.26236  0.93184  0.50059
+     76   3.18815  3.39257  3.13780  0.12585    185 t - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.01701  4.79322  4.75885  1.46634  0.26236  0.74163  0.64691
+     77   3.49723  3.27282  3.37635  0.10798    186 t - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.01607  4.83190  4.83190  1.46634  0.26236  0.91677  0.51051
+     78   3.66483  0.15142  3.99318  2.33857    187 c - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.00796  4.83715        *  1.46634  0.26236  0.00000        *
+//
+HMMER3/f [3.3 | Nov 2019]
+NAME  SSP
+LENG  81
+MAXL  144
+ALPH  DNA
+RF    no
+MM    no
+CONS  yes
+CS    no
+MAP   yes
+DATE  Wed Jun 24 11:28:48 2020
+NSEQ  481718
+EFFN  12.909916
+CKSUM 3873051367
+STATS LOCAL MSV       -9.0254  0.71855
+STATS LOCAL VITERBI  -11.0714  0.71855
+STATS LOCAL FORWARD   -3.4486  0.71855
+HMM          A        C        G        T   
+            m->m     m->i     m->d     i->m     i->i     d->m     d->d
+  COMPO   1.73658  1.91341  1.22265  0.96272
+          1.38629  1.38629  1.38629  1.38629
+          0.01332  5.01793  5.01793  1.46634  0.26236  0.00000        *
+      1   2.58385  3.05257  0.16612  3.49539      1 g - - -
+          0.38828  2.22071  2.25231  2.22483
+          0.54381  0.99085  3.03227  0.06864  2.71299  1.09861  0.40547
+      2   0.04470  4.29834  4.29507  4.10503      3 A - - -
+          1.22168  1.29409  1.45890  1.61635
+          0.08391  2.63530  4.73464  0.43799  1.03658  0.75057  0.63884
+      3   0.08192  3.57138  3.78475  3.58183      6 A - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.47374  5.00791  0.99251  1.46634  0.26236  1.00719  0.45451
+      4   1.87800  3.27192  0.27333  3.02964      7 g - - -
+          1.32615  1.38707  1.41738  1.41738
+          0.05078  3.74950  3.65050  0.96472  0.47980  2.56184  0.08030
+      5   2.25249  2.41693  1.62632  0.49591      9 t - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.05059  4.55464  3.24907  1.46634  0.26236  0.15692  1.92946
+      6   0.89024  2.82336  3.14596  0.71947     10 t - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.05313  4.99785  3.10128  1.46634  0.26236  0.81187  0.58703
+      7   2.82512  3.60552  0.17015  2.65947     11 g - - -
+          1.35901  1.41446  1.41446  1.35879
+          0.08565  4.21767  2.69782  0.99604  0.46099  0.70176  0.68461
+      8   2.77985  2.74207  2.40337  0.24449     13 t - - -
+          1.37956  1.39531  1.37516  1.39531
+          0.02990  4.64580  3.91947  1.26985  0.32972  0.56130  0.84505
+      9   3.21047  0.99551  3.28709  0.59282     15 t - - -
+          1.35861  0.93466  1.70713  1.77858
+          0.12918  2.31217  3.81035  0.49073  0.94722  0.94756  0.49051
+     10   2.78158  3.37836  0.13153  3.60444     18 g - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.53948  4.99896  0.89110  1.46634  0.26236  1.07873  0.41556
+     11   2.35369  2.72755  0.39718  1.78741     19 g - - -
+          1.48709  1.27459  1.31365  1.48905
+          0.08786  2.82124  3.70593  0.54436  0.86801  2.14442  0.12458
+     12   2.58558  1.92155  2.46513  0.36634     21 t - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.03168  4.52483  3.89459  1.46634  0.26236  1.96765  0.15057
+     13   2.02285  2.88520  0.26527  3.10379     22 g - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.04351  4.57184  3.43465  1.46634  0.26236  0.15885  1.91818
+     14   3.71675  3.08271  2.45934  0.16918     23 t - - -
+          2.07589  0.47214  2.07589  2.07589
+          0.58441  1.29592  1.77832  0.09327  2.41850  0.98199  0.46931
+     15   2.58092  0.84295  2.27351  0.93929     25 c - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.64543  4.83740  0.76006  1.46634  0.26236  0.43644  1.03940
+     16   1.84321  1.36272  1.58986  0.96293     26 t - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.05957  4.48840  3.06641  1.46634  0.26236  2.18216  0.11968
+     17   3.74440  3.37236  3.95206  0.08031     27 T - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.49016  4.49461  0.97737  1.46634  0.26236  0.19767  1.71836
+     18   2.16090  2.19560  0.32686  2.95070     28 g - - -
+          1.53699  1.53634  1.55751  1.02402
+          0.09528  2.60560  4.07327  0.37937  1.15293  0.24656  1.52089
+     19   2.40688  2.56756  0.86107  0.89044     30 g - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.03133  5.00335  3.72436  1.46634  0.26236  0.92199  0.50704
+     20   3.12573  2.73974  1.78024  0.32447     31 t - - -
+          1.77790  1.87215  1.52816  0.77593
+          0.25872  1.73929  2.95042  0.14197  2.02229  0.83599  0.56818
+     21   2.17567  2.75352  0.45120  1.68255     33 g - - -
+          1.39622  1.35026  1.39979  1.39979
+          0.03016  4.53702  3.96318  1.19217  0.36178  0.60963  0.78428
+     22   4.06896  3.20472  3.49762  0.09204     35 T - - -
+          1.41710  1.43546  1.26736  1.43546
+          0.04111  3.90243  3.90800  0.80818  0.59000  0.94077  0.49483
+     23   2.71143  0.59312  1.28660  2.25619     37 c - - -
+          2.40689  2.44494  2.44494  0.30593
+          0.42888  1.19599  3.07143  0.57659  0.82511  0.87079  0.54236
+     24   3.64646  3.05907  3.68254  0.10333     40 T - - -
+          1.84327  1.85644  0.68532  1.70624
+          0.20756  1.75883  4.18698  0.14728  1.98818  1.08241  0.41367
+     25   2.41340  1.42366  2.04053  0.61675     42 t - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.02871  4.98409  3.84195  1.46634  0.26236  0.71751  0.66936
+     26   3.51409  2.30865  4.18616  0.15592     43 t - - -
+          1.53784  1.72606  0.86119  1.69004
+          0.18733  2.15796  2.89551  0.20708  1.67639  0.91690  0.51042
+     27   2.51885  3.10217  0.34096  1.81150     45 g - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.16889  4.96593  1.90768  1.46634  0.26236  0.68356  0.70283
+     28   3.60351  3.16846  3.96761  0.09235     46 T - - -
+          1.35082  1.34570  1.42233  1.42935
+          0.03004  3.84919  4.79215  0.85502  0.55387  0.32458  1.28313
+     29   2.27343  2.50851  0.45186  1.71921     48 g - - -
+          2.08797  2.08168  0.95049  1.00844
+          0.68936  1.14439  1.71655  0.44176  1.02974  1.07994  0.41493
+     30   2.45942  2.37796  1.21340  0.64514     55 t - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.08794  4.82791  2.57459  1.46634  0.26236  0.36518  1.18440
+     31   3.46980  2.31044  3.34565  0.18102     56 t - - -
+          1.66200  1.66200  1.10993  1.23479
+          0.13209  2.32432  3.65389  0.25294  1.49841  1.03255  0.44021
+     32   2.26238  2.66655  1.04693  0.74362     58 t - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.13885  4.95346  2.09895  1.46634  0.26236  0.62463  0.76671
+     33   2.82829  0.11919  4.04364  3.33228     59 c - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.16816  4.89322  1.91541  1.46634  0.26236  0.63985  0.74944
+     34   4.28472  3.83061  3.72375  0.06147     60 T - - -
+          1.38723  1.38449  1.38624  1.38723
+          0.01619  4.80748  4.84256  1.44286  0.26952  0.45125  1.01289
+     35   2.14091  3.44083  0.27160  2.42749     62 g - - -
+          1.23854  2.72638  1.46747  0.88134
+          0.58736  0.83178  4.71764  0.74293  0.64573  1.21343  0.35265
+     36   1.14638  1.97459  2.08107  0.87084     70 t - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.08145  4.99240  2.63907  1.46634  0.26236  0.75851  0.63179
+     37   3.84804  3.19745  3.82457  0.08776     71 T - - -
+          1.39114  1.37189  1.39114  1.39114
+          0.46035  4.77522  1.02026  1.35290  0.29907  1.44622  0.26848
+     38   2.19903  3.24397  0.22018  3.04277     73 g - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.03261  4.52519  3.85112  1.46634  0.26236  1.36885  0.29357
+     39   1.93074  3.08025  0.31023  2.58050     74 g - - -
+          1.63423  1.37502  1.71249  0.98981
+          0.19105  1.85618  4.03754  0.21557  1.64032  0.19604  1.72584
+     40   2.18753  2.58809  3.56278  0.24299     76 t - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.14449  5.00656  2.05696  1.46634  0.26236  0.91242  0.51341
+     41   2.08502  4.14576  0.17439  3.91729     77 g - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.10850  4.89035  2.35074  1.46634  0.26236  0.42257  1.06526
+     42   4.19400  0.17933  4.38959  1.99011     78 c - - -
+          1.96974  1.90711  1.65645  0.65165
+          0.40236  1.72195  1.88029  0.39639  1.11702  0.45735  1.00229
+     43   2.39367  2.93455  2.85098  0.22594     81 t - - -
+          1.45666  1.45666  1.39537  1.25096
+          0.20606  3.57687  1.84356  0.74423  0.64455  1.48994  0.25539
+     44   2.42240  3.04231  0.27769  2.24400     84 g - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.14996  4.73636  2.03645  1.46634  0.26236  2.07120  0.13471
+     45   0.46324  1.88298  2.47513  2.00643     85 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.07606  4.62207  2.75825  1.46634  0.26236  0.33037  1.26820
+     46   3.79359  2.20682  3.51472  0.17712     86 t - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.36498  4.92387  1.20893  1.46634  0.26236  0.43090  1.04960
+     47   0.39909  2.41358  1.92453  2.36838     87 a - - -
+          1.39424  1.39424  1.36744  1.38951
+          0.20871  4.43298  1.73447  1.29010  0.32192  0.24742  1.51782
+     48   2.84048  2.19360  1.81684  0.40414     90 t - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.07073  4.87086  2.80310  1.46634  0.26236  0.67409  0.71258
+     49   2.85817  2.13985  2.81929  0.26748     91 t - - -
+          1.26766  1.31006  1.35481  1.65700
+          0.25604  2.31991  2.05881  0.25724  1.48362  0.42632  1.05815
+     50   1.79888  3.33404  0.26332  3.49422     93 g - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.19342  4.90120  1.78123  1.46634  0.26236  0.38682  1.13699
+     51   2.34559  0.37683  2.41415  2.04999     94 c - - -
+          1.69423  1.93215  1.95915  0.63404
+          0.47563  1.71906  1.61307  0.43552  1.04109  1.33809  0.30428
+     52   1.70332  2.31080  1.96520  0.54712     97 t - - -
+          1.41953  1.32191  1.43320  1.37436
+          0.07285  3.48146  3.23162  0.75327  0.63644  0.99190  0.46342
+     53   1.74668  2.03643  2.08546  0.56053     99 t - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.07995  4.80388  2.67888  1.46634  0.26236  0.73183  0.65590
+     54   1.76608  2.28746  1.78203  0.58129    100 t - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.19286  4.87391  1.78523  1.46634  0.26236  0.36452  1.18591
+     55   1.28244  1.50122  1.04615  1.90720    101 g - - -
+          1.61750  1.87505  1.87460  0.70352
+          0.16835  1.99205  3.98846  0.54473  0.86750  0.66010  0.72733
+     56   1.28043  1.64851  1.35291  1.30468    107 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.15647  4.95553  1.98195  1.46634  0.26236  0.96882  0.47728
+     57   1.27388  1.59987  1.05629  1.76850    108 g - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.02298  4.84857  4.20810  1.46634  0.26236  0.51819  0.90535
+     58   1.25970  1.49080  1.12977  1.78402    109 g - - -
+          1.71520  1.78677  1.74796  0.73722
+          0.46737  1.94696  1.46689  0.17814  1.81293  1.23602  0.34325
+     59   2.10504  2.60672  2.95913  0.28433    113 t - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.10809  4.73183  2.36826  1.46634  0.26236  1.05004  0.43066
+     60   1.81618  1.97960  1.51222  0.73645    114 t - - -
+          1.39411  1.37795  1.37914  1.39411
+          0.13313  4.49174  2.17641  1.29270  0.32093  0.31351  1.31257
+     61   0.88692  1.60829  1.24379  2.30699    116 a - - -
+          1.58643  1.05294  1.18783  1.95507
+          0.29359  1.44350  4.00003  0.12251  2.16021  0.51827  0.90522
+     62   1.14314  1.78771  0.83961  2.50151    120 g - - -
+          1.51417  1.22023  1.91676  1.08541
+          0.28012  1.60830  3.12177  0.12650  2.13012  0.77298  0.61922
+     63   1.25688  1.75053  1.34132  1.27197    123 a - - -
+          1.40189  1.34118  1.40160  1.40189
+          0.04030  4.49217  3.56482  1.15911  0.37654  0.68507  0.70129
+     64   1.88275  2.30699  1.64619  0.58791    125 t - - -
+          1.44274  1.34369  1.44549  1.31973
+          0.19656  3.76032  1.86323  0.74152  0.64700  0.78799  0.60652
+     65   2.19650  1.90119  2.31594  0.44512    127 t - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.02281  4.86114  4.21212  1.46634  0.26236  0.31581  1.30637
+     66   1.16322  1.65606  1.08010  1.85106    128 g - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.06144  5.01188  2.93880  1.46634  0.26236  0.98991  0.46459
+     67   1.05635  1.45767  1.17810  2.19250    129 a - - -
+          1.40167  1.46442  1.27591  1.41294
+          0.19198  1.79048  4.85385  0.54581  0.86601  0.64510  0.74362
+     68   1.28137  1.59715  1.10883  1.66112    136 g - - -
+          1.66283  1.66198  1.66283  0.84157
+          0.17303  2.39375  2.69416  0.25223  1.50087  1.02984  0.44171
+     69   1.25978  1.55111  1.17133  1.63826    138 g - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.18047  4.95526  1.84467  1.46634  0.26236  1.31176  0.31382
+     70   2.23300  2.27887  2.71208  0.32297    139 t - - -
+          1.38699  1.38699  1.38420  1.38699
+          0.11587  4.77637  2.29277  1.44863  0.26774  0.96002  0.48270
+     71   2.27089  2.85164  2.80967  0.24999    141 t - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.04170  4.80863  3.42085  1.46634  0.26236  0.36138  1.19308
+     72   1.02921  1.68910  1.19032  1.87144    142 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.11905  4.97597  2.25060  1.46634  0.26236  0.86661  0.54537
+     73   1.38380  1.44349  0.96667  2.01798    143 g - - -
+          1.41291  1.41278  1.41291  1.31057
+          0.05228  4.17000  3.33878  1.01347  0.45092  0.45636  1.00399
+     74   1.27935  1.52390  0.94053  2.17596    145 g - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.05661  4.98199  3.03284  1.46634  0.26236  0.82683  0.57525
+     75   1.23087  1.44843  1.14072  1.87448    146 g - - -
+          1.37452  1.46011  1.44252  1.27835
+          0.08738  3.48999  2.93429  0.63157  0.75877  1.13816  0.38626
+     76   2.62178  2.77001  2.44178  0.25147    149 t - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.01614  4.93589  4.73021  1.46634  0.26236  0.58943  0.80888
+     77   3.08973  2.24334  3.24330  0.21153    150 t - - -
+          1.38591  1.62896  1.51818  1.09464
+          0.11601  2.52756  3.51729  0.30422  1.33827  0.96553  0.47930
+     78   2.17396  2.77157  2.60910  0.28754    153 t - - -
+          1.36935  1.32393  1.42237  1.43340
+          0.02517  4.08036  4.83435  0.97678  0.47244  0.84399  0.56210
+     79   2.35579  3.49493  0.19560  2.94707    158 g - - -
+          1.21596  1.53404  1.53252  1.30225
+          0.10589  2.45875  4.20377  0.32742  1.27576  0.98998  0.46455
+     80   2.39283  3.73882  0.17301  3.13002    162 g - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.01347  5.00743  5.00743  1.46634  0.26236  0.94878  0.48974
+     81   3.35739  3.95267  0.08452  3.61138    163 G - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.00670  5.00956        *  1.46634  0.26236  0.00000        *
+//
+HMMER3/f [3.3 | Nov 2019]
+NAME  -SSP
+LENG  75
+MAXL  143
+ALPH  DNA
+RF    no
+MM    no
+CONS  yes
+CS    no
+MAP   yes
+DATE  Wed Jun 24 11:28:56 2020
+NSEQ  430975
+EFFN  11.209650
+CKSUM 4049756316
+STATS LOCAL MSV       -8.4366  0.71865
+STATS LOCAL VITERBI  -10.0288  0.71865
+STATS LOCAL FORWARD   -3.2265  0.71865
+HMM          A        C        G        T   
+            m->m     m->i     m->d     i->m     i->i     d->m     d->d
+  COMPO   0.98441  1.21923  1.90285  1.70516
+          1.38629  1.38629  1.38629  1.38629
+          0.01505  4.89848  4.89527  1.46634  0.26236  0.00000        *
+      1   2.99615  0.20191  2.68605  2.73790      1 c - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.43372  4.89846  1.06581  1.46634  0.26236  1.09862  0.40546
+      2   2.92324  0.21755  3.01303  2.37934      2 c - - -
+          1.40359  1.33401  1.41286  1.39665
+          0.06204  3.10362  4.18223  0.67015  0.71668  0.19472  1.73199
+      3   3.07746  0.19433  3.02246  2.50276      5 c - - -
+          0.42168  2.16785  2.16785  2.16099
+          0.50079  1.01162  3.49592  0.07910  2.57632  0.99811  0.45978
+      4   0.78508  1.06680  2.50211  2.13795      8 a - - -
+          0.56373  2.10889  1.73430  2.01727
+          0.35590  1.33657  3.30470  0.41596  1.07794  1.24135  0.34108
+      5   0.57484  1.97440  2.01339  1.80287     11 a - - -
+          2.26494  1.00393  1.49329  1.18713
+          0.59215  0.83431  4.36704  1.10377  0.40289  0.90202  0.52045
+      6   0.62907  1.90208  1.79953  1.88203     17 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.13722  4.87199  2.11556  1.46634  0.26236  0.95424  0.48630
+      7   0.20059  2.25284  3.63494  2.99037     18 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.28673  4.77042  1.42375  1.46634  0.26236  0.44385  1.02599
+      8   1.65836  1.29788  1.59666  1.09701     19 t - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.17887  4.65901  1.86882  1.46634  0.26236  0.69373  0.69257
+      9   2.09280  1.23183  1.17946  1.28210     20 g - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.14835  4.67299  2.05164  1.46634  0.26236  0.29673  1.35962
+     10   1.94618  1.20781  1.51931  1.08038     21 t - - -
+          0.77683  1.49804  1.97736  1.72519
+          0.59003  0.88525  3.40893  0.73838  0.64987  0.44127  1.03064
+     11   1.83821  1.10815  1.63382  1.15345     26 c - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.12690  4.87459  2.19338  1.46634  0.26236  0.95519  0.48571
+     12   0.91173  1.62636  1.66645  1.54830     27 a - - -
+          1.54707  1.49736  1.14738  1.40266
+          0.13796  2.70520  2.78046  0.39823  1.11323  0.65856  0.72897
+     13   0.74120  1.74389  1.99093  1.55092     29 a - - -
+          1.66961  1.66961  1.31020  1.03961
+          0.25949  2.16862  2.16960  0.24663  1.52066  0.57569  0.82626
+     14   0.99098  1.32393  2.02281  1.46787     32 a - - -
+          1.03298  1.97768  1.35030  1.40039
+          0.37372  1.67410  2.08461  0.50323  0.92780  1.22864  0.34629
+     15   1.81195  1.18252  1.46830  1.20450     36 c - - -
+          1.33080  1.40550  1.40550  1.40550
+          0.12285  4.12124  2.30882  1.10683  0.40138  0.71487  0.67188
+     16   1.79138  1.26356  1.49585  1.11912     38 t - - -
+          1.47226  1.47226  1.16546  1.47226
+          0.07621  3.21187  3.40818  0.60702  0.78739  0.34372  1.23486
+     17   1.80255  1.13177  1.66422  1.12911     40 t - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.36581  4.87600  1.20818  1.46634  0.26236  0.81153  0.58731
+     18   0.47092  2.27717  2.12375  1.87462     41 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.02107  4.56362  4.56362  1.46634  0.26236  0.51165  0.91506
+     19   0.60641  2.07295  1.71390  1.90568     42 a - - -
+          2.06411  0.94310  1.49798  1.34681
+          0.44994  1.12253  3.30006  0.11285  2.23760  0.47857  0.96671
+     20   1.46929  1.23468  1.90151  1.10975     46 t - - -
+          1.15623  1.79554  1.16117  1.57904
+          0.33365  1.29189  4.71668  0.11049  2.25761  0.77586  0.61676
+     21   1.81867  1.21856  1.41006  1.21075     49 t - - -
+          1.74446  1.42132  1.66418  0.93009
+          0.32781  1.32483  4.29371  0.10591  2.29769  1.07817  0.41584
+     22   1.11997  1.23595  1.49233  1.84324     52 a - - -
+          0.94047  1.73275  2.01534  1.20570
+          0.38996  1.20014  3.82762  0.09456  2.40541  0.99822  0.45971
+     23   0.56844  1.99945  2.32060  1.60959     55 a - - -
+          1.61085  1.55782  0.94169  1.61085
+          0.19815  2.47999  2.34331  0.30373  1.33964  0.90104  0.52113
+     24   0.46139  2.04318  1.92308  2.36637     57 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.16893  4.80703  1.91554  1.46634  0.26236  0.48781  0.95184
+     25   1.77064  1.51854  1.46400  0.96907     58 t - - -
+          1.42963  1.27517  1.42963  1.41956
+          0.21242  3.74071  1.78596  0.85276  0.55554  0.93659  0.49752
+     26   1.63772  0.99525  1.56996  1.47888     60 c - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.01909  4.66212  4.66069  1.46634  0.26236  0.27517  1.42480
+     27   1.59730  1.25370  1.79233  1.06265     61 t - - -
+          0.85251  1.71094  1.53247  1.73186
+          0.27233  1.76197  2.70766  0.15934  1.91531  1.08043  0.41468
+     28   1.81777  1.32800  1.53563  1.02922     63 t - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.18248  4.83633  1.83969  1.46634  0.26236  1.29552  0.31987
+     29   0.44697  2.02051  2.18758  2.15709     64 a - - -
+          0.97439  1.57891  1.57053  1.56809
+          0.11049  2.42938  4.10354  0.34412  1.23390  0.80261  0.59449
+     30   0.54318  2.15415  1.84238  1.93336     69 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.01742  4.79413  4.71123  1.46634  0.26236  0.47422  0.97385
+     31   0.30233  1.78666  3.30044  2.87316     70 a - - -
+          0.82610  1.66155  1.53781  1.84801
+          0.25491  1.69538  3.18249  0.18444  1.78121  1.02314  0.44545
+     32   1.78368  2.20368  0.52934  2.02048     73 g - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.02739  4.86340  3.94807  1.46634  0.26236  1.05883  0.42597
+     33   3.55010  0.13500  3.98820  2.53791     74 c - - -
+          1.33469  1.41486  1.41486  1.38294
+          0.14565  4.09619  2.12941  0.99165  0.46357  0.85309  0.55529
+     34   0.06594  4.19387  3.97359  3.50936     76 A - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.02048  4.77556  4.43637  1.46634  0.26236  0.44060  1.03185
+     35   0.37785  2.33412  1.95518  2.57395     77 a - - -
+          1.39659  1.35603  1.39659  1.39659
+          0.05015  4.54258  3.26327  1.24656  0.33896  0.95263  0.48731
+     36   2.39474  1.66850  2.92878  0.40525     79 t - - -
+          1.45935  1.10587  1.52168  1.52168
+          0.08200  2.95086  3.63305  0.45204  1.01151  0.79027  0.60463
+     37   0.09195  3.52887  3.24613  3.93273     81 A - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.05266  4.87699  3.13097  1.46634  0.26236  0.83436  0.56943
+     38   2.20769  2.01799  2.12463  0.44997     82 t - - -
+          1.39137  1.17341  1.29814  1.77834
+          0.14081  2.32465  3.39546  0.64737  0.74112  0.76691  0.62445
+     39   2.18733  0.24917  3.06625  2.78474     86 c - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.13308  4.86859  2.14629  1.46634  0.26236  1.03244  0.44027
+     40   0.08700  4.55796  2.80468  4.39673     87 A - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.14144  4.76792  2.09236  1.46634  0.26236  0.51095  0.91611
+     41   1.80517  3.08241  0.28543  3.26975     88 g - - -
+          1.43974  1.43974  1.43667  1.24375
+          0.10032  3.60887  2.68282  0.77836  0.61463  1.36212  0.29587
+     42   2.80917  0.16858  3.94185  2.58407     90 c - - -
+          1.39085  1.39085  1.39085  1.37274
+          0.08701  4.65771  2.60584  1.43579  0.27171  0.64910  0.73923
+     43   0.18206  3.01875  3.16970  2.58270     94 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.16859  4.78649  1.91865  1.46634  0.26236  0.48754  0.95227
+     44   2.80329  0.34929  1.97561  2.34836     95 c - - -
+          1.36961  1.38068  1.39759  1.39759
+          0.03373  4.38107  3.87978  1.22908  0.34610  0.39053  1.12916
+     45   2.54581  0.17693  4.07145  2.70756     97 c - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.11916  4.88332  2.25607  1.46634  0.26236  1.00566  0.45540
+     46   0.05455  4.39132  3.95756  3.83516     98 A - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.02073  4.79133  4.40469  1.46634  0.26236  0.45480  1.00670
+     47   0.31753  2.46245  2.14767  2.65825     99 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.01660  4.89155  4.71552  1.46634  0.26236  0.98755  0.46599
+     48   2.58539  0.16176  3.85306  2.94167    100 c - - -
+          0.76684  1.80302  1.50586  1.90451
+          0.41626  1.54151  2.06806  0.49990  0.93291  1.10865  0.40048
+     49   0.23401  2.59651  2.75720  2.65011    106 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.16439  4.77058  1.94410  1.46634  0.26236  0.88047  0.53544
+     50   2.83320  2.26983  0.22051  3.33157    107 g - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.19605  4.70047  1.77824  1.46634  0.26236  0.31761  1.30154
+     51   0.04888  4.40248  4.41332  3.75728    108 A - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.01783  4.75251  4.70564  1.46634  0.26236  0.46861  0.98316
+     52   0.13102  2.85899  3.61045  3.25892    109 a - - -
+          1.62654  0.89337  1.62654  1.62198
+          0.11454  2.40654  4.01210  0.28639  1.39019  0.85411  0.55454
+     53   0.34494  2.54959  2.00688  2.53553    111 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.16802  4.88792  1.91646  1.46634  0.26236  0.94739  0.49062
+     54   3.97012  0.13338  3.86005  2.46595    112 c - - -
+          1.39599  1.39224  1.39599  1.36138
+          0.06239  4.44778  3.02053  1.28129  0.32529  0.35437  1.20938
+     55   0.14936  3.79538  2.50194  3.37146    116 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.05637  4.86325  3.05570  1.46634  0.26236  0.84629  0.56038
+     56   2.43968  0.17911  4.03727  2.82768    117 c - - -
+          0.80891  1.68634  1.74115  1.63917
+          0.29076  1.95896  2.19551  0.19947  1.71017  0.96419  0.48012
+     57   0.45227  2.07511  2.09866  2.15716    120 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.08545  4.76801  2.61180  1.46634  0.26236  0.59225  0.80538
+     58   0.10679  3.98891  2.94743  3.49679    121 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.05813  4.80745  3.03017  1.46634  0.26236  0.61416  0.77891
+     59   0.49095  1.96280  1.88388  2.34870    122 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.01949  4.84372  4.47224  1.46634  0.26236  0.67197  0.71479
+     60   1.94388  2.87403  0.28975  2.95783    123 g - - -
+          1.21913  1.00194  1.75515  1.80506
+          0.20165  1.82854  3.81819  0.24589  1.52331  0.95226  0.48755
+     61   0.21263  2.93742  2.72766  2.61495    126 a - - -
+          1.47422  1.16115  1.47422  1.47422
+          0.15486  3.33614  2.22665  0.59901  0.79707  0.97727  0.47214
+     62   4.10622  0.11783  4.34539  2.50454    128 c - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.07250  4.78444  2.78754  1.46634  0.26236  1.16075  0.37579
+     63   0.31081  2.72642  2.31520  2.27351    129 a - - -
+          1.32594  1.37215  1.40896  1.44187
+          0.04894  3.80365  3.67022  0.97847  0.47142  1.00311  0.45687
+     64   2.99526  0.23430  3.16007  2.15046    133 c - - -
+          1.33071  1.39144  1.40407  1.42132
+          0.06601  3.91527  3.12476  0.92557  0.50469  0.57378  0.82872
+     65   2.25261  0.22159  3.24497  2.90653    135 c - - -
+          1.31188  1.54830  1.11802  1.65468
+          0.09010  2.61374  4.35086  0.61652  0.77614  1.01896  0.44780
+     66   1.89262  2.80560  0.30766  2.92458    139 g - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.05620  4.86221  3.05931  1.46634  0.26236  1.23398  0.34409
+     67   0.28044  2.51853  2.53590  2.46772    140 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.04867  4.82665  3.23168  1.46634  0.26236  0.82685  0.57523
+     68   4.18395  0.11259  4.42668  2.53466    141 c - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.10987  4.83769  2.34215  1.46634  0.26236  0.81263  0.58643
+     69   0.17238  3.20896  2.75339  2.91453    142 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.01888  4.78662  4.56946  1.46634  0.26236  0.82618  0.57575
+     70   0.11019  3.26011  3.45595  3.36993    143 a - - -
+          1.46671  1.30495  1.18683  1.64535
+          0.14495  2.29817  3.36706  0.40691  1.09572  0.97310  0.47467
+     71   4.19340  0.09882  4.27032  2.73305    148 C - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.07726  4.84233  2.71115  1.46634  0.26236  0.87777  0.53736
+     72   3.52362  3.60640  3.73844  0.08385    149 T - - -
+          1.38587  1.38857  1.38219  1.38857
+          0.01936  4.72768  4.57314  1.41058  0.27972  0.64947  0.73882
+     73   3.18192  2.90268  3.70235  0.12902    151 t - - -
+          1.53244  1.41314  1.34830  1.26964
+          0.07014  2.88758  4.42071  0.42770  1.05557  1.15418  0.37880
+     74   3.60344  3.61026  3.26078  0.09721    153 T - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.01569  4.86940  4.84234  1.46634  0.26236  0.85674  0.55259
+     75   3.83254  0.11846  4.10277  2.61001    154 c - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.00763  4.87971        *  1.46634  0.26236  0.00000        *
+//


=====================================
pychopper/phmm_data/PCS110_primers.hmm.h3f
=====================================
Binary files /dev/null and b/pychopper/phmm_data/PCS110_primers.hmm.h3f differ


=====================================
pychopper/phmm_data/PCS110_primers.hmm.h3i
=====================================
Binary files /dev/null and b/pychopper/phmm_data/PCS110_primers.hmm.h3i differ


=====================================
pychopper/phmm_data/PCS110_primers.hmm.h3m
=====================================
Binary files /dev/null and b/pychopper/phmm_data/PCS110_primers.hmm.h3m differ


=====================================
pychopper/phmm_data/PCS110_primers.hmm.h3p
=====================================
Binary files /dev/null and b/pychopper/phmm_data/PCS110_primers.hmm.h3p differ


=====================================
pychopper/primer_data/PCS110_primers.fas
=====================================
@@ -0,0 +1,4 @@
+>VNP
+ACTTGCCTGTCGCTCTATCTTCGAGGAGAGTCCGCCGCCCGCAAGTTT
+>SSP
+TTTCTGTTGGTGCTGATATTGCTTT


=====================================
scripts/cdna_classifier.py
=====================================
@@ -28,6 +28,8 @@ parser.add_argument(
     '-g', metavar='phmm_file', type=str, default=None, help="File with custom profile HMMs (None).", required=False)
 parser.add_argument(
     '-c', metavar='config_file', type=str, default=None, help="File to specify primer configurations for each direction (None).")
+parser.add_argument(
+    '-k', metavar='kit', type=str, default="PCS109", help="Use primer sequences from this kit (PCS109).")
 parser.add_argument(
     '-q', metavar='cutoff', type=float, default=None, help="Cutoff parameter (autotuned).")
 parser.add_argument(
@@ -174,7 +176,7 @@ def _detect_anomalies(st, config):
     anom = []
     for tmp in raw_anom:
         pc = tmp[1] * 100.0 / total
-        if pc >= 1:
+        if pc >= 3.0:
             anom.append((tmp[0], tmp[1], pc))
     if len(anom) > 0:
         sys.stderr.write("Detected {} potential artefactual primer configurations:\n".format(len(anom)))
@@ -219,14 +221,23 @@ def _plot_pd_line(df, title, report, alpha=0.7, xrot=0, vline=None):
 def _plot_stats(st, pdf):
     "Generate plots and save to report PDF"
     R = report.Report(pdf)
-    _plot_pd_bars(st.loc[st.Category == "Classification", ].copy(), "Classification of output reads", R, ann=True)
+    rs = st.loc[st.Category == "Classification", ]
+    _plot_pd_bars(rs.copy(), "Classification of output reads", R, ann=True)
+    found, rescue, unusable = float(rs.loc[rs.Name == "Primers_found", ].Value), float(rs.loc[rs.Name == "Rescue", ].Value), float(rs.loc[rs.Name == "Unusable", ].Value)
+    total = found + rescue + unusable
+    found = found / total * 100
+    rescue = rescue / total * 100
+    unusable = unusable / total * 100
+    sys.stderr.write("-----------------------------------\n")
+    sys.stderr.write("Reads with two primers:\t{:.2f}%\nRescued reads:\t\t{:.2f}%\nUnusable reads:\t\t{:.2f}%\n".format(found, rescue, unusable))
+    sys.stderr.write("-----------------------------------\n")
     _plot_pd_bars(st.loc[st.Category == "Strand", ].copy(), "Strand of oriented reads", R, ann=True)
     _plot_pd_bars(st.loc[st.Category == "RescueStrand", ].copy(), "Strand of rescued reads", R, ann=True)
     _plot_pd_bars(st.loc[st.Category == "UnclassHitNr", ].copy(), "Number of hits in unclassified reads", R)
     _plot_pd_bars(st.loc[st.Category == "RescueHitNr", ].copy(), "Number of hits in rescued reads", R)
     _plot_pd_bars(st.loc[st.Category == "RescueSegmentNr", ].copy(), "Number of usable segments per rescued read", R)
-    if args.q is None:
-        _plot_pd_line(st.loc[st.Category == "AutotuneSample", ].copy(), "Usable bases as function of cutoff(q). Best q={:.4f}".format(args.q), R, vline=args.q)
+    if q_bak is None:
+        _plot_pd_line(st.loc[st.Category == "AutotuneSample", ].copy(), "Usable bases as function of cutoff(q). Best q={:.4g}".format(args.q), R, vline=args.q)
     udf = st.loc[st.Category == "Unusable", ].copy()
     udf.Name = np.log10(1.0 + np.array(udf.Name, dtype=float))
     _plot_pd_line(udf, "Log10 length distribution of trimmed away sequences.", R)
@@ -244,17 +255,21 @@ if __name__ == '__main__':
     if args.c is not None:
         CONFIG = open(args.c, "r").readline().strip()
 
+    kits = {"PCS109": {"HMM": os.path.join(os.path.dirname(phmm_data.__file__), "cDNA_SSP_VNP.hmm"), "FAS": os.path.join(os.path.dirname(primer_data.__file__), "cDNA_SSP_VNP.fas"), }, "PCS110": {
+                                           "HMM": os.path.join(os.path.dirname(phmm_data.__file__), "PCS110_primers.hmm"), "FAS": os.path.join(os.path.dirname(primer_data.__file__), "PCS110_primers.fas")}}
+
     if args.g is None:
-        args.g = os.path.join(os.path.dirname(phmm_data.__file__), "cDNA_SSP_VNP.hmm")
+        args.g = kits[args.k]["HMM"]
 
     if args.b is None:
-        args.b = os.path.join(os.path.dirname(primer_data.__file__), "cDNA_SSP_VNP.fas")
+        args.b = kits[args.k]["FAS"]
 
     if args.x is not None and args.x in ('DCS109'):
         if args.x == "DCS109":
             CONFIG = "-:VNP,-VNP"
 
     config = utils.parse_config_string(CONFIG)
+    sys.stderr.write("Using kit: {}\n".format(args.k))
     sys.stderr.write("Configurations to consider: \"{}\"\n".format(CONFIG))
 
     in_fh = sys.stdin
@@ -306,9 +321,10 @@ if __name__ == '__main__':
     else:
         raise Exception("Invalid backend!")
 
-    # Pick the -q maximizing the number of classified reads using frid search:
+    # Pick the -q maximizing the number of classified reads using grid search:
     nr_records = None
     tune_df = None
+    q_bak = args.q
     if args.q is None:
         nr_cutoffs = args.L
         cutoffs = np.linspace(0.0, 1.0, num=nr_cutoffs)
@@ -356,7 +372,7 @@ if __name__ == '__main__':
         tune_df["Value"] += [args.q]
         if best_qi == (len(class_reads) - 1):
             sys.stderr.write("Best cuttoff value is at the edge of the search interval! Using tuned value is not safe! Please pick a q value manually and QC your data!\n")
-        sys.stderr.write("Best cutoff (q) value is {:.4f} with {:.0f}% of the reads classified.\n".format(args.q, class_reads[best_qi] * 100 / len(read_sample)))
+        sys.stderr.write("Best cutoff (q) value is {:.4g} with {:.0f}% of the reads classified.\n".format(args.q, class_reads[best_qi] * 100 / len(read_sample)))
 
     if nr_records is not None:
         input_size = nr_records
@@ -380,7 +396,7 @@ if __name__ == '__main__':
                 for trim_read in chopper.segments_to_reads(read, segments, args.p):
                     if args.l is not None and len(trim_read.Seq) < args.z:
                         st["LenFail"] += 1
-                        seu.writefq(read, l_fh)
+                        seu.writefq(trim_read, l_fh)
                         continue
                     if len(segments) == 1:
                         seu.writefq(trim_read, out_fh)


=====================================
setup.cfg
=====================================
@@ -1,5 +1,5 @@
 [bumpversion]
-current_version = 2.4.0
+current_version = 2.5.0
 commit = True
 tag = True
 


=====================================
setup.py
=====================================
@@ -26,7 +26,7 @@ test_requirements = [
 
 setup(
     name='pychopper',
-    version='2.4.0',
+    version='2.5.0',
     description="A tool to identify full length cDNA reads.",
     long_description=readme,
     author="ONT Applications Group",



View it on GitLab: https://salsa.debian.org/med-team/pychopper/-/compare/4eb8495f9969f4793c464c46820f916ee2efd337...005a84c7525f52250379cdfc8a9d7a97672b1bf5

-- 
View it on GitLab: https://salsa.debian.org/med-team/pychopper/-/compare/4eb8495f9969f4793c464c46820f916ee2efd337...005a84c7525f52250379cdfc8a9d7a97672b1bf5
You're receiving this email because of your account on salsa.debian.org.


-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://alioth-lists.debian.net/pipermail/debian-med-commit/attachments/20201026/e71b6872/attachment-0001.html>


More information about the debian-med-commit mailing list