From gitlab at salsa.debian.org Sun Jun 1 02:45:21 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Sun, 01 Jun 2025 01:45:21 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <683bb0b19b70c_3db3eeacc226231@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: 0c28dac2 by Andreas Tille at 2025-06-01T01:45:16+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,10 +1,10 @@ -Last-Update: Sat, 31 May 2025 13:42:04 +0000 +Last-Update: Sun, 01 Jun 2025 01:42:03 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- dicomscope | 29 | {imaging} | mrtrix3 | 17 | {imaging} | - oscar | 17 | {data,practice,tools} | + oscar | 17 | {data,tools,practice} | orthanc-gdcm | 14 | {imaging} | pixelmed | 14 | {imaging} | sight | 10 | {imaging} | @@ -32,22 +32,22 @@ Last-Update: Sat, 31 May 2025 13:42:04 +0000 libpal-java | 2 | {bio-dev} | pbseqlib | 2 | {bio-dev} | plasmidid | 2 | {covid-19,bio} | - python-seqcluster | 2 | {covid-19,bio-dev} | - beast-mcmc | 1 | {bio,bio-phylogeny} | + python-seqcluster | 2 | {bio-dev,covid-19} | + beast-mcmc | 1 | {bio-phylogeny,bio} | bitseq | 1 | {bio} | blimps | 1 | {bio} | brig | 1 | {bio} | - cufflinks | 1 | {cloud,bio} | + cufflinks | 1 | {bio,cloud} | dextractor | 1 | {bio,covid-19} | eegdev | 1 | {imaging-dev} | - embassy-domainatrix | 1 | {cloud,bio} | + embassy-domainatrix | 1 | {bio,cloud} | emboss-explorer | 1 | {bio} | fastml | 1 | {bio} | hinge | 1 | {bio} | htscodecs | 1 | {bio-dev,covid-19} | insighttoolkit5 | 1 | {imaging-dev} | ipig | 1 | {bio} | - jmodeltest | 1 | {bio,bio-phylogeny} | + jmodeltest | 1 | {bio-phylogeny,bio} | lamarc | 1 | {bio} | libbio-mage-utils-perl | 1 | {bio-dev} | libbiosoup-dev | 1 | {bio-dev} | @@ -62,17 +62,17 @@ Last-Update: Sat, 31 May 2025 13:42:04 +0000 libxdf | 1 | {imaging-dev} | mssstest | 1 | {tools} | opencfu | 1 | {laboratory} | - phyutility | 1 | {cloud,bio} | - proalign | 1 | {bio-phylogeny,bio} | + phyutility | 1 | {bio,cloud} | + proalign | 1 | {bio,bio-phylogeny} | rambo-k | 1 | {bio} | seq-gen | 1 | {bio} | sight | 1 | {imaging} | - spread-phy | 1 | {bio-phylogeny,bio} | + spread-phy | 1 | {bio,bio-phylogeny} | tracetuner | 1 | {bio} | treeview | 1 | {bio-phylogeny,bio} | vienna-rna | 1 | {bio,covid-19} | xdffileio | 1 | {imaging-dev} | - acedb | 0 | {cloud,bio} | + acedb | 0 | {bio,cloud} | bambamc | 0 | {bio-dev} | biojava4-live | 0 | {bio-dev} | biojava6-live | 0 | {bio-dev} | @@ -139,11 +139,11 @@ Last-Update: Sat, 31 May 2025 13:42:04 +0000 savvy | 0 | {bio-dev} | sbmltoolbox | 0 | {bio-dev} | sga | 0 | {bio} | - sibsim4 | 0 | {cloud,bio} | + sibsim4 | 0 | {bio,cloud} | sift | 0 | {bio} | sight | 0 | {imaging-dev} | skesa | 0 | {bio} | - smrtanalysis | 0 | {covid-19,bio} | + smrtanalysis | 0 | {bio,covid-19} | soapaligner | 0 | {bio} | soapsnp | 0 | {bio} | sprai | 0 | {bio} | @@ -151,10 +151,10 @@ Last-Update: Sat, 31 May 2025 13:42:04 +0000 suitename | 0 | {bio} | surankco | 0 | {bio} | surpyvor | 0 | {bio} | - thesias | 0 | {bio,covid-19} | - tophat-recondition | 0 | {bio,covid-19} | + thesias | 0 | {covid-19,bio} | + tophat-recondition | 0 | {covid-19,bio} | trace2dbest | 0 | {bio} | - varscan | 0 | {covid-19,bio} | + varscan | 0 | {bio,covid-19} | xxsds-dynamic | 0 | {bio-dev} | tipp | -1 | {covid-19,bio} | (181 rows) ===================================== debian-science-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Sat, 31 May 2025 13:42:08 +0000 +Last-Update: Sun, 01 Jun 2025 01:42:08 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- @@ -15,7 +15,7 @@ Last-Update: Sat, 31 May 2025 13:42:08 +0000 ppl | 35 | {numericalcomputation} | visidata | 35 | {datamanagement} | mbpoll | 33 | {simulations} | - fftw | 30 | {mathematics-dev,physics-dev,meteorology-dev} | + fftw | 30 | {meteorology-dev,physics-dev,mathematics-dev} | libm4ri | 30 | {mathematics-dev} | arduino-mk | 29 | {robotics} | flann | 28 | {mathematics-dev,engineering-dev} | @@ -31,7 +31,7 @@ Last-Update: Sat, 31 May 2025 13:42:08 +0000 bossa | 16 | {devices} | eccodes | 16 | {meteorology,meteorology-dev} | pyzo | 16 | {numericalcomputation} | - fftw | 15 | {meteorology-dev,mathematics-dev,physics-dev} | + fftw | 15 | {meteorology-dev,physics-dev,mathematics-dev} | gf2x | 15 | {mathematics-dev} | iml | 15 | {mathematics-dev} | libhomfly | 15 | {mathematics-dev} | @@ -48,13 +48,13 @@ Last-Update: Sat, 31 May 2025 13:42:08 +0000 matlab-support | 12 | {mathematics,numericalcomputation} | pcl | 12 | {robotics-dev} | ratpoints | 12 | {mathematics-dev} | - coinor-symphony | 10 | {logic,mathematics,numericalcomputation} | + coinor-symphony | 10 | {mathematics,numericalcomputation,logic} | feedgnuplot | 10 | {viewing} | guiqwt | 10 | {numericalcomputation,viewing} | picosat | 10 | {logic} | alberta | 9 | {engineering-dev} | geg | 9 | {viewing} | - lxi-tools | 9 | {engineering,dataacquisition} | + lxi-tools | 9 | {dataacquisition,engineering} | magics++ | 9 | {meteorology-dev} | ncl | 9 | {meteorology} | odc | 9 | {meteorology-dev} | @@ -64,9 +64,9 @@ Last-Update: Sat, 31 May 2025 13:42:08 +0000 refmac-dictionary | 8 | {highenergy-physics-dev,chemistry} | vdt | 8 | {mathematics-dev} | form | 7 | {mathematics} | - persalys | 7 | {engineering,statistics,mathematics} | + persalys | 7 | {mathematics,engineering,statistics} | python-cdo | 7 | {meteorology} | - python-escript | 7 | {numericalcomputation,simulations,engineering} | + python-escript | 7 | {numericalcomputation,engineering,simulations} | rubiks | 7 | {geometry,mathematics} | coda | 6 | {meteorology} | ucto | 6 | {linguistics} | @@ -79,14 +79,14 @@ Last-Update: Sat, 31 May 2025 13:42:08 +0000 libccp4 | 5 | {nanoscale-physics-dev} | metview | 5 | {meteorology} | opencascade | 5 | {simulations} | - persalys | 5 | {statistics,mathematics,engineering} | + persalys | 5 | {engineering,statistics,mathematics} | rheolef | 5 | {mathematics} | apophenia | 4 | {statistics} | auto-07p | 4 | {mathematics} | - debian-science | 4 | {economics,nanoscale-physics,machine-learning,physics,mathematics} | + debian-science | 4 | {mathematics,physics,machine-learning,nanoscale-physics,economics} | drslib | 4 | {meteorology} | emoslib | 4 | {meteorology-dev} | - getdp | 4 | {engineering,mathematics,simulations} | + getdp | 4 | {mathematics,simulations,engineering} | gsw | 4 | {meteorology} | hdf-eos5 | 4 | {meteorology-dev} | iapws | 4 | {meteorology} | @@ -96,14 +96,14 @@ Last-Update: Sat, 31 May 2025 13:42:08 +0000 qwtplot3d | 4 | {viewing-dev} | ros-vcstool | 4 | {robotics-dev} | silo-llnl | 4 | {engineering} | - toulbar2 | 4 | {logic,numericalcomputation,mathematics,physics} | + toulbar2 | 4 | {mathematics,logic,physics,numericalcomputation} | urdfdom-headers | 4 | {robotics-dev} | veccore | 4 | {mathematics-dev} | apertium-eval-translator | 3 | {linguistics} | cmor | 3 | {meteorology} | - code-saturne | 3 | {mathematics-dev,engineering-dev} | + code-saturne | 3 | {engineering-dev,mathematics-dev} | cylc-flow | 3 | {meteorology} | - debian-science | 3 | {physics,machine-learning,economics,nanoscale-physics} | + debian-science | 3 | {physics,economics,machine-learning,nanoscale-physics} | dimbl | 3 | {linguistics} | dune-functions | 3 | {mathematics-dev} | dune-localfunctions | 3 | {mathematics-dev} | @@ -126,7 +126,7 @@ Last-Update: Sat, 31 May 2025 13:42:08 +0000 vlfeat | 3 | {imageanalysis-dev} | asl | 2 | {physics-dev} | atlas-ecmwf | 2 | {meteorology-dev} | - coinmp | 2 | {logic,mathematics-dev,numericalcomputation} | + coinmp | 2 | {logic,numericalcomputation,mathematics-dev} | debian-science | 2 | {neuroscience-cognitive} | debian-science | 2 | {nanoscale-physics,statistics,economics,physics} | frog | 2 | {linguistics} | @@ -141,7 +141,7 @@ Last-Update: Sat, 31 May 2025 13:42:08 +0000 metkit | 2 | {meteorology-dev} | mpi4py-fft | 2 | {mathematics-dev} | mrmpi | 2 | {tools} | - ncrystal | 2 | {nanoscale-physics-dev,highenergy-physics-dev} | + ncrystal | 2 | {highenergy-physics-dev,nanoscale-physics-dev} | newmat | 2 | {mathematics-dev} | openstereogram | 2 | {tools} | polylib | 2 | {mathematics} | @@ -150,7 +150,7 @@ Last-Update: Sat, 31 May 2025 13:42:08 +0000 ros-ros-environment | 2 | {robotics-dev} | sagemath-database-conway-polynomials | 2 | {mathematics} | scram | 2 | {engineering} | - sdpb | 2 | {numericalcomputation,highenergy-physics} | + sdpb | 2 | {highenergy-physics,numericalcomputation} | silo-llnl | 2 | {engineering} | spaghetti | 2 | {geography} | syrthes | 2 | {engineering} | @@ -167,7 +167,7 @@ Last-Update: Sat, 31 May 2025 13:42:08 +0000 clipper | 1 | {nanoscale-physics-dev} | cmor | 1 | {meteorology-dev} | coda | 1 | {meteorology-dev} | - code-saturne | 1 | {engineering-dev,mathematics-dev} | + code-saturne | 1 | {mathematics-dev,engineering-dev} | coinor-bonmin | 1 | {mathematics} | debian-science | 1 | {nanoscale-physics-dev} | debian-science | 1 | {psychophysics} | @@ -190,8 +190,8 @@ Last-Update: Sat, 31 May 2025 13:42:08 +0000 libquantum | 1 | {numericalcomputation} | looptools | 1 | {highenergy-physics-dev} | looptools | 1 | {highenergy-physics} | - magma | 1 | {mathematics-dev,numericalcomputation} | - mmdb | 1 | {nanoscale-physics-dev,highenergy-physics-dev} | + magma | 1 | {numericalcomputation,mathematics-dev} | + mmdb | 1 | {highenergy-physics-dev,nanoscale-physics-dev} | mseed2sac | 1 | {dataacquisition-dev} | nrn-iv | 1 | {biology} | nrn-mod2c | 1 | {biology} | @@ -199,9 +199,9 @@ Last-Update: Sat, 31 May 2025 13:42:08 +0000 opengv | 1 | {geometry} | openmesh | 1 | {mathematics-dev} | sardana | 1 | {dataacquisition} | - schroedinger-coordgenlibs | 1 | {nanoscale-physics-dev,chemistry} | + schroedinger-coordgenlibs | 1 | {chemistry,nanoscale-physics-dev} | siscone | 1 | {highenergy-physics-dev} | - spfft | 1 | {mathematics-dev,nanoscale-physics-dev,physics-dev,meteorology-dev} | + spfft | 1 | {meteorology-dev,physics-dev,mathematics-dev,nanoscale-physics-dev} | ssm | 1 | {nanoscale-physics-dev} | tulip | 1 | {viewing-dev} | amgcl | 0 | {mathematics-dev} | @@ -213,7 +213,7 @@ Last-Update: Sat, 31 May 2025 13:42:08 +0000 apertium-urd | 0 | {linguistics} | apertium-urd-hin | 0 | {linguistics} | apriltag | 0 | {robotics-dev} | - calculix-ccx-test | 0 | {simulations,numericalcomputation,engineering} | + calculix-ccx-test | 0 | {simulations,engineering,numericalcomputation} | clhep | 0 | {highenergy-physics-dev} | coda | 0 | {meteorology-dev} | code-saturne | 0 | {engineering} | @@ -233,13 +233,13 @@ Last-Update: Sat, 31 May 2025 13:42:08 +0000 mbt | 0 | {linguistics} | mctc-lib | 0 | {nanoscale-physics-dev,highenergy-physics-dev} | meshsdfilter | 0 | {mathematics-dev} | - metis-edf | 0 | {engineering,numericalcomputation} | metis-edf | 0 | {engineering-dev} | + metis-edf | 0 | {numericalcomputation,engineering} | neartree | 0 | {mathematics-dev,numericalcomputation} | opengv | 0 | {geometry} | openigtlink | 0 | {robotics-dev} | psurface | 0 | {numericalcomputation} | - python-escript | 0 | {numericalcomputation,simulations,engineering} | + python-escript | 0 | {engineering,numericalcomputation,simulations} | python-opcodes | 0 | {tools} | qrupdate | 0 | {mathematics-dev} | quadrule | 0 | {mathematics-dev} | @@ -255,7 +255,7 @@ Last-Update: Sat, 31 May 2025 13:42:08 +0000 sagemath-database-polytopes | 0 | {mathematics} | schroedinger-maeparser | 0 | {chemistry,nanoscale-physics-dev} | siscone | 0 | {highenergy-physics-dev} | - slicot | 0 | {robotics-dev,engineering-dev} | + slicot | 0 | {engineering-dev,robotics-dev} | sparskit | 0 | {mathematics-dev} | ssm | 0 | {nanoscale-physics} | tachyon | 0 | {mathematics} | ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Sat, 31 May 2025 13:42:11 +0000 +Last-Update: Sun, 01 Jun 2025 01:42:11 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/0c28dac2b796170b89074b172572976883b3e5dd -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/0c28dac2b796170b89074b172572976883b3e5dd You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Sun Jun 1 14:43:37 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Sun, 01 Jun 2025 13:43:37 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <683c590994d1b_3db7e400278821@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: 7f9a1153 by Andreas Tille at 2025-06-01T13:43:30+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,10 +1,10 @@ -Last-Update: Sun, 01 Jun 2025 01:42:03 +0000 +Last-Update: Sun, 01 Jun 2025 13:42:03 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- - dicomscope | 29 | {imaging} | + dicomscope | 31 | {imaging} | mrtrix3 | 17 | {imaging} | - oscar | 17 | {data,tools,practice} | + oscar | 16 | {data,practice,tools} | orthanc-gdcm | 14 | {imaging} | pixelmed | 14 | {imaging} | sight | 10 | {imaging} | @@ -18,36 +18,35 @@ Last-Update: Sun, 01 Jun 2025 01:42:03 +0000 biojava-live | 7 | {bio-dev} | heudiconv | 7 | {imaging} | orthanc-postgresql | 7 | {imaging} | - jebl2 | 4 | {bio-dev} | + jebl2 | 5 | {bio-dev} | + bio-tradis | 4 | {bio,bio-dev} | ants | 3 | {imaging} | - bio-tradis | 3 | {bio,bio-dev} | getdata | 3 | {bio} | pbcopper | 3 | {bio-dev} | piler | 3 | {bio} | + plasmidid | 3 | {covid-19,bio} | staden | 3 | {bio} | + beast-mcmc | 2 | {bio,bio-phylogeny} | cmtk | 2 | {imaging} | elastix | 2 | {imaging} | libgenome | 2 | {bio-dev} | libminc | 2 | {imaging-dev} | libpal-java | 2 | {bio-dev} | pbseqlib | 2 | {bio-dev} | - plasmidid | 2 | {covid-19,bio} | - python-seqcluster | 2 | {bio-dev,covid-19} | - beast-mcmc | 1 | {bio-phylogeny,bio} | + python-seqcluster | 2 | {covid-19,bio-dev} | + tracetuner | 2 | {bio} | bitseq | 1 | {bio} | blimps | 1 | {bio} | brig | 1 | {bio} | - cufflinks | 1 | {bio,cloud} | - dextractor | 1 | {bio,covid-19} | + cufflinks | 1 | {cloud,bio} | eegdev | 1 | {imaging-dev} | - embassy-domainatrix | 1 | {bio,cloud} | emboss-explorer | 1 | {bio} | fastml | 1 | {bio} | hinge | 1 | {bio} | htscodecs | 1 | {bio-dev,covid-19} | insighttoolkit5 | 1 | {imaging-dev} | ipig | 1 | {bio} | - jmodeltest | 1 | {bio-phylogeny,bio} | + jmodeltest | 1 | {bio,bio-phylogeny} | lamarc | 1 | {bio} | libbio-mage-utils-perl | 1 | {bio-dev} | libbiosoup-dev | 1 | {bio-dev} | @@ -62,17 +61,20 @@ Last-Update: Sun, 01 Jun 2025 01:42:03 +0000 libxdf | 1 | {imaging-dev} | mssstest | 1 | {tools} | opencfu | 1 | {laboratory} | - phyutility | 1 | {bio,cloud} | - proalign | 1 | {bio,bio-phylogeny} | + phyutility | 1 | {cloud,bio} | + proalign | 1 | {bio-phylogeny,bio} | rambo-k | 1 | {bio} | seq-gen | 1 | {bio} | + sga | 1 | {bio} | sight | 1 | {imaging} | - spread-phy | 1 | {bio,bio-phylogeny} | - tracetuner | 1 | {bio} | + spread-phy | 1 | {bio-phylogeny,bio} | + surankco | 1 | {bio} | + surpyvor | 1 | {bio} | + thesias | 1 | {bio,covid-19} | treeview | 1 | {bio-phylogeny,bio} | vienna-rna | 1 | {bio,covid-19} | xdffileio | 1 | {imaging-dev} | - acedb | 0 | {bio,cloud} | + acedb | 0 | {cloud,bio} | bambamc | 0 | {bio-dev} | biojava4-live | 0 | {bio-dev} | biojava6-live | 0 | {bio-dev} | @@ -81,6 +83,8 @@ Last-Update: Sun, 01 Jun 2025 01:42:03 +0000 capsule-maven-nextflow | 0 | {bio-dev} | ctffind | 0 | {bio} | ctn | 0 | {imaging-dev} | + dextractor | 0 | {bio,covid-19} | + embassy-domainatrix | 0 | {cloud,bio} | embassy-domalign | 0 | {bio,cloud} | embassy-domsearch | 0 | {cloud,bio} | fis-gtm | 0 | {his} | @@ -138,23 +142,19 @@ Last-Update: Sun, 01 Jun 2025 01:42:03 +0000 savvy | 0 | {bio} | savvy | 0 | {bio-dev} | sbmltoolbox | 0 | {bio-dev} | - sga | 0 | {bio} | - sibsim4 | 0 | {bio,cloud} | + sibsim4 | 0 | {cloud,bio} | sift | 0 | {bio} | sight | 0 | {imaging-dev} | skesa | 0 | {bio} | - smrtanalysis | 0 | {bio,covid-19} | + smrtanalysis | 0 | {covid-19,bio} | soapaligner | 0 | {bio} | soapsnp | 0 | {bio} | sprai | 0 | {bio} | srf | 0 | {bio-dev} | suitename | 0 | {bio} | - surankco | 0 | {bio} | - surpyvor | 0 | {bio} | - thesias | 0 | {covid-19,bio} | - tophat-recondition | 0 | {covid-19,bio} | + tophat-recondition | 0 | {bio,covid-19} | trace2dbest | 0 | {bio} | - varscan | 0 | {bio,covid-19} | + varscan | 0 | {covid-19,bio} | xxsds-dynamic | 0 | {bio-dev} | tipp | -1 | {covid-19,bio} | (181 rows) ===================================== debian-science-tests.txt ===================================== @@ -1,77 +1,78 @@ -Last-Update: Sun, 01 Jun 2025 01:42:08 +0000 +Last-Update: Sun, 01 Jun 2025 13:42:07 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- - gts | 4893 | {viewing} | - nltk | 4691 | {linguistics} | - opencascade | 612 | {simulations} | - spacenavd | 230 | {tools} | - open-coarrays | 191 | {meteorology-dev} | - armadillo | 187 | {mathematics-dev} | - arpack | 106 | {mathematics-dev} | + gts | 4896 | {viewing} | + nltk | 4685 | {linguistics} | + opencascade | 618 | {simulations} | + spacenavd | 228 | {tools} | + open-coarrays | 194 | {meteorology-dev} | + armadillo | 186 | {mathematics-dev} | + arpack | 105 | {mathematics-dev} | ntl | 49 | {mathematics-dev} | - scalapack | 41 | {nanoscale-physics-dev} | - imview | 38 | {viewing} | - ppl | 35 | {numericalcomputation} | - visidata | 35 | {datamanagement} | - mbpoll | 33 | {simulations} | - fftw | 30 | {meteorology-dev,physics-dev,mathematics-dev} | + scalapack | 42 | {nanoscale-physics-dev} | + mbpoll | 36 | {simulations} | + visidata | 36 | {datamanagement} | + imview | 35 | {viewing} | + ppl | 33 | {numericalcomputation} | + fftw | 30 | {mathematics-dev,physics-dev,meteorology-dev} | libm4ri | 30 | {mathematics-dev} | arduino-mk | 29 | {robotics} | flann | 28 | {mathematics-dev,engineering-dev} | - cliquer | 27 | {mathematics} | grads | 27 | {meteorology} | + cliquer | 26 | {mathematics} | + flintqs | 26 | {mathematics} | libmatio | 26 | {mathematics-dev} | xygrib | 26 | {meteorology} | - flintqs | 25 | {mathematics} | setzer | 23 | {typesetting} | sat4j | 21 | {logic} | cliquer | 18 | {mathematics-dev} | lrcalc | 18 | {mathematics-dev} | - bossa | 16 | {devices} | eccodes | 16 | {meteorology,meteorology-dev} | pyzo | 16 | {numericalcomputation} | - fftw | 15 | {meteorology-dev,physics-dev,mathematics-dev} | + bossa | 15 | {devices} | + fftw | 15 | {meteorology-dev,mathematics-dev,physics-dev} | gf2x | 15 | {mathematics-dev} | + gts | 15 | {viewing-dev} | iml | 15 | {mathematics-dev} | libhomfly | 15 | {mathematics-dev} | dune-uggrid | 14 | {mathematics-dev} | eccodes | 14 | {meteorology-dev} | - gts | 14 | {viewing-dev} | libitpp | 14 | {mathematics-dev,engineering-dev} | libm4rie | 14 | {mathematics-dev} | sketch | 14 | {typesetting} | teem | 14 | {imageanalysis} | libzn-poly | 13 | {mathematics-dev} | - metar | 13 | {meteorology} | feff85exafs | 12 | {chemistry} | matlab-support | 12 | {mathematics,numericalcomputation} | + metar | 12 | {meteorology} | pcl | 12 | {robotics-dev} | ratpoints | 12 | {mathematics-dev} | - coinor-symphony | 10 | {mathematics,numericalcomputation,logic} | + guiqwt | 11 | {numericalcomputation,viewing} | + picosat | 11 | {logic} | + coinor-symphony | 10 | {logic,mathematics,numericalcomputation} | feedgnuplot | 10 | {viewing} | - guiqwt | 10 | {numericalcomputation,viewing} | - picosat | 10 | {logic} | + lxi-tools | 10 | {engineering,dataacquisition} | alberta | 9 | {engineering-dev} | geg | 9 | {viewing} | - lxi-tools | 9 | {dataacquisition,engineering} | magics++ | 9 | {meteorology-dev} | ncl | 9 | {meteorology} | odc | 9 | {meteorology-dev} | odc | 9 | {meteorology} | + refmac-dictionary | 9 | {highenergy-physics-dev,chemistry} | ros-rosconsole | 9 | {robotics-dev} | dxsamples | 8 | {nanoscale-physics} | - refmac-dictionary | 8 | {highenergy-physics-dev,chemistry} | + form | 8 | {mathematics} | + python-cdo | 8 | {meteorology} | vdt | 8 | {mathematics-dev} | - form | 7 | {mathematics} | - persalys | 7 | {mathematics,engineering,statistics} | - python-cdo | 7 | {meteorology} | - python-escript | 7 | {numericalcomputation,engineering,simulations} | rubiks | 7 | {geometry,mathematics} | coda | 6 | {meteorology} | + persalys | 6 | {engineering,statistics,mathematics} | + python-escript | 6 | {numericalcomputation,simulations,engineering} | ucto | 6 | {linguistics} | uctodata | 6 | {linguistics} | atlas-ecmwf | 5 | {meteorology} | + auto-07p | 5 | {mathematics} | cld2 | 5 | {linguistics} | coda | 5 | {meteorology-dev} | etsf-io | 5 | {physics,nanoscale-physics} | @@ -79,31 +80,31 @@ Last-Update: Sun, 01 Jun 2025 01:42:08 +0000 libccp4 | 5 | {nanoscale-physics-dev} | metview | 5 | {meteorology} | opencascade | 5 | {simulations} | - persalys | 5 | {engineering,statistics,mathematics} | rheolef | 5 | {mathematics} | apophenia | 4 | {statistics} | - auto-07p | 4 | {mathematics} | - debian-science | 4 | {mathematics,physics,machine-learning,nanoscale-physics,economics} | + debian-science | 4 | {economics,nanoscale-physics,machine-learning,physics,mathematics} | drslib | 4 | {meteorology} | emoslib | 4 | {meteorology-dev} | - getdp | 4 | {mathematics,simulations,engineering} | + getdp | 4 | {engineering,mathematics,simulations} | gsw | 4 | {meteorology} | hdf-eos5 | 4 | {meteorology-dev} | iapws | 4 | {meteorology} | irstlm | 4 | {linguistics} | libgctp | 4 | {meteorology-dev} | + muparser | 4 | {mathematics-dev} | + persalys | 4 | {statistics,mathematics,engineering} | psurface | 4 | {numericalcomputation} | qwtplot3d | 4 | {viewing-dev} | ros-vcstool | 4 | {robotics-dev} | silo-llnl | 4 | {engineering} | - toulbar2 | 4 | {mathematics,logic,physics,numericalcomputation} | + toulbar2 | 4 | {logic,numericalcomputation,mathematics,physics} | urdfdom-headers | 4 | {robotics-dev} | veccore | 4 | {mathematics-dev} | apertium-eval-translator | 3 | {linguistics} | cmor | 3 | {meteorology} | - code-saturne | 3 | {engineering-dev,mathematics-dev} | + code-saturne | 3 | {mathematics-dev,engineering-dev} | cylc-flow | 3 | {meteorology} | - debian-science | 3 | {physics,economics,machine-learning,nanoscale-physics} | + debian-science | 3 | {physics,machine-learning,economics,nanoscale-physics} | dimbl | 3 | {linguistics} | dune-functions | 3 | {mathematics-dev} | dune-localfunctions | 3 | {mathematics-dev} | @@ -118,7 +119,6 @@ Last-Update: Sun, 01 Jun 2025 01:42:08 +0000 libmatheval | 3 | {mathematics} | libxsmm | 3 | {mathematics-dev} | metkit | 3 | {meteorology} | - muparser | 3 | {mathematics-dev} | ncl | 3 | {meteorology-dev} | sac2mseed | 3 | {geography} | silo-llnl | 3 | {engineering-dev} | @@ -126,9 +126,10 @@ Last-Update: Sun, 01 Jun 2025 01:42:08 +0000 vlfeat | 3 | {imageanalysis-dev} | asl | 2 | {physics-dev} | atlas-ecmwf | 2 | {meteorology-dev} | - coinmp | 2 | {logic,numericalcomputation,mathematics-dev} | - debian-science | 2 | {neuroscience-cognitive} | + code-saturne | 2 | {engineering-dev,mathematics-dev} | + coinmp | 2 | {logic,mathematics-dev,numericalcomputation} | debian-science | 2 | {nanoscale-physics,statistics,economics,physics} | + debian-science | 2 | {neuroscience-cognitive} | frog | 2 | {linguistics} | gadap | 2 | {meteorology-dev} | ipe-tools | 2 | {typesetting} | @@ -141,7 +142,7 @@ Last-Update: Sun, 01 Jun 2025 01:42:08 +0000 metkit | 2 | {meteorology-dev} | mpi4py-fft | 2 | {mathematics-dev} | mrmpi | 2 | {tools} | - ncrystal | 2 | {highenergy-physics-dev,nanoscale-physics-dev} | + ncrystal | 2 | {nanoscale-physics-dev,highenergy-physics-dev} | newmat | 2 | {mathematics-dev} | openstereogram | 2 | {tools} | polylib | 2 | {mathematics} | @@ -149,8 +150,9 @@ Last-Update: Sun, 01 Jun 2025 01:42:08 +0000 qd | 2 | {mathematics-dev} | ros-ros-environment | 2 | {robotics-dev} | sagemath-database-conway-polynomials | 2 | {mathematics} | + sardana | 2 | {dataacquisition} | scram | 2 | {engineering} | - sdpb | 2 | {highenergy-physics,numericalcomputation} | + sdpb | 2 | {numericalcomputation,highenergy-physics} | silo-llnl | 2 | {engineering} | spaghetti | 2 | {geography} | syrthes | 2 | {engineering} | @@ -167,19 +169,17 @@ Last-Update: Sun, 01 Jun 2025 01:42:08 +0000 clipper | 1 | {nanoscale-physics-dev} | cmor | 1 | {meteorology-dev} | coda | 1 | {meteorology-dev} | - code-saturne | 1 | {mathematics-dev,engineering-dev} | coinor-bonmin | 1 | {mathematics} | - debian-science | 1 | {nanoscale-physics-dev} | - debian-science | 1 | {psychophysics} | - debian-science | 1 | {electrophysiology} | + debian-science | 1 | {neuroscience-cognitive,machine-learning} | debian-science | 1 | {economics} | + debian-science | 1 | {electrophysiology} | debian-science | 1 | {tools} | - debian-science | 1 | {neuroscience-cognitive,machine-learning} | + debian-science | 1 | {nanoscale-physics-dev} | + debian-science | 1 | {psychophysics} | fastjet | 1 | {highenergy-physics-dev} | fpzip | 1 | {meteorology-dev} | frogdata | 1 | {linguistics} | hepmc3 | 1 | {nanoscale-physics-dev,highenergy-physics-dev} | - ipe-tools | 1 | {typesetting} | jeuclid | 1 | {viewing,typesetting} | libcgns | 1 | {engineering} | libcvd | 1 | {imageanalysis} | @@ -188,20 +188,19 @@ Last-Update: Sun, 01 Jun 2025 01:42:08 +0000 liblxi | 1 | {engineering-dev,dataacquisition-dev} | liborigin2 | 1 | {viewing-dev} | libquantum | 1 | {numericalcomputation} | - looptools | 1 | {highenergy-physics-dev} | looptools | 1 | {highenergy-physics} | - magma | 1 | {numericalcomputation,mathematics-dev} | - mmdb | 1 | {highenergy-physics-dev,nanoscale-physics-dev} | + looptools | 1 | {highenergy-physics-dev} | + magma | 1 | {mathematics-dev,numericalcomputation} | + mmdb | 1 | {nanoscale-physics-dev,highenergy-physics-dev} | mseed2sac | 1 | {dataacquisition-dev} | nrn-iv | 1 | {biology} | nrn-mod2c | 1 | {biology} | openctm | 1 | {physics-dev} | opengv | 1 | {geometry} | openmesh | 1 | {mathematics-dev} | - sardana | 1 | {dataacquisition} | - schroedinger-coordgenlibs | 1 | {chemistry,nanoscale-physics-dev} | + schroedinger-coordgenlibs | 1 | {nanoscale-physics-dev,chemistry} | siscone | 1 | {highenergy-physics-dev} | - spfft | 1 | {meteorology-dev,physics-dev,mathematics-dev,nanoscale-physics-dev} | + spfft | 1 | {mathematics-dev,nanoscale-physics-dev,physics-dev,meteorology-dev} | ssm | 1 | {nanoscale-physics-dev} | tulip | 1 | {viewing-dev} | amgcl | 0 | {mathematics-dev} | @@ -213,7 +212,7 @@ Last-Update: Sun, 01 Jun 2025 01:42:08 +0000 apertium-urd | 0 | {linguistics} | apertium-urd-hin | 0 | {linguistics} | apriltag | 0 | {robotics-dev} | - calculix-ccx-test | 0 | {simulations,engineering,numericalcomputation} | + calculix-ccx-test | 0 | {simulations,numericalcomputation,engineering} | clhep | 0 | {highenergy-physics-dev} | coda | 0 | {meteorology-dev} | code-saturne | 0 | {engineering} | @@ -234,12 +233,12 @@ Last-Update: Sun, 01 Jun 2025 01:42:08 +0000 mctc-lib | 0 | {nanoscale-physics-dev,highenergy-physics-dev} | meshsdfilter | 0 | {mathematics-dev} | metis-edf | 0 | {engineering-dev} | - metis-edf | 0 | {numericalcomputation,engineering} | + metis-edf | 0 | {engineering,numericalcomputation} | neartree | 0 | {mathematics-dev,numericalcomputation} | opengv | 0 | {geometry} | openigtlink | 0 | {robotics-dev} | psurface | 0 | {numericalcomputation} | - python-escript | 0 | {engineering,numericalcomputation,simulations} | + python-escript | 0 | {numericalcomputation,simulations,engineering} | python-opcodes | 0 | {tools} | qrupdate | 0 | {mathematics-dev} | quadrule | 0 | {mathematics-dev} | @@ -255,7 +254,7 @@ Last-Update: Sun, 01 Jun 2025 01:42:08 +0000 sagemath-database-polytopes | 0 | {mathematics} | schroedinger-maeparser | 0 | {chemistry,nanoscale-physics-dev} | siscone | 0 | {highenergy-physics-dev} | - slicot | 0 | {engineering-dev,robotics-dev} | + slicot | 0 | {robotics-dev,engineering-dev} | sparskit | 0 | {mathematics-dev} | ssm | 0 | {nanoscale-physics} | tachyon | 0 | {mathematics} | @@ -270,5 +269,5 @@ Last-Update: Sun, 01 Jun 2025 01:42:08 +0000 virtuoso-opensource | 0 | {datamanagement} | visp-images | 0 | {robotics-dev} | libelas | -1 | {robotics-dev} | -(298 rows) +(297 rows) ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,138 +1,137 @@ -Last-Update: Sun, 01 Jun 2025 01:42:11 +0000 +Last-Update: Sun, 01 Jun 2025 13:42:11 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- - mpmath | 10220 | - python-repoze.lru | 6990 | - netifaces | 5140 | - ghp-import | 4648 | - python-lunr | 4638 | - python-babel | 4269 | - sortedcontainers | 3836 | - python-babel | 3718 | - aiosignal | 2938 | - hyperlink | 2158 | - python-notify2 | 2025 | - humanfriendly | 1919 | - referencing | 1792 | + mpmath | 10244 | + python-repoze.lru | 7001 | + netifaces | 5156 | + ghp-import | 4642 | + python-lunr | 4632 | + python-babel | 4259 | + sortedcontainers | 3833 | + python-babel | 3713 | + aiosignal | 2935 | + hyperlink | 2173 | + python-notify2 | 2030 | + humanfriendly | 1918 | + referencing | 1798 | python-mysqldb | 1515 | - python-pandocfilters | 1445 | - python-gssapi | 1405 | - python-invoke | 1403 | - python-hyperframe | 1352 | - websocket-client | 1323 | - python-hpack | 1149 | - python-rsa | 1136 | - pdfarranger | 1025 | - menulibre | 952 | - python-linux-procfs | 932 | - python-zopfli | 899 | - python-geoip | 893 | - autopep8 | 862 | - python-webob | 849 | - pytoolconfig | 775 | - firmware-microbit-micropython | 763 | - powerline | 757 | - powerline | 728 | - powerline | 722 | - kazam | 691 | - u-msgpack-python | 628 | - gaupol | 557 | - dockerpty | 523 | - asn1crypto | 507 | - python-gevent | 507 | - python-et-xmlfile | 483 | - catfish | 438 | - python-ewmh | 430 | - python-requests-oauthlib | 409 | - python-toml | 380 | - spf-engine | 343 | + python-pandocfilters | 1436 | + python-gssapi | 1408 | + python-invoke | 1406 | + python-hyperframe | 1349 | + websocket-client | 1326 | + python-hpack | 1147 | + python-rsa | 1137 | + pdfarranger | 1013 | + menulibre | 954 | + python-linux-procfs | 937 | + python-zopfli | 914 | + python-geoip | 891 | + autopep8 | 863 | + python-webob | 844 | + pytoolconfig | 779 | + firmware-microbit-micropython | 766 | + powerline | 752 | + powerline | 732 | + powerline | 726 | + kazam | 697 | + u-msgpack-python | 624 | + gaupol | 559 | + dockerpty | 526 | + asn1crypto | 513 | + python-gevent | 511 | + python-et-xmlfile | 488 | + catfish | 436 | + python-ewmh | 433 | + python-requests-oauthlib | 410 | + python-toml | 381 | + spf-engine | 341 | python-ntlm-auth | 324 | - spf-engine | 297 | - django-stronghold | 256 | - pypdf2 | 245 | - cairocffi | 220 | - python-ldap3 | 214 | - python-mimeparse | 197 | - python-hidapi | 174 | - python-smmap | 167 | - httpie | 162 | + spf-engine | 293 | + django-stronghold | 262 | + pypdf2 | 241 | + cairocffi | 223 | + python-ldap3 | 218 | + python-mimeparse | 195 | + python-hidapi | 172 | + python-smmap | 166 | + httpie | 159 | autokey | 151 | - smem | 149 | - kivy | 127 | - python-anyjson | 126 | - python-aiostream | 119 | - smartypants | 113 | + smem | 148 | + python-anyjson | 133 | + kivy | 128 | + python-aiostream | 118 | + smartypants | 115 | mypaint | 109 | python-pyu2f | 108 | - timekpr-next | 103 | - nodeenv | 102 | + nodeenv | 106 | python-click-repl | 101 | - lollypop | 100 | - pacparser | 97 | - mugshot | 96 | - pymacaroons | 92 | - python-consul | 90 | - pymediainfo | 87 | - python-colour | 87 | - pssh | 84 | - python-rfc6555 | 77 | - python-i3ipc | 71 | - python-pykka | 67 | + timekpr-next | 101 | + mugshot | 99 | + lollypop | 98 | + pacparser | 98 | + python-consul | 92 | + python-colour | 91 | + pymediainfo | 90 | + pymacaroons | 89 | + pssh | 83 | + python-rfc6555 | 78 | + python-i3ipc | 72 | + python-pykka | 68 | pywavelets | 67 | - weasyprint | 66 | - numpy-stl | 64 | - mitmproxy | 63 | - ueberzug | 59 | - fabric | 58 | - python-uritools | 57 | + numpy-stl | 65 | + weasyprint | 65 | + mitmproxy | 62 | + ueberzug | 61 | + fabric | 59 | + python-scp | 56 | + python-uritools | 56 | itstool | 54 | - python-scp | 53 | - mysql-connector-python | 50 | - khard | 49 | - show-in-file-manager | 49 | + show-in-file-manager | 52 | + mysql-connector-python | 51 | blockdiag | 47 | + khard | 47 | python-looseversion | 47 | - trac | 46 | - pyquery | 43 | - hatchling | 42 | - sshtunnel | 42 | - membernator | 41 | - pyenv | 40 | - persepolis | 39 | - certipy | 37 | - pamela | 37 | - jupyterhub | 36 | - pylibmc | 36 | + trac | 47 | + sshtunnel | 43 | + membernator | 42 | + pyquery | 42 | + hatchling | 41 | + pyenv | 39 | + certipy | 38 | + pamela | 38 | + jupyterhub | 37 | + persepolis | 37 | + pylibmc | 37 | powerline-gitstatus | 34 | - pymacs | 32 | + pymacs | 33 | + python-pysol-cards | 32 | pssh | 31 | - python-stdnum | 31 | dkimpy-milter | 30 | - python-pysol-cards | 30 | python-scrypt | 30 | + python-args | 29 | python-statsd | 29 | seqdiag | 29 | - python-args | 28 | + pdfposter | 28 | sphinxcontrib-blockdiag | 28 | sphinxcontrib-seqdiag | 27 | - backoff | 26 | - pdfposter | 25 | + typogrify | 26 | + video-downloader | 26 | + backoff | 25 | sphinx-inline-tabs | 25 | - video-downloader | 25 | + webpy | 25 | + python-clint | 24 | rst2pdf | 24 | - typogrify | 24 | - webpy | 24 | - python-clint | 23 | flask-principal | 22 | nwdiag | 22 | - python-fire | 22 | ruff | 22 | cppman | 21 | depthcharge-tools | 21 | - python-translationstring | 21 | fabric | 20 | + python-fire | 20 | python-sdnotify | 20 | + python-translationstring | 20 | python-zstd | 20 | actdiag | 19 | alot | 19 | @@ -141,99 +140,99 @@ Last-Update: Sun, 01 Jun 2025 01:42:11 +0000 spf-engine | 19 | webtest | 19 | nwg-displays | 18 | - python-hupper | 18 | + python-simpy | 18 | sphinxcontrib-actdiag | 18 | sphinxcontrib-log-cabinet | 18 | subliminal | 18 | - django-environ | 17 | gtextfsm | 17 | + python-hupper | 17 | python-priority | 17 | - python-simpy | 17 | social-auth-core | 17 | sphinxcontrib-nwdiag | 17 | subliminal | 17 | + django-environ | 16 | + mistune0 | 16 | python-inotify | 16 | - mistune0 | 15 | python-dbussy | 15 | + python-demjson | 15 | python-kyotocabinet | 15 | + python-pyalsa | 15 | python-pysubs2 | 15 | policyd-rate-limit | 14 | - python-demjson | 14 | python-pem | 14 | + python-pyrss2gen | 14 | python-xtermcolor | 14 | ansi | 13 | notebook-shim | 13 | pykwalify | 13 | + pyp | 13 | python-crcelk | 13 | python-ethtool | 13 | - python-pyalsa | 13 | - python-pyrss2gen | 13 | autotiling | 12 | gmplot | 12 | junos-eznc | 12 | - pyp | 12 | + python-slip10 | 12 | txt2tags | 12 | unearth | 12 | + beancount | 11 | btchip-python | 11 | pdm | 11 | pwntools | 11 | python-pyscss | 11 | - python-slip10 | 11 | - beancount | 10 | django-auditlog | 10 | + jschema-to-python | 10 | python-aiohttp-security | 10 | - python-digitalocean | 10 | python-parse-type | 10 | + python-sarif-python-om | 10 | speaklater | 10 | traittypes | 10 | django-sass | 9 | drf-yasg-nonfree | 9 | flask-security | 9 | - jschema-to-python | 9 | pylint-common | 9 | pytest-runner | 9 | + python-digitalocean | 9 | python-drf-spectacular-sidecar-nonfree | 9 | python-pyld | 9 | - python-sarif-python-om | 9 | todoman | 9 | trac-wysiwyg | 9 | tuna | 9 | + debiancontributors | 8 | flask-paranoid | 8 | flask-session | 8 | + httpcode | 8 | pybik | 8 | pydrive2 | 8 | pytest-django | 8 | python-envs | 8 | python-overpy | 8 | + python-pyaml-env | 8 | slimit | 8 | clustershell | 7 | easyprocess | 7 | - httpcode | 7 | mercurial-evolve | 7 | pytaglib | 7 | - python-pyaml-env | 7 | + python-openstep-plist | 7 | python-versioneer | 7 | + python-xdo | 7 | sphinx-intl | 7 | beancount | 6 | - debiancontributors | 6 | django-model-utils | 6 | hachoir | 6 | kconfiglib | 6 | kivy | 6 | + micropython-mpremote | 6 | + mypy-protobuf | 6 | python-ansicolors | 6 | - python-openstep-plist | 6 | - python-xdo | 6 | + python-numpysane | 6 | ruff | 6 | - drf-extensions | 5 | flufl.testing | 5 | graphql-relay | 5 | imap-tools | 5 | librouteros | 5 | - micropython-mpremote | 5 | - mypy-protobuf | 5 | python-biplist | 5 | python-dirq | 5 | - python-numpysane | 5 | + python-jpype | 5 | python-pgmagick | 5 | python-srp | 5 | securestring | 5 | @@ -243,6 +242,7 @@ Last-Update: Sun, 01 Jun 2025 01:42:11 +0000 django-jinja | 4 | django-paintstore | 4 | django-pglocks | 4 | + drf-extensions | 4 | drf-haystack | 4 | etm | 4 | htmlmin | 4 | @@ -252,15 +252,13 @@ Last-Update: Sun, 01 Jun 2025 01:42:11 +0000 pyjokes | 4 | pynliner | 4 | pytest-expect | 4 | + python3-onelogin-saml2 | 4 | python-dbus-next | 4 | - python-jpype | 4 | python-networkmanager | 4 | python-simpy | 4 | - s3ql | 4 | slimit | 4 | testrepository | 4 | trac-accountmanager | 4 | - voltron | 4 | west | 4 | azote | 3 | backupchecker | 3 | @@ -273,7 +271,7 @@ Last-Update: Sun, 01 Jun 2025 01:42:11 +0000 django-xmlrpc | 3 | extension-helpers | 3 | flask-api | 3 | - humanfriendly | 3 | + jpylyzer | 3 | numpy-stl | 3 | orsopy | 3 | proglog | 3 | @@ -281,21 +279,24 @@ Last-Update: Sun, 01 Jun 2025 01:42:11 +0000 pyfltk | 3 | pyjunitxml | 3 | pyprind | 3 | - python3-onelogin-saml2 | 3 | python-cookies | 3 | python-deepmerge | 3 | python-django-contact-form | 3 | python-django-registration | 3 | python-dynaconf | 3 | + python-gnuplotlib | 3 | python-ipfix | 3 | python-markuppy | 3 | python-netfilterqueue | 3 | + requests-aws | 3 | + s3ql | 3 | smem | 3 | sphinx-markdown-tables | 3 | trac-xmlrpc | 3 | utidylib | 3 | vcversioner | 3 | vf1 | 3 | + voltron | 3 | zzzeeksphinx | 3 | aiomysql | 2 | brebis | 2 | @@ -311,7 +312,7 @@ Last-Update: Sun, 01 Jun 2025 01:42:11 +0000 flask-mongoengine | 2 | fypp | 2 | gtkman | 2 | - jpylyzer | 2 | + humanfriendly | 2 | jsonrpclib-pelix | 2 | jupyter-sphinx | 2 | korean-lunar-calendar | 2 | @@ -324,19 +325,18 @@ Last-Update: Sun, 01 Jun 2025 01:42:11 +0000 pypass | 2 | python-bitbucket-api | 2 | python-bottle-sqlite | 2 | + python-btrees | 2 | python-commentjson | 2 | python-django-casclient | 2 | python-django-push-notifications | 2 | python-dnsq | 2 | python-funcy | 2 | - python-gnuplotlib | 2 | python-halo | 2 | python-libguess | 2 | python-py-zipkin | 2 | python-qtpynodeeditor | 2 | python-text-unidecode | 2 | redis-py-cluster | 2 | - requests-aws | 2 | sphinx-paramlinks | 2 | sphinxtesters | 2 | vncdotool | 2 | @@ -373,12 +373,12 @@ Last-Update: Sun, 01 Jun 2025 01:42:11 +0000 power | 1 | pydle | 1 | pynag | 1 | + pyroma | 1 | pysequoia | 1 | pyssim | 1 | python-aio-pika | 1 | python-banal | 1 | python-bottle-cork | 1 | - python-btrees | 1 | python-chartkick | 1 | python-dataset | 1 | python-ephemeral-port-reserve | 1 | @@ -387,7 +387,6 @@ Last-Update: Sun, 01 Jun 2025 01:42:11 +0000 python-getdns | 1 | python-gfloat | 1 | python-kanboard | 1 | - python-meld3 | 1 | python-netfilter | 1 | python-noise | 1 | python-openid-cla | 1 | @@ -495,7 +494,6 @@ Last-Update: Sun, 01 Jun 2025 01:42:11 +0000 pyment | 0 | py-nextbusnext | 0 | pyrad | 0 | - pyroma | 0 | pyssim | 0 | python3-simpleobsws | 0 | python-aiohttp-security | 0 | @@ -538,6 +536,7 @@ Last-Update: Sun, 01 Jun 2025 01:42:11 +0000 python-lunr | 0 | python-makefun | 0 | python-markdown-rundoc | 0 | + python-meld3 | 0 | python-netsnmpagent | 0 | python-noseofyeti | 0 | python-nubia | 0 | @@ -558,7 +557,6 @@ Last-Update: Sun, 01 Jun 2025 01:42:11 +0000 python-simpy | 0 | python-socketpool | 0 | python-sphinx-examples | 0 | - python-stdnum | 0 | python-tatsu | 0 | python-webdavclient | 0 | python-webob | 0 | @@ -596,5 +594,5 @@ Last-Update: Sun, 01 Jun 2025 01:42:11 +0000 sphinxcontrib-emojicodes | -1 | symmetrize | -1 | trac-tickettemplate | -1 | -(609 rows) +(607 rows) View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/7f9a11536449d9bcd18e5d4125d883008f27af0c -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/7f9a11536449d9bcd18e5d4125d883008f27af0c You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Mon Jun 2 02:43:17 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Mon, 02 Jun 2025 01:43:17 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <683d01b5127cf_3db1d4acf03822f9@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: c1b38ca3 by Andreas Tille at 2025-06-02T01:43:13+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Sun, 01 Jun 2025 13:42:03 +0000 +Last-Update: Mon, 02 Jun 2025 01:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- ===================================== debian-science-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Sun, 01 Jun 2025 13:42:07 +0000 +Last-Update: Mon, 02 Jun 2025 01:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Sun, 01 Jun 2025 13:42:11 +0000 +Last-Update: Mon, 02 Jun 2025 01:42:05 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/c1b38ca3393e72b1c966983a2305f348b64b10d0 -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/c1b38ca3393e72b1c966983a2305f348b64b10d0 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Mon Jun 2 14:43:29 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Mon, 02 Jun 2025 13:43:29 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <683daa8153d93_3db22161a850332c@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: 6bee709e by Andreas Tille at 2025-06-02T13:43:22+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,23 +1,23 @@ -Last-Update: Mon, 02 Jun 2025 01:42:04 +0000 +Last-Update: Mon, 02 Jun 2025 13:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- - dicomscope | 31 | {imaging} | - mrtrix3 | 17 | {imaging} | + dicomscope | 29 | {imaging} | + mrtrix3 | 16 | {imaging} | oscar | 16 | {data,practice,tools} | orthanc-gdcm | 14 | {imaging} | pixelmed | 14 | {imaging} | sight | 10 | {imaging} | - bart-view | 9 | {imaging} | gnumed-server | 9 | {covid-19,practice} | mia | 9 | {imaging} | orthanc-mysql | 9 | {imaging} | adun.app | 8 | {bio} | + bart-view | 8 | {imaging} | icb-utils | 8 | {bio-dev} | king | 8 | {typesetting,imaging} | - biojava-live | 7 | {bio-dev} | heudiconv | 7 | {imaging} | orthanc-postgresql | 7 | {imaging} | + biojava-live | 6 | {bio-dev} | jebl2 | 5 | {bio-dev} | bio-tradis | 4 | {bio,bio-dev} | ants | 3 | {imaging} | ===================================== debian-science-tests.txt ===================================== @@ -1,44 +1,44 @@ -Last-Update: Mon, 02 Jun 2025 01:42:04 +0000 +Last-Update: Mon, 02 Jun 2025 13:42:08 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- - gts | 4896 | {viewing} | + gts | 4871 | {viewing} | nltk | 4685 | {linguistics} | - opencascade | 618 | {simulations} | + opencascade | 626 | {simulations} | spacenavd | 228 | {tools} | open-coarrays | 194 | {meteorology-dev} | - armadillo | 186 | {mathematics-dev} | + armadillo | 184 | {mathematics-dev} | arpack | 105 | {mathematics-dev} | - ntl | 49 | {mathematics-dev} | - scalapack | 42 | {nanoscale-physics-dev} | + ntl | 46 | {mathematics-dev} | + scalapack | 43 | {nanoscale-physics-dev} | mbpoll | 36 | {simulations} | visidata | 36 | {datamanagement} | imview | 35 | {viewing} | - ppl | 33 | {numericalcomputation} | - fftw | 30 | {mathematics-dev,physics-dev,meteorology-dev} | - libm4ri | 30 | {mathematics-dev} | + ppl | 32 | {numericalcomputation} | arduino-mk | 29 | {robotics} | - flann | 28 | {mathematics-dev,engineering-dev} | - grads | 27 | {meteorology} | + fftw | 29 | {mathematics-dev,physics-dev,meteorology-dev} | + libm4ri | 29 | {mathematics-dev} | + libmatio | 28 | {mathematics-dev} | + flann | 27 | {mathematics-dev,engineering-dev} | cliquer | 26 | {mathematics} | flintqs | 26 | {mathematics} | - libmatio | 26 | {mathematics-dev} | - xygrib | 26 | {meteorology} | + grads | 26 | {meteorology} | + xygrib | 25 | {meteorology} | setzer | 23 | {typesetting} | sat4j | 21 | {logic} | cliquer | 18 | {mathematics-dev} | lrcalc | 18 | {mathematics-dev} | eccodes | 16 | {meteorology,meteorology-dev} | + libitpp | 16 | {mathematics-dev,engineering-dev} | pyzo | 16 | {numericalcomputation} | bossa | 15 | {devices} | - fftw | 15 | {meteorology-dev,mathematics-dev,physics-dev} | gf2x | 15 | {mathematics-dev} | gts | 15 | {viewing-dev} | iml | 15 | {mathematics-dev} | libhomfly | 15 | {mathematics-dev} | dune-uggrid | 14 | {mathematics-dev} | eccodes | 14 | {meteorology-dev} | - libitpp | 14 | {mathematics-dev,engineering-dev} | + fftw | 14 | {meteorology-dev,mathematics-dev,physics-dev} | libm4rie | 14 | {mathematics-dev} | sketch | 14 | {typesetting} | teem | 14 | {imageanalysis} | @@ -46,42 +46,43 @@ Last-Update: Mon, 02 Jun 2025 01:42:04 +0000 feff85exafs | 12 | {chemistry} | matlab-support | 12 | {mathematics,numericalcomputation} | metar | 12 | {meteorology} | - pcl | 12 | {robotics-dev} | + picosat | 12 | {logic} | ratpoints | 12 | {mathematics-dev} | guiqwt | 11 | {numericalcomputation,viewing} | - picosat | 11 | {logic} | + pcl | 11 | {robotics-dev} | coinor-symphony | 10 | {logic,mathematics,numericalcomputation} | feedgnuplot | 10 | {viewing} | lxi-tools | 10 | {engineering,dataacquisition} | + ncl | 10 | {meteorology} | alberta | 9 | {engineering-dev} | + form | 9 | {mathematics} | geg | 9 | {viewing} | - magics++ | 9 | {meteorology-dev} | - ncl | 9 | {meteorology} | - odc | 9 | {meteorology-dev} | odc | 9 | {meteorology} | + odc | 9 | {meteorology-dev} | refmac-dictionary | 9 | {highenergy-physics-dev,chemistry} | ros-rosconsole | 9 | {robotics-dev} | dxsamples | 8 | {nanoscale-physics} | - form | 8 | {mathematics} | + magics++ | 8 | {meteorology-dev} | python-cdo | 8 | {meteorology} | + python-escript | 8 | {numericalcomputation,simulations,engineering} | vdt | 8 | {mathematics-dev} | - rubiks | 7 | {geometry,mathematics} | + persalys | 7 | {engineering,statistics,mathematics} | coda | 6 | {meteorology} | - persalys | 6 | {engineering,statistics,mathematics} | - python-escript | 6 | {numericalcomputation,simulations,engineering} | + etsf-io | 6 | {physics,nanoscale-physics} | + rheolef | 6 | {mathematics} | + rubiks | 6 | {geometry,mathematics} | ucto | 6 | {linguistics} | uctodata | 6 | {linguistics} | + apophenia | 5 | {statistics} | atlas-ecmwf | 5 | {meteorology} | auto-07p | 5 | {mathematics} | cld2 | 5 | {linguistics} | coda | 5 | {meteorology-dev} | - etsf-io | 5 | {physics,nanoscale-physics} | fpzip | 5 | {meteorology} | libccp4 | 5 | {nanoscale-physics-dev} | metview | 5 | {meteorology} | opencascade | 5 | {simulations} | - rheolef | 5 | {mathematics} | - apophenia | 4 | {statistics} | + persalys | 5 | {statistics,mathematics,engineering} | debian-science | 4 | {economics,nanoscale-physics,machine-learning,physics,mathematics} | drslib | 4 | {meteorology} | emoslib | 4 | {meteorology-dev} | @@ -91,15 +92,14 @@ Last-Update: Mon, 02 Jun 2025 01:42:04 +0000 iapws | 4 | {meteorology} | irstlm | 4 | {linguistics} | libgctp | 4 | {meteorology-dev} | + libxsmm | 4 | {mathematics-dev} | muparser | 4 | {mathematics-dev} | - persalys | 4 | {statistics,mathematics,engineering} | psurface | 4 | {numericalcomputation} | qwtplot3d | 4 | {viewing-dev} | ros-vcstool | 4 | {robotics-dev} | silo-llnl | 4 | {engineering} | toulbar2 | 4 | {logic,numericalcomputation,mathematics,physics} | urdfdom-headers | 4 | {robotics-dev} | - veccore | 4 | {mathematics-dev} | apertium-eval-translator | 3 | {linguistics} | cmor | 3 | {meteorology} | code-saturne | 3 | {mathematics-dev,engineering-dev} | @@ -117,22 +117,25 @@ Last-Update: Mon, 02 Jun 2025 01:42:04 +0000 hpcc | 3 | {numericalcomputation,distributedcomputing} | libcgns | 3 | {engineering-dev} | libmatheval | 3 | {mathematics} | - libxsmm | 3 | {mathematics-dev} | metkit | 3 | {meteorology} | ncl | 3 | {meteorology-dev} | + polylib | 3 | {mathematics} | sac2mseed | 3 | {geography} | silo-llnl | 3 | {engineering-dev} | toontag | 3 | {numericalcomputation} | + veccore | 3 | {mathematics-dev} | vlfeat | 3 | {imageanalysis-dev} | asl | 2 | {physics-dev} | atlas-ecmwf | 2 | {meteorology-dev} | code-saturne | 2 | {engineering-dev,mathematics-dev} | coinmp | 2 | {logic,mathematics-dev,numericalcomputation} | - debian-science | 2 | {nanoscale-physics,statistics,economics,physics} | debian-science | 2 | {neuroscience-cognitive} | + debian-science | 2 | {nanoscale-physics,statistics,economics,physics} | frog | 2 | {linguistics} | gadap | 2 | {meteorology-dev} | ipe-tools | 2 | {typesetting} | + jeuclid | 2 | {viewing,typesetting} | + libcgns | 2 | {engineering} | liblbfgs | 2 | {mathematics-dev} | libmatheval | 2 | {mathematics-dev} | libvigraimpex | 2 | {imageanalysis-dev,machine-learning} | @@ -145,7 +148,6 @@ Last-Update: Mon, 02 Jun 2025 01:42:04 +0000 ncrystal | 2 | {nanoscale-physics-dev,highenergy-physics-dev} | newmat | 2 | {mathematics-dev} | openstereogram | 2 | {tools} | - polylib | 2 | {mathematics} | python-aws-xray-sdk | 2 | {dataacquisition-dev} | qd | 2 | {mathematics-dev} | ros-ros-environment | 2 | {robotics-dev} | @@ -170,26 +172,23 @@ Last-Update: Mon, 02 Jun 2025 01:42:04 +0000 cmor | 1 | {meteorology-dev} | coda | 1 | {meteorology-dev} | coinor-bonmin | 1 | {mathematics} | - debian-science | 1 | {neuroscience-cognitive,machine-learning} | - debian-science | 1 | {economics} | debian-science | 1 | {electrophysiology} | - debian-science | 1 | {tools} | debian-science | 1 | {nanoscale-physics-dev} | + debian-science | 1 | {tools} | debian-science | 1 | {psychophysics} | + debian-science | 1 | {neuroscience-cognitive,machine-learning} | + debian-science | 1 | {economics} | fastjet | 1 | {highenergy-physics-dev} | fpzip | 1 | {meteorology-dev} | frogdata | 1 | {linguistics} | hepmc3 | 1 | {nanoscale-physics-dev,highenergy-physics-dev} | - jeuclid | 1 | {viewing,typesetting} | - libcgns | 1 | {engineering} | - libcvd | 1 | {imageanalysis} | libcvd | 1 | {imageanalysis-dev} | + libcvd | 1 | {imageanalysis} | libgtkdatabox | 1 | {engineering-dev,viewing-dev} | liblxi | 1 | {engineering-dev,dataacquisition-dev} | liborigin2 | 1 | {viewing-dev} | - libquantum | 1 | {numericalcomputation} | - looptools | 1 | {highenergy-physics} | looptools | 1 | {highenergy-physics-dev} | + looptools | 1 | {highenergy-physics} | magma | 1 | {mathematics-dev,numericalcomputation} | mmdb | 1 | {nanoscale-physics-dev,highenergy-physics-dev} | mseed2sac | 1 | {dataacquisition-dev} | @@ -228,6 +227,7 @@ Last-Update: Mon, 02 Jun 2025 01:42:04 +0000 itsol | 0 | {mathematics-dev} | libdogleg | 0 | {mathematics-dev} | libfolia | 0 | {linguistics} | + libquantum | 0 | {numericalcomputation} | libsdsl | 0 | {dataacquisition-dev} | mbt | 0 | {linguistics} | mctc-lib | 0 | {nanoscale-physics-dev,highenergy-physics-dev} | ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,140 +1,139 @@ -Last-Update: Mon, 02 Jun 2025 01:42:05 +0000 +Last-Update: Mon, 02 Jun 2025 13:42:11 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- - mpmath | 10244 | - python-repoze.lru | 7001 | - netifaces | 5156 | - ghp-import | 4642 | - python-lunr | 4632 | - python-babel | 4259 | - sortedcontainers | 3833 | - python-babel | 3713 | - aiosignal | 2935 | + mpmath | 10243 | + python-repoze.lru | 6997 | + netifaces | 5163 | + ghp-import | 4640 | + python-lunr | 4631 | + python-babel | 4277 | + sortedcontainers | 3844 | + python-babel | 3723 | + aiosignal | 2948 | hyperlink | 2173 | - python-notify2 | 2030 | - humanfriendly | 1918 | - referencing | 1798 | - python-mysqldb | 1515 | + python-notify2 | 2018 | + humanfriendly | 1921 | + referencing | 1802 | + python-mysqldb | 1511 | python-pandocfilters | 1436 | - python-gssapi | 1408 | - python-invoke | 1406 | - python-hyperframe | 1349 | - websocket-client | 1326 | - python-hpack | 1147 | - python-rsa | 1137 | - pdfarranger | 1013 | - menulibre | 954 | - python-linux-procfs | 937 | - python-zopfli | 914 | - python-geoip | 891 | - autopep8 | 863 | - python-webob | 844 | - pytoolconfig | 779 | - firmware-microbit-micropython | 766 | - powerline | 752 | - powerline | 732 | + python-gssapi | 1411 | + python-invoke | 1411 | + python-hyperframe | 1358 | + websocket-client | 1328 | + python-hpack | 1154 | + python-rsa | 1138 | + pdfarranger | 1018 | + menulibre | 953 | + python-linux-procfs | 940 | + python-zopfli | 911 | + python-geoip | 897 | + autopep8 | 861 | + python-webob | 841 | + pytoolconfig | 781 | + firmware-microbit-micropython | 767 | + powerline | 740 | powerline | 726 | - kazam | 697 | - u-msgpack-python | 624 | - gaupol | 559 | - dockerpty | 526 | - asn1crypto | 513 | + powerline | 720 | + kazam | 696 | + u-msgpack-python | 622 | + gaupol | 553 | + dockerpty | 531 | + asn1crypto | 511 | python-gevent | 511 | - python-et-xmlfile | 488 | - catfish | 436 | - python-ewmh | 433 | - python-requests-oauthlib | 410 | - python-toml | 381 | + python-et-xmlfile | 499 | + catfish | 439 | + python-ewmh | 434 | + python-requests-oauthlib | 413 | + python-toml | 377 | spf-engine | 341 | - python-ntlm-auth | 324 | - spf-engine | 293 | - django-stronghold | 262 | - pypdf2 | 241 | - cairocffi | 223 | - python-ldap3 | 218 | - python-mimeparse | 195 | + python-ntlm-auth | 326 | + spf-engine | 295 | + django-stronghold | 263 | + cairocffi | 226 | + python-ldap3 | 222 | + python-mimeparse | 196 | python-hidapi | 172 | - python-smmap | 166 | - httpie | 159 | - autokey | 151 | - smem | 148 | - python-anyjson | 133 | - kivy | 128 | - python-aiostream | 118 | + python-smmap | 167 | + httpie | 157 | + autokey | 152 | + smem | 144 | + python-anyjson | 137 | + kivy | 129 | + python-aiostream | 119 | smartypants | 115 | - mypaint | 109 | - python-pyu2f | 108 | + python-pyu2f | 107 | nodeenv | 106 | + mugshot | 102 | + mypaint | 102 | python-click-repl | 101 | timekpr-next | 101 | - mugshot | 99 | - lollypop | 98 | + lollypop | 100 | pacparser | 98 | python-consul | 92 | - python-colour | 91 | - pymediainfo | 90 | - pymacaroons | 89 | - pssh | 83 | - python-rfc6555 | 78 | + pymacaroons | 88 | + pymediainfo | 87 | + python-colour | 87 | + pssh | 86 | + python-rfc6555 | 77 | python-i3ipc | 72 | - python-pykka | 68 | - pywavelets | 67 | - numpy-stl | 65 | - weasyprint | 65 | - mitmproxy | 62 | + python-pykka | 69 | + weasyprint | 68 | + mitmproxy | 67 | + numpy-stl | 66 | + pywavelets | 65 | + fabric | 63 | ueberzug | 61 | - fabric | 59 | + python-uritools | 57 | python-scp | 56 | - python-uritools | 56 | - itstool | 54 | - show-in-file-manager | 52 | + itstool | 52 | mysql-connector-python | 51 | - blockdiag | 47 | - khard | 47 | - python-looseversion | 47 | + show-in-file-manager | 51 | + python-looseversion | 49 | trac | 47 | - sshtunnel | 43 | + khard | 46 | + blockdiag | 45 | + sshtunnel | 44 | + hatchling | 42 | membernator | 42 | pyquery | 42 | - hatchling | 41 | - pyenv | 39 | + pyenv | 40 | certipy | 38 | pamela | 38 | jupyterhub | 37 | - persepolis | 37 | pylibmc | 37 | - powerline-gitstatus | 34 | - pymacs | 33 | - python-pysol-cards | 32 | - pssh | 31 | + persepolis | 36 | + powerline-gitstatus | 35 | + pymacs | 34 | + pssh | 33 | + python-pysol-cards | 31 | dkimpy-milter | 30 | python-scrypt | 30 | + python-statsd | 30 | python-args | 29 | - python-statsd | 29 | - seqdiag | 29 | - pdfposter | 28 | + seqdiag | 28 | sphinxcontrib-blockdiag | 28 | + pdfposter | 27 | sphinxcontrib-seqdiag | 27 | - typogrify | 26 | video-downloader | 26 | - backoff | 25 | sphinx-inline-tabs | 25 | + typogrify | 25 | webpy | 25 | + backoff | 24 | python-clint | 24 | rst2pdf | 24 | - flask-principal | 22 | + flask-principal | 23 | + cppman | 22 | nwdiag | 22 | ruff | 22 | - cppman | 21 | depthcharge-tools | 21 | - fabric | 20 | - python-fire | 20 | + fabric | 21 | + python-fire | 21 | + alot | 20 | python-sdnotify | 20 | python-translationstring | 20 | python-zstd | 20 | actdiag | 19 | - alot | 19 | enzyme | 19 | python-rangehttpserver | 19 | spf-engine | 19 | @@ -144,75 +143,74 @@ Last-Update: Mon, 02 Jun 2025 01:42:05 +0000 sphinxcontrib-actdiag | 18 | sphinxcontrib-log-cabinet | 18 | subliminal | 18 | + django-environ | 17 | gtextfsm | 17 | python-hupper | 17 | python-priority | 17 | social-auth-core | 17 | sphinxcontrib-nwdiag | 17 | subliminal | 17 | - django-environ | 16 | mistune0 | 16 | python-inotify | 16 | + policyd-rate-limit | 15 | python-dbussy | 15 | python-demjson | 15 | python-kyotocabinet | 15 | python-pyalsa | 15 | python-pysubs2 | 15 | - policyd-rate-limit | 14 | + pykwalify | 14 | python-pem | 14 | python-pyrss2gen | 14 | python-xtermcolor | 14 | ansi | 13 | - notebook-shim | 13 | - pykwalify | 13 | - pyp | 13 | python-crcelk | 13 | python-ethtool | 13 | + python-slip10 | 13 | + unearth | 13 | autotiling | 12 | + btchip-python | 12 | gmplot | 12 | junos-eznc | 12 | - python-slip10 | 12 | + notebook-shim | 12 | + pdm | 12 | + pyp | 12 | txt2tags | 12 | - unearth | 12 | - beancount | 11 | - btchip-python | 11 | - pdm | 11 | pwntools | 11 | python-pyscss | 11 | + beancount | 10 | django-auditlog | 10 | + flask-security | 10 | jschema-to-python | 10 | python-aiohttp-security | 10 | + python-digitalocean | 10 | python-parse-type | 10 | python-sarif-python-om | 10 | speaklater | 10 | traittypes | 10 | django-sass | 9 | drf-yasg-nonfree | 9 | - flask-security | 9 | pylint-common | 9 | - pytest-runner | 9 | - python-digitalocean | 9 | python-drf-spectacular-sidecar-nonfree | 9 | python-pyld | 9 | todoman | 9 | trac-wysiwyg | 9 | tuna | 9 | + clustershell | 8 | debiancontributors | 8 | flask-paranoid | 8 | flask-session | 8 | httpcode | 8 | - pybik | 8 | pydrive2 | 8 | pytest-django | 8 | + pytest-runner | 8 | python-envs | 8 | python-overpy | 8 | python-pyaml-env | 8 | slimit | 8 | - clustershell | 7 | easyprocess | 7 | mercurial-evolve | 7 | + pybik | 7 | pytaglib | 7 | - python-openstep-plist | 7 | python-versioneer | 7 | python-xdo | 7 | sphinx-intl | 7 | @@ -221,31 +219,32 @@ Last-Update: Mon, 02 Jun 2025 01:42:05 +0000 hachoir | 6 | kconfiglib | 6 | kivy | 6 | - micropython-mpremote | 6 | mypy-protobuf | 6 | python-ansicolors | 6 | python-numpysane | 6 | + python-openstep-plist | 6 | ruff | 6 | + securestring | 6 | + drf-extensions | 5 | flufl.testing | 5 | graphql-relay | 5 | - imap-tools | 5 | librouteros | 5 | + micropython-mpremote | 5 | python-biplist | 5 | python-dirq | 5 | python-jpype | 5 | - python-pgmagick | 5 | python-srp | 5 | - securestring | 5 | sorl-thumbnail | 5 | sphinxcontrib-globalsubs | 5 | + azote | 4 | clustershell | 4 | django-jinja | 4 | django-paintstore | 4 | django-pglocks | 4 | - drf-extensions | 4 | drf-haystack | 4 | etm | 4 | htmlmin | 4 | + imap-tools | 4 | logilab-constraint | 4 | panoramisk | 4 | pycallgraph | 4 | @@ -255,12 +254,13 @@ Last-Update: Mon, 02 Jun 2025 01:42:05 +0000 python3-onelogin-saml2 | 4 | python-dbus-next | 4 | python-networkmanager | 4 | + python-pgmagick | 4 | python-simpy | 4 | slimit | 4 | testrepository | 4 | trac-accountmanager | 4 | + voltron | 4 | west | 4 | - azote | 3 | backupchecker | 3 | bootstrap-flask | 3 | cram | 3 | @@ -278,6 +278,7 @@ Last-Update: Mon, 02 Jun 2025 01:42:05 +0000 pyclamd | 3 | pyfltk | 3 | pyjunitxml | 3 | + pykwalify | 3 | pyprind | 3 | python-cookies | 3 | python-deepmerge | 3 | @@ -296,7 +297,6 @@ Last-Update: Mon, 02 Jun 2025 01:42:05 +0000 utidylib | 3 | vcversioner | 3 | vf1 | 3 | - voltron | 3 | zzzeeksphinx | 3 | aiomysql | 2 | brebis | 2 | @@ -313,7 +313,6 @@ Last-Update: Mon, 02 Jun 2025 01:42:05 +0000 fypp | 2 | gtkman | 2 | humanfriendly | 2 | - jsonrpclib-pelix | 2 | jupyter-sphinx | 2 | korean-lunar-calendar | 2 | namecheap | 2 | @@ -321,7 +320,6 @@ Last-Update: Mon, 02 Jun 2025 01:42:05 +0000 omgifol | 2 | panoramisk | 2 | pycrc | 2 | - pykwalify | 2 | pypass | 2 | python-bitbucket-api | 2 | python-bottle-sqlite | 2 | @@ -362,7 +360,9 @@ Last-Update: Mon, 02 Jun 2025 01:42:05 +0000 flask-flatpages | 1 | flask-multistatic | 1 | flask-paginate | 1 | + hatch-jupyter-builder | 1 | jpy | 1 | + jsonrpclib-pelix | 1 | mbed-test-wrapper | 1 | milksnake | 1 | mkdocs-macros-plugin | 1 | @@ -374,7 +374,6 @@ Last-Update: Mon, 02 Jun 2025 01:42:05 +0000 pydle | 1 | pynag | 1 | pyroma | 1 | - pysequoia | 1 | pyssim | 1 | python-aio-pika | 1 | python-banal | 1 | @@ -457,7 +456,6 @@ Last-Update: Mon, 02 Jun 2025 01:42:05 +0000 gitlike-commands | 0 | glyphspkg | 0 | grequests | 0 | - hatch-jupyter-builder | 0 | httpie-aws-authv4 | 0 | humanfriendly | 0 | hypothesis-auto | 0 | @@ -494,6 +492,7 @@ Last-Update: Mon, 02 Jun 2025 01:42:05 +0000 pyment | 0 | py-nextbusnext | 0 | pyrad | 0 | + pysequoia | 0 | pyssim | 0 | python3-simpleobsws | 0 | python-aiohttp-security | 0 | @@ -594,5 +593,5 @@ Last-Update: Mon, 02 Jun 2025 01:42:05 +0000 sphinxcontrib-emojicodes | -1 | symmetrize | -1 | trac-tickettemplate | -1 | -(607 rows) +(606 rows) View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/6bee709e067152d8fcd89017fecd32813a826382 -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/6bee709e067152d8fcd89017fecd32813a826382 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Mon Jun 2 21:13:33 2025 From: gitlab at salsa.debian.org (=?UTF-8?B?w4l0aWVubmUgTW9sbGllciAoQGVtb2xsaWVyKQ==?=) Date: Mon, 02 Jun 2025 20:13:33 +0000 Subject: [med-svn] [Git][med-team/bitseq][master] 4 commits: d/patches/*: normalize Last-Update timestamp. Message-ID: <683e05edc57e4_3db1d5f3bc6170a6@godard.mail> ?tienne Mollier pushed to branch master at Debian Med / bitseq Commits: 0d9947bd by ?tienne Mollier at 2025-06-02T21:56:19+02:00 d/patches/*: normalize Last-Update timestamp. - - - - - 8c9890bc by ?tienne Mollier at 2025-06-02T21:59:15+02:00 d/copyright: refer to LGPL-3 instead of symlink. - - - - - 7677b430 by ?tienne Mollier at 2025-06-02T21:59:47+02:00 d/control: declare compliance to standards version 4.7.2. - - - - - 8c19f1fe by ?tienne Mollier at 2025-06-02T22:13:13+02:00 d/changelog: ready for upload to unstable. - - - - - 6 changed files: - debian/changelog - debian/control - debian/copyright - debian/patches/2to3.patch - debian/patches/fix_build_options.patch - debian/patches/link_against_system_samtools.patch Changes: ===================================== debian/changelog ===================================== @@ -1,9 +1,21 @@ -bitseq (0.7.5+dfsg-7) UNRELEASED; urgency=medium +bitseq (0.7.5+dfsg-7) unstable; urgency=medium + * Team upload. + + [ Andreas Tille ] * Remove Tim Booth since address is bouncing (Thank you for your work on this package, Tim) - -- Andreas Tille Mon, 16 Sep 2024 09:59:37 +0200 + [ Harish Chavre ] + * Add autopkgtests for bitseq + * add test for parseAlignment command + + [ ?tienne Mollier ] + * d/patches/*: normalize Last-Update timestamp. + * d/copyright: refer to LGPL-3 instead of symlink. + * d/control: declare compliance to standards version 4.7.2. + + -- ?tienne Mollier Mon, 02 Jun 2025 22:00:14 +0200 bitseq (0.7.5+dfsg-6) unstable; urgency=medium ===================================== debian/control ===================================== @@ -10,7 +10,7 @@ Build-Depends: debhelper-compat (= 13), help2man, python3, python3-numpy -Standards-Version: 4.6.0 +Standards-Version: 4.7.2 Vcs-Browser: https://salsa.debian.org/med-team/bitseq Vcs-Git: https://salsa.debian.org/med-team/bitseq.git Homepage: https://github.com/BitSeq/BitSeq ===================================== debian/copyright ===================================== @@ -13,7 +13,7 @@ Copyright: 1996-2002 FORTRAN77 version by Jose Bernardo C++ version by John Burkardt License: LGPL-3+ On Debian systems you can find the full text of the GNU Lesser General Public - License at /usr/share/common-licenses/LGPL. + License at /usr/share/common-licenses/LGPL-3. Files: debian/* Copyright: ? 2013 Tim Booth ===================================== debian/patches/2to3.patch ===================================== @@ -1,7 +1,7 @@ Description: Use 2to3 to port scripts to Python3 Bug-Debian: https://bugs.debian.org/936209 Author: Andreas Tille -Last-Update: Sun, 01 Sep 2019 07:43:45 +0200 +Last-Update: 2019-09-01 --- a/checkTR.py +++ b/checkTR.py ===================================== debian/patches/fix_build_options.patch ===================================== @@ -1,7 +1,7 @@ Description: Drop -mtune=generic from build options Bug-Debian: https://bugs.debian.org/884623 Author: Andreas Tille -Last-Update: Sun, 17 Dec 2017 21:09:59 +0100 +Last-Update: 2017-12-17 --- a/Makefile +++ b/Makefile ===================================== debian/patches/link_against_system_samtools.patch ===================================== @@ -1,5 +1,6 @@ Author: Tim Booth -Last-Update: Wed, 01 Jan 2014 19:04:47 +0100 (by Andreas Tille) +Last-Update: 2014-01-01 +Reviewed-By: Andreas Tille Description: link against Debian packaged samtools --- a/Makefile View it on GitLab: https://salsa.debian.org/med-team/bitseq/-/compare/a6976034eb47ba66df9dbea0870a4b9337f46aac...8c19f1fe56e4bdd2c8cbc522f2e440b2abc57ade -- View it on GitLab: https://salsa.debian.org/med-team/bitseq/-/compare/a6976034eb47ba66df9dbea0870a4b9337f46aac...8c19f1fe56e4bdd2c8cbc522f2e440b2abc57ade You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Mon Jun 2 22:27:48 2025 From: gitlab at salsa.debian.org (=?UTF-8?B?w4l0aWVubmUgTW9sbGllciAoQGVtb2xsaWVyKQ==?=) Date: Mon, 02 Jun 2025 21:27:48 +0000 Subject: [med-svn] [Git][med-team/bitseq][master] 2 commits: hardening.patch: inject CPPFLAGS too. Message-ID: <683e17543cca8_3db3ea314638121@godard.mail> ?tienne Mollier pushed to branch master at Debian Med / bitseq Commits: b824a9e5 by ?tienne Mollier at 2025-06-02T23:26:37+02:00 hardening.patch: inject CPPFLAGS too. - - - - - e07930fe by ?tienne Mollier at 2025-06-02T23:27:21+02:00 d/changelog: update to include hotfix. - - - - - 2 changed files: - debian/changelog - debian/patches/hardening.patch Changes: ===================================== debian/changelog ===================================== @@ -14,8 +14,9 @@ bitseq (0.7.5+dfsg-7) unstable; urgency=medium * d/patches/*: normalize Last-Update timestamp. * d/copyright: refer to LGPL-3 instead of symlink. * d/control: declare compliance to standards version 4.7.2. + * hardening.patch: inject CPPFLAGS too. - -- ?tienne Mollier Mon, 02 Jun 2025 22:00:14 +0200 + -- ?tienne Mollier Mon, 02 Jun 2025 23:27:01 +0200 bitseq (0.7.5+dfsg-6) unstable; urgency=medium ===================================== debian/patches/hardening.patch ===================================== @@ -1,15 +1,16 @@ Author: Andreas Tille -Last-Change: Wed, 01 Jan 2014 19:04:47 +0100 +Last-Update: 2025-06-02 +Reviewed-By: ?tienne Mollier Description: Propagate hardening options ---- a/Makefile -+++ b/Makefile -@@ -8,10 +8,10 @@ VERSION = 0.7.5 +--- bitseq.orig/Makefile ++++ bitseq/Makefile +@@ -8,10 +8,10 @@ # Use O1 for debuiggging so it's not totally slow. DBGFLAGS = -O1 -ggdb -U_FORTIFY_SOURCE COFLAGS = $(ARCH) -O2 -pipe -CXXFLAGS = -DBS_VERSION=\"$(VERSION)\" -Wall $(COFLAGS) -+CXXFLAGS += -DBS_VERSION=\"$(VERSION)\" -Wall $(COFLAGS) ++CXXFLAGS += $(CPPFLAGS) -DBS_VERSION=\"$(VERSION)\" -Wall $(COFLAGS) # -Wvla does not work with old gcc # -ffast-math segfaults with old gcc, don't use. -LDFLAGS = -Wl,-gc-sections View it on GitLab: https://salsa.debian.org/med-team/bitseq/-/compare/8c19f1fe56e4bdd2c8cbc522f2e440b2abc57ade...e07930fe2e8adf03d9a08f9299a16b2a09d7ad76 -- View it on GitLab: https://salsa.debian.org/med-team/bitseq/-/compare/8c19f1fe56e4bdd2c8cbc522f2e440b2abc57ade...e07930fe2e8adf03d9a08f9299a16b2a09d7ad76 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Mon Jun 2 22:33:30 2025 From: gitlab at salsa.debian.org (=?UTF-8?B?w4l0aWVubmUgTW9sbGllciAoQGVtb2xsaWVyKQ==?=) Date: Mon, 02 Jun 2025 21:33:30 +0000 Subject: [med-svn] [Git][med-team/bitseq] Pushed new tag archive/debian/0.7.5+dfsg-7 Message-ID: <683e18aa1e002_3db7e4506404b@godard.mail> ?tienne Mollier pushed new tag archive/debian/0.7.5+dfsg-7 at Debian Med / bitseq -- View it on GitLab: https://salsa.debian.org/med-team/bitseq/-/tree/archive/debian/0.7.5+dfsg-7 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Mon Jun 2 22:33:31 2025 From: gitlab at salsa.debian.org (=?UTF-8?B?w4l0aWVubmUgTW9sbGllciAoQGVtb2xsaWVyKQ==?=) Date: Mon, 02 Jun 2025 21:33:31 +0000 Subject: [med-svn] [Git][med-team/bitseq] Pushed new tag debian/0.7.5+dfsg-7 Message-ID: <683e18ab43f63_3db7e43c640769@godard.mail> ?tienne Mollier pushed new tag debian/0.7.5+dfsg-7 at Debian Med / bitseq -- View it on GitLab: https://salsa.debian.org/med-team/bitseq/-/tree/debian/0.7.5+dfsg-7 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Tue Jun 3 02:43:17 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Tue, 03 Jun 2025 01:43:17 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <683e53351772e_3db1d5e688652937@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: a531d19f by Andreas Tille at 2025-06-03T01:43:13+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Mon, 02 Jun 2025 13:42:04 +0000 +Last-Update: Tue, 03 Jun 2025 01:42:03 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- ===================================== debian-science-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Mon, 02 Jun 2025 13:42:08 +0000 +Last-Update: Tue, 03 Jun 2025 01:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Mon, 02 Jun 2025 13:42:11 +0000 +Last-Update: Tue, 03 Jun 2025 01:42:04 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/a531d19faccf2bb4b85a7168bec5b4f7ea0ba0b0 -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/a531d19faccf2bb4b85a7168bec5b4f7ea0ba0b0 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Tue Jun 3 14:43:38 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Tue, 03 Jun 2025 13:43:38 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <683efc0a852e2_3db1d48324727186@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: 0dfd07ab by Andreas Tille at 2025-06-03T13:43:31+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,26 +1,26 @@ -Last-Update: Tue, 03 Jun 2025 01:42:03 +0000 +Last-Update: Tue, 03 Jun 2025 13:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- - dicomscope | 29 | {imaging} | - mrtrix3 | 16 | {imaging} | + dicomscope | 26 | {imaging} | oscar | 16 | {data,practice,tools} | + mrtrix3 | 15 | {imaging} | orthanc-gdcm | 14 | {imaging} | - pixelmed | 14 | {imaging} | + pixelmed | 12 | {imaging} | sight | 10 | {imaging} | gnumed-server | 9 | {covid-19,practice} | - mia | 9 | {imaging} | orthanc-mysql | 9 | {imaging} | - adun.app | 8 | {bio} | bart-view | 8 | {imaging} | - icb-utils | 8 | {bio-dev} | - king | 8 | {typesetting,imaging} | + adun.app | 7 | {bio} | heudiconv | 7 | {imaging} | + king | 7 | {typesetting,imaging} | + mia | 7 | {imaging} | orthanc-postgresql | 7 | {imaging} | - biojava-live | 6 | {bio-dev} | + icb-utils | 6 | {bio-dev} | + biojava-live | 5 | {bio-dev} | jebl2 | 5 | {bio-dev} | - bio-tradis | 4 | {bio,bio-dev} | ants | 3 | {imaging} | + bio-tradis | 3 | {bio,bio-dev} | getdata | 3 | {bio} | pbcopper | 3 | {bio-dev} | piler | 3 | {bio} | @@ -29,7 +29,6 @@ Last-Update: Tue, 03 Jun 2025 01:42:03 +0000 beast-mcmc | 2 | {bio,bio-phylogeny} | cmtk | 2 | {imaging} | elastix | 2 | {imaging} | - libgenome | 2 | {bio-dev} | libminc | 2 | {imaging-dev} | libpal-java | 2 | {bio-dev} | pbseqlib | 2 | {bio-dev} | @@ -43,7 +42,6 @@ Last-Update: Tue, 03 Jun 2025 01:42:03 +0000 emboss-explorer | 1 | {bio} | fastml | 1 | {bio} | hinge | 1 | {bio} | - htscodecs | 1 | {bio-dev,covid-19} | insighttoolkit5 | 1 | {imaging-dev} | ipig | 1 | {bio} | jmodeltest | 1 | {bio,bio-phylogeny} | @@ -53,14 +51,11 @@ Last-Update: Tue, 03 Jun 2025 01:42:03 +0000 libchado-perl | 1 | {bio-dev} | libctapimkt | 1 | {practice} | libdivsufsort | 1 | {bio-dev} | - libgkarrays | 1 | {bio-dev} | - libmems | 1 | {bio-dev} | - libmuscle | 1 | {bio-dev} | - librg-utils-perl | 1 | {bio} | - libstatgen | 1 | {bio-dev} | + libgenome | 1 | {bio-dev} | libxdf | 1 | {imaging-dev} | mssstest | 1 | {tools} | opencfu | 1 | {laboratory} | + papyrus | 1 | {imaging-dev} | phyutility | 1 | {cloud,bio} | proalign | 1 | {bio-phylogeny,bio} | rambo-k | 1 | {bio} | @@ -90,6 +85,7 @@ Last-Update: Tue, 03 Jun 2025 01:42:03 +0000 fis-gtm | 0 | {his} | gatk-bwamem | 0 | {bio-dev} | gatk-fermilite | 0 | {bio-dev} | + htscodecs | 0 | {bio-dev,covid-19} | kmerresistance | 0 | {bio} | libbioparser-dev | 0 | {bio-dev} | libbpp-core | 0 | {bio-dev} | @@ -99,15 +95,20 @@ Last-Update: Tue, 03 Jun 2025 01:42:03 +0000 libbpp-raa | 0 | {bio-dev} | libbpp-seq | 0 | {bio-dev} | libbpp-seq-omics | 0 | {bio-dev} | + libgkarrays | 0 | {bio-dev} | libhmsbeagle | 0 | {bio-dev} | libics | 0 | {covid-19,imaging-dev} | libjloda-java | 0 | {bio-dev} | libmaus2 | 0 | {covid-19,bio-dev} | + libmems | 0 | {bio-dev} | libmialm | 0 | {imaging-dev} | + libmuscle | 0 | {bio-dev} | libpsortb | 0 | {bio-dev} | libqes | 0 | {bio-dev} | librdp-taxonomy-tree-java | 0 | {bio-dev} | + librg-utils-perl | 0 | {bio} | libseqlib | 0 | {bio-dev} | + libstatgen | 0 | {bio-dev} | libvbz-hdf-plugin | 0 | {bio-dev} | libvistaio | 0 | {imaging-dev} | libwfa2 | 0 | {bio-dev} | @@ -123,7 +124,6 @@ Last-Update: Tue, 03 Jun 2025 01:42:03 +0000 milib | 0 | {covid-19,bio-dev} | ncbi-vdb | 0 | {bio-dev} | orthanc-imagej | 0 | {imaging} | - papyrus | 0 | {imaging-dev} | pbseqlib | 0 | {bio-dev} | pigx-rnaseq | 0 | {covid-19,bio} | placnet | 0 | {bio} | @@ -139,8 +139,8 @@ Last-Update: Tue, 03 Jun 2025 01:42:03 +0000 rtax | 0 | {cloud,bio} | runcircos-gui | 0 | {bio} | saint | 0 | {bio} | - savvy | 0 | {bio} | savvy | 0 | {bio-dev} | + savvy | 0 | {bio} | sbmltoolbox | 0 | {bio-dev} | sibsim4 | 0 | {cloud,bio} | sift | 0 | {bio} | ===================================== debian-science-tests.txt ===================================== @@ -1,88 +1,89 @@ -Last-Update: Tue, 03 Jun 2025 01:42:04 +0000 +Last-Update: Tue, 03 Jun 2025 13:42:09 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- - gts | 4871 | {viewing} | - nltk | 4685 | {linguistics} | - opencascade | 626 | {simulations} | - spacenavd | 228 | {tools} | - open-coarrays | 194 | {meteorology-dev} | - armadillo | 184 | {mathematics-dev} | - arpack | 105 | {mathematics-dev} | + gts | 4916 | {viewing} | + nltk | 4741 | {linguistics} | + opencascade | 640 | {simulations} | + spacenavd | 229 | {tools} | + open-coarrays | 193 | {meteorology-dev} | + armadillo | 185 | {mathematics-dev} | + arpack | 102 | {mathematics-dev} | ntl | 46 | {mathematics-dev} | scalapack | 43 | {nanoscale-physics-dev} | + visidata | 37 | {datamanagement} | mbpoll | 36 | {simulations} | - visidata | 36 | {datamanagement} | imview | 35 | {viewing} | - ppl | 32 | {numericalcomputation} | - arduino-mk | 29 | {robotics} | - fftw | 29 | {mathematics-dev,physics-dev,meteorology-dev} | + ppl | 31 | {numericalcomputation} | + arduino-mk | 30 | {robotics} | libm4ri | 29 | {mathematics-dev} | - libmatio | 28 | {mathematics-dev} | flann | 27 | {mathematics-dev,engineering-dev} | - cliquer | 26 | {mathematics} | - flintqs | 26 | {mathematics} | + libmatio | 27 | {mathematics-dev} | grads | 26 | {meteorology} | - xygrib | 25 | {meteorology} | + xygrib | 26 | {meteorology} | + cliquer | 25 | {mathematics} | + flintqs | 25 | {mathematics} | setzer | 23 | {typesetting} | - sat4j | 21 | {logic} | + sat4j | 22 | {logic} | + fftw | 21 | {mathematics-dev,physics-dev,meteorology-dev} | cliquer | 18 | {mathematics-dev} | lrcalc | 18 | {mathematics-dev} | - eccodes | 16 | {meteorology,meteorology-dev} | - libitpp | 16 | {mathematics-dev,engineering-dev} | + eccodes | 17 | {meteorology,meteorology-dev} | + libitpp | 17 | {mathematics-dev,engineering-dev} | + bossa | 16 | {devices} | pyzo | 16 | {numericalcomputation} | - bossa | 15 | {devices} | gf2x | 15 | {mathematics-dev} | gts | 15 | {viewing-dev} | iml | 15 | {mathematics-dev} | libhomfly | 15 | {mathematics-dev} | + sketch | 15 | {typesetting} | dune-uggrid | 14 | {mathematics-dev} | eccodes | 14 | {meteorology-dev} | - fftw | 14 | {meteorology-dev,mathematics-dev,physics-dev} | libm4rie | 14 | {mathematics-dev} | - sketch | 14 | {typesetting} | - teem | 14 | {imageanalysis} | libzn-poly | 13 | {mathematics-dev} | + teem | 13 | {imageanalysis} | feff85exafs | 12 | {chemistry} | matlab-support | 12 | {mathematics,numericalcomputation} | - metar | 12 | {meteorology} | picosat | 12 | {logic} | ratpoints | 12 | {mathematics-dev} | guiqwt | 11 | {numericalcomputation,viewing} | + ncl | 11 | {meteorology} | pcl | 11 | {robotics-dev} | coinor-symphony | 10 | {logic,mathematics,numericalcomputation} | feedgnuplot | 10 | {viewing} | lxi-tools | 10 | {engineering,dataacquisition} | - ncl | 10 | {meteorology} | + ros-rosconsole | 10 | {robotics-dev} | alberta | 9 | {engineering-dev} | form | 9 | {mathematics} | geg | 9 | {viewing} | odc | 9 | {meteorology} | odc | 9 | {meteorology-dev} | refmac-dictionary | 9 | {highenergy-physics-dev,chemistry} | - ros-rosconsole | 9 | {robotics-dev} | dxsamples | 8 | {nanoscale-physics} | magics++ | 8 | {meteorology-dev} | + metar | 8 | {meteorology} | python-cdo | 8 | {meteorology} | - python-escript | 8 | {numericalcomputation,simulations,engineering} | vdt | 8 | {mathematics-dev} | persalys | 7 | {engineering,statistics,mathematics} | coda | 6 | {meteorology} | - etsf-io | 6 | {physics,nanoscale-physics} | + fpzip | 6 | {meteorology} | rheolef | 6 | {mathematics} | rubiks | 6 | {geometry,mathematics} | ucto | 6 | {linguistics} | uctodata | 6 | {linguistics} | apophenia | 5 | {statistics} | atlas-ecmwf | 5 | {meteorology} | - auto-07p | 5 | {mathematics} | cld2 | 5 | {linguistics} | coda | 5 | {meteorology-dev} | - fpzip | 5 | {meteorology} | + etsf-io | 5 | {physics,nanoscale-physics} | + fftw | 5 | {meteorology-dev,mathematics-dev,physics-dev} | libccp4 | 5 | {nanoscale-physics-dev} | metview | 5 | {meteorology} | + muparser | 5 | {mathematics-dev} | opencascade | 5 | {simulations} | persalys | 5 | {statistics,mathematics,engineering} | + python-escript | 5 | {numericalcomputation,simulations,engineering} | + auto-07p | 4 | {mathematics} | debian-science | 4 | {economics,nanoscale-physics,machine-learning,physics,mathematics} | drslib | 4 | {meteorology} | emoslib | 4 | {meteorology-dev} | @@ -93,11 +94,10 @@ Last-Update: Tue, 03 Jun 2025 01:42:04 +0000 irstlm | 4 | {linguistics} | libgctp | 4 | {meteorology-dev} | libxsmm | 4 | {mathematics-dev} | - muparser | 4 | {mathematics-dev} | + ncl | 4 | {meteorology-dev} | psurface | 4 | {numericalcomputation} | qwtplot3d | 4 | {viewing-dev} | ros-vcstool | 4 | {robotics-dev} | - silo-llnl | 4 | {engineering} | toulbar2 | 4 | {logic,numericalcomputation,mathematics,physics} | urdfdom-headers | 4 | {robotics-dev} | apertium-eval-translator | 3 | {linguistics} | @@ -112,29 +112,30 @@ Last-Update: Tue, 03 Jun 2025 01:42:04 +0000 dxflib | 3 | {engineering-dev} | ecbuild | 3 | {meteorology-dev} | emoslib | 3 | {meteorology} | - harp | 3 | {meteorology} | hdf-eos4 | 3 | {meteorology-dev} | hpcc | 3 | {numericalcomputation,distributedcomputing} | libcgns | 3 | {engineering-dev} | libmatheval | 3 | {mathematics} | metkit | 3 | {meteorology} | - ncl | 3 | {meteorology-dev} | polylib | 3 | {mathematics} | sac2mseed | 3 | {geography} | silo-llnl | 3 | {engineering-dev} | + silo-llnl | 3 | {engineering} | toontag | 3 | {numericalcomputation} | veccore | 3 | {mathematics-dev} | vlfeat | 3 | {imageanalysis-dev} | + apophenia | 2 | {statistics} | asl | 2 | {physics-dev} | atlas-ecmwf | 2 | {meteorology-dev} | code-saturne | 2 | {engineering-dev,mathematics-dev} | coinmp | 2 | {logic,mathematics-dev,numericalcomputation} | debian-science | 2 | {neuroscience-cognitive} | debian-science | 2 | {nanoscale-physics,statistics,economics,physics} | + fpzip | 2 | {meteorology-dev} | frog | 2 | {linguistics} | gadap | 2 | {meteorology-dev} | + harp | 2 | {meteorology} | ipe-tools | 2 | {typesetting} | - jeuclid | 2 | {viewing,typesetting} | libcgns | 2 | {engineering} | liblbfgs | 2 | {mathematics-dev} | libmatheval | 2 | {mathematics-dev} | @@ -165,23 +166,22 @@ Last-Update: Tue, 03 Jun 2025 01:42:04 +0000 x13as | 2 | {economics} | apache-opennlp | 1 | {linguistics} | apertium-streamparser | 1 | {linguistics} | - apophenia | 1 | {statistics} | ckon | 1 | {highenergy-physics-dev} | clhep | 1 | {highenergy-physics-dev} | clipper | 1 | {nanoscale-physics-dev} | cmor | 1 | {meteorology-dev} | coda | 1 | {meteorology-dev} | coinor-bonmin | 1 | {mathematics} | + debian-science | 1 | {economics} | debian-science | 1 | {electrophysiology} | debian-science | 1 | {nanoscale-physics-dev} | - debian-science | 1 | {tools} | - debian-science | 1 | {psychophysics} | debian-science | 1 | {neuroscience-cognitive,machine-learning} | - debian-science | 1 | {economics} | + debian-science | 1 | {psychophysics} | + debian-science | 1 | {tools} | fastjet | 1 | {highenergy-physics-dev} | - fpzip | 1 | {meteorology-dev} | frogdata | 1 | {linguistics} | hepmc3 | 1 | {nanoscale-physics-dev,highenergy-physics-dev} | + jeuclid | 1 | {viewing,typesetting} | libcvd | 1 | {imageanalysis-dev} | libcvd | 1 | {imageanalysis} | libgtkdatabox | 1 | {engineering-dev,viewing-dev} | @@ -244,8 +244,8 @@ Last-Update: Tue, 03 Jun 2025 01:42:04 +0000 quadrule | 0 | {mathematics-dev} | robot-testing-framework | 0 | {robotics-dev} | ros-collada-urdf | 0 | {robotics} | - ros-metapackages | 0 | {robotics-dev} | ros-metapackages | 0 | {robotics} | + ros-metapackages | 0 | {robotics-dev} | ros-opencv-apps | 0 | {robotics} | sagemath-database-combinatorial-designs | 0 | {mathematics} | sagemath-database-cremona-elliptic-curves | 0 | {mathematics} | ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,168 +1,169 @@ -Last-Update: Tue, 03 Jun 2025 01:42:04 +0000 +Last-Update: Tue, 03 Jun 2025 13:42:12 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- - mpmath | 10243 | - python-repoze.lru | 6997 | - netifaces | 5163 | - ghp-import | 4640 | - python-lunr | 4631 | - python-babel | 4277 | - sortedcontainers | 3844 | - python-babel | 3723 | - aiosignal | 2948 | - hyperlink | 2173 | - python-notify2 | 2018 | - humanfriendly | 1921 | - referencing | 1802 | - python-mysqldb | 1511 | - python-pandocfilters | 1436 | - python-gssapi | 1411 | - python-invoke | 1411 | - python-hyperframe | 1358 | - websocket-client | 1328 | - python-hpack | 1154 | - python-rsa | 1138 | - pdfarranger | 1018 | + mpmath | 10242 | + python-repoze.lru | 6985 | + netifaces | 5157 | + ghp-import | 4696 | + python-lunr | 4689 | + python-babel | 4285 | + sortedcontainers | 3857 | + python-babel | 3736 | + aiosignal | 2936 | + hyperlink | 2177 | + python-notify2 | 2034 | + humanfriendly | 1916 | + referencing | 1788 | + python-mysqldb | 1504 | + python-pandocfilters | 1446 | + python-gssapi | 1416 | + python-invoke | 1414 | + python-hyperframe | 1362 | + websocket-client | 1325 | + python-hpack | 1153 | + python-rsa | 1133 | + pdfarranger | 1034 | menulibre | 953 | python-linux-procfs | 940 | - python-zopfli | 911 | - python-geoip | 897 | - autopep8 | 861 | + python-zopfli | 912 | + python-geoip | 894 | + autopep8 | 863 | python-webob | 841 | - pytoolconfig | 781 | - firmware-microbit-micropython | 767 | - powerline | 740 | - powerline | 726 | - powerline | 720 | - kazam | 696 | - u-msgpack-python | 622 | - gaupol | 553 | - dockerpty | 531 | - asn1crypto | 511 | - python-gevent | 511 | - python-et-xmlfile | 499 | - catfish | 439 | - python-ewmh | 434 | - python-requests-oauthlib | 413 | - python-toml | 377 | - spf-engine | 341 | - python-ntlm-auth | 326 | - spf-engine | 295 | - django-stronghold | 263 | - cairocffi | 226 | - python-ldap3 | 222 | + pytoolconfig | 788 | + firmware-microbit-micropython | 768 | + powerline | 733 | + powerline | 729 | + powerline | 723 | + kazam | 701 | + u-msgpack-python | 632 | + gaupol | 559 | + dockerpty | 527 | + asn1crypto | 513 | + python-gevent | 510 | + python-et-xmlfile | 496 | + catfish | 445 | + python-ewmh | 439 | + python-requests-oauthlib | 411 | + python-toml | 378 | + spf-engine | 339 | + python-ntlm-auth | 319 | + spf-engine | 292 | + django-stronghold | 259 | + cairocffi | 229 | + python-ldap3 | 224 | python-mimeparse | 196 | + python-smmap | 173 | python-hidapi | 172 | - python-smmap | 167 | httpie | 157 | - autokey | 152 | - smem | 144 | - python-anyjson | 137 | - kivy | 129 | - python-aiostream | 119 | + autokey | 156 | + smem | 142 | + python-anyjson | 141 | + kivy | 131 | + python-aiostream | 118 | smartypants | 115 | - python-pyu2f | 107 | - nodeenv | 106 | - mugshot | 102 | - mypaint | 102 | - python-click-repl | 101 | - timekpr-next | 101 | - lollypop | 100 | - pacparser | 98 | - python-consul | 92 | + nodeenv | 109 | + mugshot | 107 | + python-pyu2f | 103 | + python-click-repl | 102 | + timekpr-next | 102 | + pacparser | 100 | + lollypop | 99 | + mypaint | 99 | + python-consul | 91 | pymacaroons | 88 | - pymediainfo | 87 | - python-colour | 87 | - pssh | 86 | - python-rfc6555 | 77 | - python-i3ipc | 72 | - python-pykka | 69 | + pssh | 85 | + pymediainfo | 85 | + python-colour | 82 | + python-rfc6555 | 76 | + python-i3ipc | 71 | + numpy-stl | 69 | + python-pykka | 68 | weasyprint | 68 | mitmproxy | 67 | - numpy-stl | 66 | - pywavelets | 65 | - fabric | 63 | - ueberzug | 61 | - python-uritools | 57 | - python-scp | 56 | - itstool | 52 | + fabric | 62 | + python-uritools | 60 | + ueberzug | 59 | + pywavelets | 56 | + python-scp | 55 | mysql-connector-python | 51 | - show-in-file-manager | 51 | - python-looseversion | 49 | - trac | 47 | - khard | 46 | + itstool | 50 | + python-looseversion | 50 | + show-in-file-manager | 49 | + trac | 46 | blockdiag | 45 | - sshtunnel | 44 | - hatchling | 42 | - membernator | 42 | - pyquery | 42 | - pyenv | 40 | - certipy | 38 | - pamela | 38 | - jupyterhub | 37 | - pylibmc | 37 | - persepolis | 36 | - powerline-gitstatus | 35 | + khard | 44 | + sshtunnel | 43 | + hatchling | 41 | + membernator | 41 | + pyenv | 41 | + pyquery | 41 | + certipy | 39 | + pamela | 39 | + pylibmc | 39 | + jupyterhub | 38 | + persepolis | 35 | + powerline-gitstatus | 34 | pymacs | 34 | - pssh | 33 | python-pysol-cards | 31 | dkimpy-milter | 30 | + pssh | 30 | python-scrypt | 30 | python-statsd | 30 | + pdfposter | 29 | python-args | 29 | - seqdiag | 28 | sphinxcontrib-blockdiag | 28 | - pdfposter | 27 | - sphinxcontrib-seqdiag | 27 | - video-downloader | 26 | - sphinx-inline-tabs | 25 | - typogrify | 25 | + seqdiag | 27 | + rst2pdf | 26 | + sphinxcontrib-seqdiag | 26 | + sphinx-inline-tabs | 26 | + python-clint | 25 | + video-downloader | 25 | webpy | 25 | backoff | 24 | - python-clint | 24 | - rst2pdf | 24 | + typogrify | 24 | flask-principal | 23 | - cppman | 22 | - nwdiag | 22 | ruff | 22 | + cppman | 21 | depthcharge-tools | 21 | fabric | 21 | - python-fire | 21 | + nwdiag | 21 | + python-zstd | 21 | alot | 20 | + python-fire | 20 | python-sdnotify | 20 | - python-translationstring | 20 | - python-zstd | 20 | - actdiag | 19 | + webtest | 20 | enzyme | 19 | python-rangehttpserver | 19 | spf-engine | 19 | - webtest | 19 | - nwg-displays | 18 | + actdiag | 18 | python-simpy | 18 | - sphinxcontrib-actdiag | 18 | + python-translationstring | 18 | sphinxcontrib-log-cabinet | 18 | subliminal | 18 | django-environ | 17 | gtextfsm | 17 | - python-hupper | 17 | + nwg-displays | 17 | python-priority | 17 | social-auth-core | 17 | - sphinxcontrib-nwdiag | 17 | + sphinxcontrib-actdiag | 17 | subliminal | 17 | mistune0 | 16 | - python-inotify | 16 | + sphinxcontrib-nwdiag | 16 | policyd-rate-limit | 15 | python-dbussy | 15 | python-demjson | 15 | + python-hupper | 15 | + python-inotify | 15 | python-kyotocabinet | 15 | - python-pyalsa | 15 | python-pysubs2 | 15 | - pykwalify | 14 | + ansi | 14 | python-pem | 14 | + python-pyalsa | 14 | python-pyrss2gen | 14 | python-xtermcolor | 14 | - ansi | 13 | + pdm | 13 | + pykwalify | 13 | python-crcelk | 13 | python-ethtool | 13 | python-slip10 | 13 | @@ -172,72 +173,71 @@ Last-Update: Tue, 03 Jun 2025 01:42:04 +0000 gmplot | 12 | junos-eznc | 12 | notebook-shim | 12 | - pdm | 12 | pyp | 12 | txt2tags | 12 | - pwntools | 11 | python-pyscss | 11 | + traittypes | 11 | beancount | 10 | django-auditlog | 10 | flask-security | 10 | jschema-to-python | 10 | + pwntools | 10 | python-aiohttp-security | 10 | python-digitalocean | 10 | python-parse-type | 10 | python-sarif-python-om | 10 | speaklater | 10 | - traittypes | 10 | django-sass | 9 | drf-yasg-nonfree | 9 | pylint-common | 9 | + pytest-runner | 9 | python-drf-spectacular-sidecar-nonfree | 9 | python-pyld | 9 | + slimit | 9 | todoman | 9 | trac-wysiwyg | 9 | tuna | 9 | - clustershell | 8 | debiancontributors | 8 | flask-paranoid | 8 | flask-session | 8 | httpcode | 8 | + kivy | 8 | pydrive2 | 8 | pytest-django | 8 | - pytest-runner | 8 | python-envs | 8 | python-overpy | 8 | python-pyaml-env | 8 | - slimit | 8 | + python-xdo | 8 | + clustershell | 7 | easyprocess | 7 | mercurial-evolve | 7 | pybik | 7 | pytaglib | 7 | python-versioneer | 7 | - python-xdo | 7 | sphinx-intl | 7 | beancount | 6 | django-model-utils | 6 | hachoir | 6 | kconfiglib | 6 | - kivy | 6 | - mypy-protobuf | 6 | python-ansicolors | 6 | python-numpysane | 6 | python-openstep-plist | 6 | - ruff | 6 | securestring | 6 | + clustershell | 5 | drf-extensions | 5 | flufl.testing | 5 | graphql-relay | 5 | librouteros | 5 | micropython-mpremote | 5 | + mypy-protobuf | 5 | python-biplist | 5 | python-dirq | 5 | - python-jpype | 5 | python-srp | 5 | + ruff | 5 | sorl-thumbnail | 5 | sphinxcontrib-globalsubs | 5 | + voltron | 5 | azote | 4 | - clustershell | 4 | django-jinja | 4 | django-paintstore | 4 | django-pglocks | 4 | @@ -253,13 +253,13 @@ Last-Update: Tue, 03 Jun 2025 01:42:04 +0000 pytest-expect | 4 | python3-onelogin-saml2 | 4 | python-dbus-next | 4 | + python-jpype | 4 | python-networkmanager | 4 | python-pgmagick | 4 | python-simpy | 4 | slimit | 4 | - testrepository | 4 | trac-accountmanager | 4 | - voltron | 4 | + utidylib | 4 | west | 4 | backupchecker | 3 | bootstrap-flask | 3 | @@ -277,8 +277,6 @@ Last-Update: Tue, 03 Jun 2025 01:42:04 +0000 proglog | 3 | pyclamd | 3 | pyfltk | 3 | - pyjunitxml | 3 | - pykwalify | 3 | pyprind | 3 | python-cookies | 3 | python-deepmerge | 3 | @@ -286,6 +284,7 @@ Last-Update: Tue, 03 Jun 2025 01:42:04 +0000 python-django-registration | 3 | python-dynaconf | 3 | python-gnuplotlib | 3 | + python-halo | 3 | python-ipfix | 3 | python-markuppy | 3 | python-netfilterqueue | 3 | @@ -293,9 +292,9 @@ Last-Update: Tue, 03 Jun 2025 01:42:04 +0000 s3ql | 3 | smem | 3 | sphinx-markdown-tables | 3 | + sphinx-paramlinks | 3 | + testrepository | 3 | trac-xmlrpc | 3 | - utidylib | 3 | - vcversioner | 3 | vf1 | 3 | zzzeeksphinx | 3 | aiomysql | 2 | @@ -315,28 +314,30 @@ Last-Update: Tue, 03 Jun 2025 01:42:04 +0000 humanfriendly | 2 | jupyter-sphinx | 2 | korean-lunar-calendar | 2 | + myst-nb | 2 | namecheap | 2 | okasha | 2 | omgifol | 2 | panoramisk | 2 | pycrc | 2 | + pyjunitxml | 2 | + pykwalify | 2 | pypass | 2 | python-bitbucket-api | 2 | python-bottle-sqlite | 2 | - python-btrees | 2 | python-commentjson | 2 | python-django-casclient | 2 | python-django-push-notifications | 2 | python-dnsq | 2 | python-funcy | 2 | - python-halo | 2 | python-libguess | 2 | python-py-zipkin | 2 | python-qtpynodeeditor | 2 | python-text-unidecode | 2 | redis-py-cluster | 2 | - sphinx-paramlinks | 2 | + sphinx-sitemap | 2 | sphinxtesters | 2 | + vcversioner | 2 | vncdotool | 2 | vrfydmn | 2 | wikitrans | 2 | @@ -361,23 +362,21 @@ Last-Update: Tue, 03 Jun 2025 01:42:04 +0000 flask-multistatic | 1 | flask-paginate | 1 | hatch-jupyter-builder | 1 | - jpy | 1 | jsonrpclib-pelix | 1 | mbed-test-wrapper | 1 | milksnake | 1 | mkdocs-macros-plugin | 1 | moviepy | 1 | - myst-nb | 1 | onetimepass | 1 | pacparser | 1 | power | 1 | - pydle | 1 | pynag | 1 | pyroma | 1 | pyssim | 1 | python-aio-pika | 1 | python-banal | 1 | python-bottle-cork | 1 | + python-btrees | 1 | python-chartkick | 1 | python-dataset | 1 | python-ephemeral-port-reserve | 1 | @@ -405,7 +404,6 @@ Last-Update: Tue, 03 Jun 2025 01:42:04 +0000 soundcraft-utils | 1 | sphinx-autorun | 1 | sphinxcontrib-github-alt | 1 | - sphinx-sitemap | 1 | trac-customfieldadmin | 1 | trac-httpauth | 1 | trac-subcomponents | 1 | @@ -460,6 +458,7 @@ Last-Update: Tue, 03 Jun 2025 01:42:04 +0000 humanfriendly | 0 | hypothesis-auto | 0 | ikos | 0 | + jpy | 0 | jpylyzer | 0 | kivy | 0 | libthumbor | 0 | @@ -483,6 +482,7 @@ Last-Update: Tue, 03 Jun 2025 01:42:04 +0000 pyatag | 0 | pydataverse | 0 | pydenticon | 0 | + pydle | 0 | pyeverlights | 0 | pyfg | 0 | pykmtronic | 0 | @@ -492,7 +492,6 @@ Last-Update: Tue, 03 Jun 2025 01:42:04 +0000 pyment | 0 | py-nextbusnext | 0 | pyrad | 0 | - pysequoia | 0 | pyssim | 0 | python3-simpleobsws | 0 | python-aiohttp-security | 0 | @@ -585,13 +584,13 @@ Last-Update: Tue, 03 Jun 2025 01:42:04 +0000 django-cachalot | -1 | ikos | -1 | pyina | -1 | + pysequoia | -1 | python-asv-bench-memray | -1 | python-gfloat | -1 | python-gradientmodel | -1 | python-nxtomomill | -1 | s3ql | -1 | - sphinxcontrib-emojicodes | -1 | symmetrize | -1 | trac-tickettemplate | -1 | -(606 rows) +(605 rows) View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/0dfd07ab0530dbc20c33b0202e6e9c0cefd018f4 -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/0dfd07ab0530dbc20c33b0202e6e9c0cefd018f4 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Wed Jun 4 02:43:27 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Wed, 04 Jun 2025 01:43:27 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <683fa4bf5176b_3db547eaf08266fb@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: 1b720250 by Andreas Tille at 2025-06-04T01:43:23+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Tue, 03 Jun 2025 13:42:04 +0000 +Last-Update: Wed, 04 Jun 2025 01:42:03 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- ===================================== debian-science-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Tue, 03 Jun 2025 13:42:09 +0000 +Last-Update: Wed, 04 Jun 2025 01:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Tue, 03 Jun 2025 13:42:12 +0000 +Last-Update: Wed, 04 Jun 2025 01:42:04 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/1b7202506a0d615c63d3ba94a1edbf244b4bb1e1 -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/1b7202506a0d615c63d3ba94a1edbf244b4bb1e1 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Wed Jun 4 14:43:30 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Wed, 04 Jun 2025 13:43:30 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <68404d82e68ed_3db7e4789401e3@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: 92c8259a by Andreas Tille at 2025-06-04T13:43:24+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,11 +1,11 @@ -Last-Update: Wed, 04 Jun 2025 01:42:03 +0000 +Last-Update: Wed, 04 Jun 2025 13:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- - dicomscope | 26 | {imaging} | - oscar | 16 | {data,practice,tools} | + dicomscope | 28 | {imaging} | mrtrix3 | 15 | {imaging} | orthanc-gdcm | 14 | {imaging} | + oscar | 13 | {data,practice,tools} | pixelmed | 12 | {imaging} | sight | 10 | {imaging} | gnumed-server | 9 | {covid-19,practice} | @@ -17,24 +17,25 @@ Last-Update: Wed, 04 Jun 2025 01:42:03 +0000 mia | 7 | {imaging} | orthanc-postgresql | 7 | {imaging} | icb-utils | 6 | {bio-dev} | - biojava-live | 5 | {bio-dev} | jebl2 | 5 | {bio-dev} | + biojava-live | 4 | {bio-dev} | + pbcopper | 4 | {bio-dev} | ants | 3 | {imaging} | bio-tradis | 3 | {bio,bio-dev} | getdata | 3 | {bio} | - pbcopper | 3 | {bio-dev} | + pbseqlib | 3 | {bio-dev} | piler | 3 | {bio} | plasmidid | 3 | {covid-19,bio} | - staden | 3 | {bio} | beast-mcmc | 2 | {bio,bio-phylogeny} | cmtk | 2 | {imaging} | elastix | 2 | {imaging} | libminc | 2 | {imaging-dev} | libpal-java | 2 | {bio-dev} | - pbseqlib | 2 | {bio-dev} | python-seqcluster | 2 | {covid-19,bio-dev} | + sight | 2 | {imaging} | + staden | 2 | {bio} | tracetuner | 2 | {bio} | - bitseq | 1 | {bio} | + biojava6-live | 1 | {bio-dev} | blimps | 1 | {bio} | brig | 1 | {bio} | cufflinks | 1 | {cloud,bio} | @@ -52,6 +53,7 @@ Last-Update: Wed, 04 Jun 2025 01:42:03 +0000 libctapimkt | 1 | {practice} | libdivsufsort | 1 | {bio-dev} | libgenome | 1 | {bio-dev} | + librg-utils-perl | 1 | {bio} | libxdf | 1 | {imaging-dev} | mssstest | 1 | {tools} | opencfu | 1 | {laboratory} | @@ -61,7 +63,6 @@ Last-Update: Wed, 04 Jun 2025 01:42:03 +0000 rambo-k | 1 | {bio} | seq-gen | 1 | {bio} | sga | 1 | {bio} | - sight | 1 | {imaging} | spread-phy | 1 | {bio-phylogeny,bio} | surankco | 1 | {bio} | surpyvor | 1 | {bio} | @@ -72,7 +73,6 @@ Last-Update: Wed, 04 Jun 2025 01:42:03 +0000 acedb | 0 | {cloud,bio} | bambamc | 0 | {bio-dev} | biojava4-live | 0 | {bio-dev} | - biojava6-live | 0 | {bio-dev} | biosyntax | 0 | {bio} | camp | 0 | {imaging-dev} | capsule-maven-nextflow | 0 | {bio-dev} | @@ -106,7 +106,6 @@ Last-Update: Wed, 04 Jun 2025 01:42:03 +0000 libpsortb | 0 | {bio-dev} | libqes | 0 | {bio-dev} | librdp-taxonomy-tree-java | 0 | {bio-dev} | - librg-utils-perl | 0 | {bio} | libseqlib | 0 | {bio-dev} | libstatgen | 0 | {bio-dev} | libvbz-hdf-plugin | 0 | {bio-dev} | @@ -157,5 +156,5 @@ Last-Update: Wed, 04 Jun 2025 01:42:03 +0000 varscan | 0 | {covid-19,bio} | xxsds-dynamic | 0 | {bio-dev} | tipp | -1 | {covid-19,bio} | -(181 rows) +(180 rows) ===================================== debian-science-tests.txt ===================================== @@ -1,148 +1,149 @@ -Last-Update: Wed, 04 Jun 2025 01:42:04 +0000 +Last-Update: Wed, 04 Jun 2025 13:42:08 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- - gts | 4916 | {viewing} | - nltk | 4741 | {linguistics} | - opencascade | 640 | {simulations} | + gts | 4920 | {viewing} | + nltk | 4767 | {linguistics} | + opencascade | 639 | {simulations} | spacenavd | 229 | {tools} | - open-coarrays | 193 | {meteorology-dev} | - armadillo | 185 | {mathematics-dev} | + open-coarrays | 192 | {meteorology-dev} | + armadillo | 183 | {mathematics-dev} | arpack | 102 | {mathematics-dev} | - ntl | 46 | {mathematics-dev} | - scalapack | 43 | {nanoscale-physics-dev} | - visidata | 37 | {datamanagement} | - mbpoll | 36 | {simulations} | - imview | 35 | {viewing} | + ntl | 45 | {mathematics-dev} | + scalapack | 44 | {nanoscale-physics-dev} | + mbpoll | 38 | {simulations} | + imview | 34 | {viewing} | + visidata | 33 | {datamanagement} | ppl | 31 | {numericalcomputation} | - arduino-mk | 30 | {robotics} | + arduino-mk | 29 | {robotics} | libm4ri | 29 | {mathematics-dev} | - flann | 27 | {mathematics-dev,engineering-dev} | - libmatio | 27 | {mathematics-dev} | - grads | 26 | {meteorology} | - xygrib | 26 | {meteorology} | - cliquer | 25 | {mathematics} | - flintqs | 25 | {mathematics} | - setzer | 23 | {typesetting} | + grads | 27 | {meteorology} | + xygrib | 27 | {meteorology} | + libmatio | 26 | {mathematics-dev} | + setzer | 26 | {typesetting} | + flann | 25 | {mathematics-dev,engineering-dev} | + cliquer | 24 | {mathematics} | + flintqs | 23 | {mathematics} | sat4j | 22 | {logic} | - fftw | 21 | {mathematics-dev,physics-dev,meteorology-dev} | - cliquer | 18 | {mathematics-dev} | - lrcalc | 18 | {mathematics-dev} | + fftw | 20 | {mathematics-dev,physics-dev,meteorology-dev} | + libitpp | 18 | {mathematics-dev,engineering-dev} | + pyzo | 18 | {numericalcomputation} | + cliquer | 17 | {mathematics-dev} | eccodes | 17 | {meteorology,meteorology-dev} | - libitpp | 17 | {mathematics-dev,engineering-dev} | + lrcalc | 17 | {mathematics-dev} | bossa | 16 | {devices} | - pyzo | 16 | {numericalcomputation} | + eccodes | 15 | {meteorology-dev} | gf2x | 15 | {mathematics-dev} | - gts | 15 | {viewing-dev} | iml | 15 | {mathematics-dev} | libhomfly | 15 | {mathematics-dev} | sketch | 15 | {typesetting} | dune-uggrid | 14 | {mathematics-dev} | - eccodes | 14 | {meteorology-dev} | + gts | 14 | {viewing-dev} | libm4rie | 14 | {mathematics-dev} | + teem | 14 | {imageanalysis} | libzn-poly | 13 | {mathematics-dev} | - teem | 13 | {imageanalysis} | feff85exafs | 12 | {chemistry} | + guiqwt | 12 | {numericalcomputation,viewing} | matlab-support | 12 | {mathematics,numericalcomputation} | picosat | 12 | {logic} | ratpoints | 12 | {mathematics-dev} | - guiqwt | 11 | {numericalcomputation,viewing} | - ncl | 11 | {meteorology} | - pcl | 11 | {robotics-dev} | + feedgnuplot | 11 | {viewing} | coinor-symphony | 10 | {logic,mathematics,numericalcomputation} | - feedgnuplot | 10 | {viewing} | + form | 10 | {mathematics} | lxi-tools | 10 | {engineering,dataacquisition} | + ncl | 10 | {meteorology} | ros-rosconsole | 10 | {robotics-dev} | alberta | 9 | {engineering-dev} | - form | 9 | {mathematics} | - geg | 9 | {viewing} | - odc | 9 | {meteorology} | odc | 9 | {meteorology-dev} | + odc | 9 | {meteorology} | + pcl | 9 | {robotics-dev} | refmac-dictionary | 9 | {highenergy-physics-dev,chemistry} | dxsamples | 8 | {nanoscale-physics} | - magics++ | 8 | {meteorology-dev} | + geg | 8 | {viewing} | metar | 8 | {meteorology} | python-cdo | 8 | {meteorology} | vdt | 8 | {mathematics-dev} | + magics++ | 7 | {meteorology-dev} | persalys | 7 | {engineering,statistics,mathematics} | + rheolef | 7 | {mathematics} | + atlas-ecmwf | 6 | {meteorology} | + cld2 | 6 | {linguistics} | coda | 6 | {meteorology} | fpzip | 6 | {meteorology} | - rheolef | 6 | {mathematics} | - rubiks | 6 | {geometry,mathematics} | - ucto | 6 | {linguistics} | + opencascade | 6 | {simulations} | uctodata | 6 | {linguistics} | apophenia | 5 | {statistics} | - atlas-ecmwf | 5 | {meteorology} | - cld2 | 5 | {linguistics} | coda | 5 | {meteorology-dev} | etsf-io | 5 | {physics,nanoscale-physics} | fftw | 5 | {meteorology-dev,mathematics-dev,physics-dev} | libccp4 | 5 | {nanoscale-physics-dev} | + libxsmm | 5 | {mathematics-dev} | metview | 5 | {meteorology} | muparser | 5 | {mathematics-dev} | - opencascade | 5 | {simulations} | persalys | 5 | {statistics,mathematics,engineering} | python-escript | 5 | {numericalcomputation,simulations,engineering} | - auto-07p | 4 | {mathematics} | + rubiks | 5 | {geometry,mathematics} | + toulbar2 | 5 | {logic,numericalcomputation,mathematics,physics} | + ucto | 5 | {linguistics} | debian-science | 4 | {economics,nanoscale-physics,machine-learning,physics,mathematics} | drslib | 4 | {meteorology} | emoslib | 4 | {meteorology-dev} | - getdp | 4 | {engineering,mathematics,simulations} | gsw | 4 | {meteorology} | hdf-eos5 | 4 | {meteorology-dev} | iapws | 4 | {meteorology} | - irstlm | 4 | {linguistics} | libgctp | 4 | {meteorology-dev} | - libxsmm | 4 | {mathematics-dev} | - ncl | 4 | {meteorology-dev} | + lrcalc | 4 | {mathematics} | psurface | 4 | {numericalcomputation} | - qwtplot3d | 4 | {viewing-dev} | ros-vcstool | 4 | {robotics-dev} | - toulbar2 | 4 | {logic,numericalcomputation,mathematics,physics} | + silo-llnl | 4 | {engineering} | urdfdom-headers | 4 | {robotics-dev} | apertium-eval-translator | 3 | {linguistics} | + atlas-ecmwf | 3 | {meteorology-dev} | + auto-07p | 3 | {mathematics} | cmor | 3 | {meteorology} | code-saturne | 3 | {mathematics-dev,engineering-dev} | cylc-flow | 3 | {meteorology} | debian-science | 3 | {physics,machine-learning,economics,nanoscale-physics} | - dimbl | 3 | {linguistics} | dune-functions | 3 | {mathematics-dev} | dune-localfunctions | 3 | {mathematics-dev} | dune-typetree | 3 | {mathematics-dev} | dxflib | 3 | {engineering-dev} | ecbuild | 3 | {meteorology-dev} | emoslib | 3 | {meteorology} | + getdp | 3 | {engineering,mathematics,simulations} | + harp | 3 | {meteorology} | hdf-eos4 | 3 | {meteorology-dev} | hpcc | 3 | {numericalcomputation,distributedcomputing} | + irstlm | 3 | {linguistics} | + libcgns | 3 | {engineering} | libcgns | 3 | {engineering-dev} | libmatheval | 3 | {mathematics} | metkit | 3 | {meteorology} | + ncl | 3 | {meteorology-dev} | polylib | 3 | {mathematics} | + qwtplot3d | 3 | {viewing-dev} | sac2mseed | 3 | {geography} | - silo-llnl | 3 | {engineering-dev} | silo-llnl | 3 | {engineering} | + silo-llnl | 3 | {engineering-dev} | toontag | 3 | {numericalcomputation} | veccore | 3 | {mathematics-dev} | vlfeat | 3 | {imageanalysis-dev} | apophenia | 2 | {statistics} | asl | 2 | {physics-dev} | - atlas-ecmwf | 2 | {meteorology-dev} | + coda | 2 | {meteorology-dev} | code-saturne | 2 | {engineering-dev,mathematics-dev} | coinmp | 2 | {logic,mathematics-dev,numericalcomputation} | - debian-science | 2 | {neuroscience-cognitive} | debian-science | 2 | {nanoscale-physics,statistics,economics,physics} | + debian-science | 2 | {neuroscience-cognitive} | + debian-science | 2 | {economics} | + dimbl | 2 | {linguistics} | fpzip | 2 | {meteorology-dev} | - frog | 2 | {linguistics} | gadap | 2 | {meteorology-dev} | - harp | 2 | {meteorology} | ipe-tools | 2 | {typesetting} | - libcgns | 2 | {engineering} | + libcvd | 2 | {imageanalysis} | liblbfgs | 2 | {mathematics-dev} | libmatheval | 2 | {mathematics-dev} | libvigraimpex | 2 | {imageanalysis-dev,machine-learning} | - lrcalc | 2 | {mathematics} | - mbt | 2 | {linguistics} | - mbtserver | 2 | {linguistics} | metkit | 2 | {meteorology-dev} | mpi4py-fft | 2 | {mathematics-dev} | mrmpi | 2 | {tools} | @@ -156,11 +157,8 @@ Last-Update: Wed, 04 Jun 2025 01:42:04 +0000 sardana | 2 | {dataacquisition} | scram | 2 | {engineering} | sdpb | 2 | {numericalcomputation,highenergy-physics} | - silo-llnl | 2 | {engineering} | spaghetti | 2 | {geography} | syrthes | 2 | {engineering} | - timbl | 2 | {linguistics} | - timblserver | 2 | {linguistics} | toon | 2 | {numericalcomputation} | trilinos | 2 | {physics-dev,mathematics-dev,engineering-dev} | x13as | 2 | {economics} | @@ -170,26 +168,26 @@ Last-Update: Wed, 04 Jun 2025 01:42:04 +0000 clhep | 1 | {highenergy-physics-dev} | clipper | 1 | {nanoscale-physics-dev} | cmor | 1 | {meteorology-dev} | - coda | 1 | {meteorology-dev} | coinor-bonmin | 1 | {mathematics} | - debian-science | 1 | {economics} | debian-science | 1 | {electrophysiology} | debian-science | 1 | {nanoscale-physics-dev} | debian-science | 1 | {neuroscience-cognitive,machine-learning} | - debian-science | 1 | {psychophysics} | debian-science | 1 | {tools} | + debian-science | 1 | {psychophysics} | fastjet | 1 | {highenergy-physics-dev} | + frog | 1 | {linguistics} | frogdata | 1 | {linguistics} | hepmc3 | 1 | {nanoscale-physics-dev,highenergy-physics-dev} | jeuclid | 1 | {viewing,typesetting} | libcvd | 1 | {imageanalysis-dev} | - libcvd | 1 | {imageanalysis} | libgtkdatabox | 1 | {engineering-dev,viewing-dev} | liblxi | 1 | {engineering-dev,dataacquisition-dev} | liborigin2 | 1 | {viewing-dev} | looptools | 1 | {highenergy-physics-dev} | looptools | 1 | {highenergy-physics} | magma | 1 | {mathematics-dev,numericalcomputation} | + mbt | 1 | {linguistics} | + mbtserver | 1 | {linguistics} | mmdb | 1 | {nanoscale-physics-dev,highenergy-physics-dev} | mseed2sac | 1 | {dataacquisition-dev} | nrn-iv | 1 | {biology} | @@ -197,10 +195,13 @@ Last-Update: Wed, 04 Jun 2025 01:42:04 +0000 openctm | 1 | {physics-dev} | opengv | 1 | {geometry} | openmesh | 1 | {mathematics-dev} | + psurface | 1 | {numericalcomputation} | schroedinger-coordgenlibs | 1 | {nanoscale-physics-dev,chemistry} | siscone | 1 | {highenergy-physics-dev} | spfft | 1 | {mathematics-dev,nanoscale-physics-dev,physics-dev,meteorology-dev} | ssm | 1 | {nanoscale-physics-dev} | + timbl | 1 | {linguistics} | + timblserver | 1 | {linguistics} | tulip | 1 | {viewing-dev} | amgcl | 0 | {mathematics-dev} | apertium-afr-nld | 0 | {linguistics} | @@ -232,12 +233,11 @@ Last-Update: Wed, 04 Jun 2025 01:42:04 +0000 mbt | 0 | {linguistics} | mctc-lib | 0 | {nanoscale-physics-dev,highenergy-physics-dev} | meshsdfilter | 0 | {mathematics-dev} | - metis-edf | 0 | {engineering-dev} | metis-edf | 0 | {engineering,numericalcomputation} | + metis-edf | 0 | {engineering-dev} | neartree | 0 | {mathematics-dev,numericalcomputation} | opengv | 0 | {geometry} | openigtlink | 0 | {robotics-dev} | - psurface | 0 | {numericalcomputation} | python-escript | 0 | {numericalcomputation,simulations,engineering} | python-opcodes | 0 | {tools} | qrupdate | 0 | {mathematics-dev} | ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,199 +1,197 @@ -Last-Update: Wed, 04 Jun 2025 01:42:04 +0000 +Last-Update: Wed, 04 Jun 2025 13:42:11 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- - mpmath | 10242 | - python-repoze.lru | 6985 | - netifaces | 5157 | - ghp-import | 4696 | - python-lunr | 4689 | - python-babel | 4285 | - sortedcontainers | 3857 | - python-babel | 3736 | - aiosignal | 2936 | - hyperlink | 2177 | - python-notify2 | 2034 | + mpmath | 10272 | + python-repoze.lru | 6988 | + netifaces | 5179 | + ghp-import | 4720 | + python-lunr | 4714 | + python-babel | 4309 | + sortedcontainers | 3885 | + python-babel | 3751 | + aiosignal | 2942 | + hyperlink | 2166 | + python-notify2 | 2032 | humanfriendly | 1916 | - referencing | 1788 | - python-mysqldb | 1504 | - python-pandocfilters | 1446 | - python-gssapi | 1416 | - python-invoke | 1414 | - python-hyperframe | 1362 | - websocket-client | 1325 | - python-hpack | 1153 | - python-rsa | 1133 | - pdfarranger | 1034 | - menulibre | 953 | - python-linux-procfs | 940 | - python-zopfli | 912 | - python-geoip | 894 | - autopep8 | 863 | - python-webob | 841 | - pytoolconfig | 788 | - firmware-microbit-micropython | 768 | - powerline | 733 | - powerline | 729 | + referencing | 1768 | + python-mysqldb | 1501 | + python-pandocfilters | 1458 | + python-gssapi | 1420 | + python-invoke | 1408 | + python-hyperframe | 1355 | + websocket-client | 1332 | + python-hpack | 1148 | + python-rsa | 1127 | + pdfarranger | 1037 | + menulibre | 962 | + python-linux-procfs | 941 | + python-zopfli | 894 | + python-geoip | 889 | + autopep8 | 881 | + python-webob | 840 | + pytoolconfig | 805 | + firmware-microbit-micropython | 771 | + powerline | 726 | powerline | 723 | - kazam | 701 | - u-msgpack-python | 632 | - gaupol | 559 | - dockerpty | 527 | - asn1crypto | 513 | - python-gevent | 510 | - python-et-xmlfile | 496 | - catfish | 445 | - python-ewmh | 439 | + powerline | 720 | + kazam | 698 | + u-msgpack-python | 629 | + gaupol | 561 | + dockerpty | 529 | + asn1crypto | 506 | + python-gevent | 505 | + python-et-xmlfile | 497 | + catfish | 444 | + python-ewmh | 443 | python-requests-oauthlib | 411 | - python-toml | 378 | - spf-engine | 339 | - python-ntlm-auth | 319 | - spf-engine | 292 | + python-toml | 381 | + spf-engine | 337 | + python-ntlm-auth | 317 | + spf-engine | 291 | django-stronghold | 259 | - cairocffi | 229 | - python-ldap3 | 224 | - python-mimeparse | 196 | - python-smmap | 173 | - python-hidapi | 172 | - httpie | 157 | - autokey | 156 | - smem | 142 | - python-anyjson | 141 | - kivy | 131 | - python-aiostream | 118 | + cairocffi | 225 | + python-ldap3 | 225 | + python-mimeparse | 195 | + python-smmap | 176 | + python-hidapi | 170 | + autokey | 158 | + httpie | 155 | + smem | 143 | + python-anyjson | 140 | + kivy | 130 | + python-aiostream | 120 | smartypants | 115 | - nodeenv | 109 | - mugshot | 107 | - python-pyu2f | 103 | - python-click-repl | 102 | + mugshot | 108 | + nodeenv | 108 | + python-click-repl | 105 | + python-pyu2f | 102 | timekpr-next | 102 | - pacparser | 100 | - lollypop | 99 | + pacparser | 101 | mypaint | 99 | - python-consul | 91 | - pymacaroons | 88 | - pssh | 85 | - pymediainfo | 85 | - python-colour | 82 | - python-rfc6555 | 76 | - python-i3ipc | 71 | - numpy-stl | 69 | - python-pykka | 68 | + lollypop | 96 | + python-consul | 93 | + pymacaroons | 87 | + pymediainfo | 86 | + python-colour | 85 | + pssh | 84 | + python-rfc6555 | 77 | + numpy-stl | 70 | + python-i3ipc | 69 | + python-pykka | 69 | weasyprint | 68 | - mitmproxy | 67 | + mitmproxy | 66 | fabric | 62 | python-uritools | 60 | ueberzug | 59 | - pywavelets | 56 | - python-scp | 55 | + pywavelets | 58 | + python-scp | 56 | mysql-connector-python | 51 | - itstool | 50 | - python-looseversion | 50 | - show-in-file-manager | 49 | - trac | 46 | - blockdiag | 45 | + show-in-file-manager | 51 | + itstool | 48 | + python-looseversion | 48 | + trac | 45 | + blockdiag | 44 | khard | 44 | + pyenv | 44 | sshtunnel | 43 | - hatchling | 41 | - membernator | 41 | - pyenv | 41 | - pyquery | 41 | + hatchling | 42 | + pyquery | 40 | certipy | 39 | + membernator | 39 | pamela | 39 | - pylibmc | 39 | jupyterhub | 38 | - persepolis | 35 | - powerline-gitstatus | 34 | + pylibmc | 38 | + persepolis | 36 | pymacs | 34 | - python-pysol-cards | 31 | + powerline-gitstatus | 32 | dkimpy-milter | 30 | pssh | 30 | python-scrypt | 30 | python-statsd | 30 | - pdfposter | 29 | python-args | 29 | - sphinxcontrib-blockdiag | 28 | + python-pysol-cards | 27 | seqdiag | 27 | + sphinxcontrib-blockdiag | 27 | + pdfposter | 26 | rst2pdf | 26 | sphinxcontrib-seqdiag | 26 | - sphinx-inline-tabs | 26 | + backoff | 25 | python-clint | 25 | + sphinx-inline-tabs | 25 | video-downloader | 25 | webpy | 25 | - backoff | 24 | typogrify | 24 | flask-principal | 23 | - ruff | 22 | cppman | 21 | depthcharge-tools | 21 | - fabric | 21 | nwdiag | 21 | python-zstd | 21 | alot | 20 | + fabric | 20 | python-fire | 20 | - python-sdnotify | 20 | + python-rangehttpserver | 20 | + ruff | 20 | webtest | 20 | enzyme | 19 | - python-rangehttpserver | 19 | + python-sdnotify | 19 | spf-engine | 19 | actdiag | 18 | - python-simpy | 18 | python-translationstring | 18 | - sphinxcontrib-log-cabinet | 18 | subliminal | 18 | - django-environ | 17 | - gtextfsm | 17 | + mistune0 | 17 | nwg-displays | 17 | python-priority | 17 | + python-simpy | 17 | social-auth-core | 17 | sphinxcontrib-actdiag | 17 | + sphinxcontrib-log-cabinet | 17 | subliminal | 17 | - mistune0 | 16 | + django-environ | 16 | + gtextfsm | 16 | + python-inotify | 16 | sphinxcontrib-nwdiag | 16 | policyd-rate-limit | 15 | python-dbussy | 15 | python-demjson | 15 | python-hupper | 15 | - python-inotify | 15 | python-kyotocabinet | 15 | python-pysubs2 | 15 | ansi | 14 | - python-pem | 14 | python-pyalsa | 14 | python-pyrss2gen | 14 | python-xtermcolor | 14 | - pdm | 13 | pykwalify | 13 | + pyp | 13 | python-crcelk | 13 | python-ethtool | 13 | + python-pem | 13 | python-slip10 | 13 | unearth | 13 | - autotiling | 12 | btchip-python | 12 | gmplot | 12 | junos-eznc | 12 | notebook-shim | 12 | - pyp | 12 | + pdm | 12 | txt2tags | 12 | + autotiling | 11 | python-pyscss | 11 | - traittypes | 11 | - beancount | 10 | django-auditlog | 10 | flask-security | 10 | - jschema-to-python | 10 | pwntools | 10 | python-aiohttp-security | 10 | python-digitalocean | 10 | python-parse-type | 10 | - python-sarif-python-om | 10 | + slimit | 10 | speaklater | 10 | + traittypes | 10 | + beancount | 9 | django-sass | 9 | drf-yasg-nonfree | 9 | + pydrive2 | 9 | pylint-common | 9 | - pytest-runner | 9 | python-drf-spectacular-sidecar-nonfree | 9 | python-pyld | 9 | - slimit | 9 | todoman | 9 | trac-wysiwyg | 9 | tuna | 9 | @@ -201,39 +199,41 @@ Last-Update: Wed, 04 Jun 2025 01:42:04 +0000 flask-paranoid | 8 | flask-session | 8 | httpcode | 8 | + jschema-to-python | 8 | kivy | 8 | - pydrive2 | 8 | + pybik | 8 | pytest-django | 8 | + pytest-runner | 8 | python-envs | 8 | python-overpy | 8 | python-pyaml-env | 8 | + python-sarif-python-om | 8 | python-xdo | 8 | clustershell | 7 | easyprocess | 7 | mercurial-evolve | 7 | - pybik | 7 | pytaglib | 7 | + python-openstep-plist | 7 | python-versioneer | 7 | sphinx-intl | 7 | beancount | 6 | django-model-utils | 6 | hachoir | 6 | kconfiglib | 6 | + mypy-protobuf | 6 | python-ansicolors | 6 | python-numpysane | 6 | - python-openstep-plist | 6 | securestring | 6 | clustershell | 5 | - drf-extensions | 5 | flufl.testing | 5 | graphql-relay | 5 | + htmlmin | 5 | librouteros | 5 | micropython-mpremote | 5 | - mypy-protobuf | 5 | + numpy-stl | 5 | python-biplist | 5 | python-dirq | 5 | python-srp | 5 | - ruff | 5 | sorl-thumbnail | 5 | sphinxcontrib-globalsubs | 5 | voltron | 5 | @@ -241,6 +241,7 @@ Last-Update: Wed, 04 Jun 2025 01:42:04 +0000 django-jinja | 4 | django-paintstore | 4 | django-pglocks | 4 | + drf-extensions | 4 | drf-haystack | 4 | etm | 4 | htmlmin | 4 | @@ -257,12 +258,12 @@ Last-Update: Wed, 04 Jun 2025 01:42:04 +0000 python-networkmanager | 4 | python-pgmagick | 4 | python-simpy | 4 | - slimit | 4 | + ruff | 4 | trac-accountmanager | 4 | utidylib | 4 | west | 4 | + aiomysql | 3 | backupchecker | 3 | - bootstrap-flask | 3 | cram | 3 | django-ckeditor | 3 | django-js-reverse | 3 | @@ -271,8 +272,6 @@ Last-Update: Wed, 04 Jun 2025 01:42:04 +0000 django-xmlrpc | 3 | extension-helpers | 3 | flask-api | 3 | - jpylyzer | 3 | - numpy-stl | 3 | orsopy | 3 | proglog | 3 | pyclamd | 3 | @@ -290,18 +289,18 @@ Last-Update: Wed, 04 Jun 2025 01:42:04 +0000 python-netfilterqueue | 3 | requests-aws | 3 | s3ql | 3 | + slimit | 3 | smem | 3 | sphinx-markdown-tables | 3 | - sphinx-paramlinks | 3 | testrepository | 3 | trac-xmlrpc | 3 | vf1 | 3 | zzzeeksphinx | 3 | - aiomysql | 2 | + bootstrap-flask | 2 | brebis | 2 | + cplay-ng | 2 | django-ajax-selects | 2 | django-bitfield | 2 | - django-cacheops | 2 | django-macaddress | 2 | django-pagination | 2 | django-render-block | 2 | @@ -312,9 +311,9 @@ Last-Update: Wed, 04 Jun 2025 01:42:04 +0000 fypp | 2 | gtkman | 2 | humanfriendly | 2 | + jpylyzer | 2 | jupyter-sphinx | 2 | korean-lunar-calendar | 2 | - myst-nb | 2 | namecheap | 2 | okasha | 2 | omgifol | 2 | @@ -325,31 +324,29 @@ Last-Update: Wed, 04 Jun 2025 01:42:04 +0000 pypass | 2 | python-bitbucket-api | 2 | python-bottle-sqlite | 2 | + python-chartkick | 2 | python-commentjson | 2 | python-django-casclient | 2 | python-django-push-notifications | 2 | python-dnsq | 2 | - python-funcy | 2 | + python-ephemeral-port-reserve | 2 | python-libguess | 2 | python-py-zipkin | 2 | python-qtpynodeeditor | 2 | python-text-unidecode | 2 | redis-py-cluster | 2 | - sphinx-sitemap | 2 | - sphinxtesters | 2 | + sphinx-paramlinks | 2 | vcversioner | 2 | vncdotool | 2 | vrfydmn | 2 | wikitrans | 2 | apkinspector | 1 | - beangulp | 1 | - beanquery | 1 | bqplot | 1 | celery-progress | 1 | codicefiscale | 1 | - cplay-ng | 1 | django-any-js | 1 | django-cachalot | 1 | + django-cacheops | 1 | django-celery-email | 1 | django-cleanup | 1 | django-graphene | 1 | @@ -357,7 +354,6 @@ Last-Update: Wed, 04 Jun 2025 01:42:04 +0000 django-yarnpkg | 1 | enlighten | 1 | errbot | 1 | - fava | 1 | flask-flatpages | 1 | flask-multistatic | 1 | flask-paginate | 1 | @@ -367,6 +363,7 @@ Last-Update: Wed, 04 Jun 2025 01:42:04 +0000 milksnake | 1 | mkdocs-macros-plugin | 1 | moviepy | 1 | + myst-nb | 1 | onetimepass | 1 | pacparser | 1 | power | 1 | @@ -377,10 +374,9 @@ Last-Update: Wed, 04 Jun 2025 01:42:04 +0000 python-banal | 1 | python-bottle-cork | 1 | python-btrees | 1 | - python-chartkick | 1 | python-dataset | 1 | - python-ephemeral-port-reserve | 1 | python-fudge | 1 | + python-funcy | 1 | python-gammu | 1 | python-getdns | 1 | python-gfloat | 1 | @@ -395,7 +391,6 @@ Last-Update: Wed, 04 Jun 2025 01:42:04 +0000 python-schedutils | 1 | python-sphinx-examples | 1 | python-spur | 1 | - python-tatsu-lts | 1 | python-undetected-chromedriver | 1 | python-urlobject | 1 | python-vega-datasets | 1 | @@ -404,6 +399,8 @@ Last-Update: Wed, 04 Jun 2025 01:42:04 +0000 soundcraft-utils | 1 | sphinx-autorun | 1 | sphinxcontrib-github-alt | 1 | + sphinx-sitemap | 1 | + sphinxtesters | 1 | trac-customfieldadmin | 1 | trac-httpauth | 1 | trac-subcomponents | 1 | @@ -421,7 +418,9 @@ Last-Update: Wed, 04 Jun 2025 01:42:04 +0000 alot | 0 | aptly-api-client | 0 | beangrow | 0 | + beangulp | 0 | beanprice | 0 | + beanquery | 0 | bootstrap-flask | 0 | cairocffi | 0 | celery-haystack-ng | 0 | @@ -442,6 +441,7 @@ Last-Update: Wed, 04 Jun 2025 01:42:04 +0000 enlighten | 0 | escapism | 0 | faadelays | 0 | + fava | 0 | firmware-microbit-micropython | 0 | fivem-api | 0 | flake8-pytest | 0 | @@ -556,6 +556,7 @@ Last-Update: Wed, 04 Jun 2025 01:42:04 +0000 python-socketpool | 0 | python-sphinx-examples | 0 | python-tatsu | 0 | + python-tatsu-lts | 0 | python-webdavclient | 0 | python-webob | 0 | python-wither | 0 | @@ -590,7 +591,8 @@ Last-Update: Wed, 04 Jun 2025 01:42:04 +0000 python-gradientmodel | -1 | python-nxtomomill | -1 | s3ql | -1 | + sphinxcontrib-emojicodes | -1 | symmetrize | -1 | trac-tickettemplate | -1 | -(605 rows) +(607 rows) View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/92c8259a52cee4cac42cb86b5c1f0dda2ecbf57a -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/92c8259a52cee4cac42cb86b5c1f0dda2ecbf57a You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Wed Jun 4 15:29:10 2025 From: gitlab at salsa.debian.org (Shengqi Chen (@harry)) Date: Wed, 04 Jun 2025 14:29:10 +0000 Subject: [med-svn] [Git][med-team/spdlog][master] 4 commits: New upstream version 1.15.3+ds Message-ID: <684058361b67d_3db544e0a894924d@godard.mail> Shengqi Chen pushed to branch master at Debian Med / spdlog Commits: fa417995 by Shengqi Chen at 2025-06-04T16:48:44+08:00 New upstream version 1.15.3+ds - - - - - 86b62191 by Shengqi Chen at 2025-06-04T16:48:44+08:00 Update upstream source from tag 'upstream/1.15.3+ds' Update to upstream version '1.15.3+ds' with Debian dir 92d80e65a026454a4437a77deec0150e82a578ae - - - - - 0d680371 by Shengqi Chen at 2025-06-04T22:27:34+08:00 d/patches: refresh and fix compilation with fmtlib10 Signed-off-by: Shengqi Chen - - - - - 2d6584fa by Shengqi Chen at 2025-06-04T22:28:51+08:00 Gbp-Dch: update and upload 1.15.3+ds-1 to unstable Signed-off-by: Shengqi Chen - - - - - 36 changed files: - CMakeLists.txt - README.md - cmake/pch.h.in - debian/changelog - debian/patches/use-external-fmt.patch - example/example.cpp - include/spdlog/async.h - include/spdlog/async_logger-inl.h - include/spdlog/common.h - include/spdlog/details/os-inl.h - include/spdlog/details/registry-inl.h - include/spdlog/details/registry.h - include/spdlog/details/thread_pool-inl.h - include/spdlog/fmt/bin_to_hex.h - include/spdlog/fmt/fmt.h - include/spdlog/mdc.h - include/spdlog/sinks/ansicolor_sink-inl.h - include/spdlog/sinks/callback_sink.h - include/spdlog/sinks/dup_filter_sink.h - include/spdlog/sinks/rotating_file_sink-inl.h - include/spdlog/sinks/rotating_file_sink.h - include/spdlog/sinks/wincolor_sink-inl.h - include/spdlog/spdlog-inl.h - include/spdlog/spdlog.h - include/spdlog/tweakme.h - include/spdlog/version.h - src/bundled_fmtlib_format.cpp - tests/CMakeLists.txt - tests/test_custom_callbacks.cpp - tests/test_daily_logger.cpp - tests/test_file_logging.cpp - tests/test_misc.cpp - tests/test_pattern_formatter.cpp - tests/test_registry.cpp - tests/test_sink.h - tests/utils.cpp The diff was not included because it is too large. View it on GitLab: https://salsa.debian.org/med-team/spdlog/-/compare/70e4dccdcc54501f1856992b9dd2a4a48d6ac630...2d6584fa6895e0d62af81b388cd10781e6fda0d3 -- View it on GitLab: https://salsa.debian.org/med-team/spdlog/-/compare/70e4dccdcc54501f1856992b9dd2a4a48d6ac630...2d6584fa6895e0d62af81b388cd10781e6fda0d3 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Wed Jun 4 15:29:13 2025 From: gitlab at salsa.debian.org (Shengqi Chen (@harry)) Date: Wed, 04 Jun 2025 14:29:13 +0000 Subject: [med-svn] [Git][med-team/spdlog] Pushed new tag debian/1%1.15.3+ds-1 Message-ID: <68405839ec2b_3db22161a89501d3@godard.mail> Shengqi Chen pushed new tag debian/1%1.15.3+ds-1 at Debian Med / spdlog -- View it on GitLab: https://salsa.debian.org/med-team/spdlog/-/tree/debian/1%251.15.3+ds-1 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Wed Jun 4 15:29:13 2025 From: gitlab at salsa.debian.org (Shengqi Chen (@harry)) Date: Wed, 04 Jun 2025 14:29:13 +0000 Subject: [med-svn] [Git][med-team/spdlog] Pushed new tag upstream/1.15.3+ds Message-ID: <68405839d4a4b_3db1d5e688950475@godard.mail> Shengqi Chen pushed new tag upstream/1.15.3+ds at Debian Med / spdlog -- View it on GitLab: https://salsa.debian.org/med-team/spdlog/-/tree/upstream/1.15.3+ds You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Wed Jun 4 15:29:11 2025 From: gitlab at salsa.debian.org (Shengqi Chen (@harry)) Date: Wed, 04 Jun 2025 14:29:11 +0000 Subject: [med-svn] [Git][med-team/spdlog][pristine-tar] pristine-tar data for spdlog_1.15.3+ds.orig.tar.xz Message-ID: <68405837152e8_3db507be3094956e@godard.mail> Shengqi Chen pushed to branch pristine-tar at Debian Med / spdlog Commits: 5ae19a18 by Shengqi Chen at 2025-06-04T16:48:44+08:00 pristine-tar data for spdlog_1.15.3+ds.orig.tar.xz - - - - - 2 changed files: - + spdlog_1.15.3+ds.orig.tar.xz.delta - + spdlog_1.15.3+ds.orig.tar.xz.id Changes: ===================================== spdlog_1.15.3+ds.orig.tar.xz.delta ===================================== Binary files /dev/null and b/spdlog_1.15.3+ds.orig.tar.xz.delta differ ===================================== spdlog_1.15.3+ds.orig.tar.xz.id ===================================== @@ -0,0 +1 @@ +2d0bbd2d02da6d6c32ceb58e01416a1687d472f8 View it on GitLab: https://salsa.debian.org/med-team/spdlog/-/commit/5ae19a18709ea2653243d84f47ffdf93c492f138 -- View it on GitLab: https://salsa.debian.org/med-team/spdlog/-/commit/5ae19a18709ea2653243d84f47ffdf93c492f138 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Wed Jun 4 15:29:12 2025 From: gitlab at salsa.debian.org (Shengqi Chen (@harry)) Date: Wed, 04 Jun 2025 14:29:12 +0000 Subject: [med-svn] [Git][med-team/spdlog][upstream] New upstream version 1.15.3+ds Message-ID: <6840583817a2f_3db3a717ac9498c1@godard.mail> Shengqi Chen pushed to branch upstream at Debian Med / spdlog Commits: fa417995 by Shengqi Chen at 2025-06-04T16:48:44+08:00 New upstream version 1.15.3+ds - - - - - 34 changed files: - CMakeLists.txt - README.md - cmake/pch.h.in - example/example.cpp - include/spdlog/async.h - include/spdlog/async_logger-inl.h - include/spdlog/common.h - include/spdlog/details/os-inl.h - include/spdlog/details/registry-inl.h - include/spdlog/details/registry.h - include/spdlog/details/thread_pool-inl.h - include/spdlog/fmt/bin_to_hex.h - include/spdlog/fmt/fmt.h - include/spdlog/mdc.h - include/spdlog/sinks/ansicolor_sink-inl.h - include/spdlog/sinks/callback_sink.h - include/spdlog/sinks/dup_filter_sink.h - include/spdlog/sinks/rotating_file_sink-inl.h - include/spdlog/sinks/rotating_file_sink.h - include/spdlog/sinks/wincolor_sink-inl.h - include/spdlog/spdlog-inl.h - include/spdlog/spdlog.h - include/spdlog/tweakme.h - include/spdlog/version.h - src/bundled_fmtlib_format.cpp - tests/CMakeLists.txt - tests/test_custom_callbacks.cpp - tests/test_daily_logger.cpp - tests/test_file_logging.cpp - tests/test_misc.cpp - tests/test_pattern_formatter.cpp - tests/test_registry.cpp - tests/test_sink.h - tests/utils.cpp The diff was not included because it is too large. View it on GitLab: https://salsa.debian.org/med-team/spdlog/-/commit/fa417995d38c6e247814a9510dbc6ae66fa31f50 -- View it on GitLab: https://salsa.debian.org/med-team/spdlog/-/commit/fa417995d38c6e247814a9510dbc6ae66fa31f50 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Thu Jun 5 02:43:26 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Thu, 05 Jun 2025 01:43:26 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <6840f63ee35ef_3db224e3c810351da@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: 5bc0c68a by Andreas Tille at 2025-06-05T01:43:22+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Wed, 04 Jun 2025 13:42:04 +0000 +Last-Update: Thu, 05 Jun 2025 01:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- ===================================== debian-science-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Wed, 04 Jun 2025 13:42:08 +0000 +Last-Update: Thu, 05 Jun 2025 01:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Wed, 04 Jun 2025 13:42:11 +0000 +Last-Update: Thu, 05 Jun 2025 01:42:04 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/5bc0c68a222128f22c0751f7b91bb524c325e2be -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/5bc0c68a222128f22c0751f7b91bb524c325e2be You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Thu Jun 5 14:43:38 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Thu, 05 Jun 2025 13:43:38 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <68419f0a5861d_3db7e4781106450@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: a3c2d20d by Andreas Tille at 2025-06-05T13:43:30+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,36 +1,37 @@ -Last-Update: Thu, 05 Jun 2025 01:42:04 +0000 +Last-Update: Thu, 05 Jun 2025 13:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- - dicomscope | 28 | {imaging} | + dicomscope | 29 | {imaging} | mrtrix3 | 15 | {imaging} | orthanc-gdcm | 14 | {imaging} | - oscar | 13 | {data,practice,tools} | + oscar | 12 | {data,practice,tools} | pixelmed | 12 | {imaging} | - sight | 10 | {imaging} | gnumed-server | 9 | {covid-19,practice} | orthanc-mysql | 9 | {imaging} | + sight | 9 | {imaging} | bart-view | 8 | {imaging} | adun.app | 7 | {bio} | heudiconv | 7 | {imaging} | king | 7 | {typesetting,imaging} | mia | 7 | {imaging} | orthanc-postgresql | 7 | {imaging} | - icb-utils | 6 | {bio-dev} | + icb-utils | 5 | {bio-dev} | jebl2 | 5 | {bio-dev} | biojava-live | 4 | {bio-dev} | pbcopper | 4 | {bio-dev} | - ants | 3 | {imaging} | bio-tradis | 3 | {bio,bio-dev} | getdata | 3 | {bio} | + libminc | 3 | {imaging-dev} | pbseqlib | 3 | {bio-dev} | piler | 3 | {bio} | - plasmidid | 3 | {covid-19,bio} | + ants | 2 | {imaging} | beast-mcmc | 2 | {bio,bio-phylogeny} | cmtk | 2 | {imaging} | elastix | 2 | {imaging} | - libminc | 2 | {imaging-dev} | + insighttoolkit5 | 2 | {imaging-dev} | libpal-java | 2 | {bio-dev} | + plasmidid | 2 | {covid-19,bio} | python-seqcluster | 2 | {covid-19,bio-dev} | sight | 2 | {imaging} | staden | 2 | {bio} | @@ -43,7 +44,6 @@ Last-Update: Thu, 05 Jun 2025 01:42:04 +0000 emboss-explorer | 1 | {bio} | fastml | 1 | {bio} | hinge | 1 | {bio} | - insighttoolkit5 | 1 | {imaging-dev} | ipig | 1 | {bio} | jmodeltest | 1 | {bio,bio-phylogeny} | lamarc | 1 | {bio} | @@ -60,7 +60,6 @@ Last-Update: Thu, 05 Jun 2025 01:42:04 +0000 papyrus | 1 | {imaging-dev} | phyutility | 1 | {cloud,bio} | proalign | 1 | {bio-phylogeny,bio} | - rambo-k | 1 | {bio} | seq-gen | 1 | {bio} | sga | 1 | {bio} | spread-phy | 1 | {bio-phylogeny,bio} | @@ -132,14 +131,15 @@ Last-Update: Thu, 05 Jun 2025 01:42:04 +0000 python-cgelib | 0 | {bio-dev} | python-seqcluster | 0 | {bio} | qcumber | 0 | {bio} | + rambo-k | 0 | {bio} | rdp-alignment | 0 | {bio} | rdp-classifier | 0 | {bio} | resfinder-db | 0 | {bio} | rtax | 0 | {cloud,bio} | runcircos-gui | 0 | {bio} | saint | 0 | {bio} | - savvy | 0 | {bio-dev} | savvy | 0 | {bio} | + savvy | 0 | {bio-dev} | sbmltoolbox | 0 | {bio-dev} | sibsim4 | 0 | {cloud,bio} | sift | 0 | {bio} | ===================================== debian-science-tests.txt ===================================== @@ -1,78 +1,78 @@ -Last-Update: Thu, 05 Jun 2025 01:42:04 +0000 +Last-Update: Thu, 05 Jun 2025 13:42:08 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- - gts | 4920 | {viewing} | - nltk | 4767 | {linguistics} | - opencascade | 639 | {simulations} | + gts | 4937 | {viewing} | + nltk | 4774 | {linguistics} | + opencascade | 642 | {simulations} | spacenavd | 229 | {tools} | open-coarrays | 192 | {meteorology-dev} | - armadillo | 183 | {mathematics-dev} | - arpack | 102 | {mathematics-dev} | - ntl | 45 | {mathematics-dev} | - scalapack | 44 | {nanoscale-physics-dev} | - mbpoll | 38 | {simulations} | + armadillo | 188 | {mathematics-dev} | + arpack | 99 | {mathematics-dev} | + ntl | 46 | {mathematics-dev} | + scalapack | 43 | {nanoscale-physics-dev} | + mbpoll | 39 | {simulations} | imview | 34 | {viewing} | - visidata | 33 | {datamanagement} | + visidata | 34 | {datamanagement} | ppl | 31 | {numericalcomputation} | arduino-mk | 29 | {robotics} | libm4ri | 29 | {mathematics-dev} | grads | 27 | {meteorology} | - xygrib | 27 | {meteorology} | libmatio | 26 | {mathematics-dev} | setzer | 26 | {typesetting} | - flann | 25 | {mathematics-dev,engineering-dev} | - cliquer | 24 | {mathematics} | + xygrib | 26 | {meteorology} | + flann | 24 | {mathematics-dev,engineering-dev} | + cliquer | 23 | {mathematics} | flintqs | 23 | {mathematics} | sat4j | 22 | {logic} | fftw | 20 | {mathematics-dev,physics-dev,meteorology-dev} | libitpp | 18 | {mathematics-dev,engineering-dev} | - pyzo | 18 | {numericalcomputation} | + lrcalc | 18 | {mathematics-dev} | cliquer | 17 | {mathematics-dev} | - eccodes | 17 | {meteorology,meteorology-dev} | - lrcalc | 17 | {mathematics-dev} | bossa | 16 | {devices} | - eccodes | 15 | {meteorology-dev} | + eccodes | 16 | {meteorology,meteorology-dev} | + pyzo | 16 | {numericalcomputation} | gf2x | 15 | {mathematics-dev} | iml | 15 | {mathematics-dev} | libhomfly | 15 | {mathematics-dev} | sketch | 15 | {typesetting} | - dune-uggrid | 14 | {mathematics-dev} | + teem | 15 | {imageanalysis} | gts | 14 | {viewing-dev} | libm4rie | 14 | {mathematics-dev} | - teem | 14 | {imageanalysis} | + dune-uggrid | 13 | {mathematics-dev} | + eccodes | 13 | {meteorology-dev} | + guiqwt | 13 | {numericalcomputation,viewing} | libzn-poly | 13 | {mathematics-dev} | + picosat | 13 | {logic} | feff85exafs | 12 | {chemistry} | - guiqwt | 12 | {numericalcomputation,viewing} | matlab-support | 12 | {mathematics,numericalcomputation} | - picosat | 12 | {logic} | + ncl | 12 | {meteorology} | ratpoints | 12 | {mathematics-dev} | feedgnuplot | 11 | {viewing} | coinor-symphony | 10 | {logic,mathematics,numericalcomputation} | form | 10 | {mathematics} | lxi-tools | 10 | {engineering,dataacquisition} | - ncl | 10 | {meteorology} | ros-rosconsole | 10 | {robotics-dev} | alberta | 9 | {engineering-dev} | - odc | 9 | {meteorology-dev} | - odc | 9 | {meteorology} | - pcl | 9 | {robotics-dev} | - refmac-dictionary | 9 | {highenergy-physics-dev,chemistry} | + python-cdo | 9 | {meteorology} | + vdt | 9 | {mathematics-dev} | dxsamples | 8 | {nanoscale-physics} | geg | 8 | {viewing} | metar | 8 | {meteorology} | - python-cdo | 8 | {meteorology} | - vdt | 8 | {mathematics-dev} | - magics++ | 7 | {meteorology-dev} | + odc | 8 | {meteorology-dev} | + odc | 8 | {meteorology} | + pcl | 8 | {robotics-dev} | persalys | 7 | {engineering,statistics,mathematics} | + refmac-dictionary | 7 | {highenergy-physics-dev,chemistry} | rheolef | 7 | {mathematics} | + apophenia | 6 | {statistics} | atlas-ecmwf | 6 | {meteorology} | - cld2 | 6 | {linguistics} | coda | 6 | {meteorology} | fpzip | 6 | {meteorology} | + magics++ | 6 | {meteorology-dev} | opencascade | 6 | {simulations} | uctodata | 6 | {linguistics} | - apophenia | 5 | {statistics} | + cld2 | 5 | {linguistics} | coda | 5 | {meteorology-dev} | etsf-io | 5 | {physics,nanoscale-physics} | fftw | 5 | {meteorology-dev,mathematics-dev,physics-dev} | @@ -80,11 +80,15 @@ Last-Update: Thu, 05 Jun 2025 01:42:04 +0000 libxsmm | 5 | {mathematics-dev} | metview | 5 | {meteorology} | muparser | 5 | {mathematics-dev} | + ncl | 5 | {meteorology-dev} | persalys | 5 | {statistics,mathematics,engineering} | + psurface | 5 | {numericalcomputation} | python-escript | 5 | {numericalcomputation,simulations,engineering} | + ros-vcstool | 5 | {robotics-dev} | rubiks | 5 | {geometry,mathematics} | toulbar2 | 5 | {logic,numericalcomputation,mathematics,physics} | ucto | 5 | {linguistics} | + cmor | 4 | {meteorology} | debian-science | 4 | {economics,nanoscale-physics,machine-learning,physics,mathematics} | drslib | 4 | {meteorology} | emoslib | 4 | {meteorology-dev} | @@ -93,14 +97,10 @@ Last-Update: Thu, 05 Jun 2025 01:42:04 +0000 iapws | 4 | {meteorology} | libgctp | 4 | {meteorology-dev} | lrcalc | 4 | {mathematics} | - psurface | 4 | {numericalcomputation} | - ros-vcstool | 4 | {robotics-dev} | silo-llnl | 4 | {engineering} | urdfdom-headers | 4 | {robotics-dev} | - apertium-eval-translator | 3 | {linguistics} | atlas-ecmwf | 3 | {meteorology-dev} | auto-07p | 3 | {mathematics} | - cmor | 3 | {meteorology} | code-saturne | 3 | {mathematics-dev,engineering-dev} | cylc-flow | 3 | {meteorology} | debian-science | 3 | {physics,machine-learning,economics,nanoscale-physics} | @@ -108,35 +108,35 @@ Last-Update: Thu, 05 Jun 2025 01:42:04 +0000 dune-localfunctions | 3 | {mathematics-dev} | dune-typetree | 3 | {mathematics-dev} | dxflib | 3 | {engineering-dev} | - ecbuild | 3 | {meteorology-dev} | emoslib | 3 | {meteorology} | getdp | 3 | {engineering,mathematics,simulations} | harp | 3 | {meteorology} | hdf-eos4 | 3 | {meteorology-dev} | hpcc | 3 | {numericalcomputation,distributedcomputing} | + ipe-tools | 3 | {typesetting} | irstlm | 3 | {linguistics} | libcgns | 3 | {engineering} | libcgns | 3 | {engineering-dev} | libmatheval | 3 | {mathematics} | metkit | 3 | {meteorology} | - ncl | 3 | {meteorology-dev} | - polylib | 3 | {mathematics} | qwtplot3d | 3 | {viewing-dev} | sac2mseed | 3 | {geography} | - silo-llnl | 3 | {engineering} | + sardana | 3 | {dataacquisition} | silo-llnl | 3 | {engineering-dev} | toontag | 3 | {numericalcomputation} | veccore | 3 | {mathematics-dev} | vlfeat | 3 | {imageanalysis-dev} | + apache-opennlp | 2 | {linguistics} | + apertium-eval-translator | 2 | {linguistics} | apophenia | 2 | {statistics} | asl | 2 | {physics-dev} | coda | 2 | {meteorology-dev} | code-saturne | 2 | {engineering-dev,mathematics-dev} | - coinmp | 2 | {logic,mathematics-dev,numericalcomputation} | - debian-science | 2 | {nanoscale-physics,statistics,economics,physics} | debian-science | 2 | {neuroscience-cognitive} | debian-science | 2 | {economics} | + debian-science | 2 | {nanoscale-physics,statistics,economics,physics} | dimbl | 2 | {linguistics} | + ecbuild | 2 | {meteorology-dev} | fpzip | 2 | {meteorology-dev} | gadap | 2 | {meteorology-dev} | ipe-tools | 2 | {typesetting} | @@ -147,14 +147,15 @@ Last-Update: Thu, 05 Jun 2025 01:42:04 +0000 metkit | 2 | {meteorology-dev} | mpi4py-fft | 2 | {mathematics-dev} | mrmpi | 2 | {tools} | + mseed2sac | 2 | {dataacquisition-dev} | ncrystal | 2 | {nanoscale-physics-dev,highenergy-physics-dev} | newmat | 2 | {mathematics-dev} | + nrn-iv | 2 | {biology} | openstereogram | 2 | {tools} | + polylib | 2 | {mathematics} | python-aws-xray-sdk | 2 | {dataacquisition-dev} | - qd | 2 | {mathematics-dev} | ros-ros-environment | 2 | {robotics-dev} | sagemath-database-conway-polynomials | 2 | {mathematics} | - sardana | 2 | {dataacquisition} | scram | 2 | {engineering} | sdpb | 2 | {numericalcomputation,highenergy-physics} | spaghetti | 2 | {geography} | @@ -162,18 +163,18 @@ Last-Update: Thu, 05 Jun 2025 01:42:04 +0000 toon | 2 | {numericalcomputation} | trilinos | 2 | {physics-dev,mathematics-dev,engineering-dev} | x13as | 2 | {economics} | - apache-opennlp | 1 | {linguistics} | apertium-streamparser | 1 | {linguistics} | ckon | 1 | {highenergy-physics-dev} | clhep | 1 | {highenergy-physics-dev} | clipper | 1 | {nanoscale-physics-dev} | cmor | 1 | {meteorology-dev} | + coinmp | 1 | {logic,mathematics-dev,numericalcomputation} | coinor-bonmin | 1 | {mathematics} | + debian-science | 1 | {tools} | + debian-science | 1 | {psychophysics} | debian-science | 1 | {electrophysiology} | debian-science | 1 | {nanoscale-physics-dev} | debian-science | 1 | {neuroscience-cognitive,machine-learning} | - debian-science | 1 | {tools} | - debian-science | 1 | {psychophysics} | fastjet | 1 | {highenergy-physics-dev} | frog | 1 | {linguistics} | frogdata | 1 | {linguistics} | @@ -189,13 +190,12 @@ Last-Update: Thu, 05 Jun 2025 01:42:04 +0000 mbt | 1 | {linguistics} | mbtserver | 1 | {linguistics} | mmdb | 1 | {nanoscale-physics-dev,highenergy-physics-dev} | - mseed2sac | 1 | {dataacquisition-dev} | - nrn-iv | 1 | {biology} | nrn-mod2c | 1 | {biology} | openctm | 1 | {physics-dev} | opengv | 1 | {geometry} | openmesh | 1 | {mathematics-dev} | psurface | 1 | {numericalcomputation} | + qd | 1 | {mathematics-dev} | schroedinger-coordgenlibs | 1 | {nanoscale-physics-dev,chemistry} | siscone | 1 | {highenergy-physics-dev} | spfft | 1 | {mathematics-dev,nanoscale-physics-dev,physics-dev,meteorology-dev} | @@ -244,8 +244,8 @@ Last-Update: Thu, 05 Jun 2025 01:42:04 +0000 quadrule | 0 | {mathematics-dev} | robot-testing-framework | 0 | {robotics-dev} | ros-collada-urdf | 0 | {robotics} | - ros-metapackages | 0 | {robotics} | ros-metapackages | 0 | {robotics-dev} | + ros-metapackages | 0 | {robotics} | ros-opencv-apps | 0 | {robotics} | sagemath-database-combinatorial-designs | 0 | {mathematics} | sagemath-database-cremona-elliptic-curves | 0 | {mathematics} | ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,260 +1,261 @@ -Last-Update: Thu, 05 Jun 2025 01:42:04 +0000 +Last-Update: Thu, 05 Jun 2025 13:42:11 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- - mpmath | 10272 | - python-repoze.lru | 6988 | - netifaces | 5179 | - ghp-import | 4720 | - python-lunr | 4714 | - python-babel | 4309 | + mpmath | 10271 | + python-repoze.lru | 6977 | + netifaces | 5169 | + ghp-import | 4726 | + python-lunr | 4719 | + python-babel | 4295 | sortedcontainers | 3885 | - python-babel | 3751 | - aiosignal | 2942 | - hyperlink | 2166 | - python-notify2 | 2032 | - humanfriendly | 1916 | - referencing | 1768 | - python-mysqldb | 1501 | - python-pandocfilters | 1458 | - python-gssapi | 1420 | - python-invoke | 1408 | - python-hyperframe | 1355 | - websocket-client | 1332 | - python-hpack | 1148 | - python-rsa | 1127 | - pdfarranger | 1037 | - menulibre | 962 | - python-linux-procfs | 941 | - python-zopfli | 894 | - python-geoip | 889 | - autopep8 | 881 | - python-webob | 840 | - pytoolconfig | 805 | - firmware-microbit-micropython | 771 | - powerline | 726 | - powerline | 723 | + python-babel | 3748 | + aiosignal | 2930 | + hyperlink | 2161 | + python-notify2 | 2033 | + humanfriendly | 1918 | + referencing | 1766 | + python-mysqldb | 1506 | + python-pandocfilters | 1467 | + python-gssapi | 1415 | + python-invoke | 1392 | + python-hyperframe | 1361 | + websocket-client | 1341 | + python-hpack | 1155 | + python-rsa | 1126 | + pdfarranger | 1038 | + menulibre | 957 | + python-linux-procfs | 937 | + python-geoip | 894 | + python-zopfli | 891 | + autopep8 | 886 | + python-webob | 833 | + pytoolconfig | 809 | + firmware-microbit-micropython | 773 | powerline | 720 | - kazam | 698 | - u-msgpack-python | 629 | - gaupol | 561 | - dockerpty | 529 | - asn1crypto | 506 | + powerline | 718 | + powerline | 714 | + kazam | 691 | + u-msgpack-python | 636 | + gaupol | 567 | + dockerpty | 527 | + asn1crypto | 508 | python-gevent | 505 | - python-et-xmlfile | 497 | - catfish | 444 | - python-ewmh | 443 | + python-et-xmlfile | 501 | + catfish | 445 | + python-ewmh | 441 | python-requests-oauthlib | 411 | - python-toml | 381 | + python-toml | 385 | spf-engine | 337 | - python-ntlm-auth | 317 | + python-ntlm-auth | 319 | spf-engine | 291 | - django-stronghold | 259 | - cairocffi | 225 | - python-ldap3 | 225 | - python-mimeparse | 195 | + django-stronghold | 260 | + cairocffi | 229 | + python-ldap3 | 226 | + python-mimeparse | 194 | python-smmap | 176 | python-hidapi | 170 | - autokey | 158 | - httpie | 155 | + autokey | 159 | + httpie | 157 | + python-anyjson | 145 | smem | 143 | - python-anyjson | 140 | kivy | 130 | - python-aiostream | 120 | - smartypants | 115 | - mugshot | 108 | - nodeenv | 108 | - python-click-repl | 105 | - python-pyu2f | 102 | - timekpr-next | 102 | + python-aiostream | 121 | + smartypants | 113 | + nodeenv | 110 | + mugshot | 106 | + python-click-repl | 103 | pacparser | 101 | - mypaint | 99 | - lollypop | 96 | - python-consul | 93 | - pymacaroons | 87 | - pymediainfo | 86 | - python-colour | 85 | - pssh | 84 | + python-pyu2f | 101 | + mypaint | 100 | + timekpr-next | 100 | + lollypop | 99 | + python-consul | 96 | + pssh | 87 | + pymacaroons | 85 | + pymediainfo | 84 | + python-colour | 80 | python-rfc6555 | 77 | - numpy-stl | 70 | - python-i3ipc | 69 | - python-pykka | 69 | - weasyprint | 68 | - mitmproxy | 66 | + numpy-stl | 72 | + python-pykka | 70 | + mitmproxy | 69 | + python-i3ipc | 67 | + weasyprint | 66 | + python-uritools | 63 | fabric | 62 | - python-uritools | 60 | - ueberzug | 59 | - pywavelets | 58 | - python-scp | 56 | - mysql-connector-python | 51 | - show-in-file-manager | 51 | + ueberzug | 60 | + pywavelets | 59 | + python-scp | 55 | + mysql-connector-python | 50 | itstool | 48 | python-looseversion | 48 | + show-in-file-manager | 47 | + pyenv | 45 | trac | 45 | blockdiag | 44 | - khard | 44 | - pyenv | 44 | - sshtunnel | 43 | - hatchling | 42 | - pyquery | 40 | + hatchling | 44 | + khard | 43 | + sshtunnel | 42 | certipy | 39 | - membernator | 39 | pamela | 39 | jupyterhub | 38 | - pylibmc | 38 | + membernator | 38 | + pyquery | 38 | + pylibmc | 37 | persepolis | 36 | - pymacs | 34 | - powerline-gitstatus | 32 | + pymacs | 35 | + powerline-gitstatus | 33 | + python-scrypt | 33 | + pssh | 31 | dkimpy-milter | 30 | - pssh | 30 | - python-scrypt | 30 | python-statsd | 30 | - python-args | 29 | - python-pysol-cards | 27 | + python-args | 28 | + python-pysol-cards | 28 | + pdfposter | 27 | seqdiag | 27 | sphinxcontrib-blockdiag | 27 | - pdfposter | 26 | - rst2pdf | 26 | + video-downloader | 27 | sphinxcontrib-seqdiag | 26 | backoff | 25 | - python-clint | 25 | - sphinx-inline-tabs | 25 | - video-downloader | 25 | + rst2pdf | 25 | webpy | 25 | - typogrify | 24 | - flask-principal | 23 | + flask-principal | 24 | + python-clint | 24 | + sphinx-inline-tabs | 24 | + typogrify | 22 | cppman | 21 | depthcharge-tools | 21 | nwdiag | 21 | python-zstd | 21 | alot | 20 | + enzyme | 20 | fabric | 20 | - python-fire | 20 | python-rangehttpserver | 20 | ruff | 20 | webtest | 20 | - enzyme | 19 | - python-sdnotify | 19 | + python-fire | 19 | spf-engine | 19 | + subliminal | 19 | actdiag | 18 | + mistune0 | 18 | + python-sdnotify | 18 | python-translationstring | 18 | - subliminal | 18 | - mistune0 | 17 | + social-auth-core | 18 | + django-environ | 17 | nwg-displays | 17 | - python-priority | 17 | python-simpy | 17 | - social-auth-core | 17 | sphinxcontrib-actdiag | 17 | sphinxcontrib-log-cabinet | 17 | subliminal | 17 | - django-environ | 16 | gtextfsm | 16 | python-inotify | 16 | + python-kyotocabinet | 16 | + python-priority | 16 | + python-pyalsa | 16 | + python-pysubs2 | 16 | sphinxcontrib-nwdiag | 16 | policyd-rate-limit | 15 | - python-dbussy | 15 | - python-demjson | 15 | python-hupper | 15 | - python-kyotocabinet | 15 | - python-pysubs2 | 15 | ansi | 14 | - python-pyalsa | 14 | + python-dbussy | 14 | + python-demjson | 14 | python-pyrss2gen | 14 | + python-slip10 | 14 | python-xtermcolor | 14 | pykwalify | 13 | pyp | 13 | - python-crcelk | 13 | - python-ethtool | 13 | python-pem | 13 | - python-slip10 | 13 | - unearth | 13 | + autotiling | 12 | btchip-python | 12 | - gmplot | 12 | junos-eznc | 12 | notebook-shim | 12 | - pdm | 12 | + pwntools | 12 | + python-crcelk | 12 | + python-ethtool | 12 | + python-pyscss | 12 | txt2tags | 12 | - autotiling | 11 | - python-pyscss | 11 | + unearth | 12 | + flask-security | 11 | + gmplot | 11 | + pdm | 11 | + speaklater | 11 | django-auditlog | 10 | - flask-security | 10 | - pwntools | 10 | + django-sass | 10 | + drf-yasg-nonfree | 10 | + flask-session | 10 | + pylint-common | 10 | python-aiohttp-security | 10 | - python-digitalocean | 10 | python-parse-type | 10 | slimit | 10 | - speaklater | 10 | traittypes | 10 | - beancount | 9 | - django-sass | 9 | - drf-yasg-nonfree | 9 | + pybik | 9 | pydrive2 | 9 | - pylint-common | 9 | + pytest-runner | 9 | + python-digitalocean | 9 | python-drf-spectacular-sidecar-nonfree | 9 | - python-pyld | 9 | todoman | 9 | trac-wysiwyg | 9 | tuna | 9 | + beancount | 8 | debiancontributors | 8 | flask-paranoid | 8 | - flask-session | 8 | httpcode | 8 | - jschema-to-python | 8 | - kivy | 8 | - pybik | 8 | pytest-django | 8 | - pytest-runner | 8 | - python-envs | 8 | python-overpy | 8 | python-pyaml-env | 8 | - python-sarif-python-om | 8 | + python-pyld | 8 | python-xdo | 8 | clustershell | 7 | easyprocess | 7 | + jschema-to-python | 7 | + kivy | 7 | mercurial-evolve | 7 | pytaglib | 7 | + python-envs | 7 | python-openstep-plist | 7 | + python-sarif-python-om | 7 | python-versioneer | 7 | sphinx-intl | 7 | - beancount | 6 | django-model-utils | 6 | + django-pglocks | 6 | + drf-extensions | 6 | hachoir | 6 | - kconfiglib | 6 | + htmlmin | 6 | + librouteros | 6 | mypy-protobuf | 6 | + python3-onelogin-saml2 | 6 | python-ansicolors | 6 | python-numpysane | 6 | securestring | 6 | + beancount | 5 | clustershell | 5 | + django-paintstore | 5 | + drf-haystack | 5 | flufl.testing | 5 | graphql-relay | 5 | - htmlmin | 5 | - librouteros | 5 | + kconfiglib | 5 | micropython-mpremote | 5 | numpy-stl | 5 | - python-biplist | 5 | + pycallgraph | 5 | python-dirq | 5 | + python-jpype | 5 | python-srp | 5 | sorl-thumbnail | 5 | sphinxcontrib-globalsubs | 5 | voltron | 5 | azote | 4 | django-jinja | 4 | - django-paintstore | 4 | - django-pglocks | 4 | - drf-extensions | 4 | - drf-haystack | 4 | etm | 4 | htmlmin | 4 | imap-tools | 4 | logilab-constraint | 4 | panoramisk | 4 | - pycallgraph | 4 | pyjokes | 4 | pynliner | 4 | pytest-expect | 4 | - python3-onelogin-saml2 | 4 | + python-biplist | 4 | python-dbus-next | 4 | - python-jpype | 4 | + python-markuppy | 4 | python-networkmanager | 4 | python-pgmagick | 4 | python-simpy | 4 | @@ -264,30 +265,37 @@ Last-Update: Thu, 05 Jun 2025 01:42:04 +0000 west | 4 | aiomysql | 3 | backupchecker | 3 | + bootstrap-flask | 3 | cram | 3 | + django-bitfield | 3 | django-ckeditor | 3 | django-js-reverse | 3 | + django-macaddress | 3 | + django-pagination | 3 | django-redis-sessions | 3 | + django-render-block | 3 | django-simple-redis-admin | 3 | + django-templated-email | 3 | django-xmlrpc | 3 | extension-helpers | 3 | flask-api | 3 | + flask-mongoengine | 3 | orsopy | 3 | proglog | 3 | pyclamd | 3 | - pyfltk | 3 | pyprind | 3 | - python-cookies | 3 | + python-btrees | 3 | python-deepmerge | 3 | + python-django-casclient | 3 | python-django-contact-form | 3 | + python-django-push-notifications | 3 | python-django-registration | 3 | python-dynaconf | 3 | python-gnuplotlib | 3 | python-halo | 3 | python-ipfix | 3 | - python-markuppy | 3 | python-netfilterqueue | 3 | - requests-aws | 3 | + python-text-unidecode | 3 | s3ql | 3 | slimit | 3 | smem | 3 | @@ -296,45 +304,47 @@ Last-Update: Thu, 05 Jun 2025 01:42:04 +0000 trac-xmlrpc | 3 | vf1 | 3 | zzzeeksphinx | 3 | - bootstrap-flask | 2 | brebis | 2 | cplay-ng | 2 | - django-ajax-selects | 2 | - django-bitfield | 2 | - django-macaddress | 2 | - django-pagination | 2 | - django-render-block | 2 | - django-templated-email | 2 | + django-any-js | 2 | + django-cachalot | 2 | + django-cacheops | 2 | + django-celery-email | 2 | + django-cleanup | 2 | + django-graphene | 2 | + django-maintenance-mode | 2 | + django-yarnpkg | 2 | dotdrop | 2 | flake8-black | 2 | - flask-mongoengine | 2 | + flask-flatpages | 2 | + flask-paginate | 2 | fypp | 2 | gtkman | 2 | + hatch-jupyter-builder | 2 | humanfriendly | 2 | jpylyzer | 2 | - jupyter-sphinx | 2 | korean-lunar-calendar | 2 | namecheap | 2 | okasha | 2 | omgifol | 2 | panoramisk | 2 | pycrc | 2 | + pyfltk | 2 | pyjunitxml | 2 | pykwalify | 2 | - pypass | 2 | python-bitbucket-api | 2 | - python-bottle-sqlite | 2 | python-chartkick | 2 | python-commentjson | 2 | - python-django-casclient | 2 | - python-django-push-notifications | 2 | - python-dnsq | 2 | + python-cookies | 2 | python-ephemeral-port-reserve | 2 | + python-funcy | 2 | + python-gammu | 2 | python-libguess | 2 | - python-py-zipkin | 2 | + python-openshift | 2 | + python-opentracing | 2 | python-qtpynodeeditor | 2 | - python-text-unidecode | 2 | redis-py-cluster | 2 | + requests-aws | 2 | sphinx-paramlinks | 2 | vcversioner | 2 | vncdotool | 2 | @@ -343,22 +353,12 @@ Last-Update: Thu, 05 Jun 2025 01:42:04 +0000 apkinspector | 1 | bqplot | 1 | celery-progress | 1 | - codicefiscale | 1 | - django-any-js | 1 | - django-cachalot | 1 | - django-cacheops | 1 | - django-celery-email | 1 | - django-cleanup | 1 | - django-graphene | 1 | - django-maintenance-mode | 1 | - django-yarnpkg | 1 | + django-ajax-selects | 1 | enlighten | 1 | errbot | 1 | - flask-flatpages | 1 | - flask-multistatic | 1 | - flask-paginate | 1 | - hatch-jupyter-builder | 1 | + jpy | 1 | jsonrpclib-pelix | 1 | + jupyter-sphinx | 1 | mbed-test-wrapper | 1 | milksnake | 1 | mkdocs-macros-plugin | 1 | @@ -367,17 +367,15 @@ Last-Update: Thu, 05 Jun 2025 01:42:04 +0000 onetimepass | 1 | pacparser | 1 | power | 1 | - pynag | 1 | + pypass | 1 | + pyrad | 1 | pyroma | 1 | pyssim | 1 | python-aio-pika | 1 | python-banal | 1 | - python-bottle-cork | 1 | - python-btrees | 1 | + python-bottle-sqlite | 1 | python-dataset | 1 | - python-fudge | 1 | - python-funcy | 1 | - python-gammu | 1 | + python-dnsq | 1 | python-getdns | 1 | python-gfloat | 1 | python-kanboard | 1 | @@ -385,8 +383,8 @@ Last-Update: Thu, 05 Jun 2025 01:42:04 +0000 python-noise | 1 | python-openid-cla | 1 | python-openqa-client | 1 | - python-opentracing | 1 | python-pysubs2 | 1 | + python-py-zipkin | 1 | python-rdflib-endpoint | 1 | python-schedutils | 1 | python-sphinx-examples | 1 | @@ -424,6 +422,7 @@ Last-Update: Thu, 05 Jun 2025 01:42:04 +0000 bootstrap-flask | 0 | cairocffi | 0 | celery-haystack-ng | 0 | + codicefiscale | 0 | colorthief | 0 | concurrent-log-handler | 0 | customidenticon | 0 | @@ -446,6 +445,7 @@ Last-Update: Thu, 05 Jun 2025 01:42:04 +0000 fivem-api | 0 | flake8-pytest | 0 | flask-flatpages | 0 | + flask-multistatic | 0 | flask-paginate | 0 | flask-security | 0 | flask-session | 0 | @@ -458,7 +458,6 @@ Last-Update: Thu, 05 Jun 2025 01:42:04 +0000 humanfriendly | 0 | hypothesis-auto | 0 | ikos | 0 | - jpy | 0 | jpylyzer | 0 | kivy | 0 | libthumbor | 0 | @@ -490,8 +489,8 @@ Last-Update: Thu, 05 Jun 2025 01:42:04 +0000 pylint-celery | 0 | pymediainfo | 0 | pyment | 0 | + pynag | 0 | py-nextbusnext | 0 | - pyrad | 0 | pyssim | 0 | python3-simpleobsws | 0 | python-aiohttp-security | 0 | @@ -501,6 +500,7 @@ Last-Update: Thu, 05 Jun 2025 01:42:04 +0000 python-babel | 0 | python-betterproto | 0 | python-bottle-beaker | 0 | + python-bottle-cork | 0 | python-briefcase | 0 | python-broadlink | 0 | python-brother-ql | 0 | View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/a3c2d20d86e8dbb8bae93c60d40498afac03cfac -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/a3c2d20d86e8dbb8bae93c60d40498afac03cfac You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Thu Jun 5 21:25:10 2025 From: gitlab at salsa.debian.org (=?UTF-8?B?w4l0aWVubmUgTW9sbGllciAoQGVtb2xsaWVyKQ==?=) Date: Thu, 05 Jun 2025 20:25:10 +0000 Subject: [med-svn] [Git][med-team/tao-json][pristine-tar] pristine-tar data for tao-json_1.0.0~beta14+really0.0+git20200604.f357d72.orig.tar.xz Message-ID: <6841fd267b684_3db507be3013337e6@godard.mail> ?tienne Mollier pushed to branch pristine-tar at Debian Med / tao-json Commits: a017b7e3 by ?tienne Mollier at 2025-06-05T21:05:10+02:00 pristine-tar data for tao-json_1.0.0~beta14+really0.0+git20200604.f357d72.orig.tar.xz - - - - - 2 changed files: - + tao-json_1.0.0~beta14+really0.0+git20200604.f357d72.orig.tar.xz.delta - + tao-json_1.0.0~beta14+really0.0+git20200604.f357d72.orig.tar.xz.id Changes: ===================================== tao-json_1.0.0~beta14+really0.0+git20200604.f357d72.orig.tar.xz.delta ===================================== Binary files /dev/null and b/tao-json_1.0.0~beta14+really0.0+git20200604.f357d72.orig.tar.xz.delta differ ===================================== tao-json_1.0.0~beta14+really0.0+git20200604.f357d72.orig.tar.xz.id ===================================== @@ -0,0 +1 @@ +c5909fcac3ea290f0d71cd4c82b99ea464c88fc4 View it on GitLab: https://salsa.debian.org/med-team/tao-json/-/commit/a017b7e3f40753f9a4a867ef07969ea801c31fad -- View it on GitLab: https://salsa.debian.org/med-team/tao-json/-/commit/a017b7e3f40753f9a4a867ef07969ea801c31fad You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Thu Jun 5 21:25:12 2025 From: gitlab at salsa.debian.org (=?UTF-8?B?w4l0aWVubmUgTW9sbGllciAoQGVtb2xsaWVyKQ==?=) Date: Thu, 05 Jun 2025 20:25:12 +0000 Subject: [med-svn] [Git][med-team/tao-json] Pushed new branch debian/unstable Message-ID: <6841fd28cea64_3db1d5cab813340c@godard.mail> ?tienne Mollier pushed new branch debian/unstable at Debian Med / tao-json -- View it on GitLab: https://salsa.debian.org/med-team/tao-json/-/tree/debian/unstable You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Thu Jun 5 21:25:26 2025 From: gitlab at salsa.debian.org (=?UTF-8?B?w4l0aWVubmUgTW9sbGllciAoQGVtb2xsaWVyKQ==?=) Date: Thu, 05 Jun 2025 20:25:26 +0000 Subject: [med-svn] [Git][med-team/tao-json] Pushed new tag upstream/1.0.0_beta14+really0.0+git20200604.f357d72 Message-ID: <6841fd36625fd_3db1d5e68813343d3@godard.mail> ?tienne Mollier pushed new tag upstream/1.0.0_beta14+really0.0+git20200604.f357d72 at Debian Med / tao-json -- View it on GitLab: https://salsa.debian.org/med-team/tao-json/-/tree/upstream/1.0.0_beta14+really0.0+git20200604.f357d72 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Thu Jun 5 23:04:48 2025 From: gitlab at salsa.debian.org (=?UTF-8?B?w4l0aWVubmUgTW9sbGllciAoQGVtb2xsaWVyKQ==?=) Date: Thu, 05 Jun 2025 22:04:48 +0000 Subject: [med-svn] [Git][med-team/tao-json] Pushed new tag archive/debian/1.0.0_beta14+really0.0+git20200604.f357d72-1 Message-ID: <68421480d7f6d_3db22161a813522c0@godard.mail> ?tienne Mollier pushed new tag archive/debian/1.0.0_beta14+really0.0+git20200604.f357d72-1 at Debian Med / tao-json -- View it on GitLab: https://salsa.debian.org/med-team/tao-json/-/tree/archive/debian/1.0.0_beta14+really0.0+git20200604.f357d72-1 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Thu Jun 5 23:04:50 2025 From: gitlab at salsa.debian.org (=?UTF-8?B?w4l0aWVubmUgTW9sbGllciAoQGVtb2xsaWVyKQ==?=) Date: Thu, 05 Jun 2025 22:04:50 +0000 Subject: [med-svn] [Git][med-team/tao-json] Pushed new tag debian/1.0.0_beta14+really0.0+git20200604.f357d72-1 Message-ID: <684214822d03d_3db1d4832413525ed@godard.mail> ?tienne Mollier pushed new tag debian/1.0.0_beta14+really0.0+git20200604.f357d72-1 at Debian Med / tao-json -- View it on GitLab: https://salsa.debian.org/med-team/tao-json/-/tree/debian/1.0.0_beta14+really0.0+git20200604.f357d72-1 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Fri Jun 6 02:43:52 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Fri, 06 Jun 2025 01:43:52 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <684247d83097_3db8002be0138149@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: 14ed05e0 by Andreas Tille at 2025-06-06T01:43:14+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Thu, 05 Jun 2025 13:42:04 +0000 +Last-Update: Fri, 06 Jun 2025 01:42:03 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- ===================================== debian-science-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Thu, 05 Jun 2025 13:42:08 +0000 +Last-Update: Fri, 06 Jun 2025 01:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Thu, 05 Jun 2025 13:42:11 +0000 +Last-Update: Fri, 06 Jun 2025 01:42:04 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/14ed05e0cb5a6fcb27df573bfba021df87c0d1e3 -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/14ed05e0cb5a6fcb27df573bfba021df87c0d1e3 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Fri Jun 6 14:43:35 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Fri, 06 Jun 2025 13:43:35 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <6842f087a377b_3db8ace04c1462236@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: 3bcb3bbf by Andreas Tille at 2025-06-06T13:43:27+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,32 +1,32 @@ -Last-Update: Fri, 06 Jun 2025 01:42:03 +0000 +Last-Update: Fri, 06 Jun 2025 13:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- dicomscope | 29 | {imaging} | - mrtrix3 | 15 | {imaging} | - orthanc-gdcm | 14 | {imaging} | + orthanc-gdcm | 15 | {imaging} | + mrtrix3 | 14 | {imaging} | oscar | 12 | {data,practice,tools} | - pixelmed | 12 | {imaging} | - gnumed-server | 9 | {covid-19,practice} | - orthanc-mysql | 9 | {imaging} | + pixelmed | 11 | {imaging} | + gnumed-server | 10 | {covid-19,practice} | + orthanc-mysql | 10 | {imaging} | sight | 9 | {imaging} | bart-view | 8 | {imaging} | + king | 8 | {typesetting,imaging} | + orthanc-postgresql | 8 | {imaging} | adun.app | 7 | {bio} | - heudiconv | 7 | {imaging} | - king | 7 | {typesetting,imaging} | - mia | 7 | {imaging} | - orthanc-postgresql | 7 | {imaging} | + heudiconv | 6 | {imaging} | + jebl2 | 6 | {bio-dev} | + mia | 6 | {imaging} | + biojava-live | 5 | {bio-dev} | icb-utils | 5 | {bio-dev} | - jebl2 | 5 | {bio-dev} | - biojava-live | 4 | {bio-dev} | pbcopper | 4 | {bio-dev} | + beast-mcmc | 3 | {bio,bio-phylogeny} | bio-tradis | 3 | {bio,bio-dev} | getdata | 3 | {bio} | libminc | 3 | {imaging-dev} | pbseqlib | 3 | {bio-dev} | piler | 3 | {bio} | ants | 2 | {imaging} | - beast-mcmc | 2 | {bio,bio-phylogeny} | cmtk | 2 | {imaging} | elastix | 2 | {imaging} | insighttoolkit5 | 2 | {imaging-dev} | @@ -60,6 +60,7 @@ Last-Update: Fri, 06 Jun 2025 01:42:03 +0000 papyrus | 1 | {imaging-dev} | phyutility | 1 | {cloud,bio} | proalign | 1 | {bio-phylogeny,bio} | + rambo-k | 1 | {bio} | seq-gen | 1 | {bio} | sga | 1 | {bio} | spread-phy | 1 | {bio-phylogeny,bio} | @@ -131,15 +132,14 @@ Last-Update: Fri, 06 Jun 2025 01:42:03 +0000 python-cgelib | 0 | {bio-dev} | python-seqcluster | 0 | {bio} | qcumber | 0 | {bio} | - rambo-k | 0 | {bio} | rdp-alignment | 0 | {bio} | rdp-classifier | 0 | {bio} | resfinder-db | 0 | {bio} | rtax | 0 | {cloud,bio} | runcircos-gui | 0 | {bio} | saint | 0 | {bio} | - savvy | 0 | {bio} | savvy | 0 | {bio-dev} | + savvy | 0 | {bio} | sbmltoolbox | 0 | {bio-dev} | sibsim4 | 0 | {cloud,bio} | sift | 0 | {bio} | ===================================== debian-science-tests.txt ===================================== @@ -1,79 +1,79 @@ -Last-Update: Fri, 06 Jun 2025 01:42:04 +0000 +Last-Update: Fri, 06 Jun 2025 13:42:09 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- - gts | 4937 | {viewing} | - nltk | 4774 | {linguistics} | - opencascade | 642 | {simulations} | - spacenavd | 229 | {tools} | - open-coarrays | 192 | {meteorology-dev} | - armadillo | 188 | {mathematics-dev} | - arpack | 99 | {mathematics-dev} | - ntl | 46 | {mathematics-dev} | - scalapack | 43 | {nanoscale-physics-dev} | - mbpoll | 39 | {simulations} | - imview | 34 | {viewing} | - visidata | 34 | {datamanagement} | + gts | 4925 | {viewing} | + nltk | 4792 | {linguistics} | + opencascade | 635 | {simulations} | + spacenavd | 228 | {tools} | + open-coarrays | 193 | {meteorology-dev} | + armadillo | 187 | {mathematics-dev} | + arpack | 100 | {mathematics-dev} | + ntl | 45 | {mathematics-dev} | + scalapack | 42 | {nanoscale-physics-dev} | + mbpoll | 38 | {simulations} | + imview | 33 | {viewing} | + visidata | 33 | {datamanagement} | ppl | 31 | {numericalcomputation} | arduino-mk | 29 | {robotics} | libm4ri | 29 | {mathematics-dev} | - grads | 27 | {meteorology} | - libmatio | 26 | {mathematics-dev} | - setzer | 26 | {typesetting} | + libmatio | 28 | {mathematics-dev} | xygrib | 26 | {meteorology} | - flann | 24 | {mathematics-dev,engineering-dev} | + grads | 24 | {meteorology} | + setzer | 24 | {typesetting} | cliquer | 23 | {mathematics} | flintqs | 23 | {mathematics} | sat4j | 22 | {logic} | - fftw | 20 | {mathematics-dev,physics-dev,meteorology-dev} | + flann | 21 | {mathematics-dev,engineering-dev} | + fftw | 19 | {mathematics-dev,physics-dev,meteorology-dev} | libitpp | 18 | {mathematics-dev,engineering-dev} | lrcalc | 18 | {mathematics-dev} | + bossa | 17 | {devices} | cliquer | 17 | {mathematics-dev} | - bossa | 16 | {devices} | - eccodes | 16 | {meteorology,meteorology-dev} | - pyzo | 16 | {numericalcomputation} | + eccodes | 15 | {meteorology,meteorology-dev} | gf2x | 15 | {mathematics-dev} | iml | 15 | {mathematics-dev} | libhomfly | 15 | {mathematics-dev} | - sketch | 15 | {typesetting} | - teem | 15 | {imageanalysis} | + picosat | 15 | {logic} | + pyzo | 15 | {numericalcomputation} | gts | 14 | {viewing-dev} | libm4rie | 14 | {mathematics-dev} | + teem | 14 | {imageanalysis} | dune-uggrid | 13 | {mathematics-dev} | eccodes | 13 | {meteorology-dev} | - guiqwt | 13 | {numericalcomputation,viewing} | libzn-poly | 13 | {mathematics-dev} | - picosat | 13 | {logic} | + sketch | 13 | {typesetting} | feff85exafs | 12 | {chemistry} | + guiqwt | 12 | {numericalcomputation,viewing} | matlab-support | 12 | {mathematics,numericalcomputation} | ncl | 12 | {meteorology} | ratpoints | 12 | {mathematics-dev} | feedgnuplot | 11 | {viewing} | + lxi-tools | 11 | {engineering,dataacquisition} | coinor-symphony | 10 | {logic,mathematics,numericalcomputation} | form | 10 | {mathematics} | - lxi-tools | 10 | {engineering,dataacquisition} | ros-rosconsole | 10 | {robotics-dev} | alberta | 9 | {engineering-dev} | - python-cdo | 9 | {meteorology} | vdt | 9 | {mathematics-dev} | dxsamples | 8 | {nanoscale-physics} | geg | 8 | {viewing} | metar | 8 | {meteorology} | odc | 8 | {meteorology-dev} | odc | 8 | {meteorology} | - pcl | 8 | {robotics-dev} | + python-cdo | 8 | {meteorology} | persalys | 7 | {engineering,statistics,mathematics} | refmac-dictionary | 7 | {highenergy-physics-dev,chemistry} | rheolef | 7 | {mathematics} | apophenia | 6 | {statistics} | atlas-ecmwf | 6 | {meteorology} | - coda | 6 | {meteorology} | fpzip | 6 | {meteorology} | magics++ | 6 | {meteorology-dev} | opencascade | 6 | {simulations} | + pcl | 6 | {robotics-dev} | uctodata | 6 | {linguistics} | cld2 | 5 | {linguistics} | coda | 5 | {meteorology-dev} | + coda | 5 | {meteorology} | etsf-io | 5 | {physics,nanoscale-physics} | fftw | 5 | {meteorology-dev,mathematics-dev,physics-dev} | libccp4 | 5 | {nanoscale-physics-dev} | @@ -88,7 +88,6 @@ Last-Update: Fri, 06 Jun 2025 01:42:04 +0000 rubiks | 5 | {geometry,mathematics} | toulbar2 | 5 | {logic,numericalcomputation,mathematics,physics} | ucto | 5 | {linguistics} | - cmor | 4 | {meteorology} | debian-science | 4 | {economics,nanoscale-physics,machine-learning,physics,mathematics} | drslib | 4 | {meteorology} | emoslib | 4 | {meteorology-dev} | @@ -101,6 +100,7 @@ Last-Update: Fri, 06 Jun 2025 01:42:04 +0000 urdfdom-headers | 4 | {robotics-dev} | atlas-ecmwf | 3 | {meteorology-dev} | auto-07p | 3 | {mathematics} | + cmor | 3 | {meteorology} | code-saturne | 3 | {mathematics-dev,engineering-dev} | cylc-flow | 3 | {meteorology} | debian-science | 3 | {physics,machine-learning,economics,nanoscale-physics} | @@ -132,15 +132,16 @@ Last-Update: Fri, 06 Jun 2025 01:42:04 +0000 asl | 2 | {physics-dev} | coda | 2 | {meteorology-dev} | code-saturne | 2 | {engineering-dev,mathematics-dev} | - debian-science | 2 | {neuroscience-cognitive} | - debian-science | 2 | {economics} | debian-science | 2 | {nanoscale-physics,statistics,economics,physics} | + debian-science | 2 | {economics} | + debian-science | 2 | {neuroscience-cognitive} | dimbl | 2 | {linguistics} | ecbuild | 2 | {meteorology-dev} | fpzip | 2 | {meteorology-dev} | gadap | 2 | {meteorology-dev} | ipe-tools | 2 | {typesetting} | libcvd | 2 | {imageanalysis} | + libgtkdatabox | 2 | {engineering-dev,viewing-dev} | liblbfgs | 2 | {mathematics-dev} | libmatheval | 2 | {mathematics-dev} | libvigraimpex | 2 | {imageanalysis-dev,machine-learning} | @@ -171,21 +172,20 @@ Last-Update: Fri, 06 Jun 2025 01:42:04 +0000 coinmp | 1 | {logic,mathematics-dev,numericalcomputation} | coinor-bonmin | 1 | {mathematics} | debian-science | 1 | {tools} | - debian-science | 1 | {psychophysics} | debian-science | 1 | {electrophysiology} | - debian-science | 1 | {nanoscale-physics-dev} | debian-science | 1 | {neuroscience-cognitive,machine-learning} | + debian-science | 1 | {psychophysics} | + debian-science | 1 | {nanoscale-physics-dev} | fastjet | 1 | {highenergy-physics-dev} | frog | 1 | {linguistics} | frogdata | 1 | {linguistics} | hepmc3 | 1 | {nanoscale-physics-dev,highenergy-physics-dev} | jeuclid | 1 | {viewing,typesetting} | libcvd | 1 | {imageanalysis-dev} | - libgtkdatabox | 1 | {engineering-dev,viewing-dev} | liblxi | 1 | {engineering-dev,dataacquisition-dev} | liborigin2 | 1 | {viewing-dev} | - looptools | 1 | {highenergy-physics-dev} | looptools | 1 | {highenergy-physics} | + looptools | 1 | {highenergy-physics-dev} | magma | 1 | {mathematics-dev,numericalcomputation} | mbt | 1 | {linguistics} | mbtserver | 1 | {linguistics} | @@ -244,8 +244,8 @@ Last-Update: Fri, 06 Jun 2025 01:42:04 +0000 quadrule | 0 | {mathematics-dev} | robot-testing-framework | 0 | {robotics-dev} | ros-collada-urdf | 0 | {robotics} | - ros-metapackages | 0 | {robotics-dev} | ros-metapackages | 0 | {robotics} | + ros-metapackages | 0 | {robotics-dev} | ros-opencv-apps | 0 | {robotics} | sagemath-database-combinatorial-designs | 0 | {mathematics} | sagemath-database-cremona-elliptic-curves | 0 | {mathematics} | ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,172 +1,172 @@ -Last-Update: Fri, 06 Jun 2025 01:42:04 +0000 +Last-Update: Fri, 06 Jun 2025 13:42:12 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- mpmath | 10271 | - python-repoze.lru | 6977 | - netifaces | 5169 | - ghp-import | 4726 | - python-lunr | 4719 | - python-babel | 4295 | - sortedcontainers | 3885 | - python-babel | 3748 | - aiosignal | 2930 | + python-repoze.lru | 6996 | + netifaces | 5150 | + ghp-import | 4746 | + python-lunr | 4739 | + python-babel | 4282 | + sortedcontainers | 3890 | + python-babel | 3744 | + aiosignal | 2924 | hyperlink | 2161 | - python-notify2 | 2033 | - humanfriendly | 1918 | - referencing | 1766 | - python-mysqldb | 1506 | - python-pandocfilters | 1467 | - python-gssapi | 1415 | - python-invoke | 1392 | - python-hyperframe | 1361 | - websocket-client | 1341 | - python-hpack | 1155 | - python-rsa | 1126 | - pdfarranger | 1038 | - menulibre | 957 | - python-linux-procfs | 937 | - python-geoip | 894 | - python-zopfli | 891 | - autopep8 | 886 | - python-webob | 833 | - pytoolconfig | 809 | - firmware-microbit-micropython | 773 | - powerline | 720 | - powerline | 718 | - powerline | 714 | - kazam | 691 | - u-msgpack-python | 636 | - gaupol | 567 | - dockerpty | 527 | - asn1crypto | 508 | - python-gevent | 505 | + python-notify2 | 2035 | + humanfriendly | 1928 | + referencing | 1769 | + python-mysqldb | 1500 | + python-pandocfilters | 1466 | + python-gssapi | 1412 | + python-invoke | 1396 | + python-hyperframe | 1364 | + websocket-client | 1351 | + python-hpack | 1162 | + python-rsa | 1121 | + pdfarranger | 1031 | + menulibre | 956 | + python-linux-procfs | 933 | + python-geoip | 892 | + autopep8 | 890 | + python-zopfli | 889 | + python-webob | 836 | + pytoolconfig | 811 | + firmware-microbit-micropython | 774 | + powerline | 722 | + powerline | 716 | + kazam | 689 | + u-msgpack-python | 633 | + gaupol | 574 | + dockerpty | 531 | + asn1crypto | 511 | + python-gevent | 503 | python-et-xmlfile | 501 | - catfish | 445 | - python-ewmh | 441 | - python-requests-oauthlib | 411 | - python-toml | 385 | - spf-engine | 337 | - python-ntlm-auth | 319 | - spf-engine | 291 | - django-stronghold | 260 | - cairocffi | 229 | - python-ldap3 | 226 | - python-mimeparse | 194 | - python-smmap | 176 | - python-hidapi | 170 | - autokey | 159 | - httpie | 157 | + python-ewmh | 442 | + catfish | 440 | + python-requests-oauthlib | 412 | + python-toml | 377 | + spf-engine | 340 | + python-ntlm-auth | 323 | + spf-engine | 292 | + django-stronghold | 258 | + cairocffi | 227 | + python-ldap3 | 220 | + python-mimeparse | 195 | + python-smmap | 175 | + python-hidapi | 168 | + autokey | 160 | + httpie | 154 | python-anyjson | 145 | - smem | 143 | - kivy | 130 | - python-aiostream | 121 | - smartypants | 113 | - nodeenv | 110 | - mugshot | 106 | + smem | 141 | + kivy | 131 | + python-aiostream | 123 | + smartypants | 114 | + nodeenv | 107 | + mugshot | 103 | python-click-repl | 103 | - pacparser | 101 | - python-pyu2f | 101 | - mypaint | 100 | + pacparser | 102 | timekpr-next | 100 | lollypop | 99 | - python-consul | 96 | - pssh | 87 | - pymacaroons | 85 | - pymediainfo | 84 | + mypaint | 99 | + python-pyu2f | 99 | + python-consul | 94 | + pssh | 86 | + pymacaroons | 86 | + pymediainfo | 86 | python-colour | 80 | - python-rfc6555 | 77 | + python-rfc6555 | 76 | numpy-stl | 72 | - python-pykka | 70 | - mitmproxy | 69 | - python-i3ipc | 67 | + python-i3ipc | 68 | + python-pykka | 68 | + mitmproxy | 67 | weasyprint | 66 | + fabric | 63 | python-uritools | 63 | - fabric | 62 | - ueberzug | 60 | - pywavelets | 59 | - python-scp | 55 | - mysql-connector-python | 50 | - itstool | 48 | - python-looseversion | 48 | + pywavelets | 62 | + ueberzug | 59 | + python-scp | 56 | + itstool | 49 | + mysql-connector-python | 49 | show-in-file-manager | 47 | + python-looseversion | 46 | + hatchling | 45 | pyenv | 45 | trac | 45 | blockdiag | 44 | - hatchling | 44 | khard | 43 | - sshtunnel | 42 | + sshtunnel | 43 | + persepolis | 40 | certipy | 39 | pamela | 39 | jupyterhub | 38 | - membernator | 38 | - pyquery | 38 | - pylibmc | 37 | - persepolis | 36 | + membernator | 37 | + pylibmc | 36 | + pyquery | 36 | pymacs | 35 | - powerline-gitstatus | 33 | - python-scrypt | 33 | + powerline-gitstatus | 34 | + python-scrypt | 32 | pssh | 31 | dkimpy-milter | 30 | python-statsd | 30 | - python-args | 28 | python-pysol-cards | 28 | - pdfposter | 27 | - seqdiag | 27 | - sphinxcontrib-blockdiag | 27 | - video-downloader | 27 | - sphinxcontrib-seqdiag | 26 | + seqdiag | 28 | + sphinxcontrib-blockdiag | 28 | + python-args | 27 | + sphinxcontrib-seqdiag | 27 | + pdfposter | 26 | + video-downloader | 26 | backoff | 25 | rst2pdf | 25 | - webpy | 25 | + sphinx-inline-tabs | 25 | flask-principal | 24 | python-clint | 24 | - sphinx-inline-tabs | 24 | - typogrify | 22 | - cppman | 21 | - depthcharge-tools | 21 | + webpy | 24 | + typogrify | 23 | + cppman | 22 | + enzyme | 22 | nwdiag | 21 | python-zstd | 21 | alot | 20 | - enzyme | 20 | + depthcharge-tools | 20 | fabric | 20 | + python-fire | 20 | python-rangehttpserver | 20 | ruff | 20 | + subliminal | 20 | webtest | 20 | - python-fire | 19 | spf-engine | 19 | - subliminal | 19 | actdiag | 18 | mistune0 | 18 | - python-sdnotify | 18 | python-translationstring | 18 | social-auth-core | 18 | + subliminal | 18 | django-environ | 17 | nwg-displays | 17 | + python-sdnotify | 17 | python-simpy | 17 | sphinxcontrib-actdiag | 17 | sphinxcontrib-log-cabinet | 17 | - subliminal | 17 | gtextfsm | 16 | python-inotify | 16 | - python-kyotocabinet | 16 | - python-priority | 16 | python-pyalsa | 16 | python-pysubs2 | 16 | sphinxcontrib-nwdiag | 16 | policyd-rate-limit | 15 | python-hupper | 15 | + python-kyotocabinet | 15 | + python-priority | 15 | + python-slip10 | 15 | ansi | 14 | python-dbussy | 14 | python-demjson | 14 | python-pyrss2gen | 14 | - python-slip10 | 14 | python-xtermcolor | 14 | + autotiling | 13 | pykwalify | 13 | pyp | 13 | python-pem | 13 | - autotiling | 12 | btchip-python | 12 | + gmplot | 12 | junos-eznc | 12 | notebook-shim | 12 | pwntools | 12 | @@ -174,62 +174,60 @@ Last-Update: Fri, 06 Jun 2025 01:42:04 +0000 python-ethtool | 12 | python-pyscss | 12 | txt2tags | 12 | - unearth | 12 | flask-security | 11 | - gmplot | 11 | pdm | 11 | speaklater | 11 | + traittypes | 11 | + unearth | 11 | django-auditlog | 10 | django-sass | 10 | - drf-yasg-nonfree | 10 | flask-session | 10 | pylint-common | 10 | python-aiohttp-security | 10 | python-parse-type | 10 | slimit | 10 | - traittypes | 10 | + beancount | 9 | + drf-yasg-nonfree | 9 | + kivy | 9 | pybik | 9 | pydrive2 | 9 | pytest-runner | 9 | python-digitalocean | 9 | python-drf-spectacular-sidecar-nonfree | 9 | - todoman | 9 | trac-wysiwyg | 9 | tuna | 9 | - beancount | 8 | debiancontributors | 8 | flask-paranoid | 8 | httpcode | 8 | + pytaglib | 8 | pytest-django | 8 | python-overpy | 8 | - python-pyaml-env | 8 | python-pyld | 8 | python-xdo | 8 | + sphinx-intl | 8 | + todoman | 8 | + beancount | 7 | clustershell | 7 | easyprocess | 7 | jschema-to-python | 7 | - kivy | 7 | mercurial-evolve | 7 | - pytaglib | 7 | python-envs | 7 | python-openstep-plist | 7 | + python-pyaml-env | 7 | python-sarif-python-om | 7 | python-versioneer | 7 | - sphinx-intl | 7 | django-model-utils | 6 | django-pglocks | 6 | - drf-extensions | 6 | hachoir | 6 | htmlmin | 6 | librouteros | 6 | mypy-protobuf | 6 | - python3-onelogin-saml2 | 6 | python-ansicolors | 6 | python-numpysane | 6 | securestring | 6 | - beancount | 5 | clustershell | 5 | django-paintstore | 5 | + drf-extensions | 5 | drf-haystack | 5 | flufl.testing | 5 | graphql-relay | 5 | @@ -237,6 +235,7 @@ Last-Update: Fri, 06 Jun 2025 01:42:04 +0000 micropython-mpremote | 5 | numpy-stl | 5 | pycallgraph | 5 | + python3-onelogin-saml2 | 5 | python-dirq | 5 | python-jpype | 5 | python-srp | 5 | @@ -246,6 +245,7 @@ Last-Update: Fri, 06 Jun 2025 01:42:04 +0000 azote | 4 | django-jinja | 4 | etm | 4 | + extension-helpers | 4 | htmlmin | 4 | imap-tools | 4 | logilab-constraint | 4 | @@ -256,11 +256,9 @@ Last-Update: Fri, 06 Jun 2025 01:42:04 +0000 python-biplist | 4 | python-dbus-next | 4 | python-markuppy | 4 | - python-networkmanager | 4 | python-pgmagick | 4 | python-simpy | 4 | ruff | 4 | - trac-accountmanager | 4 | utidylib | 4 | west | 4 | aiomysql | 3 | @@ -277,14 +275,13 @@ Last-Update: Fri, 06 Jun 2025 01:42:04 +0000 django-simple-redis-admin | 3 | django-templated-email | 3 | django-xmlrpc | 3 | - extension-helpers | 3 | flask-api | 3 | flask-mongoengine | 3 | orsopy | 3 | proglog | 3 | pyclamd | 3 | pyprind | 3 | - python-btrees | 3 | + python-chartkick | 3 | python-deepmerge | 3 | python-django-casclient | 3 | python-django-contact-form | 3 | @@ -295,12 +292,12 @@ Last-Update: Fri, 06 Jun 2025 01:42:04 +0000 python-halo | 3 | python-ipfix | 3 | python-netfilterqueue | 3 | + python-networkmanager | 3 | python-text-unidecode | 3 | - s3ql | 3 | slimit | 3 | - smem | 3 | sphinx-markdown-tables | 3 | testrepository | 3 | + trac-accountmanager | 3 | trac-xmlrpc | 3 | vf1 | 3 | zzzeeksphinx | 3 | @@ -333,18 +330,17 @@ Last-Update: Fri, 06 Jun 2025 01:42:04 +0000 pyjunitxml | 2 | pykwalify | 2 | python-bitbucket-api | 2 | - python-chartkick | 2 | + python-btrees | 2 | python-commentjson | 2 | python-cookies | 2 | python-ephemeral-port-reserve | 2 | python-funcy | 2 | - python-gammu | 2 | python-libguess | 2 | - python-openshift | 2 | - python-opentracing | 2 | python-qtpynodeeditor | 2 | redis-py-cluster | 2 | requests-aws | 2 | + s3ql | 2 | + smem | 2 | sphinx-paramlinks | 2 | vcversioner | 2 | vncdotool | 2 | @@ -376,6 +372,7 @@ Last-Update: Fri, 06 Jun 2025 01:42:04 +0000 python-bottle-sqlite | 1 | python-dataset | 1 | python-dnsq | 1 | + python-gammu | 1 | python-getdns | 1 | python-gfloat | 1 | python-kanboard | 1 | @@ -383,6 +380,8 @@ Last-Update: Fri, 06 Jun 2025 01:42:04 +0000 python-noise | 1 | python-openid-cla | 1 | python-openqa-client | 1 | + python-openshift | 1 | + python-opentracing | 1 | python-pysubs2 | 1 | python-py-zipkin | 1 | python-rdflib-endpoint | 1 | @@ -594,5 +593,5 @@ Last-Update: Fri, 06 Jun 2025 01:42:04 +0000 sphinxcontrib-emojicodes | -1 | symmetrize | -1 | trac-tickettemplate | -1 | -(607 rows) +(606 rows) View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/3bcb3bbfabf209c30392890528bcbc63268677a1 -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/3bcb3bbfabf209c30392890528bcbc63268677a1 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Sat Jun 7 02:43:38 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Sat, 07 Jun 2025 01:43:38 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <6843994ac1975_3db8af00841547620@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: aed2144c by Andreas Tille at 2025-06-07T01:43:26+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Fri, 06 Jun 2025 13:42:04 +0000 +Last-Update: Sat, 07 Jun 2025 01:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- ===================================== debian-science-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Fri, 06 Jun 2025 13:42:09 +0000 +Last-Update: Sat, 07 Jun 2025 01:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Fri, 06 Jun 2025 13:42:12 +0000 +Last-Update: Sat, 07 Jun 2025 01:42:04 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/aed2144c70a90576ef5e4d220261554c3196352a -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/aed2144c70a90576ef5e4d220261554c3196352a You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Sat Jun 7 14:43:36 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Sat, 07 Jun 2025 13:43:36 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <68444208ed2c_3db88189b0160315b@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: bb601c49 by Andreas Tille at 2025-06-07T13:43:28+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,14 +1,14 @@ -Last-Update: Sat, 07 Jun 2025 01:42:04 +0000 +Last-Update: Sat, 07 Jun 2025 13:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- dicomscope | 29 | {imaging} | orthanc-gdcm | 15 | {imaging} | - mrtrix3 | 14 | {imaging} | - oscar | 12 | {data,practice,tools} | - pixelmed | 11 | {imaging} | + mrtrix3 | 13 | {imaging} | + oscar | 13 | {data,practice,tools} | gnumed-server | 10 | {covid-19,practice} | orthanc-mysql | 10 | {imaging} | + pixelmed | 10 | {imaging} | sight | 9 | {imaging} | bart-view | 8 | {imaging} | king | 8 | {typesetting,imaging} | @@ -18,7 +18,7 @@ Last-Update: Sat, 07 Jun 2025 01:42:04 +0000 jebl2 | 6 | {bio-dev} | mia | 6 | {imaging} | biojava-live | 5 | {bio-dev} | - icb-utils | 5 | {bio-dev} | + icb-utils | 4 | {bio-dev} | pbcopper | 4 | {bio-dev} | beast-mcmc | 3 | {bio,bio-phylogeny} | bio-tradis | 3 | {bio,bio-dev} | @@ -44,13 +44,13 @@ Last-Update: Sat, 07 Jun 2025 01:42:04 +0000 emboss-explorer | 1 | {bio} | fastml | 1 | {bio} | hinge | 1 | {bio} | + htscodecs | 1 | {bio-dev,covid-19} | ipig | 1 | {bio} | jmodeltest | 1 | {bio,bio-phylogeny} | lamarc | 1 | {bio} | libbio-mage-utils-perl | 1 | {bio-dev} | libbiosoup-dev | 1 | {bio-dev} | libchado-perl | 1 | {bio-dev} | - libctapimkt | 1 | {practice} | libdivsufsort | 1 | {bio-dev} | libgenome | 1 | {bio-dev} | librg-utils-perl | 1 | {bio} | @@ -85,7 +85,6 @@ Last-Update: Sat, 07 Jun 2025 01:42:04 +0000 fis-gtm | 0 | {his} | gatk-bwamem | 0 | {bio-dev} | gatk-fermilite | 0 | {bio-dev} | - htscodecs | 0 | {bio-dev,covid-19} | kmerresistance | 0 | {bio} | libbioparser-dev | 0 | {bio-dev} | libbpp-core | 0 | {bio-dev} | @@ -95,6 +94,7 @@ Last-Update: Sat, 07 Jun 2025 01:42:04 +0000 libbpp-raa | 0 | {bio-dev} | libbpp-seq | 0 | {bio-dev} | libbpp-seq-omics | 0 | {bio-dev} | + libctapimkt | 0 | {practice} | libgkarrays | 0 | {bio-dev} | libhmsbeagle | 0 | {bio-dev} | libics | 0 | {covid-19,imaging-dev} | ===================================== debian-science-tests.txt ===================================== @@ -1,55 +1,55 @@ -Last-Update: Sat, 07 Jun 2025 01:42:04 +0000 +Last-Update: Sat, 07 Jun 2025 13:42:08 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- - gts | 4925 | {viewing} | - nltk | 4792 | {linguistics} | - opencascade | 635 | {simulations} | - spacenavd | 228 | {tools} | - open-coarrays | 193 | {meteorology-dev} | - armadillo | 187 | {mathematics-dev} | - arpack | 100 | {mathematics-dev} | - ntl | 45 | {mathematics-dev} | - scalapack | 42 | {nanoscale-physics-dev} | - mbpoll | 38 | {simulations} | - imview | 33 | {viewing} | + gts | 4894 | {viewing} | + nltk | 4796 | {linguistics} | + opencascade | 631 | {simulations} | + spacenavd | 229 | {tools} | + open-coarrays | 190 | {meteorology-dev} | + armadillo | 183 | {mathematics-dev} | + arpack | 98 | {mathematics-dev} | + ntl | 44 | {mathematics-dev} | + scalapack | 44 | {nanoscale-physics-dev} | + mbpoll | 39 | {simulations} | + imview | 34 | {viewing} | visidata | 33 | {datamanagement} | ppl | 31 | {numericalcomputation} | - arduino-mk | 29 | {robotics} | - libm4ri | 29 | {mathematics-dev} | - libmatio | 28 | {mathematics-dev} | - xygrib | 26 | {meteorology} | + libmatio | 29 | {mathematics-dev} | + arduino-mk | 28 | {robotics} | + libm4ri | 28 | {mathematics-dev} | + xygrib | 25 | {meteorology} | grads | 24 | {meteorology} | - setzer | 24 | {typesetting} | cliquer | 23 | {mathematics} | flintqs | 23 | {mathematics} | + flann | 22 | {mathematics-dev,engineering-dev} | sat4j | 22 | {logic} | - flann | 21 | {mathematics-dev,engineering-dev} | - fftw | 19 | {mathematics-dev,physics-dev,meteorology-dev} | - libitpp | 18 | {mathematics-dev,engineering-dev} | - lrcalc | 18 | {mathematics-dev} | + setzer | 21 | {typesetting} | + fftw | 18 | {mathematics-dev,physics-dev,meteorology-dev} | bossa | 17 | {devices} | - cliquer | 17 | {mathematics-dev} | - eccodes | 15 | {meteorology,meteorology-dev} | - gf2x | 15 | {mathematics-dev} | - iml | 15 | {mathematics-dev} | - libhomfly | 15 | {mathematics-dev} | + lrcalc | 17 | {mathematics-dev} | + cliquer | 16 | {mathematics-dev} | + eccodes | 16 | {meteorology,meteorology-dev} | + libitpp | 16 | {mathematics-dev,engineering-dev} | picosat | 15 | {logic} | pyzo | 15 | {numericalcomputation} | + gf2x | 14 | {mathematics-dev} | gts | 14 | {viewing-dev} | - libm4rie | 14 | {mathematics-dev} | - teem | 14 | {imageanalysis} | + iml | 14 | {mathematics-dev} | + libhomfly | 14 | {mathematics-dev} | + sketch | 14 | {typesetting} | dune-uggrid | 13 | {mathematics-dev} | eccodes | 13 | {meteorology-dev} | - libzn-poly | 13 | {mathematics-dev} | - sketch | 13 | {typesetting} | + guiqwt | 13 | {numericalcomputation,viewing} | + libm4rie | 13 | {mathematics-dev} | + teem | 13 | {imageanalysis} | feff85exafs | 12 | {chemistry} | - guiqwt | 12 | {numericalcomputation,viewing} | + libzn-poly | 12 | {mathematics-dev} | matlab-support | 12 | {mathematics,numericalcomputation} | - ncl | 12 | {meteorology} | - ratpoints | 12 | {mathematics-dev} | feedgnuplot | 11 | {viewing} | lxi-tools | 11 | {engineering,dataacquisition} | + ncl | 11 | {meteorology} | + ratpoints | 11 | {mathematics-dev} | coinor-symphony | 10 | {logic,mathematics,numericalcomputation} | form | 10 | {mathematics} | ros-rosconsole | 10 | {robotics-dev} | @@ -61,6 +61,7 @@ Last-Update: Sat, 07 Jun 2025 01:42:04 +0000 odc | 8 | {meteorology-dev} | odc | 8 | {meteorology} | python-cdo | 8 | {meteorology} | + pcl | 7 | {robotics-dev} | persalys | 7 | {engineering,statistics,mathematics} | refmac-dictionary | 7 | {highenergy-physics-dev,chemistry} | rheolef | 7 | {mathematics} | @@ -69,20 +70,16 @@ Last-Update: Sat, 07 Jun 2025 01:42:04 +0000 fpzip | 6 | {meteorology} | magics++ | 6 | {meteorology-dev} | opencascade | 6 | {simulations} | - pcl | 6 | {robotics-dev} | uctodata | 6 | {linguistics} | cld2 | 5 | {linguistics} | coda | 5 | {meteorology-dev} | coda | 5 | {meteorology} | etsf-io | 5 | {physics,nanoscale-physics} | fftw | 5 | {meteorology-dev,mathematics-dev,physics-dev} | - libccp4 | 5 | {nanoscale-physics-dev} | - libxsmm | 5 | {mathematics-dev} | metview | 5 | {meteorology} | muparser | 5 | {mathematics-dev} | ncl | 5 | {meteorology-dev} | persalys | 5 | {statistics,mathematics,engineering} | - psurface | 5 | {numericalcomputation} | python-escript | 5 | {numericalcomputation,simulations,engineering} | ros-vcstool | 5 | {robotics-dev} | rubiks | 5 | {geometry,mathematics} | @@ -94,20 +91,23 @@ Last-Update: Sat, 07 Jun 2025 01:42:04 +0000 gsw | 4 | {meteorology} | hdf-eos5 | 4 | {meteorology-dev} | iapws | 4 | {meteorology} | + libccp4 | 4 | {nanoscale-physics-dev} | libgctp | 4 | {meteorology-dev} | + libxsmm | 4 | {mathematics-dev} | lrcalc | 4 | {mathematics} | + psurface | 4 | {numericalcomputation} | silo-llnl | 4 | {engineering} | urdfdom-headers | 4 | {robotics-dev} | atlas-ecmwf | 3 | {meteorology-dev} | auto-07p | 3 | {mathematics} | cmor | 3 | {meteorology} | - code-saturne | 3 | {mathematics-dev,engineering-dev} | cylc-flow | 3 | {meteorology} | debian-science | 3 | {physics,machine-learning,economics,nanoscale-physics} | dune-functions | 3 | {mathematics-dev} | dune-localfunctions | 3 | {mathematics-dev} | dune-typetree | 3 | {mathematics-dev} | dxflib | 3 | {engineering-dev} | + ecbuild | 3 | {meteorology-dev} | emoslib | 3 | {meteorology} | getdp | 3 | {engineering,mathematics,simulations} | harp | 3 | {meteorology} | @@ -115,28 +115,26 @@ Last-Update: Sat, 07 Jun 2025 01:42:04 +0000 hpcc | 3 | {numericalcomputation,distributedcomputing} | ipe-tools | 3 | {typesetting} | irstlm | 3 | {linguistics} | - libcgns | 3 | {engineering} | libcgns | 3 | {engineering-dev} | + libcgns | 3 | {engineering} | libmatheval | 3 | {mathematics} | metkit | 3 | {meteorology} | - qwtplot3d | 3 | {viewing-dev} | sac2mseed | 3 | {geography} | sardana | 3 | {dataacquisition} | + silo-llnl | 3 | {engineering} | silo-llnl | 3 | {engineering-dev} | toontag | 3 | {numericalcomputation} | veccore | 3 | {mathematics-dev} | - vlfeat | 3 | {imageanalysis-dev} | apache-opennlp | 2 | {linguistics} | apertium-eval-translator | 2 | {linguistics} | apophenia | 2 | {statistics} | - asl | 2 | {physics-dev} | coda | 2 | {meteorology-dev} | + code-saturne | 2 | {mathematics-dev,engineering-dev} | code-saturne | 2 | {engineering-dev,mathematics-dev} | debian-science | 2 | {nanoscale-physics,statistics,economics,physics} | - debian-science | 2 | {economics} | debian-science | 2 | {neuroscience-cognitive} | + debian-science | 2 | {economics} | dimbl | 2 | {linguistics} | - ecbuild | 2 | {meteorology-dev} | fpzip | 2 | {meteorology-dev} | gadap | 2 | {meteorology-dev} | ipe-tools | 2 | {typesetting} | @@ -147,7 +145,6 @@ Last-Update: Sat, 07 Jun 2025 01:42:04 +0000 libvigraimpex | 2 | {imageanalysis-dev,machine-learning} | metkit | 2 | {meteorology-dev} | mpi4py-fft | 2 | {mathematics-dev} | - mrmpi | 2 | {tools} | mseed2sac | 2 | {dataacquisition-dev} | ncrystal | 2 | {nanoscale-physics-dev,highenergy-physics-dev} | newmat | 2 | {mathematics-dev} | @@ -155,6 +152,7 @@ Last-Update: Sat, 07 Jun 2025 01:42:04 +0000 openstereogram | 2 | {tools} | polylib | 2 | {mathematics} | python-aws-xray-sdk | 2 | {dataacquisition-dev} | + qwtplot3d | 2 | {viewing-dev} | ros-ros-environment | 2 | {robotics-dev} | sagemath-database-conway-polynomials | 2 | {mathematics} | scram | 2 | {engineering} | @@ -163,19 +161,21 @@ Last-Update: Sat, 07 Jun 2025 01:42:04 +0000 syrthes | 2 | {engineering} | toon | 2 | {numericalcomputation} | trilinos | 2 | {physics-dev,mathematics-dev,engineering-dev} | + vlfeat | 2 | {imageanalysis-dev} | x13as | 2 | {economics} | apertium-streamparser | 1 | {linguistics} | + asl | 1 | {physics-dev} | ckon | 1 | {highenergy-physics-dev} | clhep | 1 | {highenergy-physics-dev} | clipper | 1 | {nanoscale-physics-dev} | cmor | 1 | {meteorology-dev} | coinmp | 1 | {logic,mathematics-dev,numericalcomputation} | coinor-bonmin | 1 | {mathematics} | - debian-science | 1 | {tools} | + debian-science | 1 | {nanoscale-physics-dev} | debian-science | 1 | {electrophysiology} | debian-science | 1 | {neuroscience-cognitive,machine-learning} | debian-science | 1 | {psychophysics} | - debian-science | 1 | {nanoscale-physics-dev} | + debian-science | 1 | {tools} | fastjet | 1 | {highenergy-physics-dev} | frog | 1 | {linguistics} | frogdata | 1 | {linguistics} | @@ -190,9 +190,9 @@ Last-Update: Sat, 07 Jun 2025 01:42:04 +0000 mbt | 1 | {linguistics} | mbtserver | 1 | {linguistics} | mmdb | 1 | {nanoscale-physics-dev,highenergy-physics-dev} | + mrmpi | 1 | {tools} | nrn-mod2c | 1 | {biology} | openctm | 1 | {physics-dev} | - opengv | 1 | {geometry} | openmesh | 1 | {mathematics-dev} | psurface | 1 | {numericalcomputation} | qd | 1 | {mathematics-dev} | @@ -202,7 +202,6 @@ Last-Update: Sat, 07 Jun 2025 01:42:04 +0000 ssm | 1 | {nanoscale-physics-dev} | timbl | 1 | {linguistics} | timblserver | 1 | {linguistics} | - tulip | 1 | {viewing-dev} | amgcl | 0 | {mathematics-dev} | apertium-afr-nld | 0 | {linguistics} | apertium-bel-rus | 0 | {linguistics} | @@ -233,8 +232,8 @@ Last-Update: Sat, 07 Jun 2025 01:42:04 +0000 mbt | 0 | {linguistics} | mctc-lib | 0 | {nanoscale-physics-dev,highenergy-physics-dev} | meshsdfilter | 0 | {mathematics-dev} | - metis-edf | 0 | {engineering,numericalcomputation} | metis-edf | 0 | {engineering-dev} | + metis-edf | 0 | {engineering,numericalcomputation} | neartree | 0 | {mathematics-dev,numericalcomputation} | opengv | 0 | {geometry} | openigtlink | 0 | {robotics-dev} | @@ -244,8 +243,8 @@ Last-Update: Sat, 07 Jun 2025 01:42:04 +0000 quadrule | 0 | {mathematics-dev} | robot-testing-framework | 0 | {robotics-dev} | ros-collada-urdf | 0 | {robotics} | - ros-metapackages | 0 | {robotics} | ros-metapackages | 0 | {robotics-dev} | + ros-metapackages | 0 | {robotics} | ros-opencv-apps | 0 | {robotics} | sagemath-database-combinatorial-designs | 0 | {mathematics} | sagemath-database-cremona-elliptic-curves | 0 | {mathematics} | @@ -264,6 +263,7 @@ Last-Update: Sat, 07 Jun 2025 01:42:04 +0000 timbl | 0 | {linguistics} | timblserver | 0 | {linguistics} | triangle | 0 | {physics-dev} | + tulip | 0 | {viewing-dev} | ucto | 0 | {linguistics} | vecgeom | 0 | {nanoscale-physics-dev} | virtuoso-opensource | 0 | {datamanagement} | ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,194 +1,195 @@ -Last-Update: Sat, 07 Jun 2025 01:42:04 +0000 +Last-Update: Sat, 07 Jun 2025 13:42:11 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- - mpmath | 10271 | - python-repoze.lru | 6996 | + mpmath | 10237 | + python-repoze.lru | 7006 | netifaces | 5150 | - ghp-import | 4746 | - python-lunr | 4739 | - python-babel | 4282 | - sortedcontainers | 3890 | - python-babel | 3744 | - aiosignal | 2924 | - hyperlink | 2161 | - python-notify2 | 2035 | - humanfriendly | 1928 | - referencing | 1769 | - python-mysqldb | 1500 | - python-pandocfilters | 1466 | - python-gssapi | 1412 | - python-invoke | 1396 | - python-hyperframe | 1364 | - websocket-client | 1351 | - python-hpack | 1162 | - python-rsa | 1121 | + ghp-import | 4750 | + python-lunr | 4744 | + python-babel | 4291 | + sortedcontainers | 3900 | + python-babel | 3745 | + aiosignal | 2922 | + hyperlink | 2151 | + python-notify2 | 2042 | + humanfriendly | 1930 | + referencing | 1756 | + python-mysqldb | 1508 | + python-pandocfilters | 1463 | + python-gssapi | 1417 | + python-invoke | 1399 | + python-hyperframe | 1353 | + websocket-client | 1342 | + python-hpack | 1150 | + python-rsa | 1122 | pdfarranger | 1031 | - menulibre | 956 | - python-linux-procfs | 933 | - python-geoip | 892 | - autopep8 | 890 | - python-zopfli | 889 | - python-webob | 836 | - pytoolconfig | 811 | - firmware-microbit-micropython | 774 | + menulibre | 953 | + python-linux-procfs | 932 | + autopep8 | 895 | + python-geoip | 886 | + python-zopfli | 876 | + python-webob | 833 | + pytoolconfig | 819 | + firmware-microbit-micropython | 771 | + powerline | 723 | powerline | 722 | powerline | 716 | - kazam | 689 | - u-msgpack-python | 633 | - gaupol | 574 | - dockerpty | 531 | - asn1crypto | 511 | - python-gevent | 503 | - python-et-xmlfile | 501 | - python-ewmh | 442 | - catfish | 440 | - python-requests-oauthlib | 412 | - python-toml | 377 | - spf-engine | 340 | - python-ntlm-auth | 323 | - spf-engine | 292 | + kazam | 694 | + u-msgpack-python | 637 | + gaupol | 569 | + dockerpty | 525 | + asn1crypto | 510 | + python-et-xmlfile | 505 | + python-gevent | 504 | + python-ewmh | 440 | + catfish | 438 | + python-requests-oauthlib | 413 | + python-toml | 376 | + spf-engine | 342 | + python-ntlm-auth | 320 | + spf-engine | 294 | django-stronghold | 258 | - cairocffi | 227 | - python-ldap3 | 220 | - python-mimeparse | 195 | - python-smmap | 175 | + cairocffi | 224 | + python-ldap3 | 221 | + python-mimeparse | 196 | + python-smmap | 180 | python-hidapi | 168 | - autokey | 160 | + autokey | 164 | httpie | 154 | - python-anyjson | 145 | - smem | 141 | - kivy | 131 | - python-aiostream | 123 | - smartypants | 114 | - nodeenv | 107 | - mugshot | 103 | - python-click-repl | 103 | - pacparser | 102 | + python-anyjson | 146 | + smem | 145 | + kivy | 128 | + python-aiostream | 124 | + smartypants | 113 | + nodeenv | 109 | + python-click-repl | 106 | + pacparser | 103 | + mugshot | 102 | + lollypop | 101 | + mypaint | 101 | timekpr-next | 100 | - lollypop | 99 | - mypaint | 99 | - python-pyu2f | 99 | - python-consul | 94 | - pssh | 86 | + python-pyu2f | 98 | + python-consul | 96 | pymacaroons | 86 | - pymediainfo | 86 | + pymediainfo | 85 | + pssh | 83 | python-colour | 80 | - python-rfc6555 | 76 | - numpy-stl | 72 | - python-i3ipc | 68 | + python-rfc6555 | 77 | + numpy-stl | 71 | + python-i3ipc | 69 | python-pykka | 68 | - mitmproxy | 67 | - weasyprint | 66 | - fabric | 63 | - python-uritools | 63 | - pywavelets | 62 | - ueberzug | 59 | - python-scp | 56 | - itstool | 49 | + fabric | 65 | + mitmproxy | 65 | + weasyprint | 65 | + python-uritools | 61 | + pywavelets | 60 | + ueberzug | 60 | + python-scp | 55 | + itstool | 52 | mysql-connector-python | 49 | + pyenv | 47 | show-in-file-manager | 47 | python-looseversion | 46 | + blockdiag | 45 | hatchling | 45 | - pyenv | 45 | - trac | 45 | - blockdiag | 44 | + sshtunnel | 44 | + trac | 44 | khard | 43 | - sshtunnel | 43 | persepolis | 40 | certipy | 39 | pamela | 39 | jupyterhub | 38 | - membernator | 37 | - pylibmc | 36 | + membernator | 38 | + pymacs | 37 | pyquery | 36 | - pymacs | 35 | - powerline-gitstatus | 34 | - python-scrypt | 32 | + pylibmc | 35 | + powerline-gitstatus | 33 | pssh | 31 | - dkimpy-milter | 30 | - python-statsd | 30 | - python-pysol-cards | 28 | - seqdiag | 28 | + python-scrypt | 31 | + dkimpy-milter | 29 | + python-statsd | 28 | sphinxcontrib-blockdiag | 28 | + pdfposter | 27 | python-args | 27 | - sphinxcontrib-seqdiag | 27 | - pdfposter | 26 | - video-downloader | 26 | - backoff | 25 | - rst2pdf | 25 | - sphinx-inline-tabs | 25 | + seqdiag | 27 | + video-downloader | 27 | + backoff | 26 | + python-pysol-cards | 26 | + sphinxcontrib-seqdiag | 26 | flask-principal | 24 | python-clint | 24 | + sphinx-inline-tabs | 24 | webpy | 24 | + rst2pdf | 23 | typogrify | 23 | - cppman | 22 | enzyme | 22 | + cppman | 21 | + depthcharge-tools | 21 | nwdiag | 21 | python-zstd | 21 | + subliminal | 21 | alot | 20 | - depthcharge-tools | 20 | fabric | 20 | - python-fire | 20 | python-rangehttpserver | 20 | ruff | 20 | - subliminal | 20 | webtest | 20 | + python-fire | 19 | + python-translationstring | 19 | spf-engine | 19 | - actdiag | 18 | - mistune0 | 18 | - python-translationstring | 18 | + subliminal | 19 | social-auth-core | 18 | - subliminal | 18 | + actdiag | 17 | django-environ | 17 | + mistune0 | 17 | nwg-displays | 17 | - python-sdnotify | 17 | python-simpy | 17 | - sphinxcontrib-actdiag | 17 | - sphinxcontrib-log-cabinet | 17 | - gtextfsm | 16 | + python-hupper | 16 | python-inotify | 16 | - python-pyalsa | 16 | - python-pysubs2 | 16 | - sphinxcontrib-nwdiag | 16 | + sphinxcontrib-actdiag | 16 | + sphinxcontrib-log-cabinet | 16 | policyd-rate-limit | 15 | - python-hupper | 15 | + python-demjson | 15 | python-kyotocabinet | 15 | python-priority | 15 | + python-pyalsa | 15 | + python-pysubs2 | 15 | + python-sdnotify | 15 | python-slip10 | 15 | + sphinxcontrib-nwdiag | 15 | ansi | 14 | - python-dbussy | 14 | - python-demjson | 14 | + gtextfsm | 14 | python-pyrss2gen | 14 | - python-xtermcolor | 14 | autotiling | 13 | - pykwalify | 13 | pyp | 13 | + python-dbussy | 13 | python-pem | 13 | + python-xtermcolor | 13 | btchip-python | 12 | gmplot | 12 | junos-eznc | 12 | - notebook-shim | 12 | pwntools | 12 | + pykwalify | 12 | python-crcelk | 12 | python-ethtool | 12 | python-pyscss | 12 | txt2tags | 12 | flask-security | 11 | - pdm | 11 | + notebook-shim | 11 | + slimit | 11 | speaklater | 11 | - traittypes | 11 | - unearth | 11 | django-auditlog | 10 | django-sass | 10 | flask-session | 10 | + kivy | 10 | + pdm | 10 | pylint-common | 10 | python-aiohttp-security | 10 | python-parse-type | 10 | - slimit | 10 | + traittypes | 10 | + unearth | 10 | beancount | 9 | drf-yasg-nonfree | 9 | - kivy | 9 | pybik | 9 | pydrive2 | 9 | pytest-runner | 9 | @@ -199,31 +200,32 @@ Last-Update: Sat, 07 Jun 2025 01:42:04 +0000 debiancontributors | 8 | flask-paranoid | 8 | httpcode | 8 | - pytaglib | 8 | + jschema-to-python | 8 | pytest-django | 8 | python-overpy | 8 | python-pyld | 8 | + python-sarif-python-om | 8 | python-xdo | 8 | - sphinx-intl | 8 | todoman | 8 | beancount | 7 | clustershell | 7 | easyprocess | 7 | - jschema-to-python | 7 | mercurial-evolve | 7 | + pytaglib | 7 | python-envs | 7 | - python-openstep-plist | 7 | python-pyaml-env | 7 | - python-sarif-python-om | 7 | python-versioneer | 7 | + sphinx-intl | 7 | django-model-utils | 6 | django-pglocks | 6 | hachoir | 6 | htmlmin | 6 | librouteros | 6 | + micropython-mpremote | 6 | mypy-protobuf | 6 | python-ansicolors | 6 | python-numpysane | 6 | + python-openstep-plist | 6 | securestring | 6 | clustershell | 5 | django-paintstore | 5 | @@ -232,37 +234,31 @@ Last-Update: Sat, 07 Jun 2025 01:42:04 +0000 flufl.testing | 5 | graphql-relay | 5 | kconfiglib | 5 | - micropython-mpremote | 5 | numpy-stl | 5 | pycallgraph | 5 | python3-onelogin-saml2 | 5 | python-dirq | 5 | python-jpype | 5 | - python-srp | 5 | sorl-thumbnail | 5 | sphinxcontrib-globalsubs | 5 | voltron | 5 | azote | 4 | django-jinja | 4 | - etm | 4 | extension-helpers | 4 | htmlmin | 4 | imap-tools | 4 | logilab-constraint | 4 | - panoramisk | 4 | pyjokes | 4 | pynliner | 4 | pytest-expect | 4 | python-biplist | 4 | python-dbus-next | 4 | python-markuppy | 4 | - python-pgmagick | 4 | python-simpy | 4 | + python-srp | 4 | ruff | 4 | utidylib | 4 | - west | 4 | aiomysql | 3 | - backupchecker | 3 | bootstrap-flask | 3 | cram | 3 | django-bitfield | 3 | @@ -275,13 +271,15 @@ Last-Update: Sat, 07 Jun 2025 01:42:04 +0000 django-simple-redis-admin | 3 | django-templated-email | 3 | django-xmlrpc | 3 | + etm | 3 | flask-api | 3 | flask-mongoengine | 3 | + jpylyzer | 3 | orsopy | 3 | + panoramisk | 3 | proglog | 3 | pyclamd | 3 | pyprind | 3 | - python-chartkick | 3 | python-deepmerge | 3 | python-django-casclient | 3 | python-django-contact-form | 3 | @@ -293,14 +291,15 @@ Last-Update: Sat, 07 Jun 2025 01:42:04 +0000 python-ipfix | 3 | python-netfilterqueue | 3 | python-networkmanager | 3 | - python-text-unidecode | 3 | + python-pgmagick | 3 | + s3ql | 3 | slimit | 3 | sphinx-markdown-tables | 3 | testrepository | 3 | trac-accountmanager | 3 | - trac-xmlrpc | 3 | vf1 | 3 | - zzzeeksphinx | 3 | + west | 3 | + backupchecker | 2 | brebis | 2 | cplay-ng | 2 | django-any-js | 2 | @@ -319,33 +318,35 @@ Last-Update: Sat, 07 Jun 2025 01:42:04 +0000 gtkman | 2 | hatch-jupyter-builder | 2 | humanfriendly | 2 | - jpylyzer | 2 | korean-lunar-calendar | 2 | + mbed-test-wrapper | 2 | namecheap | 2 | okasha | 2 | omgifol | 2 | - panoramisk | 2 | pycrc | 2 | - pyfltk | 2 | pyjunitxml | 2 | pykwalify | 2 | + pyroma | 2 | python-bitbucket-api | 2 | python-btrees | 2 | + python-chartkick | 2 | python-commentjson | 2 | python-cookies | 2 | python-ephemeral-port-reserve | 2 | python-funcy | 2 | python-libguess | 2 | python-qtpynodeeditor | 2 | + python-text-unidecode | 2 | redis-py-cluster | 2 | requests-aws | 2 | - s3ql | 2 | smem | 2 | sphinx-paramlinks | 2 | + trac-xmlrpc | 2 | vcversioner | 2 | vncdotool | 2 | vrfydmn | 2 | wikitrans | 2 | + zzzeeksphinx | 2 | apkinspector | 1 | bqplot | 1 | celery-progress | 1 | @@ -355,19 +356,17 @@ Last-Update: Sat, 07 Jun 2025 01:42:04 +0000 jpy | 1 | jsonrpclib-pelix | 1 | jupyter-sphinx | 1 | - mbed-test-wrapper | 1 | milksnake | 1 | mkdocs-macros-plugin | 1 | moviepy | 1 | myst-nb | 1 | onetimepass | 1 | - pacparser | 1 | + panoramisk | 1 | power | 1 | + pyfltk | 1 | pypass | 1 | pyrad | 1 | - pyroma | 1 | pyssim | 1 | - python-aio-pika | 1 | python-banal | 1 | python-bottle-sqlite | 1 | python-dataset | 1 | @@ -381,8 +380,6 @@ Last-Update: Sat, 07 Jun 2025 01:42:04 +0000 python-openid-cla | 1 | python-openqa-client | 1 | python-openshift | 1 | - python-opentracing | 1 | - python-pysubs2 | 1 | python-py-zipkin | 1 | python-rdflib-endpoint | 1 | python-schedutils | 1 | @@ -392,7 +389,6 @@ Last-Update: Sat, 07 Jun 2025 01:42:04 +0000 python-urlobject | 1 | python-vega-datasets | 1 | python-zc.customdoctests | 1 | - quark-sphinx-theme | 1 | soundcraft-utils | 1 | sphinx-autorun | 1 | sphinxcontrib-github-alt | 1 | @@ -406,7 +402,6 @@ Last-Update: Sat, 07 Jun 2025 01:42:04 +0000 wikitrans | 1 | yotta | 1 | zabbix-cli | 1 | - zlmdb | 1 | aioairzone | 0 | aioaseko | 0 | aioeagle | 0 | @@ -545,6 +540,7 @@ Last-Update: Sat, 07 Jun 2025 01:42:04 +0000 python-pubchempy | 0 | python-pyout | 0 | python-pypump | 0 | + python-pysubs2 | 0 | python-qnapstats | 0 | python-rdflib-endpoint | 0 | python-requests-oauthlib | 0 | @@ -565,6 +561,7 @@ Last-Update: Sat, 07 Jun 2025 01:42:04 +0000 pytkdocs | 0 | pywavelets | 0 | pyyardian | 0 | + quark-sphinx-theme | 0 | rdflib-sqlalchemy | 0 | redis-py-cluster | 0 | sorl-thumbnail | 0 | @@ -581,6 +578,7 @@ Last-Update: Sat, 07 Jun 2025 01:42:04 +0000 webtest | 0 | yotta | 0 | zktop | 0 | + zlmdb | 0 | django-cachalot | -1 | ikos | -1 | pyina | -1 | @@ -593,5 +591,5 @@ Last-Update: Sat, 07 Jun 2025 01:42:04 +0000 sphinxcontrib-emojicodes | -1 | symmetrize | -1 | trac-tickettemplate | -1 | -(606 rows) +(604 rows) View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/bb601c49acf3587ac801427252a8aa1b6173b593 -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/bb601c49acf3587ac801427252a8aa1b6173b593 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Sun Jun 8 02:43:36 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Sun, 08 Jun 2025 01:43:36 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <6844eac8bff26_3db8ab2d4c1704217@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: 57e202bd by Andreas Tille at 2025-06-08T01:43:31+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,12 +1,12 @@ -Last-Update: Sat, 07 Jun 2025 13:42:04 +0000 +Last-Update: Sun, 08 Jun 2025 01:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- dicomscope | 29 | {imaging} | orthanc-gdcm | 15 | {imaging} | mrtrix3 | 13 | {imaging} | - oscar | 13 | {data,practice,tools} | - gnumed-server | 10 | {covid-19,practice} | + oscar | 13 | {data,tools,practice} | + gnumed-server | 10 | {practice,covid-19} | orthanc-mysql | 10 | {imaging} | pixelmed | 10 | {imaging} | sight | 9 | {imaging} | @@ -20,7 +20,7 @@ Last-Update: Sat, 07 Jun 2025 13:42:04 +0000 biojava-live | 5 | {bio-dev} | icb-utils | 4 | {bio-dev} | pbcopper | 4 | {bio-dev} | - beast-mcmc | 3 | {bio,bio-phylogeny} | + beast-mcmc | 3 | {bio-phylogeny,bio} | bio-tradis | 3 | {bio,bio-dev} | getdata | 3 | {bio} | libminc | 3 | {imaging-dev} | @@ -32,7 +32,7 @@ Last-Update: Sat, 07 Jun 2025 13:42:04 +0000 insighttoolkit5 | 2 | {imaging-dev} | libpal-java | 2 | {bio-dev} | plasmidid | 2 | {covid-19,bio} | - python-seqcluster | 2 | {covid-19,bio-dev} | + python-seqcluster | 2 | {bio-dev,covid-19} | sight | 2 | {imaging} | staden | 2 | {bio} | tracetuner | 2 | {bio} | @@ -46,7 +46,7 @@ Last-Update: Sat, 07 Jun 2025 13:42:04 +0000 hinge | 1 | {bio} | htscodecs | 1 | {bio-dev,covid-19} | ipig | 1 | {bio} | - jmodeltest | 1 | {bio,bio-phylogeny} | + jmodeltest | 1 | {bio-phylogeny,bio} | lamarc | 1 | {bio} | libbio-mage-utils-perl | 1 | {bio-dev} | libbiosoup-dev | 1 | {bio-dev} | @@ -58,8 +58,8 @@ Last-Update: Sat, 07 Jun 2025 13:42:04 +0000 mssstest | 1 | {tools} | opencfu | 1 | {laboratory} | papyrus | 1 | {imaging-dev} | - phyutility | 1 | {cloud,bio} | - proalign | 1 | {bio-phylogeny,bio} | + phyutility | 1 | {bio,cloud} | + proalign | 1 | {bio,bio-phylogeny} | rambo-k | 1 | {bio} | seq-gen | 1 | {bio} | sga | 1 | {bio} | @@ -67,10 +67,10 @@ Last-Update: Sat, 07 Jun 2025 13:42:04 +0000 surankco | 1 | {bio} | surpyvor | 1 | {bio} | thesias | 1 | {bio,covid-19} | - treeview | 1 | {bio-phylogeny,bio} | - vienna-rna | 1 | {bio,covid-19} | + treeview | 1 | {bio,bio-phylogeny} | + vienna-rna | 1 | {covid-19,bio} | xdffileio | 1 | {imaging-dev} | - acedb | 0 | {cloud,bio} | + acedb | 0 | {bio,cloud} | bambamc | 0 | {bio-dev} | biojava4-live | 0 | {bio-dev} | biosyntax | 0 | {bio} | @@ -78,10 +78,10 @@ Last-Update: Sat, 07 Jun 2025 13:42:04 +0000 capsule-maven-nextflow | 0 | {bio-dev} | ctffind | 0 | {bio} | ctn | 0 | {imaging-dev} | - dextractor | 0 | {bio,covid-19} | + dextractor | 0 | {covid-19,bio} | embassy-domainatrix | 0 | {cloud,bio} | - embassy-domalign | 0 | {bio,cloud} | - embassy-domsearch | 0 | {cloud,bio} | + embassy-domalign | 0 | {cloud,bio} | + embassy-domsearch | 0 | {bio,cloud} | fis-gtm | 0 | {his} | gatk-bwamem | 0 | {bio-dev} | gatk-fermilite | 0 | {bio-dev} | @@ -118,7 +118,7 @@ Last-Update: Sat, 07 Jun 2025 13:42:04 +0000 melting | 0 | {cloud,bio} | metastudent-data | 0 | {bio} | metastudent-data-2 | 0 | {bio} | - mhap | 0 | {bio,bio-ngs} | + mhap | 0 | {bio-ngs,bio} | mia | 0 | {imaging-dev} | milib | 0 | {covid-19,bio-dev} | ncbi-vdb | 0 | {bio-dev} | @@ -135,7 +135,7 @@ Last-Update: Sat, 07 Jun 2025 13:42:04 +0000 rdp-alignment | 0 | {bio} | rdp-classifier | 0 | {bio} | resfinder-db | 0 | {bio} | - rtax | 0 | {cloud,bio} | + rtax | 0 | {bio,cloud} | runcircos-gui | 0 | {bio} | saint | 0 | {bio} | savvy | 0 | {bio-dev} | @@ -153,7 +153,7 @@ Last-Update: Sat, 07 Jun 2025 13:42:04 +0000 suitename | 0 | {bio} | tophat-recondition | 0 | {bio,covid-19} | trace2dbest | 0 | {bio} | - varscan | 0 | {covid-19,bio} | + varscan | 0 | {bio,covid-19} | xxsds-dynamic | 0 | {bio-dev} | tipp | -1 | {covid-19,bio} | (180 rows) ===================================== debian-science-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Sat, 07 Jun 2025 13:42:08 +0000 +Last-Update: Sun, 08 Jun 2025 01:42:09 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- @@ -25,7 +25,7 @@ Last-Update: Sat, 07 Jun 2025 13:42:08 +0000 flann | 22 | {mathematics-dev,engineering-dev} | sat4j | 22 | {logic} | setzer | 21 | {typesetting} | - fftw | 18 | {mathematics-dev,physics-dev,meteorology-dev} | + fftw | 18 | {meteorology-dev,physics-dev,mathematics-dev} | bossa | 17 | {devices} | lrcalc | 17 | {mathematics-dev} | cliquer | 16 | {mathematics-dev} | @@ -47,10 +47,10 @@ Last-Update: Sat, 07 Jun 2025 13:42:08 +0000 libzn-poly | 12 | {mathematics-dev} | matlab-support | 12 | {mathematics,numericalcomputation} | feedgnuplot | 11 | {viewing} | - lxi-tools | 11 | {engineering,dataacquisition} | + lxi-tools | 11 | {dataacquisition,engineering} | ncl | 11 | {meteorology} | ratpoints | 11 | {mathematics-dev} | - coinor-symphony | 10 | {logic,mathematics,numericalcomputation} | + coinor-symphony | 10 | {mathematics,numericalcomputation,logic} | form | 10 | {mathematics} | ros-rosconsole | 10 | {robotics-dev} | alberta | 9 | {engineering-dev} | @@ -62,7 +62,7 @@ Last-Update: Sat, 07 Jun 2025 13:42:08 +0000 odc | 8 | {meteorology} | python-cdo | 8 | {meteorology} | pcl | 7 | {robotics-dev} | - persalys | 7 | {engineering,statistics,mathematics} | + persalys | 7 | {mathematics,engineering,statistics} | refmac-dictionary | 7 | {highenergy-physics-dev,chemistry} | rheolef | 7 | {mathematics} | apophenia | 6 | {statistics} | @@ -75,17 +75,17 @@ Last-Update: Sat, 07 Jun 2025 13:42:08 +0000 coda | 5 | {meteorology-dev} | coda | 5 | {meteorology} | etsf-io | 5 | {physics,nanoscale-physics} | - fftw | 5 | {meteorology-dev,mathematics-dev,physics-dev} | + fftw | 5 | {meteorology-dev,physics-dev,mathematics-dev} | metview | 5 | {meteorology} | muparser | 5 | {mathematics-dev} | ncl | 5 | {meteorology-dev} | - persalys | 5 | {statistics,mathematics,engineering} | - python-escript | 5 | {numericalcomputation,simulations,engineering} | + persalys | 5 | {engineering,statistics,mathematics} | + python-escript | 5 | {numericalcomputation,engineering,simulations} | ros-vcstool | 5 | {robotics-dev} | rubiks | 5 | {geometry,mathematics} | - toulbar2 | 5 | {logic,numericalcomputation,mathematics,physics} | + toulbar2 | 5 | {mathematics,logic,physics,numericalcomputation} | ucto | 5 | {linguistics} | - debian-science | 4 | {economics,nanoscale-physics,machine-learning,physics,mathematics} | + debian-science | 4 | {mathematics,physics,machine-learning,nanoscale-physics,economics} | drslib | 4 | {meteorology} | emoslib | 4 | {meteorology-dev} | gsw | 4 | {meteorology} | @@ -102,14 +102,14 @@ Last-Update: Sat, 07 Jun 2025 13:42:08 +0000 auto-07p | 3 | {mathematics} | cmor | 3 | {meteorology} | cylc-flow | 3 | {meteorology} | - debian-science | 3 | {physics,machine-learning,economics,nanoscale-physics} | + debian-science | 3 | {physics,economics,machine-learning,nanoscale-physics} | dune-functions | 3 | {mathematics-dev} | dune-localfunctions | 3 | {mathematics-dev} | dune-typetree | 3 | {mathematics-dev} | dxflib | 3 | {engineering-dev} | ecbuild | 3 | {meteorology-dev} | emoslib | 3 | {meteorology} | - getdp | 3 | {engineering,mathematics,simulations} | + getdp | 3 | {mathematics,simulations,engineering} | harp | 3 | {meteorology} | hdf-eos4 | 3 | {meteorology-dev} | hpcc | 3 | {numericalcomputation,distributedcomputing} | @@ -146,7 +146,7 @@ Last-Update: Sat, 07 Jun 2025 13:42:08 +0000 metkit | 2 | {meteorology-dev} | mpi4py-fft | 2 | {mathematics-dev} | mseed2sac | 2 | {dataacquisition-dev} | - ncrystal | 2 | {nanoscale-physics-dev,highenergy-physics-dev} | + ncrystal | 2 | {highenergy-physics-dev,nanoscale-physics-dev} | newmat | 2 | {mathematics-dev} | nrn-iv | 2 | {biology} | openstereogram | 2 | {tools} | @@ -156,7 +156,7 @@ Last-Update: Sat, 07 Jun 2025 13:42:08 +0000 ros-ros-environment | 2 | {robotics-dev} | sagemath-database-conway-polynomials | 2 | {mathematics} | scram | 2 | {engineering} | - sdpb | 2 | {numericalcomputation,highenergy-physics} | + sdpb | 2 | {highenergy-physics,numericalcomputation} | spaghetti | 2 | {geography} | syrthes | 2 | {engineering} | toon | 2 | {numericalcomputation} | @@ -169,7 +169,7 @@ Last-Update: Sat, 07 Jun 2025 13:42:08 +0000 clhep | 1 | {highenergy-physics-dev} | clipper | 1 | {nanoscale-physics-dev} | cmor | 1 | {meteorology-dev} | - coinmp | 1 | {logic,mathematics-dev,numericalcomputation} | + coinmp | 1 | {logic,numericalcomputation,mathematics-dev} | coinor-bonmin | 1 | {mathematics} | debian-science | 1 | {nanoscale-physics-dev} | debian-science | 1 | {electrophysiology} | @@ -186,19 +186,19 @@ Last-Update: Sat, 07 Jun 2025 13:42:08 +0000 liborigin2 | 1 | {viewing-dev} | looptools | 1 | {highenergy-physics} | looptools | 1 | {highenergy-physics-dev} | - magma | 1 | {mathematics-dev,numericalcomputation} | + magma | 1 | {numericalcomputation,mathematics-dev} | mbt | 1 | {linguistics} | mbtserver | 1 | {linguistics} | - mmdb | 1 | {nanoscale-physics-dev,highenergy-physics-dev} | + mmdb | 1 | {highenergy-physics-dev,nanoscale-physics-dev} | mrmpi | 1 | {tools} | nrn-mod2c | 1 | {biology} | openctm | 1 | {physics-dev} | openmesh | 1 | {mathematics-dev} | psurface | 1 | {numericalcomputation} | qd | 1 | {mathematics-dev} | - schroedinger-coordgenlibs | 1 | {nanoscale-physics-dev,chemistry} | + schroedinger-coordgenlibs | 1 | {chemistry,nanoscale-physics-dev} | siscone | 1 | {highenergy-physics-dev} | - spfft | 1 | {mathematics-dev,nanoscale-physics-dev,physics-dev,meteorology-dev} | + spfft | 1 | {meteorology-dev,physics-dev,mathematics-dev,nanoscale-physics-dev} | ssm | 1 | {nanoscale-physics-dev} | timbl | 1 | {linguistics} | timblserver | 1 | {linguistics} | @@ -211,7 +211,7 @@ Last-Update: Sat, 07 Jun 2025 13:42:08 +0000 apertium-urd | 0 | {linguistics} | apertium-urd-hin | 0 | {linguistics} | apriltag | 0 | {robotics-dev} | - calculix-ccx-test | 0 | {simulations,numericalcomputation,engineering} | + calculix-ccx-test | 0 | {simulations,engineering,numericalcomputation} | clhep | 0 | {highenergy-physics-dev} | coda | 0 | {meteorology-dev} | code-saturne | 0 | {engineering} | @@ -232,12 +232,12 @@ Last-Update: Sat, 07 Jun 2025 13:42:08 +0000 mbt | 0 | {linguistics} | mctc-lib | 0 | {nanoscale-physics-dev,highenergy-physics-dev} | meshsdfilter | 0 | {mathematics-dev} | + metis-edf | 0 | {numericalcomputation,engineering} | metis-edf | 0 | {engineering-dev} | - metis-edf | 0 | {engineering,numericalcomputation} | neartree | 0 | {mathematics-dev,numericalcomputation} | opengv | 0 | {geometry} | openigtlink | 0 | {robotics-dev} | - python-escript | 0 | {numericalcomputation,simulations,engineering} | + python-escript | 0 | {engineering,numericalcomputation,simulations} | python-opcodes | 0 | {tools} | qrupdate | 0 | {mathematics-dev} | quadrule | 0 | {mathematics-dev} | @@ -253,7 +253,7 @@ Last-Update: Sat, 07 Jun 2025 13:42:08 +0000 sagemath-database-polytopes | 0 | {mathematics} | schroedinger-maeparser | 0 | {chemistry,nanoscale-physics-dev} | siscone | 0 | {highenergy-physics-dev} | - slicot | 0 | {robotics-dev,engineering-dev} | + slicot | 0 | {engineering-dev,robotics-dev} | sparskit | 0 | {mathematics-dev} | ssm | 0 | {nanoscale-physics} | tachyon | 0 | {mathematics} | ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Sat, 07 Jun 2025 13:42:11 +0000 +Last-Update: Sun, 08 Jun 2025 01:42:12 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/57e202bd6cdc7bf3dc8595266d209b172504b4af -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/57e202bd6cdc7bf3dc8595266d209b172504b4af You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Sun Jun 8 14:43:40 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Sun, 08 Jun 2025 13:43:40 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <6845938c4179c_3db224e3c81777167@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: 236a86cf by Andreas Tille at 2025-06-08T13:43:30+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,26 +1,26 @@ -Last-Update: Sun, 08 Jun 2025 01:42:04 +0000 +Last-Update: Sun, 08 Jun 2025 13:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- - dicomscope | 29 | {imaging} | + dicomscope | 27 | {imaging} | orthanc-gdcm | 15 | {imaging} | mrtrix3 | 13 | {imaging} | - oscar | 13 | {data,tools,practice} | - gnumed-server | 10 | {practice,covid-19} | + oscar | 13 | {data,practice,tools} | + gnumed-server | 10 | {covid-19,practice} | orthanc-mysql | 10 | {imaging} | - pixelmed | 10 | {imaging} | + king | 9 | {typesetting,imaging} | + pixelmed | 9 | {imaging} | sight | 9 | {imaging} | + adun.app | 8 | {bio} | bart-view | 8 | {imaging} | - king | 8 | {typesetting,imaging} | orthanc-postgresql | 8 | {imaging} | - adun.app | 7 | {bio} | heudiconv | 6 | {imaging} | jebl2 | 6 | {bio-dev} | mia | 6 | {imaging} | biojava-live | 5 | {bio-dev} | icb-utils | 4 | {bio-dev} | pbcopper | 4 | {bio-dev} | - beast-mcmc | 3 | {bio-phylogeny,bio} | + beast-mcmc | 3 | {bio,bio-phylogeny} | bio-tradis | 3 | {bio,bio-dev} | getdata | 3 | {bio} | libminc | 3 | {imaging-dev} | @@ -32,13 +32,14 @@ Last-Update: Sun, 08 Jun 2025 01:42:04 +0000 insighttoolkit5 | 2 | {imaging-dev} | libpal-java | 2 | {bio-dev} | plasmidid | 2 | {covid-19,bio} | - python-seqcluster | 2 | {bio-dev,covid-19} | + python-seqcluster | 2 | {covid-19,bio-dev} | sight | 2 | {imaging} | staden | 2 | {bio} | tracetuner | 2 | {bio} | biojava6-live | 1 | {bio-dev} | blimps | 1 | {bio} | brig | 1 | {bio} | + ctn | 1 | {imaging-dev} | cufflinks | 1 | {cloud,bio} | eegdev | 1 | {imaging-dev} | emboss-explorer | 1 | {bio} | @@ -46,7 +47,7 @@ Last-Update: Sun, 08 Jun 2025 01:42:04 +0000 hinge | 1 | {bio} | htscodecs | 1 | {bio-dev,covid-19} | ipig | 1 | {bio} | - jmodeltest | 1 | {bio-phylogeny,bio} | + jmodeltest | 1 | {bio,bio-phylogeny} | lamarc | 1 | {bio} | libbio-mage-utils-perl | 1 | {bio-dev} | libbiosoup-dev | 1 | {bio-dev} | @@ -58,8 +59,8 @@ Last-Update: Sun, 08 Jun 2025 01:42:04 +0000 mssstest | 1 | {tools} | opencfu | 1 | {laboratory} | papyrus | 1 | {imaging-dev} | - phyutility | 1 | {bio,cloud} | - proalign | 1 | {bio,bio-phylogeny} | + phyutility | 1 | {cloud,bio} | + proalign | 1 | {bio-phylogeny,bio} | rambo-k | 1 | {bio} | seq-gen | 1 | {bio} | sga | 1 | {bio} | @@ -67,21 +68,20 @@ Last-Update: Sun, 08 Jun 2025 01:42:04 +0000 surankco | 1 | {bio} | surpyvor | 1 | {bio} | thesias | 1 | {bio,covid-19} | - treeview | 1 | {bio,bio-phylogeny} | - vienna-rna | 1 | {covid-19,bio} | + treeview | 1 | {bio-phylogeny,bio} | + vienna-rna | 1 | {bio,covid-19} | xdffileio | 1 | {imaging-dev} | - acedb | 0 | {bio,cloud} | + acedb | 0 | {cloud,bio} | bambamc | 0 | {bio-dev} | biojava4-live | 0 | {bio-dev} | biosyntax | 0 | {bio} | camp | 0 | {imaging-dev} | capsule-maven-nextflow | 0 | {bio-dev} | ctffind | 0 | {bio} | - ctn | 0 | {imaging-dev} | - dextractor | 0 | {covid-19,bio} | + dextractor | 0 | {bio,covid-19} | embassy-domainatrix | 0 | {cloud,bio} | - embassy-domalign | 0 | {cloud,bio} | - embassy-domsearch | 0 | {bio,cloud} | + embassy-domalign | 0 | {bio,cloud} | + embassy-domsearch | 0 | {cloud,bio} | fis-gtm | 0 | {his} | gatk-bwamem | 0 | {bio-dev} | gatk-fermilite | 0 | {bio-dev} | @@ -118,7 +118,7 @@ Last-Update: Sun, 08 Jun 2025 01:42:04 +0000 melting | 0 | {cloud,bio} | metastudent-data | 0 | {bio} | metastudent-data-2 | 0 | {bio} | - mhap | 0 | {bio-ngs,bio} | + mhap | 0 | {bio,bio-ngs} | mia | 0 | {imaging-dev} | milib | 0 | {covid-19,bio-dev} | ncbi-vdb | 0 | {bio-dev} | @@ -135,11 +135,11 @@ Last-Update: Sun, 08 Jun 2025 01:42:04 +0000 rdp-alignment | 0 | {bio} | rdp-classifier | 0 | {bio} | resfinder-db | 0 | {bio} | - rtax | 0 | {bio,cloud} | + rtax | 0 | {cloud,bio} | runcircos-gui | 0 | {bio} | saint | 0 | {bio} | - savvy | 0 | {bio-dev} | savvy | 0 | {bio} | + savvy | 0 | {bio-dev} | sbmltoolbox | 0 | {bio-dev} | sibsim4 | 0 | {cloud,bio} | sift | 0 | {bio} | @@ -153,7 +153,7 @@ Last-Update: Sun, 08 Jun 2025 01:42:04 +0000 suitename | 0 | {bio} | tophat-recondition | 0 | {bio,covid-19} | trace2dbest | 0 | {bio} | - varscan | 0 | {bio,covid-19} | + varscan | 0 | {covid-19,bio} | xxsds-dynamic | 0 | {bio-dev} | tipp | -1 | {covid-19,bio} | (180 rows) ===================================== debian-science-tests.txt ===================================== @@ -1,36 +1,37 @@ -Last-Update: Sun, 08 Jun 2025 01:42:09 +0000 +Last-Update: Sun, 08 Jun 2025 13:42:08 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- - gts | 4894 | {viewing} | - nltk | 4796 | {linguistics} | - opencascade | 631 | {simulations} | - spacenavd | 229 | {tools} | - open-coarrays | 190 | {meteorology-dev} | - armadillo | 183 | {mathematics-dev} | - arpack | 98 | {mathematics-dev} | - ntl | 44 | {mathematics-dev} | - scalapack | 44 | {nanoscale-physics-dev} | + gts | 4880 | {viewing} | + nltk | 4826 | {linguistics} | + opencascade | 624 | {simulations} | + spacenavd | 227 | {tools} | + open-coarrays | 187 | {meteorology-dev} | + armadillo | 184 | {mathematics-dev} | + arpack | 99 | {mathematics-dev} | + scalapack | 43 | {nanoscale-physics-dev} | + ntl | 41 | {mathematics-dev} | mbpoll | 39 | {simulations} | - imview | 34 | {viewing} | - visidata | 33 | {datamanagement} | - ppl | 31 | {numericalcomputation} | - libmatio | 29 | {mathematics-dev} | + imview | 36 | {viewing} | + visidata | 35 | {datamanagement} | + ppl | 33 | {numericalcomputation} | + libmatio | 30 | {mathematics-dev} | arduino-mk | 28 | {robotics} | - libm4ri | 28 | {mathematics-dev} | + libm4ri | 26 | {mathematics-dev} | + cliquer | 25 | {mathematics} | + grads | 25 | {meteorology} | xygrib | 25 | {meteorology} | - grads | 24 | {meteorology} | - cliquer | 23 | {mathematics} | - flintqs | 23 | {mathematics} | - flann | 22 | {mathematics-dev,engineering-dev} | + flintqs | 24 | {mathematics} | + flann | 23 | {mathematics-dev,engineering-dev} | sat4j | 22 | {logic} | setzer | 21 | {typesetting} | - fftw | 18 | {meteorology-dev,physics-dev,mathematics-dev} | - bossa | 17 | {devices} | + fftw | 18 | {mathematics-dev,physics-dev,meteorology-dev} | lrcalc | 17 | {mathematics-dev} | + bossa | 16 | {devices} | cliquer | 16 | {mathematics-dev} | eccodes | 16 | {meteorology,meteorology-dev} | libitpp | 16 | {mathematics-dev,engineering-dev} | + guiqwt | 15 | {numericalcomputation,viewing} | picosat | 15 | {logic} | pyzo | 15 | {numericalcomputation} | gf2x | 14 | {mathematics-dev} | @@ -40,58 +41,57 @@ Last-Update: Sun, 08 Jun 2025 01:42:09 +0000 sketch | 14 | {typesetting} | dune-uggrid | 13 | {mathematics-dev} | eccodes | 13 | {meteorology-dev} | - guiqwt | 13 | {numericalcomputation,viewing} | libm4rie | 13 | {mathematics-dev} | - teem | 13 | {imageanalysis} | feff85exafs | 12 | {chemistry} | libzn-poly | 12 | {mathematics-dev} | matlab-support | 12 | {mathematics,numericalcomputation} | - feedgnuplot | 11 | {viewing} | - lxi-tools | 11 | {dataacquisition,engineering} | - ncl | 11 | {meteorology} | ratpoints | 11 | {mathematics-dev} | - coinor-symphony | 10 | {mathematics,numericalcomputation,logic} | + teem | 11 | {imageanalysis} | + coinor-symphony | 10 | {logic,mathematics,numericalcomputation} | + feedgnuplot | 10 | {viewing} | form | 10 | {mathematics} | - ros-rosconsole | 10 | {robotics-dev} | + lxi-tools | 10 | {engineering,dataacquisition} | + ncl | 10 | {meteorology} | alberta | 9 | {engineering-dev} | + odc | 9 | {meteorology-dev} | + odc | 9 | {meteorology} | + ros-rosconsole | 9 | {robotics-dev} | vdt | 9 | {mathematics-dev} | dxsamples | 8 | {nanoscale-physics} | geg | 8 | {viewing} | metar | 8 | {meteorology} | - odc | 8 | {meteorology-dev} | - odc | 8 | {meteorology} | + pcl | 8 | {robotics-dev} | python-cdo | 8 | {meteorology} | - pcl | 7 | {robotics-dev} | - persalys | 7 | {mathematics,engineering,statistics} | + magics++ | 7 | {meteorology-dev} | + opencascade | 7 | {simulations} | + persalys | 7 | {engineering,statistics,mathematics} | refmac-dictionary | 7 | {highenergy-physics-dev,chemistry} | rheolef | 7 | {mathematics} | apophenia | 6 | {statistics} | atlas-ecmwf | 6 | {meteorology} | + fftw | 6 | {meteorology-dev,mathematics-dev,physics-dev} | fpzip | 6 | {meteorology} | - magics++ | 6 | {meteorology-dev} | - opencascade | 6 | {simulations} | + ros-vcstool | 6 | {robotics-dev} | uctodata | 6 | {linguistics} | cld2 | 5 | {linguistics} | coda | 5 | {meteorology-dev} | coda | 5 | {meteorology} | etsf-io | 5 | {physics,nanoscale-physics} | - fftw | 5 | {meteorology-dev,physics-dev,mathematics-dev} | + libccp4 | 5 | {nanoscale-physics-dev} | metview | 5 | {meteorology} | muparser | 5 | {mathematics-dev} | ncl | 5 | {meteorology-dev} | - persalys | 5 | {engineering,statistics,mathematics} | - python-escript | 5 | {numericalcomputation,engineering,simulations} | - ros-vcstool | 5 | {robotics-dev} | + persalys | 5 | {statistics,mathematics,engineering} | + python-escript | 5 | {numericalcomputation,simulations,engineering} | rubiks | 5 | {geometry,mathematics} | - toulbar2 | 5 | {mathematics,logic,physics,numericalcomputation} | + toulbar2 | 5 | {logic,numericalcomputation,mathematics,physics} | ucto | 5 | {linguistics} | - debian-science | 4 | {mathematics,physics,machine-learning,nanoscale-physics,economics} | + debian-science | 4 | {economics,nanoscale-physics,machine-learning,physics,mathematics} | drslib | 4 | {meteorology} | emoslib | 4 | {meteorology-dev} | gsw | 4 | {meteorology} | hdf-eos5 | 4 | {meteorology-dev} | iapws | 4 | {meteorology} | - libccp4 | 4 | {nanoscale-physics-dev} | libgctp | 4 | {meteorology-dev} | libxsmm | 4 | {mathematics-dev} | lrcalc | 4 | {mathematics} | @@ -102,41 +102,42 @@ Last-Update: Sun, 08 Jun 2025 01:42:09 +0000 auto-07p | 3 | {mathematics} | cmor | 3 | {meteorology} | cylc-flow | 3 | {meteorology} | - debian-science | 3 | {physics,economics,machine-learning,nanoscale-physics} | + debian-science | 3 | {physics,machine-learning,economics,nanoscale-physics} | dune-functions | 3 | {mathematics-dev} | dune-localfunctions | 3 | {mathematics-dev} | dune-typetree | 3 | {mathematics-dev} | dxflib | 3 | {engineering-dev} | ecbuild | 3 | {meteorology-dev} | emoslib | 3 | {meteorology} | - getdp | 3 | {mathematics,simulations,engineering} | harp | 3 | {meteorology} | hdf-eos4 | 3 | {meteorology-dev} | hpcc | 3 | {numericalcomputation,distributedcomputing} | ipe-tools | 3 | {typesetting} | irstlm | 3 | {linguistics} | - libcgns | 3 | {engineering-dev} | libcgns | 3 | {engineering} | + libcgns | 3 | {engineering-dev} | libmatheval | 3 | {mathematics} | metkit | 3 | {meteorology} | sac2mseed | 3 | {geography} | sardana | 3 | {dataacquisition} | - silo-llnl | 3 | {engineering} | silo-llnl | 3 | {engineering-dev} | + silo-llnl | 3 | {engineering} | toontag | 3 | {numericalcomputation} | veccore | 3 | {mathematics-dev} | apache-opennlp | 2 | {linguistics} | apertium-eval-translator | 2 | {linguistics} | apophenia | 2 | {statistics} | coda | 2 | {meteorology-dev} | - code-saturne | 2 | {mathematics-dev,engineering-dev} | code-saturne | 2 | {engineering-dev,mathematics-dev} | + code-saturne | 2 | {mathematics-dev,engineering-dev} | + debian-science | 2 | {economics} | debian-science | 2 | {nanoscale-physics,statistics,economics,physics} | debian-science | 2 | {neuroscience-cognitive} | - debian-science | 2 | {economics} | dimbl | 2 | {linguistics} | + fastjet | 2 | {highenergy-physics-dev} | fpzip | 2 | {meteorology-dev} | gadap | 2 | {meteorology-dev} | + getdp | 2 | {engineering,mathematics,simulations} | ipe-tools | 2 | {typesetting} | libcvd | 2 | {imageanalysis} | libgtkdatabox | 2 | {engineering-dev,viewing-dev} | @@ -146,7 +147,7 @@ Last-Update: Sun, 08 Jun 2025 01:42:09 +0000 metkit | 2 | {meteorology-dev} | mpi4py-fft | 2 | {mathematics-dev} | mseed2sac | 2 | {dataacquisition-dev} | - ncrystal | 2 | {highenergy-physics-dev,nanoscale-physics-dev} | + ncrystal | 2 | {nanoscale-physics-dev,highenergy-physics-dev} | newmat | 2 | {mathematics-dev} | nrn-iv | 2 | {biology} | openstereogram | 2 | {tools} | @@ -156,7 +157,8 @@ Last-Update: Sun, 08 Jun 2025 01:42:09 +0000 ros-ros-environment | 2 | {robotics-dev} | sagemath-database-conway-polynomials | 2 | {mathematics} | scram | 2 | {engineering} | - sdpb | 2 | {highenergy-physics,numericalcomputation} | + sdpb | 2 | {numericalcomputation,highenergy-physics} | + siscone | 2 | {highenergy-physics-dev} | spaghetti | 2 | {geography} | syrthes | 2 | {engineering} | toon | 2 | {numericalcomputation} | @@ -169,16 +171,16 @@ Last-Update: Sun, 08 Jun 2025 01:42:09 +0000 clhep | 1 | {highenergy-physics-dev} | clipper | 1 | {nanoscale-physics-dev} | cmor | 1 | {meteorology-dev} | - coinmp | 1 | {logic,numericalcomputation,mathematics-dev} | + coinmp | 1 | {logic,mathematics-dev,numericalcomputation} | coinor-bonmin | 1 | {mathematics} | - debian-science | 1 | {nanoscale-physics-dev} | + debian-science | 1 | {tools} | debian-science | 1 | {electrophysiology} | + debian-science | 1 | {nanoscale-physics-dev} | debian-science | 1 | {neuroscience-cognitive,machine-learning} | debian-science | 1 | {psychophysics} | - debian-science | 1 | {tools} | - fastjet | 1 | {highenergy-physics-dev} | frog | 1 | {linguistics} | frogdata | 1 | {linguistics} | + gemmlowp | 1 | {mathematics-dev} | hepmc3 | 1 | {nanoscale-physics-dev,highenergy-physics-dev} | jeuclid | 1 | {viewing,typesetting} | libcvd | 1 | {imageanalysis-dev} | @@ -186,20 +188,21 @@ Last-Update: Sun, 08 Jun 2025 01:42:09 +0000 liborigin2 | 1 | {viewing-dev} | looptools | 1 | {highenergy-physics} | looptools | 1 | {highenergy-physics-dev} | - magma | 1 | {numericalcomputation,mathematics-dev} | + magma | 1 | {mathematics-dev,numericalcomputation} | mbt | 1 | {linguistics} | mbtserver | 1 | {linguistics} | - mmdb | 1 | {highenergy-physics-dev,nanoscale-physics-dev} | + mmdb | 1 | {nanoscale-physics-dev,highenergy-physics-dev} | mrmpi | 1 | {tools} | nrn-mod2c | 1 | {biology} | openctm | 1 | {physics-dev} | openmesh | 1 | {mathematics-dev} | psurface | 1 | {numericalcomputation} | qd | 1 | {mathematics-dev} | - schroedinger-coordgenlibs | 1 | {chemistry,nanoscale-physics-dev} | + schroedinger-coordgenlibs | 1 | {nanoscale-physics-dev,chemistry} | siscone | 1 | {highenergy-physics-dev} | - spfft | 1 | {meteorology-dev,physics-dev,mathematics-dev,nanoscale-physics-dev} | + spfft | 1 | {mathematics-dev,nanoscale-physics-dev,physics-dev,meteorology-dev} | ssm | 1 | {nanoscale-physics-dev} | + tfdocgen | 1 | {linguistics} | timbl | 1 | {linguistics} | timblserver | 1 | {linguistics} | amgcl | 0 | {mathematics-dev} | @@ -211,7 +214,7 @@ Last-Update: Sun, 08 Jun 2025 01:42:09 +0000 apertium-urd | 0 | {linguistics} | apertium-urd-hin | 0 | {linguistics} | apriltag | 0 | {robotics-dev} | - calculix-ccx-test | 0 | {simulations,engineering,numericalcomputation} | + calculix-ccx-test | 0 | {simulations,numericalcomputation,engineering} | clhep | 0 | {highenergy-physics-dev} | coda | 0 | {meteorology-dev} | code-saturne | 0 | {engineering} | @@ -222,7 +225,6 @@ Last-Update: Sun, 08 Jun 2025 01:42:09 +0000 dune-grid-glue | 0 | {mathematics-dev} | etsf-io | 0 | {nanoscale-physics-dev} | fastjet | 0 | {highenergy-physics-dev} | - gemmlowp | 0 | {mathematics-dev} | glpk-java | 0 | {mathematics-dev} | itsol | 0 | {mathematics-dev} | libdogleg | 0 | {mathematics-dev} | @@ -232,12 +234,12 @@ Last-Update: Sun, 08 Jun 2025 01:42:09 +0000 mbt | 0 | {linguistics} | mctc-lib | 0 | {nanoscale-physics-dev,highenergy-physics-dev} | meshsdfilter | 0 | {mathematics-dev} | - metis-edf | 0 | {numericalcomputation,engineering} | metis-edf | 0 | {engineering-dev} | + metis-edf | 0 | {engineering,numericalcomputation} | neartree | 0 | {mathematics-dev,numericalcomputation} | opengv | 0 | {geometry} | openigtlink | 0 | {robotics-dev} | - python-escript | 0 | {engineering,numericalcomputation,simulations} | + python-escript | 0 | {numericalcomputation,simulations,engineering} | python-opcodes | 0 | {tools} | qrupdate | 0 | {mathematics-dev} | quadrule | 0 | {mathematics-dev} | @@ -253,12 +255,11 @@ Last-Update: Sun, 08 Jun 2025 01:42:09 +0000 sagemath-database-polytopes | 0 | {mathematics} | schroedinger-maeparser | 0 | {chemistry,nanoscale-physics-dev} | siscone | 0 | {highenergy-physics-dev} | - slicot | 0 | {engineering-dev,robotics-dev} | + slicot | 0 | {robotics-dev,engineering-dev} | sparskit | 0 | {mathematics-dev} | ssm | 0 | {nanoscale-physics} | tachyon | 0 | {mathematics} | tamuanova | 0 | {statistics} | - tfdocgen | 0 | {linguistics} | ticcutils | 0 | {linguistics} | timbl | 0 | {linguistics} | timblserver | 0 | {linguistics} | @@ -269,5 +270,5 @@ Last-Update: Sun, 08 Jun 2025 01:42:09 +0000 virtuoso-opensource | 0 | {datamanagement} | visp-images | 0 | {robotics-dev} | libelas | -1 | {robotics-dev} | -(297 rows) +(298 rows) ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,247 +1,248 @@ -Last-Update: Sun, 08 Jun 2025 01:42:12 +0000 +Last-Update: Sun, 08 Jun 2025 13:42:11 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- - mpmath | 10237 | - python-repoze.lru | 7006 | - netifaces | 5150 | - ghp-import | 4750 | - python-lunr | 4744 | - python-babel | 4291 | - sortedcontainers | 3900 | - python-babel | 3745 | - aiosignal | 2922 | - hyperlink | 2151 | - python-notify2 | 2042 | - humanfriendly | 1930 | - referencing | 1756 | - python-mysqldb | 1508 | - python-pandocfilters | 1463 | - python-gssapi | 1417 | - python-invoke | 1399 | - python-hyperframe | 1353 | - websocket-client | 1342 | - python-hpack | 1150 | - python-rsa | 1122 | - pdfarranger | 1031 | - menulibre | 953 | + mpmath | 10186 | + python-repoze.lru | 6996 | + netifaces | 5151 | + ghp-import | 4779 | + python-lunr | 4773 | + python-babel | 4280 | + sortedcontainers | 3887 | + python-babel | 3733 | + aiosignal | 2921 | + hyperlink | 2131 | + python-notify2 | 2038 | + humanfriendly | 1937 | + referencing | 1758 | + python-mysqldb | 1513 | + python-pandocfilters | 1459 | + python-gssapi | 1408 | + python-invoke | 1392 | + python-hyperframe | 1356 | + websocket-client | 1339 | + python-hpack | 1153 | + python-rsa | 1126 | + pdfarranger | 1021 | + menulibre | 960 | python-linux-procfs | 932 | - autopep8 | 895 | - python-geoip | 886 | - python-zopfli | 876 | - python-webob | 833 | - pytoolconfig | 819 | + autopep8 | 896 | + python-geoip | 889 | + python-zopfli | 836 | + python-webob | 835 | + pytoolconfig | 816 | firmware-microbit-micropython | 771 | - powerline | 723 | - powerline | 722 | - powerline | 716 | - kazam | 694 | - u-msgpack-python | 637 | - gaupol | 569 | - dockerpty | 525 | - asn1crypto | 510 | - python-et-xmlfile | 505 | - python-gevent | 504 | - python-ewmh | 440 | + powerline | 731 | + powerline | 720 | + powerline | 714 | + kazam | 689 | + u-msgpack-python | 636 | + gaupol | 566 | + dockerpty | 527 | + python-et-xmlfile | 512 | + asn1crypto | 504 | + python-gevent | 503 | catfish | 438 | - python-requests-oauthlib | 413 | - python-toml | 376 | - spf-engine | 342 | - python-ntlm-auth | 320 | + python-ewmh | 436 | + python-requests-oauthlib | 411 | + python-toml | 367 | + spf-engine | 344 | + python-ntlm-auth | 318 | spf-engine | 294 | - django-stronghold | 258 | - cairocffi | 224 | - python-ldap3 | 221 | + django-stronghold | 259 | + cairocffi | 222 | + python-ldap3 | 222 | python-mimeparse | 196 | python-smmap | 180 | - python-hidapi | 168 | - autokey | 164 | - httpie | 154 | - python-anyjson | 146 | - smem | 145 | - kivy | 128 | - python-aiostream | 124 | - smartypants | 113 | - nodeenv | 109 | - python-click-repl | 106 | - pacparser | 103 | - mugshot | 102 | - lollypop | 101 | - mypaint | 101 | - timekpr-next | 100 | + python-hidapi | 172 | + autokey | 167 | + httpie | 155 | + python-anyjson | 149 | + smem | 144 | + kivy | 127 | + python-aiostream | 125 | + smartypants | 112 | + nodeenv | 110 | + python-click-repl | 105 | + mugshot | 103 | + timekpr-next | 102 | + lollypop | 100 | + mypaint | 98 | + pacparser | 98 | python-pyu2f | 98 | - python-consul | 96 | + python-consul | 97 | pymacaroons | 86 | pymediainfo | 85 | pssh | 83 | - python-colour | 80 | + python-colour | 79 | python-rfc6555 | 77 | - numpy-stl | 71 | - python-i3ipc | 69 | - python-pykka | 68 | - fabric | 65 | - mitmproxy | 65 | - weasyprint | 65 | - python-uritools | 61 | - pywavelets | 60 | - ueberzug | 60 | + numpy-stl | 72 | + weasyprint | 68 | + fabric | 67 | + python-i3ipc | 67 | + python-pykka | 67 | + mitmproxy | 66 | + pywavelets | 59 | + python-uritools | 58 | + ueberzug | 58 | python-scp | 55 | - itstool | 52 | + itstool | 51 | mysql-connector-python | 49 | - pyenv | 47 | + pyenv | 48 | + python-looseversion | 47 | show-in-file-manager | 47 | - python-looseversion | 46 | blockdiag | 45 | hatchling | 45 | - sshtunnel | 44 | - trac | 44 | - khard | 43 | + trac | 45 | + sshtunnel | 42 | + khard | 41 | + certipy | 40 | + membernator | 40 | + pamela | 40 | persepolis | 40 | - certipy | 39 | - pamela | 39 | - jupyterhub | 38 | - membernator | 38 | + jupyterhub | 39 | pymacs | 37 | - pyquery | 36 | pylibmc | 35 | + pyquery | 35 | powerline-gitstatus | 33 | - pssh | 31 | - python-scrypt | 31 | + python-scrypt | 33 | + pssh | 30 | + python-pysol-cards | 30 | dkimpy-milter | 29 | - python-statsd | 28 | + pdfposter | 29 | + python-statsd | 29 | + python-args | 28 | sphinxcontrib-blockdiag | 28 | - pdfposter | 27 | - python-args | 27 | + video-downloader | 28 | seqdiag | 27 | - video-downloader | 27 | - backoff | 26 | - python-pysol-cards | 26 | sphinxcontrib-seqdiag | 26 | + backoff | 25 | + python-clint | 25 | flask-principal | 24 | - python-clint | 24 | + rst2pdf | 24 | sphinx-inline-tabs | 24 | - webpy | 24 | - rst2pdf | 23 | - typogrify | 23 | + depthcharge-tools | 23 | + webpy | 23 | enzyme | 22 | + python-zstd | 22 | + typogrify | 22 | cppman | 21 | - depthcharge-tools | 21 | + fabric | 21 | nwdiag | 21 | - python-zstd | 21 | subliminal | 21 | alot | 20 | - fabric | 20 | python-rangehttpserver | 20 | ruff | 20 | + spf-engine | 20 | webtest | 20 | python-fire | 19 | python-translationstring | 19 | - spf-engine | 19 | subliminal | 19 | social-auth-core | 18 | actdiag | 17 | django-environ | 17 | mistune0 | 17 | - nwg-displays | 17 | - python-simpy | 17 | + python-demjson | 17 | + nwg-displays | 16 | python-hupper | 16 | python-inotify | 16 | + python-simpy | 16 | + python-slip10 | 16 | sphinxcontrib-actdiag | 16 | sphinxcontrib-log-cabinet | 16 | policyd-rate-limit | 15 | - python-demjson | 15 | python-kyotocabinet | 15 | python-priority | 15 | python-pyalsa | 15 | - python-pysubs2 | 15 | python-sdnotify | 15 | - python-slip10 | 15 | sphinxcontrib-nwdiag | 15 | ansi | 14 | gtextfsm | 14 | python-pyrss2gen | 14 | + python-pysubs2 | 14 | autotiling | 13 | + pykwalify | 13 | pyp | 13 | - python-dbussy | 13 | python-pem | 13 | python-xtermcolor | 13 | btchip-python | 12 | gmplot | 12 | junos-eznc | 12 | pwntools | 12 | - pykwalify | 12 | python-crcelk | 12 | + python-dbussy | 12 | python-ethtool | 12 | python-pyscss | 12 | + slimit | 12 | txt2tags | 12 | flask-security | 11 | notebook-shim | 11 | - slimit | 11 | + pylint-common | 11 | speaklater | 11 | django-auditlog | 10 | django-sass | 10 | flask-session | 10 | kivy | 10 | pdm | 10 | - pylint-common | 10 | python-aiohttp-security | 10 | python-parse-type | 10 | traittypes | 10 | unearth | 10 | beancount | 9 | drf-yasg-nonfree | 9 | + jschema-to-python | 9 | pybik | 9 | pydrive2 | 9 | pytest-runner | 9 | python-digitalocean | 9 | python-drf-spectacular-sidecar-nonfree | 9 | + python-sarif-python-om | 9 | trac-wysiwyg | 9 | tuna | 9 | debiancontributors | 8 | flask-paranoid | 8 | httpcode | 8 | - jschema-to-python | 8 | pytest-django | 8 | python-overpy | 8 | python-pyld | 8 | - python-sarif-python-om | 8 | + python-versioneer | 8 | python-xdo | 8 | todoman | 8 | beancount | 7 | clustershell | 7 | easyprocess | 7 | + librouteros | 7 | mercurial-evolve | 7 | pytaglib | 7 | python-envs | 7 | + python-numpysane | 7 | + python-openstep-plist | 7 | python-pyaml-env | 7 | - python-versioneer | 7 | + securestring | 7 | sphinx-intl | 7 | django-model-utils | 6 | django-pglocks | 6 | hachoir | 6 | htmlmin | 6 | - librouteros | 6 | + kconfiglib | 6 | micropython-mpremote | 6 | - mypy-protobuf | 6 | + numpy-stl | 6 | python-ansicolors | 6 | - python-numpysane | 6 | - python-openstep-plist | 6 | - securestring | 6 | + voltron | 6 | clustershell | 5 | django-paintstore | 5 | drf-extensions | 5 | drf-haystack | 5 | flufl.testing | 5 | graphql-relay | 5 | - kconfiglib | 5 | - numpy-stl | 5 | + mypy-protobuf | 5 | pycallgraph | 5 | python3-onelogin-saml2 | 5 | + python-biplist | 5 | python-dirq | 5 | python-jpype | 5 | sorl-thumbnail | 5 | sphinxcontrib-globalsubs | 5 | - voltron | 5 | azote | 4 | django-jinja | 4 | extension-helpers | 4 | @@ -251,13 +252,16 @@ Last-Update: Sun, 08 Jun 2025 01:42:12 +0000 pyjokes | 4 | pynliner | 4 | pytest-expect | 4 | - python-biplist | 4 | python-dbus-next | 4 | + python-dynaconf | 4 | + python-gnuplotlib | 4 | + python-halo | 4 | python-markuppy | 4 | python-simpy | 4 | python-srp | 4 | ruff | 4 | utidylib | 4 | + west | 4 | aiomysql | 3 | bootstrap-flask | 3 | cram | 3 | @@ -275,6 +279,7 @@ Last-Update: Sun, 08 Jun 2025 01:42:12 +0000 flask-api | 3 | flask-mongoengine | 3 | jpylyzer | 3 | + mbed-test-wrapper | 3 | orsopy | 3 | panoramisk | 3 | proglog | 3 | @@ -285,9 +290,6 @@ Last-Update: Sun, 08 Jun 2025 01:42:12 +0000 python-django-contact-form | 3 | python-django-push-notifications | 3 | python-django-registration | 3 | - python-dynaconf | 3 | - python-gnuplotlib | 3 | - python-halo | 3 | python-ipfix | 3 | python-netfilterqueue | 3 | python-networkmanager | 3 | @@ -298,7 +300,6 @@ Last-Update: Sun, 08 Jun 2025 01:42:12 +0000 testrepository | 3 | trac-accountmanager | 3 | vf1 | 3 | - west | 3 | backupchecker | 2 | brebis | 2 | cplay-ng | 2 | @@ -319,11 +320,11 @@ Last-Update: Sun, 08 Jun 2025 01:42:12 +0000 hatch-jupyter-builder | 2 | humanfriendly | 2 | korean-lunar-calendar | 2 | - mbed-test-wrapper | 2 | namecheap | 2 | okasha | 2 | omgifol | 2 | pycrc | 2 | + pyfltk | 2 | pyjunitxml | 2 | pykwalify | 2 | pyroma | 2 | @@ -346,6 +347,7 @@ Last-Update: Sun, 08 Jun 2025 01:42:12 +0000 vncdotool | 2 | vrfydmn | 2 | wikitrans | 2 | + yotta | 2 | zzzeeksphinx | 2 | apkinspector | 1 | bqplot | 1 | @@ -363,7 +365,7 @@ Last-Update: Sun, 08 Jun 2025 01:42:12 +0000 onetimepass | 1 | panoramisk | 1 | power | 1 | - pyfltk | 1 | + pylint-celery | 1 | pypass | 1 | pyrad | 1 | pyssim | 1 | @@ -372,6 +374,7 @@ Last-Update: Sun, 08 Jun 2025 01:42:12 +0000 python-dataset | 1 | python-dnsq | 1 | python-gammu | 1 | + python-genson | 1 | python-getdns | 1 | python-gfloat | 1 | python-kanboard | 1 | @@ -383,6 +386,7 @@ Last-Update: Sun, 08 Jun 2025 01:42:12 +0000 python-py-zipkin | 1 | python-rdflib-endpoint | 1 | python-schedutils | 1 | + python-securesystemslib | 1 | python-sphinx-examples | 1 | python-spur | 1 | python-undetected-chromedriver | 1 | @@ -400,8 +404,8 @@ Last-Update: Sun, 08 Jun 2025 01:42:12 +0000 turbosearch | 1 | wchartype | 1 | wikitrans | 1 | - yotta | 1 | zabbix-cli | 1 | + zlmdb | 1 | aioairzone | 0 | aioaseko | 0 | aioeagle | 0 | @@ -480,7 +484,6 @@ Last-Update: Sun, 08 Jun 2025 01:42:12 +0000 pyfg | 0 | pykmtronic | 0 | pylibmc | 0 | - pylint-celery | 0 | pymediainfo | 0 | pyment | 0 | pynag | 0 | @@ -517,7 +520,6 @@ Last-Update: Sun, 08 Jun 2025 01:42:12 +0000 python-fudge | 0 | python-fullykiosk | 0 | python-funcy | 0 | - python-genson | 0 | python-getdns | 0 | python-gevent | 0 | python-gpsoauth | 0 | @@ -546,7 +548,6 @@ Last-Update: Sun, 08 Jun 2025 01:42:12 +0000 python-requests-oauthlib | 0 | python-rova | 0 | python-rpcq | 0 | - python-securesystemslib | 0 | python-simpy | 0 | python-socketpool | 0 | python-sphinx-examples | 0 | @@ -578,7 +579,6 @@ Last-Update: Sun, 08 Jun 2025 01:42:12 +0000 webtest | 0 | yotta | 0 | zktop | 0 | - zlmdb | 0 | django-cachalot | -1 | ikos | -1 | pyina | -1 | View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/236a86cf0c9e08a7988b6a6c9bc128932c55a33b -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/236a86cf0c9e08a7988b6a6c9bc128932c55a33b You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Mon Jun 9 02:43:23 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Mon, 09 Jun 2025 01:43:23 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <68463c3b665ea_3dbb9d8054186957b@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: 55b855dd by Andreas Tille at 2025-06-09T01:43:19+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Sun, 08 Jun 2025 13:42:04 +0000 +Last-Update: Mon, 09 Jun 2025 01:42:03 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- ===================================== debian-science-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Sun, 08 Jun 2025 13:42:08 +0000 +Last-Update: Mon, 09 Jun 2025 01:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Sun, 08 Jun 2025 13:42:11 +0000 +Last-Update: Mon, 09 Jun 2025 01:42:04 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/55b855dd2d54baac73d7bfa9f97cf45219145d7b -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/55b855dd2d54baac73d7bfa9f97cf45219145d7b You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Mon Jun 9 14:43:40 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Mon, 09 Jun 2025 13:43:40 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <6846e50c341e0_3dbb1535641947452@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: 4e41f05e by Andreas Tille at 2025-06-09T13:43:32+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,11 +1,11 @@ -Last-Update: Mon, 09 Jun 2025 01:42:03 +0000 +Last-Update: Mon, 09 Jun 2025 13:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- dicomscope | 27 | {imaging} | orthanc-gdcm | 15 | {imaging} | + oscar | 14 | {data,practice,tools} | mrtrix3 | 13 | {imaging} | - oscar | 13 | {data,practice,tools} | gnumed-server | 10 | {covid-19,practice} | orthanc-mysql | 10 | {imaging} | king | 9 | {typesetting,imaging} | @@ -29,6 +29,7 @@ Last-Update: Mon, 09 Jun 2025 01:42:03 +0000 ants | 2 | {imaging} | cmtk | 2 | {imaging} | elastix | 2 | {imaging} | + fastml | 2 | {bio} | insighttoolkit5 | 2 | {imaging-dev} | libpal-java | 2 | {bio-dev} | plasmidid | 2 | {covid-19,bio} | @@ -41,9 +42,9 @@ Last-Update: Mon, 09 Jun 2025 01:42:03 +0000 brig | 1 | {bio} | ctn | 1 | {imaging-dev} | cufflinks | 1 | {cloud,bio} | + dextractor | 1 | {bio,covid-19} | eegdev | 1 | {imaging-dev} | emboss-explorer | 1 | {bio} | - fastml | 1 | {bio} | hinge | 1 | {bio} | htscodecs | 1 | {bio-dev,covid-19} | ipig | 1 | {bio} | @@ -78,7 +79,6 @@ Last-Update: Mon, 09 Jun 2025 01:42:03 +0000 camp | 0 | {imaging-dev} | capsule-maven-nextflow | 0 | {bio-dev} | ctffind | 0 | {bio} | - dextractor | 0 | {bio,covid-19} | embassy-domainatrix | 0 | {cloud,bio} | embassy-domalign | 0 | {bio,cloud} | embassy-domsearch | 0 | {cloud,bio} | ===================================== debian-science-tests.txt ===================================== @@ -1,47 +1,47 @@ -Last-Update: Mon, 09 Jun 2025 01:42:04 +0000 +Last-Update: Mon, 09 Jun 2025 13:42:08 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- - gts | 4880 | {viewing} | - nltk | 4826 | {linguistics} | - opencascade | 624 | {simulations} | - spacenavd | 227 | {tools} | - open-coarrays | 187 | {meteorology-dev} | - armadillo | 184 | {mathematics-dev} | - arpack | 99 | {mathematics-dev} | - scalapack | 43 | {nanoscale-physics-dev} | - ntl | 41 | {mathematics-dev} | - mbpoll | 39 | {simulations} | + gts | 4846 | {viewing} | + nltk | 4829 | {linguistics} | + opencascade | 627 | {simulations} | + spacenavd | 226 | {tools} | + open-coarrays | 189 | {meteorology-dev} | + armadillo | 181 | {mathematics-dev} | + arpack | 98 | {mathematics-dev} | + scalapack | 46 | {nanoscale-physics-dev} | + ntl | 40 | {mathematics-dev} | + mbpoll | 38 | {simulations} | imview | 36 | {viewing} | - visidata | 35 | {datamanagement} | - ppl | 33 | {numericalcomputation} | + visidata | 36 | {datamanagement} | + ppl | 35 | {numericalcomputation} | libmatio | 30 | {mathematics-dev} | arduino-mk | 28 | {robotics} | - libm4ri | 26 | {mathematics-dev} | - cliquer | 25 | {mathematics} | - grads | 25 | {meteorology} | - xygrib | 25 | {meteorology} | - flintqs | 24 | {mathematics} | + cliquer | 26 | {mathematics} | + flintqs | 25 | {mathematics} | + libm4ri | 25 | {mathematics-dev} | + grads | 24 | {meteorology} | + xygrib | 24 | {meteorology} | flann | 23 | {mathematics-dev,engineering-dev} | - sat4j | 22 | {logic} | - setzer | 21 | {typesetting} | + sat4j | 23 | {logic} | + setzer | 23 | {typesetting} | fftw | 18 | {mathematics-dev,physics-dev,meteorology-dev} | + libitpp | 17 | {mathematics-dev,engineering-dev} | lrcalc | 17 | {mathematics-dev} | bossa | 16 | {devices} | cliquer | 16 | {mathematics-dev} | eccodes | 16 | {meteorology,meteorology-dev} | - libitpp | 16 | {mathematics-dev,engineering-dev} | - guiqwt | 15 | {numericalcomputation,viewing} | - picosat | 15 | {logic} | + picosat | 16 | {logic} | pyzo | 15 | {numericalcomputation} | gf2x | 14 | {mathematics-dev} | gts | 14 | {viewing-dev} | + guiqwt | 14 | {numericalcomputation,viewing} | iml | 14 | {mathematics-dev} | libhomfly | 14 | {mathematics-dev} | sketch | 14 | {typesetting} | dune-uggrid | 13 | {mathematics-dev} | - eccodes | 13 | {meteorology-dev} | libm4rie | 13 | {mathematics-dev} | + eccodes | 12 | {meteorology-dev} | feff85exafs | 12 | {chemistry} | libzn-poly | 12 | {mathematics-dev} | matlab-support | 12 | {mathematics,numericalcomputation} | @@ -53,13 +53,13 @@ Last-Update: Mon, 09 Jun 2025 01:42:04 +0000 lxi-tools | 10 | {engineering,dataacquisition} | ncl | 10 | {meteorology} | alberta | 9 | {engineering-dev} | - odc | 9 | {meteorology-dev} | - odc | 9 | {meteorology} | ros-rosconsole | 9 | {robotics-dev} | vdt | 9 | {mathematics-dev} | dxsamples | 8 | {nanoscale-physics} | geg | 8 | {viewing} | metar | 8 | {meteorology} | + odc | 8 | {meteorology} | + odc | 8 | {meteorology-dev} | pcl | 8 | {robotics-dev} | python-cdo | 8 | {meteorology} | magics++ | 7 | {meteorology-dev} | @@ -67,34 +67,36 @@ Last-Update: Mon, 09 Jun 2025 01:42:04 +0000 persalys | 7 | {engineering,statistics,mathematics} | refmac-dictionary | 7 | {highenergy-physics-dev,chemistry} | rheolef | 7 | {mathematics} | + uctodata | 7 | {linguistics} | apophenia | 6 | {statistics} | atlas-ecmwf | 6 | {meteorology} | fftw | 6 | {meteorology-dev,mathematics-dev,physics-dev} | fpzip | 6 | {meteorology} | + libccp4 | 6 | {nanoscale-physics-dev} | + python-escript | 6 | {numericalcomputation,simulations,engineering} | ros-vcstool | 6 | {robotics-dev} | - uctodata | 6 | {linguistics} | + ucto | 6 | {linguistics} | cld2 | 5 | {linguistics} | - coda | 5 | {meteorology-dev} | coda | 5 | {meteorology} | + coda | 5 | {meteorology-dev} | etsf-io | 5 | {physics,nanoscale-physics} | - libccp4 | 5 | {nanoscale-physics-dev} | metview | 5 | {meteorology} | - muparser | 5 | {mathematics-dev} | ncl | 5 | {meteorology-dev} | persalys | 5 | {statistics,mathematics,engineering} | - python-escript | 5 | {numericalcomputation,simulations,engineering} | rubiks | 5 | {geometry,mathematics} | toulbar2 | 5 | {logic,numericalcomputation,mathematics,physics} | - ucto | 5 | {linguistics} | debian-science | 4 | {economics,nanoscale-physics,machine-learning,physics,mathematics} | drslib | 4 | {meteorology} | + dxflib | 4 | {engineering-dev} | emoslib | 4 | {meteorology-dev} | gsw | 4 | {meteorology} | hdf-eos5 | 4 | {meteorology-dev} | iapws | 4 | {meteorology} | + irstlm | 4 | {linguistics} | libgctp | 4 | {meteorology-dev} | libxsmm | 4 | {mathematics-dev} | lrcalc | 4 | {mathematics} | + muparser | 4 | {mathematics-dev} | psurface | 4 | {numericalcomputation} | silo-llnl | 4 | {engineering} | urdfdom-headers | 4 | {robotics-dev} | @@ -103,19 +105,18 @@ Last-Update: Mon, 09 Jun 2025 01:42:04 +0000 cmor | 3 | {meteorology} | cylc-flow | 3 | {meteorology} | debian-science | 3 | {physics,machine-learning,economics,nanoscale-physics} | + dimbl | 3 | {linguistics} | dune-functions | 3 | {mathematics-dev} | dune-localfunctions | 3 | {mathematics-dev} | dune-typetree | 3 | {mathematics-dev} | - dxflib | 3 | {engineering-dev} | ecbuild | 3 | {meteorology-dev} | emoslib | 3 | {meteorology} | + fastjet | 3 | {highenergy-physics-dev} | harp | 3 | {meteorology} | hdf-eos4 | 3 | {meteorology-dev} | - hpcc | 3 | {numericalcomputation,distributedcomputing} | ipe-tools | 3 | {typesetting} | - irstlm | 3 | {linguistics} | - libcgns | 3 | {engineering} | libcgns | 3 | {engineering-dev} | + libcgns | 3 | {engineering} | libmatheval | 3 | {mathematics} | metkit | 3 | {meteorology} | sac2mseed | 3 | {geography} | @@ -128,23 +129,24 @@ Last-Update: Mon, 09 Jun 2025 01:42:04 +0000 apertium-eval-translator | 2 | {linguistics} | apophenia | 2 | {statistics} | coda | 2 | {meteorology-dev} | - code-saturne | 2 | {engineering-dev,mathematics-dev} | code-saturne | 2 | {mathematics-dev,engineering-dev} | - debian-science | 2 | {economics} | - debian-science | 2 | {nanoscale-physics,statistics,economics,physics} | + code-saturne | 2 | {engineering-dev,mathematics-dev} | debian-science | 2 | {neuroscience-cognitive} | - dimbl | 2 | {linguistics} | - fastjet | 2 | {highenergy-physics-dev} | + debian-science | 2 | {nanoscale-physics,statistics,economics,physics} | + debian-science | 2 | {economics} | fpzip | 2 | {meteorology-dev} | + frog | 2 | {linguistics} | gadap | 2 | {meteorology-dev} | getdp | 2 | {engineering,mathematics,simulations} | + hpcc | 2 | {numericalcomputation,distributedcomputing} | ipe-tools | 2 | {typesetting} | libcvd | 2 | {imageanalysis} | libgtkdatabox | 2 | {engineering-dev,viewing-dev} | liblbfgs | 2 | {mathematics-dev} | libmatheval | 2 | {mathematics-dev} | libvigraimpex | 2 | {imageanalysis-dev,machine-learning} | - metkit | 2 | {meteorology-dev} | + mbt | 2 | {linguistics} | + mbtserver | 2 | {linguistics} | mpi4py-fft | 2 | {mathematics-dev} | mseed2sac | 2 | {dataacquisition-dev} | ncrystal | 2 | {nanoscale-physics-dev,highenergy-physics-dev} | @@ -161,6 +163,8 @@ Last-Update: Mon, 09 Jun 2025 01:42:04 +0000 siscone | 2 | {highenergy-physics-dev} | spaghetti | 2 | {geography} | syrthes | 2 | {engineering} | + timbl | 2 | {linguistics} | + timblserver | 2 | {linguistics} | toon | 2 | {numericalcomputation} | trilinos | 2 | {physics-dev,mathematics-dev,engineering-dev} | vlfeat | 2 | {imageanalysis-dev} | @@ -173,15 +177,13 @@ Last-Update: Mon, 09 Jun 2025 01:42:04 +0000 cmor | 1 | {meteorology-dev} | coinmp | 1 | {logic,mathematics-dev,numericalcomputation} | coinor-bonmin | 1 | {mathematics} | - debian-science | 1 | {tools} | + debian-science | 1 | {neuroscience-cognitive,machine-learning} | debian-science | 1 | {electrophysiology} | debian-science | 1 | {nanoscale-physics-dev} | - debian-science | 1 | {neuroscience-cognitive,machine-learning} | + debian-science | 1 | {tools} | debian-science | 1 | {psychophysics} | - frog | 1 | {linguistics} | frogdata | 1 | {linguistics} | gemmlowp | 1 | {mathematics-dev} | - hepmc3 | 1 | {nanoscale-physics-dev,highenergy-physics-dev} | jeuclid | 1 | {viewing,typesetting} | libcvd | 1 | {imageanalysis-dev} | liblxi | 1 | {engineering-dev,dataacquisition-dev} | @@ -189,8 +191,7 @@ Last-Update: Mon, 09 Jun 2025 01:42:04 +0000 looptools | 1 | {highenergy-physics} | looptools | 1 | {highenergy-physics-dev} | magma | 1 | {mathematics-dev,numericalcomputation} | - mbt | 1 | {linguistics} | - mbtserver | 1 | {linguistics} | + metkit | 1 | {meteorology-dev} | mmdb | 1 | {nanoscale-physics-dev,highenergy-physics-dev} | mrmpi | 1 | {tools} | nrn-mod2c | 1 | {biology} | @@ -203,8 +204,6 @@ Last-Update: Mon, 09 Jun 2025 01:42:04 +0000 spfft | 1 | {mathematics-dev,nanoscale-physics-dev,physics-dev,meteorology-dev} | ssm | 1 | {nanoscale-physics-dev} | tfdocgen | 1 | {linguistics} | - timbl | 1 | {linguistics} | - timblserver | 1 | {linguistics} | amgcl | 0 | {mathematics-dev} | apertium-afr-nld | 0 | {linguistics} | apertium-bel-rus | 0 | {linguistics} | @@ -226,6 +225,7 @@ Last-Update: Mon, 09 Jun 2025 01:42:04 +0000 etsf-io | 0 | {nanoscale-physics-dev} | fastjet | 0 | {highenergy-physics-dev} | glpk-java | 0 | {mathematics-dev} | + hepmc3 | 0 | {nanoscale-physics-dev,highenergy-physics-dev} | itsol | 0 | {mathematics-dev} | libdogleg | 0 | {mathematics-dev} | libfolia | 0 | {linguistics} | ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,218 +1,219 @@ -Last-Update: Mon, 09 Jun 2025 01:42:04 +0000 +Last-Update: Mon, 09 Jun 2025 13:42:11 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- - mpmath | 10186 | - python-repoze.lru | 6996 | - netifaces | 5151 | + mpmath | 10155 | + python-repoze.lru | 6992 | + netifaces | 5129 | ghp-import | 4779 | - python-lunr | 4773 | - python-babel | 4280 | - sortedcontainers | 3887 | - python-babel | 3733 | - aiosignal | 2921 | - hyperlink | 2131 | - python-notify2 | 2038 | - humanfriendly | 1937 | - referencing | 1758 | - python-mysqldb | 1513 | - python-pandocfilters | 1459 | - python-gssapi | 1408 | - python-invoke | 1392 | - python-hyperframe | 1356 | - websocket-client | 1339 | - python-hpack | 1153 | - python-rsa | 1126 | - pdfarranger | 1021 | - menulibre | 960 | - python-linux-procfs | 932 | - autopep8 | 896 | - python-geoip | 889 | - python-zopfli | 836 | - python-webob | 835 | - pytoolconfig | 816 | - firmware-microbit-micropython | 771 | - powerline | 731 | - powerline | 720 | - powerline | 714 | - kazam | 689 | + python-lunr | 4775 | + python-babel | 4254 | + sortedcontainers | 3902 | + python-babel | 3703 | + aiosignal | 2918 | + hyperlink | 2140 | + python-notify2 | 2031 | + humanfriendly | 1934 | + referencing | 1752 | + python-mysqldb | 1514 | + python-pandocfilters | 1452 | + python-gssapi | 1410 | + python-invoke | 1385 | + python-hyperframe | 1357 | + websocket-client | 1333 | + python-hpack | 1149 | + python-rsa | 1125 | + pdfarranger | 1015 | + menulibre | 961 | + python-linux-procfs | 930 | + autopep8 | 894 | + python-geoip | 893 | + python-webob | 839 | + pytoolconfig | 814 | + python-zopfli | 804 | + firmware-microbit-micropython | 774 | + powerline | 736 | + powerline | 723 | + powerline | 717 | + kazam | 683 | u-msgpack-python | 636 | - gaupol | 566 | - dockerpty | 527 | + gaupol | 569 | + dockerpty | 518 | python-et-xmlfile | 512 | - asn1crypto | 504 | - python-gevent | 503 | - catfish | 438 | - python-ewmh | 436 | + asn1crypto | 507 | + python-gevent | 505 | + catfish | 441 | + python-ewmh | 438 | python-requests-oauthlib | 411 | - python-toml | 367 | - spf-engine | 344 | - python-ntlm-auth | 318 | - spf-engine | 294 | - django-stronghold | 259 | + python-toml | 369 | + spf-engine | 345 | + python-ntlm-auth | 314 | + spf-engine | 297 | + django-stronghold | 258 | + python-ldap3 | 226 | cairocffi | 222 | - python-ldap3 | 222 | - python-mimeparse | 196 | - python-smmap | 180 | - python-hidapi | 172 | - autokey | 167 | - httpie | 155 | - python-anyjson | 149 | - smem | 144 | + python-mimeparse | 194 | + python-smmap | 177 | + python-hidapi | 170 | + autokey | 165 | + httpie | 156 | + python-anyjson | 150 | + smem | 147 | kivy | 127 | - python-aiostream | 125 | + python-aiostream | 126 | smartypants | 112 | nodeenv | 110 | - python-click-repl | 105 | + python-click-repl | 106 | mugshot | 103 | - timekpr-next | 102 | - lollypop | 100 | - mypaint | 98 | - pacparser | 98 | - python-pyu2f | 98 | - python-consul | 97 | - pymacaroons | 86 | - pymediainfo | 85 | + lollypop | 101 | + timekpr-next | 101 | + python-pyu2f | 100 | + mypaint | 99 | + pacparser | 97 | + python-consul | 95 | + pymacaroons | 87 | pssh | 83 | - python-colour | 79 | - python-rfc6555 | 77 | - numpy-stl | 72 | + pymediainfo | 83 | + python-rfc6555 | 79 | + python-colour | 78 | + python-i3ipc | 70 | + mitmproxy | 68 | + numpy-stl | 68 | weasyprint | 68 | - fabric | 67 | - python-i3ipc | 67 | - python-pykka | 67 | - mitmproxy | 66 | - pywavelets | 59 | + fabric | 66 | + python-pykka | 66 | python-uritools | 58 | - ueberzug | 58 | - python-scp | 55 | - itstool | 51 | + pywavelets | 58 | + ueberzug | 56 | + itstool | 52 | + python-scp | 52 | mysql-connector-python | 49 | pyenv | 48 | - python-looseversion | 47 | - show-in-file-manager | 47 | + python-looseversion | 48 | blockdiag | 45 | - hatchling | 45 | - trac | 45 | - sshtunnel | 42 | - khard | 41 | + show-in-file-manager | 45 | + trac | 44 | + hatchling | 43 | + membernator | 41 | + sshtunnel | 41 | certipy | 40 | - membernator | 40 | + khard | 40 | pamela | 40 | - persepolis | 40 | + pymacs | 40 | jupyterhub | 39 | - pymacs | 37 | + pyquery | 39 | + persepolis | 38 | pylibmc | 35 | - pyquery | 35 | powerline-gitstatus | 33 | python-scrypt | 33 | - pssh | 30 | - python-pysol-cards | 30 | - dkimpy-milter | 29 | - pdfposter | 29 | + python-pysol-cards | 32 | + pdfposter | 30 | + pssh | 29 | python-statsd | 29 | + video-downloader | 29 | + dkimpy-milter | 28 | python-args | 28 | sphinxcontrib-blockdiag | 28 | - video-downloader | 28 | seqdiag | 27 | sphinxcontrib-seqdiag | 26 | backoff | 25 | python-clint | 25 | - flask-principal | 24 | - rst2pdf | 24 | sphinx-inline-tabs | 24 | - depthcharge-tools | 23 | + rst2pdf | 23 | webpy | 23 | + cppman | 22 | + depthcharge-tools | 22 | enzyme | 22 | + flask-principal | 22 | python-zstd | 22 | - typogrify | 22 | - cppman | 21 | fabric | 21 | nwdiag | 21 | subliminal | 21 | + typogrify | 21 | alot | 20 | python-rangehttpserver | 20 | - ruff | 20 | spf-engine | 20 | - webtest | 20 | python-fire | 19 | python-translationstring | 19 | + ruff | 19 | subliminal | 19 | + webtest | 19 | + mistune0 | 18 | + nwg-displays | 18 | social-auth-core | 18 | actdiag | 17 | - django-environ | 17 | - mistune0 | 17 | python-demjson | 17 | - nwg-displays | 16 | + django-environ | 16 | python-hupper | 16 | python-inotify | 16 | python-simpy | 16 | python-slip10 | 16 | sphinxcontrib-actdiag | 16 | sphinxcontrib-log-cabinet | 16 | - policyd-rate-limit | 15 | python-kyotocabinet | 15 | python-priority | 15 | python-pyalsa | 15 | - python-sdnotify | 15 | sphinxcontrib-nwdiag | 15 | ansi | 14 | - gtextfsm | 14 | + policyd-rate-limit | 14 | + pykwalify | 14 | python-pyrss2gen | 14 | python-pysubs2 | 14 | - autotiling | 13 | - pykwalify | 13 | + python-sdnotify | 14 | pyp | 13 | python-pem | 13 | python-xtermcolor | 13 | + autotiling | 12 | btchip-python | 12 | gmplot | 12 | + gtextfsm | 12 | junos-eznc | 12 | pwntools | 12 | python-crcelk | 12 | python-dbussy | 12 | python-ethtool | 12 | - python-pyscss | 12 | slimit | 12 | txt2tags | 12 | - flask-security | 11 | - notebook-shim | 11 | + kivy | 11 | pylint-common | 11 | - speaklater | 11 | + python-pyscss | 11 | django-auditlog | 10 | - django-sass | 10 | - flask-session | 10 | - kivy | 10 | pdm | 10 | python-aiohttp-security | 10 | python-parse-type | 10 | + speaklater | 10 | traittypes | 10 | unearth | 10 | beancount | 9 | + debiancontributors | 9 | + django-sass | 9 | drf-yasg-nonfree | 9 | + flask-security | 9 | + flask-session | 9 | jschema-to-python | 9 | - pybik | 9 | + notebook-shim | 9 | pydrive2 | 9 | pytest-runner | 9 | python-digitalocean | 9 | python-drf-spectacular-sidecar-nonfree | 9 | + python-overpy | 9 | python-sarif-python-om | 9 | - trac-wysiwyg | 9 | + todoman | 9 | tuna | 9 | - debiancontributors | 8 | - flask-paranoid | 8 | httpcode | 8 | + pybik | 8 | pytest-django | 8 | - python-overpy | 8 | python-pyld | 8 | python-versioneer | 8 | python-xdo | 8 | - todoman | 8 | + trac-wysiwyg | 8 | beancount | 7 | clustershell | 7 | easyprocess | 7 | + flask-paranoid | 7 | librouteros | 7 | mercurial-evolve | 7 | + micropython-mpremote | 7 | pytaglib | 7 | python-envs | 7 | python-numpysane | 7 | @@ -220,77 +221,63 @@ Last-Update: Mon, 09 Jun 2025 01:42:04 +0000 python-pyaml-env | 7 | securestring | 7 | sphinx-intl | 7 | - django-model-utils | 6 | django-pglocks | 6 | hachoir | 6 | - htmlmin | 6 | - kconfiglib | 6 | - micropython-mpremote | 6 | numpy-stl | 6 | python-ansicolors | 6 | voltron | 6 | clustershell | 5 | - django-paintstore | 5 | - drf-extensions | 5 | - drf-haystack | 5 | + django-model-utils | 5 | flufl.testing | 5 | graphql-relay | 5 | + htmlmin | 5 | + kconfiglib | 5 | mypy-protobuf | 5 | pycallgraph | 5 | + pyjokes | 5 | + pynliner | 5 | python3-onelogin-saml2 | 5 | python-biplist | 5 | python-dirq | 5 | + python-halo | 5 | python-jpype | 5 | + ruff | 5 | sorl-thumbnail | 5 | sphinxcontrib-globalsubs | 5 | azote | 4 | - django-jinja | 4 | + django-paintstore | 4 | + drf-extensions | 4 | extension-helpers | 4 | htmlmin | 4 | imap-tools | 4 | logilab-constraint | 4 | - pyjokes | 4 | - pynliner | 4 | pytest-expect | 4 | python-dbus-next | 4 | python-dynaconf | 4 | python-gnuplotlib | 4 | - python-halo | 4 | - python-markuppy | 4 | python-simpy | 4 | python-srp | 4 | - ruff | 4 | utidylib | 4 | west | 4 | aiomysql | 3 | bootstrap-flask | 3 | cram | 3 | - django-bitfield | 3 | django-ckeditor | 3 | - django-js-reverse | 3 | - django-macaddress | 3 | - django-pagination | 3 | - django-redis-sessions | 3 | + django-jinja | 3 | django-render-block | 3 | - django-simple-redis-admin | 3 | django-templated-email | 3 | - django-xmlrpc | 3 | + drf-haystack | 3 | etm | 3 | - flask-api | 3 | - flask-mongoengine | 3 | + flake8-black | 3 | jpylyzer | 3 | mbed-test-wrapper | 3 | orsopy | 3 | - panoramisk | 3 | proglog | 3 | pyclamd | 3 | pyprind | 3 | python-deepmerge | 3 | - python-django-casclient | 3 | - python-django-contact-form | 3 | python-django-push-notifications | 3 | - python-django-registration | 3 | - python-ipfix | 3 | + python-markuppy | 3 | python-netfilterqueue | 3 | python-networkmanager | 3 | python-pgmagick | 3 | @@ -304,25 +291,34 @@ Last-Update: Mon, 09 Jun 2025 01:42:04 +0000 brebis | 2 | cplay-ng | 2 | django-any-js | 2 | + django-bitfield | 2 | django-cachalot | 2 | django-cacheops | 2 | django-celery-email | 2 | django-cleanup | 2 | django-graphene | 2 | + django-js-reverse | 2 | + django-macaddress | 2 | django-maintenance-mode | 2 | + django-pagination | 2 | + django-redis-sessions | 2 | + django-simple-redis-admin | 2 | + django-xmlrpc | 2 | django-yarnpkg | 2 | dotdrop | 2 | - flake8-black | 2 | - flask-flatpages | 2 | + flask-api | 2 | + flask-mongoengine | 2 | flask-paginate | 2 | fypp | 2 | gtkman | 2 | hatch-jupyter-builder | 2 | humanfriendly | 2 | + jsonrpclib-pelix | 2 | korean-lunar-calendar | 2 | namecheap | 2 | okasha | 2 | omgifol | 2 | + panoramisk | 2 | pycrc | 2 | pyfltk | 2 | pyjunitxml | 2 | @@ -333,8 +329,12 @@ Last-Update: Mon, 09 Jun 2025 01:42:04 +0000 python-chartkick | 2 | python-commentjson | 2 | python-cookies | 2 | + python-django-casclient | 2 | + python-django-contact-form | 2 | + python-django-registration | 2 | python-ephemeral-port-reserve | 2 | python-funcy | 2 | + python-ipfix | 2 | python-libguess | 2 | python-qtpynodeeditor | 2 | python-text-unidecode | 2 | @@ -355,20 +355,17 @@ Last-Update: Mon, 09 Jun 2025 01:42:04 +0000 django-ajax-selects | 1 | enlighten | 1 | errbot | 1 | + flask-flatpages | 1 | jpy | 1 | - jsonrpclib-pelix | 1 | jupyter-sphinx | 1 | - milksnake | 1 | mkdocs-macros-plugin | 1 | moviepy | 1 | myst-nb | 1 | onetimepass | 1 | panoramisk | 1 | - power | 1 | pylint-celery | 1 | pypass | 1 | pyrad | 1 | - pyssim | 1 | python-banal | 1 | python-bottle-sqlite | 1 | python-dataset | 1 | @@ -459,6 +456,7 @@ Last-Update: Mon, 09 Jun 2025 01:42:04 +0000 jpylyzer | 0 | kivy | 0 | libthumbor | 0 | + milksnake | 0 | mpmath | 0 | mssql-django | 0 | mwoauth | 0 | @@ -470,6 +468,7 @@ Last-Update: Mon, 09 Jun 2025 01:42:04 +0000 panoramisk | 0 | parsimonious | 0 | portio | 0 | + power | 0 | powerline | 0 | powerline-gitstatus | 0 | prospector | 0 | @@ -591,5 +590,5 @@ Last-Update: Mon, 09 Jun 2025 01:42:04 +0000 sphinxcontrib-emojicodes | -1 | symmetrize | -1 | trac-tickettemplate | -1 | -(604 rows) +(603 rows) View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/4e41f05e5d22a3bac68b1a16ba23257ab8a91d38 -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/4e41f05e5d22a3bac68b1a16ba23257ab8a91d38 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Tue Jun 10 02:43:27 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Tue, 10 Jun 2025 01:43:27 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <68478dbfc5e27_3dbb9d955820592ae@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: dddd4621 by Andreas Tille at 2025-06-10T01:43:23+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Mon, 09 Jun 2025 13:42:04 +0000 +Last-Update: Tue, 10 Jun 2025 01:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- ===================================== debian-science-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Mon, 09 Jun 2025 13:42:08 +0000 +Last-Update: Tue, 10 Jun 2025 01:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Mon, 09 Jun 2025 13:42:11 +0000 +Last-Update: Tue, 10 Jun 2025 01:42:05 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/dddd462181f2036a27c4976ea240e9f58c41b7c1 -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/dddd462181f2036a27c4976ea240e9f58c41b7c1 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Tue Jun 10 14:43:31 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Tue, 10 Jun 2025 13:43:31 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <68483683e7848_3dbd78b0ec21137f3@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: 357e2f51 by Andreas Tille at 2025-06-10T13:43:24+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,40 +1,40 @@ -Last-Update: Tue, 10 Jun 2025 01:42:04 +0000 +Last-Update: Tue, 10 Jun 2025 13:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- dicomscope | 27 | {imaging} | orthanc-gdcm | 15 | {imaging} | - oscar | 14 | {data,practice,tools} | - mrtrix3 | 13 | {imaging} | + mrtrix3 | 14 | {imaging} | + oscar | 13 | {data,practice,tools} | gnumed-server | 10 | {covid-19,practice} | + king | 10 | {typesetting,imaging} | orthanc-mysql | 10 | {imaging} | - king | 9 | {typesetting,imaging} | - pixelmed | 9 | {imaging} | - sight | 9 | {imaging} | + pixelmed | 10 | {imaging} | + sight | 10 | {imaging} | adun.app | 8 | {bio} | bart-view | 8 | {imaging} | orthanc-postgresql | 8 | {imaging} | - heudiconv | 6 | {imaging} | + heudiconv | 7 | {imaging} | + mia | 7 | {imaging} | jebl2 | 6 | {bio-dev} | - mia | 6 | {imaging} | biojava-live | 5 | {bio-dev} | icb-utils | 4 | {bio-dev} | + libminc | 4 | {imaging-dev} | pbcopper | 4 | {bio-dev} | beast-mcmc | 3 | {bio,bio-phylogeny} | bio-tradis | 3 | {bio,bio-dev} | getdata | 3 | {bio} | - libminc | 3 | {imaging-dev} | + insighttoolkit5 | 3 | {imaging-dev} | pbseqlib | 3 | {bio-dev} | piler | 3 | {bio} | + sight | 3 | {imaging} | ants | 2 | {imaging} | cmtk | 2 | {imaging} | elastix | 2 | {imaging} | fastml | 2 | {bio} | - insighttoolkit5 | 2 | {imaging-dev} | libpal-java | 2 | {bio-dev} | plasmidid | 2 | {covid-19,bio} | python-seqcluster | 2 | {covid-19,bio-dev} | - sight | 2 | {imaging} | staden | 2 | {bio} | tracetuner | 2 | {bio} | biojava6-live | 1 | {bio-dev} | ===================================== debian-science-tests.txt ===================================== @@ -1,63 +1,63 @@ -Last-Update: Tue, 10 Jun 2025 01:42:04 +0000 +Last-Update: Tue, 10 Jun 2025 13:42:08 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- - gts | 4846 | {viewing} | - nltk | 4829 | {linguistics} | - opencascade | 627 | {simulations} | - spacenavd | 226 | {tools} | - open-coarrays | 189 | {meteorology-dev} | - armadillo | 181 | {mathematics-dev} | - arpack | 98 | {mathematics-dev} | - scalapack | 46 | {nanoscale-physics-dev} | + gts | 4867 | {viewing} | + nltk | 4831 | {linguistics} | + opencascade | 628 | {simulations} | + spacenavd | 220 | {tools} | + open-coarrays | 190 | {meteorology-dev} | + armadillo | 183 | {mathematics-dev} | + arpack | 100 | {mathematics-dev} | + scalapack | 49 | {nanoscale-physics-dev} | ntl | 40 | {mathematics-dev} | - mbpoll | 38 | {simulations} | - imview | 36 | {viewing} | + mbpoll | 39 | {simulations} | visidata | 36 | {datamanagement} | - ppl | 35 | {numericalcomputation} | + imview | 35 | {viewing} | + ppl | 34 | {numericalcomputation} | libmatio | 30 | {mathematics-dev} | - arduino-mk | 28 | {robotics} | + arduino-mk | 27 | {robotics} | cliquer | 26 | {mathematics} | flintqs | 25 | {mathematics} | libm4ri | 25 | {mathematics-dev} | + flann | 24 | {mathematics-dev,engineering-dev} | grads | 24 | {meteorology} | - xygrib | 24 | {meteorology} | - flann | 23 | {mathematics-dev,engineering-dev} | - sat4j | 23 | {logic} | setzer | 23 | {typesetting} | + xygrib | 23 | {meteorology} | + sat4j | 22 | {logic} | + bossa | 18 | {devices} | fftw | 18 | {mathematics-dev,physics-dev,meteorology-dev} | libitpp | 17 | {mathematics-dev,engineering-dev} | lrcalc | 17 | {mathematics-dev} | - bossa | 16 | {devices} | + picosat | 17 | {logic} | cliquer | 16 | {mathematics-dev} | - eccodes | 16 | {meteorology,meteorology-dev} | - picosat | 16 | {logic} | - pyzo | 15 | {numericalcomputation} | + pyzo | 16 | {numericalcomputation} | + eccodes | 15 | {meteorology,meteorology-dev} | + guiqwt | 15 | {numericalcomputation,viewing} | gf2x | 14 | {mathematics-dev} | gts | 14 | {viewing-dev} | - guiqwt | 14 | {numericalcomputation,viewing} | iml | 14 | {mathematics-dev} | libhomfly | 14 | {mathematics-dev} | sketch | 14 | {typesetting} | dune-uggrid | 13 | {mathematics-dev} | - libm4rie | 13 | {mathematics-dev} | eccodes | 12 | {meteorology-dev} | feff85exafs | 12 | {chemistry} | + libm4rie | 12 | {mathematics-dev} | libzn-poly | 12 | {mathematics-dev} | matlab-support | 12 | {mathematics,numericalcomputation} | + teem | 12 | {imageanalysis} | + coinor-symphony | 11 | {logic,mathematics,numericalcomputation} | ratpoints | 11 | {mathematics-dev} | - teem | 11 | {imageanalysis} | - coinor-symphony | 10 | {logic,mathematics,numericalcomputation} | feedgnuplot | 10 | {viewing} | form | 10 | {mathematics} | lxi-tools | 10 | {engineering,dataacquisition} | ncl | 10 | {meteorology} | - alberta | 9 | {engineering-dev} | + metar | 9 | {meteorology} | ros-rosconsole | 9 | {robotics-dev} | vdt | 9 | {mathematics-dev} | + alberta | 8 | {engineering-dev} | dxsamples | 8 | {nanoscale-physics} | geg | 8 | {viewing} | - metar | 8 | {meteorology} | odc | 8 | {meteorology} | odc | 8 | {meteorology-dev} | pcl | 8 | {robotics-dev} | @@ -65,16 +65,17 @@ Last-Update: Tue, 10 Jun 2025 01:42:04 +0000 magics++ | 7 | {meteorology-dev} | opencascade | 7 | {simulations} | persalys | 7 | {engineering,statistics,mathematics} | - refmac-dictionary | 7 | {highenergy-physics-dev,chemistry} | - rheolef | 7 | {mathematics} | + python-escript | 7 | {numericalcomputation,simulations,engineering} | uctodata | 7 | {linguistics} | apophenia | 6 | {statistics} | atlas-ecmwf | 6 | {meteorology} | fftw | 6 | {meteorology-dev,mathematics-dev,physics-dev} | fpzip | 6 | {meteorology} | libccp4 | 6 | {nanoscale-physics-dev} | - python-escript | 6 | {numericalcomputation,simulations,engineering} | + refmac-dictionary | 6 | {highenergy-physics-dev,chemistry} | + rheolef | 6 | {mathematics} | ros-vcstool | 6 | {robotics-dev} | + toulbar2 | 6 | {logic,numericalcomputation,mathematics,physics} | ucto | 6 | {linguistics} | cld2 | 5 | {linguistics} | coda | 5 | {meteorology} | @@ -83,9 +84,10 @@ Last-Update: Tue, 10 Jun 2025 01:42:04 +0000 metview | 5 | {meteorology} | ncl | 5 | {meteorology-dev} | persalys | 5 | {statistics,mathematics,engineering} | + psurface | 5 | {numericalcomputation} | rubiks | 5 | {geometry,mathematics} | - toulbar2 | 5 | {logic,numericalcomputation,mathematics,physics} | debian-science | 4 | {economics,nanoscale-physics,machine-learning,physics,mathematics} | + debian-science | 4 | {physics,machine-learning,economics,nanoscale-physics} | drslib | 4 | {meteorology} | dxflib | 4 | {engineering-dev} | emoslib | 4 | {meteorology-dev} | @@ -97,32 +99,32 @@ Last-Update: Tue, 10 Jun 2025 01:42:04 +0000 libxsmm | 4 | {mathematics-dev} | lrcalc | 4 | {mathematics} | muparser | 4 | {mathematics-dev} | - psurface | 4 | {numericalcomputation} | silo-llnl | 4 | {engineering} | urdfdom-headers | 4 | {robotics-dev} | atlas-ecmwf | 3 | {meteorology-dev} | auto-07p | 3 | {mathematics} | cmor | 3 | {meteorology} | cylc-flow | 3 | {meteorology} | - debian-science | 3 | {physics,machine-learning,economics,nanoscale-physics} | dimbl | 3 | {linguistics} | dune-functions | 3 | {mathematics-dev} | dune-localfunctions | 3 | {mathematics-dev} | dune-typetree | 3 | {mathematics-dev} | ecbuild | 3 | {meteorology-dev} | emoslib | 3 | {meteorology} | - fastjet | 3 | {highenergy-physics-dev} | harp | 3 | {meteorology} | hdf-eos4 | 3 | {meteorology-dev} | ipe-tools | 3 | {typesetting} | libcgns | 3 | {engineering-dev} | libcgns | 3 | {engineering} | libmatheval | 3 | {mathematics} | + libvigraimpex | 3 | {imageanalysis-dev,machine-learning} | metkit | 3 | {meteorology} | + mpi4py-fft | 3 | {mathematics-dev} | sac2mseed | 3 | {geography} | sardana | 3 | {dataacquisition} | - silo-llnl | 3 | {engineering-dev} | + sdpb | 3 | {numericalcomputation,highenergy-physics} | silo-llnl | 3 | {engineering} | + silo-llnl | 3 | {engineering-dev} | toontag | 3 | {numericalcomputation} | veccore | 3 | {mathematics-dev} | apache-opennlp | 2 | {linguistics} | @@ -131,9 +133,10 @@ Last-Update: Tue, 10 Jun 2025 01:42:04 +0000 coda | 2 | {meteorology-dev} | code-saturne | 2 | {mathematics-dev,engineering-dev} | code-saturne | 2 | {engineering-dev,mathematics-dev} | - debian-science | 2 | {neuroscience-cognitive} | debian-science | 2 | {nanoscale-physics,statistics,economics,physics} | + debian-science | 2 | {neuroscience-cognitive} | debian-science | 2 | {economics} | + fastjet | 2 | {highenergy-physics-dev} | fpzip | 2 | {meteorology-dev} | frog | 2 | {linguistics} | gadap | 2 | {meteorology-dev} | @@ -144,10 +147,8 @@ Last-Update: Tue, 10 Jun 2025 01:42:04 +0000 libgtkdatabox | 2 | {engineering-dev,viewing-dev} | liblbfgs | 2 | {mathematics-dev} | libmatheval | 2 | {mathematics-dev} | - libvigraimpex | 2 | {imageanalysis-dev,machine-learning} | mbt | 2 | {linguistics} | mbtserver | 2 | {linguistics} | - mpi4py-fft | 2 | {mathematics-dev} | mseed2sac | 2 | {dataacquisition-dev} | ncrystal | 2 | {nanoscale-physics-dev,highenergy-physics-dev} | newmat | 2 | {mathematics-dev} | @@ -159,37 +160,33 @@ Last-Update: Tue, 10 Jun 2025 01:42:04 +0000 ros-ros-environment | 2 | {robotics-dev} | sagemath-database-conway-polynomials | 2 | {mathematics} | scram | 2 | {engineering} | - sdpb | 2 | {numericalcomputation,highenergy-physics} | - siscone | 2 | {highenergy-physics-dev} | spaghetti | 2 | {geography} | syrthes | 2 | {engineering} | timbl | 2 | {linguistics} | timblserver | 2 | {linguistics} | toon | 2 | {numericalcomputation} | trilinos | 2 | {physics-dev,mathematics-dev,engineering-dev} | - vlfeat | 2 | {imageanalysis-dev} | x13as | 2 | {economics} | apertium-streamparser | 1 | {linguistics} | asl | 1 | {physics-dev} | ckon | 1 | {highenergy-physics-dev} | - clhep | 1 | {highenergy-physics-dev} | clipper | 1 | {nanoscale-physics-dev} | cmor | 1 | {meteorology-dev} | coinmp | 1 | {logic,mathematics-dev,numericalcomputation} | coinor-bonmin | 1 | {mathematics} | debian-science | 1 | {neuroscience-cognitive,machine-learning} | - debian-science | 1 | {electrophysiology} | - debian-science | 1 | {nanoscale-physics-dev} | debian-science | 1 | {tools} | debian-science | 1 | {psychophysics} | + debian-science | 1 | {nanoscale-physics-dev} | + debian-science | 1 | {electrophysiology} | frogdata | 1 | {linguistics} | gemmlowp | 1 | {mathematics-dev} | jeuclid | 1 | {viewing,typesetting} | libcvd | 1 | {imageanalysis-dev} | liblxi | 1 | {engineering-dev,dataacquisition-dev} | liborigin2 | 1 | {viewing-dev} | - looptools | 1 | {highenergy-physics} | looptools | 1 | {highenergy-physics-dev} | + looptools | 1 | {highenergy-physics} | magma | 1 | {mathematics-dev,numericalcomputation} | metkit | 1 | {meteorology-dev} | mmdb | 1 | {nanoscale-physics-dev,highenergy-physics-dev} | @@ -204,6 +201,7 @@ Last-Update: Tue, 10 Jun 2025 01:42:04 +0000 spfft | 1 | {mathematics-dev,nanoscale-physics-dev,physics-dev,meteorology-dev} | ssm | 1 | {nanoscale-physics-dev} | tfdocgen | 1 | {linguistics} | + vlfeat | 1 | {imageanalysis-dev} | amgcl | 0 | {mathematics-dev} | apertium-afr-nld | 0 | {linguistics} | apertium-bel-rus | 0 | {linguistics} | @@ -231,11 +229,12 @@ Last-Update: Tue, 10 Jun 2025 01:42:04 +0000 libfolia | 0 | {linguistics} | libquantum | 0 | {numericalcomputation} | libsdsl | 0 | {dataacquisition-dev} | + looptools | 0 | {highenergy-physics-dev} | mbt | 0 | {linguistics} | mctc-lib | 0 | {nanoscale-physics-dev,highenergy-physics-dev} | meshsdfilter | 0 | {mathematics-dev} | - metis-edf | 0 | {engineering-dev} | metis-edf | 0 | {engineering,numericalcomputation} | + metis-edf | 0 | {engineering-dev} | neartree | 0 | {mathematics-dev,numericalcomputation} | opengv | 0 | {geometry} | openigtlink | 0 | {robotics-dev} | @@ -270,5 +269,5 @@ Last-Update: Tue, 10 Jun 2025 01:42:04 +0000 virtuoso-opensource | 0 | {datamanagement} | visp-images | 0 | {robotics-dev} | libelas | -1 | {robotics-dev} | -(298 rows) +(297 rows) ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,233 +1,234 @@ -Last-Update: Tue, 10 Jun 2025 01:42:05 +0000 +Last-Update: Tue, 10 Jun 2025 13:42:12 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- - mpmath | 10155 | - python-repoze.lru | 6992 | - netifaces | 5129 | - ghp-import | 4779 | - python-lunr | 4775 | - python-babel | 4254 | - sortedcontainers | 3902 | - python-babel | 3703 | - aiosignal | 2918 | - hyperlink | 2140 | - python-notify2 | 2031 | - humanfriendly | 1934 | - referencing | 1752 | - python-mysqldb | 1514 | - python-pandocfilters | 1452 | - python-gssapi | 1410 | - python-invoke | 1385 | - python-hyperframe | 1357 | - websocket-client | 1333 | - python-hpack | 1149 | - python-rsa | 1125 | - pdfarranger | 1015 | - menulibre | 961 | - python-linux-procfs | 930 | - autopep8 | 894 | - python-geoip | 893 | - python-webob | 839 | + mpmath | 10114 | + python-repoze.lru | 6991 | + netifaces | 5137 | + ghp-import | 4782 | + python-lunr | 4777 | + python-babel | 4273 | + sortedcontainers | 3908 | + python-babel | 3721 | + aiosignal | 2916 | + hyperlink | 2154 | + python-notify2 | 2051 | + humanfriendly | 1944 | + referencing | 1712 | + python-mysqldb | 1522 | + python-pandocfilters | 1450 | + python-gssapi | 1416 | + python-invoke | 1391 | + python-hyperframe | 1350 | + websocket-client | 1336 | + python-hpack | 1142 | + python-rsa | 1131 | + pdfarranger | 1020 | + menulibre | 951 | + python-linux-procfs | 931 | + autopep8 | 899 | + python-geoip | 896 | + python-webob | 843 | pytoolconfig | 814 | - python-zopfli | 804 | - firmware-microbit-micropython | 774 | - powerline | 736 | - powerline | 723 | - powerline | 717 | - kazam | 683 | - u-msgpack-python | 636 | - gaupol | 569 | - dockerpty | 518 | - python-et-xmlfile | 512 | + firmware-microbit-micropython | 769 | + python-zopfli | 753 | + powerline | 751 | + powerline | 721 | + powerline | 715 | + kazam | 681 | + u-msgpack-python | 629 | + gaupol | 563 | + dockerpty | 522 | + python-et-xmlfile | 513 | asn1crypto | 507 | - python-gevent | 505 | - catfish | 441 | - python-ewmh | 438 | - python-requests-oauthlib | 411 | - python-toml | 369 | - spf-engine | 345 | - python-ntlm-auth | 314 | - spf-engine | 297 | - django-stronghold | 258 | - python-ldap3 | 226 | - cairocffi | 222 | - python-mimeparse | 194 | - python-smmap | 177 | + python-gevent | 504 | + python-ewmh | 439 | + catfish | 433 | + python-requests-oauthlib | 410 | + python-toml | 366 | + spf-engine | 344 | + python-ntlm-auth | 311 | + spf-engine | 295 | + django-stronghold | 254 | + python-ldap3 | 228 | + cairocffi | 224 | + python-mimeparse | 197 | + python-smmap | 180 | python-hidapi | 170 | autokey | 165 | httpie | 156 | - python-anyjson | 150 | - smem | 147 | - kivy | 127 | - python-aiostream | 126 | - smartypants | 112 | - nodeenv | 110 | - python-click-repl | 106 | - mugshot | 103 | - lollypop | 101 | - timekpr-next | 101 | + python-anyjson | 151 | + smem | 149 | + kivy | 128 | + python-aiostream | 128 | + smartypants | 115 | + nodeenv | 109 | + python-click-repl | 109 | + lollypop | 105 | python-pyu2f | 100 | + timekpr-next | 100 | + mugshot | 99 | mypaint | 99 | pacparser | 97 | - python-consul | 95 | + python-consul | 96 | pymacaroons | 87 | - pssh | 83 | - pymediainfo | 83 | - python-rfc6555 | 79 | + pssh | 86 | + pymediainfo | 86 | + python-rfc6555 | 81 | python-colour | 78 | - python-i3ipc | 70 | - mitmproxy | 68 | - numpy-stl | 68 | - weasyprint | 68 | - fabric | 66 | - python-pykka | 66 | - python-uritools | 58 | - pywavelets | 58 | - ueberzug | 56 | - itstool | 52 | - python-scp | 52 | - mysql-connector-python | 49 | - pyenv | 48 | - python-looseversion | 48 | - blockdiag | 45 | - show-in-file-manager | 45 | - trac | 44 | - hatchling | 43 | - membernator | 41 | + python-i3ipc | 72 | + weasyprint | 71 | + numpy-stl | 69 | + python-pykka | 68 | + mitmproxy | 66 | + fabric | 65 | + python-uritools | 57 | + pywavelets | 57 | + ueberzug | 55 | + itstool | 54 | + python-scp | 51 | + mysql-connector-python | 50 | + pyenv | 50 | + python-looseversion | 50 | + blockdiag | 46 | + trac | 45 | + show-in-file-manager | 44 | + hatchling | 42 | + membernator | 42 | + khard | 41 | sshtunnel | 41 | certipy | 40 | - khard | 40 | pamela | 40 | - pymacs | 40 | jupyterhub | 39 | + pymacs | 39 | pyquery | 39 | persepolis | 38 | - pylibmc | 35 | - powerline-gitstatus | 33 | + pylibmc | 37 | + powerline-gitstatus | 35 | + python-pysol-cards | 35 | python-scrypt | 33 | - python-pysol-cards | 32 | - pdfposter | 30 | - pssh | 29 | + pdfposter | 31 | + pssh | 30 | python-statsd | 29 | - video-downloader | 29 | + sphinxcontrib-blockdiag | 29 | dkimpy-milter | 28 | python-args | 28 | - sphinxcontrib-blockdiag | 28 | + video-downloader | 28 | seqdiag | 27 | sphinxcontrib-seqdiag | 26 | backoff | 25 | python-clint | 25 | + enzyme | 24 | + rst2pdf | 24 | sphinx-inline-tabs | 24 | - rst2pdf | 23 | - webpy | 23 | - cppman | 22 | - depthcharge-tools | 22 | - enzyme | 22 | + webpy | 24 | + cppman | 23 | + depthcharge-tools | 23 | + python-zstd | 23 | + subliminal | 23 | flask-principal | 22 | - python-zstd | 22 | + typogrify | 22 | fabric | 21 | nwdiag | 21 | + python-rangehttpserver | 21 | subliminal | 21 | - typogrify | 21 | alot | 20 | - python-rangehttpserver | 20 | + python-fire | 20 | spf-engine | 20 | - python-fire | 19 | + nwg-displays | 19 | python-translationstring | 19 | - ruff | 19 | - subliminal | 19 | webtest | 19 | mistune0 | 18 | - nwg-displays | 18 | + python-demjson | 18 | social-auth-core | 18 | actdiag | 17 | - python-demjson | 17 | + ruff | 17 | + sphinxcontrib-log-cabinet | 17 | django-environ | 16 | python-hupper | 16 | python-inotify | 16 | + python-priority | 16 | + python-pyalsa | 16 | python-simpy | 16 | - python-slip10 | 16 | sphinxcontrib-actdiag | 16 | - sphinxcontrib-log-cabinet | 16 | python-kyotocabinet | 15 | - python-priority | 15 | - python-pyalsa | 15 | + python-pysubs2 | 15 | + python-slip10 | 15 | sphinxcontrib-nwdiag | 15 | - ansi | 14 | policyd-rate-limit | 14 | - pykwalify | 14 | + pyp | 14 | + python-pem | 14 | python-pyrss2gen | 14 | - python-pysubs2 | 14 | python-sdnotify | 14 | - pyp | 13 | - python-pem | 13 | - python-xtermcolor | 13 | + ansi | 13 | + kivy | 13 | + pykwalify | 13 | autotiling | 12 | btchip-python | 12 | gmplot | 12 | gtextfsm | 12 | - junos-eznc | 12 | + pdm | 12 | pwntools | 12 | python-crcelk | 12 | python-dbussy | 12 | python-ethtool | 12 | slimit | 12 | txt2tags | 12 | - kivy | 11 | - pylint-common | 11 | + unearth | 12 | + junos-eznc | 11 | + pytest-runner | 11 | python-pyscss | 11 | + python-xtermcolor | 11 | django-auditlog | 10 | - pdm | 10 | + jschema-to-python | 10 | + pylint-common | 10 | python-aiohttp-security | 10 | + python-overpy | 10 | python-parse-type | 10 | + python-sarif-python-om | 10 | speaklater | 10 | traittypes | 10 | - unearth | 10 | beancount | 9 | debiancontributors | 9 | django-sass | 9 | drf-yasg-nonfree | 9 | flask-security | 9 | flask-session | 9 | - jschema-to-python | 9 | notebook-shim | 9 | - pydrive2 | 9 | - pytest-runner | 9 | python-digitalocean | 9 | python-drf-spectacular-sidecar-nonfree | 9 | - python-overpy | 9 | - python-sarif-python-om | 9 | todoman | 9 | tuna | 9 | + clustershell | 8 | httpcode | 8 | pybik | 8 | - pytest-django | 8 | - python-pyld | 8 | + pydrive2 | 8 | python-versioneer | 8 | - python-xdo | 8 | trac-wysiwyg | 8 | beancount | 7 | - clustershell | 7 | - easyprocess | 7 | flask-paranoid | 7 | librouteros | 7 | mercurial-evolve | 7 | micropython-mpremote | 7 | - pytaglib | 7 | + pytest-django | 7 | + python-ansicolors | 7 | python-envs | 7 | python-numpysane | 7 | python-openstep-plist | 7 | python-pyaml-env | 7 | + python-pyld | 7 | + python-xdo | 7 | securestring | 7 | sphinx-intl | 7 | + clustershell | 6 | django-pglocks | 6 | + easyprocess | 6 | hachoir | 6 | numpy-stl | 6 | - python-ansicolors | 6 | + pytaglib | 6 | voltron | 6 | - clustershell | 5 | django-model-utils | 5 | + drf-extensions | 5 | flufl.testing | 5 | graphql-relay | 5 | htmlmin | 5 | @@ -246,12 +247,11 @@ Last-Update: Tue, 10 Jun 2025 01:42:05 +0000 sphinxcontrib-globalsubs | 5 | azote | 4 | django-paintstore | 4 | - drf-extensions | 4 | + drf-haystack | 4 | extension-helpers | 4 | htmlmin | 4 | imap-tools | 4 | logilab-constraint | 4 | - pytest-expect | 4 | python-dbus-next | 4 | python-dynaconf | 4 | python-gnuplotlib | 4 | @@ -262,11 +262,9 @@ Last-Update: Tue, 10 Jun 2025 01:42:05 +0000 aiomysql | 3 | bootstrap-flask | 3 | cram | 3 | - django-ckeditor | 3 | django-jinja | 3 | django-render-block | 3 | django-templated-email | 3 | - drf-haystack | 3 | etm | 3 | flake8-black | 3 | jpylyzer | 3 | @@ -274,7 +272,9 @@ Last-Update: Tue, 10 Jun 2025 01:42:05 +0000 orsopy | 3 | proglog | 3 | pyclamd | 3 | + pyfltk | 3 | pyprind | 3 | + pytest-expect | 3 | python-deepmerge | 3 | python-django-push-notifications | 3 | python-markuppy | 3 | @@ -284,6 +284,7 @@ Last-Update: Tue, 10 Jun 2025 01:42:05 +0000 s3ql | 3 | slimit | 3 | sphinx-markdown-tables | 3 | + sphinx-paramlinks | 3 | testrepository | 3 | trac-accountmanager | 3 | vf1 | 3 | @@ -315,16 +316,14 @@ Last-Update: Tue, 10 Jun 2025 01:42:05 +0000 humanfriendly | 2 | jsonrpclib-pelix | 2 | korean-lunar-calendar | 2 | + myst-nb | 2 | namecheap | 2 | okasha | 2 | omgifol | 2 | panoramisk | 2 | pycrc | 2 | - pyfltk | 2 | pyjunitxml | 2 | - pykwalify | 2 | pyroma | 2 | - python-bitbucket-api | 2 | python-btrees | 2 | python-chartkick | 2 | python-commentjson | 2 | @@ -335,13 +334,15 @@ Last-Update: Tue, 10 Jun 2025 01:42:05 +0000 python-ephemeral-port-reserve | 2 | python-funcy | 2 | python-ipfix | 2 | + python-kanboard | 2 | python-libguess | 2 | python-qtpynodeeditor | 2 | + python-securesystemslib | 2 | python-text-unidecode | 2 | redis-py-cluster | 2 | requests-aws | 2 | smem | 2 | - sphinx-paramlinks | 2 | + sphinx-sitemap | 2 | trac-xmlrpc | 2 | vcversioner | 2 | vncdotool | 2 | @@ -360,13 +361,14 @@ Last-Update: Tue, 10 Jun 2025 01:42:05 +0000 jupyter-sphinx | 1 | mkdocs-macros-plugin | 1 | moviepy | 1 | - myst-nb | 1 | onetimepass | 1 | panoramisk | 1 | + pykwalify | 1 | pylint-celery | 1 | pypass | 1 | pyrad | 1 | python-banal | 1 | + python-bitbucket-api | 1 | python-bottle-sqlite | 1 | python-dataset | 1 | python-dnsq | 1 | @@ -374,7 +376,6 @@ Last-Update: Tue, 10 Jun 2025 01:42:05 +0000 python-genson | 1 | python-getdns | 1 | python-gfloat | 1 | - python-kanboard | 1 | python-netfilter | 1 | python-noise | 1 | python-openid-cla | 1 | @@ -383,7 +384,6 @@ Last-Update: Tue, 10 Jun 2025 01:42:05 +0000 python-py-zipkin | 1 | python-rdflib-endpoint | 1 | python-schedutils | 1 | - python-securesystemslib | 1 | python-sphinx-examples | 1 | python-spur | 1 | python-undetected-chromedriver | 1 | @@ -393,7 +393,6 @@ Last-Update: Tue, 10 Jun 2025 01:42:05 +0000 soundcraft-utils | 1 | sphinx-autorun | 1 | sphinxcontrib-github-alt | 1 | - sphinx-sitemap | 1 | sphinxtesters | 1 | trac-customfieldadmin | 1 | trac-httpauth | 1 | @@ -580,14 +579,15 @@ Last-Update: Tue, 10 Jun 2025 01:42:05 +0000 zktop | 0 | django-cachalot | -1 | ikos | -1 | + nam-files | -1 | pyina | -1 | pysequoia | -1 | python-asv-bench-memray | -1 | python-gfloat | -1 | python-gradientmodel | -1 | + python-ledgercomm | -1 | python-nxtomomill | -1 | s3ql | -1 | - sphinxcontrib-emojicodes | -1 | symmetrize | -1 | trac-tickettemplate | -1 | (603 rows) View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/357e2f51e8b7536653980fb1e8ad3b87d7bdea16 -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/357e2f51e8b7536653980fb1e8ad3b87d7bdea16 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Wed Jun 11 02:43:15 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Wed, 11 Jun 2025 01:43:15 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <6848df3381c02_3dbb9d8568221795f@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: 163c9fa8 by Andreas Tille at 2025-06-11T01:43:11+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Tue, 10 Jun 2025 13:42:04 +0000 +Last-Update: Wed, 11 Jun 2025 01:42:03 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- ===================================== debian-science-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Tue, 10 Jun 2025 13:42:08 +0000 +Last-Update: Wed, 11 Jun 2025 01:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Tue, 10 Jun 2025 13:42:12 +0000 +Last-Update: Wed, 11 Jun 2025 01:42:04 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/163c9fa84dc552144329da2dc668b3c00347bf00 -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/163c9fa84dc552144329da2dc668b3c00347bf00 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Wed Jun 11 14:43:33 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Wed, 11 Jun 2025 13:43:33 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <684988054e72d_3dbd5aa68823033ea@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: 05642693 by Andreas Tille at 2025-06-11T13:43:26+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Wed, 11 Jun 2025 01:42:03 +0000 +Last-Update: Wed, 11 Jun 2025 13:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- @@ -15,10 +15,10 @@ Last-Update: Wed, 11 Jun 2025 01:42:03 +0000 bart-view | 8 | {imaging} | orthanc-postgresql | 8 | {imaging} | heudiconv | 7 | {imaging} | - mia | 7 | {imaging} | jebl2 | 6 | {bio-dev} | + mia | 6 | {imaging} | biojava-live | 5 | {bio-dev} | - icb-utils | 4 | {bio-dev} | + icb-utils | 5 | {bio-dev} | libminc | 4 | {imaging-dev} | pbcopper | 4 | {bio-dev} | beast-mcmc | 3 | {bio,bio-phylogeny} | ===================================== debian-science-tests.txt ===================================== @@ -1,100 +1,101 @@ -Last-Update: Wed, 11 Jun 2025 01:42:04 +0000 +Last-Update: Wed, 11 Jun 2025 13:42:09 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- - gts | 4867 | {viewing} | - nltk | 4831 | {linguistics} | - opencascade | 628 | {simulations} | + gts | 4889 | {viewing} | + nltk | 4841 | {linguistics} | + opencascade | 611 | {simulations} | spacenavd | 220 | {tools} | - open-coarrays | 190 | {meteorology-dev} | + open-coarrays | 193 | {meteorology-dev} | armadillo | 183 | {mathematics-dev} | - arpack | 100 | {mathematics-dev} | + arpack | 99 | {mathematics-dev} | scalapack | 49 | {nanoscale-physics-dev} | - ntl | 40 | {mathematics-dev} | + ntl | 42 | {mathematics-dev} | mbpoll | 39 | {simulations} | - visidata | 36 | {datamanagement} | + visidata | 38 | {datamanagement} | + ppl | 36 | {numericalcomputation} | imview | 35 | {viewing} | - ppl | 34 | {numericalcomputation} | - libmatio | 30 | {mathematics-dev} | - arduino-mk | 27 | {robotics} | - cliquer | 26 | {mathematics} | - flintqs | 25 | {mathematics} | - libm4ri | 25 | {mathematics-dev} | - flann | 24 | {mathematics-dev,engineering-dev} | + libmatio | 29 | {mathematics-dev} | + arduino-mk | 28 | {robotics} | + cliquer | 28 | {mathematics} | + flintqs | 28 | {mathematics} | + libm4ri | 27 | {mathematics-dev} | + flann | 26 | {mathematics-dev,engineering-dev} | grads | 24 | {meteorology} | - setzer | 23 | {typesetting} | - xygrib | 23 | {meteorology} | - sat4j | 22 | {logic} | - bossa | 18 | {devices} | + setzer | 22 | {typesetting} | + xygrib | 22 | {meteorology} | + sat4j | 21 | {logic} | + bossa | 19 | {devices} | fftw | 18 | {mathematics-dev,physics-dev,meteorology-dev} | + lrcalc | 18 | {mathematics-dev} | + cliquer | 17 | {mathematics-dev} | libitpp | 17 | {mathematics-dev,engineering-dev} | - lrcalc | 17 | {mathematics-dev} | picosat | 17 | {logic} | - cliquer | 16 | {mathematics-dev} | - pyzo | 16 | {numericalcomputation} | + guiqwt | 16 | {numericalcomputation,viewing} | eccodes | 15 | {meteorology,meteorology-dev} | - guiqwt | 15 | {numericalcomputation,viewing} | - gf2x | 14 | {mathematics-dev} | + gf2x | 15 | {mathematics-dev} | + iml | 15 | {mathematics-dev} | + libhomfly | 15 | {mathematics-dev} | + pyzo | 15 | {numericalcomputation} | gts | 14 | {viewing-dev} | - iml | 14 | {mathematics-dev} | - libhomfly | 14 | {mathematics-dev} | sketch | 14 | {typesetting} | dune-uggrid | 13 | {mathematics-dev} | + libm4rie | 13 | {mathematics-dev} | eccodes | 12 | {meteorology-dev} | feff85exafs | 12 | {chemistry} | - libm4rie | 12 | {mathematics-dev} | libzn-poly | 12 | {mathematics-dev} | matlab-support | 12 | {mathematics,numericalcomputation} | + ratpoints | 12 | {mathematics-dev} | teem | 12 | {imageanalysis} | coinor-symphony | 11 | {logic,mathematics,numericalcomputation} | - ratpoints | 11 | {mathematics-dev} | - feedgnuplot | 10 | {viewing} | + feedgnuplot | 11 | {viewing} | + ncl | 11 | {meteorology} | form | 10 | {mathematics} | lxi-tools | 10 | {engineering,dataacquisition} | - ncl | 10 | {meteorology} | + ros-rosconsole | 10 | {robotics-dev} | metar | 9 | {meteorology} | - ros-rosconsole | 9 | {robotics-dev} | + pcl | 9 | {robotics-dev} | + python-cdo | 9 | {meteorology} | vdt | 9 | {mathematics-dev} | alberta | 8 | {engineering-dev} | dxsamples | 8 | {nanoscale-physics} | geg | 8 | {viewing} | - odc | 8 | {meteorology} | + magics++ | 8 | {meteorology-dev} | odc | 8 | {meteorology-dev} | - pcl | 8 | {robotics-dev} | - python-cdo | 8 | {meteorology} | - magics++ | 7 | {meteorology-dev} | + odc | 8 | {meteorology} | + python-escript | 8 | {numericalcomputation,simulations,engineering} | opencascade | 7 | {simulations} | persalys | 7 | {engineering,statistics,mathematics} | - python-escript | 7 | {numericalcomputation,simulations,engineering} | - uctodata | 7 | {linguistics} | apophenia | 6 | {statistics} | atlas-ecmwf | 6 | {meteorology} | + coda | 6 | {meteorology-dev} | fftw | 6 | {meteorology-dev,mathematics-dev,physics-dev} | fpzip | 6 | {meteorology} | libccp4 | 6 | {nanoscale-physics-dev} | + psurface | 6 | {numericalcomputation} | refmac-dictionary | 6 | {highenergy-physics-dev,chemistry} | rheolef | 6 | {mathematics} | ros-vcstool | 6 | {robotics-dev} | toulbar2 | 6 | {logic,numericalcomputation,mathematics,physics} | - ucto | 6 | {linguistics} | + uctodata | 6 | {linguistics} | cld2 | 5 | {linguistics} | coda | 5 | {meteorology} | - coda | 5 | {meteorology-dev} | etsf-io | 5 | {physics,nanoscale-physics} | + gsw | 5 | {meteorology} | + iapws | 5 | {meteorology} | metview | 5 | {meteorology} | ncl | 5 | {meteorology-dev} | persalys | 5 | {statistics,mathematics,engineering} | - psurface | 5 | {numericalcomputation} | rubiks | 5 | {geometry,mathematics} | - debian-science | 4 | {economics,nanoscale-physics,machine-learning,physics,mathematics} | + ucto | 5 | {linguistics} | + auto-07p | 4 | {mathematics} | + cmor | 4 | {meteorology} | debian-science | 4 | {physics,machine-learning,economics,nanoscale-physics} | + debian-science | 4 | {economics,nanoscale-physics,machine-learning,physics,mathematics} | drslib | 4 | {meteorology} | dxflib | 4 | {engineering-dev} | emoslib | 4 | {meteorology-dev} | - gsw | 4 | {meteorology} | hdf-eos5 | 4 | {meteorology-dev} | - iapws | 4 | {meteorology} | - irstlm | 4 | {linguistics} | libgctp | 4 | {meteorology-dev} | libxsmm | 4 | {mathematics-dev} | lrcalc | 4 | {mathematics} | @@ -102,68 +103,61 @@ Last-Update: Wed, 11 Jun 2025 01:42:04 +0000 silo-llnl | 4 | {engineering} | urdfdom-headers | 4 | {robotics-dev} | atlas-ecmwf | 3 | {meteorology-dev} | - auto-07p | 3 | {mathematics} | - cmor | 3 | {meteorology} | cylc-flow | 3 | {meteorology} | - dimbl | 3 | {linguistics} | dune-functions | 3 | {mathematics-dev} | dune-localfunctions | 3 | {mathematics-dev} | dune-typetree | 3 | {mathematics-dev} | ecbuild | 3 | {meteorology-dev} | emoslib | 3 | {meteorology} | + getdp | 3 | {engineering,mathematics,simulations} | harp | 3 | {meteorology} | hdf-eos4 | 3 | {meteorology-dev} | ipe-tools | 3 | {typesetting} | - libcgns | 3 | {engineering-dev} | + irstlm | 3 | {linguistics} | libcgns | 3 | {engineering} | + libcgns | 3 | {engineering-dev} | libmatheval | 3 | {mathematics} | libvigraimpex | 3 | {imageanalysis-dev,machine-learning} | metkit | 3 | {meteorology} | mpi4py-fft | 3 | {mathematics-dev} | + python-aws-xray-sdk | 3 | {dataacquisition-dev} | sac2mseed | 3 | {geography} | sardana | 3 | {dataacquisition} | sdpb | 3 | {numericalcomputation,highenergy-physics} | - silo-llnl | 3 | {engineering} | silo-llnl | 3 | {engineering-dev} | + silo-llnl | 3 | {engineering} | toontag | 3 | {numericalcomputation} | veccore | 3 | {mathematics-dev} | apache-opennlp | 2 | {linguistics} | apertium-eval-translator | 2 | {linguistics} | apophenia | 2 | {statistics} | coda | 2 | {meteorology-dev} | - code-saturne | 2 | {mathematics-dev,engineering-dev} | code-saturne | 2 | {engineering-dev,mathematics-dev} | - debian-science | 2 | {nanoscale-physics,statistics,economics,physics} | + code-saturne | 2 | {mathematics-dev,engineering-dev} | debian-science | 2 | {neuroscience-cognitive} | + debian-science | 2 | {nanoscale-physics,statistics,economics,physics} | debian-science | 2 | {economics} | + dimbl | 2 | {linguistics} | fastjet | 2 | {highenergy-physics-dev} | fpzip | 2 | {meteorology-dev} | - frog | 2 | {linguistics} | gadap | 2 | {meteorology-dev} | - getdp | 2 | {engineering,mathematics,simulations} | hpcc | 2 | {numericalcomputation,distributedcomputing} | - ipe-tools | 2 | {typesetting} | libcvd | 2 | {imageanalysis} | libgtkdatabox | 2 | {engineering-dev,viewing-dev} | liblbfgs | 2 | {mathematics-dev} | libmatheval | 2 | {mathematics-dev} | - mbt | 2 | {linguistics} | - mbtserver | 2 | {linguistics} | mseed2sac | 2 | {dataacquisition-dev} | ncrystal | 2 | {nanoscale-physics-dev,highenergy-physics-dev} | newmat | 2 | {mathematics-dev} | nrn-iv | 2 | {biology} | openstereogram | 2 | {tools} | polylib | 2 | {mathematics} | - python-aws-xray-sdk | 2 | {dataacquisition-dev} | qwtplot3d | 2 | {viewing-dev} | ros-ros-environment | 2 | {robotics-dev} | sagemath-database-conway-polynomials | 2 | {mathematics} | scram | 2 | {engineering} | spaghetti | 2 | {geography} | syrthes | 2 | {engineering} | - timbl | 2 | {linguistics} | - timblserver | 2 | {linguistics} | toon | 2 | {numericalcomputation} | trilinos | 2 | {physics-dev,mathematics-dev,engineering-dev} | x13as | 2 | {economics} | @@ -174,13 +168,15 @@ Last-Update: Wed, 11 Jun 2025 01:42:04 +0000 cmor | 1 | {meteorology-dev} | coinmp | 1 | {logic,mathematics-dev,numericalcomputation} | coinor-bonmin | 1 | {mathematics} | - debian-science | 1 | {neuroscience-cognitive,machine-learning} | + debian-science | 1 | {electrophysiology} | debian-science | 1 | {tools} | debian-science | 1 | {psychophysics} | + debian-science | 1 | {neuroscience-cognitive,machine-learning} | debian-science | 1 | {nanoscale-physics-dev} | - debian-science | 1 | {electrophysiology} | + frog | 1 | {linguistics} | frogdata | 1 | {linguistics} | gemmlowp | 1 | {mathematics-dev} | + ipe-tools | 1 | {typesetting} | jeuclid | 1 | {viewing,typesetting} | libcvd | 1 | {imageanalysis-dev} | liblxi | 1 | {engineering-dev,dataacquisition-dev} | @@ -188,6 +184,8 @@ Last-Update: Wed, 11 Jun 2025 01:42:04 +0000 looptools | 1 | {highenergy-physics-dev} | looptools | 1 | {highenergy-physics} | magma | 1 | {mathematics-dev,numericalcomputation} | + mbt | 1 | {linguistics} | + mbtserver | 1 | {linguistics} | metkit | 1 | {meteorology-dev} | mmdb | 1 | {nanoscale-physics-dev,highenergy-physics-dev} | mrmpi | 1 | {tools} | @@ -201,6 +199,8 @@ Last-Update: Wed, 11 Jun 2025 01:42:04 +0000 spfft | 1 | {mathematics-dev,nanoscale-physics-dev,physics-dev,meteorology-dev} | ssm | 1 | {nanoscale-physics-dev} | tfdocgen | 1 | {linguistics} | + timbl | 1 | {linguistics} | + timblserver | 1 | {linguistics} | vlfeat | 1 | {imageanalysis-dev} | amgcl | 0 | {mathematics-dev} | apertium-afr-nld | 0 | {linguistics} | @@ -244,8 +244,8 @@ Last-Update: Wed, 11 Jun 2025 01:42:04 +0000 quadrule | 0 | {mathematics-dev} | robot-testing-framework | 0 | {robotics-dev} | ros-collada-urdf | 0 | {robotics} | - ros-metapackages | 0 | {robotics-dev} | ros-metapackages | 0 | {robotics} | + ros-metapackages | 0 | {robotics-dev} | ros-opencv-apps | 0 | {robotics} | sagemath-database-combinatorial-designs | 0 | {mathematics} | sagemath-database-cremona-elliptic-curves | 0 | {mathematics} | ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,387 +1,392 @@ -Last-Update: Wed, 11 Jun 2025 01:42:04 +0000 +Last-Update: Wed, 11 Jun 2025 13:42:12 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- - mpmath | 10114 | - python-repoze.lru | 6991 | - netifaces | 5137 | - ghp-import | 4782 | - python-lunr | 4777 | - python-babel | 4273 | - sortedcontainers | 3908 | - python-babel | 3721 | - aiosignal | 2916 | - hyperlink | 2154 | - python-notify2 | 2051 | - humanfriendly | 1944 | - referencing | 1712 | - python-mysqldb | 1522 | - python-pandocfilters | 1450 | - python-gssapi | 1416 | - python-invoke | 1391 | - python-hyperframe | 1350 | - websocket-client | 1336 | - python-hpack | 1142 | - python-rsa | 1131 | - pdfarranger | 1020 | - menulibre | 951 | - python-linux-procfs | 931 | - autopep8 | 899 | + mpmath | 10124 | + python-repoze.lru | 6978 | + netifaces | 5155 | + ghp-import | 4793 | + python-lunr | 4788 | + python-babel | 4316 | + sortedcontainers | 3903 | + python-babel | 3774 | + aiosignal | 2933 | + hyperlink | 2170 | + python-notify2 | 2048 | + humanfriendly | 1949 | + referencing | 1672 | + python-mysqldb | 1519 | + python-pandocfilters | 1467 | + python-gssapi | 1412 | + python-invoke | 1399 | + python-hyperframe | 1357 | + websocket-client | 1340 | + python-hpack | 1148 | + python-rsa | 1135 | + pdfarranger | 1032 | + menulibre | 952 | + python-linux-procfs | 926 | + autopep8 | 907 | python-geoip | 896 | - python-webob | 843 | - pytoolconfig | 814 | - firmware-microbit-micropython | 769 | - python-zopfli | 753 | - powerline | 751 | - powerline | 721 | - powerline | 715 | - kazam | 681 | - u-msgpack-python | 629 | - gaupol | 563 | - dockerpty | 522 | - python-et-xmlfile | 513 | - asn1crypto | 507 | - python-gevent | 504 | + python-webob | 853 | + pytoolconfig | 816 | + firmware-microbit-micropython | 762 | + powerline | 746 | + powerline | 718 | + powerline | 712 | + python-zopfli | 698 | + kazam | 679 | + u-msgpack-python | 621 | + gaupol | 561 | + dockerpty | 526 | + python-et-xmlfile | 522 | + asn1crypto | 510 | + python-gevent | 508 | python-ewmh | 439 | - catfish | 433 | - python-requests-oauthlib | 410 | - python-toml | 366 | - spf-engine | 344 | - python-ntlm-auth | 311 | - spf-engine | 295 | - django-stronghold | 254 | - python-ldap3 | 228 | - cairocffi | 224 | - python-mimeparse | 197 | + catfish | 428 | + python-requests-oauthlib | 409 | + python-toml | 363 | + spf-engine | 342 | + python-ntlm-auth | 313 | + spf-engine | 294 | + django-stronghold | 251 | + python-ldap3 | 225 | + cairocffi | 219 | + python-mimeparse | 198 | python-smmap | 180 | - python-hidapi | 170 | - autokey | 165 | - httpie | 156 | - python-anyjson | 151 | - smem | 149 | - kivy | 128 | - python-aiostream | 128 | - smartypants | 115 | + python-hidapi | 169 | + autokey | 163 | + httpie | 154 | + python-anyjson | 152 | + smem | 147 | + kivy | 131 | + python-aiostream | 127 | + smartypants | 116 | + python-click-repl | 112 | nodeenv | 109 | - python-click-repl | 109 | lollypop | 105 | - python-pyu2f | 100 | - timekpr-next | 100 | - mugshot | 99 | - mypaint | 99 | + mypaint | 104 | + python-pyu2f | 103 | + mugshot | 101 | + timekpr-next | 99 | pacparser | 97 | python-consul | 96 | - pymacaroons | 87 | - pssh | 86 | - pymediainfo | 86 | - python-rfc6555 | 81 | - python-colour | 78 | - python-i3ipc | 72 | - weasyprint | 71 | - numpy-stl | 69 | + pymacaroons | 88 | + pssh | 85 | + python-rfc6555 | 85 | + pymediainfo | 84 | + python-colour | 80 | + python-i3ipc | 74 | + weasyprint | 73 | + numpy-stl | 70 | python-pykka | 68 | - mitmproxy | 66 | - fabric | 65 | - python-uritools | 57 | + fabric | 64 | + mitmproxy | 61 | pywavelets | 57 | - ueberzug | 55 | - itstool | 54 | - python-scp | 51 | - mysql-connector-python | 50 | - pyenv | 50 | - python-looseversion | 50 | - blockdiag | 46 | - trac | 45 | + python-uritools | 56 | + ueberzug | 56 | + itstool | 55 | + mysql-connector-python | 52 | + python-looseversion | 52 | + python-scp | 52 | + pyenv | 49 | + trac | 46 | + blockdiag | 45 | show-in-file-manager | 44 | - hatchling | 42 | + hatchling | 43 | + pymacs | 43 | + sshtunnel | 43 | membernator | 42 | - khard | 41 | - sshtunnel | 41 | certipy | 40 | pamela | 40 | jupyterhub | 39 | - pymacs | 39 | + khard | 39 | pyquery | 39 | - persepolis | 38 | + persepolis | 37 | + powerline-gitstatus | 37 | pylibmc | 37 | - powerline-gitstatus | 35 | - python-pysol-cards | 35 | - python-scrypt | 33 | - pdfposter | 31 | + python-pysol-cards | 36 | + python-scrypt | 34 | + pdfposter | 32 | pssh | 30 | + python-args | 29 | python-statsd | 29 | - sphinxcontrib-blockdiag | 29 | - dkimpy-milter | 28 | - python-args | 28 | - video-downloader | 28 | + sphinxcontrib-blockdiag | 28 | + dkimpy-milter | 27 | seqdiag | 27 | + video-downloader | 27 | + python-clint | 26 | sphinxcontrib-seqdiag | 26 | - backoff | 25 | - python-clint | 25 | - enzyme | 24 | + enzyme | 25 | + backoff | 24 | + python-zstd | 24 | rst2pdf | 24 | sphinx-inline-tabs | 24 | + typogrify | 24 | webpy | 24 | cppman | 23 | depthcharge-tools | 23 | - python-zstd | 23 | + flask-principal | 23 | subliminal | 23 | - flask-principal | 22 | - typogrify | 22 | fabric | 21 | nwdiag | 21 | - python-rangehttpserver | 21 | + python-fire | 21 | + python-translationstring | 21 | subliminal | 21 | alot | 20 | - python-fire | 20 | + nwg-displays | 20 | + python-rangehttpserver | 20 | spf-engine | 20 | - nwg-displays | 19 | - python-translationstring | 19 | + kivy | 19 | + python-demjson | 19 | + social-auth-core | 19 | webtest | 19 | mistune0 | 18 | - python-demjson | 18 | - social-auth-core | 18 | + python-hupper | 18 | actdiag | 17 | - ruff | 17 | - sphinxcontrib-log-cabinet | 17 | - django-environ | 16 | - python-hupper | 16 | + django-environ | 17 | python-inotify | 16 | python-priority | 16 | - python-pyalsa | 16 | python-simpy | 16 | + python-slip10 | 16 | + ruff | 16 | sphinxcontrib-actdiag | 16 | + sphinxcontrib-log-cabinet | 16 | python-kyotocabinet | 15 | + python-pem | 15 | + python-pyalsa | 15 | python-pysubs2 | 15 | - python-slip10 | 15 | sphinxcontrib-nwdiag | 15 | policyd-rate-limit | 14 | pyp | 14 | - python-pem | 14 | python-pyrss2gen | 14 | python-sdnotify | 14 | ansi | 13 | - kivy | 13 | + gmplot | 13 | + gtextfsm | 13 | pykwalify | 13 | autotiling | 12 | btchip-python | 12 | - gmplot | 12 | - gtextfsm | 12 | pdm | 12 | - pwntools | 12 | python-crcelk | 12 | python-dbussy | 12 | python-ethtool | 12 | + python-xtermcolor | 12 | slimit | 12 | txt2tags | 12 | unearth | 12 | + django-auditlog | 11 | + jschema-to-python | 11 | junos-eznc | 11 | - pytest-runner | 11 | + pwntools | 11 | + pylint-common | 11 | + python-aiohttp-security | 11 | + python-parse-type | 11 | python-pyscss | 11 | - python-xtermcolor | 11 | - django-auditlog | 10 | - jschema-to-python | 10 | - pylint-common | 10 | - python-aiohttp-security | 10 | - python-overpy | 10 | - python-parse-type | 10 | - python-sarif-python-om | 10 | - speaklater | 10 | - traittypes | 10 | - beancount | 9 | - debiancontributors | 9 | + python-sarif-python-om | 11 | + speaklater | 11 | + beancount | 10 | + debiancontributors | 10 | + drf-yasg-nonfree | 10 | + flask-security | 10 | + pytest-runner | 10 | + python-digitalocean | 10 | + python-drf-spectacular-sidecar-nonfree | 10 | django-sass | 9 | - drf-yasg-nonfree | 9 | - flask-security | 9 | + flask-paranoid | 9 | flask-session | 9 | notebook-shim | 9 | - python-digitalocean | 9 | - python-drf-spectacular-sidecar-nonfree | 9 | + python-overpy | 9 | todoman | 9 | + traittypes | 9 | tuna | 9 | + beancount | 8 | clustershell | 8 | httpcode | 8 | pybik | 8 | pydrive2 | 8 | + python-envs | 8 | + python-numpysane | 8 | + python-pyld | 8 | python-versioneer | 8 | trac-wysiwyg | 8 | - beancount | 7 | - flask-paranoid | 7 | - librouteros | 7 | + clustershell | 7 | + easyprocess | 7 | mercurial-evolve | 7 | micropython-mpremote | 7 | pytest-django | 7 | python-ansicolors | 7 | - python-envs | 7 | - python-numpysane | 7 | python-openstep-plist | 7 | python-pyaml-env | 7 | - python-pyld | 7 | python-xdo | 7 | securestring | 7 | sphinx-intl | 7 | - clustershell | 6 | + voltron | 7 | + django-model-utils | 6 | django-pglocks | 6 | - easyprocess | 6 | + drf-extensions | 6 | + graphql-relay | 6 | hachoir | 6 | + htmlmin | 6 | + librouteros | 6 | numpy-stl | 6 | pytaglib | 6 | - voltron | 6 | - django-model-utils | 5 | - drf-extensions | 5 | + python3-onelogin-saml2 | 6 | + python-biplist | 6 | + drf-haystack | 5 | flufl.testing | 5 | - graphql-relay | 5 | - htmlmin | 5 | kconfiglib | 5 | mypy-protobuf | 5 | pycallgraph | 5 | pyjokes | 5 | pynliner | 5 | - python3-onelogin-saml2 | 5 | - python-biplist | 5 | python-dirq | 5 | + python-gnuplotlib | 5 | python-halo | 5 | python-jpype | 5 | ruff | 5 | sorl-thumbnail | 5 | sphinxcontrib-globalsubs | 5 | azote | 4 | + cram | 4 | + django-jinja | 4 | django-paintstore | 4 | - drf-haystack | 4 | extension-helpers | 4 | htmlmin | 4 | imap-tools | 4 | logilab-constraint | 4 | + mbed-test-wrapper | 4 | python-dbus-next | 4 | python-dynaconf | 4 | - python-gnuplotlib | 4 | python-simpy | 4 | python-srp | 4 | utidylib | 4 | west | 4 | aiomysql | 3 | bootstrap-flask | 3 | - cram | 3 | - django-jinja | 3 | + django-bitfield | 3 | + django-js-reverse | 3 | + django-redis-sessions | 3 | django-render-block | 3 | + django-simple-redis-admin | 3 | django-templated-email | 3 | + django-xmlrpc | 3 | etm | 3 | flake8-black | 3 | + flask-api | 3 | jpylyzer | 3 | - mbed-test-wrapper | 3 | orsopy | 3 | proglog | 3 | pyclamd | 3 | pyfltk | 3 | pyprind | 3 | pytest-expect | 3 | - python-deepmerge | 3 | + python-btrees | 3 | + python-cookies | 3 | + python-django-casclient | 3 | + python-django-contact-form | 3 | python-django-push-notifications | 3 | + python-django-registration | 3 | + python-ipfix | 3 | python-markuppy | 3 | python-netfilterqueue | 3 | python-networkmanager | 3 | python-pgmagick | 3 | + requests-aws | 3 | s3ql | 3 | slimit | 3 | + smem | 3 | sphinx-markdown-tables | 3 | - sphinx-paramlinks | 3 | testrepository | 3 | trac-accountmanager | 3 | vf1 | 3 | + yotta | 3 | backupchecker | 2 | brebis | 2 | cplay-ng | 2 | + django-ajax-selects | 2 | django-any-js | 2 | - django-bitfield | 2 | django-cachalot | 2 | django-cacheops | 2 | django-celery-email | 2 | django-cleanup | 2 | django-graphene | 2 | - django-js-reverse | 2 | django-macaddress | 2 | django-maintenance-mode | 2 | django-pagination | 2 | - django-redis-sessions | 2 | - django-simple-redis-admin | 2 | - django-xmlrpc | 2 | django-yarnpkg | 2 | dotdrop | 2 | - flask-api | 2 | + flask-flatpages | 2 | flask-mongoengine | 2 | flask-paginate | 2 | fypp | 2 | - gtkman | 2 | hatch-jupyter-builder | 2 | humanfriendly | 2 | jsonrpclib-pelix | 2 | korean-lunar-calendar | 2 | - myst-nb | 2 | namecheap | 2 | okasha | 2 | omgifol | 2 | panoramisk | 2 | pycrc | 2 | pyjunitxml | 2 | + pypass | 2 | pyroma | 2 | - python-btrees | 2 | + python-bitbucket-api | 2 | + python-bottle-sqlite | 2 | python-chartkick | 2 | python-commentjson | 2 | - python-cookies | 2 | - python-django-casclient | 2 | - python-django-contact-form | 2 | - python-django-registration | 2 | + python-deepmerge | 2 | + python-dnsq | 2 | python-ephemeral-port-reserve | 2 | python-funcy | 2 | - python-ipfix | 2 | + python-gammu | 2 | + python-getdns | 2 | python-kanboard | 2 | python-libguess | 2 | + python-openshift | 2 | + python-py-zipkin | 2 | python-qtpynodeeditor | 2 | python-securesystemslib | 2 | python-text-unidecode | 2 | redis-py-cluster | 2 | - requests-aws | 2 | - smem | 2 | - sphinx-sitemap | 2 | + sphinx-paramlinks | 2 | trac-xmlrpc | 2 | vcversioner | 2 | vncdotool | 2 | - vrfydmn | 2 | wikitrans | 2 | - yotta | 2 | zzzeeksphinx | 2 | apkinspector | 1 | bqplot | 1 | celery-progress | 1 | - django-ajax-selects | 1 | + codicefiscale | 1 | enlighten | 1 | errbot | 1 | - flask-flatpages | 1 | + flask-multistatic | 1 | + gtkman | 1 | jpy | 1 | jupyter-sphinx | 1 | mkdocs-macros-plugin | 1 | moviepy | 1 | + myst-nb | 1 | onetimepass | 1 | panoramisk | 1 | pykwalify | 1 | pylint-celery | 1 | - pypass | 1 | + pynag | 1 | pyrad | 1 | python-banal | 1 | - python-bitbucket-api | 1 | - python-bottle-sqlite | 1 | + python-bottle-cork | 1 | python-dataset | 1 | - python-dnsq | 1 | - python-gammu | 1 | + python-fudge | 1 | python-genson | 1 | - python-getdns | 1 | python-gfloat | 1 | python-netfilter | 1 | python-noise | 1 | python-openid-cla | 1 | python-openqa-client | 1 | - python-openshift | 1 | - python-py-zipkin | 1 | + python-opentracing | 1 | + python-pypump | 1 | python-rdflib-endpoint | 1 | python-schedutils | 1 | python-sphinx-examples | 1 | @@ -393,11 +398,12 @@ Last-Update: Wed, 11 Jun 2025 01:42:04 +0000 soundcraft-utils | 1 | sphinx-autorun | 1 | sphinxcontrib-github-alt | 1 | + sphinx-sitemap | 1 | sphinxtesters | 1 | trac-customfieldadmin | 1 | trac-httpauth | 1 | trac-subcomponents | 1 | - turbosearch | 1 | + vrfydmn | 1 | wchartype | 1 | wikitrans | 1 | zabbix-cli | 1 | @@ -416,7 +422,6 @@ Last-Update: Wed, 11 Jun 2025 01:42:04 +0000 bootstrap-flask | 0 | cairocffi | 0 | celery-haystack-ng | 0 | - codicefiscale | 0 | colorthief | 0 | concurrent-log-handler | 0 | customidenticon | 0 | @@ -439,7 +444,6 @@ Last-Update: Wed, 11 Jun 2025 01:42:04 +0000 fivem-api | 0 | flake8-pytest | 0 | flask-flatpages | 0 | - flask-multistatic | 0 | flask-paginate | 0 | flask-security | 0 | flask-session | 0 | @@ -484,7 +488,6 @@ Last-Update: Wed, 11 Jun 2025 01:42:04 +0000 pylibmc | 0 | pymediainfo | 0 | pyment | 0 | - pynag | 0 | py-nextbusnext | 0 | pyssim | 0 | python3-simpleobsws | 0 | @@ -495,7 +498,6 @@ Last-Update: Wed, 11 Jun 2025 01:42:04 +0000 python-babel | 0 | python-betterproto | 0 | python-bottle-beaker | 0 | - python-bottle-cork | 0 | python-briefcase | 0 | python-broadlink | 0 | python-brother-ql | 0 | @@ -573,6 +575,7 @@ Last-Update: Wed, 11 Jun 2025 01:42:04 +0000 thumbor-plugins-gifv | 0 | trac-roadmap | 0 | trac-wikiprint | 0 | + turbosearch | 0 | webpy | 0 | webtest | 0 | yotta | 0 | @@ -588,7 +591,8 @@ Last-Update: Wed, 11 Jun 2025 01:42:04 +0000 python-ledgercomm | -1 | python-nxtomomill | -1 | s3ql | -1 | + sphinxcontrib-emojicodes | -1 | symmetrize | -1 | trac-tickettemplate | -1 | -(603 rows) +(607 rows) View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/05642693b02cc97fb79a9bdf9571dd25fb3e1652 -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/05642693b02cc97fb79a9bdf9571dd25fb3e1652 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Wed Jun 11 18:51:36 2025 From: gitlab at salsa.debian.org (=?UTF-8?B?w4l0aWVubmUgTW9sbGllciAoQGVtb2xsaWVyKQ==?=) Date: Wed, 11 Jun 2025 17:51:36 +0000 Subject: [med-svn] [Git][med-team/tao-json][master] 5 commits: d/changelog: align to current upload. Message-ID: <6849c2282e0c8_3dbb9d7ab423486c6@godard.mail> ?tienne Mollier pushed to branch master at Debian Med / tao-json Commits: 5bedaa83 by ?tienne Mollier at 2025-06-05T20:44:10+02:00 d/changelog: align to current upload. Gbp-Dch: ignore - - - - - a069f707 by ?tienne Mollier at 2025-06-05T20:44:42+02:00 Restore fuzzy-match.patch. Gbp-Dch: ignore - - - - - 6d219637 by ?tienne Mollier at 2025-06-05T20:58:03+02:00 d/changelog: ready to upload to unstable. - - - - - 9aeeee97 by ?tienne Mollier at 2025-06-11T19:17:19+02:00 Merge branch 'debian/unstable' Reinject tao-json 1.0.0~beta14+really0.0+git20200604.f357d72-1 into the default branch flow. - - - - - 4cc8b8b8 by ?tienne Mollier at 2025-06-11T19:50:28+02:00 d/changelog: initialise, restoring 1.0.0~beta14. - - - - - 1 changed file: - debian/changelog Changes: ===================================== debian/changelog ===================================== @@ -1,3 +1,25 @@ +tao-json (1.0.0~beta14+really1.0.0~beta14-1) UNRELEASED; urgency=medium + + * Team upload. + * Restore all the changes introduced in 1.0.0~beta14-1. + NOTE: duplicate +really version is to preserve strict monotony; it will + be much saner to restart work when 1.0.0 or beta15 is out for the + package version numbering. debian/unstable branch remains around, + should further changes out of the main flow be needed. + + -- ?tienne Mollier Wed, 11 Jun 2025 19:19:43 +0200 + +tao-json (1.0.0~beta14+really0.0+git20200604.f357d72-1) unstable; urgency=medium + + * Team upload. + * Undo all the changes introduced in 1.0.0~beta14-1 to repair + regressions affecting tao-config and xenium, in compliance with the + ongoing freeze policy for the upcoming trixie release. The only + change which is preserved is fuzzy-match.patch which addresses the + release critical bug #1103123. (Closes: #1104656, #1104658) + + -- ?tienne Mollier Thu, 05 Jun 2025 20:45:15 +0200 + tao-json (1.0.0~beta14-1) unstable; urgency=medium * Team upload. View it on GitLab: https://salsa.debian.org/med-team/tao-json/-/compare/9630e6c20b00f8a2ba93356e3c9e846105123f7b...4cc8b8b8308464b6d6cfd3cc7fe439820a42edc8 -- View it on GitLab: https://salsa.debian.org/med-team/tao-json/-/compare/9630e6c20b00f8a2ba93356e3c9e846105123f7b...4cc8b8b8308464b6d6cfd3cc7fe439820a42edc8 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Wed Jun 11 18:51:40 2025 From: gitlab at salsa.debian.org (=?UTF-8?B?w4l0aWVubmUgTW9sbGllciAoQGVtb2xsaWVyKQ==?=) Date: Wed, 11 Jun 2025 17:51:40 +0000 Subject: [med-svn] [Git][med-team/tao-json][pristine-tar] pristine-tar data for tao-json_1.0.0~beta14+really1.0.0~beta14.orig.tar.xz Message-ID: <6849c22cb9990_3dbe383b3823497d@godard.mail> ?tienne Mollier pushed to branch pristine-tar at Debian Med / tao-json Commits: 2c4bc798 by ?tienne Mollier at 2025-06-11T19:29:25+02:00 pristine-tar data for tao-json_1.0.0~beta14+really1.0.0~beta14.orig.tar.xz - - - - - 2 changed files: - + tao-json_1.0.0~beta14+really1.0.0~beta14.orig.tar.xz.delta - + tao-json_1.0.0~beta14+really1.0.0~beta14.orig.tar.xz.id Changes: ===================================== tao-json_1.0.0~beta14+really1.0.0~beta14.orig.tar.xz.delta ===================================== Binary files /dev/null and b/tao-json_1.0.0~beta14+really1.0.0~beta14.orig.tar.xz.delta differ ===================================== tao-json_1.0.0~beta14+really1.0.0~beta14.orig.tar.xz.id ===================================== @@ -0,0 +1 @@ +55a2a129dd7e5f5ca870ba06b770faaa1ea69f94 View it on GitLab: https://salsa.debian.org/med-team/tao-json/-/commit/2c4bc7983359185a6fe86e760035787488885832 -- View it on GitLab: https://salsa.debian.org/med-team/tao-json/-/commit/2c4bc7983359185a6fe86e760035787488885832 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Wed Jun 11 18:51:42 2025 From: gitlab at salsa.debian.org (=?UTF-8?B?w4l0aWVubmUgTW9sbGllciAoQGVtb2xsaWVyKQ==?=) Date: Wed, 11 Jun 2025 17:51:42 +0000 Subject: [med-svn] [Git][med-team/tao-json] Pushed new tag upstream/1.0.0_beta14+really1.0.0_beta14 Message-ID: <6849c22e3e69e_3dbb9d85682350038@godard.mail> ?tienne Mollier pushed new tag upstream/1.0.0_beta14+really1.0.0_beta14 at Debian Med / tao-json -- View it on GitLab: https://salsa.debian.org/med-team/tao-json/-/tree/upstream/1.0.0_beta14+really1.0.0_beta14 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Thu Jun 12 02:43:32 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Thu, 12 Jun 2025 01:43:32 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <684a30c4bb5f6_3dbb9d85682440429@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: b48d4987 by Andreas Tille at 2025-06-12T01:43:28+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Wed, 11 Jun 2025 13:42:04 +0000 +Last-Update: Thu, 12 Jun 2025 01:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- ===================================== debian-science-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Wed, 11 Jun 2025 13:42:09 +0000 +Last-Update: Thu, 12 Jun 2025 01:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Wed, 11 Jun 2025 13:42:12 +0000 +Last-Update: Thu, 12 Jun 2025 01:42:05 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/b48d4987fae2f92d5f69acefa6c997ca0066d269 -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/b48d4987fae2f92d5f69acefa6c997ca0066d269 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Thu Jun 12 14:43:28 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Thu, 12 Jun 2025 13:43:28 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <684ad9807f39_3dbe388a98251873d@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: 817abbed by Andreas Tille at 2025-06-12T13:43:20+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,24 +1,24 @@ -Last-Update: Thu, 12 Jun 2025 01:42:04 +0000 +Last-Update: Thu, 12 Jun 2025 13:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- - dicomscope | 27 | {imaging} | + dicomscope | 28 | {imaging} | + mrtrix3 | 15 | {imaging} | orthanc-gdcm | 15 | {imaging} | - mrtrix3 | 14 | {imaging} | - oscar | 13 | {data,practice,tools} | + oscar | 14 | {data,practice,tools} | + king | 11 | {typesetting,imaging} | + pixelmed | 11 | {imaging} | + sight | 11 | {imaging} | gnumed-server | 10 | {covid-19,practice} | - king | 10 | {typesetting,imaging} | orthanc-mysql | 10 | {imaging} | - pixelmed | 10 | {imaging} | - sight | 10 | {imaging} | adun.app | 8 | {bio} | bart-view | 8 | {imaging} | orthanc-postgresql | 8 | {imaging} | heudiconv | 7 | {imaging} | - jebl2 | 6 | {bio-dev} | mia | 6 | {imaging} | - biojava-live | 5 | {bio-dev} | icb-utils | 5 | {bio-dev} | + jebl2 | 5 | {bio-dev} | + biojava-live | 4 | {bio-dev} | libminc | 4 | {imaging-dev} | pbcopper | 4 | {bio-dev} | beast-mcmc | 3 | {bio,bio-phylogeny} | @@ -32,6 +32,7 @@ Last-Update: Thu, 12 Jun 2025 01:42:04 +0000 cmtk | 2 | {imaging} | elastix | 2 | {imaging} | fastml | 2 | {bio} | + ipig | 2 | {bio} | libpal-java | 2 | {bio-dev} | plasmidid | 2 | {covid-19,bio} | python-seqcluster | 2 | {covid-19,bio-dev} | @@ -47,7 +48,6 @@ Last-Update: Thu, 12 Jun 2025 01:42:04 +0000 emboss-explorer | 1 | {bio} | hinge | 1 | {bio} | htscodecs | 1 | {bio-dev,covid-19} | - ipig | 1 | {bio} | jmodeltest | 1 | {bio,bio-phylogeny} | lamarc | 1 | {bio} | libbio-mage-utils-perl | 1 | {bio-dev} | @@ -57,12 +57,14 @@ Last-Update: Thu, 12 Jun 2025 01:42:04 +0000 libgenome | 1 | {bio-dev} | librg-utils-perl | 1 | {bio} | libxdf | 1 | {imaging-dev} | + mhap | 1 | {bio,bio-ngs} | mssstest | 1 | {tools} | opencfu | 1 | {laboratory} | papyrus | 1 | {imaging-dev} | phyutility | 1 | {cloud,bio} | proalign | 1 | {bio-phylogeny,bio} | rambo-k | 1 | {bio} | + runcircos-gui | 1 | {bio} | seq-gen | 1 | {bio} | sga | 1 | {bio} | spread-phy | 1 | {bio-phylogeny,bio} | @@ -118,7 +120,6 @@ Last-Update: Thu, 12 Jun 2025 01:42:04 +0000 melting | 0 | {cloud,bio} | metastudent-data | 0 | {bio} | metastudent-data-2 | 0 | {bio} | - mhap | 0 | {bio,bio-ngs} | mia | 0 | {imaging-dev} | milib | 0 | {covid-19,bio-dev} | ncbi-vdb | 0 | {bio-dev} | @@ -136,7 +137,6 @@ Last-Update: Thu, 12 Jun 2025 01:42:04 +0000 rdp-classifier | 0 | {bio} | resfinder-db | 0 | {bio} | rtax | 0 | {cloud,bio} | - runcircos-gui | 0 | {bio} | saint | 0 | {bio} | savvy | 0 | {bio} | savvy | 0 | {bio-dev} | ===================================== debian-science-tests.txt ===================================== @@ -1,105 +1,106 @@ -Last-Update: Thu, 12 Jun 2025 01:42:04 +0000 +Last-Update: Thu, 12 Jun 2025 13:42:06 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- - gts | 4889 | {viewing} | + gts | 4868 | {viewing} | nltk | 4841 | {linguistics} | opencascade | 611 | {simulations} | - spacenavd | 220 | {tools} | - open-coarrays | 193 | {meteorology-dev} | - armadillo | 183 | {mathematics-dev} | - arpack | 99 | {mathematics-dev} | - scalapack | 49 | {nanoscale-physics-dev} | - ntl | 42 | {mathematics-dev} | - mbpoll | 39 | {simulations} | - visidata | 38 | {datamanagement} | - ppl | 36 | {numericalcomputation} | - imview | 35 | {viewing} | - libmatio | 29 | {mathematics-dev} | - arduino-mk | 28 | {robotics} | + spacenavd | 219 | {tools} | + open-coarrays | 191 | {meteorology-dev} | + armadillo | 181 | {mathematics-dev} | + arpack | 94 | {mathematics-dev} | + scalapack | 51 | {nanoscale-physics-dev} | + visidata | 42 | {datamanagement} | + ntl | 41 | {mathematics-dev} | + imview | 38 | {viewing} | + mbpoll | 38 | {simulations} | + ppl | 35 | {numericalcomputation} | + libmatio | 31 | {mathematics-dev} | + arduino-mk | 30 | {robotics} | + flintqs | 29 | {mathematics} | cliquer | 28 | {mathematics} | - flintqs | 28 | {mathematics} | - libm4ri | 27 | {mathematics-dev} | - flann | 26 | {mathematics-dev,engineering-dev} | + libm4ri | 26 | {mathematics-dev} | + flann | 24 | {mathematics-dev,engineering-dev} | grads | 24 | {meteorology} | + xygrib | 24 | {meteorology} | setzer | 22 | {typesetting} | - xygrib | 22 | {meteorology} | + bossa | 21 | {devices} | sat4j | 21 | {logic} | - bossa | 19 | {devices} | - fftw | 18 | {mathematics-dev,physics-dev,meteorology-dev} | - lrcalc | 18 | {mathematics-dev} | - cliquer | 17 | {mathematics-dev} | - libitpp | 17 | {mathematics-dev,engineering-dev} | + fftw | 17 | {mathematics-dev,physics-dev,meteorology-dev} | picosat | 17 | {logic} | guiqwt | 16 | {numericalcomputation,viewing} | + libitpp | 16 | {mathematics-dev,engineering-dev} | + lrcalc | 16 | {mathematics-dev} | + pyzo | 16 | {numericalcomputation} | + sketch | 16 | {typesetting} | + cliquer | 15 | {mathematics-dev} | eccodes | 15 | {meteorology,meteorology-dev} | - gf2x | 15 | {mathematics-dev} | - iml | 15 | {mathematics-dev} | - libhomfly | 15 | {mathematics-dev} | - pyzo | 15 | {numericalcomputation} | gts | 14 | {viewing-dev} | - sketch | 14 | {typesetting} | - dune-uggrid | 13 | {mathematics-dev} | - libm4rie | 13 | {mathematics-dev} | - eccodes | 12 | {meteorology-dev} | + gf2x | 13 | {mathematics-dev} | + iml | 13 | {mathematics-dev} | + libhomfly | 13 | {mathematics-dev} | + teem | 13 | {imageanalysis} | + dune-uggrid | 12 | {mathematics-dev} | feff85exafs | 12 | {chemistry} | - libzn-poly | 12 | {mathematics-dev} | matlab-support | 12 | {mathematics,numericalcomputation} | - ratpoints | 12 | {mathematics-dev} | - teem | 12 | {imageanalysis} | coinor-symphony | 11 | {logic,mathematics,numericalcomputation} | + eccodes | 11 | {meteorology-dev} | feedgnuplot | 11 | {viewing} | + libm4rie | 11 | {mathematics-dev} | ncl | 11 | {meteorology} | form | 10 | {mathematics} | + libzn-poly | 10 | {mathematics-dev} | lxi-tools | 10 | {engineering,dataacquisition} | - ros-rosconsole | 10 | {robotics-dev} | - metar | 9 | {meteorology} | + ratpoints | 10 | {mathematics-dev} | + geg | 9 | {viewing} | pcl | 9 | {robotics-dev} | python-cdo | 9 | {meteorology} | + python-escript | 9 | {numericalcomputation,simulations,engineering} | + ros-rosconsole | 9 | {robotics-dev} | vdt | 9 | {mathematics-dev} | alberta | 8 | {engineering-dev} | dxsamples | 8 | {nanoscale-physics} | - geg | 8 | {viewing} | magics++ | 8 | {meteorology-dev} | - odc | 8 | {meteorology-dev} | odc | 8 | {meteorology} | - python-escript | 8 | {numericalcomputation,simulations,engineering} | - opencascade | 7 | {simulations} | - persalys | 7 | {engineering,statistics,mathematics} | - apophenia | 6 | {statistics} | + odc | 8 | {meteorology-dev} | + persalys | 8 | {engineering,statistics,mathematics} | + apophenia | 7 | {statistics} | + metar | 7 | {meteorology} | + refmac-dictionary | 7 | {highenergy-physics-dev,chemistry} | atlas-ecmwf | 6 | {meteorology} | coda | 6 | {meteorology-dev} | - fftw | 6 | {meteorology-dev,mathematics-dev,physics-dev} | fpzip | 6 | {meteorology} | libccp4 | 6 | {nanoscale-physics-dev} | + opencascade | 6 | {simulations} | + persalys | 6 | {statistics,mathematics,engineering} | psurface | 6 | {numericalcomputation} | - refmac-dictionary | 6 | {highenergy-physics-dev,chemistry} | rheolef | 6 | {mathematics} | ros-vcstool | 6 | {robotics-dev} | toulbar2 | 6 | {logic,numericalcomputation,mathematics,physics} | uctodata | 6 | {linguistics} | cld2 | 5 | {linguistics} | coda | 5 | {meteorology} | + debian-science | 5 | {economics,nanoscale-physics,machine-learning,physics,mathematics} | etsf-io | 5 | {physics,nanoscale-physics} | + fftw | 5 | {meteorology-dev,mathematics-dev,physics-dev} | gsw | 5 | {meteorology} | iapws | 5 | {meteorology} | metview | 5 | {meteorology} | ncl | 5 | {meteorology-dev} | - persalys | 5 | {statistics,mathematics,engineering} | - rubiks | 5 | {geometry,mathematics} | ucto | 5 | {linguistics} | auto-07p | 4 | {mathematics} | cmor | 4 | {meteorology} | debian-science | 4 | {physics,machine-learning,economics,nanoscale-physics} | - debian-science | 4 | {economics,nanoscale-physics,machine-learning,physics,mathematics} | drslib | 4 | {meteorology} | dxflib | 4 | {engineering-dev} | emoslib | 4 | {meteorology-dev} | hdf-eos5 | 4 | {meteorology-dev} | + irstlm | 4 | {linguistics} | libgctp | 4 | {meteorology-dev} | libxsmm | 4 | {mathematics-dev} | lrcalc | 4 | {mathematics} | muparser | 4 | {mathematics-dev} | + rubiks | 4 | {geometry,mathematics} | silo-llnl | 4 | {engineering} | urdfdom-headers | 4 | {robotics-dev} | atlas-ecmwf | 3 | {meteorology-dev} | @@ -113,11 +114,9 @@ Last-Update: Thu, 12 Jun 2025 01:42:04 +0000 harp | 3 | {meteorology} | hdf-eos4 | 3 | {meteorology-dev} | ipe-tools | 3 | {typesetting} | - irstlm | 3 | {linguistics} | libcgns | 3 | {engineering} | libcgns | 3 | {engineering-dev} | libmatheval | 3 | {mathematics} | - libvigraimpex | 3 | {imageanalysis-dev,machine-learning} | metkit | 3 | {meteorology} | mpi4py-fft | 3 | {mathematics-dev} | python-aws-xray-sdk | 3 | {dataacquisition-dev} | @@ -134,18 +133,20 @@ Last-Update: Thu, 12 Jun 2025 01:42:04 +0000 coda | 2 | {meteorology-dev} | code-saturne | 2 | {engineering-dev,mathematics-dev} | code-saturne | 2 | {mathematics-dev,engineering-dev} | + debian-science | 2 | {economics} | debian-science | 2 | {neuroscience-cognitive} | debian-science | 2 | {nanoscale-physics,statistics,economics,physics} | - debian-science | 2 | {economics} | dimbl | 2 | {linguistics} | fastjet | 2 | {highenergy-physics-dev} | fpzip | 2 | {meteorology-dev} | gadap | 2 | {meteorology-dev} | hpcc | 2 | {numericalcomputation,distributedcomputing} | + ipe-tools | 2 | {typesetting} | libcvd | 2 | {imageanalysis} | libgtkdatabox | 2 | {engineering-dev,viewing-dev} | liblbfgs | 2 | {mathematics-dev} | libmatheval | 2 | {mathematics-dev} | + libvigraimpex | 2 | {imageanalysis-dev,machine-learning} | mseed2sac | 2 | {dataacquisition-dev} | ncrystal | 2 | {nanoscale-physics-dev,highenergy-physics-dev} | newmat | 2 | {mathematics-dev} | @@ -153,7 +154,6 @@ Last-Update: Thu, 12 Jun 2025 01:42:04 +0000 openstereogram | 2 | {tools} | polylib | 2 | {mathematics} | qwtplot3d | 2 | {viewing-dev} | - ros-ros-environment | 2 | {robotics-dev} | sagemath-database-conway-polynomials | 2 | {mathematics} | scram | 2 | {engineering} | spaghetti | 2 | {geography} | @@ -168,21 +168,19 @@ Last-Update: Thu, 12 Jun 2025 01:42:04 +0000 cmor | 1 | {meteorology-dev} | coinmp | 1 | {logic,mathematics-dev,numericalcomputation} | coinor-bonmin | 1 | {mathematics} | - debian-science | 1 | {electrophysiology} | - debian-science | 1 | {tools} | debian-science | 1 | {psychophysics} | + debian-science | 1 | {tools} | debian-science | 1 | {neuroscience-cognitive,machine-learning} | debian-science | 1 | {nanoscale-physics-dev} | + debian-science | 1 | {electrophysiology} | frog | 1 | {linguistics} | frogdata | 1 | {linguistics} | gemmlowp | 1 | {mathematics-dev} | - ipe-tools | 1 | {typesetting} | jeuclid | 1 | {viewing,typesetting} | libcvd | 1 | {imageanalysis-dev} | liblxi | 1 | {engineering-dev,dataacquisition-dev} | liborigin2 | 1 | {viewing-dev} | looptools | 1 | {highenergy-physics-dev} | - looptools | 1 | {highenergy-physics} | magma | 1 | {mathematics-dev,numericalcomputation} | mbt | 1 | {linguistics} | mbtserver | 1 | {linguistics} | @@ -191,9 +189,9 @@ Last-Update: Thu, 12 Jun 2025 01:42:04 +0000 mrmpi | 1 | {tools} | nrn-mod2c | 1 | {biology} | openctm | 1 | {physics-dev} | - openmesh | 1 | {mathematics-dev} | psurface | 1 | {numericalcomputation} | qd | 1 | {mathematics-dev} | + ros-ros-environment | 1 | {robotics-dev} | schroedinger-coordgenlibs | 1 | {nanoscale-physics-dev,chemistry} | siscone | 1 | {highenergy-physics-dev} | spfft | 1 | {mathematics-dev,nanoscale-physics-dev,physics-dev,meteorology-dev} | @@ -229,23 +227,25 @@ Last-Update: Thu, 12 Jun 2025 01:42:04 +0000 libfolia | 0 | {linguistics} | libquantum | 0 | {numericalcomputation} | libsdsl | 0 | {dataacquisition-dev} | + looptools | 0 | {highenergy-physics} | looptools | 0 | {highenergy-physics-dev} | mbt | 0 | {linguistics} | mctc-lib | 0 | {nanoscale-physics-dev,highenergy-physics-dev} | meshsdfilter | 0 | {mathematics-dev} | - metis-edf | 0 | {engineering,numericalcomputation} | metis-edf | 0 | {engineering-dev} | + metis-edf | 0 | {engineering,numericalcomputation} | neartree | 0 | {mathematics-dev,numericalcomputation} | opengv | 0 | {geometry} | openigtlink | 0 | {robotics-dev} | + openmesh | 0 | {mathematics-dev} | python-escript | 0 | {numericalcomputation,simulations,engineering} | python-opcodes | 0 | {tools} | qrupdate | 0 | {mathematics-dev} | quadrule | 0 | {mathematics-dev} | robot-testing-framework | 0 | {robotics-dev} | ros-collada-urdf | 0 | {robotics} | - ros-metapackages | 0 | {robotics} | ros-metapackages | 0 | {robotics-dev} | + ros-metapackages | 0 | {robotics} | ros-opencv-apps | 0 | {robotics} | sagemath-database-combinatorial-designs | 0 | {mathematics} | sagemath-database-cremona-elliptic-curves | 0 | {mathematics} | ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,242 +1,243 @@ -Last-Update: Thu, 12 Jun 2025 01:42:05 +0000 +Last-Update: Thu, 12 Jun 2025 13:42:08 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- - mpmath | 10124 | - python-repoze.lru | 6978 | - netifaces | 5155 | - ghp-import | 4793 | - python-lunr | 4788 | - python-babel | 4316 | - sortedcontainers | 3903 | - python-babel | 3774 | - aiosignal | 2933 | - hyperlink | 2170 | - python-notify2 | 2048 | - humanfriendly | 1949 | - referencing | 1672 | - python-mysqldb | 1519 | - python-pandocfilters | 1467 | - python-gssapi | 1412 | - python-invoke | 1399 | + mpmath | 10073 | + python-repoze.lru | 6980 | + netifaces | 5159 | + ghp-import | 4789 | + python-lunr | 4784 | + python-babel | 4307 | + sortedcontainers | 3915 | + python-babel | 3751 | + aiosignal | 2937 | + hyperlink | 2180 | + python-notify2 | 2050 | + humanfriendly | 1955 | + referencing | 1632 | + python-mysqldb | 1512 | + python-pandocfilters | 1460 | + python-gssapi | 1413 | + python-invoke | 1407 | python-hyperframe | 1357 | - websocket-client | 1340 | + websocket-client | 1347 | python-hpack | 1148 | - python-rsa | 1135 | - pdfarranger | 1032 | - menulibre | 952 | - python-linux-procfs | 926 | - autopep8 | 907 | - python-geoip | 896 | - python-webob | 853 | - pytoolconfig | 816 | - firmware-microbit-micropython | 762 | - powerline | 746 | - powerline | 718 | + python-rsa | 1144 | + pdfarranger | 1029 | + menulibre | 954 | + python-linux-procfs | 928 | + autopep8 | 909 | + python-geoip | 892 | + python-webob | 854 | + pytoolconfig | 818 | + firmware-microbit-micropython | 753 | + powerline | 753 | + powerline | 717 | powerline | 712 | - python-zopfli | 698 | - kazam | 679 | - u-msgpack-python | 621 | - gaupol | 561 | - dockerpty | 526 | - python-et-xmlfile | 522 | - asn1crypto | 510 | - python-gevent | 508 | - python-ewmh | 439 | - catfish | 428 | - python-requests-oauthlib | 409 | + kazam | 676 | + python-zopfli | 674 | + u-msgpack-python | 619 | + gaupol | 556 | + dockerpty | 527 | + python-et-xmlfile | 524 | + asn1crypto | 522 | + python-gevent | 504 | + python-ewmh | 436 | + catfish | 435 | + python-requests-oauthlib | 403 | python-toml | 363 | - spf-engine | 342 | - python-ntlm-auth | 313 | - spf-engine | 294 | - django-stronghold | 251 | - python-ldap3 | 225 | + spf-engine | 340 | + python-ntlm-auth | 318 | + spf-engine | 293 | + django-stronghold | 254 | + python-ldap3 | 227 | cairocffi | 219 | - python-mimeparse | 198 | - python-smmap | 180 | - python-hidapi | 169 | - autokey | 163 | - httpie | 154 | - python-anyjson | 152 | + python-mimeparse | 197 | + python-smmap | 176 | + python-hidapi | 171 | + autokey | 165 | + httpie | 157 | + python-anyjson | 154 | smem | 147 | - kivy | 131 | + kivy | 130 | python-aiostream | 127 | - smartypants | 116 | - python-click-repl | 112 | - nodeenv | 109 | - lollypop | 105 | + smartypants | 117 | + python-click-repl | 116 | + nodeenv | 111 | + lollypop | 107 | mypaint | 104 | - python-pyu2f | 103 | - mugshot | 101 | + python-pyu2f | 104 | timekpr-next | 99 | - pacparser | 97 | - python-consul | 96 | + mugshot | 98 | + pacparser | 95 | + python-consul | 94 | pymacaroons | 88 | pssh | 85 | python-rfc6555 | 85 | - pymediainfo | 84 | - python-colour | 80 | - python-i3ipc | 74 | - weasyprint | 73 | - numpy-stl | 70 | + pymediainfo | 83 | + python-colour | 78 | + python-i3ipc | 73 | + weasyprint | 71 | + fabric | 70 | + numpy-stl | 68 | python-pykka | 68 | - fabric | 64 | - mitmproxy | 61 | - pywavelets | 57 | + mitmproxy | 62 | + pywavelets | 59 | + ueberzug | 58 | python-uritools | 56 | - ueberzug | 56 | - itstool | 55 | - mysql-connector-python | 52 | - python-looseversion | 52 | - python-scp | 52 | - pyenv | 49 | - trac | 46 | + python-scp | 55 | + itstool | 54 | + mysql-connector-python | 51 | + pyenv | 51 | + python-looseversion | 51 | + hatchling | 46 | blockdiag | 45 | - show-in-file-manager | 44 | - hatchling | 43 | + sshtunnel | 45 | + trac | 45 | + membernator | 43 | pymacs | 43 | - sshtunnel | 43 | - membernator | 42 | - certipy | 40 | - pamela | 40 | - jupyterhub | 39 | + show-in-file-manager | 43 | + certipy | 39 | khard | 39 | + pamela | 39 | + persepolis | 39 | pyquery | 39 | - persepolis | 37 | + python-pysol-cards | 39 | + jupyterhub | 38 | powerline-gitstatus | 37 | pylibmc | 37 | - python-pysol-cards | 36 | - python-scrypt | 34 | - pdfposter | 32 | - pssh | 30 | - python-args | 29 | - python-statsd | 29 | - sphinxcontrib-blockdiag | 28 | + pdfposter | 35 | + python-scrypt | 35 | + pssh | 31 | + python-args | 31 | + python-statsd | 30 | + python-clint | 28 | + seqdiag | 28 | + video-downloader | 28 | dkimpy-milter | 27 | - seqdiag | 27 | - video-downloader | 27 | - python-clint | 26 | + sphinxcontrib-blockdiag | 27 | sphinxcontrib-seqdiag | 26 | - enzyme | 25 | - backoff | 24 | + rst2pdf | 25 | + enzyme | 24 | python-zstd | 24 | - rst2pdf | 24 | sphinx-inline-tabs | 24 | typogrify | 24 | webpy | 24 | cppman | 23 | depthcharge-tools | 23 | flask-principal | 23 | - subliminal | 23 | + kivy | 23 | + backoff | 22 | + python-fire | 22 | + subliminal | 22 | fabric | 21 | - nwdiag | 21 | - python-fire | 21 | - python-translationstring | 21 | - subliminal | 21 | alot | 20 | - nwg-displays | 20 | + nwdiag | 20 | python-rangehttpserver | 20 | + python-translationstring | 20 | spf-engine | 20 | - kivy | 19 | + subliminal | 20 | + nwg-displays | 19 | python-demjson | 19 | social-auth-core | 19 | webtest | 19 | - mistune0 | 18 | - python-hupper | 18 | actdiag | 17 | django-environ | 17 | - python-inotify | 16 | + mistune0 | 17 | + python-hupper | 17 | + python-simpy | 17 | python-priority | 16 | - python-simpy | 16 | + python-sdnotify | 16 | python-slip10 | 16 | - ruff | 16 | sphinxcontrib-actdiag | 16 | sphinxcontrib-log-cabinet | 16 | + python-inotify | 15 | python-kyotocabinet | 15 | - python-pem | 15 | - python-pyalsa | 15 | python-pysubs2 | 15 | sphinxcontrib-nwdiag | 15 | + gtextfsm | 14 | policyd-rate-limit | 14 | + pykwalify | 14 | pyp | 14 | + python-pem | 14 | python-pyrss2gen | 14 | - python-sdnotify | 14 | + ruff | 14 | ansi | 13 | gmplot | 13 | - gtextfsm | 13 | - pykwalify | 13 | + pdm | 13 | + python-dbussy | 13 | + python-ethtool | 13 | + python-pyalsa | 13 | + unearth | 13 | autotiling | 12 | - btchip-python | 12 | - pdm | 12 | - python-crcelk | 12 | - python-dbussy | 12 | - python-ethtool | 12 | + pylint-common | 12 | + python-pyscss | 12 | python-xtermcolor | 12 | slimit | 12 | - txt2tags | 12 | - unearth | 12 | + btchip-python | 11 | django-auditlog | 11 | jschema-to-python | 11 | junos-eznc | 11 | pwntools | 11 | - pylint-common | 11 | python-aiohttp-security | 11 | + python-crcelk | 11 | python-parse-type | 11 | - python-pyscss | 11 | python-sarif-python-om | 11 | - speaklater | 11 | - beancount | 10 | + txt2tags | 11 | debiancontributors | 10 | drf-yasg-nonfree | 10 | flask-security | 10 | - pytest-runner | 10 | python-digitalocean | 10 | python-drf-spectacular-sidecar-nonfree | 10 | + speaklater | 10 | + todoman | 10 | + beancount | 9 | django-sass | 9 | flask-paranoid | 9 | flask-session | 9 | - notebook-shim | 9 | + pydrive2 | 9 | + pytest-runner | 9 | python-overpy | 9 | - todoman | 9 | traittypes | 9 | tuna | 9 | - beancount | 8 | clustershell | 8 | httpcode | 8 | + micropython-mpremote | 8 | + notebook-shim | 8 | pybik | 8 | - pydrive2 | 8 | python-envs | 8 | python-numpysane | 8 | + python-openstep-plist | 8 | python-pyld | 8 | python-versioneer | 8 | + sphinx-intl | 8 | trac-wysiwyg | 8 | + beancount | 7 | clustershell | 7 | easyprocess | 7 | mercurial-evolve | 7 | - micropython-mpremote | 7 | pytest-django | 7 | - python-ansicolors | 7 | - python-openstep-plist | 7 | python-pyaml-env | 7 | python-xdo | 7 | securestring | 7 | - sphinx-intl | 7 | - voltron | 7 | django-model-utils | 6 | django-pglocks | 6 | drf-extensions | 6 | graphql-relay | 6 | - hachoir | 6 | htmlmin | 6 | librouteros | 6 | - numpy-stl | 6 | pytaglib | 6 | python3-onelogin-saml2 | 6 | + python-ansicolors | 6 | python-biplist | 6 | + voltron | 6 | drf-haystack | 5 | flufl.testing | 5 | + hachoir | 5 | + htmlmin | 5 | kconfiglib | 5 | mypy-protobuf | 5 | + numpy-stl | 5 | pycallgraph | 5 | pyjokes | 5 | pynliner | 5 | @@ -252,10 +253,8 @@ Last-Update: Thu, 12 Jun 2025 01:42:05 +0000 django-jinja | 4 | django-paintstore | 4 | extension-helpers | 4 | - htmlmin | 4 | imap-tools | 4 | logilab-constraint | 4 | - mbed-test-wrapper | 4 | python-dbus-next | 4 | python-dynaconf | 4 | python-simpy | 4 | @@ -275,6 +274,7 @@ Last-Update: Thu, 12 Jun 2025 01:42:05 +0000 flake8-black | 3 | flask-api | 3 | jpylyzer | 3 | + mbed-test-wrapper | 3 | orsopy | 3 | proglog | 3 | pyclamd | 3 | @@ -300,7 +300,6 @@ Last-Update: Thu, 12 Jun 2025 01:42:05 +0000 testrepository | 3 | trac-accountmanager | 3 | vf1 | 3 | - yotta | 3 | backupchecker | 2 | brebis | 2 | cplay-ng | 2 | @@ -320,15 +319,14 @@ Last-Update: Thu, 12 Jun 2025 01:42:05 +0000 flask-mongoengine | 2 | flask-paginate | 2 | fypp | 2 | + gtkman | 2 | hatch-jupyter-builder | 2 | humanfriendly | 2 | jsonrpclib-pelix | 2 | - korean-lunar-calendar | 2 | namecheap | 2 | okasha | 2 | omgifol | 2 | panoramisk | 2 | - pycrc | 2 | pyjunitxml | 2 | pypass | 2 | pyroma | 2 | @@ -345,6 +343,7 @@ Last-Update: Thu, 12 Jun 2025 01:42:05 +0000 python-kanboard | 2 | python-libguess | 2 | python-openshift | 2 | + python-opentracing | 2 | python-py-zipkin | 2 | python-qtpynodeeditor | 2 | python-securesystemslib | 2 | @@ -355,6 +354,7 @@ Last-Update: Thu, 12 Jun 2025 01:42:05 +0000 vcversioner | 2 | vncdotool | 2 | wikitrans | 2 | + yotta | 2 | zzzeeksphinx | 2 | apkinspector | 1 | bqplot | 1 | @@ -363,14 +363,14 @@ Last-Update: Thu, 12 Jun 2025 01:42:05 +0000 enlighten | 1 | errbot | 1 | flask-multistatic | 1 | - gtkman | 1 | jpy | 1 | jupyter-sphinx | 1 | + korean-lunar-calendar | 1 | mkdocs-macros-plugin | 1 | moviepy | 1 | myst-nb | 1 | onetimepass | 1 | - panoramisk | 1 | + pycrc | 1 | pykwalify | 1 | pylint-celery | 1 | pynag | 1 | @@ -378,6 +378,7 @@ Last-Update: Thu, 12 Jun 2025 01:42:05 +0000 python-banal | 1 | python-bottle-cork | 1 | python-dataset | 1 | + python-fluent-logger | 1 | python-fudge | 1 | python-genson | 1 | python-gfloat | 1 | @@ -385,7 +386,6 @@ Last-Update: Thu, 12 Jun 2025 01:42:05 +0000 python-noise | 1 | python-openid-cla | 1 | python-openqa-client | 1 | - python-opentracing | 1 | python-pypump | 1 | python-rdflib-endpoint | 1 | python-schedutils | 1 | @@ -394,7 +394,9 @@ Last-Update: Thu, 12 Jun 2025 01:42:05 +0000 python-undetected-chromedriver | 1 | python-urlobject | 1 | python-vega-datasets | 1 | + python-webdavclient | 1 | python-zc.customdoctests | 1 | + pytkdocs | 1 | soundcraft-utils | 1 | sphinx-autorun | 1 | sphinxcontrib-github-alt | 1 | @@ -402,14 +404,12 @@ Last-Update: Thu, 12 Jun 2025 01:42:05 +0000 sphinxtesters | 1 | trac-customfieldadmin | 1 | trac-httpauth | 1 | - trac-subcomponents | 1 | vrfydmn | 1 | wchartype | 1 | wikitrans | 1 | zabbix-cli | 1 | zlmdb | 1 | aioairzone | 0 | - aioaseko | 0 | aioeagle | 0 | aiomysql | 0 | aiotask-context | 0 | @@ -441,7 +441,6 @@ Last-Update: Thu, 12 Jun 2025 01:42:05 +0000 faadelays | 0 | fava | 0 | firmware-microbit-micropython | 0 | - fivem-api | 0 | flake8-pytest | 0 | flask-flatpages | 0 | flask-paginate | 0 | @@ -466,7 +465,6 @@ Last-Update: Thu, 12 Jun 2025 01:42:05 +0000 mypaint | 0 | nbgitpuller | 0 | okasha | 0 | - open-garage | 0 | pacparser | 0 | panoramisk | 0 | parsimonious | 0 | @@ -478,13 +476,11 @@ Last-Update: Thu, 12 Jun 2025 01:42:05 +0000 psrecord | 0 | purl | 0 | pwntools | 0 | - pyatag | 0 | pydataverse | 0 | pydenticon | 0 | pydle | 0 | pyeverlights | 0 | pyfg | 0 | - pykmtronic | 0 | pylibmc | 0 | pymediainfo | 0 | pyment | 0 | @@ -516,12 +512,12 @@ Last-Update: Thu, 12 Jun 2025 01:42:05 +0000 python-easy-ansi | 0 | python-ewmh | 0 | python-flanker | 0 | - python-fluent-logger | 0 | python-fudge | 0 | python-fullykiosk | 0 | python-funcy | 0 | python-getdns | 0 | python-gevent | 0 | + python-gfloat | 0 | python-gpsoauth | 0 | python-hiyapyco | 0 | python-imageio-ffmpeg | 0 | @@ -543,25 +539,20 @@ Last-Update: Thu, 12 Jun 2025 01:42:05 +0000 python-pyout | 0 | python-pypump | 0 | python-pysubs2 | 0 | - python-qnapstats | 0 | python-rdflib-endpoint | 0 | python-requests-oauthlib | 0 | - python-rova | 0 | python-rpcq | 0 | python-simpy | 0 | python-socketpool | 0 | python-sphinx-examples | 0 | python-tatsu | 0 | python-tatsu-lts | 0 | - python-webdavclient | 0 | python-webob | 0 | python-wither | 0 | python-ytmusicapi | 0 | python-yubiotp | 0 | python-zipfile-zstd | 0 | - pytkdocs | 0 | pywavelets | 0 | - pyyardian | 0 | quark-sphinx-theme | 0 | rdflib-sqlalchemy | 0 | redis-py-cluster | 0 | @@ -574,25 +565,33 @@ Last-Update: Thu, 12 Jun 2025 01:42:05 +0000 testrepository | 0 | thumbor-plugins-gifv | 0 | trac-roadmap | 0 | + trac-subcomponents | 0 | trac-wikiprint | 0 | turbosearch | 0 | webpy | 0 | webtest | 0 | yotta | 0 | zktop | 0 | + aioaseko | -1 | django-cachalot | -1 | + fivem-api | -1 | ikos | -1 | nam-files | -1 | + open-garage | -1 | + pyatag | -1 | pyina | -1 | + pykmtronic | -1 | pysequoia | -1 | python-asv-bench-memray | -1 | - python-gfloat | -1 | python-gradientmodel | -1 | python-ledgercomm | -1 | python-nxtomomill | -1 | + python-qnapstats | -1 | + python-rova | -1 | + pyyardian | -1 | s3ql | -1 | sphinxcontrib-emojicodes | -1 | symmetrize | -1 | trac-tickettemplate | -1 | -(607 rows) +(606 rows) View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/817abbedb549d0cbe331e59586d371e1298bc9d1 -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/817abbedb549d0cbe331e59586d371e1298bc9d1 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Fri Jun 13 02:42:50 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Fri, 13 Jun 2025 01:42:50 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <684b821a9f412_3dbd786d94261517e@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: 333bfacb by Andreas Tille at 2025-06-13T01:42:46+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Thu, 12 Jun 2025 13:42:04 +0000 +Last-Update: Fri, 13 Jun 2025 01:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- ===================================== debian-science-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Thu, 12 Jun 2025 13:42:06 +0000 +Last-Update: Fri, 13 Jun 2025 01:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Thu, 12 Jun 2025 13:42:08 +0000 +Last-Update: Fri, 13 Jun 2025 01:42:04 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/333bfacb7dd65556afc79f12b736b7440fdcc506 -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/333bfacb7dd65556afc79f12b736b7440fdcc506 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Fri Jun 13 14:43:36 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Fri, 13 Jun 2025 13:43:36 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <684c2b084da4a_3db10596aa42747162@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: 00d61ad4 by Andreas Tille at 2025-06-13T13:43:30+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,23 +1,23 @@ -Last-Update: Fri, 13 Jun 2025 01:42:04 +0000 +Last-Update: Fri, 13 Jun 2025 13:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- dicomscope | 28 | {imaging} | - mrtrix3 | 15 | {imaging} | - orthanc-gdcm | 15 | {imaging} | - oscar | 14 | {data,practice,tools} | + orthanc-gdcm | 16 | {imaging} | + oscar | 15 | {data,practice,tools} | + mrtrix3 | 14 | {imaging} | king | 11 | {typesetting,imaging} | pixelmed | 11 | {imaging} | - sight | 11 | {imaging} | + adun.app | 10 | {bio} | gnumed-server | 10 | {covid-19,practice} | orthanc-mysql | 10 | {imaging} | - adun.app | 8 | {bio} | + sight | 10 | {imaging} | + orthanc-postgresql | 9 | {imaging} | bart-view | 8 | {imaging} | - orthanc-postgresql | 8 | {imaging} | - heudiconv | 7 | {imaging} | - mia | 6 | {imaging} | - icb-utils | 5 | {bio-dev} | + heudiconv | 6 | {imaging} | + icb-utils | 6 | {bio-dev} | jebl2 | 5 | {bio-dev} | + mia | 5 | {imaging} | biojava-live | 4 | {bio-dev} | libminc | 4 | {imaging-dev} | pbcopper | 4 | {bio-dev} | @@ -29,6 +29,7 @@ Last-Update: Fri, 13 Jun 2025 01:42:04 +0000 piler | 3 | {bio} | sight | 3 | {imaging} | ants | 2 | {imaging} | + biojava6-live | 2 | {bio-dev} | cmtk | 2 | {imaging} | elastix | 2 | {imaging} | fastml | 2 | {bio} | @@ -38,7 +39,6 @@ Last-Update: Fri, 13 Jun 2025 01:42:04 +0000 python-seqcluster | 2 | {covid-19,bio-dev} | staden | 2 | {bio} | tracetuner | 2 | {bio} | - biojava6-live | 1 | {bio-dev} | blimps | 1 | {bio} | brig | 1 | {bio} | ctn | 1 | {imaging-dev} | ===================================== debian-science-tests.txt ===================================== @@ -1,60 +1,60 @@ -Last-Update: Fri, 13 Jun 2025 01:42:04 +0000 +Last-Update: Fri, 13 Jun 2025 13:42:08 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- - gts | 4868 | {viewing} | - nltk | 4841 | {linguistics} | - opencascade | 611 | {simulations} | + gts | 4840 | {viewing} | + nltk | 4838 | {linguistics} | + opencascade | 616 | {simulations} | spacenavd | 219 | {tools} | - open-coarrays | 191 | {meteorology-dev} | - armadillo | 181 | {mathematics-dev} | - arpack | 94 | {mathematics-dev} | - scalapack | 51 | {nanoscale-physics-dev} | - visidata | 42 | {datamanagement} | - ntl | 41 | {mathematics-dev} | - imview | 38 | {viewing} | - mbpoll | 38 | {simulations} | - ppl | 35 | {numericalcomputation} | + open-coarrays | 193 | {meteorology-dev} | + armadillo | 179 | {mathematics-dev} | + arpack | 93 | {mathematics-dev} | + scalapack | 54 | {nanoscale-physics-dev} | + visidata | 43 | {datamanagement} | + ntl | 42 | {mathematics-dev} | + mbpoll | 37 | {simulations} | + imview | 36 | {viewing} | + ppl | 36 | {numericalcomputation} | libmatio | 31 | {mathematics-dev} | - arduino-mk | 30 | {robotics} | - flintqs | 29 | {mathematics} | + flintqs | 30 | {mathematics} | + arduino-mk | 29 | {robotics} | cliquer | 28 | {mathematics} | + flann | 26 | {mathematics-dev,engineering-dev} | libm4ri | 26 | {mathematics-dev} | - flann | 24 | {mathematics-dev,engineering-dev} | grads | 24 | {meteorology} | - xygrib | 24 | {meteorology} | - setzer | 22 | {typesetting} | - bossa | 21 | {devices} | - sat4j | 21 | {logic} | + xygrib | 23 | {meteorology} | + bossa | 22 | {devices} | + setzer | 21 | {typesetting} | + sat4j | 20 | {logic} | fftw | 17 | {mathematics-dev,physics-dev,meteorology-dev} | + lrcalc | 17 | {mathematics-dev} | picosat | 17 | {logic} | - guiqwt | 16 | {numericalcomputation,viewing} | - libitpp | 16 | {mathematics-dev,engineering-dev} | - lrcalc | 16 | {mathematics-dev} | - pyzo | 16 | {numericalcomputation} | + cliquer | 16 | {mathematics-dev} | sketch | 16 | {typesetting} | - cliquer | 15 | {mathematics-dev} | eccodes | 15 | {meteorology,meteorology-dev} | - gts | 14 | {viewing-dev} | - gf2x | 13 | {mathematics-dev} | - iml | 13 | {mathematics-dev} | - libhomfly | 13 | {mathematics-dev} | - teem | 13 | {imageanalysis} | - dune-uggrid | 12 | {mathematics-dev} | + gts | 15 | {viewing-dev} | + guiqwt | 15 | {numericalcomputation,viewing} | + libitpp | 15 | {mathematics-dev,engineering-dev} | + pyzo | 15 | {numericalcomputation} | + gf2x | 14 | {mathematics-dev} | + iml | 14 | {mathematics-dev} | + libhomfly | 14 | {mathematics-dev} | + ncl | 14 | {meteorology} | + dune-uggrid | 13 | {mathematics-dev} | feff85exafs | 12 | {chemistry} | - matlab-support | 12 | {mathematics,numericalcomputation} | + libm4rie | 12 | {mathematics-dev} | + teem | 12 | {imageanalysis} | coinor-symphony | 11 | {logic,mathematics,numericalcomputation} | eccodes | 11 | {meteorology-dev} | feedgnuplot | 11 | {viewing} | - libm4rie | 11 | {mathematics-dev} | - ncl | 11 | {meteorology} | + matlab-support | 11 | {mathematics,numericalcomputation} | form | 10 | {mathematics} | libzn-poly | 10 | {mathematics-dev} | lxi-tools | 10 | {engineering,dataacquisition} | + pcl | 10 | {robotics-dev} | + python-cdo | 10 | {meteorology} | ratpoints | 10 | {mathematics-dev} | geg | 9 | {viewing} | - pcl | 9 | {robotics-dev} | - python-cdo | 9 | {meteorology} | python-escript | 9 | {numericalcomputation,simulations,engineering} | ros-rosconsole | 9 | {robotics-dev} | vdt | 9 | {mathematics-dev} | @@ -66,12 +66,12 @@ Last-Update: Fri, 13 Jun 2025 01:42:04 +0000 persalys | 8 | {engineering,statistics,mathematics} | apophenia | 7 | {statistics} | metar | 7 | {meteorology} | + ncl | 7 | {meteorology-dev} | refmac-dictionary | 7 | {highenergy-physics-dev,chemistry} | atlas-ecmwf | 6 | {meteorology} | coda | 6 | {meteorology-dev} | fpzip | 6 | {meteorology} | libccp4 | 6 | {nanoscale-physics-dev} | - opencascade | 6 | {simulations} | persalys | 6 | {statistics,mathematics,engineering} | psurface | 6 | {numericalcomputation} | rheolef | 6 | {mathematics} | @@ -80,16 +80,17 @@ Last-Update: Fri, 13 Jun 2025 01:42:04 +0000 uctodata | 6 | {linguistics} | cld2 | 5 | {linguistics} | coda | 5 | {meteorology} | - debian-science | 5 | {economics,nanoscale-physics,machine-learning,physics,mathematics} | etsf-io | 5 | {physics,nanoscale-physics} | fftw | 5 | {meteorology-dev,mathematics-dev,physics-dev} | gsw | 5 | {meteorology} | iapws | 5 | {meteorology} | metview | 5 | {meteorology} | - ncl | 5 | {meteorology-dev} | + opencascade | 5 | {simulations} | + rubiks | 5 | {geometry,mathematics} | ucto | 5 | {linguistics} | auto-07p | 4 | {mathematics} | cmor | 4 | {meteorology} | + debian-science | 4 | {economics,nanoscale-physics,machine-learning,physics,mathematics} | debian-science | 4 | {physics,machine-learning,economics,nanoscale-physics} | drslib | 4 | {meteorology} | dxflib | 4 | {engineering-dev} | @@ -100,7 +101,6 @@ Last-Update: Fri, 13 Jun 2025 01:42:04 +0000 libxsmm | 4 | {mathematics-dev} | lrcalc | 4 | {mathematics} | muparser | 4 | {mathematics-dev} | - rubiks | 4 | {geometry,mathematics} | silo-llnl | 4 | {engineering} | urdfdom-headers | 4 | {robotics-dev} | atlas-ecmwf | 3 | {meteorology-dev} | ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,151 +1,151 @@ -Last-Update: Fri, 13 Jun 2025 01:42:04 +0000 +Last-Update: Fri, 13 Jun 2025 13:42:11 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- - mpmath | 10073 | - python-repoze.lru | 6980 | - netifaces | 5159 | + mpmath | 10038 | + python-repoze.lru | 7005 | + netifaces | 5167 | ghp-import | 4789 | python-lunr | 4784 | - python-babel | 4307 | - sortedcontainers | 3915 | - python-babel | 3751 | - aiosignal | 2937 | - hyperlink | 2180 | - python-notify2 | 2050 | - humanfriendly | 1955 | - referencing | 1632 | - python-mysqldb | 1512 | - python-pandocfilters | 1460 | - python-gssapi | 1413 | - python-invoke | 1407 | - python-hyperframe | 1357 | - websocket-client | 1347 | - python-hpack | 1148 | - python-rsa | 1144 | - pdfarranger | 1029 | - menulibre | 954 | - python-linux-procfs | 928 | - autopep8 | 909 | - python-geoip | 892 | - python-webob | 854 | - pytoolconfig | 818 | - firmware-microbit-micropython | 753 | - powerline | 753 | + python-babel | 4282 | + sortedcontainers | 3925 | + python-babel | 3740 | + aiosignal | 2924 | + hyperlink | 2167 | + python-notify2 | 2052 | + humanfriendly | 1960 | + referencing | 1599 | + python-mysqldb | 1506 | + python-pandocfilters | 1449 | + python-gssapi | 1410 | + python-invoke | 1395 | + python-hyperframe | 1367 | + websocket-client | 1339 | + python-hpack | 1153 | + python-rsa | 1137 | + pdfarranger | 1028 | + menulibre | 951 | + python-linux-procfs | 931 | + autopep8 | 897 | + python-geoip | 887 | + python-webob | 853 | + pytoolconfig | 808 | + powerline | 765 | + firmware-microbit-micropython | 739 | powerline | 717 | powerline | 712 | - kazam | 676 | - python-zopfli | 674 | - u-msgpack-python | 619 | - gaupol | 556 | - dockerpty | 527 | - python-et-xmlfile | 524 | - asn1crypto | 522 | - python-gevent | 504 | - python-ewmh | 436 | + kazam | 682 | + python-zopfli | 626 | + u-msgpack-python | 611 | + gaupol | 545 | + dockerpty | 525 | + python-et-xmlfile | 523 | + asn1crypto | 521 | + python-gevent | 503 | + python-ewmh | 441 | catfish | 435 | python-requests-oauthlib | 403 | - python-toml | 363 | - spf-engine | 340 | - python-ntlm-auth | 318 | - spf-engine | 293 | - django-stronghold | 254 | - python-ldap3 | 227 | - cairocffi | 219 | - python-mimeparse | 197 | - python-smmap | 176 | - python-hidapi | 171 | - autokey | 165 | - httpie | 157 | - python-anyjson | 154 | - smem | 147 | - kivy | 130 | - python-aiostream | 127 | + python-toml | 359 | + spf-engine | 339 | + python-ntlm-auth | 315 | + spf-engine | 292 | + django-stronghold | 258 | + python-ldap3 | 228 | + cairocffi | 220 | + python-mimeparse | 199 | + python-smmap | 180 | + python-hidapi | 170 | + autokey | 167 | + python-anyjson | 155 | + httpie | 153 | + smem | 149 | + kivy | 131 | + python-aiostream | 125 | + python-click-repl | 119 | smartypants | 117 | - python-click-repl | 116 | nodeenv | 111 | lollypop | 107 | - mypaint | 104 | - python-pyu2f | 104 | + mypaint | 105 | + python-pyu2f | 103 | + mugshot | 99 | timekpr-next | 99 | - mugshot | 98 | - pacparser | 95 | - python-consul | 94 | - pymacaroons | 88 | - pssh | 85 | - python-rfc6555 | 85 | - pymediainfo | 83 | + pacparser | 93 | + python-consul | 93 | + pymacaroons | 90 | + pymediainfo | 84 | + python-rfc6555 | 84 | + pssh | 83 | python-colour | 78 | - python-i3ipc | 73 | - weasyprint | 71 | - fabric | 70 | - numpy-stl | 68 | + weasyprint | 73 | + python-i3ipc | 71 | + fabric | 69 | + numpy-stl | 69 | python-pykka | 68 | - mitmproxy | 62 | - pywavelets | 59 | - ueberzug | 58 | - python-uritools | 56 | + mitmproxy | 67 | + pywavelets | 61 | + python-uritools | 58 | + ueberzug | 57 | + itstool | 55 | python-scp | 55 | - itstool | 54 | + pyenv | 52 | + python-looseversion | 52 | mysql-connector-python | 51 | - pyenv | 51 | - python-looseversion | 51 | hatchling | 46 | - blockdiag | 45 | + trac | 46 | sshtunnel | 45 | - trac | 45 | - membernator | 43 | - pymacs | 43 | - show-in-file-manager | 43 | + blockdiag | 44 | + show-in-file-manager | 44 | + membernator | 42 | + pymacs | 42 | + python-pysol-cards | 40 | certipy | 39 | khard | 39 | pamela | 39 | - persepolis | 39 | pyquery | 39 | - python-pysol-cards | 39 | jupyterhub | 38 | + persepolis | 38 | + pylibmc | 38 | powerline-gitstatus | 37 | - pylibmc | 37 | - pdfposter | 35 | - python-scrypt | 35 | - pssh | 31 | + python-scrypt | 36 | + pdfposter | 34 | python-args | 31 | + pssh | 30 | python-statsd | 30 | python-clint | 28 | seqdiag | 28 | video-downloader | 28 | - dkimpy-milter | 27 | sphinxcontrib-blockdiag | 27 | + dkimpy-milter | 26 | sphinxcontrib-seqdiag | 26 | + kivy | 25 | rst2pdf | 25 | + webpy | 25 | enzyme | 24 | python-zstd | 24 | - sphinx-inline-tabs | 24 | typogrify | 24 | - webpy | 24 | cppman | 23 | depthcharge-tools | 23 | flask-principal | 23 | - kivy | 23 | + sphinx-inline-tabs | 23 | backoff | 22 | python-fire | 22 | subliminal | 22 | fabric | 21 | - alot | 20 | nwdiag | 20 | python-rangehttpserver | 20 | python-translationstring | 20 | spf-engine | 20 | subliminal | 20 | - nwg-displays | 19 | + alot | 19 | python-demjson | 19 | social-auth-core | 19 | webtest | 19 | + nwg-displays | 18 | actdiag | 17 | django-environ | 17 | - mistune0 | 17 | python-hupper | 17 | python-simpy | 17 | + mistune0 | 16 | python-priority | 16 | python-sdnotify | 16 | python-slip10 | 16 | @@ -158,23 +158,23 @@ Last-Update: Fri, 13 Jun 2025 01:42:04 +0000 gtextfsm | 14 | policyd-rate-limit | 14 | pykwalify | 14 | - pyp | 14 | python-pem | 14 | python-pyrss2gen | 14 | ruff | 14 | ansi | 13 | gmplot | 13 | pdm | 13 | + pyp | 13 | python-dbussy | 13 | python-ethtool | 13 | python-pyalsa | 13 | unearth | 13 | - autotiling | 12 | pylint-common | 12 | python-pyscss | 12 | python-xtermcolor | 12 | slimit | 12 | - btchip-python | 11 | + txt2tags | 12 | + autotiling | 11 | django-auditlog | 11 | jschema-to-python | 11 | junos-eznc | 11 | @@ -183,41 +183,40 @@ Last-Update: Fri, 13 Jun 2025 01:42:04 +0000 python-crcelk | 11 | python-parse-type | 11 | python-sarif-python-om | 11 | - txt2tags | 11 | + todoman | 11 | + btchip-python | 10 | debiancontributors | 10 | drf-yasg-nonfree | 10 | flask-security | 10 | python-digitalocean | 10 | python-drf-spectacular-sidecar-nonfree | 10 | - speaklater | 10 | - todoman | 10 | beancount | 9 | django-sass | 9 | - flask-paranoid | 9 | flask-session | 9 | - pydrive2 | 9 | pytest-runner | 9 | python-overpy | 9 | + speaklater | 9 | + sphinx-intl | 9 | traittypes | 9 | tuna | 9 | clustershell | 8 | + flask-paranoid | 8 | httpcode | 8 | + mercurial-evolve | 8 | micropython-mpremote | 8 | notebook-shim | 8 | pybik | 8 | + pydrive2 | 8 | python-envs | 8 | python-numpysane | 8 | - python-openstep-plist | 8 | + python-pyaml-env | 8 | python-pyld | 8 | python-versioneer | 8 | - sphinx-intl | 8 | trac-wysiwyg | 8 | beancount | 7 | clustershell | 7 | easyprocess | 7 | - mercurial-evolve | 7 | - pytest-django | 7 | - python-pyaml-env | 7 | + python-openstep-plist | 7 | python-xdo | 7 | securestring | 7 | django-model-utils | 6 | @@ -227,6 +226,7 @@ Last-Update: Fri, 13 Jun 2025 01:42:04 +0000 htmlmin | 6 | librouteros | 6 | pytaglib | 6 | + pytest-django | 6 | python3-onelogin-saml2 | 6 | python-ansicolors | 6 | python-biplist | 6 | @@ -291,7 +291,6 @@ Last-Update: Fri, 13 Jun 2025 01:42:04 +0000 python-markuppy | 3 | python-netfilterqueue | 3 | python-networkmanager | 3 | - python-pgmagick | 3 | requests-aws | 3 | s3ql | 3 | slimit | 3 | @@ -344,6 +343,7 @@ Last-Update: Fri, 13 Jun 2025 01:42:04 +0000 python-libguess | 2 | python-openshift | 2 | python-opentracing | 2 | + python-pgmagick | 2 | python-py-zipkin | 2 | python-qtpynodeeditor | 2 | python-securesystemslib | 2 | @@ -352,7 +352,6 @@ Last-Update: Fri, 13 Jun 2025 01:42:04 +0000 sphinx-paramlinks | 2 | trac-xmlrpc | 2 | vcversioner | 2 | - vncdotool | 2 | wikitrans | 2 | yotta | 2 | zzzeeksphinx | 2 | @@ -366,11 +365,11 @@ Last-Update: Fri, 13 Jun 2025 01:42:04 +0000 jpy | 1 | jupyter-sphinx | 1 | korean-lunar-calendar | 1 | + milksnake | 1 | mkdocs-macros-plugin | 1 | moviepy | 1 | myst-nb | 1 | onetimepass | 1 | - pycrc | 1 | pykwalify | 1 | pylint-celery | 1 | pynag | 1 | @@ -404,6 +403,7 @@ Last-Update: Fri, 13 Jun 2025 01:42:04 +0000 sphinxtesters | 1 | trac-customfieldadmin | 1 | trac-httpauth | 1 | + vncdotool | 1 | vrfydmn | 1 | wchartype | 1 | wikitrans | 1 | @@ -434,7 +434,6 @@ Last-Update: Fri, 13 Jun 2025 01:42:04 +0000 django-otp-yubikey | 0 | django-titofisto | 0 | django-widget-tweaks | 0 | - drafthorse | 0 | drf-yasg-nonfree | 0 | enlighten | 0 | escapism | 0 | @@ -458,7 +457,6 @@ Last-Update: Fri, 13 Jun 2025 01:42:04 +0000 jpylyzer | 0 | kivy | 0 | libthumbor | 0 | - milksnake | 0 | mpmath | 0 | mssql-django | 0 | mwoauth | 0 | @@ -476,6 +474,7 @@ Last-Update: Fri, 13 Jun 2025 01:42:04 +0000 psrecord | 0 | purl | 0 | pwntools | 0 | + pycrc | 0 | pydataverse | 0 | pydenticon | 0 | pydle | 0 | @@ -574,6 +573,7 @@ Last-Update: Fri, 13 Jun 2025 01:42:04 +0000 zktop | 0 | aioaseko | -1 | django-cachalot | -1 | + drafthorse | -1 | fivem-api | -1 | ikos | -1 | nam-files | -1 | View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/00d61ad49cf4b443ecb1b8ff909b7c79278428ba -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/00d61ad49cf4b443ecb1b8ff909b7c79278428ba You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Sat Jun 14 02:43:16 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Sat, 14 Jun 2025 01:43:16 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <684cd3b44af4d_3dbe388a9828840b6@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: 607030b3 by Andreas Tille at 2025-06-14T01:43:12+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Fri, 13 Jun 2025 13:42:04 +0000 +Last-Update: Sat, 14 Jun 2025 01:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- ===================================== debian-science-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Fri, 13 Jun 2025 13:42:08 +0000 +Last-Update: Sat, 14 Jun 2025 01:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Fri, 13 Jun 2025 13:42:11 +0000 +Last-Update: Sat, 14 Jun 2025 01:42:04 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/607030b34fc97d5e3b6edbbc55419b14827555c0 -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/607030b34fc97d5e3b6edbbc55419b14827555c0 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Sat Jun 14 14:43:57 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Sat, 14 Jun 2025 13:43:57 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <684d7c9d57078_3dbb9d9c102932618@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: 6503544d by Andreas Tille at 2025-06-14T13:43:50+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,18 +1,18 @@ -Last-Update: Sat, 14 Jun 2025 01:42:04 +0000 +Last-Update: Sat, 14 Jun 2025 13:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- - dicomscope | 28 | {imaging} | + dicomscope | 29 | {imaging} | orthanc-gdcm | 16 | {imaging} | oscar | 15 | {data,practice,tools} | mrtrix3 | 14 | {imaging} | king | 11 | {typesetting,imaging} | - pixelmed | 11 | {imaging} | adun.app | 10 | {bio} | gnumed-server | 10 | {covid-19,practice} | orthanc-mysql | 10 | {imaging} | sight | 10 | {imaging} | orthanc-postgresql | 9 | {imaging} | + pixelmed | 9 | {imaging} | bart-view | 8 | {imaging} | heudiconv | 6 | {imaging} | icb-utils | 6 | {bio-dev} | @@ -20,46 +20,40 @@ Last-Update: Sat, 14 Jun 2025 01:42:04 +0000 mia | 5 | {imaging} | biojava-live | 4 | {bio-dev} | libminc | 4 | {imaging-dev} | - pbcopper | 4 | {bio-dev} | beast-mcmc | 3 | {bio,bio-phylogeny} | bio-tradis | 3 | {bio,bio-dev} | getdata | 3 | {bio} | insighttoolkit5 | 3 | {imaging-dev} | + pbcopper | 3 | {bio-dev} | pbseqlib | 3 | {bio-dev} | piler | 3 | {bio} | sight | 3 | {imaging} | - ants | 2 | {imaging} | biojava6-live | 2 | {bio-dev} | cmtk | 2 | {imaging} | elastix | 2 | {imaging} | fastml | 2 | {bio} | ipig | 2 | {bio} | - libpal-java | 2 | {bio-dev} | plasmidid | 2 | {covid-19,bio} | python-seqcluster | 2 | {covid-19,bio-dev} | staden | 2 | {bio} | - tracetuner | 2 | {bio} | + ants | 1 | {imaging} | blimps | 1 | {bio} | brig | 1 | {bio} | ctn | 1 | {imaging-dev} | cufflinks | 1 | {cloud,bio} | dextractor | 1 | {bio,covid-19} | - eegdev | 1 | {imaging-dev} | emboss-explorer | 1 | {bio} | hinge | 1 | {bio} | htscodecs | 1 | {bio-dev,covid-19} | jmodeltest | 1 | {bio,bio-phylogeny} | lamarc | 1 | {bio} | libbio-mage-utils-perl | 1 | {bio-dev} | - libbiosoup-dev | 1 | {bio-dev} | libchado-perl | 1 | {bio-dev} | libdivsufsort | 1 | {bio-dev} | libgenome | 1 | {bio-dev} | + libpal-java | 1 | {bio-dev} | librg-utils-perl | 1 | {bio} | - libxdf | 1 | {imaging-dev} | mhap | 1 | {bio,bio-ngs} | - mssstest | 1 | {tools} | - opencfu | 1 | {laboratory} | papyrus | 1 | {imaging-dev} | phyutility | 1 | {cloud,bio} | proalign | 1 | {bio-phylogeny,bio} | @@ -71,9 +65,10 @@ Last-Update: Sat, 14 Jun 2025 01:42:04 +0000 surankco | 1 | {bio} | surpyvor | 1 | {bio} | thesias | 1 | {bio,covid-19} | + tracetuner | 1 | {bio} | treeview | 1 | {bio-phylogeny,bio} | + varscan | 1 | {covid-19,bio} | vienna-rna | 1 | {bio,covid-19} | - xdffileio | 1 | {imaging-dev} | acedb | 0 | {cloud,bio} | bambamc | 0 | {bio-dev} | biojava4-live | 0 | {bio-dev} | @@ -81,6 +76,7 @@ Last-Update: Sat, 14 Jun 2025 01:42:04 +0000 camp | 0 | {imaging-dev} | capsule-maven-nextflow | 0 | {bio-dev} | ctffind | 0 | {bio} | + eegdev | 0 | {imaging-dev} | embassy-domainatrix | 0 | {cloud,bio} | embassy-domalign | 0 | {bio,cloud} | embassy-domsearch | 0 | {cloud,bio} | @@ -89,6 +85,7 @@ Last-Update: Sat, 14 Jun 2025 01:42:04 +0000 gatk-fermilite | 0 | {bio-dev} | kmerresistance | 0 | {bio} | libbioparser-dev | 0 | {bio-dev} | + libbiosoup-dev | 0 | {bio-dev} | libbpp-core | 0 | {bio-dev} | libbpp-phyl | 0 | {bio-dev} | libbpp-phyl-omics | 0 | {bio-dev} | @@ -113,6 +110,7 @@ Last-Update: Sat, 14 Jun 2025 01:42:04 +0000 libvbz-hdf-plugin | 0 | {bio-dev} | libvistaio | 0 | {imaging-dev} | libwfa2 | 0 | {bio-dev} | + libxdf | 0 | {imaging-dev} | malt | 0 | {bio} | mauve-aligner | 0 | {bio} | maxflow | 0 | {imaging-dev} | @@ -122,7 +120,9 @@ Last-Update: Sat, 14 Jun 2025 01:42:04 +0000 metastudent-data-2 | 0 | {bio} | mia | 0 | {imaging-dev} | milib | 0 | {covid-19,bio-dev} | + mssstest | 0 | {tools} | ncbi-vdb | 0 | {bio-dev} | + opencfu | 0 | {laboratory} | orthanc-imagej | 0 | {imaging} | pbseqlib | 0 | {bio-dev} | pigx-rnaseq | 0 | {covid-19,bio} | @@ -153,7 +153,7 @@ Last-Update: Sat, 14 Jun 2025 01:42:04 +0000 suitename | 0 | {bio} | tophat-recondition | 0 | {bio,covid-19} | trace2dbest | 0 | {bio} | - varscan | 0 | {covid-19,bio} | + xdffileio | 0 | {imaging-dev} | xxsds-dynamic | 0 | {bio-dev} | tipp | -1 | {covid-19,bio} | (180 rows) ===================================== debian-science-tests.txt ===================================== @@ -1,221 +1,218 @@ -Last-Update: Sat, 14 Jun 2025 01:42:04 +0000 +Last-Update: Sat, 14 Jun 2025 13:42:08 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- - gts | 4840 | {viewing} | - nltk | 4838 | {linguistics} | - opencascade | 616 | {simulations} | - spacenavd | 219 | {tools} | - open-coarrays | 193 | {meteorology-dev} | - armadillo | 179 | {mathematics-dev} | - arpack | 93 | {mathematics-dev} | - scalapack | 54 | {nanoscale-physics-dev} | + nltk | 4846 | {linguistics} | + gts | 4812 | {viewing} | + opencascade | 621 | {simulations} | + spacenavd | 220 | {tools} | + open-coarrays | 191 | {meteorology-dev} | + armadillo | 180 | {mathematics-dev} | + arpack | 90 | {mathematics-dev} | + scalapack | 53 | {nanoscale-physics-dev} | visidata | 43 | {datamanagement} | - ntl | 42 | {mathematics-dev} | + ntl | 41 | {mathematics-dev} | mbpoll | 37 | {simulations} | imview | 36 | {viewing} | - ppl | 36 | {numericalcomputation} | + ppl | 35 | {numericalcomputation} | libmatio | 31 | {mathematics-dev} | + arduino-mk | 30 | {robotics} | flintqs | 30 | {mathematics} | - arduino-mk | 29 | {robotics} | - cliquer | 28 | {mathematics} | - flann | 26 | {mathematics-dev,engineering-dev} | - libm4ri | 26 | {mathematics-dev} | - grads | 24 | {meteorology} | - xygrib | 23 | {meteorology} | - bossa | 22 | {devices} | + cliquer | 27 | {mathematics} | + libm4ri | 25 | {mathematics-dev} | + flann | 24 | {mathematics-dev,engineering-dev} | + grads | 22 | {meteorology} | + xygrib | 22 | {meteorology} | setzer | 21 | {typesetting} | sat4j | 20 | {logic} | - fftw | 17 | {mathematics-dev,physics-dev,meteorology-dev} | - lrcalc | 17 | {mathematics-dev} | + bossa | 19 | {devices} | picosat | 17 | {logic} | - cliquer | 16 | {mathematics-dev} | - sketch | 16 | {typesetting} | + sketch | 17 | {typesetting} | + fftw | 16 | {mathematics-dev,physics-dev,meteorology-dev} | + gts | 16 | {viewing-dev} | + guiqwt | 16 | {numericalcomputation,viewing} | + lrcalc | 16 | {mathematics-dev} | + ncl | 16 | {meteorology} | + cliquer | 15 | {mathematics-dev} | eccodes | 15 | {meteorology,meteorology-dev} | - gts | 15 | {viewing-dev} | - guiqwt | 15 | {numericalcomputation,viewing} | - libitpp | 15 | {mathematics-dev,engineering-dev} | pyzo | 15 | {numericalcomputation} | - gf2x | 14 | {mathematics-dev} | - iml | 14 | {mathematics-dev} | - libhomfly | 14 | {mathematics-dev} | - ncl | 14 | {meteorology} | - dune-uggrid | 13 | {mathematics-dev} | + gf2x | 13 | {mathematics-dev} | + iml | 13 | {mathematics-dev} | + libhomfly | 13 | {mathematics-dev} | + dune-uggrid | 12 | {mathematics-dev} | feff85exafs | 12 | {chemistry} | - libm4rie | 12 | {mathematics-dev} | + form | 12 | {mathematics} | + libitpp | 12 | {mathematics-dev,engineering-dev} | teem | 12 | {imageanalysis} | coinor-symphony | 11 | {logic,mathematics,numericalcomputation} | - eccodes | 11 | {meteorology-dev} | - feedgnuplot | 11 | {viewing} | - matlab-support | 11 | {mathematics,numericalcomputation} | - form | 10 | {mathematics} | - libzn-poly | 10 | {mathematics-dev} | + libm4rie | 11 | {mathematics-dev} | + feedgnuplot | 10 | {viewing} | lxi-tools | 10 | {engineering,dataacquisition} | + matlab-support | 10 | {mathematics,numericalcomputation} | pcl | 10 | {robotics-dev} | python-cdo | 10 | {meteorology} | - ratpoints | 10 | {mathematics-dev} | + eccodes | 9 | {meteorology-dev} | geg | 9 | {viewing} | + libzn-poly | 9 | {mathematics-dev} | python-escript | 9 | {numericalcomputation,simulations,engineering} | + ratpoints | 9 | {mathematics-dev} | ros-rosconsole | 9 | {robotics-dev} | vdt | 9 | {mathematics-dev} | - alberta | 8 | {engineering-dev} | dxsamples | 8 | {nanoscale-physics} | - magics++ | 8 | {meteorology-dev} | - odc | 8 | {meteorology} | - odc | 8 | {meteorology-dev} | + metar | 8 | {meteorology} | + ncl | 8 | {meteorology-dev} | persalys | 8 | {engineering,statistics,mathematics} | apophenia | 7 | {statistics} | - metar | 7 | {meteorology} | - ncl | 7 | {meteorology-dev} | - refmac-dictionary | 7 | {highenergy-physics-dev,chemistry} | - atlas-ecmwf | 6 | {meteorology} | - coda | 6 | {meteorology-dev} | + magics++ | 7 | {meteorology-dev} | + odc | 7 | {meteorology-dev} | + odc | 7 | {meteorology} | + uctodata | 7 | {linguistics} | + alberta | 6 | {engineering-dev} | fpzip | 6 | {meteorology} | libccp4 | 6 | {nanoscale-physics-dev} | + metview | 6 | {meteorology} | persalys | 6 | {statistics,mathematics,engineering} | psurface | 6 | {numericalcomputation} | + refmac-dictionary | 6 | {highenergy-physics-dev,chemistry} | rheolef | 6 | {mathematics} | ros-vcstool | 6 | {robotics-dev} | toulbar2 | 6 | {logic,numericalcomputation,mathematics,physics} | - uctodata | 6 | {linguistics} | + ucto | 6 | {linguistics} | + atlas-ecmwf | 5 | {meteorology} | + auto-07p | 5 | {mathematics} | cld2 | 5 | {linguistics} | coda | 5 | {meteorology} | + coda | 5 | {meteorology-dev} | etsf-io | 5 | {physics,nanoscale-physics} | - fftw | 5 | {meteorology-dev,mathematics-dev,physics-dev} | gsw | 5 | {meteorology} | iapws | 5 | {meteorology} | - metview | 5 | {meteorology} | opencascade | 5 | {simulations} | rubiks | 5 | {geometry,mathematics} | - ucto | 5 | {linguistics} | - auto-07p | 4 | {mathematics} | cmor | 4 | {meteorology} | - debian-science | 4 | {economics,nanoscale-physics,machine-learning,physics,mathematics} | debian-science | 4 | {physics,machine-learning,economics,nanoscale-physics} | + debian-science | 4 | {economics,nanoscale-physics,machine-learning,physics,mathematics} | drslib | 4 | {meteorology} | - dxflib | 4 | {engineering-dev} | - emoslib | 4 | {meteorology-dev} | - hdf-eos5 | 4 | {meteorology-dev} | + fftw | 4 | {meteorology-dev,mathematics-dev,physics-dev} | irstlm | 4 | {linguistics} | - libgctp | 4 | {meteorology-dev} | libxsmm | 4 | {mathematics-dev} | lrcalc | 4 | {mathematics} | - muparser | 4 | {mathematics-dev} | silo-llnl | 4 | {engineering} | urdfdom-headers | 4 | {robotics-dev} | - atlas-ecmwf | 3 | {meteorology-dev} | + veccore | 4 | {mathematics-dev} | cylc-flow | 3 | {meteorology} | dune-functions | 3 | {mathematics-dev} | dune-localfunctions | 3 | {mathematics-dev} | dune-typetree | 3 | {mathematics-dev} | + dxflib | 3 | {engineering-dev} | ecbuild | 3 | {meteorology-dev} | + emoslib | 3 | {meteorology-dev} | emoslib | 3 | {meteorology} | getdp | 3 | {engineering,mathematics,simulations} | harp | 3 | {meteorology} | - hdf-eos4 | 3 | {meteorology-dev} | + hdf-eos5 | 3 | {meteorology-dev} | ipe-tools | 3 | {typesetting} | libcgns | 3 | {engineering} | - libcgns | 3 | {engineering-dev} | + libgctp | 3 | {meteorology-dev} | + libgtkdatabox | 3 | {engineering-dev,viewing-dev} | libmatheval | 3 | {mathematics} | metkit | 3 | {meteorology} | mpi4py-fft | 3 | {mathematics-dev} | - python-aws-xray-sdk | 3 | {dataacquisition-dev} | sac2mseed | 3 | {geography} | sardana | 3 | {dataacquisition} | sdpb | 3 | {numericalcomputation,highenergy-physics} | - silo-llnl | 3 | {engineering-dev} | silo-llnl | 3 | {engineering} | toontag | 3 | {numericalcomputation} | - veccore | 3 | {mathematics-dev} | apache-opennlp | 2 | {linguistics} | apertium-eval-translator | 2 | {linguistics} | apophenia | 2 | {statistics} | - coda | 2 | {meteorology-dev} | - code-saturne | 2 | {engineering-dev,mathematics-dev} | + atlas-ecmwf | 2 | {meteorology-dev} | code-saturne | 2 | {mathematics-dev,engineering-dev} | - debian-science | 2 | {economics} | - debian-science | 2 | {neuroscience-cognitive} | debian-science | 2 | {nanoscale-physics,statistics,economics,physics} | + debian-science | 2 | {economics} | dimbl | 2 | {linguistics} | fastjet | 2 | {highenergy-physics-dev} | - fpzip | 2 | {meteorology-dev} | - gadap | 2 | {meteorology-dev} | + frog | 2 | {linguistics} | hpcc | 2 | {numericalcomputation,distributedcomputing} | ipe-tools | 2 | {typesetting} | + libcgns | 2 | {engineering-dev} | libcvd | 2 | {imageanalysis} | - libgtkdatabox | 2 | {engineering-dev,viewing-dev} | liblbfgs | 2 | {mathematics-dev} | libmatheval | 2 | {mathematics-dev} | libvigraimpex | 2 | {imageanalysis-dev,machine-learning} | mseed2sac | 2 | {dataacquisition-dev} | + muparser | 2 | {mathematics-dev} | ncrystal | 2 | {nanoscale-physics-dev,highenergy-physics-dev} | newmat | 2 | {mathematics-dev} | - nrn-iv | 2 | {biology} | openstereogram | 2 | {tools} | polylib | 2 | {mathematics} | + python-aws-xray-sdk | 2 | {dataacquisition-dev} | qwtplot3d | 2 | {viewing-dev} | sagemath-database-conway-polynomials | 2 | {mathematics} | scram | 2 | {engineering} | - spaghetti | 2 | {geography} | + silo-llnl | 2 | {engineering-dev} | syrthes | 2 | {engineering} | toon | 2 | {numericalcomputation} | - trilinos | 2 | {physics-dev,mathematics-dev,engineering-dev} | x13as | 2 | {economics} | - apertium-streamparser | 1 | {linguistics} | - asl | 1 | {physics-dev} | ckon | 1 | {highenergy-physics-dev} | clipper | 1 | {nanoscale-physics-dev} | - cmor | 1 | {meteorology-dev} | + coda | 1 | {meteorology-dev} | + code-saturne | 1 | {engineering-dev,mathematics-dev} | coinmp | 1 | {logic,mathematics-dev,numericalcomputation} | coinor-bonmin | 1 | {mathematics} | - debian-science | 1 | {psychophysics} | + debian-science | 1 | {electrophysiology} | debian-science | 1 | {tools} | debian-science | 1 | {neuroscience-cognitive,machine-learning} | + debian-science | 1 | {neuroscience-cognitive} | debian-science | 1 | {nanoscale-physics-dev} | - debian-science | 1 | {electrophysiology} | - frog | 1 | {linguistics} | + fpzip | 1 | {meteorology-dev} | frogdata | 1 | {linguistics} | + gadap | 1 | {meteorology-dev} | gemmlowp | 1 | {mathematics-dev} | + hdf-eos4 | 1 | {meteorology-dev} | jeuclid | 1 | {viewing,typesetting} | libcvd | 1 | {imageanalysis-dev} | liblxi | 1 | {engineering-dev,dataacquisition-dev} | liborigin2 | 1 | {viewing-dev} | looptools | 1 | {highenergy-physics-dev} | - magma | 1 | {mathematics-dev,numericalcomputation} | mbt | 1 | {linguistics} | mbtserver | 1 | {linguistics} | metkit | 1 | {meteorology-dev} | mmdb | 1 | {nanoscale-physics-dev,highenergy-physics-dev} | mrmpi | 1 | {tools} | - nrn-mod2c | 1 | {biology} | - openctm | 1 | {physics-dev} | + nrn-iv | 1 | {biology} | psurface | 1 | {numericalcomputation} | qd | 1 | {mathematics-dev} | ros-ros-environment | 1 | {robotics-dev} | schroedinger-coordgenlibs | 1 | {nanoscale-physics-dev,chemistry} | siscone | 1 | {highenergy-physics-dev} | - spfft | 1 | {mathematics-dev,nanoscale-physics-dev,physics-dev,meteorology-dev} | + spaghetti | 1 | {geography} | ssm | 1 | {nanoscale-physics-dev} | tfdocgen | 1 | {linguistics} | timbl | 1 | {linguistics} | timblserver | 1 | {linguistics} | + trilinos | 1 | {physics-dev,mathematics-dev,engineering-dev} | vlfeat | 1 | {imageanalysis-dev} | amgcl | 0 | {mathematics-dev} | apertium-afr-nld | 0 | {linguistics} | apertium-bel-rus | 0 | {linguistics} | apertium-hin | 0 | {linguistics} | apertium-pol-szl | 0 | {linguistics} | + apertium-streamparser | 0 | {linguistics} | apertium-swe-dan | 0 | {linguistics} | apertium-urd | 0 | {linguistics} | apertium-urd-hin | 0 | {linguistics} | apriltag | 0 | {robotics-dev} | + asl | 0 | {physics-dev} | calculix-ccx-test | 0 | {simulations,numericalcomputation,engineering} | clhep | 0 | {highenergy-physics-dev} | + cmor | 0 | {meteorology-dev} | coda | 0 | {meteorology-dev} | code-saturne | 0 | {engineering} | collada-dom | 0 | {viewing-dev} | cqrlib | 0 | {mathematics-dev} | cvector | 0 | {mathematics-dev} | + debian-science | 0 | {electrophysiology} | + debian-science | 0 | {psychophysics} | debian-science | 0 | {physics} | dune-grid-glue | 0 | {mathematics-dev} | etsf-io | 0 | {nanoscale-physics-dev} | @@ -227,14 +224,17 @@ Last-Update: Sat, 14 Jun 2025 01:42:04 +0000 libfolia | 0 | {linguistics} | libquantum | 0 | {numericalcomputation} | libsdsl | 0 | {dataacquisition-dev} | - looptools | 0 | {highenergy-physics} | looptools | 0 | {highenergy-physics-dev} | + looptools | 0 | {highenergy-physics} | + magma | 0 | {mathematics-dev,numericalcomputation} | mbt | 0 | {linguistics} | mctc-lib | 0 | {nanoscale-physics-dev,highenergy-physics-dev} | meshsdfilter | 0 | {mathematics-dev} | - metis-edf | 0 | {engineering-dev} | metis-edf | 0 | {engineering,numericalcomputation} | + metis-edf | 0 | {engineering-dev} | neartree | 0 | {mathematics-dev,numericalcomputation} | + nrn-mod2c | 0 | {biology} | + openctm | 0 | {physics-dev} | opengv | 0 | {geometry} | openigtlink | 0 | {robotics-dev} | openmesh | 0 | {mathematics-dev} | @@ -256,6 +256,7 @@ Last-Update: Sat, 14 Jun 2025 01:42:04 +0000 siscone | 0 | {highenergy-physics-dev} | slicot | 0 | {robotics-dev,engineering-dev} | sparskit | 0 | {mathematics-dev} | + spfft | 0 | {mathematics-dev,nanoscale-physics-dev,physics-dev,meteorology-dev} | ssm | 0 | {nanoscale-physics} | tachyon | 0 | {mathematics} | tamuanova | 0 | {statistics} | @@ -269,5 +270,5 @@ Last-Update: Sat, 14 Jun 2025 01:42:04 +0000 virtuoso-opensource | 0 | {datamanagement} | visp-images | 0 | {robotics-dev} | libelas | -1 | {robotics-dev} | -(297 rows) +(298 rows) ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,199 +1,199 @@ -Last-Update: Sat, 14 Jun 2025 01:42:04 +0000 +Last-Update: Sat, 14 Jun 2025 13:42:12 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- - mpmath | 10038 | - python-repoze.lru | 7005 | - netifaces | 5167 | - ghp-import | 4789 | - python-lunr | 4784 | - python-babel | 4282 | - sortedcontainers | 3925 | - python-babel | 3740 | + mpmath | 10034 | + python-repoze.lru | 7017 | + netifaces | 5172 | + ghp-import | 4796 | + python-lunr | 4791 | + python-babel | 4175 | + sortedcontainers | 3812 | + python-babel | 3673 | aiosignal | 2924 | - hyperlink | 2167 | - python-notify2 | 2052 | - humanfriendly | 1960 | - referencing | 1599 | - python-mysqldb | 1506 | - python-pandocfilters | 1449 | - python-gssapi | 1410 | - python-invoke | 1395 | - python-hyperframe | 1367 | - websocket-client | 1339 | - python-hpack | 1153 | - python-rsa | 1137 | - pdfarranger | 1028 | - menulibre | 951 | - python-linux-procfs | 931 | - autopep8 | 897 | - python-geoip | 887 | - python-webob | 853 | - pytoolconfig | 808 | - powerline | 765 | - firmware-microbit-micropython | 739 | - powerline | 717 | - powerline | 712 | - kazam | 682 | - python-zopfli | 626 | - u-msgpack-python | 611 | - gaupol | 545 | - dockerpty | 525 | + hyperlink | 2170 | + python-notify2 | 2053 | + humanfriendly | 1963 | + referencing | 1583 | + python-mysqldb | 1507 | + python-gssapi | 1415 | + python-invoke | 1400 | + python-hyperframe | 1374 | + python-pandocfilters | 1334 | + websocket-client | 1331 | + python-hpack | 1159 | + python-rsa | 1130 | + pdfarranger | 1018 | + menulibre | 948 | + python-linux-procfs | 925 | + python-geoip | 883 | + python-webob | 850 | + autopep8 | 785 | + powerline | 764 | + firmware-microbit-micropython | 735 | + powerline | 721 | + powerline | 716 | + pytoolconfig | 696 | + kazam | 683 | + u-msgpack-python | 610 | + python-zopfli | 608 | + gaupol | 537 | + dockerpty | 526 | + asn1crypto | 525 | python-et-xmlfile | 523 | - asn1crypto | 521 | - python-gevent | 503 | - python-ewmh | 441 | - catfish | 435 | - python-requests-oauthlib | 403 | - python-toml | 359 | - spf-engine | 339 | - python-ntlm-auth | 315 | - spf-engine | 292 | + python-gevent | 497 | + python-ewmh | 439 | + catfish | 431 | + python-requests-oauthlib | 401 | + python-toml | 355 | + spf-engine | 341 | + python-ntlm-auth | 321 | + spf-engine | 294 | django-stronghold | 258 | - python-ldap3 | 228 | - cairocffi | 220 | - python-mimeparse | 199 | - python-smmap | 180 | - python-hidapi | 170 | - autokey | 167 | - python-anyjson | 155 | - httpie | 153 | - smem | 149 | - kivy | 131 | - python-aiostream | 125 | - python-click-repl | 119 | - smartypants | 117 | - nodeenv | 111 | - lollypop | 107 | - mypaint | 105 | - python-pyu2f | 103 | - mugshot | 99 | - timekpr-next | 99 | - pacparser | 93 | - python-consul | 93 | - pymacaroons | 90 | - pymediainfo | 84 | - python-rfc6555 | 84 | - pssh | 83 | - python-colour | 78 | + python-ldap3 | 231 | + cairocffi | 216 | + python-mimeparse | 200 | + python-smmap | 176 | + autokey | 169 | + python-hidapi | 167 | + httpie | 155 | + python-anyjson | 153 | + smem | 147 | + kivy | 130 | + python-aiostream | 124 | + python-click-repl | 120 | + smartypants | 118 | + nodeenv | 110 | + lollypop | 106 | + mypaint | 104 | + timekpr-next | 102 | + mugshot | 98 | + python-pyu2f | 98 | + pacparser | 94 | + python-consul | 91 | + pymacaroons | 89 | + python-rfc6555 | 85 | + pymediainfo | 82 | + pssh | 81 | + python-colour | 76 | weasyprint | 73 | python-i3ipc | 71 | - fabric | 69 | - numpy-stl | 69 | - python-pykka | 68 | - mitmproxy | 67 | - pywavelets | 61 | - python-uritools | 58 | - ueberzug | 57 | + fabric | 70 | + python-pykka | 69 | + mitmproxy | 68 | + numpy-stl | 67 | + pywavelets | 62 | + python-uritools | 56 | + ueberzug | 56 | itstool | 55 | python-scp | 55 | pyenv | 52 | - python-looseversion | 52 | - mysql-connector-python | 51 | + python-looseversion | 51 | + mysql-connector-python | 50 | hatchling | 46 | - trac | 46 | - sshtunnel | 45 | - blockdiag | 44 | - show-in-file-manager | 44 | - membernator | 42 | - pymacs | 42 | - python-pysol-cards | 40 | - certipy | 39 | - khard | 39 | - pamela | 39 | - pyquery | 39 | - jupyterhub | 38 | - persepolis | 38 | + sshtunnel | 44 | + trac | 44 | + blockdiag | 43 | + pymacs | 43 | + show-in-file-manager | 43 | + khard | 42 | + python-pysol-cards | 41 | + membernator | 40 | + pyquery | 40 | + powerline-gitstatus | 38 | pylibmc | 38 | - powerline-gitstatus | 37 | + certipy | 37 | + jupyterhub | 37 | + pamela | 37 | + persepolis | 37 | python-scrypt | 36 | - pdfposter | 34 | - python-args | 31 | - pssh | 30 | - python-statsd | 30 | - python-clint | 28 | + pdfposter | 35 | + pssh | 29 | + python-args | 29 | + python-statsd | 29 | + kivy | 28 | seqdiag | 28 | - video-downloader | 28 | sphinxcontrib-blockdiag | 27 | + video-downloader | 27 | dkimpy-milter | 26 | + python-clint | 26 | sphinxcontrib-seqdiag | 26 | - kivy | 25 | rst2pdf | 25 | - webpy | 25 | - enzyme | 24 | - python-zstd | 24 | - typogrify | 24 | + typogrify | 25 | + depthcharge-tools | 24 | cppman | 23 | - depthcharge-tools | 23 | flask-principal | 23 | - sphinx-inline-tabs | 23 | - backoff | 22 | + webpy | 23 | + enzyme | 22 | + fabric | 22 | python-fire | 22 | - subliminal | 22 | - fabric | 21 | - nwdiag | 20 | - python-rangehttpserver | 20 | + python-zstd | 22 | + sphinx-inline-tabs | 22 | + backoff | 21 | + python-rangehttpserver | 21 | + subliminal | 21 | python-translationstring | 20 | spf-engine | 20 | - subliminal | 20 | alot | 19 | - python-demjson | 19 | + nwdiag | 19 | + nwg-displays | 19 | social-auth-core | 19 | - webtest | 19 | - nwg-displays | 18 | - actdiag | 17 | - django-environ | 17 | + subliminal | 19 | + django-environ | 18 | + python-demjson | 18 | + webtest | 18 | + mistune0 | 17 | python-hupper | 17 | - python-simpy | 17 | - mistune0 | 16 | - python-priority | 16 | python-sdnotify | 16 | python-slip10 | 16 | - sphinxcontrib-actdiag | 16 | sphinxcontrib-log-cabinet | 16 | - python-inotify | 15 | + actdiag | 15 | python-kyotocabinet | 15 | - python-pysubs2 | 15 | + python-priority | 15 | + python-simpy | 15 | + sphinxcontrib-actdiag | 15 | sphinxcontrib-nwdiag | 15 | - gtextfsm | 14 | policyd-rate-limit | 14 | pykwalify | 14 | + python-inotify | 14 | python-pem | 14 | - python-pyrss2gen | 14 | - ruff | 14 | - ansi | 13 | + python-pyalsa | 14 | gmplot | 13 | + gtextfsm | 13 | pdm | 13 | - pyp | 13 | + pylint-common | 13 | python-dbussy | 13 | - python-ethtool | 13 | - python-pyalsa | 13 | + python-pysubs2 | 13 | + ruff | 13 | unearth | 13 | - pylint-common | 12 | + ansi | 12 | + flask-security | 12 | + jschema-to-python | 12 | + junos-eznc | 12 | + pyp | 12 | + python-pyrss2gen | 12 | python-pyscss | 12 | + python-sarif-python-om | 12 | python-xtermcolor | 12 | slimit | 12 | - txt2tags | 12 | - autotiling | 11 | + btchip-python | 11 | django-auditlog | 11 | - jschema-to-python | 11 | - junos-eznc | 11 | - pwntools | 11 | - python-aiohttp-security | 11 | - python-crcelk | 11 | - python-parse-type | 11 | - python-sarif-python-om | 11 | + python-ethtool | 11 | todoman | 11 | - btchip-python | 10 | + txt2tags | 11 | + autotiling | 10 | debiancontributors | 10 | drf-yasg-nonfree | 10 | - flask-security | 10 | + notebook-shim | 10 | + pwntools | 10 | + python-aiohttp-security | 10 | + python-crcelk | 10 | python-digitalocean | 10 | python-drf-spectacular-sidecar-nonfree | 10 | + python-parse-type | 10 | beancount | 9 | django-sass | 9 | flask-session | 9 | - pytest-runner | 9 | python-overpy | 9 | speaklater | 9 | sphinx-intl | 9 | @@ -201,49 +201,47 @@ Last-Update: Sat, 14 Jun 2025 01:42:04 +0000 tuna | 9 | clustershell | 8 | flask-paranoid | 8 | + graphql-relay | 8 | httpcode | 8 | mercurial-evolve | 8 | micropython-mpremote | 8 | - notebook-shim | 8 | pybik | 8 | - pydrive2 | 8 | python-envs | 8 | python-numpysane | 8 | - python-pyaml-env | 8 | python-pyld | 8 | - python-versioneer | 8 | trac-wysiwyg | 8 | beancount | 7 | clustershell | 7 | + drf-extensions | 7 | easyprocess | 7 | - python-openstep-plist | 7 | + pydrive2 | 7 | + pytest-django | 7 | + python-versioneer | 7 | python-xdo | 7 | securestring | 7 | + voltron | 7 | django-model-utils | 6 | django-pglocks | 6 | - drf-extensions | 6 | - graphql-relay | 6 | + hachoir | 6 | htmlmin | 6 | librouteros | 6 | + mypy-protobuf | 6 | pytaglib | 6 | - pytest-django | 6 | + pytest-runner | 6 | python3-onelogin-saml2 | 6 | - python-ansicolors | 6 | python-biplist | 6 | - voltron | 6 | + python-openstep-plist | 6 | + python-pyaml-env | 6 | drf-haystack | 5 | flufl.testing | 5 | - hachoir | 5 | htmlmin | 5 | kconfiglib | 5 | - mypy-protobuf | 5 | numpy-stl | 5 | - pycallgraph | 5 | pyjokes | 5 | pynliner | 5 | + python-ansicolors | 5 | python-dirq | 5 | python-gnuplotlib | 5 | - python-halo | 5 | python-jpype | 5 | ruff | 5 | sorl-thumbnail | 5 | @@ -252,11 +250,11 @@ Last-Update: Sat, 14 Jun 2025 01:42:04 +0000 cram | 4 | django-jinja | 4 | django-paintstore | 4 | - extension-helpers | 4 | + flask-api | 4 | imap-tools | 4 | - logilab-constraint | 4 | + pycallgraph | 4 | python-dbus-next | 4 | - python-dynaconf | 4 | + python-halo | 4 | python-simpy | 4 | python-srp | 4 | utidylib | 4 | @@ -271,11 +269,10 @@ Last-Update: Sat, 14 Jun 2025 01:42:04 +0000 django-templated-email | 3 | django-xmlrpc | 3 | etm | 3 | + extension-helpers | 3 | flake8-black | 3 | - flask-api | 3 | - jpylyzer | 3 | + logilab-constraint | 3 | mbed-test-wrapper | 3 | - orsopy | 3 | proglog | 3 | pyclamd | 3 | pyfltk | 3 | @@ -287,6 +284,7 @@ Last-Update: Sat, 14 Jun 2025 01:42:04 +0000 python-django-contact-form | 3 | python-django-push-notifications | 3 | python-django-registration | 3 | + python-dynaconf | 3 | python-ipfix | 3 | python-markuppy | 3 | python-netfilterqueue | 3 | @@ -296,10 +294,10 @@ Last-Update: Sat, 14 Jun 2025 01:42:04 +0000 slimit | 3 | smem | 3 | sphinx-markdown-tables | 3 | - testrepository | 3 | trac-accountmanager | 3 | vf1 | 3 | backupchecker | 2 | + bqplot | 2 | brebis | 2 | cplay-ng | 2 | django-ajax-selects | 2 | @@ -321,10 +319,11 @@ Last-Update: Sat, 14 Jun 2025 01:42:04 +0000 gtkman | 2 | hatch-jupyter-builder | 2 | humanfriendly | 2 | + jpylyzer | 2 | jsonrpclib-pelix | 2 | namecheap | 2 | okasha | 2 | - omgifol | 2 | + orsopy | 2 | panoramisk | 2 | pyjunitxml | 2 | pypass | 2 | @@ -340,23 +339,18 @@ Last-Update: Sat, 14 Jun 2025 01:42:04 +0000 python-gammu | 2 | python-getdns | 2 | python-kanboard | 2 | - python-libguess | 2 | python-openshift | 2 | python-opentracing | 2 | python-pgmagick | 2 | - python-py-zipkin | 2 | python-qtpynodeeditor | 2 | python-securesystemslib | 2 | python-text-unidecode | 2 | - redis-py-cluster | 2 | - sphinx-paramlinks | 2 | + python-webdavclient | 2 | + testrepository | 2 | trac-xmlrpc | 2 | vcversioner | 2 | wikitrans | 2 | yotta | 2 | - zzzeeksphinx | 2 | - apkinspector | 1 | - bqplot | 1 | celery-progress | 1 | codicefiscale | 1 | enlighten | 1 | @@ -368,38 +362,34 @@ Last-Update: Sat, 14 Jun 2025 01:42:04 +0000 milksnake | 1 | mkdocs-macros-plugin | 1 | moviepy | 1 | - myst-nb | 1 | + omgifol | 1 | onetimepass | 1 | pykwalify | 1 | pylint-celery | 1 | pynag | 1 | pyrad | 1 | - python-banal | 1 | python-bottle-cork | 1 | - python-dataset | 1 | python-fluent-logger | 1 | python-fudge | 1 | python-genson | 1 | python-gfloat | 1 | + python-libguess | 1 | + python-meld3 | 1 | python-netfilter | 1 | python-noise | 1 | - python-openid-cla | 1 | + python-noseofyeti | 1 | python-openqa-client | 1 | python-pypump | 1 | - python-rdflib-endpoint | 1 | + python-py-zipkin | 1 | python-schedutils | 1 | - python-sphinx-examples | 1 | python-spur | 1 | python-undetected-chromedriver | 1 | python-urlobject | 1 | - python-vega-datasets | 1 | - python-webdavclient | 1 | python-zc.customdoctests | 1 | pytkdocs | 1 | + redis-py-cluster | 1 | soundcraft-utils | 1 | - sphinx-autorun | 1 | - sphinxcontrib-github-alt | 1 | - sphinx-sitemap | 1 | + sphinx-paramlinks | 1 | sphinxtesters | 1 | trac-customfieldadmin | 1 | trac-httpauth | 1 | @@ -409,11 +399,13 @@ Last-Update: Sat, 14 Jun 2025 01:42:04 +0000 wikitrans | 1 | zabbix-cli | 1 | zlmdb | 1 | + zzzeeksphinx | 1 | aioairzone | 0 | aioeagle | 0 | aiomysql | 0 | aiotask-context | 0 | alot | 0 | + apkinspector | 0 | aptly-api-client | 0 | beangrow | 0 | beangulp | 0 | @@ -461,6 +453,7 @@ Last-Update: Sat, 14 Jun 2025 01:42:04 +0000 mssql-django | 0 | mwoauth | 0 | mypaint | 0 | + myst-nb | 0 | nbgitpuller | 0 | okasha | 0 | pacparser | 0 | @@ -491,6 +484,7 @@ Last-Update: Sat, 14 Jun 2025 01:42:04 +0000 python-aio-pika | 0 | python-asv-bench-memray | 0 | python-babel | 0 | + python-banal | 0 | python-betterproto | 0 | python-bottle-beaker | 0 | python-briefcase | 0 | @@ -504,6 +498,7 @@ Last-Update: Sat, 14 Jun 2025 01:42:04 +0000 python-certstream | 0 | python-chocolate | 0 | python-cogapp | 0 | + python-dataset | 0 | python-digitalocean | 0 | python-django-casclient | 0 | python-django-contact-form | 0 | @@ -525,11 +520,10 @@ Last-Update: Sat, 14 Jun 2025 01:42:04 +0000 python-lunr | 0 | python-makefun | 0 | python-markdown-rundoc | 0 | - python-meld3 | 0 | python-netsnmpagent | 0 | - python-noseofyeti | 0 | python-nubia | 0 | python-nvchecker | 0 | + python-openid-cla | 0 | python-openshift | 0 | python-opentracing | 0 | python-persisting-theory | 0 | @@ -546,6 +540,7 @@ Last-Update: Sat, 14 Jun 2025 01:42:04 +0000 python-sphinx-examples | 0 | python-tatsu | 0 | python-tatsu-lts | 0 | + python-vega-datasets | 0 | python-webob | 0 | python-wither | 0 | python-ytmusicapi | 0 | @@ -557,8 +552,11 @@ Last-Update: Sat, 14 Jun 2025 01:42:04 +0000 redis-py-cluster | 0 | sorl-thumbnail | 0 | sortedcontainers | 0 | + sphinx-autorun | 0 | sphinxcontrib-emojicodes | 0 | + sphinxcontrib-github-alt | 0 | sphinxcontrib-googleanalytics | 0 | + sphinx-sitemap | 0 | stackview | 0 | symmetrize | 0 | testrepository | 0 | @@ -593,5 +591,5 @@ Last-Update: Sat, 14 Jun 2025 01:42:04 +0000 sphinxcontrib-emojicodes | -1 | symmetrize | -1 | trac-tickettemplate | -1 | -(606 rows) +(604 rows) View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/6503544d8326bea26ecaddd86a37ce82bb219a94 -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/6503544d8326bea26ecaddd86a37ce82bb219a94 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Sat Jun 14 22:52:08 2025 From: gitlab at salsa.debian.org (=?UTF-8?B?SsOpcsO0bWUgQmVub2l0IChAY2FsY3VsdXMp?=) Date: Sat, 14 Jun 2025 21:52:08 +0000 Subject: [med-svn] [Git][med-team/igraph][master] 5 commits: New upstream version 0.10.16 Message-ID: <684def08d6392_3dbb9d9c1029856ec@godard.mail> J?r?me Benoit pushed to branch master at Debian Med / igraph Commits: d03abe4e by Jerome Benoit at 2025-06-14T19:23:02+02:00 New upstream version 0.10.16 - - - - - 93f95039 by Jerome Benoit at 2025-06-14T19:23:13+02:00 Update upstream source from tag 'upstream/0.10.16' Update to upstream version '0.10.16' with Debian dir f55e18e10a3ff851d1e0b673516141aa181aff3d - - - - - 27e566c5 by Jerome Benoit at 2025-06-14T19:23:25+02:00 New upstream version 0.10.16+ds - - - - - 4780e19c by Jerome Benoit at 2025-06-14T19:23:29+02:00 Update upstream source from tag 'upstream/0.10.16+ds' Update to upstream version '0.10.16+ds' with Debian dir f55e18e10a3ff851d1e0b673516141aa181aff3d - - - - - 171e638a by Jerome Benoit at 2025-06-14T21:13:37+02:00 Debian patch 0.10.16+ds-1 - - - - - 153 changed files: - ACKNOWLEDGEMENTS.md - CHANGELOG.md - CMakeLists.txt - CONTRIBUTING.md - CONTRIBUTORS.md - CONTRIBUTORS.txt - IGRAPH_VERSION - debian/adhoc/examples/simple/Makefile - debian/changelog - debian/copyright - debian/libigraph3t64.symbols - debian/patches/debianization.patch - debian/patches/series - ? debian/patches/upstream-fix-lintian-spelling_error-silence.patch - debian/patches/upstream-fix-multiarch-file_conflict.patch - doc/cycles.xxml - doc/igraph-docs.xml - doc/installation.xml - doc/motifs.xxml - doc/operators.xxml - doc/random.xxml - doc/spatialgames.xxml - doc/structural.xxml - etc/cmake/CodeCoverage.cmake - examples/simple/eigenvector_centrality.c - examples/simple/igraph_assortativity_degree.out - examples/simple/igraph_assortativity_nominal.out - include/igraph_arpack.h - include/igraph_constants.h - include/igraph_error.h - include/igraph_microscopic_update.h - include/igraph_motifs.h - include/igraph_operators.h - include/igraph_random.h - include/igraph_types.h - include/igraph_vector_pmt.h - interfaces/functions.yaml - interfaces/types.yaml - src/CMakeLists.txt - src/centrality/betweenness.c - src/centrality/closeness.c - src/cliques/cliques.c - src/cliques/maximal_cliques.c - src/cliques/maximal_cliques_template.h - src/community/community_misc.c - src/community/edge_betweenness.c - src/community/modularity.c - src/community/spinglass/NetDataTypes.h - src/community/spinglass/clustertool.cpp - src/connectivity/components.c - src/constructors/adjacency.c - src/constructors/atlas.c - src/constructors/basic_constructors.c - src/constructors/famous.c - src/constructors/full.c - src/constructors/regular.c - src/core/bitset.c - src/core/bitset_list.c - src/core/matrix.pmt - src/core/strvector.c - src/core/vector.pmt - src/cycles/simple_cycles.c - src/flow/flow.c - src/games/barabasi.c - src/games/callaway_traits.c - src/games/citations.c - src/games/degree_sequence.c - src/games/degree_sequence_vl/degree_sequence_vl.h - src/games/degree_sequence_vl/gengraph_mr-connected.cpp - src/games/dotproduct.c - src/games/erdos_renyi.c - src/games/establishment.c - src/games/forestfire.c - src/games/grg.c - src/games/preference.c - src/games/recent_degree.c - src/games/watts_strogatz.c - src/graph/cattributes.c - src/graph/type_indexededgelist.c - src/hrg/hrg.cc - src/hrg/hrg_types.cc - src/io/edgelist.c - src/io/graphdb.c - src/io/graphml.c - src/io/lgl.c - src/io/ncol.c - src/isomorphism/isoclasses.c - src/isomorphism/queries.c - src/isomorphism/vf2.c - src/layout/fruchterman_reingold.c - src/layout/graphopt.c - src/layout/kamada_kawai.c - src/layout/mds.c - src/layout/sugiyama.c - src/layout/umap.c - src/linalg/blas.c - src/math/safe_intop.c - src/misc/bipartite.c - src/misc/chordality.c - src/misc/conversion.c - src/misc/cycle_bases.c - src/misc/feedback_arc_set.c - src/misc/graphicality.c - src/misc/microscopic_update.c - src/misc/mixing.c - src/misc/other.c - src/operators/connect_neighborhood.c - + src/operators/products.c - src/operators/rewire.c - src/operators/simplify.c - src/operators/subgraph.c - src/paths/histogram.c - src/paths/shortest_paths.c - src/properties/basic_properties.c - src/properties/complete.c - src/properties/neighborhood.c - src/properties/trees.c - src/properties/triangles.c - src/properties/triangles_template.h - src/properties/triangles_template1.h - src/random/random.c - tests/CMakeLists.txt - + tests/benchmarks/igraph_induced_subgraph.c - tests/benchmarks/igraph_transitivity.c - + tests/benchmarks/modularity.c - tests/regression/igraph_read_graph_graphml_invalid_inputs.c - + tests/regression/invalid6.graphml - tests/unit/constructor-failure.c - tests/unit/efficiency.c - tests/unit/igraph_adjacent_triangles.c ? tests/unit/igraph_count_adjacent_triangles.c - tests/unit/igraph_adjacent_triangles.out ? tests/unit/igraph_count_adjacent_triangles.out - tests/unit/igraph_degree_sequence_game.c - ? tests/unit/igraph_deterministic_optimal_imitation.c - tests/unit/igraph_get_shortest_path_astar.c - tests/unit/igraph_modularity_matrix.c - tests/unit/igraph_modularity_matrix.out - ? tests/unit/igraph_moran_process.c - tests/unit/igraph_neighborhood.c - tests/unit/igraph_neighborhood.out - tests/unit/igraph_neighborhood_graphs.c - tests/unit/igraph_neighborhood_graphs.out - tests/unit/igraph_neighborhood_size.c - tests/unit/igraph_neighborhood_size.out - + tests/unit/igraph_product.c - tests/unit/igraph_rng_get_integer.c - ? tests/unit/igraph_roulette_wheel_imitation.c - ? tests/unit/igraph_stochastic_imitation.c - tests/unit/maximal_cliques_callback.c - + tests/unit/paths.c - + tests/unit/paths.out - tests/unit/random_sampling.c - tests/unit/vector4.c - tests/unit/vector4.out The diff was not included because it is too large. View it on GitLab: https://salsa.debian.org/med-team/igraph/-/compare/aaaef6a2ea775e350955d90e5f71f280ed456c6e...171e638ac42776619105927f9e68118d82b3a870 -- View it on GitLab: https://salsa.debian.org/med-team/igraph/-/compare/aaaef6a2ea775e350955d90e5f71f280ed456c6e...171e638ac42776619105927f9e68118d82b3a870 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Sat Jun 14 22:52:11 2025 From: gitlab at salsa.debian.org (=?UTF-8?B?SsOpcsO0bWUgQmVub2l0IChAY2FsY3VsdXMp?=) Date: Sat, 14 Jun 2025 21:52:11 +0000 Subject: [med-svn] [Git][med-team/igraph][upstream] 2 commits: New upstream version 0.10.16 Message-ID: <684def0b844c0_3db11ef6080298626@godard.mail> J?r?me Benoit pushed to branch upstream at Debian Med / igraph Commits: d03abe4e by Jerome Benoit at 2025-06-14T19:23:02+02:00 New upstream version 0.10.16 - - - - - 27e566c5 by Jerome Benoit at 2025-06-14T19:23:25+02:00 New upstream version 0.10.16+ds - - - - - 145 changed files: - ACKNOWLEDGEMENTS.md - CHANGELOG.md - CMakeLists.txt - CONTRIBUTING.md - CONTRIBUTORS.md - CONTRIBUTORS.txt - IGRAPH_VERSION - doc/cycles.xxml - doc/igraph-docs.xml - doc/installation.xml - doc/motifs.xxml - doc/operators.xxml - doc/random.xxml - doc/spatialgames.xxml - doc/structural.xxml - etc/cmake/CodeCoverage.cmake - examples/simple/eigenvector_centrality.c - examples/simple/igraph_assortativity_degree.out - examples/simple/igraph_assortativity_nominal.out - include/igraph_arpack.h - include/igraph_constants.h - include/igraph_error.h - include/igraph_microscopic_update.h - include/igraph_motifs.h - include/igraph_operators.h - include/igraph_random.h - include/igraph_types.h - include/igraph_vector_pmt.h - interfaces/functions.yaml - interfaces/types.yaml - src/CMakeLists.txt - src/centrality/betweenness.c - src/centrality/closeness.c - src/cliques/cliques.c - src/cliques/maximal_cliques.c - src/cliques/maximal_cliques_template.h - src/community/community_misc.c - src/community/edge_betweenness.c - src/community/modularity.c - src/community/spinglass/NetDataTypes.h - src/community/spinglass/clustertool.cpp - src/connectivity/components.c - src/constructors/adjacency.c - src/constructors/atlas.c - src/constructors/basic_constructors.c - src/constructors/famous.c - src/constructors/full.c - src/constructors/regular.c - src/core/bitset.c - src/core/bitset_list.c - src/core/matrix.pmt - src/core/strvector.c - src/core/vector.pmt - src/cycles/simple_cycles.c - src/flow/flow.c - src/games/barabasi.c - src/games/callaway_traits.c - src/games/citations.c - src/games/degree_sequence.c - src/games/degree_sequence_vl/degree_sequence_vl.h - src/games/degree_sequence_vl/gengraph_mr-connected.cpp - src/games/dotproduct.c - src/games/erdos_renyi.c - src/games/establishment.c - src/games/forestfire.c - src/games/grg.c - src/games/preference.c - src/games/recent_degree.c - src/games/watts_strogatz.c - src/graph/cattributes.c - src/graph/type_indexededgelist.c - src/hrg/hrg.cc - src/hrg/hrg_types.cc - src/io/edgelist.c - src/io/graphdb.c - src/io/graphml.c - src/io/lgl.c - src/io/ncol.c - src/isomorphism/isoclasses.c - src/isomorphism/queries.c - src/isomorphism/vf2.c - src/layout/fruchterman_reingold.c - src/layout/graphopt.c - src/layout/kamada_kawai.c - src/layout/mds.c - src/layout/sugiyama.c - src/layout/umap.c - src/linalg/blas.c - src/math/safe_intop.c - src/misc/bipartite.c - src/misc/chordality.c - src/misc/conversion.c - src/misc/cycle_bases.c - src/misc/feedback_arc_set.c - src/misc/graphicality.c - src/misc/microscopic_update.c - src/misc/mixing.c - src/misc/other.c - src/operators/connect_neighborhood.c - + src/operators/products.c - src/operators/rewire.c - src/operators/simplify.c - src/operators/subgraph.c - src/paths/histogram.c - src/paths/shortest_paths.c - src/properties/basic_properties.c - src/properties/complete.c - src/properties/neighborhood.c - src/properties/trees.c - src/properties/triangles.c - src/properties/triangles_template.h - src/properties/triangles_template1.h - src/random/random.c - tests/CMakeLists.txt - + tests/benchmarks/igraph_induced_subgraph.c - tests/benchmarks/igraph_transitivity.c - + tests/benchmarks/modularity.c - tests/regression/igraph_read_graph_graphml_invalid_inputs.c - + tests/regression/invalid6.graphml - tests/unit/constructor-failure.c - tests/unit/efficiency.c - tests/unit/igraph_adjacent_triangles.c ? tests/unit/igraph_count_adjacent_triangles.c - tests/unit/igraph_adjacent_triangles.out ? tests/unit/igraph_count_adjacent_triangles.out - tests/unit/igraph_degree_sequence_game.c - ? tests/unit/igraph_deterministic_optimal_imitation.c - tests/unit/igraph_get_shortest_path_astar.c - tests/unit/igraph_modularity_matrix.c - tests/unit/igraph_modularity_matrix.out - ? tests/unit/igraph_moran_process.c - tests/unit/igraph_neighborhood.c - tests/unit/igraph_neighborhood.out - tests/unit/igraph_neighborhood_graphs.c - tests/unit/igraph_neighborhood_graphs.out - tests/unit/igraph_neighborhood_size.c - tests/unit/igraph_neighborhood_size.out - + tests/unit/igraph_product.c - tests/unit/igraph_rng_get_integer.c - ? tests/unit/igraph_roulette_wheel_imitation.c - ? tests/unit/igraph_stochastic_imitation.c - tests/unit/maximal_cliques_callback.c - + tests/unit/paths.c - + tests/unit/paths.out - tests/unit/random_sampling.c - tests/unit/vector4.c - tests/unit/vector4.out The diff was not included because it is too large. View it on GitLab: https://salsa.debian.org/med-team/igraph/-/compare/8a1af5060df011ff2db70b67941dda89e6e7bfd6...27e566c5bd3727a7f13b20c6e672232914318139 -- View it on GitLab: https://salsa.debian.org/med-team/igraph/-/compare/8a1af5060df011ff2db70b67941dda89e6e7bfd6...27e566c5bd3727a7f13b20c6e672232914318139 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Sat Jun 14 22:52:10 2025 From: gitlab at salsa.debian.org (=?UTF-8?B?SsOpcsO0bWUgQmVub2l0IChAY2FsY3VsdXMp?=) Date: Sat, 14 Jun 2025 21:52:10 +0000 Subject: [med-svn] [Git][med-team/igraph][pristine-tar] 2 commits: pristine-tar data for igraph_0.10.16.orig.tar.gz Message-ID: <684def0a20841_3db10596aa4298598e@godard.mail> J?r?me Benoit pushed to branch pristine-tar at Debian Med / igraph Commits: 2f94a001 by Jerome Benoit at 2025-06-14T19:23:13+02:00 pristine-tar data for igraph_0.10.16.orig.tar.gz - - - - - 810b6d35 by Jerome Benoit at 2025-06-14T19:23:29+02:00 pristine-tar data for igraph_0.10.16+ds.orig.tar.xz - - - - - 4 changed files: - + igraph_0.10.16+ds.orig.tar.xz.delta - + igraph_0.10.16+ds.orig.tar.xz.id - + igraph_0.10.16.orig.tar.gz.delta - + igraph_0.10.16.orig.tar.gz.id Changes: ===================================== igraph_0.10.16+ds.orig.tar.xz.delta ===================================== Binary files /dev/null and b/igraph_0.10.16+ds.orig.tar.xz.delta differ ===================================== igraph_0.10.16+ds.orig.tar.xz.id ===================================== @@ -0,0 +1 @@ +6349833aa090514e312edbf42c4133b31a1dff6f ===================================== igraph_0.10.16.orig.tar.gz.delta ===================================== Binary files /dev/null and b/igraph_0.10.16.orig.tar.gz.delta differ ===================================== igraph_0.10.16.orig.tar.gz.id ===================================== @@ -0,0 +1 @@ +fa74848a653f0626aad8dbdbd276d87719251ea1 View it on GitLab: https://salsa.debian.org/med-team/igraph/-/compare/62f4d7b9afa585a1b2a2b8fd1654ec6b48a4b095...810b6d35e51b0501cb387bef26a258ad357f6ecc -- View it on GitLab: https://salsa.debian.org/med-team/igraph/-/compare/62f4d7b9afa585a1b2a2b8fd1654ec6b48a4b095...810b6d35e51b0501cb387bef26a258ad357f6ecc You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Sat Jun 14 22:52:34 2025 From: gitlab at salsa.debian.org (=?UTF-8?B?SsOpcsO0bWUgQmVub2l0IChAY2FsY3VsdXMp?=) Date: Sat, 14 Jun 2025 21:52:34 +0000 Subject: [med-svn] [Git][med-team/igraph] Pushed new tag debian/0.10.16+ds-1 Message-ID: <684def224a9c7_3db12b681ec29865e6@godard.mail> J?r?me Benoit pushed new tag debian/0.10.16+ds-1 at Debian Med / igraph -- View it on GitLab: https://salsa.debian.org/med-team/igraph/-/tree/debian/0.10.16+ds-1 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Sat Jun 14 22:52:35 2025 From: gitlab at salsa.debian.org (=?UTF-8?B?SsOpcsO0bWUgQmVub2l0IChAY2FsY3VsdXMp?=) Date: Sat, 14 Jun 2025 21:52:35 +0000 Subject: [med-svn] [Git][med-team/igraph] Pushed new tag upstream/0.10.16 Message-ID: <684def233e5be_3db12b67cc42986813@godard.mail> J?r?me Benoit pushed new tag upstream/0.10.16 at Debian Med / igraph -- View it on GitLab: https://salsa.debian.org/med-team/igraph/-/tree/upstream/0.10.16 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Sat Jun 14 22:52:36 2025 From: gitlab at salsa.debian.org (=?UTF-8?B?SsOpcsO0bWUgQmVub2l0IChAY2FsY3VsdXMp?=) Date: Sat, 14 Jun 2025 21:52:36 +0000 Subject: [med-svn] [Git][med-team/igraph] Pushed new tag upstream/0.10.16+ds Message-ID: <684def242eb0d_3dbb9d806829871c0@godard.mail> J?r?me Benoit pushed new tag upstream/0.10.16+ds at Debian Med / igraph -- View it on GitLab: https://salsa.debian.org/med-team/igraph/-/tree/upstream/0.10.16+ds You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Sun Jun 15 02:43:53 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Sun, 15 Jun 2025 01:43:53 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <684e2559745b1_3dbe388a983008750@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: fd54ea16 by Andreas Tille at 2025-06-15T01:43:47+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,14 +1,14 @@ -Last-Update: Sat, 14 Jun 2025 13:42:04 +0000 +Last-Update: Sun, 15 Jun 2025 01:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- dicomscope | 29 | {imaging} | orthanc-gdcm | 16 | {imaging} | - oscar | 15 | {data,practice,tools} | + oscar | 15 | {data,tools,practice} | mrtrix3 | 14 | {imaging} | king | 11 | {typesetting,imaging} | adun.app | 10 | {bio} | - gnumed-server | 10 | {covid-19,practice} | + gnumed-server | 10 | {practice,covid-19} | orthanc-mysql | 10 | {imaging} | sight | 10 | {imaging} | orthanc-postgresql | 9 | {imaging} | @@ -20,7 +20,7 @@ Last-Update: Sat, 14 Jun 2025 13:42:04 +0000 mia | 5 | {imaging} | biojava-live | 4 | {bio-dev} | libminc | 4 | {imaging-dev} | - beast-mcmc | 3 | {bio,bio-phylogeny} | + beast-mcmc | 3 | {bio-phylogeny,bio} | bio-tradis | 3 | {bio,bio-dev} | getdata | 3 | {bio} | insighttoolkit5 | 3 | {imaging-dev} | @@ -34,18 +34,18 @@ Last-Update: Sat, 14 Jun 2025 13:42:04 +0000 fastml | 2 | {bio} | ipig | 2 | {bio} | plasmidid | 2 | {covid-19,bio} | - python-seqcluster | 2 | {covid-19,bio-dev} | + python-seqcluster | 2 | {bio-dev,covid-19} | staden | 2 | {bio} | ants | 1 | {imaging} | blimps | 1 | {bio} | brig | 1 | {bio} | ctn | 1 | {imaging-dev} | cufflinks | 1 | {cloud,bio} | - dextractor | 1 | {bio,covid-19} | + dextractor | 1 | {covid-19,bio} | emboss-explorer | 1 | {bio} | hinge | 1 | {bio} | htscodecs | 1 | {bio-dev,covid-19} | - jmodeltest | 1 | {bio,bio-phylogeny} | + jmodeltest | 1 | {bio-phylogeny,bio} | lamarc | 1 | {bio} | libbio-mage-utils-perl | 1 | {bio-dev} | libchado-perl | 1 | {bio-dev} | @@ -53,10 +53,10 @@ Last-Update: Sat, 14 Jun 2025 13:42:04 +0000 libgenome | 1 | {bio-dev} | libpal-java | 1 | {bio-dev} | librg-utils-perl | 1 | {bio} | - mhap | 1 | {bio,bio-ngs} | + mhap | 1 | {bio-ngs,bio} | papyrus | 1 | {imaging-dev} | - phyutility | 1 | {cloud,bio} | - proalign | 1 | {bio-phylogeny,bio} | + phyutility | 1 | {bio,cloud} | + proalign | 1 | {bio,bio-phylogeny} | rambo-k | 1 | {bio} | runcircos-gui | 1 | {bio} | seq-gen | 1 | {bio} | @@ -66,10 +66,10 @@ Last-Update: Sat, 14 Jun 2025 13:42:04 +0000 surpyvor | 1 | {bio} | thesias | 1 | {bio,covid-19} | tracetuner | 1 | {bio} | - treeview | 1 | {bio-phylogeny,bio} | - varscan | 1 | {covid-19,bio} | - vienna-rna | 1 | {bio,covid-19} | - acedb | 0 | {cloud,bio} | + treeview | 1 | {bio,bio-phylogeny} | + varscan | 1 | {bio,covid-19} | + vienna-rna | 1 | {covid-19,bio} | + acedb | 0 | {bio,cloud} | bambamc | 0 | {bio-dev} | biojava4-live | 0 | {bio-dev} | biosyntax | 0 | {bio} | @@ -78,8 +78,8 @@ Last-Update: Sat, 14 Jun 2025 13:42:04 +0000 ctffind | 0 | {bio} | eegdev | 0 | {imaging-dev} | embassy-domainatrix | 0 | {cloud,bio} | - embassy-domalign | 0 | {bio,cloud} | - embassy-domsearch | 0 | {cloud,bio} | + embassy-domalign | 0 | {cloud,bio} | + embassy-domsearch | 0 | {bio,cloud} | fis-gtm | 0 | {his} | gatk-bwamem | 0 | {bio-dev} | gatk-fermilite | 0 | {bio-dev} | @@ -136,7 +136,7 @@ Last-Update: Sat, 14 Jun 2025 13:42:04 +0000 rdp-alignment | 0 | {bio} | rdp-classifier | 0 | {bio} | resfinder-db | 0 | {bio} | - rtax | 0 | {cloud,bio} | + rtax | 0 | {bio,cloud} | saint | 0 | {bio} | savvy | 0 | {bio} | savvy | 0 | {bio-dev} | ===================================== debian-science-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Sat, 14 Jun 2025 13:42:08 +0000 +Last-Update: Sun, 15 Jun 2025 01:42:09 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- @@ -28,7 +28,7 @@ Last-Update: Sat, 14 Jun 2025 13:42:08 +0000 bossa | 19 | {devices} | picosat | 17 | {logic} | sketch | 17 | {typesetting} | - fftw | 16 | {mathematics-dev,physics-dev,meteorology-dev} | + fftw | 16 | {meteorology-dev,physics-dev,mathematics-dev} | gts | 16 | {viewing-dev} | guiqwt | 16 | {numericalcomputation,viewing} | lrcalc | 16 | {mathematics-dev} | @@ -44,24 +44,24 @@ Last-Update: Sat, 14 Jun 2025 13:42:08 +0000 form | 12 | {mathematics} | libitpp | 12 | {mathematics-dev,engineering-dev} | teem | 12 | {imageanalysis} | - coinor-symphony | 11 | {logic,mathematics,numericalcomputation} | + coinor-symphony | 11 | {mathematics,numericalcomputation,logic} | libm4rie | 11 | {mathematics-dev} | feedgnuplot | 10 | {viewing} | - lxi-tools | 10 | {engineering,dataacquisition} | + lxi-tools | 10 | {dataacquisition,engineering} | matlab-support | 10 | {mathematics,numericalcomputation} | pcl | 10 | {robotics-dev} | python-cdo | 10 | {meteorology} | eccodes | 9 | {meteorology-dev} | geg | 9 | {viewing} | libzn-poly | 9 | {mathematics-dev} | - python-escript | 9 | {numericalcomputation,simulations,engineering} | + python-escript | 9 | {numericalcomputation,engineering,simulations} | ratpoints | 9 | {mathematics-dev} | ros-rosconsole | 9 | {robotics-dev} | vdt | 9 | {mathematics-dev} | dxsamples | 8 | {nanoscale-physics} | metar | 8 | {meteorology} | ncl | 8 | {meteorology-dev} | - persalys | 8 | {engineering,statistics,mathematics} | + persalys | 8 | {mathematics,engineering,statistics} | apophenia | 7 | {statistics} | magics++ | 7 | {meteorology-dev} | odc | 7 | {meteorology-dev} | @@ -71,12 +71,12 @@ Last-Update: Sat, 14 Jun 2025 13:42:08 +0000 fpzip | 6 | {meteorology} | libccp4 | 6 | {nanoscale-physics-dev} | metview | 6 | {meteorology} | - persalys | 6 | {statistics,mathematics,engineering} | + persalys | 6 | {engineering,statistics,mathematics} | psurface | 6 | {numericalcomputation} | refmac-dictionary | 6 | {highenergy-physics-dev,chemistry} | rheolef | 6 | {mathematics} | ros-vcstool | 6 | {robotics-dev} | - toulbar2 | 6 | {logic,numericalcomputation,mathematics,physics} | + toulbar2 | 6 | {mathematics,logic,physics,numericalcomputation} | ucto | 6 | {linguistics} | atlas-ecmwf | 5 | {meteorology} | auto-07p | 5 | {mathematics} | @@ -89,10 +89,10 @@ Last-Update: Sat, 14 Jun 2025 13:42:08 +0000 opencascade | 5 | {simulations} | rubiks | 5 | {geometry,mathematics} | cmor | 4 | {meteorology} | - debian-science | 4 | {physics,machine-learning,economics,nanoscale-physics} | - debian-science | 4 | {economics,nanoscale-physics,machine-learning,physics,mathematics} | + debian-science | 4 | {physics,economics,machine-learning,nanoscale-physics} | + debian-science | 4 | {mathematics,physics,machine-learning,nanoscale-physics,economics} | drslib | 4 | {meteorology} | - fftw | 4 | {meteorology-dev,mathematics-dev,physics-dev} | + fftw | 4 | {meteorology-dev,physics-dev,mathematics-dev} | irstlm | 4 | {linguistics} | libxsmm | 4 | {mathematics-dev} | lrcalc | 4 | {mathematics} | @@ -107,7 +107,7 @@ Last-Update: Sat, 14 Jun 2025 13:42:08 +0000 ecbuild | 3 | {meteorology-dev} | emoslib | 3 | {meteorology-dev} | emoslib | 3 | {meteorology} | - getdp | 3 | {engineering,mathematics,simulations} | + getdp | 3 | {mathematics,simulations,engineering} | harp | 3 | {meteorology} | hdf-eos5 | 3 | {meteorology-dev} | ipe-tools | 3 | {typesetting} | @@ -119,14 +119,14 @@ Last-Update: Sat, 14 Jun 2025 13:42:08 +0000 mpi4py-fft | 3 | {mathematics-dev} | sac2mseed | 3 | {geography} | sardana | 3 | {dataacquisition} | - sdpb | 3 | {numericalcomputation,highenergy-physics} | + sdpb | 3 | {highenergy-physics,numericalcomputation} | silo-llnl | 3 | {engineering} | toontag | 3 | {numericalcomputation} | apache-opennlp | 2 | {linguistics} | apertium-eval-translator | 2 | {linguistics} | apophenia | 2 | {statistics} | atlas-ecmwf | 2 | {meteorology-dev} | - code-saturne | 2 | {mathematics-dev,engineering-dev} | + code-saturne | 2 | {engineering-dev,mathematics-dev} | debian-science | 2 | {nanoscale-physics,statistics,economics,physics} | debian-science | 2 | {economics} | dimbl | 2 | {linguistics} | @@ -141,7 +141,7 @@ Last-Update: Sat, 14 Jun 2025 13:42:08 +0000 libvigraimpex | 2 | {imageanalysis-dev,machine-learning} | mseed2sac | 2 | {dataacquisition-dev} | muparser | 2 | {mathematics-dev} | - ncrystal | 2 | {nanoscale-physics-dev,highenergy-physics-dev} | + ncrystal | 2 | {highenergy-physics-dev,nanoscale-physics-dev} | newmat | 2 | {mathematics-dev} | openstereogram | 2 | {tools} | polylib | 2 | {mathematics} | @@ -156,8 +156,8 @@ Last-Update: Sat, 14 Jun 2025 13:42:08 +0000 ckon | 1 | {highenergy-physics-dev} | clipper | 1 | {nanoscale-physics-dev} | coda | 1 | {meteorology-dev} | - code-saturne | 1 | {engineering-dev,mathematics-dev} | - coinmp | 1 | {logic,mathematics-dev,numericalcomputation} | + code-saturne | 1 | {mathematics-dev,engineering-dev} | + coinmp | 1 | {logic,numericalcomputation,mathematics-dev} | coinor-bonmin | 1 | {mathematics} | debian-science | 1 | {electrophysiology} | debian-science | 1 | {tools} | @@ -177,13 +177,13 @@ Last-Update: Sat, 14 Jun 2025 13:42:08 +0000 mbt | 1 | {linguistics} | mbtserver | 1 | {linguistics} | metkit | 1 | {meteorology-dev} | - mmdb | 1 | {nanoscale-physics-dev,highenergy-physics-dev} | + mmdb | 1 | {highenergy-physics-dev,nanoscale-physics-dev} | mrmpi | 1 | {tools} | nrn-iv | 1 | {biology} | psurface | 1 | {numericalcomputation} | qd | 1 | {mathematics-dev} | ros-ros-environment | 1 | {robotics-dev} | - schroedinger-coordgenlibs | 1 | {nanoscale-physics-dev,chemistry} | + schroedinger-coordgenlibs | 1 | {chemistry,nanoscale-physics-dev} | siscone | 1 | {highenergy-physics-dev} | spaghetti | 1 | {geography} | ssm | 1 | {nanoscale-physics-dev} | @@ -203,7 +203,7 @@ Last-Update: Sat, 14 Jun 2025 13:42:08 +0000 apertium-urd-hin | 0 | {linguistics} | apriltag | 0 | {robotics-dev} | asl | 0 | {physics-dev} | - calculix-ccx-test | 0 | {simulations,numericalcomputation,engineering} | + calculix-ccx-test | 0 | {simulations,engineering,numericalcomputation} | clhep | 0 | {highenergy-physics-dev} | cmor | 0 | {meteorology-dev} | coda | 0 | {meteorology-dev} | @@ -226,19 +226,19 @@ Last-Update: Sat, 14 Jun 2025 13:42:08 +0000 libsdsl | 0 | {dataacquisition-dev} | looptools | 0 | {highenergy-physics-dev} | looptools | 0 | {highenergy-physics} | - magma | 0 | {mathematics-dev,numericalcomputation} | + magma | 0 | {numericalcomputation,mathematics-dev} | mbt | 0 | {linguistics} | mctc-lib | 0 | {nanoscale-physics-dev,highenergy-physics-dev} | meshsdfilter | 0 | {mathematics-dev} | - metis-edf | 0 | {engineering,numericalcomputation} | metis-edf | 0 | {engineering-dev} | + metis-edf | 0 | {numericalcomputation,engineering} | neartree | 0 | {mathematics-dev,numericalcomputation} | nrn-mod2c | 0 | {biology} | openctm | 0 | {physics-dev} | opengv | 0 | {geometry} | openigtlink | 0 | {robotics-dev} | openmesh | 0 | {mathematics-dev} | - python-escript | 0 | {numericalcomputation,simulations,engineering} | + python-escript | 0 | {engineering,numericalcomputation,simulations} | python-opcodes | 0 | {tools} | qrupdate | 0 | {mathematics-dev} | quadrule | 0 | {mathematics-dev} | @@ -254,9 +254,9 @@ Last-Update: Sat, 14 Jun 2025 13:42:08 +0000 sagemath-database-polytopes | 0 | {mathematics} | schroedinger-maeparser | 0 | {chemistry,nanoscale-physics-dev} | siscone | 0 | {highenergy-physics-dev} | - slicot | 0 | {robotics-dev,engineering-dev} | + slicot | 0 | {engineering-dev,robotics-dev} | sparskit | 0 | {mathematics-dev} | - spfft | 0 | {mathematics-dev,nanoscale-physics-dev,physics-dev,meteorology-dev} | + spfft | 0 | {meteorology-dev,physics-dev,mathematics-dev,nanoscale-physics-dev} | ssm | 0 | {nanoscale-physics} | tachyon | 0 | {mathematics} | tamuanova | 0 | {statistics} | ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Sat, 14 Jun 2025 13:42:12 +0000 +Last-Update: Sun, 15 Jun 2025 01:42:12 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/fd54ea1666e9a9bec26280ede1a0b99cd2ad46ad -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/fd54ea1666e9a9bec26280ede1a0b99cd2ad46ad You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From mail at kultnet.de Sun Jun 15 13:49:08 2025 From: mail at kultnet.de (KultNet Kultur-Ausschreibungen) Date: Sun, 15 Jun 2025 14:49:08 +0200 (CEST) Subject: [med-svn] =?utf-8?b?4q2Q77iPIExpZWJlIEt1bHR1cmludGVyZXNzaWVydGUg?= =?utf-8?q?__Ihre_Kulturausschreibungen_im_Juni_2025=2E_892662?= Message-ID: <20250615124908.DF632611EF@vps27734.alfahosting-vps.de> An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Sun Jun 15 14:43:37 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Sun, 15 Jun 2025 13:43:37 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <684ece09cfb0c_3dbe388a98308597a@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: 3209fa16 by Andreas Tille at 2025-06-15T13:43:30+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,27 +1,28 @@ -Last-Update: Sun, 15 Jun 2025 01:42:04 +0000 +Last-Update: Sun, 15 Jun 2025 13:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- - dicomscope | 29 | {imaging} | + dicomscope | 31 | {imaging} | orthanc-gdcm | 16 | {imaging} | - oscar | 15 | {data,tools,practice} | mrtrix3 | 14 | {imaging} | + oscar | 14 | {data,practice,tools} | king | 11 | {typesetting,imaging} | adun.app | 10 | {bio} | - gnumed-server | 10 | {practice,covid-19} | + gnumed-server | 10 | {covid-19,practice} | orthanc-mysql | 10 | {imaging} | + pixelmed | 10 | {imaging} | sight | 10 | {imaging} | orthanc-postgresql | 9 | {imaging} | - pixelmed | 9 | {imaging} | bart-view | 8 | {imaging} | - heudiconv | 6 | {imaging} | - icb-utils | 6 | {bio-dev} | - jebl2 | 5 | {bio-dev} | + heudiconv | 7 | {imaging} | + jebl2 | 6 | {bio-dev} | + icb-utils | 5 | {bio-dev} | + libminc | 5 | {imaging-dev} | mia | 5 | {imaging} | biojava-live | 4 | {bio-dev} | - libminc | 4 | {imaging-dev} | - beast-mcmc | 3 | {bio-phylogeny,bio} | + beast-mcmc | 3 | {bio,bio-phylogeny} | bio-tradis | 3 | {bio,bio-dev} | + cmtk | 3 | {imaging} | getdata | 3 | {bio} | insighttoolkit5 | 3 | {imaging-dev} | pbcopper | 3 | {bio-dev} | @@ -29,23 +30,22 @@ Last-Update: Sun, 15 Jun 2025 01:42:04 +0000 piler | 3 | {bio} | sight | 3 | {imaging} | biojava6-live | 2 | {bio-dev} | - cmtk | 2 | {imaging} | elastix | 2 | {imaging} | fastml | 2 | {bio} | ipig | 2 | {bio} | plasmidid | 2 | {covid-19,bio} | - python-seqcluster | 2 | {bio-dev,covid-19} | + python-seqcluster | 2 | {covid-19,bio-dev} | staden | 2 | {bio} | ants | 1 | {imaging} | blimps | 1 | {bio} | brig | 1 | {bio} | ctn | 1 | {imaging-dev} | cufflinks | 1 | {cloud,bio} | - dextractor | 1 | {covid-19,bio} | + dextractor | 1 | {bio,covid-19} | emboss-explorer | 1 | {bio} | hinge | 1 | {bio} | htscodecs | 1 | {bio-dev,covid-19} | - jmodeltest | 1 | {bio-phylogeny,bio} | + jmodeltest | 1 | {bio,bio-phylogeny} | lamarc | 1 | {bio} | libbio-mage-utils-perl | 1 | {bio-dev} | libchado-perl | 1 | {bio-dev} | @@ -53,10 +53,10 @@ Last-Update: Sun, 15 Jun 2025 01:42:04 +0000 libgenome | 1 | {bio-dev} | libpal-java | 1 | {bio-dev} | librg-utils-perl | 1 | {bio} | - mhap | 1 | {bio-ngs,bio} | + mhap | 1 | {bio,bio-ngs} | papyrus | 1 | {imaging-dev} | - phyutility | 1 | {bio,cloud} | - proalign | 1 | {bio,bio-phylogeny} | + phyutility | 1 | {cloud,bio} | + proalign | 1 | {bio-phylogeny,bio} | rambo-k | 1 | {bio} | runcircos-gui | 1 | {bio} | seq-gen | 1 | {bio} | @@ -66,10 +66,10 @@ Last-Update: Sun, 15 Jun 2025 01:42:04 +0000 surpyvor | 1 | {bio} | thesias | 1 | {bio,covid-19} | tracetuner | 1 | {bio} | - treeview | 1 | {bio,bio-phylogeny} | - varscan | 1 | {bio,covid-19} | - vienna-rna | 1 | {covid-19,bio} | - acedb | 0 | {bio,cloud} | + treeview | 1 | {bio-phylogeny,bio} | + varscan | 1 | {covid-19,bio} | + vienna-rna | 1 | {bio,covid-19} | + acedb | 0 | {cloud,bio} | bambamc | 0 | {bio-dev} | biojava4-live | 0 | {bio-dev} | biosyntax | 0 | {bio} | @@ -78,8 +78,8 @@ Last-Update: Sun, 15 Jun 2025 01:42:04 +0000 ctffind | 0 | {bio} | eegdev | 0 | {imaging-dev} | embassy-domainatrix | 0 | {cloud,bio} | - embassy-domalign | 0 | {cloud,bio} | - embassy-domsearch | 0 | {bio,cloud} | + embassy-domalign | 0 | {bio,cloud} | + embassy-domsearch | 0 | {cloud,bio} | fis-gtm | 0 | {his} | gatk-bwamem | 0 | {bio-dev} | gatk-fermilite | 0 | {bio-dev} | @@ -136,7 +136,7 @@ Last-Update: Sun, 15 Jun 2025 01:42:04 +0000 rdp-alignment | 0 | {bio} | rdp-classifier | 0 | {bio} | resfinder-db | 0 | {bio} | - rtax | 0 | {bio,cloud} | + rtax | 0 | {cloud,bio} | saint | 0 | {bio} | savvy | 0 | {bio} | savvy | 0 | {bio-dev} | ===================================== debian-science-tests.txt ===================================== @@ -1,41 +1,41 @@ -Last-Update: Sun, 15 Jun 2025 01:42:09 +0000 +Last-Update: Sun, 15 Jun 2025 13:42:08 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- - nltk | 4846 | {linguistics} | - gts | 4812 | {viewing} | - opencascade | 621 | {simulations} | - spacenavd | 220 | {tools} | - open-coarrays | 191 | {meteorology-dev} | - armadillo | 180 | {mathematics-dev} | - arpack | 90 | {mathematics-dev} | - scalapack | 53 | {nanoscale-physics-dev} | + nltk | 4850 | {linguistics} | + gts | 4785 | {viewing} | + opencascade | 622 | {simulations} | + spacenavd | 219 | {tools} | + open-coarrays | 188 | {meteorology-dev} | + armadillo | 178 | {mathematics-dev} | + arpack | 89 | {mathematics-dev} | + scalapack | 52 | {nanoscale-physics-dev} | + ntl | 43 | {mathematics-dev} | visidata | 43 | {datamanagement} | - ntl | 41 | {mathematics-dev} | - mbpoll | 37 | {simulations} | imview | 36 | {viewing} | + mbpoll | 36 | {simulations} | ppl | 35 | {numericalcomputation} | libmatio | 31 | {mathematics-dev} | - arduino-mk | 30 | {robotics} | flintqs | 30 | {mathematics} | - cliquer | 27 | {mathematics} | + arduino-mk | 29 | {robotics} | + cliquer | 28 | {mathematics} | libm4ri | 25 | {mathematics-dev} | - flann | 24 | {mathematics-dev,engineering-dev} | + flann | 23 | {mathematics-dev,engineering-dev} | + xygrib | 23 | {meteorology} | grads | 22 | {meteorology} | - xygrib | 22 | {meteorology} | - setzer | 21 | {typesetting} | sat4j | 20 | {logic} | bossa | 19 | {devices} | + setzer | 19 | {typesetting} | + fftw | 17 | {mathematics-dev,physics-dev,meteorology-dev} | + guiqwt | 17 | {numericalcomputation,viewing} | picosat | 17 | {logic} | - sketch | 17 | {typesetting} | - fftw | 16 | {meteorology-dev,physics-dev,mathematics-dev} | - gts | 16 | {viewing-dev} | - guiqwt | 16 | {numericalcomputation,viewing} | lrcalc | 16 | {mathematics-dev} | ncl | 16 | {meteorology} | + pyzo | 16 | {numericalcomputation} | + sketch | 16 | {typesetting} | cliquer | 15 | {mathematics-dev} | eccodes | 15 | {meteorology,meteorology-dev} | - pyzo | 15 | {numericalcomputation} | + gts | 14 | {viewing-dev} | gf2x | 13 | {mathematics-dev} | iml | 13 | {mathematics-dev} | libhomfly | 13 | {mathematics-dev} | @@ -44,24 +44,24 @@ Last-Update: Sun, 15 Jun 2025 01:42:09 +0000 form | 12 | {mathematics} | libitpp | 12 | {mathematics-dev,engineering-dev} | teem | 12 | {imageanalysis} | - coinor-symphony | 11 | {mathematics,numericalcomputation,logic} | + coinor-symphony | 11 | {logic,mathematics,numericalcomputation} | + feedgnuplot | 11 | {viewing} | libm4rie | 11 | {mathematics-dev} | - feedgnuplot | 10 | {viewing} | - lxi-tools | 10 | {dataacquisition,engineering} | - matlab-support | 10 | {mathematics,numericalcomputation} | - pcl | 10 | {robotics-dev} | + matlab-support | 11 | {mathematics,numericalcomputation} | + lxi-tools | 10 | {engineering,dataacquisition} | python-cdo | 10 | {meteorology} | + ros-rosconsole | 10 | {robotics-dev} | eccodes | 9 | {meteorology-dev} | geg | 9 | {viewing} | libzn-poly | 9 | {mathematics-dev} | - python-escript | 9 | {numericalcomputation,engineering,simulations} | + pcl | 9 | {robotics-dev} | + python-escript | 9 | {numericalcomputation,simulations,engineering} | ratpoints | 9 | {mathematics-dev} | - ros-rosconsole | 9 | {robotics-dev} | vdt | 9 | {mathematics-dev} | dxsamples | 8 | {nanoscale-physics} | metar | 8 | {meteorology} | ncl | 8 | {meteorology-dev} | - persalys | 8 | {mathematics,engineering,statistics} | + persalys | 8 | {engineering,statistics,mathematics} | apophenia | 7 | {statistics} | magics++ | 7 | {meteorology-dev} | odc | 7 | {meteorology-dev} | @@ -71,12 +71,12 @@ Last-Update: Sun, 15 Jun 2025 01:42:09 +0000 fpzip | 6 | {meteorology} | libccp4 | 6 | {nanoscale-physics-dev} | metview | 6 | {meteorology} | - persalys | 6 | {engineering,statistics,mathematics} | + persalys | 6 | {statistics,mathematics,engineering} | psurface | 6 | {numericalcomputation} | refmac-dictionary | 6 | {highenergy-physics-dev,chemistry} | rheolef | 6 | {mathematics} | ros-vcstool | 6 | {robotics-dev} | - toulbar2 | 6 | {mathematics,logic,physics,numericalcomputation} | + toulbar2 | 6 | {logic,numericalcomputation,mathematics,physics} | ucto | 6 | {linguistics} | atlas-ecmwf | 5 | {meteorology} | auto-07p | 5 | {mathematics} | @@ -88,18 +88,19 @@ Last-Update: Sun, 15 Jun 2025 01:42:09 +0000 iapws | 5 | {meteorology} | opencascade | 5 | {simulations} | rubiks | 5 | {geometry,mathematics} | + urdfdom-headers | 5 | {robotics-dev} | cmor | 4 | {meteorology} | - debian-science | 4 | {physics,economics,machine-learning,nanoscale-physics} | - debian-science | 4 | {mathematics,physics,machine-learning,nanoscale-physics,economics} | + debian-science | 4 | {economics,nanoscale-physics,machine-learning,physics,mathematics} | drslib | 4 | {meteorology} | - fftw | 4 | {meteorology-dev,physics-dev,mathematics-dev} | + fftw | 4 | {meteorology-dev,mathematics-dev,physics-dev} | irstlm | 4 | {linguistics} | libxsmm | 4 | {mathematics-dev} | lrcalc | 4 | {mathematics} | silo-llnl | 4 | {engineering} | - urdfdom-headers | 4 | {robotics-dev} | veccore | 4 | {mathematics-dev} | + apertium-eval-translator | 3 | {linguistics} | cylc-flow | 3 | {meteorology} | + debian-science | 3 | {physics,machine-learning,economics,nanoscale-physics} | dune-functions | 3 | {mathematics-dev} | dune-localfunctions | 3 | {mathematics-dev} | dune-typetree | 3 | {mathematics-dev} | @@ -107,7 +108,7 @@ Last-Update: Sun, 15 Jun 2025 01:42:09 +0000 ecbuild | 3 | {meteorology-dev} | emoslib | 3 | {meteorology-dev} | emoslib | 3 | {meteorology} | - getdp | 3 | {mathematics,simulations,engineering} | + getdp | 3 | {engineering,mathematics,simulations} | harp | 3 | {meteorology} | hdf-eos5 | 3 | {meteorology-dev} | ipe-tools | 3 | {typesetting} | @@ -117,16 +118,17 @@ Last-Update: Sun, 15 Jun 2025 01:42:09 +0000 libmatheval | 3 | {mathematics} | metkit | 3 | {meteorology} | mpi4py-fft | 3 | {mathematics-dev} | + muparser | 3 | {mathematics-dev} | + newmat | 3 | {mathematics-dev} | sac2mseed | 3 | {geography} | sardana | 3 | {dataacquisition} | - sdpb | 3 | {highenergy-physics,numericalcomputation} | + sdpb | 3 | {numericalcomputation,highenergy-physics} | silo-llnl | 3 | {engineering} | toontag | 3 | {numericalcomputation} | apache-opennlp | 2 | {linguistics} | - apertium-eval-translator | 2 | {linguistics} | apophenia | 2 | {statistics} | atlas-ecmwf | 2 | {meteorology-dev} | - code-saturne | 2 | {engineering-dev,mathematics-dev} | + code-saturne | 2 | {mathematics-dev,engineering-dev} | debian-science | 2 | {nanoscale-physics,statistics,economics,physics} | debian-science | 2 | {economics} | dimbl | 2 | {linguistics} | @@ -140,9 +142,7 @@ Last-Update: Sun, 15 Jun 2025 01:42:09 +0000 libmatheval | 2 | {mathematics-dev} | libvigraimpex | 2 | {imageanalysis-dev,machine-learning} | mseed2sac | 2 | {dataacquisition-dev} | - muparser | 2 | {mathematics-dev} | - ncrystal | 2 | {highenergy-physics-dev,nanoscale-physics-dev} | - newmat | 2 | {mathematics-dev} | + ncrystal | 2 | {nanoscale-physics-dev,highenergy-physics-dev} | openstereogram | 2 | {tools} | polylib | 2 | {mathematics} | python-aws-xray-sdk | 2 | {dataacquisition-dev} | @@ -153,17 +153,17 @@ Last-Update: Sun, 15 Jun 2025 01:42:09 +0000 syrthes | 2 | {engineering} | toon | 2 | {numericalcomputation} | x13as | 2 | {economics} | + apertium-streamparser | 1 | {linguistics} | ckon | 1 | {highenergy-physics-dev} | clipper | 1 | {nanoscale-physics-dev} | coda | 1 | {meteorology-dev} | - code-saturne | 1 | {mathematics-dev,engineering-dev} | - coinmp | 1 | {logic,numericalcomputation,mathematics-dev} | + code-saturne | 1 | {engineering-dev,mathematics-dev} | + coinmp | 1 | {logic,mathematics-dev,numericalcomputation} | coinor-bonmin | 1 | {mathematics} | - debian-science | 1 | {electrophysiology} | debian-science | 1 | {tools} | - debian-science | 1 | {neuroscience-cognitive,machine-learning} | debian-science | 1 | {neuroscience-cognitive} | - debian-science | 1 | {nanoscale-physics-dev} | + debian-science | 1 | {neuroscience-cognitive,machine-learning} | + debian-science | 1 | {electrophysiology} | fpzip | 1 | {meteorology-dev} | frogdata | 1 | {linguistics} | gadap | 1 | {meteorology-dev} | @@ -177,13 +177,14 @@ Last-Update: Sun, 15 Jun 2025 01:42:09 +0000 mbt | 1 | {linguistics} | mbtserver | 1 | {linguistics} | metkit | 1 | {meteorology-dev} | - mmdb | 1 | {highenergy-physics-dev,nanoscale-physics-dev} | + mmdb | 1 | {nanoscale-physics-dev,highenergy-physics-dev} | mrmpi | 1 | {tools} | nrn-iv | 1 | {biology} | + nrn-mod2c | 1 | {biology} | psurface | 1 | {numericalcomputation} | qd | 1 | {mathematics-dev} | ros-ros-environment | 1 | {robotics-dev} | - schroedinger-coordgenlibs | 1 | {chemistry,nanoscale-physics-dev} | + schroedinger-coordgenlibs | 1 | {nanoscale-physics-dev,chemistry} | siscone | 1 | {highenergy-physics-dev} | spaghetti | 1 | {geography} | ssm | 1 | {nanoscale-physics-dev} | @@ -197,13 +198,12 @@ Last-Update: Sun, 15 Jun 2025 01:42:09 +0000 apertium-bel-rus | 0 | {linguistics} | apertium-hin | 0 | {linguistics} | apertium-pol-szl | 0 | {linguistics} | - apertium-streamparser | 0 | {linguistics} | apertium-swe-dan | 0 | {linguistics} | apertium-urd | 0 | {linguistics} | apertium-urd-hin | 0 | {linguistics} | apriltag | 0 | {robotics-dev} | asl | 0 | {physics-dev} | - calculix-ccx-test | 0 | {simulations,engineering,numericalcomputation} | + calculix-ccx-test | 0 | {simulations,numericalcomputation,engineering} | clhep | 0 | {highenergy-physics-dev} | cmor | 0 | {meteorology-dev} | coda | 0 | {meteorology-dev} | @@ -211,9 +211,10 @@ Last-Update: Sun, 15 Jun 2025 01:42:09 +0000 collada-dom | 0 | {viewing-dev} | cqrlib | 0 | {mathematics-dev} | cvector | 0 | {mathematics-dev} | + debian-science | 0 | {physics} | + debian-science | 0 | {nanoscale-physics-dev} | debian-science | 0 | {electrophysiology} | debian-science | 0 | {psychophysics} | - debian-science | 0 | {physics} | dune-grid-glue | 0 | {mathematics-dev} | etsf-io | 0 | {nanoscale-physics-dev} | fastjet | 0 | {highenergy-physics-dev} | @@ -224,28 +225,27 @@ Last-Update: Sun, 15 Jun 2025 01:42:09 +0000 libfolia | 0 | {linguistics} | libquantum | 0 | {numericalcomputation} | libsdsl | 0 | {dataacquisition-dev} | - looptools | 0 | {highenergy-physics-dev} | looptools | 0 | {highenergy-physics} | - magma | 0 | {numericalcomputation,mathematics-dev} | + looptools | 0 | {highenergy-physics-dev} | + magma | 0 | {mathematics-dev,numericalcomputation} | mbt | 0 | {linguistics} | mctc-lib | 0 | {nanoscale-physics-dev,highenergy-physics-dev} | meshsdfilter | 0 | {mathematics-dev} | + metis-edf | 0 | {engineering,numericalcomputation} | metis-edf | 0 | {engineering-dev} | - metis-edf | 0 | {numericalcomputation,engineering} | neartree | 0 | {mathematics-dev,numericalcomputation} | - nrn-mod2c | 0 | {biology} | openctm | 0 | {physics-dev} | opengv | 0 | {geometry} | openigtlink | 0 | {robotics-dev} | openmesh | 0 | {mathematics-dev} | - python-escript | 0 | {engineering,numericalcomputation,simulations} | + python-escript | 0 | {numericalcomputation,simulations,engineering} | python-opcodes | 0 | {tools} | qrupdate | 0 | {mathematics-dev} | quadrule | 0 | {mathematics-dev} | robot-testing-framework | 0 | {robotics-dev} | ros-collada-urdf | 0 | {robotics} | - ros-metapackages | 0 | {robotics-dev} | ros-metapackages | 0 | {robotics} | + ros-metapackages | 0 | {robotics-dev} | ros-opencv-apps | 0 | {robotics} | sagemath-database-combinatorial-designs | 0 | {mathematics} | sagemath-database-cremona-elliptic-curves | 0 | {mathematics} | @@ -254,9 +254,9 @@ Last-Update: Sun, 15 Jun 2025 01:42:09 +0000 sagemath-database-polytopes | 0 | {mathematics} | schroedinger-maeparser | 0 | {chemistry,nanoscale-physics-dev} | siscone | 0 | {highenergy-physics-dev} | - slicot | 0 | {engineering-dev,robotics-dev} | + slicot | 0 | {robotics-dev,engineering-dev} | sparskit | 0 | {mathematics-dev} | - spfft | 0 | {meteorology-dev,physics-dev,mathematics-dev,nanoscale-physics-dev} | + spfft | 0 | {mathematics-dev,nanoscale-physics-dev,physics-dev,meteorology-dev} | ssm | 0 | {nanoscale-physics} | tachyon | 0 | {mathematics} | tamuanova | 0 | {statistics} | ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,171 +1,170 @@ -Last-Update: Sun, 15 Jun 2025 01:42:12 +0000 +Last-Update: Sun, 15 Jun 2025 13:42:12 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- - mpmath | 10034 | - python-repoze.lru | 7017 | - netifaces | 5172 | - ghp-import | 4796 | - python-lunr | 4791 | - python-babel | 4175 | - sortedcontainers | 3812 | - python-babel | 3673 | - aiosignal | 2924 | - hyperlink | 2170 | - python-notify2 | 2053 | - humanfriendly | 1963 | - referencing | 1583 | - python-mysqldb | 1507 | - python-gssapi | 1415 | - python-invoke | 1400 | - python-hyperframe | 1374 | - python-pandocfilters | 1334 | - websocket-client | 1331 | - python-hpack | 1159 | - python-rsa | 1130 | - pdfarranger | 1018 | - menulibre | 948 | - python-linux-procfs | 925 | - python-geoip | 883 | - python-webob | 850 | - autopep8 | 785 | - powerline | 764 | - firmware-microbit-micropython | 735 | + mpmath | 10017 | + python-repoze.lru | 6993 | + netifaces | 5151 | + ghp-import | 4801 | + python-lunr | 4796 | + python-babel | 4064 | + sortedcontainers | 3717 | + python-babel | 3589 | + aiosignal | 2925 | + hyperlink | 2172 | + python-notify2 | 2049 | + humanfriendly | 1975 | + referencing | 1540 | + python-mysqldb | 1513 | + python-gssapi | 1412 | + python-invoke | 1387 | + python-hyperframe | 1357 | + websocket-client | 1327 | + python-pandocfilters | 1246 | + python-hpack | 1148 | + python-rsa | 1128 | + pdfarranger | 991 | + menulibre | 953 | + python-linux-procfs | 924 | + python-geoip | 880 | + python-webob | 846 | + powerline | 772 | + firmware-microbit-micropython | 736 | + powerline | 726 | powerline | 721 | - powerline | 716 | - pytoolconfig | 696 | - kazam | 683 | - u-msgpack-python | 610 | + autopep8 | 705 | + kazam | 674 | + u-msgpack-python | 616 | + pytoolconfig | 613 | python-zopfli | 608 | - gaupol | 537 | - dockerpty | 526 | - asn1crypto | 525 | - python-et-xmlfile | 523 | - python-gevent | 497 | - python-ewmh | 439 | - catfish | 431 | - python-requests-oauthlib | 401 | - python-toml | 355 | - spf-engine | 341 | - python-ntlm-auth | 321 | - spf-engine | 294 | - django-stronghold | 258 | - python-ldap3 | 231 | - cairocffi | 216 | - python-mimeparse | 200 | - python-smmap | 176 | - autokey | 169 | - python-hidapi | 167 | - httpie | 155 | + gaupol | 538 | + asn1crypto | 528 | + dockerpty | 523 | + python-et-xmlfile | 518 | + python-gevent | 494 | + python-ewmh | 440 | + catfish | 425 | + python-requests-oauthlib | 400 | + python-toml | 356 | + spf-engine | 343 | + python-ntlm-auth | 317 | + spf-engine | 292 | + django-stronghold | 259 | + python-ldap3 | 232 | + cairocffi | 217 | + python-mimeparse | 196 | + python-smmap | 181 | + python-hidapi | 168 | + autokey | 167 | python-anyjson | 153 | + httpie | 151 | smem | 147 | - kivy | 130 | + kivy | 132 | python-aiostream | 124 | python-click-repl | 120 | - smartypants | 118 | - nodeenv | 110 | + smartypants | 116 | lollypop | 106 | - mypaint | 104 | - timekpr-next | 102 | - mugshot | 98 | - python-pyu2f | 98 | - pacparser | 94 | - python-consul | 91 | + mypaint | 105 | + nodeenv | 104 | + timekpr-next | 101 | + python-pyu2f | 97 | + mugshot | 96 | + pacparser | 93 | + python-consul | 92 | pymacaroons | 89 | - python-rfc6555 | 85 | - pymediainfo | 82 | + python-rfc6555 | 84 | pssh | 81 | - python-colour | 76 | - weasyprint | 73 | + pymediainfo | 81 | + python-colour | 74 | + weasyprint | 74 | + numpy-stl | 72 | python-i3ipc | 71 | - fabric | 70 | + fabric | 69 | python-pykka | 69 | - mitmproxy | 68 | - numpy-stl | 67 | - pywavelets | 62 | - python-uritools | 56 | - ueberzug | 56 | - itstool | 55 | - python-scp | 55 | + mitmproxy | 67 | + pywavelets | 61 | + ueberzug | 57 | + python-looseversion | 55 | + python-uritools | 55 | + python-scp | 54 | + itstool | 52 | pyenv | 52 | - python-looseversion | 51 | mysql-connector-python | 50 | hatchling | 46 | + pymacs | 46 | + khard | 45 | + blockdiag | 44 | sshtunnel | 44 | - trac | 44 | - blockdiag | 43 | - pymacs | 43 | - show-in-file-manager | 43 | - khard | 42 | - python-pysol-cards | 41 | - membernator | 40 | - pyquery | 40 | - powerline-gitstatus | 38 | + trac | 43 | + pyquery | 41 | + show-in-file-manager | 41 | + python-pysol-cards | 40 | + membernator | 39 | + powerline-gitstatus | 39 | + certipy | 38 | pylibmc | 38 | - certipy | 37 | jupyterhub | 37 | pamela | 37 | persepolis | 37 | python-scrypt | 36 | - pdfposter | 35 | - pssh | 29 | - python-args | 29 | - python-statsd | 29 | - kivy | 28 | + pdfposter | 34 | + kivy | 30 | + pssh | 30 | + python-statsd | 30 | + python-args | 28 | seqdiag | 28 | + dkimpy-milter | 27 | sphinxcontrib-blockdiag | 27 | - video-downloader | 27 | - dkimpy-milter | 26 | - python-clint | 26 | sphinxcontrib-seqdiag | 26 | + video-downloader | 26 | + python-clint | 25 | rst2pdf | 25 | - typogrify | 25 | depthcharge-tools | 24 | + typogrify | 24 | cppman | 23 | flask-principal | 23 | + sphinx-inline-tabs | 23 | webpy | 23 | enzyme | 22 | - fabric | 22 | python-fire | 22 | - python-zstd | 22 | - sphinx-inline-tabs | 22 | backoff | 21 | + fabric | 21 | python-rangehttpserver | 21 | + python-zstd | 21 | subliminal | 21 | + alot | 20 | python-translationstring | 20 | - spf-engine | 20 | - alot | 19 | nwdiag | 19 | nwg-displays | 19 | social-auth-core | 19 | - subliminal | 19 | + spf-engine | 19 | django-environ | 18 | + mistune0 | 18 | python-demjson | 18 | + subliminal | 18 | webtest | 18 | - mistune0 | 17 | python-hupper | 17 | python-sdnotify | 16 | python-slip10 | 16 | sphinxcontrib-log-cabinet | 16 | actdiag | 15 | + pykwalify | 15 | python-kyotocabinet | 15 | python-priority | 15 | python-simpy | 15 | sphinxcontrib-actdiag | 15 | sphinxcontrib-nwdiag | 15 | + unearth | 15 | + gtextfsm | 14 | + pdm | 14 | policyd-rate-limit | 14 | - pykwalify | 14 | python-inotify | 14 | python-pem | 14 | python-pyalsa | 14 | + python-pysubs2 | 14 | gmplot | 13 | - gtextfsm | 13 | - pdm | 13 | pylint-common | 13 | python-dbussy | 13 | - python-pysubs2 | 13 | - ruff | 13 | - unearth | 13 | ansi | 12 | flask-security | 12 | jschema-to-python | 12 | @@ -175,30 +174,32 @@ Last-Update: Sun, 15 Jun 2025 01:42:12 +0000 python-pyscss | 12 | python-sarif-python-om | 12 | python-xtermcolor | 12 | - slimit | 12 | + ruff | 12 | btchip-python | 11 | django-auditlog | 11 | python-ethtool | 11 | + slimit | 11 | todoman | 11 | txt2tags | 11 | autotiling | 10 | + beancount | 10 | debiancontributors | 10 | drf-yasg-nonfree | 10 | - notebook-shim | 10 | - pwntools | 10 | python-aiohttp-security | 10 | python-crcelk | 10 | python-digitalocean | 10 | python-drf-spectacular-sidecar-nonfree | 10 | python-parse-type | 10 | - beancount | 9 | + sphinx-intl | 10 | django-sass | 9 | flask-session | 9 | + notebook-shim | 9 | + pwntools | 9 | python-overpy | 9 | speaklater | 9 | - sphinx-intl | 9 | traittypes | 9 | tuna | 9 | + beancount | 8 | clustershell | 8 | flask-paranoid | 8 | graphql-relay | 8 | @@ -210,7 +211,7 @@ Last-Update: Sun, 15 Jun 2025 01:42:12 +0000 python-numpysane | 8 | python-pyld | 8 | trac-wysiwyg | 8 | - beancount | 7 | + voltron | 8 | clustershell | 7 | drf-extensions | 7 | easyprocess | 7 | @@ -218,8 +219,6 @@ Last-Update: Sun, 15 Jun 2025 01:42:12 +0000 pytest-django | 7 | python-versioneer | 7 | python-xdo | 7 | - securestring | 7 | - voltron | 7 | django-model-utils | 6 | django-pglocks | 6 | hachoir | 6 | @@ -229,8 +228,6 @@ Last-Update: Sun, 15 Jun 2025 01:42:12 +0000 pytaglib | 6 | pytest-runner | 6 | python3-onelogin-saml2 | 6 | - python-biplist | 6 | - python-openstep-plist | 6 | python-pyaml-env | 6 | drf-haystack | 5 | flufl.testing | 5 | @@ -240,12 +237,15 @@ Last-Update: Sun, 15 Jun 2025 01:42:12 +0000 pyjokes | 5 | pynliner | 5 | python-ansicolors | 5 | + python-biplist | 5 | python-dirq | 5 | python-gnuplotlib | 5 | python-jpype | 5 | + python-openstep-plist | 5 | ruff | 5 | - sorl-thumbnail | 5 | + securestring | 5 | sphinxcontrib-globalsubs | 5 | + aiomysql | 4 | azote | 4 | cram | 4 | django-jinja | 4 | @@ -257,10 +257,12 @@ Last-Update: Sun, 15 Jun 2025 01:42:12 +0000 python-halo | 4 | python-simpy | 4 | python-srp | 4 | + smem | 4 | + sorl-thumbnail | 4 | utidylib | 4 | west | 4 | - aiomysql | 3 | bootstrap-flask | 3 | + cplay-ng | 3 | django-bitfield | 3 | django-js-reverse | 3 | django-redis-sessions | 3 | @@ -270,11 +272,10 @@ Last-Update: Sun, 15 Jun 2025 01:42:12 +0000 django-xmlrpc | 3 | etm | 3 | extension-helpers | 3 | - flake8-black | 3 | logilab-constraint | 3 | mbed-test-wrapper | 3 | + panoramisk | 3 | proglog | 3 | - pyclamd | 3 | pyfltk | 3 | pyprind | 3 | pytest-expect | 3 | @@ -287,19 +288,17 @@ Last-Update: Sun, 15 Jun 2025 01:42:12 +0000 python-dynaconf | 3 | python-ipfix | 3 | python-markuppy | 3 | - python-netfilterqueue | 3 | python-networkmanager | 3 | + python-text-unidecode | 3 | requests-aws | 3 | s3ql | 3 | slimit | 3 | - smem | 3 | sphinx-markdown-tables | 3 | trac-accountmanager | 3 | vf1 | 3 | backupchecker | 2 | bqplot | 2 | brebis | 2 | - cplay-ng | 2 | django-ajax-selects | 2 | django-any-js | 2 | django-cachalot | 2 | @@ -312,6 +311,7 @@ Last-Update: Sun, 15 Jun 2025 01:42:12 +0000 django-pagination | 2 | django-yarnpkg | 2 | dotdrop | 2 | + flake8-black | 2 | flask-flatpages | 2 | flask-mongoengine | 2 | flask-paginate | 2 | @@ -324,8 +324,9 @@ Last-Update: Sun, 15 Jun 2025 01:42:12 +0000 namecheap | 2 | okasha | 2 | orsopy | 2 | - panoramisk | 2 | + pyclamd | 2 | pyjunitxml | 2 | + pykwalify | 2 | pypass | 2 | pyroma | 2 | python-bitbucket-api | 2 | @@ -338,17 +339,17 @@ Last-Update: Sun, 15 Jun 2025 01:42:12 +0000 python-funcy | 2 | python-gammu | 2 | python-getdns | 2 | - python-kanboard | 2 | + python-netfilterqueue | 2 | python-openshift | 2 | python-opentracing | 2 | python-pgmagick | 2 | python-qtpynodeeditor | 2 | python-securesystemslib | 2 | - python-text-unidecode | 2 | python-webdavclient | 2 | testrepository | 2 | trac-xmlrpc | 2 | vcversioner | 2 | + vrfydmn | 2 | wikitrans | 2 | yotta | 2 | celery-progress | 1 | @@ -362,17 +363,20 @@ Last-Update: Sun, 15 Jun 2025 01:42:12 +0000 milksnake | 1 | mkdocs-macros-plugin | 1 | moviepy | 1 | + myst-nb | 1 | omgifol | 1 | onetimepass | 1 | - pykwalify | 1 | + panoramisk | 1 | pylint-celery | 1 | pynag | 1 | pyrad | 1 | python-bottle-cork | 1 | + python-briefcase | 1 | python-fluent-logger | 1 | python-fudge | 1 | python-genson | 1 | python-gfloat | 1 | + python-kanboard | 1 | python-libguess | 1 | python-meld3 | 1 | python-netfilter | 1 | @@ -382,7 +386,6 @@ Last-Update: Sun, 15 Jun 2025 01:42:12 +0000 python-pypump | 1 | python-py-zipkin | 1 | python-schedutils | 1 | - python-spur | 1 | python-undetected-chromedriver | 1 | python-urlobject | 1 | python-zc.customdoctests | 1 | @@ -394,7 +397,6 @@ Last-Update: Sun, 15 Jun 2025 01:42:12 +0000 trac-customfieldadmin | 1 | trac-httpauth | 1 | vncdotool | 1 | - vrfydmn | 1 | wchartype | 1 | wikitrans | 1 | zabbix-cli | 1 | @@ -453,7 +455,6 @@ Last-Update: Sun, 15 Jun 2025 01:42:12 +0000 mssql-django | 0 | mwoauth | 0 | mypaint | 0 | - myst-nb | 0 | nbgitpuller | 0 | okasha | 0 | pacparser | 0 | @@ -538,6 +539,7 @@ Last-Update: Sun, 15 Jun 2025 01:42:12 +0000 python-simpy | 0 | python-socketpool | 0 | python-sphinx-examples | 0 | + python-spur | 0 | python-tatsu | 0 | python-tatsu-lts | 0 | python-vega-datasets | 0 | @@ -591,5 +593,5 @@ Last-Update: Sun, 15 Jun 2025 01:42:12 +0000 sphinxcontrib-emojicodes | -1 | symmetrize | -1 | trac-tickettemplate | -1 | -(604 rows) +(606 rows) View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/3209fa1624450a864575a0eb6ef746cd4ab889be -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/3209fa1624450a864575a0eb6ef746cd4ab889be You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Mon Jun 16 02:43:35 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Mon, 16 Jun 2025 01:43:35 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <684f76c78556a_3dbd789300318878@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: 974bf54b by Andreas Tille at 2025-06-16T01:43:31+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Sun, 15 Jun 2025 13:42:04 +0000 +Last-Update: Mon, 16 Jun 2025 01:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- ===================================== debian-science-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Sun, 15 Jun 2025 13:42:08 +0000 +Last-Update: Mon, 16 Jun 2025 01:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Sun, 15 Jun 2025 13:42:12 +0000 +Last-Update: Mon, 16 Jun 2025 01:42:05 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/974bf54b6349edc800db7f44fcb481aa4c66f193 -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/974bf54b6349edc800db7f44fcb481aa4c66f193 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Mon Jun 16 14:43:26 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Mon, 16 Jun 2025 13:43:26 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <68501f7ece757_3db12b67cc432703d0@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: d2df1ee8 by Andreas Tille at 2025-06-16T13:43:20+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,27 +1,26 @@ -Last-Update: Mon, 16 Jun 2025 01:42:04 +0000 +Last-Update: Mon, 16 Jun 2025 13:42:03 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- dicomscope | 31 | {imaging} | orthanc-gdcm | 16 | {imaging} | + oscar | 15 | {data,practice,tools} | mrtrix3 | 14 | {imaging} | - oscar | 14 | {data,practice,tools} | king | 11 | {typesetting,imaging} | - adun.app | 10 | {bio} | gnumed-server | 10 | {covid-19,practice} | orthanc-mysql | 10 | {imaging} | pixelmed | 10 | {imaging} | sight | 10 | {imaging} | + adun.app | 9 | {bio} | orthanc-postgresql | 9 | {imaging} | bart-view | 8 | {imaging} | - heudiconv | 7 | {imaging} | + heudiconv | 6 | {imaging} | jebl2 | 6 | {bio-dev} | icb-utils | 5 | {bio-dev} | libminc | 5 | {imaging-dev} | mia | 5 | {imaging} | biojava-live | 4 | {bio-dev} | beast-mcmc | 3 | {bio,bio-phylogeny} | - bio-tradis | 3 | {bio,bio-dev} | cmtk | 3 | {imaging} | getdata | 3 | {bio} | insighttoolkit5 | 3 | {imaging-dev} | @@ -30,11 +29,11 @@ Last-Update: Mon, 16 Jun 2025 01:42:04 +0000 piler | 3 | {bio} | sight | 3 | {imaging} | biojava6-live | 2 | {bio-dev} | + bio-tradis | 2 | {bio,bio-dev} | elastix | 2 | {imaging} | fastml | 2 | {bio} | ipig | 2 | {bio} | plasmidid | 2 | {covid-19,bio} | - python-seqcluster | 2 | {covid-19,bio-dev} | staden | 2 | {bio} | ants | 1 | {imaging} | blimps | 1 | {bio} | @@ -57,6 +56,7 @@ Last-Update: Mon, 16 Jun 2025 01:42:04 +0000 papyrus | 1 | {imaging-dev} | phyutility | 1 | {cloud,bio} | proalign | 1 | {bio-phylogeny,bio} | + python-seqcluster | 1 | {covid-19,bio-dev} | rambo-k | 1 | {bio} | runcircos-gui | 1 | {bio} | seq-gen | 1 | {bio} | ===================================== debian-science-tests.txt ===================================== @@ -1,124 +1,126 @@ -Last-Update: Mon, 16 Jun 2025 01:42:04 +0000 +Last-Update: Mon, 16 Jun 2025 13:42:08 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- - nltk | 4850 | {linguistics} | - gts | 4785 | {viewing} | - opencascade | 622 | {simulations} | - spacenavd | 219 | {tools} | - open-coarrays | 188 | {meteorology-dev} | - armadillo | 178 | {mathematics-dev} | - arpack | 89 | {mathematics-dev} | - scalapack | 52 | {nanoscale-physics-dev} | + nltk | 4854 | {linguistics} | + gts | 4755 | {viewing} | + opencascade | 615 | {simulations} | + spacenavd | 220 | {tools} | + armadillo | 179 | {mathematics-dev} | + open-coarrays | 178 | {meteorology-dev} | + arpack | 87 | {mathematics-dev} | + scalapack | 49 | {nanoscale-physics-dev} | + visidata | 44 | {datamanagement} | ntl | 43 | {mathematics-dev} | - visidata | 43 | {datamanagement} | - imview | 36 | {viewing} | mbpoll | 36 | {simulations} | - ppl | 35 | {numericalcomputation} | - libmatio | 31 | {mathematics-dev} | + imview | 35 | {viewing} | + ppl | 34 | {numericalcomputation} | + arduino-mk | 30 | {robotics} | flintqs | 30 | {mathematics} | - arduino-mk | 29 | {robotics} | + libmatio | 30 | {mathematics-dev} | cliquer | 28 | {mathematics} | - libm4ri | 25 | {mathematics-dev} | + libm4ri | 26 | {mathematics-dev} | flann | 23 | {mathematics-dev,engineering-dev} | xygrib | 23 | {meteorology} | - grads | 22 | {meteorology} | - sat4j | 20 | {logic} | + grads | 21 | {meteorology} | + sat4j | 21 | {logic} | + setzer | 20 | {typesetting} | bossa | 19 | {devices} | - setzer | 19 | {typesetting} | + guiqwt | 18 | {numericalcomputation,viewing} | + picosat | 18 | {logic} | fftw | 17 | {mathematics-dev,physics-dev,meteorology-dev} | - guiqwt | 17 | {numericalcomputation,viewing} | - picosat | 17 | {logic} | lrcalc | 16 | {mathematics-dev} | ncl | 16 | {meteorology} | pyzo | 16 | {numericalcomputation} | sketch | 16 | {typesetting} | cliquer | 15 | {mathematics-dev} | eccodes | 15 | {meteorology,meteorology-dev} | - gts | 14 | {viewing-dev} | gf2x | 13 | {mathematics-dev} | + gts | 13 | {viewing-dev} | iml | 13 | {mathematics-dev} | libhomfly | 13 | {mathematics-dev} | + libitpp | 13 | {mathematics-dev,engineering-dev} | dune-uggrid | 12 | {mathematics-dev} | feff85exafs | 12 | {chemistry} | - form | 12 | {mathematics} | - libitpp | 12 | {mathematics-dev,engineering-dev} | teem | 12 | {imageanalysis} | coinor-symphony | 11 | {logic,mathematics,numericalcomputation} | feedgnuplot | 11 | {viewing} | - libm4rie | 11 | {mathematics-dev} | - matlab-support | 11 | {mathematics,numericalcomputation} | + form | 11 | {mathematics} | + eccodes | 10 | {meteorology-dev} | + libm4rie | 10 | {mathematics-dev} | lxi-tools | 10 | {engineering,dataacquisition} | + matlab-support | 10 | {mathematics,numericalcomputation} | python-cdo | 10 | {meteorology} | ros-rosconsole | 10 | {robotics-dev} | - eccodes | 9 | {meteorology-dev} | geg | 9 | {viewing} | - libzn-poly | 9 | {mathematics-dev} | - pcl | 9 | {robotics-dev} | python-escript | 9 | {numericalcomputation,simulations,engineering} | ratpoints | 9 | {mathematics-dev} | vdt | 9 | {mathematics-dev} | dxsamples | 8 | {nanoscale-physics} | + libzn-poly | 8 | {mathematics-dev} | metar | 8 | {meteorology} | ncl | 8 | {meteorology-dev} | + pcl | 8 | {robotics-dev} | persalys | 8 | {engineering,statistics,mathematics} | + uctodata | 8 | {linguistics} | apophenia | 7 | {statistics} | magics++ | 7 | {meteorology-dev} | odc | 7 | {meteorology-dev} | odc | 7 | {meteorology} | - uctodata | 7 | {linguistics} | + ucto | 7 | {linguistics} | alberta | 6 | {engineering-dev} | + cld2 | 6 | {linguistics} | fpzip | 6 | {meteorology} | libccp4 | 6 | {nanoscale-physics-dev} | metview | 6 | {meteorology} | + opencascade | 6 | {simulations} | persalys | 6 | {statistics,mathematics,engineering} | psurface | 6 | {numericalcomputation} | refmac-dictionary | 6 | {highenergy-physics-dev,chemistry} | rheolef | 6 | {mathematics} | ros-vcstool | 6 | {robotics-dev} | toulbar2 | 6 | {logic,numericalcomputation,mathematics,physics} | - ucto | 6 | {linguistics} | atlas-ecmwf | 5 | {meteorology} | auto-07p | 5 | {mathematics} | - cld2 | 5 | {linguistics} | - coda | 5 | {meteorology} | coda | 5 | {meteorology-dev} | + coda | 5 | {meteorology} | + debian-science | 5 | {economics,nanoscale-physics,machine-learning,physics,mathematics} | etsf-io | 5 | {physics,nanoscale-physics} | gsw | 5 | {meteorology} | iapws | 5 | {meteorology} | - opencascade | 5 | {simulations} | + irstlm | 5 | {linguistics} | rubiks | 5 | {geometry,mathematics} | - urdfdom-headers | 5 | {robotics-dev} | cmor | 4 | {meteorology} | - debian-science | 4 | {economics,nanoscale-physics,machine-learning,physics,mathematics} | + debian-science | 4 | {physics,machine-learning,economics,nanoscale-physics} | drslib | 4 | {meteorology} | fftw | 4 | {meteorology-dev,mathematics-dev,physics-dev} | - irstlm | 4 | {linguistics} | libxsmm | 4 | {mathematics-dev} | lrcalc | 4 | {mathematics} | + muparser | 4 | {mathematics-dev} | silo-llnl | 4 | {engineering} | + urdfdom-headers | 4 | {robotics-dev} | veccore | 4 | {mathematics-dev} | apertium-eval-translator | 3 | {linguistics} | cylc-flow | 3 | {meteorology} | - debian-science | 3 | {physics,machine-learning,economics,nanoscale-physics} | + debian-science | 3 | {nanoscale-physics,statistics,economics,physics} | + dimbl | 3 | {linguistics} | dune-functions | 3 | {mathematics-dev} | dune-localfunctions | 3 | {mathematics-dev} | dune-typetree | 3 | {mathematics-dev} | dxflib | 3 | {engineering-dev} | ecbuild | 3 | {meteorology-dev} | - emoslib | 3 | {meteorology-dev} | emoslib | 3 | {meteorology} | + emoslib | 3 | {meteorology-dev} | + frog | 3 | {linguistics} | getdp | 3 | {engineering,mathematics,simulations} | harp | 3 | {meteorology} | hdf-eos5 | 3 | {meteorology-dev} | ipe-tools | 3 | {typesetting} | libcgns | 3 | {engineering} | libgctp | 3 | {meteorology-dev} | - libgtkdatabox | 3 | {engineering-dev,viewing-dev} | libmatheval | 3 | {mathematics} | metkit | 3 | {meteorology} | mpi4py-fft | 3 | {mathematics-dev} | - muparser | 3 | {mathematics-dev} | newmat | 3 | {mathematics-dev} | sac2mseed | 3 | {geography} | sardana | 3 | {dataacquisition} | @@ -129,18 +131,19 @@ Last-Update: Mon, 16 Jun 2025 01:42:04 +0000 apophenia | 2 | {statistics} | atlas-ecmwf | 2 | {meteorology-dev} | code-saturne | 2 | {mathematics-dev,engineering-dev} | - debian-science | 2 | {nanoscale-physics,statistics,economics,physics} | debian-science | 2 | {economics} | - dimbl | 2 | {linguistics} | + debian-science | 2 | {neuroscience-cognitive,machine-learning} | fastjet | 2 | {highenergy-physics-dev} | - frog | 2 | {linguistics} | hpcc | 2 | {numericalcomputation,distributedcomputing} | ipe-tools | 2 | {typesetting} | libcgns | 2 | {engineering-dev} | libcvd | 2 | {imageanalysis} | + libgtkdatabox | 2 | {engineering-dev,viewing-dev} | liblbfgs | 2 | {mathematics-dev} | libmatheval | 2 | {mathematics-dev} | libvigraimpex | 2 | {imageanalysis-dev,machine-learning} | + mbt | 2 | {linguistics} | + mbtserver | 2 | {linguistics} | mseed2sac | 2 | {dataacquisition-dev} | ncrystal | 2 | {nanoscale-physics-dev,highenergy-physics-dev} | openstereogram | 2 | {tools} | @@ -151,6 +154,8 @@ Last-Update: Mon, 16 Jun 2025 01:42:04 +0000 scram | 2 | {engineering} | silo-llnl | 2 | {engineering-dev} | syrthes | 2 | {engineering} | + timbl | 2 | {linguistics} | + timblserver | 2 | {linguistics} | toon | 2 | {numericalcomputation} | x13as | 2 | {economics} | apertium-streamparser | 1 | {linguistics} | @@ -161,9 +166,9 @@ Last-Update: Mon, 16 Jun 2025 01:42:04 +0000 coinmp | 1 | {logic,mathematics-dev,numericalcomputation} | coinor-bonmin | 1 | {mathematics} | debian-science | 1 | {tools} | - debian-science | 1 | {neuroscience-cognitive} | - debian-science | 1 | {neuroscience-cognitive,machine-learning} | debian-science | 1 | {electrophysiology} | + debian-science | 1 | {neuroscience-cognitive} | + debian-science | 1 | {nanoscale-physics-dev} | fpzip | 1 | {meteorology-dev} | frogdata | 1 | {linguistics} | gadap | 1 | {meteorology-dev} | @@ -174,13 +179,10 @@ Last-Update: Mon, 16 Jun 2025 01:42:04 +0000 liblxi | 1 | {engineering-dev,dataacquisition-dev} | liborigin2 | 1 | {viewing-dev} | looptools | 1 | {highenergy-physics-dev} | - mbt | 1 | {linguistics} | - mbtserver | 1 | {linguistics} | metkit | 1 | {meteorology-dev} | mmdb | 1 | {nanoscale-physics-dev,highenergy-physics-dev} | mrmpi | 1 | {tools} | nrn-iv | 1 | {biology} | - nrn-mod2c | 1 | {biology} | psurface | 1 | {numericalcomputation} | qd | 1 | {mathematics-dev} | ros-ros-environment | 1 | {robotics-dev} | @@ -189,8 +191,6 @@ Last-Update: Mon, 16 Jun 2025 01:42:04 +0000 spaghetti | 1 | {geography} | ssm | 1 | {nanoscale-physics-dev} | tfdocgen | 1 | {linguistics} | - timbl | 1 | {linguistics} | - timblserver | 1 | {linguistics} | trilinos | 1 | {physics-dev,mathematics-dev,engineering-dev} | vlfeat | 1 | {imageanalysis-dev} | amgcl | 0 | {mathematics-dev} | @@ -212,9 +212,8 @@ Last-Update: Mon, 16 Jun 2025 01:42:04 +0000 cqrlib | 0 | {mathematics-dev} | cvector | 0 | {mathematics-dev} | debian-science | 0 | {physics} | - debian-science | 0 | {nanoscale-physics-dev} | - debian-science | 0 | {electrophysiology} | debian-science | 0 | {psychophysics} | + debian-science | 0 | {electrophysiology} | dune-grid-glue | 0 | {mathematics-dev} | etsf-io | 0 | {nanoscale-physics-dev} | fastjet | 0 | {highenergy-physics-dev} | @@ -234,6 +233,7 @@ Last-Update: Mon, 16 Jun 2025 01:42:04 +0000 metis-edf | 0 | {engineering,numericalcomputation} | metis-edf | 0 | {engineering-dev} | neartree | 0 | {mathematics-dev,numericalcomputation} | + nrn-mod2c | 0 | {biology} | openctm | 0 | {physics-dev} | opengv | 0 | {geometry} | openigtlink | 0 | {robotics-dev} | @@ -244,8 +244,8 @@ Last-Update: Mon, 16 Jun 2025 01:42:04 +0000 quadrule | 0 | {mathematics-dev} | robot-testing-framework | 0 | {robotics-dev} | ros-collada-urdf | 0 | {robotics} | - ros-metapackages | 0 | {robotics} | ros-metapackages | 0 | {robotics-dev} | + ros-metapackages | 0 | {robotics} | ros-opencv-apps | 0 | {robotics} | sagemath-database-combinatorial-designs | 0 | {mathematics} | sagemath-database-cremona-elliptic-curves | 0 | {mathematics} | ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,207 +1,208 @@ -Last-Update: Mon, 16 Jun 2025 01:42:05 +0000 +Last-Update: Mon, 16 Jun 2025 13:42:11 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- - mpmath | 10017 | - python-repoze.lru | 6993 | - netifaces | 5151 | - ghp-import | 4801 | - python-lunr | 4796 | - python-babel | 4064 | - sortedcontainers | 3717 | - python-babel | 3589 | - aiosignal | 2925 | - hyperlink | 2172 | - python-notify2 | 2049 | - humanfriendly | 1975 | - referencing | 1540 | - python-mysqldb | 1513 | - python-gssapi | 1412 | - python-invoke | 1387 | - python-hyperframe | 1357 | - websocket-client | 1327 | - python-pandocfilters | 1246 | - python-hpack | 1148 | - python-rsa | 1128 | - pdfarranger | 991 | - menulibre | 953 | - python-linux-procfs | 924 | - python-geoip | 880 | - python-webob | 846 | - powerline | 772 | - firmware-microbit-micropython | 736 | - powerline | 726 | - powerline | 721 | - autopep8 | 705 | + mpmath | 10038 | + python-repoze.lru | 6975 | + netifaces | 5158 | + ghp-import | 4803 | + python-lunr | 4798 | + python-babel | 3960 | + sortedcontainers | 3634 | + python-babel | 3509 | + aiosignal | 2920 | + hyperlink | 2175 | + python-notify2 | 2043 | + humanfriendly | 1978 | + referencing | 1532 | + python-mysqldb | 1502 | + python-gssapi | 1411 | + python-invoke | 1382 | + python-hyperframe | 1356 | + websocket-client | 1323 | + python-pandocfilters | 1160 | + python-hpack | 1150 | + python-rsa | 1129 | + pdfarranger | 983 | + menulibre | 947 | + python-linux-procfs | 920 | + python-geoip | 882 | + python-webob | 842 | + powerline | 771 | + firmware-microbit-micropython | 733 | + powerline | 728 | + powerline | 723 | kazam | 674 | - u-msgpack-python | 616 | - pytoolconfig | 613 | - python-zopfli | 608 | - gaupol | 538 | - asn1crypto | 528 | - dockerpty | 523 | - python-et-xmlfile | 518 | - python-gevent | 494 | - python-ewmh | 440 | - catfish | 425 | - python-requests-oauthlib | 400 | - python-toml | 356 | + python-zopfli | 628 | + autopep8 | 621 | + u-msgpack-python | 615 | + gaupol | 534 | + pytoolconfig | 530 | + dockerpty | 526 | + asn1crypto | 518 | + python-et-xmlfile | 513 | + python-gevent | 496 | + python-ewmh | 438 | + catfish | 416 | + python-requests-oauthlib | 401 | + python-toml | 355 | spf-engine | 343 | - python-ntlm-auth | 317 | - spf-engine | 292 | - django-stronghold | 259 | - python-ldap3 | 232 | + python-ntlm-auth | 307 | + spf-engine | 294 | + django-stronghold | 257 | + python-ldap3 | 236 | cairocffi | 217 | - python-mimeparse | 196 | - python-smmap | 181 | - python-hidapi | 168 | - autokey | 167 | - python-anyjson | 153 | - httpie | 151 | - smem | 147 | + python-mimeparse | 197 | + python-smmap | 180 | + python-hidapi | 170 | + autokey | 164 | + python-anyjson | 155 | + httpie | 147 | + smem | 145 | kivy | 132 | - python-aiostream | 124 | - python-click-repl | 120 | - smartypants | 116 | - lollypop | 106 | - mypaint | 105 | - nodeenv | 104 | + python-aiostream | 125 | + python-click-repl | 123 | + smartypants | 119 | + nodeenv | 105 | + lollypop | 104 | + mypaint | 104 | timekpr-next | 101 | - python-pyu2f | 97 | - mugshot | 96 | + python-pyu2f | 98 | + mugshot | 95 | pacparser | 93 | python-consul | 92 | - pymacaroons | 89 | - python-rfc6555 | 84 | - pssh | 81 | - pymediainfo | 81 | - python-colour | 74 | - weasyprint | 74 | - numpy-stl | 72 | + pymacaroons | 90 | + pssh | 84 | + python-rfc6555 | 83 | + pymediainfo | 80 | + numpy-stl | 74 | + python-colour | 73 | python-i3ipc | 71 | + weasyprint | 71 | fabric | 69 | - python-pykka | 69 | + python-pykka | 68 | mitmproxy | 67 | - pywavelets | 61 | + pywavelets | 60 | ueberzug | 57 | python-looseversion | 55 | + python-scp | 55 | python-uritools | 55 | - python-scp | 54 | - itstool | 52 | pyenv | 52 | - mysql-connector-python | 50 | - hatchling | 46 | - pymacs | 46 | - khard | 45 | + mysql-connector-python | 51 | + itstool | 50 | + pymacs | 49 | + hatchling | 48 | + khard | 47 | + sshtunnel | 45 | blockdiag | 44 | - sshtunnel | 44 | - trac | 43 | - pyquery | 41 | - show-in-file-manager | 41 | + trac | 44 | + powerline-gitstatus | 40 | + pyquery | 40 | python-pysol-cards | 40 | + show-in-file-manager | 40 | membernator | 39 | - powerline-gitstatus | 39 | certipy | 38 | pylibmc | 38 | jupyterhub | 37 | + kivy | 37 | pamela | 37 | - persepolis | 37 | python-scrypt | 36 | + persepolis | 35 | pdfposter | 34 | - kivy | 30 | - pssh | 30 | + pssh | 32 | python-statsd | 30 | python-args | 28 | seqdiag | 28 | - dkimpy-milter | 27 | sphinxcontrib-blockdiag | 27 | + dkimpy-milter | 26 | + rst2pdf | 26 | sphinxcontrib-seqdiag | 26 | video-downloader | 26 | python-clint | 25 | - rst2pdf | 25 | + typogrify | 25 | depthcharge-tools | 24 | - typogrify | 24 | + flask-principal | 24 | cppman | 23 | - flask-principal | 23 | + python-fire | 23 | sphinx-inline-tabs | 23 | - webpy | 23 | enzyme | 22 | - python-fire | 22 | - backoff | 21 | + python-rangehttpserver | 22 | fabric | 21 | - python-rangehttpserver | 21 | python-zstd | 21 | subliminal | 21 | + webpy | 21 | alot | 20 | - python-translationstring | 20 | + backoff | 20 | + django-environ | 19 | nwdiag | 19 | nwg-displays | 19 | + python-translationstring | 19 | social-auth-core | 19 | spf-engine | 19 | - django-environ | 18 | mistune0 | 18 | python-demjson | 18 | + python-sdnotify | 18 | subliminal | 18 | webtest | 18 | - python-hupper | 17 | - python-sdnotify | 16 | + pykwalify | 16 | + python-hupper | 16 | python-slip10 | 16 | sphinxcontrib-log-cabinet | 16 | actdiag | 15 | - pykwalify | 15 | + policyd-rate-limit | 15 | python-kyotocabinet | 15 | python-priority | 15 | python-simpy | 15 | sphinxcontrib-actdiag | 15 | sphinxcontrib-nwdiag | 15 | unearth | 15 | - gtextfsm | 14 | + flask-security | 14 | pdm | 14 | - policyd-rate-limit | 14 | - python-inotify | 14 | python-pem | 14 | python-pyalsa | 14 | python-pysubs2 | 14 | gmplot | 13 | + gtextfsm | 13 | + junos-eznc | 13 | pylint-common | 13 | python-dbussy | 13 | + python-inotify | 13 | + python-pyscss | 13 | + python-xtermcolor | 13 | ansi | 12 | - flask-security | 12 | - jschema-to-python | 12 | - junos-eznc | 12 | pyp | 12 | python-pyrss2gen | 12 | - python-pyscss | 12 | - python-sarif-python-om | 12 | - python-xtermcolor | 12 | ruff | 12 | + todoman | 12 | + beancount | 11 | btchip-python | 11 | django-auditlog | 11 | + jschema-to-python | 11 | python-ethtool | 11 | + python-sarif-python-om | 11 | slimit | 11 | - todoman | 11 | + speaklater | 11 | txt2tags | 11 | autotiling | 10 | - beancount | 10 | debiancontributors | 10 | + django-sass | 10 | drf-yasg-nonfree | 10 | + flask-paranoid | 10 | + notebook-shim | 10 | python-aiohttp-security | 10 | python-crcelk | 10 | python-digitalocean | 10 | python-drf-spectacular-sidecar-nonfree | 10 | + python-overpy | 10 | python-parse-type | 10 | - sphinx-intl | 10 | - django-sass | 9 | - flask-session | 9 | - notebook-shim | 9 | pwntools | 9 | - python-overpy | 9 | - speaklater | 9 | + sphinx-intl | 9 | traittypes | 9 | tuna | 9 | beancount | 8 | clustershell | 8 | - flask-paranoid | 8 | + drf-extensions | 8 | + flask-session | 8 | graphql-relay | 8 | httpcode | 8 | mercurial-evolve | 8 | @@ -213,30 +214,31 @@ Last-Update: Mon, 16 Jun 2025 01:42:05 +0000 trac-wysiwyg | 8 | voltron | 8 | clustershell | 7 | - drf-extensions | 7 | + django-model-utils | 7 | easyprocess | 7 | + htmlmin | 7 | pydrive2 | 7 | + pytaglib | 7 | pytest-django | 7 | python-versioneer | 7 | python-xdo | 7 | - django-model-utils | 6 | django-pglocks | 6 | - hachoir | 6 | - htmlmin | 6 | + drf-haystack | 6 | librouteros | 6 | - mypy-protobuf | 6 | - pytaglib | 6 | - pytest-runner | 6 | python3-onelogin-saml2 | 6 | + python-ansicolors | 6 | python-pyaml-env | 6 | - drf-haystack | 5 | + django-jinja | 5 | + django-paintstore | 5 | + flask-api | 5 | flufl.testing | 5 | + hachoir | 5 | htmlmin | 5 | kconfiglib | 5 | + mypy-protobuf | 5 | numpy-stl | 5 | pyjokes | 5 | pynliner | 5 | - python-ansicolors | 5 | python-biplist | 5 | python-dirq | 5 | python-gnuplotlib | 5 | @@ -245,54 +247,56 @@ Last-Update: Mon, 16 Jun 2025 01:42:05 +0000 ruff | 5 | securestring | 5 | sphinxcontrib-globalsubs | 5 | + west | 5 | aiomysql | 4 | azote | 4 | cram | 4 | - django-jinja | 4 | - django-paintstore | 4 | - flask-api | 4 | + django-bitfield | 4 | + django-js-reverse | 4 | + django-redis-sessions | 4 | + django-simple-redis-admin | 4 | + django-xmlrpc | 4 | imap-tools | 4 | pycallgraph | 4 | + pytest-runner | 4 | python-dbus-next | 4 | + python-django-casclient | 4 | + python-django-contact-form | 4 | + python-django-registration | 4 | python-halo | 4 | + python-markuppy | 4 | python-simpy | 4 | python-srp | 4 | - smem | 4 | sorl-thumbnail | 4 | utidylib | 4 | - west | 4 | bootstrap-flask | 3 | cplay-ng | 3 | - django-bitfield | 3 | - django-js-reverse | 3 | - django-redis-sessions | 3 | + django-macaddress | 3 | + django-pagination | 3 | django-render-block | 3 | - django-simple-redis-admin | 3 | django-templated-email | 3 | - django-xmlrpc | 3 | etm | 3 | extension-helpers | 3 | + flask-flatpages | 3 | + flask-mongoengine | 3 | logilab-constraint | 3 | mbed-test-wrapper | 3 | panoramisk | 3 | proglog | 3 | pyfltk | 3 | + pyjunitxml | 3 | pyprind | 3 | pytest-expect | 3 | python-btrees | 3 | python-cookies | 3 | - python-django-casclient | 3 | - python-django-contact-form | 3 | python-django-push-notifications | 3 | - python-django-registration | 3 | python-dynaconf | 3 | python-ipfix | 3 | - python-markuppy | 3 | python-networkmanager | 3 | - python-text-unidecode | 3 | requests-aws | 3 | s3ql | 3 | slimit | 3 | + smem | 3 | sphinx-markdown-tables | 3 | trac-accountmanager | 3 | vf1 | 3 | @@ -306,14 +310,10 @@ Last-Update: Mon, 16 Jun 2025 01:42:05 +0000 django-celery-email | 2 | django-cleanup | 2 | django-graphene | 2 | - django-macaddress | 2 | django-maintenance-mode | 2 | - django-pagination | 2 | django-yarnpkg | 2 | dotdrop | 2 | flake8-black | 2 | - flask-flatpages | 2 | - flask-mongoengine | 2 | flask-paginate | 2 | fypp | 2 | gtkman | 2 | @@ -325,7 +325,6 @@ Last-Update: Mon, 16 Jun 2025 01:42:05 +0000 okasha | 2 | orsopy | 2 | pyclamd | 2 | - pyjunitxml | 2 | pykwalify | 2 | pypass | 2 | pyroma | 2 | @@ -345,8 +344,8 @@ Last-Update: Mon, 16 Jun 2025 01:42:05 +0000 python-pgmagick | 2 | python-qtpynodeeditor | 2 | python-securesystemslib | 2 | + python-text-unidecode | 2 | python-webdavclient | 2 | - testrepository | 2 | trac-xmlrpc | 2 | vcversioner | 2 | vrfydmn | 2 | @@ -354,7 +353,6 @@ Last-Update: Mon, 16 Jun 2025 01:42:05 +0000 yotta | 2 | celery-progress | 1 | codicefiscale | 1 | - enlighten | 1 | errbot | 1 | flask-multistatic | 1 | jpy | 1 | @@ -367,11 +365,11 @@ Last-Update: Mon, 16 Jun 2025 01:42:05 +0000 omgifol | 1 | onetimepass | 1 | panoramisk | 1 | + power | 1 | pylint-celery | 1 | pynag | 1 | pyrad | 1 | python-bottle-cork | 1 | - python-briefcase | 1 | python-fluent-logger | 1 | python-fudge | 1 | python-genson | 1 | @@ -394,6 +392,7 @@ Last-Update: Mon, 16 Jun 2025 01:42:05 +0000 soundcraft-utils | 1 | sphinx-paramlinks | 1 | sphinxtesters | 1 | + testrepository | 1 | trac-customfieldadmin | 1 | trac-httpauth | 1 | vncdotool | 1 | @@ -461,7 +460,6 @@ Last-Update: Mon, 16 Jun 2025 01:42:05 +0000 panoramisk | 0 | parsimonious | 0 | portio | 0 | - power | 0 | powerline | 0 | powerline-gitstatus | 0 | prospector | 0 | @@ -477,7 +475,6 @@ Last-Update: Mon, 16 Jun 2025 01:42:05 +0000 pylibmc | 0 | pymediainfo | 0 | pyment | 0 | - py-nextbusnext | 0 | pyssim | 0 | python3-simpleobsws | 0 | python-aiohttp-security | 0 | @@ -593,5 +590,5 @@ Last-Update: Mon, 16 Jun 2025 01:42:05 +0000 sphinxcontrib-emojicodes | -1 | symmetrize | -1 | trac-tickettemplate | -1 | -(606 rows) +(603 rows) View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/d2df1ee8a1de7fbd844e030127005af3d921ba6f -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/d2df1ee8a1de7fbd844e030127005af3d921ba6f You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Tue Jun 17 02:43:39 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Tue, 17 Jun 2025 01:43:39 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <6850c84bdd009_3db12b67cc43398472@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: 2484dc86 by Andreas Tille at 2025-06-17T01:43:35+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Mon, 16 Jun 2025 13:42:03 +0000 +Last-Update: Tue, 17 Jun 2025 01:42:03 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- ===================================== debian-science-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Mon, 16 Jun 2025 13:42:08 +0000 +Last-Update: Tue, 17 Jun 2025 01:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Mon, 16 Jun 2025 13:42:11 +0000 +Last-Update: Tue, 17 Jun 2025 01:42:04 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/2484dc8699c34de0e2623b1c8d447455381813e9 -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/2484dc8699c34de0e2623b1c8d447455381813e9 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Tue Jun 17 14:43:34 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Tue, 17 Jun 2025 13:43:34 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <68517106a23d_3db165a321c3478785@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: 34def847 by Andreas Tille at 2025-06-17T13:43:27+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,9 +1,9 @@ -Last-Update: Tue, 17 Jun 2025 01:42:03 +0000 +Last-Update: Tue, 17 Jun 2025 13:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- - dicomscope | 31 | {imaging} | - orthanc-gdcm | 16 | {imaging} | + dicomscope | 30 | {imaging} | + orthanc-gdcm | 17 | {imaging} | oscar | 15 | {data,practice,tools} | mrtrix3 | 14 | {imaging} | king | 11 | {typesetting,imaging} | @@ -16,9 +16,9 @@ Last-Update: Tue, 17 Jun 2025 01:42:03 +0000 bart-view | 8 | {imaging} | heudiconv | 6 | {imaging} | jebl2 | 6 | {bio-dev} | + mia | 6 | {imaging} | icb-utils | 5 | {bio-dev} | libminc | 5 | {imaging-dev} | - mia | 5 | {imaging} | biojava-live | 4 | {bio-dev} | beast-mcmc | 3 | {bio,bio-phylogeny} | cmtk | 3 | {imaging} | @@ -53,6 +53,7 @@ Last-Update: Tue, 17 Jun 2025 01:42:03 +0000 libpal-java | 1 | {bio-dev} | librg-utils-perl | 1 | {bio} | mhap | 1 | {bio,bio-ngs} | + ncbi-vdb | 1 | {bio-dev} | papyrus | 1 | {imaging-dev} | phyutility | 1 | {cloud,bio} | proalign | 1 | {bio-phylogeny,bio} | @@ -121,7 +122,6 @@ Last-Update: Tue, 17 Jun 2025 01:42:03 +0000 mia | 0 | {imaging-dev} | milib | 0 | {covid-19,bio-dev} | mssstest | 0 | {tools} | - ncbi-vdb | 0 | {bio-dev} | opencfu | 0 | {laboratory} | orthanc-imagej | 0 | {imaging} | pbseqlib | 0 | {bio-dev} | ===================================== debian-science-tests.txt ===================================== @@ -1,154 +1,157 @@ -Last-Update: Tue, 17 Jun 2025 01:42:04 +0000 +Last-Update: Tue, 17 Jun 2025 13:42:08 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- - nltk | 4854 | {linguistics} | - gts | 4755 | {viewing} | - opencascade | 615 | {simulations} | + nltk | 4858 | {linguistics} | + gts | 4767 | {viewing} | + opencascade | 621 | {simulations} | spacenavd | 220 | {tools} | + open-coarrays | 180 | {meteorology-dev} | armadillo | 179 | {mathematics-dev} | - open-coarrays | 178 | {meteorology-dev} | - arpack | 87 | {mathematics-dev} | - scalapack | 49 | {nanoscale-physics-dev} | - visidata | 44 | {datamanagement} | - ntl | 43 | {mathematics-dev} | - mbpoll | 36 | {simulations} | + arpack | 88 | {mathematics-dev} | + scalapack | 51 | {nanoscale-physics-dev} | + visidata | 45 | {datamanagement} | + ntl | 42 | {mathematics-dev} | imview | 35 | {viewing} | - ppl | 34 | {numericalcomputation} | - arduino-mk | 30 | {robotics} | - flintqs | 30 | {mathematics} | - libmatio | 30 | {mathematics-dev} | - cliquer | 28 | {mathematics} | - libm4ri | 26 | {mathematics-dev} | - flann | 23 | {mathematics-dev,engineering-dev} | - xygrib | 23 | {meteorology} | + mbpoll | 35 | {simulations} | + ppl | 32 | {numericalcomputation} | + arduino-mk | 29 | {robotics} | + flintqs | 29 | {mathematics} | + libmatio | 29 | {mathematics-dev} | + cliquer | 27 | {mathematics} | + flann | 25 | {mathematics-dev,engineering-dev} | + libm4ri | 25 | {mathematics-dev} | grads | 21 | {meteorology} | sat4j | 21 | {logic} | - setzer | 20 | {typesetting} | + xygrib | 20 | {meteorology} | bossa | 19 | {devices} | + setzer | 19 | {typesetting} | + fftw | 18 | {mathematics-dev,physics-dev,meteorology-dev} | guiqwt | 18 | {numericalcomputation,viewing} | picosat | 18 | {logic} | - fftw | 17 | {mathematics-dev,physics-dev,meteorology-dev} | - lrcalc | 16 | {mathematics-dev} | - ncl | 16 | {meteorology} | - pyzo | 16 | {numericalcomputation} | - sketch | 16 | {typesetting} | - cliquer | 15 | {mathematics-dev} | - eccodes | 15 | {meteorology,meteorology-dev} | - gf2x | 13 | {mathematics-dev} | + pyzo | 17 | {numericalcomputation} | + sketch | 17 | {typesetting} | + lrcalc | 15 | {mathematics-dev} | + ncl | 15 | {meteorology} | + cliquer | 14 | {mathematics-dev} | + dune-uggrid | 14 | {mathematics-dev} | + eccodes | 14 | {meteorology,meteorology-dev} | gts | 13 | {viewing-dev} | - iml | 13 | {mathematics-dev} | - libhomfly | 13 | {mathematics-dev} | - libitpp | 13 | {mathematics-dev,engineering-dev} | - dune-uggrid | 12 | {mathematics-dev} | + teem | 13 | {imageanalysis} | feff85exafs | 12 | {chemistry} | - teem | 12 | {imageanalysis} | + gf2x | 12 | {mathematics-dev} | + libitpp | 12 | {mathematics-dev,engineering-dev} | coinor-symphony | 11 | {logic,mathematics,numericalcomputation} | - feedgnuplot | 11 | {viewing} | form | 11 | {mathematics} | + iml | 11 | {mathematics-dev} | + libhomfly | 11 | {mathematics-dev} | + matlab-support | 11 | {mathematics,numericalcomputation} | eccodes | 10 | {meteorology-dev} | - libm4rie | 10 | {mathematics-dev} | + feedgnuplot | 10 | {viewing} | lxi-tools | 10 | {engineering,dataacquisition} | - matlab-support | 10 | {mathematics,numericalcomputation} | - python-cdo | 10 | {meteorology} | - ros-rosconsole | 10 | {robotics-dev} | - geg | 9 | {viewing} | + vdt | 10 | {mathematics-dev} | + libm4rie | 9 | {mathematics-dev} | + python-cdo | 9 | {meteorology} | python-escript | 9 | {numericalcomputation,simulations,engineering} | - ratpoints | 9 | {mathematics-dev} | - vdt | 9 | {mathematics-dev} | + ros-rosconsole | 9 | {robotics-dev} | dxsamples | 8 | {nanoscale-physics} | - libzn-poly | 8 | {mathematics-dev} | - metar | 8 | {meteorology} | - ncl | 8 | {meteorology-dev} | + geg | 8 | {viewing} | pcl | 8 | {robotics-dev} | persalys | 8 | {engineering,statistics,mathematics} | uctodata | 8 | {linguistics} | + alberta | 7 | {engineering-dev} | apophenia | 7 | {statistics} | - magics++ | 7 | {meteorology-dev} | - odc | 7 | {meteorology-dev} | - odc | 7 | {meteorology} | + libccp4 | 7 | {nanoscale-physics-dev} | + metar | 7 | {meteorology} | + ncl | 7 | {meteorology-dev} | + opencascade | 7 | {simulations} | + ratpoints | 7 | {mathematics-dev} | ucto | 7 | {linguistics} | - alberta | 6 | {engineering-dev} | cld2 | 6 | {linguistics} | - fpzip | 6 | {meteorology} | - libccp4 | 6 | {nanoscale-physics-dev} | - metview | 6 | {meteorology} | - opencascade | 6 | {simulations} | + libzn-poly | 6 | {mathematics-dev} | + magics++ | 6 | {meteorology-dev} | + odc | 6 | {meteorology-dev} | + odc | 6 | {meteorology} | persalys | 6 | {statistics,mathematics,engineering} | psurface | 6 | {numericalcomputation} | refmac-dictionary | 6 | {highenergy-physics-dev,chemistry} | rheolef | 6 | {mathematics} | ros-vcstool | 6 | {robotics-dev} | toulbar2 | 6 | {logic,numericalcomputation,mathematics,physics} | - atlas-ecmwf | 5 | {meteorology} | auto-07p | 5 | {mathematics} | - coda | 5 | {meteorology-dev} | - coda | 5 | {meteorology} | - debian-science | 5 | {economics,nanoscale-physics,machine-learning,physics,mathematics} | etsf-io | 5 | {physics,nanoscale-physics} | - gsw | 5 | {meteorology} | - iapws | 5 | {meteorology} | - irstlm | 5 | {linguistics} | + fftw | 5 | {meteorology-dev,mathematics-dev,physics-dev} | + fpzip | 5 | {meteorology} | + newmat | 5 | {mathematics-dev} | rubiks | 5 | {geometry,mathematics} | - cmor | 4 | {meteorology} | - debian-science | 4 | {physics,machine-learning,economics,nanoscale-physics} | - drslib | 4 | {meteorology} | - fftw | 4 | {meteorology-dev,mathematics-dev,physics-dev} | + veccore | 5 | {mathematics-dev} | + atlas-ecmwf | 4 | {meteorology} | + coda | 4 | {meteorology-dev} | + coda | 4 | {meteorology} | + debian-science | 4 | {economics,nanoscale-physics,machine-learning,physics,mathematics} | + gsw | 4 | {meteorology} | + iapws | 4 | {meteorology} | + irstlm | 4 | {linguistics} | libxsmm | 4 | {mathematics-dev} | lrcalc | 4 | {mathematics} | muparser | 4 | {mathematics-dev} | silo-llnl | 4 | {engineering} | + toontag | 4 | {numericalcomputation} | urdfdom-headers | 4 | {robotics-dev} | - veccore | 4 | {mathematics-dev} | apertium-eval-translator | 3 | {linguistics} | - cylc-flow | 3 | {meteorology} | - debian-science | 3 | {nanoscale-physics,statistics,economics,physics} | + cmor | 3 | {meteorology} | + debian-science | 3 | {physics,machine-learning,economics,nanoscale-physics} | dimbl | 3 | {linguistics} | + drslib | 3 | {meteorology} | dune-functions | 3 | {mathematics-dev} | dune-localfunctions | 3 | {mathematics-dev} | dune-typetree | 3 | {mathematics-dev} | dxflib | 3 | {engineering-dev} | ecbuild | 3 | {meteorology-dev} | - emoslib | 3 | {meteorology} | emoslib | 3 | {meteorology-dev} | frog | 3 | {linguistics} | getdp | 3 | {engineering,mathematics,simulations} | - harp | 3 | {meteorology} | hdf-eos5 | 3 | {meteorology-dev} | ipe-tools | 3 | {typesetting} | libcgns | 3 | {engineering} | libgctp | 3 | {meteorology-dev} | libmatheval | 3 | {mathematics} | - metkit | 3 | {meteorology} | + libvigraimpex | 3 | {imageanalysis-dev,machine-learning} | + metview | 3 | {meteorology} | mpi4py-fft | 3 | {mathematics-dev} | - newmat | 3 | {mathematics-dev} | sac2mseed | 3 | {geography} | sardana | 3 | {dataacquisition} | sdpb | 3 | {numericalcomputation,highenergy-physics} | silo-llnl | 3 | {engineering} | - toontag | 3 | {numericalcomputation} | + toon | 3 | {numericalcomputation} | apache-opennlp | 2 | {linguistics} | apophenia | 2 | {statistics} | atlas-ecmwf | 2 | {meteorology-dev} | + clipper | 2 | {nanoscale-physics-dev} | code-saturne | 2 | {mathematics-dev,engineering-dev} | + cylc-flow | 2 | {meteorology} | + debian-science | 2 | {nanoscale-physics,statistics,economics,physics} | debian-science | 2 | {economics} | - debian-science | 2 | {neuroscience-cognitive,machine-learning} | + emoslib | 2 | {meteorology} | fastjet | 2 | {highenergy-physics-dev} | + gemmlowp | 2 | {mathematics-dev} | + harp | 2 | {meteorology} | hpcc | 2 | {numericalcomputation,distributedcomputing} | - ipe-tools | 2 | {typesetting} | libcgns | 2 | {engineering-dev} | libcvd | 2 | {imageanalysis} | libgtkdatabox | 2 | {engineering-dev,viewing-dev} | liblbfgs | 2 | {mathematics-dev} | libmatheval | 2 | {mathematics-dev} | - libvigraimpex | 2 | {imageanalysis-dev,machine-learning} | mbt | 2 | {linguistics} | mbtserver | 2 | {linguistics} | + metkit | 2 | {meteorology} | + mmdb | 2 | {nanoscale-physics-dev,highenergy-physics-dev} | mseed2sac | 2 | {dataacquisition-dev} | ncrystal | 2 | {nanoscale-physics-dev,highenergy-physics-dev} | openstereogram | 2 | {tools} | polylib | 2 | {mathematics} | python-aws-xray-sdk | 2 | {dataacquisition-dev} | + qd | 2 | {mathematics-dev} | qwtplot3d | 2 | {viewing-dev} | sagemath-database-conway-polynomials | 2 | {mathematics} | scram | 2 | {engineering} | @@ -156,39 +159,38 @@ Last-Update: Tue, 17 Jun 2025 01:42:04 +0000 syrthes | 2 | {engineering} | timbl | 2 | {linguistics} | timblserver | 2 | {linguistics} | - toon | 2 | {numericalcomputation} | x13as | 2 | {economics} | apertium-streamparser | 1 | {linguistics} | ckon | 1 | {highenergy-physics-dev} | - clipper | 1 | {nanoscale-physics-dev} | coda | 1 | {meteorology-dev} | code-saturne | 1 | {engineering-dev,mathematics-dev} | coinmp | 1 | {logic,mathematics-dev,numericalcomputation} | coinor-bonmin | 1 | {mathematics} | + debian-science | 1 | {neuroscience-cognitive,machine-learning} | + debian-science | 1 | {neuroscience-cognitive} | debian-science | 1 | {tools} | debian-science | 1 | {electrophysiology} | - debian-science | 1 | {neuroscience-cognitive} | - debian-science | 1 | {nanoscale-physics-dev} | fpzip | 1 | {meteorology-dev} | frogdata | 1 | {linguistics} | gadap | 1 | {meteorology-dev} | - gemmlowp | 1 | {mathematics-dev} | hdf-eos4 | 1 | {meteorology-dev} | + hepmc3 | 1 | {nanoscale-physics-dev,highenergy-physics-dev} | + itsol | 1 | {mathematics-dev} | jeuclid | 1 | {viewing,typesetting} | libcvd | 1 | {imageanalysis-dev} | liblxi | 1 | {engineering-dev,dataacquisition-dev} | liborigin2 | 1 | {viewing-dev} | looptools | 1 | {highenergy-physics-dev} | metkit | 1 | {meteorology-dev} | - mmdb | 1 | {nanoscale-physics-dev,highenergy-physics-dev} | mrmpi | 1 | {tools} | nrn-iv | 1 | {biology} | + openmesh | 1 | {mathematics-dev} | psurface | 1 | {numericalcomputation} | - qd | 1 | {mathematics-dev} | ros-ros-environment | 1 | {robotics-dev} | schroedinger-coordgenlibs | 1 | {nanoscale-physics-dev,chemistry} | siscone | 1 | {highenergy-physics-dev} | spaghetti | 1 | {geography} | + spfft | 1 | {mathematics-dev,nanoscale-physics-dev,physics-dev,meteorology-dev} | ssm | 1 | {nanoscale-physics-dev} | tfdocgen | 1 | {linguistics} | trilinos | 1 | {physics-dev,mathematics-dev,engineering-dev} | @@ -211,15 +213,14 @@ Last-Update: Tue, 17 Jun 2025 01:42:04 +0000 collada-dom | 0 | {viewing-dev} | cqrlib | 0 | {mathematics-dev} | cvector | 0 | {mathematics-dev} | + debian-science | 0 | {electrophysiology} | + debian-science | 0 | {nanoscale-physics-dev} | debian-science | 0 | {physics} | debian-science | 0 | {psychophysics} | - debian-science | 0 | {electrophysiology} | dune-grid-glue | 0 | {mathematics-dev} | etsf-io | 0 | {nanoscale-physics-dev} | fastjet | 0 | {highenergy-physics-dev} | glpk-java | 0 | {mathematics-dev} | - hepmc3 | 0 | {nanoscale-physics-dev,highenergy-physics-dev} | - itsol | 0 | {mathematics-dev} | libdogleg | 0 | {mathematics-dev} | libfolia | 0 | {linguistics} | libquantum | 0 | {numericalcomputation} | @@ -237,15 +238,14 @@ Last-Update: Tue, 17 Jun 2025 01:42:04 +0000 openctm | 0 | {physics-dev} | opengv | 0 | {geometry} | openigtlink | 0 | {robotics-dev} | - openmesh | 0 | {mathematics-dev} | python-escript | 0 | {numericalcomputation,simulations,engineering} | python-opcodes | 0 | {tools} | qrupdate | 0 | {mathematics-dev} | quadrule | 0 | {mathematics-dev} | robot-testing-framework | 0 | {robotics-dev} | ros-collada-urdf | 0 | {robotics} | - ros-metapackages | 0 | {robotics-dev} | ros-metapackages | 0 | {robotics} | + ros-metapackages | 0 | {robotics-dev} | ros-opencv-apps | 0 | {robotics} | sagemath-database-combinatorial-designs | 0 | {mathematics} | sagemath-database-cremona-elliptic-curves | 0 | {mathematics} | @@ -256,7 +256,6 @@ Last-Update: Tue, 17 Jun 2025 01:42:04 +0000 siscone | 0 | {highenergy-physics-dev} | slicot | 0 | {robotics-dev,engineering-dev} | sparskit | 0 | {mathematics-dev} | - spfft | 0 | {mathematics-dev,nanoscale-physics-dev,physics-dev,meteorology-dev} | ssm | 0 | {nanoscale-physics} | tachyon | 0 | {mathematics} | tamuanova | 0 | {statistics} | @@ -270,5 +269,5 @@ Last-Update: Tue, 17 Jun 2025 01:42:04 +0000 virtuoso-opensource | 0 | {datamanagement} | visp-images | 0 | {robotics-dev} | libelas | -1 | {robotics-dev} | -(298 rows) +(297 rows) ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,141 +1,140 @@ -Last-Update: Tue, 17 Jun 2025 01:42:04 +0000 +Last-Update: Tue, 17 Jun 2025 13:42:11 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- - mpmath | 10038 | - python-repoze.lru | 6975 | + mpmath | 10027 | + python-repoze.lru | 6981 | netifaces | 5158 | - ghp-import | 4803 | - python-lunr | 4798 | - python-babel | 3960 | - sortedcontainers | 3634 | - python-babel | 3509 | - aiosignal | 2920 | - hyperlink | 2175 | - python-notify2 | 2043 | - humanfriendly | 1978 | - referencing | 1532 | + ghp-import | 4804 | + python-lunr | 4801 | + python-babel | 3981 | + sortedcontainers | 3630 | + python-babel | 3524 | + aiosignal | 2922 | + hyperlink | 2187 | + python-notify2 | 2053 | + humanfriendly | 1973 | + referencing | 1531 | python-mysqldb | 1502 | - python-gssapi | 1411 | - python-invoke | 1382 | - python-hyperframe | 1356 | - websocket-client | 1323 | - python-pandocfilters | 1160 | - python-hpack | 1150 | - python-rsa | 1129 | - pdfarranger | 983 | + python-gssapi | 1423 | + python-invoke | 1378 | + python-hyperframe | 1359 | + websocket-client | 1332 | + python-pandocfilters | 1163 | + python-hpack | 1156 | + python-rsa | 1132 | + pdfarranger | 984 | menulibre | 947 | - python-linux-procfs | 920 | - python-geoip | 882 | - python-webob | 842 | - powerline | 771 | - firmware-microbit-micropython | 733 | - powerline | 728 | - powerline | 723 | - kazam | 674 | - python-zopfli | 628 | + python-linux-procfs | 917 | + python-geoip | 877 | + python-webob | 848 | + powerline | 769 | + powerline | 722 | + powerline | 717 | + firmware-microbit-micropython | 711 | + kazam | 675 | + python-zopfli | 634 | autopep8 | 621 | - u-msgpack-python | 615 | - gaupol | 534 | - pytoolconfig | 530 | - dockerpty | 526 | - asn1crypto | 518 | - python-et-xmlfile | 513 | - python-gevent | 496 | - python-ewmh | 438 | - catfish | 416 | - python-requests-oauthlib | 401 | - python-toml | 355 | - spf-engine | 343 | + u-msgpack-python | 616 | + gaupol | 537 | + dockerpty | 533 | + pytoolconfig | 525 | + python-et-xmlfile | 524 | + asn1crypto | 516 | + python-gevent | 490 | + python-ewmh | 437 | + catfish | 419 | + python-requests-oauthlib | 399 | + python-toml | 349 | + spf-engine | 344 | python-ntlm-auth | 307 | spf-engine | 294 | - django-stronghold | 257 | - python-ldap3 | 236 | - cairocffi | 217 | - python-mimeparse | 197 | + django-stronghold | 261 | + python-ldap3 | 233 | + cairocffi | 218 | + python-mimeparse | 195 | python-smmap | 180 | python-hidapi | 170 | - autokey | 164 | + autokey | 163 | python-anyjson | 155 | - httpie | 147 | - smem | 145 | - kivy | 132 | - python-aiostream | 125 | - python-click-repl | 123 | - smartypants | 119 | + httpie | 146 | + smem | 142 | + kivy | 136 | + python-aiostream | 123 | + python-click-repl | 122 | + smartypants | 121 | + mypaint | 105 | nodeenv | 105 | - lollypop | 104 | - mypaint | 104 | - timekpr-next | 101 | - python-pyu2f | 98 | - mugshot | 95 | - pacparser | 93 | - python-consul | 92 | + lollypop | 103 | + python-pyu2f | 102 | + timekpr-next | 100 | + python-consul | 96 | + pacparser | 94 | + mugshot | 93 | pymacaroons | 90 | - pssh | 84 | - python-rfc6555 | 83 | + python-rfc6555 | 84 | + pssh | 83 | pymediainfo | 80 | numpy-stl | 74 | - python-colour | 73 | - python-i3ipc | 71 | - weasyprint | 71 | + python-colour | 74 | + weasyprint | 72 | + python-i3ipc | 70 | fabric | 69 | - python-pykka | 68 | - mitmproxy | 67 | - pywavelets | 60 | - ueberzug | 57 | - python-looseversion | 55 | - python-scp | 55 | - python-uritools | 55 | + mitmproxy | 66 | + python-pykka | 64 | + pywavelets | 61 | + python-looseversion | 56 | + python-uritools | 56 | + python-scp | 54 | + ueberzug | 54 | + mysql-connector-python | 52 | pyenv | 52 | - mysql-connector-python | 51 | itstool | 50 | pymacs | 49 | - hatchling | 48 | - khard | 47 | - sshtunnel | 45 | - blockdiag | 44 | + khard | 48 | + hatchling | 47 | + blockdiag | 46 | + sshtunnel | 44 | trac | 44 | - powerline-gitstatus | 40 | - pyquery | 40 | - python-pysol-cards | 40 | - show-in-file-manager | 40 | - membernator | 39 | - certipy | 38 | - pylibmc | 38 | + python-pysol-cards | 42 | + membernator | 41 | + powerline-gitstatus | 41 | + pyquery | 41 | + show-in-file-manager | 41 | + kivy | 40 | + pylibmc | 39 | + certipy | 37 | jupyterhub | 37 | - kivy | 37 | pamela | 37 | python-scrypt | 36 | - persepolis | 35 | - pdfposter | 34 | + persepolis | 34 | + pdfposter | 33 | pssh | 32 | python-statsd | 30 | - python-args | 28 | + python-args | 29 | seqdiag | 28 | - sphinxcontrib-blockdiag | 27 | - dkimpy-milter | 26 | + sphinxcontrib-blockdiag | 28 | + python-clint | 26 | rst2pdf | 26 | sphinxcontrib-seqdiag | 26 | video-downloader | 26 | - python-clint | 25 | + depthcharge-tools | 25 | + dkimpy-milter | 25 | typogrify | 25 | - depthcharge-tools | 24 | flask-principal | 24 | + python-fire | 24 | + sphinx-inline-tabs | 24 | cppman | 23 | - python-fire | 23 | - sphinx-inline-tabs | 23 | enzyme | 22 | python-rangehttpserver | 22 | + webpy | 22 | fabric | 21 | python-zstd | 21 | subliminal | 21 | - webpy | 21 | alot | 20 | backoff | 20 | + nwdiag | 20 | django-environ | 19 | - nwdiag | 19 | - nwg-displays | 19 | python-translationstring | 19 | social-auth-core | 19 | spf-engine | 19 | @@ -144,46 +143,48 @@ Last-Update: Tue, 17 Jun 2025 01:42:04 +0000 python-sdnotify | 18 | subliminal | 18 | webtest | 18 | - pykwalify | 16 | + nwg-displays | 17 | + pykwalify | 17 | + sphinxcontrib-log-cabinet | 17 | + policyd-rate-limit | 16 | python-hupper | 16 | python-slip10 | 16 | - sphinxcontrib-log-cabinet | 16 | actdiag | 15 | - policyd-rate-limit | 15 | python-kyotocabinet | 15 | - python-priority | 15 | python-simpy | 15 | sphinxcontrib-actdiag | 15 | sphinxcontrib-nwdiag | 15 | - unearth | 15 | flask-security | 14 | - pdm | 14 | + python-inotify | 14 | python-pem | 14 | - python-pyalsa | 14 | + python-priority | 14 | python-pysubs2 | 14 | + unearth | 14 | gmplot | 13 | gtextfsm | 13 | junos-eznc | 13 | - pylint-common | 13 | + pdm | 13 | python-dbussy | 13 | - python-inotify | 13 | + python-pyalsa | 13 | python-pyscss | 13 | python-xtermcolor | 13 | ansi | 12 | + pylint-common | 12 | pyp | 12 | + python-ethtool | 12 | python-pyrss2gen | 12 | ruff | 12 | todoman | 12 | beancount | 11 | - btchip-python | 11 | django-auditlog | 11 | jschema-to-python | 11 | - python-ethtool | 11 | + python-digitalocean | 11 | python-sarif-python-om | 11 | slimit | 11 | speaklater | 11 | txt2tags | 11 | autotiling | 10 | + btchip-python | 10 | debiancontributors | 10 | django-sass | 10 | drf-yasg-nonfree | 10 | @@ -191,54 +192,53 @@ Last-Update: Tue, 17 Jun 2025 01:42:04 +0000 notebook-shim | 10 | python-aiohttp-security | 10 | python-crcelk | 10 | - python-digitalocean | 10 | python-drf-spectacular-sidecar-nonfree | 10 | python-overpy | 10 | python-parse-type | 10 | + traittypes | 10 | pwntools | 9 | - sphinx-intl | 9 | - traittypes | 9 | tuna | 9 | beancount | 8 | clustershell | 8 | drf-extensions | 8 | - flask-session | 8 | - graphql-relay | 8 | httpcode | 8 | mercurial-evolve | 8 | micropython-mpremote | 8 | - pybik | 8 | python-envs | 8 | python-numpysane | 8 | python-pyld | 8 | + sphinx-intl | 8 | trac-wysiwyg | 8 | voltron | 8 | clustershell | 7 | django-model-utils | 7 | easyprocess | 7 | + flask-session | 7 | + graphql-relay | 7 | htmlmin | 7 | pydrive2 | 7 | pytaglib | 7 | pytest-django | 7 | + python-pyaml-env | 7 | python-versioneer | 7 | - python-xdo | 7 | django-pglocks | 6 | drf-haystack | 6 | + flask-api | 6 | librouteros | 6 | + numpy-stl | 6 | + pybik | 6 | python3-onelogin-saml2 | 6 | python-ansicolors | 6 | - python-pyaml-env | 6 | + python-xdo | 6 | django-jinja | 5 | django-paintstore | 5 | - flask-api | 5 | - flufl.testing | 5 | hachoir | 5 | htmlmin | 5 | kconfiglib | 5 | mypy-protobuf | 5 | - numpy-stl | 5 | pyjokes | 5 | pynliner | 5 | + pytest-runner | 5 | python-biplist | 5 | python-dirq | 5 | python-gnuplotlib | 5 | @@ -250,15 +250,17 @@ Last-Update: Tue, 17 Jun 2025 01:42:04 +0000 west | 5 | aiomysql | 4 | azote | 4 | + bootstrap-flask | 4 | cram | 4 | django-bitfield | 4 | django-js-reverse | 4 | django-redis-sessions | 4 | django-simple-redis-admin | 4 | django-xmlrpc | 4 | + flufl.testing | 4 | imap-tools | 4 | + mbed-test-wrapper | 4 | pycallgraph | 4 | - pytest-runner | 4 | python-dbus-next | 4 | python-django-casclient | 4 | python-django-contact-form | 4 | @@ -268,19 +270,17 @@ Last-Update: Tue, 17 Jun 2025 01:42:04 +0000 python-simpy | 4 | python-srp | 4 | sorl-thumbnail | 4 | + sphinx-markdown-tables | 4 | utidylib | 4 | - bootstrap-flask | 3 | cplay-ng | 3 | django-macaddress | 3 | django-pagination | 3 | django-render-block | 3 | django-templated-email | 3 | etm | 3 | - extension-helpers | 3 | flask-flatpages | 3 | flask-mongoengine | 3 | logilab-constraint | 3 | - mbed-test-wrapper | 3 | panoramisk | 3 | proglog | 3 | pyfltk | 3 | @@ -297,9 +297,9 @@ Last-Update: Tue, 17 Jun 2025 01:42:04 +0000 s3ql | 3 | slimit | 3 | smem | 3 | - sphinx-markdown-tables | 3 | trac-accountmanager | 3 | vf1 | 3 | + yotta | 3 | backupchecker | 2 | bqplot | 2 | brebis | 2 | @@ -313,7 +313,7 @@ Last-Update: Tue, 17 Jun 2025 01:42:04 +0000 django-maintenance-mode | 2 | django-yarnpkg | 2 | dotdrop | 2 | - flake8-black | 2 | + extension-helpers | 2 | flask-paginate | 2 | fypp | 2 | gtkman | 2 | @@ -323,13 +323,13 @@ Last-Update: Tue, 17 Jun 2025 01:42:04 +0000 jsonrpclib-pelix | 2 | namecheap | 2 | okasha | 2 | + omgifol | 2 | orsopy | 2 | pyclamd | 2 | pykwalify | 2 | pypass | 2 | pyroma | 2 | python-bitbucket-api | 2 | - python-bottle-sqlite | 2 | python-chartkick | 2 | python-commentjson | 2 | python-deepmerge | 2 | @@ -350,10 +350,10 @@ Last-Update: Tue, 17 Jun 2025 01:42:04 +0000 vcversioner | 2 | vrfydmn | 2 | wikitrans | 2 | - yotta | 2 | celery-progress | 1 | codicefiscale | 1 | errbot | 1 | + flake8-black | 1 | flask-multistatic | 1 | jpy | 1 | jupyter-sphinx | 1 | @@ -362,7 +362,6 @@ Last-Update: Tue, 17 Jun 2025 01:42:04 +0000 mkdocs-macros-plugin | 1 | moviepy | 1 | myst-nb | 1 | - omgifol | 1 | onetimepass | 1 | panoramisk | 1 | power | 1 | @@ -370,6 +369,7 @@ Last-Update: Tue, 17 Jun 2025 01:42:04 +0000 pynag | 1 | pyrad | 1 | python-bottle-cork | 1 | + python-bottle-sqlite | 1 | python-fluent-logger | 1 | python-fudge | 1 | python-genson | 1 | @@ -391,6 +391,7 @@ Last-Update: Tue, 17 Jun 2025 01:42:04 +0000 redis-py-cluster | 1 | soundcraft-utils | 1 | sphinx-paramlinks | 1 | + sphinx-sitemap | 1 | sphinxtesters | 1 | testrepository | 1 | trac-customfieldadmin | 1 | @@ -454,6 +455,7 @@ Last-Update: Tue, 17 Jun 2025 01:42:04 +0000 mssql-django | 0 | mwoauth | 0 | mypaint | 0 | + nam-files | 0 | nbgitpuller | 0 | okasha | 0 | pacparser | 0 | @@ -555,7 +557,6 @@ Last-Update: Tue, 17 Jun 2025 01:42:04 +0000 sphinxcontrib-emojicodes | 0 | sphinxcontrib-github-alt | 0 | sphinxcontrib-googleanalytics | 0 | - sphinx-sitemap | 0 | stackview | 0 | symmetrize | 0 | testrepository | 0 | @@ -573,7 +574,6 @@ Last-Update: Tue, 17 Jun 2025 01:42:04 +0000 drafthorse | -1 | fivem-api | -1 | ikos | -1 | - nam-files | -1 | open-garage | -1 | pyatag | -1 | pyina | -1 | @@ -587,8 +587,7 @@ Last-Update: Tue, 17 Jun 2025 01:42:04 +0000 python-rova | -1 | pyyardian | -1 | s3ql | -1 | - sphinxcontrib-emojicodes | -1 | symmetrize | -1 | trac-tickettemplate | -1 | -(603 rows) +(602 rows) View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/34def847c5163fa918675ad21e99149823f9c4a8 -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/34def847c5163fa918675ad21e99149823f9c4a8 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Tue Jun 17 21:29:29 2025 From: gitlab at salsa.debian.org (=?UTF-8?B?w4l0aWVubmUgTW9sbGllciAoQGVtb2xsaWVyKQ==?=) Date: Tue, 17 Jun 2025 20:29:29 +0000 Subject: [med-svn] [Git][med-team/beast-mcmc][master] 2 commits: d/control: remove dependency to libitext1-java. Message-ID: <6851d029e4927_3db174ca4983544237@godard.mail> ?tienne Mollier pushed to branch master at Debian Med / beast-mcmc Commits: e7cc4660 by ?tienne Mollier at 2025-06-17T22:28:10+02:00 d/control: remove dependency to libitext1-java. Closes: #1103836 - - - - - ec33e8bb by ?tienne Mollier at 2025-06-17T22:29:01+02:00 d/changelog: ready for upload to unstable. - - - - - 2 changed files: - debian/changelog - debian/control Changes: ===================================== debian/changelog ===================================== @@ -1,3 +1,10 @@ +beast-mcmc (1.10.4+dfsg-7) unstable; urgency=medium + + * Team upload. + * d/control: remove dependency to libitext1-java. (Closes: #1103836) + + -- ?tienne Mollier Tue, 17 Jun 2025 22:28:38 +0200 + beast-mcmc (1.10.4+dfsg-6) unstable; urgency=medium * Fix clean target ===================================== debian/control ===================================== @@ -21,7 +21,6 @@ Build-Depends: debhelper-compat (= 13), libjdom1-java, junit4, libmtj-java, - libitext1-java, libejml-java (>= 0.41), libjlapack-java Standards-Version: 4.7.0 View it on GitLab: https://salsa.debian.org/med-team/beast-mcmc/-/compare/cecfbbd48c20d2317c955ba701d362ae02070702...ec33e8bba692d25f84bd0983fe46bda770ec4fcf -- View it on GitLab: https://salsa.debian.org/med-team/beast-mcmc/-/compare/cecfbbd48c20d2317c955ba701d362ae02070702...ec33e8bba692d25f84bd0983fe46bda770ec4fcf You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Tue Jun 17 22:01:20 2025 From: gitlab at salsa.debian.org (=?UTF-8?B?w4l0aWVubmUgTW9sbGllciAoQGVtb2xsaWVyKQ==?=) Date: Tue, 17 Jun 2025 21:01:20 +0000 Subject: [med-svn] [Git][med-team/beast-mcmc] Pushed new tag archive/debian/1.10.4+dfsg-7 Message-ID: <6851d7a043266_3db17436b3035517f1@godard.mail> ?tienne Mollier pushed new tag archive/debian/1.10.4+dfsg-7 at Debian Med / beast-mcmc -- View it on GitLab: https://salsa.debian.org/med-team/beast-mcmc/-/tree/archive/debian/1.10.4+dfsg-7 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Tue Jun 17 22:01:21 2025 From: gitlab at salsa.debian.org (=?UTF-8?B?w4l0aWVubmUgTW9sbGllciAoQGVtb2xsaWVyKQ==?=) Date: Tue, 17 Jun 2025 21:01:21 +0000 Subject: [med-svn] [Git][med-team/beast-mcmc] Pushed new tag debian/1.10.4+dfsg-7 Message-ID: <6851d7a17915b_3db174ca49835520ee@godard.mail> ?tienne Mollier pushed new tag debian/1.10.4+dfsg-7 at Debian Med / beast-mcmc -- View it on GitLab: https://salsa.debian.org/med-team/beast-mcmc/-/tree/debian/1.10.4+dfsg-7 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Wed Jun 18 02:43:19 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Wed, 18 Jun 2025 01:43:19 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <685219b7c23c9_3db1743a67c35736c6@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: cf16168b by Andreas Tille at 2025-06-18T01:43:16+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Tue, 17 Jun 2025 13:42:04 +0000 +Last-Update: Wed, 18 Jun 2025 01:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- ===================================== debian-science-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Tue, 17 Jun 2025 13:42:08 +0000 +Last-Update: Wed, 18 Jun 2025 01:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Tue, 17 Jun 2025 13:42:11 +0000 +Last-Update: Wed, 18 Jun 2025 01:42:04 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/cf16168bba0aa8b60f25cf37a70f8d43de143bfa -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/cf16168bba0aa8b60f25cf37a70f8d43de143bfa You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Wed Jun 18 11:23:06 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Wed, 18 Jun 2025 10:23:06 +0000 Subject: [med-svn] [Git][med-team/libomp-jonathonl][master] Fix Vcs fields Message-ID: <6852938a2b2ca_3db173babd43616724@godard.mail> Andreas Tille pushed to branch master at Debian Med / libomp-jonathonl Commits: 9b66c4ee by Andreas Tille at 2025-06-18T12:22:54+02:00 Fix Vcs fields - - - - - 2 changed files: - debian/changelog - debian/control Changes: ===================================== debian/changelog ===================================== @@ -1,3 +1,9 @@ +libomp-jonathonl (1.0.0-2) UNRELEASED; urgency=medium + + * Fix Vcs fields + + -- Andreas Tille Wed, 18 Jun 2025 12:22:39 +0200 + libomp-jonathonl (1.0.0-1) unstable; urgency=medium * Upstream has tagged release 1.0.0 ===================================== debian/control ===================================== @@ -6,8 +6,8 @@ Uploaders: Andreas Tille Build-Depends: debhelper-compat (= 13), cmake Standards-Version: 4.6.1 -Vcs-Browser: https://salsa.debian.org/med-team/omp -Vcs-Git: https://salsa.debian.org/med-team/omp.git +Vcs-Browser: https://salsa.debian.org/med-team/libomp-jonathonl +Vcs-Git: https://salsa.debian.org/med-team/libomp-jonathonl.git Homepage: https://github.com/jonathonl/omp Rules-Requires-Root: no View it on GitLab: https://salsa.debian.org/med-team/libomp-jonathonl/-/commit/9b66c4ee8750340c23e8b21faa7c613f3194165a -- View it on GitLab: https://salsa.debian.org/med-team/libomp-jonathonl/-/commit/9b66c4ee8750340c23e8b21faa7c613f3194165a You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Wed Jun 18 14:43:30 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Wed, 18 Jun 2025 13:43:30 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <6852c282d4b68_3db1669551c379859d@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: 36eddf6b by Andreas Tille at 2025-06-18T13:43:23+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,13 +1,13 @@ -Last-Update: Wed, 18 Jun 2025 01:42:04 +0000 +Last-Update: Wed, 18 Jun 2025 13:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- dicomscope | 30 | {imaging} | orthanc-gdcm | 17 | {imaging} | oscar | 15 | {data,practice,tools} | - mrtrix3 | 14 | {imaging} | + mrtrix3 | 13 | {imaging} | + gnumed-server | 11 | {covid-19,practice} | king | 11 | {typesetting,imaging} | - gnumed-server | 10 | {covid-19,practice} | orthanc-mysql | 10 | {imaging} | pixelmed | 10 | {imaging} | sight | 10 | {imaging} | @@ -21,6 +21,7 @@ Last-Update: Wed, 18 Jun 2025 01:42:04 +0000 libminc | 5 | {imaging-dev} | biojava-live | 4 | {bio-dev} | beast-mcmc | 3 | {bio,bio-phylogeny} | + biojava6-live | 3 | {bio-dev} | cmtk | 3 | {imaging} | getdata | 3 | {bio} | insighttoolkit5 | 3 | {imaging-dev} | @@ -28,12 +29,12 @@ Last-Update: Wed, 18 Jun 2025 01:42:04 +0000 pbseqlib | 3 | {bio-dev} | piler | 3 | {bio} | sight | 3 | {imaging} | - biojava6-live | 2 | {bio-dev} | bio-tradis | 2 | {bio,bio-dev} | elastix | 2 | {imaging} | fastml | 2 | {bio} | ipig | 2 | {bio} | plasmidid | 2 | {covid-19,bio} | + rambo-k | 2 | {bio} | staden | 2 | {bio} | ants | 1 | {imaging} | blimps | 1 | {bio} | @@ -58,7 +59,6 @@ Last-Update: Wed, 18 Jun 2025 01:42:04 +0000 phyutility | 1 | {cloud,bio} | proalign | 1 | {bio-phylogeny,bio} | python-seqcluster | 1 | {covid-19,bio-dev} | - rambo-k | 1 | {bio} | runcircos-gui | 1 | {bio} | seq-gen | 1 | {bio} | sga | 1 | {bio} | @@ -66,6 +66,7 @@ Last-Update: Wed, 18 Jun 2025 01:42:04 +0000 surankco | 1 | {bio} | surpyvor | 1 | {bio} | thesias | 1 | {bio,covid-19} | + tophat-recondition | 1 | {bio,covid-19} | tracetuner | 1 | {bio} | treeview | 1 | {bio-phylogeny,bio} | varscan | 1 | {covid-19,bio} | @@ -151,7 +152,6 @@ Last-Update: Wed, 18 Jun 2025 01:42:04 +0000 sprai | 0 | {bio} | srf | 0 | {bio-dev} | suitename | 0 | {bio} | - tophat-recondition | 0 | {bio,covid-19} | trace2dbest | 0 | {bio} | xdffileio | 0 | {imaging-dev} | xxsds-dynamic | 0 | {bio-dev} | ===================================== debian-science-tests.txt ===================================== @@ -1,106 +1,106 @@ -Last-Update: Wed, 18 Jun 2025 01:42:04 +0000 +Last-Update: Wed, 18 Jun 2025 13:42:09 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- - nltk | 4858 | {linguistics} | - gts | 4767 | {viewing} | - opencascade | 621 | {simulations} | - spacenavd | 220 | {tools} | - open-coarrays | 180 | {meteorology-dev} | - armadillo | 179 | {mathematics-dev} | + nltk | 4881 | {linguistics} | + gts | 4807 | {viewing} | + opencascade | 620 | {simulations} | + spacenavd | 221 | {tools} | + armadillo | 182 | {mathematics-dev} | + open-coarrays | 177 | {meteorology-dev} | arpack | 88 | {mathematics-dev} | scalapack | 51 | {nanoscale-physics-dev} | - visidata | 45 | {datamanagement} | - ntl | 42 | {mathematics-dev} | - imview | 35 | {viewing} | - mbpoll | 35 | {simulations} | + visidata | 46 | {datamanagement} | + ntl | 40 | {mathematics-dev} | + mbpoll | 37 | {simulations} | + imview | 36 | {viewing} | ppl | 32 | {numericalcomputation} | - arduino-mk | 29 | {robotics} | flintqs | 29 | {mathematics} | - libmatio | 29 | {mathematics-dev} | + arduino-mk | 28 | {robotics} | + libmatio | 28 | {mathematics-dev} | cliquer | 27 | {mathematics} | - flann | 25 | {mathematics-dev,engineering-dev} | - libm4ri | 25 | {mathematics-dev} | + flann | 26 | {mathematics-dev,engineering-dev} | + libm4ri | 24 | {mathematics-dev} | grads | 21 | {meteorology} | - sat4j | 21 | {logic} | + bossa | 20 | {devices} | + setzer | 20 | {typesetting} | xygrib | 20 | {meteorology} | - bossa | 19 | {devices} | - setzer | 19 | {typesetting} | + guiqwt | 19 | {numericalcomputation,viewing} | + picosat | 19 | {logic} | + sat4j | 19 | {logic} | fftw | 18 | {mathematics-dev,physics-dev,meteorology-dev} | - guiqwt | 18 | {numericalcomputation,viewing} | - picosat | 18 | {logic} | - pyzo | 17 | {numericalcomputation} | + pyzo | 18 | {numericalcomputation} | + ncl | 17 | {meteorology} | sketch | 17 | {typesetting} | + dune-uggrid | 15 | {mathematics-dev} | lrcalc | 15 | {mathematics-dev} | - ncl | 15 | {meteorology} | cliquer | 14 | {mathematics-dev} | - dune-uggrid | 14 | {mathematics-dev} | eccodes | 14 | {meteorology,meteorology-dev} | - gts | 13 | {viewing-dev} | + gts | 14 | {viewing-dev} | + feff85exafs | 13 | {chemistry} | + libitpp | 13 | {mathematics-dev,engineering-dev} | teem | 13 | {imageanalysis} | - feff85exafs | 12 | {chemistry} | gf2x | 12 | {mathematics-dev} | - libitpp | 12 | {mathematics-dev,engineering-dev} | coinor-symphony | 11 | {logic,mathematics,numericalcomputation} | - form | 11 | {mathematics} | + feedgnuplot | 11 | {viewing} | iml | 11 | {mathematics-dev} | libhomfly | 11 | {mathematics-dev} | - matlab-support | 11 | {mathematics,numericalcomputation} | + lxi-tools | 11 | {engineering,dataacquisition} | eccodes | 10 | {meteorology-dev} | - feedgnuplot | 10 | {viewing} | - lxi-tools | 10 | {engineering,dataacquisition} | + form | 10 | {mathematics} | + matlab-support | 10 | {mathematics,numericalcomputation} | + python-escript | 10 | {numericalcomputation,simulations,engineering} | vdt | 10 | {mathematics-dev} | + geg | 9 | {viewing} | libm4rie | 9 | {mathematics-dev} | + ncl | 9 | {meteorology-dev} | python-cdo | 9 | {meteorology} | - python-escript | 9 | {numericalcomputation,simulations,engineering} | - ros-rosconsole | 9 | {robotics-dev} | - dxsamples | 8 | {nanoscale-physics} | - geg | 8 | {viewing} | + alberta | 8 | {engineering-dev} | pcl | 8 | {robotics-dev} | - persalys | 8 | {engineering,statistics,mathematics} | - uctodata | 8 | {linguistics} | - alberta | 7 | {engineering-dev} | + ros-rosconsole | 8 | {robotics-dev} | apophenia | 7 | {statistics} | + dxsamples | 7 | {nanoscale-physics} | libccp4 | 7 | {nanoscale-physics-dev} | - metar | 7 | {meteorology} | - ncl | 7 | {meteorology-dev} | opencascade | 7 | {simulations} | + persalys | 7 | {engineering,statistics,mathematics} | + psurface | 7 | {numericalcomputation} | ratpoints | 7 | {mathematics-dev} | - ucto | 7 | {linguistics} | + refmac-dictionary | 7 | {highenergy-physics-dev,chemistry} | + uctodata | 7 | {linguistics} | cld2 | 6 | {linguistics} | + etsf-io | 6 | {physics,nanoscale-physics} | libzn-poly | 6 | {mathematics-dev} | magics++ | 6 | {meteorology-dev} | + metar | 6 | {meteorology} | odc | 6 | {meteorology-dev} | odc | 6 | {meteorology} | - persalys | 6 | {statistics,mathematics,engineering} | - psurface | 6 | {numericalcomputation} | - refmac-dictionary | 6 | {highenergy-physics-dev,chemistry} | - rheolef | 6 | {mathematics} | ros-vcstool | 6 | {robotics-dev} | - toulbar2 | 6 | {logic,numericalcomputation,mathematics,physics} | - auto-07p | 5 | {mathematics} | - etsf-io | 5 | {physics,nanoscale-physics} | + ucto | 6 | {linguistics} | fftw | 5 | {meteorology-dev,mathematics-dev,physics-dev} | fpzip | 5 | {meteorology} | newmat | 5 | {mathematics-dev} | + persalys | 5 | {statistics,mathematics,engineering} | + rheolef | 5 | {mathematics} | rubiks | 5 | {geometry,mathematics} | + toontag | 5 | {numericalcomputation} | + toulbar2 | 5 | {logic,numericalcomputation,mathematics,physics} | veccore | 5 | {mathematics-dev} | atlas-ecmwf | 4 | {meteorology} | - coda | 4 | {meteorology-dev} | + auto-07p | 4 | {mathematics} | coda | 4 | {meteorology} | + coda | 4 | {meteorology-dev} | debian-science | 4 | {economics,nanoscale-physics,machine-learning,physics,mathematics} | + debian-science | 4 | {physics,machine-learning,economics,nanoscale-physics} | gsw | 4 | {meteorology} | iapws | 4 | {meteorology} | irstlm | 4 | {linguistics} | - libxsmm | 4 | {mathematics-dev} | - lrcalc | 4 | {mathematics} | - muparser | 4 | {mathematics-dev} | + sac2mseed | 4 | {geography} | + sdpb | 4 | {numericalcomputation,highenergy-physics} | silo-llnl | 4 | {engineering} | - toontag | 4 | {numericalcomputation} | + toon | 4 | {numericalcomputation} | urdfdom-headers | 4 | {robotics-dev} | apertium-eval-translator | 3 | {linguistics} | cmor | 3 | {meteorology} | - debian-science | 3 | {physics,machine-learning,economics,nanoscale-physics} | dimbl | 3 | {linguistics} | drslib | 3 | {meteorology} | dune-functions | 3 | {mathematics-dev} | @@ -117,21 +117,28 @@ Last-Update: Wed, 18 Jun 2025 01:42:04 +0000 libgctp | 3 | {meteorology-dev} | libmatheval | 3 | {mathematics} | libvigraimpex | 3 | {imageanalysis-dev,machine-learning} | + libxsmm | 3 | {mathematics-dev} | + lrcalc | 3 | {mathematics} | metview | 3 | {meteorology} | mpi4py-fft | 3 | {mathematics-dev} | - sac2mseed | 3 | {geography} | + muparser | 3 | {mathematics-dev} | + openstereogram | 3 | {tools} | + python-aws-xray-sdk | 3 | {dataacquisition-dev} | + sagemath-database-conway-polynomials | 3 | {mathematics} | sardana | 3 | {dataacquisition} | - sdpb | 3 | {numericalcomputation,highenergy-physics} | - silo-llnl | 3 | {engineering} | - toon | 3 | {numericalcomputation} | + spaghetti | 3 | {geography} | + syrthes | 3 | {engineering} | apache-opennlp | 2 | {linguistics} | + apertium-streamparser | 2 | {linguistics} | apophenia | 2 | {statistics} | atlas-ecmwf | 2 | {meteorology-dev} | clipper | 2 | {nanoscale-physics-dev} | code-saturne | 2 | {mathematics-dev,engineering-dev} | + coinor-bonmin | 2 | {mathematics} | cylc-flow | 2 | {meteorology} | - debian-science | 2 | {nanoscale-physics,statistics,economics,physics} | + debian-science | 2 | {electrophysiology} | debian-science | 2 | {economics} | + debian-science | 2 | {nanoscale-physics,statistics,economics,physics} | emoslib | 2 | {meteorology} | fastjet | 2 | {highenergy-physics-dev} | gemmlowp | 2 | {mathematics-dev} | @@ -148,28 +155,21 @@ Last-Update: Wed, 18 Jun 2025 01:42:04 +0000 mmdb | 2 | {nanoscale-physics-dev,highenergy-physics-dev} | mseed2sac | 2 | {dataacquisition-dev} | ncrystal | 2 | {nanoscale-physics-dev,highenergy-physics-dev} | - openstereogram | 2 | {tools} | polylib | 2 | {mathematics} | - python-aws-xray-sdk | 2 | {dataacquisition-dev} | qd | 2 | {mathematics-dev} | qwtplot3d | 2 | {viewing-dev} | - sagemath-database-conway-polynomials | 2 | {mathematics} | scram | 2 | {engineering} | silo-llnl | 2 | {engineering-dev} | - syrthes | 2 | {engineering} | timbl | 2 | {linguistics} | timblserver | 2 | {linguistics} | x13as | 2 | {economics} | - apertium-streamparser | 1 | {linguistics} | ckon | 1 | {highenergy-physics-dev} | coda | 1 | {meteorology-dev} | code-saturne | 1 | {engineering-dev,mathematics-dev} | coinmp | 1 | {logic,mathematics-dev,numericalcomputation} | - coinor-bonmin | 1 | {mathematics} | - debian-science | 1 | {neuroscience-cognitive,machine-learning} | debian-science | 1 | {neuroscience-cognitive} | + debian-science | 1 | {neuroscience-cognitive,machine-learning} | debian-science | 1 | {tools} | - debian-science | 1 | {electrophysiology} | fpzip | 1 | {meteorology-dev} | frogdata | 1 | {linguistics} | gadap | 1 | {meteorology-dev} | @@ -189,11 +189,9 @@ Last-Update: Wed, 18 Jun 2025 01:42:04 +0000 ros-ros-environment | 1 | {robotics-dev} | schroedinger-coordgenlibs | 1 | {nanoscale-physics-dev,chemistry} | siscone | 1 | {highenergy-physics-dev} | - spaghetti | 1 | {geography} | spfft | 1 | {mathematics-dev,nanoscale-physics-dev,physics-dev,meteorology-dev} | ssm | 1 | {nanoscale-physics-dev} | tfdocgen | 1 | {linguistics} | - trilinos | 1 | {physics-dev,mathematics-dev,engineering-dev} | vlfeat | 1 | {imageanalysis-dev} | amgcl | 0 | {mathematics-dev} | apertium-afr-nld | 0 | {linguistics} | @@ -213,10 +211,10 @@ Last-Update: Wed, 18 Jun 2025 01:42:04 +0000 collada-dom | 0 | {viewing-dev} | cqrlib | 0 | {mathematics-dev} | cvector | 0 | {mathematics-dev} | - debian-science | 0 | {electrophysiology} | - debian-science | 0 | {nanoscale-physics-dev} | debian-science | 0 | {physics} | debian-science | 0 | {psychophysics} | + debian-science | 0 | {nanoscale-physics-dev} | + debian-science | 0 | {electrophysiology} | dune-grid-glue | 0 | {mathematics-dev} | etsf-io | 0 | {nanoscale-physics-dev} | fastjet | 0 | {highenergy-physics-dev} | @@ -244,8 +242,8 @@ Last-Update: Wed, 18 Jun 2025 01:42:04 +0000 quadrule | 0 | {mathematics-dev} | robot-testing-framework | 0 | {robotics-dev} | ros-collada-urdf | 0 | {robotics} | - ros-metapackages | 0 | {robotics} | ros-metapackages | 0 | {robotics-dev} | + ros-metapackages | 0 | {robotics} | ros-opencv-apps | 0 | {robotics} | sagemath-database-combinatorial-designs | 0 | {mathematics} | sagemath-database-cremona-elliptic-curves | 0 | {mathematics} | @@ -263,11 +261,12 @@ Last-Update: Wed, 18 Jun 2025 01:42:04 +0000 timbl | 0 | {linguistics} | timblserver | 0 | {linguistics} | triangle | 0 | {physics-dev} | + trilinos | 0 | {physics-dev,mathematics-dev,engineering-dev} | tulip | 0 | {viewing-dev} | ucto | 0 | {linguistics} | vecgeom | 0 | {nanoscale-physics-dev} | virtuoso-opensource | 0 | {datamanagement} | visp-images | 0 | {robotics-dev} | libelas | -1 | {robotics-dev} | -(297 rows) +(296 rows) ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,187 +1,188 @@ -Last-Update: Wed, 18 Jun 2025 01:42:04 +0000 +Last-Update: Wed, 18 Jun 2025 13:42:12 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- - mpmath | 10027 | - python-repoze.lru | 6981 | - netifaces | 5158 | - ghp-import | 4804 | - python-lunr | 4801 | - python-babel | 3981 | - sortedcontainers | 3630 | - python-babel | 3524 | - aiosignal | 2922 | - hyperlink | 2187 | - python-notify2 | 2053 | - humanfriendly | 1973 | - referencing | 1531 | - python-mysqldb | 1502 | - python-gssapi | 1423 | - python-invoke | 1378 | - python-hyperframe | 1359 | + mpmath | 10016 | + python-repoze.lru | 6987 | + netifaces | 5168 | + ghp-import | 4825 | + python-lunr | 4823 | + python-babel | 3998 | + sortedcontainers | 3618 | + python-babel | 3529 | + aiosignal | 2927 | + hyperlink | 2189 | + python-notify2 | 2005 | + humanfriendly | 1985 | + referencing | 1547 | + python-mysqldb | 1515 | + python-gssapi | 1428 | + python-invoke | 1398 | + python-hyperframe | 1370 | websocket-client | 1332 | - python-pandocfilters | 1163 | - python-hpack | 1156 | - python-rsa | 1132 | - pdfarranger | 984 | - menulibre | 947 | - python-linux-procfs | 917 | - python-geoip | 877 | - python-webob | 848 | - powerline | 769 | - powerline | 722 | - powerline | 717 | - firmware-microbit-micropython | 711 | - kazam | 675 | - python-zopfli | 634 | - autopep8 | 621 | - u-msgpack-python | 616 | - gaupol | 537 | - dockerpty | 533 | - pytoolconfig | 525 | - python-et-xmlfile | 524 | - asn1crypto | 516 | - python-gevent | 490 | - python-ewmh | 437 | - catfish | 419 | - python-requests-oauthlib | 399 | - python-toml | 349 | - spf-engine | 344 | - python-ntlm-auth | 307 | - spf-engine | 294 | - django-stronghold | 261 | - python-ldap3 | 233 | - cairocffi | 218 | - python-mimeparse | 195 | + python-pandocfilters | 1165 | + python-hpack | 1161 | + python-rsa | 1136 | + pdfarranger | 983 | + menulibre | 953 | + python-linux-procfs | 922 | + python-geoip | 874 | + python-webob | 843 | + powerline | 773 | + powerline | 719 | + powerline | 714 | + firmware-microbit-micropython | 695 | + kazam | 672 | + python-zopfli | 642 | + autopep8 | 620 | + u-msgpack-python | 611 | + gaupol | 539 | + pytoolconfig | 530 | + python-et-xmlfile | 526 | + dockerpty | 524 | + asn1crypto | 518 | + python-gevent | 488 | + python-ewmh | 444 | + catfish | 431 | + python-requests-oauthlib | 403 | + spf-engine | 345 | + python-toml | 344 | + python-ntlm-auth | 315 | + spf-engine | 296 | + django-stronghold | 263 | + python-ldap3 | 236 | + cairocffi | 220 | + python-mimeparse | 196 | python-smmap | 180 | - python-hidapi | 170 | + python-hidapi | 171 | autokey | 163 | - python-anyjson | 155 | + python-anyjson | 152 | httpie | 146 | - smem | 142 | - kivy | 136 | - python-aiostream | 123 | - python-click-repl | 122 | - smartypants | 121 | - mypaint | 105 | - nodeenv | 105 | - lollypop | 103 | - python-pyu2f | 102 | - timekpr-next | 100 | - python-consul | 96 | + smem | 141 | + kivy | 137 | + python-aiostream | 122 | + python-click-repl | 121 | + smartypants | 116 | + mypaint | 108 | + nodeenv | 106 | + lollypop | 102 | + python-pyu2f | 101 | + timekpr-next | 99 | + python-consul | 98 | + mugshot | 95 | pacparser | 94 | - mugshot | 93 | - pymacaroons | 90 | - python-rfc6555 | 84 | - pssh | 83 | + pymacaroons | 91 | + python-rfc6555 | 87 | + pssh | 84 | pymediainfo | 80 | - numpy-stl | 74 | - python-colour | 74 | + python-colour | 75 | weasyprint | 72 | - python-i3ipc | 70 | - fabric | 69 | - mitmproxy | 66 | - python-pykka | 64 | + numpy-stl | 71 | + python-i3ipc | 71 | + fabric | 70 | + mitmproxy | 69 | + python-pykka | 62 | pywavelets | 61 | - python-looseversion | 56 | - python-uritools | 56 | - python-scp | 54 | - ueberzug | 54 | + python-scp | 56 | + python-looseversion | 55 | + python-uritools | 55 | + ueberzug | 55 | + itstool | 52 | mysql-connector-python | 52 | - pyenv | 52 | - itstool | 50 | + pyenv | 50 | pymacs | 49 | - khard | 48 | - hatchling | 47 | - blockdiag | 46 | - sshtunnel | 44 | + sshtunnel | 48 | + khard | 47 | + hatchling | 46 | + blockdiag | 45 | trac | 44 | - python-pysol-cards | 42 | - membernator | 41 | + python-pysol-cards | 43 | + membernator | 42 | powerline-gitstatus | 41 | pyquery | 41 | - show-in-file-manager | 41 | + certipy | 40 | kivy | 40 | + pamela | 40 | + show-in-file-manager | 40 | + jupyterhub | 39 | pylibmc | 39 | - certipy | 37 | - jupyterhub | 37 | - pamela | 37 | python-scrypt | 36 | - persepolis | 34 | + persepolis | 35 | + pssh | 34 | pdfposter | 33 | - pssh | 32 | - python-statsd | 30 | + python-statsd | 31 | python-args | 29 | seqdiag | 28 | - sphinxcontrib-blockdiag | 28 | + video-downloader | 28 | + sphinxcontrib-blockdiag | 27 | + dkimpy-milter | 26 | python-clint | 26 | - rst2pdf | 26 | + python-fire | 26 | sphinxcontrib-seqdiag | 26 | - video-downloader | 26 | depthcharge-tools | 25 | - dkimpy-milter | 25 | - typogrify | 25 | - flask-principal | 24 | - python-fire | 24 | - sphinx-inline-tabs | 24 | + enzyme | 25 | + flask-principal | 25 | + rst2pdf | 25 | + sphinx-inline-tabs | 25 | + typogrify | 24 | cppman | 23 | - enzyme | 22 | - python-rangehttpserver | 22 | - webpy | 22 | + python-zstd | 23 | + subliminal | 23 | + webpy | 23 | + backoff | 21 | fabric | 21 | - python-zstd | 21 | - subliminal | 21 | - alot | 20 | - backoff | 20 | - nwdiag | 20 | + nwdiag | 21 | + python-rangehttpserver | 20 | + subliminal | 20 | + alot | 19 | django-environ | 19 | - python-translationstring | 19 | + python-sdnotify | 19 | social-auth-core | 19 | spf-engine | 19 | mistune0 | 18 | + nwg-displays | 18 | python-demjson | 18 | - python-sdnotify | 18 | - subliminal | 18 | + python-translationstring | 18 | webtest | 18 | - nwg-displays | 17 | - pykwalify | 17 | - sphinxcontrib-log-cabinet | 17 | + actdiag | 16 | policyd-rate-limit | 16 | - python-hupper | 16 | + pykwalify | 16 | + python-pysubs2 | 16 | python-slip10 | 16 | - actdiag | 15 | + sphinxcontrib-log-cabinet | 16 | + python-hupper | 15 | + python-inotify | 15 | python-kyotocabinet | 15 | - python-simpy | 15 | + python-priority | 15 | sphinxcontrib-actdiag | 15 | sphinxcontrib-nwdiag | 15 | flask-security | 14 | - python-inotify | 14 | + gtextfsm | 14 | python-pem | 14 | - python-priority | 14 | - python-pysubs2 | 14 | + python-pyalsa | 14 | + python-simpy | 14 | unearth | 14 | gmplot | 13 | - gtextfsm | 13 | junos-eznc | 13 | pdm | 13 | python-dbussy | 13 | - python-pyalsa | 13 | - python-pyscss | 13 | + python-ethtool | 13 | + python-pyrss2gen | 13 | python-xtermcolor | 13 | ansi | 12 | + jschema-to-python | 12 | pylint-common | 12 | pyp | 12 | - python-ethtool | 12 | - python-pyrss2gen | 12 | + python-pyscss | 12 | + python-sarif-python-om | 12 | ruff | 12 | + speaklater | 12 | todoman | 12 | beancount | 11 | django-auditlog | 11 | - jschema-to-python | 11 | python-digitalocean | 11 | - python-sarif-python-om | 11 | + python-parse-type | 11 | slimit | 11 | - speaklater | 11 | txt2tags | 11 | autotiling | 10 | btchip-python | 10 | @@ -193,58 +194,59 @@ Last-Update: Wed, 18 Jun 2025 01:42:04 +0000 python-aiohttp-security | 10 | python-crcelk | 10 | python-drf-spectacular-sidecar-nonfree | 10 | - python-overpy | 10 | - python-parse-type | 10 | - traittypes | 10 | pwntools | 9 | + python-overpy | 9 | + python-pyaml-env | 9 | + python-pyld | 9 | + traittypes | 9 | tuna | 9 | beancount | 8 | clustershell | 8 | drf-extensions | 8 | - httpcode | 8 | + htmlmin | 8 | mercurial-evolve | 8 | micropython-mpremote | 8 | python-envs | 8 | python-numpysane | 8 | - python-pyld | 8 | + python-versioneer | 8 | sphinx-intl | 8 | trac-wysiwyg | 8 | - voltron | 8 | clustershell | 7 | - django-model-utils | 7 | - easyprocess | 7 | flask-session | 7 | graphql-relay | 7 | - htmlmin | 7 | + httpcode | 7 | pydrive2 | 7 | pytaglib | 7 | pytest-django | 7 | - python-pyaml-env | 7 | - python-versioneer | 7 | + voltron | 7 | + django-model-utils | 6 | django-pglocks | 6 | drf-haystack | 6 | + easyprocess | 6 | flask-api | 6 | librouteros | 6 | + mypy-protobuf | 6 | numpy-stl | 6 | pybik | 6 | python3-onelogin-saml2 | 6 | python-ansicolors | 6 | + python-openstep-plist | 6 | python-xdo | 6 | + ruff | 6 | django-jinja | 5 | django-paintstore | 5 | hachoir | 5 | htmlmin | 5 | - kconfiglib | 5 | - mypy-protobuf | 5 | + pycallgraph | 5 | pyjokes | 5 | pynliner | 5 | pytest-runner | 5 | python-biplist | 5 | python-dirq | 5 | python-gnuplotlib | 5 | + python-halo | 5 | python-jpype | 5 | - python-openstep-plist | 5 | - ruff | 5 | + python-simpy | 5 | securestring | 5 | sphinxcontrib-globalsubs | 5 | west | 5 | @@ -258,17 +260,13 @@ Last-Update: Wed, 18 Jun 2025 01:42:04 +0000 django-simple-redis-admin | 4 | django-xmlrpc | 4 | flufl.testing | 4 | - imap-tools | 4 | mbed-test-wrapper | 4 | - pycallgraph | 4 | python-dbus-next | 4 | python-django-casclient | 4 | python-django-contact-form | 4 | python-django-registration | 4 | - python-halo | 4 | - python-markuppy | 4 | - python-simpy | 4 | python-srp | 4 | + s3ql | 4 | sorl-thumbnail | 4 | sphinx-markdown-tables | 4 | utidylib | 4 | @@ -278,11 +276,19 @@ Last-Update: Wed, 18 Jun 2025 01:42:04 +0000 django-render-block | 3 | django-templated-email | 3 | etm | 3 | + extension-helpers | 3 | flask-flatpages | 3 | flask-mongoengine | 3 | + imap-tools | 3 | + jpylyzer | 3 | + kconfiglib | 3 | logilab-constraint | 3 | + okasha | 3 | + omgifol | 3 | + orsopy | 3 | panoramisk | 3 | proglog | 3 | + pyclamd | 3 | pyfltk | 3 | pyjunitxml | 3 | pyprind | 3 | @@ -292,12 +298,13 @@ Last-Update: Wed, 18 Jun 2025 01:42:04 +0000 python-django-push-notifications | 3 | python-dynaconf | 3 | python-ipfix | 3 | + python-markuppy | 3 | python-networkmanager | 3 | requests-aws | 3 | - s3ql | 3 | slimit | 3 | smem | 3 | trac-accountmanager | 3 | + trac-xmlrpc | 3 | vf1 | 3 | yotta | 3 | backupchecker | 2 | @@ -313,20 +320,15 @@ Last-Update: Wed, 18 Jun 2025 01:42:04 +0000 django-maintenance-mode | 2 | django-yarnpkg | 2 | dotdrop | 2 | - extension-helpers | 2 | + flake8-black | 2 | flask-paginate | 2 | fypp | 2 | gtkman | 2 | hatch-jupyter-builder | 2 | humanfriendly | 2 | - jpylyzer | 2 | jsonrpclib-pelix | 2 | namecheap | 2 | - okasha | 2 | - omgifol | 2 | - orsopy | 2 | - pyclamd | 2 | - pykwalify | 2 | + pylint-celery | 2 | pypass | 2 | pyroma | 2 | python-bitbucket-api | 2 | @@ -342,18 +344,22 @@ Last-Update: Wed, 18 Jun 2025 01:42:04 +0000 python-openshift | 2 | python-opentracing | 2 | python-pgmagick | 2 | + python-py-zipkin | 2 | python-qtpynodeeditor | 2 | python-securesystemslib | 2 | python-text-unidecode | 2 | python-webdavclient | 2 | - trac-xmlrpc | 2 | + redis-py-cluster | 2 | + sphinx-paramlinks | 2 | + sphinxtesters | 2 | + testrepository | 2 | vcversioner | 2 | vrfydmn | 2 | wikitrans | 2 | + apkinspector | 1 | celery-progress | 1 | codicefiscale | 1 | errbot | 1 | - flake8-black | 1 | flask-multistatic | 1 | jpy | 1 | jupyter-sphinx | 1 | @@ -365,11 +371,13 @@ Last-Update: Wed, 18 Jun 2025 01:42:04 +0000 onetimepass | 1 | panoramisk | 1 | power | 1 | - pylint-celery | 1 | + pykwalify | 1 | pynag | 1 | pyrad | 1 | + python-banal | 1 | python-bottle-cork | 1 | python-bottle-sqlite | 1 | + python-dataset | 1 | python-fluent-logger | 1 | python-fudge | 1 | python-genson | 1 | @@ -380,20 +388,22 @@ Last-Update: Wed, 18 Jun 2025 01:42:04 +0000 python-netfilter | 1 | python-noise | 1 | python-noseofyeti | 1 | + python-openid-cla | 1 | python-openqa-client | 1 | python-pypump | 1 | - python-py-zipkin | 1 | + python-pysubs2 | 1 | + python-rdflib-endpoint | 1 | python-schedutils | 1 | + python-sphinx-examples | 1 | python-undetected-chromedriver | 1 | python-urlobject | 1 | + python-vega-datasets | 1 | python-zc.customdoctests | 1 | pytkdocs | 1 | - redis-py-cluster | 1 | soundcraft-utils | 1 | - sphinx-paramlinks | 1 | + sphinx-autorun | 1 | + sphinxcontrib-github-alt | 1 | sphinx-sitemap | 1 | - sphinxtesters | 1 | - testrepository | 1 | trac-customfieldadmin | 1 | trac-httpauth | 1 | vncdotool | 1 | @@ -407,7 +417,6 @@ Last-Update: Wed, 18 Jun 2025 01:42:04 +0000 aiomysql | 0 | aiotask-context | 0 | alot | 0 | - apkinspector | 0 | aptly-api-client | 0 | beangrow | 0 | beangulp | 0 | @@ -484,7 +493,6 @@ Last-Update: Wed, 18 Jun 2025 01:42:04 +0000 python-aio-pika | 0 | python-asv-bench-memray | 0 | python-babel | 0 | - python-banal | 0 | python-betterproto | 0 | python-bottle-beaker | 0 | python-briefcase | 0 | @@ -498,7 +506,6 @@ Last-Update: Wed, 18 Jun 2025 01:42:04 +0000 python-certstream | 0 | python-chocolate | 0 | python-cogapp | 0 | - python-dataset | 0 | python-digitalocean | 0 | python-django-casclient | 0 | python-django-contact-form | 0 | @@ -517,13 +524,13 @@ Last-Update: Wed, 18 Jun 2025 01:42:04 +0000 python-imageio-ffmpeg | 0 | python-ionoscloud | 0 | python-laszip | 0 | + python-ledgercomm | 0 | python-lunr | 0 | python-makefun | 0 | python-markdown-rundoc | 0 | python-netsnmpagent | 0 | python-nubia | 0 | python-nvchecker | 0 | - python-openid-cla | 0 | python-openshift | 0 | python-opentracing | 0 | python-persisting-theory | 0 | @@ -531,8 +538,6 @@ Last-Update: Wed, 18 Jun 2025 01:42:04 +0000 python-pubchempy | 0 | python-pyout | 0 | python-pypump | 0 | - python-pysubs2 | 0 | - python-rdflib-endpoint | 0 | python-requests-oauthlib | 0 | python-rpcq | 0 | python-simpy | 0 | @@ -541,7 +546,6 @@ Last-Update: Wed, 18 Jun 2025 01:42:04 +0000 python-spur | 0 | python-tatsu | 0 | python-tatsu-lts | 0 | - python-vega-datasets | 0 | python-webob | 0 | python-wither | 0 | python-ytmusicapi | 0 | @@ -553,9 +557,7 @@ Last-Update: Wed, 18 Jun 2025 01:42:04 +0000 redis-py-cluster | 0 | sorl-thumbnail | 0 | sortedcontainers | 0 | - sphinx-autorun | 0 | sphinxcontrib-emojicodes | 0 | - sphinxcontrib-github-alt | 0 | sphinxcontrib-googleanalytics | 0 | stackview | 0 | symmetrize | 0 | @@ -581,13 +583,13 @@ Last-Update: Wed, 18 Jun 2025 01:42:04 +0000 pysequoia | -1 | python-asv-bench-memray | -1 | python-gradientmodel | -1 | - python-ledgercomm | -1 | python-nxtomomill | -1 | python-qnapstats | -1 | python-rova | -1 | pyyardian | -1 | s3ql | -1 | + sphinxcontrib-emojicodes | -1 | symmetrize | -1 | trac-tickettemplate | -1 | -(602 rows) +(604 rows) View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/36eddf6bb30253b06ba115f754a1ca97f19a36cf -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/36eddf6bb30253b06ba115f754a1ca97f19a36cf You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Wed Jun 18 19:53:11 2025 From: gitlab at salsa.debian.org (harish chavre (@Harish1)) Date: Wed, 18 Jun 2025 18:53:11 +0000 Subject: [med-svn] [Git][med-team/bitseq][pristine-tar] 2 commits: pristine-tar data for bitseq_0.7.5+dfsg.orig-debian-tests-data.tar.xz Message-ID: <68530b173aba0_3db1722af6c385404b@godard.mail> harish chavre pushed to branch pristine-tar at Debian Med / bitseq Commits: 997e2d2d by Harish chavre at 2025-06-17T05:11:02+00:00 pristine-tar data for bitseq_0.7.5+dfsg.orig-debian-tests-data.tar.xz - - - - - 8c2fc023 by Harish chavre at 2025-06-17T05:11:03+00:00 pristine-tar data for bitseq_0.7.5+dfsg.orig.tar.xz - - - - - 3 changed files: - + bitseq_0.7.5+dfsg.orig-debian-tests-data.tar.xz.delta - + bitseq_0.7.5+dfsg.orig-debian-tests-data.tar.xz.id - bitseq_0.7.5+dfsg.orig.tar.xz.delta Changes: ===================================== bitseq_0.7.5+dfsg.orig-debian-tests-data.tar.xz.delta ===================================== Binary files /dev/null and b/bitseq_0.7.5+dfsg.orig-debian-tests-data.tar.xz.delta differ ===================================== bitseq_0.7.5+dfsg.orig-debian-tests-data.tar.xz.id ===================================== @@ -0,0 +1 @@ +f325a12ef389c6f0254d6087d7804575ad4eff28 ===================================== bitseq_0.7.5+dfsg.orig.tar.xz.delta ===================================== Binary files a/bitseq_0.7.5+dfsg.orig.tar.xz.delta and b/bitseq_0.7.5+dfsg.orig.tar.xz.delta differ View it on GitLab: https://salsa.debian.org/med-team/bitseq/-/compare/0b435c16fdaf07ff8e41fb9d69cbbc5cd022f090...8c2fc023a78bb26977d0e4c3ca12ac8845972135 -- View it on GitLab: https://salsa.debian.org/med-team/bitseq/-/compare/0b435c16fdaf07ff8e41fb9d69cbbc5cd022f090...8c2fc023a78bb26977d0e4c3ca12ac8845972135 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Wed Jun 18 19:53:12 2025 From: gitlab at salsa.debian.org (harish chavre (@Harish1)) Date: Wed, 18 Jun 2025 18:53:12 +0000 Subject: [med-svn] [Git][med-team/bitseq][master] 5 commits: created gbp.conf Message-ID: <68530b188c352_3dbd789300385432b@godard.mail> harish chavre pushed to branch master at Debian Med / bitseq Commits: 8927d2e0 by Harish chavre at 2025-06-17T05:09:08+00:00 created gbp.conf - - - - - 5b46266b by Harish chavre at 2025-06-17T05:11:02+00:00 New upstream version 0.7.5+dfsg - - - - - 512f454d by Harish chavre at 2025-06-17T05:11:03+00:00 Update upstream source from tag 'upstream/0.7.5+dfsg' Update to upstream version '0.7.5+dfsg' with Debian dir dc18e7a51dd0355b2220579c37426eb418a58e14 - - - - - e2a66682 by Harish chavre at 2025-06-17T19:57:13+00:00 Add test data and Bowtie alignment outputs for autopkgtest - - - - - 3167b32e by Harish chavre at 2025-06-18T18:48:43+00:00 Fix autopkgtest - - - - - 11 changed files: - debian/tests/Data/Reads.fastq ? debian-tests-data/Reads.fastq - debian/tests/Data/Ref.fasta ? debian-tests-data/Ref.fasta - + debian-tests-data/index.1.ebwt - + debian-tests-data/index.2.ebwt - + debian-tests-data/index.3.ebwt - + debian-tests-data/index.4.ebwt - + debian-tests-data/index.rev.1.ebwt - + debian-tests-data/index.rev.2.ebwt - + debian-tests-data/out.sam - debian/tests/control - debian/tests/run-unit-test Changes: ===================================== debian/tests/Data/Reads.fastq ? debian-tests-data/Reads.fastq ===================================== ===================================== debian/tests/Data/Ref.fasta ? debian-tests-data/Ref.fasta ===================================== ===================================== debian-tests-data/index.1.ebwt ===================================== Binary files /dev/null and b/debian-tests-data/index.1.ebwt differ ===================================== debian-tests-data/index.2.ebwt ===================================== Binary files /dev/null and b/debian-tests-data/index.2.ebwt differ ===================================== debian-tests-data/index.3.ebwt ===================================== Binary files /dev/null and b/debian-tests-data/index.3.ebwt differ ===================================== debian-tests-data/index.4.ebwt ===================================== Binary files /dev/null and b/debian-tests-data/index.4.ebwt differ ===================================== debian-tests-data/index.rev.1.ebwt ===================================== Binary files /dev/null and b/debian-tests-data/index.rev.1.ebwt differ ===================================== debian-tests-data/index.rev.2.ebwt ===================================== Binary files /dev/null and b/debian-tests-data/index.rev.2.ebwt differ ===================================== debian-tests-data/out.sam ===================================== @@ -0,0 +1,5 @@ + at HD VN:1.0 SO:unsorted + at SQ SN:ref LN:318 + at PG ID:Bowtie VN:1.3.1 CL:"/usr/bin/bowtie-align-s --wrapper basic-0 -q -v 3 --all -m 100 --sam index Reads.fastq -S out.sam" +read1 4 * 0 0 * * 0 0 ACGTACGTACGT IIIIIIIIIIII XM:i:0 +read2 4 * 0 0 * * 0 0 ACGTACGTACGT JJJJJJJJJJJJ XM:i:0 ===================================== debian/tests/control ===================================== @@ -1,3 +1,3 @@ Tests: run-unit-test -Depends: @, bowtie, bitseq +Depends: @, bitseq Restrictions: allow-stderr ===================================== debian/tests/run-unit-test ===================================== @@ -1,31 +1,30 @@ +#!/bin/sh set -e pkg=bitseq - export LC_ALL=C.UTF-8 + +CUR_DIR=`pwd` + if [ "${AUTOPKGTEST_TMP}" = "" ] ; then AUTOPKGTEST_TMP=$(mktemp -d /tmp/${pkg}-test.XXXXXX) trap "rm -rf ${AUTOPKGTEST_TMP}" 0 INT QUIT ABRT PIPE TERM fi -cp -a "$(dirname "$0")/Data/"* "${AUTOPKGTEST_TMP}/" +cp ${CUR_DIR}/debian-tests-data/* -a "${AUTOPKGTEST_TMP}" cd "${AUTOPKGTEST_TMP}" -bowtie-build -f Ref.fasta index -bowtie -q -v 3 --all -m 100 --sam index Reads.fastq -S out.sam +# Check for pre-generated input +if [ ! -s out.sam ]; then + echo "out.sam not found" + exit 1 +fi -[ -s out.sam ] && echo "Test passed!" || { echo "Output missing or empty"; exit 1; } +parseAlignment out.sam -o result.prob --trSeqFile Ref.fasta --trInfoFile Ref.tr --uniform --verbose -parseAlignment out.sam \ - -o result.prob \ - --trSeqFile Ref.fasta \ - --trInfoFile Ref.tr \ - --uniform --verbose - if [ -s result.prob ] && [ -s Ref.tr ]; then - echo "parseAlignment test passed" + echo " test passed" else - echo "parseAlignment test failed" - exit 1 + exit 1 fi View it on GitLab: https://salsa.debian.org/med-team/bitseq/-/compare/e07930fe2e8adf03d9a08f9299a16b2a09d7ad76...3167b32eff2e733ecd6e8a7f8e99dd8359519107 -- View it on GitLab: https://salsa.debian.org/med-team/bitseq/-/compare/e07930fe2e8adf03d9a08f9299a16b2a09d7ad76...3167b32eff2e733ecd6e8a7f8e99dd8359519107 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Wed Jun 18 19:53:13 2025 From: gitlab at salsa.debian.org (harish chavre (@Harish1)) Date: Wed, 18 Jun 2025 18:53:13 +0000 Subject: [med-svn] [Git][med-team/bitseq][upstream] 2 commits: created gbp.conf Message-ID: <68530b1999f6d_3db179562a038546ba@godard.mail> harish chavre pushed to branch upstream at Debian Med / bitseq Commits: 8927d2e0 by Harish chavre at 2025-06-17T05:09:08+00:00 created gbp.conf - - - - - 5b46266b by Harish chavre at 2025-06-17T05:11:02+00:00 New upstream version 0.7.5+dfsg - - - - - 9 changed files: - + debian-tests-data/Reads.fastq - + debian-tests-data/Ref.fasta - + debian-tests-data/index.1.ebwt - + debian-tests-data/index.2.ebwt - + debian-tests-data/index.3.ebwt - + debian-tests-data/index.4.ebwt - + debian-tests-data/index.rev.1.ebwt - + debian-tests-data/index.rev.2.ebwt - + debian-tests-data/out.sam Changes: ===================================== debian-tests-data/Reads.fastq ===================================== @@ -0,0 +1,8 @@ + at read1 +ACGTACGTACGT ++ +IIIIIIIIIIII + at read2 +ACGTACGTACGT ++ +JJJJJJJJJJJJ ===================================== debian-tests-data/Ref.fasta ===================================== @@ -0,0 +1,2 @@ +>ref +ATGCTAGCATACGACTACAGCATACAGCATCAGACTACGACATCAGACTACAGCATACAGCAATACGACTACAGCATACGACTACAGCATCAGATGCTACGCAGACTACGACATCAGACTACAGCATACGACATCAGACTACTACAGACACAGACACGACGACGACGACTACGACACGACGACTACATCAGACGACGACAGCAGCAGCGACAGCAGACGACATACGACAGCATACGACGACAGACATCAGACGACGACGACGACGACGACGACGACCAGACGCATCAGCAGACACGACGAAAAAAAGGAGCATCAGCA ===================================== debian-tests-data/index.1.ebwt ===================================== Binary files /dev/null and b/debian-tests-data/index.1.ebwt differ ===================================== debian-tests-data/index.2.ebwt ===================================== Binary files /dev/null and b/debian-tests-data/index.2.ebwt differ ===================================== debian-tests-data/index.3.ebwt ===================================== Binary files /dev/null and b/debian-tests-data/index.3.ebwt differ ===================================== debian-tests-data/index.4.ebwt ===================================== Binary files /dev/null and b/debian-tests-data/index.4.ebwt differ ===================================== debian-tests-data/index.rev.1.ebwt ===================================== Binary files /dev/null and b/debian-tests-data/index.rev.1.ebwt differ ===================================== debian-tests-data/index.rev.2.ebwt ===================================== Binary files /dev/null and b/debian-tests-data/index.rev.2.ebwt differ ===================================== debian-tests-data/out.sam ===================================== @@ -0,0 +1,5 @@ + at HD VN:1.0 SO:unsorted + at SQ SN:ref LN:318 + at PG ID:Bowtie VN:1.3.1 CL:"/usr/bin/bowtie-align-s --wrapper basic-0 -q -v 3 --all -m 100 --sam index Reads.fastq -S out.sam" +read1 4 * 0 0 * * 0 0 ACGTACGTACGT IIIIIIIIIIII XM:i:0 +read2 4 * 0 0 * * 0 0 ACGTACGTACGT JJJJJJJJJJJJ XM:i:0 View it on GitLab: https://salsa.debian.org/med-team/bitseq/-/compare/ebcd5e842eff36228eb7742306a08fa2b01c6cfa...5b46266bfcba234e735f51877127e099a0cc9da6 -- View it on GitLab: https://salsa.debian.org/med-team/bitseq/-/compare/ebcd5e842eff36228eb7742306a08fa2b01c6cfa...5b46266bfcba234e735f51877127e099a0cc9da6 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Wed Jun 18 22:08:29 2025 From: gitlab at salsa.debian.org (=?UTF-8?B?w4l0aWVubmUgTW9sbGllciAoQGVtb2xsaWVyKQ==?=) Date: Wed, 18 Jun 2025 21:08:29 +0000 Subject: [med-svn] [Git][med-team/bitseq][master] 2 commits: d/gbp.conf: new: add component debian-tests-data. Message-ID: <68532acd6a553_3db174ca4983904118@godard.mail> ?tienne Mollier pushed to branch master at Debian Med / bitseq Commits: a2b5afc2 by ?tienne Mollier at 2025-06-18T22:48:46+02:00 d/gbp.conf: new: add component debian-tests-data. - - - - - f67cef33 by ?tienne Mollier at 2025-06-18T22:53:49+02:00 d/changelog: initialise changelog for the repack. - - - - - 2 changed files: - debian/changelog - + debian/gbp.conf Changes: ===================================== debian/changelog ===================================== @@ -1,3 +1,12 @@ +bitseq (0.7.5+dfsg2-1) UNRELEASED; urgency=medium + + * Team upload + * created gbp.conf + * New upstream version 0.7.5+dfsg + * Add test data and Bowtie alignment outputs for autopkgtest + + -- Harish chavre Wed, 18 Jun 2025 22:49:31 +0200 + bitseq (0.7.5+dfsg-7) unstable; urgency=medium * Team upload. ===================================== debian/gbp.conf ===================================== @@ -0,0 +1,3 @@ +[DEFAULT] +pristine-tar=True +component=['debian-tests-data'] View it on GitLab: https://salsa.debian.org/med-team/bitseq/-/compare/3167b32eff2e733ecd6e8a7f8e99dd8359519107...f67cef33bf331e9411b0bc5fedc016e64800c253 -- View it on GitLab: https://salsa.debian.org/med-team/bitseq/-/compare/3167b32eff2e733ecd6e8a7f8e99dd8359519107...f67cef33bf331e9411b0bc5fedc016e64800c253 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Wed Jun 18 22:08:33 2025 From: gitlab at salsa.debian.org (=?UTF-8?B?w4l0aWVubmUgTW9sbGllciAoQGVtb2xsaWVyKQ==?=) Date: Wed, 18 Jun 2025 21:08:33 +0000 Subject: [med-svn] [Git][med-team/bitseq] Pushed new tag upstream/0.7.5+dfsg2 Message-ID: <68532ad141b9d_3db173babd439047ac@godard.mail> ?tienne Mollier pushed new tag upstream/0.7.5+dfsg2 at Debian Med / bitseq -- View it on GitLab: https://salsa.debian.org/med-team/bitseq/-/tree/upstream/0.7.5+dfsg2 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Wed Jun 18 22:08:32 2025 From: gitlab at salsa.debian.org (=?UTF-8?B?w4l0aWVubmUgTW9sbGllciAoQGVtb2xsaWVyKQ==?=) Date: Wed, 18 Jun 2025 21:08:32 +0000 Subject: [med-svn] [Git][med-team/bitseq][pristine-tar] 3 commits: pristine-tar data for bitseq_0.7.5+dfsg2.orig-debian-tests-data.tar.xz Message-ID: <68532ad0114ec_3db1743b950390448d@godard.mail> ?tienne Mollier pushed to branch pristine-tar at Debian Med / bitseq Commits: f5884e1d by ?tienne Mollier at 2025-06-18T22:00:17+02:00 pristine-tar data for bitseq_0.7.5+dfsg2.orig-debian-tests-data.tar.xz - - - - - 2ac827d3 by ?tienne Mollier at 2025-06-18T22:00:18+02:00 pristine-tar data for bitseq_0.7.5+dfsg2.orig-debian-tests-data.tar.xz - - - - - 610960d3 by ?tienne Mollier at 2025-06-18T22:00:18+02:00 pristine-tar data for bitseq_0.7.5+dfsg2.orig.tar.xz - - - - - 4 changed files: - + bitseq_0.7.5+dfsg2.orig-debian-tests-data.tar.xz.delta - + bitseq_0.7.5+dfsg2.orig-debian-tests-data.tar.xz.id - + bitseq_0.7.5+dfsg2.orig.tar.xz.delta - + bitseq_0.7.5+dfsg2.orig.tar.xz.id Changes: ===================================== bitseq_0.7.5+dfsg2.orig-debian-tests-data.tar.xz.delta ===================================== Binary files /dev/null and b/bitseq_0.7.5+dfsg2.orig-debian-tests-data.tar.xz.delta differ ===================================== bitseq_0.7.5+dfsg2.orig-debian-tests-data.tar.xz.id ===================================== @@ -0,0 +1 @@ +f325a12ef389c6f0254d6087d7804575ad4eff28 ===================================== bitseq_0.7.5+dfsg2.orig.tar.xz.delta ===================================== Binary files /dev/null and b/bitseq_0.7.5+dfsg2.orig.tar.xz.delta differ ===================================== bitseq_0.7.5+dfsg2.orig.tar.xz.id ===================================== @@ -0,0 +1 @@ +5d2309048de6152c60997e891ed725d1fe8b8bd6 View it on GitLab: https://salsa.debian.org/med-team/bitseq/-/compare/8c2fc023a78bb26977d0e4c3ca12ac8845972135...610960d3fea03e154563076faa91faf3cbc1034d -- View it on GitLab: https://salsa.debian.org/med-team/bitseq/-/compare/8c2fc023a78bb26977d0e4c3ca12ac8845972135...610960d3fea03e154563076faa91faf3cbc1034d You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Thu Jun 19 02:43:32 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Thu, 19 Jun 2025 01:43:32 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <68536b449f16e_3db1743bbe4392758c@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: 5d6e15de by Andreas Tille at 2025-06-19T01:43:28+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Wed, 18 Jun 2025 13:42:04 +0000 +Last-Update: Thu, 19 Jun 2025 01:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- ===================================== debian-science-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Wed, 18 Jun 2025 13:42:09 +0000 +Last-Update: Thu, 19 Jun 2025 01:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Wed, 18 Jun 2025 13:42:12 +0000 +Last-Update: Thu, 19 Jun 2025 01:42:04 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/5d6e15de224704fa52a09fe72482759724445e53 -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/5d6e15de224704fa52a09fe72482759724445e53 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Thu Jun 19 14:43:38 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Thu, 19 Jun 2025 13:43:38 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <6854140a1c16d_3db174ca4984049719@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: b8b2e302 by Andreas Tille at 2025-06-19T13:43:31+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,10 +1,10 @@ -Last-Update: Thu, 19 Jun 2025 01:42:04 +0000 +Last-Update: Thu, 19 Jun 2025 13:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- dicomscope | 30 | {imaging} | orthanc-gdcm | 17 | {imaging} | - oscar | 15 | {data,practice,tools} | + oscar | 16 | {data,practice,tools} | mrtrix3 | 13 | {imaging} | gnumed-server | 11 | {covid-19,practice} | king | 11 | {typesetting,imaging} | @@ -15,13 +15,13 @@ Last-Update: Thu, 19 Jun 2025 01:42:04 +0000 orthanc-postgresql | 9 | {imaging} | bart-view | 8 | {imaging} | heudiconv | 6 | {imaging} | + icb-utils | 6 | {bio-dev} | jebl2 | 6 | {bio-dev} | mia | 6 | {imaging} | - icb-utils | 5 | {bio-dev} | libminc | 5 | {imaging-dev} | - biojava-live | 4 | {bio-dev} | beast-mcmc | 3 | {bio,bio-phylogeny} | biojava6-live | 3 | {bio-dev} | + biojava-live | 3 | {bio-dev} | cmtk | 3 | {imaging} | getdata | 3 | {bio} | insighttoolkit5 | 3 | {imaging-dev} | @@ -33,6 +33,7 @@ Last-Update: Thu, 19 Jun 2025 01:42:04 +0000 elastix | 2 | {imaging} | fastml | 2 | {bio} | ipig | 2 | {bio} | + libdivsufsort | 2 | {bio-dev} | plasmidid | 2 | {covid-19,bio} | rambo-k | 2 | {bio} | staden | 2 | {bio} | @@ -49,7 +50,6 @@ Last-Update: Thu, 19 Jun 2025 01:42:04 +0000 lamarc | 1 | {bio} | libbio-mage-utils-perl | 1 | {bio-dev} | libchado-perl | 1 | {bio-dev} | - libdivsufsort | 1 | {bio-dev} | libgenome | 1 | {bio-dev} | libpal-java | 1 | {bio-dev} | librg-utils-perl | 1 | {bio} | @@ -70,7 +70,6 @@ Last-Update: Thu, 19 Jun 2025 01:42:04 +0000 tracetuner | 1 | {bio} | treeview | 1 | {bio-phylogeny,bio} | varscan | 1 | {covid-19,bio} | - vienna-rna | 1 | {bio,covid-19} | acedb | 0 | {cloud,bio} | bambamc | 0 | {bio-dev} | biojava4-live | 0 | {bio-dev} | @@ -139,8 +138,8 @@ Last-Update: Thu, 19 Jun 2025 01:42:04 +0000 resfinder-db | 0 | {bio} | rtax | 0 | {cloud,bio} | saint | 0 | {bio} | - savvy | 0 | {bio} | savvy | 0 | {bio-dev} | + savvy | 0 | {bio} | sbmltoolbox | 0 | {bio-dev} | sibsim4 | 0 | {cloud,bio} | sift | 0 | {bio} | @@ -153,6 +152,7 @@ Last-Update: Thu, 19 Jun 2025 01:42:04 +0000 srf | 0 | {bio-dev} | suitename | 0 | {bio} | trace2dbest | 0 | {bio} | + vienna-rna | 0 | {bio,covid-19} | xdffileio | 0 | {imaging-dev} | xxsds-dynamic | 0 | {bio-dev} | tipp | -1 | {covid-19,bio} | ===================================== debian-science-tests.txt ===================================== @@ -1,42 +1,42 @@ -Last-Update: Thu, 19 Jun 2025 01:42:04 +0000 +Last-Update: Thu, 19 Jun 2025 13:42:09 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- - nltk | 4881 | {linguistics} | - gts | 4807 | {viewing} | + nltk | 4866 | {linguistics} | + gts | 4802 | {viewing} | opencascade | 620 | {simulations} | - spacenavd | 221 | {tools} | - armadillo | 182 | {mathematics-dev} | - open-coarrays | 177 | {meteorology-dev} | - arpack | 88 | {mathematics-dev} | - scalapack | 51 | {nanoscale-physics-dev} | - visidata | 46 | {datamanagement} | - ntl | 40 | {mathematics-dev} | + spacenavd | 225 | {tools} | + armadillo | 189 | {mathematics-dev} | + open-coarrays | 168 | {meteorology-dev} | + arpack | 87 | {mathematics-dev} | + scalapack | 49 | {nanoscale-physics-dev} | + visidata | 44 | {datamanagement} | + ntl | 41 | {mathematics-dev} | mbpoll | 37 | {simulations} | imview | 36 | {viewing} | ppl | 32 | {numericalcomputation} | - flintqs | 29 | {mathematics} | - arduino-mk | 28 | {robotics} | + flintqs | 30 | {mathematics} | libmatio | 28 | {mathematics-dev} | + arduino-mk | 27 | {robotics} | cliquer | 27 | {mathematics} | - flann | 26 | {mathematics-dev,engineering-dev} | - libm4ri | 24 | {mathematics-dev} | - grads | 21 | {meteorology} | + flann | 25 | {mathematics-dev,engineering-dev} | + libm4ri | 25 | {mathematics-dev} | bossa | 20 | {devices} | setzer | 20 | {typesetting} | - xygrib | 20 | {meteorology} | - guiqwt | 19 | {numericalcomputation,viewing} | + grads | 19 | {meteorology} | picosat | 19 | {logic} | sat4j | 19 | {logic} | + xygrib | 19 | {meteorology} | fftw | 18 | {mathematics-dev,physics-dev,meteorology-dev} | - pyzo | 18 | {numericalcomputation} | + guiqwt | 18 | {numericalcomputation,viewing} | ncl | 17 | {meteorology} | + pyzo | 17 | {numericalcomputation} | sketch | 17 | {typesetting} | dune-uggrid | 15 | {mathematics-dev} | + gts | 15 | {viewing-dev} | lrcalc | 15 | {mathematics-dev} | cliquer | 14 | {mathematics-dev} | eccodes | 14 | {meteorology,meteorology-dev} | - gts | 14 | {viewing-dev} | feff85exafs | 13 | {chemistry} | libitpp | 13 | {mathematics-dev,engineering-dev} | teem | 13 | {imageanalysis} | @@ -49,15 +49,16 @@ Last-Update: Thu, 19 Jun 2025 01:42:04 +0000 eccodes | 10 | {meteorology-dev} | form | 10 | {mathematics} | matlab-support | 10 | {mathematics,numericalcomputation} | + ncl | 10 | {meteorology-dev} | python-escript | 10 | {numericalcomputation,simulations,engineering} | - vdt | 10 | {mathematics-dev} | geg | 9 | {viewing} | libm4rie | 9 | {mathematics-dev} | - ncl | 9 | {meteorology-dev} | python-cdo | 9 | {meteorology} | + vdt | 9 | {mathematics-dev} | alberta | 8 | {engineering-dev} | pcl | 8 | {robotics-dev} | ros-rosconsole | 8 | {robotics-dev} | + uctodata | 8 | {linguistics} | apophenia | 7 | {statistics} | dxsamples | 7 | {nanoscale-physics} | libccp4 | 7 | {nanoscale-physics-dev} | @@ -66,8 +67,6 @@ Last-Update: Thu, 19 Jun 2025 01:42:04 +0000 psurface | 7 | {numericalcomputation} | ratpoints | 7 | {mathematics-dev} | refmac-dictionary | 7 | {highenergy-physics-dev,chemistry} | - uctodata | 7 | {linguistics} | - cld2 | 6 | {linguistics} | etsf-io | 6 | {physics,nanoscale-physics} | libzn-poly | 6 | {mathematics-dev} | magics++ | 6 | {meteorology-dev} | @@ -76,6 +75,7 @@ Last-Update: Thu, 19 Jun 2025 01:42:04 +0000 odc | 6 | {meteorology} | ros-vcstool | 6 | {robotics-dev} | ucto | 6 | {linguistics} | + cld2 | 5 | {linguistics} | fftw | 5 | {meteorology-dev,mathematics-dev,physics-dev} | fpzip | 5 | {meteorology} | newmat | 5 | {mathematics-dev} | @@ -87,14 +87,13 @@ Last-Update: Thu, 19 Jun 2025 01:42:04 +0000 veccore | 5 | {mathematics-dev} | atlas-ecmwf | 4 | {meteorology} | auto-07p | 4 | {mathematics} | - coda | 4 | {meteorology} | coda | 4 | {meteorology-dev} | + coda | 4 | {meteorology} | debian-science | 4 | {economics,nanoscale-physics,machine-learning,physics,mathematics} | debian-science | 4 | {physics,machine-learning,economics,nanoscale-physics} | gsw | 4 | {meteorology} | iapws | 4 | {meteorology} | irstlm | 4 | {linguistics} | - sac2mseed | 4 | {geography} | sdpb | 4 | {numericalcomputation,highenergy-physics} | silo-llnl | 4 | {engineering} | toon | 4 | {numericalcomputation} | @@ -124,8 +123,10 @@ Last-Update: Thu, 19 Jun 2025 01:42:04 +0000 muparser | 3 | {mathematics-dev} | openstereogram | 3 | {tools} | python-aws-xray-sdk | 3 | {dataacquisition-dev} | + sac2mseed | 3 | {geography} | sagemath-database-conway-polynomials | 3 | {mathematics} | sardana | 3 | {dataacquisition} | + silo-llnl | 3 | {engineering} | spaghetti | 3 | {geography} | syrthes | 3 | {engineering} | apache-opennlp | 2 | {linguistics} | @@ -136,8 +137,8 @@ Last-Update: Thu, 19 Jun 2025 01:42:04 +0000 code-saturne | 2 | {mathematics-dev,engineering-dev} | coinor-bonmin | 2 | {mathematics} | cylc-flow | 2 | {meteorology} | - debian-science | 2 | {electrophysiology} | debian-science | 2 | {economics} | + debian-science | 2 | {electrophysiology} | debian-science | 2 | {nanoscale-physics,statistics,economics,physics} | emoslib | 2 | {meteorology} | fastjet | 2 | {highenergy-physics-dev} | @@ -155,6 +156,7 @@ Last-Update: Thu, 19 Jun 2025 01:42:04 +0000 mmdb | 2 | {nanoscale-physics-dev,highenergy-physics-dev} | mseed2sac | 2 | {dataacquisition-dev} | ncrystal | 2 | {nanoscale-physics-dev,highenergy-physics-dev} | + nrn-iv | 2 | {biology} | polylib | 2 | {mathematics} | qd | 2 | {mathematics-dev} | qwtplot3d | 2 | {viewing-dev} | @@ -162,7 +164,6 @@ Last-Update: Thu, 19 Jun 2025 01:42:04 +0000 silo-llnl | 2 | {engineering-dev} | timbl | 2 | {linguistics} | timblserver | 2 | {linguistics} | - x13as | 2 | {economics} | ckon | 1 | {highenergy-physics-dev} | coda | 1 | {meteorology-dev} | code-saturne | 1 | {engineering-dev,mathematics-dev} | @@ -183,7 +184,6 @@ Last-Update: Thu, 19 Jun 2025 01:42:04 +0000 looptools | 1 | {highenergy-physics-dev} | metkit | 1 | {meteorology-dev} | mrmpi | 1 | {tools} | - nrn-iv | 1 | {biology} | openmesh | 1 | {mathematics-dev} | psurface | 1 | {numericalcomputation} | ros-ros-environment | 1 | {robotics-dev} | @@ -193,6 +193,7 @@ Last-Update: Thu, 19 Jun 2025 01:42:04 +0000 ssm | 1 | {nanoscale-physics-dev} | tfdocgen | 1 | {linguistics} | vlfeat | 1 | {imageanalysis-dev} | + x13as | 1 | {economics} | amgcl | 0 | {mathematics-dev} | apertium-afr-nld | 0 | {linguistics} | apertium-bel-rus | 0 | {linguistics} | @@ -223,8 +224,8 @@ Last-Update: Thu, 19 Jun 2025 01:42:04 +0000 libfolia | 0 | {linguistics} | libquantum | 0 | {numericalcomputation} | libsdsl | 0 | {dataacquisition-dev} | - looptools | 0 | {highenergy-physics} | looptools | 0 | {highenergy-physics-dev} | + looptools | 0 | {highenergy-physics} | magma | 0 | {mathematics-dev,numericalcomputation} | mbt | 0 | {linguistics} | mctc-lib | 0 | {nanoscale-physics-dev,highenergy-physics-dev} | @@ -242,8 +243,8 @@ Last-Update: Thu, 19 Jun 2025 01:42:04 +0000 quadrule | 0 | {mathematics-dev} | robot-testing-framework | 0 | {robotics-dev} | ros-collada-urdf | 0 | {robotics} | - ros-metapackages | 0 | {robotics-dev} | ros-metapackages | 0 | {robotics} | + ros-metapackages | 0 | {robotics-dev} | ros-opencv-apps | 0 | {robotics} | sagemath-database-combinatorial-designs | 0 | {mathematics} | sagemath-database-cremona-elliptic-curves | 0 | {mathematics} | @@ -268,5 +269,5 @@ Last-Update: Thu, 19 Jun 2025 01:42:04 +0000 virtuoso-opensource | 0 | {datamanagement} | visp-images | 0 | {robotics-dev} | libelas | -1 | {robotics-dev} | -(296 rows) +(297 rows) ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,185 +1,184 @@ -Last-Update: Thu, 19 Jun 2025 01:42:04 +0000 +Last-Update: Thu, 19 Jun 2025 13:42:13 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- - mpmath | 10016 | - python-repoze.lru | 6987 | - netifaces | 5168 | - ghp-import | 4825 | - python-lunr | 4823 | - python-babel | 3998 | - sortedcontainers | 3618 | - python-babel | 3529 | - aiosignal | 2927 | - hyperlink | 2189 | - python-notify2 | 2005 | - humanfriendly | 1985 | - referencing | 1547 | - python-mysqldb | 1515 | - python-gssapi | 1428 | - python-invoke | 1398 | - python-hyperframe | 1370 | - websocket-client | 1332 | - python-pandocfilters | 1165 | - python-hpack | 1161 | - python-rsa | 1136 | - pdfarranger | 983 | - menulibre | 953 | - python-linux-procfs | 922 | - python-geoip | 874 | - python-webob | 843 | - powerline | 773 | - powerline | 719 | - powerline | 714 | - firmware-microbit-micropython | 695 | - kazam | 672 | - python-zopfli | 642 | - autopep8 | 620 | - u-msgpack-python | 611 | - gaupol | 539 | - pytoolconfig | 530 | - python-et-xmlfile | 526 | - dockerpty | 524 | - asn1crypto | 518 | - python-gevent | 488 | - python-ewmh | 444 | - catfish | 431 | - python-requests-oauthlib | 403 | - spf-engine | 345 | - python-toml | 344 | - python-ntlm-auth | 315 | + mpmath | 9983 | + python-repoze.lru | 6986 | + netifaces | 5158 | + ghp-import | 4810 | + python-lunr | 4806 | + python-babel | 3922 | + sortedcontainers | 3551 | + python-babel | 3459 | + aiosignal | 2918 | + hyperlink | 2170 | + humanfriendly | 1987 | + python-notify2 | 1984 | + referencing | 1534 | + python-mysqldb | 1520 | + python-gssapi | 1420 | + python-invoke | 1401 | + python-hyperframe | 1379 | + websocket-client | 1325 | + python-hpack | 1164 | + python-rsa | 1135 | + python-pandocfilters | 1094 | + pdfarranger | 995 | + menulibre | 956 | + python-linux-procfs | 926 | + python-geoip | 865 | + python-webob | 840 | + powerline | 778 | + powerline | 712 | + powerline | 707 | + kazam | 675 | + firmware-microbit-micropython | 665 | + python-zopfli | 649 | + u-msgpack-python | 613 | + autopep8 | 547 | + gaupol | 527 | + python-et-xmlfile | 521 | + dockerpty | 519 | + asn1crypto | 510 | + python-gevent | 485 | + pytoolconfig | 457 | + python-ewmh | 448 | + catfish | 428 | + python-requests-oauthlib | 398 | + python-toml | 345 | + spf-engine | 344 | + python-ntlm-auth | 307 | spf-engine | 296 | - django-stronghold | 263 | + django-stronghold | 252 | python-ldap3 | 236 | - cairocffi | 220 | - python-mimeparse | 196 | - python-smmap | 180 | - python-hidapi | 171 | - autokey | 163 | - python-anyjson | 152 | - httpie | 146 | - smem | 141 | - kivy | 137 | - python-aiostream | 122 | - python-click-repl | 121 | - smartypants | 116 | - mypaint | 108 | - nodeenv | 106 | - lollypop | 102 | - python-pyu2f | 101 | + cairocffi | 217 | + python-mimeparse | 195 | + python-smmap | 178 | + python-hidapi | 168 | + autokey | 161 | + httpie | 148 | + python-anyjson | 146 | + smem | 139 | + kivy | 136 | + python-aiostream | 123 | + python-click-repl | 120 | + smartypants | 115 | + mypaint | 113 | + nodeenv | 107 | + lollypop | 105 | timekpr-next | 99 | - python-consul | 98 | - mugshot | 95 | + mugshot | 97 | + python-consul | 96 | + python-pyu2f | 96 | pacparser | 94 | - pymacaroons | 91 | - python-rfc6555 | 87 | - pssh | 84 | - pymediainfo | 80 | + pymacaroons | 90 | + python-rfc6555 | 88 | + pssh | 83 | + pymediainfo | 79 | python-colour | 75 | - weasyprint | 72 | - numpy-stl | 71 | + numpy-stl | 73 | python-i3ipc | 71 | - fabric | 70 | - mitmproxy | 69 | - python-pykka | 62 | - pywavelets | 61 | - python-scp | 56 | + weasyprint | 70 | + fabric | 68 | + mitmproxy | 68 | + python-pykka | 64 | + pywavelets | 64 | + ueberzug | 57 | python-looseversion | 55 | - python-uritools | 55 | - ueberzug | 55 | - itstool | 52 | - mysql-connector-python | 52 | + itstool | 54 | + python-uritools | 54 | + python-scp | 52 | + mysql-connector-python | 51 | pyenv | 50 | pymacs | 49 | + khard | 48 | sshtunnel | 48 | - khard | 47 | - hatchling | 46 | - blockdiag | 45 | + hatchling | 47 | + blockdiag | 44 | trac | 44 | python-pysol-cards | 43 | + kivy | 42 | membernator | 42 | powerline-gitstatus | 41 | - pyquery | 41 | certipy | 40 | - kivy | 40 | pamela | 40 | show-in-file-manager | 40 | jupyterhub | 39 | - pylibmc | 39 | - python-scrypt | 36 | + pyquery | 39 | + pylibmc | 38 | persepolis | 35 | - pssh | 34 | + python-scrypt | 35 | pdfposter | 33 | - python-statsd | 31 | - python-args | 29 | + pssh | 33 | + python-statsd | 29 | seqdiag | 28 | - video-downloader | 28 | + python-args | 27 | sphinxcontrib-blockdiag | 27 | + video-downloader | 27 | dkimpy-milter | 26 | - python-clint | 26 | - python-fire | 26 | sphinxcontrib-seqdiag | 26 | - depthcharge-tools | 25 | enzyme | 25 | - flask-principal | 25 | rst2pdf | 25 | sphinx-inline-tabs | 25 | - typogrify | 24 | - cppman | 23 | - python-zstd | 23 | + depthcharge-tools | 24 | + python-clint | 24 | + flask-principal | 23 | + python-fire | 23 | subliminal | 23 | + typogrify | 23 | webpy | 23 | - backoff | 21 | + cppman | 22 | fabric | 21 | - nwdiag | 21 | + python-zstd | 21 | + subliminal | 21 | + nwdiag | 20 | python-rangehttpserver | 20 | - subliminal | 20 | alot | 19 | - django-environ | 19 | + backoff | 19 | python-sdnotify | 19 | - social-auth-core | 19 | spf-engine | 19 | mistune0 | 18 | nwg-displays | 18 | python-demjson | 18 | - python-translationstring | 18 | webtest | 18 | + django-environ | 17 | + python-pysubs2 | 17 | + social-auth-core | 17 | + sphinxcontrib-log-cabinet | 17 | actdiag | 16 | policyd-rate-limit | 16 | pykwalify | 16 | - python-pysubs2 | 16 | python-slip10 | 16 | - sphinxcontrib-log-cabinet | 16 | - python-hupper | 15 | + python-translationstring | 16 | python-inotify | 15 | - python-kyotocabinet | 15 | - python-priority | 15 | sphinxcontrib-actdiag | 15 | sphinxcontrib-nwdiag | 15 | flask-security | 14 | - gtextfsm | 14 | - python-pem | 14 | - python-pyalsa | 14 | + python-kyotocabinet | 14 | python-simpy | 14 | unearth | 14 | - gmplot | 13 | junos-eznc | 13 | pdm | 13 | python-dbussy | 13 | - python-ethtool | 13 | + python-hupper | 13 | + python-pem | 13 | + python-priority | 13 | + python-pyalsa | 13 | python-pyrss2gen | 13 | python-xtermcolor | 13 | + todoman | 13 | ansi | 12 | jschema-to-python | 12 | - pylint-common | 12 | pyp | 12 | + python-ethtool | 12 | python-pyscss | 12 | python-sarif-python-om | 12 | ruff | 12 | speaklater | 12 | - todoman | 12 | beancount | 11 | - django-auditlog | 11 | + gmplot | 11 | + notebook-shim | 11 | + pylint-common | 11 | python-digitalocean | 11 | python-parse-type | 11 | slimit | 11 | @@ -188,37 +187,37 @@ Last-Update: Thu, 19 Jun 2025 01:42:04 +0000 btchip-python | 10 | debiancontributors | 10 | django-sass | 10 | - drf-yasg-nonfree | 10 | flask-paranoid | 10 | - notebook-shim | 10 | - python-aiohttp-security | 10 | - python-crcelk | 10 | - python-drf-spectacular-sidecar-nonfree | 10 | + gtextfsm | 10 | + django-auditlog | 9 | pwntools | 9 | python-overpy | 9 | python-pyaml-env | 9 | python-pyld | 9 | traittypes | 9 | tuna | 9 | + voltron | 9 | beancount | 8 | clustershell | 8 | drf-extensions | 8 | + drf-yasg-nonfree | 8 | htmlmin | 8 | - mercurial-evolve | 8 | - micropython-mpremote | 8 | - python-envs | 8 | + python-aiohttp-security | 8 | + python-crcelk | 8 | + python-drf-spectacular-sidecar-nonfree | 8 | python-numpysane | 8 | python-versioneer | 8 | sphinx-intl | 8 | - trac-wysiwyg | 8 | clustershell | 7 | flask-session | 7 | graphql-relay | 7 | httpcode | 7 | - pydrive2 | 7 | + mercurial-evolve | 7 | + micropython-mpremote | 7 | pytaglib | 7 | pytest-django | 7 | - voltron | 7 | + ruff | 7 | + trac-wysiwyg | 7 | django-model-utils | 6 | django-pglocks | 6 | drf-haystack | 6 | @@ -226,26 +225,24 @@ Last-Update: Thu, 19 Jun 2025 01:42:04 +0000 flask-api | 6 | librouteros | 6 | mypy-protobuf | 6 | - numpy-stl | 6 | pybik | 6 | + pycallgraph | 6 | + pydrive2 | 6 | python3-onelogin-saml2 | 6 | python-ansicolors | 6 | + python-envs | 6 | python-openstep-plist | 6 | python-xdo | 6 | - ruff | 6 | django-jinja | 5 | django-paintstore | 5 | - hachoir | 5 | htmlmin | 5 | - pycallgraph | 5 | + numpy-stl | 5 | pyjokes | 5 | pynliner | 5 | pytest-runner | 5 | python-biplist | 5 | - python-dirq | 5 | python-gnuplotlib | 5 | python-halo | 5 | - python-jpype | 5 | python-simpy | 5 | securestring | 5 | sphinxcontrib-globalsubs | 5 | @@ -260,8 +257,9 @@ Last-Update: Thu, 19 Jun 2025 01:42:04 +0000 django-simple-redis-admin | 4 | django-xmlrpc | 4 | flufl.testing | 4 | + hachoir | 4 | mbed-test-wrapper | 4 | - python-dbus-next | 4 | + python-dirq | 4 | python-django-casclient | 4 | python-django-contact-form | 4 | python-django-registration | 4 | @@ -269,7 +267,6 @@ Last-Update: Thu, 19 Jun 2025 01:42:04 +0000 s3ql | 4 | sorl-thumbnail | 4 | sphinx-markdown-tables | 4 | - utidylib | 4 | cplay-ng | 3 | django-macaddress | 3 | django-pagination | 3 | @@ -293,11 +290,12 @@ Last-Update: Thu, 19 Jun 2025 01:42:04 +0000 pyjunitxml | 3 | pyprind | 3 | pytest-expect | 3 | - python-btrees | 3 | python-cookies | 3 | + python-dbus-next | 3 | python-django-push-notifications | 3 | python-dynaconf | 3 | python-ipfix | 3 | + python-jpype | 3 | python-markuppy | 3 | python-networkmanager | 3 | requests-aws | 3 | @@ -305,6 +303,7 @@ Last-Update: Thu, 19 Jun 2025 01:42:04 +0000 smem | 3 | trac-accountmanager | 3 | trac-xmlrpc | 3 | + utidylib | 3 | vf1 | 3 | yotta | 3 | backupchecker | 2 | @@ -319,19 +318,18 @@ Last-Update: Thu, 19 Jun 2025 01:42:04 +0000 django-graphene | 2 | django-maintenance-mode | 2 | django-yarnpkg | 2 | - dotdrop | 2 | flake8-black | 2 | flask-paginate | 2 | fypp | 2 | gtkman | 2 | hatch-jupyter-builder | 2 | - humanfriendly | 2 | jsonrpclib-pelix | 2 | namecheap | 2 | pylint-celery | 2 | pypass | 2 | pyroma | 2 | python-bitbucket-api | 2 | + python-btrees | 2 | python-chartkick | 2 | python-commentjson | 2 | python-deepmerge | 2 | @@ -344,6 +342,7 @@ Last-Update: Thu, 19 Jun 2025 01:42:04 +0000 python-openshift | 2 | python-opentracing | 2 | python-pgmagick | 2 | + python-pysubs2 | 2 | python-py-zipkin | 2 | python-qtpynodeeditor | 2 | python-securesystemslib | 2 | @@ -356,12 +355,14 @@ Last-Update: Thu, 19 Jun 2025 01:42:04 +0000 vcversioner | 2 | vrfydmn | 2 | wikitrans | 2 | + zabbix-cli | 2 | apkinspector | 1 | celery-progress | 1 | codicefiscale | 1 | + dotdrop | 1 | errbot | 1 | flask-multistatic | 1 | - jpy | 1 | + humanfriendly | 1 | jupyter-sphinx | 1 | korean-lunar-calendar | 1 | milksnake | 1 | @@ -391,7 +392,6 @@ Last-Update: Thu, 19 Jun 2025 01:42:04 +0000 python-openid-cla | 1 | python-openqa-client | 1 | python-pypump | 1 | - python-pysubs2 | 1 | python-rdflib-endpoint | 1 | python-schedutils | 1 | python-sphinx-examples | 1 | @@ -409,7 +409,6 @@ Last-Update: Thu, 19 Jun 2025 01:42:04 +0000 vncdotool | 1 | wchartype | 1 | wikitrans | 1 | - zabbix-cli | 1 | zlmdb | 1 | zzzeeksphinx | 1 | aioairzone | 0 | @@ -457,6 +456,7 @@ Last-Update: Thu, 19 Jun 2025 01:42:04 +0000 humanfriendly | 0 | hypothesis-auto | 0 | ikos | 0 | + jpy | 0 | jpylyzer | 0 | kivy | 0 | libthumbor | 0 | View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/b8b2e302eb397b9da0e2ea9a8d871c290bcd9ee0 -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/b8b2e302eb397b9da0e2ea9a8d871c290bcd9ee0 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Fri Jun 20 02:43:36 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Fri, 20 Jun 2025 01:43:36 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <6854bcc894404_3db174ca498418056e@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: 3104076b by Andreas Tille at 2025-06-20T01:43:32+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Thu, 19 Jun 2025 13:42:04 +0000 +Last-Update: Fri, 20 Jun 2025 01:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- ===================================== debian-science-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Thu, 19 Jun 2025 13:42:09 +0000 +Last-Update: Fri, 20 Jun 2025 01:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Thu, 19 Jun 2025 13:42:13 +0000 +Last-Update: Fri, 20 Jun 2025 01:42:05 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/3104076b7351a5227237c8da11de26a87ee665bc -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/3104076b7351a5227237c8da11de26a87ee665bc You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Fri Jun 20 14:43:39 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Fri, 20 Jun 2025 13:43:39 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <6855658bb469_3db1722af6c42957e1@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: 54db7f6a by Andreas Tille at 2025-06-20T13:43:31+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,34 +1,35 @@ -Last-Update: Fri, 20 Jun 2025 01:42:04 +0000 +Last-Update: Fri, 20 Jun 2025 13:42:03 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- dicomscope | 30 | {imaging} | orthanc-gdcm | 17 | {imaging} | - oscar | 16 | {data,practice,tools} | - mrtrix3 | 13 | {imaging} | + oscar | 17 | {data,tools,practice} | + mrtrix3 | 14 | {imaging} | gnumed-server | 11 | {covid-19,practice} | king | 11 | {typesetting,imaging} | + pixelmed | 11 | {imaging} | orthanc-mysql | 10 | {imaging} | - pixelmed | 10 | {imaging} | sight | 10 | {imaging} | adun.app | 9 | {bio} | + bart-view | 9 | {imaging} | orthanc-postgresql | 9 | {imaging} | - bart-view | 8 | {imaging} | + icb-utils | 7 | {bio-dev} | heudiconv | 6 | {imaging} | - icb-utils | 6 | {bio-dev} | jebl2 | 6 | {bio-dev} | + libminc | 6 | {imaging-dev} | mia | 6 | {imaging} | - libminc | 5 | {imaging-dev} | + insighttoolkit5 | 4 | {imaging-dev} | beast-mcmc | 3 | {bio,bio-phylogeny} | biojava6-live | 3 | {bio-dev} | biojava-live | 3 | {bio-dev} | cmtk | 3 | {imaging} | getdata | 3 | {bio} | - insighttoolkit5 | 3 | {imaging-dev} | pbcopper | 3 | {bio-dev} | pbseqlib | 3 | {bio-dev} | piler | 3 | {bio} | sight | 3 | {imaging} | + ants | 2 | {imaging} | bio-tradis | 2 | {bio,bio-dev} | elastix | 2 | {imaging} | fastml | 2 | {bio} | @@ -36,13 +37,13 @@ Last-Update: Fri, 20 Jun 2025 01:42:04 +0000 libdivsufsort | 2 | {bio-dev} | plasmidid | 2 | {covid-19,bio} | rambo-k | 2 | {bio} | - staden | 2 | {bio} | - ants | 1 | {imaging} | + tracetuner | 2 | {bio} | blimps | 1 | {bio} | brig | 1 | {bio} | ctn | 1 | {imaging-dev} | cufflinks | 1 | {cloud,bio} | dextractor | 1 | {bio,covid-19} | + eegdev | 1 | {imaging-dev} | emboss-explorer | 1 | {bio} | hinge | 1 | {bio} | htscodecs | 1 | {bio-dev,covid-19} | @@ -53,23 +54,25 @@ Last-Update: Fri, 20 Jun 2025 01:42:04 +0000 libgenome | 1 | {bio-dev} | libpal-java | 1 | {bio-dev} | librg-utils-perl | 1 | {bio} | + melting | 1 | {cloud,bio} | mhap | 1 | {bio,bio-ngs} | ncbi-vdb | 1 | {bio-dev} | papyrus | 1 | {imaging-dev} | phyutility | 1 | {cloud,bio} | proalign | 1 | {bio-phylogeny,bio} | - python-seqcluster | 1 | {covid-19,bio-dev} | + python-seqcluster | 1 | {bio-dev,covid-19} | runcircos-gui | 1 | {bio} | seq-gen | 1 | {bio} | sga | 1 | {bio} | - spread-phy | 1 | {bio-phylogeny,bio} | + spread-phy | 1 | {bio,bio-phylogeny} | + staden | 1 | {bio} | surankco | 1 | {bio} | surpyvor | 1 | {bio} | thesias | 1 | {bio,covid-19} | - tophat-recondition | 1 | {bio,covid-19} | - tracetuner | 1 | {bio} | + tophat-recondition | 1 | {covid-19,bio} | treeview | 1 | {bio-phylogeny,bio} | varscan | 1 | {covid-19,bio} | + xdffileio | 1 | {imaging-dev} | acedb | 0 | {cloud,bio} | bambamc | 0 | {bio-dev} | biojava4-live | 0 | {bio-dev} | @@ -77,7 +80,6 @@ Last-Update: Fri, 20 Jun 2025 01:42:04 +0000 camp | 0 | {imaging-dev} | capsule-maven-nextflow | 0 | {bio-dev} | ctffind | 0 | {bio} | - eegdev | 0 | {imaging-dev} | embassy-domainatrix | 0 | {cloud,bio} | embassy-domalign | 0 | {bio,cloud} | embassy-domsearch | 0 | {cloud,bio} | @@ -116,7 +118,6 @@ Last-Update: Fri, 20 Jun 2025 01:42:04 +0000 mauve-aligner | 0 | {bio} | maxflow | 0 | {imaging-dev} | megan-ce | 0 | {bio} | - melting | 0 | {cloud,bio} | metastudent-data | 0 | {bio} | metastudent-data-2 | 0 | {bio} | mia | 0 | {imaging-dev} | @@ -125,7 +126,7 @@ Last-Update: Fri, 20 Jun 2025 01:42:04 +0000 opencfu | 0 | {laboratory} | orthanc-imagej | 0 | {imaging} | pbseqlib | 0 | {bio-dev} | - pigx-rnaseq | 0 | {covid-19,bio} | + pigx-rnaseq | 0 | {bio,covid-19} | placnet | 0 | {bio} | plasmidseeker | 0 | {bio} | pscan-chip | 0 | {bio} | @@ -136,7 +137,7 @@ Last-Update: Fri, 20 Jun 2025 01:42:04 +0000 rdp-alignment | 0 | {bio} | rdp-classifier | 0 | {bio} | resfinder-db | 0 | {bio} | - rtax | 0 | {cloud,bio} | + rtax | 0 | {bio,cloud} | saint | 0 | {bio} | savvy | 0 | {bio-dev} | savvy | 0 | {bio} | @@ -145,7 +146,7 @@ Last-Update: Fri, 20 Jun 2025 01:42:04 +0000 sift | 0 | {bio} | sight | 0 | {imaging-dev} | skesa | 0 | {bio} | - smrtanalysis | 0 | {covid-19,bio} | + smrtanalysis | 0 | {bio,covid-19} | soapaligner | 0 | {bio} | soapsnp | 0 | {bio} | sprai | 0 | {bio} | @@ -153,8 +154,8 @@ Last-Update: Fri, 20 Jun 2025 01:42:04 +0000 suitename | 0 | {bio} | trace2dbest | 0 | {bio} | vienna-rna | 0 | {bio,covid-19} | - xdffileio | 0 | {imaging-dev} | xxsds-dynamic | 0 | {bio-dev} | - tipp | -1 | {covid-19,bio} | -(180 rows) + sideretro | -1 | {bio} | + tipp | -1 | {bio,covid-19} | +(181 rows) ===================================== debian-science-tests.txt ===================================== @@ -1,82 +1,81 @@ -Last-Update: Fri, 20 Jun 2025 01:42:04 +0000 +Last-Update: Fri, 20 Jun 2025 13:42:08 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- - nltk | 4866 | {linguistics} | - gts | 4802 | {viewing} | - opencascade | 620 | {simulations} | - spacenavd | 225 | {tools} | - armadillo | 189 | {mathematics-dev} | + nltk | 4858 | {linguistics} | + gts | 4780 | {viewing} | + opencascade | 616 | {simulations} | + spacenavd | 222 | {tools} | + armadillo | 188 | {mathematics-dev} | open-coarrays | 168 | {meteorology-dev} | - arpack | 87 | {mathematics-dev} | + arpack | 85 | {mathematics-dev} | scalapack | 49 | {nanoscale-physics-dev} | - visidata | 44 | {datamanagement} | + visidata | 43 | {datamanagement} | ntl | 41 | {mathematics-dev} | + imview | 37 | {viewing} | mbpoll | 37 | {simulations} | - imview | 36 | {viewing} | ppl | 32 | {numericalcomputation} | - flintqs | 30 | {mathematics} | - libmatio | 28 | {mathematics-dev} | - arduino-mk | 27 | {robotics} | - cliquer | 27 | {mathematics} | + flintqs | 29 | {mathematics} | + libmatio | 27 | {mathematics-dev} | + cliquer | 26 | {mathematics} | + libm4ri | 26 | {mathematics-dev} | + arduino-mk | 25 | {robotics} | flann | 25 | {mathematics-dev,engineering-dev} | - libm4ri | 25 | {mathematics-dev} | bossa | 20 | {devices} | - setzer | 20 | {typesetting} | + fftw | 19 | {mathematics-dev,physics-dev,meteorology-dev} | grads | 19 | {meteorology} | picosat | 19 | {logic} | sat4j | 19 | {logic} | + setzer | 19 | {typesetting} | xygrib | 19 | {meteorology} | - fftw | 18 | {mathematics-dev,physics-dev,meteorology-dev} | guiqwt | 18 | {numericalcomputation,viewing} | ncl | 17 | {meteorology} | pyzo | 17 | {numericalcomputation} | - sketch | 17 | {typesetting} | - dune-uggrid | 15 | {mathematics-dev} | + lrcalc | 16 | {mathematics-dev} | + sketch | 16 | {typesetting} | + cliquer | 15 | {mathematics-dev} | gts | 15 | {viewing-dev} | - lrcalc | 15 | {mathematics-dev} | - cliquer | 14 | {mathematics-dev} | + dune-uggrid | 14 | {mathematics-dev} | eccodes | 14 | {meteorology,meteorology-dev} | feff85exafs | 13 | {chemistry} | - libitpp | 13 | {mathematics-dev,engineering-dev} | + gf2x | 13 | {mathematics-dev} | teem | 13 | {imageanalysis} | - gf2x | 12 | {mathematics-dev} | + iml | 12 | {mathematics-dev} | + libhomfly | 12 | {mathematics-dev} | + libitpp | 12 | {mathematics-dev,engineering-dev} | + lxi-tools | 12 | {engineering,dataacquisition} | coinor-symphony | 11 | {logic,mathematics,numericalcomputation} | feedgnuplot | 11 | {viewing} | - iml | 11 | {mathematics-dev} | - libhomfly | 11 | {mathematics-dev} | - lxi-tools | 11 | {engineering,dataacquisition} | eccodes | 10 | {meteorology-dev} | form | 10 | {mathematics} | + libm4rie | 10 | {mathematics-dev} | matlab-support | 10 | {mathematics,numericalcomputation} | ncl | 10 | {meteorology-dev} | python-escript | 10 | {numericalcomputation,simulations,engineering} | geg | 9 | {viewing} | - libm4rie | 9 | {mathematics-dev} | + pcl | 9 | {robotics-dev} | python-cdo | 9 | {meteorology} | - vdt | 9 | {mathematics-dev} | - alberta | 8 | {engineering-dev} | - pcl | 8 | {robotics-dev} | + ratpoints | 8 | {mathematics-dev} | ros-rosconsole | 8 | {robotics-dev} | - uctodata | 8 | {linguistics} | + vdt | 8 | {mathematics-dev} | + alberta | 7 | {engineering-dev} | apophenia | 7 | {statistics} | dxsamples | 7 | {nanoscale-physics} | libccp4 | 7 | {nanoscale-physics-dev} | + libzn-poly | 7 | {mathematics-dev} | opencascade | 7 | {simulations} | persalys | 7 | {engineering,statistics,mathematics} | psurface | 7 | {numericalcomputation} | - ratpoints | 7 | {mathematics-dev} | refmac-dictionary | 7 | {highenergy-physics-dev,chemistry} | + uctodata | 7 | {linguistics} | + cld2 | 6 | {linguistics} | etsf-io | 6 | {physics,nanoscale-physics} | - libzn-poly | 6 | {mathematics-dev} | + fftw | 6 | {meteorology-dev,mathematics-dev,physics-dev} | magics++ | 6 | {meteorology-dev} | metar | 6 | {meteorology} | - odc | 6 | {meteorology-dev} | odc | 6 | {meteorology} | + odc | 6 | {meteorology-dev} | ros-vcstool | 6 | {robotics-dev} | - ucto | 6 | {linguistics} | - cld2 | 5 | {linguistics} | - fftw | 5 | {meteorology-dev,mathematics-dev,physics-dev} | fpzip | 5 | {meteorology} | newmat | 5 | {mathematics-dev} | persalys | 5 | {statistics,mathematics,engineering} | @@ -84,23 +83,22 @@ Last-Update: Fri, 20 Jun 2025 01:42:04 +0000 rubiks | 5 | {geometry,mathematics} | toontag | 5 | {numericalcomputation} | toulbar2 | 5 | {logic,numericalcomputation,mathematics,physics} | + ucto | 5 | {linguistics} | veccore | 5 | {mathematics-dev} | atlas-ecmwf | 4 | {meteorology} | auto-07p | 4 | {mathematics} | coda | 4 | {meteorology-dev} | coda | 4 | {meteorology} | - debian-science | 4 | {economics,nanoscale-physics,machine-learning,physics,mathematics} | debian-science | 4 | {physics,machine-learning,economics,nanoscale-physics} | + debian-science | 4 | {economics,nanoscale-physics,machine-learning,physics,mathematics} | + getdp | 4 | {engineering,mathematics,simulations} | gsw | 4 | {meteorology} | iapws | 4 | {meteorology} | - irstlm | 4 | {linguistics} | sdpb | 4 | {numericalcomputation,highenergy-physics} | silo-llnl | 4 | {engineering} | toon | 4 | {numericalcomputation} | - urdfdom-headers | 4 | {robotics-dev} | apertium-eval-translator | 3 | {linguistics} | cmor | 3 | {meteorology} | - dimbl | 3 | {linguistics} | drslib | 3 | {meteorology} | dune-functions | 3 | {mathematics-dev} | dune-localfunctions | 3 | {mathematics-dev} | @@ -108,10 +106,9 @@ Last-Update: Fri, 20 Jun 2025 01:42:04 +0000 dxflib | 3 | {engineering-dev} | ecbuild | 3 | {meteorology-dev} | emoslib | 3 | {meteorology-dev} | - frog | 3 | {linguistics} | - getdp | 3 | {engineering,mathematics,simulations} | hdf-eos5 | 3 | {meteorology-dev} | ipe-tools | 3 | {typesetting} | + irstlm | 3 | {linguistics} | libcgns | 3 | {engineering} | libgctp | 3 | {meteorology-dev} | libmatheval | 3 | {mathematics} | @@ -129,19 +126,22 @@ Last-Update: Fri, 20 Jun 2025 01:42:04 +0000 silo-llnl | 3 | {engineering} | spaghetti | 3 | {geography} | syrthes | 3 | {engineering} | + urdfdom-headers | 3 | {robotics-dev} | apache-opennlp | 2 | {linguistics} | apertium-streamparser | 2 | {linguistics} | apophenia | 2 | {statistics} | atlas-ecmwf | 2 | {meteorology-dev} | clipper | 2 | {nanoscale-physics-dev} | - code-saturne | 2 | {mathematics-dev,engineering-dev} | coinor-bonmin | 2 | {mathematics} | cylc-flow | 2 | {meteorology} | + debian-science | 2 | {neuroscience-cognitive} | debian-science | 2 | {economics} | debian-science | 2 | {electrophysiology} | debian-science | 2 | {nanoscale-physics,statistics,economics,physics} | + dimbl | 2 | {linguistics} | emoslib | 2 | {meteorology} | fastjet | 2 | {highenergy-physics-dev} | + frog | 2 | {linguistics} | gemmlowp | 2 | {mathematics-dev} | harp | 2 | {meteorology} | hpcc | 2 | {numericalcomputation,distributedcomputing} | @@ -150,8 +150,6 @@ Last-Update: Fri, 20 Jun 2025 01:42:04 +0000 libgtkdatabox | 2 | {engineering-dev,viewing-dev} | liblbfgs | 2 | {mathematics-dev} | libmatheval | 2 | {mathematics-dev} | - mbt | 2 | {linguistics} | - mbtserver | 2 | {linguistics} | metkit | 2 | {meteorology} | mmdb | 2 | {nanoscale-physics-dev,highenergy-physics-dev} | mseed2sac | 2 | {dataacquisition-dev} | @@ -162,15 +160,15 @@ Last-Update: Fri, 20 Jun 2025 01:42:04 +0000 qwtplot3d | 2 | {viewing-dev} | scram | 2 | {engineering} | silo-llnl | 2 | {engineering-dev} | - timbl | 2 | {linguistics} | - timblserver | 2 | {linguistics} | + asl | 1 | {physics-dev} | ckon | 1 | {highenergy-physics-dev} | coda | 1 | {meteorology-dev} | + code-saturne | 1 | {mathematics-dev,engineering-dev} | code-saturne | 1 | {engineering-dev,mathematics-dev} | coinmp | 1 | {logic,mathematics-dev,numericalcomputation} | - debian-science | 1 | {neuroscience-cognitive} | debian-science | 1 | {neuroscience-cognitive,machine-learning} | debian-science | 1 | {tools} | + debian-science | 1 | {psychophysics} | fpzip | 1 | {meteorology-dev} | frogdata | 1 | {linguistics} | gadap | 1 | {meteorology-dev} | @@ -182,8 +180,11 @@ Last-Update: Fri, 20 Jun 2025 01:42:04 +0000 liblxi | 1 | {engineering-dev,dataacquisition-dev} | liborigin2 | 1 | {viewing-dev} | looptools | 1 | {highenergy-physics-dev} | + mbt | 1 | {linguistics} | + mbtserver | 1 | {linguistics} | metkit | 1 | {meteorology-dev} | mrmpi | 1 | {tools} | + neartree | 1 | {mathematics-dev,numericalcomputation} | openmesh | 1 | {mathematics-dev} | psurface | 1 | {numericalcomputation} | ros-ros-environment | 1 | {robotics-dev} | @@ -192,6 +193,8 @@ Last-Update: Fri, 20 Jun 2025 01:42:04 +0000 spfft | 1 | {mathematics-dev,nanoscale-physics-dev,physics-dev,meteorology-dev} | ssm | 1 | {nanoscale-physics-dev} | tfdocgen | 1 | {linguistics} | + timbl | 1 | {linguistics} | + timblserver | 1 | {linguistics} | vlfeat | 1 | {imageanalysis-dev} | x13as | 1 | {economics} | amgcl | 0 | {mathematics-dev} | @@ -203,7 +206,6 @@ Last-Update: Fri, 20 Jun 2025 01:42:04 +0000 apertium-urd | 0 | {linguistics} | apertium-urd-hin | 0 | {linguistics} | apriltag | 0 | {robotics-dev} | - asl | 0 | {physics-dev} | calculix-ccx-test | 0 | {simulations,numericalcomputation,engineering} | clhep | 0 | {highenergy-physics-dev} | cmor | 0 | {meteorology-dev} | @@ -212,10 +214,9 @@ Last-Update: Fri, 20 Jun 2025 01:42:04 +0000 collada-dom | 0 | {viewing-dev} | cqrlib | 0 | {mathematics-dev} | cvector | 0 | {mathematics-dev} | - debian-science | 0 | {physics} | - debian-science | 0 | {psychophysics} | debian-science | 0 | {nanoscale-physics-dev} | debian-science | 0 | {electrophysiology} | + debian-science | 0 | {physics} | dune-grid-glue | 0 | {mathematics-dev} | etsf-io | 0 | {nanoscale-physics-dev} | fastjet | 0 | {highenergy-physics-dev} | @@ -232,7 +233,6 @@ Last-Update: Fri, 20 Jun 2025 01:42:04 +0000 meshsdfilter | 0 | {mathematics-dev} | metis-edf | 0 | {engineering,numericalcomputation} | metis-edf | 0 | {engineering-dev} | - neartree | 0 | {mathematics-dev,numericalcomputation} | nrn-mod2c | 0 | {biology} | openctm | 0 | {physics-dev} | opengv | 0 | {geometry} | ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,252 +1,251 @@ -Last-Update: Fri, 20 Jun 2025 01:42:05 +0000 +Last-Update: Fri, 20 Jun 2025 13:42:11 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- - mpmath | 9983 | - python-repoze.lru | 6986 | - netifaces | 5158 | - ghp-import | 4810 | - python-lunr | 4806 | - python-babel | 3922 | - sortedcontainers | 3551 | - python-babel | 3459 | - aiosignal | 2918 | - hyperlink | 2170 | - humanfriendly | 1987 | - python-notify2 | 1984 | - referencing | 1534 | + mpmath | 9943 | + python-repoze.lru | 6981 | + netifaces | 5173 | + ghp-import | 4804 | + python-lunr | 4799 | + python-babel | 3874 | + sortedcontainers | 3516 | + python-babel | 3424 | + aiosignal | 2933 | + hyperlink | 2160 | + humanfriendly | 1980 | + python-notify2 | 1967 | + referencing | 1540 | python-mysqldb | 1520 | - python-gssapi | 1420 | - python-invoke | 1401 | - python-hyperframe | 1379 | - websocket-client | 1325 | - python-hpack | 1164 | - python-rsa | 1135 | - python-pandocfilters | 1094 | - pdfarranger | 995 | - menulibre | 956 | - python-linux-procfs | 926 | - python-geoip | 865 | - python-webob | 840 | - powerline | 778 | - powerline | 712 | - powerline | 707 | - kazam | 675 | + python-gssapi | 1450 | + python-invoke | 1402 | + python-hyperframe | 1367 | + websocket-client | 1320 | + python-hpack | 1153 | + python-rsa | 1132 | + python-pandocfilters | 1057 | + pdfarranger | 985 | + menulibre | 946 | + python-linux-procfs | 927 | + python-geoip | 866 | + python-webob | 818 | + powerline | 768 | + powerline | 708 | + powerline | 702 | firmware-microbit-micropython | 665 | - python-zopfli | 649 | - u-msgpack-python | 613 | - autopep8 | 547 | - gaupol | 527 | - python-et-xmlfile | 521 | - dockerpty | 519 | + python-zopfli | 663 | + kazam | 660 | + u-msgpack-python | 607 | + python-et-xmlfile | 524 | + gaupol | 522 | + autopep8 | 515 | + dockerpty | 515 | asn1crypto | 510 | python-gevent | 485 | - pytoolconfig | 457 | - python-ewmh | 448 | - catfish | 428 | - python-requests-oauthlib | 398 | - python-toml | 345 | + python-ewmh | 453 | + catfish | 426 | + pytoolconfig | 426 | + python-requests-oauthlib | 400 | spf-engine | 344 | + python-toml | 340 | python-ntlm-auth | 307 | spf-engine | 296 | - django-stronghold | 252 | - python-ldap3 | 236 | + django-stronghold | 248 | + python-ldap3 | 241 | cairocffi | 217 | python-mimeparse | 195 | - python-smmap | 178 | - python-hidapi | 168 | - autokey | 161 | - httpie | 148 | - python-anyjson | 146 | + python-smmap | 175 | + python-hidapi | 165 | + autokey | 163 | + httpie | 146 | + python-anyjson | 144 | smem | 139 | kivy | 136 | - python-aiostream | 123 | - python-click-repl | 120 | - smartypants | 115 | + python-aiostream | 126 | + python-click-repl | 124 | + smartypants | 120 | mypaint | 113 | - nodeenv | 107 | + nodeenv | 106 | lollypop | 105 | timekpr-next | 99 | - mugshot | 97 | - python-consul | 96 | + python-consul | 97 | + mugshot | 96 | python-pyu2f | 96 | - pacparser | 94 | - pymacaroons | 90 | - python-rfc6555 | 88 | - pssh | 83 | - pymediainfo | 79 | - python-colour | 75 | - numpy-stl | 73 | - python-i3ipc | 71 | - weasyprint | 70 | - fabric | 68 | - mitmproxy | 68 | - python-pykka | 64 | - pywavelets | 64 | + pacparser | 93 | + pymacaroons | 91 | + python-rfc6555 | 89 | + pssh | 82 | + pymediainfo | 77 | + python-colour | 73 | + python-i3ipc | 72 | + numpy-stl | 71 | + weasyprint | 68 | + mitmproxy | 67 | + fabric | 66 | + python-pykka | 66 | + pywavelets | 66 | ueberzug | 57 | + python-uritools | 56 | python-looseversion | 55 | itstool | 54 | - python-uritools | 54 | - python-scp | 52 | + python-scp | 53 | mysql-connector-python | 51 | pyenv | 50 | pymacs | 49 | - khard | 48 | sshtunnel | 48 | hatchling | 47 | + khard | 47 | blockdiag | 44 | trac | 44 | - python-pysol-cards | 43 | + membernator | 43 | kivy | 42 | - membernator | 42 | - powerline-gitstatus | 41 | + python-pysol-cards | 41 | certipy | 40 | pamela | 40 | - show-in-file-manager | 40 | + pyquery | 40 | jupyterhub | 39 | - pyquery | 39 | + powerline-gitstatus | 38 | pylibmc | 38 | + show-in-file-manager | 37 | + python-scrypt | 36 | persepolis | 35 | - python-scrypt | 35 | pdfposter | 33 | pssh | 33 | - python-statsd | 29 | + python-statsd | 30 | + python-args | 28 | seqdiag | 28 | - python-args | 27 | + dkimpy-milter | 27 | sphinxcontrib-blockdiag | 27 | - video-downloader | 27 | - dkimpy-milter | 26 | + enzyme | 26 | + flask-principal | 26 | sphinxcontrib-seqdiag | 26 | - enzyme | 25 | + depthcharge-tools | 25 | + python-clint | 25 | rst2pdf | 25 | sphinx-inline-tabs | 25 | - depthcharge-tools | 24 | - python-clint | 24 | - flask-principal | 23 | - python-fire | 23 | - subliminal | 23 | - typogrify | 23 | + typogrify | 25 | + video-downloader | 25 | + python-fire | 24 | + subliminal | 24 | webpy | 23 | cppman | 22 | + python-zstd | 22 | + subliminal | 22 | fabric | 21 | - python-zstd | 21 | - subliminal | 21 | + backoff | 20 | nwdiag | 20 | python-rangehttpserver | 20 | + python-sdnotify | 20 | + spf-engine | 20 | alot | 19 | - backoff | 19 | - python-sdnotify | 19 | - spf-engine | 19 | - mistune0 | 18 | + python-demjson | 19 | + django-environ | 18 | nwg-displays | 18 | - python-demjson | 18 | + python-pysubs2 | 18 | webtest | 18 | - django-environ | 17 | - python-pysubs2 | 17 | + mistune0 | 17 | + python-translationstring | 17 | social-auth-core | 17 | sphinxcontrib-log-cabinet | 17 | actdiag | 16 | + flask-security | 16 | policyd-rate-limit | 16 | - pykwalify | 16 | python-slip10 | 16 | - python-translationstring | 16 | python-inotify | 15 | sphinxcontrib-actdiag | 15 | sphinxcontrib-nwdiag | 15 | - flask-security | 14 | + todoman | 15 | + unearth | 15 | + pdm | 14 | + pykwalify | 14 | + python-ethtool | 14 | + python-hupper | 14 | python-kyotocabinet | 14 | + python-pem | 14 | + python-priority | 14 | + python-pyalsa | 14 | python-simpy | 14 | - unearth | 14 | junos-eznc | 13 | - pdm | 13 | python-dbussy | 13 | - python-hupper | 13 | - python-pem | 13 | - python-priority | 13 | - python-pyalsa | 13 | - python-pyrss2gen | 13 | + python-pyscss | 13 | python-xtermcolor | 13 | - todoman | 13 | ansi | 12 | + gmplot | 12 | jschema-to-python | 12 | + notebook-shim | 12 | pyp | 12 | - python-ethtool | 12 | - python-pyscss | 12 | + python-pyrss2gen | 12 | python-sarif-python-om | 12 | ruff | 12 | speaklater | 12 | - beancount | 11 | - gmplot | 11 | - notebook-shim | 11 | + autotiling | 11 | + flask-paranoid | 11 | + gtextfsm | 11 | pylint-common | 11 | python-digitalocean | 11 | python-parse-type | 11 | slimit | 11 | txt2tags | 11 | - autotiling | 10 | + beancount | 10 | btchip-python | 10 | - debiancontributors | 10 | + django-auditlog | 10 | django-sass | 10 | - flask-paranoid | 10 | - gtextfsm | 10 | - django-auditlog | 9 | + python-pyld | 10 | + tuna | 10 | + clustershell | 9 | + debiancontributors | 9 | + drf-yasg-nonfree | 9 | pwntools | 9 | + python-aiohttp-security | 9 | + python-crcelk | 9 | + python-drf-spectacular-sidecar-nonfree | 9 | + python-numpysane | 9 | python-overpy | 9 | python-pyaml-env | 9 | - python-pyld | 9 | traittypes | 9 | - tuna | 9 | voltron | 9 | - beancount | 8 | - clustershell | 8 | drf-extensions | 8 | - drf-yasg-nonfree | 8 | + flask-session | 8 | htmlmin | 8 | - python-aiohttp-security | 8 | - python-crcelk | 8 | - python-drf-spectacular-sidecar-nonfree | 8 | - python-numpysane | 8 | python-versioneer | 8 | sphinx-intl | 8 | + beancount | 7 | clustershell | 7 | - flask-session | 7 | + flask-api | 7 | graphql-relay | 7 | httpcode | 7 | mercurial-evolve | 7 | micropython-mpremote | 7 | + pybik | 7 | pytaglib | 7 | pytest-django | 7 | + python-envs | 7 | ruff | 7 | trac-wysiwyg | 7 | django-model-utils | 6 | django-pglocks | 6 | drf-haystack | 6 | easyprocess | 6 | - flask-api | 6 | librouteros | 6 | mypy-protobuf | 6 | - pybik | 6 | pycallgraph | 6 | pydrive2 | 6 | python3-onelogin-saml2 | 6 | python-ansicolors | 6 | - python-envs | 6 | + python-biplist | 6 | + python-gnuplotlib | 6 | python-openstep-plist | 6 | python-xdo | 6 | django-jinja | 5 | django-paintstore | 5 | + hachoir | 5 | htmlmin | 5 | numpy-stl | 5 | pyjokes | 5 | pynliner | 5 | pytest-runner | 5 | - python-biplist | 5 | - python-gnuplotlib | 5 | python-halo | 5 | python-simpy | 5 | - securestring | 5 | sphinxcontrib-globalsubs | 5 | - west | 5 | aiomysql | 4 | azote | 4 | bootstrap-flask | 4 | @@ -256,17 +255,21 @@ Last-Update: Fri, 20 Jun 2025 01:42:05 +0000 django-redis-sessions | 4 | django-simple-redis-admin | 4 | django-xmlrpc | 4 | + flask-flatpages | 4 | flufl.testing | 4 | - hachoir | 4 | mbed-test-wrapper | 4 | + pyjunitxml | 4 | + python-cookies | 4 | python-dirq | 4 | python-django-casclient | 4 | python-django-contact-form | 4 | python-django-registration | 4 | python-srp | 4 | s3ql | 4 | + securestring | 4 | sorl-thumbnail | 4 | sphinx-markdown-tables | 4 | + west | 4 | cplay-ng | 3 | django-macaddress | 3 | django-pagination | 3 | @@ -274,8 +277,8 @@ Last-Update: Fri, 20 Jun 2025 01:42:05 +0000 django-templated-email | 3 | etm | 3 | extension-helpers | 3 | - flask-flatpages | 3 | flask-mongoengine | 3 | + flask-paginate | 3 | imap-tools | 3 | jpylyzer | 3 | kconfiglib | 3 | @@ -287,10 +290,8 @@ Last-Update: Fri, 20 Jun 2025 01:42:05 +0000 proglog | 3 | pyclamd | 3 | pyfltk | 3 | - pyjunitxml | 3 | pyprind | 3 | pytest-expect | 3 | - python-cookies | 3 | python-dbus-next | 3 | python-django-push-notifications | 3 | python-dynaconf | 3 | @@ -301,10 +302,12 @@ Last-Update: Fri, 20 Jun 2025 01:42:05 +0000 requests-aws | 3 | slimit | 3 | smem | 3 | + soundcraft-utils | 3 | trac-accountmanager | 3 | trac-xmlrpc | 3 | utidylib | 3 | vf1 | 3 | + wikitrans | 3 | yotta | 3 | backupchecker | 2 | bqplot | 2 | @@ -319,8 +322,6 @@ Last-Update: Fri, 20 Jun 2025 01:42:05 +0000 django-maintenance-mode | 2 | django-yarnpkg | 2 | flake8-black | 2 | - flask-paginate | 2 | - fypp | 2 | gtkman | 2 | hatch-jupyter-builder | 2 | jsonrpclib-pelix | 2 | @@ -338,6 +339,7 @@ Last-Update: Fri, 20 Jun 2025 01:42:05 +0000 python-funcy | 2 | python-gammu | 2 | python-getdns | 2 | + python-gfloat | 2 | python-netfilterqueue | 2 | python-openshift | 2 | python-opentracing | 2 | @@ -347,6 +349,7 @@ Last-Update: Fri, 20 Jun 2025 01:42:05 +0000 python-qtpynodeeditor | 2 | python-securesystemslib | 2 | python-text-unidecode | 2 | + python-urlobject | 2 | python-webdavclient | 2 | redis-py-cluster | 2 | sphinx-paramlinks | 2 | @@ -354,7 +357,6 @@ Last-Update: Fri, 20 Jun 2025 01:42:05 +0000 testrepository | 2 | vcversioner | 2 | vrfydmn | 2 | - wikitrans | 2 | zabbix-cli | 2 | apkinspector | 1 | celery-progress | 1 | @@ -362,6 +364,7 @@ Last-Update: Fri, 20 Jun 2025 01:42:05 +0000 dotdrop | 1 | errbot | 1 | flask-multistatic | 1 | + fypp | 1 | humanfriendly | 1 | jupyter-sphinx | 1 | korean-lunar-calendar | 1 | @@ -378,29 +381,25 @@ Last-Update: Fri, 20 Jun 2025 01:42:05 +0000 python-banal | 1 | python-bottle-cork | 1 | python-bottle-sqlite | 1 | + python-broadlink | 1 | python-dataset | 1 | python-fluent-logger | 1 | python-fudge | 1 | python-genson | 1 | - python-gfloat | 1 | python-kanboard | 1 | python-libguess | 1 | python-meld3 | 1 | python-netfilter | 1 | - python-noise | 1 | python-noseofyeti | 1 | python-openid-cla | 1 | - python-openqa-client | 1 | python-pypump | 1 | python-rdflib-endpoint | 1 | python-schedutils | 1 | python-sphinx-examples | 1 | python-undetected-chromedriver | 1 | - python-urlobject | 1 | python-vega-datasets | 1 | python-zc.customdoctests | 1 | pytkdocs | 1 | - soundcraft-utils | 1 | sphinx-autorun | 1 | sphinxcontrib-github-alt | 1 | sphinx-sitemap | 1 | @@ -496,7 +495,6 @@ Last-Update: Fri, 20 Jun 2025 01:42:05 +0000 python-betterproto | 0 | python-bottle-beaker | 0 | python-briefcase | 0 | - python-broadlink | 0 | python-brother-ql | 0 | python-btrees | 0 | python-bumpfontversion | 0 | @@ -529,8 +527,10 @@ Last-Update: Fri, 20 Jun 2025 01:42:05 +0000 python-makefun | 0 | python-markdown-rundoc | 0 | python-netsnmpagent | 0 | + python-noise | 0 | python-nubia | 0 | python-nvchecker | 0 | + python-openqa-client | 0 | python-openshift | 0 | python-opentracing | 0 | python-persisting-theory | 0 | View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/54db7f6add1c8de52e332f95e3d581e42056630f -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/54db7f6add1c8de52e332f95e3d581e42056630f You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Sat Jun 21 02:43:37 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Sat, 21 Jun 2025 01:43:37 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <68560e49112f5_3db1b26619445102b1@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: 734fa7a9 by Andreas Tille at 2025-06-21T01:43:33+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Fri, 20 Jun 2025 13:42:03 +0000 +Last-Update: Sat, 21 Jun 2025 01:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- ===================================== debian-science-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Fri, 20 Jun 2025 13:42:08 +0000 +Last-Update: Sat, 21 Jun 2025 01:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Fri, 20 Jun 2025 13:42:11 +0000 +Last-Update: Sat, 21 Jun 2025 01:42:04 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/734fa7a9535de2a6fb14332a138e9b212804eaf0 -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/734fa7a9535de2a6fb14332a138e9b212804eaf0 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Sat Jun 21 09:53:52 2025 From: gitlab at salsa.debian.org (harish chavre (@Harish1)) Date: Sat, 21 Jun 2025 08:53:52 +0000 Subject: [med-svn] [Git][med-team/bitseq][master] Add README.debian explaining use of precomputed test data in autopkgtest Message-ID: <685673203c0c0_3db177c49c84535542@godard.mail> harish chavre pushed to branch master at Debian Med / bitseq Commits: 5c981f1c by Harish chavre at 2025-06-21T08:52:57+00:00 Add README.debian explaining use of precomputed test data in autopkgtest - - - - - 1 changed file: - + debian/tests/README.Debian Changes: ===================================== debian/tests/README.Debian ===================================== @@ -0,0 +1,22 @@ +Debian Tests Data +================= + +The autopkgtest for bitseq was updated to use pregenerated test +data instead of dynamically running bowtie. + +This is necessary because bowtie is not available on 32-bit +architectures (such as i386, armel, armhf). With this change, +the test is skipped on those architectures and runs normally +elsewhere. + +The dataset is shipped via the 'debian-tests-data' component +tarball. It contains Bowtie index files and a SAM alignment file +required to test bitseq. + +To regenerate the dataset manually on a 64-bit machine: + + bowtie-build -f Ref.fasta index + bowtie -q -v 3 --all -m 100 --sam index Reads.fastq -S out.sam + +Make sure bowtie is installed and available in your PATH. + View it on GitLab: https://salsa.debian.org/med-team/bitseq/-/commit/5c981f1cd518e864a254e793f193fe31e951d43c -- View it on GitLab: https://salsa.debian.org/med-team/bitseq/-/commit/5c981f1cd518e864a254e793f193fe31e951d43c You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Sat Jun 21 14:43:03 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Sat, 21 Jun 2025 13:43:03 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <6856b6e7dbc4f_3db1be0d6c84560481@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: 42293ec6 by Andreas Tille at 2025-06-21T13:42:57+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,10 +1,10 @@ -Last-Update: Sat, 21 Jun 2025 01:42:04 +0000 +Last-Update: Sat, 21 Jun 2025 13:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- dicomscope | 30 | {imaging} | orthanc-gdcm | 17 | {imaging} | - oscar | 17 | {data,tools,practice} | + oscar | 16 | {data,tools,practice} | mrtrix3 | 14 | {imaging} | gnumed-server | 11 | {covid-19,practice} | king | 11 | {typesetting,imaging} | @@ -18,12 +18,11 @@ Last-Update: Sat, 21 Jun 2025 01:42:04 +0000 heudiconv | 6 | {imaging} | jebl2 | 6 | {bio-dev} | libminc | 6 | {imaging-dev} | - mia | 6 | {imaging} | + mia | 5 | {imaging} | insighttoolkit5 | 4 | {imaging-dev} | beast-mcmc | 3 | {bio,bio-phylogeny} | biojava6-live | 3 | {bio-dev} | biojava-live | 3 | {bio-dev} | - cmtk | 3 | {imaging} | getdata | 3 | {bio} | pbcopper | 3 | {bio-dev} | pbseqlib | 3 | {bio-dev} | @@ -31,6 +30,7 @@ Last-Update: Sat, 21 Jun 2025 01:42:04 +0000 sight | 3 | {imaging} | ants | 2 | {imaging} | bio-tradis | 2 | {bio,bio-dev} | + cmtk | 2 | {imaging} | elastix | 2 | {imaging} | fastml | 2 | {bio} | ipig | 2 | {bio} | ===================================== debian-science-tests.txt ===================================== @@ -1,52 +1,52 @@ -Last-Update: Sat, 21 Jun 2025 01:42:04 +0000 +Last-Update: Sat, 21 Jun 2025 13:42:08 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- - nltk | 4858 | {linguistics} | - gts | 4780 | {viewing} | - opencascade | 616 | {simulations} | - spacenavd | 222 | {tools} | - armadillo | 188 | {mathematics-dev} | - open-coarrays | 168 | {meteorology-dev} | - arpack | 85 | {mathematics-dev} | + nltk | 4831 | {linguistics} | + gts | 4751 | {viewing} | + opencascade | 614 | {simulations} | + spacenavd | 221 | {tools} | + armadillo | 180 | {mathematics-dev} | + open-coarrays | 166 | {meteorology-dev} | + arpack | 83 | {mathematics-dev} | scalapack | 49 | {nanoscale-physics-dev} | - visidata | 43 | {datamanagement} | - ntl | 41 | {mathematics-dev} | + ntl | 43 | {mathematics-dev} | + visidata | 41 | {datamanagement} | imview | 37 | {viewing} | - mbpoll | 37 | {simulations} | + mbpoll | 36 | {simulations} | ppl | 32 | {numericalcomputation} | flintqs | 29 | {mathematics} | + libm4ri | 27 | {mathematics-dev} | libmatio | 27 | {mathematics-dev} | cliquer | 26 | {mathematics} | - libm4ri | 26 | {mathematics-dev} | - arduino-mk | 25 | {robotics} | flann | 25 | {mathematics-dev,engineering-dev} | - bossa | 20 | {devices} | - fftw | 19 | {mathematics-dev,physics-dev,meteorology-dev} | + arduino-mk | 23 | {robotics} | + xygrib | 20 | {meteorology} | + bossa | 19 | {devices} | grads | 19 | {meteorology} | - picosat | 19 | {logic} | sat4j | 19 | {logic} | - setzer | 19 | {typesetting} | - xygrib | 19 | {meteorology} | + fftw | 18 | {mathematics-dev,physics-dev,meteorology-dev} | guiqwt | 18 | {numericalcomputation,viewing} | + picosat | 18 | {logic} | + setzer | 18 | {typesetting} | + lrcalc | 17 | {mathematics-dev} | ncl | 17 | {meteorology} | - pyzo | 17 | {numericalcomputation} | - lrcalc | 16 | {mathematics-dev} | + gts | 16 | {viewing-dev} | + pyzo | 16 | {numericalcomputation} | sketch | 16 | {typesetting} | cliquer | 15 | {mathematics-dev} | - gts | 15 | {viewing-dev} | + eccodes | 15 | {meteorology,meteorology-dev} | dune-uggrid | 14 | {mathematics-dev} | - eccodes | 14 | {meteorology,meteorology-dev} | feff85exafs | 13 | {chemistry} | gf2x | 13 | {mathematics-dev} | - teem | 13 | {imageanalysis} | + libitpp | 13 | {mathematics-dev,engineering-dev} | iml | 12 | {mathematics-dev} | libhomfly | 12 | {mathematics-dev} | - libitpp | 12 | {mathematics-dev,engineering-dev} | - lxi-tools | 12 | {engineering,dataacquisition} | + teem | 12 | {imageanalysis} | coinor-symphony | 11 | {logic,mathematics,numericalcomputation} | - feedgnuplot | 11 | {viewing} | + lxi-tools | 11 | {engineering,dataacquisition} | eccodes | 10 | {meteorology-dev} | + feedgnuplot | 10 | {viewing} | form | 10 | {mathematics} | libm4rie | 10 | {mathematics-dev} | matlab-support | 10 | {mathematics,numericalcomputation} | @@ -55,10 +55,9 @@ Last-Update: Sat, 21 Jun 2025 01:42:04 +0000 geg | 9 | {viewing} | pcl | 9 | {robotics-dev} | python-cdo | 9 | {meteorology} | + alberta | 8 | {engineering-dev} | ratpoints | 8 | {mathematics-dev} | - ros-rosconsole | 8 | {robotics-dev} | vdt | 8 | {mathematics-dev} | - alberta | 7 | {engineering-dev} | apophenia | 7 | {statistics} | dxsamples | 7 | {nanoscale-physics} | libccp4 | 7 | {nanoscale-physics-dev} | @@ -67,14 +66,15 @@ Last-Update: Sat, 21 Jun 2025 01:42:04 +0000 persalys | 7 | {engineering,statistics,mathematics} | psurface | 7 | {numericalcomputation} | refmac-dictionary | 7 | {highenergy-physics-dev,chemistry} | + ros-rosconsole | 7 | {robotics-dev} | uctodata | 7 | {linguistics} | cld2 | 6 | {linguistics} | etsf-io | 6 | {physics,nanoscale-physics} | fftw | 6 | {meteorology-dev,mathematics-dev,physics-dev} | magics++ | 6 | {meteorology-dev} | metar | 6 | {meteorology} | - odc | 6 | {meteorology} | odc | 6 | {meteorology-dev} | + odc | 6 | {meteorology} | ros-vcstool | 6 | {robotics-dev} | fpzip | 5 | {meteorology} | newmat | 5 | {mathematics-dev} | @@ -89,14 +89,15 @@ Last-Update: Sat, 21 Jun 2025 01:42:04 +0000 auto-07p | 4 | {mathematics} | coda | 4 | {meteorology-dev} | coda | 4 | {meteorology} | - debian-science | 4 | {physics,machine-learning,economics,nanoscale-physics} | debian-science | 4 | {economics,nanoscale-physics,machine-learning,physics,mathematics} | + debian-science | 4 | {physics,machine-learning,economics,nanoscale-physics} | getdp | 4 | {engineering,mathematics,simulations} | gsw | 4 | {meteorology} | iapws | 4 | {meteorology} | sdpb | 4 | {numericalcomputation,highenergy-physics} | silo-llnl | 4 | {engineering} | toon | 4 | {numericalcomputation} | + urdfdom-headers | 4 | {robotics-dev} | apertium-eval-translator | 3 | {linguistics} | cmor | 3 | {meteorology} | drslib | 3 | {meteorology} | @@ -126,7 +127,6 @@ Last-Update: Sat, 21 Jun 2025 01:42:04 +0000 silo-llnl | 3 | {engineering} | spaghetti | 3 | {geography} | syrthes | 3 | {engineering} | - urdfdom-headers | 3 | {robotics-dev} | apache-opennlp | 2 | {linguistics} | apertium-streamparser | 2 | {linguistics} | apophenia | 2 | {statistics} | @@ -145,10 +145,8 @@ Last-Update: Sat, 21 Jun 2025 01:42:04 +0000 gemmlowp | 2 | {mathematics-dev} | harp | 2 | {meteorology} | hpcc | 2 | {numericalcomputation,distributedcomputing} | - libcgns | 2 | {engineering-dev} | libcvd | 2 | {imageanalysis} | libgtkdatabox | 2 | {engineering-dev,viewing-dev} | - liblbfgs | 2 | {mathematics-dev} | libmatheval | 2 | {mathematics-dev} | metkit | 2 | {meteorology} | mmdb | 2 | {nanoscale-physics-dev,highenergy-physics-dev} | @@ -160,14 +158,15 @@ Last-Update: Sat, 21 Jun 2025 01:42:04 +0000 qwtplot3d | 2 | {viewing-dev} | scram | 2 | {engineering} | silo-llnl | 2 | {engineering-dev} | + x13as | 2 | {economics} | asl | 1 | {physics-dev} | ckon | 1 | {highenergy-physics-dev} | coda | 1 | {meteorology-dev} | - code-saturne | 1 | {mathematics-dev,engineering-dev} | code-saturne | 1 | {engineering-dev,mathematics-dev} | + code-saturne | 1 | {mathematics-dev,engineering-dev} | coinmp | 1 | {logic,mathematics-dev,numericalcomputation} | - debian-science | 1 | {neuroscience-cognitive,machine-learning} | debian-science | 1 | {tools} | + debian-science | 1 | {neuroscience-cognitive,machine-learning} | debian-science | 1 | {psychophysics} | fpzip | 1 | {meteorology-dev} | frogdata | 1 | {linguistics} | @@ -176,7 +175,9 @@ Last-Update: Sat, 21 Jun 2025 01:42:04 +0000 hepmc3 | 1 | {nanoscale-physics-dev,highenergy-physics-dev} | itsol | 1 | {mathematics-dev} | jeuclid | 1 | {viewing,typesetting} | + libcgns | 1 | {engineering-dev} | libcvd | 1 | {imageanalysis-dev} | + liblbfgs | 1 | {mathematics-dev} | liblxi | 1 | {engineering-dev,dataacquisition-dev} | liborigin2 | 1 | {viewing-dev} | looptools | 1 | {highenergy-physics-dev} | @@ -196,7 +197,6 @@ Last-Update: Sat, 21 Jun 2025 01:42:04 +0000 timbl | 1 | {linguistics} | timblserver | 1 | {linguistics} | vlfeat | 1 | {imageanalysis-dev} | - x13as | 1 | {economics} | amgcl | 0 | {mathematics-dev} | apertium-afr-nld | 0 | {linguistics} | apertium-bel-rus | 0 | {linguistics} | @@ -214,9 +214,9 @@ Last-Update: Sat, 21 Jun 2025 01:42:04 +0000 collada-dom | 0 | {viewing-dev} | cqrlib | 0 | {mathematics-dev} | cvector | 0 | {mathematics-dev} | - debian-science | 0 | {nanoscale-physics-dev} | - debian-science | 0 | {electrophysiology} | debian-science | 0 | {physics} | + debian-science | 0 | {electrophysiology} | + debian-science | 0 | {nanoscale-physics-dev} | dune-grid-glue | 0 | {mathematics-dev} | etsf-io | 0 | {nanoscale-physics-dev} | fastjet | 0 | {highenergy-physics-dev} | @@ -231,8 +231,8 @@ Last-Update: Sat, 21 Jun 2025 01:42:04 +0000 mbt | 0 | {linguistics} | mctc-lib | 0 | {nanoscale-physics-dev,highenergy-physics-dev} | meshsdfilter | 0 | {mathematics-dev} | - metis-edf | 0 | {engineering,numericalcomputation} | metis-edf | 0 | {engineering-dev} | + metis-edf | 0 | {engineering,numericalcomputation} | nrn-mod2c | 0 | {biology} | openctm | 0 | {physics-dev} | opengv | 0 | {geometry} | @@ -243,8 +243,8 @@ Last-Update: Sat, 21 Jun 2025 01:42:04 +0000 quadrule | 0 | {mathematics-dev} | robot-testing-framework | 0 | {robotics-dev} | ros-collada-urdf | 0 | {robotics} | - ros-metapackages | 0 | {robotics} | ros-metapackages | 0 | {robotics-dev} | + ros-metapackages | 0 | {robotics} | ros-opencv-apps | 0 | {robotics} | sagemath-database-combinatorial-designs | 0 | {mathematics} | sagemath-database-cremona-elliptic-curves | 0 | {mathematics} | ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,185 +1,183 @@ -Last-Update: Sat, 21 Jun 2025 01:42:04 +0000 +Last-Update: Sat, 21 Jun 2025 13:42:11 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- - mpmath | 9943 | - python-repoze.lru | 6981 | - netifaces | 5173 | - ghp-import | 4804 | - python-lunr | 4799 | - python-babel | 3874 | - sortedcontainers | 3516 | - python-babel | 3424 | - aiosignal | 2933 | - hyperlink | 2160 | - humanfriendly | 1980 | - python-notify2 | 1967 | - referencing | 1540 | - python-mysqldb | 1520 | - python-gssapi | 1450 | - python-invoke | 1402 | - python-hyperframe | 1367 | + mpmath | 9886 | + python-repoze.lru | 6976 | + netifaces | 5160 | + ghp-import | 4778 | + python-lunr | 4772 | + python-babel | 3834 | + sortedcontainers | 3483 | + python-babel | 3389 | + aiosignal | 2939 | + hyperlink | 2155 | + humanfriendly | 1987 | + python-notify2 | 1947 | + referencing | 1550 | + python-mysqldb | 1517 | + python-gssapi | 1448 | + python-invoke | 1393 | + python-hyperframe | 1374 | websocket-client | 1320 | - python-hpack | 1153 | - python-rsa | 1132 | - python-pandocfilters | 1057 | - pdfarranger | 985 | - menulibre | 946 | - python-linux-procfs | 927 | - python-geoip | 866 | - python-webob | 818 | - powerline | 768 | - powerline | 708 | + python-hpack | 1157 | + python-rsa | 1127 | + python-pandocfilters | 1039 | + pdfarranger | 983 | + menulibre | 953 | + python-linux-procfs | 925 | + python-geoip | 862 | + python-webob | 820 | + powerline | 772 | + powerline | 707 | powerline | 702 | - firmware-microbit-micropython | 665 | - python-zopfli | 663 | - kazam | 660 | - u-msgpack-python | 607 | - python-et-xmlfile | 524 | - gaupol | 522 | - autopep8 | 515 | - dockerpty | 515 | - asn1crypto | 510 | - python-gevent | 485 | - python-ewmh | 453 | - catfish | 426 | - pytoolconfig | 426 | + python-zopfli | 675 | + firmware-microbit-micropython | 667 | + kazam | 656 | + u-msgpack-python | 605 | + python-et-xmlfile | 515 | + dockerpty | 513 | + asn1crypto | 499 | + autopep8 | 495 | + gaupol | 493 | + python-gevent | 479 | + python-ewmh | 450 | + catfish | 427 | + pytoolconfig | 407 | python-requests-oauthlib | 400 | - spf-engine | 344 | - python-toml | 340 | - python-ntlm-auth | 307 | - spf-engine | 296 | - django-stronghold | 248 | - python-ldap3 | 241 | - cairocffi | 217 | + spf-engine | 346 | + python-toml | 338 | + python-ntlm-auth | 305 | + spf-engine | 298 | + django-stronghold | 250 | + python-ldap3 | 239 | + cairocffi | 213 | python-mimeparse | 195 | - python-smmap | 175 | - python-hidapi | 165 | - autokey | 163 | - httpie | 146 | - python-anyjson | 144 | + python-smmap | 172 | + python-hidapi | 167 | + autokey | 160 | + httpie | 145 | + python-anyjson | 139 | smem | 139 | - kivy | 136 | - python-aiostream | 126 | + kivy | 134 | + python-aiostream | 124 | python-click-repl | 124 | - smartypants | 120 | - mypaint | 113 | - nodeenv | 106 | - lollypop | 105 | - timekpr-next | 99 | - python-consul | 97 | - mugshot | 96 | + smartypants | 118 | + mypaint | 112 | + lollypop | 104 | + nodeenv | 104 | + timekpr-next | 100 | + python-consul | 99 | + mugshot | 97 | python-pyu2f | 96 | - pacparser | 93 | + pacparser | 94 | pymacaroons | 91 | - python-rfc6555 | 89 | + python-rfc6555 | 88 | pssh | 82 | - pymediainfo | 77 | - python-colour | 73 | - python-i3ipc | 72 | + pymediainfo | 75 | + python-colour | 72 | numpy-stl | 71 | - weasyprint | 68 | - mitmproxy | 67 | - fabric | 66 | - python-pykka | 66 | - pywavelets | 66 | - ueberzug | 57 | - python-uritools | 56 | + python-i3ipc | 69 | + pywavelets | 67 | + mitmproxy | 66 | + python-pykka | 65 | + fabric | 64 | + weasyprint | 64 | + ueberzug | 58 | + itstool | 55 | python-looseversion | 55 | - itstool | 54 | + python-uritools | 54 | python-scp | 53 | - mysql-connector-python | 51 | + mysql-connector-python | 50 | pyenv | 50 | - pymacs | 49 | + pymacs | 48 | sshtunnel | 48 | - hatchling | 47 | - khard | 47 | + khard | 46 | + hatchling | 45 | blockdiag | 44 | - trac | 44 | - membernator | 43 | - kivy | 42 | + kivy | 43 | + trac | 43 | + membernator | 42 | python-pysol-cards | 41 | certipy | 40 | pamela | 40 | - pyquery | 40 | jupyterhub | 39 | - powerline-gitstatus | 38 | + pyquery | 39 | pylibmc | 38 | - show-in-file-manager | 37 | - python-scrypt | 36 | - persepolis | 35 | - pdfposter | 33 | + powerline-gitstatus | 37 | + python-scrypt | 35 | + show-in-file-manager | 35 | + pdfposter | 34 | + persepolis | 33 | pssh | 33 | - python-statsd | 30 | + python-statsd | 31 | python-args | 28 | seqdiag | 28 | dkimpy-milter | 27 | sphinxcontrib-blockdiag | 27 | - enzyme | 26 | - flask-principal | 26 | sphinxcontrib-seqdiag | 26 | + sphinx-inline-tabs | 26 | depthcharge-tools | 25 | + enzyme | 25 | + flask-principal | 25 | python-clint | 25 | rst2pdf | 25 | - sphinx-inline-tabs | 25 | - typogrify | 25 | video-downloader | 25 | - python-fire | 24 | - subliminal | 24 | + typogrify | 24 | + cppman | 23 | + python-fire | 23 | + subliminal | 23 | webpy | 23 | - cppman | 22 | - python-zstd | 22 | - subliminal | 22 | - fabric | 21 | - backoff | 20 | + python-zstd | 21 | + subliminal | 21 | + fabric | 20 | nwdiag | 20 | python-rangehttpserver | 20 | python-sdnotify | 20 | spf-engine | 20 | - alot | 19 | + backoff | 19 | python-demjson | 19 | - django-environ | 18 | + alot | 18 | nwg-displays | 18 | python-pysubs2 | 18 | - webtest | 18 | + django-environ | 17 | mistune0 | 17 | - python-translationstring | 17 | - social-auth-core | 17 | sphinxcontrib-log-cabinet | 17 | + webtest | 17 | actdiag | 16 | flask-security | 16 | policyd-rate-limit | 16 | - python-slip10 | 16 | + python-translationstring | 16 | + social-auth-core | 16 | + unearth | 16 | + pdm | 15 | python-inotify | 15 | + python-slip10 | 15 | sphinxcontrib-actdiag | 15 | sphinxcontrib-nwdiag | 15 | todoman | 15 | - unearth | 15 | - pdm | 14 | pykwalify | 14 | python-ethtool | 14 | - python-hupper | 14 | python-kyotocabinet | 14 | - python-pem | 14 | - python-priority | 14 | python-pyalsa | 14 | python-simpy | 14 | junos-eznc | 13 | - python-dbussy | 13 | + python-hupper | 13 | + python-pem | 13 | + python-priority | 13 | python-pyscss | 13 | python-xtermcolor | 13 | ansi | 12 | - gmplot | 12 | jschema-to-python | 12 | - notebook-shim | 12 | pyp | 12 | + python-dbussy | 12 | python-pyrss2gen | 12 | python-sarif-python-om | 12 | ruff | 12 | speaklater | 12 | - autotiling | 11 | flask-paranoid | 11 | - gtextfsm | 11 | + gmplot | 11 | + notebook-shim | 11 | pylint-common | 11 | python-digitalocean | 11 | python-parse-type | 11 | @@ -187,56 +185,58 @@ Last-Update: Sat, 21 Jun 2025 01:42:04 +0000 txt2tags | 11 | beancount | 10 | btchip-python | 10 | - django-auditlog | 10 | - django-sass | 10 | + gtextfsm | 10 | python-pyld | 10 | tuna | 10 | + autotiling | 9 | clustershell | 9 | debiancontributors | 9 | - drf-yasg-nonfree | 9 | + django-auditlog | 9 | + django-sass | 9 | pwntools | 9 | - python-aiohttp-security | 9 | - python-crcelk | 9 | - python-drf-spectacular-sidecar-nonfree | 9 | python-numpysane | 9 | - python-overpy | 9 | python-pyaml-env | 9 | traittypes | 9 | voltron | 9 | drf-extensions | 8 | - flask-session | 8 | + drf-yasg-nonfree | 8 | htmlmin | 8 | + pytaglib | 8 | + python-aiohttp-security | 8 | + python-ansicolors | 8 | + python-crcelk | 8 | + python-drf-spectacular-sidecar-nonfree | 8 | + python-overpy | 8 | python-versioneer | 8 | sphinx-intl | 8 | beancount | 7 | - clustershell | 7 | flask-api | 7 | + flask-session | 7 | graphql-relay | 7 | httpcode | 7 | mercurial-evolve | 7 | micropython-mpremote | 7 | pybik | 7 | - pytaglib | 7 | + pycallgraph | 7 | pytest-django | 7 | - python-envs | 7 | ruff | 7 | trac-wysiwyg | 7 | + clustershell | 6 | django-model-utils | 6 | - django-pglocks | 6 | drf-haystack | 6 | easyprocess | 6 | librouteros | 6 | mypy-protobuf | 6 | - pycallgraph | 6 | pydrive2 | 6 | python3-onelogin-saml2 | 6 | - python-ansicolors | 6 | python-biplist | 6 | + python-envs | 6 | python-gnuplotlib | 6 | python-openstep-plist | 6 | python-xdo | 6 | django-jinja | 5 | django-paintstore | 5 | + django-pglocks | 5 | hachoir | 5 | htmlmin | 5 | numpy-stl | 5 | @@ -247,7 +247,6 @@ Last-Update: Sat, 21 Jun 2025 01:42:04 +0000 python-simpy | 5 | sphinxcontrib-globalsubs | 5 | aiomysql | 4 | - azote | 4 | bootstrap-flask | 4 | cram | 4 | django-bitfield | 4 | @@ -267,9 +266,11 @@ Last-Update: Sat, 21 Jun 2025 01:42:04 +0000 python-srp | 4 | s3ql | 4 | securestring | 4 | + smem | 4 | sorl-thumbnail | 4 | sphinx-markdown-tables | 4 | west | 4 | + azote | 3 | cplay-ng | 3 | django-macaddress | 3 | django-pagination | 3 | @@ -286,7 +287,6 @@ Last-Update: Sat, 21 Jun 2025 01:42:04 +0000 okasha | 3 | omgifol | 3 | orsopy | 3 | - panoramisk | 3 | proglog | 3 | pyclamd | 3 | pyfltk | 3 | @@ -301,15 +301,12 @@ Last-Update: Sat, 21 Jun 2025 01:42:04 +0000 python-networkmanager | 3 | requests-aws | 3 | slimit | 3 | - smem | 3 | soundcraft-utils | 3 | trac-accountmanager | 3 | trac-xmlrpc | 3 | utidylib | 3 | - vf1 | 3 | wikitrans | 3 | yotta | 3 | - backupchecker | 2 | bqplot | 2 | brebis | 2 | django-ajax-selects | 2 | @@ -324,8 +321,10 @@ Last-Update: Sat, 21 Jun 2025 01:42:04 +0000 flake8-black | 2 | gtkman | 2 | hatch-jupyter-builder | 2 | + humanfriendly | 2 | jsonrpclib-pelix | 2 | namecheap | 2 | + panoramisk | 2 | pylint-celery | 2 | pypass | 2 | pyroma | 2 | @@ -356,16 +355,17 @@ Last-Update: Sat, 21 Jun 2025 01:42:04 +0000 sphinxtesters | 2 | testrepository | 2 | vcversioner | 2 | + vf1 | 2 | vrfydmn | 2 | zabbix-cli | 2 | apkinspector | 1 | + backupchecker | 1 | celery-progress | 1 | codicefiscale | 1 | dotdrop | 1 | errbot | 1 | flask-multistatic | 1 | fypp | 1 | - humanfriendly | 1 | jupyter-sphinx | 1 | korean-lunar-calendar | 1 | milksnake | 1 | @@ -396,8 +396,10 @@ Last-Update: Sat, 21 Jun 2025 01:42:04 +0000 python-rdflib-endpoint | 1 | python-schedutils | 1 | python-sphinx-examples | 1 | + python-spur | 1 | python-undetected-chromedriver | 1 | python-vega-datasets | 1 | + python-wither | 1 | python-zc.customdoctests | 1 | pytkdocs | 1 | sphinx-autorun | 1 | @@ -543,11 +545,9 @@ Last-Update: Sat, 21 Jun 2025 01:42:04 +0000 python-simpy | 0 | python-socketpool | 0 | python-sphinx-examples | 0 | - python-spur | 0 | python-tatsu | 0 | python-tatsu-lts | 0 | python-webob | 0 | - python-wither | 0 | python-ytmusicapi | 0 | python-yubiotp | 0 | python-zipfile-zstd | 0 | View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/42293ec62ea1d606b76c9a1ec905a1dbb11717eb -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/42293ec62ea1d606b76c9a1ec905a1dbb11717eb You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Sun Jun 22 02:44:05 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Sun, 22 Jun 2025 01:44:05 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <68575fe515e1d_3db1d0f24dc4746560@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: 2492475e by Andreas Tille at 2025-06-22T01:43:58+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,13 +1,13 @@ -Last-Update: Sat, 21 Jun 2025 13:42:04 +0000 +Last-Update: Sun, 22 Jun 2025 01:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- dicomscope | 30 | {imaging} | orthanc-gdcm | 17 | {imaging} | - oscar | 16 | {data,tools,practice} | + oscar | 16 | {tools,practice,data} | mrtrix3 | 14 | {imaging} | gnumed-server | 11 | {covid-19,practice} | - king | 11 | {typesetting,imaging} | + king | 11 | {imaging,typesetting} | pixelmed | 11 | {imaging} | orthanc-mysql | 10 | {imaging} | sight | 10 | {imaging} | @@ -20,7 +20,7 @@ Last-Update: Sat, 21 Jun 2025 13:42:04 +0000 libminc | 6 | {imaging-dev} | mia | 5 | {imaging} | insighttoolkit5 | 4 | {imaging-dev} | - beast-mcmc | 3 | {bio,bio-phylogeny} | + beast-mcmc | 3 | {bio-phylogeny,bio} | biojava6-live | 3 | {bio-dev} | biojava-live | 3 | {bio-dev} | getdata | 3 | {bio} | @@ -35,14 +35,14 @@ Last-Update: Sat, 21 Jun 2025 13:42:04 +0000 fastml | 2 | {bio} | ipig | 2 | {bio} | libdivsufsort | 2 | {bio-dev} | - plasmidid | 2 | {covid-19,bio} | + plasmidid | 2 | {bio,covid-19} | rambo-k | 2 | {bio} | tracetuner | 2 | {bio} | blimps | 1 | {bio} | brig | 1 | {bio} | ctn | 1 | {imaging-dev} | cufflinks | 1 | {cloud,bio} | - dextractor | 1 | {bio,covid-19} | + dextractor | 1 | {covid-19,bio} | eegdev | 1 | {imaging-dev} | emboss-explorer | 1 | {bio} | hinge | 1 | {bio} | @@ -54,24 +54,24 @@ Last-Update: Sat, 21 Jun 2025 13:42:04 +0000 libgenome | 1 | {bio-dev} | libpal-java | 1 | {bio-dev} | librg-utils-perl | 1 | {bio} | - melting | 1 | {cloud,bio} | - mhap | 1 | {bio,bio-ngs} | + melting | 1 | {bio,cloud} | + mhap | 1 | {bio-ngs,bio} | ncbi-vdb | 1 | {bio-dev} | papyrus | 1 | {imaging-dev} | - phyutility | 1 | {cloud,bio} | + phyutility | 1 | {bio,cloud} | proalign | 1 | {bio-phylogeny,bio} | python-seqcluster | 1 | {bio-dev,covid-19} | runcircos-gui | 1 | {bio} | seq-gen | 1 | {bio} | sga | 1 | {bio} | - spread-phy | 1 | {bio,bio-phylogeny} | + spread-phy | 1 | {bio-phylogeny,bio} | staden | 1 | {bio} | surankco | 1 | {bio} | surpyvor | 1 | {bio} | - thesias | 1 | {bio,covid-19} | - tophat-recondition | 1 | {covid-19,bio} | + thesias | 1 | {covid-19,bio} | + tophat-recondition | 1 | {bio,covid-19} | treeview | 1 | {bio-phylogeny,bio} | - varscan | 1 | {covid-19,bio} | + varscan | 1 | {bio,covid-19} | xdffileio | 1 | {imaging-dev} | acedb | 0 | {cloud,bio} | bambamc | 0 | {bio-dev} | @@ -81,8 +81,8 @@ Last-Update: Sat, 21 Jun 2025 13:42:04 +0000 capsule-maven-nextflow | 0 | {bio-dev} | ctffind | 0 | {bio} | embassy-domainatrix | 0 | {cloud,bio} | - embassy-domalign | 0 | {bio,cloud} | - embassy-domsearch | 0 | {cloud,bio} | + embassy-domalign | 0 | {cloud,bio} | + embassy-domsearch | 0 | {bio,cloud} | fis-gtm | 0 | {his} | gatk-bwamem | 0 | {bio-dev} | gatk-fermilite | 0 | {bio-dev} | @@ -101,7 +101,7 @@ Last-Update: Sat, 21 Jun 2025 13:42:04 +0000 libhmsbeagle | 0 | {bio-dev} | libics | 0 | {covid-19,imaging-dev} | libjloda-java | 0 | {bio-dev} | - libmaus2 | 0 | {covid-19,bio-dev} | + libmaus2 | 0 | {bio-dev,covid-19} | libmems | 0 | {bio-dev} | libmialm | 0 | {imaging-dev} | libmuscle | 0 | {bio-dev} | @@ -137,7 +137,7 @@ Last-Update: Sat, 21 Jun 2025 13:42:04 +0000 rdp-alignment | 0 | {bio} | rdp-classifier | 0 | {bio} | resfinder-db | 0 | {bio} | - rtax | 0 | {bio,cloud} | + rtax | 0 | {cloud,bio} | saint | 0 | {bio} | savvy | 0 | {bio-dev} | savvy | 0 | {bio} | @@ -146,14 +146,14 @@ Last-Update: Sat, 21 Jun 2025 13:42:04 +0000 sift | 0 | {bio} | sight | 0 | {imaging-dev} | skesa | 0 | {bio} | - smrtanalysis | 0 | {bio,covid-19} | + smrtanalysis | 0 | {covid-19,bio} | soapaligner | 0 | {bio} | soapsnp | 0 | {bio} | sprai | 0 | {bio} | srf | 0 | {bio-dev} | suitename | 0 | {bio} | trace2dbest | 0 | {bio} | - vienna-rna | 0 | {bio,covid-19} | + vienna-rna | 0 | {covid-19,bio} | xxsds-dynamic | 0 | {bio-dev} | sideretro | -1 | {bio} | tipp | -1 | {bio,covid-19} | ===================================== debian-science-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Sat, 21 Jun 2025 13:42:08 +0000 +Last-Update: Sun, 22 Jun 2025 01:42:09 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- @@ -25,7 +25,7 @@ Last-Update: Sat, 21 Jun 2025 13:42:08 +0000 bossa | 19 | {devices} | grads | 19 | {meteorology} | sat4j | 19 | {logic} | - fftw | 18 | {mathematics-dev,physics-dev,meteorology-dev} | + fftw | 18 | {meteorology-dev,physics-dev,mathematics-dev} | guiqwt | 18 | {numericalcomputation,viewing} | picosat | 18 | {logic} | setzer | 18 | {typesetting} | @@ -43,15 +43,15 @@ Last-Update: Sat, 21 Jun 2025 13:42:08 +0000 iml | 12 | {mathematics-dev} | libhomfly | 12 | {mathematics-dev} | teem | 12 | {imageanalysis} | - coinor-symphony | 11 | {logic,mathematics,numericalcomputation} | - lxi-tools | 11 | {engineering,dataacquisition} | + coinor-symphony | 11 | {mathematics,numericalcomputation,logic} | + lxi-tools | 11 | {dataacquisition,engineering} | eccodes | 10 | {meteorology-dev} | feedgnuplot | 10 | {viewing} | form | 10 | {mathematics} | libm4rie | 10 | {mathematics-dev} | matlab-support | 10 | {mathematics,numericalcomputation} | ncl | 10 | {meteorology-dev} | - python-escript | 10 | {numericalcomputation,simulations,engineering} | + python-escript | 10 | {numericalcomputation,engineering,simulations} | geg | 9 | {viewing} | pcl | 9 | {robotics-dev} | python-cdo | 9 | {meteorology} | @@ -63,14 +63,14 @@ Last-Update: Sat, 21 Jun 2025 13:42:08 +0000 libccp4 | 7 | {nanoscale-physics-dev} | libzn-poly | 7 | {mathematics-dev} | opencascade | 7 | {simulations} | - persalys | 7 | {engineering,statistics,mathematics} | + persalys | 7 | {mathematics,engineering,statistics} | psurface | 7 | {numericalcomputation} | refmac-dictionary | 7 | {highenergy-physics-dev,chemistry} | ros-rosconsole | 7 | {robotics-dev} | uctodata | 7 | {linguistics} | cld2 | 6 | {linguistics} | etsf-io | 6 | {physics,nanoscale-physics} | - fftw | 6 | {meteorology-dev,mathematics-dev,physics-dev} | + fftw | 6 | {meteorology-dev,physics-dev,mathematics-dev} | magics++ | 6 | {meteorology-dev} | metar | 6 | {meteorology} | odc | 6 | {meteorology-dev} | @@ -78,23 +78,23 @@ Last-Update: Sat, 21 Jun 2025 13:42:08 +0000 ros-vcstool | 6 | {robotics-dev} | fpzip | 5 | {meteorology} | newmat | 5 | {mathematics-dev} | - persalys | 5 | {statistics,mathematics,engineering} | + persalys | 5 | {engineering,statistics,mathematics} | rheolef | 5 | {mathematics} | rubiks | 5 | {geometry,mathematics} | toontag | 5 | {numericalcomputation} | - toulbar2 | 5 | {logic,numericalcomputation,mathematics,physics} | + toulbar2 | 5 | {mathematics,logic,physics,numericalcomputation} | ucto | 5 | {linguistics} | veccore | 5 | {mathematics-dev} | atlas-ecmwf | 4 | {meteorology} | auto-07p | 4 | {mathematics} | coda | 4 | {meteorology-dev} | coda | 4 | {meteorology} | - debian-science | 4 | {economics,nanoscale-physics,machine-learning,physics,mathematics} | - debian-science | 4 | {physics,machine-learning,economics,nanoscale-physics} | - getdp | 4 | {engineering,mathematics,simulations} | + debian-science | 4 | {mathematics,physics,machine-learning,nanoscale-physics,economics} | + debian-science | 4 | {physics,economics,machine-learning,nanoscale-physics} | + getdp | 4 | {mathematics,simulations,engineering} | gsw | 4 | {meteorology} | iapws | 4 | {meteorology} | - sdpb | 4 | {numericalcomputation,highenergy-physics} | + sdpb | 4 | {highenergy-physics,numericalcomputation} | silo-llnl | 4 | {engineering} | toon | 4 | {numericalcomputation} | urdfdom-headers | 4 | {robotics-dev} | @@ -149,9 +149,9 @@ Last-Update: Sat, 21 Jun 2025 13:42:08 +0000 libgtkdatabox | 2 | {engineering-dev,viewing-dev} | libmatheval | 2 | {mathematics-dev} | metkit | 2 | {meteorology} | - mmdb | 2 | {nanoscale-physics-dev,highenergy-physics-dev} | + mmdb | 2 | {highenergy-physics-dev,nanoscale-physics-dev} | mseed2sac | 2 | {dataacquisition-dev} | - ncrystal | 2 | {nanoscale-physics-dev,highenergy-physics-dev} | + ncrystal | 2 | {highenergy-physics-dev,nanoscale-physics-dev} | nrn-iv | 2 | {biology} | polylib | 2 | {mathematics} | qd | 2 | {mathematics-dev} | @@ -164,7 +164,7 @@ Last-Update: Sat, 21 Jun 2025 13:42:08 +0000 coda | 1 | {meteorology-dev} | code-saturne | 1 | {engineering-dev,mathematics-dev} | code-saturne | 1 | {mathematics-dev,engineering-dev} | - coinmp | 1 | {logic,mathematics-dev,numericalcomputation} | + coinmp | 1 | {logic,numericalcomputation,mathematics-dev} | debian-science | 1 | {tools} | debian-science | 1 | {neuroscience-cognitive,machine-learning} | debian-science | 1 | {psychophysics} | @@ -189,9 +189,9 @@ Last-Update: Sat, 21 Jun 2025 13:42:08 +0000 openmesh | 1 | {mathematics-dev} | psurface | 1 | {numericalcomputation} | ros-ros-environment | 1 | {robotics-dev} | - schroedinger-coordgenlibs | 1 | {nanoscale-physics-dev,chemistry} | + schroedinger-coordgenlibs | 1 | {chemistry,nanoscale-physics-dev} | siscone | 1 | {highenergy-physics-dev} | - spfft | 1 | {mathematics-dev,nanoscale-physics-dev,physics-dev,meteorology-dev} | + spfft | 1 | {meteorology-dev,physics-dev,mathematics-dev,nanoscale-physics-dev} | ssm | 1 | {nanoscale-physics-dev} | tfdocgen | 1 | {linguistics} | timbl | 1 | {linguistics} | @@ -206,7 +206,7 @@ Last-Update: Sat, 21 Jun 2025 13:42:08 +0000 apertium-urd | 0 | {linguistics} | apertium-urd-hin | 0 | {linguistics} | apriltag | 0 | {robotics-dev} | - calculix-ccx-test | 0 | {simulations,numericalcomputation,engineering} | + calculix-ccx-test | 0 | {simulations,engineering,numericalcomputation} | clhep | 0 | {highenergy-physics-dev} | cmor | 0 | {meteorology-dev} | coda | 0 | {meteorology-dev} | @@ -227,17 +227,17 @@ Last-Update: Sat, 21 Jun 2025 13:42:08 +0000 libsdsl | 0 | {dataacquisition-dev} | looptools | 0 | {highenergy-physics-dev} | looptools | 0 | {highenergy-physics} | - magma | 0 | {mathematics-dev,numericalcomputation} | + magma | 0 | {numericalcomputation,mathematics-dev} | mbt | 0 | {linguistics} | mctc-lib | 0 | {nanoscale-physics-dev,highenergy-physics-dev} | meshsdfilter | 0 | {mathematics-dev} | + metis-edf | 0 | {numericalcomputation,engineering} | metis-edf | 0 | {engineering-dev} | - metis-edf | 0 | {engineering,numericalcomputation} | nrn-mod2c | 0 | {biology} | openctm | 0 | {physics-dev} | opengv | 0 | {geometry} | openigtlink | 0 | {robotics-dev} | - python-escript | 0 | {numericalcomputation,simulations,engineering} | + python-escript | 0 | {engineering,numericalcomputation,simulations} | python-opcodes | 0 | {tools} | qrupdate | 0 | {mathematics-dev} | quadrule | 0 | {mathematics-dev} | @@ -253,7 +253,7 @@ Last-Update: Sat, 21 Jun 2025 13:42:08 +0000 sagemath-database-polytopes | 0 | {mathematics} | schroedinger-maeparser | 0 | {chemistry,nanoscale-physics-dev} | siscone | 0 | {highenergy-physics-dev} | - slicot | 0 | {robotics-dev,engineering-dev} | + slicot | 0 | {engineering-dev,robotics-dev} | sparskit | 0 | {mathematics-dev} | ssm | 0 | {nanoscale-physics} | tachyon | 0 | {mathematics} | ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Sat, 21 Jun 2025 13:42:11 +0000 +Last-Update: Sun, 22 Jun 2025 01:42:12 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/2492475ecfaedfdd1803270927db11d8fe2c8cf9 -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/2492475ecfaedfdd1803270927db11d8fe2c8cf9 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Sun Jun 22 14:43:39 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Sun, 22 Jun 2025 13:43:39 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <6858088bc8729_3db1aa5bef44809486@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: d785523f by Andreas Tille at 2025-06-22T13:43:32+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,13 +1,13 @@ -Last-Update: Sun, 22 Jun 2025 01:42:04 +0000 +Last-Update: Sun, 22 Jun 2025 13:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- dicomscope | 30 | {imaging} | orthanc-gdcm | 17 | {imaging} | - oscar | 16 | {tools,practice,data} | + oscar | 16 | {data,tools,practice} | mrtrix3 | 14 | {imaging} | gnumed-server | 11 | {covid-19,practice} | - king | 11 | {imaging,typesetting} | + king | 11 | {typesetting,imaging} | pixelmed | 11 | {imaging} | orthanc-mysql | 10 | {imaging} | sight | 10 | {imaging} | @@ -15,17 +15,15 @@ Last-Update: Sun, 22 Jun 2025 01:42:04 +0000 bart-view | 9 | {imaging} | orthanc-postgresql | 9 | {imaging} | icb-utils | 7 | {bio-dev} | + libminc | 7 | {imaging-dev} | heudiconv | 6 | {imaging} | jebl2 | 6 | {bio-dev} | - libminc | 6 | {imaging-dev} | mia | 5 | {imaging} | insighttoolkit5 | 4 | {imaging-dev} | - beast-mcmc | 3 | {bio-phylogeny,bio} | + beast-mcmc | 3 | {bio,bio-phylogeny} | biojava6-live | 3 | {bio-dev} | biojava-live | 3 | {bio-dev} | getdata | 3 | {bio} | - pbcopper | 3 | {bio-dev} | - pbseqlib | 3 | {bio-dev} | piler | 3 | {bio} | sight | 3 | {imaging} | ants | 2 | {imaging} | @@ -35,14 +33,16 @@ Last-Update: Sun, 22 Jun 2025 01:42:04 +0000 fastml | 2 | {bio} | ipig | 2 | {bio} | libdivsufsort | 2 | {bio-dev} | - plasmidid | 2 | {bio,covid-19} | + pbcopper | 2 | {bio-dev} | + pbseqlib | 2 | {bio-dev} | + plasmidid | 2 | {covid-19,bio} | rambo-k | 2 | {bio} | tracetuner | 2 | {bio} | blimps | 1 | {bio} | brig | 1 | {bio} | ctn | 1 | {imaging-dev} | cufflinks | 1 | {cloud,bio} | - dextractor | 1 | {covid-19,bio} | + dextractor | 1 | {bio,covid-19} | eegdev | 1 | {imaging-dev} | emboss-explorer | 1 | {bio} | hinge | 1 | {bio} | @@ -54,24 +54,24 @@ Last-Update: Sun, 22 Jun 2025 01:42:04 +0000 libgenome | 1 | {bio-dev} | libpal-java | 1 | {bio-dev} | librg-utils-perl | 1 | {bio} | - melting | 1 | {bio,cloud} | - mhap | 1 | {bio-ngs,bio} | + melting | 1 | {cloud,bio} | + mhap | 1 | {bio,bio-ngs} | ncbi-vdb | 1 | {bio-dev} | papyrus | 1 | {imaging-dev} | - phyutility | 1 | {bio,cloud} | + phyutility | 1 | {cloud,bio} | proalign | 1 | {bio-phylogeny,bio} | python-seqcluster | 1 | {bio-dev,covid-19} | runcircos-gui | 1 | {bio} | seq-gen | 1 | {bio} | sga | 1 | {bio} | - spread-phy | 1 | {bio-phylogeny,bio} | + spread-phy | 1 | {bio,bio-phylogeny} | staden | 1 | {bio} | surankco | 1 | {bio} | surpyvor | 1 | {bio} | - thesias | 1 | {covid-19,bio} | - tophat-recondition | 1 | {bio,covid-19} | + thesias | 1 | {bio,covid-19} | + tophat-recondition | 1 | {covid-19,bio} | treeview | 1 | {bio-phylogeny,bio} | - varscan | 1 | {bio,covid-19} | + varscan | 1 | {covid-19,bio} | xdffileio | 1 | {imaging-dev} | acedb | 0 | {cloud,bio} | bambamc | 0 | {bio-dev} | @@ -81,8 +81,8 @@ Last-Update: Sun, 22 Jun 2025 01:42:04 +0000 capsule-maven-nextflow | 0 | {bio-dev} | ctffind | 0 | {bio} | embassy-domainatrix | 0 | {cloud,bio} | - embassy-domalign | 0 | {cloud,bio} | - embassy-domsearch | 0 | {bio,cloud} | + embassy-domalign | 0 | {bio,cloud} | + embassy-domsearch | 0 | {cloud,bio} | fis-gtm | 0 | {his} | gatk-bwamem | 0 | {bio-dev} | gatk-fermilite | 0 | {bio-dev} | @@ -101,7 +101,7 @@ Last-Update: Sun, 22 Jun 2025 01:42:04 +0000 libhmsbeagle | 0 | {bio-dev} | libics | 0 | {covid-19,imaging-dev} | libjloda-java | 0 | {bio-dev} | - libmaus2 | 0 | {bio-dev,covid-19} | + libmaus2 | 0 | {covid-19,bio-dev} | libmems | 0 | {bio-dev} | libmialm | 0 | {imaging-dev} | libmuscle | 0 | {bio-dev} | @@ -137,7 +137,7 @@ Last-Update: Sun, 22 Jun 2025 01:42:04 +0000 rdp-alignment | 0 | {bio} | rdp-classifier | 0 | {bio} | resfinder-db | 0 | {bio} | - rtax | 0 | {cloud,bio} | + rtax | 0 | {bio,cloud} | saint | 0 | {bio} | savvy | 0 | {bio-dev} | savvy | 0 | {bio} | @@ -146,14 +146,14 @@ Last-Update: Sun, 22 Jun 2025 01:42:04 +0000 sift | 0 | {bio} | sight | 0 | {imaging-dev} | skesa | 0 | {bio} | - smrtanalysis | 0 | {covid-19,bio} | + smrtanalysis | 0 | {bio,covid-19} | soapaligner | 0 | {bio} | soapsnp | 0 | {bio} | sprai | 0 | {bio} | srf | 0 | {bio-dev} | suitename | 0 | {bio} | trace2dbest | 0 | {bio} | - vienna-rna | 0 | {covid-19,bio} | + vienna-rna | 0 | {bio,covid-19} | xxsds-dynamic | 0 | {bio-dev} | sideretro | -1 | {bio} | tipp | -1 | {bio,covid-19} | ===================================== debian-science-tests.txt ===================================== @@ -1,100 +1,100 @@ -Last-Update: Sun, 22 Jun 2025 01:42:09 +0000 +Last-Update: Sun, 22 Jun 2025 13:42:08 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- - nltk | 4831 | {linguistics} | - gts | 4751 | {viewing} | - opencascade | 614 | {simulations} | + nltk | 4832 | {linguistics} | + gts | 4686 | {viewing} | + opencascade | 607 | {simulations} | spacenavd | 221 | {tools} | armadillo | 180 | {mathematics-dev} | - open-coarrays | 166 | {meteorology-dev} | + open-coarrays | 170 | {meteorology-dev} | arpack | 83 | {mathematics-dev} | scalapack | 49 | {nanoscale-physics-dev} | - ntl | 43 | {mathematics-dev} | - visidata | 41 | {datamanagement} | + ntl | 41 | {mathematics-dev} | + visidata | 40 | {datamanagement} | imview | 37 | {viewing} | mbpoll | 36 | {simulations} | - ppl | 32 | {numericalcomputation} | - flintqs | 29 | {mathematics} | - libm4ri | 27 | {mathematics-dev} | + ppl | 30 | {numericalcomputation} | + flintqs | 28 | {mathematics} | libmatio | 27 | {mathematics-dev} | - cliquer | 26 | {mathematics} | + cliquer | 25 | {mathematics} | flann | 25 | {mathematics-dev,engineering-dev} | + libm4ri | 24 | {mathematics-dev} | arduino-mk | 23 | {robotics} | xygrib | 20 | {meteorology} | bossa | 19 | {devices} | grads | 19 | {meteorology} | sat4j | 19 | {logic} | - fftw | 18 | {meteorology-dev,physics-dev,mathematics-dev} | + fftw | 18 | {mathematics-dev,physics-dev,meteorology-dev} | guiqwt | 18 | {numericalcomputation,viewing} | picosat | 18 | {logic} | setzer | 18 | {typesetting} | - lrcalc | 17 | {mathematics-dev} | ncl | 17 | {meteorology} | - gts | 16 | {viewing-dev} | + lrcalc | 16 | {mathematics-dev} | pyzo | 16 | {numericalcomputation} | sketch | 16 | {typesetting} | - cliquer | 15 | {mathematics-dev} | eccodes | 15 | {meteorology,meteorology-dev} | + gts | 15 | {viewing-dev} | dune-uggrid | 14 | {mathematics-dev} | + cliquer | 13 | {mathematics-dev} | feff85exafs | 13 | {chemistry} | - gf2x | 13 | {mathematics-dev} | libitpp | 13 | {mathematics-dev,engineering-dev} | - iml | 12 | {mathematics-dev} | - libhomfly | 12 | {mathematics-dev} | teem | 12 | {imageanalysis} | - coinor-symphony | 11 | {mathematics,numericalcomputation,logic} | - lxi-tools | 11 | {dataacquisition,engineering} | + coinor-symphony | 11 | {logic,mathematics,numericalcomputation} | + feedgnuplot | 11 | {viewing} | + gf2x | 11 | {mathematics-dev} | eccodes | 10 | {meteorology-dev} | - feedgnuplot | 10 | {viewing} | form | 10 | {mathematics} | - libm4rie | 10 | {mathematics-dev} | + iml | 10 | {mathematics-dev} | + libhomfly | 10 | {mathematics-dev} | + lxi-tools | 10 | {engineering,dataacquisition} | matlab-support | 10 | {mathematics,numericalcomputation} | ncl | 10 | {meteorology-dev} | - python-escript | 10 | {numericalcomputation,engineering,simulations} | + pcl | 10 | {robotics-dev} | + python-escript | 10 | {numericalcomputation,simulations,engineering} | geg | 9 | {viewing} | - pcl | 9 | {robotics-dev} | + libm4rie | 9 | {mathematics-dev} | python-cdo | 9 | {meteorology} | alberta | 8 | {engineering-dev} | - ratpoints | 8 | {mathematics-dev} | vdt | 8 | {mathematics-dev} | apophenia | 7 | {statistics} | - dxsamples | 7 | {nanoscale-physics} | libccp4 | 7 | {nanoscale-physics-dev} | - libzn-poly | 7 | {mathematics-dev} | opencascade | 7 | {simulations} | - persalys | 7 | {mathematics,engineering,statistics} | psurface | 7 | {numericalcomputation} | + ratpoints | 7 | {mathematics-dev} | refmac-dictionary | 7 | {highenergy-physics-dev,chemistry} | ros-rosconsole | 7 | {robotics-dev} | uctodata | 7 | {linguistics} | cld2 | 6 | {linguistics} | + dxsamples | 6 | {nanoscale-physics} | etsf-io | 6 | {physics,nanoscale-physics} | - fftw | 6 | {meteorology-dev,physics-dev,mathematics-dev} | + fftw | 6 | {meteorology-dev,mathematics-dev,physics-dev} | + libzn-poly | 6 | {mathematics-dev} | magics++ | 6 | {meteorology-dev} | metar | 6 | {meteorology} | odc | 6 | {meteorology-dev} | odc | 6 | {meteorology} | + persalys | 6 | {engineering,statistics,mathematics} | ros-vcstool | 6 | {robotics-dev} | fpzip | 5 | {meteorology} | newmat | 5 | {mathematics-dev} | - persalys | 5 | {engineering,statistics,mathematics} | + persalys | 5 | {statistics,mathematics,engineering} | rheolef | 5 | {mathematics} | rubiks | 5 | {geometry,mathematics} | toontag | 5 | {numericalcomputation} | - toulbar2 | 5 | {mathematics,logic,physics,numericalcomputation} | + toulbar2 | 5 | {logic,numericalcomputation,mathematics,physics} | ucto | 5 | {linguistics} | veccore | 5 | {mathematics-dev} | atlas-ecmwf | 4 | {meteorology} | auto-07p | 4 | {mathematics} | coda | 4 | {meteorology-dev} | coda | 4 | {meteorology} | - debian-science | 4 | {mathematics,physics,machine-learning,nanoscale-physics,economics} | - debian-science | 4 | {physics,economics,machine-learning,nanoscale-physics} | - getdp | 4 | {mathematics,simulations,engineering} | + debian-science | 4 | {economics,nanoscale-physics,machine-learning,physics,mathematics} | + debian-science | 4 | {physics,machine-learning,economics,nanoscale-physics} | + getdp | 4 | {engineering,mathematics,simulations} | gsw | 4 | {meteorology} | iapws | 4 | {meteorology} | - sdpb | 4 | {highenergy-physics,numericalcomputation} | + sdpb | 4 | {numericalcomputation,highenergy-physics} | silo-llnl | 4 | {engineering} | toon | 4 | {numericalcomputation} | urdfdom-headers | 4 | {robotics-dev} | @@ -149,9 +149,9 @@ Last-Update: Sun, 22 Jun 2025 01:42:09 +0000 libgtkdatabox | 2 | {engineering-dev,viewing-dev} | libmatheval | 2 | {mathematics-dev} | metkit | 2 | {meteorology} | - mmdb | 2 | {highenergy-physics-dev,nanoscale-physics-dev} | + mmdb | 2 | {nanoscale-physics-dev,highenergy-physics-dev} | mseed2sac | 2 | {dataacquisition-dev} | - ncrystal | 2 | {highenergy-physics-dev,nanoscale-physics-dev} | + ncrystal | 2 | {nanoscale-physics-dev,highenergy-physics-dev} | nrn-iv | 2 | {biology} | polylib | 2 | {mathematics} | qd | 2 | {mathematics-dev} | @@ -164,7 +164,7 @@ Last-Update: Sun, 22 Jun 2025 01:42:09 +0000 coda | 1 | {meteorology-dev} | code-saturne | 1 | {engineering-dev,mathematics-dev} | code-saturne | 1 | {mathematics-dev,engineering-dev} | - coinmp | 1 | {logic,numericalcomputation,mathematics-dev} | + coinmp | 1 | {logic,mathematics-dev,numericalcomputation} | debian-science | 1 | {tools} | debian-science | 1 | {neuroscience-cognitive,machine-learning} | debian-science | 1 | {psychophysics} | @@ -189,9 +189,9 @@ Last-Update: Sun, 22 Jun 2025 01:42:09 +0000 openmesh | 1 | {mathematics-dev} | psurface | 1 | {numericalcomputation} | ros-ros-environment | 1 | {robotics-dev} | - schroedinger-coordgenlibs | 1 | {chemistry,nanoscale-physics-dev} | + schroedinger-coordgenlibs | 1 | {nanoscale-physics-dev,chemistry} | siscone | 1 | {highenergy-physics-dev} | - spfft | 1 | {meteorology-dev,physics-dev,mathematics-dev,nanoscale-physics-dev} | + spfft | 1 | {mathematics-dev,nanoscale-physics-dev,physics-dev,meteorology-dev} | ssm | 1 | {nanoscale-physics-dev} | tfdocgen | 1 | {linguistics} | timbl | 1 | {linguistics} | @@ -206,7 +206,7 @@ Last-Update: Sun, 22 Jun 2025 01:42:09 +0000 apertium-urd | 0 | {linguistics} | apertium-urd-hin | 0 | {linguistics} | apriltag | 0 | {robotics-dev} | - calculix-ccx-test | 0 | {simulations,engineering,numericalcomputation} | + calculix-ccx-test | 0 | {simulations,numericalcomputation,engineering} | clhep | 0 | {highenergy-physics-dev} | cmor | 0 | {meteorology-dev} | coda | 0 | {meteorology-dev} | @@ -227,17 +227,17 @@ Last-Update: Sun, 22 Jun 2025 01:42:09 +0000 libsdsl | 0 | {dataacquisition-dev} | looptools | 0 | {highenergy-physics-dev} | looptools | 0 | {highenergy-physics} | - magma | 0 | {numericalcomputation,mathematics-dev} | + magma | 0 | {mathematics-dev,numericalcomputation} | mbt | 0 | {linguistics} | mctc-lib | 0 | {nanoscale-physics-dev,highenergy-physics-dev} | meshsdfilter | 0 | {mathematics-dev} | - metis-edf | 0 | {numericalcomputation,engineering} | metis-edf | 0 | {engineering-dev} | + metis-edf | 0 | {engineering,numericalcomputation} | nrn-mod2c | 0 | {biology} | openctm | 0 | {physics-dev} | opengv | 0 | {geometry} | openigtlink | 0 | {robotics-dev} | - python-escript | 0 | {engineering,numericalcomputation,simulations} | + python-escript | 0 | {numericalcomputation,simulations,engineering} | python-opcodes | 0 | {tools} | qrupdate | 0 | {mathematics-dev} | quadrule | 0 | {mathematics-dev} | @@ -253,7 +253,7 @@ Last-Update: Sun, 22 Jun 2025 01:42:09 +0000 sagemath-database-polytopes | 0 | {mathematics} | schroedinger-maeparser | 0 | {chemistry,nanoscale-physics-dev} | siscone | 0 | {highenergy-physics-dev} | - slicot | 0 | {engineering-dev,robotics-dev} | + slicot | 0 | {robotics-dev,engineering-dev} | sparskit | 0 | {mathematics-dev} | ssm | 0 | {nanoscale-physics} | tachyon | 0 | {mathematics} | ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,102 +1,102 @@ -Last-Update: Sun, 22 Jun 2025 01:42:12 +0000 +Last-Update: Sun, 22 Jun 2025 13:42:11 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- - mpmath | 9886 | - python-repoze.lru | 6976 | - netifaces | 5160 | + mpmath | 9857 | + python-repoze.lru | 6965 | + netifaces | 5145 | ghp-import | 4778 | python-lunr | 4772 | - python-babel | 3834 | - sortedcontainers | 3483 | - python-babel | 3389 | - aiosignal | 2939 | - hyperlink | 2155 | - humanfriendly | 1987 | - python-notify2 | 1947 | - referencing | 1550 | - python-mysqldb | 1517 | - python-gssapi | 1448 | - python-invoke | 1393 | - python-hyperframe | 1374 | - websocket-client | 1320 | - python-hpack | 1157 | - python-rsa | 1127 | - python-pandocfilters | 1039 | - pdfarranger | 983 | - menulibre | 953 | - python-linux-procfs | 925 | - python-geoip | 862 | - python-webob | 820 | - powerline | 772 | - powerline | 707 | - powerline | 702 | - python-zopfli | 675 | - firmware-microbit-micropython | 667 | - kazam | 656 | - u-msgpack-python | 605 | - python-et-xmlfile | 515 | - dockerpty | 513 | - asn1crypto | 499 | - autopep8 | 495 | - gaupol | 493 | - python-gevent | 479 | - python-ewmh | 450 | - catfish | 427 | - pytoolconfig | 407 | - python-requests-oauthlib | 400 | - spf-engine | 346 | - python-toml | 338 | - python-ntlm-auth | 305 | - spf-engine | 298 | + python-babel | 3803 | + sortedcontainers | 3468 | + python-babel | 3374 | + aiosignal | 2933 | + hyperlink | 2133 | + humanfriendly | 1989 | + python-notify2 | 1957 | + referencing | 1556 | + python-mysqldb | 1519 | + python-gssapi | 1451 | + python-invoke | 1382 | + python-hyperframe | 1364 | + websocket-client | 1304 | + python-hpack | 1145 | + python-rsa | 1126 | + python-pandocfilters | 1011 | + pdfarranger | 970 | + menulibre | 950 | + python-linux-procfs | 929 | + python-geoip | 861 | + python-webob | 812 | + powerline | 778 | + powerline | 706 | + powerline | 701 | + python-zopfli | 682 | + firmware-microbit-micropython | 669 | + kazam | 654 | + u-msgpack-python | 608 | + python-et-xmlfile | 517 | + dockerpty | 505 | + asn1crypto | 495 | + gaupol | 489 | + python-gevent | 481 | + autopep8 | 474 | + python-ewmh | 454 | + catfish | 430 | + python-requests-oauthlib | 399 | + pytoolconfig | 386 | + spf-engine | 349 | + python-toml | 337 | + python-ntlm-auth | 303 | + spf-engine | 297 | django-stronghold | 250 | - python-ldap3 | 239 | - cairocffi | 213 | - python-mimeparse | 195 | - python-smmap | 172 | - python-hidapi | 167 | - autokey | 160 | - httpie | 145 | - python-anyjson | 139 | - smem | 139 | + python-ldap3 | 241 | + cairocffi | 211 | + python-mimeparse | 191 | + python-smmap | 173 | + python-hidapi | 166 | + autokey | 163 | + httpie | 143 | + smem | 138 | + python-anyjson | 137 | kivy | 134 | - python-aiostream | 124 | - python-click-repl | 124 | + python-aiostream | 123 | smartypants | 118 | - mypaint | 112 | + python-click-repl | 117 | + mypaint | 115 | lollypop | 104 | - nodeenv | 104 | + nodeenv | 103 | timekpr-next | 100 | + mugshot | 99 | python-consul | 99 | - mugshot | 97 | python-pyu2f | 96 | - pacparser | 94 | - pymacaroons | 91 | - python-rfc6555 | 88 | - pssh | 82 | - pymediainfo | 75 | + pacparser | 95 | + pymacaroons | 90 | + python-rfc6555 | 87 | + pssh | 83 | + pymediainfo | 77 | python-colour | 72 | - numpy-stl | 71 | python-i3ipc | 69 | - pywavelets | 67 | - mitmproxy | 66 | - python-pykka | 65 | - fabric | 64 | - weasyprint | 64 | - ueberzug | 58 | - itstool | 55 | - python-looseversion | 55 | - python-uritools | 54 | + numpy-stl | 68 | + mitmproxy | 67 | + pywavelets | 66 | + weasyprint | 66 | + fabric | 63 | + python-pykka | 63 | + itstool | 54 | + python-looseversion | 54 | + ueberzug | 54 | python-scp | 53 | + python-uritools | 52 | mysql-connector-python | 50 | pyenv | 50 | pymacs | 48 | sshtunnel | 48 | khard | 46 | + blockdiag | 45 | hatchling | 45 | - blockdiag | 44 | + trac | 44 | kivy | 43 | - trac | 43 | membernator | 42 | python-pysol-cards | 41 | certipy | 40 | @@ -105,107 +105,107 @@ Last-Update: Sun, 22 Jun 2025 01:42:12 +0000 pyquery | 39 | pylibmc | 38 | powerline-gitstatus | 37 | - python-scrypt | 35 | + python-scrypt | 36 | + pdfposter | 35 | show-in-file-manager | 35 | - pdfposter | 34 | - persepolis | 33 | pssh | 33 | - python-statsd | 31 | + persepolis | 32 | + python-statsd | 32 | + seqdiag | 29 | python-args | 28 | - seqdiag | 28 | + sphinxcontrib-blockdiag | 28 | dkimpy-milter | 27 | - sphinxcontrib-blockdiag | 27 | - sphinxcontrib-seqdiag | 26 | - sphinx-inline-tabs | 26 | + sphinxcontrib-seqdiag | 27 | + video-downloader | 27 | + enzyme | 26 | depthcharge-tools | 25 | - enzyme | 25 | flask-principal | 25 | python-clint | 25 | rst2pdf | 25 | - video-downloader | 25 | + sphinx-inline-tabs | 25 | + subliminal | 24 | typogrify | 24 | cppman | 23 | - python-fire | 23 | - subliminal | 23 | webpy | 23 | + python-demjson | 22 | + python-fire | 22 | + subliminal | 22 | + nwdiag | 21 | + python-rangehttpserver | 21 | python-zstd | 21 | - subliminal | 21 | + backoff | 20 | fabric | 20 | - nwdiag | 20 | - python-rangehttpserver | 20 | python-sdnotify | 20 | - spf-engine | 20 | - backoff | 19 | - python-demjson | 19 | + nwg-displays | 19 | + python-pysubs2 | 19 | + spf-engine | 19 | alot | 18 | - nwg-displays | 18 | - python-pysubs2 | 18 | + actdiag | 17 | django-environ | 17 | mistune0 | 17 | sphinxcontrib-log-cabinet | 17 | webtest | 17 | - actdiag | 16 | flask-security | 16 | policyd-rate-limit | 16 | python-translationstring | 16 | social-auth-core | 16 | - unearth | 16 | - pdm | 15 | + sphinxcontrib-actdiag | 16 | + sphinxcontrib-nwdiag | 16 | + pykwalify | 15 | + python-ethtool | 15 | python-inotify | 15 | + python-pyalsa | 15 | python-slip10 | 15 | - sphinxcontrib-actdiag | 15 | - sphinxcontrib-nwdiag | 15 | todoman | 15 | - pykwalify | 14 | - python-ethtool | 14 | + unearth | 15 | + pdm | 14 | python-kyotocabinet | 14 | - python-pyalsa | 14 | - python-simpy | 14 | junos-eznc | 13 | python-hupper | 13 | python-pem | 13 | python-priority | 13 | python-pyscss | 13 | + python-simpy | 13 | python-xtermcolor | 13 | ansi | 12 | jschema-to-python | 12 | - pyp | 12 | python-dbussy | 12 | python-pyrss2gen | 12 | python-sarif-python-om | 12 | ruff | 12 | speaklater | 12 | + beancount | 11 | flask-paranoid | 11 | gmplot | 11 | notebook-shim | 11 | pylint-common | 11 | + pyp | 11 | python-digitalocean | 11 | python-parse-type | 11 | slimit | 11 | + tuna | 11 | txt2tags | 11 | - beancount | 10 | + autotiling | 10 | btchip-python | 10 | gtextfsm | 10 | python-pyld | 10 | - tuna | 10 | - autotiling | 9 | clustershell | 9 | debiancontributors | 9 | django-auditlog | 9 | django-sass | 9 | - pwntools | 9 | - python-numpysane | 9 | python-pyaml-env | 9 | traittypes | 9 | voltron | 9 | drf-extensions | 8 | drf-yasg-nonfree | 8 | htmlmin | 8 | - pytaglib | 8 | + httpcode | 8 | + pwntools | 8 | python-aiohttp-security | 8 | python-ansicolors | 8 | python-crcelk | 8 | python-drf-spectacular-sidecar-nonfree | 8 | + python-numpysane | 8 | python-overpy | 8 | python-versioneer | 8 | sphinx-intl | 8 | @@ -213,13 +213,12 @@ Last-Update: Sun, 22 Jun 2025 01:42:12 +0000 flask-api | 7 | flask-session | 7 | graphql-relay | 7 | - httpcode | 7 | mercurial-evolve | 7 | micropython-mpremote | 7 | pybik | 7 | pycallgraph | 7 | + pytaglib | 7 | pytest-django | 7 | - ruff | 7 | trac-wysiwyg | 7 | clustershell | 6 | django-model-utils | 6 | @@ -228,12 +227,12 @@ Last-Update: Sun, 22 Jun 2025 01:42:12 +0000 librouteros | 6 | mypy-protobuf | 6 | pydrive2 | 6 | + pytest-runner | 6 | python3-onelogin-saml2 | 6 | python-biplist | 6 | python-envs | 6 | python-gnuplotlib | 6 | - python-openstep-plist | 6 | - python-xdo | 6 | + ruff | 6 | django-jinja | 5 | django-paintstore | 5 | django-pglocks | 5 | @@ -242,9 +241,11 @@ Last-Update: Sun, 22 Jun 2025 01:42:12 +0000 numpy-stl | 5 | pyjokes | 5 | pynliner | 5 | - pytest-runner | 5 | python-halo | 5 | + python-openstep-plist | 5 | python-simpy | 5 | + python-xdo | 5 | + smem | 5 | sphinxcontrib-globalsubs | 5 | aiomysql | 4 | bootstrap-flask | 4 | @@ -266,7 +267,6 @@ Last-Update: Sun, 22 Jun 2025 01:42:12 +0000 python-srp | 4 | s3ql | 4 | securestring | 4 | - smem | 4 | sorl-thumbnail | 4 | sphinx-markdown-tables | 4 | west | 4 | @@ -304,7 +304,6 @@ Last-Update: Sun, 22 Jun 2025 01:42:12 +0000 soundcraft-utils | 3 | trac-accountmanager | 3 | trac-xmlrpc | 3 | - utidylib | 3 | wikitrans | 3 | yotta | 3 | bqplot | 2 | @@ -318,6 +317,7 @@ Last-Update: Sun, 22 Jun 2025 01:42:12 +0000 django-graphene | 2 | django-maintenance-mode | 2 | django-yarnpkg | 2 | + dotdrop | 2 | flake8-black | 2 | gtkman | 2 | hatch-jupyter-builder | 2 | @@ -325,6 +325,7 @@ Last-Update: Sun, 22 Jun 2025 01:42:12 +0000 jsonrpclib-pelix | 2 | namecheap | 2 | panoramisk | 2 | + pykwalify | 2 | pylint-celery | 2 | pypass | 2 | pyroma | 2 | @@ -354,15 +355,14 @@ Last-Update: Sun, 22 Jun 2025 01:42:12 +0000 sphinx-paramlinks | 2 | sphinxtesters | 2 | testrepository | 2 | + utidylib | 2 | vcversioner | 2 | vf1 | 2 | - vrfydmn | 2 | zabbix-cli | 2 | apkinspector | 1 | backupchecker | 1 | celery-progress | 1 | codicefiscale | 1 | - dotdrop | 1 | errbot | 1 | flask-multistatic | 1 | fypp | 1 | @@ -373,9 +373,7 @@ Last-Update: Sun, 22 Jun 2025 01:42:12 +0000 moviepy | 1 | myst-nb | 1 | onetimepass | 1 | - panoramisk | 1 | power | 1 | - pykwalify | 1 | pynag | 1 | pyrad | 1 | python-banal | 1 | @@ -408,6 +406,7 @@ Last-Update: Sun, 22 Jun 2025 01:42:12 +0000 trac-customfieldadmin | 1 | trac-httpauth | 1 | vncdotool | 1 | + vrfydmn | 1 | wchartype | 1 | wikitrans | 1 | zlmdb | 1 | @@ -591,5 +590,5 @@ Last-Update: Sun, 22 Jun 2025 01:42:12 +0000 sphinxcontrib-emojicodes | -1 | symmetrize | -1 | trac-tickettemplate | -1 | -(604 rows) +(603 rows) View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/d785523f7028e1be90da492d5f3f3d1a97ca1da0 -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/d785523f7028e1be90da492d5f3f3d1a97ca1da0 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Mon Jun 23 00:06:18 2025 From: gitlab at salsa.debian.org (Charles Plessy (@plessy)) Date: Sun, 22 Jun 2025 23:06:18 +0000 Subject: [med-svn] [Git][med-team/policy][master] Pushable URL alias for Salsa Message-ID: <68588c6a28b27_3db179562a04890258@godard.mail> Charles Plessy pushed to branch master at Debian Med / policy Commits: cd6102b5 by Charles Plessy at 2025-06-23T08:05:53+09:00 Pushable URL alias for Salsa - - - - - 2 changed files: - policy.html - policy.rst Changes: ===================================== policy.html ===================================== @@ -386,73 +386,74 @@ ul.auto-toc {
  • Git tips
    • -
  • Updating a source package managed with Git
    • +
  • Updating a source package managed with Git
    • -
  • Packaging
      -
    • Newcomer guidelines for building proper Debian packages
      • -
    • Announcing intent to package
      • -
    • Backports
      • -
    • PPA for Ubuntu
      • -
    • Debian unstable chroot on Ubuntu
      • -
    • Derivatives working together with Debian Med
      • -
    • R packages
      • +
    • Packaging
      • -
    • Tasks
      • -
    • Policy
        -
      • debian/control
        • -
      • debian/copyright
        • -
      • debian/changelog
        • -
      • debian/upstream
        • -
      • debian/gbp.conf
        • -
      • debian/README.source
        • -
      • debian/README.test
        • -
      • debian/source/format
        • -
      • debian/source/options
        • -
      • debian/salsa-ci.yml
        • -
      • debian/symbols
        • -
      • Debhelper
        • -
      • Version control systems
          -
        • Source package stored in a Git repository on Salsa
          • -
        • Tags
          • +
        • Tasks
          • +
        • Policy
            +
          • debian/control
            • +
          • debian/copyright
            • +
          • debian/changelog
            • +
          • debian/upstream
            • +
          • debian/gbp.conf
            • +
          • debian/README.source
            • +
          • debian/README.test
            • +
          • debian/source/format
            • +
          • debian/source/options
            • +
          • debian/salsa-ci.yml
            • +
          • debian/symbols
            • +
          • Debhelper
            • +
          • Version control systems
            • -
          • New package
            • -
          • The Debian Med Blend tasks
            • -
          • Building and tagging the packages
            • -
          • Handling patches
              -
            • Using quilt
              • -
            • Embedding Large Test Data
              • -
            • FAQ @@ -642,8 +643,20 @@ git config --global user.name "$DEBFULLNAME" git config --global user.email "$DEBEMAIL" +
              +

              Configure Git to create a short alias to pushable Salsa URLs

              +

              With the first command you can configure Git so that you do not have +to edit by hand https URLs presented to you by debcheckout, +apt-cache, etc. into pushable git@ URLs. The second command +creates an alias to further simplify pushable URLs. For instance +this repository would become salsa:med-team/policy.

              +
              +git config --global url."git@salsa.debian.org:".pushInsteadOf "https://salsa.debian.org/"
+git config --global url."git@salsa.debian.org:".insteadOf salsa:
+
              +
              -

              To create a new local git repository

              +

              To create a new local git repository

              Before you create a new git repository you probably want to check whether your target project just exists. In the Gitlab interface of Salsa you can seek for software @@ -673,14 +686,14 @@ upstream .. _debcheckout-git-track:

              -

              To clone and follow every branch of a git repository.

              +

              To clone and follow every branch of a git repository.

              When the package is already in the Debian archive, you can use the debcheckout command with its --git-track='*' option.

              To update the upstream, master and pristine-tar branches at once, use the gbp pull.

              -

              To track extra upstream branches, simply check them out.

              +

              To track extra upstream branches, simply check them out.

              With recent versions of git, the remote branch will be automatically tracked when running git checkout. For example, when a pristine-tar branch is available upstream and not yet tracked @@ -688,7 +701,7 @@ locally, the command git checkout git branch -t pristine-tar origin/pristine-tar.

              -

              To create a pristine-tar branch when it is missing.

              +

              To create a pristine-tar branch when it is missing.

              See the documentation of git-buildpackage for details. Use a similar command for any other missing branch.

              @@ -700,7 +713,7 @@ git checkout -f master
              -

              Creating a new repository on Salsa

              +

              Creating a new repository on Salsa

              Before pushing to salsa.debian.org for the first time, an empty repository needs to be created there in the Gitlab interface.

              Each package is kept in its own Git repository. Now, on your local @@ -710,7 +723,7 @@ git remote add origin git@salsa.debian.org:med-team/<pkg>.git

              -

              To change the default branch.

              +

              To change the default branch.

              If the Debian work is not on the master branch, change the default branch by editing the HEAD file in the bare repository on Salsa, and replace master by the name of the new default branch. For a branch @@ -718,7 +731,7 @@ called debian/unstable the contents of the fil refs/heads/debian/unstable.

              -

              To push the package.

              +

              To push the package.

              (make sure you've added the salsa remote!), do the following: git push origin master. For the first push, it's necessary to specify origin master. The next time you will push, a git push will @@ -729,7 +742,7 @@ git push --set-upstream

              -

              To push all your work

              +

              To push all your work

              Be sure to also do a run git push with --all, and one with --tags if you created new tags.

              @@ -738,12 +751,12 @@ git push --tags
              -

              To tag a release

              +

              To tag a release

              git tag debian/x.y-z. You can also easily retroactively make tags: git tag debian/x.y-z <commit hash>. Remember to git push --tags.

              -

              If upstream manages their sources with Git.

              +

              If upstream manages their sources with Git.

              The following makefile script can help producing a version number when no Git tag is available:

              @@ -760,7 +773,7 @@ get-orig-source:
              -

              To make gbp buildpackage build the package with pdebuild.

              +

              To make gbp buildpackage build the package with pdebuild.

              Add the following to the configuration file ~/.gbp.conf or debian/gbp.conf:

              @@ -794,7 +807,7 @@ for Debian 11 only source uploads are allowed.
              • -

              Updating a source package managed with Git

              +

              Updating a source package managed with Git

              Most source packages maintained as Git repositories in Debian Med are using the gbp buildpackage helper toolkit. In doubt, try this one first.

              @@ -833,9 +846,9 @@ to upgrade some package to the latest upstream version.

              -

              Packaging

              +

              Packaging

              -

              Newcomer guidelines for building proper Debian packages

              +

              Newcomer guidelines for building proper Debian packages

              Some newcomers tend to go the create DEBIAN dir, move files around and `dpkg-deb -b` way to create Debian packages. Short answer: Forget about this. The only way to the official Debian mirror leads via proper @@ -851,7 +864,7 @@ student to get a personal training how to start working inside the Debian Med team.

              -

              Announcing intent to package

              +

              Announcing intent to package

              If you intent to work on a Debian package you should follow the normal Debian rules and file a WNPP bug report.

              @@ -864,7 +877,7 @@ we notice if for some reason the package has not been uploaded.

              best, and document your ITP number using the WNPP field name.

              -

              Backports

              +

              Backports

              Debian offers backports to provide up-to-date software for users of the official stable releases. Backports of Debian Med packages should be kept as branches in our @@ -900,7 +913,7 @@ dch --bpo

              Now, you can try building against a Stable chroot.

              -

              PPA for Ubuntu

              +

              PPA for Ubuntu

              Debian Med operates a Personal Package Archive (PPA) on Launchpad, where packages are backported for Ubuntu. There is currently @@ -925,11 +938,11 @@ for versioning packages in PPA.

              follows: LINTIAN_PROFILE=ubuntu.

              -

              Debian unstable chroot on Ubuntu

              +

              Debian unstable chroot on Ubuntu

              cowbuilder-dist sid create cowbuilder-dist sid login

              -

              Derivatives working together with Debian Med

              +

              Derivatives working together with Debian Med

              Debian Med is proud that derivatives (like for instance Bio-Linux) are profiting from our work inside Debian and we try to establish strong connections @@ -944,7 +957,7 @@ it should get the version the versioning scheme usually used by Ubuntu).

              -

              R packages

              +

              R packages

              Debian R packages should be maintained within the Debian R Packages Team.

              GNU R sometimes introduces @@ -956,7 +969,7 @@ binary package.

              -

              Tasks

              +

              Tasks

              The Debian Med Debian Pure Blend is organised by tasks, that group packages around broad themes such as medical @@ -973,9 +986,9 @@ and described in the -

              Policy

              +

              Policy

              -

              debian/control

              +

              debian/control

              1. Section.

                Should be ?science? for the source package.

                @@ -1004,7 +1017,7 @@ upload.

              2. Build-Depends.

                For new packages of tools that produce architecture-dependant binary packages (anything besides Architecture: all), then the following dependencies -SHOULD be listed to skip building on non-64-bit and non-little-endian +should be listed to skip building on non-64-bit and non-little-endian architectures: architecture-is-64-bit, architecture-is-little-endian.

              3. Standards-Version.

                @@ -1048,7 +1061,7 @@ you want to use the cme GUI you also need to

                cme edit dpkg

              -

              debian/changelog

              +

              debian/changelog

              Packages hosted in our Git repository, that have been modified but not uploaded must use UNRELEASED as a distribution name. This can be done automatically by declaring @@ -1087,7 +1100,7 @@ done automatically by declaring dch.

              -

              debian/upstream

              +

              debian/upstream

              We use the bibliographic information which should be stored in the file debian/upstream. The purpose of @@ -1100,7 +1113,7 @@ RRID, bio.tools, OMICtools). The metadata allows for references to publications and entries in these registries alike.

              -

              debian/gbp.conf

              +

              debian/gbp.conf

              Include this file to document the layout of the repository. Packages managed with gbp buildpackage may omit default values.

              @@ -1119,7 +1132,7 @@ pristine-tar = True
              -

              debian/README.source

              +

              debian/README.source

              This file is recommended by the Policy (? 4.14) from version 3.8.0 for documenting source package handling. Please @@ -1128,20 +1141,20 @@ a patch system, when the upstream sources are in another format than gzipped tar archive, when we repack the sources,?

              -

              debian/README.test

              +

              debian/README.test

              This file was (recommended by the Security team) for describing to others than the regular maintainer how the package's functionality can properly be tested.

              -

              debian/source/format

              +

              debian/source/format

              This file sould contain ?3.0 (quilt)? in order to use this source format. Other formats should be avoided unless they bring a specific advantage.

              -

              debian/source/options

              +

              debian/source/options

              For packages not using quilt patches, for example when committing changes directly to the Debian branch, this file should contain ?single-debian-patch? in order to emulate the 1.0 @@ -1150,7 +1163,7 @@ the 3.0 (quilt) format brings other advantages the conservation of file permissions in the debian directory.

              -

              debian/salsa-ci.yml

              +

              debian/salsa-ci.yml

              To run continuous integration tests at each push in our Salsa forge, the Salsa CI team provides a pipeline that can be activated by including some template files available from their repository. The simplest and @@ -1183,7 +1196,7 @@ variables:

              Again, refer to the README provided by the Salsa CI team for more options.

              -

              debian/symbols

              +

              debian/symbols

              Symbols files in libraries usually require more effort for maintenance. However, these can be very important to detect ABI changes that are @@ -1199,7 +1212,7 @@ could simplify the creation and maintenance of symbols files. The is available online.

              -

              Debhelper

              +

              Debhelper

              Debhelper uses compatibility levels to control the behaviour of its commands. We currently recommend to use the level 10 which is available in current Stable and backported to Oldstable. However, @@ -1211,26 +1224,26 @@ easy to understand the packaging for other members of the team. Even complex packaging becomes quite transparent this way.

              -

              Version control systems

              +

              Version control systems

              -

              Tags

              +

              Tags

              Tags indicate the revision corresponding to uploaded packages. For a released package debian/ is added before the package version number.

              -

              New package

              +

              New package

              Try to inject a new package only after successfully building it with dpkg-buildpackage (or any wrapper around it). Use a file like debian/DRAFT to mention when the package is a draft.

              -

              The Debian Med Blend tasks

              +

              The Debian Med Blend tasks

              Once you injected a new package please make sure that it is mentioned in the appropriate tasks file in the Git source of the debian-med Blend package. Some team members watch the changes in the @@ -1238,13 +1251,13 @@ Debian Med packaging pool but it helps if the maintainer of a new package verifies that everything is in the right place.

              -

              Building and tagging the packages

              +

              Building and tagging the packages

              We prefer that uploaded packages are built in a chroot, to provide similar build environment to the whole team. After upload, please tag the Git repository.

              -

              Handling patches

              +

              Handling patches

              Often happens that the upstream code doesn't fit well into the Debian distribution: be this wrong paths, missing features, anything that implies editing the source files. When you directly edit upstream's @@ -1256,7 +1269,7 @@ the debian/patches directory.

              The 3.0 (quilt) Dpkg source format provides its own patch system. You can use it with the quilt command.

              -

              Using quilt

              +

              Using quilt

              Using quilt is rather easy.

              First, make sure you have correctly setup quilt: open .quiltrc in your home directory (create it if you don't have one), and make sure it @@ -1272,7 +1285,7 @@ QUILT_PATCHES="debian/patches" instructions in the New Maintainer's Guide.

              -

              Creating a patch

              +

              Creating a patch

              To create a patch, use the new command. Run:

              quilt new <patch_name>.patch
              @@ -1295,7 +1308,7 @@ format:

              quilt header -e --dep3
              -

              Applying and unapplying patches

              +

              Applying and unapplying patches

              Just two easy commands to do the job:

              • quilt pop will unapply the topmost patch.
                • @@ -1310,7 +1323,7 @@ apply/unapply all patches in the series.

              -

              Editing patches

              +

              Editing patches

              To edit a patch, first make it the topmost:

              quilt push <patch_name>
              @@ -1320,13 +1333,13 @@ apply/unapply all patches in the series.

              when you're done, quilt refresh.

              -

              Renaming patches

              +

              Renaming patches

              Sometimes it's useful to rename a patch. Without any hassle, do:

              quilt rename -P <old_name>.patch <new_name>.patch
              -

              Updating patches

              +

              Updating patches

              After updating a package to a new upstream version, it can happen that the patches do not apply cleanly anymore. Try quilt pop -a, to remove all patches, and then quilt push one patch at a time.

              @@ -1343,7 +1356,7 @@ corresponding *.rej files, and then update the quilt refresh.

              -

              Other commands

              +

              Other commands

              Please see man 1 quilt to have a comprehensive list of commands and the UsingQuilt page on the Debian Wiki.

              @@ -1351,7 +1364,7 @@ the Debian Wiki.

              -

              Embedding Large Test Data

              +

              Embedding Large Test Data

              Often a lot of times, there's a need to fetch external data for adding autopkgtests. We choose to make a separate orig tarball for data if the size of data far exceeds the size of package.

              Step - 1:

              @@ -1401,9 +1414,9 @@ Simply use the debian-tests-data< For further reading, check Javascript Team Embedding wiki

              -

              FAQ

              +

              FAQ

              -

              How to easily help upstream exactly reproduce build/test errors that may be specific to Debian?

              +

              How to easily help upstream exactly reproduce build/test errors that may be specific to Debian?

              For packages already uploaded, you can adapt the Dockerfile below to share with upstream so they can see the error and be able to inspect and troubleshoot with the exact @@ -1427,7 +1440,7 @@ option to docker build (or linux/mips64le for mips64**el**.

              -

              What to do if a large package does not build on a specific autobuilder architecture?

              +

              What to do if a large package does not build on a specific autobuilder architecture?

              Some of our target packages are large regarding memory consumption or requiring more computing power to build on not so powerful architectures. Since the Debian autobuilder infrastructure consists of ===================================== policy.rst ===================================== @@ -248,6 +248,22 @@ per-repository only: .. _new-repository-with-gbp: +Configure Git to create a short alias to pushable Salsa URLs +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +With the first command you can configure Git so that you do not have +to edit by hand ``https`` URLs presented to you by ``debcheckout``, +``apt-cache``, etc. into pushable ``git@`` URLs. The second command +creates an alias to further simplify pushable URLs. For instance +this repository would become ``salsa:med-team/policy``. + +:: + + git config --global url."git at salsa.debian.org:".pushInsteadOf "https://salsa.debian.org/" + git config --global url."git at salsa.debian.org:".insteadOf salsa: + +.. _pushable-salsa-url-alias: + To create a new local git repository ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ View it on GitLab: https://salsa.debian.org/med-team/policy/-/commit/cd6102b550e050d8ce43b652be4331a723400291 -- View it on GitLab: https://salsa.debian.org/med-team/policy/-/commit/cd6102b550e050d8ce43b652be4331a723400291 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Mon Jun 23 02:43:34 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Mon, 23 Jun 2025 01:43:34 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <6858b1469759_3db1c73b254490259f@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: bda5c948 by Andreas Tille at 2025-06-23T01:43:30+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Sun, 22 Jun 2025 13:42:04 +0000 +Last-Update: Mon, 23 Jun 2025 01:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- ===================================== debian-science-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Sun, 22 Jun 2025 13:42:08 +0000 +Last-Update: Mon, 23 Jun 2025 01:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Sun, 22 Jun 2025 13:42:11 +0000 +Last-Update: Mon, 23 Jun 2025 01:42:05 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/bda5c948627f67d08229a27259221180a1a619c0 -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/bda5c948627f67d08229a27259221180a1a619c0 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Mon Jun 23 14:43:30 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Mon, 23 Jun 2025 13:43:30 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <68595a0285f71_3db1e270e4849641ea@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: 91dd0f5e by Andreas Tille at 2025-06-23T13:43:23+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,32 +1,32 @@ -Last-Update: Mon, 23 Jun 2025 01:42:04 +0000 +Last-Update: Mon, 23 Jun 2025 13:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- - dicomscope | 30 | {imaging} | + dicomscope | 28 | {imaging} | + oscar | 18 | {data,tools,practice} | orthanc-gdcm | 17 | {imaging} | - oscar | 16 | {data,tools,practice} | mrtrix3 | 14 | {imaging} | gnumed-server | 11 | {covid-19,practice} | - king | 11 | {typesetting,imaging} | pixelmed | 11 | {imaging} | + king | 10 | {typesetting,imaging} | orthanc-mysql | 10 | {imaging} | sight | 10 | {imaging} | adun.app | 9 | {bio} | bart-view | 9 | {imaging} | orthanc-postgresql | 9 | {imaging} | - icb-utils | 7 | {bio-dev} | - libminc | 7 | {imaging-dev} | + icb-utils | 8 | {bio-dev} | + libminc | 8 | {imaging-dev} | heudiconv | 6 | {imaging} | - jebl2 | 6 | {bio-dev} | + jebl2 | 5 | {bio-dev} | mia | 5 | {imaging} | + biojava-live | 4 | {bio-dev} | insighttoolkit5 | 4 | {imaging-dev} | - beast-mcmc | 3 | {bio,bio-phylogeny} | + sight | 4 | {imaging} | biojava6-live | 3 | {bio-dev} | - biojava-live | 3 | {bio-dev} | getdata | 3 | {bio} | piler | 3 | {bio} | - sight | 3 | {imaging} | ants | 2 | {imaging} | + beast-mcmc | 2 | {bio,bio-phylogeny} | bio-tradis | 2 | {bio,bio-dev} | cmtk | 2 | {imaging} | elastix | 2 | {imaging} | @@ -60,7 +60,6 @@ Last-Update: Mon, 23 Jun 2025 01:42:04 +0000 papyrus | 1 | {imaging-dev} | phyutility | 1 | {cloud,bio} | proalign | 1 | {bio-phylogeny,bio} | - python-seqcluster | 1 | {bio-dev,covid-19} | runcircos-gui | 1 | {bio} | seq-gen | 1 | {bio} | sga | 1 | {bio} | @@ -132,6 +131,7 @@ Last-Update: Mon, 23 Jun 2025 01:42:04 +0000 pscan-chip | 0 | {bio} | pymia | 0 | {imaging-dev} | python-cgelib | 0 | {bio-dev} | + python-seqcluster | 0 | {bio-dev,covid-19} | python-seqcluster | 0 | {bio} | qcumber | 0 | {bio} | rdp-alignment | 0 | {bio} | @@ -139,8 +139,8 @@ Last-Update: Mon, 23 Jun 2025 01:42:04 +0000 resfinder-db | 0 | {bio} | rtax | 0 | {bio,cloud} | saint | 0 | {bio} | - savvy | 0 | {bio-dev} | savvy | 0 | {bio} | + savvy | 0 | {bio-dev} | sbmltoolbox | 0 | {bio-dev} | sibsim4 | 0 | {cloud,bio} | sift | 0 | {bio} | ===================================== debian-science-tests.txt ===================================== @@ -1,67 +1,68 @@ -Last-Update: Mon, 23 Jun 2025 01:42:04 +0000 +Last-Update: Mon, 23 Jun 2025 13:42:08 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- - nltk | 4832 | {linguistics} | - gts | 4686 | {viewing} | + nltk | 4819 | {linguistics} | + gts | 4646 | {viewing} | opencascade | 607 | {simulations} | - spacenavd | 221 | {tools} | - armadillo | 180 | {mathematics-dev} | - open-coarrays | 170 | {meteorology-dev} | + spacenavd | 225 | {tools} | + armadillo | 181 | {mathematics-dev} | + open-coarrays | 169 | {meteorology-dev} | arpack | 83 | {mathematics-dev} | scalapack | 49 | {nanoscale-physics-dev} | + visidata | 42 | {datamanagement} | ntl | 41 | {mathematics-dev} | - visidata | 40 | {datamanagement} | imview | 37 | {viewing} | mbpoll | 36 | {simulations} | - ppl | 30 | {numericalcomputation} | - flintqs | 28 | {mathematics} | - libmatio | 27 | {mathematics-dev} | + ppl | 31 | {numericalcomputation} | + flintqs | 29 | {mathematics} | + libmatio | 26 | {mathematics-dev} | cliquer | 25 | {mathematics} | - flann | 25 | {mathematics-dev,engineering-dev} | - libm4ri | 24 | {mathematics-dev} | - arduino-mk | 23 | {robotics} | - xygrib | 20 | {meteorology} | + libm4ri | 25 | {mathematics-dev} | + arduino-mk | 24 | {robotics} | + flann | 24 | {mathematics-dev,engineering-dev} | + xygrib | 22 | {meteorology} | bossa | 19 | {devices} | - grads | 19 | {meteorology} | + picosat | 19 | {logic} | sat4j | 19 | {logic} | + setzer | 19 | {typesetting} | fftw | 18 | {mathematics-dev,physics-dev,meteorology-dev} | + grads | 18 | {meteorology} | guiqwt | 18 | {numericalcomputation,viewing} | - picosat | 18 | {logic} | - setzer | 18 | {typesetting} | - ncl | 17 | {meteorology} | - lrcalc | 16 | {mathematics-dev} | + lrcalc | 17 | {mathematics-dev} | pyzo | 16 | {numericalcomputation} | sketch | 16 | {typesetting} | eccodes | 15 | {meteorology,meteorology-dev} | gts | 15 | {viewing-dev} | - dune-uggrid | 14 | {mathematics-dev} | - cliquer | 13 | {mathematics-dev} | + ncl | 15 | {meteorology} | + cliquer | 14 | {mathematics-dev} | + dune-uggrid | 13 | {mathematics-dev} | feff85exafs | 13 | {chemistry} | libitpp | 13 | {mathematics-dev,engineering-dev} | + gf2x | 12 | {mathematics-dev} | teem | 12 | {imageanalysis} | coinor-symphony | 11 | {logic,mathematics,numericalcomputation} | - feedgnuplot | 11 | {viewing} | - gf2x | 11 | {mathematics-dev} | + iml | 11 | {mathematics-dev} | + libhomfly | 11 | {mathematics-dev} | + lxi-tools | 11 | {engineering,dataacquisition} | eccodes | 10 | {meteorology-dev} | + feedgnuplot | 10 | {viewing} | form | 10 | {mathematics} | - iml | 10 | {mathematics-dev} | - libhomfly | 10 | {mathematics-dev} | - lxi-tools | 10 | {engineering,dataacquisition} | + libm4rie | 10 | {mathematics-dev} | matlab-support | 10 | {mathematics,numericalcomputation} | ncl | 10 | {meteorology-dev} | pcl | 10 | {robotics-dev} | python-escript | 10 | {numericalcomputation,simulations,engineering} | geg | 9 | {viewing} | - libm4rie | 9 | {mathematics-dev} | python-cdo | 9 | {meteorology} | - alberta | 8 | {engineering-dev} | + ratpoints | 8 | {mathematics-dev} | vdt | 8 | {mathematics-dev} | + alberta | 7 | {engineering-dev} | apophenia | 7 | {statistics} | libccp4 | 7 | {nanoscale-physics-dev} | + libzn-poly | 7 | {mathematics-dev} | opencascade | 7 | {simulations} | psurface | 7 | {numericalcomputation} | - ratpoints | 7 | {mathematics-dev} | refmac-dictionary | 7 | {highenergy-physics-dev,chemistry} | ros-rosconsole | 7 | {robotics-dev} | uctodata | 7 | {linguistics} | @@ -69,11 +70,10 @@ Last-Update: Mon, 23 Jun 2025 01:42:04 +0000 dxsamples | 6 | {nanoscale-physics} | etsf-io | 6 | {physics,nanoscale-physics} | fftw | 6 | {meteorology-dev,mathematics-dev,physics-dev} | - libzn-poly | 6 | {mathematics-dev} | magics++ | 6 | {meteorology-dev} | metar | 6 | {meteorology} | - odc | 6 | {meteorology-dev} | odc | 6 | {meteorology} | + odc | 6 | {meteorology-dev} | persalys | 6 | {engineering,statistics,mathematics} | ros-vcstool | 6 | {robotics-dev} | fpzip | 5 | {meteorology} | @@ -84,26 +84,23 @@ Last-Update: Mon, 23 Jun 2025 01:42:04 +0000 toontag | 5 | {numericalcomputation} | toulbar2 | 5 | {logic,numericalcomputation,mathematics,physics} | ucto | 5 | {linguistics} | + urdfdom-headers | 5 | {robotics-dev} | veccore | 5 | {mathematics-dev} | atlas-ecmwf | 4 | {meteorology} | auto-07p | 4 | {mathematics} | coda | 4 | {meteorology-dev} | coda | 4 | {meteorology} | - debian-science | 4 | {economics,nanoscale-physics,machine-learning,physics,mathematics} | debian-science | 4 | {physics,machine-learning,economics,nanoscale-physics} | + debian-science | 4 | {economics,nanoscale-physics,machine-learning,physics,mathematics} | getdp | 4 | {engineering,mathematics,simulations} | gsw | 4 | {meteorology} | iapws | 4 | {meteorology} | sdpb | 4 | {numericalcomputation,highenergy-physics} | silo-llnl | 4 | {engineering} | toon | 4 | {numericalcomputation} | - urdfdom-headers | 4 | {robotics-dev} | apertium-eval-translator | 3 | {linguistics} | cmor | 3 | {meteorology} | drslib | 3 | {meteorology} | - dune-functions | 3 | {mathematics-dev} | - dune-localfunctions | 3 | {mathematics-dev} | - dune-typetree | 3 | {mathematics-dev} | dxflib | 3 | {engineering-dev} | ecbuild | 3 | {meteorology-dev} | emoslib | 3 | {meteorology-dev} | @@ -134,17 +131,21 @@ Last-Update: Mon, 23 Jun 2025 01:42:04 +0000 clipper | 2 | {nanoscale-physics-dev} | coinor-bonmin | 2 | {mathematics} | cylc-flow | 2 | {meteorology} | - debian-science | 2 | {neuroscience-cognitive} | debian-science | 2 | {economics} | debian-science | 2 | {electrophysiology} | debian-science | 2 | {nanoscale-physics,statistics,economics,physics} | + debian-science | 2 | {neuroscience-cognitive} | dimbl | 2 | {linguistics} | + dune-functions | 2 | {mathematics-dev} | + dune-localfunctions | 2 | {mathematics-dev} | + dune-typetree | 2 | {mathematics-dev} | emoslib | 2 | {meteorology} | fastjet | 2 | {highenergy-physics-dev} | frog | 2 | {linguistics} | gemmlowp | 2 | {mathematics-dev} | harp | 2 | {meteorology} | hpcc | 2 | {numericalcomputation,distributedcomputing} | + ipe-tools | 2 | {typesetting} | libcvd | 2 | {imageanalysis} | libgtkdatabox | 2 | {engineering-dev,viewing-dev} | libmatheval | 2 | {mathematics-dev} | @@ -166,8 +167,8 @@ Last-Update: Mon, 23 Jun 2025 01:42:04 +0000 code-saturne | 1 | {mathematics-dev,engineering-dev} | coinmp | 1 | {logic,mathematics-dev,numericalcomputation} | debian-science | 1 | {tools} | - debian-science | 1 | {neuroscience-cognitive,machine-learning} | debian-science | 1 | {psychophysics} | + debian-science | 1 | {neuroscience-cognitive,machine-learning} | fpzip | 1 | {meteorology-dev} | frogdata | 1 | {linguistics} | gadap | 1 | {meteorology-dev} | @@ -215,8 +216,8 @@ Last-Update: Mon, 23 Jun 2025 01:42:04 +0000 cqrlib | 0 | {mathematics-dev} | cvector | 0 | {mathematics-dev} | debian-science | 0 | {physics} | - debian-science | 0 | {electrophysiology} | debian-science | 0 | {nanoscale-physics-dev} | + debian-science | 0 | {electrophysiology} | dune-grid-glue | 0 | {mathematics-dev} | etsf-io | 0 | {nanoscale-physics-dev} | fastjet | 0 | {highenergy-physics-dev} | @@ -243,8 +244,8 @@ Last-Update: Mon, 23 Jun 2025 01:42:04 +0000 quadrule | 0 | {mathematics-dev} | robot-testing-framework | 0 | {robotics-dev} | ros-collada-urdf | 0 | {robotics} | - ros-metapackages | 0 | {robotics-dev} | ros-metapackages | 0 | {robotics} | + ros-metapackages | 0 | {robotics-dev} | ros-opencv-apps | 0 | {robotics} | sagemath-database-combinatorial-designs | 0 | {mathematics} | sagemath-database-cremona-elliptic-curves | 0 | {mathematics} | @@ -269,5 +270,5 @@ Last-Update: Mon, 23 Jun 2025 01:42:04 +0000 virtuoso-opensource | 0 | {datamanagement} | visp-images | 0 | {robotics-dev} | libelas | -1 | {robotics-dev} | -(297 rows) +(298 rows) ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,128 +1,128 @@ -Last-Update: Mon, 23 Jun 2025 01:42:05 +0000 +Last-Update: Mon, 23 Jun 2025 13:42:11 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- - mpmath | 9857 | - python-repoze.lru | 6965 | - netifaces | 5145 | - ghp-import | 4778 | - python-lunr | 4772 | - python-babel | 3803 | - sortedcontainers | 3468 | - python-babel | 3374 | - aiosignal | 2933 | - hyperlink | 2133 | - humanfriendly | 1989 | - python-notify2 | 1957 | - referencing | 1556 | - python-mysqldb | 1519 | - python-gssapi | 1451 | - python-invoke | 1382 | - python-hyperframe | 1364 | - websocket-client | 1304 | - python-hpack | 1145 | - python-rsa | 1126 | - python-pandocfilters | 1011 | - pdfarranger | 970 | - menulibre | 950 | - python-linux-procfs | 929 | - python-geoip | 861 | - python-webob | 812 | - powerline | 778 | - powerline | 706 | - powerline | 701 | - python-zopfli | 682 | - firmware-microbit-micropython | 669 | - kazam | 654 | - u-msgpack-python | 608 | - python-et-xmlfile | 517 | - dockerpty | 505 | - asn1crypto | 495 | - gaupol | 489 | - python-gevent | 481 | - autopep8 | 474 | - python-ewmh | 454 | - catfish | 430 | + mpmath | 9832 | + python-repoze.lru | 6964 | + netifaces | 5130 | + ghp-import | 4765 | + python-lunr | 4758 | + python-babel | 3776 | + sortedcontainers | 3447 | + python-babel | 3351 | + aiosignal | 2952 | + hyperlink | 2120 | + humanfriendly | 1992 | + python-notify2 | 1962 | + referencing | 1557 | + python-mysqldb | 1521 | + python-gssapi | 1453 | + python-invoke | 1392 | + python-hyperframe | 1370 | + websocket-client | 1301 | + python-hpack | 1151 | + python-rsa | 1124 | + python-pandocfilters | 1004 | + pdfarranger | 973 | + menulibre | 952 | + python-linux-procfs | 931 | + python-geoip | 859 | + python-webob | 815 | + powerline | 783 | + powerline | 714 | + powerline | 709 | + python-zopfli | 691 | + firmware-microbit-micropython | 666 | + kazam | 656 | + u-msgpack-python | 600 | + python-et-xmlfile | 514 | + dockerpty | 501 | + asn1crypto | 489 | + python-gevent | 482 | + gaupol | 477 | + autopep8 | 456 | + python-ewmh | 448 | + catfish | 437 | python-requests-oauthlib | 399 | - pytoolconfig | 386 | - spf-engine | 349 | - python-toml | 337 | - python-ntlm-auth | 303 | - spf-engine | 297 | - django-stronghold | 250 | - python-ldap3 | 241 | - cairocffi | 211 | - python-mimeparse | 191 | - python-smmap | 173 | + pytoolconfig | 369 | + spf-engine | 347 | + python-toml | 335 | + python-ntlm-auth | 304 | + spf-engine | 298 | + django-stronghold | 246 | + python-ldap3 | 242 | + cairocffi | 214 | + python-mimeparse | 192 | + python-smmap | 171 | python-hidapi | 166 | - autokey | 163 | - httpie | 143 | - smem | 138 | - python-anyjson | 137 | - kivy | 134 | + autokey | 164 | + httpie | 145 | + smem | 137 | + python-anyjson | 135 | + kivy | 133 | python-aiostream | 123 | + mypaint | 121 | smartypants | 118 | python-click-repl | 117 | - mypaint | 115 | - lollypop | 104 | - nodeenv | 103 | - timekpr-next | 100 | - mugshot | 99 | + lollypop | 103 | + mugshot | 101 | + nodeenv | 100 | python-consul | 99 | + timekpr-next | 99 | python-pyu2f | 96 | pacparser | 95 | - pymacaroons | 90 | + pymacaroons | 91 | python-rfc6555 | 87 | - pssh | 83 | - pymediainfo | 77 | - python-colour | 72 | - python-i3ipc | 69 | - numpy-stl | 68 | - mitmproxy | 67 | - pywavelets | 66 | + pssh | 81 | + pymediainfo | 78 | + python-colour | 73 | + python-i3ipc | 72 | + numpy-stl | 70 | + mitmproxy | 66 | weasyprint | 66 | + python-pykka | 65 | + pywavelets | 64 | fabric | 63 | - python-pykka | 63 | - itstool | 54 | + itstool | 55 | + ueberzug | 55 | python-looseversion | 54 | - ueberzug | 54 | python-scp | 53 | - python-uritools | 52 | - mysql-connector-python | 50 | - pyenv | 50 | - pymacs | 48 | + pyenv | 51 | + python-uritools | 51 | + mysql-connector-python | 49 | + pymacs | 49 | + khard | 48 | sshtunnel | 48 | - khard | 46 | blockdiag | 45 | - hatchling | 45 | + hatchling | 44 | + kivy | 44 | trac | 44 | - kivy | 43 | + python-pysol-cards | 43 | membernator | 42 | - python-pysol-cards | 41 | certipy | 40 | pamela | 40 | + pyquery | 40 | jupyterhub | 39 | - pyquery | 39 | - pylibmc | 38 | - powerline-gitstatus | 37 | + pylibmc | 39 | + powerline-gitstatus | 38 | + show-in-file-manager | 37 | + pdfposter | 36 | python-scrypt | 36 | - pdfposter | 35 | - show-in-file-manager | 35 | - pssh | 33 | - persepolis | 32 | + pssh | 34 | + persepolis | 33 | python-statsd | 32 | seqdiag | 29 | + dkimpy-milter | 28 | python-args | 28 | sphinxcontrib-blockdiag | 28 | - dkimpy-milter | 27 | sphinxcontrib-seqdiag | 27 | video-downloader | 27 | enzyme | 26 | depthcharge-tools | 25 | - flask-principal | 25 | python-clint | 25 | rst2pdf | 25 | sphinx-inline-tabs | 25 | + flask-principal | 24 | subliminal | 24 | typogrify | 24 | cppman | 23 | @@ -133,98 +133,97 @@ Last-Update: Mon, 23 Jun 2025 01:42:05 +0000 nwdiag | 21 | python-rangehttpserver | 21 | python-zstd | 21 | - backoff | 20 | fabric | 20 | + nwg-displays | 20 | python-sdnotify | 20 | - nwg-displays | 19 | + backoff | 19 | python-pysubs2 | 19 | spf-engine | 19 | alot | 18 | actdiag | 17 | - django-environ | 17 | - mistune0 | 17 | + social-auth-core | 17 | sphinxcontrib-log-cabinet | 17 | webtest | 17 | - flask-security | 16 | - policyd-rate-limit | 16 | + django-environ | 16 | + mistune0 | 16 | + pykwalify | 16 | python-translationstring | 16 | - social-auth-core | 16 | sphinxcontrib-actdiag | 16 | sphinxcontrib-nwdiag | 16 | - pykwalify | 15 | + flask-security | 15 | + policyd-rate-limit | 15 | python-ethtool | 15 | - python-inotify | 15 | python-pyalsa | 15 | - python-slip10 | 15 | todoman | 15 | unearth | 15 | pdm | 14 | + python-inotify | 14 | python-kyotocabinet | 14 | + python-slip10 | 14 | junos-eznc | 13 | python-hupper | 13 | python-pem | 13 | python-priority | 13 | - python-pyscss | 13 | python-simpy | 13 | - python-xtermcolor | 13 | ansi | 12 | + beancount | 12 | jschema-to-python | 12 | + notebook-shim | 12 | python-dbussy | 12 | python-pyrss2gen | 12 | + python-pyscss | 12 | python-sarif-python-om | 12 | - ruff | 12 | - speaklater | 12 | - beancount | 11 | + python-xtermcolor | 12 | flask-paranoid | 11 | gmplot | 11 | - notebook-shim | 11 | pylint-common | 11 | pyp | 11 | python-digitalocean | 11 | python-parse-type | 11 | - slimit | 11 | - tuna | 11 | + ruff | 11 | txt2tags | 11 | autotiling | 10 | btchip-python | 10 | gtextfsm | 10 | python-pyld | 10 | - clustershell | 9 | + slimit | 10 | + speaklater | 10 | + tuna | 10 | debiancontributors | 9 | django-auditlog | 9 | django-sass | 9 | - python-pyaml-env | 9 | + pwntools | 9 | traittypes | 9 | - voltron | 9 | - drf-extensions | 8 | + beancount | 8 | + clustershell | 8 | drf-yasg-nonfree | 8 | + flask-session | 8 | htmlmin | 8 | httpcode | 8 | - pwntools | 8 | python-aiohttp-security | 8 | python-ansicolors | 8 | python-crcelk | 8 | python-drf-spectacular-sidecar-nonfree | 8 | python-numpysane | 8 | python-overpy | 8 | + python-pyaml-env | 8 | python-versioneer | 8 | - sphinx-intl | 8 | - beancount | 7 | + drf-extensions | 7 | flask-api | 7 | - flask-session | 7 | graphql-relay | 7 | - mercurial-evolve | 7 | micropython-mpremote | 7 | pybik | 7 | pycallgraph | 7 | pytaglib | 7 | pytest-django | 7 | + sphinx-intl | 7 | trac-wysiwyg | 7 | - clustershell | 6 | + voltron | 7 | django-model-utils | 6 | drf-haystack | 6 | easyprocess | 6 | librouteros | 6 | + mercurial-evolve | 6 | mypy-protobuf | 6 | pydrive2 | 6 | pytest-runner | 6 | @@ -232,7 +231,7 @@ Last-Update: Mon, 23 Jun 2025 01:42:05 +0000 python-biplist | 6 | python-envs | 6 | python-gnuplotlib | 6 | - ruff | 6 | + clustershell | 5 | django-jinja | 5 | django-paintstore | 5 | django-pglocks | 5 | @@ -244,9 +243,9 @@ Last-Update: Mon, 23 Jun 2025 01:42:05 +0000 python-halo | 5 | python-openstep-plist | 5 | python-simpy | 5 | - python-xdo | 5 | - smem | 5 | + ruff | 5 | sphinxcontrib-globalsubs | 5 | + west | 5 | aiomysql | 4 | bootstrap-flask | 4 | cram | 4 | @@ -265,22 +264,20 @@ Last-Update: Mon, 23 Jun 2025 01:42:05 +0000 python-django-contact-form | 4 | python-django-registration | 4 | python-srp | 4 | + python-xdo | 4 | s3ql | 4 | securestring | 4 | + smem | 4 | sorl-thumbnail | 4 | sphinx-markdown-tables | 4 | - west | 4 | - azote | 3 | cplay-ng | 3 | django-macaddress | 3 | django-pagination | 3 | django-render-block | 3 | django-templated-email | 3 | etm | 3 | - extension-helpers | 3 | flask-mongoengine | 3 | flask-paginate | 3 | - imap-tools | 3 | jpylyzer | 3 | kconfiglib | 3 | logilab-constraint | 3 | @@ -291,6 +288,7 @@ Last-Update: Mon, 23 Jun 2025 01:42:05 +0000 pyclamd | 3 | pyfltk | 3 | pyprind | 3 | + pyroma | 3 | pytest-expect | 3 | python-dbus-next | 3 | python-django-push-notifications | 3 | @@ -306,6 +304,7 @@ Last-Update: Mon, 23 Jun 2025 01:42:05 +0000 trac-xmlrpc | 3 | wikitrans | 3 | yotta | 3 | + azote | 2 | bqplot | 2 | brebis | 2 | django-ajax-selects | 2 | @@ -318,17 +317,19 @@ Last-Update: Mon, 23 Jun 2025 01:42:05 +0000 django-maintenance-mode | 2 | django-yarnpkg | 2 | dotdrop | 2 | + extension-helpers | 2 | flake8-black | 2 | + fypp | 2 | gtkman | 2 | hatch-jupyter-builder | 2 | humanfriendly | 2 | + imap-tools | 2 | jsonrpclib-pelix | 2 | namecheap | 2 | panoramisk | 2 | pykwalify | 2 | pylint-celery | 2 | pypass | 2 | - pyroma | 2 | python-bitbucket-api | 2 | python-btrees | 2 | python-chartkick | 2 | @@ -365,7 +366,6 @@ Last-Update: Mon, 23 Jun 2025 01:42:05 +0000 codicefiscale | 1 | errbot | 1 | flask-multistatic | 1 | - fypp | 1 | jupyter-sphinx | 1 | korean-lunar-calendar | 1 | milksnake | 1 | @@ -403,8 +403,8 @@ Last-Update: Mon, 23 Jun 2025 01:42:05 +0000 sphinx-autorun | 1 | sphinxcontrib-github-alt | 1 | sphinx-sitemap | 1 | - trac-customfieldadmin | 1 | trac-httpauth | 1 | + trac-subcomponents | 1 | vncdotool | 1 | vrfydmn | 1 | wchartype | 1 | @@ -562,8 +562,8 @@ Last-Update: Mon, 23 Jun 2025 01:42:05 +0000 symmetrize | 0 | testrepository | 0 | thumbor-plugins-gifv | 0 | + trac-customfieldadmin | 0 | trac-roadmap | 0 | - trac-subcomponents | 0 | trac-wikiprint | 0 | turbosearch | 0 | webpy | 0 | @@ -589,6 +589,7 @@ Last-Update: Mon, 23 Jun 2025 01:42:05 +0000 s3ql | -1 | sphinxcontrib-emojicodes | -1 | symmetrize | -1 | + thumbor | -1 | trac-tickettemplate | -1 | -(603 rows) +(604 rows) View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/91dd0f5ebec3d360f51eb95a72dd405d6d733776 -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/91dd0f5ebec3d360f51eb95a72dd405d6d733776 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Tue Jun 24 02:43:34 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Tue, 24 Jun 2025 01:43:34 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <685a02c65337b_3db1d5164f05082156@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: 9468be84 by Andreas Tille at 2025-06-24T01:43:30+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Mon, 23 Jun 2025 13:42:04 +0000 +Last-Update: Tue, 24 Jun 2025 01:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- ===================================== debian-science-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Mon, 23 Jun 2025 13:42:08 +0000 +Last-Update: Tue, 24 Jun 2025 01:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Mon, 23 Jun 2025 13:42:11 +0000 +Last-Update: Tue, 24 Jun 2025 01:42:04 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/9468be84c00f81aa1e84d8791edc0971538a6694 -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/9468be84c00f81aa1e84d8791edc0971538a6694 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Tue Jun 24 14:43:29 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Tue, 24 Jun 2025 13:43:29 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <685aab81debb2_3db1f88302851574f6@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: a111f1dd by Andreas Tille at 2025-06-24T13:43:23+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,24 +1,24 @@ -Last-Update: Tue, 24 Jun 2025 01:42:04 +0000 +Last-Update: Tue, 24 Jun 2025 13:42:03 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- - dicomscope | 28 | {imaging} | + dicomscope | 27 | {imaging} | oscar | 18 | {data,tools,practice} | orthanc-gdcm | 17 | {imaging} | - mrtrix3 | 14 | {imaging} | + mrtrix3 | 15 | {imaging} | + pixelmed | 12 | {imaging} | gnumed-server | 11 | {covid-19,practice} | - pixelmed | 11 | {imaging} | + adun.app | 10 | {bio} | king | 10 | {typesetting,imaging} | orthanc-mysql | 10 | {imaging} | - sight | 10 | {imaging} | - adun.app | 9 | {bio} | bart-view | 9 | {imaging} | + libminc | 9 | {imaging-dev} | orthanc-postgresql | 9 | {imaging} | + sight | 9 | {imaging} | icb-utils | 8 | {bio-dev} | - libminc | 8 | {imaging-dev} | - heudiconv | 6 | {imaging} | + heudiconv | 7 | {imaging} | + mia | 6 | {imaging} | jebl2 | 5 | {bio-dev} | - mia | 5 | {imaging} | biojava-live | 4 | {bio-dev} | insighttoolkit5 | 4 | {imaging-dev} | sight | 4 | {imaging} | ===================================== debian-science-tests.txt ===================================== @@ -1,46 +1,47 @@ -Last-Update: Tue, 24 Jun 2025 01:42:04 +0000 +Last-Update: Tue, 24 Jun 2025 13:42:08 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- - nltk | 4819 | {linguistics} | - gts | 4646 | {viewing} | - opencascade | 607 | {simulations} | - spacenavd | 225 | {tools} | - armadillo | 181 | {mathematics-dev} | - open-coarrays | 169 | {meteorology-dev} | - arpack | 83 | {mathematics-dev} | - scalapack | 49 | {nanoscale-physics-dev} | - visidata | 42 | {datamanagement} | - ntl | 41 | {mathematics-dev} | - imview | 37 | {viewing} | + nltk | 4811 | {linguistics} | + gts | 4701 | {viewing} | + opencascade | 606 | {simulations} | + spacenavd | 226 | {tools} | + armadillo | 180 | {mathematics-dev} | + open-coarrays | 171 | {meteorology-dev} | + arpack | 82 | {mathematics-dev} | + scalapack | 50 | {nanoscale-physics-dev} | + visidata | 43 | {datamanagement} | + ntl | 40 | {mathematics-dev} | + imview | 38 | {viewing} | mbpoll | 36 | {simulations} | ppl | 31 | {numericalcomputation} | flintqs | 29 | {mathematics} | - libmatio | 26 | {mathematics-dev} | - cliquer | 25 | {mathematics} | - libm4ri | 25 | {mathematics-dev} | + libmatio | 27 | {mathematics-dev} | arduino-mk | 24 | {robotics} | - flann | 24 | {mathematics-dev,engineering-dev} | + cliquer | 24 | {mathematics} | + libm4ri | 24 | {mathematics-dev} | + flann | 23 | {mathematics-dev,engineering-dev} | xygrib | 22 | {meteorology} | + setzer | 20 | {typesetting} | bossa | 19 | {devices} | + grads | 19 | {meteorology} | picosat | 19 | {logic} | sat4j | 19 | {logic} | - setzer | 19 | {typesetting} | fftw | 18 | {mathematics-dev,physics-dev,meteorology-dev} | - grads | 18 | {meteorology} | guiqwt | 18 | {numericalcomputation,viewing} | - lrcalc | 17 | {mathematics-dev} | - pyzo | 16 | {numericalcomputation} | + lrcalc | 16 | {mathematics-dev} | sketch | 16 | {typesetting} | eccodes | 15 | {meteorology,meteorology-dev} | gts | 15 | {viewing-dev} | ncl | 15 | {meteorology} | - cliquer | 14 | {mathematics-dev} | - dune-uggrid | 13 | {mathematics-dev} | + pyzo | 15 | {numericalcomputation} | + cliquer | 13 | {mathematics-dev} | feff85exafs | 13 | {chemistry} | libitpp | 13 | {mathematics-dev,engineering-dev} | + teem | 13 | {imageanalysis} | + dune-uggrid | 12 | {mathematics-dev} | gf2x | 12 | {mathematics-dev} | - teem | 12 | {imageanalysis} | + matlab-support | 12 | {mathematics,numericalcomputation} | coinor-symphony | 11 | {logic,mathematics,numericalcomputation} | iml | 11 | {mathematics-dev} | libhomfly | 11 | {mathematics-dev} | @@ -49,22 +50,20 @@ Last-Update: Tue, 24 Jun 2025 01:42:04 +0000 feedgnuplot | 10 | {viewing} | form | 10 | {mathematics} | libm4rie | 10 | {mathematics-dev} | - matlab-support | 10 | {mathematics,numericalcomputation} | ncl | 10 | {meteorology-dev} | pcl | 10 | {robotics-dev} | python-escript | 10 | {numericalcomputation,simulations,engineering} | geg | 9 | {viewing} | - python-cdo | 9 | {meteorology} | + alberta | 8 | {engineering-dev} | + python-cdo | 8 | {meteorology} | ratpoints | 8 | {mathematics-dev} | vdt | 8 | {mathematics-dev} | - alberta | 7 | {engineering-dev} | apophenia | 7 | {statistics} | libccp4 | 7 | {nanoscale-physics-dev} | libzn-poly | 7 | {mathematics-dev} | opencascade | 7 | {simulations} | psurface | 7 | {numericalcomputation} | refmac-dictionary | 7 | {highenergy-physics-dev,chemistry} | - ros-rosconsole | 7 | {robotics-dev} | uctodata | 7 | {linguistics} | cld2 | 6 | {linguistics} | dxsamples | 6 | {nanoscale-physics} | @@ -75,14 +74,14 @@ Last-Update: Tue, 24 Jun 2025 01:42:04 +0000 odc | 6 | {meteorology} | odc | 6 | {meteorology-dev} | persalys | 6 | {engineering,statistics,mathematics} | - ros-vcstool | 6 | {robotics-dev} | + ros-rosconsole | 6 | {robotics-dev} | + toulbar2 | 6 | {logic,numericalcomputation,mathematics,physics} | fpzip | 5 | {meteorology} | newmat | 5 | {mathematics-dev} | persalys | 5 | {statistics,mathematics,engineering} | rheolef | 5 | {mathematics} | rubiks | 5 | {geometry,mathematics} | toontag | 5 | {numericalcomputation} | - toulbar2 | 5 | {logic,numericalcomputation,mathematics,physics} | ucto | 5 | {linguistics} | urdfdom-headers | 5 | {robotics-dev} | veccore | 5 | {mathematics-dev} | @@ -90,11 +89,12 @@ Last-Update: Tue, 24 Jun 2025 01:42:04 +0000 auto-07p | 4 | {mathematics} | coda | 4 | {meteorology-dev} | coda | 4 | {meteorology} | - debian-science | 4 | {physics,machine-learning,economics,nanoscale-physics} | debian-science | 4 | {economics,nanoscale-physics,machine-learning,physics,mathematics} | + debian-science | 4 | {physics,machine-learning,economics,nanoscale-physics} | getdp | 4 | {engineering,mathematics,simulations} | gsw | 4 | {meteorology} | iapws | 4 | {meteorology} | + ros-vcstool | 4 | {robotics-dev} | sdpb | 4 | {numericalcomputation,highenergy-physics} | silo-llnl | 4 | {engineering} | toon | 4 | {numericalcomputation} | @@ -104,6 +104,7 @@ Last-Update: Tue, 24 Jun 2025 01:42:04 +0000 dxflib | 3 | {engineering-dev} | ecbuild | 3 | {meteorology-dev} | emoslib | 3 | {meteorology-dev} | + harp | 3 | {meteorology} | hdf-eos5 | 3 | {meteorology-dev} | ipe-tools | 3 | {typesetting} | irstlm | 3 | {linguistics} | @@ -121,6 +122,7 @@ Last-Update: Tue, 24 Jun 2025 01:42:04 +0000 sac2mseed | 3 | {geography} | sagemath-database-conway-polynomials | 3 | {mathematics} | sardana | 3 | {dataacquisition} | + scram | 3 | {engineering} | silo-llnl | 3 | {engineering} | spaghetti | 3 | {geography} | syrthes | 3 | {engineering} | @@ -131,10 +133,10 @@ Last-Update: Tue, 24 Jun 2025 01:42:04 +0000 clipper | 2 | {nanoscale-physics-dev} | coinor-bonmin | 2 | {mathematics} | cylc-flow | 2 | {meteorology} | + debian-science | 2 | {neuroscience-cognitive} | debian-science | 2 | {economics} | debian-science | 2 | {electrophysiology} | debian-science | 2 | {nanoscale-physics,statistics,economics,physics} | - debian-science | 2 | {neuroscience-cognitive} | dimbl | 2 | {linguistics} | dune-functions | 2 | {mathematics-dev} | dune-localfunctions | 2 | {mathematics-dev} | @@ -143,7 +145,6 @@ Last-Update: Tue, 24 Jun 2025 01:42:04 +0000 fastjet | 2 | {highenergy-physics-dev} | frog | 2 | {linguistics} | gemmlowp | 2 | {mathematics-dev} | - harp | 2 | {meteorology} | hpcc | 2 | {numericalcomputation,distributedcomputing} | ipe-tools | 2 | {typesetting} | libcvd | 2 | {imageanalysis} | @@ -157,14 +158,13 @@ Last-Update: Tue, 24 Jun 2025 01:42:04 +0000 polylib | 2 | {mathematics} | qd | 2 | {mathematics-dev} | qwtplot3d | 2 | {viewing-dev} | - scram | 2 | {engineering} | silo-llnl | 2 | {engineering-dev} | x13as | 2 | {economics} | asl | 1 | {physics-dev} | ckon | 1 | {highenergy-physics-dev} | coda | 1 | {meteorology-dev} | - code-saturne | 1 | {engineering-dev,mathematics-dev} | code-saturne | 1 | {mathematics-dev,engineering-dev} | + code-saturne | 1 | {engineering-dev,mathematics-dev} | coinmp | 1 | {logic,mathematics-dev,numericalcomputation} | debian-science | 1 | {tools} | debian-science | 1 | {psychophysics} | @@ -215,8 +215,8 @@ Last-Update: Tue, 24 Jun 2025 01:42:04 +0000 collada-dom | 0 | {viewing-dev} | cqrlib | 0 | {mathematics-dev} | cvector | 0 | {mathematics-dev} | - debian-science | 0 | {physics} | debian-science | 0 | {nanoscale-physics-dev} | + debian-science | 0 | {physics} | debian-science | 0 | {electrophysiology} | dune-grid-glue | 0 | {mathematics-dev} | etsf-io | 0 | {nanoscale-physics-dev} | @@ -226,8 +226,8 @@ Last-Update: Tue, 24 Jun 2025 01:42:04 +0000 libfolia | 0 | {linguistics} | libquantum | 0 | {numericalcomputation} | libsdsl | 0 | {dataacquisition-dev} | - looptools | 0 | {highenergy-physics-dev} | looptools | 0 | {highenergy-physics} | + looptools | 0 | {highenergy-physics-dev} | magma | 0 | {mathematics-dev,numericalcomputation} | mbt | 0 | {linguistics} | mctc-lib | 0 | {nanoscale-physics-dev,highenergy-physics-dev} | @@ -244,8 +244,8 @@ Last-Update: Tue, 24 Jun 2025 01:42:04 +0000 quadrule | 0 | {mathematics-dev} | robot-testing-framework | 0 | {robotics-dev} | ros-collada-urdf | 0 | {robotics} | - ros-metapackages | 0 | {robotics} | ros-metapackages | 0 | {robotics-dev} | + ros-metapackages | 0 | {robotics} | ros-opencv-apps | 0 | {robotics} | sagemath-database-combinatorial-designs | 0 | {mathematics} | sagemath-database-cremona-elliptic-curves | 0 | {mathematics} | ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,222 +1,223 @@ -Last-Update: Tue, 24 Jun 2025 01:42:04 +0000 +Last-Update: Tue, 24 Jun 2025 13:42:11 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- - mpmath | 9832 | - python-repoze.lru | 6964 | - netifaces | 5130 | - ghp-import | 4765 | - python-lunr | 4758 | - python-babel | 3776 | - sortedcontainers | 3447 | - python-babel | 3351 | - aiosignal | 2952 | - hyperlink | 2120 | - humanfriendly | 1992 | - python-notify2 | 1962 | - referencing | 1557 | - python-mysqldb | 1521 | - python-gssapi | 1453 | - python-invoke | 1392 | - python-hyperframe | 1370 | - websocket-client | 1301 | - python-hpack | 1151 | + mpmath | 9891 | + python-repoze.lru | 6979 | + netifaces | 5146 | + ghp-import | 4754 | + python-lunr | 4746 | + python-babel | 3808 | + sortedcontainers | 3449 | + python-babel | 3396 | + aiosignal | 2973 | + hyperlink | 2134 | + humanfriendly | 1989 | + python-notify2 | 1980 | + referencing | 1555 | + python-mysqldb | 1524 | + python-gssapi | 1455 | + python-invoke | 1406 | + python-hyperframe | 1389 | + websocket-client | 1306 | + python-hpack | 1172 | python-rsa | 1124 | - python-pandocfilters | 1004 | - pdfarranger | 973 | - menulibre | 952 | + python-pandocfilters | 1031 | + pdfarranger | 969 | + menulibre | 962 | python-linux-procfs | 931 | - python-geoip | 859 | - python-webob | 815 | - powerline | 783 | - powerline | 714 | - powerline | 709 | - python-zopfli | 691 | - firmware-microbit-micropython | 666 | - kazam | 656 | - u-msgpack-python | 600 | - python-et-xmlfile | 514 | + python-geoip | 856 | + python-webob | 821 | + powerline | 757 | + powerline | 707 | + python-zopfli | 707 | + powerline | 702 | + kazam | 657 | + firmware-microbit-micropython | 645 | + u-msgpack-python | 596 | + python-et-xmlfile | 517 | dockerpty | 501 | - asn1crypto | 489 | - python-gevent | 482 | - gaupol | 477 | - autopep8 | 456 | - python-ewmh | 448 | + asn1crypto | 498 | + python-gevent | 487 | + gaupol | 483 | + autopep8 | 465 | + python-ewmh | 453 | catfish | 437 | python-requests-oauthlib | 399 | - pytoolconfig | 369 | - spf-engine | 347 | - python-toml | 335 | - python-ntlm-auth | 304 | - spf-engine | 298 | - django-stronghold | 246 | - python-ldap3 | 242 | - cairocffi | 214 | - python-mimeparse | 192 | - python-smmap | 171 | - python-hidapi | 166 | - autokey | 164 | - httpie | 145 | - smem | 137 | - python-anyjson | 135 | + pytoolconfig | 382 | + spf-engine | 346 | + python-toml | 340 | + python-ntlm-auth | 303 | + spf-engine | 295 | + django-stronghold | 250 | + python-ldap3 | 250 | + cairocffi | 216 | + python-mimeparse | 193 | + python-smmap | 172 | + python-hidapi | 170 | + autokey | 162 | + httpie | 148 | + smem | 136 | + python-anyjson | 134 | kivy | 133 | - python-aiostream | 123 | - mypaint | 121 | - smartypants | 118 | - python-click-repl | 117 | - lollypop | 103 | - mugshot | 101 | - nodeenv | 100 | - python-consul | 99 | + python-aiostream | 125 | + mypaint | 123 | + smartypants | 121 | + python-click-repl | 118 | + lollypop | 102 | + mugshot | 102 | + nodeenv | 102 | + python-consul | 102 | timekpr-next | 99 | - python-pyu2f | 96 | pacparser | 95 | + python-pyu2f | 95 | pymacaroons | 91 | - python-rfc6555 | 87 | + python-rfc6555 | 88 | pssh | 81 | - pymediainfo | 78 | - python-colour | 73 | - python-i3ipc | 72 | - numpy-stl | 70 | - mitmproxy | 66 | - weasyprint | 66 | + pymediainfo | 80 | + python-colour | 75 | + numpy-stl | 73 | + python-i3ipc | 71 | + fabric | 66 | + mitmproxy | 65 | python-pykka | 65 | + weasyprint | 65 | pywavelets | 64 | - fabric | 63 | - itstool | 55 | - ueberzug | 55 | + itstool | 59 | python-looseversion | 54 | + ueberzug | 54 | + pyenv | 53 | python-scp | 53 | - pyenv | 51 | - python-uritools | 51 | - mysql-connector-python | 49 | - pymacs | 49 | - khard | 48 | + python-uritools | 53 | + mysql-connector-python | 50 | sshtunnel | 48 | - blockdiag | 45 | - hatchling | 44 | + blockdiag | 47 | + khard | 47 | + pymacs | 47 | kivy | 44 | + membernator | 44 | trac | 44 | + hatchling | 43 | python-pysol-cards | 43 | - membernator | 42 | + pyquery | 41 | certipy | 40 | pamela | 40 | - pyquery | 40 | + pylibmc | 40 | jupyterhub | 39 | - pylibmc | 39 | - powerline-gitstatus | 38 | - show-in-file-manager | 37 | + show-in-file-manager | 38 | + powerline-gitstatus | 37 | pdfposter | 36 | python-scrypt | 36 | pssh | 34 | persepolis | 33 | python-statsd | 32 | seqdiag | 29 | + sphinxcontrib-blockdiag | 29 | dkimpy-milter | 28 | - python-args | 28 | - sphinxcontrib-blockdiag | 28 | + python-args | 27 | sphinxcontrib-seqdiag | 27 | video-downloader | 27 | - enzyme | 26 | - depthcharge-tools | 25 | - python-clint | 25 | + enzyme | 25 | rst2pdf | 25 | sphinx-inline-tabs | 25 | - flask-principal | 24 | - subliminal | 24 | + depthcharge-tools | 24 | + python-clint | 24 | typogrify | 24 | cppman | 23 | + flask-principal | 23 | + python-rangehttpserver | 23 | + subliminal | 23 | webpy | 23 | + nwdiag | 22 | python-demjson | 22 | - python-fire | 22 | - subliminal | 22 | - nwdiag | 21 | - python-rangehttpserver | 21 | - python-zstd | 21 | - fabric | 20 | - nwg-displays | 20 | + fabric | 21 | + python-fire | 21 | + subliminal | 21 | + python-pysubs2 | 20 | python-sdnotify | 20 | - backoff | 19 | - python-pysubs2 | 19 | + python-zstd | 20 | spf-engine | 19 | alot | 18 | + backoff | 18 | + nwg-displays | 18 | + sphinxcontrib-log-cabinet | 18 | + webtest | 18 | actdiag | 17 | - social-auth-core | 17 | - sphinxcontrib-log-cabinet | 17 | - webtest | 17 | + mistune0 | 17 | + pykwalify | 17 | django-environ | 16 | - mistune0 | 16 | - pykwalify | 16 | - python-translationstring | 16 | sphinxcontrib-actdiag | 16 | sphinxcontrib-nwdiag | 16 | flask-security | 15 | policyd-rate-limit | 15 | python-ethtool | 15 | python-pyalsa | 15 | + social-auth-core | 15 | todoman | 15 | - unearth | 15 | - pdm | 14 | python-inotify | 14 | - python-kyotocabinet | 14 | python-slip10 | 14 | + python-translationstring | 14 | + unearth | 14 | junos-eznc | 13 | - python-hupper | 13 | + pdm | 13 | python-pem | 13 | - python-priority | 13 | python-simpy | 13 | ansi | 12 | beancount | 12 | jschema-to-python | 12 | notebook-shim | 12 | python-dbussy | 12 | + python-kyotocabinet | 12 | + python-parse-type | 12 | + python-priority | 12 | python-pyrss2gen | 12 | python-pyscss | 12 | python-sarif-python-om | 12 | python-xtermcolor | 12 | flask-paranoid | 11 | - gmplot | 11 | pylint-common | 11 | pyp | 11 | python-digitalocean | 11 | - python-parse-type | 11 | + python-hupper | 11 | ruff | 11 | txt2tags | 11 | autotiling | 10 | btchip-python | 10 | - gtextfsm | 10 | + gmplot | 10 | python-pyld | 10 | slimit | 10 | speaklater | 10 | + traittypes | 10 | tuna | 10 | debiancontributors | 9 | - django-auditlog | 9 | - django-sass | 9 | + gtextfsm | 9 | pwntools | 9 | - traittypes | 9 | beancount | 8 | clustershell | 8 | - drf-yasg-nonfree | 8 | + django-auditlog | 8 | + django-sass | 8 | + drf-extensions | 8 | flask-session | 8 | htmlmin | 8 | httpcode | 8 | - python-aiohttp-security | 8 | + micropython-mpremote | 8 | python-ansicolors | 8 | - python-crcelk | 8 | - python-drf-spectacular-sidecar-nonfree | 8 | python-numpysane | 8 | - python-overpy | 8 | python-pyaml-env | 8 | python-versioneer | 8 | - drf-extensions | 7 | + sphinx-intl | 8 | + drf-yasg-nonfree | 7 | flask-api | 7 | graphql-relay | 7 | - micropython-mpremote | 7 | pybik | 7 | pycallgraph | 7 | pytaglib | 7 | pytest-django | 7 | - sphinx-intl | 7 | + pytest-runner | 7 | + python-aiohttp-security | 7 | + python-crcelk | 7 | + python-drf-spectacular-sidecar-nonfree | 7 | + python-overpy | 7 | trac-wysiwyg | 7 | voltron | 7 | django-model-utils | 6 | @@ -226,11 +227,11 @@ Last-Update: Tue, 24 Jun 2025 01:42:04 +0000 mercurial-evolve | 6 | mypy-protobuf | 6 | pydrive2 | 6 | - pytest-runner | 6 | python3-onelogin-saml2 | 6 | python-biplist | 6 | - python-envs | 6 | python-gnuplotlib | 6 | + python-halo | 6 | + west | 6 | clustershell | 5 | django-jinja | 5 | django-paintstore | 5 | @@ -240,12 +241,11 @@ Last-Update: Tue, 24 Jun 2025 01:42:04 +0000 numpy-stl | 5 | pyjokes | 5 | pynliner | 5 | - python-halo | 5 | + python-envs | 5 | python-openstep-plist | 5 | python-simpy | 5 | ruff | 5 | sphinxcontrib-globalsubs | 5 | - west | 5 | aiomysql | 4 | bootstrap-flask | 4 | cram | 4 | @@ -256,13 +256,14 @@ Last-Update: Tue, 24 Jun 2025 01:42:04 +0000 django-xmlrpc | 4 | flask-flatpages | 4 | flufl.testing | 4 | - mbed-test-wrapper | 4 | + pyfltk | 4 | pyjunitxml | 4 | python-cookies | 4 | python-dirq | 4 | python-django-casclient | 4 | python-django-contact-form | 4 | python-django-registration | 4 | + python-networkmanager | 4 | python-srp | 4 | python-xdo | 4 | s3ql | 4 | @@ -281,12 +282,11 @@ Last-Update: Tue, 24 Jun 2025 01:42:04 +0000 jpylyzer | 3 | kconfiglib | 3 | logilab-constraint | 3 | + mbed-test-wrapper | 3 | okasha | 3 | omgifol | 3 | orsopy | 3 | proglog | 3 | - pyclamd | 3 | - pyfltk | 3 | pyprind | 3 | pyroma | 3 | pytest-expect | 3 | @@ -296,14 +296,14 @@ Last-Update: Tue, 24 Jun 2025 01:42:04 +0000 python-ipfix | 3 | python-jpype | 3 | python-markuppy | 3 | - python-networkmanager | 3 | + python-webdavclient | 3 | requests-aws | 3 | slimit | 3 | soundcraft-utils | 3 | + testrepository | 3 | trac-accountmanager | 3 | trac-xmlrpc | 3 | wikitrans | 3 | - yotta | 3 | azote | 2 | bqplot | 2 | brebis | 2 | @@ -325,8 +325,10 @@ Last-Update: Tue, 24 Jun 2025 01:42:04 +0000 humanfriendly | 2 | imap-tools | 2 | jsonrpclib-pelix | 2 | + myst-nb | 2 | namecheap | 2 | panoramisk | 2 | + pyclamd | 2 | pykwalify | 2 | pylint-celery | 2 | pypass | 2 | @@ -351,14 +353,13 @@ Last-Update: Tue, 24 Jun 2025 01:42:04 +0000 python-securesystemslib | 2 | python-text-unidecode | 2 | python-urlobject | 2 | - python-webdavclient | 2 | redis-py-cluster | 2 | sphinx-paramlinks | 2 | sphinxtesters | 2 | - testrepository | 2 | utidylib | 2 | vcversioner | 2 | vf1 | 2 | + yotta | 2 | zabbix-cli | 2 | apkinspector | 1 | backupchecker | 1 | @@ -371,7 +372,6 @@ Last-Update: Tue, 24 Jun 2025 01:42:04 +0000 milksnake | 1 | mkdocs-macros-plugin | 1 | moviepy | 1 | - myst-nb | 1 | onetimepass | 1 | power | 1 | pynag | 1 | @@ -405,7 +405,6 @@ Last-Update: Tue, 24 Jun 2025 01:42:04 +0000 sphinx-sitemap | 1 | trac-httpauth | 1 | trac-subcomponents | 1 | - vncdotool | 1 | vrfydmn | 1 | wchartype | 1 | wikitrans | 1 | @@ -566,6 +565,7 @@ Last-Update: Tue, 24 Jun 2025 01:42:04 +0000 trac-roadmap | 0 | trac-wikiprint | 0 | turbosearch | 0 | + vncdotool | 0 | webpy | 0 | webtest | 0 | yotta | 0 | @@ -587,9 +587,8 @@ Last-Update: Tue, 24 Jun 2025 01:42:04 +0000 python-rova | -1 | pyyardian | -1 | s3ql | -1 | - sphinxcontrib-emojicodes | -1 | symmetrize | -1 | thumbor | -1 | trac-tickettemplate | -1 | -(604 rows) +(603 rows) View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/a111f1ddbbede0b54eab8d7a02c879cbbf9ae2fc -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/a111f1ddbbede0b54eab8d7a02c879cbbf9ae2fc You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Tue Jun 24 20:11:57 2025 From: gitlab at salsa.debian.org (Stephan Lachnit (@stephanlachnit)) Date: Tue, 24 Jun 2025 19:11:57 +0000 Subject: [med-svn] [Git][med-team/libatomic-queue] Pushed new tag debian/1.6.9-1 Message-ID: <685af87dc1378_3db209eb8245198022@godard.mail> Stephan Lachnit pushed new tag debian/1.6.9-1 at Debian Med / libatomic-queue -- View it on GitLab: https://salsa.debian.org/med-team/libatomic-queue/-/tree/debian/1.6.9-1 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Tue Jun 24 20:11:59 2025 From: gitlab at salsa.debian.org (Stephan Lachnit (@stephanlachnit)) Date: Tue, 24 Jun 2025 19:11:59 +0000 Subject: [med-svn] [Git][med-team/libatomic-queue] Pushed new tag upstream/1.6.9 Message-ID: <685af87fe8be1_3db179562a051983be@godard.mail> Stephan Lachnit pushed new tag upstream/1.6.9 at Debian Med / libatomic-queue -- View it on GitLab: https://salsa.debian.org/med-team/libatomic-queue/-/tree/upstream/1.6.9 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Tue Jun 24 20:12:16 2025 From: gitlab at salsa.debian.org (Stephan Lachnit (@stephanlachnit)) Date: Tue, 24 Jun 2025 19:12:16 +0000 Subject: [med-svn] [Git][med-team/libatomic-queue][master] 3 commits: New upstream version 1.6.9 Message-ID: <685af88ff4239_3db1ee8d2805198663@godard.mail> Stephan Lachnit pushed to branch master at Debian Med / libatomic-queue Commits: f2b7705e by Stephan Lachnit at 2025-06-24T20:31:38+02:00 New upstream version 1.6.9 - - - - - 889d3f8a by Stephan Lachnit at 2025-06-24T20:31:38+02:00 Update upstream source from tag 'upstream/1.6.9' Update to upstream version '1.6.9' with Debian dir 2b8f75ee73d9c0a66b86b1aaffe24a563130dbd0 - - - - - ad2de3d8 by Stephan Lachnit at 2025-06-24T21:11:09+02:00 Update to 1.6.9 and build using meson - - - - - 24 changed files: - + .github/workflows/ci-meson.yml - .github/workflows/ci.yml - CONTRIBUTORS.txt - Makefile - README.md - debian/changelog - debian/control - ? debian/libatomic-queue0.symbols - ? debian/patches/compiler.patch - ? debian/patches/concurrentqueue.patch - ? debian/patches/fix_unused_variable.patch - ? debian/patches/generate-shared-library.patch - ? debian/patches/no-native - ? debian/patches/no_thin_archives.patch - ? debian/patches/series - debian/rules - debian/salsa-ci.yml - debian/tests/control - debian/tests/run-unit-test - include/atomic_queue/atomic_queue.h - include/atomic_queue/defs.h - meson.build - meson_options.txt - src/tests.cc Changes: ===================================== .github/workflows/ci-meson.yml ===================================== @@ -0,0 +1,34 @@ +name: Meson Continuous Integrations + +on: + push: + branches: [ master ] + pull_request: + branches: [ master ] + +jobs: + build-and-test: + strategy: + fail-fast: false + matrix: + cpp_compiler: [g++, clang++] + sanitize: [address ,undefined, thread] + + runs-on: ubuntu-latest + + steps: + - uses: actions/checkout at v4 + + - name: Install Meson and Boost.Test + run: sudo apt-get --quiet --yes install meson libboost-test-dev + + - name: Setup + env: + CXX: ${{ matrix.cpp_compiler }} + run: meson setup build -Dwerror=true -Dwarning_level=3 -Db_sanitize=${{ matrix.sanitize }} + + - name: Compile + run: meson compile -C build + + - name: Test + run: meson test -C build --print-errorlogs ===================================== .github/workflows/ci.yml ===================================== @@ -11,11 +11,7 @@ jobs: strategy: matrix: toolset: [gcc, clang] - os: [ubuntu-20.04, ubuntu-22.04, ubuntu-24.04] - include: - - sanitize: 1 - - os: ubuntu-20.04 # Work-around for https://bugs.launchpad.net/ubuntu/+source/gcc-10/+bug/2029910 - sanitize: 0 + os: [ubuntu-22.04, ubuntu-24.04] runs-on: ${{ matrix.os }} ===================================== CONTRIBUTORS.txt ===================================== @@ -18,3 +18,10 @@ Contributors: - Yvan (https://github.com/max0x7ba/atomic_queue/pull/63) - Luiz Feldmann (https://github.com/max0x7ba/atomic_queue/pull/72) - dummyunit (https://github.com/max0x7ba/atomic_queue/pull/73) +- NakanoMiku (https://github.com/max0x7ba/atomic_queue/pull/74) +- Stephan Lachnit (https://github.com/max0x7ba/atomic_queue/pull/77) +- Stephan Lachnit (https://github.com/max0x7ba/atomic_queue/pull/78) +- Stephan Lachnit (https://github.com/max0x7ba/atomic_queue/pull/79) +- Stephan Lachnit (https://github.com/max0x7ba/atomic_queue/pull/80) +- Stephan Lachnit (https://github.com/max0x7ba/atomic_queue/pull/81) +- Stephan Lachnit (https://github.com/max0x7ba/atomic_queue/pull/82) ===================================== Makefile ===================================== @@ -38,23 +38,24 @@ AR := ${ar.${TOOLSET}} cxxflags.gcc.debug := -Og -fstack-protector-all -fno-omit-frame-pointer # -D_GLIBCXX_DEBUG cxxflags.gcc.release := -O3 -mtune=native -ffast-math -falign-{functions,loops}=64 -DNDEBUG cxxflags.gcc.sanitize := ${cxxflags.gcc.release} -fsanitize=thread -cxxflags.gcc := -pthread -march=native -std=gnu++14 -W{all,extra,error,no-{maybe-uninitialized,unused-variable,unused-function,unused-local-typedefs,error=array-bounds}} -g -fmessage-length=0 ${cxxflags.gcc.${BUILD}} +cxxflags.gcc := -std=gnu++14 -pthread -march=native -W{all,extra,error,no-{array-bounds,maybe-uninitialized,unused-variable,unused-function,unused-local-typedefs}} -fmessage-length=0 ${cxxflags.gcc.${BUILD}} ldflags.gcc.sanitize := ${ldflags.gcc.release} -fsanitize=thread ldflags.gcc := ${ldflags.gcc.${BUILD}} -cflags.gcc := -pthread -march=native -W{all,extra} -g -fmessage-length=0 ${cxxflags.gcc.${BUILD}} +cflags.gcc := -pthread -march=native -W{all,extra} -fmessage-length=0 ${cxxflags.gcc.${BUILD}} cxxflags.clang.debug := -O0 -fstack-protector-all cxxflags.clang.release := -O3 -mtune=native -ffast-math -falign-functions=64 -DNDEBUG cxxflags.clang.sanitize := ${cxxflags.clang.release} -fsanitize=thread -cxxflags.clang := -stdlib=libstdc++ -pthread -march=native -std=gnu++14 -W{all,extra,error,no-{unused-variable,unused-function,unused-local-typedefs}} -g -fmessage-length=0 ${cxxflags.clang.${BUILD}} +cxxflags.clang := -std=gnu++14 -pthread -march=native -stdlib=libstdc++ -W{all,extra,error,no-{unused-variable,unused-function,unused-local-typedefs}} -fmessage-length=0 ${cxxflags.clang.${BUILD}} ldflags.clang.sanitize := ${ldflags.clang.release} -fsanitize=thread +ldflags.clang.debug := -latomic ldflags.clang := -stdlib=libstdc++ ${ldflags.clang.${BUILD}} # Additional CPPFLAGS, CXXFLAGS, CFLAGS, LDLIBS, LDFLAGS can come from the command line, e.g. make CPPFLAGS='-I', or from environment variables. -cxxflags := ${cxxflags.${TOOLSET}} ${CXXFLAGS} -cflags := ${cflags.${TOOLSET}} ${CFLAGS} -cppflags := ${CPPFLAGS} -Iinclude +cxxflags := ${cxxflags.${TOOLSET}} -g ${CXXFLAGS} +cflags := ${cflags.${TOOLSET}} -g ${CFLAGS} +cppflags := -Iinclude ${CPPFLAGS} ldflags := -fuse-ld=gold -pthread -g ${ldflags.${TOOLSET}} ${LDFLAGS} ldlibs := -lrt ${LDLIBS} @@ -65,14 +66,13 @@ cppflags.moodycamel := -I$(abspath ..) ldlibs.moodycamel := cppflags.xenium := -I${abspath ../xenium} +cxxflags.xenium := -std=gnu++17 ldlibs.xenium := recompile := ${build_dir}/.make/recompile relink := ${build_dir}/.make/relink COMPILE.CXX = ${CXX} -o $@ -c ${cppflags} ${cxxflags} -MD -MP $(abspath $<) -COMPILE.S = ${CXX} -o- -S -fverbose-asm -masm=intel ${cppflags} ${cxxflags} $(abspath $<) | c++filt | egrep -v '^[[:space:]]*\.(loc|cfi|L[A-Z])' > $@ -PREPROCESS.CXX = ${CXX} -o $@ -E ${cppflags} ${cxxflags} $(abspath $<) COMPILE.C = ${CC} -o $@ -c ${cppflags} ${cflags} -MD -MP $(abspath $<) LINK.EXE = ${LD} -o $@ $(ldflags) $(filter-out ${relink},$^) $(ldlibs) LINK.SO = ${LD} -o $@ -shared $(ldflags) $(filter-out ${relink},$^) $(ldlibs) @@ -86,15 +86,17 @@ else strip2 = $(strip ${1}) endif +# +# Build targets definitions begin. +# + exes := benchmarks tests example all : ${exes} -${exes} : % : ${build_dir}/% - ln -sf ${<:${CURDIR}/%=%} - benchmarks_src := benchmarks.cc cpu_base_frequency.cc huge_pages.cc ${build_dir}/benchmarks : cppflags += ${cppflags.tbb} ${cppflags.moodycamel} ${cppflags.xenium} +${build_dir}/benchmarks : cxxflags += ${cxxflags.tbb} ${cxxflags.moodycamel} ${cxxflags.xenium} ${build_dir}/benchmarks : ldlibs += ${ldlibs.tbb} ${ldlibs.moodycamel} ${ldlibs.xenium} -ldl ${build_dir}/benchmarks : ${benchmarks_src:%.cc=${build_dir}/%.o} ${relink} | ${build_dir} $(call strip2,${LINK.EXE}) @@ -112,6 +114,13 @@ ${build_dir}/example : ${example_src:%.cc=${build_dir}/%.o} ${relink} | ${build_ $(call strip2,${LINK.EXE}) -include ${example_src:%.cc=${build_dir}/%.d} +# +# Build targets definitions end. +# + +${exes} : % : ${build_dir}/% + ln -sf ${<:${CURDIR}/%=%} + ${build_dir}/%.so : cxxflags += -fPIC ${build_dir}/%.so : ${relink} | ${build_dir} $(call strip2,${LINK.SO}) @@ -125,14 +134,6 @@ ${build_dir}/%.o : src/%.cc ${recompile} | ${build_dir} ${build_dir}/%.o : src/%.c ${recompile} | ${build_dir} $(call strip2,${COMPILE.C}) -${build_dir}/%.S : cppflags += ${cppflags.tbb} ${cppflags.moodycamel} ${cppflags.xenium} -${build_dir}/%.S : src/%.cc ${recompile} | ${build_dir} - $(call strip2,${COMPILE.S}) - -${build_dir}/%.I : cppflags += ${cppflags.tbb} ${cppflags.moodycamel} ${cppflags.xenium} -${build_dir}/%.I : src/%.cc ${recompile} | ${build_dir} - $(call strip2,${PREPROCESS.CXX}) - ${build_dir}/%.d : ; ${build_dir}/.make : | ${build_dir} @@ -141,7 +142,7 @@ ${build_dir} ${build_dir}/.make: ver = "$(shell ${1} --version | head -n1)" # Trigger recompilation when compiler environment change. -env.compile := $(call ver,${CXX}) ${cppflags} ${cxxflags} ${cppflags.tbb} ${cppflags.moodycamel} ${cppflags.xenium} +env.compile := $(call ver,${CXX}) ${cppflags} ${cxxflags} ${cppflags.tbb} ${cppflags.moodycamel} ${cppflags.xenium} ${cxxflags.tbb} ${cxxflags.moodycamel} ${cxxflags.xenium} # Trigger relink when linker environment change. env.link := $(call ver,${LD}) ${ldflags} ${ldlibs} ${ldlibs.tbb} ${ldlibs.moodycamel} ${ldlibs.xenium} @@ -174,7 +175,7 @@ rtags : ${MAKE} --always-make --just-print all | { rtags-rc -c -; true; } clean : - rm -rf ${build_dir} ${exes} + rm -rf ${exes} ${build_dir} versions: ${MAKE} --version | awk 'FNR<2' @@ -184,3 +185,10 @@ env : env | sort --ignore-case .PHONY : update_env_txt env versions rtags run_benchmarks clean all run_% +.DELETE_ON_ERROR: +.SECONDARY: +.SUFFIXES: + +# Local Variables: +# compile-command: "/bin/time make -rC ~/src/atomic_queue -j$(($(nproc)/2)) BUILD=debug run_tests" +# End: ===================================== README.md ===================================== @@ -7,6 +7,7 @@
              [![Makefile Continuous Integrations](https://github.com/max0x7ba/atomic_queue/actions/workflows/ci.yml/badge.svg)](https://github.com/max0x7ba/atomic_queue/actions/workflows/ci.yml) [![CMake Continuous Integrations](https://github.com/max0x7ba/atomic_queue/actions/workflows/cmake-gcc-clang.yml/badge.svg)](https://github.com/max0x7ba/atomic_queue/actions/workflows/cmake-gcc-clang.yml) +[![Meson Continuous Integrations](https://github.com/max0x7ba/atomic_queue/actions/workflows/ci-meson.yml/badge.svg)](https://github.com/max0x7ba/atomic_queue/actions/workflows/ci-meson.yml)
              ![platform Linux x86_64](https://img.shields.io/badge/platform-Linux%20x86_64--bit-yellow) ![platform Linux ARM](https://img.shields.io/badge/platform-Linux%20ARM-yellow) @@ -15,13 +16,17 @@ ![platform Linux IBM System/390](https://img.shields.io/badge/platform-Linux%20IBM%20System/390-yellow) # atomic_queue -C++14 multiple-producer-multiple-consumer *lock-free* queues based on circular buffer and [`std::atomic`][3]. Designed with a goal to minimize the latency between one thread pushing an element into a queue and another thread popping it from the queue. +C++14 multiple-producer-multiple-consumer *lock-free* queues based on circular buffers and [`std::atomic`][3]. -It has been developed, tested and benchmarked on Linux, but should support any C++14 platforms which implement `std::atomic`. Reported as compatible with Windows, but the continuous integrations hosted by GitHub are currently set up only for x86_64 platform on Ubuntu-20.04 and Ubuntu-22.04. Pull requests to extend the [continuous integrations][18] to run on other architectures and/or platforms are welcome. +Designed with a goal to minimize the latency between one thread pushing an element into a queue and another thread popping it from the queue. + +It has been developed, tested and benchmarked on Linux, but should support any C++14 platforms which implement `std::atomic`. Reported as compatible with Windows, but the continuous integrations hosted by GitHub are currently set up only for x86_64 platform on Ubuntu-22.04 and Ubuntu-24.04. Pull requests to extend the [continuous integrations][18] to run on other architectures and/or platforms are welcome. ## Design Principles When minimizing latency a good design is not when there is nothing left to add, but rather when there is nothing left to remove, as these queues exemplify. +Minimizing latency naturally maximizes throughput. Low latency reciprocal is high throuhput, in ideal mathematical and practical engineering sense. Low latency is incompatible with any delays and/or batching, which destroy original (hardware) global time order of events pushed into one queue by different threads. Maximizing throughput, on the other hand, can be done at expense of latency by delaying and batching multiple updates. + The main design principle these queues follow is _minimalism_, which results in such design choices as: * Bare minimum of atomic instructions. Inlinable by default push and pop functions can hardly be any cheaper in terms of CPU instruction number / L1i cache pressure. @@ -38,20 +43,6 @@ These design choices are also limitations: Ultra-low-latency applications need just that and nothing more. The minimalism pays off, see the [throughput and latency benchmarks][1]. -Available containers are: -* `AtomicQueue` - a fixed size ring-buffer for atomic elements. -* `OptimistAtomicQueue` - a faster fixed size ring-buffer for atomic elements which busy-waits when empty or full. It is `AtomicQueue` used with `push`/`pop` instead of `try_push`/`try_pop`. -* `AtomicQueue2` - a fixed size ring-buffer for non-atomic elements. -* `OptimistAtomicQueue2` - a faster fixed size ring-buffer for non-atomic elements which busy-waits when empty or full. It is `AtomicQueue2` used with `push`/`pop` instead of `try_push`/`try_pop`. - -These containers have corresponding `AtomicQueueB`, `OptimistAtomicQueueB`, `AtomicQueueB2`, `OptimistAtomicQueueB2` versions where the buffer size is specified as an argument to the constructor. - -Totally ordered mode is supported. In this mode consumers receive messages in the same FIFO order the messages were posted. This mode is supported for `push` and `pop` functions, but for not the `try_` versions. On Intel x86 the totally ordered mode has 0 cost, as of 2019. - -Single-producer-single-consumer mode is supported. In this mode, no expensive atomic read-modify-write CPU instructions are necessary, only the cheapest atomic loads and stores. That improves queue throughput significantly. - -Move-only queue element types are fully supported. For example, a queue of `std::unique_ptr` elements would be `AtomicQueue2B>` or `AtomicQueue2, CAPACITY>`. - ## Role Models Several other well established and popular thread-safe containers are used for reference in the [benchmarks][1]: * `std::mutex` - a fixed size ring-buffer with `std::mutex`. @@ -102,7 +93,30 @@ make -r -j4 run_benchmarks The benchmark also requires Intel TBB library to be available. It assumes that it is installed in `/usr/local/include` and `/usr/local/lib`. If it is installed elsewhere you may like to modify `cppflags.tbb` and `ldlibs.tbb` in `Makefile`. -# API +# Library contents +## Available queues +* `AtomicQueue` - a fixed size ring-buffer for atomic elements. +* `OptimistAtomicQueue` - a faster fixed size ring-buffer for atomic elements which busy-waits when empty or full. It is `AtomicQueue` used with `push`/`pop` instead of `try_push`/`try_pop`. +* `AtomicQueue2` - a fixed size ring-buffer for non-atomic elements. +* `OptimistAtomicQueue2` - a faster fixed size ring-buffer for non-atomic elements which busy-waits when empty or full. It is `AtomicQueue2` used with `push`/`pop` instead of `try_push`/`try_pop`. + +These containers have corresponding `AtomicQueueB`, `OptimistAtomicQueueB`, `AtomicQueueB2`, `OptimistAtomicQueueB2` versions where the buffer size is specified as an argument to the constructor. + +Totally ordered mode is supported. In this mode consumers receive messages in the same FIFO order the messages were posted. This mode is supported for `push` and `pop` functions, but for not the `try_` versions. On Intel x86 the totally ordered mode has 0 cost, as of 2019. + +Single-producer-single-consumer mode is supported. In this mode, no expensive atomic read-modify-write CPU instructions are necessary, only the cheapest atomic loads and stores. That improves queue throughput significantly. + +Move-only queue element types are fully supported. For example, a queue of `std::unique_ptr` elements would be `AtomicQueue2B>` or `AtomicQueue2, CAPACITY>`. + +## Queue schematics + +``` +queue-end queue-front +[newest-element, ..., oldest-element] +push() pop() +``` + +## Queue API The queue class templates provide the following member functions: * `try_push` - Appends an element to the end of the queue. Returns `false` when the queue is full. * `try_pop` - Removes an element from the front of the queue. Returns `false` when the queue is empty. @@ -121,15 +135,13 @@ Note that _optimism_ is a choice of a queue modification operation control flow, See [example.cc](src/example.cc) for a usage example. -TODO: full API reference. - +# Implementation Notes ## Memory order of non-atomic loads and stores `push` and `try_push` operations _synchronize-with_ (as defined in [`std::memory_order`][17]) with any subsequent `pop` or `try_pop` operation of the same queue object. Meaning that: * No non-atomic load/store gets reordered past `push`/`try_push`, which is a `memory_order::release` operation. Same memory order as that of `std::mutex::unlock`. * No non-atomic load/store gets reordered prior to `pop`/`try_pop`, which is a `memory_order::acquire` operation. Same memory order as that of `std::mutex::lock`. * The effects of a producer thread's non-atomic stores followed by `push`/`try_push` of an element into a queue become visible in the consumer's thread which `pop`/`try_pop` that particular element. -# Implementation Notes ## Ring-buffer capacity The available queues here use a ring-buffer array for storing elements. The capacity of the queue is fixed at compile time or construction time. @@ -190,6 +202,8 @@ There are a few OS behaviours that complicate benchmarking: * Real-time thread throttling disabled. * Adverse address space randomisation may cause extra CPU cache conflicts, as well as other processes running on the system. To minimise effects of that `benchmarks` executable is run at least 33 times. The benchmark charts display average values. The chart tooltip also displays the standard deviation, minimum and maximum values. +Benchmark performance of single-producer-single-consumer queues `boost::lockfree::spsc_queue`, `moodycamel::ReaderWriterQueue` and these queues in single-producer-single-consumer mode should be identical because they implement exactly the same algorithm using exactly the same atomic load and store instructions. `boost::lockfree::spsc_queue` implementation benchmarked at that time had no optimizations for minimizing L1d cache contention, cold branch misprediction or pipeline stalls from subtler issues noticable only in the generated assembly code. + I only have access to a few x86-64 machines. If you have access to different hardware feel free to submit the output file of `scripts/run-benchmarks.sh` and I will include your results into the benchmarks page. ### Huge pages @@ -216,7 +230,7 @@ One thread posts an integer to another thread through one queue and waits for a Contributions are more than welcome. `.editorconfig` and `.clang-format` can be used to automatically match code formatting. # Reading material -Some books on the subject of multi-threaded programming I found instructive: +Some books on the subject of multi-threaded programming I found quite instructive: * _Programming with POSIX Threads_ by David R. Butenhof. * _The Art of Multiprocessor Programming_ by Maurice Herlihy, Nir Shavit. ===================================== debian/changelog ===================================== @@ -1,3 +1,11 @@ +libatomic-queue (1.6.9-1) experimental; urgency=medium + + * New upstream version 1.6.9 + * d/control: declare compliance to standards version 4.7.2. + * Use meson for installation, removes libatomic-queue0. (Closes: #1104583) + + -- Stephan Lachnit Tue, 24 Jun 2025 20:31:53 +0200 + libatomic-queue (1.6.5-2) unstable; urgency=medium * d/control: build depends on binutils-gold to pull ld.gold. ===================================== debian/control ===================================== @@ -2,69 +2,24 @@ Source: libatomic-queue Maintainer: Debian Med Packaging Team Uploaders: Steffen Moeller , Andreas Tille , - ?tienne Mollier + ?tienne Mollier , + Stephan Lachnit , Section: libs Priority: optional Build-Depends: debhelper-compat (= 13), - binutils-gold, - d-shlibs, - libboost-dev, + meson, libboost-test-dev, - libconcurrentqueue-dev, - libreaderwriterqueue-dev, - libtbb-dev, - libxenium-dev -Standards-Version: 4.7.1 +Standards-Version: 4.7.2 Vcs-Browser: https://salsa.debian.org/med-team/libatomic-queue Vcs-Git: https://salsa.debian.org/med-team/libatomic-queue.git Homepage: https://github.com/max0x7ba/atomic_queue Rules-Requires-Root: no -Package: libatomic-queue0 -Architecture: any -Depends: ${shlibs:Depends}, - ${misc:Depends} -Description: C++ atomic_queue library - C++11 multiple-producer-multiple-consumer lockless queues based on - circular buffer with std::atomic. The main design principle these - queues follow is simplicity: the bare minimum of atomic operations, - fixed size buffer, value semantics. - . - The circular buffer side-steps the memory reclamation problem inherent - in linked-list based queues for the price of fixed buffer size. See - Effective memory reclamation for lock-free data structures in C++ - for more details. - . - These qualities are also limitations: - . - * The maximum queue size must be set at compile time or construction time. - * There are no OS-blocking push/pop functions. - . - Nevertheless, ultra-low-latency applications need just that and nothing - more. The simplicity pays off, see the throughput and latency benchmarks. - . - Available containers are: - . - * AtomicQueue - a fixed size ring-buffer for atomic elements. - * OptimistAtomicQueue - a faster fixed size ring-buffer for atomic - elements which busy-waits when empty or full. - * AtomicQueue2 - a fixed size ring-buffer for non-atomic elements. - * OptimistAtomicQueue2 - a faster fixed size ring-buffer for non-atomic - elements which busy-waits when empty or full. - . - These containers have corresponding AtomicQueueB, OptimistAtomicQueueB, - AtomicQueueB2, OptimistAtomicQueueB2 versions where the buffer size is - specified as an argument to the constructor. - . - This package contains the dynamic library. - Package: libatomic-queue-dev Architecture: any Section: libdevel -Depends: libatomic-queue0 (= ${binary:Version}), - libboost-dev, - ${shlibs:Depends}, - ${misc:Depends} +Depends: ${shlibs:Depends}, + ${misc:Depends}, Description: devel files for C++ atomic_queue library C++11 multiple-producer-multiple-consumer lockless queues based on circular buffer with std::atomic. The main design principle these @@ -96,5 +51,3 @@ Description: devel files for C++ atomic_queue library These containers have corresponding AtomicQueueB, OptimistAtomicQueueB, AtomicQueueB2, OptimistAtomicQueueB2 versions where the buffer size is specified as an argument to the constructor. - . - This package contains the header files and static library. ===================================== debian/libatomic-queue0.symbols deleted ===================================== @@ -1,238 +0,0 @@ -libatomic_queue.so.0 libatomic-queue0 #MINVER# -* Build-Depends-Package: libatomic-queue-dev - _ZGVZNKSt8__detail11_AnyMatcherINSt7__cxx1112regex_traitsIcEELb0ELb0ELb0EEclEcE5__nul at Base 0.0+git20201007.df79403 - _ZGVZNKSt8__detail11_AnyMatcherINSt7__cxx1112regex_traitsIcEELb0ELb0ELb1EEclEcE5__nul at Base 0.0+git20201007.df79403 - _ZGVZNKSt8__detail11_AnyMatcherINSt7__cxx1112regex_traitsIcEELb0ELb1ELb0EEclEcE5__nul at Base 0.0+git20201007.df79403 - _ZGVZNKSt8__detail11_AnyMatcherINSt7__cxx1112regex_traitsIcEELb0ELb1ELb1EEclEcE5__nul at Base 0.0+git20201007.df79403 - _ZN12atomic_queue12hw_thread_idERKSt6vectorINS_15CpuTopologyInfoESaIS1_EE at Base 0.0+git20201007.df79403 - _ZN12atomic_queue15sort_by_core_idERKSt6vectorINS_15CpuTopologyInfoESaIS1_EE at Base 0.0+git20201007.df79403 - _ZN12atomic_queue18cpu_base_frequencyEv at Base 0.0+git20201007.df79403 - _ZN12atomic_queue19set_thread_affinityEj at Base 0.0+git20201007.df79403 - _ZN12atomic_queue20sort_by_hw_thread_idERKSt6vectorINS_15CpuTopologyInfoESaIS1_EE at Base 0.0+git20201007.df79403 - _ZN12atomic_queue21HugePageAllocatorBase2hpE at Base 0.0+git20201007.df79403 - _ZN12atomic_queue21get_cpu_topology_infoEv at Base 0.0+git20201007.df79403 - _ZN12atomic_queue21reset_thread_affinityEv at Base 0.0+git20201007.df79403 - _ZN12atomic_queue27set_default_thread_affinityEj at Base 0.0+git20201007.df79403 - _ZN12atomic_queue9HugePages17warn_no_1GB_pagesE at Base 0.0+git20201007.df79403 - _ZN12atomic_queue9HugePages17warn_no_2MB_pagesE at Base 0.0+git20201007.df79403 - _ZN12atomic_queue9HugePagesC1ENS0_4TypeEm at Base 0.0+git20201007.df79403 - _ZN12atomic_queue9HugePagesC2ENS0_4TypeEm at Base 0.0+git20201007.df79403 - _ZN12atomic_queue9HugePagesD1Ev at Base 0.0+git20201007.df79403 - _ZN12atomic_queue9HugePagesD2Ev at Base 0.0+git20201007.df79403 - (optional)_ZNKSt5ctypeIcE8do_widenEc at Base 0.0+git20201007.df79403 - (optional)_ZNKSt5ctypeIcE9do_narrowEcc at Base 0.0+git20201007.df79403 - (optional)_ZNKSt7__cxx1112regex_traitsIcE16lookup_classnameIPKcEENS1_10_RegexMaskET_S6_b at Base 0.0+git20201007.df79403 - (optional)_ZNKSt7__cxx1112regex_traitsIcE16translate_nocaseEc at Base 0.0+git20201007.df79403 - (optional)_ZNKSt7__cxx1112regex_traitsIcE17transform_primaryIPKcEENS_12basic_stringIcSt11char_traitsIcESaIcEEET_SA_ at Base 0.0+git20201007.df79403 - (optional)_ZNKSt7__cxx1112regex_traitsIcE18lookup_collatenameIPKcEENS_12basic_stringIcSt11char_traitsIcESaIcEEET_SA_ at Base 0.0+git20201007.df79403 - (optional)_ZNKSt8__detail20_RegexTranslatorBaseINSt7__cxx1112regex_traitsIcEELb0ELb1EE12_M_transformEc at Base 0.0+git20201007.df79403 - (optional)_ZNKSt8__detail20_RegexTranslatorBaseINSt7__cxx1112regex_traitsIcEELb1ELb1EE12_M_transformEc at Base 0.0+git20201007.df79403 - (optional)_ZNKSt8__detail9_ExecutorIN9__gnu_cxx17__normal_iteratorIPKcNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEEESaINS5_9sub_matchISB_EEENS5_12regex_traitsIcEELb0EE16_M_word_boundaryEv at Base 0.0+git20201007.df79403 - (optional)_ZNKSt8__detail9_ExecutorIN9__gnu_cxx17__normal_iteratorIPKcNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEEESaINS5_9sub_matchISB_EEENS5_12regex_traitsIcEELb0EE21_M_is_line_terminatorEc at Base 0.0+git20211209.7db4cea - (optional)_ZNKSt8__detail9_ExecutorIN9__gnu_cxx17__normal_iteratorIPKcNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEEESaINS5_9sub_matchISB_EEENS5_12regex_traitsIcEELb1EE16_M_word_boundaryEv at Base 0.0+git20201007.df79403 - (optional)_ZNKSt8__detail9_ExecutorIN9__gnu_cxx17__normal_iteratorIPKcNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEEESaINS5_9sub_matchISB_EEENS5_12regex_traitsIcEELb1EE21_M_is_line_terminatorEc at Base 0.0+git20211209.7db4cea - (optional)_ZNSt11_Deque_baseINSt8__detail9_StateSeqINSt7__cxx1112regex_traitsIcEEEESaIS5_EED1Ev at Base 0.0+git20201007.df79403 - (optional)_ZNSt11_Deque_baseINSt8__detail9_StateSeqINSt7__cxx1112regex_traitsIcEEEESaIS5_EED2Ev at Base 0.0+git20201007.df79403 - (optional)_ZNSt11_Deque_baseIlSaIlEE17_M_initialize_mapEm at Base 0.0+git20201007.df79403 - (optional)_ZNSt11_Deque_baseIlSaIlEED1Ev at Base 0.0+git20201007.df79403 - (optional)_ZNSt11_Deque_baseIlSaIlEED2Ev at Base 0.0+git20201007.df79403 - (optional)_ZNSt12system_errorC1ESt10error_codePKc at Base 0.0+git20201007.df79403 - (optional)_ZNSt12system_errorC2ESt10error_codePKc at Base 0.0+git20201007.df79403 - (optional)_ZNSt14_Function_baseD1Ev at Base 0.0+git20201007.df79403 - (optional)_ZNSt14_Function_baseD2Ev at Base 0.0+git20201007.df79403 - (optional)_ZNSt16_Sp_counted_baseILN9__gnu_cxx12_Lock_policyE2EE10_M_releaseEv at Base 0.0+git20211209.7db4cea - (optional)_ZNSt16_Sp_counted_baseILN9__gnu_cxx12_Lock_policyE2EE24_M_release_last_use_coldEv at Base 0.0+git20211209.7db4cea - _ZNSt17_Function_handlerIFbcENSt8__detail11_AnyMatcherINSt7__cxx1112regex_traitsIcEELb0ELb0ELb0EEEE10_M_managerERSt9_Any_dataRKS8_St18_Manager_operation at Base 0.0+git20201007.df79403 - _ZNSt17_Function_handlerIFbcENSt8__detail11_AnyMatcherINSt7__cxx1112regex_traitsIcEELb0ELb0ELb0EEEE9_M_invokeERKSt9_Any_dataOc at Base 0.0+git20201007.df79403 - _ZNSt17_Function_handlerIFbcENSt8__detail11_AnyMatcherINSt7__cxx1112regex_traitsIcEELb0ELb0ELb1EEEE10_M_managerERSt9_Any_dataRKS8_St18_Manager_operation at Base 0.0+git20201007.df79403 - _ZNSt17_Function_handlerIFbcENSt8__detail11_AnyMatcherINSt7__cxx1112regex_traitsIcEELb0ELb0ELb1EEEE9_M_invokeERKSt9_Any_dataOc at Base 0.0+git20201007.df79403 - _ZNSt17_Function_handlerIFbcENSt8__detail11_AnyMatcherINSt7__cxx1112regex_traitsIcEELb0ELb1ELb0EEEE10_M_managerERSt9_Any_dataRKS8_St18_Manager_operation at Base 0.0+git20201007.df79403 - _ZNSt17_Function_handlerIFbcENSt8__detail11_AnyMatcherINSt7__cxx1112regex_traitsIcEELb0ELb1ELb0EEEE9_M_invokeERKSt9_Any_dataOc at Base 0.0+git20201007.df79403 - _ZNSt17_Function_handlerIFbcENSt8__detail11_AnyMatcherINSt7__cxx1112regex_traitsIcEELb0ELb1ELb1EEEE10_M_managerERSt9_Any_dataRKS8_St18_Manager_operation at Base 0.0+git20201007.df79403 - _ZNSt17_Function_handlerIFbcENSt8__detail11_AnyMatcherINSt7__cxx1112regex_traitsIcEELb0ELb1ELb1EEEE9_M_invokeERKSt9_Any_dataOc at Base 0.0+git20201007.df79403 - _ZNSt17_Function_handlerIFbcENSt8__detail11_AnyMatcherINSt7__cxx1112regex_traitsIcEELb1ELb0ELb0EEEE10_M_managerERSt9_Any_dataRKS8_St18_Manager_operation at Base 0.0+git20201007.df79403 - _ZNSt17_Function_handlerIFbcENSt8__detail11_AnyMatcherINSt7__cxx1112regex_traitsIcEELb1ELb0ELb0EEEE9_M_invokeERKSt9_Any_dataOc at Base 0.0+git20201007.df79403 - _ZNSt17_Function_handlerIFbcENSt8__detail11_AnyMatcherINSt7__cxx1112regex_traitsIcEELb1ELb0ELb1EEEE10_M_managerERSt9_Any_dataRKS8_St18_Manager_operation at Base 0.0+git20201007.df79403 - _ZNSt17_Function_handlerIFbcENSt8__detail11_AnyMatcherINSt7__cxx1112regex_traitsIcEELb1ELb0ELb1EEEE9_M_invokeERKSt9_Any_dataOc at Base 0.0+git20201007.df79403 - _ZNSt17_Function_handlerIFbcENSt8__detail11_AnyMatcherINSt7__cxx1112regex_traitsIcEELb1ELb1ELb0EEEE10_M_managerERSt9_Any_dataRKS8_St18_Manager_operation at Base 0.0+git20201007.df79403 - _ZNSt17_Function_handlerIFbcENSt8__detail11_AnyMatcherINSt7__cxx1112regex_traitsIcEELb1ELb1ELb0EEEE9_M_invokeERKSt9_Any_dataOc at Base 0.0+git20201007.df79403 - _ZNSt17_Function_handlerIFbcENSt8__detail11_AnyMatcherINSt7__cxx1112regex_traitsIcEELb1ELb1ELb1EEEE10_M_managerERSt9_Any_dataRKS8_St18_Manager_operation at Base 0.0+git20201007.df79403 - _ZNSt17_Function_handlerIFbcENSt8__detail11_AnyMatcherINSt7__cxx1112regex_traitsIcEELb1ELb1ELb1EEEE9_M_invokeERKSt9_Any_dataOc at Base 0.0+git20201007.df79403 - _ZNSt17_Function_handlerIFbcENSt8__detail12_CharMatcherINSt7__cxx1112regex_traitsIcEELb0ELb0EEEE10_M_managerERSt9_Any_dataRKS8_St18_Manager_operation at Base 0.0+git20201007.df79403 - _ZNSt17_Function_handlerIFbcENSt8__detail12_CharMatcherINSt7__cxx1112regex_traitsIcEELb0ELb0EEEE9_M_invokeERKSt9_Any_dataOc at Base 0.0+git20201007.df79403 - _ZNSt17_Function_handlerIFbcENSt8__detail12_CharMatcherINSt7__cxx1112regex_traitsIcEELb0ELb1EEEE10_M_managerERSt9_Any_dataRKS8_St18_Manager_operation at Base 0.0+git20201007.df79403 - _ZNSt17_Function_handlerIFbcENSt8__detail12_CharMatcherINSt7__cxx1112regex_traitsIcEELb0ELb1EEEE9_M_invokeERKSt9_Any_dataOc at Base 0.0+git20201007.df79403 - _ZNSt17_Function_handlerIFbcENSt8__detail12_CharMatcherINSt7__cxx1112regex_traitsIcEELb1ELb0EEEE10_M_managerERSt9_Any_dataRKS8_St18_Manager_operation at Base 0.0+git20201007.df79403 - _ZNSt17_Function_handlerIFbcENSt8__detail12_CharMatcherINSt7__cxx1112regex_traitsIcEELb1ELb0EEEE9_M_invokeERKSt9_Any_dataOc at Base 0.0+git20201007.df79403 - _ZNSt17_Function_handlerIFbcENSt8__detail12_CharMatcherINSt7__cxx1112regex_traitsIcEELb1ELb1EEEE10_M_managerERSt9_Any_dataRKS8_St18_Manager_operation at Base 0.0+git20201007.df79403 - _ZNSt17_Function_handlerIFbcENSt8__detail12_CharMatcherINSt7__cxx1112regex_traitsIcEELb1ELb1EEEE9_M_invokeERKSt9_Any_dataOc at Base 0.0+git20201007.df79403 - _ZNSt17_Function_handlerIFbcENSt8__detail15_BracketMatcherINSt7__cxx1112regex_traitsIcEELb0ELb0EEEE10_M_managerERSt9_Any_dataRKS8_St18_Manager_operation at Base 0.0+git20201007.df79403 - _ZNSt17_Function_handlerIFbcENSt8__detail15_BracketMatcherINSt7__cxx1112regex_traitsIcEELb0ELb0EEEE9_M_invokeERKSt9_Any_dataOc at Base 0.0+git20201007.df79403 - _ZNSt17_Function_handlerIFbcENSt8__detail15_BracketMatcherINSt7__cxx1112regex_traitsIcEELb0ELb1EEEE10_M_managerERSt9_Any_dataRKS8_St18_Manager_operation at Base 0.0+git20201007.df79403 - _ZNSt17_Function_handlerIFbcENSt8__detail15_BracketMatcherINSt7__cxx1112regex_traitsIcEELb0ELb1EEEE9_M_invokeERKSt9_Any_dataOc at Base 0.0+git20201007.df79403 - _ZNSt17_Function_handlerIFbcENSt8__detail15_BracketMatcherINSt7__cxx1112regex_traitsIcEELb1ELb0EEEE10_M_managerERSt9_Any_dataRKS8_St18_Manager_operation at Base 0.0+git20201007.df79403 - _ZNSt17_Function_handlerIFbcENSt8__detail15_BracketMatcherINSt7__cxx1112regex_traitsIcEELb1ELb0EEEE9_M_invokeERKSt9_Any_dataOc at Base 0.0+git20201007.df79403 - _ZNSt17_Function_handlerIFbcENSt8__detail15_BracketMatcherINSt7__cxx1112regex_traitsIcEELb1ELb1EEEE10_M_managerERSt9_Any_dataRKS8_St18_Manager_operation at Base 0.0+git20201007.df79403 - _ZNSt17_Function_handlerIFbcENSt8__detail15_BracketMatcherINSt7__cxx1112regex_traitsIcEELb1ELb1EEEE9_M_invokeERKSt9_Any_dataOc at Base 0.0+git20201007.df79403 - (optional)_ZNSt23_Sp_counted_ptr_inplaceINSt8__detail4_NFAINSt7__cxx1112regex_traitsIcEEEESaIvELN9__gnu_cxx12_Lock_policyE2EE10_M_destroyEv at Base 0.0+git20211209.7db4cea - (optional)_ZNSt23_Sp_counted_ptr_inplaceINSt8__detail4_NFAINSt7__cxx1112regex_traitsIcEEEESaIvELN9__gnu_cxx12_Lock_policyE2EE10_M_disposeEv at Base 0.0+git20211209.7db4cea - (optional)_ZNSt23_Sp_counted_ptr_inplaceINSt8__detail4_NFAINSt7__cxx1112regex_traitsIcEEEESaIvELN9__gnu_cxx12_Lock_policyE2EE14_M_get_deleterERKSt9type_info at Base 0.0+git20211209.7db4cea - (optional)_ZNSt23_Sp_counted_ptr_inplaceINSt8__detail4_NFAINSt7__cxx1112regex_traitsIcEEEESaIvELN9__gnu_cxx12_Lock_policyE2EED0Ev at Base 0.0+git20211209.7db4cea - (optional)_ZNSt23_Sp_counted_ptr_inplaceINSt8__detail4_NFAINSt7__cxx1112regex_traitsIcEEEESaIvELN9__gnu_cxx12_Lock_policyE2EED1Ev at Base 0.0+git20211209.7db4cea - (optional)_ZNSt23_Sp_counted_ptr_inplaceINSt8__detail4_NFAINSt7__cxx1112regex_traitsIcEEEESaIvELN9__gnu_cxx12_Lock_policyE2EED2Ev at Base 0.0+git20211209.7db4cea - (optional)_ZNSt5dequeINSt8__detail9_StateSeqINSt7__cxx1112regex_traitsIcEEEESaIS5_EE12emplace_backIJS5_EEEvDpOT_ at Base 0.0+git20201007.df79403 - (optional)_ZNSt5dequeINSt8__detail9_StateSeqINSt7__cxx1112regex_traitsIcEEEESaIS5_EE16_M_push_back_auxIJRKS5_EEEvDpOT_ at Base 0.0+git20201007.df79403 - (optional)_ZNSt5dequeINSt8__detail9_StateSeqINSt7__cxx1112regex_traitsIcEEEESaIS5_EE17_M_reallocate_mapEmb at Base 0.0+git20201007.df79403 - (optional)_ZNSt5dequeINSt8__detail9_StateSeqINSt7__cxx1112regex_traitsIcEEEESaIS5_EE9push_backERKS5_ at Base 0.0+git20211209.7db4cea - (optional)_ZNSt5dequeIlSaIlEE16_M_push_back_auxIJRKlEEEvDpOT_ at Base 0.0+git20201007.df79403 - (optional)_ZNSt6vectorIN12atomic_queue15CpuTopologyInfoESaIS1_EE17_M_realloc_insertIJRKS1_EEEvN9__gnu_cxx17__normal_iteratorIPS1_S3_EEDpOT_ at Base 0.0+git20201007.df79403 - (optional)_ZNSt6vectorINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESaIS5_EE17_M_realloc_insertIJRKS5_EEEvN9__gnu_cxx17__normal_iteratorIPS5_S7_EEDpOT_ at Base 0.0+git20201007.df79403 - (optional)_ZNSt6vectorINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESaIS5_EEC1ERKS7_ at Base 0.0+git20201007.df79403 - (optional)_ZNSt6vectorINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESaIS5_EEC2ERKS7_ at Base 0.0+git20201007.df79403 - (optional)_ZNSt6vectorINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESaIS5_EED1Ev at Base 0.0+git20201007.df79403 - (optional)_ZNSt6vectorINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESaIS5_EED2Ev at Base 0.0+git20201007.df79403 - (optional)_ZNSt6vectorINSt7__cxx1112regex_traitsIcE10_RegexMaskESaIS3_EE17_M_realloc_insertIJRKS3_EEEvN9__gnu_cxx17__normal_iteratorIPS3_S5_EEDpOT_ at Base 0.0+git20201007.df79403 - (optional)_ZNSt6vectorINSt7__cxx119sub_matchIN9__gnu_cxx17__normal_iteratorIPKcNS0_12basic_stringIcSt11char_traitsIcESaIcEEEEEEESaISC_EE14_M_fill_assignEmRKSC_ at Base 0.0+git20201007.df79403 - (optional)_ZNSt6vectorINSt7__cxx119sub_matchIN9__gnu_cxx17__normal_iteratorIPKcNS0_12basic_stringIcSt11char_traitsIcESaIcEEEEEEESaISC_EED1Ev at Base 0.0+git20230629.b770bb2 - (optional)_ZNSt6vectorINSt7__cxx119sub_matchIN9__gnu_cxx17__normal_iteratorIPKcNS0_12basic_stringIcSt11char_traitsIcESaIcEEEEEEESaISC_EED2Ev at Base 0.0+git20230629.b770bb2 - (optional)_ZNSt6vectorINSt8__detail6_StateIcEESaIS2_EE17_M_realloc_insertIJS2_EEEvN9__gnu_cxx17__normal_iteratorIPS2_S4_EEDpOT_ at Base 0.0+git20201007.df79403 - (optional)_ZNSt6vectorISt4pairIN9__gnu_cxx17__normal_iteratorIPKcNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEEEiESaISC_EED1Ev at Base 0.0+git20230629.b770bb2 - (optional)_ZNSt6vectorISt4pairIN9__gnu_cxx17__normal_iteratorIPKcNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEEEiESaISC_EED2Ev at Base 0.0+git20230629.b770bb2 - (optional)_ZNSt6vectorISt4pairINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEES6_ESaIS7_EE17_M_realloc_insertIJS7_EEEvN9__gnu_cxx17__normal_iteratorIPS7_S9_EEDpOT_ at Base 0.0+git20201007.df79403 - (optional)_ZNSt6vectorISt4pairINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEES6_ESaIS7_EEC1ERKS9_ at Base 0.0+git20201007.df79403 - (optional)_ZNSt6vectorISt4pairINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEES6_ESaIS7_EEC2ERKS9_ at Base 0.0+git20201007.df79403 - (optional)_ZNSt6vectorISt4pairINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEES6_ESaIS7_EED1Ev at Base 0.0+git20201007.df79403 - (optional)_ZNSt6vectorISt4pairINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEES6_ESaIS7_EED2Ev at Base 0.0+git20201007.df79403 - (optional)_ZNSt6vectorISt4pairIccESaIS1_EE17_M_realloc_insertIJS1_EEEvN9__gnu_cxx17__normal_iteratorIPS1_S3_EEDpOT_ at Base 0.0+git20201007.df79403 - (optional)_ZNSt6vectorISt4pairIccESaIS1_EED1Ev at Base 0.0+git20230629.b770bb2 - (optional)_ZNSt6vectorISt4pairIccESaIS1_EED2Ev at Base 0.0+git20230629.b770bb2 - (optional)_ZNSt6vectorISt4pairIlS_INSt7__cxx119sub_matchIN9__gnu_cxx17__normal_iteratorIPKcNS1_12basic_stringIcSt11char_traitsIcESaIcEEEEEEESaISD_EEESaISG_EE12emplace_backIJRlRKSF_EEEvDpOT_ at Base 0.0+git20201108.d9d66b6 - (optional)_ZNSt6vectorISt4pairIlS_INSt7__cxx119sub_matchIN9__gnu_cxx17__normal_iteratorIPKcNS1_12basic_stringIcSt11char_traitsIcESaIcEEEEEEESaISD_EEESaISG_EE17_M_realloc_insertIJRlRKSF_EEEvNS4_IPSG_SI_EEDpOT_ at Base 0.0+git20201007.df79403 - (optional)_ZNSt6vectorISt4pairIlS_INSt7__cxx119sub_matchIN9__gnu_cxx17__normal_iteratorIPKcNS1_12basic_stringIcSt11char_traitsIcESaIcEEEEEEESaISD_EEESaISG_EED1Ev at Base 0.0+git20201007.df79403 - (optional)_ZNSt6vectorISt4pairIlS_INSt7__cxx119sub_matchIN9__gnu_cxx17__normal_iteratorIPKcNS1_12basic_stringIcSt11char_traitsIcESaIcEEEEEEESaISD_EEESaISG_EED2Ev at Base 0.0+git20201007.df79403 - (optional)_ZNSt6vectorIcSaIcEE12emplace_backIJcEEEvDpOT_ at Base 0.0+git20201007.df79403 - (optional)_ZNSt6vectorIcSaIcEE17_M_realloc_insertIJcEEEvN9__gnu_cxx17__normal_iteratorIPcS1_EEDpOT_ at Base 0.0+git20201007.df79403 - (optional)_ZNSt6vectorIcSaIcEED1Ev at Base 0.0+git20230629.b770bb2 - (optional)_ZNSt6vectorIcSaIcEED2Ev at Base 0.0+git20230629.b770bb2 - (optional)_ZNSt6vectorImSaImEE17_M_realloc_insertIJRKmEEEvN9__gnu_cxx17__normal_iteratorIPmS1_EEDpOT_ at Base 0.0+git20201007.df79403 - (optional)_ZNSt7__cxx1111basic_regexIcNS_12regex_traitsIcEEED1Ev at Base 0.0+git20201007.df79403 - (optional)_ZNSt7__cxx1111basic_regexIcNS_12regex_traitsIcEEED2Ev at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail15_BracketMatcherINSt7__cxx1112regex_traitsIcEELb0ELb0EE8_M_readyEv at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail15_BracketMatcherINSt7__cxx1112regex_traitsIcEELb0ELb0EED1Ev at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail15_BracketMatcherINSt7__cxx1112regex_traitsIcEELb0ELb0EED2Ev at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail15_BracketMatcherINSt7__cxx1112regex_traitsIcEELb0ELb1EE13_M_make_rangeEcc at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail15_BracketMatcherINSt7__cxx1112regex_traitsIcEELb0ELb1EED1Ev at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail15_BracketMatcherINSt7__cxx1112regex_traitsIcEELb0ELb1EED2Ev at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail15_BracketMatcherINSt7__cxx1112regex_traitsIcEELb1ELb0EED1Ev at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail15_BracketMatcherINSt7__cxx1112regex_traitsIcEELb1ELb0EED2Ev at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail15_BracketMatcherINSt7__cxx1112regex_traitsIcEELb1ELb1EE13_M_make_rangeEcc at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail15_BracketMatcherINSt7__cxx1112regex_traitsIcEELb1ELb1EED1Ev at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail15_BracketMatcherINSt7__cxx1112regex_traitsIcEELb1ELb1EED2Ev at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail17__regex_algo_implIN9__gnu_cxx17__normal_iteratorIPKcNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEEESaINS5_9sub_matchISB_EEEcNS5_12regex_traitsIcEEEEbT_SH_RNS5_13match_resultsISH_T0_EERKNS5_11basic_regexIT1_T2_EENSt15regex_constants15match_flag_typeENS_20_RegexExecutorPolicyEb at Base 0.0+git20211209.7db4cea - (optional)_ZNSt8__detail4_NFAINSt7__cxx1112regex_traitsIcEEE15_M_insert_dummyEv at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail4_NFAINSt7__cxx1112regex_traitsIcEEE15_M_insert_stateENS_6_StateIcEE at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail4_NFAINSt7__cxx1112regex_traitsIcEEE16_M_insert_acceptEv at Base 0.0+git20230629.b770bb2 - (optional)_ZNSt8__detail4_NFAINSt7__cxx1112regex_traitsIcEEE16_M_insert_repeatEllb at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail4_NFAINSt7__cxx1112regex_traitsIcEEE17_M_insert_backrefEm at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail4_NFAINSt7__cxx1112regex_traitsIcEEE17_M_insert_matcherESt8functionIFbcEE at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail4_NFAINSt7__cxx1112regex_traitsIcEEE21_M_insert_subexpr_endEv at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail4_NFAINSt7__cxx1112regex_traitsIcEEE23_M_insert_subexpr_beginEv at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail8_ScannerIcE12_M_eat_classEc at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail8_ScannerIcE14_M_scan_normalEv at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail8_ScannerIcE16_M_scan_in_braceEv at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail8_ScannerIcE17_M_eat_escape_awkEv at Base 0.0+git20201007.df79403 - _ZNSt8__detail8_ScannerIcE18_M_eat_escape_ecmaEv at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail8_ScannerIcE18_M_scan_in_bracketEv at Base 0.0+git20201007.df79403 - _ZNSt8__detail8_ScannerIcE19_M_eat_escape_posixEv at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail8_ScannerIcEC1EPKcS3_NSt15regex_constants18syntax_option_typeESt6locale at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail8_ScannerIcEC2EPKcS3_NSt15regex_constants18syntax_option_typeESt6locale at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail9_CompilerINSt7__cxx1112regex_traitsIcEEE11_M_try_charEv at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail9_CompilerINSt7__cxx1112regex_traitsIcEEE12_M_assertionEv at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail9_CompilerINSt7__cxx1112regex_traitsIcEEE13_M_quantifierEv at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail9_CompilerINSt7__cxx1112regex_traitsIcEEE14_M_alternativeEv at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail9_CompilerINSt7__cxx1112regex_traitsIcEEE14_M_disjunctionEv at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail9_CompilerINSt7__cxx1112regex_traitsIcEEE16_M_cur_int_valueEi at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail9_CompilerINSt7__cxx1112regex_traitsIcEEE18_M_expression_termILb0ELb0EEEbRNS4_13_BracketStateERNS_15_BracketMatcherIS3_XT_EXT0_EEE at Base 0.0+git20211209.7db4cea - (optional)_ZNSt8__detail9_CompilerINSt7__cxx1112regex_traitsIcEEE18_M_expression_termILb0ELb1EEEbRNS4_13_BracketStateERNS_15_BracketMatcherIS3_XT_EXT0_EEE at Base 0.0+git20211209.7db4cea - (optional)_ZNSt8__detail9_CompilerINSt7__cxx1112regex_traitsIcEEE18_M_expression_termILb1ELb0EEEbRNS4_13_BracketStateERNS_15_BracketMatcherIS3_XT_EXT0_EEE at Base 0.0+git20211209.7db4cea - (optional)_ZNSt8__detail9_CompilerINSt7__cxx1112regex_traitsIcEEE18_M_expression_termILb1ELb1EEEbRNS4_13_BracketStateERNS_15_BracketMatcherIS3_XT_EXT0_EEE at Base 0.0+git20211209.7db4cea - (optional)_ZNSt8__detail9_CompilerINSt7__cxx1112regex_traitsIcEEE21_M_bracket_expressionEv at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail9_CompilerINSt7__cxx1112regex_traitsIcEEE25_M_insert_bracket_matcherILb0ELb0EEEvb at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail9_CompilerINSt7__cxx1112regex_traitsIcEEE25_M_insert_bracket_matcherILb0ELb1EEEvb at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail9_CompilerINSt7__cxx1112regex_traitsIcEEE25_M_insert_bracket_matcherILb1ELb0EEEvb at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail9_CompilerINSt7__cxx1112regex_traitsIcEEE25_M_insert_bracket_matcherILb1ELb1EEEvb at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail9_CompilerINSt7__cxx1112regex_traitsIcEEE33_M_insert_character_class_matcherILb0ELb0EEEvv at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail9_CompilerINSt7__cxx1112regex_traitsIcEEE33_M_insert_character_class_matcherILb0ELb1EEEvv at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail9_CompilerINSt7__cxx1112regex_traitsIcEEE33_M_insert_character_class_matcherILb1ELb0EEEvv at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail9_CompilerINSt7__cxx1112regex_traitsIcEEE33_M_insert_character_class_matcherILb1ELb1EEEvv at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail9_CompilerINSt7__cxx1112regex_traitsIcEEE6_M_popEv at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail9_CompilerINSt7__cxx1112regex_traitsIcEEE7_M_atomEv at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail9_CompilerINSt7__cxx1112regex_traitsIcEEEC1EPKcS6_RKSt6localeNSt15regex_constants18syntax_option_typeE at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail9_CompilerINSt7__cxx1112regex_traitsIcEEEC2EPKcS6_RKSt6localeNSt15regex_constants18syntax_option_typeE at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail9_ExecutorIN9__gnu_cxx17__normal_iteratorIPKcNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEEESaINS5_9sub_matchISB_EEENS5_12regex_traitsIcEELb0EE12_M_lookaheadEl at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail9_ExecutorIN9__gnu_cxx17__normal_iteratorIPKcNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEEESaINS5_9sub_matchISB_EEENS5_12regex_traitsIcEELb0EE16_M_rep_once_moreENSH_11_Match_modeEl at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail9_ExecutorIN9__gnu_cxx17__normal_iteratorIPKcNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEEESaINS5_9sub_matchISB_EEENS5_12regex_traitsIcEELb0EE6_M_dfsENSH_11_Match_modeEl at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail9_ExecutorIN9__gnu_cxx17__normal_iteratorIPKcNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEEESaINS5_9sub_matchISB_EEENS5_12regex_traitsIcEELb0EED1Ev at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail9_ExecutorIN9__gnu_cxx17__normal_iteratorIPKcNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEEESaINS5_9sub_matchISB_EEENS5_12regex_traitsIcEELb0EED2Ev at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail9_ExecutorIN9__gnu_cxx17__normal_iteratorIPKcNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEEESaINS5_9sub_matchISB_EEENS5_12regex_traitsIcEELb1EE12_M_lookaheadEl at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail9_ExecutorIN9__gnu_cxx17__normal_iteratorIPKcNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEEESaINS5_9sub_matchISB_EEENS5_12regex_traitsIcEELb1EE16_M_rep_once_moreENSH_11_Match_modeEl at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail9_ExecutorIN9__gnu_cxx17__normal_iteratorIPKcNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEEESaINS5_9sub_matchISB_EEENS5_12regex_traitsIcEELb1EE6_M_dfsENSH_11_Match_modeEl at Base 0.0+git20201007.df79403 - (optional)_ZNSt8__detail9_StateSeqINSt7__cxx1112regex_traitsIcEEE8_M_cloneEv at Base 0.0+git20201007.df79403 - (optional)_ZSt13binary_searchIN9__gnu_cxx17__normal_iteratorIPKcSt6vectorIcSaIcEEEEcEbT_S8_RKT0_ at Base 0.0+git20201007.df79403 - (optional)_ZSt19__throw_regex_errorNSt15regex_constants10error_typeEPKc at Base 0.0+git20201007.df79403 - (optional)_ZSt4findIN9__gnu_cxx17__normal_iteratorIPKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt6vectorIS7_SaIS7_EEEES7_ET_SE_SE_RKT0_ at Base 0.0+git20201108.d9d66b6 - _ZTINSt8__detail11_AnyMatcherINSt7__cxx1112regex_traitsIcEELb0ELb0ELb0EEE at Base 0.0+git20201007.df79403 - _ZTINSt8__detail11_AnyMatcherINSt7__cxx1112regex_traitsIcEELb0ELb0ELb1EEE at Base 0.0+git20201007.df79403 - _ZTINSt8__detail11_AnyMatcherINSt7__cxx1112regex_traitsIcEELb0ELb1ELb0EEE at Base 0.0+git20201007.df79403 - _ZTINSt8__detail11_AnyMatcherINSt7__cxx1112regex_traitsIcEELb0ELb1ELb1EEE at Base 0.0+git20201007.df79403 - _ZTINSt8__detail11_AnyMatcherINSt7__cxx1112regex_traitsIcEELb1ELb0ELb0EEE at Base 0.0+git20201007.df79403 - _ZTINSt8__detail11_AnyMatcherINSt7__cxx1112regex_traitsIcEELb1ELb0ELb1EEE at Base 0.0+git20201007.df79403 - _ZTINSt8__detail11_AnyMatcherINSt7__cxx1112regex_traitsIcEELb1ELb1ELb0EEE at Base 0.0+git20201007.df79403 - _ZTINSt8__detail11_AnyMatcherINSt7__cxx1112regex_traitsIcEELb1ELb1ELb1EEE at Base 0.0+git20201007.df79403 - _ZTINSt8__detail12_CharMatcherINSt7__cxx1112regex_traitsIcEELb0ELb0EEE at Base 0.0+git20201007.df79403 - _ZTINSt8__detail12_CharMatcherINSt7__cxx1112regex_traitsIcEELb0ELb1EEE at Base 0.0+git20201007.df79403 - _ZTINSt8__detail12_CharMatcherINSt7__cxx1112regex_traitsIcEELb1ELb0EEE at Base 0.0+git20201007.df79403 - _ZTINSt8__detail12_CharMatcherINSt7__cxx1112regex_traitsIcEELb1ELb1EEE at Base 0.0+git20201007.df79403 - _ZTINSt8__detail15_BracketMatcherINSt7__cxx1112regex_traitsIcEELb0ELb0EEE at Base 0.0+git20201007.df79403 - _ZTINSt8__detail15_BracketMatcherINSt7__cxx1112regex_traitsIcEELb0ELb1EEE at Base 0.0+git20201007.df79403 - _ZTINSt8__detail15_BracketMatcherINSt7__cxx1112regex_traitsIcEELb1ELb0EEE at Base 0.0+git20201007.df79403 - _ZTINSt8__detail15_BracketMatcherINSt7__cxx1112regex_traitsIcEELb1ELb1EEE at Base 0.0+git20201007.df79403 - _ZTISt11_Mutex_baseILN9__gnu_cxx12_Lock_policyE2EE at Base 0.0+git20201007.df79403 - _ZTISt16_Sp_counted_baseILN9__gnu_cxx12_Lock_policyE2EE at Base 0.0+git20201007.df79403 - (optional)_ZTISt23_Sp_counted_ptr_inplaceINSt8__detail4_NFAINSt7__cxx1112regex_traitsIcEEEESaIvELN9__gnu_cxx12_Lock_policyE2EE at Base 0.0+git20211209.7db4cea - _ZTSNSt8__detail11_AnyMatcherINSt7__cxx1112regex_traitsIcEELb0ELb0ELb0EEE at Base 0.0+git20201007.df79403 - _ZTSNSt8__detail11_AnyMatcherINSt7__cxx1112regex_traitsIcEELb0ELb0ELb1EEE at Base 0.0+git20201007.df79403 - _ZTSNSt8__detail11_AnyMatcherINSt7__cxx1112regex_traitsIcEELb0ELb1ELb0EEE at Base 0.0+git20201007.df79403 - _ZTSNSt8__detail11_AnyMatcherINSt7__cxx1112regex_traitsIcEELb0ELb1ELb1EEE at Base 0.0+git20201007.df79403 - _ZTSNSt8__detail11_AnyMatcherINSt7__cxx1112regex_traitsIcEELb1ELb0ELb0EEE at Base 0.0+git20201007.df79403 - _ZTSNSt8__detail11_AnyMatcherINSt7__cxx1112regex_traitsIcEELb1ELb0ELb1EEE at Base 0.0+git20201007.df79403 - _ZTSNSt8__detail11_AnyMatcherINSt7__cxx1112regex_traitsIcEELb1ELb1ELb0EEE at Base 0.0+git20201007.df79403 - _ZTSNSt8__detail11_AnyMatcherINSt7__cxx1112regex_traitsIcEELb1ELb1ELb1EEE at Base 0.0+git20201007.df79403 - _ZTSNSt8__detail12_CharMatcherINSt7__cxx1112regex_traitsIcEELb0ELb0EEE at Base 0.0+git20201007.df79403 - _ZTSNSt8__detail12_CharMatcherINSt7__cxx1112regex_traitsIcEELb0ELb1EEE at Base 0.0+git20201007.df79403 - _ZTSNSt8__detail12_CharMatcherINSt7__cxx1112regex_traitsIcEELb1ELb0EEE at Base 0.0+git20201007.df79403 - _ZTSNSt8__detail12_CharMatcherINSt7__cxx1112regex_traitsIcEELb1ELb1EEE at Base 0.0+git20201007.df79403 - _ZTSNSt8__detail15_BracketMatcherINSt7__cxx1112regex_traitsIcEELb0ELb0EEE at Base 0.0+git20201007.df79403 - _ZTSNSt8__detail15_BracketMatcherINSt7__cxx1112regex_traitsIcEELb0ELb1EEE at Base 0.0+git20201007.df79403 - _ZTSNSt8__detail15_BracketMatcherINSt7__cxx1112regex_traitsIcEELb1ELb0EEE at Base 0.0+git20201007.df79403 - _ZTSNSt8__detail15_BracketMatcherINSt7__cxx1112regex_traitsIcEELb1ELb1EEE at Base 0.0+git20201007.df79403 - _ZTSSt11_Mutex_baseILN9__gnu_cxx12_Lock_policyE2EE at Base 0.0+git20201007.df79403 - _ZTSSt16_Sp_counted_baseILN9__gnu_cxx12_Lock_policyE2EE at Base 0.0+git20201007.df79403 - _ZTSSt19_Sp_make_shared_tag at Base 0.0+git20201007.df79403 - (optional)_ZTSSt23_Sp_counted_ptr_inplaceINSt8__detail4_NFAINSt7__cxx1112regex_traitsIcEEEESaIvELN9__gnu_cxx12_Lock_policyE2EE at Base 0.0+git20211209.7db4cea - (optional)_ZTVSt23_Sp_counted_ptr_inplaceINSt8__detail4_NFAINSt7__cxx1112regex_traitsIcEEEESaIvELN9__gnu_cxx12_Lock_policyE2EE at Base 0.0+git20211209.7db4cea - _ZZNKSt7__cxx1112regex_traitsIcE16lookup_classnameIPKcEENS1_10_RegexMaskET_S6_bE12__classnames at Base 0.0+git20201007.df79403 - _ZZNKSt7__cxx1112regex_traitsIcE18lookup_collatenameIPKcEENS_12basic_stringIcSt11char_traitsIcESaIcEEET_SA_E14__collatenames at Base 0.0+git20201007.df79403 - _ZZNKSt8__detail11_AnyMatcherINSt7__cxx1112regex_traitsIcEELb0ELb0ELb0EEclEcE5__nul at Base 0.0+git20201007.df79403 - _ZZNKSt8__detail11_AnyMatcherINSt7__cxx1112regex_traitsIcEELb0ELb0ELb1EEclEcE5__nul at Base 0.0+git20201007.df79403 - _ZZNKSt8__detail11_AnyMatcherINSt7__cxx1112regex_traitsIcEELb0ELb1ELb0EEclEcE5__nul at Base 0.0+git20201007.df79403 - _ZZNKSt8__detail11_AnyMatcherINSt7__cxx1112regex_traitsIcEELb0ELb1ELb1EEclEcE5__nul at Base 0.0+git20201007.df79403 - (optional)_ZZNKSt8__detail15_BracketMatcherINSt7__cxx1112regex_traitsIcEELb0ELb1EE8_M_applyEcSt17integral_constantIbLb0EEENKUlvE_clEv at Base 0.0+git20201007.df79403 - (optional)_ZZNKSt8__detail15_BracketMatcherINSt7__cxx1112regex_traitsIcEELb1ELb0EE8_M_applyEcSt17integral_constantIbLb0EEENKUlvE_clEv at Base 0.0+git20201007.df79403 - (optional)_ZZNKSt8__detail15_BracketMatcherINSt7__cxx1112regex_traitsIcEELb1ELb1EE8_M_applyEcSt17integral_constantIbLb0EEENKUlvE_clEv at Base 0.0+git20201007.df79403 - _ZZNKSt8__detail9_ExecutorIN9__gnu_cxx17__normal_iteratorIPKcNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEEESaINS5_9sub_matchISB_EEENS5_12regex_traitsIcEELb0EE10_M_is_wordEcE3__s at Base 0.0+git20201007.df79403 - _ZZNKSt8__detail9_ExecutorIN9__gnu_cxx17__normal_iteratorIPKcNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEEESaINS5_9sub_matchISB_EEENS5_12regex_traitsIcEELb1EE10_M_is_wordEcE3__s at Base 0.0+git20201007.df79403 - _ZZNSt19_Sp_make_shared_tag5_S_tiEvE5__tag at Base 0.0+git20201007.df79403 - (optional)_ZZNSt8__detail9_CompilerINSt7__cxx1112regex_traitsIcEEE18_M_expression_termILb1ELb0EEEbRNS4_13_BracketStateERNS_15_BracketMatcherIS3_XT_EXT0_EEEENKUlcE_clEc at Base 0.0+git20230629.b770bb2 - (optional)_ZZNSt8__detail9_CompilerINSt7__cxx1112regex_traitsIcEEE18_M_expression_termILb1ELb1EEEbRNS4_13_BracketStateERNS_15_BracketMatcherIS3_XT_EXT0_EEEENKUlcE_clEc at Base 0.0+git20230629.b770bb2 - pthread_create at Base 0.0+git20201007.df79403 ===================================== debian/patches/compiler.patch deleted ===================================== @@ -1,21 +0,0 @@ -Description: don't erase compiler environment variables. - This helps with testing alternative compilers, and it should also give a - little hand to cross-builds. -Author: ?tienne Mollier -Forwarded: not-needed -Last-Update: 2022-07-01 ---- -This patch header follows DEP-3: http://dep.debian.net/deps/dep3/ ---- libatomic-queue.orig/Makefile -+++ libatomic-queue/Makefile -@@ -31,8 +31,8 @@ - ld.clang := clang++ - ar.clang := ar - --CXX := ${cxx.${TOOLSET}} --CC := ${cc.${TOOLSET}} -+CXX ?= ${cxx.${TOOLSET}} -+CC ?= ${cc.${TOOLSET}} - LD := ${ld.${TOOLSET}} - AR := ${ar.${TOOLSET}} - ===================================== debian/patches/concurrentqueue.patch deleted ===================================== @@ -1,22 +0,0 @@ -Description: fix concurrentqueue.h import - For some reason, possibly Debian specific, the concurrentqueue include has - a moodycamel namespace straight in the libconcurrentqueue-dev path, which is - not compatible with what is currently specified in upstream source code. It's - a bit unclear right now whether the issue is in concurrentqueue or in the - libatomic-queue. -Author: ?tienne Mollier -Forwarded: no -Last-Update: 2023-07-18 ---- -This patch header follows DEP-3: http://dep.debian.net/deps/dep3/ ---- libatomic-queue.orig/src/moodycamel.h -+++ libatomic-queue/src/moodycamel.h -@@ -6,7 +6,7 @@ - - #include "benchmarks.h" - --#include -+#include - #include - - #include "atomic_queue/defs.h" ===================================== debian/patches/fix_unused_variable.patch deleted ===================================== @@ -1,42 +0,0 @@ -Author: Andreas Tille -Last-Update: 2020-10-23 -Description: Fix unused variable - ---- libatomic-queue.orig/src/benchmarks.cc -+++ libatomic-queue/src/benchmarks.cc -@@ -180,7 +180,7 @@ - cycles_t expected = 0; - t0->compare_exchange_strong(expected, __builtin_ia32_rdtsc(), std::memory_order_acq_rel, std::memory_order_relaxed); - -- region_guard_t guard; -+ //region_guard_t guard; - ProducerOf producer{*queue}; - for(unsigned n = 1, stop = N + 1; n <= stop; ++n) - producer.push(*queue, n); -@@ -191,7 +191,7 @@ - unsigned const stop = N + 1; - sum_t sum = 0; - -- region_guard_t guard; -+ //region_guard_t guard; - ConsumerOf consumer{*queue}; - for(;;) { - unsigned n = consumer.pop(*queue); -@@ -393,7 +393,7 @@ - template - void ping_pong_thread_impl(Queue* q1, Queue* q2, unsigned N, cycles_t* time, std::false_type /*sender*/) { - cycles_t t0 = __builtin_ia32_rdtsc(); -- region_guard_t guard; -+ //region_guard_t guard; - ConsumerOf consumer_q1{*q1}; - ProducerOf producer_q2{*q2}; - for(unsigned i = 1, j = 0; j < N; ++i) { -@@ -407,7 +407,7 @@ - template - void ping_pong_thread_impl(Queue* q1, Queue* q2, unsigned N, cycles_t* time, std::true_type /*sender*/) { - cycles_t t0 = __builtin_ia32_rdtsc(); -- region_guard_t guard; -+ //region_guard_t guard; - ProducerOf producer_q1{*q1}; - ConsumerOf consumer_q2{*q2}; - for(unsigned i = 1, j = 0; j < N; ++i) { ===================================== debian/patches/generate-shared-library.patch deleted ===================================== @@ -1,91 +0,0 @@ -Author: Nilesh Patra , - Andreas Tille -Reviewed-By: ?tienne Mollier -Last-Update: 2024-08-23 -Description: add rules to generate a shared library. - ---- libatomic-queue.orig/Makefile -+++ libatomic-queue/Makefile -@@ -19,6 +19,7 @@ - TOOLSET := gcc - - build_dir := ${CURDIR}/build/${BUILD}/${TOOLSET} -+build_dir_shared := ${CURDIR}/build_shared/${BUILD}/${TOOLSET} - - cxx.gcc := g++ - cc.gcc := gcc -@@ -75,7 +76,8 @@ - PREPROCESS.CXX = ${CXX} -o $@ -E ${cppflags} ${cxxflags} $(abspath $<) - COMPILE.C = ${CC} -o $@ -c ${cppflags} ${cflags} -MD -MP $(abspath $<) - LINK.EXE = ${LD} -o $@ $(ldflags) $(filter-out ${relink},$^) $(ldlibs) --LINK.SO = ${LD} -o $@ -shared $(ldflags) $(filter-out ${relink},$^) $(ldlibs) -+SOVERSION := 0 -+LINK.SO = ${LD} -o $@.$(SOVERSION) -shared -Wl,-soname,`basename $@`.$(SOVERSION) $(ldflags) $(filter-out Makefile,$^) $(ldlibs) - LINK.A = ${AR} rscT $@ $(filter-out ${relink},$^) - - ifneq (,$(findstring n,$(firstword -${MAKEFLAGS}))) -@@ -90,9 +92,17 @@ - - all : ${exes} - --${exes} : % : ${build_dir}/% -+${exes} : % : ${build_dir}/% ${build_dir}/libatomic_queue.a ${build_dir_shared}/libatomic_queue.so - ln -sf ${<:${CURDIR}/%=%} - -+${build_dir}/libatomic_queue.a : $(addprefix ${build_dir}/,cpu_base_frequency.o huge_pages.o) -+-include ${build_dir}/cpu_base_frequency.d -+-include ${build_dir}/huge_pages.d -+ -+${build_dir_shared}/libatomic_queue.so : $(addprefix ${build_dir_shared}/,cpu_base_frequency.o huge_pages.o) -+-include ${build_dir_shared}/cpu_base_frequency.d -+-include ${build_dir_shared}/huge_pages.d -+ - benchmarks_src := benchmarks.cc cpu_base_frequency.cc huge_pages.cc - ${build_dir}/benchmarks : cppflags += ${cppflags.tbb} ${cppflags.moodycamel} ${cppflags.xenium} - ${build_dir}/benchmarks : ldlibs += ${ldlibs.tbb} ${ldlibs.moodycamel} ${ldlibs.xenium} -ldl -@@ -112,9 +122,10 @@ - $(call strip2,${LINK.EXE}) - -include ${example_src:%.cc=${build_dir}/%.d} - --${build_dir}/%.so : cxxflags += -fPIC --${build_dir}/%.so : ${relink} | ${build_dir} -- $(call strip2,${LINK.SO}) -+${build_dir_shared}/%.so : cxxflags += -fPIC -+${build_dir_shared}/%.so : Makefile | ${build_dir_shared} -+ ${LINK.SO} -+ ln -s `basename $@`.$(SOVERSION) $@ - - ${build_dir}/%.a : ${relink} | ${build_dir} - $(call strip2,${LINK.A}) -@@ -125,6 +136,12 @@ - ${build_dir}/%.o : src/%.c ${recompile} | ${build_dir} - $(call strip2,${COMPILE.C}) - -+${build_dir_shared}/%.o : src/%.cc Makefile | ${build_dir_shared} -+ $(call strip2,${COMPILE.CXX}) -+ -+${build_dir_shared}/%.o : src/%.c Makefile | ${build_dir_shared} -+ $(call strip2,${COMPILE.C}) -+ - ${build_dir}/%.S : cppflags += ${cppflags.tbb} ${cppflags.moodycamel} ${cppflags.xenium} - ${build_dir}/%.S : src/%.cc ${recompile} | ${build_dir} - $(call strip2,${COMPILE.S}) -@@ -139,6 +156,10 @@ - ${build_dir} ${build_dir}/.make: - mkdir -p $@ - -+${build_dir_shared}/.make : | ${build_dir_shared} -+${build_dir_shared} ${build_dir_shared}/.make: -+ mkdir -p $@ -+ - ver = "$(shell ${1} --version | head -n1)" - # Trigger recompilation when compiler environment change. - env.compile := $(call ver,${CXX}) ${cppflags} ${cxxflags} ${cppflags.tbb} ${cppflags.moodycamel} ${cppflags.xenium} -@@ -175,6 +196,7 @@ - - clean : - rm -rf ${build_dir} ${exes} -+ rm -rf ${build_dir_shared} - - versions: - ${MAKE} --version | awk 'FNR<2' ===================================== debian/patches/no-native deleted ===================================== @@ -1,32 +0,0 @@ -Author: Michael R. Crusoe -Description: Don't build with -m{arch,tune}=native -Bug-Debian: https://bugs.debian.org/987532 -Forwarded: not-needed - -It violates Debian's architectual baseline and causes reproducibilty problems ---- libatomic-queue.orig/Makefile -+++ libatomic-queue/Makefile -@@ -37,18 +37,18 @@ - AR := ${ar.${TOOLSET}} - - cxxflags.gcc.debug := -Og -fstack-protector-all -fno-omit-frame-pointer # -D_GLIBCXX_DEBUG --cxxflags.gcc.release := -O3 -mtune=native -ffast-math -falign-{functions,loops}=64 -DNDEBUG -+cxxflags.gcc.release := -O3 -ffast-math -falign-{functions,loops}=64 -DNDEBUG - cxxflags.gcc.sanitize := ${cxxflags.gcc.release} -fsanitize=thread --cxxflags.gcc := -pthread -march=native -std=gnu++14 -W{all,extra,error,no-{maybe-uninitialized,unused-variable,unused-function,unused-local-typedefs,error=array-bounds}} -g -fmessage-length=0 ${cxxflags.gcc.${BUILD}} -+cxxflags.gcc := -pthread -std=gnu++14 -W{all,extra,error,no-{maybe-uninitialized,unused-variable,unused-function,unused-local-typedefs,error=array-bounds}} -g -fmessage-length=0 ${cxxflags.gcc.${BUILD}} - ldflags.gcc.sanitize := ${ldflags.gcc.release} -fsanitize=thread - ldflags.gcc := ${ldflags.gcc.${BUILD}} - --cflags.gcc := -pthread -march=native -W{all,extra} -g -fmessage-length=0 ${cxxflags.gcc.${BUILD}} -+cflags.gcc := -pthread -W{all,extra} -g -fmessage-length=0 ${cxxflags.gcc.${BUILD}} - - cxxflags.clang.debug := -O0 -fstack-protector-all --cxxflags.clang.release := -O3 -mtune=native -ffast-math -falign-functions=64 -DNDEBUG -+cxxflags.clang.release := -O3 -ffast-math -falign-functions=64 -DNDEBUG - cxxflags.clang.sanitize := ${cxxflags.clang.release} -fsanitize=thread --cxxflags.clang := -stdlib=libstdc++ -pthread -march=native -std=gnu++14 -W{all,extra,error,no-{unused-variable,unused-function,unused-local-typedefs}} -g -fmessage-length=0 ${cxxflags.clang.${BUILD}} -+cxxflags.clang := -stdlib=libstdc++ -pthread -std=gnu++14 -W{all,extra,error,no-{unused-variable,unused-function,unused-local-typedefs}} -g -fmessage-length=0 ${cxxflags.clang.${BUILD}} - ldflags.clang.sanitize := ${ldflags.clang.release} -fsanitize=thread - ldflags.clang := -stdlib=libstdc++ ${ldflags.clang.${BUILD}} - ===================================== debian/patches/no_thin_archives.patch deleted ===================================== @@ -1,17 +0,0 @@ -Author: Andreas Tille -Last-Update: 2021-12-21 -Description: The build system is set up to produce "thin" archives - that can't stand on their own -Origin: https://lists.debian.org/debian-med/2021/12/msg00131.html - ---- libatomic-queue.orig/Makefile -+++ libatomic-queue/Makefile -@@ -78,7 +78,7 @@ - LINK.EXE = ${LD} -o $@ $(ldflags) $(filter-out ${relink},$^) $(ldlibs) - SOVERSION := 0 - LINK.SO = ${LD} -o $@.$(SOVERSION) -shared -Wl,-soname,`basename $@`.$(SOVERSION) $(ldflags) $(filter-out Makefile,$^) $(ldlibs) --LINK.A = ${AR} rscT $@ $(filter-out ${relink},$^) -+LINK.A = ${AR} rsc $@ $(filter-out ${relink},$^) - - ifneq (,$(findstring n,$(firstword -${MAKEFLAGS}))) - # Perform bash parameter expansion when --just-print for rtags. ===================================== debian/patches/series deleted ===================================== @@ -1,6 +0,0 @@ -fix_unused_variable.patch -generate-shared-library.patch -no-native -no_thin_archives.patch -compiler.patch -concurrentqueue.patch ===================================== debian/rules ===================================== @@ -1,21 +1,4 @@ #!/usr/bin/make -f -export DEB_BUILD_MAINT_OPTIONS = optimize=+lto %: - dh $@ - -override_dh_install: - dh_install - mv `find . -name "*.a"` `dirname $$(find . -name "*.so")` - d-shlibmove --commit \ - --multiarch \ - --devunversioned \ - --exclude-la \ - --movedev include usr \ - $$(find . -name "*.so") - rm -vf debian/libatomic-queue-dev/usr/include/CMakeLists.txt - -override_dh_auto_test: -ifeq (,$(filter nocheck,$(DEB_BUILD_OPTIONS))) - $(MAKE) example run_tests -endif + dh $@ -Smeson ===================================== debian/salsa-ci.yml ===================================== @@ -1,8 +1,4 @@ --- include: - - https://salsa.debian.org/salsa-ci-team/pipeline/raw/master/salsa-ci.yml - - https://salsa.debian.org/salsa-ci-team/pipeline/raw/master/pipeline-jobs.yml - -# Build-Depends on libxenium-dev which is not available on i386 -variables: - SALSA_CI_DISABLE_BUILD_PACKAGE_I386: 1 + - https://salsa.debian.org/salsa-ci-team/pipeline/raw/master/salsa-ci.yml + - https://salsa.debian.org/salsa-ci-team/pipeline/raw/master/pipeline-jobs.yml ===================================== debian/tests/control ===================================== @@ -1,3 +1,2 @@ Tests: run-unit-test -Depends: libatomic-queue-dev, libboost-test-dev, g++ -Restrictions: allow-stderr +Depends: g++, meson, pkgconf, libatomic-queue-dev, libboost-test-dev ===================================== debian/tests/run-unit-test ===================================== @@ -1,18 +1,20 @@ #!/bin/bash set -e -pkg=libatomic-queue +# Copy tests to temporary directory +cp src/tests.cc "${AUTOPKGTEST_TMP}"/ +cd ${AUTOPKGTEST_TMP} -export LC_ALL=C.UTF-8 -if [ "${AUTOPKGTEST_TMP}" = "" ] ; then - AUTOPKGTEST_TMP=$(mktemp -d /tmp/${pkg}-test.XXXXXX) - trap "rm -rf ${AUTOPKGTEST_TMP}" 0 INT QUIT ABRT PIPE TERM -fi +# Create meson file +cat > $AUTOPKGTEST_TMP/meson.build << EOL +project('atomic_queue_tests', 'cpp') +atomic_queue_dep = dependency('atomic_queue') +boost_dep = dependency('boost', modules: ['unit_test_framework']) +atomic_queue_tests_exe = executable('atomic_queue_tests', 'tests.cc', dependencies: [atomic_queue_dep, boost_dep]) +test('atomic_queue_tests', atomic_queue_tests_exe) +EOL -cp Makefile "${AUTOPKGTEST_TMP}"/ -mkdir "${AUTOPKGTEST_TMP}/src" -cp src/tests.cc "${AUTOPKGTEST_TMP}/src/" - -cd "${AUTOPKGTEST_TMP}" - -make run_tests +# Compile and run test +meson setup build +meson compile -C build +meson test -C build ===================================== include/atomic_queue/atomic_queue.h ===================================== @@ -334,7 +334,7 @@ public: } bool was_full() const noexcept { - return was_size() >= static_cast(static_cast(*this).size_); + return was_size() >= capacity(); } unsigned was_size() const noexcept { ===================================== include/atomic_queue/defs.h ===================================== @@ -56,6 +56,14 @@ static inline void spin_loop_pause() noexcept { asm volatile (".insn i 0x0F, 0, x0, x0, 0x010"); } } // namespace atomic_queue +#elif defined(__loongarch__) +namespace atomic_queue { +constexpr int CACHE_LINE_SIZE = 64; +static inline void spin_loop_pause() noexcept +{ + asm volatile("nop \n nop \n nop \n nop \n nop \n nop \n nop \n nop"); +} +} // namespace atomic_queue #else #ifdef _MSC_VER #pragma message("Unknown CPU architecture. Using L1 cache line size of 64 bytes and no spinloop pause instruction.") ===================================== meson.build ===================================== @@ -1,6 +1,6 @@ # Copyright (c) 2019 Maxim Egorushkin. MIT License. See the full licence in file LICENSE. -# (rm -rf build; meson build; cd build; time ninja -v) +# (rm -rf build; meson setup build; time ninja -C build -v) project( 'atomic_queue', 'cpp', @@ -8,35 +8,63 @@ project( default_options : ['cpp_std=gnu++14', 'buildtype=release', 'b_ndebug=if-release'] ) -cxx = meson.get_compiler('cpp') -dl = cxx.find_library('dl', required : true) -threads = dependency('threads') -unit_test_framework = dependency('boost', modules : ['unit_test_framework']) -if get_option('benchmarks') - tbb = cxx.find_library('tbb', required : true) - xenium = declare_dependency(include_directories : '../xenium') - moodycamel = declare_dependency(include_directories : '../') -endif +threads_dep = dependency('threads') -atomic_queue = declare_dependency(include_directories : ['include'], dependencies : threads) +atomic_queue_dep = declare_dependency(include_directories : ['include'], dependencies : threads_dep) -tests_exe = executable( - 'tests', - 'src/tests.cc', - dependencies : [atomic_queue, unit_test_framework] -) -test('tests', tests_exe) +if get_option('tests') + unit_test_framework_dep = dependency('boost', modules : ['unit_test_framework']) -example_exe = executable( - 'example', - 'src/example.cc', - dependencies : [atomic_queue] -) + tests_exe = executable( + 'tests', + 'src/tests.cc', + dependencies : [atomic_queue_dep, unit_test_framework_dep], + ) + test('tests', tests_exe) + + example_exe = executable( + 'example', + 'src/example.cc', + dependencies : [atomic_queue_dep], + ) + test('example', example_exe) +endif if get_option('benchmarks') + incompatible_cpp_std = ['c++98', 'c++03', 'c++11', 'c++14', 'gnu++03', 'gnu++11', 'gnu++14', 'vc++14'] + if incompatible_cpp_std.contains(get_option('cpp_std')) + error('Benchmarks require C++17 or higher') + endif + + cxx = meson.get_compiler('cpp') + dl_dep = cxx.find_library('dl') + xenium_dep = declare_dependency(include_directories : '../xenium') + boost_dep = dependency('boost') + tbb_dep = cxx.find_library('tbb') + moodycamel_dep = declare_dependency(include_directories : '../') + benchmarks_exe = executable( 'benchmarks', ['src/benchmarks.cc', 'src/cpu_base_frequency.cc', 'src/huge_pages.cc'], - dependencies : [atomic_queue, xenium, moodycamel, tbb, dl] + include_directories : ['src'], + dependencies : [atomic_queue_dep, dl_dep, xenium_dep, boost_dep, tbb_dep, moodycamel_dep], ) + benchmark('benchmarks', benchmarks_exe) endif + +install_headers( + files( + 'include/atomic_queue/atomic_queue.h', + 'include/atomic_queue/atomic_queue_mutex.h', + 'include/atomic_queue/barrier.h', + 'include/atomic_queue/defs.h', + 'include/atomic_queue/spinlock.h', + ), + subdir: 'atomic_queue' +) +pkg = import('pkgconfig') +pkg.generate( + name: 'atomic_queue', + description: 'C++14 multiple-producer-multiple-consumer lock-free queues based on circular buffers', + libraries: [threads_dep] +) ===================================== meson_options.txt ===================================== @@ -1,2 +1,4 @@ -option('benchmarks', type : 'boolean', value : true, - description : 'Do not build benchmarks; ignore their dependencies') +option('benchmarks', type : 'boolean', value : false, + description : 'Build benchmarks (requires Boost, TBB, Xenium, moodycamel and C++17)') +option('tests', type : 'boolean', value : true, + description : 'Build tests and example (requires Boost)') ===================================== src/tests.cc ===================================== @@ -6,7 +6,6 @@ #include #include "atomic_queue/atomic_queue.h" -#include "atomic_queue/atomic_queue_mutex.h" #include "atomic_queue/barrier.h" #include @@ -250,6 +249,8 @@ BOOST_AUTO_TEST_CASE(try_push) { BOOST_AUTO_TEST_CASE(size) { atomic_queue::RetryDecorator> q(10); BOOST_CHECK_EQUAL(q.capacity(), CACHE_LINE_SIZE * CACHE_LINE_SIZE); + BOOST_CHECK(q.was_empty()); + BOOST_CHECK(!q.was_full()); } BOOST_AUTO_TEST_CASE(power_of_2) { View it on GitLab: https://salsa.debian.org/med-team/libatomic-queue/-/compare/7b31c445db9bdbb8548e41bbee63745e8c062f1e...ad2de3d8a3d151513720a8337006834b46b65298 -- View it on GitLab: https://salsa.debian.org/med-team/libatomic-queue/-/compare/7b31c445db9bdbb8548e41bbee63745e8c062f1e...ad2de3d8a3d151513720a8337006834b46b65298 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Tue Jun 24 20:12:22 2025 From: gitlab at salsa.debian.org (Stephan Lachnit (@stephanlachnit)) Date: Tue, 24 Jun 2025 19:12:22 +0000 Subject: [med-svn] [Git][med-team/libatomic-queue][upstream] New upstream version 1.6.9 Message-ID: <685af8963925e_3db1c73b77c5198960@godard.mail> Stephan Lachnit pushed to branch upstream at Debian Med / libatomic-queue Commits: f2b7705e by Stephan Lachnit at 2025-06-24T20:31:38+02:00 New upstream version 1.6.9 - - - - - 10 changed files: - + .github/workflows/ci-meson.yml - .github/workflows/ci.yml - CONTRIBUTORS.txt - Makefile - README.md - include/atomic_queue/atomic_queue.h - include/atomic_queue/defs.h - meson.build - meson_options.txt - src/tests.cc Changes: ===================================== .github/workflows/ci-meson.yml ===================================== @@ -0,0 +1,34 @@ +name: Meson Continuous Integrations + +on: + push: + branches: [ master ] + pull_request: + branches: [ master ] + +jobs: + build-and-test: + strategy: + fail-fast: false + matrix: + cpp_compiler: [g++, clang++] + sanitize: [address ,undefined, thread] + + runs-on: ubuntu-latest + + steps: + - uses: actions/checkout at v4 + + - name: Install Meson and Boost.Test + run: sudo apt-get --quiet --yes install meson libboost-test-dev + + - name: Setup + env: + CXX: ${{ matrix.cpp_compiler }} + run: meson setup build -Dwerror=true -Dwarning_level=3 -Db_sanitize=${{ matrix.sanitize }} + + - name: Compile + run: meson compile -C build + + - name: Test + run: meson test -C build --print-errorlogs ===================================== .github/workflows/ci.yml ===================================== @@ -11,11 +11,7 @@ jobs: strategy: matrix: toolset: [gcc, clang] - os: [ubuntu-20.04, ubuntu-22.04, ubuntu-24.04] - include: - - sanitize: 1 - - os: ubuntu-20.04 # Work-around for https://bugs.launchpad.net/ubuntu/+source/gcc-10/+bug/2029910 - sanitize: 0 + os: [ubuntu-22.04, ubuntu-24.04] runs-on: ${{ matrix.os }} ===================================== CONTRIBUTORS.txt ===================================== @@ -18,3 +18,10 @@ Contributors: - Yvan (https://github.com/max0x7ba/atomic_queue/pull/63) - Luiz Feldmann (https://github.com/max0x7ba/atomic_queue/pull/72) - dummyunit (https://github.com/max0x7ba/atomic_queue/pull/73) +- NakanoMiku (https://github.com/max0x7ba/atomic_queue/pull/74) +- Stephan Lachnit (https://github.com/max0x7ba/atomic_queue/pull/77) +- Stephan Lachnit (https://github.com/max0x7ba/atomic_queue/pull/78) +- Stephan Lachnit (https://github.com/max0x7ba/atomic_queue/pull/79) +- Stephan Lachnit (https://github.com/max0x7ba/atomic_queue/pull/80) +- Stephan Lachnit (https://github.com/max0x7ba/atomic_queue/pull/81) +- Stephan Lachnit (https://github.com/max0x7ba/atomic_queue/pull/82) ===================================== Makefile ===================================== @@ -38,23 +38,24 @@ AR := ${ar.${TOOLSET}} cxxflags.gcc.debug := -Og -fstack-protector-all -fno-omit-frame-pointer # -D_GLIBCXX_DEBUG cxxflags.gcc.release := -O3 -mtune=native -ffast-math -falign-{functions,loops}=64 -DNDEBUG cxxflags.gcc.sanitize := ${cxxflags.gcc.release} -fsanitize=thread -cxxflags.gcc := -pthread -march=native -std=gnu++14 -W{all,extra,error,no-{maybe-uninitialized,unused-variable,unused-function,unused-local-typedefs,error=array-bounds}} -g -fmessage-length=0 ${cxxflags.gcc.${BUILD}} +cxxflags.gcc := -std=gnu++14 -pthread -march=native -W{all,extra,error,no-{array-bounds,maybe-uninitialized,unused-variable,unused-function,unused-local-typedefs}} -fmessage-length=0 ${cxxflags.gcc.${BUILD}} ldflags.gcc.sanitize := ${ldflags.gcc.release} -fsanitize=thread ldflags.gcc := ${ldflags.gcc.${BUILD}} -cflags.gcc := -pthread -march=native -W{all,extra} -g -fmessage-length=0 ${cxxflags.gcc.${BUILD}} +cflags.gcc := -pthread -march=native -W{all,extra} -fmessage-length=0 ${cxxflags.gcc.${BUILD}} cxxflags.clang.debug := -O0 -fstack-protector-all cxxflags.clang.release := -O3 -mtune=native -ffast-math -falign-functions=64 -DNDEBUG cxxflags.clang.sanitize := ${cxxflags.clang.release} -fsanitize=thread -cxxflags.clang := -stdlib=libstdc++ -pthread -march=native -std=gnu++14 -W{all,extra,error,no-{unused-variable,unused-function,unused-local-typedefs}} -g -fmessage-length=0 ${cxxflags.clang.${BUILD}} +cxxflags.clang := -std=gnu++14 -pthread -march=native -stdlib=libstdc++ -W{all,extra,error,no-{unused-variable,unused-function,unused-local-typedefs}} -fmessage-length=0 ${cxxflags.clang.${BUILD}} ldflags.clang.sanitize := ${ldflags.clang.release} -fsanitize=thread +ldflags.clang.debug := -latomic ldflags.clang := -stdlib=libstdc++ ${ldflags.clang.${BUILD}} # Additional CPPFLAGS, CXXFLAGS, CFLAGS, LDLIBS, LDFLAGS can come from the command line, e.g. make CPPFLAGS='-I', or from environment variables. -cxxflags := ${cxxflags.${TOOLSET}} ${CXXFLAGS} -cflags := ${cflags.${TOOLSET}} ${CFLAGS} -cppflags := ${CPPFLAGS} -Iinclude +cxxflags := ${cxxflags.${TOOLSET}} -g ${CXXFLAGS} +cflags := ${cflags.${TOOLSET}} -g ${CFLAGS} +cppflags := -Iinclude ${CPPFLAGS} ldflags := -fuse-ld=gold -pthread -g ${ldflags.${TOOLSET}} ${LDFLAGS} ldlibs := -lrt ${LDLIBS} @@ -65,14 +66,13 @@ cppflags.moodycamel := -I$(abspath ..) ldlibs.moodycamel := cppflags.xenium := -I${abspath ../xenium} +cxxflags.xenium := -std=gnu++17 ldlibs.xenium := recompile := ${build_dir}/.make/recompile relink := ${build_dir}/.make/relink COMPILE.CXX = ${CXX} -o $@ -c ${cppflags} ${cxxflags} -MD -MP $(abspath $<) -COMPILE.S = ${CXX} -o- -S -fverbose-asm -masm=intel ${cppflags} ${cxxflags} $(abspath $<) | c++filt | egrep -v '^[[:space:]]*\.(loc|cfi|L[A-Z])' > $@ -PREPROCESS.CXX = ${CXX} -o $@ -E ${cppflags} ${cxxflags} $(abspath $<) COMPILE.C = ${CC} -o $@ -c ${cppflags} ${cflags} -MD -MP $(abspath $<) LINK.EXE = ${LD} -o $@ $(ldflags) $(filter-out ${relink},$^) $(ldlibs) LINK.SO = ${LD} -o $@ -shared $(ldflags) $(filter-out ${relink},$^) $(ldlibs) @@ -86,15 +86,17 @@ else strip2 = $(strip ${1}) endif +# +# Build targets definitions begin. +# + exes := benchmarks tests example all : ${exes} -${exes} : % : ${build_dir}/% - ln -sf ${<:${CURDIR}/%=%} - benchmarks_src := benchmarks.cc cpu_base_frequency.cc huge_pages.cc ${build_dir}/benchmarks : cppflags += ${cppflags.tbb} ${cppflags.moodycamel} ${cppflags.xenium} +${build_dir}/benchmarks : cxxflags += ${cxxflags.tbb} ${cxxflags.moodycamel} ${cxxflags.xenium} ${build_dir}/benchmarks : ldlibs += ${ldlibs.tbb} ${ldlibs.moodycamel} ${ldlibs.xenium} -ldl ${build_dir}/benchmarks : ${benchmarks_src:%.cc=${build_dir}/%.o} ${relink} | ${build_dir} $(call strip2,${LINK.EXE}) @@ -112,6 +114,13 @@ ${build_dir}/example : ${example_src:%.cc=${build_dir}/%.o} ${relink} | ${build_ $(call strip2,${LINK.EXE}) -include ${example_src:%.cc=${build_dir}/%.d} +# +# Build targets definitions end. +# + +${exes} : % : ${build_dir}/% + ln -sf ${<:${CURDIR}/%=%} + ${build_dir}/%.so : cxxflags += -fPIC ${build_dir}/%.so : ${relink} | ${build_dir} $(call strip2,${LINK.SO}) @@ -125,14 +134,6 @@ ${build_dir}/%.o : src/%.cc ${recompile} | ${build_dir} ${build_dir}/%.o : src/%.c ${recompile} | ${build_dir} $(call strip2,${COMPILE.C}) -${build_dir}/%.S : cppflags += ${cppflags.tbb} ${cppflags.moodycamel} ${cppflags.xenium} -${build_dir}/%.S : src/%.cc ${recompile} | ${build_dir} - $(call strip2,${COMPILE.S}) - -${build_dir}/%.I : cppflags += ${cppflags.tbb} ${cppflags.moodycamel} ${cppflags.xenium} -${build_dir}/%.I : src/%.cc ${recompile} | ${build_dir} - $(call strip2,${PREPROCESS.CXX}) - ${build_dir}/%.d : ; ${build_dir}/.make : | ${build_dir} @@ -141,7 +142,7 @@ ${build_dir} ${build_dir}/.make: ver = "$(shell ${1} --version | head -n1)" # Trigger recompilation when compiler environment change. -env.compile := $(call ver,${CXX}) ${cppflags} ${cxxflags} ${cppflags.tbb} ${cppflags.moodycamel} ${cppflags.xenium} +env.compile := $(call ver,${CXX}) ${cppflags} ${cxxflags} ${cppflags.tbb} ${cppflags.moodycamel} ${cppflags.xenium} ${cxxflags.tbb} ${cxxflags.moodycamel} ${cxxflags.xenium} # Trigger relink when linker environment change. env.link := $(call ver,${LD}) ${ldflags} ${ldlibs} ${ldlibs.tbb} ${ldlibs.moodycamel} ${ldlibs.xenium} @@ -174,7 +175,7 @@ rtags : ${MAKE} --always-make --just-print all | { rtags-rc -c -; true; } clean : - rm -rf ${build_dir} ${exes} + rm -rf ${exes} ${build_dir} versions: ${MAKE} --version | awk 'FNR<2' @@ -184,3 +185,10 @@ env : env | sort --ignore-case .PHONY : update_env_txt env versions rtags run_benchmarks clean all run_% +.DELETE_ON_ERROR: +.SECONDARY: +.SUFFIXES: + +# Local Variables: +# compile-command: "/bin/time make -rC ~/src/atomic_queue -j$(($(nproc)/2)) BUILD=debug run_tests" +# End: ===================================== README.md ===================================== @@ -7,6 +7,7 @@
              [![Makefile Continuous Integrations](https://github.com/max0x7ba/atomic_queue/actions/workflows/ci.yml/badge.svg)](https://github.com/max0x7ba/atomic_queue/actions/workflows/ci.yml) [![CMake Continuous Integrations](https://github.com/max0x7ba/atomic_queue/actions/workflows/cmake-gcc-clang.yml/badge.svg)](https://github.com/max0x7ba/atomic_queue/actions/workflows/cmake-gcc-clang.yml) +[![Meson Continuous Integrations](https://github.com/max0x7ba/atomic_queue/actions/workflows/ci-meson.yml/badge.svg)](https://github.com/max0x7ba/atomic_queue/actions/workflows/ci-meson.yml)
              ![platform Linux x86_64](https://img.shields.io/badge/platform-Linux%20x86_64--bit-yellow) ![platform Linux ARM](https://img.shields.io/badge/platform-Linux%20ARM-yellow) @@ -15,13 +16,17 @@ ![platform Linux IBM System/390](https://img.shields.io/badge/platform-Linux%20IBM%20System/390-yellow) # atomic_queue -C++14 multiple-producer-multiple-consumer *lock-free* queues based on circular buffer and [`std::atomic`][3]. Designed with a goal to minimize the latency between one thread pushing an element into a queue and another thread popping it from the queue. +C++14 multiple-producer-multiple-consumer *lock-free* queues based on circular buffers and [`std::atomic`][3]. -It has been developed, tested and benchmarked on Linux, but should support any C++14 platforms which implement `std::atomic`. Reported as compatible with Windows, but the continuous integrations hosted by GitHub are currently set up only for x86_64 platform on Ubuntu-20.04 and Ubuntu-22.04. Pull requests to extend the [continuous integrations][18] to run on other architectures and/or platforms are welcome. +Designed with a goal to minimize the latency between one thread pushing an element into a queue and another thread popping it from the queue. + +It has been developed, tested and benchmarked on Linux, but should support any C++14 platforms which implement `std::atomic`. Reported as compatible with Windows, but the continuous integrations hosted by GitHub are currently set up only for x86_64 platform on Ubuntu-22.04 and Ubuntu-24.04. Pull requests to extend the [continuous integrations][18] to run on other architectures and/or platforms are welcome. ## Design Principles When minimizing latency a good design is not when there is nothing left to add, but rather when there is nothing left to remove, as these queues exemplify. +Minimizing latency naturally maximizes throughput. Low latency reciprocal is high throuhput, in ideal mathematical and practical engineering sense. Low latency is incompatible with any delays and/or batching, which destroy original (hardware) global time order of events pushed into one queue by different threads. Maximizing throughput, on the other hand, can be done at expense of latency by delaying and batching multiple updates. + The main design principle these queues follow is _minimalism_, which results in such design choices as: * Bare minimum of atomic instructions. Inlinable by default push and pop functions can hardly be any cheaper in terms of CPU instruction number / L1i cache pressure. @@ -38,20 +43,6 @@ These design choices are also limitations: Ultra-low-latency applications need just that and nothing more. The minimalism pays off, see the [throughput and latency benchmarks][1]. -Available containers are: -* `AtomicQueue` - a fixed size ring-buffer for atomic elements. -* `OptimistAtomicQueue` - a faster fixed size ring-buffer for atomic elements which busy-waits when empty or full. It is `AtomicQueue` used with `push`/`pop` instead of `try_push`/`try_pop`. -* `AtomicQueue2` - a fixed size ring-buffer for non-atomic elements. -* `OptimistAtomicQueue2` - a faster fixed size ring-buffer for non-atomic elements which busy-waits when empty or full. It is `AtomicQueue2` used with `push`/`pop` instead of `try_push`/`try_pop`. - -These containers have corresponding `AtomicQueueB`, `OptimistAtomicQueueB`, `AtomicQueueB2`, `OptimistAtomicQueueB2` versions where the buffer size is specified as an argument to the constructor. - -Totally ordered mode is supported. In this mode consumers receive messages in the same FIFO order the messages were posted. This mode is supported for `push` and `pop` functions, but for not the `try_` versions. On Intel x86 the totally ordered mode has 0 cost, as of 2019. - -Single-producer-single-consumer mode is supported. In this mode, no expensive atomic read-modify-write CPU instructions are necessary, only the cheapest atomic loads and stores. That improves queue throughput significantly. - -Move-only queue element types are fully supported. For example, a queue of `std::unique_ptr` elements would be `AtomicQueue2B>` or `AtomicQueue2, CAPACITY>`. - ## Role Models Several other well established and popular thread-safe containers are used for reference in the [benchmarks][1]: * `std::mutex` - a fixed size ring-buffer with `std::mutex`. @@ -102,7 +93,30 @@ make -r -j4 run_benchmarks The benchmark also requires Intel TBB library to be available. It assumes that it is installed in `/usr/local/include` and `/usr/local/lib`. If it is installed elsewhere you may like to modify `cppflags.tbb` and `ldlibs.tbb` in `Makefile`. -# API +# Library contents +## Available queues +* `AtomicQueue` - a fixed size ring-buffer for atomic elements. +* `OptimistAtomicQueue` - a faster fixed size ring-buffer for atomic elements which busy-waits when empty or full. It is `AtomicQueue` used with `push`/`pop` instead of `try_push`/`try_pop`. +* `AtomicQueue2` - a fixed size ring-buffer for non-atomic elements. +* `OptimistAtomicQueue2` - a faster fixed size ring-buffer for non-atomic elements which busy-waits when empty or full. It is `AtomicQueue2` used with `push`/`pop` instead of `try_push`/`try_pop`. + +These containers have corresponding `AtomicQueueB`, `OptimistAtomicQueueB`, `AtomicQueueB2`, `OptimistAtomicQueueB2` versions where the buffer size is specified as an argument to the constructor. + +Totally ordered mode is supported. In this mode consumers receive messages in the same FIFO order the messages were posted. This mode is supported for `push` and `pop` functions, but for not the `try_` versions. On Intel x86 the totally ordered mode has 0 cost, as of 2019. + +Single-producer-single-consumer mode is supported. In this mode, no expensive atomic read-modify-write CPU instructions are necessary, only the cheapest atomic loads and stores. That improves queue throughput significantly. + +Move-only queue element types are fully supported. For example, a queue of `std::unique_ptr` elements would be `AtomicQueue2B>` or `AtomicQueue2, CAPACITY>`. + +## Queue schematics + +``` +queue-end queue-front +[newest-element, ..., oldest-element] +push() pop() +``` + +## Queue API The queue class templates provide the following member functions: * `try_push` - Appends an element to the end of the queue. Returns `false` when the queue is full. * `try_pop` - Removes an element from the front of the queue. Returns `false` when the queue is empty. @@ -121,15 +135,13 @@ Note that _optimism_ is a choice of a queue modification operation control flow, See [example.cc](src/example.cc) for a usage example. -TODO: full API reference. - +# Implementation Notes ## Memory order of non-atomic loads and stores `push` and `try_push` operations _synchronize-with_ (as defined in [`std::memory_order`][17]) with any subsequent `pop` or `try_pop` operation of the same queue object. Meaning that: * No non-atomic load/store gets reordered past `push`/`try_push`, which is a `memory_order::release` operation. Same memory order as that of `std::mutex::unlock`. * No non-atomic load/store gets reordered prior to `pop`/`try_pop`, which is a `memory_order::acquire` operation. Same memory order as that of `std::mutex::lock`. * The effects of a producer thread's non-atomic stores followed by `push`/`try_push` of an element into a queue become visible in the consumer's thread which `pop`/`try_pop` that particular element. -# Implementation Notes ## Ring-buffer capacity The available queues here use a ring-buffer array for storing elements. The capacity of the queue is fixed at compile time or construction time. @@ -190,6 +202,8 @@ There are a few OS behaviours that complicate benchmarking: * Real-time thread throttling disabled. * Adverse address space randomisation may cause extra CPU cache conflicts, as well as other processes running on the system. To minimise effects of that `benchmarks` executable is run at least 33 times. The benchmark charts display average values. The chart tooltip also displays the standard deviation, minimum and maximum values. +Benchmark performance of single-producer-single-consumer queues `boost::lockfree::spsc_queue`, `moodycamel::ReaderWriterQueue` and these queues in single-producer-single-consumer mode should be identical because they implement exactly the same algorithm using exactly the same atomic load and store instructions. `boost::lockfree::spsc_queue` implementation benchmarked at that time had no optimizations for minimizing L1d cache contention, cold branch misprediction or pipeline stalls from subtler issues noticable only in the generated assembly code. + I only have access to a few x86-64 machines. If you have access to different hardware feel free to submit the output file of `scripts/run-benchmarks.sh` and I will include your results into the benchmarks page. ### Huge pages @@ -216,7 +230,7 @@ One thread posts an integer to another thread through one queue and waits for a Contributions are more than welcome. `.editorconfig` and `.clang-format` can be used to automatically match code formatting. # Reading material -Some books on the subject of multi-threaded programming I found instructive: +Some books on the subject of multi-threaded programming I found quite instructive: * _Programming with POSIX Threads_ by David R. Butenhof. * _The Art of Multiprocessor Programming_ by Maurice Herlihy, Nir Shavit. ===================================== include/atomic_queue/atomic_queue.h ===================================== @@ -334,7 +334,7 @@ public: } bool was_full() const noexcept { - return was_size() >= static_cast(static_cast(*this).size_); + return was_size() >= capacity(); } unsigned was_size() const noexcept { ===================================== include/atomic_queue/defs.h ===================================== @@ -56,6 +56,14 @@ static inline void spin_loop_pause() noexcept { asm volatile (".insn i 0x0F, 0, x0, x0, 0x010"); } } // namespace atomic_queue +#elif defined(__loongarch__) +namespace atomic_queue { +constexpr int CACHE_LINE_SIZE = 64; +static inline void spin_loop_pause() noexcept +{ + asm volatile("nop \n nop \n nop \n nop \n nop \n nop \n nop \n nop"); +} +} // namespace atomic_queue #else #ifdef _MSC_VER #pragma message("Unknown CPU architecture. Using L1 cache line size of 64 bytes and no spinloop pause instruction.") ===================================== meson.build ===================================== @@ -1,6 +1,6 @@ # Copyright (c) 2019 Maxim Egorushkin. MIT License. See the full licence in file LICENSE. -# (rm -rf build; meson build; cd build; time ninja -v) +# (rm -rf build; meson setup build; time ninja -C build -v) project( 'atomic_queue', 'cpp', @@ -8,35 +8,63 @@ project( default_options : ['cpp_std=gnu++14', 'buildtype=release', 'b_ndebug=if-release'] ) -cxx = meson.get_compiler('cpp') -dl = cxx.find_library('dl', required : true) -threads = dependency('threads') -unit_test_framework = dependency('boost', modules : ['unit_test_framework']) -if get_option('benchmarks') - tbb = cxx.find_library('tbb', required : true) - xenium = declare_dependency(include_directories : '../xenium') - moodycamel = declare_dependency(include_directories : '../') -endif +threads_dep = dependency('threads') -atomic_queue = declare_dependency(include_directories : ['include'], dependencies : threads) +atomic_queue_dep = declare_dependency(include_directories : ['include'], dependencies : threads_dep) -tests_exe = executable( - 'tests', - 'src/tests.cc', - dependencies : [atomic_queue, unit_test_framework] -) -test('tests', tests_exe) +if get_option('tests') + unit_test_framework_dep = dependency('boost', modules : ['unit_test_framework']) -example_exe = executable( - 'example', - 'src/example.cc', - dependencies : [atomic_queue] -) + tests_exe = executable( + 'tests', + 'src/tests.cc', + dependencies : [atomic_queue_dep, unit_test_framework_dep], + ) + test('tests', tests_exe) + + example_exe = executable( + 'example', + 'src/example.cc', + dependencies : [atomic_queue_dep], + ) + test('example', example_exe) +endif if get_option('benchmarks') + incompatible_cpp_std = ['c++98', 'c++03', 'c++11', 'c++14', 'gnu++03', 'gnu++11', 'gnu++14', 'vc++14'] + if incompatible_cpp_std.contains(get_option('cpp_std')) + error('Benchmarks require C++17 or higher') + endif + + cxx = meson.get_compiler('cpp') + dl_dep = cxx.find_library('dl') + xenium_dep = declare_dependency(include_directories : '../xenium') + boost_dep = dependency('boost') + tbb_dep = cxx.find_library('tbb') + moodycamel_dep = declare_dependency(include_directories : '../') + benchmarks_exe = executable( 'benchmarks', ['src/benchmarks.cc', 'src/cpu_base_frequency.cc', 'src/huge_pages.cc'], - dependencies : [atomic_queue, xenium, moodycamel, tbb, dl] + include_directories : ['src'], + dependencies : [atomic_queue_dep, dl_dep, xenium_dep, boost_dep, tbb_dep, moodycamel_dep], ) + benchmark('benchmarks', benchmarks_exe) endif + +install_headers( + files( + 'include/atomic_queue/atomic_queue.h', + 'include/atomic_queue/atomic_queue_mutex.h', + 'include/atomic_queue/barrier.h', + 'include/atomic_queue/defs.h', + 'include/atomic_queue/spinlock.h', + ), + subdir: 'atomic_queue' +) +pkg = import('pkgconfig') +pkg.generate( + name: 'atomic_queue', + description: 'C++14 multiple-producer-multiple-consumer lock-free queues based on circular buffers', + libraries: [threads_dep] +) ===================================== meson_options.txt ===================================== @@ -1,2 +1,4 @@ -option('benchmarks', type : 'boolean', value : true, - description : 'Do not build benchmarks; ignore their dependencies') +option('benchmarks', type : 'boolean', value : false, + description : 'Build benchmarks (requires Boost, TBB, Xenium, moodycamel and C++17)') +option('tests', type : 'boolean', value : true, + description : 'Build tests and example (requires Boost)') ===================================== src/tests.cc ===================================== @@ -6,7 +6,6 @@ #include #include "atomic_queue/atomic_queue.h" -#include "atomic_queue/atomic_queue_mutex.h" #include "atomic_queue/barrier.h" #include @@ -250,6 +249,8 @@ BOOST_AUTO_TEST_CASE(try_push) { BOOST_AUTO_TEST_CASE(size) { atomic_queue::RetryDecorator> q(10); BOOST_CHECK_EQUAL(q.capacity(), CACHE_LINE_SIZE * CACHE_LINE_SIZE); + BOOST_CHECK(q.was_empty()); + BOOST_CHECK(!q.was_full()); } BOOST_AUTO_TEST_CASE(power_of_2) { View it on GitLab: https://salsa.debian.org/med-team/libatomic-queue/-/commit/f2b7705efe38224d4647010c3014127c3b471f3b -- View it on GitLab: https://salsa.debian.org/med-team/libatomic-queue/-/commit/f2b7705efe38224d4647010c3014127c3b471f3b You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Tue Jun 24 20:21:13 2025 From: gitlab at salsa.debian.org (Stephan Lachnit (@stephanlachnit)) Date: Tue, 24 Jun 2025 19:21:13 +0000 Subject: [med-svn] [Git][med-team/libatomic-queue][pristine-tar] pristine-tar data for libatomic-queue_1.6.9.orig.tar.xz Message-ID: <685afaa961757_3db1aa5bef45199876@godard.mail> Stephan Lachnit pushed to branch pristine-tar at Debian Med / libatomic-queue Commits: 43c98dbb by Stephan Lachnit at 2025-06-24T21:20:34+02:00 pristine-tar data for libatomic-queue_1.6.9.orig.tar.xz - - - - - 2 changed files: - + libatomic-queue_1.6.9.orig.tar.xz.delta - + libatomic-queue_1.6.9.orig.tar.xz.id Changes: ===================================== libatomic-queue_1.6.9.orig.tar.xz.delta ===================================== Binary files /dev/null and b/libatomic-queue_1.6.9.orig.tar.xz.delta differ ===================================== libatomic-queue_1.6.9.orig.tar.xz.id ===================================== @@ -0,0 +1 @@ +17a3878e5390a797fd18ccb5342ab1134c9c826e View it on GitLab: https://salsa.debian.org/med-team/libatomic-queue/-/commit/43c98dbbb3b36526b6253a1c75971fcc38e1c3d8 -- View it on GitLab: https://salsa.debian.org/med-team/libatomic-queue/-/commit/43c98dbbb3b36526b6253a1c75971fcc38e1c3d8 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From mail at kultnet.de Tue Jun 24 21:29:39 2025 From: mail at kultnet.de (KultNet Kultur-Ausschreibungen) Date: Tue, 24 Jun 2025 22:29:39 +0200 (CEST) Subject: [med-svn] - Dein Newsletter-Bestaetigungsklick Kultur-Ausschreibungen 892662 Message-ID: <20250624202939.70BBF604CE@vps27734.alfahosting-vps.de> An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Wed Jun 25 02:43:35 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Wed, 25 Jun 2025 01:43:35 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <685b54472e981_3db1bb0e864523949c@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: 42686f9c by Andreas Tille at 2025-06-25T01:43:31+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Tue, 24 Jun 2025 13:42:03 +0000 +Last-Update: Wed, 25 Jun 2025 01:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- ===================================== debian-science-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Tue, 24 Jun 2025 13:42:08 +0000 +Last-Update: Wed, 25 Jun 2025 01:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Tue, 24 Jun 2025 13:42:11 +0000 +Last-Update: Wed, 25 Jun 2025 01:42:05 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/42686f9c7f4c907c0c478350c6049daf5a4308ea -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/42686f9c7f4c907c0c478350c6049daf5a4308ea You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Wed Jun 25 13:15:27 2025 From: gitlab at salsa.debian.org (Alexandre Detiste (@detiste-guest)) Date: Wed, 25 Jun 2025 12:15:27 +0000 Subject: [med-svn] [Git][med-team/nipype][master] python3-acres is now packaged Message-ID: <685be85fee40c_3db209eb824534183f@godard.mail> Alexandre Detiste pushed to branch master at Debian Med / nipype Commits: 24ac9db6 by Alexandre Detiste at 2025-06-25T13:23:27+02:00 python3-acres is now packaged - - - - - 3 changed files: - debian/control - ? debian/patches/acres.patch - debian/patches/series Changes: ===================================== debian/control ===================================== @@ -9,6 +9,7 @@ Build-Depends: debhelper-compat (= 13), dh-sequence-python3, pybuild-plugin-pyproject, python3-setuptools, + python3-acres, python3-all, python3-sphinx, python3-sphinxcontrib.apidoc, @@ -51,6 +52,7 @@ Section: python Depends: ${python3:Depends}, ${shlibs:Depends}, ${misc:Depends}, + python3-acres, python3-click, python3-dateutil, python3-dipy, ===================================== debian/patches/acres.patch deleted ===================================== @@ -1,237 +0,0 @@ ---- /dev/null -+++ b/nipype/acres.py -@@ -0,0 +1,212 @@ -+# Copyright The NiPreps Developers -+# -+# Licensed under the Apache License, Version 2.0 (the "License"); -+# you may not use this file except in compliance with the License. -+# You may obtain a copy of the License at -+# -+# http://www.apache.org/licenses/LICENSE-2.0 -+# -+# Unless required by applicable law or agreed to in writing, software -+# distributed under the License is distributed on an "AS IS" BASIS, -+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. -+# See the License for the specific language governing permissions and -+# limitations under the License. -+# -+# We support and encourage derived works from this project, please read -+# about our expectations at -+# -+# https://www.nipreps.org/community/licensing/ -+# -+# -+# This package was adapted from the fmriprep.data module released in 24.0.0, -+# which evolved from an implementation in the Nibabies project, -+# introduced in the following commit: https://github.com/nipreps/nibabies/commit/45a63a6 -+# -+# Changes as of the fork (2024 July 15): -+# - This implementation uses a global ExitStack and resource cache, -+# to avoid `Loader` instances from containing self-references and -+# potentially leaking memory. -+# -+# Future modifications will be tracked in the change log. -+"""Data loading utility for Python packages. -+ -+This module provides a class that wraps :mod:`importlib.resources` to -+provide resource retrieval functions with commonly-needed scoping, -+including interpreter-lifetime caching. -+""" -+ -+from __future__ import annotations -+ -+import atexit -+import sys -+from contextlib import AbstractContextManager, ExitStack -+from functools import cached_property -+from pathlib import Path -+from types import ModuleType -+ -+if sys.version_info >= (3, 9): -+ from functools import cache -+else: -+ from functools import lru_cache as cache -+ -+if sys.version_info >= (3, 11): -+ from importlib.resources import as_file, files -+ from importlib.resources.abc import Traversable -+else: -+ from importlib_resources import as_file, files -+ from importlib_resources.abc import Traversable -+ -+__all__ = ['Loader'] -+ -+ -+# Use one global exit stack -+EXIT_STACK = ExitStack() -+atexit.register(EXIT_STACK.close) -+ -+ -+ at cache -+def _cache_resource(anchor: str | ModuleType, segments: tuple[str]) -> Path: -+ # PY310(importlib_resources): no-any-return, PY311+(importlib.resources): unused-ignore -+ return EXIT_STACK.enter_context(as_file(files(anchor).joinpath(*segments))) # type: ignore[no-any-return,unused-ignore] -+ -+ -+class Loader: -+ """A loader for package files relative to a module -+ -+ This class wraps :mod:`importlib.resources` to provide a getter -+ function with an interpreter-lifetime scope. For typical packages -+ it simply passes through filesystem paths as :class:`~pathlib.Path` -+ objects. For zipped distributions, it will unpack the files into -+ a temporary directory that is cleaned up on interpreter exit. -+ -+ This loader accepts a fully-qualified module name or a module -+ object. -+ -+ Expected usage:: -+ -+ '''Data package -+ -+ .. autofunction:: load_data -+ -+ .. automethod:: load_data.readable -+ -+ .. automethod:: load_data.as_path -+ -+ .. automethod:: load_data.cached -+ ''' -+ -+ from acres import Loader -+ -+ load_data = Loader(__spec__.name) -+ -+ :class:`~Loader` objects implement the :func:`callable` interface -+ and generate a docstring, and are intended to be treated and documented -+ as functions. -+ -+ For greater flexibility and improved readability over the ``importlib.resources`` -+ interface, explicit methods are provided to access resources. -+ -+ +---------------+----------------+------------------+ -+ | On-filesystem | Lifetime | Method | -+ +---------------+----------------+------------------+ -+ | `True` | Interpreter | :meth:`cached` | -+ +---------------+----------------+------------------+ -+ | `True` | `with` context | :meth:`as_path` | -+ +---------------+----------------+------------------+ -+ | `False` | n/a | :meth:`readable` | -+ +---------------+----------------+------------------+ -+ -+ It is also possible to use ``Loader`` directly:: -+ -+ from acres import Loader -+ -+ Loader(other_package).readable('data/resource.ext').read_text() -+ -+ with Loader(other_package).as_path('data') as pkgdata: -+ # Call function that requires full Path implementation -+ func(pkgdata) -+ -+ # contrast to -+ -+ from importlib_resources import files, as_file -+ -+ files(other_package).joinpath('data/resource.ext').read_text() -+ -+ with as_file(files(other_package) / 'data') as pkgdata: -+ func(pkgdata) -+ -+ .. automethod:: readable -+ -+ .. automethod:: as_path -+ -+ .. automethod:: cached -+ """ -+ -+ def __init__(self, anchor: str | ModuleType): -+ self._anchor = anchor -+ self.files = files(anchor) -+ # Allow class to have a different docstring from instances -+ self.__doc__ = self._doc -+ -+ @cached_property -+ def _doc(self) -> str: -+ """Construct docstring for instances -+ -+ Lists the public top-level paths inside the location, where -+ non-public means has a `.` or `_` prefix or is a 'tests' -+ directory. -+ """ -+ top_level = sorted( -+ f'{p.name}/' if p.is_dir() else p.name -+ for p in self.files.iterdir() -+ if p.name[0] not in ('.', '_') and p.name != 'tests' -+ ) -+ doclines = [ -+ f'Load package files relative to ``{self._anchor}``.', -+ '', -+ 'This package contains the following (top-level) files/directories:', -+ '', -+ *(f'* ``{path}``' for path in top_level), -+ ] -+ -+ return '\n'.join(doclines) -+ -+ def readable(self, *segments: str) -> Traversable: -+ """Provide read access to a resource through a Path-like interface. -+ -+ This file may or may not exist on the filesystem, and may be -+ efficiently used for read operations, including directory traversal. -+ -+ This result is not cached or copied to the filesystem in cases where -+ that would be necessary. -+ """ -+ # PY310(importlib_resources): no-any-return, PY311+(importlib.resources): unused-ignore -+ return self.files.joinpath(*segments) # type: ignore[no-any-return,unused-ignore] -+ -+ def as_path(self, *segments: str) -> AbstractContextManager[Path]: -+ """Ensure data is available as a :class:`~pathlib.Path`. -+ -+ This method generates a context manager that yields a Path when -+ entered. -+ -+ This result is not cached, and any temporary files that are created -+ are deleted when the context is exited. -+ """ -+ # PY310(importlib_resources): no-any-return, PY311+(importlib.resources): unused-ignore -+ return as_file(self.files.joinpath(*segments)) # type: ignore[no-any-return,unused-ignore] -+ -+ def cached(self, *segments: str) -> Path: -+ """Ensure data resource is available as a :class:`~pathlib.Path`. -+ -+ Any temporary files that are created remain available throughout -+ the duration of the program, and are deleted when Python exits. -+ -+ Results are cached so that multiple calls do not unpack the same -+ data multiple times, but directories and their contents being -+ requested separately may result in some duplication. -+ """ -+ # Use self._anchor and segments to ensure the cache does not depend on id(self.files) -+ # PY310(importlib_resources): unused-ignore, PY311+(importlib.resources) arg-type -+ return _cache_resource(self._anchor, segments) # type: ignore[arg-type,unused-ignore] -+ -+ __call__ = cached ---- a/nipype/interfaces/base/tests/test_support.py -+++ b/nipype/interfaces/base/tests/test_support.py -@@ -3,7 +3,7 @@ - import os - import pytest - --import acres -+from .... import acres - - from ....utils.filemanip import md5 - from ... import base as nib ---- a/nipype/interfaces/fsl/model.py -+++ b/nipype/interfaces/fsl/model.py -@@ -9,7 +9,7 @@ - from shutil import rmtree - from string import Template - --import acres -+from ... import acres - import numpy as np - from looseversion import LooseVersion - from nibabel import load ===================================== debian/patches/series ===================================== @@ -9,5 +9,4 @@ sphinx.patch fix-transpose.patch reproducible-build.patch fix-privacy-breaches.patch -acres.patch sphinx_8.2.1.patch View it on GitLab: https://salsa.debian.org/med-team/nipype/-/commit/24ac9db6014913555570fd876110e82c862bc6bd -- View it on GitLab: https://salsa.debian.org/med-team/nipype/-/commit/24ac9db6014913555570fd876110e82c862bc6bd You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Wed Jun 25 13:44:23 2025 From: gitlab at salsa.debian.org (Alexandre Detiste (@detiste-guest)) Date: Wed, 25 Jun 2025 12:44:23 +0000 Subject: [med-svn] [Git][med-team/nipype][master] retry Salsa CI Message-ID: <685bef274d0fd_3db1f7df4dc5352871@godard.mail> Alexandre Detiste pushed to branch master at Debian Med / nipype Commits: a28cb0c8 by Alexandre Detiste at 2025-06-25T14:44:17+02:00 retry Salsa CI - - - - - 1 changed file: - debian/changelog Changes: ===================================== debian/changelog ===================================== @@ -1,3 +1,11 @@ +nipype (1.9.2-4) UNRELEASED; urgency=medium + + * Team Upload + * Use the new python3-acres instead of a vendored copy + * Upload to unstable + + -- Alexandre Detiste Wed, 25 Jun 2025 14:43:22 +0200 + nipype (1.9.2-3) experimental; urgency=medium * Team Upload View it on GitLab: https://salsa.debian.org/med-team/nipype/-/commit/a28cb0c8b3ad99d5f4f1520a94d6b2f8e9db33e2 -- View it on GitLab: https://salsa.debian.org/med-team/nipype/-/commit/a28cb0c8b3ad99d5f4f1520a94d6b2f8e9db33e2 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Wed Jun 25 14:43:33 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Wed, 25 Jun 2025 13:43:33 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <685bfd054260_3db209eb82453659f2@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: 8c400df4 by Andreas Tille at 2025-06-25T13:43:26+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,21 +1,21 @@ -Last-Update: Wed, 25 Jun 2025 01:42:04 +0000 +Last-Update: Wed, 25 Jun 2025 13:42:03 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- - dicomscope | 27 | {imaging} | + dicomscope | 25 | {imaging} | oscar | 18 | {data,tools,practice} | orthanc-gdcm | 17 | {imaging} | mrtrix3 | 15 | {imaging} | pixelmed | 12 | {imaging} | gnumed-server | 11 | {covid-19,practice} | adun.app | 10 | {bio} | + bart-view | 10 | {imaging} | king | 10 | {typesetting,imaging} | orthanc-mysql | 10 | {imaging} | - bart-view | 9 | {imaging} | libminc | 9 | {imaging-dev} | orthanc-postgresql | 9 | {imaging} | - sight | 9 | {imaging} | icb-utils | 8 | {bio-dev} | + sight | 8 | {imaging} | heudiconv | 7 | {imaging} | mia | 6 | {imaging} | jebl2 | 5 | {bio-dev} | ===================================== debian-science-tests.txt ===================================== @@ -1,37 +1,37 @@ -Last-Update: Wed, 25 Jun 2025 01:42:04 +0000 +Last-Update: Wed, 25 Jun 2025 13:42:08 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- - nltk | 4811 | {linguistics} | - gts | 4701 | {viewing} | - opencascade | 606 | {simulations} | - spacenavd | 226 | {tools} | + nltk | 4798 | {linguistics} | + gts | 4708 | {viewing} | + opencascade | 604 | {simulations} | + spacenavd | 228 | {tools} | armadillo | 180 | {mathematics-dev} | open-coarrays | 171 | {meteorology-dev} | - arpack | 82 | {mathematics-dev} | - scalapack | 50 | {nanoscale-physics-dev} | + arpack | 83 | {mathematics-dev} | + scalapack | 49 | {nanoscale-physics-dev} | visidata | 43 | {datamanagement} | - ntl | 40 | {mathematics-dev} | - imview | 38 | {viewing} | - mbpoll | 36 | {simulations} | - ppl | 31 | {numericalcomputation} | - flintqs | 29 | {mathematics} | + ntl | 41 | {mathematics-dev} | + imview | 39 | {viewing} | + mbpoll | 35 | {simulations} | + ppl | 32 | {numericalcomputation} | + flintqs | 30 | {mathematics} | libmatio | 27 | {mathematics-dev} | + cliquer | 25 | {mathematics} | arduino-mk | 24 | {robotics} | - cliquer | 24 | {mathematics} | libm4ri | 24 | {mathematics-dev} | - flann | 23 | {mathematics-dev,engineering-dev} | + flann | 22 | {mathematics-dev,engineering-dev} | xygrib | 22 | {meteorology} | - setzer | 20 | {typesetting} | + setzer | 21 | {typesetting} | + grads | 20 | {meteorology} | bossa | 19 | {devices} | - grads | 19 | {meteorology} | + guiqwt | 19 | {numericalcomputation,viewing} | picosat | 19 | {logic} | sat4j | 19 | {logic} | fftw | 18 | {mathematics-dev,physics-dev,meteorology-dev} | - guiqwt | 18 | {numericalcomputation,viewing} | + eccodes | 16 | {meteorology,meteorology-dev} | lrcalc | 16 | {mathematics-dev} | sketch | 16 | {typesetting} | - eccodes | 15 | {meteorology,meteorology-dev} | gts | 15 | {viewing-dev} | ncl | 15 | {meteorology} | pyzo | 15 | {numericalcomputation} | @@ -39,25 +39,25 @@ Last-Update: Wed, 25 Jun 2025 01:42:04 +0000 feff85exafs | 13 | {chemistry} | libitpp | 13 | {mathematics-dev,engineering-dev} | teem | 13 | {imageanalysis} | - dune-uggrid | 12 | {mathematics-dev} | gf2x | 12 | {mathematics-dev} | matlab-support | 12 | {mathematics,numericalcomputation} | coinor-symphony | 11 | {logic,mathematics,numericalcomputation} | + eccodes | 11 | {meteorology-dev} | iml | 11 | {mathematics-dev} | libhomfly | 11 | {mathematics-dev} | lxi-tools | 11 | {engineering,dataacquisition} | - eccodes | 10 | {meteorology-dev} | + pcl | 11 | {robotics-dev} | + dune-uggrid | 10 | {mathematics-dev} | feedgnuplot | 10 | {viewing} | form | 10 | {mathematics} | libm4rie | 10 | {mathematics-dev} | ncl | 10 | {meteorology-dev} | - pcl | 10 | {robotics-dev} | python-escript | 10 | {numericalcomputation,simulations,engineering} | geg | 9 | {viewing} | - alberta | 8 | {engineering-dev} | python-cdo | 8 | {meteorology} | ratpoints | 8 | {mathematics-dev} | vdt | 8 | {mathematics-dev} | + alberta | 7 | {engineering-dev} | apophenia | 7 | {statistics} | libccp4 | 7 | {nanoscale-physics-dev} | libzn-poly | 7 | {mathematics-dev} | @@ -94,6 +94,7 @@ Last-Update: Wed, 25 Jun 2025 01:42:04 +0000 getdp | 4 | {engineering,mathematics,simulations} | gsw | 4 | {meteorology} | iapws | 4 | {meteorology} | + muparser | 4 | {mathematics-dev} | ros-vcstool | 4 | {robotics-dev} | sdpb | 4 | {numericalcomputation,highenergy-physics} | silo-llnl | 4 | {engineering} | @@ -116,8 +117,8 @@ Last-Update: Wed, 25 Jun 2025 01:42:04 +0000 lrcalc | 3 | {mathematics} | metview | 3 | {meteorology} | mpi4py-fft | 3 | {mathematics-dev} | - muparser | 3 | {mathematics-dev} | openstereogram | 3 | {tools} | + polylib | 3 | {mathematics} | python-aws-xray-sdk | 3 | {dataacquisition-dev} | sac2mseed | 3 | {geography} | sagemath-database-conway-polynomials | 3 | {mathematics} | @@ -133,9 +134,9 @@ Last-Update: Wed, 25 Jun 2025 01:42:04 +0000 clipper | 2 | {nanoscale-physics-dev} | coinor-bonmin | 2 | {mathematics} | cylc-flow | 2 | {meteorology} | + debian-science | 2 | {electrophysiology} | debian-science | 2 | {neuroscience-cognitive} | debian-science | 2 | {economics} | - debian-science | 2 | {electrophysiology} | debian-science | 2 | {nanoscale-physics,statistics,economics,physics} | dimbl | 2 | {linguistics} | dune-functions | 2 | {mathematics-dev} | @@ -155,7 +156,6 @@ Last-Update: Wed, 25 Jun 2025 01:42:04 +0000 mseed2sac | 2 | {dataacquisition-dev} | ncrystal | 2 | {nanoscale-physics-dev,highenergy-physics-dev} | nrn-iv | 2 | {biology} | - polylib | 2 | {mathematics} | qd | 2 | {mathematics-dev} | qwtplot3d | 2 | {viewing-dev} | silo-llnl | 2 | {engineering-dev} | @@ -167,8 +167,8 @@ Last-Update: Wed, 25 Jun 2025 01:42:04 +0000 code-saturne | 1 | {engineering-dev,mathematics-dev} | coinmp | 1 | {logic,mathematics-dev,numericalcomputation} | debian-science | 1 | {tools} | - debian-science | 1 | {psychophysics} | debian-science | 1 | {neuroscience-cognitive,machine-learning} | + debian-science | 1 | {psychophysics} | fpzip | 1 | {meteorology-dev} | frogdata | 1 | {linguistics} | gadap | 1 | {meteorology-dev} | @@ -197,6 +197,7 @@ Last-Update: Wed, 25 Jun 2025 01:42:04 +0000 tfdocgen | 1 | {linguistics} | timbl | 1 | {linguistics} | timblserver | 1 | {linguistics} | + trilinos | 1 | {physics-dev,mathematics-dev,engineering-dev} | vlfeat | 1 | {imageanalysis-dev} | amgcl | 0 | {mathematics-dev} | apertium-afr-nld | 0 | {linguistics} | @@ -216,8 +217,8 @@ Last-Update: Wed, 25 Jun 2025 01:42:04 +0000 cqrlib | 0 | {mathematics-dev} | cvector | 0 | {mathematics-dev} | debian-science | 0 | {nanoscale-physics-dev} | - debian-science | 0 | {physics} | debian-science | 0 | {electrophysiology} | + debian-science | 0 | {physics} | dune-grid-glue | 0 | {mathematics-dev} | etsf-io | 0 | {nanoscale-physics-dev} | fastjet | 0 | {highenergy-physics-dev} | @@ -226,14 +227,14 @@ Last-Update: Wed, 25 Jun 2025 01:42:04 +0000 libfolia | 0 | {linguistics} | libquantum | 0 | {numericalcomputation} | libsdsl | 0 | {dataacquisition-dev} | - looptools | 0 | {highenergy-physics} | looptools | 0 | {highenergy-physics-dev} | + looptools | 0 | {highenergy-physics} | magma | 0 | {mathematics-dev,numericalcomputation} | mbt | 0 | {linguistics} | mctc-lib | 0 | {nanoscale-physics-dev,highenergy-physics-dev} | meshsdfilter | 0 | {mathematics-dev} | - metis-edf | 0 | {engineering-dev} | metis-edf | 0 | {engineering,numericalcomputation} | + metis-edf | 0 | {engineering-dev} | nrn-mod2c | 0 | {biology} | openctm | 0 | {physics-dev} | opengv | 0 | {geometry} | @@ -244,8 +245,8 @@ Last-Update: Wed, 25 Jun 2025 01:42:04 +0000 quadrule | 0 | {mathematics-dev} | robot-testing-framework | 0 | {robotics-dev} | ros-collada-urdf | 0 | {robotics} | - ros-metapackages | 0 | {robotics-dev} | ros-metapackages | 0 | {robotics} | + ros-metapackages | 0 | {robotics-dev} | ros-opencv-apps | 0 | {robotics} | sagemath-database-combinatorial-designs | 0 | {mathematics} | sagemath-database-cremona-elliptic-curves | 0 | {mathematics} | @@ -263,7 +264,6 @@ Last-Update: Wed, 25 Jun 2025 01:42:04 +0000 timbl | 0 | {linguistics} | timblserver | 0 | {linguistics} | triangle | 0 | {physics-dev} | - trilinos | 0 | {physics-dev,mathematics-dev,engineering-dev} | tulip | 0 | {viewing-dev} | ucto | 0 | {linguistics} | vecgeom | 0 | {nanoscale-physics-dev} | ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,253 +1,253 @@ -Last-Update: Wed, 25 Jun 2025 01:42:05 +0000 +Last-Update: Wed, 25 Jun 2025 13:42:12 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- - mpmath | 9891 | - python-repoze.lru | 6979 | - netifaces | 5146 | - ghp-import | 4754 | - python-lunr | 4746 | - python-babel | 3808 | - sortedcontainers | 3449 | - python-babel | 3396 | - aiosignal | 2973 | - hyperlink | 2134 | - humanfriendly | 1989 | - python-notify2 | 1980 | - referencing | 1555 | - python-mysqldb | 1524 | - python-gssapi | 1455 | - python-invoke | 1406 | - python-hyperframe | 1389 | - websocket-client | 1306 | - python-hpack | 1172 | - python-rsa | 1124 | - python-pandocfilters | 1031 | - pdfarranger | 969 | - menulibre | 962 | - python-linux-procfs | 931 | - python-geoip | 856 | - python-webob | 821 | - powerline | 757 | - powerline | 707 | - python-zopfli | 707 | + mpmath | 9873 | + python-repoze.lru | 6980 | + netifaces | 5143 | + ghp-import | 4739 | + python-lunr | 4731 | + python-babel | 3816 | + sortedcontainers | 3478 | + python-babel | 3405 | + aiosignal | 2982 | + hyperlink | 2158 | + humanfriendly | 1993 | + python-notify2 | 1969 | + referencing | 1576 | + python-mysqldb | 1533 | + python-gssapi | 1459 | + python-invoke | 1402 | + python-hyperframe | 1399 | + websocket-client | 1309 | + python-hpack | 1186 | + python-rsa | 1130 | + python-pandocfilters | 1035 | + menulibre | 961 | + pdfarranger | 958 | + python-linux-procfs | 934 | + python-geoip | 863 | + python-webob | 825 | + powerline | 747 | + python-zopfli | 722 | powerline | 702 | - kazam | 657 | - firmware-microbit-micropython | 645 | - u-msgpack-python | 596 | - python-et-xmlfile | 517 | - dockerpty | 501 | - asn1crypto | 498 | - python-gevent | 487 | - gaupol | 483 | - autopep8 | 465 | - python-ewmh | 453 | + powerline | 697 | + kazam | 661 | + firmware-microbit-micropython | 646 | + u-msgpack-python | 587 | + python-et-xmlfile | 526 | + asn1crypto | 502 | + dockerpty | 496 | + python-gevent | 491 | + gaupol | 479 | + autopep8 | 470 | + python-ewmh | 447 | catfish | 437 | - python-requests-oauthlib | 399 | - pytoolconfig | 382 | + python-requests-oauthlib | 401 | + pytoolconfig | 385 | spf-engine | 346 | - python-toml | 340 | + python-toml | 338 | python-ntlm-auth | 303 | - spf-engine | 295 | - django-stronghold | 250 | - python-ldap3 | 250 | - cairocffi | 216 | - python-mimeparse | 193 | - python-smmap | 172 | - python-hidapi | 170 | - autokey | 162 | - httpie | 148 | - smem | 136 | - python-anyjson | 134 | + spf-engine | 296 | + python-ldap3 | 263 | + django-stronghold | 247 | + cairocffi | 220 | + python-mimeparse | 194 | + python-smmap | 175 | + python-hidapi | 167 | + autokey | 165 | + httpie | 147 | + python-anyjson | 136 | kivy | 133 | - python-aiostream | 125 | - mypaint | 123 | - smartypants | 121 | - python-click-repl | 118 | - lollypop | 102 | - mugshot | 102 | - nodeenv | 102 | + smem | 132 | + python-aiostream | 126 | + smartypants | 123 | + python-click-repl | 120 | + mypaint | 118 | + lollypop | 104 | + nodeenv | 103 | python-consul | 102 | - timekpr-next | 99 | - pacparser | 95 | - python-pyu2f | 95 | - pymacaroons | 91 | - python-rfc6555 | 88 | - pssh | 81 | - pymediainfo | 80 | - python-colour | 75 | - numpy-stl | 73 | - python-i3ipc | 71 | - fabric | 66 | - mitmproxy | 65 | + mugshot | 99 | + timekpr-next | 98 | + python-pyu2f | 97 | + pacparser | 96 | + pymacaroons | 90 | + python-rfc6555 | 87 | + pymediainfo | 83 | + pssh | 80 | + python-colour | 76 | + numpy-stl | 72 | + python-i3ipc | 70 | + weasyprint | 70 | + mitmproxy | 68 | + fabric | 67 | + pywavelets | 67 | python-pykka | 65 | - weasyprint | 65 | - pywavelets | 64 | - itstool | 59 | + itstool | 58 | python-looseversion | 54 | + python-scp | 54 | ueberzug | 54 | - pyenv | 53 | - python-scp | 53 | - python-uritools | 53 | - mysql-connector-python | 50 | + mysql-connector-python | 53 | + pyenv | 52 | + python-uritools | 51 | + khard | 48 | + pymacs | 48 | sshtunnel | 48 | blockdiag | 47 | - khard | 47 | - pymacs | 47 | - kivy | 44 | + kivy | 46 | + hatchling | 44 | membernator | 44 | + python-pysol-cards | 44 | trac | 44 | - hatchling | 43 | - python-pysol-cards | 43 | pyquery | 41 | certipy | 40 | pamela | 40 | - pylibmc | 40 | + show-in-file-manager | 40 | jupyterhub | 39 | - show-in-file-manager | 38 | + pylibmc | 39 | + pdfposter | 37 | powerline-gitstatus | 37 | - pdfposter | 36 | python-scrypt | 36 | pssh | 34 | - persepolis | 33 | - python-statsd | 32 | + persepolis | 32 | + dkimpy-milter | 29 | seqdiag | 29 | - sphinxcontrib-blockdiag | 29 | - dkimpy-milter | 28 | - python-args | 27 | + python-args | 28 | + sphinxcontrib-blockdiag | 28 | + rst2pdf | 27 | sphinxcontrib-seqdiag | 27 | - video-downloader | 27 | - enzyme | 25 | - rst2pdf | 25 | + python-statsd | 26 | + video-downloader | 26 | + flask-principal | 25 | + python-clint | 25 | sphinx-inline-tabs | 25 | + typogrify | 25 | depthcharge-tools | 24 | - python-clint | 24 | - typogrify | 24 | + enzyme | 24 | + python-rangehttpserver | 24 | cppman | 23 | - flask-principal | 23 | - python-rangehttpserver | 23 | - subliminal | 23 | webpy | 23 | nwdiag | 22 | python-demjson | 22 | + python-zstd | 22 | + subliminal | 22 | fabric | 21 | python-fire | 21 | - subliminal | 21 | python-pysubs2 | 20 | python-sdnotify | 20 | - python-zstd | 20 | + subliminal | 20 | + backoff | 19 | spf-engine | 19 | + actdiag | 18 | alot | 18 | - backoff | 18 | nwg-displays | 18 | - sphinxcontrib-log-cabinet | 18 | - webtest | 18 | - actdiag | 17 | - mistune0 | 17 | + django-environ | 17 | pykwalify | 17 | - django-environ | 16 | + webtest | 17 | + flask-security | 16 | + mistune0 | 16 | + social-auth-core | 16 | sphinxcontrib-actdiag | 16 | + sphinxcontrib-log-cabinet | 16 | sphinxcontrib-nwdiag | 16 | - flask-security | 15 | policyd-rate-limit | 15 | python-ethtool | 15 | python-pyalsa | 15 | - social-auth-core | 15 | + python-translationstring | 15 | todoman | 15 | python-inotify | 14 | + python-pem | 14 | python-slip10 | 14 | - python-translationstring | 14 | unearth | 14 | + beancount | 13 | junos-eznc | 13 | pdm | 13 | - python-pem | 13 | + pylint-common | 13 | + python-priority | 13 | python-simpy | 13 | - ansi | 12 | - beancount | 12 | + flask-paranoid | 12 | jschema-to-python | 12 | notebook-shim | 12 | + pyp | 12 | python-dbussy | 12 | - python-kyotocabinet | 12 | + python-hupper | 12 | python-parse-type | 12 | - python-priority | 12 | - python-pyrss2gen | 12 | python-pyscss | 12 | python-sarif-python-om | 12 | python-xtermcolor | 12 | - flask-paranoid | 11 | - pylint-common | 11 | - pyp | 11 | - python-digitalocean | 11 | - python-hupper | 11 | + gmplot | 11 | + python-kyotocabinet | 11 | + python-pyrss2gen | 11 | ruff | 11 | + speaklater | 11 | txt2tags | 11 | + ansi | 10 | autotiling | 10 | btchip-python | 10 | - gmplot | 10 | + gtextfsm | 10 | + pwntools | 10 | + python-digitalocean | 10 | python-pyld | 10 | slimit | 10 | - speaklater | 10 | - traittypes | 10 | tuna | 10 | + beancount | 9 | debiancontributors | 9 | - gtextfsm | 9 | - pwntools | 9 | - beancount | 8 | + django-auditlog | 9 | + flask-session | 9 | + sphinx-intl | 9 | + traittypes | 9 | clustershell | 8 | - django-auditlog | 8 | django-sass | 8 | - drf-extensions | 8 | - flask-session | 8 | + drf-yasg-nonfree | 8 | htmlmin | 8 | httpcode | 8 | micropython-mpremote | 8 | - python-ansicolors | 8 | + python-aiohttp-security | 8 | + python-crcelk | 8 | + python-drf-spectacular-sidecar-nonfree | 8 | python-numpysane | 8 | python-pyaml-env | 8 | python-versioneer | 8 | - sphinx-intl | 8 | - drf-yasg-nonfree | 7 | + drf-extensions | 7 | flask-api | 7 | graphql-relay | 7 | - pybik | 7 | pycallgraph | 7 | pytaglib | 7 | pytest-django | 7 | pytest-runner | 7 | - python-aiohttp-security | 7 | - python-crcelk | 7 | - python-drf-spectacular-sidecar-nonfree | 7 | + python-ansicolors | 7 | python-overpy | 7 | trac-wysiwyg | 7 | voltron | 7 | django-model-utils | 6 | - drf-haystack | 6 | easyprocess | 6 | librouteros | 6 | mercurial-evolve | 6 | mypy-protobuf | 6 | + pybik | 6 | pydrive2 | 6 | python3-onelogin-saml2 | 6 | python-biplist | 6 | + python-envs | 6 | python-gnuplotlib | 6 | python-halo | 6 | west | 6 | - clustershell | 5 | django-jinja | 5 | django-paintstore | 5 | django-pglocks | 5 | + drf-haystack | 5 | hachoir | 5 | htmlmin | 5 | numpy-stl | 5 | pyjokes | 5 | pynliner | 5 | - python-envs | 5 | python-openstep-plist | 5 | python-simpy | 5 | ruff | 5 | sphinxcontrib-globalsubs | 5 | aiomysql | 4 | bootstrap-flask | 4 | + clustershell | 4 | cram | 4 | django-bitfield | 4 | django-js-reverse | 4 | @@ -258,6 +258,7 @@ Last-Update: Wed, 25 Jun 2025 01:42:05 +0000 flufl.testing | 4 | pyfltk | 4 | pyjunitxml | 4 | + pyroma | 4 | python-cookies | 4 | python-dirq | 4 | python-django-casclient | 4 | @@ -284,13 +285,12 @@ Last-Update: Wed, 25 Jun 2025 01:42:05 +0000 logilab-constraint | 3 | mbed-test-wrapper | 3 | okasha | 3 | - omgifol | 3 | orsopy | 3 | proglog | 3 | + pyclamd | 3 | + pylint-celery | 3 | pyprind | 3 | - pyroma | 3 | pytest-expect | 3 | - python-dbus-next | 3 | python-django-push-notifications | 3 | python-dynaconf | 3 | python-ipfix | 3 | @@ -300,6 +300,7 @@ Last-Update: Wed, 25 Jun 2025 01:42:05 +0000 requests-aws | 3 | slimit | 3 | soundcraft-utils | 3 | + sphinx-paramlinks | 3 | testrepository | 3 | trac-accountmanager | 3 | trac-xmlrpc | 3 | @@ -319,23 +320,21 @@ Last-Update: Wed, 25 Jun 2025 01:42:05 +0000 dotdrop | 2 | extension-helpers | 2 | flake8-black | 2 | - fypp | 2 | gtkman | 2 | hatch-jupyter-builder | 2 | humanfriendly | 2 | imap-tools | 2 | jsonrpclib-pelix | 2 | - myst-nb | 2 | namecheap | 2 | + omgifol | 2 | panoramisk | 2 | - pyclamd | 2 | pykwalify | 2 | - pylint-celery | 2 | pypass | 2 | python-bitbucket-api | 2 | python-btrees | 2 | python-chartkick | 2 | python-commentjson | 2 | + python-dbus-next | 2 | python-deepmerge | 2 | python-dnsq | 2 | python-ephemeral-port-reserve | 2 | @@ -354,7 +353,6 @@ Last-Update: Wed, 25 Jun 2025 01:42:05 +0000 python-text-unidecode | 2 | python-urlobject | 2 | redis-py-cluster | 2 | - sphinx-paramlinks | 2 | sphinxtesters | 2 | utidylib | 2 | vcversioner | 2 | @@ -367,13 +365,16 @@ Last-Update: Wed, 25 Jun 2025 01:42:05 +0000 codicefiscale | 1 | errbot | 1 | flask-multistatic | 1 | + fypp | 1 | jupyter-sphinx | 1 | korean-lunar-calendar | 1 | milksnake | 1 | mkdocs-macros-plugin | 1 | moviepy | 1 | + myst-nb | 1 | onetimepass | 1 | power | 1 | + prospector | 1 | pynag | 1 | pyrad | 1 | python-banal | 1 | @@ -405,6 +406,7 @@ Last-Update: Wed, 25 Jun 2025 01:42:05 +0000 sphinx-sitemap | 1 | trac-httpauth | 1 | trac-subcomponents | 1 | + trac-wikiprint | 1 | vrfydmn | 1 | wchartype | 1 | wikitrans | 1 | @@ -472,7 +474,6 @@ Last-Update: Wed, 25 Jun 2025 01:42:05 +0000 portio | 0 | powerline | 0 | powerline-gitstatus | 0 | - prospector | 0 | psrecord | 0 | purl | 0 | pwntools | 0 | @@ -563,7 +564,6 @@ Last-Update: Wed, 25 Jun 2025 01:42:05 +0000 thumbor-plugins-gifv | 0 | trac-customfieldadmin | 0 | trac-roadmap | 0 | - trac-wikiprint | 0 | turbosearch | 0 | vncdotool | 0 | webpy | 0 | @@ -587,8 +587,9 @@ Last-Update: Wed, 25 Jun 2025 01:42:05 +0000 python-rova | -1 | pyyardian | -1 | s3ql | -1 | + sphinxcontrib-emojicodes | -1 | symmetrize | -1 | thumbor | -1 | trac-tickettemplate | -1 | -(603 rows) +(604 rows) View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/8c400df4ed4dc086723e9cc6ba94cc7bdfdf38cd -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/8c400df4ed4dc086723e9cc6ba94cc7bdfdf38cd You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Thu Jun 26 02:43:36 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Thu, 26 Jun 2025 01:43:36 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <685ca5c8f1bfa_3db179562a055371e2@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: 52783cf5 by Andreas Tille at 2025-06-26T01:43:33+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Wed, 25 Jun 2025 13:42:03 +0000 +Last-Update: Thu, 26 Jun 2025 01:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- ===================================== debian-science-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Wed, 25 Jun 2025 13:42:08 +0000 +Last-Update: Thu, 26 Jun 2025 01:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Wed, 25 Jun 2025 13:42:12 +0000 +Last-Update: Thu, 26 Jun 2025 01:42:04 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/52783cf57acce8c8eb0caf7a08cc4701bd094091 -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/52783cf57acce8c8eb0caf7a08cc4701bd094091 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Thu Jun 26 13:37:46 2025 From: gitlab at salsa.debian.org (=?UTF-8?B?UmFmYWVsIExhYm9pc3Npw6hyZSAoQHJhZmFlbCk=?=) Date: Thu, 26 Jun 2025 12:37:46 +0000 Subject: [med-svn] [Git][med-team/praat] Pushed new tag debian/6.4.35+dfsg-1 Message-ID: <685d3f1acab13_3db21b869f856213b8@godard.mail> Rafael Laboissi?re pushed new tag debian/6.4.35+dfsg-1 at Debian Med / praat -- View it on GitLab: https://salsa.debian.org/med-team/praat/-/tree/debian/6.4.35+dfsg-1 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Thu Jun 26 13:37:51 2025 From: gitlab at salsa.debian.org (=?UTF-8?B?UmFmYWVsIExhYm9pc3Npw6hyZSAoQHJhZmFlbCk=?=) Date: Thu, 26 Jun 2025 12:37:51 +0000 Subject: [med-svn] [Git][med-team/praat] Pushed new tag upstream/6.4.35+dfsg Message-ID: <685d3f1fc737d_3db21e81568562167d@godard.mail> Rafael Laboissi?re pushed new tag upstream/6.4.35+dfsg at Debian Med / praat -- View it on GitLab: https://salsa.debian.org/med-team/praat/-/tree/upstream/6.4.35+dfsg You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Thu Jun 26 13:38:01 2025 From: gitlab at salsa.debian.org (=?UTF-8?B?UmFmYWVsIExhYm9pc3Npw6hyZSAoQHJhZmFlbCk=?=) Date: Thu, 26 Jun 2025 12:38:01 +0000 Subject: [med-svn] [Git][med-team/praat][master] 8 commits: d/copyright: Strip prebuilt binaries from upstream tarball Message-ID: <685d3f29cf8c_3db21ebd0e05621947@godard.mail> Rafael Laboissi?re pushed to branch master at Debian Med / praat Commits: 333f7e37 by Rafael Laboissi?re at 2025-06-20T17:15:37-03:00 d/copyright: Strip prebuilt binaries from upstream tarball - - - - - 96fc2ddb by Rafael Laboissi?re at 2025-06-20T17:24:19-03:00 New upstream version 6.4.35+dfsg - - - - - f182dade by Rafael Laboissi?re at 2025-06-20T17:26:04-03:00 Update upstream source from tag 'upstream/6.4.35+dfsg' Update to upstream version '6.4.35+dfsg' with Debian dir e1e6ffecc3390fa82710036bdc37c157cd8300a1 - - - - - 20a5632f by Rafael Laboissi?re at 2025-06-23T08:34:07-03:00 d/s/lintian-overrides: Override lintian warnings source-is-missing and very-long-line-length-in-source-file - - - - - b70381ed by Rafael Laboissi?re at 2025-06-26T08:03:18-03:00 Create new package praat-doc - - - - - 936b1e19 by Rafael Laboissi?re at 2025-06-26T08:03:18-03:00 d/p/local-icon-url.patch: New patch - - - - - 698fda63 by Rafael Laboissi?re at 2025-06-26T08:03:18-03:00 d/copyright: Add copyright notices and licensing conditions for files docs/* - - - - - f70a45a4 by Rafael Laboissi?re at 2025-06-26T08:03:18-03:00 d/changelog: Add entry for release 6.4.35+dfsg-1 Gbp-Dch: Ignore - - - - - 2191 changed files: - README.md - debian/changelog - debian/control - debian/copyright - + debian/patches/local-icon-url.patch - debian/patches/series - + debian/praat-doc.doc-base - + debian/praat-doc.docs - debian/source/lintian-overrides - + docs/.nojekyll - + docs/CNAME - + docs/CharisSIL-6.200.zip - + docs/DoulosSIL-6.200.zip - + docs/GdiPlus_headers.zip - + docs/download_chrome.html - + docs/download_freebsd.html - + docs/download_hpux.html - + docs/download_linux.html - + docs/download_mac.html - + docs/download_raspberrypi.html - + docs/download_sgi.html - + docs/download_solaris.html - + docs/download_sources.html - + docs/download_win.html - + docs/favicon.ico - + docs/index.html - + docs/libgdiplus.a-32.zip - + docs/manual/10.html - + docs/manual/12.html - + docs/manual/14.html - + docs/manual/18.html - + docs/manual/24.html - + docs/manual/Abramowitz___Stegun__1970_.html - + docs/manual/Acknowledgments.html - + docs/manual/ActivationList.html - + docs/manual/Add_action_command___.html - + docs/manual/Add_menu_command___.html - + docs/manual/Add_to_dynamic_menu___.html - + docs/manual/Add_to_fixed_menu___.html - + docs/manual/Add_to_menu___.html - + docs/manual/Advanced_pulses_settings___.html - + docs/manual/Advanced_spectrogram_settings___.html - + docs/manual/AffineTransform.html - + docs/manual/AffineTransform__Invert.html - + docs/manual/Ammar_et_al___2001_.html - + docs/manual/AmplitudeTier.html - + docs/manual/AmplitudeTier__Add_point___.html - + docs/manual/Analyses_menu.html - + docs/manual/Anderson__1935_.html - + docs/manual/Anderson__1978_.html - + docs/manual/Anderson_et_al___1999_.html - + docs/manual/Archangeli___Pulleyblank__1994_.html - + docs/manual/Articulatory_synthesis.html - + docs/manual/Artword.html - + docs/manual/Artword___Speaker__To_Sound___.html - + docs/manual/Axes___.html - + docs/manual/BHEP_multivariate_normality_test.html - + docs/manual/Bai___Demmel__1993_.html - + docs/manual/BarkFilter.html - + docs/manual/BarkSpectrogram.html - + docs/manual/BarkSpectrogram__Draw_Sekey-Hanson_auditory_filters___.html - + docs/manual/BarkSpectrogram__Paint_image___.html - + docs/manual/Bartlett__1954_.html - + docs/manual/Berry_et_al___2007_.html - + docs/manual/Bishop__2006_.html - + docs/manual/Black.html - + docs/manual/Blue.html - + docs/manual/Blumensath___Davies__2010_.html - + docs/manual/Boersma__1993_.html - + docs/manual/Boersma__1997_.html - + docs/manual/Boersma__1998_.html - + docs/manual/Boersma__2000_.html - + docs/manual/Boersma__2009a_.html - + docs/manual/Boersma__2009b_.html - + docs/manual/Boersma___Escudero__2008_.html - + docs/manual/Boersma___Hayes__2001_.html - + docs/manual/Boersma___Kovacic__2006_.html - + docs/manual/Boersma___Pater__2016_.html - + docs/manual/Boll__1979_.html - + docs/manual/Bonferroni_correction.html - + docs/manual/Boomsma__1977_.html - + docs/manual/Borg___Groenen__1997_.html - + docs/manual/Brokken__1983_.html - + docs/manual/Buse__1973_.html - + docs/manual/ButtonEditor.html - + docs/manual/CANDECOMP.html - + docs/manual/CC.html - + docs/manual/CCA.html - + docs/manual/CCA__Get_zero_correlation_probability___.html - + docs/manual/CCA___Correlation__Get_redundancy__sl____.html - + docs/manual/CCA___Correlation__Get_variance_fraction___.html - + docs/manual/CCA___Correlation__To_TableOfReal__loadings_.html - + docs/manual/CCA___TableOfReal__Predict___.html - + docs/manual/CCA___TableOfReal__To_TableOfReal__loadings_.html - + docs/manual/CCA___TableOfReal__To_TableOfReal__scores____.html - + docs/manual/CC__Get_c0_value_in_frame___.html - + docs/manual/CC__Get_value_in_frame___.html - + docs/manual/CC__Paint___.html - + docs/manual/CC__To_DTW___.html - + docs/manual/CC__To_Matrix.html - + docs/manual/Cailliez__1983_.html - + docs/manual/Calculator.html - + docs/manual/Calculator___.html - + docs/manual/Candidate_modelling_settings___.html - + docs/manual/Canonical_correlation_analysis.html - + docs/manual/Carroll___Chang__1970_.html - + docs/manual/Carroll___Wish__1974_.html - + docs/manual/Categories.html - + docs/manual/CategoriesEditor.html - + docs/manual/Categories__Append.html - + docs/manual/Categories__Difference.html - + docs/manual/Categories__Edit.html - + docs/manual/Categories__To_Confusion.html - + docs/manual/Cepstrum.html - + docs/manual/Chan__Golub___LeVeque__1979_.html - + docs/manual/Chan__Golub___LeVeque__1983_.html - + docs/manual/ChebyshevSeries.html - + docs/manual/ChebyshevSeries__To_Polynomial.html - + docs/manual/Chebyshev_polynomials.html - + docs/manual/Checking_for_updates.html - + docs/manual/Childers__1978_.html - + docs/manual/ClassificationTable.html - + docs/manual/ClassificationTable__To_Confusion___.html - + docs/manual/Clear_history.html - + docs/manual/Click.html - + docs/manual/Cochleagram.html - + docs/manual/Cochleagram__Formula___.html - + docs/manual/Colour.html - + docs/manual/Colour___.html - + docs/manual/Command-click.html - + docs/manual/Configuration.html - + docs/manual/Configuration__Centralize.html - + docs/manual/Configuration__Draw___.html - + docs/manual/Configuration__Invert_dimension___.html - + docs/manual/Configuration__Normalize___.html - + docs/manual/Configuration__Randomize.html - + docs/manual/Configuration__Rotate___.html - + docs/manual/Configuration__Rotate__pc_.html - + docs/manual/Configuration__To_Configuration__procrustes_.html - + docs/manual/Configuration__To_Configuration__varimax____.html - + docs/manual/Configuration__To_Distance.html - + docs/manual/Configuration__To_Similarity__cc_.html - + docs/manual/Configuration___AffineTransform__To_Configuration.html - + docs/manual/Configuration___Configuration__To_Procrustes___.html - + docs/manual/Configuration___Procrustes__To_Configuration.html - + docs/manual/Configurations__To_AffineTransform__congruence____.html - + docs/manual/Confusion.html - + docs/manual/Confusion__Condense___.html - + docs/manual/Confusion__Get_fraction_correct.html - + docs/manual/Confusion__Get_response_sum___.html - + docs/manual/Confusion__Get_stimulus_sum___.html - + docs/manual/Confusion__Group___.html - + docs/manual/Confusion__Group_responses___.html - + docs/manual/Confusion__Group_stimuli___.html - + docs/manual/Confusion__Increase___.html - + docs/manual/Confusion__To_Dissimilarity___.html - + docs/manual/Confusion__To_Dissimilarity__pdf____.html - + docs/manual/Confusion__To_Similarity___.html - + docs/manual/Confusion__To_TableOfReal__marginals_.html - + docs/manual/Confusion___ClassificationTable__Increase_confusion_cou.html - + docs/manual/ConstantQLogFSpectrogram.html - + docs/manual/ContingencyTable.html - + docs/manual/ContingencyTable__To_Configuration__ca____.html - + docs/manual/Cooley___Lohnes__1971_.html - + docs/manual/Copy___.html - + docs/manual/Copy_to_clipboard.html - + docs/manual/Correlation.html - + docs/manual/Correlation__Confidence_intervals___.html - + docs/manual/Correspondence_analysis.html - + docs/manual/Courier.html - + docs/manual/Covariance.html - + docs/manual/Covariance__Difference.html - + docs/manual/Covariance__Get_fraction_variance___.html - + docs/manual/Covariance__Get_significance_of_means_difference___.html - + docs/manual/Covariance__Get_significance_of_one_mean___.html - + docs/manual/Covariance__Get_significance_of_one_variance___.html - + docs/manual/Covariance__Get_significance_of_variance_ratio___.html - + docs/manual/Covariance__Set_value___.html - + docs/manual/Covariance__To_TableOfReal__random_sampling____.html - + docs/manual/Covariance___TableOfReal__Extract_quantile_range___.html - + docs/manual/Covariance___TableOfReal__To_TableOfReal__mahalanobis__.html - + docs/manual/Covariances__Report_equality.html - + docs/manual/Covariances__Report_multivariate_mean_difference___.html - + docs/manual/Create_AmplitudeTier___.html - + docs/manual/Create_Artword___.html - + docs/manual/Create_ChebyshevSeries___.html - + docs/manual/Create_Configuration___.html - + docs/manual/Create_Corpus___.html - + docs/manual/Create_DurationTier___.html - + docs/manual/Create_DurationTier____1.png - + docs/manual/Create_FFNet___.html - + docs/manual/Create_FFNet__linear_outputs____.html - + docs/manual/Create_FormantGrid___.html - + docs/manual/Create_H1H2_table__Keating___Esposito_2006_.html - + docs/manual/Create_INDSCAL_Carroll___Wish_example___.html - + docs/manual/Create_INDSCAL_Carroll___Wish_example____1.png - + docs/manual/Create_INDSCAL_Carroll___Wish_example____2.png - + docs/manual/Create_ISpline___.html - + docs/manual/Create_IntensityTier___.html - + docs/manual/Create_KlattGrid___.html - + docs/manual/Create_KlattGrid_from_vowel___.html - + docs/manual/Create_LegendreSeries___.html - + docs/manual/Create_MSpline___.html - + docs/manual/Create_Matrix___.html - + docs/manual/Create_NoCoda_grammar.html - + docs/manual/Create_Permutation___.html - + docs/manual/Create_Photo___.html - + docs/manual/Create_PitchTier___.html - + docs/manual/Create_Poisson_process___.html - + docs/manual/Create_Poisson_process____1.png - + docs/manual/Create_Poisson_process____2.png - + docs/manual/Create_Poisson_process____3.png - + docs/manual/Create_Poisson_process____4.png - + docs/manual/Create_Polygon_from_values___.html - + docs/manual/Create_Polygon_from_values____1.png - + docs/manual/Create_Polynomial___.html - + docs/manual/Create_Sound_as_Shepard_tone___.html - + docs/manual/Create_Sound_as_gammatone___.html - + docs/manual/Create_Sound_as_pure_tone___.html - + docs/manual/Create_Sound_as_tone_complex___.html - + docs/manual/Create_Sound_from_formula___.html - + docs/manual/Create_Speaker___.html - + docs/manual/Create_SpeechSynthesizer___.html - + docs/manual/Create_Strings_as_directory_list___.html - + docs/manual/Create_Strings_as_file_list___.html - + docs/manual/Create_Strings_as_file_list____1.png - + docs/manual/Create_Strings_as_folder_list___.html - + docs/manual/Create_Strings_from_tokens___.html - + docs/manual/Create_TableOfReal.html - + docs/manual/Create_TableOfReal__Pols_1973____.html - + docs/manual/Create_TableOfReal__Sandwell_1987_.html - + docs/manual/Create_TableOfReal__Sandwell_1987__1.png - + docs/manual/Create_TableOfReal__Van_Nierop_1973____.html - + docs/manual/Create_TableOfReal__Weenink_1985____.html - + docs/manual/Create_Table__Ganong_1980_.html - + docs/manual/Create_Table_with_column_names___.html - + docs/manual/Create_Table_without_column_names___.html - + docs/manual/Create_TextGrid___.html - + docs/manual/Create_Vocal_Tract_from_phone___.html - + docs/manual/Create_empty_EditCostsTable___.html - + docs/manual/Create_empty_PointProcess___.html - + docs/manual/Create_formant_table__Peterson___Barney_1952_.html - + docs/manual/Create_formant_table__Pols___Van_Nierop_1973_.html - + docs/manual/Create_formant_table__Weenink_1985_.html - + docs/manual/Create_iris_data_set.html - + docs/manual/Create_iris_example___.html - + docs/manual/Create_letter_R_example___.html - + docs/manual/Create_letter_R_example____1.png - + docs/manual/Create_simple_Confusion___.html - + docs/manual/Create_simple_Correlation___.html - + docs/manual/Create_simple_Covariance___.html - + docs/manual/Create_simple_Matrix___.html - + docs/manual/Create_simple_Matrix_from_values___.html - + docs/manual/Create_simple_MixingMatrix___.html - + docs/manual/Create_simple_Photo___.html - + docs/manual/Create_tongue-root_grammar___.html - + docs/manual/CrossCorrelationTable.html - + docs/manual/CrossCorrelationTableList.html - + docs/manual/CrossCorrelationTableList__Create_test_set___.html - + docs/manual/CrossCorrelationTableList__Create_test_set____1.png - + docs/manual/Cyan.html - + docs/manual/DTW.html - + docs/manual/DTW__Draw_warp__x____.html - + docs/manual/DTW__Find_path__band___slope____.html - + docs/manual/DTW__Get_distance__weighted_.html - + docs/manual/DTW__Get_maximum_consecutive_steps___.html - + docs/manual/DTW__Get_time_along_path___.html - + docs/manual/DTW__Get_x_time_from_y_time___.html - + docs/manual/DTW__Get_y_time_from_x_time___.html - + docs/manual/DTW__Swap_axes.html - + docs/manual/DTW__To_Polygon___.html - + docs/manual/DTW___Sounds__Draw___.html - + docs/manual/DTW___Sounds__Draw_warp__x____.html - + docs/manual/DTW___TextGrid__To_TextGrid__warp_times_.html - + docs/manual/DataModeler.html - + docs/manual/DataModeler__Draw_estimated_track___.html - + docs/manual/DataModeler__Draw_model___.html - + docs/manual/DataModeler__Get_coefficient_of_determination.html - + docs/manual/DataModeler__Get_residual_sum_of_squares.html - + docs/manual/DataModeler__Speckle___.html - + docs/manual/DataModeler__To_Table__z-scores_.html - + docs/manual/Davis___Mermelstein__1980_.html - + docs/manual/De_Leeuw__1977_.html - + docs/manual/De_Leeuw___Pruzansky__1978_.html - + docs/manual/Deliyski__1993_.html - + docs/manual/Demo_window.html - + docs/manual/Demo_window_1__My_first_Demo_window_script.html - + docs/manual/Demo_window_2__Getting_user_input.html - + docs/manual/Demo_window_3__Getting_click_locations.html - + docs/manual/Demo_window_4__Full-screen_viewing.html - + docs/manual/Demo_window_5__Asynchronous_play.html - + docs/manual/Demo_window_6__Animation.html - + docs/manual/Demo_window_7__Miscellaneous.html - + docs/manual/Demo_window_8__Tips_and_Tricks.html - + docs/manual/Deng___Tang__2011_.html - + docs/manual/Deng_et_al___2006_.html - + docs/manual/Difference_of_two_proportions.html - + docs/manual/Discriminant.html - + docs/manual/Discriminant__Draw_sigma_ellipses___.html - + docs/manual/Discriminant__Extract_pooled_within-groups_SSCP.html - + docs/manual/Discriminant__Extract_within-group_SSCP___.html - + docs/manual/Discriminant__Get_Wilks__lambda___.html - + docs/manual/Discriminant__Get_concentration_ellipse_area___.html - + docs/manual/Discriminant__Get_confidence_ellipse_area___.html - + docs/manual/Discriminant__Get_contribution_of_component___.html - + docs/manual/Discriminant__Get_partial_discrimination_probability___.html - + docs/manual/Discriminant___PatternList__To_Categories___.html - + docs/manual/Discriminant___SSCP__Project.html - + docs/manual/Discriminant___TableOfReal__To_ClassificationTable___.html - + docs/manual/Discriminant___TableOfReal__To_Configuration___.html - + docs/manual/Discriminant___TableOfReal__To_TableOfReal__mahalanobis.html - + docs/manual/Discriminant_analysis.html - + docs/manual/Discriminant_analysis_1.png - + docs/manual/Discriminant_analysis_2.png - + docs/manual/Discriminant_analysis_3.png - + docs/manual/Dissimilarity.html - + docs/manual/Dissimilarity__Get_additive_constant.html - + docs/manual/Dissimilarity__To_Configuration__absolute_mds____.html - + docs/manual/Dissimilarity__To_Configuration__i-spline_mds____.html - + docs/manual/Dissimilarity__To_Configuration__interval_mds____.html - + docs/manual/Dissimilarity__To_Configuration__kruskal____.html - + docs/manual/Dissimilarity__To_Configuration__monotone_mds____.html - + docs/manual/Dissimilarity__To_Configuration__ratio_mds____.html - + docs/manual/Dissimilarity__To_Distance___.html - + docs/manual/Dissimilarity__To_Weight.html - + docs/manual/Dissimilarity___Configuration__Draw_Shepard_diagram___.html - + docs/manual/Dissimilarity___Configuration__Draw_regression__absolut.html - + docs/manual/Dissimilarity___Configuration__Draw_regression__i-splin.html - + docs/manual/Dissimilarity___Configuration__Draw_regression__interva.html - + docs/manual/Dissimilarity___Configuration__Draw_regression__monoton.html - + docs/manual/Dissimilarity___Configuration__Draw_regression__ratio_m.html - + docs/manual/Dissimilarity___Configuration__Get_stress__absolute_mds.html - + docs/manual/Dissimilarity___Configuration__Get_stress__i-spline_mds.html - + docs/manual/Dissimilarity___Configuration__Get_stress__interval_mds.html - + docs/manual/Dissimilarity___Configuration__Get_stress__monotone_mds.html - + docs/manual/Dissimilarity___Configuration__Get_stress__ratio_mds___.html - + docs/manual/Dissimilarity___Configuration__To_Configuration__absolu.html - + docs/manual/Dissimilarity___Configuration__To_Configuration__i-spli.html - + docs/manual/Dissimilarity___Configuration__To_Configuration__interv.html - + docs/manual/Dissimilarity___Configuration__To_Configuration__kruska.html - + docs/manual/Dissimilarity___Configuration__To_Configuration__monoto.html - + docs/manual/Dissimilarity___Configuration__To_Configuration__ratio_.html - + docs/manual/Dissimilarity___Configuration___Weight__Get_stress___.html - + docs/manual/Dissimilarity___Configuration___Weight__To_Configuratio.html - + docs/manual/Dissimilarity___Weight__To_Configuration___.html - + docs/manual/Distance.html - + docs/manual/Distance__To_Configuration__indscal____.html - + docs/manual/Distance__To_Configuration__ytl____.html - + docs/manual/Distance__To_ScalarProduct___.html - + docs/manual/Distance___Configuration__Draw_scatter_diagram___.html - + docs/manual/Distance___Configuration__Get_VAF___.html - + docs/manual/Distance___Configuration__To_Configuration__indscal____.html - + docs/manual/Distance___Configuration___Salience__Get_VAF___.html - + docs/manual/Distance___Configuration___Salience__To_Configuration__.html - + docs/manual/Distributions.html - + docs/manual/Distributions__To_Strings___.html - + docs/manual/Drag.html - + docs/manual/Draw_inner_box.html - + docs/manual/Draw_line___.html - + docs/manual/Draw_menu.html - + docs/manual/Draw_rectangle___.html - + docs/manual/Draw_rounded_rectangle___.html - + docs/manual/DurationTier.html - + docs/manual/DurationTierEditor.html - + docs/manual/DurationTier__Add_point___.html - + docs/manual/DurationTier__Get_target_duration___.html - + docs/manual/Dynamic_menu.html - + docs/manual/EEG.html - + docs/manual/EditCostsTable.html - + docs/manual/EditCostsTable_1.png - + docs/manual/EditDistanceTable.html - + docs/manual/EditDistanceTable_1.png - + docs/manual/EditDistanceTable_2.png - + docs/manual/EditDistanceTable___EditCostsTable__Set_new_edit_costs.html - + docs/manual/Editors.html - + docs/manual/Efron___Tibshirani__1993_.html - + docs/manual/Eigen.html - + docs/manual/Eigen__Draw_eigenvalues___.html - + docs/manual/Eigen__Draw_eigenvector___.html - + docs/manual/Eigen__Extract_eigenvector___.html - + docs/manual/Eigen__Get_contribution_of_component___.html - + docs/manual/Eigen__Get_cumulative_contribution_of_components___.html - + docs/manual/Eigen__Get_eigenvalue___.html - + docs/manual/Eigen__Get_eigenvector_element___.html - + docs/manual/Eigen___Matrix__To_Matrix__project_columns____.html - + docs/manual/Eigen___Matrix__To_Matrix__project_rows____.html - + docs/manual/Eigen___SSCP__Project.html - + docs/manual/Eigen___TableOfReal__Project___.html - + docs/manual/Electroglottogram.html - + docs/manual/Electroglottogram_1.png - + docs/manual/Electroglottogram__Derivative___.html - + docs/manual/Electroglottogram__First_central_difference___.html - + docs/manual/Electroglottogram__High-pass_filter___.html - + docs/manual/Electroglottogram__To_AmplitudeTier__levels____.html - + docs/manual/Electroglottogram__To_TextGrid__closed_glottis____.html - + docs/manual/Electroglottogram__To_TextGrid__closed_glottis_____1.png - + docs/manual/Encapsulated_PostScript.html - + docs/manual/Erase_all.html - + docs/manual/Escudero__Boersma__Rauber___Bion__2009_.html - + docs/manual/Escudero___Boersma__2004_.html - + docs/manual/Excitation.html - + docs/manual/Excitation__Formula___.html - + docs/manual/Excitation__Get_loudness.html - + docs/manual/Excitations.html - + docs/manual/Excitations__Append.html - + docs/manual/Excitations__To_PatternList___.html - + docs/manual/ExperimentMFC.html - + docs/manual/ExperimentMFC_1__When_to_use_Praat.html - + docs/manual/ExperimentMFC_2_1__The_experiment_file.html - + docs/manual/ExperimentMFC_2_2__The_stimuli.html - + docs/manual/ExperimentMFC_2_3__The_carrier_phrase.html - + docs/manual/ExperimentMFC_2_4__Breaks.html - + docs/manual/ExperimentMFC_2_5__Randomization_strategies.html - + docs/manual/ExperimentMFC_2_6__Instructions.html - + docs/manual/ExperimentMFC_2_7__Response_categories.html - + docs/manual/ExperimentMFC_2_8__Goodness_judgments.html - + docs/manual/ExperimentMFC_2_9__How_an_experiment_proceeds.html - + docs/manual/ExperimentMFC_2__The_first_example.html - + docs/manual/ExperimentMFC_3_1__A_simple_discrimination_experiment.html - + docs/manual/ExperimentMFC_3_2__An_AXB_discrimination_experiment.html - + docs/manual/ExperimentMFC_3_3__A_4I-oddity_experiment.html - + docs/manual/ExperimentMFC_3_4__Variable_inter-stimulus_intervals.html - + docs/manual/ExperimentMFC_3__More_examples.html - + docs/manual/ExperimentMFC_4_1__The_replay_button.html - + docs/manual/ExperimentMFC_4_2__The_OK_button.html - + docs/manual/ExperimentMFC_4_3__The_oops_button.html - + docs/manual/ExperimentMFC_4__Special_buttons.html - + docs/manual/ExperimentMFC_5_1__The_stimulus-dependent_run_text.html - + docs/manual/ExperimentMFC_5_2__Stimulus-dependent_response_buttons.html - + docs/manual/ExperimentMFC_5__Stimulus-dependent_texts.html - + docs/manual/ExperimentMFC_6__Responses_are_sounds.html - + docs/manual/ExperimentMFC_7__Blanking_the_screen.html - + docs/manual/ExperimentMFC_8__Running_multiple_experiments.html - + docs/manual/Extract_one_channel___.html - + docs/manual/Extract_selected_sound__windowed____.html - + docs/manual/Extract_visible_formant_contour.html - + docs/manual/Extract_visible_intensity_contour.html - + docs/manual/Extract_visible_pitch_contour.html - + docs/manual/Extract_visible_spectrogram.html - + docs/manual/FAQ__Formant_analysis.html - + docs/manual/FAQ__Frequently_Asked_Questions_.html - + docs/manual/FAQ__How_to_cite_Praat.html - + docs/manual/FAQ__Pitch_analysis.html - + docs/manual/FAQ__Scripts.html - + docs/manual/FAQ__Spectrograms.html - + docs/manual/FFNet.html - + docs/manual/FFNet__Categories.html - + docs/manual/FFNet__Draw_cost_history___.html - + docs/manual/FFNet__Draw_topology.html - + docs/manual/FFNet__Draw_weights___.html - + docs/manual/FFNet__Extract_weights___.html - + docs/manual/FFNet__Get_number_of_hidden_units___.html - + docs/manual/FFNet__Get_number_of_hidden_weights___.html - + docs/manual/FFNet__Get_number_of_inputs.html - + docs/manual/FFNet__Get_number_of_outputs.html - + docs/manual/FFNet__Principal_components.html - + docs/manual/FFNet__Reset___.html - + docs/manual/FFNet__Select_biases___.html - + docs/manual/FFNet___PatternList__To_Categories___.html - + docs/manual/FFNet___PatternList___ActivationList__Get_average_costs.html - + docs/manual/FFNet___PatternList___ActivationList__Get_total_costs__.html - + docs/manual/FFNet___PatternList___Categories__Get_average_costs___.html - + docs/manual/FFNet___PatternList___Categories__Get_total_costs___.html - + docs/manual/FFNet___PatternList___Categories__Learn___.html - + docs/manual/FFNet___PatternList___Categories__Learn_slow___.html - + docs/manual/FFT.html - + docs/manual/FLAC_BSD_3-clause_license.html - + docs/manual/FLAC_files.html - + docs/manual/Fant__1960_.html - + docs/manual/Fast_Fourier_Transform.html - + docs/manual/Feedforward_neural_networks.html - + docs/manual/Feedforward_neural_networks_1_1__The_learning_phase.html - + docs/manual/Feedforward_neural_networks_1_2__The_classification_pha.html - + docs/manual/Feedforward_neural_networks_1__What_is_a_feedforward_ne.html - + docs/manual/Feedforward_neural_networks_1__What_is_a_feedforward_ne_1.png - + docs/manual/Feedforward_neural_networks_2__Quick_start.html - + docs/manual/Feedforward_neural_networks_3__FFNet_versus_discriminan.html - + docs/manual/Feedforward_neural_networks_4__Command_overview.html - + docs/manual/Figueiredo___Jain__2002_.html - + docs/manual/File_menu.html - + docs/manual/FilterBank__Draw_filter_functions___.html - + docs/manual/FilterBank__Draw_frequency_scales___.html - + docs/manual/FilterBank__Get_frequency_in_Bark___.html - + docs/manual/FilterBank__Get_frequency_in_Hertz___.html - + docs/manual/FilterBank__Get_frequency_in_mel___.html - + docs/manual/Filtering.html - + docs/manual/Fischer__2005_.html - + docs/manual/Fisher__1936_.html - + docs/manual/Flanagan__1960_.html - + docs/manual/Flanagan___Landgraf__1968_.html - + docs/manual/Fleisher_et_al___2015_.html - + docs/manual/Font_menu.html - + docs/manual/Font_size___.html - + docs/manual/Formant.html - + docs/manual/FormantFilter.html - + docs/manual/FormantGrid.html - + docs/manual/FormantGrid__Add_bandwidth_point___.html - + docs/manual/FormantGrid__Add_formant_point___.html - + docs/manual/FormantGrid__Remove_bandwidth_points_between___.html - + docs/manual/FormantGrid__Remove_formant_points_between___.html - + docs/manual/FormantModeler__Get_residual_sum_of_squares___.html - + docs/manual/FormantPath.html - + docs/manual/FormantPathEditor.html - + docs/manual/FormantPath__Down_to_Table__optimal_interval____.html - + docs/manual/FormantPath__Down_to_Table__stresses____.html - + docs/manual/Formant__Down_to_FormantGrid.html - + docs/manual/Formant__Draw_tracks___.html - + docs/manual/Formant__Formula__bandwidths____.html - + docs/manual/Formant__Formula__frequencies____.html - + docs/manual/Formant__Get_bandwidth_at_time___.html - + docs/manual/Formant__Get_maximum___.html - + docs/manual/Formant__Get_mean___.html - + docs/manual/Formant__Get_minimum___.html - + docs/manual/Formant__Get_number_of_formants.html - + docs/manual/Formant__Get_quantile___.html - + docs/manual/Formant__Get_standard_deviation.html - + docs/manual/Formant__Get_time_of_maximum___.html - + docs/manual/Formant__Get_time_of_minimum___.html - + docs/manual/Formant__Get_value_at_time___.html - + docs/manual/Formant__List_formant_slope___.html - + docs/manual/Formant__Speckle___.html - + docs/manual/Formant__Track___.html - + docs/manual/Formant___Spectrogram__To_IntensityTier___.html - + docs/manual/Formants__Extract_smoothest_part___.html - + docs/manual/Formants__Extract_smoothest_part____1.png - + docs/manual/Formants__Extract_smoothest_part__constrained____.html - + docs/manual/Formants___LPC_menu.html - + docs/manual/Formants_menu.html - + docs/manual/Formula___.html - + docs/manual/Formulas.html - + docs/manual/Formulas_1_1__Formulas_in_the_calculator.html - + docs/manual/Formulas_1_2__Numeric_expressions.html - + docs/manual/Formulas_1_3__String_expressions.html - + docs/manual/Formulas_1_4__Array_expressions.html - + docs/manual/Formulas_1_5__Formulas_in_settings_windows.html - + docs/manual/Formulas_1_6__Formulas_for_creation.html - + docs/manual/Formulas_1_7__Formulas_for_modification.html - + docs/manual/Formulas_1_8__Formulas_in_scripts.html - + docs/manual/Formulas_1__My_first_formulas.html - + docs/manual/Formulas_2_1__Representation_of_numbers.html - + docs/manual/Formulas_2_2__Representation_of_strings.html - + docs/manual/Formulas_2_3__Representation_of_arrays.html - + docs/manual/Formulas_2__Representations.html - + docs/manual/Formulas_3__Operators.html - + docs/manual/Formulas_4__Constants.html - + docs/manual/Formulas_5__Mathematical_functions.html - + docs/manual/Formulas_6__String_functions.html - + docs/manual/Formulas_7__Control_structures.html - + docs/manual/Formulas_8__Attributes_of_objects.html - + docs/manual/Formulas_9__Data_in_objects.html - + docs/manual/Frequency_selection.html - + docs/manual/Friedl__1997_.html - + docs/manual/Functions.html - + docs/manual/F?votte__Bertin___Durrieu__2009_.html - + docs/manual/GNU_Lesser_General_Public_License__version_2_1.html - + docs/manual/Ganong__1980_.html - + docs/manual/Garofolo__Lamel__Fisher__Fiscus__Pallett___Dahlgren__19.html - + docs/manual/GaussianMixture.html - + docs/manual/GaussianMixture__Draw_concentration_ellipses___.html - + docs/manual/GaussianMixture__Draw_marginal_pdf___.html - + docs/manual/GaussianMixture__Get_probability_at_position.html - + docs/manual/GaussianMixture__Split_component___.html - + docs/manual/GaussianMixture__To_Covariance__between_.html - + docs/manual/GaussianMixture__To_Covariance__total_.html - + docs/manual/GaussianMixture__To_Covariance__within_.html - + docs/manual/GaussianMixture__To_PCA.html - + docs/manual/GaussianMixture__To_TableOfReal__random_sampling____.html - + docs/manual/GaussianMixture___PCA__Draw_concentration_ellipses___.html - + docs/manual/GaussianMixture___PCA__To_Matrix__density____.html - + docs/manual/GaussianMixture___TableOfReal__Get_likelihood_value___.html - + docs/manual/GaussianMixture___TableOfReal__Improve_likelihood___.html - + docs/manual/GaussianMixture___TableOfReal__To_ClassificationTable.html - + docs/manual/GaussianMixture___TableOfReal__To_Correlation__columns_.html - + docs/manual/GaussianMixture___TableOfReal__To_GaussianMixture__CEMM.html - + docs/manual/GaussianMixture___TableOfReal__To_Table__BHEP_normality.html - + docs/manual/General_Public_License__version_2.html - + docs/manual/General_Public_License__version_3.html - + docs/manual/Get_area___.html - + docs/manual/Get_first_formant.html - + docs/manual/Get_frame_number_from_time___.html - + docs/manual/Get_high_index_from_time___.html - + docs/manual/Get_incomplete_gamma___.html - + docs/manual/Get_low_index_from_time___.html - + docs/manual/Get_nearest_index_from_time___.html - + docs/manual/Get_number_of_frames.html - + docs/manual/Get_number_of_samples.html - + docs/manual/Get_pitch.html - + docs/manual/Get_sample_number_from_time___.html - + docs/manual/Get_sampling_frequency.html - + docs/manual/Get_sampling_period.html - + docs/manual/Get_second_formant.html - + docs/manual/Get_time_from_frame_number___.html - + docs/manual/Get_time_from_sample_number___.html - + docs/manual/Get_time_step.html - + docs/manual/Gifi__1990_.html - + docs/manual/Golub___van_Loan__1996_.html - + docs/manual/Goodies.html - + docs/manual/Green.html - + docs/manual/Green__Carmone___Smith__1989_.html - + docs/manual/Greiner___Hormann__1998_.html - + docs/manual/Grey.html - + docs/manual/HMM.html - + docs/manual/HMMObservationSequence.html - + docs/manual/HMMObservationSequence__To_TableOfReal__bigrams____.html - + docs/manual/HMMStateSequence.html - + docs/manual/HMM_1.png - + docs/manual/HMM__Create_simple_HMM___.html - + docs/manual/HMM__Extract_emission_probabilities.html - + docs/manual/HMM__Extract_transition_probabilities.html - + docs/manual/HMM__Get_emission_probability___.html - + docs/manual/HMM__Get_expected_duration_in_state___.html - + docs/manual/HMM__Get_p__time__state____.html - + docs/manual/HMM__Get_p__time__state__symbol____.html - + docs/manual/HMM__Get_probability_staying_in_state___.html - + docs/manual/HMM__Get_start_probability___.html - + docs/manual/HMM__Get_transition_probability___.html - + docs/manual/HMM__Set_emission_probabilities___.html - + docs/manual/HMM__Set_start_probabilities___.html - + docs/manual/HMM__Set_transition_probabilities___.html - + docs/manual/HMM__To_HMMObservationSequence___.html - + docs/manual/HMM___HMMObservationSequence__Get_cross-entropy.html - + docs/manual/HMM___HMMObservationSequence__Get_probability.html - + docs/manual/HMM___HMMObservationSequence__To_TableOfReal__bigrams__.html - + docs/manual/HMM___HMMObservationSequences__Learn___.html - + docs/manual/HMM___HMMStateSequence__Get_probability.html - + docs/manual/HMM___HMM__Get_cross-entropy___.html - + docs/manual/HMM___HMM___HMMObservationSequence__Get_cross-entropy.html - + docs/manual/HTK_parameter_file_format.html - + docs/manual/Harmonicity.html - + docs/manual/Harmonicity__Formula___.html - + docs/manual/Harmonicity__Get_maximum___.html - + docs/manual/Harmonicity__Get_mean___.html - + docs/manual/Harmonicity__Get_minimum___.html - + docs/manual/Harmonicity__Get_standard_deviation___.html - + docs/manual/Harmonicity__Get_time_of_maximum___.html - + docs/manual/Harmonicity__Get_time_of_minimum___.html - + docs/manual/Harmonicity__Get_value_at_time___.html - + docs/manual/Harmonicity__Get_value_in_frame___.html - + docs/manual/Hastie__Tibshirani___Friedman__2001_.html - + docs/manual/Hawks___Miller__1995_.html - + docs/manual/Hayes___MacEachern__1998_.html - + docs/manual/Heath_et_al___1986_.html - + docs/manual/Helvetica.html - + docs/manual/Henrich_et_al___2004_.html - + docs/manual/Henze___Wagner__1997_.html - + docs/manual/Herbst__2019_.html - + docs/manual/Herbst_et_al___2014_.html - + docs/manual/Hermes__1988_.html - + docs/manual/Hillenbrand___Houde__1996_.html - + docs/manual/Hillenbrand_et_al___1994_.html - + docs/manual/History_mechanism.html - + docs/manual/Holighaus_et_al___2013_.html - + docs/manual/Hormann___Agathos__2001_.html - + docs/manual/How_to_concatenate_sound_files.html - + docs/manual/IDX_file_format.html - + docs/manual/INDSCAL_analysis.html - + docs/manual/ISpline.html - + docs/manual/Independent_Component_Analysis_on_EEG.html - + docs/manual/Index.html - + docs/manual/Index__Extract_part___.html - + docs/manual/Index__To_Permutation___.html - + docs/manual/Info.html - + docs/manual/Info_window.html - + docs/manual/Insert_picture_from_file___.html - + docs/manual/Inspect.html - + docs/manual/Intensity.html - + docs/manual/IntensityTier.html - + docs/manual/IntensityTierEditor.html - + docs/manual/IntensityTier__Add_point___.html - + docs/manual/IntensityTier__Down_to_PointProcess.html - + docs/manual/Intensity__Get_maximum___.html - + docs/manual/Intensity__Get_mean___.html - + docs/manual/Intensity__Get_minimum___.html - + docs/manual/Intensity__Get_standard_deviation___.html - + docs/manual/Intensity__Get_time_of_maximum___.html - + docs/manual/Intensity__Get_time_of_minimum___.html - + docs/manual/Intensity__Get_value_at_time___.html - + docs/manual/Intensity__Get_value_in_frame___.html - + docs/manual/Intensity__To_IntensityTier.html - + docs/manual/Intensity__To_TextGrid__silences____.html - + docs/manual/Intensity___PointProcess__To_IntensityTier___.html - + docs/manual/Interoperability.html - + docs/manual/Intro.html - + docs/manual/Intro_1_1__Recording_a_sound.html - + docs/manual/Intro_1_2__Reading_a_sound_from_disk.html - + docs/manual/Intro_1_3__Creating_a_sound_from_a_formula.html - + docs/manual/Intro_1__How_to_get_a_sound.html - + docs/manual/Intro_2_1__Saving_a_sound_to_disk.html - + docs/manual/Intro_2_2__Viewing_and_editing_a_sound.html - + docs/manual/Intro_2__What_to_do_with_a_sound.html - + docs/manual/Intro_3_1__Viewing_a_spectrogram.html - + docs/manual/Intro_3_2__Configuring_the_spectrogram.html - + docs/manual/Intro_3_3__Querying_the_spectrogram.html - + docs/manual/Intro_3_4__Printing_the_spectrogram.html - + docs/manual/Intro_3_5__The_Spectrogram_object.html - + docs/manual/Intro_3_6__Viewing_a_spectral_slice.html - + docs/manual/Intro_3_7__Configuring_the_spectral_slice.html - + docs/manual/Intro_3_8__The_Spectrum_object.html - + docs/manual/Intro_3__Spectral_analysis.html - + docs/manual/Intro_4_1__Viewing_a_pitch_contour.html - + docs/manual/Intro_4_2__Configuring_the_pitch_contour.html - + docs/manual/Intro_4_3__Querying_the_pitch_contour.html - + docs/manual/Intro_4_4__Printing_the_pitch_contour.html - + docs/manual/Intro_4_5__The_Pitch_object.html - + docs/manual/Intro_4__Pitch_analysis.html - + docs/manual/Intro_5_1__Viewing_formant_contours.html - + docs/manual/Intro_5_2__Configuring_the_formant_contours.html - + docs/manual/Intro_5_3__Querying_the_formant_contours.html - + docs/manual/Intro_5_4__The_Formant_object.html - + docs/manual/Intro_5__Formant_analysis.html - + docs/manual/Intro_6_1__Viewing_an_intensity_contour.html - + docs/manual/Intro_6_2__Configuring_the_intensity_contour.html - + docs/manual/Intro_6_3__Querying_the_intensity_contour.html - + docs/manual/Intro_6_4__The_Intensity_object.html - + docs/manual/Intro_6__Intensity_analysis.html - + docs/manual/Intro_7__Annotation.html - + docs/manual/Intro_8_1__Manipulation_of_pitch.html - + docs/manual/Intro_8_2__Manipulation_of_duration.html - + docs/manual/Intro_8_3__Manipulation_of_intensity.html - + docs/manual/Intro_8_4__Manipulation_of_formants.html - + docs/manual/Intro_8__Manipulation.html - + docs/manual/Irino___Patterson__1997_.html - + docs/manual/Ishizaka___Flanagan__1972_.html - + docs/manual/Itakura-Saito_divergence.html - + docs/manual/Itakura___Saito__1968_.html - + docs/manual/Jacquelin__2009_.html - + docs/manual/Janecek_et_al___2011_.html - + docs/manual/Jesteadt__Wier___Green__1977_.html - + docs/manual/Johannesma__1972_.html - + docs/manual/Johnson__1998_.html - + docs/manual/J?ger__2003_.html - + docs/manual/Kaiser__1958_.html - + docs/manual/Keating___Esposito__2006_.html - + docs/manual/Keyboard_shortcuts.html - + docs/manual/Khuri__1998_.html - + docs/manual/Kiers___Groenen__1996_.html - + docs/manual/Kim___Kim__2006_.html - + docs/manual/Kirshenbaum_phonetic_encoding.html - + docs/manual/KlattGrid.html - + docs/manual/KlattGrid_1.png - + docs/manual/KlattGrid_2.png - + docs/manual/KlattGrid__Extract_oral_formant_grid__open_phases____.html - + docs/manual/KlattGrid__Play_special___.html - + docs/manual/KlattGrid__To_Sound__phonation____.html - + docs/manual/KlattGrid__To_Sound__special____.html - + docs/manual/KlattTable.html - + docs/manual/Klatt___Klatt__1990_.html - + docs/manual/Klein__Plomp___Pols__1970_.html - + docs/manual/Kostlan___Gokhman__1987_.html - + docs/manual/Krishnamoorthy___Yu__2004_.html - + docs/manual/Kruskal__1964_.html - + docs/manual/Kruskal_analysis.html - + docs/manual/LAPACK.html - + docs/manual/LFCC.html - + docs/manual/LFCC__To_LPC___.html - + docs/manual/LPC.html - + docs/manual/LPC__Draw_gain___.html - + docs/manual/LPC__Draw_poles___.html - + docs/manual/LPC__To_Formant.html - + docs/manual/LPC__To_LFCC___.html - + docs/manual/LPC__To_Matrix.html - + docs/manual/LPC__To_Polynomial__slice____.html - + docs/manual/LPC__To_Spectrogram___.html - + docs/manual/LPC__To_Spectrum__slice____.html - + docs/manual/LPC__To_VocalTract__slice____.html - + docs/manual/LPC___Sound__Filter___.html - + docs/manual/LPC___Sound__Filter__inverse_.html - + docs/manual/LPC___Sound__Filter__inverse__with_filter_at_time___.html - + docs/manual/LPC___Sound__Filter_with_filter_at_time___.html - + docs/manual/Labelling.html - + docs/manual/Ladefoged__2001_.html - + docs/manual/Ladefoged___Maddieson__1996_.html - + docs/manual/Lamel__Kassel___Seneff__1986_.html - + docs/manual/Lee__1988_.html - + docs/manual/Lee___Seung__2001_.html - + docs/manual/LegendreSeries.html - + docs/manual/LegendreSeries__To_Polynomial.html - + docs/manual/Legendre_polynomials.html - + docs/manual/License.html - + docs/manual/Lime.html - + docs/manual/List_of_Objects.html - + docs/manual/Log_files.html - + docs/manual/Logarithmic_marks_left_right_top_bottom___.html - + docs/manual/Logistic_regression.html - + docs/manual/LongSound.html - + docs/manual/LongSoundEditor.html - + docs/manual/LongSound__To_TextGrid___.html - + docs/manual/LongSound__View.html - + docs/manual/Ltas.html - + docs/manual/Ltas__Average.html - + docs/manual/Ltas__Get_bin_number_from_frequency___.html - + docs/manual/Ltas__Get_bin_width.html - + docs/manual/Ltas__Get_frequency_from_bin_number___.html - + docs/manual/Ltas__Get_frequency_of_maximum___.html - + docs/manual/Ltas__Get_frequency_of_minimum___.html - + docs/manual/Ltas__Get_highest_frequency.html - + docs/manual/Ltas__Get_lowest_frequency.html - + docs/manual/Ltas__Get_maximum___.html - + docs/manual/Ltas__Get_mean___.html - + docs/manual/Ltas__Get_minimum___.html - + docs/manual/Ltas__Get_number_of_bins.html - + docs/manual/Ltas__Get_standard_deviation___.html - + docs/manual/Ltas__Get_value_at_frequency___.html - + docs/manual/Ltas__Get_value_in_bin___.html - + docs/manual/MDS_models.html - + docs/manual/MDS_models_1.png - + docs/manual/MFCC.html - + docs/manual/MFCC__To_MelFilter___.html - + docs/manual/MFCC__To_MelSpectrogram___.html - + docs/manual/MFCC__To_TableOfReal___.html - + docs/manual/MSpline.html - + docs/manual/Ma___Nishihara__2013_.html - + docs/manual/Magenta.html - + docs/manual/Magron___Virtanen__2018_.html - + docs/manual/Mahalanobis_distance.html - + docs/manual/ManPages.html - + docs/manual/ManPages_1.png - + docs/manual/Manipulation.html - + docs/manual/ManipulationEditor.html - + docs/manual/Manipulation__Extract_duration_tier.html - + docs/manual/Manipulation__Extract_original_sound.html - + docs/manual/Manipulation__Extract_pitch_tier.html - + docs/manual/Manipulation__Extract_pulses.html - + docs/manual/Manipulation__Get_resynthesis__overlap-add_.html - + docs/manual/Manipulation__Play__overlap-add_.html - + docs/manual/Manipulation__Replace_duration_tier.html - + docs/manual/Manipulation__Replace_original_sound.html - + docs/manual/Manipulation__Replace_pitch_tier.html - + docs/manual/Manipulation__Replace_pulses.html - + docs/manual/Manual.html - + docs/manual/Margins.html - + docs/manual/Markel___Gray__1976_.html - + docs/manual/Marks_bottom_every___.html - + docs/manual/Marks_left_right_top_bottom___.html - + docs/manual/Marks_left_right_top_bottom_every___.html - + docs/manual/Maroon.html - + docs/manual/Marple__1980_.html - + docs/manual/Marsaglia___Tsang__2000_.html - + docs/manual/Matrix.html - + docs/manual/Matrix__Draw_as_squares___.html - + docs/manual/Matrix__Draw_distribution___.html - + docs/manual/Matrix__Formula___.html - + docs/manual/Matrix__Paint_cells___.html - + docs/manual/Matrix__Set_value___.html - + docs/manual/Matrix__Solve_equation___.html - + docs/manual/Matrix__To_NMF__ALS____.html - + docs/manual/Matrix__To_NMF__IS____.html - + docs/manual/Matrix__To_NMF__m_u_____.html - + docs/manual/Matrix__To_TableOfReal.html - + docs/manual/McCarthy___Prince__1995_.html - + docs/manual/Measurement_levels.html - + docs/manual/MelFilter.html - + docs/manual/MelSpectrogram.html - + docs/manual/MelSpectrogram__Paint_image___.html - + docs/manual/MelSpectrogram__To_MFCC___.html - + docs/manual/MixingMatrix.html - + docs/manual/MixingMatrix__Multiply_input_channel___.html - + docs/manual/Modify.html - + docs/manual/Morrison__1990_.html - + docs/manual/Moulines___Charpentier__1990_.html - + docs/manual/Multidimensional_scaling.html - + docs/manual/Multidimensional_scaling_1.png - + docs/manual/Multidimensional_scaling_2.png - + docs/manual/Multidimensional_scaling_3.png - + docs/manual/NIST_files.html - + docs/manual/NMF.html - + docs/manual/Nagarajan__Wang__Merzenich__Schreiner__Johnston__Jenkin.html - + docs/manual/NavigationContext.html - + docs/manual/Navy.html - + docs/manual/New_Praat_notebook.html - + docs/manual/New_Praat_script.html - + docs/manual/New_menu.html - + docs/manual/Nocedal___Wright__1999_.html - + docs/manual/NotebookEditor.html - + docs/manual/Nyquist_frequency.html - + docs/manual/OT.html - + docs/manual/OTGrammar.html - + docs/manual/OTGrammarEditor.html - + docs/manual/OTGrammar__Generate_inputs___.html - + docs/manual/OTGrammar__Input_to_output___.html - + docs/manual/OTGrammar__Input_to_outputs___.html - + docs/manual/OTGrammar__Learn_one___.html - + docs/manual/OTGrammar__To_output_Distributions___.html - + docs/manual/OTGrammar___2_Strings__Learn___.html - + docs/manual/OTGrammar___PairDistribution__Find_positive_weights___.html - + docs/manual/OTGrammar___Strings__Inputs_to_outputs___.html - + docs/manual/OT_learning.html - + docs/manual/OT_learning_1__Kinds_of_grammars.html - + docs/manual/OT_learning_2_1__Viewing_a_grammar.html - + docs/manual/OT_learning_2_1__Viewing_a_grammar_1.png - + docs/manual/OT_learning_2_1__Viewing_a_grammar_2.png - + docs/manual/OT_learning_2_2__Inside_the_grammar.html - + docs/manual/OT_learning_2_3__Defining_your_own_grammar.html - + docs/manual/OT_learning_2_4__Evaluation.html - + docs/manual/OT_learning_2_4__Evaluation_1.png - + docs/manual/OT_learning_2_5__Editing_a_grammar.html - + docs/manual/OT_learning_2_5__Editing_a_grammar_1.png - + docs/manual/OT_learning_2_5__Editing_a_grammar_2.png - + docs/manual/OT_learning_2_6__Variable_output.html - + docs/manual/OT_learning_2_6__Variable_output_1.png - + docs/manual/OT_learning_2_6__Variable_output_2.png - + docs/manual/OT_learning_2_6__Variable_output_3.png - + docs/manual/OT_learning_2_6__Variable_output_4.png - + docs/manual/OT_learning_2_6__Variable_output_5.png - + docs/manual/OT_learning_2_6__Variable_output_6.png - + docs/manual/OT_learning_2_7__Tableau_pictures.html - + docs/manual/OT_learning_2_8__Asking_for_one_output.html - + docs/manual/OT_learning_2_9__Output_distributions.html - + docs/manual/OT_learning_2__The_grammar.html - + docs/manual/OT_learning_3_1__Data_from_a_pair_distribution.html - + docs/manual/OT_learning_3_2__Data_from_another_grammar.html - + docs/manual/OT_learning_3_2__Data_from_another_grammar_1.png - + docs/manual/OT_learning_3_2__Data_from_another_grammar_2.png - + docs/manual/OT_learning_3_2__Data_from_another_grammar_3.png - + docs/manual/OT_learning_3_2__Data_from_another_grammar_4.png - + docs/manual/OT_learning_3__Generating_language_data.html - + docs/manual/OT_learning_4__Learning_an_ordinal_grammar.html - + docs/manual/OT_learning_4__Learning_an_ordinal_grammar_1.png - + docs/manual/OT_learning_5__Learning_a_stochastic_grammar.html - + docs/manual/OT_learning_6__Shortcut_to_grammar_learning.html - + docs/manual/OT_learning_7__Learning_from_overt_forms.html - + docs/manual/Objects_window.html - + docs/manual/Ogg_Vorbis_BSD_3-clause_license.html - + docs/manual/Olive.html - + docs/manual/One_logarithmic_mark_left_right_top_bottom___.html - + docs/manual/One_mark_left_right_top_bottom___.html - + docs/manual/Open_Praat_notebook___.html - + docs/manual/Open_Praat_script___.html - + docs/manual/Open_long_sound_file___.html - + docs/manual/Open_menu.html - + docs/manual/Optimality_Theory.html - + docs/manual/Opus_BSD_3-clause_license.html - + docs/manual/PCA.html - + docs/manual/PCA__Get_eigenvalue___.html - + docs/manual/PCA__Get_eigenvector_element___.html - + docs/manual/PCA__Get_equality_of_eigenvalues___.html - + docs/manual/PCA__Get_fraction_variance_accounted_for___.html - + docs/manual/PCA__Get_number_of_components__VAF____.html - + docs/manual/PCA__To_TableOfReal__reconstruct_1____.html - + docs/manual/PCA___Configuration__To_TableOfReal__reconstruct_.html - + docs/manual/PCA___Covariance__Project.html - + docs/manual/PCA___PCA__Get_angle_between_pc1-pc2_planes.html - + docs/manual/PCA___PCA__To_Procrustes___.html - + docs/manual/PCA___SSCP__Project.html - + docs/manual/PCA___TableOfReal__Get_fraction_variance___.html - + docs/manual/PCA___TableOfReal__To_Configuration___.html - + docs/manual/PCA___TableOfReal__To_TableOfReal__z-scores____.html - + docs/manual/Paint_rectangle___.html - + docs/manual/Paint_rounded_rectangle___.html - + docs/manual/PairDistribution.html - + docs/manual/PairDistribution__To_Stringses___.html - + docs/manual/Palatino.html - + docs/manual/ParamCurve.html - + docs/manual/Paste_history.html - + docs/manual/Pater__2008_.html - + docs/manual/Pater__Potts___Bhatt__2007_.html - + docs/manual/PatternList.html - + docs/manual/PatternList___Categories__To_FFNet___.html - + docs/manual/Patterson___Wightman__1976_.html - + docs/manual/Pen_menu.html - + docs/manual/Periodicity_menu.html - + docs/manual/Permutation.html - + docs/manual/Permutation__Get_index___.html - + docs/manual/Permutation__Get_value___.html - + docs/manual/Permutation__Interleave___.html - + docs/manual/Permutation__Invert.html - + docs/manual/Permutation__Next.html - + docs/manual/Permutation__Permute_part___.html - + docs/manual/Permutation__Permute_randomly___.html - + docs/manual/Permutation__Permute_randomly__blocks____.html - + docs/manual/Permutation__Previous.html - + docs/manual/Permutation__Reverse___.html - + docs/manual/Permutation__Rotate___.html - + docs/manual/Permutation__Sort.html - + docs/manual/Permutation__Swap_blocks___.html - + docs/manual/Permutation__Swap_numbers___.html - + docs/manual/Permutation__Swap_one_from_range___.html - + docs/manual/Permutation__Swap_positions___.html - + docs/manual/Permutation__Table_jump___.html - + docs/manual/Permutations__Multiply.html - + docs/manual/Peterson___Barney__1952_.html - + docs/manual/Phonetic_symbols.html - + docs/manual/Phonetic_symbols__consonants.html - + docs/manual/Phonetic_symbols__consonants_1.png - + docs/manual/Phonetic_symbols__diacritics.html - + docs/manual/Phonetic_symbols__vowels.html - + docs/manual/Phonetic_symbols__vowels_1.png - + docs/manual/Photo.html - + docs/manual/Picture_window.html - + docs/manual/Pink.html - + docs/manual/Pitch.html - + docs/manual/PitchEditor.html - + docs/manual/PitchTier.html - + docs/manual/PitchTierEditor.html - + docs/manual/PitchTier__Add_point___.html - + docs/manual/PitchTier__Down_to_PointProcess.html - + docs/manual/PitchTier__Get_mean__curve____.html - + docs/manual/PitchTier__Get_mean__points____.html - + docs/manual/PitchTier__Get_standard_deviation__curve____.html - + docs/manual/PitchTier__Get_standard_deviation__points____.html - + docs/manual/PitchTier__Modify_interval___.html - + docs/manual/PitchTier__Modify_interval____1.png - + docs/manual/PitchTier__Modify_interval__tone_levels____.html - + docs/manual/PitchTier__Modify_interval__tone_levels_____1.png - + docs/manual/PitchTier__Stylize___.html - + docs/manual/PitchTier__To_Pitch___.html - + docs/manual/PitchTier__To_PointProcess.html - + docs/manual/Pitch__Draw___.html - + docs/manual/Pitch__Interpolate.html - + docs/manual/Pitch__Smooth___.html - + docs/manual/Pitch__To_PitchTier.html - + docs/manual/Pitch__To_PointProcess.html - + docs/manual/Pitch___PointProcess__To_PitchTier___.html - + docs/manual/Pitch_menu.html - + docs/manual/Pitch_settings___.html - + docs/manual/Play.html - + docs/manual/Plomp__1967_.html - + docs/manual/PointEditor.html - + docs/manual/PointProcess.html - + docs/manual/PointProcess__Add_point___.html - + docs/manual/PointProcess__Add_points___.html - + docs/manual/PointProcess__Draw___.html - + docs/manual/PointProcess__Get_high_index___.html - + docs/manual/PointProcess__Get_interval___.html - + docs/manual/PointProcess__Get_jitter__ddp____.html - + docs/manual/PointProcess__Get_jitter__ddp_____1.png - + docs/manual/PointProcess__Get_jitter__local____.html - + docs/manual/PointProcess__Get_jitter__local_____1.png - + docs/manual/PointProcess__Get_jitter__local__absolute____.html - + docs/manual/PointProcess__Get_jitter__local__absolute_____1.png - + docs/manual/PointProcess__Get_jitter__ppq5____.html - + docs/manual/PointProcess__Get_jitter__ppq5_____1.png - + docs/manual/PointProcess__Get_jitter__rap____.html - + docs/manual/PointProcess__Get_jitter__rap_____1.png - + docs/manual/PointProcess__Get_low_index___.html - + docs/manual/PointProcess__Get_nearest_index___.html - + docs/manual/PointProcess__Hum.html - + docs/manual/PointProcess__Play.html - + docs/manual/PointProcess__Remove_point___.html - + docs/manual/PointProcess__Remove_point_near___.html - + docs/manual/PointProcess__Remove_points___.html - + docs/manual/PointProcess__Remove_points_between___.html - + docs/manual/PointProcess__To_PitchTier___.html - + docs/manual/PointProcess__To_Sound__hum____.html - + docs/manual/PointProcess__To_Sound__phonation____.html - + docs/manual/PointProcess__To_Sound__phonation_____1.png - + docs/manual/PointProcess__To_Sound__phonation_____2.png - + docs/manual/PointProcess__To_Sound__phonation_____3.png - + docs/manual/PointProcess__To_Sound__phonation_____4.png - + docs/manual/PointProcess__To_Sound__phonation_____5.png - + docs/manual/PointProcess__To_Sound__phonation_____6.png - + docs/manual/PointProcess__To_Sound__phonation_____7.png - + docs/manual/PointProcess__To_Sound__phonation_____8.png - + docs/manual/PointProcess__To_Sound__pulse_train____.html - + docs/manual/PointProcess__To_TextGrid___.html - + docs/manual/PointProcess__To_TextGrid__vuv____.html - + docs/manual/PointProcess__Up_to_IntensityTier___.html - + docs/manual/PointProcess__Up_to_PitchTier___.html - + docs/manual/PointProcess__Up_to_TextGrid___.html - + docs/manual/PointProcesses__Difference.html - + docs/manual/PointProcesses__Intersection.html - + docs/manual/PointProcesses__Union.html - + docs/manual/Pols_et_al___1973_.html - + docs/manual/Polygon.html - + docs/manual/Polygon__Get_location_of_point___.html - + docs/manual/Polygon__Rotate___.html - + docs/manual/Polygon__Simplify.html - + docs/manual/Polygon__Simplify_1.png - + docs/manual/Polygon__Translate___.html - + docs/manual/Polynomial.html - + docs/manual/Polynomial__Get_area___.html - + docs/manual/Polynomial__Get_function_value___.html - + docs/manual/Polynomial__Get_maximum___.html - + docs/manual/Polynomial__Get_minimum___.html - + docs/manual/Polynomial__Get_x_of_maximum___.html - + docs/manual/Polynomial__Get_x_of_minimum___.html - + docs/manual/Polynomial__Scale_x___.html - + docs/manual/Polynomial__To_Polynomial__derivative_.html - + docs/manual/Polynomial__To_Polynomial__primitive_.html - + docs/manual/Polynomial__To_Roots.html - + docs/manual/Polynomial__To_Spectrum___.html - + docs/manual/Polynomials__Multiply.html - + docs/manual/PostScript_settings___.html - + docs/manual/PowerCepstrogram.html - + docs/manual/PowerCepstrogram__Get_CPPS___.html - + docs/manual/PowerCepstrogram__Paint___.html - + docs/manual/PowerCepstrogram__Paint____1.png - + docs/manual/PowerCepstrogram__Smooth___.html - + docs/manual/PowerCepstrogram__To_Table__cepstral_peak_prominences__.html - + docs/manual/PowerCepstrogram__To_Table__cepstral_peak_prominences___1.png - + docs/manual/PowerCepstrum.html - + docs/manual/PowerCepstrum__Draw___.html - + docs/manual/PowerCepstrum__Draw_trend_line___.html - + docs/manual/PowerCepstrum__Draw_trend_line____1.png - + docs/manual/PowerCepstrum__Get_peak___.html - + docs/manual/PowerCepstrum__Get_peak_prominence___.html - + docs/manual/PowerCepstrum__Get_peak_prominence____1.png - + docs/manual/PowerCepstrum__Get_peak_prominence____2.png - + docs/manual/PowerCepstrum__Get_peak_prominence____3.png - + docs/manual/PowerCepstrum__Get_quefrency_of_peak___.html - + docs/manual/PowerCepstrum__Get_trend_line_intercept___.html - + docs/manual/PowerCepstrum__Get_trend_line_slope___.html - + docs/manual/PowerCepstrum__Smooth___.html - + docs/manual/PowerCepstrum__Smooth____1.png - + docs/manual/PowerCepstrum__Smooth____2.png - + docs/manual/PowerCepstrum__Smooth____3.png - + docs/manual/PowerCepstrum__Subtract_trend___.html - + docs/manual/Praat_menu.html - + docs/manual/Praat_notebook.html - + docs/manual/Praat_script.html - + docs/manual/Press_et_al___1992_.html - + docs/manual/Prince___Smolensky__1993_.html - + docs/manual/Principal_component_analysis.html - + docs/manual/Print___.html - + docs/manual/Printing.html - + docs/manual/Privacy_and_security.html - + docs/manual/Procrustes.html - + docs/manual/Procrustes_transform.html - + docs/manual/Programming_with_Praat.html - + docs/manual/Proximity.html - + docs/manual/Purple.html - + docs/manual/Query_submenu.html - + docs/manual/Quit.html - + docs/manual/Rabiner__1989_.html - + docs/manual/Ramsay__1988_.html - + docs/manual/Read_Matrix_from_raw_text_file___.html - + docs/manual/Read_Strings_from_raw_text_file___.html - + docs/manual/Read_TableOfReal_from_headerless_spreadsheet_file___.html - + docs/manual/Read_Table_from_comma-separated_file___.html - + docs/manual/Read_Table_from_semicolon-separated_file___.html - + docs/manual/Read_Table_from_tab-separated_file___.html - + docs/manual/Read_Table_from_whitespace-separated_file___.html - + docs/manual/Read_from_Praat_picture_file___.html - + docs/manual/Read_from_file___.html - + docs/manual/Read_separate_channels_from_sound_file___.html - + docs/manual/RealTier.html - + docs/manual/Record_Sound__fixed_time____.html - + docs/manual/Record_mono_Sound___.html - + docs/manual/Record_stereo_Sound___.html - + docs/manual/Red.html - + docs/manual/Regular_expressions.html - + docs/manual/Regular_expressions_1__Special_characters.html - + docs/manual/Regular_expressions_2__Quantifiers.html - + docs/manual/Regular_expressions_3__Anchors.html - + docs/manual/Regular_expressions_4__Special_constructs_with_parenthe.html - + docs/manual/Regular_expressions_5__Special_control_characters.html - + docs/manual/Regular_expressions_6__Convenience_escape_sequences.html - + docs/manual/Regular_expressions_7__Octal_and_hexadecimal_escapes.html - + docs/manual/Regular_expressions_8__Substitution_special_characters.html - + docs/manual/Remove.html - + docs/manual/Remove_point___.html - + docs/manual/Remove_point_near___.html - + docs/manual/Remove_points_between___.html - + docs/manual/Rename___.html - + docs/manual/Reporting_a_problem.html - + docs/manual/Robust_Interpretive_Parsing.html - + docs/manual/Roots.html - + docs/manual/Rosenberg__1971_.html - + docs/manual/Rosenblatt__1962_.html - + docs/manual/Rothweiler__1999_.html - + docs/manual/Rumelhart___McClelland__1986_.html - + docs/manual/SSCP.html - + docs/manual/SSCP__Draw_sigma_ellipse___.html - + docs/manual/SSCP__Get_confidence_ellipse_area___.html - + docs/manual/SSCP__Get_diagonality__bartlett____.html - + docs/manual/SSCP__Get_fraction_variation___.html - + docs/manual/SSCP__Get_sigma_ellipse_area___.html - + docs/manual/SSCP__To_CCA___.html - + docs/manual/SSCP__To_CCA____1.png - + docs/manual/SSCP__To_Covariance___.html - + docs/manual/SSCP___TableOfReal__Extract_quantile_range___.html - + docs/manual/SVD.html - + docs/manual/SVD__Get_minimum_number_of_singular_values___.html - + docs/manual/Sakoe___Chiba__1978_.html - + docs/manual/Salience.html - + docs/manual/Sandwell__1987_.html - + docs/manual/Save_as_AIFC_file___.html - + docs/manual/Save_as_AIFF_file___.html - + docs/manual/Save_as_EPS_file___.html - + docs/manual/Save_as_FLAC_file___.html - + docs/manual/Save_as_NIST_file___.html - + docs/manual/Save_as_NeXT_Sun_file___.html - + docs/manual/Save_as_PDF_file___.html - + docs/manual/Save_as_PNG_file___.html - + docs/manual/Save_as_Praat_picture_file___.html - + docs/manual/Save_as_WAV_file___.html - + docs/manual/Save_as_Windows_metafile___.html - + docs/manual/Save_as_binary_file___.html - + docs/manual/Save_as_short_text_file___.html - + docs/manual/Save_as_text_file___.html - + docs/manual/Save_menu.html - + docs/manual/ScalarProduct.html - + docs/manual/Schott__2001_.html - + docs/manual/Scree_plot.html - + docs/manual/ScriptEditor.html - + docs/manual/Script_for_TextGrid_boundary_drawing.html - + docs/manual/Script_for_analysing_pitch_with_a_TextGrid.html - + docs/manual/Script_for_creating_a_frequency_sweep.html - + docs/manual/Script_for_listing_F0_statistics.html - + docs/manual/Script_for_listing_time_F0_intensity.html - + docs/manual/Script_for_listing_time_F0_pairs.html - + docs/manual/Script_for_onset_detection.html - + docs/manual/Scripting.html - + docs/manual/Scripting_10__Old_functions.html - + docs/manual/Scripting_1__Your_first_scripts.html - + docs/manual/Scripting_1__Your_first_scripts_1.png - + docs/manual/Scripting_1__Your_first_scripts_2.png - + docs/manual/Scripting_2__How_to_script_settings_windows.html - + docs/manual/Scripting_2__How_to_script_settings_windows_1.png - + docs/manual/Scripting_2__How_to_script_settings_windows_2.png - + docs/manual/Scripting_2__How_to_script_settings_windows_3.png - + docs/manual/Scripting_2__How_to_script_settings_windows_4.png - + docs/manual/Scripting_2__How_to_script_settings_windows_5.png - + docs/manual/Scripting_2__How_to_script_settings_windows_6.png - + docs/manual/Scripting_2__How_to_script_settings_windows_7.png - + docs/manual/Scripting_2__How_to_script_settings_windows_8.png - + docs/manual/Scripting_2__How_to_script_settings_windows_9.png - + docs/manual/Scripting_3_1__Hello_world.html - + docs/manual/Scripting_3_1__Hello_world_1.png - + docs/manual/Scripting_3_1__Hello_world_2.png - + docs/manual/Scripting_3_1__Hello_world_3.png - + docs/manual/Scripting_3_1__Hello_world_4.png - + docs/manual/Scripting_3_2__Numeric_variables.html - + docs/manual/Scripting_3_3__Numeric_queries.html - + docs/manual/Scripting_3_3__Numeric_queries_1.png - + docs/manual/Scripting_3_3__Numeric_queries_2.png - + docs/manual/Scripting_3_3__Numeric_queries_3.png - + docs/manual/Scripting_3_4__String_variables.html - + docs/manual/Scripting_3_5__String_queries.html - + docs/manual/Scripting_3_5__String_queries_1.png - + docs/manual/Scripting_3_5__String_queries_2.png - + docs/manual/Scripting_3_5__String_queries_3.png - + docs/manual/Scripting_3_5__String_queries_4.png - + docs/manual/Scripting_3_5__String_queries_5.png - + docs/manual/Scripting_3_6___For__loops.html - + docs/manual/Scripting_3_6___For__loops_1.png - + docs/manual/Scripting_3_6___For__loops_2.png - + docs/manual/Scripting_3_7__Layout.html - + docs/manual/Scripting_3__Simple_language_elements.html - + docs/manual/Scripting_4_1__Selecting_objects.html - + docs/manual/Scripting_4_2__Removing_objects.html - + docs/manual/Scripting_4_3__Querying_objects.html - + docs/manual/Scripting_4__Object_selection.html - + docs/manual/Scripting_5_1__Variables.html - + docs/manual/Scripting_5_1__Variables_1.png - + docs/manual/Scripting_5_1__Variables_2.png - + docs/manual/Scripting_5_2__Expressions.html - + docs/manual/Scripting_5_3__Jumps.html - + docs/manual/Scripting_5_4__Loops.html - + docs/manual/Scripting_5_5__Procedures.html - + docs/manual/Scripting_5_6__Arrays_and_dictionaries.html - + docs/manual/Scripting_5_7__Vectors_and_matrices.html - + docs/manual/Scripting_5_8__Including_other_scripts.html - + docs/manual/Scripting_5_9__Quitting.html - + docs/manual/Scripting_5__Language_elements_reference.html - + docs/manual/Scripting_6_1__Arguments_to_the_script.html - + docs/manual/Scripting_6_2__Writing_to_the_Info_window.html - + docs/manual/Scripting_6_3__Query_commands.html - + docs/manual/Scripting_6_4__Files.html - + docs/manual/Scripting_6_5__Calling_system_commands.html - + docs/manual/Scripting_6_6__Controlling_the_user.html - + docs/manual/Scripting_6_7__Sending_a_message_to_another_program.html - + docs/manual/Scripting_6_8__Messages_to_the_user.html - + docs/manual/Scripting_6_9__Calling_from_the_command_line.html - + docs/manual/Scripting_6__Communication_outside_the_script.html - + docs/manual/Scripting_7_1__Scripting_an_editor_from_a_shell_script.html - + docs/manual/Scripting_7_2__Scripting_an_editor_from_within.html - + docs/manual/Scripting_7__Scripting_the_editors.html - + docs/manual/Scripting_8_1__The_sendpraat_subroutine.html - + docs/manual/Scripting_8_2__The_sendpraat_program.html - + docs/manual/Scripting_8__Controlling_Praat_from_another_program.html - + docs/manual/Scripting_9__Turning_a_script_into_a_stand-alone_progra.html - + docs/manual/Scripting_examples.html - + docs/manual/Segmentation.html - + docs/manual/Sekey___Hanson__1984_.html - + docs/manual/Select_inner_viewport___.html - + docs/manual/Select_outer_viewport___.html - + docs/manual/Sesam_LVS_files.html - + docs/manual/Shepard__1964_.html - + docs/manual/Shift-click.html - + docs/manual/Shift-drag.html - + docs/manual/Show_formant.html - + docs/manual/Show_intensity.html - + docs/manual/Show_pitch.html - + docs/manual/Show_pulses.html - + docs/manual/Show_spectrogram.html - + docs/manual/Silver.html - + docs/manual/Similarity.html - + docs/manual/Similarity__To_Dissimilarity___.html - + docs/manual/Skype_Limited_BSD_3-clause_license.html - + docs/manual/Slaney__1993_.html - + docs/manual/Smolensky__1986_.html - + docs/manual/Smolensky___Legendre__2006_.html - + docs/manual/Soderstrom__Mathis___Smolensky__2006_.html - + docs/manual/Sound.html - + docs/manual/SoundEditor.html - + docs/manual/SoundRecorder.html - + docs/manual/Sound__Autocorrelate___.html - + docs/manual/Sound__Autocorrelate____1.png - + docs/manual/Sound__Autocorrelate____2.png - + docs/manual/Sound__Change_gender___.html - + docs/manual/Sound__Change_speaker___.html - + docs/manual/Sound__De-emphasize__in-place____.html - + docs/manual/Sound__Deepen_band_modulation___.html - + docs/manual/Sound__Deepen_band_modulation____1.png - + docs/manual/Sound__Deepen_band_modulation____2.png - + docs/manual/Sound__Draw___.html - + docs/manual/Sound__Draw_where___.html - + docs/manual/Sound__Draw_where____1.png - + docs/manual/Sound__Draw_where____2.png - + docs/manual/Sound__Extract_Electroglottogram___.html - + docs/manual/Sound__Extract_part___.html - + docs/manual/Sound__Extract_part____1.png - + docs/manual/Sound__Extract_part____10.png - + docs/manual/Sound__Extract_part____11.png - + docs/manual/Sound__Extract_part____12.png - + docs/manual/Sound__Extract_part____13.png - + docs/manual/Sound__Extract_part____2.png - + docs/manual/Sound__Extract_part____3.png - + docs/manual/Sound__Extract_part____4.png - + docs/manual/Sound__Extract_part____5.png - + docs/manual/Sound__Extract_part____6.png - + docs/manual/Sound__Extract_part____7.png - + docs/manual/Sound__Extract_part____8.png - + docs/manual/Sound__Extract_part____9.png - + docs/manual/Sound__Fade_in___.html - + docs/manual/Sound__Fade_out___.html - + docs/manual/Sound__Filter__de-emphasis____.html - + docs/manual/Sound__Filter__formula____.html - + docs/manual/Sound__Filter__gammatone____.html - + docs/manual/Sound__Filter__one_formant____.html - + docs/manual/Sound__Filter__pass_Hann_band____.html - + docs/manual/Sound__Filter__pre-emphasis____.html - + docs/manual/Sound__Filter__stop_Hann_band____.html - + docs/manual/Sound__Filter_with_one_formant__in-place____.html - + docs/manual/Sound__Formula___.html - + docs/manual/Sound__Get_absolute_extremum___.html - + docs/manual/Sound__Get_energy___.html - + docs/manual/Sound__Get_energy_in_air.html - + docs/manual/Sound__Get_intensity__dB_.html - + docs/manual/Sound__Get_maximum___.html - + docs/manual/Sound__Get_mean___.html - + docs/manual/Sound__Get_minimum___.html - + docs/manual/Sound__Get_nearest_zero_crossing___.html - + docs/manual/Sound__Get_power___.html - + docs/manual/Sound__Get_power_in_air.html - + docs/manual/Sound__Get_root-mean-square___.html - + docs/manual/Sound__Get_standard_deviation___.html - + docs/manual/Sound__Get_time_of_maximum___.html - + docs/manual/Sound__Get_time_of_minimum___.html - + docs/manual/Sound__Get_value_at_sample_number___.html - + docs/manual/Sound__Get_value_at_time___.html - + docs/manual/Sound__LPC_analysis.html - + docs/manual/Sound__Lengthen__overlap-add____.html - + docs/manual/Sound__Multiply_by_window___.html - + docs/manual/Sound__Multiply_by_window____1.png - + docs/manual/Sound__Multiply_by_window____10.png - + docs/manual/Sound__Multiply_by_window____11.png - + docs/manual/Sound__Multiply_by_window____12.png - + docs/manual/Sound__Multiply_by_window____13.png - + docs/manual/Sound__Multiply_by_window____14.png - + docs/manual/Sound__Multiply_by_window____15.png - + docs/manual/Sound__Multiply_by_window____2.png - + docs/manual/Sound__Multiply_by_window____3.png - + docs/manual/Sound__Multiply_by_window____4.png - + docs/manual/Sound__Multiply_by_window____5.png - + docs/manual/Sound__Multiply_by_window____6.png - + docs/manual/Sound__Multiply_by_window____7.png - + docs/manual/Sound__Multiply_by_window____8.png - + docs/manual/Sound__Multiply_by_window____9.png - + docs/manual/Sound__Paint_where___.html - + docs/manual/Sound__Paint_where____1.png - + docs/manual/Sound__Paint_where____2.png - + docs/manual/Sound__Paint_where____3.png - + docs/manual/Sound__Paint_where____4.png - + docs/manual/Sound__Play.html - + docs/manual/Sound__Play_as_frequency_shifted___.html - + docs/manual/Sound__Pre-emphasize__in-place____.html - + docs/manual/Sound__Remove_noise___.html - + docs/manual/Sound__Remove_noise____1.png - + docs/manual/Sound__Resample___.html - + docs/manual/Sound__Scale_intensity___.html - + docs/manual/Sound__Scale_peak___.html - + docs/manual/Sound__Scale_peak____1.png - + docs/manual/Sound__Scale_peak____2.png - + docs/manual/Sound__Scale_peak____3.png - + docs/manual/Sound__Scale_peak____4.png - + docs/manual/Sound__Set_value_at_sample_number___.html - + docs/manual/Sound__To_BarkSpectrogram___.html - + docs/manual/Sound__To_ConstantQLogFSpectrogram___.html - + docs/manual/Sound__To_Covariance__channels____.html - + docs/manual/Sound__To_CrossCorrelationTable___.html - + docs/manual/Sound__To_CrossCorrelationTable____1.png - + docs/manual/Sound__To_FormantFilter___.html - + docs/manual/Sound__To_FormantPath__burg____.html - + docs/manual/Sound__To_Formant__burg____.html - + docs/manual/Sound__To_Formant__keep_all____.html - + docs/manual/Sound__To_Formant__robust____.html - + docs/manual/Sound__To_Formant__sl____.html - + docs/manual/Sound__To_Harmonicity__ac____.html - + docs/manual/Sound__To_Harmonicity__cc____.html - + docs/manual/Sound__To_Intensity___.html - + docs/manual/Sound__To_KlattGrid__simple____.html - + docs/manual/Sound__To_LPC__autocorrelation____.html - + docs/manual/Sound__To_LPC__burg____.html - + docs/manual/Sound__To_LPC__covariance____.html - + docs/manual/Sound__To_LPC__marple____.html - + docs/manual/Sound__To_Ltas__pitch-corrected____.html - + docs/manual/Sound__To_MFCC___.html - + docs/manual/Sound__To_MelFilter___.html - + docs/manual/Sound__To_MelSpectrogram___.html - + docs/manual/Sound__To_Pitch___.html - + docs/manual/Sound__To_Pitch__ac____.html - + docs/manual/Sound__To_Pitch__cc____.html - + docs/manual/Sound__To_Pitch__filtered_ac____.html - + docs/manual/Sound__To_Pitch__filtered_autocorrelation____.html - + docs/manual/Sound__To_Pitch__filtered_cc____.html - + docs/manual/Sound__To_Pitch__filtered_cross-correlation____.html - + docs/manual/Sound__To_Pitch__raw_ac____.html - + docs/manual/Sound__To_Pitch__raw_autocorrelation____.html - + docs/manual/Sound__To_Pitch__raw_cc____.html - + docs/manual/Sound__To_Pitch__raw_cross-correlation____.html - + docs/manual/Sound__To_Pitch__shs____.html - + docs/manual/Sound__To_PointProcess__periodic__cc____.html - + docs/manual/Sound__To_PointProcess__periodic__peaks____.html - + docs/manual/Sound__To_Polygon___.html - + docs/manual/Sound__To_Polygon____1.png - + docs/manual/Sound__To_PowerCepstrogram___.html - + docs/manual/Sound__To_Sound__blind_source_separation____.html - + docs/manual/Sound__To_Sound__blind_source_separation_____1.png - + docs/manual/Sound__To_Sound__blind_source_separation_____2.png - + docs/manual/Sound__To_Sound__derivative____.html - + docs/manual/Sound__To_Sound__whiten_channels____.html - + docs/manual/Sound__To_Spectrogram___.html - + docs/manual/Sound__To_Spectrogram__pitch-dependent____.html - + docs/manual/Sound__To_Spectrum___.html - + docs/manual/Sound__To_Spectrum__resampled____.html - + docs/manual/Sound__To_Spectrum__resampled_____1.png - + docs/manual/Sound__To_TextGrid___.html - + docs/manual/Sound__To_TextGrid__silences____.html - + docs/manual/Sound__To_TextGrid__speech_activity____.html - + docs/manual/Sound__Trim_silences___.html - + docs/manual/Sound___FormantGrid__Filter.html - + docs/manual/Sound___FormantGrid__Filter__no_scale_.html - + docs/manual/Sound___Formant__Filter.html - + docs/manual/Sound___Formant__Filter__no_scale_.html - + docs/manual/Sound___IntensityTier__Multiply.html - + docs/manual/Sound___KlattGrid__Filter_by_vocal_tract___.html - + docs/manual/Sound___Pitch__Change_gender___.html - + docs/manual/Sound___Pitch__Change_speaker___.html - + docs/manual/Sound___Pitch__To_PointProcess__cc_.html - + docs/manual/Sound___Pitch__To_PointProcess__peaks____.html - + docs/manual/Sound___Pitch__To_Spectrogram___.html - + docs/manual/Sound_files.html - + docs/manual/Sound_files_1_1__Sampling.html - + docs/manual/Sound_files_1_2__Quantization.html - + docs/manual/Sound_files_1_3__Channels.html - + docs/manual/Sound_files_1_4__The_header.html - + docs/manual/Sound_files_1_5__Size.html - + docs/manual/Sound_files_1_6__Compression.html - + docs/manual/Sound_files_1__General_structure.html - + docs/manual/Sound_files_2_1__WAV_files.html - + docs/manual/Sound_files_2_2__AIFF_files.html - + docs/manual/Sound_files_2_3__AIFC_files.html - + docs/manual/Sound_files_2_4__NeXT_Sun___au__files.html - + docs/manual/Sound_files_2_5__NIST_files.html - + docs/manual/Sound_files_2_6__FLAC_files.html - + docs/manual/Sound_files_2_7__MP3_files.html - + docs/manual/Sound_files_2_8__Ogg_Vorbis_files.html - + docs/manual/Sound_files_2_9__Ogg_Opus_files.html - + docs/manual/Sound_files_2__File_types.html - + docs/manual/Sound_files_3__Files_that_Praat_can_read.html - + docs/manual/Sound_files_4__Files_that_Praat_can_write.html - + docs/manual/Sounds__Combine_to_stereo.html - + docs/manual/Sounds__Concatenate.html - + docs/manual/Sounds__Concatenate_with_overlap___.html - + docs/manual/Sounds__Concatenate_with_overlap____1.png - + docs/manual/Sounds__Concatenate_with_overlap____2.png - + docs/manual/Sounds__Concatenate_with_overlap____3.png - + docs/manual/Sounds__Concatenate_with_overlap____4.png - + docs/manual/Sounds__Concatenate_with_overlap____5.png - + docs/manual/Sounds__Convolve___.html - + docs/manual/Sounds__Convolve____1.png - + docs/manual/Sounds__Convolve____2.png - + docs/manual/Sounds__Convolve____3.png - + docs/manual/Sounds__Convolve____4.png - + docs/manual/Sounds__Convolve____5.png - + docs/manual/Sounds__Cross-correlate___.html - + docs/manual/Sounds__Cross-correlate____1.png - + docs/manual/Sounds__Cross-correlate____2.png - + docs/manual/Sounds__Paint_enclosed___.html - + docs/manual/Sounds__Paint_enclosed____1.png - + docs/manual/Sounds__Paint_enclosed____2.png - + docs/manual/Source-filter_synthesis.html - + docs/manual/Source-filter_synthesis_1__Creating_a_source_from_pitch.html - + docs/manual/Source-filter_synthesis_1__Creating_a_source_from_pitch_1.png - + docs/manual/Source-filter_synthesis_1__Creating_a_source_from_pitch_2.png - + docs/manual/Source-filter_synthesis_1__Creating_a_source_from_pitch_3.png - + docs/manual/Source-filter_synthesis_2__Filtering_a_source.html - + docs/manual/Source-filter_synthesis_3__The_ba-da_continuum.html - + docs/manual/Source-filter_synthesis_4__Using_existing_sounds.html - + docs/manual/Speaker.html - + docs/manual/Special_symbols.html - + docs/manual/Spectra__Multiply.html - + docs/manual/Spectrogram.html - + docs/manual/Spectrogram__Formula___.html - + docs/manual/Spectrogram__Paint___.html - + docs/manual/Spectrogram__To_Spectrum__slice____.html - + docs/manual/Spectrogram_menu.html - + docs/manual/Spectrogram_settings___.html - + docs/manual/Spectrum.html - + docs/manual/SpectrumEditor.html - + docs/manual/Spectrum__Conjugate.html - + docs/manual/Spectrum__Filter__pass_Hann_band____.html - + docs/manual/Spectrum__Filter__pass_Hann_band_____1.png - + docs/manual/Spectrum__Filter__pass_Hann_band_____2.png - + docs/manual/Spectrum__Filter__stop_Hann_band____.html - + docs/manual/Spectrum__Filter__stop_Hann_band_____1.png - + docs/manual/Spectrum__Filter__stop_Hann_band_____2.png - + docs/manual/Spectrum__Formula___.html - + docs/manual/Spectrum__Get_central_moment___.html - + docs/manual/Spectrum__Get_centre_of_gravity___.html - + docs/manual/Spectrum__Get_kurtosis___.html - + docs/manual/Spectrum__Get_skewness___.html - + docs/manual/Spectrum__Get_standard_deviation___.html - + docs/manual/Spectrum__Shift_frequencies___.html - + docs/manual/Spectrum__Tabulate__verbose_.html - + docs/manual/Spectrum__To_Ltas__1-to-1_.html - + docs/manual/Spectrum__To_PowerCepstrum.html - + docs/manual/Spectrum__To_Sound.html - + docs/manual/Spectrum__To_Sound__resampled____.html - + docs/manual/Spectrum__To_Spectrogram.html - + docs/manual/SpeechSynthesizer.html - + docs/manual/SpeechSynthesizer__Play_text___.html - + docs/manual/SpeechSynthesizer__Set_speech_rate_from_speech___.html - + docs/manual/SpeechSynthesizer__Set_text_input_settings___.html - + docs/manual/SpeechSynthesizer__Speech_output_settings___.html - + docs/manual/SpeechSynthesizer__To_Sound___.html - + docs/manual/SpellingChecker.html - + docs/manual/Statistics.html - + docs/manual/Stevens__1951_.html - + docs/manual/Strings.html - + docs/manual/Strings__To_Distributions.html - + docs/manual/Strings__To_Index.html - + docs/manual/Strings__To_Permutation___.html - + docs/manual/Strings___Permutation__Permute_strings.html - + docs/manual/T-test.html - + docs/manual/TIMIT_acoustic-phonetic_speech_corpus.html - + docs/manual/Table.html - + docs/manual/TableOfReal.html - + docs/manual/TableOfReal__Centre_columns.html - + docs/manual/TableOfReal__Centre_rows.html - + docs/manual/TableOfReal__Change_column_labels___.html - + docs/manual/TableOfReal__Change_row_labels___.html - + docs/manual/TableOfReal__Draw_as_scalable_squares___.html - + docs/manual/TableOfReal__Draw_biplot___.html - + docs/manual/TableOfReal__Draw_box_plots___.html - + docs/manual/TableOfReal__Draw_rows_as_histogram___.html - + docs/manual/TableOfReal__Get_table_norm.html - + docs/manual/TableOfReal__Normalize_columns___.html - + docs/manual/TableOfReal__Normalize_rows___.html - + docs/manual/TableOfReal__Normalize_table___.html - + docs/manual/TableOfReal__Report_multivariate_normality__BHEP____.html - + docs/manual/TableOfReal__Select_columns_where_row___.html - + docs/manual/TableOfReal__Set_value___.html - + docs/manual/TableOfReal__Standardize_columns.html - + docs/manual/TableOfReal__To_CCA___.html - + docs/manual/TableOfReal__To_Configuration__lda____.html - + docs/manual/TableOfReal__To_Configuration__pca____.html - + docs/manual/TableOfReal__To_Correlation.html - + docs/manual/TableOfReal__To_Correlation__rank_.html - + docs/manual/TableOfReal__To_Covariance.html - + docs/manual/TableOfReal__To_Discriminant.html - + docs/manual/TableOfReal__To_GaussianMixture___.html - + docs/manual/TableOfReal__To_GaussianMixture__row_labels____.html - + docs/manual/TableOfReal__To_PCA.html - + docs/manual/TableOfReal__To_PatternList_and_Categories___.html - + docs/manual/TableOfReal__To_SSCP___.html - + docs/manual/TableOfReal__To_TableOfReal__means_by_row_labels____.html - + docs/manual/TableOfReal___Permutation__Permute_rows.html - + docs/manual/Table__Bar_plot___.html - + docs/manual/Table__Bar_plot____1.png - + docs/manual/Table__Bar_plot____2.png - + docs/manual/Table__Bar_plot____3.png - + docs/manual/Table__Bar_plot____4.png - + docs/manual/Table__Box_plots___.html - + docs/manual/Table__Box_plots____1.png - + docs/manual/Table__Collapse_rows___.html - + docs/manual/Table__Extract_rows_where___.html - + docs/manual/Table__Extract_rows_where_column__number____.html - + docs/manual/Table__Extract_rows_where_column__text____.html - + docs/manual/Table__Formula___.html - + docs/manual/Table__Formula__column_range____.html - + docs/manual/Table__Get_group_mean___.html - + docs/manual/Table__Get_maximum___.html - + docs/manual/Table__Get_mean___.html - + docs/manual/Table__Get_median_absolute_deviation___.html - + docs/manual/Table__Get_minimum___.html - + docs/manual/Table__Get_quantile___.html - + docs/manual/Table__Get_standard_deviation___.html - + docs/manual/Table__Get_sum___.html - + docs/manual/Table__Horizontal_error_bars_plot___.html - + docs/manual/Table__Line_graph___.html - + docs/manual/Table__Line_graph____1.png - + docs/manual/Table__Line_graph____2.png - + docs/manual/Table__Line_graph____3.png - + docs/manual/Table__Line_graph_where___.html - + docs/manual/Table__Normal_probability_plot___.html - + docs/manual/Table__Quantile-quantile_plot___.html - + docs/manual/Table__Report_group_mean__Student_t____.html - + docs/manual/Table__Report_mean__Student_t____.html - + docs/manual/Table__Report_one-way_Kruskal-Wallis___.html - + docs/manual/Table__Report_one-way_anova___.html - + docs/manual/Table__Report_two-way_anova___.html - + docs/manual/Table__Rows_to_columns___.html - + docs/manual/Table__Save_as_comma-separated_file___.html - + docs/manual/Table__Save_as_semicolon-separated_file___.html - + docs/manual/Table__Save_as_tab-separated_file___.html - + docs/manual/Table__Scatter_plot___.html - + docs/manual/Table__Sort_rows___.html - + docs/manual/Table__Vertical_error_bars_plot___.html - + docs/manual/Table__Vertical_error_bars_plot____1.png - + docs/manual/Takane__Young___de_Leeuw__1976_.html - + docs/manual/Teal.html - + docs/manual/Technical.html - + docs/manual/Ten_Berge__1991_.html - + docs/manual/Ten_Berge__1995_.html - + docs/manual/Ten_Berge__Kiers___Krijnen__1993_.html - + docs/manual/Tenreiro__2009_.html - + docs/manual/Tesar___Smolensky__1998_.html - + docs/manual/TextGrid.html - + docs/manual/TextGridEditor.html - + docs/manual/TextGridNavigator.html - + docs/manual/TextGridNavigator___TextGrid__Add_search_tier___.html - + docs/manual/TextGridNavigator___TextGrid__Replace_search_tiers.html - + docs/manual/TextGrid__Count_labels___.html - + docs/manual/TextGrid__Extend_time___.html - + docs/manual/TextGrid__To_DurationTier___.html - + docs/manual/TextGrid__To_DurationTier____1.png - + docs/manual/TextGrid__To_DurationTier____2.png - + docs/manual/TextGrid__To_TextGridNavigator___.html - + docs/manual/TextGrid___DurationTier__To_TextGrid__scale_times_.html - + docs/manual/TextGrid_file_formats.html - + docs/manual/TextGrid_file_formats_1.png - + docs/manual/TextGrid_file_formats_2.png - + docs/manual/TextGrids__Merge.html - + docs/manual/TextGrids__Merge___.html - + docs/manual/Text___.html - + docs/manual/Text_bottom___.html - + docs/manual/Text_left_right_top_bottom___.html - + docs/manual/Text_styles.html - + docs/manual/Text_top___.html - + docs/manual/Theil__1950_.html - + docs/manual/Time_step_settings___.html - + docs/manual/Times.html - + docs/manual/Torgerson__1958_.html - + docs/manual/Tribolet_et_al___1979_.html - + docs/manual/Tukey__1977_.html - + docs/manual/Types_of_objects.html - + docs/manual/Undo.html - + docs/manual/Unicode.html - + docs/manual/Unicode_Inc__license_agreement.html - + docs/manual/Van_Nierop_et_al___1973_.html - + docs/manual/Velasco_et_al___2011_.html - + docs/manual/View___Edit.html - + docs/manual/Viewport_text___.html - + docs/manual/VocalTract.html - + docs/manual/VocalTractTier.html - + docs/manual/VocalTract__Formula___.html - + docs/manual/Voice.html - + docs/manual/Voice_1__Voice_breaks.html - + docs/manual/Voice_2__Jitter.html - + docs/manual/Voice_3__Shimmer.html - + docs/manual/Voice_4__Additive_noise.html - + docs/manual/Voice_5__Comparison_with_other_programs.html - + docs/manual/Voice_6__Automating_voice_analysis_with_a_script.html - + docs/manual/Voice_report.html - + docs/manual/Vollgraf___Obermayer__2006_.html - + docs/manual/VowelEditor.html - + docs/manual/VowelEditor__Show_vowel_marks_from_Table_file___.html - + docs/manual/Wakita__1977_.html - + docs/manual/Watrous__1991_.html - + docs/manual/Weenink__1985_.html - + docs/manual/Weenink__1999_.html - + docs/manual/Weenink__2003_.html - + docs/manual/Weenink__2015_.html - + docs/manual/Weight.html - + docs/manual/Weller___Romney__1990_.html - + docs/manual/Wessel___Bercovici__1989_.html - + docs/manual/What_s_new_.html - + docs/manual/What_was_new_in_3_1_.html - + docs/manual/What_was_new_in_3_2_.html - + docs/manual/What_was_new_in_3_3_.html - + docs/manual/What_was_new_in_3_5_.html - + docs/manual/What_was_new_in_3_6_.html - + docs/manual/What_was_new_in_3_7_.html - + docs/manual/What_was_new_in_3_8_.html - + docs/manual/What_was_new_in_3_9_.html - + docs/manual/What_was_new_in_4_0_.html - + docs/manual/What_was_new_in_4_1_.html - + docs/manual/What_was_new_in_4_2_.html - + docs/manual/What_was_new_in_4_3_.html - + docs/manual/What_was_new_in_4_4_.html - + docs/manual/What_was_new_in_4_5_.html - + docs/manual/What_was_new_in_4_6_.html - + docs/manual/What_was_new_in_5_0_.html - + docs/manual/What_was_new_in_5_1_.html - + docs/manual/What_was_new_in_5_2_.html - + docs/manual/What_was_new_in_5_3_.html - + docs/manual/What_was_new_in_5_4_.html - + docs/manual/What_was_new_in_6_0_.html - + docs/manual/What_was_new_in_6_1_.html - + docs/manual/What_was_new_in_6_2_.html - + docs/manual/What_was_new_in_6_3_.html - + docs/manual/What_was_new_in_6_4_.html - + docs/manual/Willems__1986_.html - + docs/manual/WordList.html - + docs/manual/World_menu.html - + docs/manual/Wu_et_al___2018_.html - + docs/manual/Yellow.html - + docs/manual/Young__Takane___Lewyckyj__1978_.html - + docs/manual/Zhang_et_al___2003_.html - + docs/manual/Ziehe_et_al___2004_.html - + docs/manual/_abs-H-H_.html - + docs/manual/_abs-H_.html - + docs/manual/_abs_.html - + docs/manual/_appDay_.html - + docs/manual/_appMonth-S_.html - + docs/manual/_appMonth_.html - + docs/manual/_appVersion-S_.html - + docs/manual/_appVersion_.html - + docs/manual/_appYear_.html - + docs/manual/_appendFileLine_.html - + docs/manual/_appendFile_.html - + docs/manual/_appendInfoLine_.html - + docs/manual/_appendInfo_.html - + docs/manual/_arccos-H-H_.html - + docs/manual/_arccos-H_.html - + docs/manual/_arccos_.html - + docs/manual/_arccosh-H-H_.html - + docs/manual/_arccosh-H_.html - + docs/manual/_arccosh_.html - + docs/manual/_arcsin-H-H_.html - + docs/manual/_arcsin-H_.html - + docs/manual/_arcsin_.html - + docs/manual/_arcsinh-H-H_.html - + docs/manual/_arcsinh-H_.html - + docs/manual/_arcsinh_.html - + docs/manual/_arctan-H-H_.html - + docs/manual/_arctan-H_.html - + docs/manual/_arctan2_.html - + docs/manual/_arctan_.html - + docs/manual/_arctanh-H-H_.html - + docs/manual/_arctanh-H_.html - + docs/manual/_arctanh_.html - + docs/manual/_assert_.html - + docs/manual/_asserterror_.html - + docs/manual/_asynchronous_.html - + docs/manual/_backslashTrigraphsToUnicode-S_.html - + docs/manual/_barkToHertz_.html - + docs/manual/_besselI_.html - + docs/manual/_besselK_.html - + docs/manual/_beta_.html - + docs/manual/_between_by-H_.html - + docs/manual/_between_count-H_.html - + docs/manual/_binomialP_.html - + docs/manual/_binomialQ_.html - + docs/manual/_ceiling-H-H_.html - + docs/manual/_ceiling-H_.html - + docs/manual/_ceiling_.html - + docs/manual/_center_.html - + docs/manual/_chiSquareP_.html - + docs/manual/_chiSquareQ_.html - + docs/manual/_chooseFolder-S_.html - + docs/manual/_chooseReadFile-S_.html - + docs/manual/_chooseWriteFile-S_.html - + docs/manual/_clearinfo_.html - + docs/manual/_clock_.html - + docs/manual/_col-H_.html - + docs/manual/_col-S_.html - + docs/manual/_col_.html - + docs/manual/_columnSums-H_.html - + docs/manual/_combine-H_.html - + docs/manual/_correlation_.html - + docs/manual/_cos-H-H_.html - + docs/manual/_cos-H_.html - + docs/manual/_cos_.html - + docs/manual/_cos__1.png - + docs/manual/_cosh-H-H_.html - + docs/manual/_cosh-H_.html - + docs/manual/_cosh_.html - + docs/manual/_createFolder_.html - + docs/manual/_date-H_.html - + docs/manual/_date-S_.html - + docs/manual/_date_iso-S_.html - + docs/manual/_date_utc-H_.html - + docs/manual/_date_utc-S_.html - + docs/manual/_date_utc_iso-S_.html - + docs/manual/_deleteFile_.html - + docs/manual/_demoClickedIn_.html - + docs/manual/_demoClicked_.html - + docs/manual/_demoCommandKeyPressed_.html - + docs/manual/_demoInput_.html - + docs/manual/_demoKey-S_.html - + docs/manual/_demoKeyPressed_.html - + docs/manual/_demoOptionKeyPressed_.html - + docs/manual/_demoPeekInput_.html - + docs/manual/_demoShiftKeyPressed_.html - + docs/manual/_demoShow_.html - + docs/manual/_demoWaitForInput_.html - + docs/manual/_demoWindowTitle_.html - + docs/manual/_demoX_.html - + docs/manual/_demoY_.html - + docs/manual/_demo_.html - + docs/manual/_demo__1.png - + docs/manual/_differenceLimensToPhon_.html - + docs/manual/_dx_.html - + docs/manual/_dy_.html - + docs/manual/_editor_.html - + docs/manual/_empty-S-H_.html - + docs/manual/_endeditor_.html - + docs/manual/_endproc_.html - + docs/manual/_endsWith_.html - + docs/manual/_endsWith_caseInsensitive_.html - + docs/manual/_environment-S_.html - + docs/manual/_erbToHertz_.html - + docs/manual/_erb_.html - + docs/manual/_erf_.html - + docs/manual/_erfc_.html - + docs/manual/_exitScript_.html - + docs/manual/_exp-H-H_.html - + docs/manual/_exp-H_.html - + docs/manual/_exp_.html - + docs/manual/_extractLine-S_.html - + docs/manual/_extractNumber_.html - + docs/manual/_extractWord-S_.html - + docs/manual/_fileNames-S-H_.html - + docs/manual/_fileNames_caseInsensitive-S-H_.html - + docs/manual/_fileReadable_.html - + docs/manual/_fisherP_.html - + docs/manual/_fisherQ_.html - + docs/manual/_fixed-S_.html - + docs/manual/_floor-H-H_.html - + docs/manual/_floor-H_.html - + docs/manual/_floor_.html - + docs/manual/_folderExists_.html - + docs/manual/_folderNames-S-H_.html - + docs/manual/_folderNames_caseInsensitive-S-H_.html - + docs/manual/_from_to-H_.html - + docs/manual/_from_to_by-H_.html - + docs/manual/_from_to_count-H_.html - + docs/manual/_gaussP_.html - + docs/manual/_gaussQ_.html - + docs/manual/_goto_.html - + docs/manual/_hertzToBark_.html - + docs/manual/_hertzToErb_.html - + docs/manual/_hertzToMel_.html - + docs/manual/_hertzToSemitones_.html - + docs/manual/_imax_.html - + docs/manual/_imin_.html - + docs/manual/_index_.html - + docs/manual/_index_caseInsensitive_.html - + docs/manual/_index_regex_.html - + docs/manual/_inner_.html - + docs/manual/_invBinomialP_.html - + docs/manual/_invBinomialQ_.html - + docs/manual/_invChiSquareQ_.html - + docs/manual/_invFisherQ_.html - + docs/manual/_invGaussQ_.html - + docs/manual/_invSigmoid-H-H_.html - + docs/manual/_invSigmoid-H_.html - + docs/manual/_invSigmoid_.html - + docs/manual/_invStudentQ_.html - + docs/manual/_label_.html - + docs/manual/_left-S_.html - + docs/manual/_length_.html - + docs/manual/_ln-H-H_.html - + docs/manual/_ln-H_.html - + docs/manual/_lnGamma_.html - + docs/manual/_ln_.html - + docs/manual/_log10-H-H_.html - + docs/manual/_log10-H_.html - + docs/manual/_log10_.html - + docs/manual/_log2-H-H_.html - + docs/manual/_log2-H_.html - + docs/manual/_log2_.html - + docs/manual/_lowerCaseAppName-S_.html - + docs/manual/_max_.html - + docs/manual/_mean_.html - + docs/manual/_melToHertz_.html - + docs/manual/_mid-S_.html - + docs/manual/_min_.html - + docs/manual/_minusObject_.html - + docs/manual/_mul-H-H_.html - + docs/manual/_ncol_.html - + docs/manual/_nrow_.html - + docs/manual/_number-H_.html - + docs/manual/_numberOfColumns_.html - + docs/manual/_numberOfRows_.html - + docs/manual/_number_.html - + docs/manual/_nx_.html - + docs/manual/_ny_.html - + docs/manual/_outer-H-H_.html - + docs/manual/_padLeft-S_.html - + docs/manual/_padOrTruncateLeft-S_.html - + docs/manual/_padOrTruncateRight-S_.html - + docs/manual/_padRight-S_.html - + docs/manual/_part-H-H_.html - + docs/manual/_part-H_.html - + docs/manual/_pauseScript_.html - + docs/manual/_percent-S_.html - + docs/manual/_phonToDifferenceLimens_.html - + docs/manual/_plusObject_.html - + docs/manual/_procedure_.html - + docs/manual/_randomBernoulli-H-H_.html - + docs/manual/_randomBernoulli-H_.html - + docs/manual/_randomBernoulli_.html - + docs/manual/_randomGamma-H-H_.html - + docs/manual/_randomGamma-H_.html - + docs/manual/_randomGamma_.html - + docs/manual/_randomGauss-H-H_.html - + docs/manual/_randomGauss-H_.html - + docs/manual/_randomGauss_.html - + docs/manual/_randomInteger-H-H_.html - + docs/manual/_randomInteger-H_.html - + docs/manual/_randomInteger_.html - + docs/manual/_randomPoisson-H-H_.html - + docs/manual/_randomPoisson-H_.html - + docs/manual/_randomPoisson_.html - + docs/manual/_randomUniform-H-H_.html - + docs/manual/_randomUniform-H_.html - + docs/manual/_randomUniform_.html - + docs/manual/_random_initializeSafelyAndUnpredictably_.html - + docs/manual/_random_initializeWithSeedUnsafelyButPredictably_.html - + docs/manual/_readFile-H-H_.html - + docs/manual/_readFile-H_.html - + docs/manual/_readFile-S_.html - + docs/manual/_readFile_.html - + docs/manual/_readLinesFromFile-S-H_.html - + docs/manual/_rectify-H-H_.html - + docs/manual/_rectify-H_.html - + docs/manual/_rectify_.html - + docs/manual/_removeObject_.html - + docs/manual/_repeat-H_.html - + docs/manual/_replace-S_.html - + docs/manual/_replace_regex-S_.html - + docs/manual/_right-S_.html - + docs/manual/_rindex_.html - + docs/manual/_rindex_caseInsensitive_.html - + docs/manual/_rindex_regex_.html - + docs/manual/_round-H-H_.html - + docs/manual/_round-H_.html - + docs/manual/_round_.html - + docs/manual/_row-H_.html - + docs/manual/_row-S_.html - + docs/manual/_rowSums-H_.html - + docs/manual/_row_.html - + docs/manual/_runScript_.html - + docs/manual/_runSubprocess-S_.html - + docs/manual/_runSubprocess_.html - + docs/manual/_runSystem-S_.html - + docs/manual/_runSystem_.html - + docs/manual/_selectObject_.html - + docs/manual/_selected-H_.html - + docs/manual/_selected-S-H_.html - + docs/manual/_selected-S_.html - + docs/manual/_selected_.html - + docs/manual/_semitonesToHertz_.html - + docs/manual/_shuffle-H_.html - + docs/manual/_shuffle-S-H_.html - + docs/manual/_sigmoid-H-H_.html - + docs/manual/_sigmoid-H_.html - + docs/manual/_sigmoid_.html - + docs/manual/_sin-H-H_.html - + docs/manual/_sin-H_.html - + docs/manual/_sin_.html - + docs/manual/_sin__1.png - + docs/manual/_sinc_.html - + docs/manual/_sincpi_.html - + docs/manual/_sinh-H-H_.html - + docs/manual/_sinh-H_.html - + docs/manual/_sinh_.html - + docs/manual/_size_.html - + docs/manual/_sleep_.html - + docs/manual/_softmax-H_.html - + docs/manual/_softmaxPerRow-H-H_.html - + docs/manual/_solve-H-H_.html - + docs/manual/_solve-H_.html - + docs/manual/_solveNonnegative-H_.html - + docs/manual/_solveSparse-H_.html - + docs/manual/_solveWeaklyConstrained-H_.html - + docs/manual/_sort-H_.html - + docs/manual/_sort-S-H_.html - + docs/manual/_sort_numberAware-S-H_.html - + docs/manual/_splitByWhitespace-S-H_.html - + docs/manual/_sqrt-H-H_.html - + docs/manual/_sqrt-H_.html - + docs/manual/_sqrt_.html - + docs/manual/_startsWith_.html - + docs/manual/_startsWith_caseInsensitive_.html - + docs/manual/_stdev_.html - + docs/manual/_stopwatch_.html - + docs/manual/_string-S_.html - + docs/manual/_studentP_.html - + docs/manual/_studentQ_.html - + docs/manual/_sumOver_.html - + docs/manual/_sum_.html - + docs/manual/_tan-H-H_.html - + docs/manual/_tan-H_.html - + docs/manual/_tan_.html - + docs/manual/_tanh-H-H_.html - + docs/manual/_tanh-H_.html - + docs/manual/_tanh_.html - + docs/manual/_to-H_.html - + docs/manual/_transpose-H-H_.html - + docs/manual/_truncateLeft-S_.html - + docs/manual/_truncateRight-S_.html - + docs/manual/_tryToAppendFile_.html - + docs/manual/_tryToWriteFile_.html - + docs/manual/_unicode-S_.html - + docs/manual/_unicodeToBackslashTrigraphs-S_.html - + docs/manual/_unicode_.html - + docs/manual/_upperCaseAppName-S_.html - + docs/manual/_variableExists_.html - + docs/manual/_vertical-S_.html - + docs/manual/_writeFileLine_.html - + docs/manual/_writeFile_.html - + docs/manual/_writeInfoLine_.html - + docs/manual/_writeInfo_.html - + docs/manual/_x_.html - + docs/manual/_xmax_.html - + docs/manual/_xmin_.html - + docs/manual/_y_.html - + docs/manual/_ymax_.html - + docs/manual/_ymin_.html - + docs/manual/_zero-H-H_.html - + docs/manual/_zero-H_.html - + docs/manual/action_commands.html - + docs/manual/aliasing.html - + docs/manual/audio_control_panel.html - + docs/manual/band_filtering_in_the_frequency_domain.html - + docs/manual/biharmonic_spline_interpolation.html - + docs/manual/blind_source_separation.html - + docs/manual/bootstrap.html - + docs/manual/box_plot.html - + docs/manual/box_plot_1.png - + docs/manual/buttons_file.html - + docs/manual/canonical_variate.html - + docs/manual/concentration_ellipse.html - + docs/manual/confidence_interval.html - + docs/manual/confidence_level.html - + docs/manual/congruence_coefficient.html - + docs/manual/constant_extrapolation.html - + docs/manual/constant_extrapolation_1.png - + docs/manual/constraints.html - + docs/manual/disparities.html - + docs/manual/eSpeak.html - + docs/manual/electroglottography.html - + docs/manual/end_time.html - + docs/manual/energy_integration_continuity_test.html - + docs/manual/epoch.html - + docs/manual/equivalent_rectangular_bandwidth.html - + docs/manual/expectation-maximization.html - + docs/manual/fixed_menu_commands.html - + docs/manual/frequency.html - + docs/manual/gammatone.html - + docs/manual/generalized_singular_value_decomposition.html - + docs/manual/hidden_commands.html - + docs/manual/how_to_choose_a_pitch_analysis_method.html - + docs/manual/how_to_choose_a_pitch_analysis_method_1.png - + docs/manual/identity_permutation.html - + docs/manual/incompleteBeta.html - + docs/manual/incompleteGammaP.html - + docs/manual/incomplete_gamma_function.html - + docs/manual/individual_difference_scaling.html - + docs/manual/initialization_script.html - + docs/manual/iris_data_set.html - + docs/manual/jackknife.html - + docs/manual/lexicographic_permutation_order.html - + docs/manual/linear_interpolation.html - + docs/manual/linear_interpolation_1.png - + docs/manual/lnBeta.html - + docs/manual/natural_sort_order.html - + docs/manual/non-negative_matrix_factorization.html - + docs/manual/objects.html - + docs/manual/overlap-add.html - + docs/manual/pairwise_algorithm_for_computing_sample_variances.html - + docs/manual/pause_window.html - + docs/manual/pitch_analysis_by_filtered_autocorrelation.html - + docs/manual/pitch_analysis_by_filtered_autocorrelation_1.png - + docs/manual/pitch_analysis_by_filtered_autocorrelation_2.png - + docs/manual/pitch_analysis_by_filtered_autocorrelation_3.png - + docs/manual/pitch_analysis_by_filtered_cross-correlation.html - + docs/manual/pitch_analysis_by_raw_autocorrelation.html - + docs/manual/pitch_analysis_by_raw_cross-correlation.html - + docs/manual/pitch_floor.html - + docs/manual/plug-ins.html - + docs/manual/plugins.html - + docs/manual/power_spectral_density.html - + docs/manual/preferences_file.html - + docs/manual/preferences_folder.html - + docs/manual/quantile_algorithm.html - + docs/manual/reverberation_time.html - + docs/manual/sampling_frequency.html - + docs/manual/sampling_period.html - + docs/manual/sendpraat.html - + docs/manual/singular_value_decomposition.html - + docs/manual/smacof.html - + docs/manual/solving_matrix_equations.html - + docs/manual/sound_pressure_calibration.html - + docs/manual/sound_pressure_level.html - + docs/manual/spectro-temporal_representation.html - + docs/manual/spline.html - + docs/manual/spline_1.png - + docs/manual/spline_2.png - + docs/manual/start_time.html - + docs/manual/stereo.html - + docs/manual/stress.html - + docs/manual/theil_regression.html - + docs/manual/time.html - + docs/manual/time_domain.html - + docs/manual/time_domain_1.png - + docs/manual/time_domain_2.png - + docs/manual/time_selection.html - + docs/manual/total_duration.html - + docs/manual/undefined.html - + docs/manual/vector_peak_interpolation.html - + docs/manual/vector_value_interpolation.html - + docs/manual/waveform.html - + docs/manualsByOthers.html - + docs/old/4100/Praat7_4100 - + docs/old/4100/praat4100_hpux.tar.gz - + docs/old/4100/praat4100_sgi.tar.gz - + docs/old/4113/PraatM_4113.app/Contents/Info.plist - + docs/old/4113/PraatM_4113.app/Contents/PkgInfo - + docs/old/4113/PraatM_4113.app/Contents/Resources/English.lproj/InfoPlist.strings - + docs/old/4113/PraatM_4113.app/Contents/Resources/Praat.rsrc - + docs/old/4113/PraatM_4113.app/Icon - + docs/old/4113/PraatM_4113.sit - + docs/old/4113/praat4113_macX.zip - + docs/old/4223/praat4223_mac7.sit - + docs/old/4300/praat4300_solaris.tar.gz - + docs/old/4501/praat4501_mac9.sit - + docs/old/4601/PraatMNoQAAC_4601.sit - + docs/old/4601/PraatMQAAC_4601.sit - + docs/old/4601/PraatNoQAAC.app/Contents/Info.plist - + docs/old/4601/PraatNoQAAC.app/Contents/PkgInfo - + docs/old/4601/PraatNoQAAC.app/Contents/Resources/English.lproj/InfoPlist.strings - + docs/old/4601/PraatQAAC.app/Contents/Info.plist - + docs/old/4601/PraatQAAC.app/Contents/PkgInfo - + docs/old/4601/PraatQAAC.app/Contents/Resources/English.lproj/InfoPlist.strings - + docs/old/4601/praat4601_win98.zip - + docs/old/4601/praatcon4601_win98.zip - + docs/old/5119/praat5119_macU.dmg - + docs/old/5119/praat5119_macU.sit - + docs/old/5217/praat5217_macU.dmg - + docs/old/5314/praat5314_mac32.dmg - + docs/old/5314/praat5314_win32.zip - + docs/old/5314/praatcon5314_win32.zip - + docs/pictures/arm64.png - + docs/pictures/david.gif - + docs/pictures/dontrun.png - + docs/pictures/intel64.png - + docs/pictures/paul.jpg - + docs/pictures/pboersma.jpg - + docs/pictures/pboersma.png - + docs/pictures/praat.png - + docs/pictures/praat.tiff - + docs/pictures/praat_black.gif - + docs/pictures/praat_white.gif - + docs/pictures/unblock.png - + docs/sendpraat.c - + docs/sendpraat.html - + docs/silipa93.sit - + docs/silipa93.zip - external/glpk/READ_ME.TXT - fon/manual_functions.cpp - fon/manual_licenses.cpp - fon/manual_references.cpp - fon/manual_tutorials.cpp - fon/manual_voice.cpp - fon/manual_whatsnew.cpp - foned/SoundAnalysisArea.cpp - ? main/GNU_General_Public_License.txt - main/main_Praat.cpp - main/main_Praat.h - melder/melder_ftoa.cpp - melder/melder_tensor.h - sys/Formula.cpp - sys/GuiDialog.cpp - sys/GuiWindow.cpp The diff was not included because it is too large. View it on GitLab: https://salsa.debian.org/med-team/praat/-/compare/e2f6d8fa1c31da81f92f2a73a99c6ce5386f3338...f70a45a462d912adbf1b07ea7fcc6e6e649c18a1 -- View it on GitLab: https://salsa.debian.org/med-team/praat/-/compare/e2f6d8fa1c31da81f92f2a73a99c6ce5386f3338...f70a45a462d912adbf1b07ea7fcc6e6e649c18a1 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Thu Jun 26 13:38:04 2025 From: gitlab at salsa.debian.org (=?UTF-8?B?UmFmYWVsIExhYm9pc3Npw6hyZSAoQHJhZmFlbCk=?=) Date: Thu, 26 Jun 2025 12:38:04 +0000 Subject: [med-svn] [Git][med-team/praat][upstream] New upstream version 6.4.35+dfsg Message-ID: <685d3f2cc45e8_3db21ebd1d05622296@godard.mail> Rafael Laboissi?re pushed to branch upstream at Debian Med / praat Commits: 96fc2ddb by Rafael Laboissi?re at 2025-06-20T17:24:19-03:00 New upstream version 6.4.35+dfsg - - - - - 2183 changed files: - README.md - + docs/.nojekyll - + docs/CNAME - + docs/CharisSIL-6.200.zip - + docs/DoulosSIL-6.200.zip - + docs/GdiPlus_headers.zip - + docs/download_chrome.html - + docs/download_freebsd.html - + docs/download_hpux.html - + docs/download_linux.html - + docs/download_mac.html - + docs/download_raspberrypi.html - + docs/download_sgi.html - + docs/download_solaris.html - + docs/download_sources.html - + docs/download_win.html - + docs/favicon.ico - + docs/index.html - + docs/libgdiplus.a-32.zip - + docs/manual/10.html - + docs/manual/12.html - + docs/manual/14.html - + docs/manual/18.html - + docs/manual/24.html - + docs/manual/Abramowitz___Stegun__1970_.html - + docs/manual/Acknowledgments.html - + docs/manual/ActivationList.html - + docs/manual/Add_action_command___.html - + docs/manual/Add_menu_command___.html - + docs/manual/Add_to_dynamic_menu___.html - + docs/manual/Add_to_fixed_menu___.html - + docs/manual/Add_to_menu___.html - + docs/manual/Advanced_pulses_settings___.html - + docs/manual/Advanced_spectrogram_settings___.html - + docs/manual/AffineTransform.html - + docs/manual/AffineTransform__Invert.html - + docs/manual/Ammar_et_al___2001_.html - + docs/manual/AmplitudeTier.html - + docs/manual/AmplitudeTier__Add_point___.html - + docs/manual/Analyses_menu.html - + docs/manual/Anderson__1935_.html - + docs/manual/Anderson__1978_.html - + docs/manual/Anderson_et_al___1999_.html - + docs/manual/Archangeli___Pulleyblank__1994_.html - + docs/manual/Articulatory_synthesis.html - + docs/manual/Artword.html - + docs/manual/Artword___Speaker__To_Sound___.html - + docs/manual/Axes___.html - + docs/manual/BHEP_multivariate_normality_test.html - + docs/manual/Bai___Demmel__1993_.html - + docs/manual/BarkFilter.html - + docs/manual/BarkSpectrogram.html - + docs/manual/BarkSpectrogram__Draw_Sekey-Hanson_auditory_filters___.html - + docs/manual/BarkSpectrogram__Paint_image___.html - + docs/manual/Bartlett__1954_.html - + docs/manual/Berry_et_al___2007_.html - + docs/manual/Bishop__2006_.html - + docs/manual/Black.html - + docs/manual/Blue.html - + docs/manual/Blumensath___Davies__2010_.html - + docs/manual/Boersma__1993_.html - + docs/manual/Boersma__1997_.html - + docs/manual/Boersma__1998_.html - + docs/manual/Boersma__2000_.html - + docs/manual/Boersma__2009a_.html - + docs/manual/Boersma__2009b_.html - + docs/manual/Boersma___Escudero__2008_.html - + docs/manual/Boersma___Hayes__2001_.html - + docs/manual/Boersma___Kovacic__2006_.html - + docs/manual/Boersma___Pater__2016_.html - + docs/manual/Boll__1979_.html - + docs/manual/Bonferroni_correction.html - + docs/manual/Boomsma__1977_.html - + docs/manual/Borg___Groenen__1997_.html - + docs/manual/Brokken__1983_.html - + docs/manual/Buse__1973_.html - + docs/manual/ButtonEditor.html - + docs/manual/CANDECOMP.html - + docs/manual/CC.html - + docs/manual/CCA.html - + docs/manual/CCA__Get_zero_correlation_probability___.html - + docs/manual/CCA___Correlation__Get_redundancy__sl____.html - + docs/manual/CCA___Correlation__Get_variance_fraction___.html - + docs/manual/CCA___Correlation__To_TableOfReal__loadings_.html - + docs/manual/CCA___TableOfReal__Predict___.html - + docs/manual/CCA___TableOfReal__To_TableOfReal__loadings_.html - + docs/manual/CCA___TableOfReal__To_TableOfReal__scores____.html - + docs/manual/CC__Get_c0_value_in_frame___.html - + docs/manual/CC__Get_value_in_frame___.html - + docs/manual/CC__Paint___.html - + docs/manual/CC__To_DTW___.html - + docs/manual/CC__To_Matrix.html - + docs/manual/Cailliez__1983_.html - + docs/manual/Calculator.html - + docs/manual/Calculator___.html - + docs/manual/Candidate_modelling_settings___.html - + docs/manual/Canonical_correlation_analysis.html - + docs/manual/Carroll___Chang__1970_.html - + docs/manual/Carroll___Wish__1974_.html - + docs/manual/Categories.html - + docs/manual/CategoriesEditor.html - + docs/manual/Categories__Append.html - + docs/manual/Categories__Difference.html - + docs/manual/Categories__Edit.html - + docs/manual/Categories__To_Confusion.html - + docs/manual/Cepstrum.html - + docs/manual/Chan__Golub___LeVeque__1979_.html - + docs/manual/Chan__Golub___LeVeque__1983_.html - + docs/manual/ChebyshevSeries.html - + docs/manual/ChebyshevSeries__To_Polynomial.html - + docs/manual/Chebyshev_polynomials.html - + docs/manual/Checking_for_updates.html - + docs/manual/Childers__1978_.html - + docs/manual/ClassificationTable.html - + docs/manual/ClassificationTable__To_Confusion___.html - + docs/manual/Clear_history.html - + docs/manual/Click.html - + docs/manual/Cochleagram.html - + docs/manual/Cochleagram__Formula___.html - + docs/manual/Colour.html - + docs/manual/Colour___.html - + docs/manual/Command-click.html - + docs/manual/Configuration.html - + docs/manual/Configuration__Centralize.html - + docs/manual/Configuration__Draw___.html - + docs/manual/Configuration__Invert_dimension___.html - + docs/manual/Configuration__Normalize___.html - + docs/manual/Configuration__Randomize.html - + docs/manual/Configuration__Rotate___.html - + docs/manual/Configuration__Rotate__pc_.html - + docs/manual/Configuration__To_Configuration__procrustes_.html - + docs/manual/Configuration__To_Configuration__varimax____.html - + docs/manual/Configuration__To_Distance.html - + docs/manual/Configuration__To_Similarity__cc_.html - + docs/manual/Configuration___AffineTransform__To_Configuration.html - + docs/manual/Configuration___Configuration__To_Procrustes___.html - + docs/manual/Configuration___Procrustes__To_Configuration.html - + docs/manual/Configurations__To_AffineTransform__congruence____.html - + docs/manual/Confusion.html - + docs/manual/Confusion__Condense___.html - + docs/manual/Confusion__Get_fraction_correct.html - + docs/manual/Confusion__Get_response_sum___.html - + docs/manual/Confusion__Get_stimulus_sum___.html - + docs/manual/Confusion__Group___.html - + docs/manual/Confusion__Group_responses___.html - + docs/manual/Confusion__Group_stimuli___.html - + docs/manual/Confusion__Increase___.html - + docs/manual/Confusion__To_Dissimilarity___.html - + docs/manual/Confusion__To_Dissimilarity__pdf____.html - + docs/manual/Confusion__To_Similarity___.html - + docs/manual/Confusion__To_TableOfReal__marginals_.html - + docs/manual/Confusion___ClassificationTable__Increase_confusion_cou.html - + docs/manual/ConstantQLogFSpectrogram.html - + docs/manual/ContingencyTable.html - + docs/manual/ContingencyTable__To_Configuration__ca____.html - + docs/manual/Cooley___Lohnes__1971_.html - + docs/manual/Copy___.html - + docs/manual/Copy_to_clipboard.html - + docs/manual/Correlation.html - + docs/manual/Correlation__Confidence_intervals___.html - + docs/manual/Correspondence_analysis.html - + docs/manual/Courier.html - + docs/manual/Covariance.html - + docs/manual/Covariance__Difference.html - + docs/manual/Covariance__Get_fraction_variance___.html - + docs/manual/Covariance__Get_significance_of_means_difference___.html - + docs/manual/Covariance__Get_significance_of_one_mean___.html - + docs/manual/Covariance__Get_significance_of_one_variance___.html - + docs/manual/Covariance__Get_significance_of_variance_ratio___.html - + docs/manual/Covariance__Set_value___.html - + docs/manual/Covariance__To_TableOfReal__random_sampling____.html - + docs/manual/Covariance___TableOfReal__Extract_quantile_range___.html - + docs/manual/Covariance___TableOfReal__To_TableOfReal__mahalanobis__.html - + docs/manual/Covariances__Report_equality.html - + docs/manual/Covariances__Report_multivariate_mean_difference___.html - + docs/manual/Create_AmplitudeTier___.html - + docs/manual/Create_Artword___.html - + docs/manual/Create_ChebyshevSeries___.html - + docs/manual/Create_Configuration___.html - + docs/manual/Create_Corpus___.html - + docs/manual/Create_DurationTier___.html - + docs/manual/Create_DurationTier____1.png - + docs/manual/Create_FFNet___.html - + docs/manual/Create_FFNet__linear_outputs____.html - + docs/manual/Create_FormantGrid___.html - + docs/manual/Create_H1H2_table__Keating___Esposito_2006_.html - + docs/manual/Create_INDSCAL_Carroll___Wish_example___.html - + docs/manual/Create_INDSCAL_Carroll___Wish_example____1.png - + docs/manual/Create_INDSCAL_Carroll___Wish_example____2.png - + docs/manual/Create_ISpline___.html - + docs/manual/Create_IntensityTier___.html - + docs/manual/Create_KlattGrid___.html - + docs/manual/Create_KlattGrid_from_vowel___.html - + docs/manual/Create_LegendreSeries___.html - + docs/manual/Create_MSpline___.html - + docs/manual/Create_Matrix___.html - + docs/manual/Create_NoCoda_grammar.html - + docs/manual/Create_Permutation___.html - + docs/manual/Create_Photo___.html - + docs/manual/Create_PitchTier___.html - + docs/manual/Create_Poisson_process___.html - + docs/manual/Create_Poisson_process____1.png - + docs/manual/Create_Poisson_process____2.png - + docs/manual/Create_Poisson_process____3.png - + docs/manual/Create_Poisson_process____4.png - + docs/manual/Create_Polygon_from_values___.html - + docs/manual/Create_Polygon_from_values____1.png - + docs/manual/Create_Polynomial___.html - + docs/manual/Create_Sound_as_Shepard_tone___.html - + docs/manual/Create_Sound_as_gammatone___.html - + docs/manual/Create_Sound_as_pure_tone___.html - + docs/manual/Create_Sound_as_tone_complex___.html - + docs/manual/Create_Sound_from_formula___.html - + docs/manual/Create_Speaker___.html - + docs/manual/Create_SpeechSynthesizer___.html - + docs/manual/Create_Strings_as_directory_list___.html - + docs/manual/Create_Strings_as_file_list___.html - + docs/manual/Create_Strings_as_file_list____1.png - + docs/manual/Create_Strings_as_folder_list___.html - + docs/manual/Create_Strings_from_tokens___.html - + docs/manual/Create_TableOfReal.html - + docs/manual/Create_TableOfReal__Pols_1973____.html - + docs/manual/Create_TableOfReal__Sandwell_1987_.html - + docs/manual/Create_TableOfReal__Sandwell_1987__1.png - + docs/manual/Create_TableOfReal__Van_Nierop_1973____.html - + docs/manual/Create_TableOfReal__Weenink_1985____.html - + docs/manual/Create_Table__Ganong_1980_.html - + docs/manual/Create_Table_with_column_names___.html - + docs/manual/Create_Table_without_column_names___.html - + docs/manual/Create_TextGrid___.html - + docs/manual/Create_Vocal_Tract_from_phone___.html - + docs/manual/Create_empty_EditCostsTable___.html - + docs/manual/Create_empty_PointProcess___.html - + docs/manual/Create_formant_table__Peterson___Barney_1952_.html - + docs/manual/Create_formant_table__Pols___Van_Nierop_1973_.html - + docs/manual/Create_formant_table__Weenink_1985_.html - + docs/manual/Create_iris_data_set.html - + docs/manual/Create_iris_example___.html - + docs/manual/Create_letter_R_example___.html - + docs/manual/Create_letter_R_example____1.png - + docs/manual/Create_simple_Confusion___.html - + docs/manual/Create_simple_Correlation___.html - + docs/manual/Create_simple_Covariance___.html - + docs/manual/Create_simple_Matrix___.html - + docs/manual/Create_simple_Matrix_from_values___.html - + docs/manual/Create_simple_MixingMatrix___.html - + docs/manual/Create_simple_Photo___.html - + docs/manual/Create_tongue-root_grammar___.html - + docs/manual/CrossCorrelationTable.html - + docs/manual/CrossCorrelationTableList.html - + docs/manual/CrossCorrelationTableList__Create_test_set___.html - + docs/manual/CrossCorrelationTableList__Create_test_set____1.png - + docs/manual/Cyan.html - + docs/manual/DTW.html - + docs/manual/DTW__Draw_warp__x____.html - + docs/manual/DTW__Find_path__band___slope____.html - + docs/manual/DTW__Get_distance__weighted_.html - + docs/manual/DTW__Get_maximum_consecutive_steps___.html - + docs/manual/DTW__Get_time_along_path___.html - + docs/manual/DTW__Get_x_time_from_y_time___.html - + docs/manual/DTW__Get_y_time_from_x_time___.html - + docs/manual/DTW__Swap_axes.html - + docs/manual/DTW__To_Polygon___.html - + docs/manual/DTW___Sounds__Draw___.html - + docs/manual/DTW___Sounds__Draw_warp__x____.html - + docs/manual/DTW___TextGrid__To_TextGrid__warp_times_.html - + docs/manual/DataModeler.html - + docs/manual/DataModeler__Draw_estimated_track___.html - + docs/manual/DataModeler__Draw_model___.html - + docs/manual/DataModeler__Get_coefficient_of_determination.html - + docs/manual/DataModeler__Get_residual_sum_of_squares.html - + docs/manual/DataModeler__Speckle___.html - + docs/manual/DataModeler__To_Table__z-scores_.html - + docs/manual/Davis___Mermelstein__1980_.html - + docs/manual/De_Leeuw__1977_.html - + docs/manual/De_Leeuw___Pruzansky__1978_.html - + docs/manual/Deliyski__1993_.html - + docs/manual/Demo_window.html - + docs/manual/Demo_window_1__My_first_Demo_window_script.html - + docs/manual/Demo_window_2__Getting_user_input.html - + docs/manual/Demo_window_3__Getting_click_locations.html - + docs/manual/Demo_window_4__Full-screen_viewing.html - + docs/manual/Demo_window_5__Asynchronous_play.html - + docs/manual/Demo_window_6__Animation.html - + docs/manual/Demo_window_7__Miscellaneous.html - + docs/manual/Demo_window_8__Tips_and_Tricks.html - + docs/manual/Deng___Tang__2011_.html - + docs/manual/Deng_et_al___2006_.html - + docs/manual/Difference_of_two_proportions.html - + docs/manual/Discriminant.html - + docs/manual/Discriminant__Draw_sigma_ellipses___.html - + docs/manual/Discriminant__Extract_pooled_within-groups_SSCP.html - + docs/manual/Discriminant__Extract_within-group_SSCP___.html - + docs/manual/Discriminant__Get_Wilks__lambda___.html - + docs/manual/Discriminant__Get_concentration_ellipse_area___.html - + docs/manual/Discriminant__Get_confidence_ellipse_area___.html - + docs/manual/Discriminant__Get_contribution_of_component___.html - + docs/manual/Discriminant__Get_partial_discrimination_probability___.html - + docs/manual/Discriminant___PatternList__To_Categories___.html - + docs/manual/Discriminant___SSCP__Project.html - + docs/manual/Discriminant___TableOfReal__To_ClassificationTable___.html - + docs/manual/Discriminant___TableOfReal__To_Configuration___.html - + docs/manual/Discriminant___TableOfReal__To_TableOfReal__mahalanobis.html - + docs/manual/Discriminant_analysis.html - + docs/manual/Discriminant_analysis_1.png - + docs/manual/Discriminant_analysis_2.png - + docs/manual/Discriminant_analysis_3.png - + docs/manual/Dissimilarity.html - + docs/manual/Dissimilarity__Get_additive_constant.html - + docs/manual/Dissimilarity__To_Configuration__absolute_mds____.html - + docs/manual/Dissimilarity__To_Configuration__i-spline_mds____.html - + docs/manual/Dissimilarity__To_Configuration__interval_mds____.html - + docs/manual/Dissimilarity__To_Configuration__kruskal____.html - + docs/manual/Dissimilarity__To_Configuration__monotone_mds____.html - + docs/manual/Dissimilarity__To_Configuration__ratio_mds____.html - + docs/manual/Dissimilarity__To_Distance___.html - + docs/manual/Dissimilarity__To_Weight.html - + docs/manual/Dissimilarity___Configuration__Draw_Shepard_diagram___.html - + docs/manual/Dissimilarity___Configuration__Draw_regression__absolut.html - + docs/manual/Dissimilarity___Configuration__Draw_regression__i-splin.html - + docs/manual/Dissimilarity___Configuration__Draw_regression__interva.html - + docs/manual/Dissimilarity___Configuration__Draw_regression__monoton.html - + docs/manual/Dissimilarity___Configuration__Draw_regression__ratio_m.html - + docs/manual/Dissimilarity___Configuration__Get_stress__absolute_mds.html - + docs/manual/Dissimilarity___Configuration__Get_stress__i-spline_mds.html - + docs/manual/Dissimilarity___Configuration__Get_stress__interval_mds.html - + docs/manual/Dissimilarity___Configuration__Get_stress__monotone_mds.html - + docs/manual/Dissimilarity___Configuration__Get_stress__ratio_mds___.html - + docs/manual/Dissimilarity___Configuration__To_Configuration__absolu.html - + docs/manual/Dissimilarity___Configuration__To_Configuration__i-spli.html - + docs/manual/Dissimilarity___Configuration__To_Configuration__interv.html - + docs/manual/Dissimilarity___Configuration__To_Configuration__kruska.html - + docs/manual/Dissimilarity___Configuration__To_Configuration__monoto.html - + docs/manual/Dissimilarity___Configuration__To_Configuration__ratio_.html - + docs/manual/Dissimilarity___Configuration___Weight__Get_stress___.html - + docs/manual/Dissimilarity___Configuration___Weight__To_Configuratio.html - + docs/manual/Dissimilarity___Weight__To_Configuration___.html - + docs/manual/Distance.html - + docs/manual/Distance__To_Configuration__indscal____.html - + docs/manual/Distance__To_Configuration__ytl____.html - + docs/manual/Distance__To_ScalarProduct___.html - + docs/manual/Distance___Configuration__Draw_scatter_diagram___.html - + docs/manual/Distance___Configuration__Get_VAF___.html - + docs/manual/Distance___Configuration__To_Configuration__indscal____.html - + docs/manual/Distance___Configuration___Salience__Get_VAF___.html - + docs/manual/Distance___Configuration___Salience__To_Configuration__.html - + docs/manual/Distributions.html - + docs/manual/Distributions__To_Strings___.html - + docs/manual/Drag.html - + docs/manual/Draw_inner_box.html - + docs/manual/Draw_line___.html - + docs/manual/Draw_menu.html - + docs/manual/Draw_rectangle___.html - + docs/manual/Draw_rounded_rectangle___.html - + docs/manual/DurationTier.html - + docs/manual/DurationTierEditor.html - + docs/manual/DurationTier__Add_point___.html - + docs/manual/DurationTier__Get_target_duration___.html - + docs/manual/Dynamic_menu.html - + docs/manual/EEG.html - + docs/manual/EditCostsTable.html - + docs/manual/EditCostsTable_1.png - + docs/manual/EditDistanceTable.html - + docs/manual/EditDistanceTable_1.png - + docs/manual/EditDistanceTable_2.png - + docs/manual/EditDistanceTable___EditCostsTable__Set_new_edit_costs.html - + docs/manual/Editors.html - + docs/manual/Efron___Tibshirani__1993_.html - + docs/manual/Eigen.html - + docs/manual/Eigen__Draw_eigenvalues___.html - + docs/manual/Eigen__Draw_eigenvector___.html - + docs/manual/Eigen__Extract_eigenvector___.html - + docs/manual/Eigen__Get_contribution_of_component___.html - + docs/manual/Eigen__Get_cumulative_contribution_of_components___.html - + docs/manual/Eigen__Get_eigenvalue___.html - + docs/manual/Eigen__Get_eigenvector_element___.html - + docs/manual/Eigen___Matrix__To_Matrix__project_columns____.html - + docs/manual/Eigen___Matrix__To_Matrix__project_rows____.html - + docs/manual/Eigen___SSCP__Project.html - + docs/manual/Eigen___TableOfReal__Project___.html - + docs/manual/Electroglottogram.html - + docs/manual/Electroglottogram_1.png - + docs/manual/Electroglottogram__Derivative___.html - + docs/manual/Electroglottogram__First_central_difference___.html - + docs/manual/Electroglottogram__High-pass_filter___.html - + docs/manual/Electroglottogram__To_AmplitudeTier__levels____.html - + docs/manual/Electroglottogram__To_TextGrid__closed_glottis____.html - + docs/manual/Electroglottogram__To_TextGrid__closed_glottis_____1.png - + docs/manual/Encapsulated_PostScript.html - + docs/manual/Erase_all.html - + docs/manual/Escudero__Boersma__Rauber___Bion__2009_.html - + docs/manual/Escudero___Boersma__2004_.html - + docs/manual/Excitation.html - + docs/manual/Excitation__Formula___.html - + docs/manual/Excitation__Get_loudness.html - + docs/manual/Excitations.html - + docs/manual/Excitations__Append.html - + docs/manual/Excitations__To_PatternList___.html - + docs/manual/ExperimentMFC.html - + docs/manual/ExperimentMFC_1__When_to_use_Praat.html - + docs/manual/ExperimentMFC_2_1__The_experiment_file.html - + docs/manual/ExperimentMFC_2_2__The_stimuli.html - + docs/manual/ExperimentMFC_2_3__The_carrier_phrase.html - + docs/manual/ExperimentMFC_2_4__Breaks.html - + docs/manual/ExperimentMFC_2_5__Randomization_strategies.html - + docs/manual/ExperimentMFC_2_6__Instructions.html - + docs/manual/ExperimentMFC_2_7__Response_categories.html - + docs/manual/ExperimentMFC_2_8__Goodness_judgments.html - + docs/manual/ExperimentMFC_2_9__How_an_experiment_proceeds.html - + docs/manual/ExperimentMFC_2__The_first_example.html - + docs/manual/ExperimentMFC_3_1__A_simple_discrimination_experiment.html - + docs/manual/ExperimentMFC_3_2__An_AXB_discrimination_experiment.html - + docs/manual/ExperimentMFC_3_3__A_4I-oddity_experiment.html - + docs/manual/ExperimentMFC_3_4__Variable_inter-stimulus_intervals.html - + docs/manual/ExperimentMFC_3__More_examples.html - + docs/manual/ExperimentMFC_4_1__The_replay_button.html - + docs/manual/ExperimentMFC_4_2__The_OK_button.html - + docs/manual/ExperimentMFC_4_3__The_oops_button.html - + docs/manual/ExperimentMFC_4__Special_buttons.html - + docs/manual/ExperimentMFC_5_1__The_stimulus-dependent_run_text.html - + docs/manual/ExperimentMFC_5_2__Stimulus-dependent_response_buttons.html - + docs/manual/ExperimentMFC_5__Stimulus-dependent_texts.html - + docs/manual/ExperimentMFC_6__Responses_are_sounds.html - + docs/manual/ExperimentMFC_7__Blanking_the_screen.html - + docs/manual/ExperimentMFC_8__Running_multiple_experiments.html - + docs/manual/Extract_one_channel___.html - + docs/manual/Extract_selected_sound__windowed____.html - + docs/manual/Extract_visible_formant_contour.html - + docs/manual/Extract_visible_intensity_contour.html - + docs/manual/Extract_visible_pitch_contour.html - + docs/manual/Extract_visible_spectrogram.html - + docs/manual/FAQ__Formant_analysis.html - + docs/manual/FAQ__Frequently_Asked_Questions_.html - + docs/manual/FAQ__How_to_cite_Praat.html - + docs/manual/FAQ__Pitch_analysis.html - + docs/manual/FAQ__Scripts.html - + docs/manual/FAQ__Spectrograms.html - + docs/manual/FFNet.html - + docs/manual/FFNet__Categories.html - + docs/manual/FFNet__Draw_cost_history___.html - + docs/manual/FFNet__Draw_topology.html - + docs/manual/FFNet__Draw_weights___.html - + docs/manual/FFNet__Extract_weights___.html - + docs/manual/FFNet__Get_number_of_hidden_units___.html - + docs/manual/FFNet__Get_number_of_hidden_weights___.html - + docs/manual/FFNet__Get_number_of_inputs.html - + docs/manual/FFNet__Get_number_of_outputs.html - + docs/manual/FFNet__Principal_components.html - + docs/manual/FFNet__Reset___.html - + docs/manual/FFNet__Select_biases___.html - + docs/manual/FFNet___PatternList__To_Categories___.html - + docs/manual/FFNet___PatternList___ActivationList__Get_average_costs.html - + docs/manual/FFNet___PatternList___ActivationList__Get_total_costs__.html - + docs/manual/FFNet___PatternList___Categories__Get_average_costs___.html - + docs/manual/FFNet___PatternList___Categories__Get_total_costs___.html - + docs/manual/FFNet___PatternList___Categories__Learn___.html - + docs/manual/FFNet___PatternList___Categories__Learn_slow___.html - + docs/manual/FFT.html - + docs/manual/FLAC_BSD_3-clause_license.html - + docs/manual/FLAC_files.html - + docs/manual/Fant__1960_.html - + docs/manual/Fast_Fourier_Transform.html - + docs/manual/Feedforward_neural_networks.html - + docs/manual/Feedforward_neural_networks_1_1__The_learning_phase.html - + docs/manual/Feedforward_neural_networks_1_2__The_classification_pha.html - + docs/manual/Feedforward_neural_networks_1__What_is_a_feedforward_ne.html - + docs/manual/Feedforward_neural_networks_1__What_is_a_feedforward_ne_1.png - + docs/manual/Feedforward_neural_networks_2__Quick_start.html - + docs/manual/Feedforward_neural_networks_3__FFNet_versus_discriminan.html - + docs/manual/Feedforward_neural_networks_4__Command_overview.html - + docs/manual/Figueiredo___Jain__2002_.html - + docs/manual/File_menu.html - + docs/manual/FilterBank__Draw_filter_functions___.html - + docs/manual/FilterBank__Draw_frequency_scales___.html - + docs/manual/FilterBank__Get_frequency_in_Bark___.html - + docs/manual/FilterBank__Get_frequency_in_Hertz___.html - + docs/manual/FilterBank__Get_frequency_in_mel___.html - + docs/manual/Filtering.html - + docs/manual/Fischer__2005_.html - + docs/manual/Fisher__1936_.html - + docs/manual/Flanagan__1960_.html - + docs/manual/Flanagan___Landgraf__1968_.html - + docs/manual/Fleisher_et_al___2015_.html - + docs/manual/Font_menu.html - + docs/manual/Font_size___.html - + docs/manual/Formant.html - + docs/manual/FormantFilter.html - + docs/manual/FormantGrid.html - + docs/manual/FormantGrid__Add_bandwidth_point___.html - + docs/manual/FormantGrid__Add_formant_point___.html - + docs/manual/FormantGrid__Remove_bandwidth_points_between___.html - + docs/manual/FormantGrid__Remove_formant_points_between___.html - + docs/manual/FormantModeler__Get_residual_sum_of_squares___.html - + docs/manual/FormantPath.html - + docs/manual/FormantPathEditor.html - + docs/manual/FormantPath__Down_to_Table__optimal_interval____.html - + docs/manual/FormantPath__Down_to_Table__stresses____.html - + docs/manual/Formant__Down_to_FormantGrid.html - + docs/manual/Formant__Draw_tracks___.html - + docs/manual/Formant__Formula__bandwidths____.html - + docs/manual/Formant__Formula__frequencies____.html - + docs/manual/Formant__Get_bandwidth_at_time___.html - + docs/manual/Formant__Get_maximum___.html - + docs/manual/Formant__Get_mean___.html - + docs/manual/Formant__Get_minimum___.html - + docs/manual/Formant__Get_number_of_formants.html - + docs/manual/Formant__Get_quantile___.html - + docs/manual/Formant__Get_standard_deviation.html - + docs/manual/Formant__Get_time_of_maximum___.html - + docs/manual/Formant__Get_time_of_minimum___.html - + docs/manual/Formant__Get_value_at_time___.html - + docs/manual/Formant__List_formant_slope___.html - + docs/manual/Formant__Speckle___.html - + docs/manual/Formant__Track___.html - + docs/manual/Formant___Spectrogram__To_IntensityTier___.html - + docs/manual/Formants__Extract_smoothest_part___.html - + docs/manual/Formants__Extract_smoothest_part____1.png - + docs/manual/Formants__Extract_smoothest_part__constrained____.html - + docs/manual/Formants___LPC_menu.html - + docs/manual/Formants_menu.html - + docs/manual/Formula___.html - + docs/manual/Formulas.html - + docs/manual/Formulas_1_1__Formulas_in_the_calculator.html - + docs/manual/Formulas_1_2__Numeric_expressions.html - + docs/manual/Formulas_1_3__String_expressions.html - + docs/manual/Formulas_1_4__Array_expressions.html - + docs/manual/Formulas_1_5__Formulas_in_settings_windows.html - + docs/manual/Formulas_1_6__Formulas_for_creation.html - + docs/manual/Formulas_1_7__Formulas_for_modification.html - + docs/manual/Formulas_1_8__Formulas_in_scripts.html - + docs/manual/Formulas_1__My_first_formulas.html - + docs/manual/Formulas_2_1__Representation_of_numbers.html - + docs/manual/Formulas_2_2__Representation_of_strings.html - + docs/manual/Formulas_2_3__Representation_of_arrays.html - + docs/manual/Formulas_2__Representations.html - + docs/manual/Formulas_3__Operators.html - + docs/manual/Formulas_4__Constants.html - + docs/manual/Formulas_5__Mathematical_functions.html - + docs/manual/Formulas_6__String_functions.html - + docs/manual/Formulas_7__Control_structures.html - + docs/manual/Formulas_8__Attributes_of_objects.html - + docs/manual/Formulas_9__Data_in_objects.html - + docs/manual/Frequency_selection.html - + docs/manual/Friedl__1997_.html - + docs/manual/Functions.html - + docs/manual/F?votte__Bertin___Durrieu__2009_.html - + docs/manual/GNU_Lesser_General_Public_License__version_2_1.html - + docs/manual/Ganong__1980_.html - + docs/manual/Garofolo__Lamel__Fisher__Fiscus__Pallett___Dahlgren__19.html - + docs/manual/GaussianMixture.html - + docs/manual/GaussianMixture__Draw_concentration_ellipses___.html - + docs/manual/GaussianMixture__Draw_marginal_pdf___.html - + docs/manual/GaussianMixture__Get_probability_at_position.html - + docs/manual/GaussianMixture__Split_component___.html - + docs/manual/GaussianMixture__To_Covariance__between_.html - + docs/manual/GaussianMixture__To_Covariance__total_.html - + docs/manual/GaussianMixture__To_Covariance__within_.html - + docs/manual/GaussianMixture__To_PCA.html - + docs/manual/GaussianMixture__To_TableOfReal__random_sampling____.html - + docs/manual/GaussianMixture___PCA__Draw_concentration_ellipses___.html - + docs/manual/GaussianMixture___PCA__To_Matrix__density____.html - + docs/manual/GaussianMixture___TableOfReal__Get_likelihood_value___.html - + docs/manual/GaussianMixture___TableOfReal__Improve_likelihood___.html - + docs/manual/GaussianMixture___TableOfReal__To_ClassificationTable.html - + docs/manual/GaussianMixture___TableOfReal__To_Correlation__columns_.html - + docs/manual/GaussianMixture___TableOfReal__To_GaussianMixture__CEMM.html - + docs/manual/GaussianMixture___TableOfReal__To_Table__BHEP_normality.html - + docs/manual/General_Public_License__version_2.html - + docs/manual/General_Public_License__version_3.html - + docs/manual/Get_area___.html - + docs/manual/Get_first_formant.html - + docs/manual/Get_frame_number_from_time___.html - + docs/manual/Get_high_index_from_time___.html - + docs/manual/Get_incomplete_gamma___.html - + docs/manual/Get_low_index_from_time___.html - + docs/manual/Get_nearest_index_from_time___.html - + docs/manual/Get_number_of_frames.html - + docs/manual/Get_number_of_samples.html - + docs/manual/Get_pitch.html - + docs/manual/Get_sample_number_from_time___.html - + docs/manual/Get_sampling_frequency.html - + docs/manual/Get_sampling_period.html - + docs/manual/Get_second_formant.html - + docs/manual/Get_time_from_frame_number___.html - + docs/manual/Get_time_from_sample_number___.html - + docs/manual/Get_time_step.html - + docs/manual/Gifi__1990_.html - + docs/manual/Golub___van_Loan__1996_.html - + docs/manual/Goodies.html - + docs/manual/Green.html - + docs/manual/Green__Carmone___Smith__1989_.html - + docs/manual/Greiner___Hormann__1998_.html - + docs/manual/Grey.html - + docs/manual/HMM.html - + docs/manual/HMMObservationSequence.html - + docs/manual/HMMObservationSequence__To_TableOfReal__bigrams____.html - + docs/manual/HMMStateSequence.html - + docs/manual/HMM_1.png - + docs/manual/HMM__Create_simple_HMM___.html - + docs/manual/HMM__Extract_emission_probabilities.html - + docs/manual/HMM__Extract_transition_probabilities.html - + docs/manual/HMM__Get_emission_probability___.html - + docs/manual/HMM__Get_expected_duration_in_state___.html - + docs/manual/HMM__Get_p__time__state____.html - + docs/manual/HMM__Get_p__time__state__symbol____.html - + docs/manual/HMM__Get_probability_staying_in_state___.html - + docs/manual/HMM__Get_start_probability___.html - + docs/manual/HMM__Get_transition_probability___.html - + docs/manual/HMM__Set_emission_probabilities___.html - + docs/manual/HMM__Set_start_probabilities___.html - + docs/manual/HMM__Set_transition_probabilities___.html - + docs/manual/HMM__To_HMMObservationSequence___.html - + docs/manual/HMM___HMMObservationSequence__Get_cross-entropy.html - + docs/manual/HMM___HMMObservationSequence__Get_probability.html - + docs/manual/HMM___HMMObservationSequence__To_TableOfReal__bigrams__.html - + docs/manual/HMM___HMMObservationSequences__Learn___.html - + docs/manual/HMM___HMMStateSequence__Get_probability.html - + docs/manual/HMM___HMM__Get_cross-entropy___.html - + docs/manual/HMM___HMM___HMMObservationSequence__Get_cross-entropy.html - + docs/manual/HTK_parameter_file_format.html - + docs/manual/Harmonicity.html - + docs/manual/Harmonicity__Formula___.html - + docs/manual/Harmonicity__Get_maximum___.html - + docs/manual/Harmonicity__Get_mean___.html - + docs/manual/Harmonicity__Get_minimum___.html - + docs/manual/Harmonicity__Get_standard_deviation___.html - + docs/manual/Harmonicity__Get_time_of_maximum___.html - + docs/manual/Harmonicity__Get_time_of_minimum___.html - + docs/manual/Harmonicity__Get_value_at_time___.html - + docs/manual/Harmonicity__Get_value_in_frame___.html - + docs/manual/Hastie__Tibshirani___Friedman__2001_.html - + docs/manual/Hawks___Miller__1995_.html - + docs/manual/Hayes___MacEachern__1998_.html - + docs/manual/Heath_et_al___1986_.html - + docs/manual/Helvetica.html - + docs/manual/Henrich_et_al___2004_.html - + docs/manual/Henze___Wagner__1997_.html - + docs/manual/Herbst__2019_.html - + docs/manual/Herbst_et_al___2014_.html - + docs/manual/Hermes__1988_.html - + docs/manual/Hillenbrand___Houde__1996_.html - + docs/manual/Hillenbrand_et_al___1994_.html - + docs/manual/History_mechanism.html - + docs/manual/Holighaus_et_al___2013_.html - + docs/manual/Hormann___Agathos__2001_.html - + docs/manual/How_to_concatenate_sound_files.html - + docs/manual/IDX_file_format.html - + docs/manual/INDSCAL_analysis.html - + docs/manual/ISpline.html - + docs/manual/Independent_Component_Analysis_on_EEG.html - + docs/manual/Index.html - + docs/manual/Index__Extract_part___.html - + docs/manual/Index__To_Permutation___.html - + docs/manual/Info.html - + docs/manual/Info_window.html - + docs/manual/Insert_picture_from_file___.html - + docs/manual/Inspect.html - + docs/manual/Intensity.html - + docs/manual/IntensityTier.html - + docs/manual/IntensityTierEditor.html - + docs/manual/IntensityTier__Add_point___.html - + docs/manual/IntensityTier__Down_to_PointProcess.html - + docs/manual/Intensity__Get_maximum___.html - + docs/manual/Intensity__Get_mean___.html - + docs/manual/Intensity__Get_minimum___.html - + docs/manual/Intensity__Get_standard_deviation___.html - + docs/manual/Intensity__Get_time_of_maximum___.html - + docs/manual/Intensity__Get_time_of_minimum___.html - + docs/manual/Intensity__Get_value_at_time___.html - + docs/manual/Intensity__Get_value_in_frame___.html - + docs/manual/Intensity__To_IntensityTier.html - + docs/manual/Intensity__To_TextGrid__silences____.html - + docs/manual/Intensity___PointProcess__To_IntensityTier___.html - + docs/manual/Interoperability.html - + docs/manual/Intro.html - + docs/manual/Intro_1_1__Recording_a_sound.html - + docs/manual/Intro_1_2__Reading_a_sound_from_disk.html - + docs/manual/Intro_1_3__Creating_a_sound_from_a_formula.html - + docs/manual/Intro_1__How_to_get_a_sound.html - + docs/manual/Intro_2_1__Saving_a_sound_to_disk.html - + docs/manual/Intro_2_2__Viewing_and_editing_a_sound.html - + docs/manual/Intro_2__What_to_do_with_a_sound.html - + docs/manual/Intro_3_1__Viewing_a_spectrogram.html - + docs/manual/Intro_3_2__Configuring_the_spectrogram.html - + docs/manual/Intro_3_3__Querying_the_spectrogram.html - + docs/manual/Intro_3_4__Printing_the_spectrogram.html - + docs/manual/Intro_3_5__The_Spectrogram_object.html - + docs/manual/Intro_3_6__Viewing_a_spectral_slice.html - + docs/manual/Intro_3_7__Configuring_the_spectral_slice.html - + docs/manual/Intro_3_8__The_Spectrum_object.html - + docs/manual/Intro_3__Spectral_analysis.html - + docs/manual/Intro_4_1__Viewing_a_pitch_contour.html - + docs/manual/Intro_4_2__Configuring_the_pitch_contour.html - + docs/manual/Intro_4_3__Querying_the_pitch_contour.html - + docs/manual/Intro_4_4__Printing_the_pitch_contour.html - + docs/manual/Intro_4_5__The_Pitch_object.html - + docs/manual/Intro_4__Pitch_analysis.html - + docs/manual/Intro_5_1__Viewing_formant_contours.html - + docs/manual/Intro_5_2__Configuring_the_formant_contours.html - + docs/manual/Intro_5_3__Querying_the_formant_contours.html - + docs/manual/Intro_5_4__The_Formant_object.html - + docs/manual/Intro_5__Formant_analysis.html - + docs/manual/Intro_6_1__Viewing_an_intensity_contour.html - + docs/manual/Intro_6_2__Configuring_the_intensity_contour.html - + docs/manual/Intro_6_3__Querying_the_intensity_contour.html - + docs/manual/Intro_6_4__The_Intensity_object.html - + docs/manual/Intro_6__Intensity_analysis.html - + docs/manual/Intro_7__Annotation.html - + docs/manual/Intro_8_1__Manipulation_of_pitch.html - + docs/manual/Intro_8_2__Manipulation_of_duration.html - + docs/manual/Intro_8_3__Manipulation_of_intensity.html - + docs/manual/Intro_8_4__Manipulation_of_formants.html - + docs/manual/Intro_8__Manipulation.html - + docs/manual/Irino___Patterson__1997_.html - + docs/manual/Ishizaka___Flanagan__1972_.html - + docs/manual/Itakura-Saito_divergence.html - + docs/manual/Itakura___Saito__1968_.html - + docs/manual/Jacquelin__2009_.html - + docs/manual/Janecek_et_al___2011_.html - + docs/manual/Jesteadt__Wier___Green__1977_.html - + docs/manual/Johannesma__1972_.html - + docs/manual/Johnson__1998_.html - + docs/manual/J?ger__2003_.html - + docs/manual/Kaiser__1958_.html - + docs/manual/Keating___Esposito__2006_.html - + docs/manual/Keyboard_shortcuts.html - + docs/manual/Khuri__1998_.html - + docs/manual/Kiers___Groenen__1996_.html - + docs/manual/Kim___Kim__2006_.html - + docs/manual/Kirshenbaum_phonetic_encoding.html - + docs/manual/KlattGrid.html - + docs/manual/KlattGrid_1.png - + docs/manual/KlattGrid_2.png - + docs/manual/KlattGrid__Extract_oral_formant_grid__open_phases____.html - + docs/manual/KlattGrid__Play_special___.html - + docs/manual/KlattGrid__To_Sound__phonation____.html - + docs/manual/KlattGrid__To_Sound__special____.html - + docs/manual/KlattTable.html - + docs/manual/Klatt___Klatt__1990_.html - + docs/manual/Klein__Plomp___Pols__1970_.html - + docs/manual/Kostlan___Gokhman__1987_.html - + docs/manual/Krishnamoorthy___Yu__2004_.html - + docs/manual/Kruskal__1964_.html - + docs/manual/Kruskal_analysis.html - + docs/manual/LAPACK.html - + docs/manual/LFCC.html - + docs/manual/LFCC__To_LPC___.html - + docs/manual/LPC.html - + docs/manual/LPC__Draw_gain___.html - + docs/manual/LPC__Draw_poles___.html - + docs/manual/LPC__To_Formant.html - + docs/manual/LPC__To_LFCC___.html - + docs/manual/LPC__To_Matrix.html - + docs/manual/LPC__To_Polynomial__slice____.html - + docs/manual/LPC__To_Spectrogram___.html - + docs/manual/LPC__To_Spectrum__slice____.html - + docs/manual/LPC__To_VocalTract__slice____.html - + docs/manual/LPC___Sound__Filter___.html - + docs/manual/LPC___Sound__Filter__inverse_.html - + docs/manual/LPC___Sound__Filter__inverse__with_filter_at_time___.html - + docs/manual/LPC___Sound__Filter_with_filter_at_time___.html - + docs/manual/Labelling.html - + docs/manual/Ladefoged__2001_.html - + docs/manual/Ladefoged___Maddieson__1996_.html - + docs/manual/Lamel__Kassel___Seneff__1986_.html - + docs/manual/Lee__1988_.html - + docs/manual/Lee___Seung__2001_.html - + docs/manual/LegendreSeries.html - + docs/manual/LegendreSeries__To_Polynomial.html - + docs/manual/Legendre_polynomials.html - + docs/manual/License.html - + docs/manual/Lime.html - + docs/manual/List_of_Objects.html - + docs/manual/Log_files.html - + docs/manual/Logarithmic_marks_left_right_top_bottom___.html - + docs/manual/Logistic_regression.html - + docs/manual/LongSound.html - + docs/manual/LongSoundEditor.html - + docs/manual/LongSound__To_TextGrid___.html - + docs/manual/LongSound__View.html - + docs/manual/Ltas.html - + docs/manual/Ltas__Average.html - + docs/manual/Ltas__Get_bin_number_from_frequency___.html - + docs/manual/Ltas__Get_bin_width.html - + docs/manual/Ltas__Get_frequency_from_bin_number___.html - + docs/manual/Ltas__Get_frequency_of_maximum___.html - + docs/manual/Ltas__Get_frequency_of_minimum___.html - + docs/manual/Ltas__Get_highest_frequency.html - + docs/manual/Ltas__Get_lowest_frequency.html - + docs/manual/Ltas__Get_maximum___.html - + docs/manual/Ltas__Get_mean___.html - + docs/manual/Ltas__Get_minimum___.html - + docs/manual/Ltas__Get_number_of_bins.html - + docs/manual/Ltas__Get_standard_deviation___.html - + docs/manual/Ltas__Get_value_at_frequency___.html - + docs/manual/Ltas__Get_value_in_bin___.html - + docs/manual/MDS_models.html - + docs/manual/MDS_models_1.png - + docs/manual/MFCC.html - + docs/manual/MFCC__To_MelFilter___.html - + docs/manual/MFCC__To_MelSpectrogram___.html - + docs/manual/MFCC__To_TableOfReal___.html - + docs/manual/MSpline.html - + docs/manual/Ma___Nishihara__2013_.html - + docs/manual/Magenta.html - + docs/manual/Magron___Virtanen__2018_.html - + docs/manual/Mahalanobis_distance.html - + docs/manual/ManPages.html - + docs/manual/ManPages_1.png - + docs/manual/Manipulation.html - + docs/manual/ManipulationEditor.html - + docs/manual/Manipulation__Extract_duration_tier.html - + docs/manual/Manipulation__Extract_original_sound.html - + docs/manual/Manipulation__Extract_pitch_tier.html - + docs/manual/Manipulation__Extract_pulses.html - + docs/manual/Manipulation__Get_resynthesis__overlap-add_.html - + docs/manual/Manipulation__Play__overlap-add_.html - + docs/manual/Manipulation__Replace_duration_tier.html - + docs/manual/Manipulation__Replace_original_sound.html - + docs/manual/Manipulation__Replace_pitch_tier.html - + docs/manual/Manipulation__Replace_pulses.html - + docs/manual/Manual.html - + docs/manual/Margins.html - + docs/manual/Markel___Gray__1976_.html - + docs/manual/Marks_bottom_every___.html - + docs/manual/Marks_left_right_top_bottom___.html - + docs/manual/Marks_left_right_top_bottom_every___.html - + docs/manual/Maroon.html - + docs/manual/Marple__1980_.html - + docs/manual/Marsaglia___Tsang__2000_.html - + docs/manual/Matrix.html - + docs/manual/Matrix__Draw_as_squares___.html - + docs/manual/Matrix__Draw_distribution___.html - + docs/manual/Matrix__Formula___.html - + docs/manual/Matrix__Paint_cells___.html - + docs/manual/Matrix__Set_value___.html - + docs/manual/Matrix__Solve_equation___.html - + docs/manual/Matrix__To_NMF__ALS____.html - + docs/manual/Matrix__To_NMF__IS____.html - + docs/manual/Matrix__To_NMF__m_u_____.html - + docs/manual/Matrix__To_TableOfReal.html - + docs/manual/McCarthy___Prince__1995_.html - + docs/manual/Measurement_levels.html - + docs/manual/MelFilter.html - + docs/manual/MelSpectrogram.html - + docs/manual/MelSpectrogram__Paint_image___.html - + docs/manual/MelSpectrogram__To_MFCC___.html - + docs/manual/MixingMatrix.html - + docs/manual/MixingMatrix__Multiply_input_channel___.html - + docs/manual/Modify.html - + docs/manual/Morrison__1990_.html - + docs/manual/Moulines___Charpentier__1990_.html - + docs/manual/Multidimensional_scaling.html - + docs/manual/Multidimensional_scaling_1.png - + docs/manual/Multidimensional_scaling_2.png - + docs/manual/Multidimensional_scaling_3.png - + docs/manual/NIST_files.html - + docs/manual/NMF.html - + docs/manual/Nagarajan__Wang__Merzenich__Schreiner__Johnston__Jenkin.html - + docs/manual/NavigationContext.html - + docs/manual/Navy.html - + docs/manual/New_Praat_notebook.html - + docs/manual/New_Praat_script.html - + docs/manual/New_menu.html - + docs/manual/Nocedal___Wright__1999_.html - + docs/manual/NotebookEditor.html - + docs/manual/Nyquist_frequency.html - + docs/manual/OT.html - + docs/manual/OTGrammar.html - + docs/manual/OTGrammarEditor.html - + docs/manual/OTGrammar__Generate_inputs___.html - + docs/manual/OTGrammar__Input_to_output___.html - + docs/manual/OTGrammar__Input_to_outputs___.html - + docs/manual/OTGrammar__Learn_one___.html - + docs/manual/OTGrammar__To_output_Distributions___.html - + docs/manual/OTGrammar___2_Strings__Learn___.html - + docs/manual/OTGrammar___PairDistribution__Find_positive_weights___.html - + docs/manual/OTGrammar___Strings__Inputs_to_outputs___.html - + docs/manual/OT_learning.html - + docs/manual/OT_learning_1__Kinds_of_grammars.html - + docs/manual/OT_learning_2_1__Viewing_a_grammar.html - + docs/manual/OT_learning_2_1__Viewing_a_grammar_1.png - + docs/manual/OT_learning_2_1__Viewing_a_grammar_2.png - + docs/manual/OT_learning_2_2__Inside_the_grammar.html - + docs/manual/OT_learning_2_3__Defining_your_own_grammar.html - + docs/manual/OT_learning_2_4__Evaluation.html - + docs/manual/OT_learning_2_4__Evaluation_1.png - + docs/manual/OT_learning_2_5__Editing_a_grammar.html - + docs/manual/OT_learning_2_5__Editing_a_grammar_1.png - + docs/manual/OT_learning_2_5__Editing_a_grammar_2.png - + docs/manual/OT_learning_2_6__Variable_output.html - + docs/manual/OT_learning_2_6__Variable_output_1.png - + docs/manual/OT_learning_2_6__Variable_output_2.png - + docs/manual/OT_learning_2_6__Variable_output_3.png - + docs/manual/OT_learning_2_6__Variable_output_4.png - + docs/manual/OT_learning_2_6__Variable_output_5.png - + docs/manual/OT_learning_2_6__Variable_output_6.png - + docs/manual/OT_learning_2_7__Tableau_pictures.html - + docs/manual/OT_learning_2_8__Asking_for_one_output.html - + docs/manual/OT_learning_2_9__Output_distributions.html - + docs/manual/OT_learning_2__The_grammar.html - + docs/manual/OT_learning_3_1__Data_from_a_pair_distribution.html - + docs/manual/OT_learning_3_2__Data_from_another_grammar.html - + docs/manual/OT_learning_3_2__Data_from_another_grammar_1.png - + docs/manual/OT_learning_3_2__Data_from_another_grammar_2.png - + docs/manual/OT_learning_3_2__Data_from_another_grammar_3.png - + docs/manual/OT_learning_3_2__Data_from_another_grammar_4.png - + docs/manual/OT_learning_3__Generating_language_data.html - + docs/manual/OT_learning_4__Learning_an_ordinal_grammar.html - + docs/manual/OT_learning_4__Learning_an_ordinal_grammar_1.png - + docs/manual/OT_learning_5__Learning_a_stochastic_grammar.html - + docs/manual/OT_learning_6__Shortcut_to_grammar_learning.html - + docs/manual/OT_learning_7__Learning_from_overt_forms.html - + docs/manual/Objects_window.html - + docs/manual/Ogg_Vorbis_BSD_3-clause_license.html - + docs/manual/Olive.html - + docs/manual/One_logarithmic_mark_left_right_top_bottom___.html - + docs/manual/One_mark_left_right_top_bottom___.html - + docs/manual/Open_Praat_notebook___.html - + docs/manual/Open_Praat_script___.html - + docs/manual/Open_long_sound_file___.html - + docs/manual/Open_menu.html - + docs/manual/Optimality_Theory.html - + docs/manual/Opus_BSD_3-clause_license.html - + docs/manual/PCA.html - + docs/manual/PCA__Get_eigenvalue___.html - + docs/manual/PCA__Get_eigenvector_element___.html - + docs/manual/PCA__Get_equality_of_eigenvalues___.html - + docs/manual/PCA__Get_fraction_variance_accounted_for___.html - + docs/manual/PCA__Get_number_of_components__VAF____.html - + docs/manual/PCA__To_TableOfReal__reconstruct_1____.html - + docs/manual/PCA___Configuration__To_TableOfReal__reconstruct_.html - + docs/manual/PCA___Covariance__Project.html - + docs/manual/PCA___PCA__Get_angle_between_pc1-pc2_planes.html - + docs/manual/PCA___PCA__To_Procrustes___.html - + docs/manual/PCA___SSCP__Project.html - + docs/manual/PCA___TableOfReal__Get_fraction_variance___.html - + docs/manual/PCA___TableOfReal__To_Configuration___.html - + docs/manual/PCA___TableOfReal__To_TableOfReal__z-scores____.html - + docs/manual/Paint_rectangle___.html - + docs/manual/Paint_rounded_rectangle___.html - + docs/manual/PairDistribution.html - + docs/manual/PairDistribution__To_Stringses___.html - + docs/manual/Palatino.html - + docs/manual/ParamCurve.html - + docs/manual/Paste_history.html - + docs/manual/Pater__2008_.html - + docs/manual/Pater__Potts___Bhatt__2007_.html - + docs/manual/PatternList.html - + docs/manual/PatternList___Categories__To_FFNet___.html - + docs/manual/Patterson___Wightman__1976_.html - + docs/manual/Pen_menu.html - + docs/manual/Periodicity_menu.html - + docs/manual/Permutation.html - + docs/manual/Permutation__Get_index___.html - + docs/manual/Permutation__Get_value___.html - + docs/manual/Permutation__Interleave___.html - + docs/manual/Permutation__Invert.html - + docs/manual/Permutation__Next.html - + docs/manual/Permutation__Permute_part___.html - + docs/manual/Permutation__Permute_randomly___.html - + docs/manual/Permutation__Permute_randomly__blocks____.html - + docs/manual/Permutation__Previous.html - + docs/manual/Permutation__Reverse___.html - + docs/manual/Permutation__Rotate___.html - + docs/manual/Permutation__Sort.html - + docs/manual/Permutation__Swap_blocks___.html - + docs/manual/Permutation__Swap_numbers___.html - + docs/manual/Permutation__Swap_one_from_range___.html - + docs/manual/Permutation__Swap_positions___.html - + docs/manual/Permutation__Table_jump___.html - + docs/manual/Permutations__Multiply.html - + docs/manual/Peterson___Barney__1952_.html - + docs/manual/Phonetic_symbols.html - + docs/manual/Phonetic_symbols__consonants.html - + docs/manual/Phonetic_symbols__consonants_1.png - + docs/manual/Phonetic_symbols__diacritics.html - + docs/manual/Phonetic_symbols__vowels.html - + docs/manual/Phonetic_symbols__vowels_1.png - + docs/manual/Photo.html - + docs/manual/Picture_window.html - + docs/manual/Pink.html - + docs/manual/Pitch.html - + docs/manual/PitchEditor.html - + docs/manual/PitchTier.html - + docs/manual/PitchTierEditor.html - + docs/manual/PitchTier__Add_point___.html - + docs/manual/PitchTier__Down_to_PointProcess.html - + docs/manual/PitchTier__Get_mean__curve____.html - + docs/manual/PitchTier__Get_mean__points____.html - + docs/manual/PitchTier__Get_standard_deviation__curve____.html - + docs/manual/PitchTier__Get_standard_deviation__points____.html - + docs/manual/PitchTier__Modify_interval___.html - + docs/manual/PitchTier__Modify_interval____1.png - + docs/manual/PitchTier__Modify_interval__tone_levels____.html - + docs/manual/PitchTier__Modify_interval__tone_levels_____1.png - + docs/manual/PitchTier__Stylize___.html - + docs/manual/PitchTier__To_Pitch___.html - + docs/manual/PitchTier__To_PointProcess.html - + docs/manual/Pitch__Draw___.html - + docs/manual/Pitch__Interpolate.html - + docs/manual/Pitch__Smooth___.html - + docs/manual/Pitch__To_PitchTier.html - + docs/manual/Pitch__To_PointProcess.html - + docs/manual/Pitch___PointProcess__To_PitchTier___.html - + docs/manual/Pitch_menu.html - + docs/manual/Pitch_settings___.html - + docs/manual/Play.html - + docs/manual/Plomp__1967_.html - + docs/manual/PointEditor.html - + docs/manual/PointProcess.html - + docs/manual/PointProcess__Add_point___.html - + docs/manual/PointProcess__Add_points___.html - + docs/manual/PointProcess__Draw___.html - + docs/manual/PointProcess__Get_high_index___.html - + docs/manual/PointProcess__Get_interval___.html - + docs/manual/PointProcess__Get_jitter__ddp____.html - + docs/manual/PointProcess__Get_jitter__ddp_____1.png - + docs/manual/PointProcess__Get_jitter__local____.html - + docs/manual/PointProcess__Get_jitter__local_____1.png - + docs/manual/PointProcess__Get_jitter__local__absolute____.html - + docs/manual/PointProcess__Get_jitter__local__absolute_____1.png - + docs/manual/PointProcess__Get_jitter__ppq5____.html - + docs/manual/PointProcess__Get_jitter__ppq5_____1.png - + docs/manual/PointProcess__Get_jitter__rap____.html - + docs/manual/PointProcess__Get_jitter__rap_____1.png - + docs/manual/PointProcess__Get_low_index___.html - + docs/manual/PointProcess__Get_nearest_index___.html - + docs/manual/PointProcess__Hum.html - + docs/manual/PointProcess__Play.html - + docs/manual/PointProcess__Remove_point___.html - + docs/manual/PointProcess__Remove_point_near___.html - + docs/manual/PointProcess__Remove_points___.html - + docs/manual/PointProcess__Remove_points_between___.html - + docs/manual/PointProcess__To_PitchTier___.html - + docs/manual/PointProcess__To_Sound__hum____.html - + docs/manual/PointProcess__To_Sound__phonation____.html - + docs/manual/PointProcess__To_Sound__phonation_____1.png - + docs/manual/PointProcess__To_Sound__phonation_____2.png - + docs/manual/PointProcess__To_Sound__phonation_____3.png - + docs/manual/PointProcess__To_Sound__phonation_____4.png - + docs/manual/PointProcess__To_Sound__phonation_____5.png - + docs/manual/PointProcess__To_Sound__phonation_____6.png - + docs/manual/PointProcess__To_Sound__phonation_____7.png - + docs/manual/PointProcess__To_Sound__phonation_____8.png - + docs/manual/PointProcess__To_Sound__pulse_train____.html - + docs/manual/PointProcess__To_TextGrid___.html - + docs/manual/PointProcess__To_TextGrid__vuv____.html - + docs/manual/PointProcess__Up_to_IntensityTier___.html - + docs/manual/PointProcess__Up_to_PitchTier___.html - + docs/manual/PointProcess__Up_to_TextGrid___.html - + docs/manual/PointProcesses__Difference.html - + docs/manual/PointProcesses__Intersection.html - + docs/manual/PointProcesses__Union.html - + docs/manual/Pols_et_al___1973_.html - + docs/manual/Polygon.html - + docs/manual/Polygon__Get_location_of_point___.html - + docs/manual/Polygon__Rotate___.html - + docs/manual/Polygon__Simplify.html - + docs/manual/Polygon__Simplify_1.png - + docs/manual/Polygon__Translate___.html - + docs/manual/Polynomial.html - + docs/manual/Polynomial__Get_area___.html - + docs/manual/Polynomial__Get_function_value___.html - + docs/manual/Polynomial__Get_maximum___.html - + docs/manual/Polynomial__Get_minimum___.html - + docs/manual/Polynomial__Get_x_of_maximum___.html - + docs/manual/Polynomial__Get_x_of_minimum___.html - + docs/manual/Polynomial__Scale_x___.html - + docs/manual/Polynomial__To_Polynomial__derivative_.html - + docs/manual/Polynomial__To_Polynomial__primitive_.html - + docs/manual/Polynomial__To_Roots.html - + docs/manual/Polynomial__To_Spectrum___.html - + docs/manual/Polynomials__Multiply.html - + docs/manual/PostScript_settings___.html - + docs/manual/PowerCepstrogram.html - + docs/manual/PowerCepstrogram__Get_CPPS___.html - + docs/manual/PowerCepstrogram__Paint___.html - + docs/manual/PowerCepstrogram__Paint____1.png - + docs/manual/PowerCepstrogram__Smooth___.html - + docs/manual/PowerCepstrogram__To_Table__cepstral_peak_prominences__.html - + docs/manual/PowerCepstrogram__To_Table__cepstral_peak_prominences___1.png - + docs/manual/PowerCepstrum.html - + docs/manual/PowerCepstrum__Draw___.html - + docs/manual/PowerCepstrum__Draw_trend_line___.html - + docs/manual/PowerCepstrum__Draw_trend_line____1.png - + docs/manual/PowerCepstrum__Get_peak___.html - + docs/manual/PowerCepstrum__Get_peak_prominence___.html - + docs/manual/PowerCepstrum__Get_peak_prominence____1.png - + docs/manual/PowerCepstrum__Get_peak_prominence____2.png - + docs/manual/PowerCepstrum__Get_peak_prominence____3.png - + docs/manual/PowerCepstrum__Get_quefrency_of_peak___.html - + docs/manual/PowerCepstrum__Get_trend_line_intercept___.html - + docs/manual/PowerCepstrum__Get_trend_line_slope___.html - + docs/manual/PowerCepstrum__Smooth___.html - + docs/manual/PowerCepstrum__Smooth____1.png - + docs/manual/PowerCepstrum__Smooth____2.png - + docs/manual/PowerCepstrum__Smooth____3.png - + docs/manual/PowerCepstrum__Subtract_trend___.html - + docs/manual/Praat_menu.html - + docs/manual/Praat_notebook.html - + docs/manual/Praat_script.html - + docs/manual/Press_et_al___1992_.html - + docs/manual/Prince___Smolensky__1993_.html - + docs/manual/Principal_component_analysis.html - + docs/manual/Print___.html - + docs/manual/Printing.html - + docs/manual/Privacy_and_security.html - + docs/manual/Procrustes.html - + docs/manual/Procrustes_transform.html - + docs/manual/Programming_with_Praat.html - + docs/manual/Proximity.html - + docs/manual/Purple.html - + docs/manual/Query_submenu.html - + docs/manual/Quit.html - + docs/manual/Rabiner__1989_.html - + docs/manual/Ramsay__1988_.html - + docs/manual/Read_Matrix_from_raw_text_file___.html - + docs/manual/Read_Strings_from_raw_text_file___.html - + docs/manual/Read_TableOfReal_from_headerless_spreadsheet_file___.html - + docs/manual/Read_Table_from_comma-separated_file___.html - + docs/manual/Read_Table_from_semicolon-separated_file___.html - + docs/manual/Read_Table_from_tab-separated_file___.html - + docs/manual/Read_Table_from_whitespace-separated_file___.html - + docs/manual/Read_from_Praat_picture_file___.html - + docs/manual/Read_from_file___.html - + docs/manual/Read_separate_channels_from_sound_file___.html - + docs/manual/RealTier.html - + docs/manual/Record_Sound__fixed_time____.html - + docs/manual/Record_mono_Sound___.html - + docs/manual/Record_stereo_Sound___.html - + docs/manual/Red.html - + docs/manual/Regular_expressions.html - + docs/manual/Regular_expressions_1__Special_characters.html - + docs/manual/Regular_expressions_2__Quantifiers.html - + docs/manual/Regular_expressions_3__Anchors.html - + docs/manual/Regular_expressions_4__Special_constructs_with_parenthe.html - + docs/manual/Regular_expressions_5__Special_control_characters.html - + docs/manual/Regular_expressions_6__Convenience_escape_sequences.html - + docs/manual/Regular_expressions_7__Octal_and_hexadecimal_escapes.html - + docs/manual/Regular_expressions_8__Substitution_special_characters.html - + docs/manual/Remove.html - + docs/manual/Remove_point___.html - + docs/manual/Remove_point_near___.html - + docs/manual/Remove_points_between___.html - + docs/manual/Rename___.html - + docs/manual/Reporting_a_problem.html - + docs/manual/Robust_Interpretive_Parsing.html - + docs/manual/Roots.html - + docs/manual/Rosenberg__1971_.html - + docs/manual/Rosenblatt__1962_.html - + docs/manual/Rothweiler__1999_.html - + docs/manual/Rumelhart___McClelland__1986_.html - + docs/manual/SSCP.html - + docs/manual/SSCP__Draw_sigma_ellipse___.html - + docs/manual/SSCP__Get_confidence_ellipse_area___.html - + docs/manual/SSCP__Get_diagonality__bartlett____.html - + docs/manual/SSCP__Get_fraction_variation___.html - + docs/manual/SSCP__Get_sigma_ellipse_area___.html - + docs/manual/SSCP__To_CCA___.html - + docs/manual/SSCP__To_CCA____1.png - + docs/manual/SSCP__To_Covariance___.html - + docs/manual/SSCP___TableOfReal__Extract_quantile_range___.html - + docs/manual/SVD.html - + docs/manual/SVD__Get_minimum_number_of_singular_values___.html - + docs/manual/Sakoe___Chiba__1978_.html - + docs/manual/Salience.html - + docs/manual/Sandwell__1987_.html - + docs/manual/Save_as_AIFC_file___.html - + docs/manual/Save_as_AIFF_file___.html - + docs/manual/Save_as_EPS_file___.html - + docs/manual/Save_as_FLAC_file___.html - + docs/manual/Save_as_NIST_file___.html - + docs/manual/Save_as_NeXT_Sun_file___.html - + docs/manual/Save_as_PDF_file___.html - + docs/manual/Save_as_PNG_file___.html - + docs/manual/Save_as_Praat_picture_file___.html - + docs/manual/Save_as_WAV_file___.html - + docs/manual/Save_as_Windows_metafile___.html - + docs/manual/Save_as_binary_file___.html - + docs/manual/Save_as_short_text_file___.html - + docs/manual/Save_as_text_file___.html - + docs/manual/Save_menu.html - + docs/manual/ScalarProduct.html - + docs/manual/Schott__2001_.html - + docs/manual/Scree_plot.html - + docs/manual/ScriptEditor.html - + docs/manual/Script_for_TextGrid_boundary_drawing.html - + docs/manual/Script_for_analysing_pitch_with_a_TextGrid.html - + docs/manual/Script_for_creating_a_frequency_sweep.html - + docs/manual/Script_for_listing_F0_statistics.html - + docs/manual/Script_for_listing_time_F0_intensity.html - + docs/manual/Script_for_listing_time_F0_pairs.html - + docs/manual/Script_for_onset_detection.html - + docs/manual/Scripting.html - + docs/manual/Scripting_10__Old_functions.html - + docs/manual/Scripting_1__Your_first_scripts.html - + docs/manual/Scripting_1__Your_first_scripts_1.png - + docs/manual/Scripting_1__Your_first_scripts_2.png - + docs/manual/Scripting_2__How_to_script_settings_windows.html - + docs/manual/Scripting_2__How_to_script_settings_windows_1.png - + docs/manual/Scripting_2__How_to_script_settings_windows_2.png - + docs/manual/Scripting_2__How_to_script_settings_windows_3.png - + docs/manual/Scripting_2__How_to_script_settings_windows_4.png - + docs/manual/Scripting_2__How_to_script_settings_windows_5.png - + docs/manual/Scripting_2__How_to_script_settings_windows_6.png - + docs/manual/Scripting_2__How_to_script_settings_windows_7.png - + docs/manual/Scripting_2__How_to_script_settings_windows_8.png - + docs/manual/Scripting_2__How_to_script_settings_windows_9.png - + docs/manual/Scripting_3_1__Hello_world.html - + docs/manual/Scripting_3_1__Hello_world_1.png - + docs/manual/Scripting_3_1__Hello_world_2.png - + docs/manual/Scripting_3_1__Hello_world_3.png - + docs/manual/Scripting_3_1__Hello_world_4.png - + docs/manual/Scripting_3_2__Numeric_variables.html - + docs/manual/Scripting_3_3__Numeric_queries.html - + docs/manual/Scripting_3_3__Numeric_queries_1.png - + docs/manual/Scripting_3_3__Numeric_queries_2.png - + docs/manual/Scripting_3_3__Numeric_queries_3.png - + docs/manual/Scripting_3_4__String_variables.html - + docs/manual/Scripting_3_5__String_queries.html - + docs/manual/Scripting_3_5__String_queries_1.png - + docs/manual/Scripting_3_5__String_queries_2.png - + docs/manual/Scripting_3_5__String_queries_3.png - + docs/manual/Scripting_3_5__String_queries_4.png - + docs/manual/Scripting_3_5__String_queries_5.png - + docs/manual/Scripting_3_6___For__loops.html - + docs/manual/Scripting_3_6___For__loops_1.png - + docs/manual/Scripting_3_6___For__loops_2.png - + docs/manual/Scripting_3_7__Layout.html - + docs/manual/Scripting_3__Simple_language_elements.html - + docs/manual/Scripting_4_1__Selecting_objects.html - + docs/manual/Scripting_4_2__Removing_objects.html - + docs/manual/Scripting_4_3__Querying_objects.html - + docs/manual/Scripting_4__Object_selection.html - + docs/manual/Scripting_5_1__Variables.html - + docs/manual/Scripting_5_1__Variables_1.png - + docs/manual/Scripting_5_1__Variables_2.png - + docs/manual/Scripting_5_2__Expressions.html - + docs/manual/Scripting_5_3__Jumps.html - + docs/manual/Scripting_5_4__Loops.html - + docs/manual/Scripting_5_5__Procedures.html - + docs/manual/Scripting_5_6__Arrays_and_dictionaries.html - + docs/manual/Scripting_5_7__Vectors_and_matrices.html - + docs/manual/Scripting_5_8__Including_other_scripts.html - + docs/manual/Scripting_5_9__Quitting.html - + docs/manual/Scripting_5__Language_elements_reference.html - + docs/manual/Scripting_6_1__Arguments_to_the_script.html - + docs/manual/Scripting_6_2__Writing_to_the_Info_window.html - + docs/manual/Scripting_6_3__Query_commands.html - + docs/manual/Scripting_6_4__Files.html - + docs/manual/Scripting_6_5__Calling_system_commands.html - + docs/manual/Scripting_6_6__Controlling_the_user.html - + docs/manual/Scripting_6_7__Sending_a_message_to_another_program.html - + docs/manual/Scripting_6_8__Messages_to_the_user.html - + docs/manual/Scripting_6_9__Calling_from_the_command_line.html - + docs/manual/Scripting_6__Communication_outside_the_script.html - + docs/manual/Scripting_7_1__Scripting_an_editor_from_a_shell_script.html - + docs/manual/Scripting_7_2__Scripting_an_editor_from_within.html - + docs/manual/Scripting_7__Scripting_the_editors.html - + docs/manual/Scripting_8_1__The_sendpraat_subroutine.html - + docs/manual/Scripting_8_2__The_sendpraat_program.html - + docs/manual/Scripting_8__Controlling_Praat_from_another_program.html - + docs/manual/Scripting_9__Turning_a_script_into_a_stand-alone_progra.html - + docs/manual/Scripting_examples.html - + docs/manual/Segmentation.html - + docs/manual/Sekey___Hanson__1984_.html - + docs/manual/Select_inner_viewport___.html - + docs/manual/Select_outer_viewport___.html - + docs/manual/Sesam_LVS_files.html - + docs/manual/Shepard__1964_.html - + docs/manual/Shift-click.html - + docs/manual/Shift-drag.html - + docs/manual/Show_formant.html - + docs/manual/Show_intensity.html - + docs/manual/Show_pitch.html - + docs/manual/Show_pulses.html - + docs/manual/Show_spectrogram.html - + docs/manual/Silver.html - + docs/manual/Similarity.html - + docs/manual/Similarity__To_Dissimilarity___.html - + docs/manual/Skype_Limited_BSD_3-clause_license.html - + docs/manual/Slaney__1993_.html - + docs/manual/Smolensky__1986_.html - + docs/manual/Smolensky___Legendre__2006_.html - + docs/manual/Soderstrom__Mathis___Smolensky__2006_.html - + docs/manual/Sound.html - + docs/manual/SoundEditor.html - + docs/manual/SoundRecorder.html - + docs/manual/Sound__Autocorrelate___.html - + docs/manual/Sound__Autocorrelate____1.png - + docs/manual/Sound__Autocorrelate____2.png - + docs/manual/Sound__Change_gender___.html - + docs/manual/Sound__Change_speaker___.html - + docs/manual/Sound__De-emphasize__in-place____.html - + docs/manual/Sound__Deepen_band_modulation___.html - + docs/manual/Sound__Deepen_band_modulation____1.png - + docs/manual/Sound__Deepen_band_modulation____2.png - + docs/manual/Sound__Draw___.html - + docs/manual/Sound__Draw_where___.html - + docs/manual/Sound__Draw_where____1.png - + docs/manual/Sound__Draw_where____2.png - + docs/manual/Sound__Extract_Electroglottogram___.html - + docs/manual/Sound__Extract_part___.html - + docs/manual/Sound__Extract_part____1.png - + docs/manual/Sound__Extract_part____10.png - + docs/manual/Sound__Extract_part____11.png - + docs/manual/Sound__Extract_part____12.png - + docs/manual/Sound__Extract_part____13.png - + docs/manual/Sound__Extract_part____2.png - + docs/manual/Sound__Extract_part____3.png - + docs/manual/Sound__Extract_part____4.png - + docs/manual/Sound__Extract_part____5.png - + docs/manual/Sound__Extract_part____6.png - + docs/manual/Sound__Extract_part____7.png - + docs/manual/Sound__Extract_part____8.png - + docs/manual/Sound__Extract_part____9.png - + docs/manual/Sound__Fade_in___.html - + docs/manual/Sound__Fade_out___.html - + docs/manual/Sound__Filter__de-emphasis____.html - + docs/manual/Sound__Filter__formula____.html - + docs/manual/Sound__Filter__gammatone____.html - + docs/manual/Sound__Filter__one_formant____.html - + docs/manual/Sound__Filter__pass_Hann_band____.html - + docs/manual/Sound__Filter__pre-emphasis____.html - + docs/manual/Sound__Filter__stop_Hann_band____.html - + docs/manual/Sound__Filter_with_one_formant__in-place____.html - + docs/manual/Sound__Formula___.html - + docs/manual/Sound__Get_absolute_extremum___.html - + docs/manual/Sound__Get_energy___.html - + docs/manual/Sound__Get_energy_in_air.html - + docs/manual/Sound__Get_intensity__dB_.html - + docs/manual/Sound__Get_maximum___.html - + docs/manual/Sound__Get_mean___.html - + docs/manual/Sound__Get_minimum___.html - + docs/manual/Sound__Get_nearest_zero_crossing___.html - + docs/manual/Sound__Get_power___.html - + docs/manual/Sound__Get_power_in_air.html - + docs/manual/Sound__Get_root-mean-square___.html - + docs/manual/Sound__Get_standard_deviation___.html - + docs/manual/Sound__Get_time_of_maximum___.html - + docs/manual/Sound__Get_time_of_minimum___.html - + docs/manual/Sound__Get_value_at_sample_number___.html - + docs/manual/Sound__Get_value_at_time___.html - + docs/manual/Sound__LPC_analysis.html - + docs/manual/Sound__Lengthen__overlap-add____.html - + docs/manual/Sound__Multiply_by_window___.html - + docs/manual/Sound__Multiply_by_window____1.png - + docs/manual/Sound__Multiply_by_window____10.png - + docs/manual/Sound__Multiply_by_window____11.png - + docs/manual/Sound__Multiply_by_window____12.png - + docs/manual/Sound__Multiply_by_window____13.png - + docs/manual/Sound__Multiply_by_window____14.png - + docs/manual/Sound__Multiply_by_window____15.png - + docs/manual/Sound__Multiply_by_window____2.png - + docs/manual/Sound__Multiply_by_window____3.png - + docs/manual/Sound__Multiply_by_window____4.png - + docs/manual/Sound__Multiply_by_window____5.png - + docs/manual/Sound__Multiply_by_window____6.png - + docs/manual/Sound__Multiply_by_window____7.png - + docs/manual/Sound__Multiply_by_window____8.png - + docs/manual/Sound__Multiply_by_window____9.png - + docs/manual/Sound__Paint_where___.html - + docs/manual/Sound__Paint_where____1.png - + docs/manual/Sound__Paint_where____2.png - + docs/manual/Sound__Paint_where____3.png - + docs/manual/Sound__Paint_where____4.png - + docs/manual/Sound__Play.html - + docs/manual/Sound__Play_as_frequency_shifted___.html - + docs/manual/Sound__Pre-emphasize__in-place____.html - + docs/manual/Sound__Remove_noise___.html - + docs/manual/Sound__Remove_noise____1.png - + docs/manual/Sound__Resample___.html - + docs/manual/Sound__Scale_intensity___.html - + docs/manual/Sound__Scale_peak___.html - + docs/manual/Sound__Scale_peak____1.png - + docs/manual/Sound__Scale_peak____2.png - + docs/manual/Sound__Scale_peak____3.png - + docs/manual/Sound__Scale_peak____4.png - + docs/manual/Sound__Set_value_at_sample_number___.html - + docs/manual/Sound__To_BarkSpectrogram___.html - + docs/manual/Sound__To_ConstantQLogFSpectrogram___.html - + docs/manual/Sound__To_Covariance__channels____.html - + docs/manual/Sound__To_CrossCorrelationTable___.html - + docs/manual/Sound__To_CrossCorrelationTable____1.png - + docs/manual/Sound__To_FormantFilter___.html - + docs/manual/Sound__To_FormantPath__burg____.html - + docs/manual/Sound__To_Formant__burg____.html - + docs/manual/Sound__To_Formant__keep_all____.html - + docs/manual/Sound__To_Formant__robust____.html - + docs/manual/Sound__To_Formant__sl____.html - + docs/manual/Sound__To_Harmonicity__ac____.html - + docs/manual/Sound__To_Harmonicity__cc____.html - + docs/manual/Sound__To_Intensity___.html - + docs/manual/Sound__To_KlattGrid__simple____.html - + docs/manual/Sound__To_LPC__autocorrelation____.html - + docs/manual/Sound__To_LPC__burg____.html - + docs/manual/Sound__To_LPC__covariance____.html - + docs/manual/Sound__To_LPC__marple____.html - + docs/manual/Sound__To_Ltas__pitch-corrected____.html - + docs/manual/Sound__To_MFCC___.html - + docs/manual/Sound__To_MelFilter___.html - + docs/manual/Sound__To_MelSpectrogram___.html - + docs/manual/Sound__To_Pitch___.html - + docs/manual/Sound__To_Pitch__ac____.html - + docs/manual/Sound__To_Pitch__cc____.html - + docs/manual/Sound__To_Pitch__filtered_ac____.html - + docs/manual/Sound__To_Pitch__filtered_autocorrelation____.html - + docs/manual/Sound__To_Pitch__filtered_cc____.html - + docs/manual/Sound__To_Pitch__filtered_cross-correlation____.html - + docs/manual/Sound__To_Pitch__raw_ac____.html - + docs/manual/Sound__To_Pitch__raw_autocorrelation____.html - + docs/manual/Sound__To_Pitch__raw_cc____.html - + docs/manual/Sound__To_Pitch__raw_cross-correlation____.html - + docs/manual/Sound__To_Pitch__shs____.html - + docs/manual/Sound__To_PointProcess__periodic__cc____.html - + docs/manual/Sound__To_PointProcess__periodic__peaks____.html - + docs/manual/Sound__To_Polygon___.html - + docs/manual/Sound__To_Polygon____1.png - + docs/manual/Sound__To_PowerCepstrogram___.html - + docs/manual/Sound__To_Sound__blind_source_separation____.html - + docs/manual/Sound__To_Sound__blind_source_separation_____1.png - + docs/manual/Sound__To_Sound__blind_source_separation_____2.png - + docs/manual/Sound__To_Sound__derivative____.html - + docs/manual/Sound__To_Sound__whiten_channels____.html - + docs/manual/Sound__To_Spectrogram___.html - + docs/manual/Sound__To_Spectrogram__pitch-dependent____.html - + docs/manual/Sound__To_Spectrum___.html - + docs/manual/Sound__To_Spectrum__resampled____.html - + docs/manual/Sound__To_Spectrum__resampled_____1.png - + docs/manual/Sound__To_TextGrid___.html - + docs/manual/Sound__To_TextGrid__silences____.html - + docs/manual/Sound__To_TextGrid__speech_activity____.html - + docs/manual/Sound__Trim_silences___.html - + docs/manual/Sound___FormantGrid__Filter.html - + docs/manual/Sound___FormantGrid__Filter__no_scale_.html - + docs/manual/Sound___Formant__Filter.html - + docs/manual/Sound___Formant__Filter__no_scale_.html - + docs/manual/Sound___IntensityTier__Multiply.html - + docs/manual/Sound___KlattGrid__Filter_by_vocal_tract___.html - + docs/manual/Sound___Pitch__Change_gender___.html - + docs/manual/Sound___Pitch__Change_speaker___.html - + docs/manual/Sound___Pitch__To_PointProcess__cc_.html - + docs/manual/Sound___Pitch__To_PointProcess__peaks____.html - + docs/manual/Sound___Pitch__To_Spectrogram___.html - + docs/manual/Sound_files.html - + docs/manual/Sound_files_1_1__Sampling.html - + docs/manual/Sound_files_1_2__Quantization.html - + docs/manual/Sound_files_1_3__Channels.html - + docs/manual/Sound_files_1_4__The_header.html - + docs/manual/Sound_files_1_5__Size.html - + docs/manual/Sound_files_1_6__Compression.html - + docs/manual/Sound_files_1__General_structure.html - + docs/manual/Sound_files_2_1__WAV_files.html - + docs/manual/Sound_files_2_2__AIFF_files.html - + docs/manual/Sound_files_2_3__AIFC_files.html - + docs/manual/Sound_files_2_4__NeXT_Sun___au__files.html - + docs/manual/Sound_files_2_5__NIST_files.html - + docs/manual/Sound_files_2_6__FLAC_files.html - + docs/manual/Sound_files_2_7__MP3_files.html - + docs/manual/Sound_files_2_8__Ogg_Vorbis_files.html - + docs/manual/Sound_files_2_9__Ogg_Opus_files.html - + docs/manual/Sound_files_2__File_types.html - + docs/manual/Sound_files_3__Files_that_Praat_can_read.html - + docs/manual/Sound_files_4__Files_that_Praat_can_write.html - + docs/manual/Sounds__Combine_to_stereo.html - + docs/manual/Sounds__Concatenate.html - + docs/manual/Sounds__Concatenate_with_overlap___.html - + docs/manual/Sounds__Concatenate_with_overlap____1.png - + docs/manual/Sounds__Concatenate_with_overlap____2.png - + docs/manual/Sounds__Concatenate_with_overlap____3.png - + docs/manual/Sounds__Concatenate_with_overlap____4.png - + docs/manual/Sounds__Concatenate_with_overlap____5.png - + docs/manual/Sounds__Convolve___.html - + docs/manual/Sounds__Convolve____1.png - + docs/manual/Sounds__Convolve____2.png - + docs/manual/Sounds__Convolve____3.png - + docs/manual/Sounds__Convolve____4.png - + docs/manual/Sounds__Convolve____5.png - + docs/manual/Sounds__Cross-correlate___.html - + docs/manual/Sounds__Cross-correlate____1.png - + docs/manual/Sounds__Cross-correlate____2.png - + docs/manual/Sounds__Paint_enclosed___.html - + docs/manual/Sounds__Paint_enclosed____1.png - + docs/manual/Sounds__Paint_enclosed____2.png - + docs/manual/Source-filter_synthesis.html - + docs/manual/Source-filter_synthesis_1__Creating_a_source_from_pitch.html - + docs/manual/Source-filter_synthesis_1__Creating_a_source_from_pitch_1.png - + docs/manual/Source-filter_synthesis_1__Creating_a_source_from_pitch_2.png - + docs/manual/Source-filter_synthesis_1__Creating_a_source_from_pitch_3.png - + docs/manual/Source-filter_synthesis_2__Filtering_a_source.html - + docs/manual/Source-filter_synthesis_3__The_ba-da_continuum.html - + docs/manual/Source-filter_synthesis_4__Using_existing_sounds.html - + docs/manual/Speaker.html - + docs/manual/Special_symbols.html - + docs/manual/Spectra__Multiply.html - + docs/manual/Spectrogram.html - + docs/manual/Spectrogram__Formula___.html - + docs/manual/Spectrogram__Paint___.html - + docs/manual/Spectrogram__To_Spectrum__slice____.html - + docs/manual/Spectrogram_menu.html - + docs/manual/Spectrogram_settings___.html - + docs/manual/Spectrum.html - + docs/manual/SpectrumEditor.html - + docs/manual/Spectrum__Conjugate.html - + docs/manual/Spectrum__Filter__pass_Hann_band____.html - + docs/manual/Spectrum__Filter__pass_Hann_band_____1.png - + docs/manual/Spectrum__Filter__pass_Hann_band_____2.png - + docs/manual/Spectrum__Filter__stop_Hann_band____.html - + docs/manual/Spectrum__Filter__stop_Hann_band_____1.png - + docs/manual/Spectrum__Filter__stop_Hann_band_____2.png - + docs/manual/Spectrum__Formula___.html - + docs/manual/Spectrum__Get_central_moment___.html - + docs/manual/Spectrum__Get_centre_of_gravity___.html - + docs/manual/Spectrum__Get_kurtosis___.html - + docs/manual/Spectrum__Get_skewness___.html - + docs/manual/Spectrum__Get_standard_deviation___.html - + docs/manual/Spectrum__Shift_frequencies___.html - + docs/manual/Spectrum__Tabulate__verbose_.html - + docs/manual/Spectrum__To_Ltas__1-to-1_.html - + docs/manual/Spectrum__To_PowerCepstrum.html - + docs/manual/Spectrum__To_Sound.html - + docs/manual/Spectrum__To_Sound__resampled____.html - + docs/manual/Spectrum__To_Spectrogram.html - + docs/manual/SpeechSynthesizer.html - + docs/manual/SpeechSynthesizer__Play_text___.html - + docs/manual/SpeechSynthesizer__Set_speech_rate_from_speech___.html - + docs/manual/SpeechSynthesizer__Set_text_input_settings___.html - + docs/manual/SpeechSynthesizer__Speech_output_settings___.html - + docs/manual/SpeechSynthesizer__To_Sound___.html - + docs/manual/SpellingChecker.html - + docs/manual/Statistics.html - + docs/manual/Stevens__1951_.html - + docs/manual/Strings.html - + docs/manual/Strings__To_Distributions.html - + docs/manual/Strings__To_Index.html - + docs/manual/Strings__To_Permutation___.html - + docs/manual/Strings___Permutation__Permute_strings.html - + docs/manual/T-test.html - + docs/manual/TIMIT_acoustic-phonetic_speech_corpus.html - + docs/manual/Table.html - + docs/manual/TableOfReal.html - + docs/manual/TableOfReal__Centre_columns.html - + docs/manual/TableOfReal__Centre_rows.html - + docs/manual/TableOfReal__Change_column_labels___.html - + docs/manual/TableOfReal__Change_row_labels___.html - + docs/manual/TableOfReal__Draw_as_scalable_squares___.html - + docs/manual/TableOfReal__Draw_biplot___.html - + docs/manual/TableOfReal__Draw_box_plots___.html - + docs/manual/TableOfReal__Draw_rows_as_histogram___.html - + docs/manual/TableOfReal__Get_table_norm.html - + docs/manual/TableOfReal__Normalize_columns___.html - + docs/manual/TableOfReal__Normalize_rows___.html - + docs/manual/TableOfReal__Normalize_table___.html - + docs/manual/TableOfReal__Report_multivariate_normality__BHEP____.html - + docs/manual/TableOfReal__Select_columns_where_row___.html - + docs/manual/TableOfReal__Set_value___.html - + docs/manual/TableOfReal__Standardize_columns.html - + docs/manual/TableOfReal__To_CCA___.html - + docs/manual/TableOfReal__To_Configuration__lda____.html - + docs/manual/TableOfReal__To_Configuration__pca____.html - + docs/manual/TableOfReal__To_Correlation.html - + docs/manual/TableOfReal__To_Correlation__rank_.html - + docs/manual/TableOfReal__To_Covariance.html - + docs/manual/TableOfReal__To_Discriminant.html - + docs/manual/TableOfReal__To_GaussianMixture___.html - + docs/manual/TableOfReal__To_GaussianMixture__row_labels____.html - + docs/manual/TableOfReal__To_PCA.html - + docs/manual/TableOfReal__To_PatternList_and_Categories___.html - + docs/manual/TableOfReal__To_SSCP___.html - + docs/manual/TableOfReal__To_TableOfReal__means_by_row_labels____.html - + docs/manual/TableOfReal___Permutation__Permute_rows.html - + docs/manual/Table__Bar_plot___.html - + docs/manual/Table__Bar_plot____1.png - + docs/manual/Table__Bar_plot____2.png - + docs/manual/Table__Bar_plot____3.png - + docs/manual/Table__Bar_plot____4.png - + docs/manual/Table__Box_plots___.html - + docs/manual/Table__Box_plots____1.png - + docs/manual/Table__Collapse_rows___.html - + docs/manual/Table__Extract_rows_where___.html - + docs/manual/Table__Extract_rows_where_column__number____.html - + docs/manual/Table__Extract_rows_where_column__text____.html - + docs/manual/Table__Formula___.html - + docs/manual/Table__Formula__column_range____.html - + docs/manual/Table__Get_group_mean___.html - + docs/manual/Table__Get_maximum___.html - + docs/manual/Table__Get_mean___.html - + docs/manual/Table__Get_median_absolute_deviation___.html - + docs/manual/Table__Get_minimum___.html - + docs/manual/Table__Get_quantile___.html - + docs/manual/Table__Get_standard_deviation___.html - + docs/manual/Table__Get_sum___.html - + docs/manual/Table__Horizontal_error_bars_plot___.html - + docs/manual/Table__Line_graph___.html - + docs/manual/Table__Line_graph____1.png - + docs/manual/Table__Line_graph____2.png - + docs/manual/Table__Line_graph____3.png - + docs/manual/Table__Line_graph_where___.html - + docs/manual/Table__Normal_probability_plot___.html - + docs/manual/Table__Quantile-quantile_plot___.html - + docs/manual/Table__Report_group_mean__Student_t____.html - + docs/manual/Table__Report_mean__Student_t____.html - + docs/manual/Table__Report_one-way_Kruskal-Wallis___.html - + docs/manual/Table__Report_one-way_anova___.html - + docs/manual/Table__Report_two-way_anova___.html - + docs/manual/Table__Rows_to_columns___.html - + docs/manual/Table__Save_as_comma-separated_file___.html - + docs/manual/Table__Save_as_semicolon-separated_file___.html - + docs/manual/Table__Save_as_tab-separated_file___.html - + docs/manual/Table__Scatter_plot___.html - + docs/manual/Table__Sort_rows___.html - + docs/manual/Table__Vertical_error_bars_plot___.html - + docs/manual/Table__Vertical_error_bars_plot____1.png - + docs/manual/Takane__Young___de_Leeuw__1976_.html - + docs/manual/Teal.html - + docs/manual/Technical.html - + docs/manual/Ten_Berge__1991_.html - + docs/manual/Ten_Berge__1995_.html - + docs/manual/Ten_Berge__Kiers___Krijnen__1993_.html - + docs/manual/Tenreiro__2009_.html - + docs/manual/Tesar___Smolensky__1998_.html - + docs/manual/TextGrid.html - + docs/manual/TextGridEditor.html - + docs/manual/TextGridNavigator.html - + docs/manual/TextGridNavigator___TextGrid__Add_search_tier___.html - + docs/manual/TextGridNavigator___TextGrid__Replace_search_tiers.html - + docs/manual/TextGrid__Count_labels___.html - + docs/manual/TextGrid__Extend_time___.html - + docs/manual/TextGrid__To_DurationTier___.html - + docs/manual/TextGrid__To_DurationTier____1.png - + docs/manual/TextGrid__To_DurationTier____2.png - + docs/manual/TextGrid__To_TextGridNavigator___.html - + docs/manual/TextGrid___DurationTier__To_TextGrid__scale_times_.html - + docs/manual/TextGrid_file_formats.html - + docs/manual/TextGrid_file_formats_1.png - + docs/manual/TextGrid_file_formats_2.png - + docs/manual/TextGrids__Merge.html - + docs/manual/TextGrids__Merge___.html - + docs/manual/Text___.html - + docs/manual/Text_bottom___.html - + docs/manual/Text_left_right_top_bottom___.html - + docs/manual/Text_styles.html - + docs/manual/Text_top___.html - + docs/manual/Theil__1950_.html - + docs/manual/Time_step_settings___.html - + docs/manual/Times.html - + docs/manual/Torgerson__1958_.html - + docs/manual/Tribolet_et_al___1979_.html - + docs/manual/Tukey__1977_.html - + docs/manual/Types_of_objects.html - + docs/manual/Undo.html - + docs/manual/Unicode.html - + docs/manual/Unicode_Inc__license_agreement.html - + docs/manual/Van_Nierop_et_al___1973_.html - + docs/manual/Velasco_et_al___2011_.html - + docs/manual/View___Edit.html - + docs/manual/Viewport_text___.html - + docs/manual/VocalTract.html - + docs/manual/VocalTractTier.html - + docs/manual/VocalTract__Formula___.html - + docs/manual/Voice.html - + docs/manual/Voice_1__Voice_breaks.html - + docs/manual/Voice_2__Jitter.html - + docs/manual/Voice_3__Shimmer.html - + docs/manual/Voice_4__Additive_noise.html - + docs/manual/Voice_5__Comparison_with_other_programs.html - + docs/manual/Voice_6__Automating_voice_analysis_with_a_script.html - + docs/manual/Voice_report.html - + docs/manual/Vollgraf___Obermayer__2006_.html - + docs/manual/VowelEditor.html - + docs/manual/VowelEditor__Show_vowel_marks_from_Table_file___.html - + docs/manual/Wakita__1977_.html - + docs/manual/Watrous__1991_.html - + docs/manual/Weenink__1985_.html - + docs/manual/Weenink__1999_.html - + docs/manual/Weenink__2003_.html - + docs/manual/Weenink__2015_.html - + docs/manual/Weight.html - + docs/manual/Weller___Romney__1990_.html - + docs/manual/Wessel___Bercovici__1989_.html - + docs/manual/What_s_new_.html - + docs/manual/What_was_new_in_3_1_.html - + docs/manual/What_was_new_in_3_2_.html - + docs/manual/What_was_new_in_3_3_.html - + docs/manual/What_was_new_in_3_5_.html - + docs/manual/What_was_new_in_3_6_.html - + docs/manual/What_was_new_in_3_7_.html - + docs/manual/What_was_new_in_3_8_.html - + docs/manual/What_was_new_in_3_9_.html - + docs/manual/What_was_new_in_4_0_.html - + docs/manual/What_was_new_in_4_1_.html - + docs/manual/What_was_new_in_4_2_.html - + docs/manual/What_was_new_in_4_3_.html - + docs/manual/What_was_new_in_4_4_.html - + docs/manual/What_was_new_in_4_5_.html - + docs/manual/What_was_new_in_4_6_.html - + docs/manual/What_was_new_in_5_0_.html - + docs/manual/What_was_new_in_5_1_.html - + docs/manual/What_was_new_in_5_2_.html - + docs/manual/What_was_new_in_5_3_.html - + docs/manual/What_was_new_in_5_4_.html - + docs/manual/What_was_new_in_6_0_.html - + docs/manual/What_was_new_in_6_1_.html - + docs/manual/What_was_new_in_6_2_.html - + docs/manual/What_was_new_in_6_3_.html - + docs/manual/What_was_new_in_6_4_.html - + docs/manual/Willems__1986_.html - + docs/manual/WordList.html - + docs/manual/World_menu.html - + docs/manual/Wu_et_al___2018_.html - + docs/manual/Yellow.html - + docs/manual/Young__Takane___Lewyckyj__1978_.html - + docs/manual/Zhang_et_al___2003_.html - + docs/manual/Ziehe_et_al___2004_.html - + docs/manual/_abs-H-H_.html - + docs/manual/_abs-H_.html - + docs/manual/_abs_.html - + docs/manual/_appDay_.html - + docs/manual/_appMonth-S_.html - + docs/manual/_appMonth_.html - + docs/manual/_appVersion-S_.html - + docs/manual/_appVersion_.html - + docs/manual/_appYear_.html - + docs/manual/_appendFileLine_.html - + docs/manual/_appendFile_.html - + docs/manual/_appendInfoLine_.html - + docs/manual/_appendInfo_.html - + docs/manual/_arccos-H-H_.html - + docs/manual/_arccos-H_.html - + docs/manual/_arccos_.html - + docs/manual/_arccosh-H-H_.html - + docs/manual/_arccosh-H_.html - + docs/manual/_arccosh_.html - + docs/manual/_arcsin-H-H_.html - + docs/manual/_arcsin-H_.html - + docs/manual/_arcsin_.html - + docs/manual/_arcsinh-H-H_.html - + docs/manual/_arcsinh-H_.html - + docs/manual/_arcsinh_.html - + docs/manual/_arctan-H-H_.html - + docs/manual/_arctan-H_.html - + docs/manual/_arctan2_.html - + docs/manual/_arctan_.html - + docs/manual/_arctanh-H-H_.html - + docs/manual/_arctanh-H_.html - + docs/manual/_arctanh_.html - + docs/manual/_assert_.html - + docs/manual/_asserterror_.html - + docs/manual/_asynchronous_.html - + docs/manual/_backslashTrigraphsToUnicode-S_.html - + docs/manual/_barkToHertz_.html - + docs/manual/_besselI_.html - + docs/manual/_besselK_.html - + docs/manual/_beta_.html - + docs/manual/_between_by-H_.html - + docs/manual/_between_count-H_.html - + docs/manual/_binomialP_.html - + docs/manual/_binomialQ_.html - + docs/manual/_ceiling-H-H_.html - + docs/manual/_ceiling-H_.html - + docs/manual/_ceiling_.html - + docs/manual/_center_.html - + docs/manual/_chiSquareP_.html - + docs/manual/_chiSquareQ_.html - + docs/manual/_chooseFolder-S_.html - + docs/manual/_chooseReadFile-S_.html - + docs/manual/_chooseWriteFile-S_.html - + docs/manual/_clearinfo_.html - + docs/manual/_clock_.html - + docs/manual/_col-H_.html - + docs/manual/_col-S_.html - + docs/manual/_col_.html - + docs/manual/_columnSums-H_.html - + docs/manual/_combine-H_.html - + docs/manual/_correlation_.html - + docs/manual/_cos-H-H_.html - + docs/manual/_cos-H_.html - + docs/manual/_cos_.html - + docs/manual/_cos__1.png - + docs/manual/_cosh-H-H_.html - + docs/manual/_cosh-H_.html - + docs/manual/_cosh_.html - + docs/manual/_createFolder_.html - + docs/manual/_date-H_.html - + docs/manual/_date-S_.html - + docs/manual/_date_iso-S_.html - + docs/manual/_date_utc-H_.html - + docs/manual/_date_utc-S_.html - + docs/manual/_date_utc_iso-S_.html - + docs/manual/_deleteFile_.html - + docs/manual/_demoClickedIn_.html - + docs/manual/_demoClicked_.html - + docs/manual/_demoCommandKeyPressed_.html - + docs/manual/_demoInput_.html - + docs/manual/_demoKey-S_.html - + docs/manual/_demoKeyPressed_.html - + docs/manual/_demoOptionKeyPressed_.html - + docs/manual/_demoPeekInput_.html - + docs/manual/_demoShiftKeyPressed_.html - + docs/manual/_demoShow_.html - + docs/manual/_demoWaitForInput_.html - + docs/manual/_demoWindowTitle_.html - + docs/manual/_demoX_.html - + docs/manual/_demoY_.html - + docs/manual/_demo_.html - + docs/manual/_demo__1.png - + docs/manual/_differenceLimensToPhon_.html - + docs/manual/_dx_.html - + docs/manual/_dy_.html - + docs/manual/_editor_.html - + docs/manual/_empty-S-H_.html - + docs/manual/_endeditor_.html - + docs/manual/_endproc_.html - + docs/manual/_endsWith_.html - + docs/manual/_endsWith_caseInsensitive_.html - + docs/manual/_environment-S_.html - + docs/manual/_erbToHertz_.html - + docs/manual/_erb_.html - + docs/manual/_erf_.html - + docs/manual/_erfc_.html - + docs/manual/_exitScript_.html - + docs/manual/_exp-H-H_.html - + docs/manual/_exp-H_.html - + docs/manual/_exp_.html - + docs/manual/_extractLine-S_.html - + docs/manual/_extractNumber_.html - + docs/manual/_extractWord-S_.html - + docs/manual/_fileNames-S-H_.html - + docs/manual/_fileNames_caseInsensitive-S-H_.html - + docs/manual/_fileReadable_.html - + docs/manual/_fisherP_.html - + docs/manual/_fisherQ_.html - + docs/manual/_fixed-S_.html - + docs/manual/_floor-H-H_.html - + docs/manual/_floor-H_.html - + docs/manual/_floor_.html - + docs/manual/_folderExists_.html - + docs/manual/_folderNames-S-H_.html - + docs/manual/_folderNames_caseInsensitive-S-H_.html - + docs/manual/_from_to-H_.html - + docs/manual/_from_to_by-H_.html - + docs/manual/_from_to_count-H_.html - + docs/manual/_gaussP_.html - + docs/manual/_gaussQ_.html - + docs/manual/_goto_.html - + docs/manual/_hertzToBark_.html - + docs/manual/_hertzToErb_.html - + docs/manual/_hertzToMel_.html - + docs/manual/_hertzToSemitones_.html - + docs/manual/_imax_.html - + docs/manual/_imin_.html - + docs/manual/_index_.html - + docs/manual/_index_caseInsensitive_.html - + docs/manual/_index_regex_.html - + docs/manual/_inner_.html - + docs/manual/_invBinomialP_.html - + docs/manual/_invBinomialQ_.html - + docs/manual/_invChiSquareQ_.html - + docs/manual/_invFisherQ_.html - + docs/manual/_invGaussQ_.html - + docs/manual/_invSigmoid-H-H_.html - + docs/manual/_invSigmoid-H_.html - + docs/manual/_invSigmoid_.html - + docs/manual/_invStudentQ_.html - + docs/manual/_label_.html - + docs/manual/_left-S_.html - + docs/manual/_length_.html - + docs/manual/_ln-H-H_.html - + docs/manual/_ln-H_.html - + docs/manual/_lnGamma_.html - + docs/manual/_ln_.html - + docs/manual/_log10-H-H_.html - + docs/manual/_log10-H_.html - + docs/manual/_log10_.html - + docs/manual/_log2-H-H_.html - + docs/manual/_log2-H_.html - + docs/manual/_log2_.html - + docs/manual/_lowerCaseAppName-S_.html - + docs/manual/_max_.html - + docs/manual/_mean_.html - + docs/manual/_melToHertz_.html - + docs/manual/_mid-S_.html - + docs/manual/_min_.html - + docs/manual/_minusObject_.html - + docs/manual/_mul-H-H_.html - + docs/manual/_ncol_.html - + docs/manual/_nrow_.html - + docs/manual/_number-H_.html - + docs/manual/_numberOfColumns_.html - + docs/manual/_numberOfRows_.html - + docs/manual/_number_.html - + docs/manual/_nx_.html - + docs/manual/_ny_.html - + docs/manual/_outer-H-H_.html - + docs/manual/_padLeft-S_.html - + docs/manual/_padOrTruncateLeft-S_.html - + docs/manual/_padOrTruncateRight-S_.html - + docs/manual/_padRight-S_.html - + docs/manual/_part-H-H_.html - + docs/manual/_part-H_.html - + docs/manual/_pauseScript_.html - + docs/manual/_percent-S_.html - + docs/manual/_phonToDifferenceLimens_.html - + docs/manual/_plusObject_.html - + docs/manual/_procedure_.html - + docs/manual/_randomBernoulli-H-H_.html - + docs/manual/_randomBernoulli-H_.html - + docs/manual/_randomBernoulli_.html - + docs/manual/_randomGamma-H-H_.html - + docs/manual/_randomGamma-H_.html - + docs/manual/_randomGamma_.html - + docs/manual/_randomGauss-H-H_.html - + docs/manual/_randomGauss-H_.html - + docs/manual/_randomGauss_.html - + docs/manual/_randomInteger-H-H_.html - + docs/manual/_randomInteger-H_.html - + docs/manual/_randomInteger_.html - + docs/manual/_randomPoisson-H-H_.html - + docs/manual/_randomPoisson-H_.html - + docs/manual/_randomPoisson_.html - + docs/manual/_randomUniform-H-H_.html - + docs/manual/_randomUniform-H_.html - + docs/manual/_randomUniform_.html - + docs/manual/_random_initializeSafelyAndUnpredictably_.html - + docs/manual/_random_initializeWithSeedUnsafelyButPredictably_.html - + docs/manual/_readFile-H-H_.html - + docs/manual/_readFile-H_.html - + docs/manual/_readFile-S_.html - + docs/manual/_readFile_.html - + docs/manual/_readLinesFromFile-S-H_.html - + docs/manual/_rectify-H-H_.html - + docs/manual/_rectify-H_.html - + docs/manual/_rectify_.html - + docs/manual/_removeObject_.html - + docs/manual/_repeat-H_.html - + docs/manual/_replace-S_.html - + docs/manual/_replace_regex-S_.html - + docs/manual/_right-S_.html - + docs/manual/_rindex_.html - + docs/manual/_rindex_caseInsensitive_.html - + docs/manual/_rindex_regex_.html - + docs/manual/_round-H-H_.html - + docs/manual/_round-H_.html - + docs/manual/_round_.html - + docs/manual/_row-H_.html - + docs/manual/_row-S_.html - + docs/manual/_rowSums-H_.html - + docs/manual/_row_.html - + docs/manual/_runScript_.html - + docs/manual/_runSubprocess-S_.html - + docs/manual/_runSubprocess_.html - + docs/manual/_runSystem-S_.html - + docs/manual/_runSystem_.html - + docs/manual/_selectObject_.html - + docs/manual/_selected-H_.html - + docs/manual/_selected-S-H_.html - + docs/manual/_selected-S_.html - + docs/manual/_selected_.html - + docs/manual/_semitonesToHertz_.html - + docs/manual/_shuffle-H_.html - + docs/manual/_shuffle-S-H_.html - + docs/manual/_sigmoid-H-H_.html - + docs/manual/_sigmoid-H_.html - + docs/manual/_sigmoid_.html - + docs/manual/_sin-H-H_.html - + docs/manual/_sin-H_.html - + docs/manual/_sin_.html - + docs/manual/_sin__1.png - + docs/manual/_sinc_.html - + docs/manual/_sincpi_.html - + docs/manual/_sinh-H-H_.html - + docs/manual/_sinh-H_.html - + docs/manual/_sinh_.html - + docs/manual/_size_.html - + docs/manual/_sleep_.html - + docs/manual/_softmax-H_.html - + docs/manual/_softmaxPerRow-H-H_.html - + docs/manual/_solve-H-H_.html - + docs/manual/_solve-H_.html - + docs/manual/_solveNonnegative-H_.html - + docs/manual/_solveSparse-H_.html - + docs/manual/_solveWeaklyConstrained-H_.html - + docs/manual/_sort-H_.html - + docs/manual/_sort-S-H_.html - + docs/manual/_sort_numberAware-S-H_.html - + docs/manual/_splitByWhitespace-S-H_.html - + docs/manual/_sqrt-H-H_.html - + docs/manual/_sqrt-H_.html - + docs/manual/_sqrt_.html - + docs/manual/_startsWith_.html - + docs/manual/_startsWith_caseInsensitive_.html - + docs/manual/_stdev_.html - + docs/manual/_stopwatch_.html - + docs/manual/_string-S_.html - + docs/manual/_studentP_.html - + docs/manual/_studentQ_.html - + docs/manual/_sumOver_.html - + docs/manual/_sum_.html - + docs/manual/_tan-H-H_.html - + docs/manual/_tan-H_.html - + docs/manual/_tan_.html - + docs/manual/_tanh-H-H_.html - + docs/manual/_tanh-H_.html - + docs/manual/_tanh_.html - + docs/manual/_to-H_.html - + docs/manual/_transpose-H-H_.html - + docs/manual/_truncateLeft-S_.html - + docs/manual/_truncateRight-S_.html - + docs/manual/_tryToAppendFile_.html - + docs/manual/_tryToWriteFile_.html - + docs/manual/_unicode-S_.html - + docs/manual/_unicodeToBackslashTrigraphs-S_.html - + docs/manual/_unicode_.html - + docs/manual/_upperCaseAppName-S_.html - + docs/manual/_variableExists_.html - + docs/manual/_vertical-S_.html - + docs/manual/_writeFileLine_.html - + docs/manual/_writeFile_.html - + docs/manual/_writeInfoLine_.html - + docs/manual/_writeInfo_.html - + docs/manual/_x_.html - + docs/manual/_xmax_.html - + docs/manual/_xmin_.html - + docs/manual/_y_.html - + docs/manual/_ymax_.html - + docs/manual/_ymin_.html - + docs/manual/_zero-H-H_.html - + docs/manual/_zero-H_.html - + docs/manual/action_commands.html - + docs/manual/aliasing.html - + docs/manual/audio_control_panel.html - + docs/manual/band_filtering_in_the_frequency_domain.html - + docs/manual/biharmonic_spline_interpolation.html - + docs/manual/blind_source_separation.html - + docs/manual/bootstrap.html - + docs/manual/box_plot.html - + docs/manual/box_plot_1.png - + docs/manual/buttons_file.html - + docs/manual/canonical_variate.html - + docs/manual/concentration_ellipse.html - + docs/manual/confidence_interval.html - + docs/manual/confidence_level.html - + docs/manual/congruence_coefficient.html - + docs/manual/constant_extrapolation.html - + docs/manual/constant_extrapolation_1.png - + docs/manual/constraints.html - + docs/manual/disparities.html - + docs/manual/eSpeak.html - + docs/manual/electroglottography.html - + docs/manual/end_time.html - + docs/manual/energy_integration_continuity_test.html - + docs/manual/epoch.html - + docs/manual/equivalent_rectangular_bandwidth.html - + docs/manual/expectation-maximization.html - + docs/manual/fixed_menu_commands.html - + docs/manual/frequency.html - + docs/manual/gammatone.html - + docs/manual/generalized_singular_value_decomposition.html - + docs/manual/hidden_commands.html - + docs/manual/how_to_choose_a_pitch_analysis_method.html - + docs/manual/how_to_choose_a_pitch_analysis_method_1.png - + docs/manual/identity_permutation.html - + docs/manual/incompleteBeta.html - + docs/manual/incompleteGammaP.html - + docs/manual/incomplete_gamma_function.html - + docs/manual/individual_difference_scaling.html - + docs/manual/initialization_script.html - + docs/manual/iris_data_set.html - + docs/manual/jackknife.html - + docs/manual/lexicographic_permutation_order.html - + docs/manual/linear_interpolation.html - + docs/manual/linear_interpolation_1.png - + docs/manual/lnBeta.html - + docs/manual/natural_sort_order.html - + docs/manual/non-negative_matrix_factorization.html - + docs/manual/objects.html - + docs/manual/overlap-add.html - + docs/manual/pairwise_algorithm_for_computing_sample_variances.html - + docs/manual/pause_window.html - + docs/manual/pitch_analysis_by_filtered_autocorrelation.html - + docs/manual/pitch_analysis_by_filtered_autocorrelation_1.png - + docs/manual/pitch_analysis_by_filtered_autocorrelation_2.png - + docs/manual/pitch_analysis_by_filtered_autocorrelation_3.png - + docs/manual/pitch_analysis_by_filtered_cross-correlation.html - + docs/manual/pitch_analysis_by_raw_autocorrelation.html - + docs/manual/pitch_analysis_by_raw_cross-correlation.html - + docs/manual/pitch_floor.html - + docs/manual/plug-ins.html - + docs/manual/plugins.html - + docs/manual/power_spectral_density.html - + docs/manual/preferences_file.html - + docs/manual/preferences_folder.html - + docs/manual/quantile_algorithm.html - + docs/manual/reverberation_time.html - + docs/manual/sampling_frequency.html - + docs/manual/sampling_period.html - + docs/manual/sendpraat.html - + docs/manual/singular_value_decomposition.html - + docs/manual/smacof.html - + docs/manual/solving_matrix_equations.html - + docs/manual/sound_pressure_calibration.html - + docs/manual/sound_pressure_level.html - + docs/manual/spectro-temporal_representation.html - + docs/manual/spline.html - + docs/manual/spline_1.png - + docs/manual/spline_2.png - + docs/manual/start_time.html - + docs/manual/stereo.html - + docs/manual/stress.html - + docs/manual/theil_regression.html - + docs/manual/time.html - + docs/manual/time_domain.html - + docs/manual/time_domain_1.png - + docs/manual/time_domain_2.png - + docs/manual/time_selection.html - + docs/manual/total_duration.html - + docs/manual/undefined.html - + docs/manual/vector_peak_interpolation.html - + docs/manual/vector_value_interpolation.html - + docs/manual/waveform.html - + docs/manualsByOthers.html - + docs/old/4100/Praat7_4100 - + docs/old/4100/praat4100_hpux.tar.gz - + docs/old/4100/praat4100_sgi.tar.gz - + docs/old/4113/PraatM_4113.app/Contents/Info.plist - + docs/old/4113/PraatM_4113.app/Contents/PkgInfo - + docs/old/4113/PraatM_4113.app/Contents/Resources/English.lproj/InfoPlist.strings - + docs/old/4113/PraatM_4113.app/Contents/Resources/Praat.rsrc - + docs/old/4113/PraatM_4113.app/Icon - + docs/old/4113/PraatM_4113.sit - + docs/old/4113/praat4113_macX.zip - + docs/old/4223/praat4223_mac7.sit - + docs/old/4300/praat4300_solaris.tar.gz - + docs/old/4501/praat4501_mac9.sit - + docs/old/4601/PraatMNoQAAC_4601.sit - + docs/old/4601/PraatMQAAC_4601.sit - + docs/old/4601/PraatNoQAAC.app/Contents/Info.plist - + docs/old/4601/PraatNoQAAC.app/Contents/PkgInfo - + docs/old/4601/PraatNoQAAC.app/Contents/Resources/English.lproj/InfoPlist.strings - + docs/old/4601/PraatQAAC.app/Contents/Info.plist - + docs/old/4601/PraatQAAC.app/Contents/PkgInfo - + docs/old/4601/PraatQAAC.app/Contents/Resources/English.lproj/InfoPlist.strings - + docs/old/4601/praat4601_win98.zip - + docs/old/4601/praatcon4601_win98.zip - + docs/old/5119/praat5119_macU.dmg - + docs/old/5119/praat5119_macU.sit - + docs/old/5217/praat5217_macU.dmg - + docs/old/5314/praat5314_mac32.dmg - + docs/old/5314/praat5314_win32.zip - + docs/old/5314/praatcon5314_win32.zip - + docs/pictures/arm64.png - + docs/pictures/david.gif - + docs/pictures/dontrun.png - + docs/pictures/intel64.png - + docs/pictures/paul.jpg - + docs/pictures/pboersma.jpg - + docs/pictures/pboersma.png - + docs/pictures/praat.png - + docs/pictures/praat.tiff - + docs/pictures/praat_black.gif - + docs/pictures/praat_white.gif - + docs/pictures/unblock.png - + docs/sendpraat.c - + docs/sendpraat.html - + docs/silipa93.sit - + docs/silipa93.zip - external/glpk/READ_ME.TXT - fon/manual_functions.cpp - fon/manual_licenses.cpp - fon/manual_references.cpp - fon/manual_tutorials.cpp - fon/manual_voice.cpp - fon/manual_whatsnew.cpp - foned/SoundAnalysisArea.cpp - ? main/GNU_General_Public_License.txt - main/main_Praat.cpp - main/main_Praat.h - melder/melder_ftoa.cpp - melder/melder_tensor.h - sys/Formula.cpp - sys/GuiDialog.cpp - sys/GuiWindow.cpp The diff was not included because it is too large. View it on GitLab: https://salsa.debian.org/med-team/praat/-/commit/96fc2ddbb9c5162c84b534c263fca48efa30d4c6 -- View it on GitLab: https://salsa.debian.org/med-team/praat/-/commit/96fc2ddbb9c5162c84b534c263fca48efa30d4c6 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Thu Jun 26 13:38:08 2025 From: gitlab at salsa.debian.org (=?UTF-8?B?UmFmYWVsIExhYm9pc3Npw6hyZSAoQHJhZmFlbCk=?=) Date: Thu, 26 Jun 2025 12:38:08 +0000 Subject: [med-svn] [Git][med-team/praat][pristine-tar] pristine-tar data for praat_6.4.35+dfsg.orig.tar.xz Message-ID: <685d3f30b7216_3db209eb108562259b@godard.mail> Rafael Laboissi?re pushed to branch pristine-tar at Debian Med / praat Commits: 912ff553 by Rafael Laboissi?re at 2025-06-20T17:26:04-03:00 pristine-tar data for praat_6.4.35+dfsg.orig.tar.xz - - - - - 2 changed files: - + praat_6.4.35+dfsg.orig.tar.xz.delta - + praat_6.4.35+dfsg.orig.tar.xz.id Changes: ===================================== praat_6.4.35+dfsg.orig.tar.xz.delta ===================================== Binary files /dev/null and b/praat_6.4.35+dfsg.orig.tar.xz.delta differ ===================================== praat_6.4.35+dfsg.orig.tar.xz.id ===================================== @@ -0,0 +1 @@ +133283ac1e058c1985e8d333aedadad1ff79c6bb View it on GitLab: https://salsa.debian.org/med-team/praat/-/commit/912ff5538a182e6867783f59a47cd6d514b0acca -- View it on GitLab: https://salsa.debian.org/med-team/praat/-/commit/912ff5538a182e6867783f59a47cd6d514b0acca You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Thu Jun 26 14:43:28 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Thu, 26 Jun 2025 13:43:28 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <685d4e80b9cae_3db21ebd0e056283e4@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: 81c7bf17 by Andreas Tille at 2025-06-26T13:43:22+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,35 +1,34 @@ -Last-Update: Thu, 26 Jun 2025 01:42:04 +0000 +Last-Update: Thu, 26 Jun 2025 13:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- - dicomscope | 25 | {imaging} | + dicomscope | 26 | {imaging} | oscar | 18 | {data,tools,practice} | orthanc-gdcm | 17 | {imaging} | mrtrix3 | 15 | {imaging} | pixelmed | 12 | {imaging} | gnumed-server | 11 | {covid-19,practice} | - adun.app | 10 | {bio} | bart-view | 10 | {imaging} | king | 10 | {typesetting,imaging} | orthanc-mysql | 10 | {imaging} | - libminc | 9 | {imaging-dev} | + adun.app | 9 | {bio} | orthanc-postgresql | 9 | {imaging} | + sight | 9 | {imaging} | icb-utils | 8 | {bio-dev} | - sight | 8 | {imaging} | + libminc | 8 | {imaging-dev} | heudiconv | 7 | {imaging} | mia | 6 | {imaging} | jebl2 | 5 | {bio-dev} | biojava-live | 4 | {bio-dev} | - insighttoolkit5 | 4 | {imaging-dev} | sight | 4 | {imaging} | biojava6-live | 3 | {bio-dev} | getdata | 3 | {bio} | + insighttoolkit5 | 3 | {imaging-dev} | piler | 3 | {bio} | ants | 2 | {imaging} | beast-mcmc | 2 | {bio,bio-phylogeny} | bio-tradis | 2 | {bio,bio-dev} | cmtk | 2 | {imaging} | - elastix | 2 | {imaging} | fastml | 2 | {bio} | ipig | 2 | {bio} | libdivsufsort | 2 | {bio-dev} | @@ -44,6 +43,7 @@ Last-Update: Thu, 26 Jun 2025 01:42:04 +0000 cufflinks | 1 | {cloud,bio} | dextractor | 1 | {bio,covid-19} | eegdev | 1 | {imaging-dev} | + elastix | 1 | {imaging} | emboss-explorer | 1 | {bio} | hinge | 1 | {bio} | htscodecs | 1 | {bio-dev,covid-19} | ===================================== debian-science-tests.txt ===================================== @@ -1,59 +1,60 @@ -Last-Update: Thu, 26 Jun 2025 01:42:04 +0000 +Last-Update: Thu, 26 Jun 2025 13:42:08 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- - nltk | 4798 | {linguistics} | - gts | 4708 | {viewing} | - opencascade | 604 | {simulations} | + nltk | 4789 | {linguistics} | + gts | 4691 | {viewing} | + opencascade | 597 | {simulations} | spacenavd | 228 | {tools} | - armadillo | 180 | {mathematics-dev} | - open-coarrays | 171 | {meteorology-dev} | - arpack | 83 | {mathematics-dev} | - scalapack | 49 | {nanoscale-physics-dev} | - visidata | 43 | {datamanagement} | + armadillo | 178 | {mathematics-dev} | + open-coarrays | 174 | {meteorology-dev} | + arpack | 84 | {mathematics-dev} | + scalapack | 51 | {nanoscale-physics-dev} | + visidata | 44 | {datamanagement} | ntl | 41 | {mathematics-dev} | imview | 39 | {viewing} | - mbpoll | 35 | {simulations} | - ppl | 32 | {numericalcomputation} | - flintqs | 30 | {mathematics} | - libmatio | 27 | {mathematics-dev} | + mbpoll | 34 | {simulations} | + ppl | 33 | {numericalcomputation} | + flintqs | 31 | {mathematics} | + libmatio | 28 | {mathematics-dev} | + arduino-mk | 25 | {robotics} | cliquer | 25 | {mathematics} | - arduino-mk | 24 | {robotics} | + flann | 24 | {mathematics-dev,engineering-dev} | libm4ri | 24 | {mathematics-dev} | - flann | 22 | {mathematics-dev,engineering-dev} | - xygrib | 22 | {meteorology} | - setzer | 21 | {typesetting} | - grads | 20 | {meteorology} | - bossa | 19 | {devices} | + xygrib | 23 | {meteorology} | + setzer | 22 | {typesetting} | + sat4j | 20 | {logic} | + grads | 19 | {meteorology} | guiqwt | 19 | {numericalcomputation,viewing} | - picosat | 19 | {logic} | - sat4j | 19 | {logic} | + bossa | 18 | {devices} | fftw | 18 | {mathematics-dev,physics-dev,meteorology-dev} | - eccodes | 16 | {meteorology,meteorology-dev} | + picosat | 18 | {logic} | lrcalc | 16 | {mathematics-dev} | sketch | 16 | {typesetting} | gts | 15 | {viewing-dev} | ncl | 15 | {meteorology} | pyzo | 15 | {numericalcomputation} | + eccodes | 14 | {meteorology,meteorology-dev} | cliquer | 13 | {mathematics-dev} | - feff85exafs | 13 | {chemistry} | libitpp | 13 | {mathematics-dev,engineering-dev} | teem | 13 | {imageanalysis} | + dune-uggrid | 12 | {mathematics-dev} | + feff85exafs | 12 | {chemistry} | gf2x | 12 | {mathematics-dev} | + lxi-tools | 12 | {engineering,dataacquisition} | matlab-support | 12 | {mathematics,numericalcomputation} | - coinor-symphony | 11 | {logic,mathematics,numericalcomputation} | eccodes | 11 | {meteorology-dev} | iml | 11 | {mathematics-dev} | libhomfly | 11 | {mathematics-dev} | - lxi-tools | 11 | {engineering,dataacquisition} | pcl | 11 | {robotics-dev} | - dune-uggrid | 10 | {mathematics-dev} | + coinor-symphony | 10 | {logic,mathematics,numericalcomputation} | feedgnuplot | 10 | {viewing} | - form | 10 | {mathematics} | libm4rie | 10 | {mathematics-dev} | ncl | 10 | {meteorology-dev} | - python-escript | 10 | {numericalcomputation,simulations,engineering} | + form | 9 | {mathematics} | geg | 9 | {viewing} | + python-escript | 9 | {numericalcomputation,simulations,engineering} | + metar | 8 | {meteorology} | python-cdo | 8 | {meteorology} | ratpoints | 8 | {mathematics-dev} | vdt | 8 | {mathematics-dev} | @@ -62,20 +63,20 @@ Last-Update: Thu, 26 Jun 2025 01:42:04 +0000 libccp4 | 7 | {nanoscale-physics-dev} | libzn-poly | 7 | {mathematics-dev} | opencascade | 7 | {simulations} | - psurface | 7 | {numericalcomputation} | refmac-dictionary | 7 | {highenergy-physics-dev,chemistry} | - uctodata | 7 | {linguistics} | cld2 | 6 | {linguistics} | dxsamples | 6 | {nanoscale-physics} | - etsf-io | 6 | {physics,nanoscale-physics} | fftw | 6 | {meteorology-dev,mathematics-dev,physics-dev} | magics++ | 6 | {meteorology-dev} | - metar | 6 | {meteorology} | odc | 6 | {meteorology} | odc | 6 | {meteorology-dev} | persalys | 6 | {engineering,statistics,mathematics} | + psurface | 6 | {numericalcomputation} | ros-rosconsole | 6 | {robotics-dev} | toulbar2 | 6 | {logic,numericalcomputation,mathematics,physics} | + uctodata | 6 | {linguistics} | + urdfdom-headers | 6 | {robotics-dev} | + etsf-io | 5 | {physics,nanoscale-physics} | fpzip | 5 | {meteorology} | newmat | 5 | {mathematics-dev} | persalys | 5 | {statistics,mathematics,engineering} | @@ -83,21 +84,22 @@ Last-Update: Thu, 26 Jun 2025 01:42:04 +0000 rubiks | 5 | {geometry,mathematics} | toontag | 5 | {numericalcomputation} | ucto | 5 | {linguistics} | - urdfdom-headers | 5 | {robotics-dev} | veccore | 5 | {mathematics-dev} | atlas-ecmwf | 4 | {meteorology} | auto-07p | 4 | {mathematics} | coda | 4 | {meteorology-dev} | coda | 4 | {meteorology} | - debian-science | 4 | {economics,nanoscale-physics,machine-learning,physics,mathematics} | debian-science | 4 | {physics,machine-learning,economics,nanoscale-physics} | + debian-science | 4 | {economics,nanoscale-physics,machine-learning,physics,mathematics} | getdp | 4 | {engineering,mathematics,simulations} | gsw | 4 | {meteorology} | iapws | 4 | {meteorology} | muparser | 4 | {mathematics-dev} | - ros-vcstool | 4 | {robotics-dev} | + openstereogram | 4 | {tools} | + sardana | 4 | {dataacquisition} | sdpb | 4 | {numericalcomputation,highenergy-physics} | silo-llnl | 4 | {engineering} | + syrthes | 4 | {engineering} | toon | 4 | {numericalcomputation} | apertium-eval-translator | 3 | {linguistics} | cmor | 3 | {meteorology} | @@ -113,21 +115,15 @@ Last-Update: Thu, 26 Jun 2025 01:42:04 +0000 libgctp | 3 | {meteorology-dev} | libmatheval | 3 | {mathematics} | libvigraimpex | 3 | {imageanalysis-dev,machine-learning} | - libxsmm | 3 | {mathematics-dev} | lrcalc | 3 | {mathematics} | metview | 3 | {meteorology} | - mpi4py-fft | 3 | {mathematics-dev} | - openstereogram | 3 | {tools} | polylib | 3 | {mathematics} | python-aws-xray-sdk | 3 | {dataacquisition-dev} | + ros-vcstool | 3 | {robotics-dev} | sac2mseed | 3 | {geography} | sagemath-database-conway-polynomials | 3 | {mathematics} | - sardana | 3 | {dataacquisition} | scram | 3 | {engineering} | - silo-llnl | 3 | {engineering} | spaghetti | 3 | {geography} | - syrthes | 3 | {engineering} | - apache-opennlp | 2 | {linguistics} | apertium-streamparser | 2 | {linguistics} | apophenia | 2 | {statistics} | atlas-ecmwf | 2 | {meteorology-dev} | @@ -135,9 +131,9 @@ Last-Update: Thu, 26 Jun 2025 01:42:04 +0000 coinor-bonmin | 2 | {mathematics} | cylc-flow | 2 | {meteorology} | debian-science | 2 | {electrophysiology} | - debian-science | 2 | {neuroscience-cognitive} | - debian-science | 2 | {economics} | debian-science | 2 | {nanoscale-physics,statistics,economics,physics} | + debian-science | 2 | {economics} | + debian-science | 2 | {neuroscience-cognitive} | dimbl | 2 | {linguistics} | dune-functions | 2 | {mathematics-dev} | dune-localfunctions | 2 | {mathematics-dev} | @@ -153,13 +149,14 @@ Last-Update: Thu, 26 Jun 2025 01:42:04 +0000 libmatheval | 2 | {mathematics-dev} | metkit | 2 | {meteorology} | mmdb | 2 | {nanoscale-physics-dev,highenergy-physics-dev} | + mpi4py-fft | 2 | {mathematics-dev} | mseed2sac | 2 | {dataacquisition-dev} | ncrystal | 2 | {nanoscale-physics-dev,highenergy-physics-dev} | nrn-iv | 2 | {biology} | - qd | 2 | {mathematics-dev} | qwtplot3d | 2 | {viewing-dev} | silo-llnl | 2 | {engineering-dev} | x13as | 2 | {economics} | + apache-opennlp | 1 | {linguistics} | asl | 1 | {physics-dev} | ckon | 1 | {highenergy-physics-dev} | coda | 1 | {meteorology-dev} | @@ -181,6 +178,7 @@ Last-Update: Thu, 26 Jun 2025 01:42:04 +0000 liblbfgs | 1 | {mathematics-dev} | liblxi | 1 | {engineering-dev,dataacquisition-dev} | liborigin2 | 1 | {viewing-dev} | + libxsmm | 1 | {mathematics-dev} | looptools | 1 | {highenergy-physics-dev} | mbt | 1 | {linguistics} | mbtserver | 1 | {linguistics} | @@ -189,6 +187,7 @@ Last-Update: Thu, 26 Jun 2025 01:42:04 +0000 neartree | 1 | {mathematics-dev,numericalcomputation} | openmesh | 1 | {mathematics-dev} | psurface | 1 | {numericalcomputation} | + qd | 1 | {mathematics-dev} | ros-ros-environment | 1 | {robotics-dev} | schroedinger-coordgenlibs | 1 | {nanoscale-physics-dev,chemistry} | siscone | 1 | {highenergy-physics-dev} | @@ -216,8 +215,8 @@ Last-Update: Thu, 26 Jun 2025 01:42:04 +0000 collada-dom | 0 | {viewing-dev} | cqrlib | 0 | {mathematics-dev} | cvector | 0 | {mathematics-dev} | - debian-science | 0 | {nanoscale-physics-dev} | debian-science | 0 | {electrophysiology} | + debian-science | 0 | {nanoscale-physics-dev} | debian-science | 0 | {physics} | dune-grid-glue | 0 | {mathematics-dev} | etsf-io | 0 | {nanoscale-physics-dev} | @@ -227,8 +226,8 @@ Last-Update: Thu, 26 Jun 2025 01:42:04 +0000 libfolia | 0 | {linguistics} | libquantum | 0 | {numericalcomputation} | libsdsl | 0 | {dataacquisition-dev} | - looptools | 0 | {highenergy-physics-dev} | looptools | 0 | {highenergy-physics} | + looptools | 0 | {highenergy-physics-dev} | magma | 0 | {mathematics-dev,numericalcomputation} | mbt | 0 | {linguistics} | mctc-lib | 0 | {nanoscale-physics-dev,highenergy-physics-dev} | @@ -270,5 +269,5 @@ Last-Update: Thu, 26 Jun 2025 01:42:04 +0000 virtuoso-opensource | 0 | {datamanagement} | visp-images | 0 | {robotics-dev} | libelas | -1 | {robotics-dev} | -(298 rows) +(297 rows) ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,112 +1,112 @@ -Last-Update: Thu, 26 Jun 2025 01:42:04 +0000 +Last-Update: Thu, 26 Jun 2025 13:42:12 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- - mpmath | 9873 | - python-repoze.lru | 6980 | - netifaces | 5143 | - ghp-import | 4739 | - python-lunr | 4731 | - python-babel | 3816 | - sortedcontainers | 3478 | - python-babel | 3405 | - aiosignal | 2982 | - hyperlink | 2158 | - humanfriendly | 1993 | - python-notify2 | 1969 | - referencing | 1576 | - python-mysqldb | 1533 | - python-gssapi | 1459 | - python-invoke | 1402 | - python-hyperframe | 1399 | - websocket-client | 1309 | - python-hpack | 1186 | - python-rsa | 1130 | - python-pandocfilters | 1035 | - menulibre | 961 | - pdfarranger | 958 | - python-linux-procfs | 934 | - python-geoip | 863 | - python-webob | 825 | - powerline | 747 | - python-zopfli | 722 | - powerline | 702 | - powerline | 697 | - kazam | 661 | - firmware-microbit-micropython | 646 | - u-msgpack-python | 587 | - python-et-xmlfile | 526 | - asn1crypto | 502 | - dockerpty | 496 | - python-gevent | 491 | - gaupol | 479 | + mpmath | 9842 | + python-repoze.lru | 6977 | + netifaces | 5126 | + ghp-import | 4733 | + python-lunr | 4727 | + python-babel | 3793 | + sortedcontainers | 3475 | + python-babel | 3392 | + aiosignal | 2991 | + hyperlink | 2148 | + humanfriendly | 1991 | + python-notify2 | 1965 | + referencing | 1590 | + python-mysqldb | 1525 | + python-gssapi | 1457 | + python-invoke | 1388 | + python-hyperframe | 1381 | + websocket-client | 1297 | + python-hpack | 1170 | + python-rsa | 1127 | + python-pandocfilters | 1027 | + menulibre | 967 | + pdfarranger | 948 | + python-linux-procfs | 933 | + python-geoip | 857 | + python-webob | 824 | + powerline | 751 | + python-zopfli | 743 | + powerline | 700 | + powerline | 695 | + kazam | 663 | + firmware-microbit-micropython | 639 | + u-msgpack-python | 581 | + python-et-xmlfile | 519 | + asn1crypto | 496 | + python-gevent | 495 | + dockerpty | 494 | + gaupol | 478 | autopep8 | 470 | - python-ewmh | 447 | - catfish | 437 | - python-requests-oauthlib | 401 | - pytoolconfig | 385 | - spf-engine | 346 | - python-toml | 338 | - python-ntlm-auth | 303 | - spf-engine | 296 | - python-ldap3 | 263 | - django-stronghold | 247 | - cairocffi | 220 | + python-ewmh | 445 | + catfish | 438 | + python-requests-oauthlib | 399 | + pytoolconfig | 377 | + spf-engine | 344 | + python-toml | 337 | + python-ntlm-auth | 299 | + spf-engine | 295 | + django-stronghold | 262 | + python-ldap3 | 259 | + cairocffi | 217 | python-mimeparse | 194 | - python-smmap | 175 | - python-hidapi | 167 | + python-smmap | 173 | + python-hidapi | 166 | autokey | 165 | - httpie | 147 | - python-anyjson | 136 | + httpie | 146 | + python-anyjson | 134 | kivy | 133 | - smem | 132 | + smem | 130 | python-aiostream | 126 | - smartypants | 123 | - python-click-repl | 120 | - mypaint | 118 | - lollypop | 104 | - nodeenv | 103 | - python-consul | 102 | + mypaint | 123 | + smartypants | 122 | + python-click-repl | 118 | + lollypop | 103 | + nodeenv | 101 | mugshot | 99 | + python-consul | 98 | timekpr-next | 98 | - python-pyu2f | 97 | - pacparser | 96 | - pymacaroons | 90 | + python-pyu2f | 96 | + pacparser | 95 | + pymacaroons | 91 | python-rfc6555 | 87 | - pymediainfo | 83 | - pssh | 80 | - python-colour | 76 | + pymediainfo | 84 | + pssh | 82 | + python-colour | 78 | numpy-stl | 72 | python-i3ipc | 70 | - weasyprint | 70 | - mitmproxy | 68 | - fabric | 67 | + weasyprint | 68 | pywavelets | 67 | - python-pykka | 65 | - itstool | 58 | - python-looseversion | 54 | - python-scp | 54 | - ueberzug | 54 | - mysql-connector-python | 53 | - pyenv | 52 | - python-uritools | 51 | - khard | 48 | - pymacs | 48 | - sshtunnel | 48 | - blockdiag | 47 | + fabric | 66 | + python-pykka | 66 | + mitmproxy | 63 | + itstool | 57 | + pyenv | 53 | + mysql-connector-python | 52 | + python-looseversion | 52 | + python-scp | 52 | + ueberzug | 51 | + python-uritools | 50 | + khard | 49 | + pymacs | 49 | + blockdiag | 48 | + sshtunnel | 47 | kivy | 46 | - hatchling | 44 | membernator | 44 | python-pysol-cards | 44 | trac | 44 | + hatchling | 42 | + show-in-file-manager | 42 | pyquery | 41 | certipy | 40 | pamela | 40 | - show-in-file-manager | 40 | jupyterhub | 39 | + powerline-gitstatus | 39 | pylibmc | 39 | - pdfposter | 37 | - powerline-gitstatus | 37 | + pdfposter | 36 | python-scrypt | 36 | pssh | 34 | persepolis | 32 | @@ -114,19 +114,19 @@ Last-Update: Thu, 26 Jun 2025 01:42:04 +0000 seqdiag | 29 | python-args | 28 | sphinxcontrib-blockdiag | 28 | - rst2pdf | 27 | sphinxcontrib-seqdiag | 27 | - python-statsd | 26 | - video-downloader | 26 | + rst2pdf | 26 | + sphinx-inline-tabs | 26 | flask-principal | 25 | python-clint | 25 | - sphinx-inline-tabs | 25 | + python-statsd | 25 | typogrify | 25 | + video-downloader | 25 | depthcharge-tools | 24 | enzyme | 24 | - python-rangehttpserver | 24 | + webpy | 24 | cppman | 23 | - webpy | 23 | + python-rangehttpserver | 23 | nwdiag | 22 | python-demjson | 22 | python-zstd | 22 | @@ -143,71 +143,70 @@ Last-Update: Thu, 26 Jun 2025 01:42:04 +0000 nwg-displays | 18 | django-environ | 17 | pykwalify | 17 | + python-translationstring | 17 | + sphinxcontrib-log-cabinet | 17 | webtest | 17 | + beancount | 16 | flask-security | 16 | mistune0 | 16 | social-auth-core | 16 | sphinxcontrib-actdiag | 16 | - sphinxcontrib-log-cabinet | 16 | sphinxcontrib-nwdiag | 16 | policyd-rate-limit | 15 | python-ethtool | 15 | python-pyalsa | 15 | - python-translationstring | 15 | todoman | 15 | + python-hupper | 14 | python-inotify | 14 | python-pem | 14 | python-slip10 | 14 | unearth | 14 | - beancount | 13 | junos-eznc | 13 | pdm | 13 | - pylint-common | 13 | python-priority | 13 | - python-simpy | 13 | + ruff | 13 | + beancount | 12 | flask-paranoid | 12 | jschema-to-python | 12 | notebook-shim | 12 | + pylint-common | 12 | pyp | 12 | python-dbussy | 12 | - python-hupper | 12 | + python-kyotocabinet | 12 | python-parse-type | 12 | python-pyscss | 12 | python-sarif-python-om | 12 | + python-simpy | 12 | python-xtermcolor | 12 | + speaklater | 12 | + txt2tags | 12 | gmplot | 11 | - python-kyotocabinet | 11 | - python-pyrss2gen | 11 | - ruff | 11 | - speaklater | 11 | - txt2tags | 11 | + gtextfsm | 11 | ansi | 10 | autotiling | 10 | btchip-python | 10 | - gtextfsm | 10 | - pwntools | 10 | - python-digitalocean | 10 | python-pyld | 10 | + python-pyrss2gen | 10 | slimit | 10 | tuna | 10 | - beancount | 9 | - debiancontributors | 9 | django-auditlog | 9 | - flask-session | 9 | + pwntools | 9 | + python-digitalocean | 9 | sphinx-intl | 9 | traittypes | 9 | - clustershell | 8 | + debiancontributors | 8 | django-sass | 8 | drf-yasg-nonfree | 8 | + flask-session | 8 | htmlmin | 8 | httpcode | 8 | micropython-mpremote | 8 | - python-aiohttp-security | 8 | + python-ansicolors | 8 | python-crcelk | 8 | python-drf-spectacular-sidecar-nonfree | 8 | - python-numpysane | 8 | python-pyaml-env | 8 | python-versioneer | 8 | + clustershell | 7 | drf-extensions | 7 | flask-api | 7 | graphql-relay | 7 | @@ -215,7 +214,8 @@ Last-Update: Thu, 26 Jun 2025 01:42:04 +0000 pytaglib | 7 | pytest-django | 7 | pytest-runner | 7 | - python-ansicolors | 7 | + python-aiohttp-security | 7 | + python-numpysane | 7 | python-overpy | 7 | trac-wysiwyg | 7 | voltron | 7 | @@ -226,12 +226,9 @@ Last-Update: Thu, 26 Jun 2025 01:42:04 +0000 mypy-protobuf | 6 | pybik | 6 | pydrive2 | 6 | - python3-onelogin-saml2 | 6 | python-biplist | 6 | python-envs | 6 | - python-gnuplotlib | 6 | python-halo | 6 | - west | 6 | django-jinja | 5 | django-paintstore | 5 | django-pglocks | 5 | @@ -241,13 +238,17 @@ Last-Update: Thu, 26 Jun 2025 01:42:04 +0000 numpy-stl | 5 | pyjokes | 5 | pynliner | 5 | + python3-onelogin-saml2 | 5 | + python-gnuplotlib | 5 | python-openstep-plist | 5 | python-simpy | 5 | ruff | 5 | sphinxcontrib-globalsubs | 5 | + west | 5 | aiomysql | 4 | bootstrap-flask | 4 | clustershell | 4 | + cplay-ng | 4 | cram | 4 | django-bitfield | 4 | django-js-reverse | 4 | @@ -256,6 +257,7 @@ Last-Update: Thu, 26 Jun 2025 01:42:04 +0000 django-xmlrpc | 4 | flask-flatpages | 4 | flufl.testing | 4 | + pyclamd | 4 | pyfltk | 4 | pyjunitxml | 4 | pyroma | 4 | @@ -264,6 +266,7 @@ Last-Update: Thu, 26 Jun 2025 01:42:04 +0000 python-django-casclient | 4 | python-django-contact-form | 4 | python-django-registration | 4 | + python-jpype | 4 | python-networkmanager | 4 | python-srp | 4 | python-xdo | 4 | @@ -271,8 +274,6 @@ Last-Update: Thu, 26 Jun 2025 01:42:04 +0000 securestring | 4 | smem | 4 | sorl-thumbnail | 4 | - sphinx-markdown-tables | 4 | - cplay-ng | 3 | django-macaddress | 3 | django-pagination | 3 | django-render-block | 3 | @@ -287,19 +288,19 @@ Last-Update: Thu, 26 Jun 2025 01:42:04 +0000 okasha | 3 | orsopy | 3 | proglog | 3 | - pyclamd | 3 | pylint-celery | 3 | pyprind | 3 | pytest-expect | 3 | + python-btrees | 3 | python-django-push-notifications | 3 | - python-dynaconf | 3 | python-ipfix | 3 | - python-jpype | 3 | python-markuppy | 3 | + python-text-unidecode | 3 | python-webdavclient | 3 | requests-aws | 3 | slimit | 3 | soundcraft-utils | 3 | + sphinx-markdown-tables | 3 | sphinx-paramlinks | 3 | testrepository | 3 | trac-accountmanager | 3 | @@ -330,13 +331,14 @@ Last-Update: Thu, 26 Jun 2025 01:42:04 +0000 panoramisk | 2 | pykwalify | 2 | pypass | 2 | + pyrad | 2 | python-bitbucket-api | 2 | - python-btrees | 2 | python-chartkick | 2 | python-commentjson | 2 | python-dbus-next | 2 | python-deepmerge | 2 | python-dnsq | 2 | + python-dynaconf | 2 | python-ephemeral-port-reserve | 2 | python-funcy | 2 | python-gammu | 2 | @@ -350,7 +352,6 @@ Last-Update: Thu, 26 Jun 2025 01:42:04 +0000 python-py-zipkin | 2 | python-qtpynodeeditor | 2 | python-securesystemslib | 2 | - python-text-unidecode | 2 | python-urlobject | 2 | redis-py-cluster | 2 | sphinxtesters | 2 | @@ -366,6 +367,7 @@ Last-Update: Thu, 26 Jun 2025 01:42:04 +0000 errbot | 1 | flask-multistatic | 1 | fypp | 1 | + jpy | 1 | jupyter-sphinx | 1 | korean-lunar-calendar | 1 | milksnake | 1 | @@ -376,7 +378,6 @@ Last-Update: Thu, 26 Jun 2025 01:42:04 +0000 power | 1 | prospector | 1 | pynag | 1 | - pyrad | 1 | python-banal | 1 | python-bottle-cork | 1 | python-bottle-sqlite | 1 | @@ -457,7 +458,6 @@ Last-Update: Thu, 26 Jun 2025 01:42:04 +0000 humanfriendly | 0 | hypothesis-auto | 0 | ikos | 0 | - jpy | 0 | jpylyzer | 0 | kivy | 0 | libthumbor | 0 | View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/81c7bf17bfb708f7ec35c461b0fe2a04a160e987 -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/81c7bf17bfb708f7ec35c461b0fe2a04a160e987 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Fri Jun 27 02:43:36 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Fri, 27 Jun 2025 01:43:36 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <685df748f1e90_3db2342b724571823a@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: f81b10a2 by Andreas Tille at 2025-06-27T01:43:33+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Thu, 26 Jun 2025 13:42:04 +0000 +Last-Update: Fri, 27 Jun 2025 01:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- ===================================== debian-science-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Thu, 26 Jun 2025 13:42:08 +0000 +Last-Update: Fri, 27 Jun 2025 01:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Thu, 26 Jun 2025 13:42:12 +0000 +Last-Update: Fri, 27 Jun 2025 01:42:05 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/f81b10a2f3b46d41cd2e9bf93cb091ab4f5f572b -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/f81b10a2f3b46d41cd2e9bf93cb091ab4f5f572b You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Fri Jun 27 14:43:39 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Fri, 27 Jun 2025 13:43:39 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <685ea00b9f130_3db2397f56858250ca@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: 9741070d by Andreas Tille at 2025-06-27T13:43:30+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,63 +1,52 @@ -Last-Update: Fri, 27 Jun 2025 01:42:04 +0000 +Last-Update: Fri, 27 Jun 2025 13:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- dicomscope | 26 | {imaging} | - oscar | 18 | {data,tools,practice} | orthanc-gdcm | 17 | {imaging} | + oscar | 17 | {data,tools,practice} | mrtrix3 | 15 | {imaging} | pixelmed | 12 | {imaging} | gnumed-server | 11 | {covid-19,practice} | - bart-view | 10 | {imaging} | - king | 10 | {typesetting,imaging} | orthanc-mysql | 10 | {imaging} | - adun.app | 9 | {bio} | + bart-view | 9 | {imaging} | + king | 9 | {typesetting,imaging} | orthanc-postgresql | 9 | {imaging} | sight | 9 | {imaging} | - icb-utils | 8 | {bio-dev} | + adun.app | 8 | {bio} | libminc | 8 | {imaging-dev} | heudiconv | 7 | {imaging} | + icb-utils | 7 | {bio-dev} | mia | 6 | {imaging} | - jebl2 | 5 | {bio-dev} | - biojava-live | 4 | {bio-dev} | + jebl2 | 4 | {bio-dev} | sight | 4 | {imaging} | biojava6-live | 3 | {bio-dev} | - getdata | 3 | {bio} | + biojava-live | 3 | {bio-dev} | insighttoolkit5 | 3 | {imaging-dev} | piler | 3 | {bio} | ants | 2 | {imaging} | - beast-mcmc | 2 | {bio,bio-phylogeny} | - bio-tradis | 2 | {bio,bio-dev} | - cmtk | 2 | {imaging} | - fastml | 2 | {bio} | - ipig | 2 | {bio} | + getdata | 2 | {bio} | libdivsufsort | 2 | {bio-dev} | - pbcopper | 2 | {bio-dev} | - pbseqlib | 2 | {bio-dev} | plasmidid | 2 | {covid-19,bio} | rambo-k | 2 | {bio} | tracetuner | 2 | {bio} | - blimps | 1 | {bio} | - brig | 1 | {bio} | + beast-mcmc | 1 | {bio,bio-phylogeny} | + bio-tradis | 1 | {bio,bio-dev} | + cmtk | 1 | {imaging} | ctn | 1 | {imaging-dev} | - cufflinks | 1 | {cloud,bio} | dextractor | 1 | {bio,covid-19} | eegdev | 1 | {imaging-dev} | elastix | 1 | {imaging} | - emboss-explorer | 1 | {bio} | - hinge | 1 | {bio} | + fastml | 1 | {bio} | htscodecs | 1 | {bio-dev,covid-19} | - jmodeltest | 1 | {bio,bio-phylogeny} | - lamarc | 1 | {bio} | - libbio-mage-utils-perl | 1 | {bio-dev} | - libchado-perl | 1 | {bio-dev} | + ipig | 1 | {bio} | libgenome | 1 | {bio-dev} | - libpal-java | 1 | {bio-dev} | - librg-utils-perl | 1 | {bio} | melting | 1 | {cloud,bio} | mhap | 1 | {bio,bio-ngs} | ncbi-vdb | 1 | {bio-dev} | papyrus | 1 | {imaging-dev} | + pbcopper | 1 | {bio-dev} | + pbseqlib | 1 | {bio-dev} | phyutility | 1 | {cloud,bio} | proalign | 1 | {bio-phylogeny,bio} | runcircos-gui | 1 | {bio} | @@ -76,16 +65,24 @@ Last-Update: Fri, 27 Jun 2025 01:42:04 +0000 bambamc | 0 | {bio-dev} | biojava4-live | 0 | {bio-dev} | biosyntax | 0 | {bio} | + blimps | 0 | {bio} | + brig | 0 | {bio} | camp | 0 | {imaging-dev} | capsule-maven-nextflow | 0 | {bio-dev} | ctffind | 0 | {bio} | + cufflinks | 0 | {cloud,bio} | embassy-domainatrix | 0 | {cloud,bio} | embassy-domalign | 0 | {bio,cloud} | embassy-domsearch | 0 | {cloud,bio} | + emboss-explorer | 0 | {bio} | fis-gtm | 0 | {his} | gatk-bwamem | 0 | {bio-dev} | gatk-fermilite | 0 | {bio-dev} | + hinge | 0 | {bio} | + jmodeltest | 0 | {bio,bio-phylogeny} | kmerresistance | 0 | {bio} | + lamarc | 0 | {bio} | + libbio-mage-utils-perl | 0 | {bio-dev} | libbioparser-dev | 0 | {bio-dev} | libbiosoup-dev | 0 | {bio-dev} | libbpp-core | 0 | {bio-dev} | @@ -95,6 +92,7 @@ Last-Update: Fri, 27 Jun 2025 01:42:04 +0000 libbpp-raa | 0 | {bio-dev} | libbpp-seq | 0 | {bio-dev} | libbpp-seq-omics | 0 | {bio-dev} | + libchado-perl | 0 | {bio-dev} | libctapimkt | 0 | {practice} | libgkarrays | 0 | {bio-dev} | libhmsbeagle | 0 | {bio-dev} | @@ -104,9 +102,11 @@ Last-Update: Fri, 27 Jun 2025 01:42:04 +0000 libmems | 0 | {bio-dev} | libmialm | 0 | {imaging-dev} | libmuscle | 0 | {bio-dev} | + libpal-java | 0 | {bio-dev} | libpsortb | 0 | {bio-dev} | libqes | 0 | {bio-dev} | librdp-taxonomy-tree-java | 0 | {bio-dev} | + librg-utils-perl | 0 | {bio} | libseqlib | 0 | {bio-dev} | libstatgen | 0 | {bio-dev} | libvbz-hdf-plugin | 0 | {bio-dev} | @@ -131,16 +131,16 @@ Last-Update: Fri, 27 Jun 2025 01:42:04 +0000 pscan-chip | 0 | {bio} | pymia | 0 | {imaging-dev} | python-cgelib | 0 | {bio-dev} | - python-seqcluster | 0 | {bio-dev,covid-19} | python-seqcluster | 0 | {bio} | + python-seqcluster | 0 | {bio-dev,covid-19} | qcumber | 0 | {bio} | rdp-alignment | 0 | {bio} | rdp-classifier | 0 | {bio} | resfinder-db | 0 | {bio} | rtax | 0 | {bio,cloud} | saint | 0 | {bio} | - savvy | 0 | {bio} | savvy | 0 | {bio-dev} | + savvy | 0 | {bio} | sbmltoolbox | 0 | {bio-dev} | sibsim4 | 0 | {cloud,bio} | sift | 0 | {bio} | ===================================== debian-science-tests.txt ===================================== @@ -1,140 +1,134 @@ -Last-Update: Fri, 27 Jun 2025 01:42:04 +0000 +Last-Update: Fri, 27 Jun 2025 13:42:08 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- - nltk | 4789 | {linguistics} | - gts | 4691 | {viewing} | - opencascade | 597 | {simulations} | - spacenavd | 228 | {tools} | - armadillo | 178 | {mathematics-dev} | - open-coarrays | 174 | {meteorology-dev} | - arpack | 84 | {mathematics-dev} | - scalapack | 51 | {nanoscale-physics-dev} | - visidata | 44 | {datamanagement} | - ntl | 41 | {mathematics-dev} | + nltk | 4806 | {linguistics} | + gts | 4657 | {viewing} | + opencascade | 594 | {simulations} | + spacenavd | 226 | {tools} | + armadillo | 179 | {mathematics-dev} | + open-coarrays | 166 | {meteorology-dev} | + arpack | 82 | {mathematics-dev} | + scalapack | 49 | {nanoscale-physics-dev} | + visidata | 45 | {datamanagement} | + ntl | 40 | {mathematics-dev} | imview | 39 | {viewing} | - mbpoll | 34 | {simulations} | - ppl | 33 | {numericalcomputation} | - flintqs | 31 | {mathematics} | - libmatio | 28 | {mathematics-dev} | - arduino-mk | 25 | {robotics} | - cliquer | 25 | {mathematics} | - flann | 24 | {mathematics-dev,engineering-dev} | - libm4ri | 24 | {mathematics-dev} | + mbpoll | 32 | {simulations} | + ppl | 32 | {numericalcomputation} | + flintqs | 29 | {mathematics} | + libmatio | 27 | {mathematics-dev} | + flann | 25 | {mathematics-dev,engineering-dev} | + arduino-mk | 24 | {robotics} | + cliquer | 24 | {mathematics} | + libm4ri | 23 | {mathematics-dev} | xygrib | 23 | {meteorology} | setzer | 22 | {typesetting} | - sat4j | 20 | {logic} | grads | 19 | {meteorology} | - guiqwt | 19 | {numericalcomputation,viewing} | - bossa | 18 | {devices} | - fftw | 18 | {mathematics-dev,physics-dev,meteorology-dev} | - picosat | 18 | {logic} | - lrcalc | 16 | {mathematics-dev} | - sketch | 16 | {typesetting} | - gts | 15 | {viewing-dev} | + sat4j | 19 | {logic} | + guiqwt | 18 | {numericalcomputation,viewing} | + fftw | 17 | {mathematics-dev,physics-dev,meteorology-dev} | + picosat | 17 | {logic} | + bossa | 15 | {devices} | + lrcalc | 15 | {mathematics-dev} | ncl | 15 | {meteorology} | pyzo | 15 | {numericalcomputation} | - eccodes | 14 | {meteorology,meteorology-dev} | - cliquer | 13 | {mathematics-dev} | + sketch | 15 | {typesetting} | + gts | 14 | {viewing-dev} | + teem | 14 | {imageanalysis} | + eccodes | 13 | {meteorology,meteorology-dev} | libitpp | 13 | {mathematics-dev,engineering-dev} | - teem | 13 | {imageanalysis} | + cliquer | 12 | {mathematics-dev} | dune-uggrid | 12 | {mathematics-dev} | feff85exafs | 12 | {chemistry} | - gf2x | 12 | {mathematics-dev} | lxi-tools | 12 | {engineering,dataacquisition} | matlab-support | 12 | {mathematics,numericalcomputation} | + pcl | 12 | {robotics-dev} | eccodes | 11 | {meteorology-dev} | - iml | 11 | {mathematics-dev} | - libhomfly | 11 | {mathematics-dev} | - pcl | 11 | {robotics-dev} | + gf2x | 11 | {mathematics-dev} | coinor-symphony | 10 | {logic,mathematics,numericalcomputation} | feedgnuplot | 10 | {viewing} | - libm4rie | 10 | {mathematics-dev} | + iml | 10 | {mathematics-dev} | + libhomfly | 10 | {mathematics-dev} | ncl | 10 | {meteorology-dev} | - form | 9 | {mathematics} | - geg | 9 | {viewing} | + libm4rie | 9 | {mathematics-dev} | python-escript | 9 | {numericalcomputation,simulations,engineering} | + geg | 8 | {viewing} | metar | 8 | {meteorology} | - python-cdo | 8 | {meteorology} | - ratpoints | 8 | {mathematics-dev} | + opencascade | 8 | {simulations} | vdt | 8 | {mathematics-dev} | alberta | 7 | {engineering-dev} | - apophenia | 7 | {statistics} | + form | 7 | {mathematics} | libccp4 | 7 | {nanoscale-physics-dev} | - libzn-poly | 7 | {mathematics-dev} | - opencascade | 7 | {simulations} | + python-cdo | 7 | {meteorology} | + ratpoints | 7 | {mathematics-dev} | refmac-dictionary | 7 | {highenergy-physics-dev,chemistry} | + apophenia | 6 | {statistics} | cld2 | 6 | {linguistics} | - dxsamples | 6 | {nanoscale-physics} | - fftw | 6 | {meteorology-dev,mathematics-dev,physics-dev} | - magics++ | 6 | {meteorology-dev} | - odc | 6 | {meteorology} | - odc | 6 | {meteorology-dev} | + libzn-poly | 6 | {mathematics-dev} | persalys | 6 | {engineering,statistics,mathematics} | psurface | 6 | {numericalcomputation} | ros-rosconsole | 6 | {robotics-dev} | toulbar2 | 6 | {logic,numericalcomputation,mathematics,physics} | uctodata | 6 | {linguistics} | urdfdom-headers | 6 | {robotics-dev} | - etsf-io | 5 | {physics,nanoscale-physics} | + dxsamples | 5 | {nanoscale-physics} | + fftw | 5 | {meteorology-dev,mathematics-dev,physics-dev} | fpzip | 5 | {meteorology} | + magics++ | 5 | {meteorology-dev} | newmat | 5 | {mathematics-dev} | + odc | 5 | {meteorology} | + odc | 5 | {meteorology-dev} | persalys | 5 | {statistics,mathematics,engineering} | - rheolef | 5 | {mathematics} | rubiks | 5 | {geometry,mathematics} | toontag | 5 | {numericalcomputation} | ucto | 5 | {linguistics} | veccore | 5 | {mathematics-dev} | - atlas-ecmwf | 4 | {meteorology} | - auto-07p | 4 | {mathematics} | - coda | 4 | {meteorology-dev} | - coda | 4 | {meteorology} | - debian-science | 4 | {physics,machine-learning,economics,nanoscale-physics} | debian-science | 4 | {economics,nanoscale-physics,machine-learning,physics,mathematics} | - getdp | 4 | {engineering,mathematics,simulations} | - gsw | 4 | {meteorology} | - iapws | 4 | {meteorology} | + debian-science | 4 | {physics,machine-learning,economics,nanoscale-physics} | + etsf-io | 4 | {physics,nanoscale-physics} | muparser | 4 | {mathematics-dev} | openstereogram | 4 | {tools} | + rheolef | 4 | {mathematics} | sardana | 4 | {dataacquisition} | sdpb | 4 | {numericalcomputation,highenergy-physics} | silo-llnl | 4 | {engineering} | syrthes | 4 | {engineering} | toon | 4 | {numericalcomputation} | - apertium-eval-translator | 3 | {linguistics} | - cmor | 3 | {meteorology} | - drslib | 3 | {meteorology} | + atlas-ecmwf | 3 | {meteorology} | + auto-07p | 3 | {mathematics} | + coda | 3 | {meteorology-dev} | + coda | 3 | {meteorology} | dxflib | 3 | {engineering-dev} | ecbuild | 3 | {meteorology-dev} | emoslib | 3 | {meteorology-dev} | - harp | 3 | {meteorology} | + getdp | 3 | {engineering,mathematics,simulations} | + gsw | 3 | {meteorology} | hdf-eos5 | 3 | {meteorology-dev} | + iapws | 3 | {meteorology} | ipe-tools | 3 | {typesetting} | - irstlm | 3 | {linguistics} | libcgns | 3 | {engineering} | libgctp | 3 | {meteorology-dev} | - libmatheval | 3 | {mathematics} | libvigraimpex | 3 | {imageanalysis-dev,machine-learning} | - lrcalc | 3 | {mathematics} | metview | 3 | {meteorology} | + mpi4py-fft | 3 | {mathematics-dev} | polylib | 3 | {mathematics} | - python-aws-xray-sdk | 3 | {dataacquisition-dev} | ros-vcstool | 3 | {robotics-dev} | sac2mseed | 3 | {geography} | sagemath-database-conway-polynomials | 3 | {mathematics} | scram | 3 | {engineering} | + silo-llnl | 3 | {engineering} | spaghetti | 3 | {geography} | + apertium-eval-translator | 2 | {linguistics} | apertium-streamparser | 2 | {linguistics} | apophenia | 2 | {statistics} | - atlas-ecmwf | 2 | {meteorology-dev} | clipper | 2 | {nanoscale-physics-dev} | + cmor | 2 | {meteorology} | coinor-bonmin | 2 | {mathematics} | cylc-flow | 2 | {meteorology} | - debian-science | 2 | {electrophysiology} | debian-science | 2 | {nanoscale-physics,statistics,economics,physics} | + debian-science | 2 | {electrophysiology} | debian-science | 2 | {economics} | - debian-science | 2 | {neuroscience-cognitive} | - dimbl | 2 | {linguistics} | + drslib | 2 | {meteorology} | dune-functions | 2 | {mathematics-dev} | dune-localfunctions | 2 | {mathematics-dev} | dune-typetree | 2 | {mathematics-dev} | @@ -142,32 +136,35 @@ Last-Update: Fri, 27 Jun 2025 01:42:04 +0000 fastjet | 2 | {highenergy-physics-dev} | frog | 2 | {linguistics} | gemmlowp | 2 | {mathematics-dev} | + harp | 2 | {meteorology} | hpcc | 2 | {numericalcomputation,distributedcomputing} | ipe-tools | 2 | {typesetting} | + irstlm | 2 | {linguistics} | libcvd | 2 | {imageanalysis} | libgtkdatabox | 2 | {engineering-dev,viewing-dev} | + libmatheval | 2 | {mathematics} | libmatheval | 2 | {mathematics-dev} | + lrcalc | 2 | {mathematics} | metkit | 2 | {meteorology} | mmdb | 2 | {nanoscale-physics-dev,highenergy-physics-dev} | - mpi4py-fft | 2 | {mathematics-dev} | mseed2sac | 2 | {dataacquisition-dev} | ncrystal | 2 | {nanoscale-physics-dev,highenergy-physics-dev} | nrn-iv | 2 | {biology} | + python-aws-xray-sdk | 2 | {dataacquisition-dev} | qwtplot3d | 2 | {viewing-dev} | silo-llnl | 2 | {engineering-dev} | x13as | 2 | {economics} | apache-opennlp | 1 | {linguistics} | asl | 1 | {physics-dev} | - ckon | 1 | {highenergy-physics-dev} | - coda | 1 | {meteorology-dev} | + atlas-ecmwf | 1 | {meteorology-dev} | code-saturne | 1 | {mathematics-dev,engineering-dev} | - code-saturne | 1 | {engineering-dev,mathematics-dev} | coinmp | 1 | {logic,mathematics-dev,numericalcomputation} | - debian-science | 1 | {tools} | debian-science | 1 | {neuroscience-cognitive,machine-learning} | + debian-science | 1 | {neuroscience-cognitive} | debian-science | 1 | {psychophysics} | + debian-science | 1 | {tools} | + dimbl | 1 | {linguistics} | fpzip | 1 | {meteorology-dev} | - frogdata | 1 | {linguistics} | gadap | 1 | {meteorology-dev} | hdf-eos4 | 1 | {meteorology-dev} | hepmc3 | 1 | {nanoscale-physics-dev,highenergy-physics-dev} | @@ -179,14 +176,12 @@ Last-Update: Fri, 27 Jun 2025 01:42:04 +0000 liblxi | 1 | {engineering-dev,dataacquisition-dev} | liborigin2 | 1 | {viewing-dev} | libxsmm | 1 | {mathematics-dev} | - looptools | 1 | {highenergy-physics-dev} | mbt | 1 | {linguistics} | mbtserver | 1 | {linguistics} | metkit | 1 | {meteorology-dev} | mrmpi | 1 | {tools} | neartree | 1 | {mathematics-dev,numericalcomputation} | openmesh | 1 | {mathematics-dev} | - psurface | 1 | {numericalcomputation} | qd | 1 | {mathematics-dev} | ros-ros-environment | 1 | {robotics-dev} | schroedinger-coordgenlibs | 1 | {nanoscale-physics-dev,chemistry} | @@ -208,9 +203,11 @@ Last-Update: Fri, 27 Jun 2025 01:42:04 +0000 apertium-urd-hin | 0 | {linguistics} | apriltag | 0 | {robotics-dev} | calculix-ccx-test | 0 | {simulations,numericalcomputation,engineering} | + ckon | 0 | {highenergy-physics-dev} | clhep | 0 | {highenergy-physics-dev} | cmor | 0 | {meteorology-dev} | coda | 0 | {meteorology-dev} | + code-saturne | 0 | {engineering-dev,mathematics-dev} | code-saturne | 0 | {engineering} | collada-dom | 0 | {viewing-dev} | cqrlib | 0 | {mathematics-dev} | @@ -221,6 +218,7 @@ Last-Update: Fri, 27 Jun 2025 01:42:04 +0000 dune-grid-glue | 0 | {mathematics-dev} | etsf-io | 0 | {nanoscale-physics-dev} | fastjet | 0 | {highenergy-physics-dev} | + frogdata | 0 | {linguistics} | glpk-java | 0 | {mathematics-dev} | libdogleg | 0 | {mathematics-dev} | libfolia | 0 | {linguistics} | @@ -232,12 +230,13 @@ Last-Update: Fri, 27 Jun 2025 01:42:04 +0000 mbt | 0 | {linguistics} | mctc-lib | 0 | {nanoscale-physics-dev,highenergy-physics-dev} | meshsdfilter | 0 | {mathematics-dev} | - metis-edf | 0 | {engineering,numericalcomputation} | metis-edf | 0 | {engineering-dev} | + metis-edf | 0 | {engineering,numericalcomputation} | nrn-mod2c | 0 | {biology} | openctm | 0 | {physics-dev} | opengv | 0 | {geometry} | openigtlink | 0 | {robotics-dev} | + psurface | 0 | {numericalcomputation} | python-escript | 0 | {numericalcomputation,simulations,engineering} | python-opcodes | 0 | {tools} | qrupdate | 0 | {mathematics-dev} | @@ -269,5 +268,5 @@ Last-Update: Fri, 27 Jun 2025 01:42:04 +0000 virtuoso-opensource | 0 | {datamanagement} | visp-images | 0 | {robotics-dev} | libelas | -1 | {robotics-dev} | -(297 rows) +(296 rows) ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,245 +1,237 @@ -Last-Update: Fri, 27 Jun 2025 01:42:05 +0000 +Last-Update: Fri, 27 Jun 2025 13:42:11 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- - mpmath | 9842 | - python-repoze.lru | 6977 | - netifaces | 5126 | - ghp-import | 4733 | - python-lunr | 4727 | - python-babel | 3793 | - sortedcontainers | 3475 | - python-babel | 3392 | - aiosignal | 2991 | - hyperlink | 2148 | - humanfriendly | 1991 | - python-notify2 | 1965 | - referencing | 1590 | - python-mysqldb | 1525 | + mpmath | 9833 | + python-repoze.lru | 6959 | + netifaces | 5114 | + ghp-import | 4749 | + python-lunr | 4743 | + python-babel | 3767 | + sortedcontainers | 3477 | + python-babel | 3361 | + aiosignal | 2990 | + hyperlink | 2136 | + humanfriendly | 1982 | + python-notify2 | 1962 | + referencing | 1600 | + python-mysqldb | 1529 | python-gssapi | 1457 | - python-invoke | 1388 | - python-hyperframe | 1381 | - websocket-client | 1297 | - python-hpack | 1170 | - python-rsa | 1127 | - python-pandocfilters | 1027 | - menulibre | 967 | - pdfarranger | 948 | + python-invoke | 1386 | + python-hyperframe | 1367 | + websocket-client | 1298 | + python-hpack | 1154 | + python-rsa | 1122 | + python-pandocfilters | 1035 | + menulibre | 966 | + pdfarranger | 936 | python-linux-procfs | 933 | - python-geoip | 857 | + python-geoip | 859 | python-webob | 824 | - powerline | 751 | - python-zopfli | 743 | + python-zopfli | 757 | + powerline | 750 | powerline | 700 | powerline | 695 | + firmware-microbit-micropython | 676 | kazam | 663 | - firmware-microbit-micropython | 639 | - u-msgpack-python | 581 | - python-et-xmlfile | 519 | - asn1crypto | 496 | - python-gevent | 495 | - dockerpty | 494 | - gaupol | 478 | - autopep8 | 470 | - python-ewmh | 445 | - catfish | 438 | - python-requests-oauthlib | 399 | - pytoolconfig | 377 | + u-msgpack-python | 578 | + python-et-xmlfile | 514 | + asn1crypto | 493 | + dockerpty | 493 | + python-gevent | 488 | + autopep8 | 475 | + gaupol | 474 | + python-ewmh | 450 | + catfish | 436 | + python-requests-oauthlib | 393 | + pytoolconfig | 379 | spf-engine | 344 | - python-toml | 337 | - python-ntlm-auth | 299 | - spf-engine | 295 | - django-stronghold | 262 | - python-ldap3 | 259 | - cairocffi | 217 | - python-mimeparse | 194 | - python-smmap | 173 | - python-hidapi | 166 | - autokey | 165 | - httpie | 146 | - python-anyjson | 134 | + python-toml | 330 | + python-ntlm-auth | 295 | + spf-engine | 294 | + django-stronghold | 267 | + python-ldap3 | 260 | + cairocffi | 210 | + python-mimeparse | 191 | + python-smmap | 170 | + python-hidapi | 168 | + autokey | 164 | + httpie | 145 | kivy | 133 | - smem | 130 | - python-aiostream | 126 | - mypaint | 123 | - smartypants | 122 | - python-click-repl | 118 | + python-anyjson | 132 | + smem | 131 | + python-aiostream | 127 | + mypaint | 124 | + smartypants | 123 | + python-click-repl | 117 | lollypop | 103 | - nodeenv | 101 | - mugshot | 99 | - python-consul | 98 | + nodeenv | 100 | + mugshot | 98 | timekpr-next | 98 | - python-pyu2f | 96 | + python-consul | 96 | pacparser | 95 | - pymacaroons | 91 | - python-rfc6555 | 87 | - pymediainfo | 84 | - pssh | 82 | - python-colour | 78 | - numpy-stl | 72 | + python-pyu2f | 94 | + pymacaroons | 92 | + pymediainfo | 86 | + python-rfc6555 | 86 | + pssh | 81 | + python-colour | 77 | + numpy-stl | 70 | python-i3ipc | 70 | - weasyprint | 68 | - pywavelets | 67 | - fabric | 66 | + weasyprint | 67 | python-pykka | 66 | - mitmproxy | 63 | - itstool | 57 | - pyenv | 53 | + pywavelets | 66 | + fabric | 63 | + mitmproxy | 61 | + itstool | 56 | + pyenv | 54 | mysql-connector-python | 52 | - python-looseversion | 52 | - python-scp | 52 | - ueberzug | 51 | - python-uritools | 50 | - khard | 49 | - pymacs | 49 | - blockdiag | 48 | + python-uritools | 52 | + ueberzug | 52 | + khard | 51 | + python-scp | 51 | + python-looseversion | 49 | + pymacs | 48 | + blockdiag | 47 | sshtunnel | 47 | kivy | 46 | - membernator | 44 | - python-pysol-cards | 44 | + membernator | 45 | + python-pysol-cards | 45 | trac | 44 | - hatchling | 42 | - show-in-file-manager | 42 | - pyquery | 41 | + show-in-file-manager | 43 | + hatchling | 41 | certipy | 40 | pamela | 40 | jupyterhub | 39 | - powerline-gitstatus | 39 | pylibmc | 39 | - pdfposter | 36 | - python-scrypt | 36 | - pssh | 34 | - persepolis | 32 | + pyquery | 39 | + powerline-gitstatus | 38 | + pdfposter | 37 | + python-scrypt | 35 | + pssh | 33 | dkimpy-milter | 29 | + persepolis | 29 | seqdiag | 29 | python-args | 28 | sphinxcontrib-blockdiag | 28 | sphinxcontrib-seqdiag | 27 | + sphinx-inline-tabs | 27 | rst2pdf | 26 | - sphinx-inline-tabs | 26 | - flask-principal | 25 | + depthcharge-tools | 25 | python-clint | 25 | python-statsd | 25 | - typogrify | 25 | video-downloader | 25 | - depthcharge-tools | 24 | enzyme | 24 | + typogrify | 24 | webpy | 24 | - cppman | 23 | - python-rangehttpserver | 23 | + flask-principal | 23 | + subliminal | 23 | + cppman | 22 | nwdiag | 22 | - python-demjson | 22 | - python-zstd | 22 | - subliminal | 22 | + python-rangehttpserver | 22 | fabric | 21 | + python-demjson | 21 | python-fire | 21 | + python-zstd | 21 | + subliminal | 21 | python-pysubs2 | 20 | python-sdnotify | 20 | - subliminal | 20 | backoff | 19 | spf-engine | 19 | actdiag | 18 | alot | 18 | nwg-displays | 18 | - django-environ | 17 | - pykwalify | 17 | - python-translationstring | 17 | sphinxcontrib-log-cabinet | 17 | webtest | 17 | - beancount | 16 | - flask-security | 16 | - mistune0 | 16 | - social-auth-core | 16 | + django-environ | 16 | + pykwalify | 16 | + python-translationstring | 16 | sphinxcontrib-actdiag | 16 | sphinxcontrib-nwdiag | 16 | + mistune0 | 15 | policyd-rate-limit | 15 | - python-ethtool | 15 | - python-pyalsa | 15 | + python-slip10 | 15 | + ruff | 15 | + social-auth-core | 15 | todoman | 15 | - python-hupper | 14 | - python-inotify | 14 | - python-pem | 14 | - python-slip10 | 14 | + beancount | 14 | + flask-security | 14 | + python-ethtool | 14 | unearth | 14 | junos-eznc | 13 | pdm | 13 | - python-priority | 13 | - ruff | 13 | - beancount | 12 | - flask-paranoid | 12 | - jschema-to-python | 12 | - notebook-shim | 12 | - pylint-common | 12 | + python-hupper | 13 | + python-inotify | 13 | + python-kyotocabinet | 13 | + python-pem | 13 | + python-pyalsa | 13 | pyp | 12 | python-dbussy | 12 | - python-kyotocabinet | 12 | - python-parse-type | 12 | - python-pyscss | 12 | - python-sarif-python-om | 12 | + python-priority | 12 | python-simpy | 12 | python-xtermcolor | 12 | speaklater | 12 | txt2tags | 12 | - gmplot | 11 | - gtextfsm | 11 | + flask-paranoid | 11 | + jschema-to-python | 11 | + pwntools | 11 | + pylint-common | 11 | + python-parse-type | 11 | + python-pyscss | 11 | + python-sarif-python-om | 11 | ansi | 10 | autotiling | 10 | + beancount | 10 | btchip-python | 10 | - python-pyld | 10 | - python-pyrss2gen | 10 | + gmplot | 10 | + gtextfsm | 10 | + notebook-shim | 10 | slimit | 10 | tuna | 10 | - django-auditlog | 9 | - pwntools | 9 | - python-digitalocean | 9 | + python-pyld | 9 | + python-pyrss2gen | 9 | sphinx-intl | 9 | traittypes | 9 | - debiancontributors | 8 | + django-auditlog | 8 | django-sass | 8 | - drf-yasg-nonfree | 8 | flask-session | 8 | - htmlmin | 8 | httpcode | 8 | - micropython-mpremote | 8 | python-ansicolors | 8 | - python-crcelk | 8 | - python-drf-spectacular-sidecar-nonfree | 8 | + python-digitalocean | 8 | python-pyaml-env | 8 | python-versioneer | 8 | clustershell | 7 | - drf-extensions | 7 | - flask-api | 7 | - graphql-relay | 7 | + drf-yasg-nonfree | 7 | + htmlmin | 7 | + micropython-mpremote | 7 | pycallgraph | 7 | pytaglib | 7 | pytest-django | 7 | pytest-runner | 7 | - python-aiohttp-security | 7 | - python-numpysane | 7 | + python-crcelk | 7 | + python-drf-spectacular-sidecar-nonfree | 7 | python-overpy | 7 | trac-wysiwyg | 7 | voltron | 7 | - django-model-utils | 6 | - easyprocess | 6 | - librouteros | 6 | + debiancontributors | 6 | + drf-extensions | 6 | + flask-api | 6 | + graphql-relay | 6 | mercurial-evolve | 6 | mypy-protobuf | 6 | pybik | 6 | pydrive2 | 6 | - python-biplist | 6 | - python-envs | 6 | + python-aiohttp-security | 6 | python-halo | 6 | - django-jinja | 5 | - django-paintstore | 5 | - django-pglocks | 5 | - drf-haystack | 5 | + python-numpysane | 6 | + django-model-utils | 5 | + easyprocess | 5 | hachoir | 5 | - htmlmin | 5 | - numpy-stl | 5 | pyjokes | 5 | pynliner | 5 | - python3-onelogin-saml2 | 5 | - python-gnuplotlib | 5 | + python-biplist | 5 | + python-envs | 5 | + python-networkmanager | 5 | python-openstep-plist | 5 | python-simpy | 5 | ruff | 5 | @@ -247,42 +239,44 @@ Last-Update: Fri, 27 Jun 2025 01:42:05 +0000 west | 5 | aiomysql | 4 | bootstrap-flask | 4 | - clustershell | 4 | cplay-ng | 4 | - cram | 4 | - django-bitfield | 4 | - django-js-reverse | 4 | - django-redis-sessions | 4 | - django-simple-redis-admin | 4 | - django-xmlrpc | 4 | - flask-flatpages | 4 | - flufl.testing | 4 | + django-jinja | 4 | + django-paintstore | 4 | + django-pglocks | 4 | + drf-haystack | 4 | + htmlmin | 4 | + numpy-stl | 4 | pyclamd | 4 | pyfltk | 4 | pyjunitxml | 4 | pyroma | 4 | - python-cookies | 4 | + python3-onelogin-saml2 | 4 | python-dirq | 4 | - python-django-casclient | 4 | - python-django-contact-form | 4 | - python-django-registration | 4 | - python-jpype | 4 | - python-networkmanager | 4 | + python-gnuplotlib | 4 | python-srp | 4 | python-xdo | 4 | s3ql | 4 | - securestring | 4 | smem | 4 | sorl-thumbnail | 4 | + testrepository | 4 | + clustershell | 3 | + cram | 3 | + django-bitfield | 3 | + django-js-reverse | 3 | django-macaddress | 3 | django-pagination | 3 | + django-redis-sessions | 3 | django-render-block | 3 | + django-simple-redis-admin | 3 | django-templated-email | 3 | - etm | 3 | + django-xmlrpc | 3 | + flask-flatpages | 3 | flask-mongoengine | 3 | flask-paginate | 3 | + flufl.testing | 3 | jpylyzer | 3 | kconfiglib | 3 | + librouteros | 3 | logilab-constraint | 3 | mbed-test-wrapper | 3 | okasha | 3 | @@ -291,25 +285,25 @@ Last-Update: Fri, 27 Jun 2025 01:42:05 +0000 pylint-celery | 3 | pyprind | 3 | pytest-expect | 3 | - python-btrees | 3 | + python-cookies | 3 | + python-django-casclient | 3 | + python-django-contact-form | 3 | python-django-push-notifications | 3 | - python-ipfix | 3 | + python-django-registration | 3 | + python-jpype | 3 | python-markuppy | 3 | python-text-unidecode | 3 | + python-urlobject | 3 | python-webdavclient | 3 | - requests-aws | 3 | - slimit | 3 | + securestring | 3 | soundcraft-utils | 3 | sphinx-markdown-tables | 3 | sphinx-paramlinks | 3 | - testrepository | 3 | trac-accountmanager | 3 | trac-xmlrpc | 3 | wikitrans | 3 | azote | 2 | bqplot | 2 | - brebis | 2 | - django-ajax-selects | 2 | django-any-js | 2 | django-cachalot | 2 | django-cacheops | 2 | @@ -319,21 +313,17 @@ Last-Update: Fri, 27 Jun 2025 01:42:05 +0000 django-maintenance-mode | 2 | django-yarnpkg | 2 | dotdrop | 2 | + etm | 2 | extension-helpers | 2 | flake8-black | 2 | gtkman | 2 | hatch-jupyter-builder | 2 | - humanfriendly | 2 | imap-tools | 2 | - jsonrpclib-pelix | 2 | namecheap | 2 | omgifol | 2 | panoramisk | 2 | pykwalify | 2 | - pypass | 2 | pyrad | 2 | - python-bitbucket-api | 2 | - python-chartkick | 2 | python-commentjson | 2 | python-dbus-next | 2 | python-deepmerge | 2 | @@ -341,33 +331,31 @@ Last-Update: Fri, 27 Jun 2025 01:42:05 +0000 python-dynaconf | 2 | python-ephemeral-port-reserve | 2 | python-funcy | 2 | - python-gammu | 2 | - python-getdns | 2 | python-gfloat | 2 | + python-ipfix | 2 | python-netfilterqueue | 2 | - python-openshift | 2 | - python-opentracing | 2 | python-pgmagick | 2 | python-pysubs2 | 2 | - python-py-zipkin | 2 | python-qtpynodeeditor | 2 | python-securesystemslib | 2 | - python-urlobject | 2 | redis-py-cluster | 2 | + requests-aws | 2 | + slimit | 2 | sphinxtesters | 2 | utidylib | 2 | vcversioner | 2 | - vf1 | 2 | yotta | 2 | zabbix-cli | 2 | apkinspector | 1 | - backupchecker | 1 | + brebis | 1 | celery-progress | 1 | - codicefiscale | 1 | + django-ajax-selects | 1 | + enlighten | 1 | errbot | 1 | - flask-multistatic | 1 | fypp | 1 | + humanfriendly | 1 | jpy | 1 | + jsonrpclib-pelix | 1 | jupyter-sphinx | 1 | korean-lunar-calendar | 1 | milksnake | 1 | @@ -377,22 +365,26 @@ Last-Update: Fri, 27 Jun 2025 01:42:05 +0000 onetimepass | 1 | power | 1 | prospector | 1 | - pynag | 1 | + pypass | 1 | python-banal | 1 | - python-bottle-cork | 1 | - python-bottle-sqlite | 1 | + python-bitbucket-api | 1 | python-broadlink | 1 | + python-btrees | 1 | + python-chartkick | 1 | python-dataset | 1 | python-fluent-logger | 1 | - python-fudge | 1 | + python-gammu | 1 | python-genson | 1 | + python-getdns | 1 | python-kanboard | 1 | python-libguess | 1 | python-meld3 | 1 | python-netfilter | 1 | python-noseofyeti | 1 | python-openid-cla | 1 | - python-pypump | 1 | + python-openshift | 1 | + python-opentracing | 1 | + python-py-zipkin | 1 | python-rdflib-endpoint | 1 | python-schedutils | 1 | python-sphinx-examples | 1 | @@ -400,6 +392,7 @@ Last-Update: Fri, 27 Jun 2025 01:42:05 +0000 python-undetected-chromedriver | 1 | python-vega-datasets | 1 | python-wither | 1 | + python-ytmusicapi | 1 | python-zc.customdoctests | 1 | pytkdocs | 1 | sphinx-autorun | 1 | @@ -408,6 +401,7 @@ Last-Update: Fri, 27 Jun 2025 01:42:05 +0000 trac-httpauth | 1 | trac-subcomponents | 1 | trac-wikiprint | 1 | + vf1 | 1 | vrfydmn | 1 | wchartype | 1 | wikitrans | 1 | @@ -419,6 +413,7 @@ Last-Update: Fri, 27 Jun 2025 01:42:05 +0000 aiotask-context | 0 | alot | 0 | aptly-api-client | 0 | + backupchecker | 0 | beangrow | 0 | beangulp | 0 | beanprice | 0 | @@ -426,6 +421,7 @@ Last-Update: Fri, 27 Jun 2025 01:42:05 +0000 bootstrap-flask | 0 | cairocffi | 0 | celery-haystack-ng | 0 | + codicefiscale | 0 | colorthief | 0 | concurrent-log-handler | 0 | customidenticon | 0 | @@ -446,6 +442,7 @@ Last-Update: Fri, 27 Jun 2025 01:42:05 +0000 firmware-microbit-micropython | 0 | flake8-pytest | 0 | flask-flatpages | 0 | + flask-multistatic | 0 | flask-paginate | 0 | flask-security | 0 | flask-session | 0 | @@ -486,6 +483,7 @@ Last-Update: Fri, 27 Jun 2025 01:42:05 +0000 pylibmc | 0 | pymediainfo | 0 | pyment | 0 | + pynag | 0 | pyssim | 0 | python3-simpleobsws | 0 | python-aiohttp-security | 0 | @@ -495,6 +493,8 @@ Last-Update: Fri, 27 Jun 2025 01:42:05 +0000 python-babel | 0 | python-betterproto | 0 | python-bottle-beaker | 0 | + python-bottle-cork | 0 | + python-bottle-sqlite | 0 | python-briefcase | 0 | python-brother-ql | 0 | python-btrees | 0 | View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/9741070d87a89b47694fa0db8e436f6f69c715e3 -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/9741070d87a89b47694fa0db8e436f6f69c715e3 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Sat Jun 28 02:44:35 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Sat, 28 Jun 2025 01:44:35 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <685f4903b21b2_3db24850de459175b9@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: af82bcde by Andreas Tille at 2025-06-28T01:43:25+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Fri, 27 Jun 2025 13:42:04 +0000 +Last-Update: Sat, 28 Jun 2025 01:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- ===================================== debian-science-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Fri, 27 Jun 2025 13:42:08 +0000 +Last-Update: Sat, 28 Jun 2025 01:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Fri, 27 Jun 2025 13:42:11 +0000 +Last-Update: Sat, 28 Jun 2025 01:42:05 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/af82bcdeffdae888c0202c6cc27f45715e6fc5fd -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/af82bcdeffdae888c0202c6cc27f45715e6fc5fd You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Sat Jun 28 14:46:22 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Sat, 28 Jun 2025 13:46:22 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <685ff22e9c981_3db254b22e0595238@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: e2470f44 by Andreas Tille at 2025-06-28T13:43:25+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,30 +1,30 @@ -Last-Update: Sat, 28 Jun 2025 01:42:04 +0000 +Last-Update: Sat, 28 Jun 2025 13:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- - dicomscope | 26 | {imaging} | + dicomscope | 27 | {imaging} | + oscar | 20 | {data,tools,practice} | orthanc-gdcm | 17 | {imaging} | - oscar | 17 | {data,tools,practice} | mrtrix3 | 15 | {imaging} | - pixelmed | 12 | {imaging} | + pixelmed | 14 | {imaging} | gnumed-server | 11 | {covid-19,practice} | + sight | 11 | {imaging} | + king | 10 | {typesetting,imaging} | orthanc-mysql | 10 | {imaging} | bart-view | 9 | {imaging} | - king | 9 | {typesetting,imaging} | + libminc | 9 | {imaging-dev} | orthanc-postgresql | 9 | {imaging} | - sight | 9 | {imaging} | adun.app | 8 | {bio} | - libminc | 8 | {imaging-dev} | + icb-utils | 8 | {bio-dev} | heudiconv | 7 | {imaging} | - icb-utils | 7 | {bio-dev} | mia | 6 | {imaging} | + sight | 5 | {imaging} | + insighttoolkit5 | 4 | {imaging-dev} | jebl2 | 4 | {bio-dev} | - sight | 4 | {imaging} | + ants | 3 | {imaging} | biojava6-live | 3 | {bio-dev} | biojava-live | 3 | {bio-dev} | - insighttoolkit5 | 3 | {imaging-dev} | piler | 3 | {bio} | - ants | 2 | {imaging} | getdata | 2 | {bio} | libdivsufsort | 2 | {bio-dev} | plasmidid | 2 | {covid-19,bio} | ===================================== debian-science-tests.txt ===================================== @@ -1,46 +1,46 @@ -Last-Update: Sat, 28 Jun 2025 01:42:04 +0000 +Last-Update: Sat, 28 Jun 2025 13:42:08 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- - nltk | 4806 | {linguistics} | - gts | 4657 | {viewing} | - opencascade | 594 | {simulations} | + nltk | 4812 | {linguistics} | + gts | 4604 | {viewing} | + opencascade | 588 | {simulations} | spacenavd | 226 | {tools} | - armadillo | 179 | {mathematics-dev} | - open-coarrays | 166 | {meteorology-dev} | - arpack | 82 | {mathematics-dev} | + armadillo | 178 | {mathematics-dev} | + open-coarrays | 164 | {meteorology-dev} | + arpack | 81 | {mathematics-dev} | scalapack | 49 | {nanoscale-physics-dev} | visidata | 45 | {datamanagement} | - ntl | 40 | {mathematics-dev} | - imview | 39 | {viewing} | + imview | 41 | {viewing} | + ntl | 41 | {mathematics-dev} | + ppl | 33 | {numericalcomputation} | mbpoll | 32 | {simulations} | - ppl | 32 | {numericalcomputation} | flintqs | 29 | {mathematics} | - libmatio | 27 | {mathematics-dev} | + arduino-mk | 27 | {robotics} | + libmatio | 26 | {mathematics-dev} | + cliquer | 25 | {mathematics} | flann | 25 | {mathematics-dev,engineering-dev} | - arduino-mk | 24 | {robotics} | - cliquer | 24 | {mathematics} | libm4ri | 23 | {mathematics-dev} | xygrib | 23 | {meteorology} | setzer | 22 | {typesetting} | - grads | 19 | {meteorology} | - sat4j | 19 | {logic} | + grads | 18 | {meteorology} | guiqwt | 18 | {numericalcomputation,viewing} | + sat4j | 18 | {logic} | + bossa | 17 | {devices} | fftw | 17 | {mathematics-dev,physics-dev,meteorology-dev} | - picosat | 17 | {logic} | - bossa | 15 | {devices} | + picosat | 16 | {logic} | + pyzo | 16 | {numericalcomputation} | + sketch | 16 | {typesetting} | lrcalc | 15 | {mathematics-dev} | ncl | 15 | {meteorology} | - pyzo | 15 | {numericalcomputation} | - sketch | 15 | {typesetting} | + teem | 15 | {imageanalysis} | gts | 14 | {viewing-dev} | - teem | 14 | {imageanalysis} | eccodes | 13 | {meteorology,meteorology-dev} | libitpp | 13 | {mathematics-dev,engineering-dev} | + lxi-tools | 13 | {engineering,dataacquisition} | cliquer | 12 | {mathematics-dev} | dune-uggrid | 12 | {mathematics-dev} | feff85exafs | 12 | {chemistry} | - lxi-tools | 12 | {engineering,dataacquisition} | matlab-support | 12 | {mathematics,numericalcomputation} | pcl | 12 | {robotics-dev} | eccodes | 11 | {meteorology-dev} | @@ -50,57 +50,56 @@ Last-Update: Sat, 28 Jun 2025 01:42:04 +0000 iml | 10 | {mathematics-dev} | libhomfly | 10 | {mathematics-dev} | ncl | 10 | {meteorology-dev} | + geg | 9 | {viewing} | libm4rie | 9 | {mathematics-dev} | python-escript | 9 | {numericalcomputation,simulations,engineering} | - geg | 8 | {viewing} | - metar | 8 | {meteorology} | opencascade | 8 | {simulations} | + persalys | 8 | {engineering,statistics,mathematics} | vdt | 8 | {mathematics-dev} | alberta | 7 | {engineering-dev} | form | 7 | {mathematics} | libccp4 | 7 | {nanoscale-physics-dev} | - python-cdo | 7 | {meteorology} | + metar | 7 | {meteorology} | + persalys | 7 | {statistics,mathematics,engineering} | ratpoints | 7 | {mathematics-dev} | refmac-dictionary | 7 | {highenergy-physics-dev,chemistry} | + urdfdom-headers | 7 | {robotics-dev} | apophenia | 6 | {statistics} | cld2 | 6 | {linguistics} | libzn-poly | 6 | {mathematics-dev} | - persalys | 6 | {engineering,statistics,mathematics} | psurface | 6 | {numericalcomputation} | - ros-rosconsole | 6 | {robotics-dev} | + python-cdo | 6 | {meteorology} | toulbar2 | 6 | {logic,numericalcomputation,mathematics,physics} | uctodata | 6 | {linguistics} | - urdfdom-headers | 6 | {robotics-dev} | + debian-science | 5 | {economics,nanoscale-physics,machine-learning,physics,mathematics} | dxsamples | 5 | {nanoscale-physics} | fftw | 5 | {meteorology-dev,mathematics-dev,physics-dev} | - fpzip | 5 | {meteorology} | magics++ | 5 | {meteorology-dev} | newmat | 5 | {mathematics-dev} | odc | 5 | {meteorology} | odc | 5 | {meteorology-dev} | - persalys | 5 | {statistics,mathematics,engineering} | + ros-rosconsole | 5 | {robotics-dev} | rubiks | 5 | {geometry,mathematics} | toontag | 5 | {numericalcomputation} | ucto | 5 | {linguistics} | veccore | 5 | {mathematics-dev} | - debian-science | 4 | {economics,nanoscale-physics,machine-learning,physics,mathematics} | debian-science | 4 | {physics,machine-learning,economics,nanoscale-physics} | etsf-io | 4 | {physics,nanoscale-physics} | muparser | 4 | {mathematics-dev} | openstereogram | 4 | {tools} | rheolef | 4 | {mathematics} | - sardana | 4 | {dataacquisition} | sdpb | 4 | {numericalcomputation,highenergy-physics} | silo-llnl | 4 | {engineering} | syrthes | 4 | {engineering} | toon | 4 | {numericalcomputation} | atlas-ecmwf | 3 | {meteorology} | auto-07p | 3 | {mathematics} | - coda | 3 | {meteorology-dev} | coda | 3 | {meteorology} | + coda | 3 | {meteorology-dev} | dxflib | 3 | {engineering-dev} | ecbuild | 3 | {meteorology-dev} | emoslib | 3 | {meteorology-dev} | + fpzip | 3 | {meteorology} | getdp | 3 | {engineering,mathematics,simulations} | gsw | 3 | {meteorology} | hdf-eos5 | 3 | {meteorology-dev} | @@ -115,6 +114,7 @@ Last-Update: Sat, 28 Jun 2025 01:42:04 +0000 ros-vcstool | 3 | {robotics-dev} | sac2mseed | 3 | {geography} | sagemath-database-conway-polynomials | 3 | {mathematics} | + sardana | 3 | {dataacquisition} | scram | 3 | {engineering} | silo-llnl | 3 | {engineering} | spaghetti | 3 | {geography} | @@ -125,9 +125,9 @@ Last-Update: Sat, 28 Jun 2025 01:42:04 +0000 cmor | 2 | {meteorology} | coinor-bonmin | 2 | {mathematics} | cylc-flow | 2 | {meteorology} | - debian-science | 2 | {nanoscale-physics,statistics,economics,physics} | - debian-science | 2 | {electrophysiology} | debian-science | 2 | {economics} | + debian-science | 2 | {electrophysiology} | + debian-science | 2 | {nanoscale-physics,statistics,economics,physics} | drslib | 2 | {meteorology} | dune-functions | 2 | {mathematics-dev} | dune-localfunctions | 2 | {mathematics-dev} | @@ -153,18 +153,16 @@ Last-Update: Sat, 28 Jun 2025 01:42:04 +0000 python-aws-xray-sdk | 2 | {dataacquisition-dev} | qwtplot3d | 2 | {viewing-dev} | silo-llnl | 2 | {engineering-dev} | - x13as | 2 | {economics} | apache-opennlp | 1 | {linguistics} | asl | 1 | {physics-dev} | atlas-ecmwf | 1 | {meteorology-dev} | code-saturne | 1 | {mathematics-dev,engineering-dev} | coinmp | 1 | {logic,mathematics-dev,numericalcomputation} | - debian-science | 1 | {neuroscience-cognitive,machine-learning} | debian-science | 1 | {neuroscience-cognitive} | + debian-science | 1 | {neuroscience-cognitive,machine-learning} | debian-science | 1 | {psychophysics} | debian-science | 1 | {tools} | dimbl | 1 | {linguistics} | - fpzip | 1 | {meteorology-dev} | gadap | 1 | {meteorology-dev} | hdf-eos4 | 1 | {meteorology-dev} | hepmc3 | 1 | {nanoscale-physics-dev,highenergy-physics-dev} | @@ -193,6 +191,7 @@ Last-Update: Sat, 28 Jun 2025 01:42:04 +0000 timblserver | 1 | {linguistics} | trilinos | 1 | {physics-dev,mathematics-dev,engineering-dev} | vlfeat | 1 | {imageanalysis-dev} | + x13as | 1 | {economics} | amgcl | 0 | {mathematics-dev} | apertium-afr-nld | 0 | {linguistics} | apertium-bel-rus | 0 | {linguistics} | @@ -207,8 +206,8 @@ Last-Update: Sat, 28 Jun 2025 01:42:04 +0000 clhep | 0 | {highenergy-physics-dev} | cmor | 0 | {meteorology-dev} | coda | 0 | {meteorology-dev} | - code-saturne | 0 | {engineering-dev,mathematics-dev} | code-saturne | 0 | {engineering} | + code-saturne | 0 | {engineering-dev,mathematics-dev} | collada-dom | 0 | {viewing-dev} | cqrlib | 0 | {mathematics-dev} | cvector | 0 | {mathematics-dev} | @@ -218,6 +217,7 @@ Last-Update: Sat, 28 Jun 2025 01:42:04 +0000 dune-grid-glue | 0 | {mathematics-dev} | etsf-io | 0 | {nanoscale-physics-dev} | fastjet | 0 | {highenergy-physics-dev} | + fpzip | 0 | {meteorology-dev} | frogdata | 0 | {linguistics} | glpk-java | 0 | {mathematics-dev} | libdogleg | 0 | {mathematics-dev} | @@ -230,8 +230,8 @@ Last-Update: Sat, 28 Jun 2025 01:42:04 +0000 mbt | 0 | {linguistics} | mctc-lib | 0 | {nanoscale-physics-dev,highenergy-physics-dev} | meshsdfilter | 0 | {mathematics-dev} | - metis-edf | 0 | {engineering-dev} | metis-edf | 0 | {engineering,numericalcomputation} | + metis-edf | 0 | {engineering-dev} | nrn-mod2c | 0 | {biology} | openctm | 0 | {physics-dev} | opengv | 0 | {geometry} | ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,240 +1,240 @@ -Last-Update: Sat, 28 Jun 2025 01:42:05 +0000 +Last-Update: Sat, 28 Jun 2025 13:42:11 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- - mpmath | 9833 | - python-repoze.lru | 6959 | - netifaces | 5114 | - ghp-import | 4749 | - python-lunr | 4743 | - python-babel | 3767 | - sortedcontainers | 3477 | - python-babel | 3361 | - aiosignal | 2990 | - hyperlink | 2136 | - humanfriendly | 1982 | - python-notify2 | 1962 | - referencing | 1600 | - python-mysqldb | 1529 | - python-gssapi | 1457 | - python-invoke | 1386 | + mpmath | 9826 | + python-repoze.lru | 6939 | + netifaces | 5097 | + ghp-import | 4754 | + python-lunr | 4748 | + python-babel | 3748 | + sortedcontainers | 3461 | + python-babel | 3350 | + aiosignal | 2986 | + hyperlink | 2138 | + humanfriendly | 1984 | + python-notify2 | 1963 | + referencing | 1610 | + python-mysqldb | 1530 | + python-gssapi | 1451 | + python-invoke | 1370 | python-hyperframe | 1367 | - websocket-client | 1298 | - python-hpack | 1154 | - python-rsa | 1122 | - python-pandocfilters | 1035 | - menulibre | 966 | - pdfarranger | 936 | - python-linux-procfs | 933 | - python-geoip | 859 | - python-webob | 824 | - python-zopfli | 757 | - powerline | 750 | - powerline | 700 | + websocket-client | 1294 | + python-hpack | 1148 | + python-rsa | 1113 | + python-pandocfilters | 1007 | + menulibre | 970 | + python-linux-procfs | 932 | + pdfarranger | 925 | + python-geoip | 863 | + python-webob | 821 | + python-zopfli | 764 | + powerline | 752 | powerline | 695 | - firmware-microbit-micropython | 676 | - kazam | 663 | - u-msgpack-python | 578 | - python-et-xmlfile | 514 | - asn1crypto | 493 | - dockerpty | 493 | - python-gevent | 488 | - autopep8 | 475 | - gaupol | 474 | + powerline | 689 | + firmware-microbit-micropython | 683 | + kazam | 665 | + u-msgpack-python | 576 | + python-et-xmlfile | 513 | + python-gevent | 494 | + asn1crypto | 490 | + dockerpty | 489 | + autopep8 | 468 | + gaupol | 466 | python-ewmh | 450 | - catfish | 436 | - python-requests-oauthlib | 393 | - pytoolconfig | 379 | - spf-engine | 344 | - python-toml | 330 | - python-ntlm-auth | 295 | - spf-engine | 294 | - django-stronghold | 267 | - python-ldap3 | 260 | - cairocffi | 210 | - python-mimeparse | 191 | - python-smmap | 170 | + catfish | 435 | + python-requests-oauthlib | 391 | + pytoolconfig | 374 | + spf-engine | 347 | + python-toml | 324 | + spf-engine | 297 | + python-ntlm-auth | 292 | + django-stronghold | 271 | + python-ldap3 | 257 | + cairocffi | 211 | + python-mimeparse | 195 | + python-smmap | 169 | python-hidapi | 168 | autokey | 164 | httpie | 145 | kivy | 133 | - python-anyjson | 132 | - smem | 131 | - python-aiostream | 127 | - mypaint | 124 | - smartypants | 123 | + python-anyjson | 133 | + smem | 129 | + mypaint | 128 | + python-aiostream | 128 | python-click-repl | 117 | - lollypop | 103 | - nodeenv | 100 | - mugshot | 98 | - timekpr-next | 98 | - python-consul | 96 | + smartypants | 117 | + nodeenv | 104 | + lollypop | 102 | + timekpr-next | 99 | + python-consul | 98 | + mugshot | 97 | pacparser | 95 | - python-pyu2f | 94 | - pymacaroons | 92 | - pymediainfo | 86 | - python-rfc6555 | 86 | - pssh | 81 | - python-colour | 77 | - numpy-stl | 70 | - python-i3ipc | 70 | + python-pyu2f | 92 | + pymacaroons | 91 | + pymediainfo | 89 | + python-rfc6555 | 89 | + pssh | 82 | + python-colour | 80 | + numpy-stl | 71 | + python-i3ipc | 71 | weasyprint | 67 | - python-pykka | 66 | - pywavelets | 66 | - fabric | 63 | - mitmproxy | 61 | - itstool | 56 | - pyenv | 54 | - mysql-connector-python | 52 | + python-pykka | 65 | + fabric | 64 | + pywavelets | 63 | + mitmproxy | 59 | + itstool | 58 | + pyenv | 55 | python-uritools | 52 | ueberzug | 52 | - khard | 51 | - python-scp | 51 | - python-looseversion | 49 | - pymacs | 48 | - blockdiag | 47 | - sshtunnel | 47 | + khard | 50 | + mysql-connector-python | 50 | + python-looseversion | 50 | + python-scp | 49 | + sshtunnel | 48 | + blockdiag | 46 | kivy | 46 | + pymacs | 46 | + show-in-file-manager | 46 | membernator | 45 | python-pysol-cards | 45 | - trac | 44 | - show-in-file-manager | 43 | + trac | 43 | hatchling | 41 | - certipy | 40 | - pamela | 40 | - jupyterhub | 39 | + certipy | 39 | + pamela | 39 | + pdfposter | 39 | pylibmc | 39 | pyquery | 39 | + jupyterhub | 38 | powerline-gitstatus | 38 | - pdfposter | 37 | - python-scrypt | 35 | - pssh | 33 | + python-scrypt | 34 | + pssh | 32 | + persepolis | 30 | dkimpy-milter | 29 | - persepolis | 29 | seqdiag | 29 | python-args | 28 | - sphinxcontrib-blockdiag | 28 | + sphinxcontrib-blockdiag | 27 | sphinxcontrib-seqdiag | 27 | - sphinx-inline-tabs | 27 | - rst2pdf | 26 | - depthcharge-tools | 25 | + depthcharge-tools | 26 | + python-statsd | 26 | + sphinx-inline-tabs | 26 | python-clint | 25 | - python-statsd | 25 | - video-downloader | 25 | + rst2pdf | 25 | enzyme | 24 | - typogrify | 24 | - webpy | 24 | - flask-principal | 23 | subliminal | 23 | + typogrify | 23 | + video-downloader | 23 | + webpy | 23 | cppman | 22 | + flask-principal | 22 | nwdiag | 22 | python-rangehttpserver | 22 | fabric | 21 | python-demjson | 21 | python-fire | 21 | - python-zstd | 21 | subliminal | 21 | python-pysubs2 | 20 | python-sdnotify | 20 | - backoff | 19 | + nwg-displays | 19 | + python-zstd | 19 | spf-engine | 19 | actdiag | 18 | alot | 18 | - nwg-displays | 18 | + backoff | 18 | + ruff | 17 | sphinxcontrib-log-cabinet | 17 | webtest | 17 | - django-environ | 16 | pykwalify | 16 | - python-translationstring | 16 | sphinxcontrib-actdiag | 16 | sphinxcontrib-nwdiag | 16 | - mistune0 | 15 | + beancount | 15 | + django-environ | 15 | policyd-rate-limit | 15 | python-slip10 | 15 | - ruff | 15 | - social-auth-core | 15 | + python-translationstring | 15 | todoman | 15 | - beancount | 14 | flask-security | 14 | - python-ethtool | 14 | + mistune0 | 14 | + social-auth-core | 14 | unearth | 14 | - junos-eznc | 13 | pdm | 13 | - python-hupper | 13 | + python-ethtool | 13 | python-inotify | 13 | python-kyotocabinet | 13 | - python-pem | 13 | python-pyalsa | 13 | + junos-eznc | 12 | pyp | 12 | python-dbussy | 12 | - python-priority | 12 | + python-hupper | 12 | + python-pem | 12 | python-simpy | 12 | python-xtermcolor | 12 | speaklater | 12 | txt2tags | 12 | + beancount | 11 | flask-paranoid | 11 | jschema-to-python | 11 | pwntools | 11 | pylint-common | 11 | python-parse-type | 11 | + python-priority | 11 | python-pyscss | 11 | python-sarif-python-om | 11 | ansi | 10 | autotiling | 10 | - beancount | 10 | btchip-python | 10 | - gmplot | 10 | - gtextfsm | 10 | - notebook-shim | 10 | slimit | 10 | tuna | 10 | + flask-session | 9 | + gmplot | 9 | + gtextfsm | 9 | python-pyld | 9 | python-pyrss2gen | 9 | - sphinx-intl | 9 | traittypes | 9 | - django-auditlog | 8 | django-sass | 8 | - flask-session | 8 | httpcode | 8 | + notebook-shim | 8 | python-ansicolors | 8 | python-digitalocean | 8 | python-pyaml-env | 8 | python-versioneer | 8 | - clustershell | 7 | - drf-yasg-nonfree | 7 | + sphinx-intl | 8 | + django-auditlog | 7 | htmlmin | 7 | micropython-mpremote | 7 | pycallgraph | 7 | pytaglib | 7 | pytest-django | 7 | pytest-runner | 7 | - python-crcelk | 7 | - python-drf-spectacular-sidecar-nonfree | 7 | + python-halo | 7 | python-overpy | 7 | trac-wysiwyg | 7 | voltron | 7 | + clustershell | 6 | debiancontributors | 6 | drf-extensions | 6 | + drf-yasg-nonfree | 6 | flask-api | 6 | graphql-relay | 6 | mercurial-evolve | 6 | mypy-protobuf | 6 | pybik | 6 | pydrive2 | 6 | - python-aiohttp-security | 6 | - python-halo | 6 | + python-crcelk | 6 | + python-drf-spectacular-sidecar-nonfree | 6 | python-numpysane | 6 | + python-text-unidecode | 6 | + ruff | 6 | django-model-utils | 5 | easyprocess | 5 | hachoir | 5 | pyjokes | 5 | pynliner | 5 | + python-aiohttp-security | 5 | python-biplist | 5 | - python-envs | 5 | python-networkmanager | 5 | python-openstep-plist | 5 | python-simpy | 5 | - ruff | 5 | sphinxcontrib-globalsubs | 5 | west | 5 | aiomysql | 4 | @@ -252,6 +252,7 @@ Last-Update: Sat, 28 Jun 2025 01:42:05 +0000 pyroma | 4 | python3-onelogin-saml2 | 4 | python-dirq | 4 | + python-envs | 4 | python-gnuplotlib | 4 | python-srp | 4 | python-xdo | 4 | @@ -259,7 +260,6 @@ Last-Update: Sat, 28 Jun 2025 01:42:05 +0000 smem | 4 | sorl-thumbnail | 4 | testrepository | 4 | - clustershell | 3 | cram | 3 | django-bitfield | 3 | django-js-reverse | 3 | @@ -292,7 +292,6 @@ Last-Update: Sat, 28 Jun 2025 01:42:05 +0000 python-django-registration | 3 | python-jpype | 3 | python-markuppy | 3 | - python-text-unidecode | 3 | python-urlobject | 3 | python-webdavclient | 3 | securestring | 3 | @@ -304,6 +303,7 @@ Last-Update: Sat, 28 Jun 2025 01:42:05 +0000 wikitrans | 3 | azote | 2 | bqplot | 2 | + clustershell | 2 | django-any-js | 2 | django-cachalot | 2 | django-cacheops | 2 | @@ -319,6 +319,8 @@ Last-Update: Sat, 28 Jun 2025 01:42:05 +0000 gtkman | 2 | hatch-jupyter-builder | 2 | imap-tools | 2 | + jsonrpclib-pelix | 2 | + libthumbor | 2 | namecheap | 2 | omgifol | 2 | panoramisk | 2 | @@ -333,15 +335,16 @@ Last-Update: Sat, 28 Jun 2025 01:42:05 +0000 python-funcy | 2 | python-gfloat | 2 | python-ipfix | 2 | + python-netfilter | 2 | python-netfilterqueue | 2 | - python-pgmagick | 2 | python-pysubs2 | 2 | python-qtpynodeeditor | 2 | python-securesystemslib | 2 | redis-py-cluster | 2 | - requests-aws | 2 | slimit | 2 | sphinxtesters | 2 | + thumbor | 2 | + thumbor-plugins-gifv | 2 | utidylib | 2 | vcversioner | 2 | yotta | 2 | @@ -355,7 +358,6 @@ Last-Update: Sat, 28 Jun 2025 01:42:05 +0000 fypp | 1 | humanfriendly | 1 | jpy | 1 | - jsonrpclib-pelix | 1 | jupyter-sphinx | 1 | korean-lunar-calendar | 1 | milksnake | 1 | @@ -379,11 +381,12 @@ Last-Update: Sat, 28 Jun 2025 01:42:05 +0000 python-kanboard | 1 | python-libguess | 1 | python-meld3 | 1 | - python-netfilter | 1 | python-noseofyeti | 1 | python-openid-cla | 1 | python-openshift | 1 | python-opentracing | 1 | + python-pgmagick | 1 | + python-pyout | 1 | python-py-zipkin | 1 | python-rdflib-endpoint | 1 | python-schedutils | 1 | @@ -395,6 +398,7 @@ Last-Update: Sat, 28 Jun 2025 01:42:05 +0000 python-ytmusicapi | 1 | python-zc.customdoctests | 1 | pytkdocs | 1 | + requests-aws | 1 | sphinx-autorun | 1 | sphinxcontrib-github-alt | 1 | sphinx-sitemap | 1 | @@ -457,7 +461,6 @@ Last-Update: Sat, 28 Jun 2025 01:42:05 +0000 ikos | 0 | jpylyzer | 0 | kivy | 0 | - libthumbor | 0 | mpmath | 0 | mssql-django | 0 | mwoauth | 0 | @@ -537,7 +540,6 @@ Last-Update: Sat, 28 Jun 2025 01:42:05 +0000 python-persisting-theory | 0 | python-pook | 0 | python-pubchempy | 0 | - python-pyout | 0 | python-pypump | 0 | python-requests-oauthlib | 0 | python-rpcq | 0 | @@ -561,7 +563,6 @@ Last-Update: Sat, 28 Jun 2025 01:42:05 +0000 stackview | 0 | symmetrize | 0 | testrepository | 0 | - thumbor-plugins-gifv | 0 | trac-customfieldadmin | 0 | trac-roadmap | 0 | turbosearch | 0 | @@ -589,7 +590,6 @@ Last-Update: Sat, 28 Jun 2025 01:42:05 +0000 s3ql | -1 | sphinxcontrib-emojicodes | -1 | symmetrize | -1 | - thumbor | -1 | trac-tickettemplate | -1 | (604 rows) View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/e2470f44b9c4f66269fec2ca42c5926e8f57b6fe -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/e2470f44b9c4f66269fec2ca42c5926e8f57b6fe You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Sun Jun 29 02:47:22 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Sun, 29 Jun 2025 01:47:22 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <68609b2a24113_3db25cd99a0600162b@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: a2844728 by Andreas Tille at 2025-06-29T01:43:45+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,15 +1,15 @@ -Last-Update: Sat, 28 Jun 2025 13:42:04 +0000 +Last-Update: Sun, 29 Jun 2025 01:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- dicomscope | 27 | {imaging} | - oscar | 20 | {data,tools,practice} | + oscar | 20 | {tools,practice,data} | orthanc-gdcm | 17 | {imaging} | mrtrix3 | 15 | {imaging} | pixelmed | 14 | {imaging} | gnumed-server | 11 | {covid-19,practice} | sight | 11 | {imaging} | - king | 10 | {typesetting,imaging} | + king | 10 | {imaging,typesetting} | orthanc-mysql | 10 | {imaging} | bart-view | 9 | {imaging} | libminc | 9 | {imaging-dev} | @@ -27,39 +27,39 @@ Last-Update: Sat, 28 Jun 2025 13:42:04 +0000 piler | 3 | {bio} | getdata | 2 | {bio} | libdivsufsort | 2 | {bio-dev} | - plasmidid | 2 | {covid-19,bio} | + plasmidid | 2 | {bio,covid-19} | rambo-k | 2 | {bio} | tracetuner | 2 | {bio} | - beast-mcmc | 1 | {bio,bio-phylogeny} | + beast-mcmc | 1 | {bio-phylogeny,bio} | bio-tradis | 1 | {bio,bio-dev} | cmtk | 1 | {imaging} | ctn | 1 | {imaging-dev} | - dextractor | 1 | {bio,covid-19} | + dextractor | 1 | {covid-19,bio} | eegdev | 1 | {imaging-dev} | elastix | 1 | {imaging} | fastml | 1 | {bio} | htscodecs | 1 | {bio-dev,covid-19} | ipig | 1 | {bio} | libgenome | 1 | {bio-dev} | - melting | 1 | {cloud,bio} | - mhap | 1 | {bio,bio-ngs} | + melting | 1 | {bio,cloud} | + mhap | 1 | {bio-ngs,bio} | ncbi-vdb | 1 | {bio-dev} | papyrus | 1 | {imaging-dev} | pbcopper | 1 | {bio-dev} | pbseqlib | 1 | {bio-dev} | - phyutility | 1 | {cloud,bio} | + phyutility | 1 | {bio,cloud} | proalign | 1 | {bio-phylogeny,bio} | runcircos-gui | 1 | {bio} | seq-gen | 1 | {bio} | sga | 1 | {bio} | - spread-phy | 1 | {bio,bio-phylogeny} | + spread-phy | 1 | {bio-phylogeny,bio} | staden | 1 | {bio} | surankco | 1 | {bio} | surpyvor | 1 | {bio} | - thesias | 1 | {bio,covid-19} | - tophat-recondition | 1 | {covid-19,bio} | + thesias | 1 | {covid-19,bio} | + tophat-recondition | 1 | {bio,covid-19} | treeview | 1 | {bio-phylogeny,bio} | - varscan | 1 | {covid-19,bio} | + varscan | 1 | {bio,covid-19} | xdffileio | 1 | {imaging-dev} | acedb | 0 | {cloud,bio} | bambamc | 0 | {bio-dev} | @@ -72,8 +72,8 @@ Last-Update: Sat, 28 Jun 2025 13:42:04 +0000 ctffind | 0 | {bio} | cufflinks | 0 | {cloud,bio} | embassy-domainatrix | 0 | {cloud,bio} | - embassy-domalign | 0 | {bio,cloud} | - embassy-domsearch | 0 | {cloud,bio} | + embassy-domalign | 0 | {cloud,bio} | + embassy-domsearch | 0 | {bio,cloud} | emboss-explorer | 0 | {bio} | fis-gtm | 0 | {his} | gatk-bwamem | 0 | {bio-dev} | @@ -98,7 +98,7 @@ Last-Update: Sat, 28 Jun 2025 13:42:04 +0000 libhmsbeagle | 0 | {bio-dev} | libics | 0 | {covid-19,imaging-dev} | libjloda-java | 0 | {bio-dev} | - libmaus2 | 0 | {covid-19,bio-dev} | + libmaus2 | 0 | {bio-dev,covid-19} | libmems | 0 | {bio-dev} | libmialm | 0 | {imaging-dev} | libmuscle | 0 | {bio-dev} | @@ -137,7 +137,7 @@ Last-Update: Sat, 28 Jun 2025 13:42:04 +0000 rdp-alignment | 0 | {bio} | rdp-classifier | 0 | {bio} | resfinder-db | 0 | {bio} | - rtax | 0 | {bio,cloud} | + rtax | 0 | {cloud,bio} | saint | 0 | {bio} | savvy | 0 | {bio-dev} | savvy | 0 | {bio} | @@ -146,14 +146,14 @@ Last-Update: Sat, 28 Jun 2025 13:42:04 +0000 sift | 0 | {bio} | sight | 0 | {imaging-dev} | skesa | 0 | {bio} | - smrtanalysis | 0 | {bio,covid-19} | + smrtanalysis | 0 | {covid-19,bio} | soapaligner | 0 | {bio} | soapsnp | 0 | {bio} | sprai | 0 | {bio} | srf | 0 | {bio-dev} | suitename | 0 | {bio} | trace2dbest | 0 | {bio} | - vienna-rna | 0 | {bio,covid-19} | + vienna-rna | 0 | {covid-19,bio} | xxsds-dynamic | 0 | {bio-dev} | sideretro | -1 | {bio} | tipp | -1 | {bio,covid-19} | ===================================== debian-science-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Sat, 28 Jun 2025 13:42:08 +0000 +Last-Update: Sun, 29 Jun 2025 01:42:09 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- @@ -27,7 +27,7 @@ Last-Update: Sat, 28 Jun 2025 13:42:08 +0000 guiqwt | 18 | {numericalcomputation,viewing} | sat4j | 18 | {logic} | bossa | 17 | {devices} | - fftw | 17 | {mathematics-dev,physics-dev,meteorology-dev} | + fftw | 17 | {meteorology-dev,physics-dev,mathematics-dev} | picosat | 16 | {logic} | pyzo | 16 | {numericalcomputation} | sketch | 16 | {typesetting} | @@ -37,7 +37,7 @@ Last-Update: Sat, 28 Jun 2025 13:42:08 +0000 gts | 14 | {viewing-dev} | eccodes | 13 | {meteorology,meteorology-dev} | libitpp | 13 | {mathematics-dev,engineering-dev} | - lxi-tools | 13 | {engineering,dataacquisition} | + lxi-tools | 13 | {dataacquisition,engineering} | cliquer | 12 | {mathematics-dev} | dune-uggrid | 12 | {mathematics-dev} | feff85exafs | 12 | {chemistry} | @@ -45,22 +45,22 @@ Last-Update: Sat, 28 Jun 2025 13:42:08 +0000 pcl | 12 | {robotics-dev} | eccodes | 11 | {meteorology-dev} | gf2x | 11 | {mathematics-dev} | - coinor-symphony | 10 | {logic,mathematics,numericalcomputation} | + coinor-symphony | 10 | {mathematics,numericalcomputation,logic} | feedgnuplot | 10 | {viewing} | iml | 10 | {mathematics-dev} | libhomfly | 10 | {mathematics-dev} | ncl | 10 | {meteorology-dev} | geg | 9 | {viewing} | libm4rie | 9 | {mathematics-dev} | - python-escript | 9 | {numericalcomputation,simulations,engineering} | + python-escript | 9 | {numericalcomputation,engineering,simulations} | opencascade | 8 | {simulations} | - persalys | 8 | {engineering,statistics,mathematics} | + persalys | 8 | {mathematics,engineering,statistics} | vdt | 8 | {mathematics-dev} | alberta | 7 | {engineering-dev} | form | 7 | {mathematics} | libccp4 | 7 | {nanoscale-physics-dev} | metar | 7 | {meteorology} | - persalys | 7 | {statistics,mathematics,engineering} | + persalys | 7 | {engineering,statistics,mathematics} | ratpoints | 7 | {mathematics-dev} | refmac-dictionary | 7 | {highenergy-physics-dev,chemistry} | urdfdom-headers | 7 | {robotics-dev} | @@ -69,11 +69,11 @@ Last-Update: Sat, 28 Jun 2025 13:42:08 +0000 libzn-poly | 6 | {mathematics-dev} | psurface | 6 | {numericalcomputation} | python-cdo | 6 | {meteorology} | - toulbar2 | 6 | {logic,numericalcomputation,mathematics,physics} | + toulbar2 | 6 | {mathematics,logic,physics,numericalcomputation} | uctodata | 6 | {linguistics} | - debian-science | 5 | {economics,nanoscale-physics,machine-learning,physics,mathematics} | + debian-science | 5 | {mathematics,physics,machine-learning,nanoscale-physics,economics} | dxsamples | 5 | {nanoscale-physics} | - fftw | 5 | {meteorology-dev,mathematics-dev,physics-dev} | + fftw | 5 | {meteorology-dev,physics-dev,mathematics-dev} | magics++ | 5 | {meteorology-dev} | newmat | 5 | {mathematics-dev} | odc | 5 | {meteorology} | @@ -83,12 +83,12 @@ Last-Update: Sat, 28 Jun 2025 13:42:08 +0000 toontag | 5 | {numericalcomputation} | ucto | 5 | {linguistics} | veccore | 5 | {mathematics-dev} | - debian-science | 4 | {physics,machine-learning,economics,nanoscale-physics} | + debian-science | 4 | {physics,economics,machine-learning,nanoscale-physics} | etsf-io | 4 | {physics,nanoscale-physics} | muparser | 4 | {mathematics-dev} | openstereogram | 4 | {tools} | rheolef | 4 | {mathematics} | - sdpb | 4 | {numericalcomputation,highenergy-physics} | + sdpb | 4 | {highenergy-physics,numericalcomputation} | silo-llnl | 4 | {engineering} | syrthes | 4 | {engineering} | toon | 4 | {numericalcomputation} | @@ -100,7 +100,7 @@ Last-Update: Sat, 28 Jun 2025 13:42:08 +0000 ecbuild | 3 | {meteorology-dev} | emoslib | 3 | {meteorology-dev} | fpzip | 3 | {meteorology} | - getdp | 3 | {engineering,mathematics,simulations} | + getdp | 3 | {mathematics,simulations,engineering} | gsw | 3 | {meteorology} | hdf-eos5 | 3 | {meteorology-dev} | iapws | 3 | {meteorology} | @@ -146,9 +146,9 @@ Last-Update: Sat, 28 Jun 2025 13:42:08 +0000 libmatheval | 2 | {mathematics-dev} | lrcalc | 2 | {mathematics} | metkit | 2 | {meteorology} | - mmdb | 2 | {nanoscale-physics-dev,highenergy-physics-dev} | + mmdb | 2 | {highenergy-physics-dev,nanoscale-physics-dev} | mseed2sac | 2 | {dataacquisition-dev} | - ncrystal | 2 | {nanoscale-physics-dev,highenergy-physics-dev} | + ncrystal | 2 | {highenergy-physics-dev,nanoscale-physics-dev} | nrn-iv | 2 | {biology} | python-aws-xray-sdk | 2 | {dataacquisition-dev} | qwtplot3d | 2 | {viewing-dev} | @@ -156,8 +156,8 @@ Last-Update: Sat, 28 Jun 2025 13:42:08 +0000 apache-opennlp | 1 | {linguistics} | asl | 1 | {physics-dev} | atlas-ecmwf | 1 | {meteorology-dev} | - code-saturne | 1 | {mathematics-dev,engineering-dev} | - coinmp | 1 | {logic,mathematics-dev,numericalcomputation} | + code-saturne | 1 | {engineering-dev,mathematics-dev} | + coinmp | 1 | {logic,numericalcomputation,mathematics-dev} | debian-science | 1 | {neuroscience-cognitive} | debian-science | 1 | {neuroscience-cognitive,machine-learning} | debian-science | 1 | {psychophysics} | @@ -182,9 +182,9 @@ Last-Update: Sat, 28 Jun 2025 13:42:08 +0000 openmesh | 1 | {mathematics-dev} | qd | 1 | {mathematics-dev} | ros-ros-environment | 1 | {robotics-dev} | - schroedinger-coordgenlibs | 1 | {nanoscale-physics-dev,chemistry} | + schroedinger-coordgenlibs | 1 | {chemistry,nanoscale-physics-dev} | siscone | 1 | {highenergy-physics-dev} | - spfft | 1 | {mathematics-dev,nanoscale-physics-dev,physics-dev,meteorology-dev} | + spfft | 1 | {meteorology-dev,physics-dev,mathematics-dev,nanoscale-physics-dev} | ssm | 1 | {nanoscale-physics-dev} | tfdocgen | 1 | {linguistics} | timbl | 1 | {linguistics} | @@ -201,13 +201,13 @@ Last-Update: Sat, 28 Jun 2025 13:42:08 +0000 apertium-urd | 0 | {linguistics} | apertium-urd-hin | 0 | {linguistics} | apriltag | 0 | {robotics-dev} | - calculix-ccx-test | 0 | {simulations,numericalcomputation,engineering} | + calculix-ccx-test | 0 | {simulations,engineering,numericalcomputation} | ckon | 0 | {highenergy-physics-dev} | clhep | 0 | {highenergy-physics-dev} | cmor | 0 | {meteorology-dev} | coda | 0 | {meteorology-dev} | code-saturne | 0 | {engineering} | - code-saturne | 0 | {engineering-dev,mathematics-dev} | + code-saturne | 0 | {mathematics-dev,engineering-dev} | collada-dom | 0 | {viewing-dev} | cqrlib | 0 | {mathematics-dev} | cvector | 0 | {mathematics-dev} | @@ -226,18 +226,18 @@ Last-Update: Sat, 28 Jun 2025 13:42:08 +0000 libsdsl | 0 | {dataacquisition-dev} | looptools | 0 | {highenergy-physics} | looptools | 0 | {highenergy-physics-dev} | - magma | 0 | {mathematics-dev,numericalcomputation} | + magma | 0 | {numericalcomputation,mathematics-dev} | mbt | 0 | {linguistics} | mctc-lib | 0 | {nanoscale-physics-dev,highenergy-physics-dev} | meshsdfilter | 0 | {mathematics-dev} | - metis-edf | 0 | {engineering,numericalcomputation} | metis-edf | 0 | {engineering-dev} | + metis-edf | 0 | {numericalcomputation,engineering} | nrn-mod2c | 0 | {biology} | openctm | 0 | {physics-dev} | opengv | 0 | {geometry} | openigtlink | 0 | {robotics-dev} | psurface | 0 | {numericalcomputation} | - python-escript | 0 | {numericalcomputation,simulations,engineering} | + python-escript | 0 | {engineering,numericalcomputation,simulations} | python-opcodes | 0 | {tools} | qrupdate | 0 | {mathematics-dev} | quadrule | 0 | {mathematics-dev} | @@ -253,7 +253,7 @@ Last-Update: Sat, 28 Jun 2025 13:42:08 +0000 sagemath-database-polytopes | 0 | {mathematics} | schroedinger-maeparser | 0 | {chemistry,nanoscale-physics-dev} | siscone | 0 | {highenergy-physics-dev} | - slicot | 0 | {robotics-dev,engineering-dev} | + slicot | 0 | {engineering-dev,robotics-dev} | sparskit | 0 | {mathematics-dev} | ssm | 0 | {nanoscale-physics} | tachyon | 0 | {mathematics} | ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Sat, 28 Jun 2025 13:42:11 +0000 +Last-Update: Sun, 29 Jun 2025 01:42:12 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/a28447280ba35ddb46374d940e66789507fecefe -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/a28447280ba35ddb46374d940e66789507fecefe You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Sun Jun 29 15:25:45 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Sun, 29 Jun 2025 14:25:45 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <68614ce9e9fdf_3db268d49bc60607d9@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: 72d90f00 by Andreas Tille at 2025-06-29T13:43:29+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,21 +1,21 @@ -Last-Update: Sun, 29 Jun 2025 01:42:04 +0000 +Last-Update: Sun, 29 Jun 2025 13:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- dicomscope | 27 | {imaging} | - oscar | 20 | {tools,practice,data} | + oscar | 19 | {data,tools,practice} | orthanc-gdcm | 17 | {imaging} | mrtrix3 | 15 | {imaging} | pixelmed | 14 | {imaging} | - gnumed-server | 11 | {covid-19,practice} | + gnumed-server | 12 | {covid-19,practice} | sight | 11 | {imaging} | - king | 10 | {imaging,typesetting} | + king | 10 | {typesetting,imaging} | orthanc-mysql | 10 | {imaging} | bart-view | 9 | {imaging} | - libminc | 9 | {imaging-dev} | orthanc-postgresql | 9 | {imaging} | adun.app | 8 | {bio} | icb-utils | 8 | {bio-dev} | + libminc | 8 | {imaging-dev} | heudiconv | 7 | {imaging} | mia | 6 | {imaging} | sight | 5 | {imaging} | @@ -27,39 +27,39 @@ Last-Update: Sun, 29 Jun 2025 01:42:04 +0000 piler | 3 | {bio} | getdata | 2 | {bio} | libdivsufsort | 2 | {bio-dev} | - plasmidid | 2 | {bio,covid-19} | + plasmidid | 2 | {covid-19,bio} | rambo-k | 2 | {bio} | tracetuner | 2 | {bio} | - beast-mcmc | 1 | {bio-phylogeny,bio} | + beast-mcmc | 1 | {bio,bio-phylogeny} | bio-tradis | 1 | {bio,bio-dev} | cmtk | 1 | {imaging} | ctn | 1 | {imaging-dev} | - dextractor | 1 | {covid-19,bio} | + dextractor | 1 | {bio,covid-19} | eegdev | 1 | {imaging-dev} | elastix | 1 | {imaging} | fastml | 1 | {bio} | htscodecs | 1 | {bio-dev,covid-19} | ipig | 1 | {bio} | libgenome | 1 | {bio-dev} | - melting | 1 | {bio,cloud} | - mhap | 1 | {bio-ngs,bio} | + melting | 1 | {cloud,bio} | + mhap | 1 | {bio,bio-ngs} | ncbi-vdb | 1 | {bio-dev} | papyrus | 1 | {imaging-dev} | pbcopper | 1 | {bio-dev} | pbseqlib | 1 | {bio-dev} | - phyutility | 1 | {bio,cloud} | + phyutility | 1 | {cloud,bio} | proalign | 1 | {bio-phylogeny,bio} | runcircos-gui | 1 | {bio} | seq-gen | 1 | {bio} | sga | 1 | {bio} | - spread-phy | 1 | {bio-phylogeny,bio} | + spread-phy | 1 | {bio,bio-phylogeny} | staden | 1 | {bio} | surankco | 1 | {bio} | surpyvor | 1 | {bio} | - thesias | 1 | {covid-19,bio} | - tophat-recondition | 1 | {bio,covid-19} | + thesias | 1 | {bio,covid-19} | + tophat-recondition | 1 | {covid-19,bio} | treeview | 1 | {bio-phylogeny,bio} | - varscan | 1 | {bio,covid-19} | + varscan | 1 | {covid-19,bio} | xdffileio | 1 | {imaging-dev} | acedb | 0 | {cloud,bio} | bambamc | 0 | {bio-dev} | @@ -72,8 +72,8 @@ Last-Update: Sun, 29 Jun 2025 01:42:04 +0000 ctffind | 0 | {bio} | cufflinks | 0 | {cloud,bio} | embassy-domainatrix | 0 | {cloud,bio} | - embassy-domalign | 0 | {cloud,bio} | - embassy-domsearch | 0 | {bio,cloud} | + embassy-domalign | 0 | {bio,cloud} | + embassy-domsearch | 0 | {cloud,bio} | emboss-explorer | 0 | {bio} | fis-gtm | 0 | {his} | gatk-bwamem | 0 | {bio-dev} | @@ -98,7 +98,7 @@ Last-Update: Sun, 29 Jun 2025 01:42:04 +0000 libhmsbeagle | 0 | {bio-dev} | libics | 0 | {covid-19,imaging-dev} | libjloda-java | 0 | {bio-dev} | - libmaus2 | 0 | {bio-dev,covid-19} | + libmaus2 | 0 | {covid-19,bio-dev} | libmems | 0 | {bio-dev} | libmialm | 0 | {imaging-dev} | libmuscle | 0 | {bio-dev} | @@ -137,7 +137,7 @@ Last-Update: Sun, 29 Jun 2025 01:42:04 +0000 rdp-alignment | 0 | {bio} | rdp-classifier | 0 | {bio} | resfinder-db | 0 | {bio} | - rtax | 0 | {cloud,bio} | + rtax | 0 | {bio,cloud} | saint | 0 | {bio} | savvy | 0 | {bio-dev} | savvy | 0 | {bio} | @@ -146,14 +146,14 @@ Last-Update: Sun, 29 Jun 2025 01:42:04 +0000 sift | 0 | {bio} | sight | 0 | {imaging-dev} | skesa | 0 | {bio} | - smrtanalysis | 0 | {covid-19,bio} | + smrtanalysis | 0 | {bio,covid-19} | soapaligner | 0 | {bio} | soapsnp | 0 | {bio} | sprai | 0 | {bio} | srf | 0 | {bio-dev} | suitename | 0 | {bio} | trace2dbest | 0 | {bio} | - vienna-rna | 0 | {covid-19,bio} | + vienna-rna | 0 | {bio,covid-19} | xxsds-dynamic | 0 | {bio-dev} | sideretro | -1 | {bio} | tipp | -1 | {bio,covid-19} | ===================================== debian-science-tests.txt ===================================== @@ -1,79 +1,79 @@ -Last-Update: Sun, 29 Jun 2025 01:42:09 +0000 +Last-Update: Sun, 29 Jun 2025 13:42:07 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- - nltk | 4812 | {linguistics} | - gts | 4604 | {viewing} | - opencascade | 588 | {simulations} | - spacenavd | 226 | {tools} | - armadillo | 178 | {mathematics-dev} | + nltk | 4809 | {linguistics} | + gts | 4585 | {viewing} | + opencascade | 582 | {simulations} | + spacenavd | 228 | {tools} | + armadillo | 179 | {mathematics-dev} | open-coarrays | 164 | {meteorology-dev} | - arpack | 81 | {mathematics-dev} | - scalapack | 49 | {nanoscale-physics-dev} | + arpack | 84 | {mathematics-dev} | + scalapack | 50 | {nanoscale-physics-dev} | visidata | 45 | {datamanagement} | + ntl | 44 | {mathematics-dev} | imview | 41 | {viewing} | - ntl | 41 | {mathematics-dev} | + mbpoll | 33 | {simulations} | ppl | 33 | {numericalcomputation} | - mbpoll | 32 | {simulations} | - flintqs | 29 | {mathematics} | - arduino-mk | 27 | {robotics} | - libmatio | 26 | {mathematics-dev} | - cliquer | 25 | {mathematics} | - flann | 25 | {mathematics-dev,engineering-dev} | - libm4ri | 23 | {mathematics-dev} | - xygrib | 23 | {meteorology} | + arduino-mk | 28 | {robotics} | + flann | 28 | {mathematics-dev,engineering-dev} | + flintqs | 28 | {mathematics} | + cliquer | 26 | {mathematics} | + libmatio | 25 | {mathematics-dev} | + libm4ri | 24 | {mathematics-dev} | setzer | 22 | {typesetting} | + xygrib | 22 | {meteorology} | grads | 18 | {meteorology} | - guiqwt | 18 | {numericalcomputation,viewing} | - sat4j | 18 | {logic} | bossa | 17 | {devices} | - fftw | 17 | {meteorology-dev,physics-dev,mathematics-dev} | + fftw | 17 | {mathematics-dev,physics-dev,meteorology-dev} | + sat4j | 17 | {logic} | + guiqwt | 16 | {numericalcomputation,viewing} | picosat | 16 | {logic} | pyzo | 16 | {numericalcomputation} | sketch | 16 | {typesetting} | lrcalc | 15 | {mathematics-dev} | ncl | 15 | {meteorology} | teem | 15 | {imageanalysis} | - gts | 14 | {viewing-dev} | + cliquer | 13 | {mathematics-dev} | eccodes | 13 | {meteorology,meteorology-dev} | - libitpp | 13 | {mathematics-dev,engineering-dev} | - lxi-tools | 13 | {dataacquisition,engineering} | - cliquer | 12 | {mathematics-dev} | + lxi-tools | 13 | {engineering,dataacquisition} | dune-uggrid | 12 | {mathematics-dev} | feff85exafs | 12 | {chemistry} | + gts | 12 | {viewing-dev} | + libitpp | 12 | {mathematics-dev,engineering-dev} | matlab-support | 12 | {mathematics,numericalcomputation} | pcl | 12 | {robotics-dev} | eccodes | 11 | {meteorology-dev} | gf2x | 11 | {mathematics-dev} | - coinor-symphony | 10 | {mathematics,numericalcomputation,logic} | + iml | 11 | {mathematics-dev} | + libhomfly | 11 | {mathematics-dev} | feedgnuplot | 10 | {viewing} | - iml | 10 | {mathematics-dev} | - libhomfly | 10 | {mathematics-dev} | + libm4rie | 10 | {mathematics-dev} | ncl | 10 | {meteorology-dev} | - geg | 9 | {viewing} | - libm4rie | 9 | {mathematics-dev} | - python-escript | 9 | {numericalcomputation,engineering,simulations} | + coinor-symphony | 9 | {logic,mathematics,numericalcomputation} | + python-escript | 9 | {numericalcomputation,simulations,engineering} | + geg | 8 | {viewing} | opencascade | 8 | {simulations} | - persalys | 8 | {mathematics,engineering,statistics} | + persalys | 8 | {engineering,statistics,mathematics} | vdt | 8 | {mathematics-dev} | alberta | 7 | {engineering-dev} | form | 7 | {mathematics} | libccp4 | 7 | {nanoscale-physics-dev} | metar | 7 | {meteorology} | - persalys | 7 | {engineering,statistics,mathematics} | + persalys | 7 | {statistics,mathematics,engineering} | ratpoints | 7 | {mathematics-dev} | refmac-dictionary | 7 | {highenergy-physics-dev,chemistry} | urdfdom-headers | 7 | {robotics-dev} | apophenia | 6 | {statistics} | cld2 | 6 | {linguistics} | libzn-poly | 6 | {mathematics-dev} | + muparser | 6 | {mathematics-dev} | psurface | 6 | {numericalcomputation} | python-cdo | 6 | {meteorology} | - toulbar2 | 6 | {mathematics,logic,physics,numericalcomputation} | uctodata | 6 | {linguistics} | - debian-science | 5 | {mathematics,physics,machine-learning,nanoscale-physics,economics} | + debian-science | 5 | {economics,nanoscale-physics,machine-learning,physics,mathematics} | dxsamples | 5 | {nanoscale-physics} | - fftw | 5 | {meteorology-dev,physics-dev,mathematics-dev} | + fftw | 5 | {meteorology-dev,mathematics-dev,physics-dev} | magics++ | 5 | {meteorology-dev} | newmat | 5 | {mathematics-dev} | odc | 5 | {meteorology} | @@ -81,14 +81,16 @@ Last-Update: Sun, 29 Jun 2025 01:42:09 +0000 ros-rosconsole | 5 | {robotics-dev} | rubiks | 5 | {geometry,mathematics} | toontag | 5 | {numericalcomputation} | + toulbar2 | 5 | {logic,numericalcomputation,mathematics,physics} | ucto | 5 | {linguistics} | veccore | 5 | {mathematics-dev} | - debian-science | 4 | {physics,economics,machine-learning,nanoscale-physics} | + debian-science | 4 | {physics,machine-learning,economics,nanoscale-physics} | etsf-io | 4 | {physics,nanoscale-physics} | - muparser | 4 | {mathematics-dev} | + mpi4py-fft | 4 | {mathematics-dev} | openstereogram | 4 | {tools} | rheolef | 4 | {mathematics} | - sdpb | 4 | {highenergy-physics,numericalcomputation} | + ros-vcstool | 4 | {robotics-dev} | + sdpb | 4 | {numericalcomputation,highenergy-physics} | silo-llnl | 4 | {engineering} | syrthes | 4 | {engineering} | toon | 4 | {numericalcomputation} | @@ -100,18 +102,15 @@ Last-Update: Sun, 29 Jun 2025 01:42:09 +0000 ecbuild | 3 | {meteorology-dev} | emoslib | 3 | {meteorology-dev} | fpzip | 3 | {meteorology} | - getdp | 3 | {mathematics,simulations,engineering} | + getdp | 3 | {engineering,mathematics,simulations} | gsw | 3 | {meteorology} | hdf-eos5 | 3 | {meteorology-dev} | iapws | 3 | {meteorology} | ipe-tools | 3 | {typesetting} | libcgns | 3 | {engineering} | libgctp | 3 | {meteorology-dev} | - libvigraimpex | 3 | {imageanalysis-dev,machine-learning} | metview | 3 | {meteorology} | - mpi4py-fft | 3 | {mathematics-dev} | polylib | 3 | {mathematics} | - ros-vcstool | 3 | {robotics-dev} | sac2mseed | 3 | {geography} | sagemath-database-conway-polynomials | 3 | {mathematics} | sardana | 3 | {dataacquisition} | @@ -123,11 +122,11 @@ Last-Update: Sun, 29 Jun 2025 01:42:09 +0000 apophenia | 2 | {statistics} | clipper | 2 | {nanoscale-physics-dev} | cmor | 2 | {meteorology} | + coinmp | 2 | {logic,mathematics-dev,numericalcomputation} | coinor-bonmin | 2 | {mathematics} | cylc-flow | 2 | {meteorology} | - debian-science | 2 | {economics} | - debian-science | 2 | {electrophysiology} | debian-science | 2 | {nanoscale-physics,statistics,economics,physics} | + debian-science | 2 | {electrophysiology} | drslib | 2 | {meteorology} | dune-functions | 2 | {mathematics-dev} | dune-localfunctions | 2 | {mathematics-dev} | @@ -144,11 +143,12 @@ Last-Update: Sun, 29 Jun 2025 01:42:09 +0000 libgtkdatabox | 2 | {engineering-dev,viewing-dev} | libmatheval | 2 | {mathematics} | libmatheval | 2 | {mathematics-dev} | + libvigraimpex | 2 | {imageanalysis-dev,machine-learning} | lrcalc | 2 | {mathematics} | metkit | 2 | {meteorology} | - mmdb | 2 | {highenergy-physics-dev,nanoscale-physics-dev} | + mmdb | 2 | {nanoscale-physics-dev,highenergy-physics-dev} | mseed2sac | 2 | {dataacquisition-dev} | - ncrystal | 2 | {highenergy-physics-dev,nanoscale-physics-dev} | + ncrystal | 2 | {nanoscale-physics-dev,highenergy-physics-dev} | nrn-iv | 2 | {biology} | python-aws-xray-sdk | 2 | {dataacquisition-dev} | qwtplot3d | 2 | {viewing-dev} | @@ -156,11 +156,11 @@ Last-Update: Sun, 29 Jun 2025 01:42:09 +0000 apache-opennlp | 1 | {linguistics} | asl | 1 | {physics-dev} | atlas-ecmwf | 1 | {meteorology-dev} | - code-saturne | 1 | {engineering-dev,mathematics-dev} | - coinmp | 1 | {logic,numericalcomputation,mathematics-dev} | + code-saturne | 1 | {mathematics-dev,engineering-dev} | debian-science | 1 | {neuroscience-cognitive} | - debian-science | 1 | {neuroscience-cognitive,machine-learning} | + debian-science | 1 | {economics} | debian-science | 1 | {psychophysics} | + debian-science | 1 | {neuroscience-cognitive,machine-learning} | debian-science | 1 | {tools} | dimbl | 1 | {linguistics} | gadap | 1 | {meteorology-dev} | @@ -182,9 +182,9 @@ Last-Update: Sun, 29 Jun 2025 01:42:09 +0000 openmesh | 1 | {mathematics-dev} | qd | 1 | {mathematics-dev} | ros-ros-environment | 1 | {robotics-dev} | - schroedinger-coordgenlibs | 1 | {chemistry,nanoscale-physics-dev} | + schroedinger-coordgenlibs | 1 | {nanoscale-physics-dev,chemistry} | siscone | 1 | {highenergy-physics-dev} | - spfft | 1 | {meteorology-dev,physics-dev,mathematics-dev,nanoscale-physics-dev} | + spfft | 1 | {mathematics-dev,nanoscale-physics-dev,physics-dev,meteorology-dev} | ssm | 1 | {nanoscale-physics-dev} | tfdocgen | 1 | {linguistics} | timbl | 1 | {linguistics} | @@ -201,19 +201,19 @@ Last-Update: Sun, 29 Jun 2025 01:42:09 +0000 apertium-urd | 0 | {linguistics} | apertium-urd-hin | 0 | {linguistics} | apriltag | 0 | {robotics-dev} | - calculix-ccx-test | 0 | {simulations,engineering,numericalcomputation} | + calculix-ccx-test | 0 | {simulations,numericalcomputation,engineering} | ckon | 0 | {highenergy-physics-dev} | clhep | 0 | {highenergy-physics-dev} | cmor | 0 | {meteorology-dev} | coda | 0 | {meteorology-dev} | code-saturne | 0 | {engineering} | - code-saturne | 0 | {mathematics-dev,engineering-dev} | + code-saturne | 0 | {engineering-dev,mathematics-dev} | collada-dom | 0 | {viewing-dev} | cqrlib | 0 | {mathematics-dev} | cvector | 0 | {mathematics-dev} | + debian-science | 0 | {physics} | debian-science | 0 | {electrophysiology} | debian-science | 0 | {nanoscale-physics-dev} | - debian-science | 0 | {physics} | dune-grid-glue | 0 | {mathematics-dev} | etsf-io | 0 | {nanoscale-physics-dev} | fastjet | 0 | {highenergy-physics-dev} | @@ -226,25 +226,25 @@ Last-Update: Sun, 29 Jun 2025 01:42:09 +0000 libsdsl | 0 | {dataacquisition-dev} | looptools | 0 | {highenergy-physics} | looptools | 0 | {highenergy-physics-dev} | - magma | 0 | {numericalcomputation,mathematics-dev} | + magma | 0 | {mathematics-dev,numericalcomputation} | mbt | 0 | {linguistics} | mctc-lib | 0 | {nanoscale-physics-dev,highenergy-physics-dev} | meshsdfilter | 0 | {mathematics-dev} | metis-edf | 0 | {engineering-dev} | - metis-edf | 0 | {numericalcomputation,engineering} | + metis-edf | 0 | {engineering,numericalcomputation} | nrn-mod2c | 0 | {biology} | openctm | 0 | {physics-dev} | opengv | 0 | {geometry} | openigtlink | 0 | {robotics-dev} | psurface | 0 | {numericalcomputation} | - python-escript | 0 | {engineering,numericalcomputation,simulations} | + python-escript | 0 | {numericalcomputation,simulations,engineering} | python-opcodes | 0 | {tools} | qrupdate | 0 | {mathematics-dev} | quadrule | 0 | {mathematics-dev} | robot-testing-framework | 0 | {robotics-dev} | ros-collada-urdf | 0 | {robotics} | - ros-metapackages | 0 | {robotics} | ros-metapackages | 0 | {robotics-dev} | + ros-metapackages | 0 | {robotics} | ros-opencv-apps | 0 | {robotics} | sagemath-database-combinatorial-designs | 0 | {mathematics} | sagemath-database-cremona-elliptic-curves | 0 | {mathematics} | @@ -253,7 +253,7 @@ Last-Update: Sun, 29 Jun 2025 01:42:09 +0000 sagemath-database-polytopes | 0 | {mathematics} | schroedinger-maeparser | 0 | {chemistry,nanoscale-physics-dev} | siscone | 0 | {highenergy-physics-dev} | - slicot | 0 | {engineering-dev,robotics-dev} | + slicot | 0 | {robotics-dev,engineering-dev} | sparskit | 0 | {mathematics-dev} | ssm | 0 | {nanoscale-physics} | tachyon | 0 | {mathematics} | ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,157 +1,157 @@ -Last-Update: Sun, 29 Jun 2025 01:42:12 +0000 +Last-Update: Sun, 29 Jun 2025 13:42:11 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- - mpmath | 9826 | - python-repoze.lru | 6939 | - netifaces | 5097 | - ghp-import | 4754 | - python-lunr | 4748 | - python-babel | 3748 | - sortedcontainers | 3461 | - python-babel | 3350 | - aiosignal | 2986 | - hyperlink | 2138 | - humanfriendly | 1984 | - python-notify2 | 1963 | - referencing | 1610 | - python-mysqldb | 1530 | - python-gssapi | 1451 | - python-invoke | 1370 | - python-hyperframe | 1367 | - websocket-client | 1294 | - python-hpack | 1148 | + mpmath | 9849 | + python-repoze.lru | 6945 | + netifaces | 5105 | + ghp-import | 4753 | + python-lunr | 4747 | + python-babel | 3734 | + sortedcontainers | 3467 | + python-babel | 3339 | + aiosignal | 2992 | + hyperlink | 2144 | + humanfriendly | 1991 | + python-notify2 | 1961 | + referencing | 1607 | + python-mysqldb | 1528 | + python-gssapi | 1450 | + python-hyperframe | 1370 | + python-invoke | 1367 | + websocket-client | 1295 | + python-hpack | 1155 | python-rsa | 1113 | - python-pandocfilters | 1007 | - menulibre | 970 | - python-linux-procfs | 932 | - pdfarranger | 925 | - python-geoip | 863 | - python-webob | 821 | - python-zopfli | 764 | + python-pandocfilters | 995 | + menulibre | 969 | + python-linux-procfs | 935 | + pdfarranger | 920 | + python-geoip | 862 | + python-webob | 826 | + python-zopfli | 790 | powerline | 752 | - powerline | 695 | - powerline | 689 | - firmware-microbit-micropython | 683 | - kazam | 665 | - u-msgpack-python | 576 | - python-et-xmlfile | 513 | - python-gevent | 494 | + powerline | 697 | + powerline | 691 | + firmware-microbit-micropython | 681 | + kazam | 666 | + u-msgpack-python | 582 | + python-et-xmlfile | 511 | + python-gevent | 495 | asn1crypto | 490 | - dockerpty | 489 | - autopep8 | 468 | - gaupol | 466 | + dockerpty | 487 | + gaupol | 465 | + autopep8 | 462 | python-ewmh | 450 | - catfish | 435 | - python-requests-oauthlib | 391 | - pytoolconfig | 374 | - spf-engine | 347 | - python-toml | 324 | - spf-engine | 297 | - python-ntlm-auth | 292 | + catfish | 432 | + python-requests-oauthlib | 388 | + pytoolconfig | 373 | + spf-engine | 348 | + python-toml | 322 | + spf-engine | 296 | + python-ntlm-auth | 290 | django-stronghold | 271 | - python-ldap3 | 257 | - cairocffi | 211 | - python-mimeparse | 195 | - python-smmap | 169 | - python-hidapi | 168 | - autokey | 164 | - httpie | 145 | - kivy | 133 | - python-anyjson | 133 | - smem | 129 | + python-ldap3 | 262 | + cairocffi | 212 | + python-mimeparse | 193 | + python-hidapi | 169 | + python-smmap | 168 | + autokey | 161 | + httpie | 143 | + kivy | 135 | + python-anyjson | 130 | + smem | 130 | mypaint | 128 | - python-aiostream | 128 | - python-click-repl | 117 | + python-aiostream | 127 | + python-click-repl | 120 | smartypants | 117 | - nodeenv | 104 | - lollypop | 102 | - timekpr-next | 99 | - python-consul | 98 | - mugshot | 97 | - pacparser | 95 | - python-pyu2f | 92 | - pymacaroons | 91 | - pymediainfo | 89 | + lollypop | 105 | + nodeenv | 102 | + python-consul | 101 | + timekpr-next | 100 | + pacparser | 97 | + mugshot | 95 | + python-pyu2f | 93 | + pymacaroons | 90 | python-rfc6555 | 89 | + pymediainfo | 88 | pssh | 82 | - python-colour | 80 | - numpy-stl | 71 | - python-i3ipc | 71 | - weasyprint | 67 | - python-pykka | 65 | - fabric | 64 | + python-colour | 78 | + numpy-stl | 72 | + python-i3ipc | 72 | + python-pykka | 69 | + weasyprint | 68 | + fabric | 63 | + mitmproxy | 63 | pywavelets | 63 | - mitmproxy | 59 | - itstool | 58 | - pyenv | 55 | - python-uritools | 52 | - ueberzug | 52 | + itstool | 57 | + pyenv | 54 | + python-uritools | 54 | + python-looseversion | 52 | + ueberzug | 51 | khard | 50 | mysql-connector-python | 50 | - python-looseversion | 50 | - python-scp | 49 | sshtunnel | 48 | + python-scp | 47 | blockdiag | 46 | kivy | 46 | + membernator | 46 | pymacs | 46 | - show-in-file-manager | 46 | - membernator | 45 | - python-pysol-cards | 45 | + show-in-file-manager | 45 | + python-pysol-cards | 44 | trac | 43 | - hatchling | 41 | + hatchling | 42 | + pylibmc | 40 | certipy | 39 | pamela | 39 | pdfposter | 39 | - pylibmc | 39 | pyquery | 39 | jupyterhub | 38 | powerline-gitstatus | 38 | python-scrypt | 34 | pssh | 32 | persepolis | 30 | + seqdiag | 30 | dkimpy-milter | 29 | - seqdiag | 29 | python-args | 28 | - sphinxcontrib-blockdiag | 27 | - sphinxcontrib-seqdiag | 27 | + sphinxcontrib-blockdiag | 28 | + sphinxcontrib-seqdiag | 28 | depthcharge-tools | 26 | - python-statsd | 26 | sphinx-inline-tabs | 26 | python-clint | 25 | - rst2pdf | 25 | + python-statsd | 25 | enzyme | 24 | + rst2pdf | 24 | + video-downloader | 24 | + nwdiag | 23 | subliminal | 23 | - typogrify | 23 | - video-downloader | 23 | webpy | 23 | cppman | 22 | flask-principal | 22 | - nwdiag | 22 | + python-fire | 22 | python-rangehttpserver | 22 | + typogrify | 22 | fabric | 21 | python-demjson | 21 | - python-fire | 21 | subliminal | 21 | python-pysubs2 | 20 | python-sdnotify | 20 | + actdiag | 19 | + backoff | 19 | nwg-displays | 19 | python-zstd | 19 | spf-engine | 19 | - actdiag | 18 | alot | 18 | - backoff | 18 | - ruff | 17 | - sphinxcontrib-log-cabinet | 17 | + sphinxcontrib-log-cabinet | 18 | + sphinxcontrib-actdiag | 17 | + sphinxcontrib-nwdiag | 17 | webtest | 17 | pykwalify | 16 | - sphinxcontrib-actdiag | 16 | - sphinxcontrib-nwdiag | 16 | + python-translationstring | 16 | beancount | 15 | django-environ | 15 | policyd-rate-limit | 15 | python-slip10 | 15 | - python-translationstring | 15 | + ruff | 15 | todoman | 15 | flask-security | 14 | mistune0 | 14 | @@ -159,56 +159,56 @@ Last-Update: Sun, 29 Jun 2025 01:42:12 +0000 unearth | 14 | pdm | 13 | python-ethtool | 13 | + python-hupper | 13 | python-inotify | 13 | python-kyotocabinet | 13 | python-pyalsa | 13 | - junos-eznc | 12 | + pylint-common | 12 | pyp | 12 | python-dbussy | 12 | - python-hupper | 12 | python-pem | 12 | - python-simpy | 12 | - python-xtermcolor | 12 | + python-pyscss | 12 | speaklater | 12 | txt2tags | 12 | beancount | 11 | flask-paranoid | 11 | jschema-to-python | 11 | - pwntools | 11 | - pylint-common | 11 | - python-parse-type | 11 | + junos-eznc | 11 | python-priority | 11 | - python-pyscss | 11 | python-sarif-python-om | 11 | + python-simpy | 11 | + python-xtermcolor | 11 | ansi | 10 | autotiling | 10 | btchip-python | 10 | + pwntools | 10 | + python-parse-type | 10 | + python-pyld | 10 | + python-pyrss2gen | 10 | slimit | 10 | tuna | 10 | flask-session | 9 | gmplot | 9 | gtextfsm | 9 | - python-pyld | 9 | - python-pyrss2gen | 9 | - traittypes | 9 | django-sass | 8 | httpcode | 8 | notebook-shim | 8 | python-ansicolors | 8 | python-digitalocean | 8 | - python-pyaml-env | 8 | python-versioneer | 8 | - sphinx-intl | 8 | + trac-wysiwyg | 8 | + traittypes | 8 | django-auditlog | 7 | - htmlmin | 7 | micropython-mpremote | 7 | pycallgraph | 7 | pytaglib | 7 | pytest-django | 7 | pytest-runner | 7 | python-halo | 7 | + python-numpysane | 7 | python-overpy | 7 | - trac-wysiwyg | 7 | + python-pyaml-env | 7 | + sphinx-intl | 7 | voltron | 7 | clustershell | 6 | debiancontributors | 6 | @@ -216,24 +216,26 @@ Last-Update: Sun, 29 Jun 2025 01:42:12 +0000 drf-yasg-nonfree | 6 | flask-api | 6 | graphql-relay | 6 | + htmlmin | 6 | mercurial-evolve | 6 | mypy-protobuf | 6 | pybik | 6 | pydrive2 | 6 | python-crcelk | 6 | python-drf-spectacular-sidecar-nonfree | 6 | - python-numpysane | 6 | + python-openstep-plist | 6 | python-text-unidecode | 6 | ruff | 6 | django-model-utils | 5 | easyprocess | 5 | hachoir | 5 | + pyfltk | 5 | pyjokes | 5 | pynliner | 5 | python-aiohttp-security | 5 | python-biplist | 5 | + python-gnuplotlib | 5 | python-networkmanager | 5 | - python-openstep-plist | 5 | python-simpy | 5 | sphinxcontrib-globalsubs | 5 | west | 5 | @@ -244,16 +246,12 @@ Last-Update: Sun, 29 Jun 2025 01:42:12 +0000 django-paintstore | 4 | django-pglocks | 4 | drf-haystack | 4 | - htmlmin | 4 | - numpy-stl | 4 | pyclamd | 4 | - pyfltk | 4 | pyjunitxml | 4 | pyroma | 4 | python3-onelogin-saml2 | 4 | python-dirq | 4 | python-envs | 4 | - python-gnuplotlib | 4 | python-srp | 4 | python-xdo | 4 | s3ql | 4 | @@ -274,6 +272,7 @@ Last-Update: Sun, 29 Jun 2025 01:42:12 +0000 flask-mongoengine | 3 | flask-paginate | 3 | flufl.testing | 3 | + htmlmin | 3 | jpylyzer | 3 | kconfiglib | 3 | librouteros | 3 | @@ -321,7 +320,9 @@ Last-Update: Sun, 29 Jun 2025 01:42:12 +0000 imap-tools | 2 | jsonrpclib-pelix | 2 | libthumbor | 2 | + myst-nb | 2 | namecheap | 2 | + numpy-stl | 2 | omgifol | 2 | panoramisk | 2 | pykwalify | 2 | @@ -363,7 +364,6 @@ Last-Update: Sun, 29 Jun 2025 01:42:12 +0000 milksnake | 1 | mkdocs-macros-plugin | 1 | moviepy | 1 | - myst-nb | 1 | onetimepass | 1 | power | 1 | prospector | 1 | @@ -372,7 +372,6 @@ Last-Update: Sun, 29 Jun 2025 01:42:12 +0000 python-bitbucket-api | 1 | python-broadlink | 1 | python-btrees | 1 | - python-chartkick | 1 | python-dataset | 1 | python-fluent-logger | 1 | python-gammu | 1 | @@ -386,7 +385,6 @@ Last-Update: Sun, 29 Jun 2025 01:42:12 +0000 python-openshift | 1 | python-opentracing | 1 | python-pgmagick | 1 | - python-pyout | 1 | python-py-zipkin | 1 | python-rdflib-endpoint | 1 | python-schedutils | 1 | @@ -402,6 +400,7 @@ Last-Update: Sun, 29 Jun 2025 01:42:12 +0000 sphinx-autorun | 1 | sphinxcontrib-github-alt | 1 | sphinx-sitemap | 1 | + trac-customfieldadmin | 1 | trac-httpauth | 1 | trac-subcomponents | 1 | trac-wikiprint | 1 | @@ -409,7 +408,6 @@ Last-Update: Sun, 29 Jun 2025 01:42:12 +0000 vrfydmn | 1 | wchartype | 1 | wikitrans | 1 | - zlmdb | 1 | zzzeeksphinx | 1 | aioairzone | 0 | aioeagle | 0 | @@ -506,6 +504,7 @@ Last-Update: Sun, 29 Jun 2025 01:42:12 +0000 python-calendra | 0 | python-casttube | 0 | python-certstream | 0 | + python-chartkick | 0 | python-chocolate | 0 | python-cogapp | 0 | python-digitalocean | 0 | @@ -540,6 +539,7 @@ Last-Update: Sun, 29 Jun 2025 01:42:12 +0000 python-persisting-theory | 0 | python-pook | 0 | python-pubchempy | 0 | + python-pyout | 0 | python-pypump | 0 | python-requests-oauthlib | 0 | python-rpcq | 0 | @@ -563,7 +563,6 @@ Last-Update: Sun, 29 Jun 2025 01:42:12 +0000 stackview | 0 | symmetrize | 0 | testrepository | 0 | - trac-customfieldadmin | 0 | trac-roadmap | 0 | turbosearch | 0 | vncdotool | 0 | @@ -571,6 +570,7 @@ Last-Update: Sun, 29 Jun 2025 01:42:12 +0000 webtest | 0 | yotta | 0 | zktop | 0 | + zlmdb | 0 | aioaseko | -1 | django-cachalot | -1 | drafthorse | -1 | View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/72d90f0059ea344065ba263fa75d8b6411b1bc2b -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/72d90f0059ea344065ba263fa75d8b6411b1bc2b You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Mon Jun 30 02:44:09 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Mon, 30 Jun 2025 01:44:09 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <6861ebe95fae3_3db26d5163460893d6@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: 7791ef16 by Andreas Tille at 2025-06-30T01:43:10+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Sun, 29 Jun 2025 13:42:04 +0000 +Last-Update: Mon, 30 Jun 2025 01:42:03 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- ===================================== debian-science-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Sun, 29 Jun 2025 13:42:07 +0000 +Last-Update: Mon, 30 Jun 2025 01:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,4 +1,4 @@ -Last-Update: Sun, 29 Jun 2025 13:42:11 +0000 +Last-Update: Mon, 30 Jun 2025 01:42:04 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/7791ef160b7125b0807bcf034a06a2b71b12b3a1 -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/7791ef160b7125b0807bcf034a06a2b71b12b3a1 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Mon Jun 30 10:22:12 2025 From: gitlab at salsa.debian.org (Alexandre Detiste (@detiste-guest)) Date: Mon, 30 Jun 2025 09:22:12 +0000 Subject: [med-svn] [Git][med-team/bcbio][master] 2 commits: patch-out python3-mock Message-ID: <686257449da02_3db273476386121660@godard.mail> Alexandre Detiste pushed to branch master at Debian Med / bcbio Commits: cca9c807 by Alexandre Detiste at 2025-06-30T11:09:09+02:00 patch-out python3-mock - - - - - 64f8e389 by Alexandre Detiste at 2025-06-30T11:13:05+02:00 fix typo in changelog - - - - - 5 changed files: - debian/TODO - debian/changelog - debian/control - + debian/patches/remove_mock.patch - debian/patches/series Changes: ===================================== debian/TODO ===================================== @@ -65,7 +65,6 @@ convinced that this is no longer required. htslib # not called directly? #pip # ridiculous openssl >=1.1.1c,<1.1.2a - pytest-mock pytest-cov seaborn # not called directly? viennarna dragged in via python3-seqcluster @@ -83,7 +82,6 @@ convinced that this is no longer required. logbook matplotlib msgpack-python https://msgpack.org/ - mock mosdepth python pandas ===================================== debian/changelog ===================================== @@ -1,3 +1,10 @@ +bcbio (1.2.9-4) unstable; urgency=medium + + * Team upload. + * Patch-out build-dependency on python3-mock + + -- Alexandre Detiste Mon, 30 Jun 2025 11:08:43 +0200 + bcbio (1.2.9-3) unstable; urgency=medium * Team upload. @@ -6,7 +13,7 @@ bcbio (1.2.9-3) unstable; urgency=medium * Fix lintian-overrides about script-with-language-extension * DEP3 * Do not ship empty manpage - * Use pytest instead of node + * Use pytest instead of nose Closes: #1018312 * Standards-Version: 4.6.2 (routine-update) * Build-Depends: s/dh-python/dh-sequence-python3/ (routine-update) ===================================== debian/control ===================================== @@ -10,7 +10,6 @@ Build-Depends: debhelper-compat (= 13), python3-all, python3-setuptools, python3-gffutils, - python3-mock, python3-pandas, python3-pybedtools, python3-pysam, ===================================== debian/patches/remove_mock.patch ===================================== @@ -0,0 +1,18 @@ +--- a/tests/unit/distributed/test_transaction.py ++++ b/tests/unit/distributed/test_transaction.py +@@ -1,5 +1,5 @@ + import pytest +-import mock ++from unittest import mock + + from bcbio.distributed import transaction + from bcbio.distributed.transaction import tx_tmpdir +--- a/tests/unit/upload/test_upload.py ++++ b/tests/unit/upload/test_upload.py +@@ -1,5 +1,5 @@ + import os +-import mock ++from unittest import mock + import pytest + + from bcbio import upload ===================================== debian/patches/series ===================================== @@ -7,3 +7,4 @@ hts_nim_tools.patch cnvkitPath.patch fixeFreetypePreload.patch RscriptIsSystemVersion.patch +remove_mock.patch View it on GitLab: https://salsa.debian.org/med-team/bcbio/-/compare/41a2c17f3f159969810a843f1f61c1e0a08061e5...64f8e389fc0acb1ec9c565c1f1509960542e6630 -- View it on GitLab: https://salsa.debian.org/med-team/bcbio/-/compare/41a2c17f3f159969810a843f1f61c1e0a08061e5...64f8e389fc0acb1ec9c565c1f1509960542e6630 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Mon Jun 30 10:57:26 2025 From: gitlab at salsa.debian.org (Alexandre Detiste (@detiste-guest)) Date: Mon, 30 Jun 2025 09:57:26 +0000 Subject: [med-svn] [Git][med-team/bcbio][master] Salsa: do not attempt build on i386 Message-ID: <68625f86c3f4d_3db27396030613474d@godard.mail> Alexandre Detiste pushed to branch master at Debian Med / bcbio Commits: a8db4d01 by Alexandre Detiste at 2025-06-30T11:45:50+02:00 Salsa: do not attempt build on i386 - - - - - 1 changed file: - debian/salsa-ci.yml Changes: ===================================== debian/salsa-ci.yml ===================================== @@ -2,3 +2,6 @@ include: - https://salsa.debian.org/salsa-ci-team/pipeline/raw/master/salsa-ci.yml - https://salsa.debian.org/salsa-ci-team/pipeline/raw/master/pipeline-jobs.yml + +variables: + SALSA_CI_DISABLE_BUILD_PACKAGE_I386: 1 View it on GitLab: https://salsa.debian.org/med-team/bcbio/-/commit/a8db4d01ddbf2695263720f8f2c14b28c3e00783 -- View it on GitLab: https://salsa.debian.org/med-team/bcbio/-/commit/a8db4d01ddbf2695263720f8f2c14b28c3e00783 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Mon Jun 30 11:04:17 2025 From: gitlab at salsa.debian.org (Alexandre Detiste (@detiste-guest)) Date: Mon, 30 Jun 2025 10:04:17 +0000 Subject: [med-svn] [Git][med-team/bcbio] Pushed new tag debian/1.2.9-4 Message-ID: <68626121a4a5b_3db2754dec8613694a@godard.mail> Alexandre Detiste pushed new tag debian/1.2.9-4 at Debian Med / bcbio -- View it on GitLab: https://salsa.debian.org/med-team/bcbio/-/tree/debian/1.2.9-4 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: From gitlab at salsa.debian.org Mon Jun 30 14:45:18 2025 From: gitlab at salsa.debian.org (Andreas Tille (@tille)) Date: Mon, 30 Jun 2025 13:45:18 +0000 Subject: [med-svn] [Git][med-team/community/helper-scripts][master] automatic update Message-ID: <686294eeefb64_3db2755824c6177155@godard.mail> Andreas Tille pushed to branch master at Debian Med / community / helper-scripts Commits: 79bc0235 by Andreas Tille at 2025-06-30T13:43:22+00:00 automatic update - - - - - 4 changed files: - debian-med-tests.txt - debian-science-tests.txt - outdated_med-packages.txt - python-team-tests.txt Changes: ===================================== debian-med-tests.txt ===================================== @@ -1,37 +1,33 @@ -Last-Update: Mon, 30 Jun 2025 01:42:03 +0000 +Last-Update: Mon, 30 Jun 2025 13:42:04 +0000 Source | Vote | Tasks | Tags -------------------------------+--------+--------------------------------------------+---------------------------------------------------------------------- dicomscope | 27 | {imaging} | - oscar | 19 | {data,tools,practice} | + oscar | 18 | {data,tools,practice} | orthanc-gdcm | 17 | {imaging} | mrtrix3 | 15 | {imaging} | pixelmed | 14 | {imaging} | gnumed-server | 12 | {covid-19,practice} | + king | 11 | {typesetting,imaging} | sight | 11 | {imaging} | - king | 10 | {typesetting,imaging} | orthanc-mysql | 10 | {imaging} | + orthanc-postgresql | 10 | {imaging} | bart-view | 9 | {imaging} | - orthanc-postgresql | 9 | {imaging} | adun.app | 8 | {bio} | icb-utils | 8 | {bio-dev} | libminc | 8 | {imaging-dev} | heudiconv | 7 | {imaging} | mia | 6 | {imaging} | - sight | 5 | {imaging} | insighttoolkit5 | 4 | {imaging-dev} | - jebl2 | 4 | {bio-dev} | + sight | 4 | {imaging} | ants | 3 | {imaging} | - biojava6-live | 3 | {bio-dev} | biojava-live | 3 | {bio-dev} | + jebl2 | 3 | {bio-dev} | piler | 3 | {bio} | + biojava6-live | 2 | {bio-dev} | getdata | 2 | {bio} | libdivsufsort | 2 | {bio-dev} | - plasmidid | 2 | {covid-19,bio} | rambo-k | 2 | {bio} | - tracetuner | 2 | {bio} | - beast-mcmc | 1 | {bio,bio-phylogeny} | - bio-tradis | 1 | {bio,bio-dev} | cmtk | 1 | {imaging} | ctn | 1 | {imaging-dev} | dextractor | 1 | {bio,covid-19} | @@ -40,6 +36,7 @@ Last-Update: Mon, 30 Jun 2025 01:42:03 +0000 fastml | 1 | {bio} | htscodecs | 1 | {bio-dev,covid-19} | ipig | 1 | {bio} | + libctapimkt | 1 | {practice} | libgenome | 1 | {bio-dev} | melting | 1 | {cloud,bio} | mhap | 1 | {bio,bio-ngs} | @@ -48,23 +45,23 @@ Last-Update: Mon, 30 Jun 2025 01:42:03 +0000 pbcopper | 1 | {bio-dev} | pbseqlib | 1 | {bio-dev} | phyutility | 1 | {cloud,bio} | + plasmidid | 1 | {covid-19,bio} | proalign | 1 | {bio-phylogeny,bio} | runcircos-gui | 1 | {bio} | seq-gen | 1 | {bio} | - sga | 1 | {bio} | spread-phy | 1 | {bio,bio-phylogeny} | staden | 1 | {bio} | - surankco | 1 | {bio} | - surpyvor | 1 | {bio} | - thesias | 1 | {bio,covid-19} | tophat-recondition | 1 | {covid-19,bio} | + tracetuner | 1 | {bio} | treeview | 1 | {bio-phylogeny,bio} | varscan | 1 | {covid-19,bio} | xdffileio | 1 | {imaging-dev} | acedb | 0 | {cloud,bio} | bambamc | 0 | {bio-dev} | + beast-mcmc | 0 | {bio,bio-phylogeny} | biojava4-live | 0 | {bio-dev} | biosyntax | 0 | {bio} | + bio-tradis | 0 | {bio,bio-dev} | blimps | 0 | {bio} | brig | 0 | {bio} | camp | 0 | {imaging-dev} | @@ -93,7 +90,6 @@ Last-Update: Mon, 30 Jun 2025 01:42:03 +0000 libbpp-seq | 0 | {bio-dev} | libbpp-seq-omics | 0 | {bio-dev} | libchado-perl | 0 | {bio-dev} | - libctapimkt | 0 | {practice} | libgkarrays | 0 | {bio-dev} | libhmsbeagle | 0 | {bio-dev} | libics | 0 | {covid-19,imaging-dev} | @@ -131,8 +127,8 @@ Last-Update: Mon, 30 Jun 2025 01:42:03 +0000 pscan-chip | 0 | {bio} | pymia | 0 | {imaging-dev} | python-cgelib | 0 | {bio-dev} | - python-seqcluster | 0 | {bio} | python-seqcluster | 0 | {bio-dev,covid-19} | + python-seqcluster | 0 | {bio} | qcumber | 0 | {bio} | rdp-alignment | 0 | {bio} | rdp-classifier | 0 | {bio} | @@ -142,6 +138,7 @@ Last-Update: Mon, 30 Jun 2025 01:42:03 +0000 savvy | 0 | {bio-dev} | savvy | 0 | {bio} | sbmltoolbox | 0 | {bio-dev} | + sga | 0 | {bio} | sibsim4 | 0 | {cloud,bio} | sift | 0 | {bio} | sight | 0 | {imaging-dev} | @@ -152,6 +149,9 @@ Last-Update: Mon, 30 Jun 2025 01:42:03 +0000 sprai | 0 | {bio} | srf | 0 | {bio-dev} | suitename | 0 | {bio} | + surankco | 0 | {bio} | + surpyvor | 0 | {bio} | + thesias | 0 | {bio,covid-19} | trace2dbest | 0 | {bio} | vienna-rna | 0 | {bio,covid-19} | xxsds-dynamic | 0 | {bio-dev} | ===================================== debian-science-tests.txt ===================================== @@ -1,58 +1,58 @@ -Last-Update: Mon, 30 Jun 2025 01:42:04 +0000 +Last-Update: Mon, 30 Jun 2025 13:42:08 +0000 Source | Vote | Tasks | Tags -------------------------------------------+--------+---------------------------------------------------------------------+----------------------------------------------------- - nltk | 4809 | {linguistics} | - gts | 4585 | {viewing} | - opencascade | 582 | {simulations} | - spacenavd | 228 | {tools} | + nltk | 4823 | {linguistics} | + gts | 4568 | {viewing} | + opencascade | 576 | {simulations} | + spacenavd | 230 | {tools} | armadillo | 179 | {mathematics-dev} | - open-coarrays | 164 | {meteorology-dev} | - arpack | 84 | {mathematics-dev} | - scalapack | 50 | {nanoscale-physics-dev} | - visidata | 45 | {datamanagement} | - ntl | 44 | {mathematics-dev} | - imview | 41 | {viewing} | - mbpoll | 33 | {simulations} | + open-coarrays | 166 | {meteorology-dev} | + arpack | 83 | {mathematics-dev} | + scalapack | 48 | {nanoscale-physics-dev} | + visidata | 44 | {datamanagement} | + imview | 42 | {viewing} | + ntl | 41 | {mathematics-dev} | ppl | 33 | {numericalcomputation} | - arduino-mk | 28 | {robotics} | + mbpoll | 32 | {simulations} | + flintqs | 30 | {mathematics} | flann | 28 | {mathematics-dev,engineering-dev} | - flintqs | 28 | {mathematics} | - cliquer | 26 | {mathematics} | + cliquer | 27 | {mathematics} | + arduino-mk | 26 | {robotics} | libmatio | 25 | {mathematics-dev} | - libm4ri | 24 | {mathematics-dev} | + libm4ri | 22 | {mathematics-dev} | setzer | 22 | {typesetting} | - xygrib | 22 | {meteorology} | - grads | 18 | {meteorology} | - bossa | 17 | {devices} | - fftw | 17 | {mathematics-dev,physics-dev,meteorology-dev} | - sat4j | 17 | {logic} | + xygrib | 21 | {meteorology} | + sat4j | 18 | {logic} | + grads | 17 | {meteorology} | + picosat | 17 | {logic} | + bossa | 16 | {devices} | + fftw | 16 | {mathematics-dev,physics-dev,meteorology-dev} | guiqwt | 16 | {numericalcomputation,viewing} | - picosat | 16 | {logic} | pyzo | 16 | {numericalcomputation} | sketch | 16 | {typesetting} | - lrcalc | 15 | {mathematics-dev} | ncl | 15 | {meteorology} | - teem | 15 | {imageanalysis} | - cliquer | 13 | {mathematics-dev} | + gts | 14 | {viewing-dev} | + lrcalc | 14 | {mathematics-dev} | + teem | 14 | {imageanalysis} | eccodes | 13 | {meteorology,meteorology-dev} | - lxi-tools | 13 | {engineering,dataacquisition} | + cliquer | 12 | {mathematics-dev} | dune-uggrid | 12 | {mathematics-dev} | feff85exafs | 12 | {chemistry} | - gts | 12 | {viewing-dev} | - libitpp | 12 | {mathematics-dev,engineering-dev} | + lxi-tools | 12 | {engineering,dataacquisition} | matlab-support | 12 | {mathematics,numericalcomputation} | pcl | 12 | {robotics-dev} | - eccodes | 11 | {meteorology-dev} | gf2x | 11 | {mathematics-dev} | iml | 11 | {mathematics-dev} | libhomfly | 11 | {mathematics-dev} | + coinor-symphony | 10 | {logic,mathematics,numericalcomputation} | + eccodes | 10 | {meteorology-dev} | feedgnuplot | 10 | {viewing} | + geg | 10 | {viewing} | libm4rie | 10 | {mathematics-dev} | ncl | 10 | {meteorology-dev} | - coinor-symphony | 9 | {logic,mathematics,numericalcomputation} | + libitpp | 9 | {mathematics-dev,engineering-dev} | python-escript | 9 | {numericalcomputation,simulations,engineering} | - geg | 8 | {viewing} | opencascade | 8 | {simulations} | persalys | 8 | {engineering,statistics,mathematics} | vdt | 8 | {mathematics-dev} | @@ -66,22 +66,23 @@ Last-Update: Mon, 30 Jun 2025 01:42:04 +0000 urdfdom-headers | 7 | {robotics-dev} | apophenia | 6 | {statistics} | cld2 | 6 | {linguistics} | + fftw | 6 | {meteorology-dev,mathematics-dev,physics-dev} | libzn-poly | 6 | {mathematics-dev} | - muparser | 6 | {mathematics-dev} | psurface | 6 | {numericalcomputation} | python-cdo | 6 | {meteorology} | + toulbar2 | 6 | {logic,numericalcomputation,mathematics,physics} | uctodata | 6 | {linguistics} | debian-science | 5 | {economics,nanoscale-physics,machine-learning,physics,mathematics} | dxsamples | 5 | {nanoscale-physics} | - fftw | 5 | {meteorology-dev,mathematics-dev,physics-dev} | magics++ | 5 | {meteorology-dev} | + muparser | 5 | {mathematics-dev} | newmat | 5 | {mathematics-dev} | odc | 5 | {meteorology} | odc | 5 | {meteorology-dev} | ros-rosconsole | 5 | {robotics-dev} | + ros-vcstool | 5 | {robotics-dev} | rubiks | 5 | {geometry,mathematics} | toontag | 5 | {numericalcomputation} | - toulbar2 | 5 | {logic,numericalcomputation,mathematics,physics} | ucto | 5 | {linguistics} | veccore | 5 | {mathematics-dev} | debian-science | 4 | {physics,machine-learning,economics,nanoscale-physics} | @@ -89,7 +90,6 @@ Last-Update: Mon, 30 Jun 2025 01:42:04 +0000 mpi4py-fft | 4 | {mathematics-dev} | openstereogram | 4 | {tools} | rheolef | 4 | {mathematics} | - ros-vcstool | 4 | {robotics-dev} | sdpb | 4 | {numericalcomputation,highenergy-physics} | silo-llnl | 4 | {engineering} | syrthes | 4 | {engineering} | @@ -98,7 +98,6 @@ Last-Update: Mon, 30 Jun 2025 01:42:04 +0000 auto-07p | 3 | {mathematics} | coda | 3 | {meteorology} | coda | 3 | {meteorology-dev} | - dxflib | 3 | {engineering-dev} | ecbuild | 3 | {meteorology-dev} | emoslib | 3 | {meteorology-dev} | fpzip | 3 | {meteorology} | @@ -107,13 +106,14 @@ Last-Update: Mon, 30 Jun 2025 01:42:04 +0000 hdf-eos5 | 3 | {meteorology-dev} | iapws | 3 | {meteorology} | ipe-tools | 3 | {typesetting} | + irstlm | 3 | {linguistics} | libcgns | 3 | {engineering} | libgctp | 3 | {meteorology-dev} | + libvigraimpex | 3 | {imageanalysis-dev,machine-learning} | metview | 3 | {meteorology} | polylib | 3 | {mathematics} | sac2mseed | 3 | {geography} | sagemath-database-conway-polynomials | 3 | {mathematics} | - sardana | 3 | {dataacquisition} | scram | 3 | {engineering} | silo-llnl | 3 | {engineering} | spaghetti | 3 | {geography} | @@ -126,24 +126,23 @@ Last-Update: Mon, 30 Jun 2025 01:42:04 +0000 coinor-bonmin | 2 | {mathematics} | cylc-flow | 2 | {meteorology} | debian-science | 2 | {nanoscale-physics,statistics,economics,physics} | + debian-science | 2 | {economics} | debian-science | 2 | {electrophysiology} | drslib | 2 | {meteorology} | dune-functions | 2 | {mathematics-dev} | dune-localfunctions | 2 | {mathematics-dev} | dune-typetree | 2 | {mathematics-dev} | + dxflib | 2 | {engineering-dev} | emoslib | 2 | {meteorology} | - fastjet | 2 | {highenergy-physics-dev} | frog | 2 | {linguistics} | gemmlowp | 2 | {mathematics-dev} | harp | 2 | {meteorology} | hpcc | 2 | {numericalcomputation,distributedcomputing} | ipe-tools | 2 | {typesetting} | - irstlm | 2 | {linguistics} | libcvd | 2 | {imageanalysis} | libgtkdatabox | 2 | {engineering-dev,viewing-dev} | - libmatheval | 2 | {mathematics} | libmatheval | 2 | {mathematics-dev} | - libvigraimpex | 2 | {imageanalysis-dev,machine-learning} | + libmatheval | 2 | {mathematics} | lrcalc | 2 | {mathematics} | metkit | 2 | {meteorology} | mmdb | 2 | {nanoscale-physics-dev,highenergy-physics-dev} | @@ -152,17 +151,19 @@ Last-Update: Mon, 30 Jun 2025 01:42:04 +0000 nrn-iv | 2 | {biology} | python-aws-xray-sdk | 2 | {dataacquisition-dev} | qwtplot3d | 2 | {viewing-dev} | + sardana | 2 | {dataacquisition} | silo-llnl | 2 | {engineering-dev} | + timbl | 2 | {linguistics} | apache-opennlp | 1 | {linguistics} | asl | 1 | {physics-dev} | atlas-ecmwf | 1 | {meteorology-dev} | code-saturne | 1 | {mathematics-dev,engineering-dev} | - debian-science | 1 | {neuroscience-cognitive} | - debian-science | 1 | {economics} | debian-science | 1 | {psychophysics} | - debian-science | 1 | {neuroscience-cognitive,machine-learning} | debian-science | 1 | {tools} | + debian-science | 1 | {neuroscience-cognitive} | + debian-science | 1 | {neuroscience-cognitive,machine-learning} | dimbl | 1 | {linguistics} | + fastjet | 1 | {highenergy-physics-dev} | gadap | 1 | {meteorology-dev} | hdf-eos4 | 1 | {meteorology-dev} | hepmc3 | 1 | {nanoscale-physics-dev,highenergy-physics-dev} | @@ -187,7 +188,6 @@ Last-Update: Mon, 30 Jun 2025 01:42:04 +0000 spfft | 1 | {mathematics-dev,nanoscale-physics-dev,physics-dev,meteorology-dev} | ssm | 1 | {nanoscale-physics-dev} | tfdocgen | 1 | {linguistics} | - timbl | 1 | {linguistics} | timblserver | 1 | {linguistics} | trilinos | 1 | {physics-dev,mathematics-dev,engineering-dev} | vlfeat | 1 | {imageanalysis-dev} | @@ -206,14 +206,14 @@ Last-Update: Mon, 30 Jun 2025 01:42:04 +0000 clhep | 0 | {highenergy-physics-dev} | cmor | 0 | {meteorology-dev} | coda | 0 | {meteorology-dev} | - code-saturne | 0 | {engineering} | code-saturne | 0 | {engineering-dev,mathematics-dev} | + code-saturne | 0 | {engineering} | collada-dom | 0 | {viewing-dev} | cqrlib | 0 | {mathematics-dev} | cvector | 0 | {mathematics-dev} | + debian-science | 0 | {nanoscale-physics-dev} | debian-science | 0 | {physics} | debian-science | 0 | {electrophysiology} | - debian-science | 0 | {nanoscale-physics-dev} | dune-grid-glue | 0 | {mathematics-dev} | etsf-io | 0 | {nanoscale-physics-dev} | fastjet | 0 | {highenergy-physics-dev} | @@ -224,14 +224,14 @@ Last-Update: Mon, 30 Jun 2025 01:42:04 +0000 libfolia | 0 | {linguistics} | libquantum | 0 | {numericalcomputation} | libsdsl | 0 | {dataacquisition-dev} | - looptools | 0 | {highenergy-physics} | looptools | 0 | {highenergy-physics-dev} | + looptools | 0 | {highenergy-physics} | magma | 0 | {mathematics-dev,numericalcomputation} | mbt | 0 | {linguistics} | mctc-lib | 0 | {nanoscale-physics-dev,highenergy-physics-dev} | meshsdfilter | 0 | {mathematics-dev} | - metis-edf | 0 | {engineering-dev} | metis-edf | 0 | {engineering,numericalcomputation} | + metis-edf | 0 | {engineering-dev} | nrn-mod2c | 0 | {biology} | openctm | 0 | {physics-dev} | opengv | 0 | {geometry} | ===================================== outdated_med-packages.txt ===================================== The diff for this file was not included because it is too large. ===================================== python-team-tests.txt ===================================== @@ -1,207 +1,207 @@ -Last-Update: Mon, 30 Jun 2025 01:42:04 +0000 +Last-Update: Mon, 30 Jun 2025 13:42:11 +0000 Source | Vote | Tags ----------------------------------------+--------+-------------------------------------------------------- - mpmath | 9849 | - python-repoze.lru | 6945 | - netifaces | 5105 | - ghp-import | 4753 | - python-lunr | 4747 | - python-babel | 3734 | - sortedcontainers | 3467 | - python-babel | 3339 | - aiosignal | 2992 | - hyperlink | 2144 | - humanfriendly | 1991 | - python-notify2 | 1961 | - referencing | 1607 | - python-mysqldb | 1528 | - python-gssapi | 1450 | - python-hyperframe | 1370 | - python-invoke | 1367 | - websocket-client | 1295 | - python-hpack | 1155 | - python-rsa | 1113 | - python-pandocfilters | 995 | - menulibre | 969 | - python-linux-procfs | 935 | - pdfarranger | 920 | - python-geoip | 862 | - python-webob | 826 | - python-zopfli | 790 | - powerline | 752 | - powerline | 697 | - powerline | 691 | - firmware-microbit-micropython | 681 | - kazam | 666 | - u-msgpack-python | 582 | - python-et-xmlfile | 511 | - python-gevent | 495 | - asn1crypto | 490 | - dockerpty | 487 | - gaupol | 465 | - autopep8 | 462 | - python-ewmh | 450 | - catfish | 432 | + mpmath | 9887 | + python-repoze.lru | 6941 | + netifaces | 5114 | + ghp-import | 4763 | + python-lunr | 4760 | + python-babel | 3744 | + sortedcontainers | 3458 | + python-babel | 3348 | + aiosignal | 2976 | + hyperlink | 2135 | + humanfriendly | 1994 | + python-notify2 | 1959 | + referencing | 1591 | + python-mysqldb | 1533 | + python-gssapi | 1446 | + python-invoke | 1368 | + python-hyperframe | 1355 | + websocket-client | 1306 | + python-hpack | 1144 | + python-rsa | 1111 | + python-pandocfilters | 987 | + menulibre | 960 | + python-linux-procfs | 938 | + pdfarranger | 914 | + python-geoip | 864 | + python-zopfli | 818 | + python-webob | 811 | + powerline | 756 | + powerline | 701 | + powerline | 695 | + firmware-microbit-micropython | 677 | + kazam | 657 | + u-msgpack-python | 581 | + python-et-xmlfile | 505 | + dockerpty | 492 | + python-gevent | 489 | + asn1crypto | 485 | + autopep8 | 458 | + gaupol | 456 | + python-ewmh | 448 | + catfish | 431 | python-requests-oauthlib | 388 | - pytoolconfig | 373 | - spf-engine | 348 | - python-toml | 322 | - spf-engine | 296 | - python-ntlm-auth | 290 | - django-stronghold | 271 | + pytoolconfig | 369 | + spf-engine | 347 | + python-toml | 324 | + spf-engine | 299 | + python-ntlm-auth | 283 | + django-stronghold | 270 | python-ldap3 | 262 | - cairocffi | 212 | - python-mimeparse | 193 | - python-hidapi | 169 | - python-smmap | 168 | + cairocffi | 213 | + python-mimeparse | 192 | + python-hidapi | 168 | + python-smmap | 166 | autokey | 161 | - httpie | 143 | - kivy | 135 | - python-anyjson | 130 | + httpie | 142 | + kivy | 136 | + mypaint | 131 | smem | 130 | - mypaint | 128 | - python-aiostream | 127 | - python-click-repl | 120 | - smartypants | 117 | - lollypop | 105 | + python-anyjson | 128 | + python-aiostream | 126 | + python-click-repl | 119 | + smartypants | 116 | + lollypop | 106 | nodeenv | 102 | - python-consul | 101 | + python-consul | 102 | timekpr-next | 100 | - pacparser | 97 | + pacparser | 98 | mugshot | 95 | - python-pyu2f | 93 | - pymacaroons | 90 | - python-rfc6555 | 89 | - pymediainfo | 88 | - pssh | 82 | + python-pyu2f | 92 | + pymacaroons | 88 | + python-rfc6555 | 87 | + pymediainfo | 86 | + pssh | 79 | python-colour | 78 | - numpy-stl | 72 | python-i3ipc | 72 | + numpy-stl | 69 | python-pykka | 69 | - weasyprint | 68 | - fabric | 63 | - mitmproxy | 63 | - pywavelets | 63 | - itstool | 57 | - pyenv | 54 | + weasyprint | 67 | + pywavelets | 64 | + mitmproxy | 62 | + fabric | 60 | + itstool | 55 | + pyenv | 55 | python-uritools | 54 | - python-looseversion | 52 | - ueberzug | 51 | khard | 50 | mysql-connector-python | 50 | - sshtunnel | 48 | - python-scp | 47 | - blockdiag | 46 | + python-looseversion | 50 | + ueberzug | 50 | + blockdiag | 47 | kivy | 46 | membernator | 46 | - pymacs | 46 | - show-in-file-manager | 45 | - python-pysol-cards | 44 | + sshtunnel | 46 | + python-pysol-cards | 45 | + python-scp | 44 | + show-in-file-manager | 44 | + pymacs | 43 | trac | 43 | - hatchling | 42 | + hatchling | 40 | pylibmc | 40 | certipy | 39 | pamela | 39 | - pdfposter | 39 | - pyquery | 39 | + powerline-gitstatus | 39 | jupyterhub | 38 | - powerline-gitstatus | 38 | + pdfposter | 38 | + pyquery | 37 | + pssh | 34 | python-scrypt | 34 | - pssh | 32 | persepolis | 30 | seqdiag | 30 | - dkimpy-milter | 29 | - python-args | 28 | sphinxcontrib-blockdiag | 28 | sphinxcontrib-seqdiag | 28 | + dkimpy-milter | 27 | depthcharge-tools | 26 | + python-args | 26 | sphinx-inline-tabs | 26 | - python-clint | 25 | python-statsd | 25 | + video-downloader | 25 | enzyme | 24 | rst2pdf | 24 | - video-downloader | 24 | - nwdiag | 23 | + cppman | 23 | + python-clint | 23 | + python-rangehttpserver | 23 | subliminal | 23 | - webpy | 23 | - cppman | 22 | - flask-principal | 22 | + fabric | 22 | + nwdiag | 22 | python-fire | 22 | - python-rangehttpserver | 22 | + python-sdnotify | 22 | typogrify | 22 | - fabric | 21 | - python-demjson | 21 | + webpy | 22 | + flask-principal | 21 | subliminal | 21 | + nwg-displays | 20 | python-pysubs2 | 20 | - python-sdnotify | 20 | - actdiag | 19 | backoff | 19 | - nwg-displays | 19 | + python-demjson | 19 | python-zstd | 19 | spf-engine | 19 | + actdiag | 18 | alot | 18 | - sphinxcontrib-log-cabinet | 18 | - sphinxcontrib-actdiag | 17 | - sphinxcontrib-nwdiag | 17 | + sphinxcontrib-log-cabinet | 17 | webtest | 17 | pykwalify | 16 | python-translationstring | 16 | + sphinxcontrib-actdiag | 16 | + sphinxcontrib-nwdiag | 16 | beancount | 15 | - django-environ | 15 | + mistune0 | 15 | policyd-rate-limit | 15 | python-slip10 | 15 | ruff | 15 | todoman | 15 | - flask-security | 14 | - mistune0 | 14 | + unearth | 15 | + django-environ | 14 | + python-pyalsa | 14 | social-auth-core | 14 | - unearth | 14 | + flask-security | 13 | pdm | 13 | - python-ethtool | 13 | python-hupper | 13 | python-inotify | 13 | python-kyotocabinet | 13 | - python-pyalsa | 13 | pylint-common | 12 | - pyp | 12 | python-dbussy | 12 | + python-ethtool | 12 | python-pem | 12 | python-pyscss | 12 | - speaklater | 12 | txt2tags | 12 | + autotiling | 11 | beancount | 11 | - flask-paranoid | 11 | jschema-to-python | 11 | junos-eznc | 11 | - python-priority | 11 | + pyp | 11 | python-sarif-python-om | 11 | python-simpy | 11 | python-xtermcolor | 11 | + speaklater | 11 | ansi | 10 | - autotiling | 10 | btchip-python | 10 | + flask-paranoid | 10 | pwntools | 10 | python-parse-type | 10 | + python-priority | 10 | python-pyld | 10 | python-pyrss2gen | 10 | - slimit | 10 | tuna | 10 | - flask-session | 9 | gmplot | 9 | gtextfsm | 9 | - django-sass | 8 | - httpcode | 8 | - notebook-shim | 8 | + httpcode | 9 | + notebook-shim | 9 | + slimit | 9 | + flask-session | 8 | python-ansicolors | 8 | python-digitalocean | 8 | python-versioneer | 8 | trac-wysiwyg | 8 | traittypes | 8 | django-auditlog | 7 | + django-sass | 7 | micropython-mpremote | 7 | + pybik | 7 | pycallgraph | 7 | - pytaglib | 7 | pytest-django | 7 | pytest-runner | 7 | python-halo | 7 | @@ -209,26 +209,24 @@ Last-Update: Mon, 30 Jun 2025 01:42:04 +0000 python-overpy | 7 | python-pyaml-env | 7 | sphinx-intl | 7 | - voltron | 7 | clustershell | 6 | debiancontributors | 6 | - drf-extensions | 6 | drf-yasg-nonfree | 6 | - flask-api | 6 | - graphql-relay | 6 | - htmlmin | 6 | + hachoir | 6 | mercurial-evolve | 6 | - mypy-protobuf | 6 | - pybik | 6 | pydrive2 | 6 | + pytaglib | 6 | python-crcelk | 6 | python-drf-spectacular-sidecar-nonfree | 6 | - python-openstep-plist | 6 | - python-text-unidecode | 6 | ruff | 6 | - django-model-utils | 5 | + voltron | 6 | + west | 6 | + drf-extensions | 5 | easyprocess | 5 | - hachoir | 5 | + flask-api | 5 | + graphql-relay | 5 | + htmlmin | 5 | + mypy-protobuf | 5 | pyfltk | 5 | pyjokes | 5 | pynliner | 5 | @@ -236,41 +234,32 @@ Last-Update: Mon, 30 Jun 2025 01:42:04 +0000 python-biplist | 5 | python-gnuplotlib | 5 | python-networkmanager | 5 | + python-openstep-plist | 5 | python-simpy | 5 | - sphinxcontrib-globalsubs | 5 | - west | 5 | + python-text-unidecode | 5 | aiomysql | 4 | - bootstrap-flask | 4 | - cplay-ng | 4 | - django-jinja | 4 | - django-paintstore | 4 | - django-pglocks | 4 | - drf-haystack | 4 | + django-model-utils | 4 | pyclamd | 4 | + pyjokes | 4 | pyjunitxml | 4 | pyroma | 4 | python3-onelogin-saml2 | 4 | python-dirq | 4 | python-envs | 4 | python-srp | 4 | - python-xdo | 4 | s3ql | 4 | smem | 4 | sorl-thumbnail | 4 | + sphinxcontrib-globalsubs | 4 | testrepository | 4 | + bootstrap-flask | 3 | + cplay-ng | 3 | cram | 3 | - django-bitfield | 3 | - django-js-reverse | 3 | - django-macaddress | 3 | - django-pagination | 3 | - django-redis-sessions | 3 | - django-render-block | 3 | - django-simple-redis-admin | 3 | - django-templated-email | 3 | - django-xmlrpc | 3 | - flask-flatpages | 3 | - flask-mongoengine | 3 | - flask-paginate | 3 | + django-jinja | 3 | + django-paintstore | 3 | + django-pglocks | 3 | + drf-haystack | 3 | + flake8-black | 3 | flufl.testing | 3 | htmlmin | 3 | jpylyzer | 3 | @@ -285,57 +274,56 @@ Last-Update: Mon, 30 Jun 2025 01:42:04 +0000 pyprind | 3 | pytest-expect | 3 | python-cookies | 3 | - python-django-casclient | 3 | - python-django-contact-form | 3 | - python-django-push-notifications | 3 | - python-django-registration | 3 | + python-dynaconf | 3 | python-jpype | 3 | - python-markuppy | 3 | python-urlobject | 3 | python-webdavclient | 3 | + python-xdo | 3 | securestring | 3 | soundcraft-utils | 3 | sphinx-markdown-tables | 3 | sphinx-paramlinks | 3 | trac-accountmanager | 3 | trac-xmlrpc | 3 | - wikitrans | 3 | azote | 2 | bqplot | 2 | clustershell | 2 | - django-any-js | 2 | - django-cachalot | 2 | - django-cacheops | 2 | - django-celery-email | 2 | - django-cleanup | 2 | - django-graphene | 2 | - django-maintenance-mode | 2 | - django-yarnpkg | 2 | + django-bitfield | 2 | + django-js-reverse | 2 | + django-macaddress | 2 | + django-pagination | 2 | + django-redis-sessions | 2 | + django-render-block | 2 | + django-simple-redis-admin | 2 | + django-templated-email | 2 | + django-xmlrpc | 2 | dotdrop | 2 | etm | 2 | extension-helpers | 2 | - flake8-black | 2 | + flask-flatpages | 2 | + flask-mongoengine | 2 | + flask-paginate | 2 | gtkman | 2 | hatch-jupyter-builder | 2 | imap-tools | 2 | - jsonrpclib-pelix | 2 | libthumbor | 2 | myst-nb | 2 | namecheap | 2 | - numpy-stl | 2 | omgifol | 2 | panoramisk | 2 | - pykwalify | 2 | + pypass | 2 | pyrad | 2 | python-commentjson | 2 | python-dbus-next | 2 | python-deepmerge | 2 | + python-django-casclient | 2 | + python-django-contact-form | 2 | + python-django-push-notifications | 2 | + python-django-registration | 2 | python-dnsq | 2 | - python-dynaconf | 2 | - python-ephemeral-port-reserve | 2 | - python-funcy | 2 | python-gfloat | 2 | python-ipfix | 2 | + python-markuppy | 2 | python-netfilter | 2 | python-netfilterqueue | 2 | python-pysubs2 | 2 | @@ -348,32 +336,46 @@ Last-Update: Mon, 30 Jun 2025 01:42:04 +0000 thumbor-plugins-gifv | 2 | utidylib | 2 | vcversioner | 2 | + wikitrans | 2 | yotta | 2 | zabbix-cli | 2 | apkinspector | 1 | brebis | 1 | celery-progress | 1 | django-ajax-selects | 1 | + django-any-js | 1 | + django-cachalot | 1 | + django-cacheops | 1 | + django-celery-email | 1 | + django-cleanup | 1 | + django-graphene | 1 | + django-maintenance-mode | 1 | + django-yarnpkg | 1 | enlighten | 1 | errbot | 1 | fypp | 1 | humanfriendly | 1 | jpy | 1 | + jsonrpclib-pelix | 1 | jupyter-sphinx | 1 | korean-lunar-calendar | 1 | milksnake | 1 | mkdocs-macros-plugin | 1 | moviepy | 1 | + numpy-stl | 1 | onetimepass | 1 | power | 1 | prospector | 1 | + pykwalify | 1 | pypass | 1 | python-banal | 1 | python-bitbucket-api | 1 | python-broadlink | 1 | python-btrees | 1 | python-dataset | 1 | + python-ephemeral-port-reserve | 1 | python-fluent-logger | 1 | + python-funcy | 1 | python-gammu | 1 | python-genson | 1 | python-getdns | 1 | @@ -387,6 +389,7 @@ Last-Update: Mon, 30 Jun 2025 01:42:04 +0000 python-pgmagick | 1 | python-py-zipkin | 1 | python-rdflib-endpoint | 1 | + python-rpcq | 1 | python-schedutils | 1 | python-sphinx-examples | 1 | python-spur | 1 | @@ -407,7 +410,6 @@ Last-Update: Mon, 30 Jun 2025 01:42:04 +0000 vf1 | 1 | vrfydmn | 1 | wchartype | 1 | - wikitrans | 1 | zzzeeksphinx | 1 | aioairzone | 0 | aioeagle | 0 | @@ -542,7 +544,6 @@ Last-Update: Mon, 30 Jun 2025 01:42:04 +0000 python-pyout | 0 | python-pypump | 0 | python-requests-oauthlib | 0 | - python-rpcq | 0 | python-simpy | 0 | python-socketpool | 0 | python-sphinx-examples | 0 | @@ -568,6 +569,7 @@ Last-Update: Mon, 30 Jun 2025 01:42:04 +0000 vncdotool | 0 | webpy | 0 | webtest | 0 | + wikitrans | 0 | yotta | 0 | zktop | 0 | zlmdb | 0 | @@ -584,12 +586,11 @@ Last-Update: Mon, 30 Jun 2025 01:42:04 +0000 python-asv-bench-memray | -1 | python-gradientmodel | -1 | python-nxtomomill | -1 | - python-qnapstats | -1 | python-rova | -1 | pyyardian | -1 | s3ql | -1 | sphinxcontrib-emojicodes | -1 | symmetrize | -1 | trac-tickettemplate | -1 | -(604 rows) +(605 rows) View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/79bc023507860b573e41f83b9063b5797594d4f0 -- View it on GitLab: https://salsa.debian.org/med-team/community/helper-scripts/-/commit/79bc023507860b573e41f83b9063b5797594d4f0 You're receiving this email because of your account on salsa.debian.org. -------------- next part -------------- An HTML attachment was scrubbed... URL: