[med-svn] [Git][med-team/igv][2.17.3] Fixing double @Ignore annotations in the tests
Pierre Gruet (@pgt)
gitlab at salsa.debian.org
Fri Mar 8 17:04:49 GMT 2024
Pierre Gruet pushed to branch 2.17.3 at Debian Med / igv
Commits:
53d08239 by Pierre Gruet at 2024-03-08T17:29:31+01:00
Fixing double @Ignore annotations in the tests
- - - - -
1 changed file:
- debian/patches/skip_tests_network.patch
Changes:
=====================================
debian/patches/skip_tests_network.patch
=====================================
@@ -9,7 +9,7 @@ Bug-Debian: https://bugs.debian.org/1065646
--- a/src/test/java/org/broad/igv/feature/genome/GenomeTest.java
+++ b/src/test/java/org/broad/igv/feature/genome/GenomeTest.java
-@@ -31,6 +31,7 @@ import org.broad.igv.feature.genome.fast
+@@ -31,6 +31,7 @@
import org.broad.igv.feature.genome.load.GenomeConfig;
import org.broad.igv.util.TestUtils;
import org.junit.Assume;
@@ -17,7 +17,7 @@ Bug-Debian: https://bugs.debian.org/1065646
import org.junit.Rule;
import org.junit.Test;
import org.junit.rules.TestRule;
-@@ -58,6 +59,7 @@ public class GenomeTest extends Abstract
+@@ -58,6 +59,7 @@
*
* @throws Exception
*/
@@ -25,7 +25,7 @@ Bug-Debian: https://bugs.debian.org/1065646
@Test
public void testAlias_01() throws Exception {
String genomeURL = "https://s3.amazonaws.com/igv.broadinstitute.org/genomes/hg19.genome";
-@@ -67,6 +69,7 @@ public class GenomeTest extends Abstract
+@@ -67,6 +69,7 @@
assertEquals("chr14", genome.getCanonicalChrName("14"));
}
@@ -43,7 +43,7 @@ Bug-Debian: https://bugs.debian.org/1065646
import org.junit.Test;
import static org.junit.Assert.assertEquals;
-@@ -12,6 +13,7 @@ import static org.junit.Assert.assertNot
+@@ -12,6 +13,7 @@
public class FastaBlockCompressedSequenceTest {
@@ -51,7 +51,7 @@ Bug-Debian: https://bugs.debian.org/1065646
@Test
public void findBlockContaining() throws Exception {
-@@ -25,6 +27,7 @@ public class FastaBlockCompressedSequenc
+@@ -25,6 +27,7 @@
}
@@ -61,7 +61,7 @@ Bug-Debian: https://bugs.debian.org/1065646
--- a/src/test/java/org/broad/igv/sam/AlignmentDataManagerTest.java
+++ b/src/test/java/org/broad/igv/sam/AlignmentDataManagerTest.java
-@@ -65,6 +65,7 @@ public class AlignmentDataManagerTest ex
+@@ -65,6 +65,7 @@
super.tearDown();
}
@@ -71,7 +71,7 @@ Bug-Debian: https://bugs.debian.org/1065646
String testFile = TestUtils.DATA_DIR + "bam/gstt1_sample.bam";
--- a/src/test/java/org/broad/igv/sam/cram/CRAMReaderTest.java
+++ b/src/test/java/org/broad/igv/sam/cram/CRAMReaderTest.java
-@@ -40,6 +40,7 @@ import org.broad.igv.util.ResourceLocato
+@@ -40,6 +40,7 @@
import org.broad.igv.util.TestUtils;
import org.junit.AfterClass;
import org.junit.BeforeClass;
@@ -79,7 +79,7 @@ Bug-Debian: https://bugs.debian.org/1065646
import org.junit.Test;
import java.util.List;
-@@ -65,6 +66,7 @@ public class CRAMReaderTest {
+@@ -65,6 +66,7 @@
}
@@ -87,7 +87,7 @@ Bug-Debian: https://bugs.debian.org/1065646
@Test
public void testIterateLocalCraiCram() throws Exception {
-@@ -83,6 +85,7 @@ public class CRAMReaderTest {
+@@ -83,6 +85,7 @@
}
@@ -95,7 +95,7 @@ Bug-Debian: https://bugs.debian.org/1065646
@Test
public void testQueryLocalCraiCram() throws Exception {
-@@ -97,6 +100,7 @@ public class CRAMReaderTest {
+@@ -97,6 +100,7 @@
}
@@ -103,7 +103,7 @@ Bug-Debian: https://bugs.debian.org/1065646
@Test
public void testQueryLocalBaiCram() throws Exception {
-@@ -112,6 +116,7 @@ public class CRAMReaderTest {
+@@ -112,6 +116,7 @@
@@ -111,7 +111,7 @@ Bug-Debian: https://bugs.debian.org/1065646
@Test
public void testRemoteCraiCram() throws Exception {
-@@ -126,6 +131,7 @@ public class CRAMReaderTest {
+@@ -126,6 +131,7 @@
}
@@ -121,7 +121,7 @@ Bug-Debian: https://bugs.debian.org/1065646
--- a/src/test/java/org/broad/igv/sam/cram/IGVReferenceSourceTest.java
+++ b/src/test/java/org/broad/igv/sam/cram/IGVReferenceSourceTest.java
-@@ -28,6 +28,7 @@ package org.broad.igv.sam.cram;
+@@ -28,6 +28,7 @@
import htsjdk.samtools.*;
import org.broad.igv.feature.genome.GenomeManager;
import org.junit.Before;
@@ -129,7 +129,7 @@ Bug-Debian: https://bugs.debian.org/1065646
import org.junit.Test;
import java.io.IOException;
-@@ -63,16 +64,19 @@ public class IGVReferenceSourceTest {
+@@ -63,16 +64,19 @@
assertEquals(expected, new String(bases, StandardCharsets.US_ASCII));
}
@@ -151,7 +151,7 @@ Bug-Debian: https://bugs.debian.org/1065646
--- a/src/test/java/org/broad/igv/sam/reader/BAMHttpReaderTest.java
+++ b/src/test/java/org/broad/igv/sam/reader/BAMHttpReaderTest.java
-@@ -42,6 +42,7 @@ import java.io.IOException;
+@@ -42,6 +42,7 @@
import java.util.List;
import java.util.stream.Collectors;
@@ -159,7 +159,7 @@ Bug-Debian: https://bugs.debian.org/1065646
import static org.junit.Assert.*;
/**
-@@ -74,6 +75,7 @@ public class BAMHttpReaderTest extends A
+@@ -74,6 +75,7 @@
reader = null;
}
@@ -167,7 +167,7 @@ Bug-Debian: https://bugs.debian.org/1065646
@Test
public void testGetHeader() throws IOException {
SAMFileHeader header = reader.getFileHeader();
-@@ -81,6 +83,7 @@ public class BAMHttpReaderTest extends A
+@@ -81,6 +83,7 @@
assertEquals("1.0", header.getVersion());
}
@@ -175,7 +175,7 @@ Bug-Debian: https://bugs.debian.org/1065646
@Test
public void testIterator() throws IOException {
CloseableIterator<SAMAlignment> iter = reader.iterator();
-@@ -101,6 +104,7 @@ public class BAMHttpReaderTest extends A
+@@ -101,6 +104,7 @@
}
@@ -185,7 +185,7 @@ Bug-Debian: https://bugs.debian.org/1065646
int expected_count = 4;
--- a/src/test/java/org/broad/igv/tdf/TDFRegressionTests.java
+++ b/src/test/java/org/broad/igv/tdf/TDFRegressionTests.java
-@@ -36,6 +36,7 @@ import org.broad.igv.feature.genome.Geno
+@@ -36,6 +36,7 @@
import org.broad.igv.util.ResourceLocator;
import org.broad.igv.util.TestUtils;
import org.junit.Assume;
@@ -193,7 +193,7 @@ Bug-Debian: https://bugs.debian.org/1065646
import org.junit.Rule;
import org.junit.Test;
import org.junit.rules.TestRule;
-@@ -60,6 +61,7 @@ public class TDFRegressionTests extends
+@@ -60,6 +61,7 @@
/**
* IGV-1417 and/or IGV-1421 - error reading a version 1 file (error thrown in header)
*/
@@ -201,7 +201,7 @@ Bug-Debian: https://bugs.debian.org/1065646
@Test
public void test_IGV1417() {
String tdfFile = "http://data.broadinstitute.org/igvdata/annotations/hg18/conservation/pi.ewig.tdf";
-@@ -72,6 +74,7 @@ public class TDFRegressionTests extends
+@@ -72,6 +74,7 @@
String[] dm3emptyChromos = new String[]{"chrUextra"};
@@ -209,7 +209,7 @@ Bug-Debian: https://bugs.debian.org/1065646
@Test
public void testChrAlldm3_v4() throws Exception{
String genPath = "http://igvdata.broadinstitute.org/genomes/dm3.genome";
-@@ -86,6 +89,7 @@ public class TDFRegressionTests extends
+@@ -86,6 +89,7 @@
String[] hg18posChromos = new String[]{"chr6", "chr7", "chr10", "chr11", "chr12"};
String[] hg18emptyChromos = new String[]{"chr1", "chr13", "chr14", "chr15", "chr16", "chr17", "chr18", "chr19", "chrY"};
@@ -219,7 +219,7 @@ Bug-Debian: https://bugs.debian.org/1065646
String genPath = TestUtils.DATA_DIR + "genomes/hg18.unittest.genome";
--- a/src/test/java/org/broad/igv/tools/parsers/GCTtoIGVConverterTest.java
+++ b/src/test/java/org/broad/igv/tools/parsers/GCTtoIGVConverterTest.java
-@@ -29,6 +29,7 @@ import org.broad.igv.AbstractHeadlessTes
+@@ -29,6 +29,7 @@
import org.broad.igv.tools.converters.GCTtoIGVConverter;
import org.broad.igv.util.ResourceLocator;
import org.broad.igv.util.TestUtils;
@@ -227,7 +227,7 @@ Bug-Debian: https://bugs.debian.org/1065646
import org.junit.Test;
import java.io.File;
-@@ -51,6 +52,7 @@ public class GCTtoIGVConverterTest exten
+@@ -51,6 +52,7 @@
}
@@ -237,7 +237,7 @@ Bug-Debian: https://bugs.debian.org/1065646
String gctFile = TestUtils.DATA_DIR + "gct/affy_human.gct";
--- a/src/test/java/org/broad/igv/track/TrackLoaderTest.java
+++ b/src/test/java/org/broad/igv/track/TrackLoaderTest.java
-@@ -36,6 +36,7 @@ import org.broad.igv.util.TestUtils;
+@@ -36,6 +36,7 @@
import org.broad.igv.variant.VariantTrack;
import htsjdk.tribble.Feature;
import org.junit.Before;
@@ -245,7 +245,7 @@ Bug-Debian: https://bugs.debian.org/1065646
import org.junit.Rule;
import org.junit.Test;
import org.junit.rules.TestRule;
-@@ -258,6 +259,7 @@ public class TrackLoaderTest extends Abs
+@@ -258,6 +259,7 @@
tstFilesHeadless(filenamesTryIndex, true);
}
@@ -263,7 +263,7 @@ Bug-Debian: https://bugs.debian.org/1065646
import org.junit.Test;
import java.io.IOException;
-@@ -43,12 +44,14 @@ public class IGVHttpClientUtilsTest {
+@@ -43,12 +44,14 @@
String url = "https://s3.amazonaws.com/igv.org.test/csi_test/chr10p.bam.csi";
int byteCount = 105063;
@@ -280,7 +280,7 @@ Bug-Debian: https://bugs.debian.org/1065646
--- a/src/test/java/org/broad/igv/util/stream/IGVSeekableBufferedStreamTest.java
+++ b/src/test/java/org/broad/igv/util/stream/IGVSeekableBufferedStreamTest.java
-@@ -34,6 +34,7 @@ import org.broad.igv.AbstractHeadlessTes
+@@ -34,6 +34,7 @@
import org.broad.igv.util.HttpUtils;
import org.broad.igv.util.TestUtils;
import org.junit.Assume;
@@ -288,7 +288,7 @@ Bug-Debian: https://bugs.debian.org/1065646
import org.junit.Before;
import org.junit.BeforeClass;
import org.junit.Test;
-@@ -248,6 +249,7 @@ public class IGVSeekableBufferedStreamTe
+@@ -248,6 +249,7 @@
*
* @throws IOException
*/
@@ -296,7 +296,7 @@ Bug-Debian: https://bugs.debian.org/1065646
@Test
public void testRandomRead() throws IOException {
-@@ -276,6 +278,7 @@ public class IGVSeekableBufferedStreamTe
+@@ -276,6 +278,7 @@
*
* @throws IOException
*/
@@ -306,7 +306,7 @@ Bug-Debian: https://bugs.debian.org/1065646
--- a/src/test/java/org/broad/igv/tools/IGVToolsTest.java
+++ b/src/test/java/org/broad/igv/tools/IGVToolsTest.java
-@@ -209,6 +209,7 @@ public class IGVToolsTest extends Abstra
+@@ -209,6 +209,7 @@
}
@@ -314,7 +314,7 @@ Bug-Debian: https://bugs.debian.org/1065646
@Test
public void testTileGCT_01() throws IOException {
String inputFile = TestUtils.DATA_DIR + "gct/OV.transcriptome__agilentg4502.data.txt";
-@@ -217,6 +218,7 @@ public class IGVToolsTest extends Abstra
+@@ -217,6 +218,7 @@
igvTools.run(args);
}
@@ -324,7 +324,7 @@ Bug-Debian: https://bugs.debian.org/1065646
String inputFile = TestUtils.DATA_DIR + "gct/GBM.methylation__sampled.data.txt";
--- a/src/test/java/org/broad/igv/tools/converters/ExpressionFormatterTest.java
+++ b/src/test/java/org/broad/igv/tools/converters/ExpressionFormatterTest.java
-@@ -30,6 +30,7 @@ import org.broad.igv.data.Dataset;
+@@ -30,6 +30,7 @@
import org.broad.igv.data.expression.ExpressionFileParser;
import org.broad.igv.util.ResourceLocator;
import org.broad.igv.util.TestUtils;
@@ -332,7 +332,7 @@ Bug-Debian: https://bugs.debian.org/1065646
import org.junit.Test;
import java.io.File;
-@@ -43,6 +44,7 @@ import static junit.framework.Assert.ass
+@@ -43,6 +44,7 @@
*/
public class ExpressionFormatterTest extends AbstractHeadlessTest {
@@ -342,7 +342,7 @@ Bug-Debian: https://bugs.debian.org/1065646
//String inputPath = TestUtils.DATA_DIR + "gct/igv_test2.gct";
--- a/src/test/java/org/broad/igv/tools/motiffinder/MotifFinderSourceTest.java
+++ b/src/test/java/org/broad/igv/tools/motiffinder/MotifFinderSourceTest.java
-@@ -154,6 +154,7 @@ public class MotifFinderSourceTest exten
+@@ -154,6 +154,7 @@
assertEquals("ACTG[M,A,C]ACTG.ACT[S,G,C]G", regex);
}
@@ -350,7 +350,7 @@ Bug-Debian: https://bugs.debian.org/1065646
@Test
public void testExactSearch_EGFR() throws Exception{
String motif = "CTTCGGGGAGCAGCGATGCGACCCTCCGGGACGGCCGGGGCAGCGCTCCTGGCGCTGCTGGCTGCGCTCTGCCCGGCGAGTCGGGCTCTGGAGGAAAAGAAAGGTAAGGGCGTGTCTCGCCGGCTCCCGCGCCGCCCCCGGATCGCGCCCCGGACCCCGCAGCCCGCCCAACCGCG";
-@@ -162,6 +163,7 @@ public class MotifFinderSourceTest exten
+@@ -162,6 +163,7 @@
tstSearchGenome_EGFR(motif, expStart, expStart + motif.length());
}
@@ -358,7 +358,7 @@ Bug-Debian: https://bugs.debian.org/1065646
@Test
public void testAmbiguousSearch_EGFR() throws Exception{
String motif = "CTTYKSVDAGCAGNGATGCRRCCCYCCGGGACGGCCGGGNCAGCGCKCCBGGCGCDGCTGGCTGCGCTCTGCCCGGCGAGTCGGGCTCTGGAGGRMWHGAAAGGNNVGGGCGTGTCTCGCCGGCTCCCGCGCCGCCCCCGGATCGCGCCCCGGACCCCGCAGCCCGCCCAACCGCG";
-@@ -171,6 +173,7 @@ public class MotifFinderSourceTest exten
+@@ -171,6 +173,7 @@
tstSearchGenome_EGFR(pattern, expStart, expStart + motif.length());
}
@@ -366,7 +366,7 @@ Bug-Debian: https://bugs.debian.org/1065646
@Test
public void testSearchNoResult() throws Exception{
tstSearchGenomeSingResult("GATCRYMKSWHBVDNGATCGATCGATCGATCGATCGATCGATCGATCGATC", Strand.POSITIVE, "chr7",
-@@ -181,6 +184,7 @@ public class MotifFinderSourceTest exten
+@@ -181,6 +184,7 @@
* Test searching for a motif which has 2 overlapping hits
* @throws Exception
*/
@@ -376,7 +376,7 @@ Bug-Debian: https://bugs.debian.org/1065646
String motif = "ATGCATGCATGC";
--- a/src/test/java/org/broad/igv/feature/ExonTest.java
+++ b/src/test/java/org/broad/igv/feature/ExonTest.java
-@@ -30,6 +30,7 @@ import org.broad.igv.feature.aa.AminoAci
+@@ -30,6 +30,7 @@
import org.broad.igv.feature.aa.AminoAcidSequence;
import org.broad.igv.feature.aa.CodonTable;
import org.broad.igv.feature.aa.CodonTableManager;
@@ -384,7 +384,7 @@ Bug-Debian: https://bugs.debian.org/1065646
import org.junit.Test;
import static junit.framework.Assert.assertEquals;
-@@ -82,6 +83,7 @@ public class ExonTest extends AbstractHe
+@@ -82,6 +83,7 @@
}
@@ -394,7 +394,7 @@ Bug-Debian: https://bugs.debian.org/1065646
--- a/src/test/java/org/broad/igv/feature/FeatureDBTest.java
+++ b/src/test/java/org/broad/igv/feature/FeatureDBTest.java
-@@ -28,6 +28,7 @@ package org.broad.igv.feature;
+@@ -28,6 +28,7 @@
import org.broad.igv.AbstractHeadlessTest;
import org.junit.Before;
import org.junit.BeforeClass;
@@ -402,7 +402,7 @@ Bug-Debian: https://bugs.debian.org/1065646
import org.junit.Test;
import java.util.List;
-@@ -130,6 +131,7 @@ public class FeatureDBTest extends Abstr
+@@ -130,6 +131,7 @@
}
@@ -410,7 +410,7 @@ Bug-Debian: https://bugs.debian.org/1065646
@Test
public void testMutationSearch() throws Exception {
-@@ -162,6 +164,7 @@ public class FeatureDBTest extends Abstr
+@@ -162,6 +164,7 @@
}
}
@@ -418,7 +418,7 @@ Bug-Debian: https://bugs.debian.org/1065646
@Test
public void testMutationSearchNegStrand() throws Exception {
String name = "KRAS";
-@@ -174,6 +177,7 @@ public class FeatureDBTest extends Abstr
+@@ -174,6 +177,7 @@
}
@@ -426,7 +426,7 @@ Bug-Debian: https://bugs.debian.org/1065646
@Test
public void testMutationSearchFail() throws Exception {
String name = "EGFR";
-@@ -185,6 +189,7 @@ public class FeatureDBTest extends Abstr
+@@ -185,6 +189,7 @@
}
}
@@ -434,7 +434,7 @@ Bug-Debian: https://bugs.debian.org/1065646
@Test
public void testMutationSearchNT() throws Exception {
String name = "EGFR";
-@@ -196,6 +201,7 @@ public class FeatureDBTest extends Abstr
+@@ -196,6 +201,7 @@
}
}
@@ -444,7 +444,7 @@ Bug-Debian: https://bugs.debian.org/1065646
String name = "KRAS";
--- a/build.gradle
+++ b/build.gradle
-@@ -167,6 +167,78 @@ tasks.withType(Test) {
+@@ -167,6 +167,78 @@
maxParallelForks = Runtime.runtime.availableProcessors().intdiv(2) ?: 1
}
@@ -525,7 +525,7 @@ Bug-Debian: https://bugs.debian.org/1065646
from("scripts") {
--- a/src/test/java/org/broad/igv/htsget/HtsgetBAMReaderTest.java
+++ b/src/test/java/org/broad/igv/htsget/HtsgetBAMReaderTest.java
-@@ -31,6 +31,7 @@ public class HtsgetBAMReaderTest {
+@@ -31,6 +31,7 @@
*
* @throws Exception
*/
@@ -535,7 +535,7 @@ Bug-Debian: https://bugs.debian.org/1065646
--- a/src/test/java/org/broad/igv/htsget/HtsgetReaderTest.java
+++ b/src/test/java/org/broad/igv/htsget/HtsgetReaderTest.java
-@@ -8,6 +8,7 @@ import static org.junit.Assert.*;
+@@ -8,6 +8,7 @@
@Ignore // Problems with reference server?
public class HtsgetReaderTest {
@@ -543,7 +543,7 @@ Bug-Debian: https://bugs.debian.org/1065646
@Test
public void testReadHeader() throws Exception {
-@@ -18,6 +19,7 @@ public class HtsgetReaderTest {
+@@ -18,6 +19,7 @@
assertNotNull(headerBytes);
}
@@ -553,7 +553,7 @@ Bug-Debian: https://bugs.debian.org/1065646
--- a/src/test/java/org/broad/igv/htsget/HtsgetVariantSourceTest.java
+++ b/src/test/java/org/broad/igv/htsget/HtsgetVariantSourceTest.java
-@@ -13,6 +13,7 @@ import static org.junit.Assert.*;
+@@ -13,6 +13,7 @@
@Ignore // Problems with reference server?
public class HtsgetVariantSourceTest {
@@ -561,7 +561,7 @@ Bug-Debian: https://bugs.debian.org/1065646
@Test
public void testGetHeader() throws Exception {
-@@ -24,6 +25,7 @@ public class HtsgetVariantSourceTest {
+@@ -24,6 +25,7 @@
assertNotNull(header);
}
@@ -571,7 +571,7 @@ Bug-Debian: https://bugs.debian.org/1065646
--- a/src/test/java/org/broad/igv/tools/parsers/TestBEDCodecs.java
+++ b/src/test/java/org/broad/igv/tools/parsers/TestBEDCodecs.java
-@@ -41,6 +41,7 @@ import htsjdk.tribble.FeatureCodec;
+@@ -41,6 +41,7 @@
import htsjdk.tribble.bed.BEDCodec;
import org.junit.After;
import org.junit.Before;
@@ -579,7 +579,7 @@ Bug-Debian: https://bugs.debian.org/1065646
import org.junit.Test;
import java.util.Iterator;
-@@ -106,6 +107,7 @@ public class TestBEDCodecs {
+@@ -106,6 +107,7 @@
tstUnigeneBed(bedFile, new IGVBEDCodec());
}
@@ -587,7 +587,7 @@ Bug-Debian: https://bugs.debian.org/1065646
@Test
public void testGffTags() throws Exception {
String bedFile = TestUtils.DATA_DIR + "bed/gene.bed";
-@@ -218,6 +220,7 @@ public class TestBEDCodecs {
+@@ -218,6 +220,7 @@
}
@@ -597,7 +597,7 @@ Bug-Debian: https://bugs.debian.org/1065646
String bedFile = TestUtils.DATA_DIR + "bed/snp_calls.bed";
--- a/src/test/java/org/broad/igv/ucsc/bb/BBDataSourceTest.java
+++ b/src/test/java/org/broad/igv/ucsc/bb/BBDataSourceTest.java
-@@ -4,6 +4,7 @@ import org.broad.igv.data.DataTile;
+@@ -4,6 +4,7 @@
import org.broad.igv.feature.LocusScore;
import org.broad.igv.feature.genome.Genome;
import org.broad.igv.util.TestUtils;
@@ -605,7 +605,7 @@ Bug-Debian: https://bugs.debian.org/1065646
import org.junit.Test;
import java.io.IOException;
-@@ -13,6 +14,7 @@ import static org.junit.Assert.*;
+@@ -13,6 +14,7 @@
public class BBDataSourceTest {
@@ -613,7 +613,7 @@ Bug-Debian: https://bugs.debian.org/1065646
@Test
public void testUncompressedBigwig() throws IOException {
-@@ -33,6 +35,7 @@ public class BBDataSourceTest {
+@@ -33,6 +35,7 @@
}
@@ -621,7 +621,7 @@ Bug-Debian: https://bugs.debian.org/1065646
@Test
public void testBigWigZoom() throws IOException {
-@@ -59,6 +62,7 @@ public class BBDataSourceTest {
+@@ -59,6 +62,7 @@
}
@@ -639,7 +639,7 @@ Bug-Debian: https://bugs.debian.org/1065646
import org.junit.Test;
import java.io.IOException;
-@@ -27,6 +28,7 @@ public class TwoBitSequenceTest {
+@@ -27,6 +28,7 @@
assertEquals(expectedSequence.substring(start, end), seqString);
}
@@ -649,7 +649,7 @@ Bug-Debian: https://bugs.debian.org/1065646
--- a/src/test/java/org/broad/igv/feature/genome/load/JsonGenomeLoaderTest.java
+++ b/src/test/java/org/broad/igv/feature/genome/load/JsonGenomeLoaderTest.java
-@@ -4,6 +4,7 @@ import org.broad.igv.feature.genome.Geno
+@@ -4,6 +4,7 @@
import org.broad.igv.track.Track;
import org.broad.igv.util.ResourceLocator;
import org.broad.igv.util.TestUtils;
@@ -657,7 +657,7 @@ Bug-Debian: https://bugs.debian.org/1065646
import org.junit.Test;
import java.io.IOException;
-@@ -15,6 +16,7 @@ import static org.junit.Assert.*;
+@@ -15,6 +16,7 @@
public class JsonGenomeLoaderTest {
@@ -667,16 +667,18 @@ Bug-Debian: https://bugs.debian.org/1065646
String path = TestUtils.DATA_DIR + "genomes/json/hg38.json";
--- a/src/test/java/org/broad/igv/ucsc/bb/BBFeatureSourceTest.java
+++ b/src/test/java/org/broad/igv/ucsc/bb/BBFeatureSourceTest.java
-@@ -97,7 +97,7 @@ public class BBFeatureSourceTest {
+@@ -97,9 +97,8 @@
}
-
+ @Ignore("No network access")
@Test
- @Ignore
+- @Ignore
// Ignored as data file has moved or been deleted
-@@ -124,6 +124,7 @@ public class BBFeatureSourceTest {
+ public void testBigGenePred() throws IOException {
+
+@@ -124,6 +123,7 @@
assertTrue(count > 0);
}
@@ -684,7 +686,7 @@ Bug-Debian: https://bugs.debian.org/1065646
@Test
public void testBigNarrowpeak() throws IOException {
-@@ -148,6 +149,7 @@ public class BBFeatureSourceTest {
+@@ -148,6 +148,7 @@
}
// NOTE: bigInteract is not yet supported in IGV desktop, bigInteract is treated as a plain bed file.
@@ -692,14 +694,23 @@ Bug-Debian: https://bugs.debian.org/1065646
@Test
public void testBigInteract() throws IOException {
-@@ -196,6 +198,7 @@ public class BBFeatureSourceTest {
+@@ -196,8 +197,8 @@
// })
// NOTE: bigInteract is not yet supported in IGV desktop, bigInteract is treated as a plain bed file.
+ @Ignore("No network access")
@Test
- @Ignore
+- @Ignore
// Ignored as data file has moved or been deleted
+ public void testBigRmsk() throws IOException {
+
+@@ -223,4 +224,4 @@
+
+
+
+-}
+\ No newline at end of file
++}
--- a/src/test/java/org/broad/igv/tdf/TDFReaderTest.java
+++ b/src/test/java/org/broad/igv/tdf/TDFReaderTest.java
@@ -26,6 +26,7 @@
@@ -710,7 +721,7 @@ Bug-Debian: https://bugs.debian.org/1065646
import org.junit.Test;
import java.util.Set;
-@@ -41,6 +42,7 @@ import static junit.framework.Assert.ass
+@@ -41,6 +42,7 @@
*/
public class TDFReaderTest {
@@ -720,7 +731,7 @@ Bug-Debian: https://bugs.debian.org/1065646
String url = "http://data.broadinstitute.org/igvdata/tutorials/hg18/wgEncodeBroadChipSeqSignalK562H3k4me3.wig.gz.tdf";
--- a/src/test/java/org/broad/igv/util/blat/BlatClientTest.java
+++ b/src/test/java/org/broad/igv/util/blat/BlatClientTest.java
-@@ -6,6 +6,7 @@ import org.broad.igv.feature.Strand;
+@@ -6,6 +6,7 @@
import org.broad.igv.prefs.Constants;
import org.broad.igv.prefs.PreferencesManager;
import org.broad.igv.ui.util.MessageUtils;
@@ -728,7 +739,7 @@ Bug-Debian: https://bugs.debian.org/1065646
import org.junit.Test;
import java.io.IOException;
-@@ -15,6 +16,7 @@ import static org.junit.Assert.*;
+@@ -15,6 +16,7 @@
public class BlatClientTest extends AbstractHeadlessTest {
@@ -736,7 +747,7 @@ Bug-Debian: https://bugs.debian.org/1065646
@Test
public void blatGET() throws IOException {
-@@ -30,6 +32,7 @@ public class BlatClientTest extends Abst
+@@ -30,6 +32,7 @@
assertEquals(34, results.get(0).getqSize());
}
@@ -744,7 +755,7 @@ Bug-Debian: https://bugs.debian.org/1065646
@Test
public void blatPOST() throws IOException {
-@@ -45,6 +48,7 @@ public class BlatClientTest extends Abst
+@@ -45,6 +48,7 @@
assertEquals(34, results.get(0).getqSize());
}
@@ -754,7 +765,7 @@ Bug-Debian: https://bugs.debian.org/1065646
--- a/src/test/java/org/broad/igv/sam/mods/BaseModificationCountsTest.java
+++ b/src/test/java/org/broad/igv/sam/mods/BaseModificationCountsTest.java
-@@ -9,6 +9,7 @@ import org.broad.igv.sam.reader.BAMReade
+@@ -9,6 +9,7 @@
import org.broad.igv.util.ResourceLocator;
import org.broad.igv.util.TestUtils;
import org.junit.Before;
@@ -762,7 +773,7 @@ Bug-Debian: https://bugs.debian.org/1065646
import org.junit.Test;
import java.io.IOException;
-@@ -55,6 +56,7 @@ public class BaseModificationCountsTest
+@@ -55,6 +56,7 @@
}
}
View it on GitLab: https://salsa.debian.org/med-team/igv/-/commit/53d08239a9626edbf3c5988496f0210b7c7fac86
--
View it on GitLab: https://salsa.debian.org/med-team/igv/-/commit/53d08239a9626edbf3c5988496f0210b7c7fac86
You're receiving this email because of your account on salsa.debian.org.
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://alioth-lists.debian.net/pipermail/debian-med-commit/attachments/20240308/edbe1825/attachment-0001.htm>
More information about the debian-med-commit
mailing list