[med-svn] [Git][med-team/python-pyani][master] 11 commits: Add missing build dependency on python3:any | python3-all:any |...

Étienne Mollier (@emollier) gitlab at salsa.debian.org
Sat Dec 3 17:36:37 GMT 2022



Étienne Mollier pushed to branch master at Debian Med / python-pyani


Commits:
90918ced by Étienne Mollier at 2022-12-03T17:43:41+01:00
Add missing build dependency on python3:any | python3-all:any | python3-dev:any | python3-all-dev:any | dh-sequence-python3 for addon python3.

Changes-By: lintian-brush
Fixes: lintian: missing-build-dependency-for-dh-addon
See-also: https://lintian.debian.org/tags/missing-build-dependency-for-dh-addon.html

- - - - -
b0c73010 by Étienne Mollier at 2022-12-03T18:26:45+01:00
d/control: move from nose to pytest.

- - - - -
a58f908e by Étienne Mollier at 2022-12-03T18:27:02+01:00
d/t/control: move from nose to pytest.

- - - - -
5e85d100 by Étienne Mollier at 2022-12-03T18:27:20+01:00
d/t/run-unit-test: replace nosetests by pytest.

- - - - -
5aaee090 by Étienne Mollier at 2022-12-03T18:28:06+01:00
pytest.patch: migrate from nose to pytest.

Closes: #1018559

- - - - -
74992c6b by Étienne Mollier at 2022-12-03T18:29:08+01:00
d/control: revert change from lintian-brush

Gbp-Dch: ignore

- - - - -
ab3941c2 by Étienne Mollier at 2022-12-03T18:29:53+01:00
d/t/run-unit-test: run against all supported python versions.

- - - - -
543cb223 by Étienne Mollier at 2022-12-03T18:30:55+01:00
d/control: add myself to uploaders.

- - - - -
3f9cc33b by Étienne Mollier at 2022-12-03T18:31:55+01:00
d/control: restore python3-all-dev.

This can be done since python-biopython 1.80 is built for python3.11.

- - - - -
d2c2f8b9 by Étienne Mollier at 2022-12-03T18:33:56+01:00
d/copyright: bump copyright year.

- - - - -
f22ed322 by Étienne Mollier at 2022-12-03T18:35:32+01:00
ready to upload to unstable.

- - - - -


7 changed files:

- debian/changelog
- debian/control
- debian/copyright
- + debian/patches/pytest.patch
- + debian/patches/series
- debian/tests/control
- debian/tests/run-unit-test


Changes:

=====================================
debian/changelog
=====================================
@@ -1,8 +1,20 @@
-python-pyani (0.2.12-2) UNRELEASED; urgency=medium
+python-pyani (0.2.12-2) unstable; urgency=medium
 
+  [ Andreas Tille ]
   * Proper filename for download tarball
 
- -- Andreas Tille <tille at debian.org>  Fri, 25 Nov 2022 07:33:11 +0100
+  [ Étienne Mollier ]
+  * d/control: move from nose to pytest.
+  * d/t/control: move from nose to pytest.
+  * d/t/run-unit-test: replace nosetests by pytest.
+  * pytest.patch: migrate from nose to pytest. (Closes: #1018559)
+  * d/t/run-unit-test: run against all supported python versions.
+  * d/control: add myself to uploaders.
+  * d/control: restore python3-all-dev now that python-biopython 1.80 is built
+    for python3.11.
+  * d/copyright: bump copyright year.
+
+ -- Étienne Mollier <emollier at debian.org>  Sat, 03 Dec 2022 18:34:26 +0100
 
 python-pyani (0.2.12-1) unstable; urgency=medium
 


=====================================
debian/control
=====================================
@@ -1,12 +1,12 @@
 Source: python-pyani
 Maintainer: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-Uploaders: Andreas Tille <tille at debian.org>
+Uploaders: Andreas Tille <tille at debian.org>,
+           Étienne Mollier <emollier at debian.org>
 Section: science
 Priority: optional
 Build-Depends: debhelper-compat (= 13),
                dh-python,
-# FIXME:       python3-all-dev, # Once python-biopython is build for Python 3.11 this should be activated
-               python3-dev,
+               python3-all-dev,
                python3-setuptools,
                python3-biopython <!nocheck>,
                python3-matplotlib <!nocheck>,
@@ -15,7 +15,7 @@ Build-Depends: debhelper-compat (= 13),
                python3-seaborn <!nocheck>,
                mummer <!nocheck>,
                ncbi-blast+ <!nocheck>,
-               python3-nose <!nocheck>
+               python3-pytest <!nocheck>
 Standards-Version: 4.6.1
 Vcs-Browser: https://salsa.debian.org/med-team/python-pyani
 Vcs-Git: https://salsa.debian.org/med-team/python-pyani.git


=====================================
debian/copyright
=====================================
@@ -7,7 +7,7 @@ Copyright: 2010-2019 The James Hutton Institute
 License: MIT
 
 Files: debian/*
-Copyright: 2019 Andreas Tille <tille at debian.org>
+Copyright: 2019-2022 Andreas Tille <tille at debian.org>
 License: MIT
 
 License: MIT


=====================================
debian/patches/pytest.patch
=====================================
@@ -0,0 +1,763 @@
+Description: migrate from nose to pytest
+Author: Étienne Mollier <emollier at debian.org>
+Bug-Debian: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=1018559
+Forwarded: no
+Last-Update: 2022-12-03
+---
+This patch header follows DEP-3: http://dep.debian.net/deps/dep3/
+--- python-pyani.orig/tests/test_anib.py
++++ python-pyani/tests/test_anib.py
+@@ -6,10 +6,10 @@
+ 
+ These tests are intended to be run from the repository root using:
+ 
+-nosetests -v
++pytest -v
+ 
+-print() statements will be caught by nosetests unless there is an
+-error. They can also be recovered with the -s option.
++print() statements will be caught by pytest unless there is an
++error.
+ 
+ (c) The James Hutton Institute 2017
+ Author: Leighton Pritchard
+@@ -55,7 +55,7 @@
+ 
+ import pandas as pd
+ 
+-from nose.tools import assert_equal, nottest
++import pytest
+ from pandas.testing import assert_frame_equal
+ 
+ from pyani import anib, pyani_files
+@@ -290,13 +290,13 @@
+         os.makedirs(self.fmtdboutdir, exist_ok=True)
+         os.makedirs(self.makeblastdbdir, exist_ok=True)
+ 
+-    @nottest  #  legacy BLAST deprecated
++    @pytest.mark.skip(reason="legacy BLAST deprecated")
+     def test_formatdb_generation(self):
+         """generate formatdb command-line."""
+         cmd = anib.construct_formatdb_cmd(
+             os.path.join(self.seqdir, "NC_002696.fna"), self.fmtdboutdir
+         )
+-        assert_equal(cmd[0], self.fmtdbcmd)  # correct command
++        assert cmd[0] == self.fmtdbcmd  # correct command
+         assert os.path.isfile(cmd[1])  # creates new file
+ 
+     def test_makeblastdb_generation(self):
+@@ -304,7 +304,7 @@
+         cmd = anib.construct_makeblastdb_cmd(
+             os.path.join(self.seqdir, "NC_002696.fna"), self.makeblastdbdir
+         )
+-        assert_equal(cmd[0], self.makeblastdbcmd)  # correct command
++        assert cmd[0] == self.makeblastdbcmd  # correct command
+ 
+     def test_blastdb_commands(self):
+         """generate BLAST+ db commands."""
+@@ -312,31 +312,31 @@
+         cmds = anib.generate_blastdb_commands(
+             self.blastdbfnames, self.outdir, mode="ANIb"
+         )
+-        assert_equal(cmds, self.blastdbtgt)
++        assert cmds == self.blastdbtgt
+ 
+-    @nottest  #  legacy BLAST deprecated
++    @pytest.mark.skip(reason="legacy BLAST deprecated")
+     def test_legacy_blastdb_commands(self):
+         """generate legacy BLAST db commands."""
+         # legacy
+         cmds = anib.generate_blastdb_commands(
+             self.blastdbfnames, self.outdir, mode="ANIblastall"
+         )
+-        assert_equal(cmds, self.blastdbtgtlegacy)
++        assert cmds == self.blastdbtgtlegacy
+ 
+     def test_blastn_generation(self):
+         """generate BLASTN+ command-line."""
+         cmd = anib.construct_blastn_cmdline(
+             self.blastdbfnames[0], self.blastdbfnames[1], self.outdir
+         )
+-        assert_equal(cmd, self.blastncmd)
++        assert cmd == self.blastncmd
+ 
+-    @nottest  #  legacy BLAST deprecated
++    @pytest.mark.skip(reason="legacy BLAST deprecated")
+     def test_blastall_generation(self):
+         """generate legacy BLASTN command-line."""
+         cmd = anib.construct_blastall_cmdline(
+             self.blastdbfnames[0], self.blastdbfnames[1], self.outdir
+         )
+-        assert_equal(cmd, self.blastallcmd)
++        assert cmd == self.blastallcmd
+ 
+     def test_blastn_commands(self):
+         """generate BLASTN+ commands."""
+@@ -344,32 +344,28 @@
+         cmds = anib.generate_blastn_commands(
+             self.blastdbfnames, self.outdir, mode="ANIb"
+         )
+-        assert_equal(cmds, self.blastntgt)
++        assert cmds == self.blastntgt
+ 
+-    @nottest  #  legacy BLAST deprecated
++    @pytest.mark.skip(reason="legacy BLAST deprecated")
+     def test_legacy_blastn_commands(self):
+         """generate legacy BLASTN commands."""
+         cmds = anib.generate_blastn_commands(
+             self.blastdbfnames, self.outdir, mode="ANIblastall"
+         )
+-        assert_equal(cmds, self.blastalltgt)
++        assert cmds == self.blastalltgt
+ 
+-    @nottest  #  legacy BLAST deprecated
++    @pytest.mark.skip(reason="legacy BLAST deprecated")
+     def test_blastall_dbjobdict(self):
+         """generate dictionary of legacy BLASTN database jobs."""
+         blastcmds = anib.make_blastcmd_builder("ANIblastall", self.outdir)
+         jobdict = anib.build_db_jobs(self.infiles, blastcmds)
+-        assert_equal(
+-            sorted([(k, v.script) for (k, v) in jobdict.items()]), self.blastalljobdict
+-        )
++        assert sorted([(k, v.script) for (k, v) in jobdict.items()]) == self.blastalljobdict
+ 
+     def test_blastn_dbjobdict(self):
+         """generate dictionary of BLASTN+ database jobs."""
+         blastcmds = anib.make_blastcmd_builder("ANIb", self.outdir)
+         jobdict = anib.build_db_jobs(self.infiles, blastcmds)
+-        assert_equal(
+-            sorted([(k, v.script) for (k, v) in jobdict.items()]), self.blastnjobdict
+-        )
++        assert sorted([(k, v.script) for (k, v) in jobdict.items()]) == self.blastnjobdict
+ 
+     def test_blastn_graph(self):
+         """create jobgraph for BLASTN+ jobs."""
+@@ -380,11 +376,11 @@
+         # is a single dependency, which is a makeblastdb job
+         for job in jobgraph:
+             assert job.script.startswith("blastn")
+-            assert_equal(1, len(job.dependencies))
++            assert 1 == len(job.dependencies)
+             dep = job.dependencies[0]
+             assert dep.script.startswith("makeblastdb")
+ 
+-    @nottest  #  legacy BLAST deprecated
++    @pytest.mark.skip(reason="legacy BLAST deprecated")
+     def test_blastall_graph(self):
+         """create jobgraph for legacy BLASTN jobs."""
+         fragresult = anib.fragment_fasta_files(self.infiles, self.outdir, self.fraglen)
+@@ -394,7 +390,7 @@
+         # is a single dependency, which is a makeblastdb job
+         for job in jobgraph:
+             assert job.script.startswith("blastall -p blastn")
+-            assert_equal(1, len(job.dependencies))
++            assert 1 == len(job.dependencies)
+             dep = job.dependencies[0]
+             assert dep.script.startswith("formatdb")
+ 
+@@ -494,18 +490,18 @@
+             index=["NC_002696", "NC_010338", "NC_011916", "NC_014100"],
+         )
+ 
+-    @nottest  # legacy BLASTN deprecated
++    @pytest.mark.skip(reason="legacy BLAST deprecated")
+     def test_parse_blasttab(self):
+         """parses ANIblastall .blast_tab output."""
+         fragdata = anib.get_fraglength_dict([self.fragfname])
+         # ANIb output
+         result = anib.parse_blast_tab(self.fname, fragdata, 0.3, 0.7, mode="ANIb")
+-        assert_equal(result, (4016551, 93, 99.997693577050029))
++        assert result == (4016551, 93, 99.997693577050029)
+         # ANIblastall output
+         result = anib.parse_blast_tab(
+             self.fname_legacy, fragdata, 0.3, 0.7, mode="ANIblastall"
+         )
+-        assert_equal(result, (1966922, 406104, 78.578978313253018))
++        assert result == (1966922, 406104, 78.578978313253018)
+ 
+     def test_blastdir_processing(self):
+         """parses directory of .blast_tab output."""
+@@ -518,7 +514,7 @@
+             self.anibtgt.sort_index(1).sort_index(),
+         )
+ 
+-    @nottest  #  legacy BLAST deprecated
++    @pytest.mark.skip(reason="legacy BLAST deprecated")
+     def test_legacy_blastdir_processing(self):
+         """parse directory of legacy .blast_tab output"""
+         orglengths = pyani_files.get_sequence_lengths(self.infnames)
+--- python-pyani.orig/tests/test_anim.py
++++ python-pyani/tests/test_anim.py
+@@ -7,10 +7,10 @@
+ 
+ These tests are intended to be run from the repository root using:
+ 
+-nosetests -v
++pytest -v
+ 
+-print() statements will be caught by nosetests unless there is an
+-error. They can also be recovered with the -s option.
++print() statements will be caught by pytest unless there is an
++error.
+ 
+ (c) The James Hutton Institute 2017
+ Author: Leighton Pritchard
+@@ -56,7 +56,7 @@
+ 
+ import pandas as pd
+ 
+-from nose.tools import assert_equal
++import pytest
+ from pandas.testing import assert_frame_equal
+ 
+ from pyani import anim, pyani_files
+@@ -155,14 +155,14 @@
+         cmds = anim.construct_nucmer_cmdline(
+             "file1.fna", "file2.fna", outdir=self.outdir
+         )
+-        assert_equal(cmds, (self.ntgt, self.ftgt))
++        assert cmds == (self.ntgt, self.ftgt)
+ 
+     def test_maxmatch_cmd_generation(self):
+         """generate NUCmer command line with maxmatch."""
+         ncmd, fcmd = anim.construct_nucmer_cmdline(
+             "file1.fna", "file2.fna", outdir=self.outdir, maxmatch=True
+         )
+-        assert_equal(ncmd, self.ntgtmax)
++        assert ncmd == self.ntgtmax
+ 
+     def test_multi_cmd_generation(self):
+         """generate multiple abstract NUCmer/delta-filter command-lines..
+@@ -170,7 +170,7 @@
+         Tests that all the input files are correctly-paired
+         """
+         cmds = anim.generate_nucmer_commands(self.files)
+-        assert_equal(cmds, (self.ncmdlist, self.fcmdlist))
++        assert cmds == (self.ncmdlist, self.fcmdlist)
+ 
+     def test_nucmer_job_generation(self):
+         """generate dependency tree of NUCmer/delta-filter jobs.
+@@ -178,13 +178,12 @@
+         Tests that the correct dependency graph and naming scheme is produced.
+         """
+         joblist = anim.generate_nucmer_jobs(self.files, jobprefix="test")
+-        assert_equal(len(joblist), 6)
++        assert len(joblist) == 6
+         for idx, job in enumerate(joblist):
+-            assert_equal(job.name, "test_%06d-f" % idx)  # filter job name
+-            assert_equal(len(job.dependencies), 1)  # has NUCmer job
+-            assert_equal(
+-                job.dependencies[0].name, "test_%06d-n" % idx
+-            )  # NUCmer job name
++            assert job.name == "test_%06d-f" % idx  # filter job name
++            assert len(job.dependencies) == 1  # has NUCmer job
++            assert job.dependencies[0].name == "test_%06d-n" % idx
++            # NUCmer job name
+ 
+ 
+ class TestDeltafileProcessing(unittest.TestCase):
+@@ -211,7 +210,7 @@
+     def test_deltafile_import(self):
+         """parses NUCmer .delta/.filter file."""
+         result = anim.parse_delta(self.deltafile)
+-        assert_equal(result, (4073917, 2191))
++        assert result == (4073917, 2191)
+ 
+     def test_process_deltadir(self):
+         """processes directory of .delta files into ANIResults."""
+--- python-pyani.orig/tests/test_concordance.py
++++ python-pyani/tests/test_concordance.py
+@@ -7,10 +7,10 @@
+ 
+ These tests are intended to be run from the repository root using:
+ 
+-nosetests -v
++pytest -v
+ 
+-print() statements will be caught by nosetests unless there is an
+-error. They can also be recovered with the -s option.
++print() statements will be caught by pytest unless there is an
++error.
+ 
+ (c) The James Hutton Institute 2017-2019
+ Author: Leighton Pritchard
+@@ -59,7 +59,7 @@
+ 
+ import pandas as pd
+ 
+-from nose.tools import assert_equal, assert_less, nottest
++import pytest
+ 
+ from pyani import run_multiprocessing as run_mp
+ from pyani import anib, anim, tetra, pyani_files, pyani_config
+@@ -162,7 +162,7 @@
+             diffmat, index=result_pid.index, columns=result_pid.columns
+         )
+         anim_diff.to_csv(os.path.join(self.outdir, "pyani_anim_diff.tab"), sep="\t")
+-        assert_less(anim_diff.abs().values.max(), self.tolerance["ANIm"])
++        assert anim_diff.abs().values.max() < self.tolerance["ANIm"]
+ 
+     def test_anib_concordance(self):
+         """ANIb results concordant with JSpecies.
+@@ -179,7 +179,7 @@
+         jobgraph = anib.make_job_graph(
+             self.infiles, fragfiles, anib.make_blastcmd_builder("ANIb", outdir)
+         )
+-        assert_equal(0, run_mp.run_dependency_graph(jobgraph))
++        assert 0 == run_mp.run_dependency_graph(jobgraph)
+         results = anib.process_blast(outdir, self.orglengths, fraglengths, mode="ANIb")
+         result_pid = results.percentage_identity
+         result_pid.to_csv(os.path.join(self.outdir, "pyani_anib.tab"), sep="\t")
+@@ -206,10 +206,10 @@
+             diffmat, index=result_pid.index, columns=result_pid.columns
+         )
+         anib_diff.to_csv(os.path.join(self.outdir, "pyani_anib_diff.tab"), sep="\t")
+-        assert_less(lo_diff.abs().values.max(), self.tolerance["ANIb_lo"])
+-        assert_less(hi_diff.abs().values.max(), self.tolerance["ANIb_hi"])
++        assert lo_diff.abs().values.max() < self.tolerance["ANIb_lo"]
++        assert hi_diff.abs().values.max() < self.tolerance["ANIb_hi"]
+ 
+-    @nottest  # legacy BLAST is deprecated
++    @pytest.mark.skip(reason="legacy BLAST is deprecated")
+     def test_aniblastall_concordance(self):
+         """ANIblastall results concordant with JSpecies."""
+         # Perform ANIblastall on the input directory contents
+@@ -221,7 +221,7 @@
+         jobgraph = anib.make_job_graph(
+             self.infiles, fragfiles, anib.make_blastcmd_builder("ANIblastall", outdir)
+         )
+-        assert_equal(0, run_mp.run_dependency_graph(jobgraph))
++        assert 0 == run_mp.run_dependency_graph(jobgraph)
+         results = anib.process_blast(
+             outdir, self.orglengths, fraglengths, mode="ANIblastall"
+         )
+@@ -237,7 +237,7 @@
+         aniblastall_diff.to_csv(
+             os.path.join(self.outdir, "pyani_aniblastall_diff.tab"), sep="\t"
+         )
+-        assert_less(aniblastall_diff.abs().values.max(), self.tolerance["ANIblastall"])
++        assert aniblastall_diff.abs().values.max() < self.tolerance["ANIblastall"]
+ 
+     def test_tetra_concordance(self):
+         """TETRA results concordant with JSpecies."""
+@@ -253,4 +253,4 @@
+         diffmat = results.values - self.target["Tetra"].values
+         tetra_diff = pd.DataFrame(diffmat, index=results.index, columns=results.columns)
+         tetra_diff.to_csv(os.path.join(self.outdir, "pyani_tetra_diff.tab"), sep="\t")
+-        assert_less(tetra_diff.abs().values.max(), self.tolerance["TETRA"])
++        assert tetra_diff.abs().values.max() < self.tolerance["TETRA"]
+--- python-pyani.orig/tests/test_dependencies.py
++++ python-pyani/tests/test_dependencies.py
+@@ -3,15 +3,12 @@
+ """Tests for availability of pyani dependencies
+ 
+ We only test for dependencies from non-standard libraries.
+-
+-These tests are intended to be run using the nose package
+-(see https://nose.readthedocs.org/en/latest/).
+ """
+ 
+ import subprocess
+ import sys
+ 
+-from nose.tools import assert_equal, nottest
++import pytest
+ 
+ 
+ def test_import_biopython():
+@@ -50,10 +47,10 @@
+         check=True,
+     )
+     print(result.stdout)
+-    assert_equal(result.stdout[:6], b"blastn")
++    assert result.stdout[:6] == b"blastn"
+ 
+ 
+- at nottest
++ at pytest.mark.skip()
+ def test_run_blastall():
+     """Test that legacy BLAST is runnable."""
+     cmd = "blastall"
+@@ -65,7 +62,7 @@
+         stderr=subprocess.PIPE,
+     )
+     print(result.stdout)
+-    assert_equal(result.stdout[1:9], b"blastall")
++    assert result.stdout[1:9] == b"blastall"
+ 
+ 
+ def test_run_nucmer():
+@@ -79,4 +76,4 @@
+         check=True,
+     )
+     print(result.stderr)  # NUCmer puts output to STDERR!
+-    assert_equal(result.stderr[:6], b"nucmer")
++    assert result.stderr[:6] == b"nucmer"
+--- python-pyani.orig/tests/test_graphics.py
++++ python-pyani/tests/test_graphics.py
+@@ -2,10 +2,6 @@
+ 
+ """Tests for pyani graphics
+ 
+-These tests are intended to be run using the nose package
+-(see https://nose.readthedocs.org/en/latest/), from the repository root
+-directory.
+-
+ If the test is run directly at the command-line, the output obtained by each
+ test is returned to STDOUT.
+ """
+@@ -14,7 +10,6 @@
+ import pandas as pd
+ import shutil
+ 
+-from nose.tools import assert_equal, assert_less, nottest
+ from pyani import pyani_graphics, pyani_config, pyani_tools
+ 
+ 
+--- python-pyani.orig/tests/test_jobs.py
++++ python-pyani/tests/test_jobs.py
+@@ -7,10 +7,10 @@
+ 
+ These tests are intended to be run from the repository root using:
+ 
+-nosetests -v
++pytest -v
+ 
+-print() statements will be caught by nosetests unless there is an
+-error. They can also be recovered with the -s option.
++print() statements will be caught by pytest unless there is an
++error.
+ 
+ (c) The James Hutton Institute 2017
+ Author: Leighton Pritchard
+@@ -53,7 +53,7 @@
+ 
+ import unittest
+ 
+-from nose.tools import (assert_equal, )
++import pytest
+ 
+ from pyani import (pyani_jobs, )
+ 
+@@ -69,33 +69,33 @@
+     def test_create_job(self):
+         """create a dummy job."""
+         job = pyani_jobs.Job('empty', '')
+-        assert_equal(job.script, "")
++        assert job.script == ""
+ 
+     def test_create_job_with_command(self):
+         """create dummy job with command."""
+         job = pyani_jobs.Job('dummy', self.cmds[0])
+-        assert_equal(job.script, self.cmds[0])
++        assert job.script == self.cmds[0]
+ 
+     def test_add_dependency(self):
+         """create dummy job with dependency."""
+         job1 = pyani_jobs.Job('dummy_with_dependency', self.cmds[0])
+         job2 = pyani_jobs.Job('dummy_dependency', self.cmds[1])
+         job1.add_dependency(job2)
+-        assert_equal(self.cmds[0], job1.script)
+-        assert_equal(1, len(job1.dependencies))
++        assert self.cmds[0] == job1.script
++        assert 1 == len(job1.dependencies)
+         dep = job1.dependencies[0]
+-        assert_equal(self.cmds[1], dep.script)
++        assert self.cmds[1] == dep.script
+ 
+     def test_remove_dependency(self):
+         """create dummy job, add and remove dependency."""
+         job1 = pyani_jobs.Job('dummy_with_dependency', self.cmds[0])
+         job2 = pyani_jobs.Job('dummy_dependency', self.cmds[1])
+         job1.add_dependency(job2)
+-        assert_equal(1, len(job1.dependencies))
++        assert 1 == len(job1.dependencies)
+         dep = job1.dependencies[0]
+-        assert_equal(self.cmds[1], dep.script)
++        assert self.cmds[1] == dep.script
+         job1.remove_dependency(dep)
+-        assert_equal(0, len(job1.dependencies))
++        assert 0 == len(job1.dependencies)
+ 
+ 
+ class TestJobGroup(unittest.TestCase):
+@@ -128,38 +128,38 @@
+     def test_create_jobgroup(self):
+         """create dummy jobgroup."""
+         jobgroup = pyani_jobs.JobGroup('empty', '')
+-        assert_equal(jobgroup.script, self.emptyscript)
++        assert jobgroup.script == self.emptyscript
+ 
+     def test_1d_jobgroup(self):
+         """create dummy 1-parameter sweep jobgroup."""
+         jobgroup = pyani_jobs.JobGroup('1d-sweep', 'cat', arguments=self.params1)
+-        assert_equal(jobgroup.script, self.p1script)
+-        assert_equal(3, jobgroup.tasks)
++        assert jobgroup.script == self.p1script
++        assert 3 == jobgroup.tasks
+ 
+     def test_2d_jobgroup(self):
+         """create dummy 2-parameter sweep jobgroup."""
+         jobgroup = pyani_jobs.JobGroup('2d-sweep', 'myprog', arguments=self.params2)
+-        assert_equal(jobgroup.script, self.p2script)
+-        assert_equal(4, jobgroup.tasks)
++        assert jobgroup.script == self.p2script
++        assert 4 == jobgroup.tasks
+ 
+     def test_add_dependency(self):
+         """add jobgroup dependency."""
+         jg1 = pyani_jobs.JobGroup('1d-sweep', 'cat', arguments=self.params1)
+         jg2 = pyani_jobs.JobGroup('2d-sweep', 'myprog', arguments=self.params2)
+         jg2.add_dependency(jg1)
+-        assert_equal(4, jg2.tasks)
+-        assert_equal(1, len(jg2.dependencies))
++        assert 4 == jg2.tasks
++        assert 1 == len(jg2.dependencies)
+         dep = jg2.dependencies[0]
+-        assert_equal(3, dep.tasks)
+-        assert_equal('1d-sweep', dep.name)
++        assert 3 == dep.tasks
++        assert '1d-sweep' == dep.name
+ 
+     def test_remove_dependency(self):
+         """add and remove jobgroup dependency."""
+         jg1 = pyani_jobs.JobGroup('1d-sweep', 'cat', arguments=self.params1)
+         jg2 = pyani_jobs.JobGroup('2d-sweep', 'myprog', arguments=self.params2)
+         jg2.add_dependency(jg1)
+-        assert_equal(1, len(jg2.dependencies))
++        assert 1 == len(jg2.dependencies)
+         dep = jg2.dependencies[0]
+-        assert_equal('1d-sweep', dep.name)
++        assert '1d-sweep' == dep.name
+         jg2.remove_dependency(dep)
+-        assert_equal(0, len(jg2.dependencies))
++        assert 0 == len(jg2.dependencies)
+--- python-pyani.orig/requirements-dev.txt
++++ python-pyani/requirements-dev.txt
+@@ -1,6 +1,5 @@
+ black
+ flake8
+-nose
+ pytest
+ pytest-cov
+ setuptools
+--- python-pyani.orig/test-requirements.txt
++++ python-pyani/test-requirements.txt
+@@ -1,3 +1,3 @@
+-nose
+ coverage
+-codecov
+\ No newline at end of file
++codecov
++pytest
+--- python-pyani.orig/tests/README.md
++++ python-pyani/tests/README.md
+@@ -6,40 +6,62 @@
+ 
+ ### Dependencies
+ 
+-The tests in this directory rely on the [`nose`](https://nose.readthedocs.org/en/latest/) package, which can be installed using
++The tests in this directory rely on the [`pytest`](https://docs.pytest.org/en/latest/) package, which can be installed using
+ 
+ ```
+-pip install nose
++pip install pytest
+ ```
+ 
+ ### Running tests
+ 
+-To run the tests in this directory with `nose` run the following command:
++To run the tests in this directory with `pytest` run the following command:
+ 
+ ```
+-nosetests
++pytest
+ ```
+ 
+ This will run silently for quite a while (the comparisons are not quick), but should generate output that looks like this:
+ 
+ ```
+-$ nosetests
+-........
+-Thread 2: value 0
+-Thread 2: value 1
+-Thread 3: value 0
+-Thread 3: value 1
+-Thread 3: value 2
+-Thread 1: value 0
+-Thread 4: value 0
+-Thread 4: value 1
+-Thread 4: value 2
+-Thread 4: value 3
+-..
+-----------------------------------------------------------------------
+-Ran 14 tests in 804.833s
++$ pytest
++============================= test session starts ==============================
++platform linux -- Python 3.11.0+, pytest-7.1.2, pluggy-1.0.0+repack
++rootdir: /<<PKGBUILDDIR>>
++collected 56 items
++
++tests/test_anib.py sss.....sss...ss                                      [ 28%]
++tests/test_anim.py ......                                                [ 39%]
++tests/test_concordance.py .s..                                           [ 46%]
++tests/test_dependencies.py ......s.                                      [ 60%]
++tests/test_graphics.py ......                                            [ 71%]
++tests/test_jobs.py .........                                             [ 87%]
++tests/test_multiprocessing.py ...                                        [ 92%]
++tests/test_parsing.py .                                                  [ 94%]
++tests/test_tetra.py ...                                                  [100%]
++
++=============================== warnings summary ===============================
++../../../../../../usr/lib/python3/dist-packages/pyparsing/core.py:26
++  /usr/lib/python3/dist-packages/pyparsing/core.py:26: DeprecationWarning: module 'sre_constants' is deprecated
++    import sre_constants
++
++.pybuild/cpython3_3.11_pyani/build/tests/test_anib.py::TestParsing::test_blastdir_processing
++  /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_pyani/build/tests/test_anib.py:513: FutureWarning: In a future version of pandas all arguments of DataFrame.sort_index will be keyword-only
++    result.percentage_identity.sort_index(1).sort_index(),
++
++.pybuild/cpython3_3.11_pyani/build/tests/test_anib.py::TestParsing::test_blastdir_processing
++  /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_pyani/build/tests/test_anib.py:514: FutureWarning: In a future version of pandas all arguments of DataFrame.sort_index will be keyword-only
++    self.anibtgt.sort_index(1).sort_index(),
++
++.pybuild/cpython3_3.11_pyani/build/tests/test_anim.py::TestDeltafileProcessing::test_process_deltadir
++  /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_pyani/build/tests/test_anim.py:221: FutureWarning: In a future version of pandas all arguments of DataFrame.sort_index will be keyword-only
++    result.percentage_identity.sort_index(1).sort_index(),
++
++.pybuild/cpython3_3.11_pyani/build/tests/test_anim.py::TestDeltafileProcessing::test_process_deltadir
++  /<<PKGBUILDDIR>>/.pybuild/cpython3_3.11_pyani/build/tests/test_anim.py:222: FutureWarning: In a future version of pandas all arguments of DataFrame.sort_index will be keyword-only
++    self.df_pid.sort_index(1).sort_index(),
+ 
+-OK
++-- Docs: https://docs.pytest.org/en/stable/how-to/capture-warnings.html
++============ 46 passed, 10 skipped, 5 warnings in 104.81s (0:01:44) ============
+ ```
+ 
+ 
+@@ -77,4 +99,4 @@
+ 
+ The `test_ani_data` directory contains input files for testing `pyani`, and examples for comparative testing of graphics output.
+ 
+-The `test_failing_data` directory contains input data that throws expected errors in ANI analysis, as described in `test_failing_data/README.md`..
+\ No newline at end of file
++The `test_failing_data` directory contains input data that throws expected errors in ANI analysis, as described in `test_failing_data/README.md`..
+--- python-pyani.orig/tests/test_multiprocessing.py
++++ python-pyani/tests/test_multiprocessing.py
+@@ -7,9 +7,9 @@
+ 
+ These tests are intended to be run from the repository root using:
+ 
+-nosetests -v
++pytest -v
+ 
+-print() statements will be caught by nosetests unless there is an
++print() statements will be caught by pytest unless there is an
+ error. They can also be recovered with the -s option.
+ 
+ (c) The James Hutton Institute 2017
+@@ -54,7 +54,7 @@
+ import os
+ import unittest
+ 
+-from nose.tools import assert_equal, nottest
++import pytest
+ 
+ from pyani import run_multiprocessing, pyani_jobs, anib
+ 
+@@ -82,7 +82,7 @@
+     def test_multiprocessing_run(self):
+         """multiprocessing() runs basic jobs."""
+         result = run_multiprocessing.multiprocessing_run(self.cmdlist)
+-        assert_equal(0, result)
++        assert 0 == result
+ 
+     def test_cmdsets(self):
+         """module builds command sets."""
+@@ -91,7 +91,7 @@
+         job1.add_dependency(job2)
+         cmdsets = run_multiprocessing.populate_cmdsets(job1, list(), depth=1)
+         target = [{cmd} for cmd in self.cmds]
+-        assert_equal(cmdsets, target)
++        assert cmdsets == target
+ 
+     def test_dependency_graph_run(self):
+         """module runs dependency graph."""
+@@ -99,4 +99,4 @@
+         blastcmds = anib.make_blastcmd_builder("ANIb", self.outdir)
+         jobgraph = anib.make_job_graph(self.infiles, fragresult[0], blastcmds)
+         result = run_multiprocessing.run_dependency_graph(jobgraph)
+-        assert_equal(0, result)
++        assert 0 == result
+--- python-pyani.orig/tests/test_parsing.py
++++ python-pyani/tests/test_parsing.py
+@@ -1,14 +1,10 @@
+ #!/usr/bin/env python
+ 
+-"""Tests for pyani package intermediate file parsing
+-
+-These tests are intended to be run using the nose package
+-(see https://nose.readthedocs.org/en/latest/).
+-"""
++"""Tests for pyani package intermediate file parsing"""
+ 
+ import os
+ 
+-from nose.tools import assert_equal
++import pytest
+ from pyani import anim
+ 
+ # Work out where we are. We need to do this to find related data files
+@@ -24,6 +20,6 @@
+ def test_anim_delta():
+     """Test parsing of NUCmer delta file."""
+     aln, sim = anim.parse_delta(DELTAFILE)
+-    assert_equal(aln, 4073917)
+-    assert_equal(sim, 2191)
++    assert aln == 4073917
++    assert sim == 2191
+     print("Alignment length: {0}\nSimilarity Errors: {1}".format(aln, sim))
+--- python-pyani.orig/tests/test_tetra.py
++++ python-pyani/tests/test_tetra.py
+@@ -7,10 +7,10 @@
+ 
+ These tests are intended to be run from the repository root using:
+ 
+-nosetests -v
++pytest -v
+ 
+-print() statements will be caught by nosetests unless there is an
+-error. They can also be recovered with the -s option.
++print() statements will be caught by pytest unless there is an
++error.
+ 
+ (c) The James Hutton Institute 2017
+ Author: Leighton Pritchard
+@@ -57,7 +57,7 @@
+ 
+ import pandas as pd
+ 
+-from nose.tools import assert_equal, assert_false, assert_true
++import pytest
+ from pandas.testing import assert_frame_equal
+ 
+ from pyani import tetra
+@@ -88,15 +88,15 @@
+ 
+     def test_tetraclean(self):
+         """detects unambiguous IUPAC symbols correctly."""
+-        assert_false(tetra.tetra_clean("ACGTYACGTACNGTACGWTACGT"))
+-        assert_true(tetra.tetra_clean("ACGTACGTACGTACGTACGTAC"))
++        assert tetra.tetra_clean("ACGTYACGTACNGTACGWTACGT") == False
++        assert tetra.tetra_clean("ACGTACGTACGTACGTACGTAC") == True
+ 
+     def test_zscore(self):
+         """TETRA Z-score calculated correctly."""
+         tetra_z = tetra.calculate_tetra_zscore(self.infile)
+         with open(os.path.join(self.tgtdir, "zscore.json"), "r") as ifh:
+             target = json.load(ifh)
+-        assert_equal(ordered(tetra_z), ordered(target))
++        assert ordered(tetra_z) == ordered(target)
+ 
+     def test_correlations(self):
+         """TETRA correlation calculated correctly."""


=====================================
debian/patches/series
=====================================
@@ -0,0 +1 @@
+pytest.patch


=====================================
debian/tests/control
=====================================
@@ -1,3 +1,3 @@
 Tests: run-unit-test
-Depends: @, python3-nose
+Depends: @, python3-pytest
 Restrictions: allow-stderr


=====================================
debian/tests/run-unit-test
=====================================
@@ -1,6 +1,6 @@
 #!/bin/bash
 set -e
-for py in $(py3versions -r 2> /dev/null)
+for py in $(py3versions -s)
 do echo "Testing with $py in $(pwd):"
-    nosetests3 -v
+    pytest-3 -v
 done



View it on GitLab: https://salsa.debian.org/med-team/python-pyani/-/compare/a88d803dbcba71ab296904f895e76557faaf4687...f22ed322a7347d46307500a943f51170cf8972c3

-- 
View it on GitLab: https://salsa.debian.org/med-team/python-pyani/-/compare/a88d803dbcba71ab296904f895e76557faaf4687...f22ed322a7347d46307500a943f51170cf8972c3
You're receiving this email because of your account on salsa.debian.org.


-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://alioth-lists.debian.net/pipermail/debian-med-commit/attachments/20221203/272f2c1d/attachment-0001.htm>


More information about the debian-med-commit mailing list