[med-svn] [Git][med-team/nanosv][master] 3 commits: Since toy.sam is available in the samtools package already, simply take the...

[Nilesh Patra (@nilesh)]

Nilesh Patra pushed to branch master at Debian Med / nanosv


Commits:
48726de4 by Nilesh Patra at 2021-05-29T21:08:59+05:30
Since toy.sam is available in the samtools package already, simply take the relevant file from there

- - - - -
3c875e17 by Nilesh Patra at 2021-05-29T21:10:39+05:30
Add recommends on sambamba

- - - - -
ace8e110 by Nilesh Patra at 2021-05-29T21:10:43+05:30
Update Interim changelog entry

- - - - -


7 changed files:

- debian/README.test
- debian/changelog
- debian/control
- debian/copyright
- − debian/examples
- − debian/tests/data/read.sam
- debian/tests/run-unit-test


Changes:

=====================================
debian/README.test
=====================================
@@ -9,7 +9,3 @@ in order to confirm its integrity.
 
 Notes on the files used for testing 
 ────────────────────────────────────────
-Files: debian/tests/data/*
-Source: https://github.com/samtools/samtools/blob/develop/examples/toy.sam
-
-


=====================================
debian/changelog
=====================================
@@ -1,8 +1,7 @@
 nanosv (1.2.4+git20190409.c1ae30c-4) UNRELEASED; urgency=medium
 
-  * Add test data
+  * Team Upload.
   * Add autopkgtests
-  * Add examples and docs
 
  -- Shruti Sridhar <shruti.sridhar99 at gmail.com>  Wed, 26 May 2021 17:09:51 +0530
 


=====================================
debian/control
=====================================
@@ -18,6 +18,7 @@ Rules-Requires-Root: no
 
 Package: nanosv
 Architecture: all
+Recommends: sambamba
 Depends: ${python3:Depends},
          ${misc:Depends},
          python3-pysam,


=====================================
debian/copyright
=====================================
@@ -10,10 +10,6 @@ Files: debian/*
 Copyright: 2020 Steffen Moeller <moeller at debian.org>
 License: MIT
 
-Files: debian/tests/data/*
-Copyright: 2008-2020 Genome Research Ltd.
-License : MIT
-
 License: MIT
  Permission is hereby granted, free of charge, to any person obtaining a
  copy of this software and associated documentation files (the "Software"),


=====================================
debian/examples deleted
=====================================
@@ -1 +0,0 @@
-debian/tests/data/*
\ No newline at end of file


=====================================
debian/tests/data/read.sam deleted
=====================================
@@ -1,14 +0,0 @@
- at SQ	SN:ref	LN:45
- at SQ	SN:ref2	LN:40
-r001	163	ref	7	30	8M4I4M1D3M	=	37	39	TTAGATAAAGAGGATACTG	*	XX:B:S,12561,2,20,112
-r002	0	ref	9	30	1S2I6M1P1I1P1I4M2I	*	0	0	AAAAGATAAGGGATAAA	*
-r003	0	ref	9	30	5H6M	*	0	0	AGCTAA	*
-r004	0	ref	16	30	6M14N1I5M	*	0	0	ATAGCTCTCAGC	*
-r003	16	ref	29	30	6H5M	*	0	0	TAGGC	*
-r001	83	ref	37	30	9M	=	7	-39	CAGCGCCAT	*
-x1	0	ref2	1	30	20M	*	0	0	aggttttataaaacaaataa	????????????????????
-x2	0	ref2	2	30	21M	*	0	0	ggttttataaaacaaataatt	?????????????????????
-x3	0	ref2	6	30	9M4I13M	*	0	0	ttataaaacAAATaattaagtctaca	??????????????????????????
-x4	0	ref2	10	30	25M	*	0	0	CaaaTaattaagtctacagagcaac	?????????????????????????
-x5	0	ref2	12	30	24M	*	0	0	aaTaattaagtctacagagcaact	????????????????????????
-x6	0	ref2	14	30	23M	*	0	0	Taattaagtctacagagcaacta	???????????????????????
\ No newline at end of file


=====================================
debian/tests/run-unit-test
=====================================
@@ -2,6 +2,7 @@
 set -e
 
 pkg=nanosv
+examplepkg=samtools
 
 export LC_ALL=C.UTF-8
 if [ "${AUTOPKGTEST_TMP}" = "" ] ; then
@@ -9,18 +10,17 @@ if [ "${AUTOPKGTEST_TMP}" = "" ] ; then
   trap "rm -rf ${AUTOPKGTEST_TMP}" 0 INT QUIT ABRT PIPE TERM
 fi
 
-cp -a /usr/share/doc/${pkg}/examples/* "${AUTOPKGTEST_TMP}"
+cp -a /usr/share/doc/${examplepkg}/examples/toy.sam "${AUTOPKGTEST_TMP}"
 
 cd "${AUTOPKGTEST_TMP}"
+mv -f toy.sam read.sam
 
 cat read.sam| samtools view -Sb > reads.bam
 samtools sort reads.bam > reads_sort.bam
 samtools index reads_sort.bam reads_sort.bai
 bedtools bamtobed -i  reads_sort.bam > target.bed
 
-NanoSV reads_sort.bam -b target.bed -s sambamba -o output.vcf 
-[ -s "output.vcf" ] || exit 1 && echo "PASS Test"
-
 #Output generated is not consistent and cannot be compared with a reference. 
-
- 
\ No newline at end of file
+NanoSV reads_sort.bam -b target.bed -s sambamba -o output.vcf
+[ -s "output.vcf" ] || exit 1
+echo "PASS Test"



View it on GitLab: https://salsa.debian.org/med-team/nanosv/-/compare/a0c6fe0a2d2402755e55659a12e88a885771b908...ace8e1103ee955bd8002e22c6275f3ae77d05286

-- 
View it on GitLab: https://salsa.debian.org/med-team/nanosv/-/compare/a0c6fe0a2d2402755e55659a12e88a885771b908...ace8e1103ee955bd8002e22c6275f3ae77d05286
You're receiving this email because of your account on salsa.debian.org.


-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://alioth-lists.debian.net/pipermail/debian-med-commit/attachments/20210529/7a44f253/attachment-0001.htm>