[med-svn] [Git][med-team/mirtop][master] 2 commits: New upstream version 0.4.28
Alexandre Detiste (@detiste-guest)
gitlab at salsa.debian.org
Sat Oct 12 13:48:50 BST 2024
Alexandre Detiste pushed to branch master at Debian Med / mirtop
Commits:
d6a23114 by Alexandre Detiste at 2024-10-12T14:35:37+02:00
New upstream version 0.4.28
- - - - -
c0a2829c by Alexandre Detiste at 2024-10-12T14:35:39+02:00
Update upstream source from tag 'upstream/0.4.28'
Update to upstream version '0.4.28'
with Debian dir c9e66e9cbea41efe300407602ee3ee0b7ade3369
- - - - -
17 changed files:
- + .github/workflows/ci-cd.yml
- + .github/workflows/python-package-conda.yml
- + .travis.yml
- HISTORY.md
- + environment.yml
- mirtop/bam/bam.py
- mirtop/gff/__init__.py
- mirtop/gff/convert.py
- mirtop/gff/stats.py
- mirtop/libs/parse.py
- mirtop/mirna/mintplates.py
- mirtop/mirna/realign.py
- scripts/import_gff3.py
- scripts/prepare.py
- setup.py
- test/test_automated_analysis.py
- test/test_functions.py
Changes:
=====================================
.github/workflows/ci-cd.yml
=====================================
@@ -0,0 +1,94 @@
+name: Publish Python 🐍 distribution 📦 to PyPI and TestPyPI
+
+on: push
+
+jobs:
+ build:
+ name: Build distribution 📦
+ runs-on: ubuntu-latest
+
+ steps:
+ - uses: actions/checkout at v4
+ - name: Set up Python
+ uses: actions/setup-python at v5
+ with:
+ python-version: "3.x"
+ - name: Install pypa/build
+ run: >-
+ python3 -m
+ pip install
+ build
+ --user
+ - name: Build a binary wheel and a source tarball
+ run: python3 -m build
+ - name: Store the distribution packages
+ uses: actions/upload-artifact at v4
+ with:
+ name: python-package-distributions
+ path: dist/
+
+ publish-to-pypi:
+ name: >-
+ Publish Python 🐍 distribution 📦 to PyPI
+ if: startsWith(github.ref, 'refs/tags/') # only publish to PyPI on tag pushes
+ needs:
+ - build
+ runs-on: ubuntu-latest
+ environment:
+ name: pypi
+ url: https://pypi.org/p/mirtop # Replace <package-name> with your PyPI project name
+ permissions:
+ id-token: write # IMPORTANT: mandatory for trusted publishing
+
+ steps:
+ - name: Download all the dists
+ uses: actions/download-artifact at v4
+ with:
+ name: python-package-distributions
+ path: dist/
+ - name: Publish distribution 📦 to PyPI
+ uses: pypa/gh-action-pypi-publish at release/v1
+
+ github-release:
+ name: >-
+ Sign the Python 🐍 distribution 📦 with Sigstore
+ and upload them to GitHub Release
+ needs:
+ - publish-to-pypi
+ runs-on: ubuntu-latest
+
+ permissions:
+ contents: write # IMPORTANT: mandatory for making GitHub Releases
+ id-token: write # IMPORTANT: mandatory for sigstore
+
+ steps:
+ - name: Download all the dists
+ uses: actions/download-artifact at v4
+ with:
+ name: python-package-distributions
+ path: dist/
+ - name: Sign the dists with Sigstore
+ uses: sigstore/gh-action-sigstore-python at v2.1.1
+ with:
+ inputs: >-
+ ./dist/*.tar.gz
+ ./dist/*.whl
+ - name: Create GitHub Release
+ env:
+ GITHUB_TOKEN: ${{ github.token }}
+ run: >-
+ gh release create
+ '${{ github.ref_name }}'
+ --repo '${{ github.repository }}'
+ --notes ""
+ - name: Upload artifact signatures to GitHub Release
+ env:
+ GITHUB_TOKEN: ${{ github.token }}
+ # Upload to GitHub Release using the `gh` CLI.
+ # `dist/` contains the built packages, and the
+ # sigstore-produced signatures and certificates.
+ run: >-
+ gh release upload
+ '${{ github.ref_name }}' dist/**
+ --repo '${{ github.repository }}'
+
=====================================
.github/workflows/python-package-conda.yml
=====================================
@@ -0,0 +1,46 @@
+name: Python Package using Conda
+
+on:
+ push:
+ branches:
+ - main
+ - master
+ - dev
+ - release/*
+ pull_request:
+ branches:
+ - main
+ - master
+
+jobs:
+ build-linux:
+ runs-on: ubuntu-latest
+ strategy:
+ max-parallel: 5
+
+ steps:
+ - uses: actions/checkout at v4
+ - name: Set up Python 3.11
+ uses: actions/setup-python at v3
+ with:
+ python-version: '3.11'
+ - name: Add conda to system path
+ run: |
+ # $CONDA is an environment variable pointing to the root of the miniconda directory
+ echo $CONDA/bin >> $GITHUB_PATH
+ - name: Install dependencies
+ run: |
+ conda env update --file environment.yml --name base
+ - name: Lint with flake8
+ run: |
+ conda install flake8
+ # stop the build if there are Python syntax errors or undefined names
+ flake8 . --count --select=E9,F63,F7,F82 --show-source --statistics
+ # exit-zero treats all errors as warnings. The GitHub editor is 127 chars wide
+ # flake8 . --count --exit-zero --max-complexity=10 --max-line-length=127 --statistics
+ #flake8 . --count --max-complexity=10 --max-line-length=127 --statistics
+ - name: Test with pytest
+ run: |
+ conda install pytest
+ python setup.py develop
+ pytest
=====================================
.travis.yml
=====================================
@@ -0,0 +1,37 @@
+sudo: required
+dist: trusty
+language: python
+python:
+ - "3.6"
+ - "2.7"
+notifications:
+ email:
+ recipients:
+ - lorena.pantano at gmail.com
+ on_failure: always
+before_install:
+- echo $TRAVIS_PYTHON_VERSION
+- miniconda="Miniconda3-latest-Linux-x86_64.sh"
+- if [[ $TRAVIS_PYTHON_VERSION == "2.7" ]] ; then miniconda="Miniconda2-latest-Linux-x86_64.sh"; fi
+- wget -O miniconda.sh http://repo.continuum.io/miniconda/${miniconda}
+- bash miniconda.sh -b -p ~/install
+install:
+- export PATH=~/install/bin/:$PATH
+- conda install --yes ncurses -c conda-forge
+- conda install --yes -c conda-forge -c bioconda bedtools samtools razers3 pip nose pysam pandas pyyaml pybedtools biopython setuptools codecov -q
+script:
+- python setup.py develop
+- nosetests --with-coverage
+after_success:
+ - codecov
+deploy:
+ provider: pypi
+ user: lpantano
+ password:
+ secure: cxfwBMREy+KIQl7Y2EeT8fBChASr6F7GvZxkwe7xXhwPS5Ezw51IX5ktHz8s8O6psseSP6GFLOzfc6wUTY2KM9i5syFtQUc8dQ8B4GmPbZKb+r8hcu4Q3VQqyrkMgyOV6DZ3jZ/Dowqd0005c5tW872RB3ABjflEq1xOr3ddOAp1UmjswYoM+cHE6gurT3z7XYyWS8O6jBee27Pf/tZkrc5tQaN6uVyEvEbYgtkomJ46CsKhgXACqQJiW6CKbzc03VypjEs+oUDNu6DsXmTuTXRyDHH/CA9M0zmQc9EOfZuBauwJ7/PgAS7LVICTq9cvq5RZ4sGEdZ1I1FDTMupp4Hybt6kbEU+Pntfj0nWWYhRZkeWN96Gar7p2BEQ9y68zVvyoM3S3fshLCYF1gonI4Dvy2XXjy+zyQuOSiNbqKwR/GjeDZV/U/TVhIVakQ7yQllyv2Fio8pwE28qpgfIhaddRC+Cp2KBhFBbpwM8Mxx5PeayTIQnhD3zDUt8ZdP1djvH4q/S+qLp77l2znD9CwaELYEzXvVbocsyed4jsXbMtD1z092JViA9/YzZPnuQ0PR7Ccs1bsdvMI0gOyoIroTEP+aPkXKyrL5O7O3sF8UX0ES0vxOC9cJwpEPH39sRxYxjJ4K1NpaGWlHiZG0hihLP6QkeBDthMYNEb0Veqcwc=
+ skip_existing: true
+ on:
+ all_branches: true
+ condition: $TRAVIS_BRANCH =~ ^master|dev$
+ distributions: sdist bdist_wheel
+ repo: miRTop/mirtop
=====================================
HISTORY.md
=====================================
@@ -1,3 +1,16 @@
+0.4.28
+
+* fix random order in Variant field [#84](https://github.com/miRTop/mirtop/issues/83)
+
+0.4.27
+
+* fix possible duplication of lines [#80](https://github.com/miRTop/mirtop/issues/80)
+* accept prefix for gff output [#84](https://github.com/miRTop/mirtop/issues/84)
+
+0.4.26
+
+* Support spaces and special characters in bam files
+
0.4.25
* [fix outliers samples](https://github.com/nf-core/smrnaseq/issues/137). When there is no identification of reference sequences or isomirs, the multiqc module will fails because it won't find the expected keys. Adding 0 when is the case.
=====================================
environment.yml
=====================================
@@ -0,0 +1,7 @@
+dependencies:
+ - python=3.11
+ - bioconda::pysam
+ - bioconda::pybedtools
+ - bioconda::samtools=1.21
+ - conda-forge::pandas
+ - conda-forge::biopython=1.83
\ No newline at end of file
=====================================
mirtop/bam/bam.py
=====================================
@@ -6,6 +6,7 @@ import os.path as op
import os
import pysam
from collections import defaultdict
+from shlex import quote
import pybedtools
@@ -321,7 +322,7 @@ def _sam_to_bam(bam_fn):
if not bam_fn.endswith("bam"):
bam_out = "%s.bam" % os.path.splitext(bam_fn)[0]
cmd = "samtools view -Sbh {bam_fn} -o {bam_out}"
- do.run(cmd.format(**locals()))
+ do.run(cmd.format(bam_fn=quote(bam_fn), bam_out=quote(bam_out)))
return bam_out
return bam_fn
@@ -330,7 +331,7 @@ def _bam_sort(bam_fn):
bam_sort_by_n = op.splitext(bam_fn)[0] + "_sort.bam"
if not file_exists(bam_sort_by_n):
do.run(("samtools sort -n -o {bam_sort_by_n} {bam_fn}").format(
- **locals()))
+ bam_sort_by_n=quote(bam_sort_by_n), bam_fn=quote(bam_fn)))
return bam_sort_by_n
=====================================
mirtop/gff/__init__.py
=====================================
@@ -68,7 +68,7 @@ def reader(args):
if args.low_memory:
return None
merged = merge.merge(out_dts, samples)
- fn_merged_out = op.join(args.out, "mirtop.%s" % args.out_format)
+ fn_merged_out = op.join(args.out, "%s.%s" % (args.prefix, args.out_format))
_write(merged, header.create(samples, database, header.make_tools([args.format])), fn_merged_out, args)
=====================================
mirtop/gff/convert.py
=====================================
@@ -3,6 +3,7 @@
from __future__ import print_function
import os.path as op
+import pandas as pd
from mirtop.mirna import fasta, mapper
from mirtop.mirna.realign import read_id
@@ -25,69 +26,69 @@ def convert_gff_counts(args):
UID miRNA Variant Sample1 Sample2 ... Sample N
"""
sep = "\t"
- variant_header = sep.join(['iso_5p', 'iso_3p',
- 'iso_add3p', 'iso_snp'])
+ variant_header = ['iso_5p', 'iso_3p',
+ 'iso_add3p', 'iso_snp']
if args.add_extra:
precursors = fasta.read_precursor(args.hairpin, args.sps)
matures = mapper.read_gtf_to_precursor(args.gtf)
- variant_header = sep.join([variant_header,
- 'iso_5p_nt', 'iso_3p_nt',
- 'iso_add3p_nt', 'iso_snp_nt'])
+ variant_header = variant_header + ['iso_5p_nt', 'iso_3p_nt', 'iso_add3p_nt', 'iso_snp_nt']
logger.info("INFO Reading GFF file %s", args.gff)
logger.info("INFO Writing TSV file to directory %s", args.out)
gff_file = open(args.gff, 'r')
out_file = op.join(args.out, "%s.tsv" % op.splitext(op.basename(args.gff))[0])
+ all_lines = []
missing_parent = 0
missing_mirna = 0
unvalid_uid = 0
- with open(out_file, 'w') as outh:
-
- for samples_line in gff_file:
- if samples_line.startswith("## COLDATA:"):
- samples = sep.join(samples_line.strip().split("COLDATA:")[1].strip().split(","))
- header = sep.join(['UID', 'Read', 'miRNA', 'Variant',
- variant_header, samples])
- print(header, file=outh)
- break
-
- for mirna_line in gff_file:
- gff = feature(mirna_line)
- attr = gff.attributes
- UID = attr["UID"]
- Read = attr["Read"]
- mirna = attr["Name"]
- parent = attr["Parent"]
- variant = attr["Variant"]
- try:
- read_id(UID)
- except KeyError:
- unvalid_uid += 1
+ #with open(out_file, 'w') as outh:
+
+ for samples_line in gff_file:
+ if samples_line.startswith("## COLDATA:"):
+ samples = [sep.join(samples_line.strip().split("COLDATA:")[1].strip().split(","))]
+ #header = sep.join(['UID', 'Read', 'miRNA', 'Variant',
+ # variant_header, samples])
+ #print(header, file=outh)
+ break
+
+ for mirna_line in gff_file:
+ gff = feature(mirna_line)
+ attr = gff.attributes
+ UID = attr["UID"]
+ Read = attr["Read"]
+ mirna = attr["Name"]
+ parent = attr["Parent"]
+ variant = attr["Variant"]
+ try:
+ read_id(UID)
+ except KeyError:
+ unvalid_uid += 1
+ continue
+
+ expression = [sep.join(attr["Expression"].strip().split(","))]
+ cols_variants = _expand(variant)
+ logger.debug("COUNTS::Read:%s" % Read)
+ logger.debug("COUNTS::EXTRA:%s" % variant)
+ if args.add_extra:
+ if parent not in precursors:
+ missing_parent += 1
continue
-
- expression = sep.join(attr["Expression"].strip().split(","))
- cols_variants = sep.join(_expand(variant))
- logger.debug("COUNTS::Read:%s" % Read)
- logger.debug("COUNTS::EXTRA:%s" % variant)
- if args.add_extra:
- if parent not in precursors:
- missing_parent += 1
- continue
- if mirna not in matures[parent]:
- missing_mirna += 1
- continue
- extra = variant_with_nt(mirna_line, precursors, matures)
- if extra == "Invalid":
- continue
- logger.debug("COUNTS::EXTRA:%s" % extra)
- cols_variants = sep.join([cols_variants] + _expand(extra, True))
- summary = sep.join([UID, Read, mirna, variant,
- cols_variants, expression])
- logger.debug(summary)
- print(summary, file=outh)
-
- gff_file.close()
+ if mirna not in matures[parent]:
+ missing_mirna += 1
+ continue
+ extra = variant_with_nt(mirna_line, precursors, matures)
+ if extra == "Invalid":
+ continue
+ logger.debug("COUNTS::EXTRA:%s" % extra)
+ cols_variants = cols_variants + _expand(extra, True)
+ summary = [UID, Read, mirna, variant] + cols_variants + expression
+ logger.debug(summary)
+ all_lines.append(summary)
+ #import pdb; pdb.set_trace()
+ df = pd.DataFrame(all_lines, columns = ['UID', 'Read', 'miRNA', 'Variant'] + variant_header + samples)
+ df = df.drop_duplicates()
+ df.to_csv(out_file, sep="\t", index=False)
logger.info("Missing Parents in hairpin file: %s" % missing_parent)
logger.info("Missing MiRNAs in GFF file: %s" % missing_mirna)
logger.info("Non valid UID: %s" % unvalid_uid)
=====================================
mirtop/gff/stats.py
=====================================
@@ -107,13 +107,13 @@ def _add_missing(df):
# ref_miRNA_mean
category = "ref_miRNA_mean"
if sum(df['category']==category) == 0:
- df2 = {'category': category, 'sample': df['sample'].iat[0], 'counts': 0}
- df = df.append(df2, ignore_index = True)
+ df2 = pd.DataFrame({'category': category, 'sample': df['sample'].iat[0], 'counts': 0}, index=[0])
+ df = pd.concat([df, df2], ignore_index = True)
category = "isomiR_sum"
if sum(df['category']==category) == 0:
- df2 = {'category': category, 'sample': df['sample'].iat[0], 'counts': 0}
- df = df.append(df2, ignore_index = True)
+ df2 = pd.DataFrame({'category': category, 'sample': df['sample'].iat[0], 'counts': 0}, index=[0])
+ df = pd.concat([df, df2], ignore_index = True)
return df
=====================================
mirtop/libs/parse.py
=====================================
@@ -82,6 +82,8 @@ def _add_subparser_gff(subparsers):
parser.add_argument("files", nargs="*", help="Bam files.")
parser.add_argument("-o", "--out", dest="out", required=1,
help="dir of output files")
+ parser.add_argument("--prefix", dest="prefix", required=0,
+ default="mirtop", help="prefix for output file")
parser.add_argument("--sps",
help="species")
parser.add_argument("--keep-name", action="store_true",
=====================================
mirtop/mirna/mintplates.py
=====================================
@@ -509,7 +509,7 @@ def encode_sequence(sequence, prefix):
"""
length = len(sequence)
# Encode label
- if prefix is '':
+ if prefix == '':
final_result = [(str(length) + '-')]
else:
final_result = [prefix + "-" + str(length) + "-"]
=====================================
mirtop/mirna/realign.py
=====================================
@@ -94,7 +94,7 @@ class isomir:
value.append("iso_3p:%s%s" % (direction, size))
if not value:
value = ["NA"]
- return ",".join(list(set(value)))
+ return ",".join(sorted(list(set(value))))
def format(self, sep="\t"):
"""Create tabular line from variant fields."""
=====================================
scripts/import_gff3.py
=====================================
@@ -11,7 +11,7 @@ def loadfile(filename,verbose=True):
try:
if verbose==True:
- print 'Loading', filename
+ print('Loading', filename)
# obtaning sample names and number from 3rd line in header
num_header_lines=0
with open(filename) as f:
@@ -26,12 +26,12 @@ def loadfile(filename,verbose=True):
num_header_lines+=1
sample_number = len(sample_names)
if verbose==True:
- print '--------------------------------------'
- print sample_number,' samples in the file'
- print '--------------------------------------'
+ print('--------------------------------------')
+ print(sample_number,' samples in the file')
+ print('--------------------------------------')
for elem in sample_names:
- print elem
- print '--------------------------------------'
+ print(elem)
+ print('--------------------------------------')
@@ -59,11 +59,11 @@ def loadfile(filename,verbose=True):
num_attr = len(attr_names) #number of attributes
#expression_colindex=attr_names.index ('Expression') #position of the expression column in the attr column
if verbose==True:
- print num_attr,' attributes in the file '
- print '--------------------------------------'
+ print(num_attr,' attributes in the file ')
+ print('--------------------------------------')
for attr in attr_names:
- print attr
- print '--------------------------------------'
+ print(attr)
+ print('--------------------------------------')
# joining rows of attributes without the descriptor
for row in range(atr_data.shape[0]):
@@ -113,7 +113,7 @@ def loadfile(filename,verbose=True):
data.at[row.Index,var]=np.nan
return data
except:
- print 'Error loading the file'
+ print('Error loading the file')
"""
@@ -137,7 +137,7 @@ def load_check_gff3(filename):
data_1=rowfile.split('\t')
break
if coldata_found==False:
- print 'No COLDATA, bad header'
+ print('No COLDATA, bad header')
return False
#Number of columns without breaking down attributes column
@@ -155,33 +155,33 @@ def load_check_gff3(filename):
for attr in list_attr:
if attr not in possible_attr:
Error=True
- print attr,'is not a possible attribute'
+ print(attr,'is not a possible attribute')
break
if Error:
- print 'File format error'
+ print('File format error')
return False
# If not format error, loading content
try:
dataframe=loadfile(filename,True)
except:
- print 'Error loading file'
+ print('Error loading file')
return False
- print 'Checking content'
+ print('Checking content')
for i in range(dataframe.shape[0]):
# Labels in type column
if dataframe.loc[i, 'type'] not in ['ref_miRNA', 'isomiR']:
Error = True
- print'line', i, 'pip install Markdownbad type error'
+ print('line', i, 'pip install Markdownbad type error')
# start<end
if dataframe.loc[i, 'start'] >= dataframe.loc[i, 'end']:
Error = True
- print 'line', i, 'start >=end error'
+ print('line', i, 'start >=end error')
# Strand + or -
if dataframe.loc[i, 'strand'] not in ['+', '-']:
Error = True
- print 'line', i, 'bad strand error'
+ print('line', i, 'bad strand error')
# Variant checking
possible_variant=['iso_5p','iso_3p','iso_add','iso_snp_seed','iso_snp_central_offset','iso_snp_central',
'iso_central_supp','iso_snp_central_supp','iso_snp']
@@ -191,36 +191,36 @@ def load_check_gff3(filename):
if len(variant_i)==1 and variant_i[0]!='NA':
if variant_i[0].split(':')[0] not in possible_variant:
Error = True
- print 'Variant error', variant_i[0].split(':')[0], 'line', i
+ print('Variant error', variant_i[0].split(':')[0], 'line', i)
elif variant_i[0]!='NA':
for var in range(len(variant_i)):
if variant_i[var].split(':')[0] not in possible_variant:
Error = True
- print 'Variant error', variant_i[0].split(':')[0], 'line', i
+ print('Variant error', variant_i[0].split(':')[0], 'line', i)
#Checking expression data
expression_cols=[col for col in dataframe.columns if 'Expression_' in col]
for col in expression_cols:
for i in range(dataframe.shape[0]):
if not dataframe.loc[i,col].isdigit():
- print dataframe.loc[i,col].isdigit()
- print 'Expression count error line',i
+ print(dataframe.loc[i,col].isdigit())
+ print('Expression count error line',i)
Error= True
dataframe[col]=dataframe[col].astype(int) #setting the datatype of counts
dataframe[col]=dataframe[col].replace(0,np.nan) #Setting 0 reads to NaN
if 'Filter' in dataframe.columns:
for i in range(dataframe.shape[0]):
if dataframe.loc[i, 'Filter']!='Pass':
- print 'Warning non-pass filter in line',i
+ print('Warning non-pass filter in line',i)
if Error:
- print 'File format error'
+ print('File format error')
return False
- print '--------------------------------------'
- print dataframe.dtypes
- print '--------------------------------------'
- print 'Format ok'
+ print('--------------------------------------')
+ print(dataframe.dtypes)
+ print('--------------------------------------')
+ print('Format ok')
return dataframe
except:
- print 'Error checking the file'
+ print('Error checking the file')
return False
=====================================
scripts/prepare.py
=====================================
@@ -62,7 +62,7 @@ if __name__ == "__main__":
for mir in fa:
if mir in bed:
precursor = bed[mir][mir + "_pre"]
- print precursor
+ print(precursor)
mir5p = ""
mir3p = ""
for mature in bed[mir]:
@@ -82,7 +82,7 @@ if __name__ == "__main__":
if mature.find("3p") > 0:
mir3p = "[%s:%s-%s]" % (mature, start, end)
- print >>OUT, ">%s (X) %s %s" % (mir, mir5p, mir3p)
- print >>OUTP, ">%s\n%s" % (mir, fa[mir])
+ print(">%s (X) %s %s" % (mir, mir5p, mir3p), file=OUT)
+ print(">%s\n%s" % (mir, fa[mir]),file=OUTP)
OUT.close()
OUTP.close()
=====================================
setup.py
=====================================
@@ -3,8 +3,7 @@
import os
from setuptools import setup, find_packages
-version = '0.4.25'
-
+version = '0.4.28'
url = 'http://github.com/mirtop/mirtop'
=====================================
test/test_automated_analysis.py
=====================================
@@ -10,8 +10,9 @@ import shutil
import contextlib
import functools
-from nose import SkipTest
-from nose.plugins.attrib import attr
+# from nose import SkipTest
+import pytest
+#from nose.plugins.attrib import attr
@contextlib.contextmanager
@@ -39,7 +40,7 @@ def expected_failure(test):
try:
test(*args, **kwargs)
except Exception:
- raise SkipTest
+ raise pytest.skip
else:
raise AssertionError('Failure expected')
return inner
@@ -66,7 +67,7 @@ class AutomatedAnalysisTest(unittest.TestCase):
shutil.move(os.path.basename(dirname), dirname)
os.remove(os.path.basename(url))
- @attr(simulate=True)
+ ##@attr(simulate=True)
def test_simulate(self):
"""Check simulated data"""
mirna = "TGAGGTAGTAGGTTGTATAGTT"
@@ -102,10 +103,10 @@ class AutomatedAnalysisTest(unittest.TestCase):
n += 1
print("rate %s/%s" % (correct, n))
- @attr(complete=True)
- @attr(annotate=True)
- @attr(bam=True)
- @attr(cmd=True)
+ ##@attr(complete=True)
+ ##@attr(annotate=True)
+ ##@attr(bam=True)
+ ##@attr(cmd=True)
def test_srnaseq_annotation_bam(self):
"""Run miraligner analysis
"""
@@ -121,9 +122,9 @@ class AutomatedAnalysisTest(unittest.TestCase):
print(" ".join(clcode))
subprocess.check_call(clcode)
- @attr(complete=True)
- @attr(low_memory=True)
- @attr(cmd=True)
+ ##@attr(complete=True)
+ ##@attr(low_memory=True)
+ ##@attr(cmd=True)
def test_srnaseq_annotation_bam_chunk(self):
"""Run miraligner analysis
"""
@@ -139,9 +140,9 @@ class AutomatedAnalysisTest(unittest.TestCase):
print(" ".join(clcode))
subprocess.check_call(clcode)
- @attr(cmd_bam_genomic=True)
- @attr(complete=True)
- @attr(cmd=True)
+ ##@attr(cmd_bam_genomic=True)
+ ##@attr(complete=True)
+ ##@attr(cmd=True)
def test_srnaseq_annotation_genomic_bam(self):
"""Run genomic bam analysis
"""
@@ -157,9 +158,9 @@ class AutomatedAnalysisTest(unittest.TestCase):
print(" ".join(clcode))
subprocess.check_call(clcode)
- @attr(cmd_bam_genomic_low_memory=True)
- @attr(complete=True)
- @attr(cmd=True)
+ ##@attr(cmd_bam_genomic_low_memory=True)
+ ##@attr(complete=True)
+ ##@attr(cmd=True)
def test_srnaseq_annotation_genomic_bam_low_memory(self):
"""Run genomic bam analysis
"""
@@ -175,127 +176,127 @@ class AutomatedAnalysisTest(unittest.TestCase):
print(" ".join(clcode))
subprocess.check_call(clcode)
- @attr(complete=True)
- @attr(cmd_seqbuster=True)
- @attr(cmd=True)
- def test_srnaseq_annotation_seqbuster(self):
- """Run miraligner analysis
- """
- with make_workdir():
- clcode = ["mirtop",
- "gff",
- "--format", "seqbuster",
- "--sps", "hsa",
- "--hairpin", "../../data/examples/annotate/hairpin.fa",
- "--gtf", "../../data/examples/annotate/hsa.gff3",
- "-o", "test_out_mirs",
- "../../data/examples/seqbuster/reads.mirna"]
- print("")
- print(" ".join(clcode))
- subprocess.check_call(clcode)
-
- @attr(complete=True)
- @attr(cmd_seqbuster_low_memory=True)
- @attr(cmd=True)
- def test_srnaseq_annotation_seqbuster_low_memory(self):
- """Run miraligner analysis
- """
- with make_workdir():
- clcode = ["mirtop",
- "gff", "--low-memory",
- "--format", "seqbuster",
- "--sps", "hsa",
- "--hairpin", "../../data/examples/annotate/hairpin.fa",
- "--gtf", "../../data/examples/annotate/hsa.gff3",
- "-o", "test_out_mirs",
- "../../data/examples/seqbuster/reads.mirna"]
- print("")
- print(" ".join(clcode))
- subprocess.check_call(clcode)
-
- @attr(complete=True)
- @attr(cmd_isomirsea=True)
- @attr(cmd=True)
- def test_srnaseq_annotation_isomirsea(self):
- """Run isomirsea analysis
- """
- with make_workdir():
- clcode = ["mirtop",
- "gff",
- "--format", "isomirsea",
- "--sps", "hsa",
- "--hairpin", "../../data/examples/annotate/hairpin.fa",
- "--gtf", "../../data/examples/annotate/hsa.gff3",
- "-o", "test_out_mirs",
- "../../data/examples/isomir-sea/tagMir-all.gff",
- "-d", "-vd"]
- print("")
- print(" ".join(clcode))
- subprocess.check_call(clcode)
-
- @attr(complete=True)
- @attr(cmd_srnabench=True)
- @attr(cmd=True)
- def test_srnaseq_annotation_srnabench(self):
- """Run srnabench analysis
- """
- with make_workdir():
- clcode = ["mirtop",
- "gff",
- "--format", "srnabench",
- "--sps", "hsa",
- "--hairpin", "../../data/examples/annotate/hairpin.fa",
- "--gtf", "../../data/examples/annotate/hsa.gff3",
- "-o", "test_out_mirs",
- "../../data/examples/srnabench/",
- "-d", "-vd"]
- print("")
- print(" ".join(clcode))
- subprocess.check_call(clcode)
-
- @attr(complete=True)
- @attr(cmd_optimir=True)
- @attr(cmd=True)
- def test_srnaseq_annotation_optimir(self):
- """Run optimir analysis
- """
- with make_workdir():
- clcode = ["mirtop",
- "gff",
- "--format", "optimir",
- "--sps", "hsa",
- "--hairpin", "../../data/examples/annotate/hairpin.fa",
- "--gtf", "../../data/examples/annotate/hsa.gff3",
- "-o", "test_out_mirs",
- "../../data/examples/optimir/synthetic_100_full.gff3",
- "-d", "-vd"]
- print("")
- print(" ".join(clcode))
- subprocess.check_call(clcode)
-
- @attr(complete=True)
- @attr(cmd_manatee=True)
- @attr(cmd=True)
- def test_srnaseq_annotation_manatee(self):
- """Run Manatee analysis
- """
- with make_workdir():
- clcode = ["mirtop",
- "gff",
- "--format", "manatee",
- "--sps", "hsa",
- "--hairpin", "../../data/examples/annotate/hairpin.fa",
- "--gtf", "../../data/examples/annotate/hsa.gff3",
- "-o", "test_out_mirs",
- "../../data/examples/manatee/simulated.sam",
- "-d", "-vd"]
- print("")
- print(" ".join(clcode))
- subprocess.check_call(clcode)
-
- @attr(complete=True)
- @attr(cmd_stats=True)
- @attr(cmd=True)
+ # ###@attr(complete=True)
+ # ###@attr(cmd_seqbuster=True)
+ # ####@attr(cmd=True)
+ # def test_srnaseq_annotation_seqbuster(self):
+ # """Run miraligner analysis
+ # """
+ # with make_workdir():
+ # clcode = ["mirtop",
+ # "gff",
+ # "--format", "seqbuster",
+ # "--sps", "hsa",
+ # "--hairpin", "../../data/examples/annotate/hairpin.fa",
+ # "--gtf", "../../data/examples/annotate/hsa.gff3",
+ # "-o", "test_out_mirs",
+ # "../../data/examples/seqbuster/reads.mirna"]
+ # print("")
+ # print(" ".join(clcode))
+ # subprocess.check_call(clcode)
+
+ # ###@attr(complete=True)
+ # ###@attr(cmd_seqbuster_low_memory=True)
+ # ###@attr(cmd=True)
+ # def test_srnaseq_annotation_seqbuster_low_memory(self):
+ # """Run miraligner analysis
+ # """
+ # with make_workdir():
+ # clcode = ["mirtop",
+ # "gff", "--low-memory",
+ # "--format", "seqbuster",
+ # "--sps", "hsa",
+ # "--hairpin", "../../data/examples/annotate/hairpin.fa",
+ # "--gtf", "../../data/examples/annotate/hsa.gff3",
+ # "-o", "test_out_mirs",
+ # "../../data/examples/seqbuster/reads.mirna"]
+ # print("")
+ # print(" ".join(clcode))
+ # subprocess.check_call(clcode)
+
+ # ##@attr(complete=True)
+ # ##@attr(cmd_isomirsea=True)
+ # ##@attr(cmd=True)
+ # def test_srnaseq_annotation_isomirsea(self):
+ # """Run isomirsea analysis
+ # """
+ # with make_workdir():
+ # clcode = ["mirtop",
+ # "gff",
+ # "--format", "isomirsea",
+ # "--sps", "hsa",
+ # "--hairpin", "../../data/examples/annotate/hairpin.fa",
+ # "--gtf", "../../data/examples/annotate/hsa.gff3",
+ # "-o", "test_out_mirs",
+ # "../../data/examples/isomir-sea/tagMir-all.gff",
+ # "-d", "-vd"]
+ # print("")
+ # print(" ".join(clcode))
+ # subprocess.check_call(clcode)
+
+ # ##@attr(complete=True)
+ # ##@attr(cmd_srnabench=True)
+ # ##@attr(cmd=True)
+ # def test_srnaseq_annotation_srnabench(self):
+ # """Run srnabench analysis
+ # """
+ # with make_workdir():
+ # clcode = ["mirtop",
+ # "gff",
+ # "--format", "srnabench",
+ # "--sps", "hsa",
+ # "--hairpin", "../../data/examples/annotate/hairpin.fa",
+ # "--gtf", "../../data/examples/annotate/hsa.gff3",
+ # "-o", "test_out_mirs",
+ # "../../data/examples/srnabench/",
+ # "-d", "-vd"]
+ # print("")
+ # print(" ".join(clcode))
+ # subprocess.check_call(clcode)
+
+ # ##@attr(complete=True)
+ # ##@attr(cmd_optimir=True)
+ # ##@attr(cmd=True)
+ # def test_srnaseq_annotation_optimir(self):
+ # """Run optimir analysis
+ # """
+ # with make_workdir():
+ # clcode = ["mirtop",
+ # "gff",
+ # "--format", "optimir",
+ # "--sps", "hsa",
+ # "--hairpin", "../../data/examples/annotate/hairpin.fa",
+ # "--gtf", "../../data/examples/annotate/hsa.gff3",
+ # "-o", "test_out_mirs",
+ # "../../data/examples/optimir/synthetic_100_full.gff3",
+ # "-d", "-vd"]
+ # print("")
+ # print(" ".join(clcode))
+ # subprocess.check_call(clcode)
+
+ # ##@attr(complete=True)
+ # ##@attr(cmd_manatee=True)
+ # ##@attr(cmd=True)
+ # def test_srnaseq_annotation_manatee(self):
+ # """Run Manatee analysis
+ # """
+ # with make_workdir():
+ # clcode = ["mirtop",
+ # "gff",
+ # "--format", "manatee",
+ # "--sps", "hsa",
+ # "--hairpin", "../../data/examples/annotate/hairpin.fa",
+ # "--gtf", "../../data/examples/annotate/hsa.gff3",
+ # "-o", "test_out_mirs",
+ # "../../data/examples/manatee/simulated.sam",
+ # "-d", "-vd"]
+ # print("")
+ # print(" ".join(clcode))
+ # subprocess.check_call(clcode)
+
+ ##@attr(complete=True)
+ ##@attr(cmd_stats=True)
+ ##@attr(cmd=True)
def test_srnaseq_stats(self):
"""Run stats analysis
"""
@@ -312,9 +313,9 @@ class AutomatedAnalysisTest(unittest.TestCase):
if sum(1 for line in open('test_out_mirs/mirtop_stats.txt')) == 1:
raise ValueError("File is empty, something is wrong with stats cmd.")
- @attr(complete=True)
- @attr(cmd_merge=True)
- @attr(cmd=True)
+ ##@attr(complete=True)
+ ##@attr(cmd_merge=True)
+ ##@attr(cmd=True)
def test_merge_bam(self):
"""
Run collapse two samples
@@ -332,9 +333,9 @@ class AutomatedAnalysisTest(unittest.TestCase):
print(" ".join(clcode))
subprocess.check_call(clcode)
- @attr(complete=True)
- @attr(cmd_export_seqbuster=True)
- @attr(cmd=True)
+ ##@attr(complete=True)
+ ##@attr(cmd_export_seqbuster=True)
+ ##@attr(cmd=True)
def test_export_seqbuster(self):
"""
Run SEQBUSTER export command
@@ -350,9 +351,9 @@ class AutomatedAnalysisTest(unittest.TestCase):
print(" ".join(clcode))
subprocess.check_call(clcode)
- @attr(complete=True)
- @attr(cmd_export_vcf=True)
- @attr(cmd=True)
+ ##@attr(complete=True)
+ ##@attr(cmd_export_vcf=True)
+ ##@attr(cmd=True)
def test_export_vcf(self):
"""
Run VCF export command
@@ -370,9 +371,9 @@ class AutomatedAnalysisTest(unittest.TestCase):
print(" ".join(clcode))
subprocess.check_call(clcode)
- @attr(complete=True)
- @attr(cmd_export_fasta=True)
- @attr(cmd=True)
+ ##@attr(complete=True)
+ ##@attr(cmd_export_fasta=True)
+ ##@attr(cmd=True)
def test_export_fasta(self):
"""
Run FASTA export command
@@ -390,9 +391,9 @@ class AutomatedAnalysisTest(unittest.TestCase):
print(" ".join(clcode))
subprocess.check_call(clcode)
- @attr(complete=True)
- @attr(cmd_count=True)
- @attr(cmd=True)
+ ##@attr(complete=True)
+ ##@attr(cmd_count=True)
+ ##@attr(cmd=True)
def test_count(self):
"""
Run count command
@@ -408,49 +409,49 @@ class AutomatedAnalysisTest(unittest.TestCase):
print(" ".join(clcode))
subprocess.check_call(clcode)
- @attr(complete=True)
- @attr(cmd_spikeins=True)
- @attr(cmd=True)
- def test_spikeins_cmd(self):
- """Run spikeins analysis
- """
- import platform
- with make_workdir():
- shutil.copy("../../data/examples/spikeins/spikeins.fa",
- "spikeins.fa")
- clcode = ["mirtop",
- "spikein",
- "spikeins.fa",
- "-o",
- "test_out_spikeins"]
- print("")
- print(" ".join(clcode))
- subprocess.check_call(clcode)
-
- if platform.system() == "Linux":
- clcode = ["razers3", "-dr", "0", "-i", "80", "-rr", "90",
- "-f", "-o", "spikeins.sam",
- "test_out_spikeins/spikeins_pre.fasta",
- "../../data/examples/spikeins/test-spikeins.fa"]
- print(" ".join(clcode))
- subprocess.check_call(clcode)
- else:
- shutil.copy("../../data/examples/spikeins/spikeins.sam",
- "spikeins.sam")
- clcode = ["mirtop",
- "gff",
- "--add-extra",
- "--hairpin", "test_out_spikeins/spikeins_pre.fasta",
- "--gtf", "test_out_spikeins/spikeins_pre.gff",
- "-o", "test_out_mirs",
- "spikeins.sam"]
- print("")
- print(" ".join(clcode))
- subprocess.check_call(clcode)
-
- @attr(complete=True)
- @attr(cmd_update=True)
- @attr(cmd=True)
+ ##@attr(complete=True)
+ ##@attr(cmd_spikeins=True)
+ ##@attr(cmd=True)
+ # def test_spikeins_cmd(self):
+ # """Run spikeins analysis
+ # """
+ # import platform
+ # with make_workdir():
+ # shutil.copy("../../data/examples/spikeins/spikeins.fa",
+ # "spikeins.fa")
+ # clcode = ["mirtop",
+ # "spikein",
+ # "spikeins.fa",
+ # "-o",
+ # "test_out_spikeins"]
+ # print("")
+ # print(" ".join(clcode))
+ # subprocess.check_call(clcode)
+
+ # if platform.system() == "Linux":
+ # clcode = ["razers3", "-dr", "0", "-i", "80", "-rr", "90",
+ # "-f", "-o", "spikeins.sam",
+ # "test_out_spikeins/spikeins_pre.fasta",
+ # "../../data/examples/spikeins/test-spikeins.fa"]
+ # print(" ".join(clcode))
+ # subprocess.check_call(clcode)
+ # else:
+ # shutil.copy("../../data/examples/spikeins/spikeins.sam",
+ # "spikeins.sam")
+ # clcode = ["mirtop",
+ # "gff",
+ # "--add-extra",
+ # "--hairpin", "test_out_spikeins/spikeins_pre.fasta",
+ # "--gtf", "test_out_spikeins/spikeins_pre.gff",
+ # "-o", "test_out_mirs",
+ # "spikeins.sam"]
+ # print("")
+ # print(" ".join(clcode))
+ # subprocess.check_call(clcode)
+
+ ##@attr(complete=True)
+ ##@attr(cmd_update=True)
+ ##@attr(cmd=True)
def test_update_cmd(self):
"""Run update analysis
"""
@@ -463,9 +464,9 @@ class AutomatedAnalysisTest(unittest.TestCase):
print(" ".join(clcode))
subprocess.check_call(clcode)
- @attr(complete=True)
- @attr(cmd_validate=True)
- @attr(cmd=True)
+ ##@attr(complete=True)
+ ##@attr(cmd_validate=True)
+ ##@attr(cmd=True)
def test_validate_cmd(self):
"""Run update analysis
"""
@@ -478,9 +479,9 @@ class AutomatedAnalysisTest(unittest.TestCase):
subprocess.check_call(clcode)
- @attr(complete=True)
- @attr(cmd_validate=True)
- @attr(cmd=True)
+ ##@attr(complete=True)
+ ##@attr(cmd_validate=True)
+ ##@attr(cmd=True)
def test_sql_create_1_cmd(self):
"""Run sql command to incorporate GFF to SQLite
"""
@@ -499,9 +500,9 @@ class AutomatedAnalysisTest(unittest.TestCase):
subprocess.check_call(clcode)
- @attr(complete=True)
- @attr(cmd_validate=True)
- @attr(cmd=True)
+ ##@attr(complete=True)
+ ##@attr(cmd_validate=True)
+ ##@attr(cmd=True)
def test_sql_create_2_cmd(self):
"""Run sql command to incorporate GFF to SQLite
"""
@@ -517,9 +518,9 @@ class AutomatedAnalysisTest(unittest.TestCase):
print(" ".join(clcode))
subprocess.check_call(clcode)
- @attr(complete=True)
- @attr(cmd_validate=True)
- @attr(cmd=True)
+ ##@attr(complete=True)
+ ##@attr(cmd_validate=True)
+ ##@attr(cmd=True)
def test_sql_query_showTables_cmd(self):
"""Run sql command to query from a database to show tables using SQLite
"""
@@ -535,9 +536,9 @@ class AutomatedAnalysisTest(unittest.TestCase):
print(" ".join(clcode))
subprocess.check_call(clcode)
- @attr(complete=True)
- @attr(cmd_validate=True)
- @attr(cmd=True)
+ ##@attr(complete=True)
+ ##@attr(cmd_validate=True)
+ ##@attr(cmd=True)
def test_sql_query_showSchema_cmd(self):
"""Run sql command to query from a database to show schema using SQLite
"""
@@ -555,9 +556,9 @@ class AutomatedAnalysisTest(unittest.TestCase):
print(" ".join(clcode))
subprocess.check_call(clcode)
- @attr(complete=True)
- @attr(cmd_validate=True)
- @attr(cmd=True)
+ ##@attr(complete=True)
+ ##@attr(cmd_validate=True)
+ ##@attr(cmd=True)
def test_sql_query_showColumns_cmd(self):
"""Run sql command to query from a database to show columns using SQLite
"""
@@ -573,9 +574,9 @@ class AutomatedAnalysisTest(unittest.TestCase):
print(" ".join(clcode))
subprocess.check_call(clcode)
- @attr(complete=True)
- @attr(cmd_validate=True)
- @attr(cmd=True)
+ ##@attr(complete=True)
+ ##@attr(cmd_validate=True)
+ ##@attr(cmd=True)
def test_sql_query_descSummary_cmd(self):
"""Run sql command to query from a database to display the header of the GFF using SQLite
"""
@@ -591,9 +592,9 @@ class AutomatedAnalysisTest(unittest.TestCase):
print(" ".join(clcode))
subprocess.check_call(clcode)
- @attr(complete=True)
- @attr(cmd_validate=True)
- @attr(cmd=True)
+ ##@attr(complete=True)
+ ##@attr(cmd_validate=True)
+ ##@attr(cmd=True)
def test_sql_query_statIsomirs_cmd(self):
"""Run sql command to query from a database to summarize isomirs per miRNA
"""
@@ -611,9 +612,9 @@ class AutomatedAnalysisTest(unittest.TestCase):
print(" ".join(clcode))
subprocess.check_call(clcode)
- @attr(complete=True)
- @attr(cmd_validate=True)
- @attr(cmd=True)
+ ##@attr(complete=True)
+ ##@attr(cmd_validate=True)
+ ##@attr(cmd=True)
def test_sql_query_statIsomirsFile_cmd(self):
"""Run sql command to query from a database to summarize isomirs per miRNA reading from afile
"""
@@ -631,9 +632,9 @@ class AutomatedAnalysisTest(unittest.TestCase):
print(" ".join(clcode))
subprocess.check_call(clcode)
- @attr(complete=True)
- @attr(cmd_validate=True)
- @attr(cmd=True)
+ ##@attr(complete=True)
+ ##@attr(cmd_validate=True)
+ ##@attr(cmd=True)
def test_sql_query_SelectLimit_cmd(self):
"""Run sql command to query from database using limit option
"""
@@ -651,9 +652,9 @@ class AutomatedAnalysisTest(unittest.TestCase):
print(" ".join(clcode))
subprocess.check_call(clcode)
- @attr(complete=True)
- @attr(cmd_validate=True)
- @attr(cmd=True)
+ ##@attr(complete=True)
+ ##@attr(cmd_validate=True)
+ ##@attr(cmd=True)
def test_sql_query_SelectColumns_cmd(self):
"""Run sql command to query from database using limit option
"""
@@ -673,9 +674,9 @@ class AutomatedAnalysisTest(unittest.TestCase):
print(" ".join(clcode))
subprocess.check_call(clcode)
- @attr(complete=True)
- @attr(cmd_validate=True)
- @attr(cmd=True)
+ ##@attr(complete=True)
+ ##@attr(cmd_validate=True)
+ ##@attr(cmd=True)
def test_sql_query_SelectMirna_cmd(self):
"""Run sql command to query from database for specific miRNAs
"""
@@ -697,9 +698,9 @@ class AutomatedAnalysisTest(unittest.TestCase):
print(" ".join(clcode))
subprocess.check_call(clcode)
- @attr(complete=True)
- @attr(cmd_validate=True)
- @attr(cmd=True)
+ ##@attr(complete=True)
+ ##@attr(cmd_validate=True)
+ ##@attr(cmd=True)
def test_sql_query_SelectiVariant_cmd(self):
"""Run sql command to query from database for specific variant types
"""
@@ -719,9 +720,9 @@ class AutomatedAnalysisTest(unittest.TestCase):
print(" ".join(clcode))
subprocess.check_call(clcode)
- @attr(complete=True)
- @attr(cmd_validate=True)
- @attr(cmd=True)
+ ##@attr(complete=True)
+ ##@attr(cmd_validate=True)
+ ##@attr(cmd=True)
def test_sql_query_SelectFilter_cmd(self):
"""Run sql command to query from database using filters
"""
@@ -743,9 +744,9 @@ class AutomatedAnalysisTest(unittest.TestCase):
print(" ".join(clcode))
subprocess.check_call(clcode)
- @attr(complete=True)
- @attr(cmd_validate=True)
- @attr(cmd=True)
+ ##@attr(complete=True)
+ ##@attr(cmd_validate=True)
+ ##@attr(cmd=True)
def test_sql_query_SelectCount_cmd(self):
"""Run sql command to query from database to fetch counts of the return values
"""
@@ -763,9 +764,9 @@ class AutomatedAnalysisTest(unittest.TestCase):
print(" ".join(clcode))
subprocess.check_call(clcode)
- @attr(complete=True)
- @attr(cmd_validate=True)
- @attr(cmd=True)
+ ##@attr(complete=True)
+ ##@attr(cmd_validate=True)
+ ##@attr(cmd=True)
def test_sql_query_SelectTextOut_cmd(self):
"""Run sql command to query from database and return the output to a text file
"""
=====================================
test/test_functions.py
=====================================
@@ -10,7 +10,7 @@ import argparse
import contextlib
import shutil
-from nose.plugins.attrib import attr
+#from nose.plugins.attrib import attr
@contextlib.contextmanager
@@ -64,7 +64,7 @@ def annotate(fn, read_file, load=False, create=True, keep_name=False,
class FunctionsTest(unittest.TestCase):
"""Setup a full automated analysis and run the pipeline.
"""
- @attr(database=True)
+ #@pytest.mark.database
def test_database(self):
from mirtop.mirna import mapper
args = argparse.Namespace()
@@ -75,7 +75,7 @@ class FunctionsTest(unittest.TestCase):
if db != "miRBasev21":
raise ValueError("%s not eq to miRBasev21" % db)
- @attr(read_hairpin=True)
+ #@pytest.mark.read_hairpin
def test_read_hairpin(self):
from mirtop.mirna import mapper, fasta
from mirtop.libs import logger
@@ -96,7 +96,7 @@ class FunctionsTest(unittest.TestCase):
# read data/aligments/let7-perfect.bam
return True
- @attr(read_hairpin_mirgenedb=True)
+ ##@attr(read_hairpin_mirgenedb=True)
def test_read_hairpin_mirgenedb(self):
from mirtop.mirna import mapper
from mirtop.libs import logger
@@ -105,7 +105,7 @@ class FunctionsTest(unittest.TestCase):
"data/db/mirgenedb/hsa.gff")
print(map_mir)
- @attr(read_mir2chr=True)
+ ##@attr(read_mir2chr=True)
def test_read_mir2chr(self):
from mirtop.mirna import mapper
from mirtop.libs import logger
@@ -114,7 +114,7 @@ class FunctionsTest(unittest.TestCase):
print(map_mir)
# print(mapper.read_gtf_chr2mirna2("data/examples/annotate/hsa.gff3"))
- @attr(read_mir2genomic=True)
+ ##@attr(read_mir2genomic=True)
def test_read_mir2genomic(self):
from mirtop.mirna import mapper
from mirtop.libs import logger
@@ -122,7 +122,7 @@ class FunctionsTest(unittest.TestCase):
map_mir = mapper.read_gtf_to_mirna("data/examples/annotate/hsa.gff3")
print(map_mir)
- @attr(read_line=True)
+ ##@attr(read_line=True)
def test_read_line(self):
"""Read GFF/GTF line"""
from mirtop.gff.body import read_gff_line
@@ -130,7 +130,7 @@ class FunctionsTest(unittest.TestCase):
for line in inh:
print(read_gff_line(line))
- @attr(code=True)
+ ##@attr(code=True)
def test_code(self):
"""testing code correction function"""
from mirtop.mirna.realign import make_id, read_id
@@ -153,7 +153,7 @@ class FunctionsTest(unittest.TestCase):
# if read_id("asD(-"):
# raise ValueError("This should be False, Not valid code.")
- @attr(code_convert=True)
+ ##@attr(code_convert=True)
def test_code_convert(self):
"""testing code correction function"""
from mirtop.mirna.realign import make_id
@@ -164,7 +164,7 @@ class FunctionsTest(unittest.TestCase):
if not make_id(read_uid_10("@#%$@2")) == "iso-13-B1NYDX":
raise ValueError("Update ID is not working.")
- @attr(cigar=True)
+ ##@attr(cigar=True)
def test_cigar(self):
"""testing cigar correction function"""
cigar = [[0, 14], [1, 1], [0, 5]]
@@ -188,7 +188,7 @@ class FunctionsTest(unittest.TestCase):
raise ValueError("3MA3M not equal AAATCCC but %s" %
cigar2snp("3MA3M", "AAATCCC"))
- @attr(sequence=True)
+ ##@attr(sequence=True)
def test_is_sequence(self):
"""testing if string is valid sequence"""
from mirtop.mirna.realign import is_sequence
@@ -197,7 +197,7 @@ class FunctionsTest(unittest.TestCase):
if is_sequence("AC2TGC"):
raise ValueError("AC2TGC should return false.")
- @attr(locala=True)
+ ##@attr(locala=True)
def test_locala(self):
"""testing pairwise alignment"""
from mirtop.mirna.realign import align
@@ -209,7 +209,7 @@ class FunctionsTest(unittest.TestCase):
print(align("TGANTAGTNGNTTGTATNGTT", "TGAGTATAGGCCTTGTATAGTT")[0])
print(align("NCANAGTCCAAGNTCATN", "TCATAGTCCAAGGTCATG")[0])
- @attr(reverse=True)
+ ##@attr(reverse=True)
def test_reverse(self):
"""Test reverse complement function"""
from mirtop.mirna.realign import reverse_complement
@@ -218,7 +218,7 @@ class FunctionsTest(unittest.TestCase):
raise ValueError("ATGC complement is not: %s" %
reverse_complement("ATGC"))
- @attr(class_gff=True)
+ ##@attr(class_gff=True)
def test_class(self):
"""Test class to read GFF line"""
from mirtop.gff.classgff import feature
@@ -231,7 +231,7 @@ class FunctionsTest(unittest.TestCase):
print(gff.columns)
print(gff.attributes)
- @attr(merge=True)
+ ##@attr(merge=True)
def test_merge(self):
"""Test merge functions"""
from mirtop.gff import merge
@@ -250,7 +250,7 @@ class FunctionsTest(unittest.TestCase):
if expression != "1,2":
raise ValueError("This is wrong: %s" % expression)
- @attr(align_mature=True)
+ ##@attr(align_mature=True)
def test_variant(self):
"""testing get mature sequence"""
from mirtop.mirna import fasta, mapper
@@ -315,10 +315,10 @@ class FunctionsTest(unittest.TestCase):
raise ValueError("Wrong alignment for test 8 %s" % res)
- @attr(alignment=True)
+ ##@attr(alignment=True)
def test_alignment(self):
"""testing alignments function"""
- from mirtop.bam import bam
+ from mirtop import bam
from mirtop.gff.classgff import feature
fns = {"let7-last1D.sam": {56:"iso_add3p:1,iso_snv"},
"let7-1D.sam": {5:"iso_snv,iso_3p:-5"},
@@ -328,13 +328,13 @@ class FunctionsTest(unittest.TestCase):
"let7-triming.sam": {5:"iso_3p:+2",4:"iso_5p:-1",6:"iso_5p:+1,iso_3p:-3"}}
#import pdb; pdb.set_trace()
for fn in fns:
- gff = annotate("data/aligments/%s" % fn, bam.read_bam)
+ gff = annotate("data/aligments/%s" % fn, bam.bam.read_bam)
for pos in gff['hsa-let-7a-1']:
f = feature(gff['hsa-let-7a-1'][pos][0][4])
if not set(f.attributes['Variant'].split(",")) == set(fns[fn][pos].split(",")):
raise ValueError("Error in %s" % fn)
- @attr(alignment_genomic=True)
+ ##@attr(alignment_genomic=True)
def test_alignment_genomic(self):
"""testing alignments function"""
from mirtop.bam import bam
@@ -351,7 +351,7 @@ class FunctionsTest(unittest.TestCase):
bam.read_bam,
gtf="data/db/mirbase/hsa.gff3", genomic=True))
- @attr(keep_name=True)
+ ##@attr(keep_name=True)
def test_keep_name(self):
from mirtop.bam import bam
line = annotate("data/aligments/let7-perfect.sam",
@@ -361,7 +361,7 @@ class FunctionsTest(unittest.TestCase):
if line["hsa-let-7a-1"][5][0][4].find("seq_perfect_x2") < 0:
raise ValueError("Keep name failed: %s" % line)
- @attr(seqbuster=True)
+ ##@attr(seqbuster=True)
def test_seqbuster(self):
"""testing reading seqbuster files function"""
from mirtop.libs import logger
@@ -375,7 +375,7 @@ class FunctionsTest(unittest.TestCase):
print("\nno frequency\n")
annotate("data/examples/seqbuster/seqbuster_nofreq.mirna", seqbuster.read_file)
- @attr(srnabench=True)
+ ##@attr(srnabench=True)
def test_srnabench(self):
"""testing reading srnabench files function"""
from mirtop.libs import logger
@@ -384,7 +384,7 @@ class FunctionsTest(unittest.TestCase):
from mirtop.importer import srnabench
annotate("data/examples/srnabench", srnabench.read_file, create=False)
- @attr(optimir=True)
+ ##@attr(optimir=True)
def test_optimir(self):
"""testing reading optimir files function"""
from mirtop.libs import logger
@@ -393,7 +393,7 @@ class FunctionsTest(unittest.TestCase):
from mirtop.importer import optimir
annotate("data/examples/optimir/synthetic_100_full.gff3", optimir.read_file, create=False)
- @attr(prost=True)
+ ##@attr(prost=True)
def test_prost(self):
"""testing reading prost files function"""
from mirtop.libs import logger
@@ -408,7 +408,7 @@ class FunctionsTest(unittest.TestCase):
fn, precursors, "miRBasev21", "data/examples/annotate/hsa.gff3")
annotate("data/example/prost/prost.example.txt", reads, True)
- @attr(gff=True)
+ ##@attr(gff=True)
def test_gff(self):
"""testing GFF function"""
from mirtop.libs import logger
@@ -419,7 +419,7 @@ class FunctionsTest(unittest.TestCase):
annotate(bam_fn, bam.read_bam)
return True
- @attr(collapse=True)
+ ##@attr(collapse=True)
def test_collapse(self):
"""testing GFF function"""
from mirtop.libs import logger
@@ -430,7 +430,7 @@ class FunctionsTest(unittest.TestCase):
annotate(bam_fn, bam.read_bam)
return True
- @attr(counts=True)
+ ##@attr(counts=True)
def test_counts(self):
"""testing convert_gff_counts in convert.py function"""
from mirtop.libs import logger
@@ -452,7 +452,7 @@ class FunctionsTest(unittest.TestCase):
return True
- @attr(stats=True)
+ ##@attr(stats=True)
def test_stats(self):
"""testing stats function"""
from mirtop.gff import stats
@@ -461,7 +461,7 @@ class FunctionsTest(unittest.TestCase):
stats._dump_log(df, version, None)
print(df)
- @attr(variant=True)
+ ##@attr(variant=True)
def test_string_variant(self):
"""testing parsing string variants"""
from mirtop.gff import body
@@ -477,7 +477,7 @@ class FunctionsTest(unittest.TestCase):
if (truthv > list(gff.values())) - (list(gff.values()) > truthv):
raise ValueError("Not found expected Values.")
- @attr(validate=True)
+ ##@attr(validate=True)
def test_validator(self):
"""test validator functions"""
from mirtop.gff.validator import _check_file
@@ -493,7 +493,7 @@ class FunctionsTest(unittest.TestCase):
raise ValueError("Validator did catch an unexpected error in correct_file.gff.")
- @attr(spikeins=True)
+ ###@attr(spikeins=True)
def test_spikeins(self):
"""Test spikeins reading and annotation"""
from mirtop.libs import spikeins
@@ -519,19 +519,19 @@ class FunctionsTest(unittest.TestCase):
fasta_precursor = fasta.read_precursor(file_fasta, None)
print(fasta_precursor)
- @attr(export_fasta=True)
+ #@attr(export_fasta=True)
def test_export_fasta(self):
from mirtop.exporter.fasta import _process
print("\n")
_process("data/examples/gff/2samples.gff", None)
- @attr(update=True)
+ #@attr(update=True)
def test_update(self):
from mirtop.gff.update import update_file
print("\n")
update_file("data/examples/versions/version1.0.gff", None)
- @attr(sql=True)
+ #@attr(sql=True)
def test_sql(self):
"""testing mirtop_sql in sql.py function"""
from mirtop.libs import logger
@@ -548,13 +548,13 @@ class FunctionsTest(unittest.TestCase):
os.remove(os.path.join(args.out, "SQL_sample.db"))
return True
- @attr(issue64=True)
+ #@attr(issue64=True)
def test_issue64(self):
from mirtop.bam.filter import tune
subs, add, cigar = tune("TATCACAGTGGCTGTTCTTTTTT", "CCCCCTATCACAGTGGCTGTTCTTTTTT", 5, None)
if add:
raise ValueError("Bad annotation in for seqs with 6T/As at the end")
- @attr(error69=True)
+ #@attr(error69=True)
def test_error69(self):
from mirtop.bam.filter import tune
v = tune("CTTATCAGATTGTATTGTAATT",
View it on GitLab: https://salsa.debian.org/med-team/mirtop/-/compare/2b436c9442e152c1346165ea0d0f48688c0b8b09...c0a2829c3f62e8bd1206c7ba6e01e9e4698d400f
--
View it on GitLab: https://salsa.debian.org/med-team/mirtop/-/compare/2b436c9442e152c1346165ea0d0f48688c0b8b09...c0a2829c3f62e8bd1206c7ba6e01e9e4698d400f
You're receiving this email because of your account on salsa.debian.org.
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://alioth-lists.debian.net/pipermail/debian-med-commit/attachments/20241012/a4c87dc0/attachment-0001.htm>
More information about the debian-med-commit
mailing list