[Debian-med-packaging] [SCM] The European Molecular Biology Open Software Suite. branch, master, updated. upstream/6.3.0-25-g2887c25
Charles Plessy
plessy at debian.org
Fri Jul 16 04:26:26 UTC 2010
The following commit has been merged in the master branch:
commit 2887c250e1df375e5e0191ac473c1d15556884f9
Author: Charles Plessy <plessy at debian.org>
Date: Fri Jul 16 13:26:28 2010 +0900
Refreshed auto-generated manual pages.
$ ./debian/build-manpages.sh
$ sort debian/emboss.manpages | sponge debian/emboss.manpages
diff --git a/debian/emboss.manpages b/debian/emboss.manpages
index 398c0ce..ec99dc3 100644
--- a/debian/emboss.manpages
+++ b/debian/emboss.manpages
@@ -1,229 +1,239 @@
-debian/manpages/dbiblast.1e
-debian/manpages/polydot.1e
-debian/manpages/trimest.1e
-debian/manpages/showfeat.1e
-debian/manpages/helixturnhelix.1e
-debian/manpages/dbigcg.1e
-debian/manpages/btwisted.1e
+debian/manpages/aaindexextract.1e
+debian/manpages/abiview.1e
+debian/manpages/acdc.1e
+debian/manpages/acdlog.1e
+debian/manpages/acdpretty.1e
+debian/manpages/acdrelations.1e
+debian/manpages/acdtable.1e
+debian/manpages/acdtrace.1e
+debian/manpages/acdvalid.1e
+debian/manpages/ajbad.1e
+debian/manpages/ajfeatest.1e
+debian/manpages/ajtest.1e
+debian/manpages/aligncopy.1e
debian/manpages/aligncopypair.1e
-debian/manpages/tranalign.1e
-debian/manpages/jaspscan.1e
+debian/manpages/antigenic.1e
+debian/manpages/backtranambig.1e
+debian/manpages/backtranseq.1e
+debian/manpages/banana.1e
+debian/manpages/biosed.1e
+debian/manpages/btwisted.1e
+debian/manpages/cai.1e
+debian/manpages/chaos.1e
+debian/manpages/charge.1e
+debian/manpages/checktrans.1e
debian/manpages/chips.1e
+debian/manpages/cirdna.1e
+debian/manpages/codcmp.1e
debian/manpages/codcopy.1e
-debian/manpages/wossname.1e
+debian/manpages/coderet.1e
+debian/manpages/complex.1e
+debian/manpages/compseq.1e
+debian/manpages/cons.1e
+debian/manpages/consambig.1e
+debian/manpages/corbatest.1e
+debian/manpages/cpgplot.1e
+debian/manpages/cpgreport.1e
+debian/manpages/cusp.1e
+debian/manpages/cutgextract.1e
+debian/manpages/cutseq.1e
+debian/manpages/dan.1e
+debian/manpages/dbiblast.1e
+debian/manpages/dbifasta.1e
+debian/manpages/dbiflat.1e
+debian/manpages/dbigcg.1e
+debian/manpages/dbxfasta.1e
+debian/manpages/dbxflat.1e
+debian/manpages/dbxgcg.1e
+debian/manpages/dbxreport.1e
+debian/manpages/dbxstat.1e
+debian/manpages/degapseq.1e
+debian/manpages/density.1e
+debian/manpages/descseq.1e
+debian/manpages/diffseq.1e
+debian/manpages/digest.1e
+debian/manpages/distmat.1e
+debian/manpages/domtesta.1e
+debian/manpages/domtestb.1e
+debian/manpages/domtestc.1e
+debian/manpages/domtestd.1e
+debian/manpages/dotmatcher.1e
debian/manpages/dotpath.1e
-debian/manpages/restrict.1e
-debian/manpages/octanol.1e
-debian/manpages/maskambigprot.1e
-debian/manpages/banana.1e
-debian/manpages/pepwheel.1e
-debian/manpages/treetypedisplay.1e
+debian/manpages/dottup.1e
+debian/manpages/dreg.1e
debian/manpages/edamclean.1e
-debian/manpages/prophecy.1e
-debian/manpages/redata.1e
-debian/manpages/sirna.1e
-debian/manpages/supermatcher.1e
-debian/manpages/distmat.1e
-debian/manpages/recoder.1e
-debian/manpages/hmoment.1e
-debian/manpages/pepnet.1e
-debian/manpages/maskambignuc.1e
-debian/manpages/plotcon.1e
-debian/manpages/tcode.1e
-debian/manpages/textsearch.1e
-debian/manpages/mwcontam.1e
debian/manpages/edialign.1e
+debian/manpages/einverted.1e
+debian/manpages/embossdata.1e
+debian/manpages/embossversion.1e
+debian/manpages/emma.1e
+debian/manpages/emowse.1e
+debian/manpages/ensembltest.1e
+debian/manpages/entrails.1e
+debian/manpages/entrailsbook.1e
+debian/manpages/entrailshtml.1e
+debian/manpages/entrailswiki.1e
+debian/manpages/entret.1e
+debian/manpages/epestfind.1e
+debian/manpages/eprimer3.1e
+debian/manpages/equicktandem.1e
+debian/manpages/est2genome.1e
+debian/manpages/etandem.1e
+debian/manpages/extractalign.1e
+debian/manpages/extractfeat.1e
+debian/manpages/extractseq.1e
+debian/manpages/featcopy.1e
+debian/manpages/featreport.1e
debian/manpages/finddb.1e
+debian/manpages/findkm.1e
+debian/manpages/freak.1e
+debian/manpages/fuzznuc.1e
+debian/manpages/fuzzpro.1e
+debian/manpages/fuzztran.1e
+debian/manpages/garnier.1e
+debian/manpages/geecee.1e
+debian/manpages/getorf.1e
+debian/manpages/helixturnhelix.1e
+debian/manpages/histogramtest.1e
+debian/manpages/hmoment.1e
+debian/manpages/idtell.1e
+debian/manpages/iep.1e
+debian/manpages/infoalign.1e
+debian/manpages/infobase.1e
+debian/manpages/inforesidue.1e
+debian/manpages/infoseq.1e
debian/manpages/intconv.1e
-debian/manpages/extractfeat.1e
-debian/manpages/syco.1e
-debian/manpages/pepwindow.1e
-debian/manpages/dbxreport.1e
-debian/manpages/prettyseq.1e
-debian/manpages/primers.1e
-debian/manpages/twofeat.1e
+debian/manpages/isochore.1e
+debian/manpages/jaspextract.1e
+debian/manpages/jaspscan.1e
+debian/manpages/lindna.1e
+debian/manpages/listor.1e
debian/manpages/makenucseq.1e
-debian/manpages/shuffleseq.1e
+debian/manpages/makeprotseq.1e
+debian/manpages/marscan.1e
+debian/manpages/martattributes.1e
+debian/manpages/martdatasets.1e
+debian/manpages/martfilters.1e
+debian/manpages/martquery.1e
+debian/manpages/martregistry.1e
+debian/manpages/martseqs.1e
+debian/manpages/maskambignuc.1e
+debian/manpages/maskambigprot.1e
+debian/manpages/maskfeat.1e
+debian/manpages/maskseq.1e
+debian/manpages/matcher.1e
+debian/manpages/megamerger.1e
+debian/manpages/merger.1e
debian/manpages/msbar.1e
-debian/manpages/extractalign.1e
-debian/manpages/ensembltest.1e
+debian/manpages/mwcontam.1e
+debian/manpages/mwfilter.1e
debian/manpages/needle.1e
-debian/manpages/est2genome.1e
-debian/manpages/showseq.1e
-debian/manpages/prima.1e
-debian/manpages/cutseq.1e
-debian/manpages/wordcount.1e
-debian/manpages/equicktandem.1e
-debian/manpages/dbifasta.1e
-debian/manpages/noreturn.1e
debian/manpages/needleall.1e
-debian/manpages/nthseq.1e
debian/manpages/newcoils.1e
-debian/manpages/seqinfo.1e
-debian/manpages/mwfilter.1e
-debian/manpages/chaos.1e
-debian/manpages/showdb.1e
-debian/manpages/digest.1e
-debian/manpages/dbxstat.1e
-debian/manpages/merger.1e
-debian/manpages/acdpretty.1e
-debian/manpages/infobase.1e
-debian/manpages/tfextract.1e
-debian/manpages/splitter.1e
-debian/manpages/cirdna.1e
-debian/manpages/biosed.1e
-debian/manpages/rebaseextract.1e
-debian/manpages/showpep.1e
-debian/manpages/dbxfasta.1e
-debian/manpages/einverted.1e
-debian/manpages/epestfind.1e
+debian/manpages/newcpgreport.1e
+debian/manpages/newcpgseek.1e
+debian/manpages/newseq.1e
+debian/manpages/nohtml.1e
+debian/manpages/noreturn.1e
debian/manpages/nospace.1e
-debian/manpages/garnier.1e
-debian/manpages/restover.1e
-debian/manpages/getorf.1e
-debian/manpages/prettyplot.1e
-debian/manpages/acdc.1e
-debian/manpages/degapseq.1e
-debian/manpages/freak.1e
-debian/manpages/prophet.1e
-debian/manpages/diffseq.1e
-debian/manpages/inforesidue.1e
-debian/manpages/acdtable.1e
-debian/manpages/skipseq.1e
-debian/manpages/patmatdb.1e
+debian/manpages/notab.1e
+debian/manpages/notseq.1e
+debian/manpages/nthseq.1e
debian/manpages/nthseqset.1e
-debian/manpages/entrails.1e
-debian/manpages/stretcher.1e
-debian/manpages/aligncopy.1e
-debian/manpages/descseq.1e
-debian/manpages/dreg.1e
-debian/manpages/codcmp.1e
-debian/manpages/seqretset.1e
+debian/manpages/octanol.1e
+debian/manpages/oddcomp.1e
+debian/manpages/origsplitter.1e
+debian/manpages/origunion.1e
+debian/manpages/palindrome.1e
+debian/manpages/pasteseq.1e
+debian/manpages/patmatdb.1e
+debian/manpages/patmatmotifs.1e
+debian/manpages/patmattest.1e
debian/manpages/pepcoil.1e
-debian/manpages/lindna.1e
-debian/manpages/backtranambig.1e
-debian/manpages/acdlog.1e
-debian/manpages/antigenic.1e
-debian/manpages/showorf.1e
-debian/manpages/infoalign.1e
-debian/manpages/seqretsingle.1e
-debian/manpages/splitsource.1e
+debian/manpages/pepinfo.1e
+debian/manpages/pepnet.1e
+debian/manpages/pepstats.1e
+debian/manpages/pepwheel.1e
+debian/manpages/pepwindow.1e
debian/manpages/pepwindowall.1e
-debian/manpages/newseq.1e
-debian/manpages/makeprotseq.1e
-debian/manpages/transeq.1e
+debian/manpages/plotcon.1e
+debian/manpages/plotorf.1e
+debian/manpages/polydot.1e
+debian/manpages/preg.1e
+debian/manpages/prettyplot.1e
+debian/manpages/prettyseq.1e
+debian/manpages/prima.1e
+debian/manpages/primers.1e
+debian/manpages/primersearch.1e
+debian/manpages/printsextract.1e
+debian/manpages/profit.1e
+debian/manpages/prophecy.1e
+debian/manpages/prophet.1e
+debian/manpages/prosextract.1e
+debian/manpages/pscan.1e
+debian/manpages/psiphi.1e
+debian/manpages/rebaseextract.1e
+debian/manpages/recoder.1e
+debian/manpages/redata.1e
+debian/manpages/remap.1e
+debian/manpages/restover.1e
+debian/manpages/restrict.1e
+debian/manpages/revseq.1e
debian/manpages/seealso.1e
+debian/manpages/seqinfo.1e
+debian/manpages/seqmatchall.1e
+debian/manpages/seqret.1e
+debian/manpages/seqretall.1e
debian/manpages/seqretallfeat.1e
-debian/manpages/tfscan.1e
-debian/manpages/pepstats.1e
-debian/manpages/sqltest.1e
-debian/manpages/charge.1e
+debian/manpages/seqretset.1e
+debian/manpages/seqretsetall.1e
+debian/manpages/seqretsingle.1e
+debian/manpages/seqretsplit.1e
+debian/manpages/seqrettype.1e
+debian/manpages/seqxrefall.1e
+debian/manpages/showalign.1e
+debian/manpages/showdb.1e
debian/manpages/showdball.1e
-debian/manpages/wordfinder.1e
-debian/manpages/skipredundant.1e
-debian/manpages/psiphi.1e
-debian/manpages/backtranseq.1e
-debian/manpages/seqretall.1e
-debian/manpages/iep.1e
-debian/manpages/newcpgreport.1e
-debian/manpages/maskseq.1e
-debian/manpages/embossversion.1e
-debian/manpages/entret.1e
-debian/manpages/marscan.1e
-debian/manpages/listor.1e
-debian/manpages/seqret.1e
-debian/manpages/featreport.1e
-debian/manpages/dbxgcg.1e
-debian/manpages/checktrans.1e
-debian/manpages/origunion.1e
-debian/manpages/patmattest.1e
-debian/manpages/eprimer3.1e
-debian/manpages/prosextract.1e
-debian/manpages/origsplitter.1e
-debian/manpages/trimspace.1e
-debian/manpages/geecee.1e
-debian/manpages/printsextract.1e
-debian/manpages/coderet.1e
+debian/manpages/showfeat.1e
+debian/manpages/showorf.1e
+debian/manpages/showpep.1e
+debian/manpages/showseq.1e
+debian/manpages/shuffleseq.1e
+debian/manpages/sigcleave.1e
+debian/manpages/silent.1e
+debian/manpages/sirna.1e
+debian/manpages/sixpack.1e
debian/manpages/sizeseq.1e
-debian/manpages/maskfeat.1e
-debian/manpages/nohtml.1e
-debian/manpages/cons.1e
-debian/manpages/idtell.1e
-debian/manpages/embossdata.1e
-debian/manpages/etandem.1e
-debian/manpages/water.1e
-debian/manpages/oddcomp.1e
-debian/manpages/wobble.1e
-debian/manpages/isochore.1e
-debian/manpages/cai.1e
-debian/manpages/cpgreport.1e
-debian/manpages/wordmatch.1e
-debian/manpages/pepinfo.1e
-debian/manpages/findkm.1e
-debian/manpages/ajtest.1e
+debian/manpages/skipredundant.1e
+debian/manpages/skipseq.1e
+debian/manpages/splitsource.1e
+debian/manpages/splitter.1e
+debian/manpages/sqltest.1e
+debian/manpages/stretcher.1e
+debian/manpages/stssearch.1e
+debian/manpages/supermatcher.1e
+debian/manpages/syco.1e
+debian/manpages/tcode.1e
+debian/manpages/testplot.1e
+debian/manpages/textsearch.1e
+debian/manpages/tfextract.1e
debian/manpages/tfm.1e
+debian/manpages/tfscan.1e
debian/manpages/tmap.1e
-debian/manpages/union.1e
-debian/manpages/entrailsbook.1e
-debian/manpages/histogramtest.1e
-debian/manpages/patmatmotifs.1e
-debian/manpages/acdtrace.1e
-debian/manpages/silent.1e
-debian/manpages/ajbad.1e
-debian/manpages/whichdb.1e
-debian/manpages/seqmatchall.1e
-debian/manpages/abiview.1e
-debian/manpages/seqretsetall.1e
-debian/manpages/primersearch.1e
-debian/manpages/cpgplot.1e
-debian/manpages/megamerger.1e
+debian/manpages/tranalign.1e
+debian/manpages/transeq.1e
+debian/manpages/treetypedisplay.1e
+debian/manpages/trimest.1e
debian/manpages/trimseq.1e
-debian/manpages/matcher.1e
-debian/manpages/fuzznuc.1e
-debian/manpages/cusp.1e
-debian/manpages/complex.1e
-debian/manpages/dbiflat.1e
-debian/manpages/acdvalid.1e
-debian/manpages/plotorf.1e
-debian/manpages/testplot.1e
-debian/manpages/compseq.1e
-debian/manpages/entrailshtml.1e
-debian/manpages/corbatest.1e
-debian/manpages/showalign.1e
-debian/manpages/newcpgseek.1e
-debian/manpages/dbxflat.1e
+debian/manpages/trimspace.1e
+debian/manpages/twofeat.1e
+debian/manpages/union.1e
debian/manpages/vectorstrip.1e
-debian/manpages/dotmatcher.1e
-debian/manpages/notab.1e
-debian/manpages/cutgextract.1e
-debian/manpages/fuzzpro.1e
-debian/manpages/fuzztran.1e
-debian/manpages/dan.1e
-debian/manpages/emowse.1e
-debian/manpages/profit.1e
-debian/manpages/consambig.1e
-debian/manpages/dottup.1e
-debian/manpages/aaindexextract.1e
+debian/manpages/water.1e
+debian/manpages/whichdb.1e
+debian/manpages/wobble.1e
+debian/manpages/wordcount.1e
+debian/manpages/wordfinder.1e
+debian/manpages/wordmatch.1e
+debian/manpages/wossname.1e
debian/manpages/yank.1e
-debian/manpages/acdrelations.1e
-debian/manpages/ajfeatest.1e
-debian/manpages/emma.1e
-debian/manpages/notseq.1e
-debian/manpages/remap.1e
-debian/manpages/sixpack.1e
-debian/manpages/seqxrefall.1e
-debian/manpages/revseq.1e
-debian/manpages/seqretsplit.1e
-debian/manpages/palindrome.1e
-debian/manpages/jaspextract.1e
-debian/manpages/extractseq.1e
-debian/manpages/stssearch.1e
-debian/manpages/featcopy.1e
-debian/manpages/infoseq.1e
-debian/manpages/pasteseq.1e
-debian/manpages/seqrettype.1e
-debian/manpages/density.1e
-debian/manpages/entrailswiki.1e
-debian/manpages/sigcleave.1e
-debian/manpages/preg.1e
-debian/manpages/pscan.1e
diff --git a/debian/manpages/aaindexextract.1e b/debian/manpages/aaindexextract.1e
index fbd130b..3f512e7 100644
--- a/debian/manpages/aaindexextract.1e
+++ b/debian/manpages/aaindexextract.1e
@@ -2,12 +2,21 @@
.\" Title: AAINDEXEXTRACT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "AAINDEXEXTRACT" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "AAINDEXEXTRACT" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/abiview.1e b/debian/manpages/abiview.1e
index 58a624e..a1cce85 100644
--- a/debian/manpages/abiview.1e
+++ b/debian/manpages/abiview.1e
@@ -2,12 +2,21 @@
.\" Title: ABIVIEW
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "ABIVIEW" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "ABIVIEW" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/acdc.1e b/debian/manpages/acdc.1e
index e248a6c..fae7fe4 100644
--- a/debian/manpages/acdc.1e
+++ b/debian/manpages/acdc.1e
@@ -2,12 +2,21 @@
.\" Title: ACDC
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "ACDC" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "ACDC" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/acdlog.1e b/debian/manpages/acdlog.1e
index 58a4ce9..f7f58ae 100644
--- a/debian/manpages/acdlog.1e
+++ b/debian/manpages/acdlog.1e
@@ -2,12 +2,21 @@
.\" Title: ACDLOG
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "ACDLOG" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "ACDLOG" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/acdpretty.1e b/debian/manpages/acdpretty.1e
index 27e95a7..bd03797 100644
--- a/debian/manpages/acdpretty.1e
+++ b/debian/manpages/acdpretty.1e
@@ -2,12 +2,21 @@
.\" Title: ACDPRETTY
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "ACDPRETTY" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "ACDPRETTY" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/acdrelations.1e b/debian/manpages/acdrelations.1e
index cb5cdd7..5125bda 100644
--- a/debian/manpages/acdrelations.1e
+++ b/debian/manpages/acdrelations.1e
@@ -2,12 +2,21 @@
.\" Title: ACDRELATIONS
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "ACDRELATIONS" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "ACDRELATIONS" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -22,7 +31,7 @@
acdrelations \- Add relations: attribute to ACD files
.SH "SYNOPSIS"
.HP \w'\fBacdrelations\fR\ 'u
-\fBacdrelations\fR \fB\-indir\ \fR\fB\fIdirlist\fR\fR \fB\-infileedam\ \fR\fB\fIdatafile\fR\fR \fB\-infiletype\ \fR\fB\fIinfile\fR\fR \fB\-outdir\ \fR\fB\fIoutdir\fR\fR
+\fBacdrelations\fR \fB\-indir\ \fR\fB\fIdirlist\fR\fR \fB\-inedamfile\ \fR\fB\fIdatafile\fR\fR \fB\-intypefile\ \fR\fB\fIinfile\fR\fR \fB\-outdir\ \fR\fB\fIoutdir\fR\fR
.HP \w'\fBacdrelations\fR\ 'u
\fBacdrelations\fR \fB\-help\fR
.SH "DESCRIPTION"
@@ -37,12 +46,12 @@ is a command line program from EMBOSS (\(lqthe European Molecular Biology Open S
Default value: acdin
.RE
.PP
-\fB\-infileedam\fR \fIdatafile\fR
+\fB\-inedamfile\fR \fIdatafile\fR
.RS 4
Default value: edamtoacd\&.dat
.RE
.PP
-\fB\-infiletype\fR \fIinfile\fR
+\fB\-intypefile\fR \fIinfile\fR
.RS 4
Default value: /homes/jison/emboss/emboss/emboss/acd/knowntypes\&.standard
.RE
diff --git a/debian/manpages/acdtable.1e b/debian/manpages/acdtable.1e
index 382799f..58f47b5 100644
--- a/debian/manpages/acdtable.1e
+++ b/debian/manpages/acdtable.1e
@@ -2,12 +2,21 @@
.\" Title: ACDTABLE
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "ACDTABLE" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "ACDTABLE" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/acdtrace.1e b/debian/manpages/acdtrace.1e
index 5e30155..8148242 100644
--- a/debian/manpages/acdtrace.1e
+++ b/debian/manpages/acdtrace.1e
@@ -2,12 +2,21 @@
.\" Title: ACDTRACE
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "ACDTRACE" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "ACDTRACE" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/acdvalid.1e b/debian/manpages/acdvalid.1e
index 035abf9..58807d0 100644
--- a/debian/manpages/acdvalid.1e
+++ b/debian/manpages/acdvalid.1e
@@ -2,12 +2,21 @@
.\" Title: ACDVALID
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "ACDVALID" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "ACDVALID" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/ajbad.1e b/debian/manpages/ajbad.1e
index 6c78cf3..b39fdc0 100644
--- a/debian/manpages/ajbad.1e
+++ b/debian/manpages/ajbad.1e
@@ -2,12 +2,21 @@
.\" Title: AJBAD
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "AJBAD" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "AJBAD" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/ajfeatest.1e b/debian/manpages/ajfeatest.1e
index 399d271..312d7ab 100644
--- a/debian/manpages/ajfeatest.1e
+++ b/debian/manpages/ajfeatest.1e
@@ -2,12 +2,21 @@
.\" Title: AJFEATEST
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "AJFEATEST" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "AJFEATEST" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/ajtest.1e b/debian/manpages/ajtest.1e
index c95951a..f7b5c48 100644
--- a/debian/manpages/ajtest.1e
+++ b/debian/manpages/ajtest.1e
@@ -2,12 +2,21 @@
.\" Title: AJTEST
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "AJTEST" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "AJTEST" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -22,7 +31,7 @@
ajtest \- Test file for ACD parsing
.SH "SYNOPSIS"
.HP \w'\fBajtest\fR\ 'u
-\fBajtest\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-bsequence\ \fR\fB\fIseqset\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR \fB\-outseq\ \fR\fB\fIseqout\fR\fR \fB\-outfeat\ \fR\fB\fIfeatout\fR\fR \fB\-outdir\ \fR\fB\fIoutdir\fR\fR
+\fBajtest\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-bsequence\ \fR\fB\fIseqset\fR\fR \fB\-obofile\ \fR\fB\fIinfile\fR\fR \fB\-dbxreffile\ \fR\fB\fIinfile\fR\fR \fB\-taxdir\ \fR\fB\fIdirectory\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR \fB\-outseq\ \fR\fB\fIseqout\fR\fR \fB\-outfeat\ \fR\fB\fIfeatout\fR\fR \fB\-outdir\ \fR\fB\fIoutdir\fR\fR
.HP \w'\fBajtest\fR\ 'u
\fBajtest\fR \fB\-help\fR
.SH "DESCRIPTION"
@@ -39,6 +48,18 @@ is a command line program from EMBOSS (\(lqthe European Molecular Biology Open S
\fB\-bsequence\fR \fIseqset\fR
.RS 4
.RE
+.PP
+\fB\-obofile\fR \fIinfile\fR
+.RS 4
+.RE
+.PP
+\fB\-dbxreffile\fR \fIinfile\fR
+.RS 4
+.RE
+.PP
+\fB\-taxdir\fR \fIdirectory\fR
+.RS 4
+.RE
.SS "Output section"
.PP
\fB\-outfile\fR \fIoutfile\fR
diff --git a/debian/manpages/aligncopy.1e b/debian/manpages/aligncopy.1e
index e83097e..a940e68 100644
--- a/debian/manpages/aligncopy.1e
+++ b/debian/manpages/aligncopy.1e
@@ -2,12 +2,21 @@
.\" Title: ALIGNCOPY
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "ALIGNCOPY" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "ALIGNCOPY" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/aligncopypair.1e b/debian/manpages/aligncopypair.1e
index b233ac1..5a8b99d 100644
--- a/debian/manpages/aligncopypair.1e
+++ b/debian/manpages/aligncopypair.1e
@@ -2,12 +2,21 @@
.\" Title: ALIGNCOPYPAIR
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "ALIGNCOPYPAIR" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "ALIGNCOPYPAIR" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/antigenic.1e b/debian/manpages/antigenic.1e
index 9b22bea..98eb70a 100644
--- a/debian/manpages/antigenic.1e
+++ b/debian/manpages/antigenic.1e
@@ -2,12 +2,21 @@
.\" Title: ANTIGENIC
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "ANTIGENIC" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "ANTIGENIC" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/backtranambig.1e b/debian/manpages/backtranambig.1e
index a947085..1d26c63 100644
--- a/debian/manpages/backtranambig.1e
+++ b/debian/manpages/backtranambig.1e
@@ -2,12 +2,21 @@
.\" Title: BACKTRANAMBIG
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "BACKTRANAMBIG" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "BACKTRANAMBIG" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/backtranseq.1e b/debian/manpages/backtranseq.1e
index ffcf8a9..3d856db 100644
--- a/debian/manpages/backtranseq.1e
+++ b/debian/manpages/backtranseq.1e
@@ -2,12 +2,21 @@
.\" Title: BACKTRANSEQ
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "BACKTRANSEQ" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "BACKTRANSEQ" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/banana.1e b/debian/manpages/banana.1e
index fc7cb8f..15508a7 100644
--- a/debian/manpages/banana.1e
+++ b/debian/manpages/banana.1e
@@ -2,12 +2,21 @@
.\" Title: BANANA
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "BANANA" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "BANANA" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/biosed.1e b/debian/manpages/biosed.1e
index 966b2a1..37ae49d 100644
--- a/debian/manpages/biosed.1e
+++ b/debian/manpages/biosed.1e
@@ -2,12 +2,21 @@
.\" Title: BIOSED
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "BIOSED" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "BIOSED" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/btwisted.1e b/debian/manpages/btwisted.1e
index 8948118..ca436c2 100644
--- a/debian/manpages/btwisted.1e
+++ b/debian/manpages/btwisted.1e
@@ -2,12 +2,21 @@
.\" Title: BTWISTED
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "BTWISTED" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "BTWISTED" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/cai.1e b/debian/manpages/cai.1e
index 244905e..207c39a 100644
--- a/debian/manpages/cai.1e
+++ b/debian/manpages/cai.1e
@@ -2,12 +2,21 @@
.\" Title: CAI
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "CAI" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "CAI" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/chaos.1e b/debian/manpages/chaos.1e
index 2fc89a7..da3f95e 100644
--- a/debian/manpages/chaos.1e
+++ b/debian/manpages/chaos.1e
@@ -2,12 +2,21 @@
.\" Title: CHAOS
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "CHAOS" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "CHAOS" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/charge.1e b/debian/manpages/charge.1e
index 8ef2b14..03fab90 100644
--- a/debian/manpages/charge.1e
+++ b/debian/manpages/charge.1e
@@ -2,12 +2,21 @@
.\" Title: CHARGE
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "CHARGE" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "CHARGE" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/checktrans.1e b/debian/manpages/checktrans.1e
index d2b730e..71a2329 100644
--- a/debian/manpages/checktrans.1e
+++ b/debian/manpages/checktrans.1e
@@ -2,12 +2,21 @@
.\" Title: CHECKTRANS
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "CHECKTRANS" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "CHECKTRANS" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/chips.1e b/debian/manpages/chips.1e
index 5eb8314..2126226 100644
--- a/debian/manpages/chips.1e
+++ b/debian/manpages/chips.1e
@@ -2,12 +2,21 @@
.\" Title: CHIPS
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "CHIPS" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "CHIPS" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/cirdna.1e b/debian/manpages/cirdna.1e
index f937b3a..67110ba 100644
--- a/debian/manpages/cirdna.1e
+++ b/debian/manpages/cirdna.1e
@@ -2,12 +2,21 @@
.\" Title: CIRDNA
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "CIRDNA" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "CIRDNA" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/codcmp.1e b/debian/manpages/codcmp.1e
index 5e0d46a..d7e7a25 100644
--- a/debian/manpages/codcmp.1e
+++ b/debian/manpages/codcmp.1e
@@ -2,12 +2,21 @@
.\" Title: CODCMP
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "CODCMP" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "CODCMP" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/codcopy.1e b/debian/manpages/codcopy.1e
index b86a83a..971067b 100644
--- a/debian/manpages/codcopy.1e
+++ b/debian/manpages/codcopy.1e
@@ -2,12 +2,21 @@
.\" Title: CODCOPY
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "CODCOPY" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "CODCOPY" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/coderet.1e b/debian/manpages/coderet.1e
index 09a6e94..9908081 100644
--- a/debian/manpages/coderet.1e
+++ b/debian/manpages/coderet.1e
@@ -2,12 +2,21 @@
.\" Title: CODERET
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "CODERET" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "CODERET" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/complex.1e b/debian/manpages/complex.1e
index d9f7956..3027800 100644
--- a/debian/manpages/complex.1e
+++ b/debian/manpages/complex.1e
@@ -2,12 +2,21 @@
.\" Title: COMPLEX
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "COMPLEX" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "COMPLEX" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/compseq.1e b/debian/manpages/compseq.1e
index bf1a0ff..3c99014 100644
--- a/debian/manpages/compseq.1e
+++ b/debian/manpages/compseq.1e
@@ -2,12 +2,21 @@
.\" Title: COMPSEQ
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "COMPSEQ" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "COMPSEQ" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -38,7 +47,7 @@ is a command line program from EMBOSS (\(lqthe European Molecular Biology Open S
.PP
\fB\-infile\fR \fIinfile\fR
.RS 4
-This is a file previously produced by \'compseq\' that can be used to set the expected frequencies of words in this analysis\&. The word size in the current run must be the same as the one in this results file\&. Obviously, you should use a file produced from protein sequences if you are counting protein sequence word frequencies, and you must use one made from nucleotide frequencies if you are analysing a nucleotide sequence\&.
+This is a file previously produced by \*(Aqcompseq\*(Aq that can be used to set the expected frequencies of words in this analysis\&. The word size in the current run must be the same as the one in this results file\&. Obviously, you should use a file produced from protein sequences if you are counting protein sequence word frequencies, and you must use one made from nucleotide frequencies if you are analysing a nucleotide sequence\&.
.RE
.SS "Required section"
.PP
@@ -50,12 +59,12 @@ This is the size of word (n\-mer) to count\&. Thus if you want to count codon fr
.PP
\fB\-frame\fR \fIinteger\fR
.RS 4
-The normal behaviour of \'compseq\' is to count the frequencies of all words that occur by moving a window of length \'word\' up by one each time\&. This option allows you to move the window up by the length of the word each time, skipping over the intervening words\&. You can count only those words that occur in a single frame of the word by setting this value to a number other than zero\&. If you set it to 1 it will only count the words in frame 1, 2 will only count the words in frame 2 and so on\&.
+The normal behaviour of \*(Aqcompseq\*(Aq is to count the frequencies of all words that occur by moving a window of length \*(Aqword\*(Aq up by one each time\&. This option allows you to move the window up by the length of the word each time, skipping over the intervening words\&. You can count only those words that occur in a single frame of the word by setting this value to a number other than zero\&. If you set it to 1 it will only count the words in frame 1, 2 will only count the words in frame 2 and so on\&.
.RE
.PP
\fB\-ignorebz\fR \fIboolean\fR
.RS 4
-The amino acid code B represents Asparagine or Aspartic acid and the code Z represents Glutamine or Glutamic acid\&. These are not commonly used codes and you may wish not to count words containing them, just noting them in the count of \'Other\' words\&. Default value: Y
+The amino acid code B represents Asparagine or Aspartic acid and the code Z represents Glutamine or Glutamic acid\&. These are not commonly used codes and you may wish not to count words containing them, just noting them in the count of \*(AqOther\*(Aq words\&. Default value: Y
.RE
.PP
\fB\-reverse\fR \fIboolean\fR
@@ -65,7 +74,7 @@ Set this to be true if you also wish to also count words in the reverse compleme
.PP
\fB\-calcfreq\fR \fIboolean\fR
.RS 4
-If this is set true then the expected frequencies of words are calculated from the observed frequency of single bases or residues in the sequences\&. If you are reporting a word size of 1 (single bases or residues) then there is no point in using this option because the calculated expected frequency will be equal to the observed frequency\&. Calculating the expected frequencies like this will give an approximation of the expected frequencies that you might get by using an input file of frequencies produced by a previous run of this program\&. If an input file of expected word frequencies has been specified then the values from that file will be used instead of this calculation of expected frequency from the sequence, even if \'calcfreq\' is set to be true\&. Default value: N
+If this is set true then the expected frequencies of words are calculated from the observed frequency of single bases or residues in the sequences\&. If you are reporting a word size of 1 (single bases or residues) then there is no point in using this option because the calculated expected frequency will be equal to the observed frequency\&. Calculating the expected frequencies like this will give an approximation of the expected frequencies that you might get by using an input file of frequencies produced by a previous run of this program\&. If an input file of expected word frequencies has been specified then the values from that file will be used instead of this calculation of expected frequency from the sequence, even if \*(Aqcalcfreq\*(Aq is set to be true\&. Default value: N
.RE
.SS "Output section"
.PP
diff --git a/debian/manpages/cons.1e b/debian/manpages/cons.1e
index a99aed4..9389d7b 100644
--- a/debian/manpages/cons.1e
+++ b/debian/manpages/cons.1e
@@ -2,12 +2,21 @@
.\" Title: CONS
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "CONS" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "CONS" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -39,7 +48,7 @@ File containing a sequence alignment\&.
.PP
\fB\-datafile\fR \fImatrix\fR
.RS 4
-This is the scoring matrix file used when comparing sequences\&. By default it is the file \'EBLOSUM62\' (for proteins) or the file \'EDNAFULL\' (for nucleic sequences)\&. These files are found in the \'data\' directory of the EMBOSS installation\&.
+This is the scoring matrix file used when comparing sequences\&. By default it is the file \*(AqEBLOSUM62\*(Aq (for proteins) or the file \*(AqEDNAFULL\*(Aq (for nucleic sequences)\&. These files are found in the \*(Aqdata\*(Aq directory of the EMBOSS installation\&.
.RE
.SS "Additional section"
.PP
diff --git a/debian/manpages/consambig.1e b/debian/manpages/consambig.1e
index 0c87965..af5f53f 100644
--- a/debian/manpages/consambig.1e
+++ b/debian/manpages/consambig.1e
@@ -2,12 +2,21 @@
.\" Title: CONSAMBIG
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "CONSAMBIG" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "CONSAMBIG" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/corbatest.1e b/debian/manpages/corbatest.1e
index 78497fa..cb84fc3 100644
--- a/debian/manpages/corbatest.1e
+++ b/debian/manpages/corbatest.1e
@@ -2,12 +2,21 @@
.\" Title: CORBATEST
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "CORBATEST" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "CORBATEST" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/cpgplot.1e b/debian/manpages/cpgplot.1e
index 018054a..1b8cec7 100644
--- a/debian/manpages/cpgplot.1e
+++ b/debian/manpages/cpgplot.1e
@@ -2,12 +2,21 @@
.\" Title: CPGPLOT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "CPGPLOT" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "CPGPLOT" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/cpgreport.1e b/debian/manpages/cpgreport.1e
index 36aba71..f087041 100644
--- a/debian/manpages/cpgreport.1e
+++ b/debian/manpages/cpgreport.1e
@@ -2,12 +2,21 @@
.\" Title: CPGREPORT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "CPGREPORT" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "CPGREPORT" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/cusp.1e b/debian/manpages/cusp.1e
index 423c4db..41f25d3 100644
--- a/debian/manpages/cusp.1e
+++ b/debian/manpages/cusp.1e
@@ -2,12 +2,21 @@
.\" Title: CUSP
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "CUSP" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "CUSP" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/cutgextract.1e b/debian/manpages/cutgextract.1e
index 80fe25b..f8c69d8 100644
--- a/debian/manpages/cutgextract.1e
+++ b/debian/manpages/cutgextract.1e
@@ -2,12 +2,21 @@
.\" Title: CUTGEXTRACT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "CUTGEXTRACT" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "CUTGEXTRACT" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/cutseq.1e b/debian/manpages/cutseq.1e
index fd18a4a..102cb3a 100644
--- a/debian/manpages/cutseq.1e
+++ b/debian/manpages/cutseq.1e
@@ -2,12 +2,21 @@
.\" Title: CUTSEQ
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "CUTSEQ" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "CUTSEQ" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/dan.1e b/debian/manpages/dan.1e
index f8aa8c3..a922efe 100644
--- a/debian/manpages/dan.1e
+++ b/debian/manpages/dan.1e
@@ -2,12 +2,21 @@
.\" Title: DAN
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "DAN" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "DAN" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -76,7 +85,7 @@ This specifies the percent mismatch to be used in calculations (it is ignored un
.PP
\fB\-prodlen\fR \fIinteger\fR
.RS 4
-This specifies the product length to be used in calculations (it is ignored unless \-product is used)\&. Default value: $(windowSize)
+This specifies the product length to be used in calculations (it is ignored unless \-product is used)\&. Default value: $(windowsize)
.RE
.SS "Thermodynamic options"
.PP
diff --git a/debian/manpages/dbiblast.1e b/debian/manpages/dbiblast.1e
index 2e88371..f59e696 100644
--- a/debian/manpages/dbiblast.1e
+++ b/debian/manpages/dbiblast.1e
@@ -2,12 +2,21 @@
.\" Title: DBIBLAST
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "DBIBLAST" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "DBIBLAST" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -79,7 +88,7 @@ Default value: acc
.PP
\fB\-sortoptions\fR \fIstring\fR
.RS 4
-Sort options, typically \'\-T \&.\' to use current directory for work files and \'\-k 1,1\' to force GNU sort to use the first field Default value: \-T \&. \-k 1,1
+Sort options, typically \*(Aq\-T \&.\*(Aq to use current directory for work files and \*(Aq\-k 1,1\*(Aq to force GNU sort to use the first field Default value: \-T \&. \-k 1,1
.RE
.PP
\fB\-maxindex\fR \fIinteger\fR
diff --git a/debian/manpages/dbifasta.1e b/debian/manpages/dbifasta.1e
index a85c5a9..ff0f70c 100644
--- a/debian/manpages/dbifasta.1e
+++ b/debian/manpages/dbifasta.1e
@@ -2,12 +2,21 @@
.\" Title: DBIFASTA
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "DBIFASTA" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "DBIFASTA" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -78,7 +87,7 @@ Default value: acc
.PP
\fB\-sortoptions\fR \fIstring\fR
.RS 4
-Sort options, typically \'\-T \&.\' to use current directory for work files and \'\-k 1,1\' to force GNU sort to use the first field Default value: \-T \&. \-k 1,1
+Sort options, typically \*(Aq\-T \&.\*(Aq to use current directory for work files and \*(Aq\-k 1,1\*(Aq to force GNU sort to use the first field Default value: \-T \&. \-k 1,1
.RE
.PP
\fB\-systemsort\fR \fIboolean\fR
diff --git a/debian/manpages/dbiflat.1e b/debian/manpages/dbiflat.1e
index 5b8a002..3feb78e 100644
--- a/debian/manpages/dbiflat.1e
+++ b/debian/manpages/dbiflat.1e
@@ -2,12 +2,21 @@
.\" Title: DBIFLAT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "DBIFLAT" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "DBIFLAT" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -78,7 +87,7 @@ Default value: acc
.PP
\fB\-sortoptions\fR \fIstring\fR
.RS 4
-Sort options, typically \'\-T \&.\' to use current directory for work files and \'\-k 1,1\' to force GNU sort to use the first field Default value: \-T \&. \-k 1,1
+Sort options, typically \*(Aq\-T \&.\*(Aq to use current directory for work files and \*(Aq\-k 1,1\*(Aq to force GNU sort to use the first field Default value: \-T \&. \-k 1,1
.RE
.PP
\fB\-systemsort\fR \fIboolean\fR
diff --git a/debian/manpages/dbigcg.1e b/debian/manpages/dbigcg.1e
index f82877e..a010c0d 100644
--- a/debian/manpages/dbigcg.1e
+++ b/debian/manpages/dbigcg.1e
@@ -2,12 +2,21 @@
.\" Title: DBIGCG
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "DBIGCG" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "DBIGCG" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -78,7 +87,7 @@ Default value: acc
.PP
\fB\-sortoptions\fR \fIstring\fR
.RS 4
-Sort options, typically \'\-T \&.\' to use current directory for work files and \'\-k 1,1\' to force GNU sort to use the first field Default value: \-T \&. \-k 1,1
+Sort options, typically \*(Aq\-T \&.\*(Aq to use current directory for work files and \*(Aq\-k 1,1\*(Aq to force GNU sort to use the first field Default value: \-T \&. \-k 1,1
.RE
.PP
\fB\-systemsort\fR \fIboolean\fR
diff --git a/debian/manpages/dbxfasta.1e b/debian/manpages/dbxfasta.1e
index ac4070f..c65e157 100644
--- a/debian/manpages/dbxfasta.1e
+++ b/debian/manpages/dbxfasta.1e
@@ -2,12 +2,21 @@
.\" Title: DBXFASTA
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "DBXFASTA" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "DBXFASTA" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/dbxflat.1e b/debian/manpages/dbxflat.1e
index 2d077d5..574de1e 100644
--- a/debian/manpages/dbxflat.1e
+++ b/debian/manpages/dbxflat.1e
@@ -2,12 +2,21 @@
.\" Title: DBXFLAT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "DBXFLAT" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "DBXFLAT" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/dbxgcg.1e b/debian/manpages/dbxgcg.1e
index ecc519d..f7e2e55 100644
--- a/debian/manpages/dbxgcg.1e
+++ b/debian/manpages/dbxgcg.1e
@@ -2,12 +2,21 @@
.\" Title: DBXGCG
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "DBXGCG" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "DBXGCG" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/dbxreport.1e b/debian/manpages/dbxreport.1e
index 071bea9..906756c 100644
--- a/debian/manpages/dbxreport.1e
+++ b/debian/manpages/dbxreport.1e
@@ -2,12 +2,21 @@
.\" Title: DBXREPORT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "DBXREPORT" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "DBXREPORT" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/dbxstat.1e b/debian/manpages/dbxstat.1e
index 09c6559..292b145 100644
--- a/debian/manpages/dbxstat.1e
+++ b/debian/manpages/dbxstat.1e
@@ -2,12 +2,21 @@
.\" Title: DBXSTAT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "DBXSTAT" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "DBXSTAT" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/degapseq.1e b/debian/manpages/degapseq.1e
index 446d126..22cbd65 100644
--- a/debian/manpages/degapseq.1e
+++ b/debian/manpages/degapseq.1e
@@ -2,12 +2,21 @@
.\" Title: DEGAPSEQ
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "DEGAPSEQ" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "DEGAPSEQ" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/density.1e b/debian/manpages/density.1e
index 93c71c8..994f928 100644
--- a/debian/manpages/density.1e
+++ b/debian/manpages/density.1e
@@ -2,12 +2,21 @@
.\" Title: DENSITY
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "DENSITY" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "DENSITY" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/descseq.1e b/debian/manpages/descseq.1e
index 83868a0..0e60130 100644
--- a/debian/manpages/descseq.1e
+++ b/debian/manpages/descseq.1e
@@ -2,12 +2,21 @@
.\" Title: DESCSEQ
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "DESCSEQ" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "DESCSEQ" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/diffseq.1e b/debian/manpages/diffseq.1e
index b7ed05c..959d5a2 100644
--- a/debian/manpages/diffseq.1e
+++ b/debian/manpages/diffseq.1e
@@ -2,12 +2,21 @@
.\" Title: DIFFSEQ
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "DIFFSEQ" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "DIFFSEQ" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -43,7 +52,7 @@ is a command line program from EMBOSS (\(lqthe European Molecular Biology Open S
.PP
\fB\-wordsize\fR \fIinteger\fR
.RS 4
-The similar regions between the two sequences are found by creating a hash table of \'wordsize\'d subsequences\&. 10 is a reasonable default\&. Making this value larger (20?) may speed up the program slightly, but will mean that any two differences within \'wordsize\' of each other will be grouped as a single region of difference\&. This value may be made smaller (4?) to improve the resolution of nearby differences, but the program will go much slower\&. Default value: 10
+The similar regions between the two sequences are found by creating a hash table of \*(Aqwordsize\*(Aqd subsequences\&. 10 is a reasonable default\&. Making this value larger (20?) may speed up the program slightly, but will mean that any two differences within \*(Aqwordsize\*(Aq of each other will be grouped as a single region of difference\&. This value may be made smaller (4?) to improve the resolution of nearby differences, but the program will go much slower\&. Default value: 10
.RE
.SS "Additional section"
.PP
@@ -59,12 +68,12 @@ Normally this program will find regions of identity that are the length of the s
.PP
\fB\-aoutfeat\fR \fIfeatout\fR
.RS 4
-File for output of first sequence\'s features Default value: $(asequence\&.name)\&.diffgff
+File for output of first sequence\*(Aqs features Default value: $(asequence\&.name)\&.diffgff
.RE
.PP
\fB\-boutfeat\fR \fIfeatout\fR
.RS 4
-File for output of second sequence\'s features Default value: $(bsequence\&.name)\&.diffgff
+File for output of second sequence\*(Aqs features Default value: $(bsequence\&.name)\&.diffgff
.RE
.SH "BUGS"
.PP
diff --git a/debian/manpages/digest.1e b/debian/manpages/digest.1e
index 7cd490f..9552971 100644
--- a/debian/manpages/digest.1e
+++ b/debian/manpages/digest.1e
@@ -2,12 +2,21 @@
.\" Title: DIGEST
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "DIGEST" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "DIGEST" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -55,7 +64,7 @@ Default value: N
.PP
\fB\-unfavoured\fR \fIboolean\fR
.RS 4
-Trypsin will not normally cut after \'KR\' if they are followed by any of \'KRIFLP\'\&. Lys\-C will not normally cut after \'K\' if it is followed by \'P\'\&. Arg\-C will not normally cut after \'R\' if it is followed by \'P\'\&. V8\-bicarb will not normally cut after \'E\' if it is followed by any of \'KREP\'\&. V8\-phosph will not normally cut after \'DE\' if they are followed by \'P\'\&. Chymotrypsin will not normally cut after \'FYWLM\' if they are followed by \'P\'\&. Specifying unfavoured shows these unfavoured cuts as well as the favoured ones\&.
+Trypsin will not normally cut after \*(AqKR\*(Aq if they are followed by any of \*(AqKRIFLP\*(Aq\&. Lys\-C will not normally cut after \*(AqK\*(Aq if it is followed by \*(AqP\*(Aq\&. Arg\-C will not normally cut after \*(AqR\*(Aq if it is followed by \*(AqP\*(Aq\&. V8\-bicarb will not normally cut after \*(AqE\*(Aq if it is followed by any of \*(AqKREP\*(Aq\&. V8\-phosph will not normally cut after \*(AqDE\*(Aq if they are followed by \*(AqP\*(Aq\&. Chymotrypsin will not normally cut after \*(AqFYWLM\*(Aq if they are followed by \*(AqP\*(Aq\&. Specifying unfavoured shows these unfavoured cuts as well as the favoured ones\&.
.RE
.PP
\fB\-ragging\fR \fIboolean\fR
diff --git a/debian/manpages/distmat.1e b/debian/manpages/distmat.1e
index b177a77..ce25c92 100644
--- a/debian/manpages/distmat.1e
+++ b/debian/manpages/distmat.1e
@@ -2,12 +2,21 @@
.\" Title: DISTMAT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "DISTMAT" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "DISTMAT" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -66,12 +75,12 @@ Choose base positions to analyse in each codon i\&.e\&. 123 (all bases), 12 (the
.PP
\fB\-calculatea\fR \fIboolean\fR
.RS 4
-This will force the calculation of parameter \'a\' in the Jin\-Nei Gamma distance calculation, otherwise the default is 1\&.0 (see \-parametera option)\&. Default value: N
+This will force the calculation of parameter \*(Aqa\*(Aq in the Jin\-Nei Gamma distance calculation, otherwise the default is 1\&.0 (see \-parametera option)\&. Default value: N
.RE
.PP
\fB\-parametera\fR \fIfloat\fR
.RS 4
-User defined parameter \'a\' to be use in the Jin\-Nei Gamma distance calculation\&. The suggested value to be used is 1\&.0 (Jin et al\&.) and this is the default\&. Default value: 1\&.0
+User defined parameter \*(Aqa\*(Aq to be use in the Jin\-Nei Gamma distance calculation\&. The suggested value to be used is 1\&.0 (Jin et al\&.) and this is the default\&. Default value: 1\&.0
.RE
.SS "Output section"
.PP
diff --git a/debian/manpages/domtesta.1e b/debian/manpages/domtesta.1e
new file mode 100644
index 0000000..0a13b23
--- /dev/null
+++ b/debian/manpages/domtesta.1e
@@ -0,0 +1,70 @@
+'\" t
+.\" Title: DOMTESTA
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
+.\" Date: 07/16/2010
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.3.0
+.\" Language: English
+.\"
+.TH "DOMTESTA" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+domtesta \- Reads an XML file into the DOM and writes it back out
+.SH "SYNOPSIS"
+.HP \w'\fBdomtesta\fR\ 'u
+\fBdomtesta\fR \fB\-infile\ \fR\fB\fIinfile\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP \w'\fBdomtesta\fR\ 'u
+\fBdomtesta\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdomtesta\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-infile\fR \fIinfile\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+domtesta is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/domtestb.1e b/debian/manpages/domtestb.1e
new file mode 100644
index 0000000..5aa4430
--- /dev/null
+++ b/debian/manpages/domtestb.1e
@@ -0,0 +1,65 @@
+'\" t
+.\" Title: DOMTESTB
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
+.\" Date: 07/16/2010
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.3.0
+.\" Language: English
+.\"
+.TH "DOMTESTB" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+domtestb \- Create, manipulate and write out XML
+.SH "SYNOPSIS"
+.HP \w'\fBdomtestb\fR\ 'u
+\fBdomtestb\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP \w'\fBdomtestb\fR\ 'u
+\fBdomtestb\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdomtestb\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&.
+.SH "OPTIONS"
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+domtestb is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/domtestc.1e b/debian/manpages/domtestc.1e
new file mode 100644
index 0000000..9b2e566
--- /dev/null
+++ b/debian/manpages/domtestc.1e
@@ -0,0 +1,65 @@
+'\" t
+.\" Title: DOMTESTC
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
+.\" Date: 07/16/2010
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.3.0
+.\" Language: English
+.\"
+.TH "DOMTESTC" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+domtestc \- Create and write out some typical XML
+.SH "SYNOPSIS"
+.HP \w'\fBdomtestc\fR\ 'u
+\fBdomtestc\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP \w'\fBdomtestc\fR\ 'u
+\fBdomtestc\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdomtestc\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&.
+.SH "OPTIONS"
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+domtestc is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/domtestd.1e b/debian/manpages/domtestd.1e
new file mode 100644
index 0000000..e4a9650
--- /dev/null
+++ b/debian/manpages/domtestd.1e
@@ -0,0 +1,65 @@
+'\" t
+.\" Title: DOMTESTD
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
+.\" Date: 07/16/2010
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.3.0
+.\" Language: English
+.\"
+.TH "DOMTESTD" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+domtestd \- Create some XML and search for an element
+.SH "SYNOPSIS"
+.HP \w'\fBdomtestd\fR\ 'u
+\fBdomtestd\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP \w'\fBdomtestd\fR\ 'u
+\fBdomtestd\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdomtestd\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&.
+.SH "OPTIONS"
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+domtestd is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/dotmatcher.1e b/debian/manpages/dotmatcher.1e
index 3734250..a47b7fa 100644
--- a/debian/manpages/dotmatcher.1e
+++ b/debian/manpages/dotmatcher.1e
@@ -2,12 +2,21 @@
.\" Title: DOTMATCHER
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "DOTMATCHER" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "DOTMATCHER" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -42,7 +51,7 @@ is a command line program from EMBOSS (\(lqthe European Molecular Biology Open S
.PP
\fB\-matrixfile\fR \fImatrix\fR
.RS 4
-This is the scoring matrix file used when comparing sequences\&. By default it is the file \'EBLOSUM62\' (for proteins) or the file \'EDNAFULL\' (for nucleic sequences)\&. These files are found in the \'data\' directory of the EMBOSS installation\&.
+This is the scoring matrix file used when comparing sequences\&. By default it is the file \*(AqEBLOSUM62\*(Aq (for proteins) or the file \*(AqEDNAFULL\*(Aq (for nucleic sequences)\&. These files are found in the \*(Aqdata\*(Aq directory of the EMBOSS installation\&.
.RE
.SS "Additional section"
.PP
diff --git a/debian/manpages/dotpath.1e b/debian/manpages/dotpath.1e
index d2aab50..fdb7b31 100644
--- a/debian/manpages/dotpath.1e
+++ b/debian/manpages/dotpath.1e
@@ -2,12 +2,21 @@
.\" Title: DOTPATH
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "DOTPATH" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "DOTPATH" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/dottup.1e b/debian/manpages/dottup.1e
index a30de57..44fa8e5 100644
--- a/debian/manpages/dottup.1e
+++ b/debian/manpages/dottup.1e
@@ -2,12 +2,21 @@
.\" Title: DOTTUP
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "DOTTUP" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "DOTTUP" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/dreg.1e b/debian/manpages/dreg.1e
index 1554cf3..f2a1f33 100644
--- a/debian/manpages/dreg.1e
+++ b/debian/manpages/dreg.1e
@@ -2,12 +2,21 @@
.\" Title: DREG
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "DREG" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "DREG" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/edamclean.1e b/debian/manpages/edamclean.1e
index cae7b93..2631c8d 100644
--- a/debian/manpages/edamclean.1e
+++ b/debian/manpages/edamclean.1e
@@ -2,12 +2,21 @@
.\" Title: EDAMCLEAN
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "EDAMCLEAN" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "EDAMCLEAN" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -22,19 +31,19 @@
edamclean \- Validate and fix EDAM OBO ontology
.SH "SYNOPSIS"
.HP \w'\fBedamclean\fR\ 'u
-\fBedamclean\fR \fB\-edamin\ \fR\fB\fIinfile\fR\fR \fB\-mode\ \fR\fB\fIselection\fR\fR \fB\-edamout\ \fR\fB\fIoutfile\fR\fR \fB\-log\ \fR\fB\fIoutfile\fR\fR
+\fBedamclean\fR \fB\-edamin\ \fR\fB\fIinfile\fR\fR \fB\-mode\ \fR\fB\fIselection\fR\fR \fB\-edamout\ \fR\fB\fIoutfile\fR\fR \fB\-log\ \fR\fB\fIoutfile\fR\fR \fB\-xml\ \fR\fB\fIoutfile\fR\fR
.HP \w'\fBedamclean\fR\ 'u
\fBedamclean\fR \fB\-help\fR
.SH "DESCRIPTION"
.PP
\fBedamclean\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Ontology:EDAM" command group(s)\&.
.SH "OPTIONS"
.SS "Input section"
.PP
\fB\-edamin\fR \fIinfile\fR
.RS 4
-Default value: /homes/jison/Ontologies/EDAM_beta1\&.obo
+Default value: /homes/jison/edam/EDAM\&.obo
.RE
.SS "Required section"
.PP
@@ -54,6 +63,11 @@ Default value: EDAM_out\&.obo
.RS 4
Default value: EDAM_out\&.log
.RE
+.PP
+\fB\-xml\fR \fIoutfile\fR
+.RS 4
+Default value: EDAM_out\&.xml
+.RE
.SH "BUGS"
.PP
Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
diff --git a/debian/manpages/edialign.1e b/debian/manpages/edialign.1e
index 62536ff..a846935 100644
--- a/debian/manpages/edialign.1e
+++ b/debian/manpages/edialign.1e
@@ -2,12 +2,21 @@
.\" Title: EDIALIGN
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "EDIALIGN" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "EDIALIGN" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -49,7 +58,7 @@ Default value: N
.PP
\fB\-overlapw\fR \fIselection\fR
.RS 4
-By default overlap weights are used when Nseq =<35 but you can set this to \'yes\' or \'no\' Default value: default (when Nseq =< 35)
+By default overlap weights are used when Nseq =<35 but you can set this to \*(Aqyes\*(Aq or \*(Aqno\*(Aq Default value: default (when Nseq =< 35)
.RE
.PP
\fB\-linkage\fR \fIlist\fR
diff --git a/debian/manpages/einverted.1e b/debian/manpages/einverted.1e
index 1f3dfdb..06a869a 100644
--- a/debian/manpages/einverted.1e
+++ b/debian/manpages/einverted.1e
@@ -2,12 +2,21 @@
.\" Title: EINVERTED
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "EINVERTED" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "EINVERTED" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/embossdata.1e b/debian/manpages/embossdata.1e
index ddcbc12..7524f51 100644
--- a/debian/manpages/embossdata.1e
+++ b/debian/manpages/embossdata.1e
@@ -2,12 +2,21 @@
.\" Title: EMBOSSDATA
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "EMBOSSDATA" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "EMBOSSDATA" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/embossversion.1e b/debian/manpages/embossversion.1e
index e0b6a99..c09114b 100644
--- a/debian/manpages/embossversion.1e
+++ b/debian/manpages/embossversion.1e
@@ -2,12 +2,21 @@
.\" Title: EMBOSSVERSION
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "EMBOSSVERSION" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "EMBOSSVERSION" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/emma.1e b/debian/manpages/emma.1e
index 65c8088..d12b6a6 100644
--- a/debian/manpages/emma.1e
+++ b/debian/manpages/emma.1e
@@ -2,12 +2,21 @@
.\" Title: EMMA
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "EMMA" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "EMMA" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -58,7 +67,7 @@ A distance is calculated between every pair of sequences and these are used to c
.PP
\fB\-pwmatrix\fR \fIlist\fR
.RS 4
-The scoring table which describes the similarity of each amino acid to each other\&. There are three \'in\-built\' series of weight matrices offered\&. Each consists of several matrices which work differently at different evolutionary distances\&. To see the exact details, read the documentation\&. Crudely, we store several matrices in memory, spanning the full range of amino acid distance (from almost identical sequences to highly divergent ones)\&. For very similar sequences, it is best to use a strict weight matrix which only gives a high score to identities and the most favoured conservative substitutions\&. For more divergent sequences, it is appropriate to use \'softer\' matrices which give a high score to many other frequent substitutions\&. 1) BLOSUM (Henikoff)\&. These matrices appear to be the best available for carrying out data base similarity (homology searches)\&. The matrices used are: Blosum80, 62, 45 and 30\&. 2) PAM (Dayhoff)\&. These have been extremely widely used since the late \'70s\&. We use the PAM 120, 160, 250 and 350 matrices\&. 3) GONNET \&. These matrices were derived using almost the same procedure as the Dayhoff one (above) but are much more up to date and are based on a far larger data set\&. They appear to be more sensitive than the Dayhoff series\&. We use the GONNET 40, 80, 120, 160, 250 and 350 matrices\&. We also supply an identity matrix which gives a score of 1\&.0 to two identical amino acids and a score of zero otherwise\&. This matrix is not very useful\&. Default value: b
+The scoring table which describes the similarity of each amino acid to each other\&. There are three \*(Aqin\-built\*(Aq series of weight matrices offered\&. Each consists of several matrices which work differently at different evolutionary distances\&. To see the exact details, read the documentation\&. Crudely, we store several matrices in memory, spanning the full range of amino acid distance (from almost identical sequences to highly divergent ones)\&. For very similar sequences, it is best to use a strict weight matrix which only gives a high score to identities and the most favoured conservative substitutions\&. For more divergent sequences, it is appropriate to use \*(Aqsofter\*(Aq matrices which give a high score to many other frequent substitutions\&. 1) BLOSUM (Henikoff)\&. These matrices appear to be the best available for carrying out data base similarity (homology searches)\&. The matrices used are: Blosum80, 62, 45 and 30\&. 2) PAM (Dayhoff)\&. These have been extremely widely used since the late \*(Aq70s\&. We use the PAM 120, 160, 250 and 350 matrices\&. 3) GONNET \&. These matrices were derived using almost the same procedure as the Dayhoff one (above) but are much more up to date and are based on a far larger data set\&. They appear to be more sensitive than the Dayhoff series\&. We use the GONNET 40, 80, 120, 160, 250 and 350 matrices\&. We also supply an identity matrix which gives a score of 1\&.0 to two identical amino acids and a score of zero otherwise\&. This matrix is not very useful\&. Default value: b
.RE
.PP
\fB\-pwdnamatrix\fR \fIlist\fR
@@ -77,7 +86,7 @@ The scoring table which describes the scores assigned to matches and mismatches
.PP
\fB\-matrix\fR \fIlist\fR
.RS 4
-This gives a menu where you are offered a choice of weight matrices\&. The default for proteins is the PAM series derived by Gonnet and colleagues\&. Note, a series is used! The actual matrix that is used depends on how similar the sequences to be aligned at this alignment step are\&. Different matrices work differently at each evolutionary distance\&. There are three \'in\-built\' series of weight matrices offered\&. Each consists of several matrices which work differently at different evolutionary distances\&. To see the exact details, read the documentation\&. Crudely, we store several matrices in memory, spanning the full range of amino acid distance (from almost identical sequences to highly divergent ones)\&. For very similar sequences, it is best to use a strict weight matrix which only gives a high score to identities and the most favoured conservative substitutions\&. For more divergent sequences, it is appropriate to use \'softer\' matrices which give a high score to many other frequent substitutions\&. 1) BLOSUM (Henikoff)\&. These matrices appear to be the best available for carrying out data base similarity (homology searches)\&. The matrices used are: Blosum80, 62, 45 and 30\&. 2) PAM (Dayhoff)\&. These have been extremely widely used since the late \'70s\&. We use the PAM 120, 160, 250 and 350 matrices\&. 3) GONNET \&. These matrices were derived using almost the same procedure as the Dayhoff one (above) but are much more up to date and are based on a far larger data set\&. They appear to be more sensitive than the Dayhoff series\&. We use the GONNET 40, 80, 120, 160, 250 and 350 matrices\&. We also supply an identity matrix which gives a score of 1\&.0 to two identical amino acids and a score of zero otherwise\&. This matrix is not very useful\&. Alternatively, you can read in your own (just one matrix, not a series)\&. Default value: b
+This gives a menu where you are offered a choice of weight matrices\&. The default for proteins is the PAM series derived by Gonnet and colleagues\&. Note, a series is used! The actual matrix that is used depends on how similar the sequences to be aligned at this alignment step are\&. Different matrices work differently at each evolutionary distance\&. There are three \*(Aqin\-built\*(Aq series of weight matrices offered\&. Each consists of several matrices which work differently at different evolutionary distances\&. To see the exact details, read the documentation\&. Crudely, we store several matrices in memory, spanning the full range of amino acid distance (from almost identical sequences to highly divergent ones)\&. For very similar sequences, it is best to use a strict weight matrix which only gives a high score to identities and the most favoured conservative substitutions\&. For more divergent sequences, it is appropriate to use \*(Aqsofter\*(Aq matrices which give a high score to many other frequent substitutions\&. 1) BLOSUM (Henikoff)\&. These matrices appear to be the best available for carrying out data base similarity (homology searches)\&. The matrices used are: Blosum80, 62, 45 and 30\&. 2) PAM (Dayhoff)\&. These have been extremely widely used since the late \*(Aq70s\&. We use the PAM 120, 160, 250 and 350 matrices\&. 3) GONNET \&. These matrices were derived using almost the same procedure as the Dayhoff one (above) but are much more up to date and are based on a far larger data set\&. They appear to be more sensitive than the Dayhoff series\&. We use the GONNET 40, 80, 120, 160, 250 and 350 matrices\&. We also supply an identity matrix which gives a score of 1\&.0 to two identical amino acids and a score of zero otherwise\&. This matrix is not very useful\&. Alternatively, you can read in your own (just one matrix, not a series)\&. Default value: b
.RE
.PP
\fB\-usermamatrix\fR \fIvariable\fR
@@ -127,7 +136,7 @@ The number of k\-tuple matches on each diagonal (in an imaginary dot\-matrix plo
.PP
\fB\-window\fR \fIinteger\fR
.RS 4
-This is the number of diagonals around each of the \'best\' diagonals that will be used\&. Decrease for speed; increase for sensitivity\&. Default value: @($(acdprotein)?5:4)
+This is the number of diagonals around each of the \*(Aqbest\*(Aq diagonals that will be used\&. Decrease for speed; increase for sensitivity\&. Default value: @($(acdprotein)?5:4)
.RE
.PP
\fB\-nopercent\fR \fIboolean\fR
@@ -148,7 +157,7 @@ The penalty for extending a gap by 1 residue\&. Increasing the gap extension pen
.PP
\fB\-endgaps\fR \fIboolean\fR
.RS 4
-End gap separation: treats end gaps just like internal gaps for the purposes of avoiding gaps that are too close (set by \'gap separation distance\')\&. If you turn this off, end gaps will be ignored for this purpose\&. This is useful when you wish to align fragments where the end gaps are not biologically meaningful\&. Default value: Y
+End gap separation: treats end gaps just like internal gaps for the purposes of avoiding gaps that are too close (set by \*(Aqgap separation distance\*(Aq)\&. If you turn this off, end gaps will be ignored for this purpose\&. This is useful when you wish to align fragments where the end gaps are not biologically meaningful\&. Default value: Y
.RE
.PP
\fB\-gapdist\fR \fIinteger\fR
@@ -163,12 +172,12 @@ Residue specific penalties: amino acid specific gap penalties that reduce or inc
.PP
\fB\-hgapres\fR \fIstring\fR
.RS 4
-This is a set of the residues \'considered\' to be hydrophilic\&. It is used when introducing Hydrophilic gap penalties\&. Default value: GPSNDQEKR
+This is a set of the residues \*(Aqconsidered\*(Aq to be hydrophilic\&. It is used when introducing Hydrophilic gap penalties\&. Default value: GPSNDQEKR
.RE
.PP
\fB\-nohgap\fR \fIboolean\fR
.RS 4
-Hydrophilic gap penalties: used to increase the chances of a gap within a run (5 or more residues) of hydrophilic amino acids; these are likely to be loop or random coil regions where gaps are more common\&. The residues that are \'considered\' to be hydrophilic are set by \'\-hgapres\'\&. Default value: N
+Hydrophilic gap penalties: used to increase the chances of a gap within a run (5 or more residues) of hydrophilic amino acids; these are likely to be loop or random coil regions where gaps are more common\&. The residues that are \*(Aqconsidered\*(Aq to be hydrophilic are set by \*(Aq\-hgapres\*(Aq\&. Default value: N
.RE
.PP
\fB\-maxdiv\fR \fIinteger\fR
diff --git a/debian/manpages/emowse.1e b/debian/manpages/emowse.1e
index ccb206a..3b467e9 100644
--- a/debian/manpages/emowse.1e
+++ b/debian/manpages/emowse.1e
@@ -2,12 +2,21 @@
.\" Title: EMOWSE
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "EMOWSE" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "EMOWSE" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/ensembltest.1e b/debian/manpages/ensembltest.1e
index 3c3e2c2..08fba01 100644
--- a/debian/manpages/ensembltest.1e
+++ b/debian/manpages/ensembltest.1e
@@ -2,12 +2,21 @@
.\" Title: ENSEMBLTEST
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "ENSEMBLTEST" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "ENSEMBLTEST" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -22,7 +31,7 @@
ensembltest \- Demonstration of the Ensembl API to be\&.
.SH "SYNOPSIS"
.HP \w'\fBensembltest\fR\ 'u
-\fBensembltest\fR \fB\-large\ \fR\fB\fIboolean\fR\fR \fB\-maxnum\ \fR\fB\fIinteger\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR \fB\-exons\ \fR\fB\fIseqoutall\fR\fR \fB\-transcripts\ \fR\fB\fIseqoutall\fR\fR \fB\-translations\ \fR\fB\fIseqoutall\fR\fR
+\fBensembltest\fR \fB\-large\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR \fB\-maxnum\ \fR\fB\fIinteger\fR\fR \fB\-exons\ \fR\fB\fIseqoutall\fR\fR \fB\-transcripts\ \fR\fB\fIseqoutall\fR\fR \fB\-translations\ \fR\fB\fIseqoutall\fR\fR
.HP \w'\fBensembltest\fR\ 'u
\fBensembltest\fR \fB\-help\fR
.SH "DESCRIPTION"
@@ -32,16 +41,11 @@ is a command line program from EMBOSS (\(lqthe European Molecular Biology Open S
.SH "OPTIONS"
.SS "Input section"
.SS "Required section"
-.SS "Advanced section"
+.SS "Additional section"
.PP
\fB\-large\fR \fIboolean\fR
.RS 4
-Set this to \'Y\' to download large test data sets\&. Default value: N
-.RE
-.PP
-\fB\-maxnum\fR \fIinteger\fR
-.RS 4
-Default value: 25
+Set this to \*(AqY\*(Aq to download large test data sets\&. Default value: N
.RE
.SS "Output section"
.PP
@@ -53,6 +57,11 @@ Default value: 25
.RS 4
.RE
.PP
+\fB\-maxnum\fR \fIinteger\fR
+.RS 4
+Default value: 25
+.RE
+.PP
\fB\-exons\fR \fIseqoutall\fR
.RS 4
.RE
diff --git a/debian/manpages/entrails.1e b/debian/manpages/entrails.1e
index 2f03400..0df70eb 100644
--- a/debian/manpages/entrails.1e
+++ b/debian/manpages/entrails.1e
@@ -2,12 +2,21 @@
.\" Title: ENTRAILS
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "ENTRAILS" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "ENTRAILS" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/entrailsbook.1e b/debian/manpages/entrailsbook.1e
index dc6b4ce..9506707 100644
--- a/debian/manpages/entrailsbook.1e
+++ b/debian/manpages/entrailsbook.1e
@@ -2,12 +2,21 @@
.\" Title: ENTRAILSBOOK
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "ENTRAILSBOOK" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "ENTRAILSBOOK" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/entrailshtml.1e b/debian/manpages/entrailshtml.1e
index 675daeb..2bbe818 100644
--- a/debian/manpages/entrailshtml.1e
+++ b/debian/manpages/entrailshtml.1e
@@ -2,12 +2,21 @@
.\" Title: ENTRAILSHTML
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "ENTRAILSHTML" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "ENTRAILSHTML" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/entrailswiki.1e b/debian/manpages/entrailswiki.1e
index 1d8264e..f29c473 100644
--- a/debian/manpages/entrailswiki.1e
+++ b/debian/manpages/entrailswiki.1e
@@ -2,12 +2,21 @@
.\" Title: ENTRAILSWIKI
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "ENTRAILSWIKI" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "ENTRAILSWIKI" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/entret.1e b/debian/manpages/entret.1e
index 0ad41c3..3a39b9c 100644
--- a/debian/manpages/entret.1e
+++ b/debian/manpages/entret.1e
@@ -2,12 +2,21 @@
.\" Title: ENTRET
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "ENTRET" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "ENTRET" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/epestfind.1e b/debian/manpages/epestfind.1e
index 9f681ba..c481eba 100644
--- a/debian/manpages/epestfind.1e
+++ b/debian/manpages/epestfind.1e
@@ -2,12 +2,21 @@
.\" Title: EPESTFIND
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "EPESTFIND" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "EPESTFIND" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -56,7 +65,7 @@ Name of the output file which holds the results of the analysis\&. Results may b
.PP
\fB\-threshold\fR \fIfloat\fR
.RS 4
-Threshold value to discriminate weak from potential PEST motifs\&. Valid PEST motifs are discriminated into \'poor\' and \'potential\' motifs depending on this threshold score\&. By default, the default value is set to +5\&.0 based on experimental data\&. Alterations are not recommended since significance is a matter of biology, not mathematics\&. Default value: +5\&.0
+Threshold value to discriminate weak from potential PEST motifs\&. Valid PEST motifs are discriminated into \*(Aqpoor\*(Aq and \*(Aqpotential\*(Aq motifs depending on this threshold score\&. By default, the default value is set to +5\&.0 based on experimental data\&. Alterations are not recommended since significance is a matter of biology, not mathematics\&. Default value: +5\&.0
.RE
.SS "Advanced section"
.PP
diff --git a/debian/manpages/eprimer3.1e b/debian/manpages/eprimer3.1e
index dbb214f..4e3cdc1 100644
--- a/debian/manpages/eprimer3.1e
+++ b/debian/manpages/eprimer3.1e
@@ -2,12 +2,21 @@
.\" Title: EPRIMER3
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "EPRIMER3" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "EPRIMER3" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -34,7 +43,7 @@ is a command line program from EMBOSS (\(lqthe European Molecular Biology Open S
.PP
\fB\-sequence\fR \fIseqall\fR
.RS 4
-The sequence from which to choose primers\&. The sequence must be presented 5\' to 3\'
+The sequence from which to choose primers\&. The sequence must be presented 5\*(Aq to 3\*(Aq
.RE
.PP
\fB\-primer\fR \fItoggle\fR
@@ -44,29 +53,29 @@ Tell EPrimer3 to pick primer(s) Default value: Y
.PP
\fB\-task\fR \fIlist\fR
.RS 4
-Tell EPrimer3 what task to perform\&. Legal values are 1: \'Pick PCR primers\', 2: \'Pick forward primer only\', 3: \'Pick reverse primer only\', 4: \'No primers needed\'\&. Default value: 1
+Tell EPrimer3 what task to perform\&. Legal values are 1: \*(AqPick PCR primers\*(Aq, 2: \*(AqPick forward primer only\*(Aq, 3: \*(AqPick reverse primer only\*(Aq, 4: \*(AqNo primers needed\*(Aq\&. Default value: 1
.RE
.PP
\fB\-hybridprobe\fR \fItoggle\fR
.RS 4
-An \'internal oligo\' is intended to be used as a hybridization probe (hyb probe) to detect the PCR product after amplification\&. Default value: N
+An \*(Aqinternal oligo\*(Aq is intended to be used as a hybridization probe (hyb probe) to detect the PCR product after amplification\&. Default value: N
.RE
.PP
\fB\-mishyblibraryfile\fR \fIinfile\fR
.RS 4
-Similar to MISPRIMING\-LIBRARY, except that the event we seek to avoid is hybridization of the internal oligo to sequences in this library rather than priming from them\&. The file must be in (a slightly restricted) FASTA format (W\&. B\&. Pearson and D\&.J\&. Lipman, PNAS 85:8 pp 2444\-2448 [1988]); we briefly discuss the organization of this file below\&. If this parameter is specified then EPrimer3 locally aligns each candidate oligo against each library sequence and rejects those primers for which the local alignment score times a specified weight (see below) exceeds INTERNAL\-OLIGO\-MAX\-MISHYB\&. (The maximum value of the weight is arbitrarily set to 12\&.0\&.) Each sequence entry in the FASTA\-format file must begin with an \'id line\' that starts with \'>\'\&. The contents of the id line is \'slightly restricted\' in that EPrimer3 parses everything after any optional asterisk (\'*\') as a floating point number to use as the weight mentioned above\&. If the id line contains no asterisk then the weight defaults to 1\&.0\&. The alignment scoring system used is the same as for calculating complementarity among oligos (e\&.g\&. SELF\-ANY)\&. The remainder of an entry contains the sequence as lines following the id line up until a line starting with \'>\' or the end of the file\&. Whitespace and newlines are ignored\&. Characters \'A\', \'T\', \'G\', \'C\', \'a\', \'t\', \'g\', \'c\' are retained and any other character is converted to \'N\' (with the consequence that any IUB / IUPAC codes for ambiguous bases are converted to \'N\')\&. There are no restrictions on line length\&. An empty value for this parameter indicates that no library should be used\&.
+Similar to MISPRIMING\-LIBRARY, except that the event we seek to avoid is hybridization of the internal oligo to sequences in this library rather than priming from them\&. The file must be in (a slightly restricted) FASTA format (W\&. B\&. Pearson and D\&.J\&. Lipman, PNAS 85:8 pp 2444\-2448 [1988]); we briefly discuss the organization of this file below\&. If this parameter is specified then EPrimer3 locally aligns each candidate oligo against each library sequence and rejects those primers for which the local alignment score times a specified weight (see below) exceeds INTERNAL\-OLIGO\-MAX\-MISHYB\&. (The maximum value of the weight is arbitrarily set to 12\&.0\&.) Each sequence entry in the FASTA\-format file must begin with an \*(Aqid line\*(Aq that starts with \*(Aq>\*(Aq\&. The contents of the id line is \*(Aqslightly restricted\*(Aq in that EPrimer3 parses everything after any optional asterisk (\*(Aq*\*(Aq) as a floating point number to use as the weight mentioned above\&. If the id line contains no asterisk then the weight defaults to 1\&.0\&. The alignment scoring system used is the same as for calculating complementarity among oligos (e\&.g\&. SELF\-ANY)\&. The remainder of an entry contains the sequence as lines following the id line up until a line starting with \*(Aq>\*(Aq or the end of the file\&. Whitespace and newlines are ignored\&. Characters \*(AqA\*(Aq, \*(AqT\*(Aq, \*(AqG\*(Aq, \*(AqC\*(Aq, \*(Aqa\*(Aq, \*(Aqt\*(Aq, \*(Aqg\*(Aq, \*(Aqc\*(Aq are retained and any other character is converted to \*(AqN\*(Aq (with the consequence that any IUB / IUPAC codes for ambiguous bases are converted to \*(AqN\*(Aq)\&. There are no restrictions on line length\&. An empty value for this parameter indicates that no library should be used\&.
.RE
.PP
\fB\-mispriminglibraryfile\fR \fIinfile\fR
.RS 4
-The name of a file containing a nucleotide sequence library of sequences to avoid amplifying (for example repetitive sequences, or possibly the sequences of genes in a gene family that should not be amplified\&.) The file must be in (a slightly restricted) FASTA format (W\&. B\&. Pearson and D\&.J\&. Lipman, PNAS 85:8 pp 2444\-2448 [1988]); we briefly discuss the organization of this file below\&. If this parameter is specified then EPrimer3 locally aligns each candidate primer against each library sequence and rejects those primers for which the local alignment score times a specified weight (see below) exceeds MAX\-MISPRIMING\&. (The maximum value of the weight is arbitrarily set to 100\&.0\&.) Each sequence entry in the FASTA\-format file must begin with an \'id line\' that starts with \'>\'\&. The contents of the id line is \'slightly restricted\' in that EPrimer3 parses everything after any optional asterisk (\'*\') as a floating point number to use as the weight mentioned above\&. If the id line contains no asterisk then the weight defaults to 1\&.0\&. The alignment scoring system used is the same as for calculating complementarity among oligos (e\&.g\&. SELF\-ANY)\&. The remainder of an entry contains the sequence as lines following the id line up until a line starting with \'>\' or the end of the file\&. Whitespace and newlines are ignored\&. Characters \'A\', \'T\', \'G\', \'C\', \'a\', \'t\', \'g\', \'c\' are retained and any other character is converted to \'N\' (with the consequence that any IUB / IUPAC codes for ambiguous bases are converted to \'N\')\&. There are no restrictions on line length\&. An empty value for this parameter indicates that no repeat library should be used\&.
+The name of a file containing a nucleotide sequence library of sequences to avoid amplifying (for example repetitive sequences, or possibly the sequences of genes in a gene family that should not be amplified\&.) The file must be in (a slightly restricted) FASTA format (W\&. B\&. Pearson and D\&.J\&. Lipman, PNAS 85:8 pp 2444\-2448 [1988]); we briefly discuss the organization of this file below\&. If this parameter is specified then EPrimer3 locally aligns each candidate primer against each library sequence and rejects those primers for which the local alignment score times a specified weight (see below) exceeds MAX\-MISPRIMING\&. (The maximum value of the weight is arbitrarily set to 100\&.0\&.) Each sequence entry in the FASTA\-format file must begin with an \*(Aqid line\*(Aq that starts with \*(Aq>\*(Aq\&. The contents of the id line is \*(Aqslightly restricted\*(Aq in that EPrimer3 parses everything after any optional asterisk (\*(Aq*\*(Aq) as a floating point number to use as the weight mentioned above\&. If the id line contains no asterisk then the weight defaults to 1\&.0\&. The alignment scoring system used is the same as for calculating complementarity among oligos (e\&.g\&. SELF\-ANY)\&. The remainder of an entry contains the sequence as lines following the id line up until a line starting with \*(Aq>\*(Aq or the end of the file\&. Whitespace and newlines are ignored\&. Characters \*(AqA\*(Aq, \*(AqT\*(Aq, \*(AqG\*(Aq, \*(AqC\*(Aq, \*(Aqa\*(Aq, \*(Aqt\*(Aq, \*(Aqg\*(Aq, \*(Aqc\*(Aq are retained and any other character is converted to \*(AqN\*(Aq (with the consequence that any IUB / IUPAC codes for ambiguous bases are converted to \*(AqN\*(Aq)\&. There are no restrictions on line length\&. An empty value for this parameter indicates that no repeat library should be used\&.
.RE
.SS "Additional section"
.SS "Program options"
.PP
\fB\-numreturn\fR \fIinteger\fR
.RS 4
-The maximum number of primer pairs to return\&. Primer pairs returned are sorted by their \'quality\', in other words by the value of the objective function (where a lower number indicates a better primer pair)\&. Caution: setting this parameter to a large value will increase running time\&. Default value: 5
+The maximum number of primer pairs to return\&. Primer pairs returned are sorted by their \*(Aqquality\*(Aq, in other words by the value of the objective function (where a lower number indicates a better primer pair)\&. Caution: setting this parameter to a large value will increase running time\&. Default value: 5
.RE
.SS "Sequence options"
.PP
@@ -98,7 +107,7 @@ The sequence of a reverse primer to check and around which to design forward pri
.PP
\fB\-gcclamp\fR \fIinteger\fR
.RS 4
-Require the specified number of consecutive Gs and Cs at the 3\' end of both the forward and reverse primer\&. (This parameter has no effect on the internal oligo if one is requested\&.)
+Require the specified number of consecutive Gs and Cs at the 3\*(Aq end of both the forward and reverse primer\&. (This parameter has no effect on the internal oligo if one is requested\&.)
.RE
.PP
\fB\-osize\fR \fIinteger\fR
@@ -113,7 +122,7 @@ Minimum acceptable length of a primer\&. Must be greater than 0 and less than or
.PP
\fB\-maxsize\fR \fIinteger\fR
.RS 4
-Maximum acceptable length (in bases) of a primer\&. Currently this parameter cannot be larger than 35\&. This limit is governed by the maximum oligo size for which EPrimer3\'s melting\-temperature is valid\&. Default value: 27
+Maximum acceptable length (in bases) of a primer\&. Currently this parameter cannot be larger than 35\&. This limit is governed by the maximum oligo size for which EPrimer3\*(Aqs melting\-temperature is valid\&. Default value: 27
.RE
.PP
\fB\-otm\fR \fIfloat\fR
@@ -158,7 +167,7 @@ The millimolar concentration of salt (usually KCl) in the PCR\&. EPrimer3 uses t
.PP
\fB\-dnaconc\fR \fIfloat\fR
.RS 4
-The nanomolar concentration of annealing oligos in the PCR\&. EPrimer3 uses this argument to calculate oligo melting temperatures\&. The default (50nM) works well with the standard protocol used at the Whitehead/MIT Center for Genome Research\-\-0\&.5 microliters of 20 micromolar concentration for each primer oligo in a 20 microliter reaction with 10 nanograms template, 0\&.025 units/microliter Taq polymerase in 0\&.1 mM each dNTP, 1\&.5mM MgCl2, 50mM KCl, 10mM Tris\-HCL (pH 9\&.3) using 35 cycles with an annealing temperature of 56 degrees Celsius\&. This parameter corresponds to \'c\' in Rychlik, Spencer and Rhoads\' equation (ii) (Nucleic Acids Research, vol 18, num 21) where a suitable value (for a lower initial concentration of template) is \'empirically determined\'\&. The value of this parameter is less than the actual concentration of oligos in the reaction because it is the concentration of annealing oligos, which in turn depends on the amount of template (including PCR product) in a given cycle\&. This concentration increases a great deal during a PCR; fortunately PCR seems quite robust for a variety of oligo melting temperatures\&. See ADVICE FOR PICKING PRIMERS\&. Default value: 50\&.0
+The nanomolar concentration of annealing oligos in the PCR\&. EPrimer3 uses this argument to calculate oligo melting temperatures\&. The default (50nM) works well with the standard protocol used at the Whitehead/MIT Center for Genome Research\-\-0\&.5 microliters of 20 micromolar concentration for each primer oligo in a 20 microliter reaction with 10 nanograms template, 0\&.025 units/microliter Taq polymerase in 0\&.1 mM each dNTP, 1\&.5mM MgCl2, 50mM KCl, 10mM Tris\-HCL (pH 9\&.3) using 35 cycles with an annealing temperature of 56 degrees Celsius\&. This parameter corresponds to \*(Aqc\*(Aq in Rychlik, Spencer and Rhoads\*(Aq equation (ii) (Nucleic Acids Research, vol 18, num 21) where a suitable value (for a lower initial concentration of template) is \*(Aqempirically determined\*(Aq\&. The value of this parameter is less than the actual concentration of oligos in the reaction because it is the concentration of annealing oligos, which in turn depends on the amount of template (including PCR product) in a given cycle\&. This concentration increases a great deal during a PCR; fortunately PCR seems quite robust for a variety of oligo melting temperatures\&. See ADVICE FOR PICKING PRIMERS\&. Default value: 50\&.0
.RE
.PP
\fB\-maxpolyx\fR \fIinteger\fR
@@ -189,7 +198,7 @@ The minimum allowed melting temperature of the amplicon\&. Please see the docume
.PP
\fB\-ptmmax\fR \fIfloat\fR
.RS 4
-The maximum allowed melting temperature of the amplicon\&. Product Tm is calculated using the formula from Bolton and McCarthy, PNAS 84:1390 (1962) as presented in Sambrook, Fritsch and Maniatis, Molecular Cloning, p 11\&.46 (1989, CSHL Press)\&. Tm = 81\&.5 + 16\&.6(log10([Na+])) + \&.41*(%GC) \- 600/length Where [Na+} is the molar sodium concentration, (%GC) is the percent of Gs and Cs in the sequence, and length is the length of the sequence\&. A similar formula is used by the prime primer selection program in GCG http://www\&.gcg\&.com), which instead uses 675\&.0/length in the last term (after F\&. Baldino, Jr, M\&.\-F\&. Chesselet, and M\&.E\&. Lewis, Methods in Enzymology 168:766 (1989) eqn (1) on page 766 without the mismatch and formamide terms)\&. The formulas here and in Baldino et al\&. assume Na+ rather than K+\&. According to J\&.G\&. Wetmur, Critical Reviews in BioChem\&. and Mol\&. Bio\&. 26:227 (1991) 50 mM K+ should be equivalent in these formulae to \&.2 M Na+\&. EPrimer3 uses the same salt concentration value for calculating both the primer melting temperature and the oligo melting temperature\&. If you are planning to use the PCR product for hybridization later this behavior will not give you the Tm under hybridization conditions\&. Default value: 1000000\&.0
+The maximum allowed melting temperature of the amplicon\&. Product Tm is calculated using the formula from Bolton and McCarthy, PNAS 84:1390 (1962) as presented in Sambrook, Fritsch and Maniatis, Molecular Cloning, p 11\&.46 (1989, CSHL Press)\&. Tm = 81\&.5 + 16\&.6(log10([Na+])) + \&.41*(%GC) \- 600/length Where [Na+} is the molar sodium concentration, (%GC) is the percent of Gs and Cs in the sequence, and length is the length of the sequence\&. A similar formula is used by the prime primer selection program in GCG, which instead uses 675\&.0/length in the last term (after F\&. Baldino, Jr, M\&.\-F\&. Chesselet, and M\&.E\&. Lewis, Methods in Enzymology 168:766 (1989) eqn (1) on page 766 without the mismatch and formamide terms)\&. The formulas here and in Baldino et al\&. assume Na+ rather than K+\&. According to J\&.G\&. Wetmur, Critical Reviews in BioChem\&. and Mol\&. Bio\&. 26:227 (1991) 50 mM K+ should be equivalent in these formulae to \&.2 M Na+\&. EPrimer3 uses the same salt concentration value for calculating both the primer melting temperature and the oligo melting temperature\&. If you are planning to use the PCR product for hybridization later this behavior will not give you the Tm under hybridization conditions\&. Default value: 1000000\&.0
.RE
.SS "Internal oligo input"
.PP
@@ -216,7 +225,7 @@ Minimum acceptable length of an internal oligo\&. Must be greater than 0 and les
.PP
\fB\-omaxsize\fR \fIinteger\fR
.RS 4
-Maximum acceptable length (in bases) of an internal oligo\&. Currently this parameter cannot be larger than 35\&. This limit is governed by maximum oligo size for which EPrimer3\'s melting\-temperature is valid\&. Default value: 27
+Maximum acceptable length (in bases) of an internal oligo\&. Currently this parameter cannot be larger than 35\&. This limit is governed by maximum oligo size for which EPrimer3\*(Aqs melting\-temperature is valid\&. Default value: 27
.RE
.PP
\fB\-otmopt\fR \fIfloat\fR
@@ -261,12 +270,12 @@ The nanomolar concentration of annealing internal oligo in the hybridization\&.
.PP
\fB\-oanyself\fR \fIfloat\fR
.RS 4
-The maximum allowable local alignment score when testing an internal oligo for (local) self\-complementarity\&. Local self\-complementarity is taken to predict the tendency of oligos to anneal to themselves The scoring system gives 1\&.00 for complementary bases, \-0\&.25 for a match of any base (or N) with an N, \-1\&.00 for a mismatch, and \-2\&.00 for a gap\&. Only single\-base\-pair gaps are allowed\&. For example, the alignment 5\' ATCGNA 3\' || | | 3\' TA\-CGT 5\' is allowed (and yields a score of 1\&.75), but the alignment 5\' ATCCGNA 3\' || | | 3\' TA\-\-CGT 5\' is not considered\&. Scores are non\-negative, and a score of 0\&.00 indicates that there is no reasonable local alignment between two oligos\&. Default value: 12\&.00
+The maximum allowable local alignment score when testing an internal oligo for (local) self\-complementarity\&. Local self\-complementarity is taken to predict the tendency of oligos to anneal to themselves The scoring system gives 1\&.00 for complementary bases, \-0\&.25 for a match of any base (or N) with an N, \-1\&.00 for a mismatch, and \-2\&.00 for a gap\&. Only single\-base\-pair gaps are allowed\&. For example, the alignment 5\*(Aq ATCGNA 3\*(Aq || | | 3\*(Aq TA\-CGT 5\*(Aq is allowed (and yields a score of 1\&.75), but the alignment 5\*(Aq ATCCGNA 3\*(Aq || | | 3\*(Aq TA\-\-CGT 5\*(Aq is not considered\&. Scores are non\-negative, and a score of 0\&.00 indicates that there is no reasonable local alignment between two oligos\&. Default value: 12\&.00
.RE
.PP
\fB\-oendself\fR \fIfloat\fR
.RS 4
-The maximum allowable 3\'\-anchored global alignment score when testing a single oligo for self\-complementarity\&. The scoring system is as for the Maximum Complementarity argument\&. In the examples above the scores are 7\&.00 and 6\&.00 respectively\&. Scores are non\-negative, and a score of 0\&.00 indicates that there is no reasonable 3\'\-anchored global alignment between two oligos\&. In order to estimate 3\'\-anchored global alignments for candidate oligos, Primer assumes that the sequence from which to choose oligos is presented 5\' to 3\'\&. INTERNAL\-OLIGO\-SELF\-END is meaningless when applied to internal oligos used for hybridization\-based detection, since primer\-dimer will not occur\&. We recommend that INTERNAL\-OLIGO\-SELF\-END be set at least as high as INTERNAL\-OLIGO\-SELF\-ANY\&. Default value: 12\&.00
+The maximum allowable 3\*(Aq\-anchored global alignment score when testing a single oligo for self\-complementarity\&. The scoring system is as for the Maximum Complementarity argument\&. In the examples above the scores are 7\&.00 and 6\&.00 respectively\&. Scores are non\-negative, and a score of 0\&.00 indicates that there is no reasonable 3\*(Aq\-anchored global alignment between two oligos\&. In order to estimate 3\*(Aq\-anchored global alignments for candidate oligos, Primer assumes that the sequence from which to choose oligos is presented 5\*(Aq to 3\*(Aq\&. INTERNAL\-OLIGO\-SELF\-END is meaningless when applied to internal oligos used for hybridization\-based detection, since primer\-dimer will not occur\&. We recommend that INTERNAL\-OLIGO\-SELF\-END be set at least as high as INTERNAL\-OLIGO\-SELF\-ANY\&. Default value: 12\&.00
.RE
.PP
\fB\-opolyxmax\fR \fIinteger\fR
@@ -317,18 +326,18 @@ Maximum number of unknown bases (N) allowable in any primer\&.
.PP
\fB\-selfany\fR \fIfloat\fR
.RS 4
-The maximum allowable local alignment score when testing a single primer for (local) self\-complementarity and the maximum allowable local alignment score when testing for complementarity between forward and reverse primers\&. Local self\-complementarity is taken to predict the tendency of primers to anneal to each other without necessarily causing self\-priming in the PCR\&. The scoring system gives 1\&.00 for complementary bases, \-0\&.25 for a match of any base (or N) with an N, \-1\&.00 for a mismatch, and \-2\&.00 for a gap\&. Only single\-base\-pair gaps are allowed\&. For example, the alignment 5\' ATCGNA 3\' \&.\&.\&.|| | | 3\' TA\-CGT 5\' is allowed (and yields a score of 1\&.75), but the alignment 5\' ATCCGNA 3\' \&.\&.\&.|| | | 3\' TA\-\-CGT 5\' is not considered\&. Scores are non\-negative, and a score of 0\&.00 indicates that there is no reasonable local alignment between two oligos\&. Default value: 8\&.00
+The maximum allowable local alignment score when testing a single primer for (local) self\-complementarity and the maximum allowable local alignment score when testing for complementarity between forward and reverse primers\&. Local self\-complementarity is taken to predict the tendency of primers to anneal to each other without necessarily causing self\-priming in the PCR\&. The scoring system gives 1\&.00 for complementary bases, \-0\&.25 for a match of any base (or N) with an N, \-1\&.00 for a mismatch, and \-2\&.00 for a gap\&. Only single\-base\-pair gaps are allowed\&. For example, the alignment 5\*(Aq ATCGNA 3\*(Aq \&.\&.\&.|| | | 3\*(Aq TA\-CGT 5\*(Aq is allowed (and yields a score of 1\&.75), but the alignment 5\*(Aq ATCCGNA 3\*(Aq \&.\&.\&.|| | | 3\*(Aq TA\-\-CGT 5\*(Aq is not considered\&. Scores are non\-negative, and a score of 0\&.00 indicates that there is no reasonable local alignment between two oligos\&. Default value: 8\&.00
.RE
.PP
\fB\-selfend\fR \fIfloat\fR
.RS 4
-The maximum allowable 3\'\-anchored global alignment score when testing a single primer for self\-complementarity, and the maximum allowable 3\'\-anchored global alignment score when testing for complementarity between forward and reverse primers\&. The 3\'\-anchored global alignment score is taken to predict the likelihood of PCR\-priming primer\-dimers, for example 5\' ATGCCCTAGCTTCCGGATG 3\' \&.\&.\&.\&.\&.\&.\&.\&.\&.\&.\&.\&.\&.||| ||||| \&.\&.\&.\&.\&.\&.\&.\&.\&.\&.3\' AAGTCCTACATTTAGCCTAGT 5\' or 5\' AGGCTATGGGCCTCGCGA 3\' \&.\&.\&.\&.\&.\&.\&.\&.\&.\&.\&.\&.\&.\&.\&.|||||| \&.\&.\&.\&.\&.\&.\&.\&.\&.\&.\&.\&.3\' AGCGCTCCGGGTATCGGA 5\' The scoring system is as for the Maximum Complementarity argument\&. In the examples above the scores are 7\&.00 and 6\&.00 respectively\&. Scores are non\-negative, and a score of 0\&.00 indicates that there is no reasonable 3\'\-anchored global alignment between two oligos\&. In order to estimate 3\'\-anchored global alignments for candidate primers and primer pairs, Primer assumes that the sequence from which to choose primers is presented 5\' to 3\'\&. It is nonsensical to provide a larger value for this parameter than for the Maximum (local) Complementarity parameter because the score of a local alignment will always be at least as great as the score of a global alignment\&. Default value: 3\&.00
+The maximum allowable 3\*(Aq\-anchored global alignment score when testing a single primer for self\-complementarity, and the maximum allowable 3\*(Aq\-anchored global alignment score when testing for complementarity between forward and reverse primers\&. The 3\*(Aq\-anchored global alignment score is taken to predict the likelihood of PCR\-priming primer\-dimers, for example 5\*(Aq ATGCCCTAGCTTCCGGATG 3\*(Aq \&.\&.\&.\&.\&.\&.\&.\&.\&.\&.\&.\&.\&.||| ||||| \&.\&.\&.\&.\&.\&.\&.\&.\&.\&.3\*(Aq AAGTCCTACATTTAGCCTAGT 5\*(Aq or 5\*(Aq AGGCTATGGGCCTCGCGA 3\*(Aq \&.\&.\&.\&.\&.\&.\&.\&.\&.\&.\&.\&.\&.\&.\&.|||||| \&.\&.\&.\&.\&.\&.\&.\&.\&.\&.\&.\&.3\*(Aq AGCGCTCCGGGTATCGGA 5\*(Aq The scoring system is as for the Maximum Complementarity argument\&. In the examples above the scores are 7\&.00 and 6\&.00 respectively\&. Scores are non\-negative, and a score of 0\&.00 indicates that there is no reasonable 3\*(Aq\-anchored global alignment between two oligos\&. In order to estimate 3\*(Aq\-anchored global alignments for candidate primers and primer pairs, Primer assumes that the sequence from which to choose primers is presented 5\*(Aq to 3\*(Aq\&. It is nonsensical to provide a larger value for this parameter than for the Maximum (local) Complementarity parameter because the score of a local alignment will always be at least as great as the score of a global alignment\&. Default value: 3\&.00
.RE
.SS "Primer penalty weights"
.PP
\fB\-maxendstability\fR \fIfloat\fR
.RS 4
-The maximum stability for the five 3\' bases of a forward or reverse primer\&. Bigger numbers mean more stable 3\' ends\&. The value is the maximum delta G for duplex disruption for the five 3\' bases as calculated using the nearest neighbor parameters published in Breslauer, Frank, Bloecker and Marky, Proc\&. Natl\&. Acad\&. Sci\&. USA, vol 83, pp 3746\-3750\&. EPrimer3 uses a completely permissive default value for backward compatibility (which we may change in the next release)\&. Rychlik recommends a maximum value of 9 (Wojciech Rychlik, \'Selection of Primers for Polymerase Chain Reaction\' in BA White, Ed\&., \'Methods in Molecular Biology, Vol\&. 15: PCR Protocols: Current Methods and Applications\', 1993, pp 31\-40, Humana Press, Totowa NJ)\&. Default value: 9\&.0
+The maximum stability for the five 3\*(Aq bases of a forward or reverse primer\&. Bigger numbers mean more stable 3\*(Aq ends\&. The value is the maximum delta G for duplex disruption for the five 3\*(Aq bases as calculated using the nearest neighbor parameters published in Breslauer, Frank, Bloecker and Marky, Proc\&. Natl\&. Acad\&. Sci\&. USA, vol 83, pp 3746\-3750\&. EPrimer3 uses a completely permissive default value for backward compatibility (which we may change in the next release)\&. Rychlik recommends a maximum value of 9 (Wojciech Rychlik, \*(AqSelection of Primers for Polymerase Chain Reaction\*(Aq in BA White, Ed\&., \*(AqMethods in Molecular Biology, Vol\&. 15: PCR Protocols: Current Methods and Applications\*(Aq, 1993, pp 31\-40, Humana Press, Totowa NJ)\&. Default value: 9\&.0
.RE
.SS "Output section"
.PP
diff --git a/debian/manpages/equicktandem.1e b/debian/manpages/equicktandem.1e
index 80ee477..b0a6806 100644
--- a/debian/manpages/equicktandem.1e
+++ b/debian/manpages/equicktandem.1e
@@ -2,12 +2,21 @@
.\" Title: EQUICKTANDEM
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "EQUICKTANDEM" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "EQUICKTANDEM" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/est2genome.1e b/debian/manpages/est2genome.1e
index 3ab4596..32ad0a2 100644
--- a/debian/manpages/est2genome.1e
+++ b/debian/manpages/est2genome.1e
@@ -2,12 +2,21 @@
.\" Title: EST2GENOME
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "EST2GENOME" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "EST2GENOME" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -84,7 +93,7 @@ Use donor and acceptor splice sites\&. If you want to ignore donor\-acceptor sit
.PP
\fB\-mode\fR \fIlist\fR
.RS 4
-This determines the comparison mode\&. The default value is \'both\', in which case both strands of the est are compared assuming a forward gene direction (ie GT/AG splice sites), and the best comparison redone assuming a reversed (CT/AC) gene splicing direction\&. The other allowed modes are \'forward\', when just the forward strand is searched, and \'reverse\', ditto for the reverse strand\&. Default value: both
+This determines the comparison mode\&. The default value is \*(Aqboth\*(Aq, in which case both strands of the est are compared assuming a forward gene direction (ie GT/AG splice sites), and the best comparison redone assuming a reversed (CT/AC) gene splicing direction\&. The other allowed modes are \*(Aqforward\*(Aq, when just the forward strand is searched, and \*(Aqreverse\*(Aq, ditto for the reverse strand\&. Default value: both
.RE
.PP
\fB\-best\fR \fIboolean\fR
@@ -94,7 +103,7 @@ You can print out all comparisons instead of just the best one by setting this t
.PP
\fB\-space\fR \fIfloat\fR
.RS 4
-For linear\-space recursion\&. If product of sequence lengths divided by 4 exceeds this then a divide\-and\-conquer strategy is used to control the memory requirements\&. In this way very long sequences can be aligned\&. If you have a machine with plenty of memory you can raise this parameter (but do not exceed the machine\'s physical RAM) Default value: 10\&.0
+For linear\-space recursion\&. If product of sequence lengths divided by 4 exceeds this then a divide\-and\-conquer strategy is used to control the memory requirements\&. In this way very long sequences can be aligned\&. If you have a machine with plenty of memory you can raise this parameter (but do not exceed the machine\*(Aqs physical RAM) Default value: 10\&.0
.RE
.PP
\fB\-shuffle\fR \fIinteger\fR
diff --git a/debian/manpages/etandem.1e b/debian/manpages/etandem.1e
index f945f4b..e3f6454 100644
--- a/debian/manpages/etandem.1e
+++ b/debian/manpages/etandem.1e
@@ -2,12 +2,21 @@
.\" Title: ETANDEM
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "ETANDEM" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "ETANDEM" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/extractalign.1e b/debian/manpages/extractalign.1e
index c4fae80..8501fe6 100644
--- a/debian/manpages/extractalign.1e
+++ b/debian/manpages/extractalign.1e
@@ -2,12 +2,21 @@
.\" Title: EXTRACTALIGN
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "EXTRACTALIGN" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "EXTRACTALIGN" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/extractfeat.1e b/debian/manpages/extractfeat.1e
index fe2bd84..988e5dc 100644
--- a/debian/manpages/extractfeat.1e
+++ b/debian/manpages/extractfeat.1e
@@ -2,12 +2,21 @@
.\" Title: EXTRACTFEAT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "EXTRACTFEAT" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "EXTRACTFEAT" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -39,22 +48,22 @@ is a command line program from EMBOSS (\(lqthe European Molecular Biology Open S
.PP
\fB\-before\fR \fIinteger\fR
.RS 4
-If this value is greater than 0 then that number of bases or residues before the feature are included in the extracted sequence\&. This allows you to get the context of the feature\&. If this value is negative then the start of the extracted sequence will be this number of bases/residues before the end of the feature\&. So a value of \'10\' will start the extraction 10 bases/residues before the start of the sequence, and a value of \'\-10\' will start the extraction 10 bases/residues before the end of the feature\&. The output sequence will be padded with \'N\' or \'X\' characters if the sequence starts after the required start of the extraction\&.
+If this value is greater than 0 then that number of bases or residues before the feature are included in the extracted sequence\&. This allows you to get the context of the feature\&. If this value is negative then the start of the extracted sequence will be this number of bases/residues before the end of the feature\&. So a value of \*(Aq10\*(Aq will start the extraction 10 bases/residues before the start of the sequence, and a value of \*(Aq\-10\*(Aq will start the extraction 10 bases/residues before the end of the feature\&. The output sequence will be padded with \*(AqN\*(Aq or \*(AqX\*(Aq characters if the sequence starts after the required start of the extraction\&.
.RE
.PP
\fB\-after\fR \fIinteger\fR
.RS 4
-If this value is greater than 0 then that number of bases or residues after the feature are included in the extracted sequence\&. This allows you to get the context of the feature\&. If this value is negative then the end of the extracted sequence will be this number of bases/residues after the start of the feature\&. So a value of \'10\' will end the extraction 10 bases/residues after the end of the sequence, and a value of \'\-10\' will end the extraction 10 bases/residues after the start of the feature\&. The output sequence will be padded with \'N\' or \'X\' characters if the sequence ends before the required end of the extraction\&.
+If this value is greater than 0 then that number of bases or residues after the feature are included in the extracted sequence\&. This allows you to get the context of the feature\&. If this value is negative then the end of the extracted sequence will be this number of bases/residues after the start of the feature\&. So a value of \*(Aq10\*(Aq will end the extraction 10 bases/residues after the end of the sequence, and a value of \*(Aq\-10\*(Aq will end the extraction 10 bases/residues after the start of the feature\&. The output sequence will be padded with \*(AqN\*(Aq or \*(AqX\*(Aq characters if the sequence ends before the required end of the extraction\&.
.RE
.PP
\fB\-source\fR \fIstring\fR
.RS 4
-By default any feature source in the feature table is shown\&. You can set this to match any feature source you wish to show\&. The source name is usually either the name of the program that detected the feature or it is the feature table (eg: EMBL) that the feature came from\&. The source may be wildcarded by using \'*\'\&. If you wish to show more than one source, separate their names with the character \'|\', eg: gene* | embl Default value: *
+By default any feature source in the feature table is shown\&. You can set this to match any feature source you wish to show\&. The source name is usually either the name of the program that detected the feature or it is the feature table (eg: EMBL) that the feature came from\&. The source may be wildcarded by using \*(Aq*\*(Aq\&. If you wish to show more than one source, separate their names with the character \*(Aq|\*(Aq, eg: gene* | embl Default value: *
.RE
.PP
\fB\-type\fR \fIstring\fR
.RS 4
-By default every feature in the feature table is extracted\&. You can set this to be any feature type you wish to extract\&. See http://www\&.ebi\&.ac\&.uk/Services/WebFeat/ for a list of the EMBL feature types and see the Uniprot user manual in http://www\&.uniprot\&.org/manual/sequence_annotation for a list of the Uniprot feature types\&. The type may be wildcarded by using \'*\'\&. If you wish to extract more than one type, separate their names with the character \'|\', eg: *UTR | intron Default value: *
+By default every feature in the feature table is extracted\&. You can set this to be any feature type you wish to extract\&. See http://www\&.ebi\&.ac\&.uk/embl/WebFeat/ for a list of the EMBL feature types and see the Uniprot user manual in http://www\&.uniprot\&.org/manual/sequence_annotation for a list of the Uniprot feature types\&. The type may be wildcarded by using \*(Aq*\*(Aq\&. If you wish to extract more than one type, separate their names with the character \*(Aq|\*(Aq, eg: *UTR | intron Default value: *
.RE
.PP
\fB\-sense\fR \fIinteger\fR
@@ -74,18 +83,18 @@ Maximum score of feature to extract\&. If both minscore and maxscore are zero (t
.PP
\fB\-tag\fR \fIstring\fR
.RS 4
-Tags are the types of extra values that a feature may have\&. For example in the EMBL feature table, a \'CDS\' type of feature may have the tags \'/codon\', \'/codon_start\', \'/db_xref\', \'/EC_number\', \'/evidence\', \'/exception\', \'/function\', \'/gene\', \'/label\', \'/map\', \'/note\', \'/number\', \'/partial\', \'/product\', \'/protein_id\', \'/pseudo\', \'/standard_name\', \'/translation\', \'/transl_except\', \'/transl_table\', or \'/usedin\'\&. Some of these tags also have values, for example \'/gene\' can have the value of the gene name\&. By default any feature tag in the feature table is extracted\&. You can set this to match any feature tag you wish to show\&. The tag may be wildcarded by using \'*\'\&. If you wish to extract more than one tag, separate their names with the character \'|\', eg: gene | label Default value: *
+Tags are the types of extra values that a feature may have\&. For example in the EMBL feature table, a \*(AqCDS\*(Aq type of feature may have the tags \*(Aq/codon\*(Aq, \*(Aq/codon_start\*(Aq, \*(Aq/db_xref\*(Aq, \*(Aq/EC_number\*(Aq, \*(Aq/evidence\*(Aq, \*(Aq/exception\*(Aq, \*(Aq/function\*(Aq, \*(Aq/gene\*(Aq, \*(Aq/label\*(Aq, \*(Aq/map\*(Aq, \*(Aq/note\*(Aq, \*(Aq/number\*(Aq, \*(Aq/partial\*(Aq, \*(Aq/product\*(Aq, \*(Aq/protein_id\*(Aq, \*(Aq/pseudo\*(Aq, \*(Aq/standard_name\*(Aq, \*(Aq/translation\*(Aq, \*(Aq/transl_except\*(Aq, \*(Aq/transl_table\*(Aq, or \*(Aq/usedin\*(Aq\&. Some of these tags also have values, for example \*(Aq/gene\*(Aq can have the value of the gene name\&. By default any feature tag in the feature table is extracted\&. You can set this to match any feature tag you wish to show\&. The tag may be wildcarded by using \*(Aq*\*(Aq\&. If you wish to extract more than one tag, separate their names with the character \*(Aq|\*(Aq, eg: gene | label Default value: *
.RE
.PP
\fB\-value\fR \fIstring\fR
.RS 4
-Tag values are the values associated with a feature tag\&. Tags are the types of extra values that a feature may have\&. For example in the EMBL feature table, a \'CDS\' type of feature may have the tags \'/codon\', \'/codon_start\', \'/db_xref\', \'/EC_number\', \'/evidence\', \'/exception\', \'/function\', \'/gene\', \'/label\', \'/map\', \'/note\', \'/number\', \'/partial\', \'/product\', \'/protein_id\', \'/pseudo\', \'/standard_name\', \'/translation\', \'/transl_except\', \'/transl_table\', or \'/usedin\'\&. Only some of these tags can have values, for example \'/gene\' can have the value of the gene name\&. By default any feature tag value in the feature table is shown\&. You can set this to match any feature tag value you wish to show\&. The tag value may be wildcarded by using \'*\'\&. If you wish to show more than one tag value, separate their names with a space or the character \'|\', eg: pax* | 10 Default value: *
+Tag values are the values associated with a feature tag\&. Tags are the types of extra values that a feature may have\&. For example in the EMBL feature table, a \*(AqCDS\*(Aq type of feature may have the tags \*(Aq/codon\*(Aq, \*(Aq/codon_start\*(Aq, \*(Aq/db_xref\*(Aq, \*(Aq/EC_number\*(Aq, \*(Aq/evidence\*(Aq, \*(Aq/exception\*(Aq, \*(Aq/function\*(Aq, \*(Aq/gene\*(Aq, \*(Aq/label\*(Aq, \*(Aq/map\*(Aq, \*(Aq/note\*(Aq, \*(Aq/number\*(Aq, \*(Aq/partial\*(Aq, \*(Aq/product\*(Aq, \*(Aq/protein_id\*(Aq, \*(Aq/pseudo\*(Aq, \*(Aq/standard_name\*(Aq, \*(Aq/translation\*(Aq, \*(Aq/transl_except\*(Aq, \*(Aq/transl_table\*(Aq, or \*(Aq/usedin\*(Aq\&. Only some of these tags can have values, for example \*(Aq/gene\*(Aq can have the value of the gene name\&. By default any feature tag value in the feature table is shown\&. You can set this to match any feature tag value you wish to show\&. The tag value may be wildcarded by using \*(Aq*\*(Aq\&. If you wish to show more than one tag value, separate their names with a space or the character \*(Aq|\*(Aq, eg: pax* | 10 Default value: *
.RE
.SS "Output section"
.PP
\fB\-join\fR \fIboolean\fR
.RS 4
-Some features, such as CDS (coding sequence) and mRNA are composed of introns concatenated together\&. There may be other forms of \'joined\' sequence, depending on the feature table\&. If this option is set TRUE, then any group of these features will be output as a single sequence\&. If the \'before\' and \'after\' qualifiers have been set, then only the sequence before the first feature and after the last feature are added\&. Default value: N
+Some features, such as CDS (coding sequence) and mRNA are composed of introns concatenated together\&. There may be other forms of \*(Aqjoined\*(Aq sequence, depending on the feature table\&. If this option is set TRUE, then any group of these features will be output as a single sequence\&. If the \*(Aqbefore\*(Aq and \*(Aqafter\*(Aq qualifiers have been set, then only the sequence before the first feature and after the last feature are added\&. Default value: N
.RE
.PP
\fB\-featinname\fR \fIboolean\fR
@@ -95,7 +104,7 @@ To aid you in identifying the type of feature that has been output, the type of
.PP
\fB\-describe\fR \fIstring\fR
.RS 4
-To aid you in identifying some further properties of a feature that has been output, this lets you specify one or more tag names that should be added to the output sequence Description text, together with their values (if any)\&. For example, if this is set to be \'gene\', then if any output feature has the tag (for example) \'/gene=BRCA1\' associated with it, then the text \'(gene=BRCA1)\' will be added to the Description line\&. Tags are the types of extra values that a feature may have\&. For example in the EMBL feature table, a \'CDS\' type of feature may have the tags \'/codon\', \'/codon_start\', \'/db_xref\', \'/EC_number\', \'/evidence\', \'/exception\', \'/function\', \'/gene\', \'/label\', \'/map\', \'/note\', \'/number\', \'/partial\', \'/product\', \'/protein_id\', \'/pseudo\', \'/standard_name\', \'/translation\', \'/transl_except\', \'/transl_table\', or \'/usedin\'\&. Some of these tags also have values, for example \'/gene\' can have the value of the gene name\&. By default no feature tag is displayed\&. You can set this to match any feature tag you wish to show\&. The tag may be wildcarded by using \'*\'\&. If you wish to extract more than one tag, separate their names with the character \'|\', eg: gene | label
+To aid you in identifying some further properties of a feature that has been output, this lets you specify one or more tag names that should be added to the output sequence Description text, together with their values (if any)\&. For example, if this is set to be \*(Aqgene\*(Aq, then if any output feature has the tag (for example) \*(Aq/gene=BRCA1\*(Aq associated with it, then the text \*(Aq(gene=BRCA1)\*(Aq will be added to the Description line\&. Tags are the types of extra values that a feature may have\&. For example in the EMBL feature table, a \*(AqCDS\*(Aq type of feature may have the tags \*(Aq/codon\*(Aq, \*(Aq/codon_start\*(Aq, \*(Aq/db_xref\*(Aq, \*(Aq/EC_number\*(Aq, \*(Aq/evidence\*(Aq, \*(Aq/exception\*(Aq, \*(Aq/function\*(Aq, \*(Aq/gene\*(Aq, \*(Aq/label\*(Aq, \*(Aq/map\*(Aq, \*(Aq/note\*(Aq, \*(Aq/number\*(Aq, \*(Aq/partial\*(Aq, \*(Aq/product\*(Aq, \*(Aq/protein_id\*(Aq, \*(Aq/pseudo\*(Aq, \*(Aq/standard_name\*(Aq, \*(Aq/translation\*(Aq, \*(Aq/transl_except\*(Aq, \*(Aq/transl_table\*(Aq, or \*(Aq/usedin\*(Aq\&. Some of these tags also have values, for example \*(Aq/gene\*(Aq can have the value of the gene name\&. By default no feature tag is displayed\&. You can set this to match any feature tag you wish to show\&. The tag may be wildcarded by using \*(Aq*\*(Aq\&. If you wish to extract more than one tag, separate their names with the character \*(Aq|\*(Aq, eg: gene | label
.RE
.PP
\fB\-outseq\fR \fIseqout\fR
diff --git a/debian/manpages/extractseq.1e b/debian/manpages/extractseq.1e
index 6373c49..de3bd50 100644
--- a/debian/manpages/extractseq.1e
+++ b/debian/manpages/extractseq.1e
@@ -2,12 +2,21 @@
.\" Title: EXTRACTSEQ
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "EXTRACTSEQ" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "EXTRACTSEQ" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/featcopy.1e b/debian/manpages/featcopy.1e
index 1418149..c9594c8 100644
--- a/debian/manpages/featcopy.1e
+++ b/debian/manpages/featcopy.1e
@@ -2,12 +2,21 @@
.\" Title: FEATCOPY
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "FEATCOPY" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "FEATCOPY" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/featreport.1e b/debian/manpages/featreport.1e
index b8ebd23..04aad6d 100644
--- a/debian/manpages/featreport.1e
+++ b/debian/manpages/featreport.1e
@@ -2,12 +2,21 @@
.\" Title: FEATREPORT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "FEATREPORT" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "FEATREPORT" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/finddb.1e b/debian/manpages/finddb.1e
index 017dda4..5b650e3 100644
--- a/debian/manpages/finddb.1e
+++ b/debian/manpages/finddb.1e
@@ -2,12 +2,21 @@
.\" Title: FINDDB
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "FINDDB" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "FINDDB" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/findkm.1e b/debian/manpages/findkm.1e
index 2ee146a..a2efde8 100644
--- a/debian/manpages/findkm.1e
+++ b/debian/manpages/findkm.1e
@@ -2,12 +2,21 @@
.\" Title: FINDKM
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "FINDKM" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "FINDKM" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/freak.1e b/debian/manpages/freak.1e
index a9b1dd6..10e36e7 100644
--- a/debian/manpages/freak.1e
+++ b/debian/manpages/freak.1e
@@ -2,12 +2,21 @@
.\" Title: FREAK
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "FREAK" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "FREAK" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/fuzznuc.1e b/debian/manpages/fuzznuc.1e
index d182259..ee32585 100644
--- a/debian/manpages/fuzznuc.1e
+++ b/debian/manpages/fuzznuc.1e
@@ -2,12 +2,21 @@
.\" Title: FUZZNUC
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "FUZZNUC" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "FUZZNUC" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -38,7 +47,7 @@ is a command line program from EMBOSS (\(lqthe European Molecular Biology Open S
.PP
\fB\-pattern\fR \fIpattern\fR
.RS 4
-The standard IUPAC one\-letter codes for the nucleotides are used\&. The symbol \'n\' is used for a position where any nucleotide is accepted\&. Ambiguities are indicated by listing the acceptable nucleotides for a given position, between square parentheses \'[ ]\'\&. For example: [ACG] stands for A or C or G\&. Ambiguities are also indicated by listing between a pair of curly brackets \'{ }\' the nucleotides that are not accepted at a given position\&. For example: {AG} stands for any nucleotides except A and G\&. Each element in a pattern is separated from its neighbor by a \'\-\'\&. (Optional in fuzznuc)\&. Repetition of an element of the pattern can be indicated by following that element with a numerical value or a numerical range between parenthesis\&. Examples: N(3) corresponds to N\-N\-N, N(2,4) corresponds to N\-N or N\-N\-N or N\-N\-N\-N\&. When a pattern is restricted to either the 5\' or 3\' end of a sequence, that pattern either starts with a \'<\' symbol or respectively ends with a \'>\' symbol\&. A period ends the pattern\&. (Optional in fuzznuc)\&. For example, [CG](5)TG{A}N(1,5)C
+The standard IUPAC one\-letter codes for the nucleotides are used\&. The symbol \*(Aqn\*(Aq is used for a position where any nucleotide is accepted\&. Ambiguities are indicated by listing the acceptable nucleotides for a given position, between square parentheses \*(Aq[ ]\*(Aq\&. For example: [ACG] stands for A or C or G\&. Ambiguities are also indicated by listing between a pair of curly brackets \*(Aq{ }\*(Aq the nucleotides that are not accepted at a given position\&. For example: {AG} stands for any nucleotides except A and G\&. Each element in a pattern is separated from its neighbor by a \*(Aq\-\*(Aq\&. (Optional in fuzznuc)\&. Repetition of an element of the pattern can be indicated by following that element with a numerical value or a numerical range between parenthesis\&. Examples: N(3) corresponds to N\-N\-N, N(2,4) corresponds to N\-N or N\-N\-N or N\-N\-N\-N\&. When a pattern is restricted to either the 5\*(Aq or 3\*(Aq end of a sequence, that pattern either starts with a \*(Aq<\*(Aq symbol or respectively ends with a \*(Aq>\*(Aq symbol\&. A period ends the pattern\&. (Optional in fuzznuc)\&. For example, [CG](5)TG{A}N(1,5)C
.RE
.SS "Advanced section"
.PP
diff --git a/debian/manpages/fuzzpro.1e b/debian/manpages/fuzzpro.1e
index fbeeaa1..5fdafda 100644
--- a/debian/manpages/fuzzpro.1e
+++ b/debian/manpages/fuzzpro.1e
@@ -2,12 +2,21 @@
.\" Title: FUZZPRO
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "FUZZPRO" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "FUZZPRO" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -38,7 +47,7 @@ is a command line program from EMBOSS (\(lqthe European Molecular Biology Open S
.PP
\fB\-pattern\fR \fIpattern\fR
.RS 4
-The standard IUPAC one\-letter codes for the amino acids are used\&. The symbol \'x\' is used for a position where any amino acid is accepted\&. Ambiguities are indicated by listing the acceptable amino acids for a given position, between square parentheses \'[ ]\'\&. For example: [ALT] stands for Ala or Leu or Thr\&. Ambiguities are also indicated by listing between a pair of curly brackets \'{ }\' the amino acids that are not accepted at a given position\&. For example: {AM} stands for any amino acid except Ala and Met\&. Each element in a pattern is separated from its neighbor by a \'\-\'\&. (Optional in fuzzpro)\&. Repetition of an element of the pattern can be indicated by following that element with a numerical value or a numerical range between parenthesis\&. Examples: x(3) corresponds to x\-x\-x, x(2,4) corresponds to x\-x or x\-x\-x or x\-x\-x\-x\&. When a pattern is restricted to either the N\- or C\-terminal of a sequence, that pattern either starts with a \'<\' symbol or respectively ends with a \'>\' symbol\&. A period ends the pattern\&. (Optional in fuzzpro)\&. For example, [DE](2)HS{P}X(2)PX(2,4)C
+The standard IUPAC one\-letter codes for the amino acids are used\&. The symbol \*(Aqx\*(Aq is used for a position where any amino acid is accepted\&. Ambiguities are indicated by listing the acceptable amino acids for a given position, between square parentheses \*(Aq[ ]\*(Aq\&. For example: [ALT] stands for Ala or Leu or Thr\&. Ambiguities are also indicated by listing between a pair of curly brackets \*(Aq{ }\*(Aq the amino acids that are not accepted at a given position\&. For example: {AM} stands for any amino acid except Ala and Met\&. Each element in a pattern is separated from its neighbor by a \*(Aq\-\*(Aq\&. (Optional in fuzzpro)\&. Repetition of an element of the pattern can be indicated by following that element with a numerical value or a numerical range between parenthesis\&. Examples: x(3) corresponds to x\-x\-x, x(2,4) corresponds to x\-x or x\-x\-x or x\-x\-x\-x\&. When a pattern is restricted to either the N\- or C\-terminal of a sequence, that pattern either starts with a \*(Aq<\*(Aq symbol or respectively ends with a \*(Aq>\*(Aq symbol\&. A period ends the pattern\&. (Optional in fuzzpro)\&. For example, [DE](2)HS{P}X(2)PX(2,4)C
.RE
.SS "Output section"
.PP
diff --git a/debian/manpages/fuzztran.1e b/debian/manpages/fuzztran.1e
index 70a2408..f880968 100644
--- a/debian/manpages/fuzztran.1e
+++ b/debian/manpages/fuzztran.1e
@@ -2,12 +2,21 @@
.\" Title: FUZZTRAN
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "FUZZTRAN" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "FUZZTRAN" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -38,7 +47,7 @@ is a command line program from EMBOSS (\(lqthe European Molecular Biology Open S
.PP
\fB\-pattern\fR \fIpattern\fR
.RS 4
-The standard IUPAC one\-letter codes for the amino acids are used\&. The symbol \'x\' is used for a position where any amino acid is accepted\&. Ambiguities are indicated by listing the acceptable amino acids for a given position, between square parentheses \'[ ]\'\&. For example: [ALT] stands for Ala or Leu or Thr\&. Ambiguities are also indicated by listing between a pair of curly brackets \'{ }\' the amino acids that are not accepted at a gven position\&. For example: {AM} stands for any amino acid except Ala and Met\&. Each element in a pattern is separated from its neighbor by a \'\-\'\&. (Optional in fuzztran) Repetition of an element of the pattern can be indicated by following that element with a numerical value or a numerical range between parenthesis\&. Examples: x(3) corresponds to x\-x\-x, x(2,4) corresponds to x\-x or x\-x\-x or x\-x\-x\-x\&. When a pattern is restricted to either the N\- or C\-terminal of a sequence, that pattern either starts with a \'<\' symbol or respectively ends with a \'>\' symbol\&. A period ends the pattern\&. (Optional in fuzztran)\&. For example, [DE](2)HS{P}X(2)PX(2,4)C
+The standard IUPAC one\-letter codes for the amino acids are used\&. The symbol \*(Aqx\*(Aq is used for a position where any amino acid is accepted\&. Ambiguities are indicated by listing the acceptable amino acids for a given position, between square parentheses \*(Aq[ ]\*(Aq\&. For example: [ALT] stands for Ala or Leu or Thr\&. Ambiguities are also indicated by listing between a pair of curly brackets \*(Aq{ }\*(Aq the amino acids that are not accepted at a gven position\&. For example: {AM} stands for any amino acid except Ala and Met\&. Each element in a pattern is separated from its neighbor by a \*(Aq\-\*(Aq\&. (Optional in fuzztran) Repetition of an element of the pattern can be indicated by following that element with a numerical value or a numerical range between parenthesis\&. Examples: x(3) corresponds to x\-x\-x, x(2,4) corresponds to x\-x or x\-x\-x or x\-x\-x\-x\&. When a pattern is restricted to either the N\- or C\-terminal of a sequence, that pattern either starts with a \*(Aq<\*(Aq symbol or respectively ends with a \*(Aq>\*(Aq symbol\&. A period ends the pattern\&. (Optional in fuzztran)\&. For example, [DE](2)HS{P}X(2)PX(2,4)C
.RE
.SS "Additional section"
.PP
diff --git a/debian/manpages/garnier.1e b/debian/manpages/garnier.1e
index f670c58..3553ada 100644
--- a/debian/manpages/garnier.1e
+++ b/debian/manpages/garnier.1e
@@ -2,12 +2,21 @@
.\" Title: GARNIER
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "GARNIER" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "GARNIER" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -39,7 +48,7 @@ is a command line program from EMBOSS (\(lqthe European Molecular Biology Open S
.PP
\fB\-idc\fR \fIinteger\fR
.RS 4
-In their paper, GOR mention that if you know something about the secondary structure content of the protein you are analyzing, you can do better in prediction\&. \'idc\' is an index into a set of arrays, dharr[] and dsarr[], which provide \'decision constants\' (dch, dcs), which are offsets that are applied to the weights for the helix and sheet (extend) terms\&. So, idc=0 says don\'t use the decision constant offsets, and idc=1 to 6 indicates that various combinations of dch,dcs offsets should be used\&.
+In their paper, GOR mention that if you know something about the secondary structure content of the protein you are analyzing, you can do better in prediction\&. \*(Aqidc\*(Aq is an index into a set of arrays, dharr[] and dsarr[], which provide \*(Aqdecision constants\*(Aq (dch, dcs), which are offsets that are applied to the weights for the helix and sheet (extend) terms\&. So, idc=0 says don\*(Aqt use the decision constant offsets, and idc=1 to 6 indicates that various combinations of dch,dcs offsets should be used\&.
.RE
.SS "Output section"
.PP
diff --git a/debian/manpages/geecee.1e b/debian/manpages/geecee.1e
index bd22ef1..1096c87 100644
--- a/debian/manpages/geecee.1e
+++ b/debian/manpages/geecee.1e
@@ -2,12 +2,21 @@
.\" Title: GEECEE
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "GEECEE" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "GEECEE" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/getorf.1e b/debian/manpages/getorf.1e
index fbe32f6..721fd79 100644
--- a/debian/manpages/getorf.1e
+++ b/debian/manpages/getorf.1e
@@ -2,12 +2,21 @@
.\" Title: GETORF
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "GETORF" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "GETORF" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/helixturnhelix.1e b/debian/manpages/helixturnhelix.1e
index 228a2bd..ebc2052 100644
--- a/debian/manpages/helixturnhelix.1e
+++ b/debian/manpages/helixturnhelix.1e
@@ -2,12 +2,21 @@
.\" Title: HELIXTURNHELIX
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "HELIXTURNHELIX" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "HELIXTURNHELIX" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/histogramtest.1e b/debian/manpages/histogramtest.1e
index 3e55994..f9aa6bd 100644
--- a/debian/manpages/histogramtest.1e
+++ b/debian/manpages/histogramtest.1e
@@ -2,12 +2,21 @@
.\" Title: HISTOGRAMTEST
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "HISTOGRAMTEST" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "HISTOGRAMTEST" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/hmoment.1e b/debian/manpages/hmoment.1e
index 9e98631..e255700 100644
--- a/debian/manpages/hmoment.1e
+++ b/debian/manpages/hmoment.1e
@@ -2,12 +2,21 @@
.\" Title: HMOMENT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "HMOMENT" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "HMOMENT" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/idtell.1e b/debian/manpages/idtell.1e
index 1c533e4..41c7576 100644
--- a/debian/manpages/idtell.1e
+++ b/debian/manpages/idtell.1e
@@ -2,12 +2,21 @@
.\" Title: IDTELL
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "IDTELL" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "IDTELL" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -19,7 +28,7 @@
.\" * MAIN CONTENT STARTS HERE *
.\" -----------------------------------------------------------------
.SH "NAME"
-idtell \- Identify the type of a data identifier / query term
+idtell \- Identify the type of a data identifier or query term
.SH "SYNOPSIS"
.HP \w'\fBidtell\fR\ 'u
\fBidtell\fR [\fB\-identifier\ \fR\fB\fIstring\fR\fR] \fB\-dbref\ \fR\fB\fIdatafile\fR\fR
diff --git a/debian/manpages/iep.1e b/debian/manpages/iep.1e
index 2eaaa59..debb5c9 100644
--- a/debian/manpages/iep.1e
+++ b/debian/manpages/iep.1e
@@ -2,12 +2,21 @@
.\" Title: IEP
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "IEP" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "IEP" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/infoalign.1e b/debian/manpages/infoalign.1e
index 992e045..c1b9474 100644
--- a/debian/manpages/infoalign.1e
+++ b/debian/manpages/infoalign.1e
@@ -2,12 +2,21 @@
.\" Title: INFOALIGN
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "INFOALIGN" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "INFOALIGN" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -39,7 +48,7 @@ The sequence alignment to be displayed\&.
.PP
\fB\-matrix\fR \fImatrix\fR
.RS 4
-This is the scoring matrix file used when comparing sequences\&. By default it is the file \'EBLOSUM62\' (for proteins) or the file \'EDNAFULL\' (for nucleic sequences)\&. These files are found in the \'data\' directory of the EMBOSS installation\&.
+This is the scoring matrix file used when comparing sequences\&. By default it is the file \*(AqEBLOSUM62\*(Aq (for proteins) or the file \*(AqEDNAFULL\*(Aq (for nucleic sequences)\&. These files are found in the \*(Aqdata\*(Aq directory of the EMBOSS installation\&.
.RE
.PP
\fB\-refseq\fR \fIstring\fR
@@ -71,7 +80,7 @@ Default value: N
.PP
\fB\-only\fR \fIboolean\fR
.RS 4
-This is a way of shortening the command line if you only want a few things to be displayed\&. Instead of specifying: \'\-nohead \-nousa \-noname \-noalign \-nogaps \-nogapcount \-nosimcount \-noidcount \-nodiffcount \-noweight\' to get only the sequence length output, you can specify \'\-only \-seqlength\' Default value: N
+This is a way of shortening the command line if you only want a few things to be displayed\&. Instead of specifying: \*(Aq\-nohead \-nousa \-noname \-noalign \-nogaps \-nogapcount \-nosimcount \-noidcount \-nodiffcount \-noweight\*(Aq to get only the sequence length output, you can specify \*(Aq\-only \-seqlength\*(Aq Default value: N
.RE
.PP
\fB\-heading\fR \fIboolean\fR
diff --git a/debian/manpages/infobase.1e b/debian/manpages/infobase.1e
index f1ea8c5..2a49354 100644
--- a/debian/manpages/infobase.1e
+++ b/debian/manpages/infobase.1e
@@ -2,12 +2,21 @@
.\" Title: INFOBASE
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "INFOBASE" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "INFOBASE" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/inforesidue.1e b/debian/manpages/inforesidue.1e
index d85987c..fba9fc1 100644
--- a/debian/manpages/inforesidue.1e
+++ b/debian/manpages/inforesidue.1e
@@ -2,12 +2,21 @@
.\" Title: INFORESIDUE
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "INFORESIDUE" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "INFORESIDUE" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/infoseq.1e b/debian/manpages/infoseq.1e
index 9ee0215..19c9e3d 100644
--- a/debian/manpages/infoseq.1e
+++ b/debian/manpages/infoseq.1e
@@ -2,12 +2,21 @@
.\" Title: INFOSEQ
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "INFOSEQ" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "INFOSEQ" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -22,7 +31,7 @@
infoseq \- Display basic information about sequences
.SH "SYNOPSIS"
.HP \w'\fBinfoseq\fR\ 'u
-\fBinfoseq\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-columns\ \fR\fB\fIboolean\fR\fR \fB\-delimiter\ \fR\fB\fIstring\fR\fR [\fB\-outfile\ \fR\fB\fIoutfile\fR\fR] [\fB\-html\ \fR\fB\fIboolean\fR\fR] \fB\-only\ \fR\fB\fIboolean\fR\fR \fB\-heading\ \fR\fB\fIboolean\fR\fR \fB\-usa\ \fR\fB\fIboolean\fR\fR \fB\-database\ \fR\fB\fIboolean\fR\fR \fB\-name\ \fR\fB\fIboolean\fR\fR \fB\-accession\ \fR\fB\fIboolean\fR\fR \fB\-gi\ \fR\fB\fIboolean\fR\fR \fB\-seqversion\ \fR\fB\fIboolean\fR\fR \fB\-type\ \fR\fB\fIboolean\fR\fR \fB\-length\ \fR\fB\fIboolean\fR\fR \fB\-pgc\ \fR\fB\fIboolean\fR\fR \fB\-description\ \fR\fB\fIboolean\fR\fR
+\fBinfoseq\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-columns\ \fR\fB\fIboolean\fR\fR \fB\-delimiter\ \fR\fB\fIstring\fR\fR [\fB\-outfile\ \fR\fB\fIoutfile\fR\fR] [\fB\-html\ \fR\fB\fIboolean\fR\fR] \fB\-only\ \fR\fB\fIboolean\fR\fR \fB\-heading\ \fR\fB\fIboolean\fR\fR \fB\-usa\ \fR\fB\fIboolean\fR\fR \fB\-database\ \fR\fB\fIboolean\fR\fR \fB\-name\ \fR\fB\fIboolean\fR\fR \fB\-accession\ \fR\fB\fIboolean\fR\fR \fB\-gi\ \fR\fB\fIboolean\fR\fR \fB\-seqversion\ \fR\fB\fIboolean\fR\fR \fB\-type\ \fR\fB\fIboolean\fR\fR \fB\-length\ \fR\fB\fIboolean\fR\fR \fB\-pgc\ \fR\fB\fIboolean\fR\fR \fB\-organism\ \fR\fB\fIboolean\fR\fR \fB\-description\ \fR\fB\fIboolean\fR\fR
.HP \w'\fBinfoseq\fR\ 'u
\fBinfoseq\fR \fB\-help\fR
.SH "DESCRIPTION"
@@ -60,7 +69,7 @@ Default value: N
.PP
\fB\-only\fR \fIboolean\fR
.RS 4
-This is a way of shortening the command line if you only want a few things to be displayed\&. Instead of specifying: \'\-nohead \-noname \-noacc \-notype \-nopgc \-nodesc\' to get only the length output, you can specify \'\-only \-length\' Default value: N
+This is a way of shortening the command line if you only want a few things to be displayed\&. Instead of specifying: \*(Aq\-nohead \-noname \-noacc \-notype \-nopgc \-nodesc\*(Aq to get only the length output, you can specify \*(Aq\-only \-length\*(Aq Default value: N
.RE
.PP
\fB\-heading\fR \fIboolean\fR
@@ -113,6 +122,11 @@ Default value: @(!$(only))
Default value: @(!$(only))
.RE
.PP
+\fB\-organism\fR \fIboolean\fR
+.RS 4
+Default value: @(!$(only))
+.RE
+.PP
\fB\-description\fR \fIboolean\fR
.RS 4
Default value: @(!$(only))
diff --git a/debian/manpages/intconv.1e b/debian/manpages/intconv.1e
index e9347ab..8f2acf8 100644
--- a/debian/manpages/intconv.1e
+++ b/debian/manpages/intconv.1e
@@ -2,12 +2,21 @@
.\" Title: INTCONV
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "INTCONV" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "INTCONV" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/isochore.1e b/debian/manpages/isochore.1e
index e30244f..d143efc 100644
--- a/debian/manpages/isochore.1e
+++ b/debian/manpages/isochore.1e
@@ -2,12 +2,21 @@
.\" Title: ISOCHORE
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "ISOCHORE" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "ISOCHORE" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/jaspextract.1e b/debian/manpages/jaspextract.1e
index 535bd41..ffaf8dc 100644
--- a/debian/manpages/jaspextract.1e
+++ b/debian/manpages/jaspextract.1e
@@ -2,12 +2,21 @@
.\" Title: JASPEXTRACT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "JASPEXTRACT" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "JASPEXTRACT" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -34,7 +43,7 @@ is a command line program from EMBOSS (\(lqthe European Molecular Biology Open S
.PP
\fB\-directory\fR \fIdirectory\fR
.RS 4
-The directory containing the unzipped and untarred JASPAR_CORE, JASPAR_FAM and JASPAR_PHYLOFACTS subdirectories
+The FlatFileDir directory containing the \&.pfm files and the matrix_list\&.txt file
.RE
.SH "BUGS"
.PP
diff --git a/debian/manpages/jaspscan.1e b/debian/manpages/jaspscan.1e
index 29a9c41..a44ede7 100644
--- a/debian/manpages/jaspscan.1e
+++ b/debian/manpages/jaspscan.1e
@@ -2,12 +2,21 @@
.\" Title: JASPSCAN
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "JASPSCAN" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "JASPSCAN" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -43,7 +52,7 @@ Default value: C
.PP
\fB\-matrices\fR \fIstring\fR
.RS 4
-The name \'all\' reads in all matrix files from the selected JASPAR matrix set\&. You can specify individual matrices by giving their names with commas between then, such as: \'ma0001,ma0015\'\&. The case of the names is not important\&. You can specify a file of matrix names to read in by giving the name of the file holding the matrix names with a \'@\' character in front of it, for example, \'@matrix\&.list\'\&. Blank lines and lines starting with a hash character or \'!\' are ignored and all other lines are concatenated together with a comma character \',\' and then treated as the list of enzymes to search for\&. An example of a file of matrix names is: ! my matrices ma0001, ma0002 ! other matrices ma0010 ma0032 ma0053 Default value: all
+The name \*(Aqall\*(Aq reads in all matrix files from the selected JASPAR matrix set\&. You can specify individual matrices by giving their names with commas between then, such as: \*(Aqma0001\&.1,ma0015*\*(Aq\&. The case of the names is not important\&. You can specify a file of matrix names to read in by giving the name of the file holding the matrix names with a \*(Aq@\*(Aq character in front of it, for example, \*(Aq at matrix\&.list\*(Aq\&. Blank lines and lines starting with a hash character or \*(Aq!\*(Aq are ignored and all other lines are concatenated together with a comma character \*(Aq,\*(Aq and then treated as the list of enzymes to search for\&. An example of a file of matrix names is: ! my matrices ma0001\&.1, ma0002\&.1 ! other matrices ma0010\&.1 ma0032* ma0053\&.1 Default value: all
.RE
.SS "Required section"
.PP
@@ -55,7 +64,7 @@ If the matrix score is greater than or equal to this percentage then a hit will
.PP
\fB\-exclude\fR \fIstring\fR
.RS 4
-The names of any matrices to exclude from the \'matrices\' list\&. Matrices are specified in the same way as for the selection list\&.
+The names of any matrices to exclude from the \*(Aqmatrices\*(Aq list\&. Matrices are specified in the same way as for the selection list\&.
.RE
.PP
\fB\-both\fR \fIboolean\fR
diff --git a/debian/manpages/lindna.1e b/debian/manpages/lindna.1e
index 7026098..3f50a97 100644
--- a/debian/manpages/lindna.1e
+++ b/debian/manpages/lindna.1e
@@ -2,12 +2,21 @@
.\" Title: LINDNA
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "LINDNA" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "LINDNA" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/listor.1e b/debian/manpages/listor.1e
index 6158f43..983d614 100644
--- a/debian/manpages/listor.1e
+++ b/debian/manpages/listor.1e
@@ -2,12 +2,21 @@
.\" Title: LISTOR
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "LISTOR" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "LISTOR" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/makenucseq.1e b/debian/manpages/makenucseq.1e
index 0a7a4b1..c7cb424 100644
--- a/debian/manpages/makenucseq.1e
+++ b/debian/manpages/makenucseq.1e
@@ -2,12 +2,21 @@
.\" Title: MAKENUCSEQ
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "MAKENUCSEQ" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "MAKENUCSEQ" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/makeprotseq.1e b/debian/manpages/makeprotseq.1e
index 37c36c0..f12334e 100644
--- a/debian/manpages/makeprotseq.1e
+++ b/debian/manpages/makeprotseq.1e
@@ -2,12 +2,21 @@
.\" Title: MAKEPROTSEQ
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "MAKEPROTSEQ" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "MAKEPROTSEQ" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/marscan.1e b/debian/manpages/marscan.1e
index 22c186b..8232999 100644
--- a/debian/manpages/marscan.1e
+++ b/debian/manpages/marscan.1e
@@ -2,12 +2,21 @@
.\" Title: MARSCAN
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "MARSCAN" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "MARSCAN" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/martattributes.1e b/debian/manpages/martattributes.1e
new file mode 100644
index 0000000..ce6a3a5
--- /dev/null
+++ b/debian/manpages/martattributes.1e
@@ -0,0 +1,87 @@
+'\" t
+.\" Title: MARTATTRIBUTES
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
+.\" Date: 07/16/2010
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.3.0
+.\" Language: English
+.\"
+.TH "MARTATTRIBUTES" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+martattributes \- Return attributes from a mart dataset from a mart host
+.SH "SYNOPSIS"
+.HP \w'\fBmartattributes\fR\ 'u
+\fBmartattributes\fR \fB\-dataset\ \fR\fB\fIstring\fR\fR \fB\-host\ \fR\fB\fIstring\fR\fR \fB\-path\ \fR\fB\fIstring\fR\fR \fB\-port\ \fR\fB\fIinteger\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP \w'\fBmartattributes\fR\ 'u
+\fBmartattributes\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBmartattributes\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-dataset\fR \fIstring\fR
+.RS 4
+Default value: oanatinus_gene_ensembl
+.RE
+.SS "Advanced section"
+.PP
+\fB\-host\fR \fIstring\fR
+.RS 4
+Default value: www\&.biomart\&.org
+.RE
+.PP
+\fB\-path\fR \fIstring\fR
+.RS 4
+Default value: /biomart/martservice
+.RE
+.PP
+\fB\-port\fR \fIinteger\fR
+.RS 4
+Default value: 80
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+martattributes is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/martdatasets.1e b/debian/manpages/martdatasets.1e
new file mode 100644
index 0000000..0c8125e
--- /dev/null
+++ b/debian/manpages/martdatasets.1e
@@ -0,0 +1,87 @@
+'\" t
+.\" Title: MARTDATASETS
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
+.\" Date: 07/16/2010
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.3.0
+.\" Language: English
+.\"
+.TH "MARTDATASETS" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+martdatasets \- Return datasets from a mart from a registry
+.SH "SYNOPSIS"
+.HP \w'\fBmartdatasets\fR\ 'u
+\fBmartdatasets\fR \fB\-mart\ \fR\fB\fIstring\fR\fR \fB\-host\ \fR\fB\fIstring\fR\fR \fB\-path\ \fR\fB\fIstring\fR\fR \fB\-port\ \fR\fB\fIinteger\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP \w'\fBmartdatasets\fR\ 'u
+\fBmartdatasets\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBmartdatasets\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-mart\fR \fIstring\fR
+.RS 4
+Default value: ensembl
+.RE
+.SS "Advanced section"
+.PP
+\fB\-host\fR \fIstring\fR
+.RS 4
+Default value: www\&.biomart\&.org
+.RE
+.PP
+\fB\-path\fR \fIstring\fR
+.RS 4
+Default value: /biomart/martservice
+.RE
+.PP
+\fB\-port\fR \fIinteger\fR
+.RS 4
+Default value: 80
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+martdatasets is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/martfilters.1e b/debian/manpages/martfilters.1e
new file mode 100644
index 0000000..ccec162
--- /dev/null
+++ b/debian/manpages/martfilters.1e
@@ -0,0 +1,87 @@
+'\" t
+.\" Title: MARTFILTERS
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
+.\" Date: 07/16/2010
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.3.0
+.\" Language: English
+.\"
+.TH "MARTFILTERS" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+martfilters \- Return filters from a mart dataset from a mart host
+.SH "SYNOPSIS"
+.HP \w'\fBmartfilters\fR\ 'u
+\fBmartfilters\fR \fB\-dataset\ \fR\fB\fIstring\fR\fR \fB\-host\ \fR\fB\fIstring\fR\fR \fB\-path\ \fR\fB\fIstring\fR\fR \fB\-port\ \fR\fB\fIinteger\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP \w'\fBmartfilters\fR\ 'u
+\fBmartfilters\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBmartfilters\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-dataset\fR \fIstring\fR
+.RS 4
+Default value: oanatinus_gene_ensembl
+.RE
+.SS "Advanced section"
+.PP
+\fB\-host\fR \fIstring\fR
+.RS 4
+Default value: www\&.biomart\&.org
+.RE
+.PP
+\fB\-path\fR \fIstring\fR
+.RS 4
+Default value: /biomart/martservice
+.RE
+.PP
+\fB\-port\fR \fIinteger\fR
+.RS 4
+Default value: 80
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+martfilters is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/martquery.1e b/debian/manpages/martquery.1e
new file mode 100644
index 0000000..1827e7a
--- /dev/null
+++ b/debian/manpages/martquery.1e
@@ -0,0 +1,97 @@
+'\" t
+.\" Title: MARTQUERY
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
+.\" Date: 07/16/2010
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.3.0
+.\" Language: English
+.\"
+.TH "MARTQUERY" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+martquery \- Perform a biomart query
+.SH "SYNOPSIS"
+.HP \w'\fBmartquery\fR\ 'u
+\fBmartquery\fR \fB\-dataset\ \fR\fB\fIstring\fR\fR \fB\-attributes\ \fR\fB\fIstring\fR\fR \fB\-filters\ \fR\fB\fIstring\fR\fR \fB\-host\ \fR\fB\fIstring\fR\fR \fB\-path\ \fR\fB\fIstring\fR\fR \fB\-port\ \fR\fB\fIinteger\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP \w'\fBmartquery\fR\ 'u
+\fBmartquery\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBmartquery\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-dataset\fR \fIstring\fR
+.RS 4
+Default value: drerio_gene_ensembl
+.RE
+.PP
+\fB\-attributes\fR \fIstring\fR
+.RS 4
+Default value: ensembl_gene_id,ensembl_transcript_id
+.RE
+.PP
+\fB\-filters\fR \fIstring\fR
+.RS 4
+Default value: with_transmembrane_domain
+.RE
+.SS "Advanced section"
+.PP
+\fB\-host\fR \fIstring\fR
+.RS 4
+Default value: www\&.biomart\&.org
+.RE
+.PP
+\fB\-path\fR \fIstring\fR
+.RS 4
+Default value: /biomart/martservice
+.RE
+.PP
+\fB\-port\fR \fIinteger\fR
+.RS 4
+Default value: 80
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+martquery is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/martregistry.1e b/debian/manpages/martregistry.1e
new file mode 100644
index 0000000..67897d6
--- /dev/null
+++ b/debian/manpages/martregistry.1e
@@ -0,0 +1,81 @@
+'\" t
+.\" Title: MARTREGISTRY
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
+.\" Date: 07/16/2010
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.3.0
+.\" Language: English
+.\"
+.TH "MARTREGISTRY" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+martregistry \- Show Biomart registries listed on a host
+.SH "SYNOPSIS"
+.HP \w'\fBmartregistry\fR\ 'u
+\fBmartregistry\fR \fB\-host\ \fR\fB\fIstring\fR\fR \fB\-path\ \fR\fB\fIstring\fR\fR \fB\-port\ \fR\fB\fIinteger\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP \w'\fBmartregistry\fR\ 'u
+\fBmartregistry\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBmartregistry\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-host\fR \fIstring\fR
+.RS 4
+Default value: www\&.biomart\&.org
+.RE
+.PP
+\fB\-path\fR \fIstring\fR
+.RS 4
+Default value: /biomart/martservice
+.RE
+.PP
+\fB\-port\fR \fIinteger\fR
+.RS 4
+Default value: 80
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+martregistry is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/martseqs.1e b/debian/manpages/martseqs.1e
new file mode 100644
index 0000000..cf54d28
--- /dev/null
+++ b/debian/manpages/martseqs.1e
@@ -0,0 +1,81 @@
+'\" t
+.\" Title: MARTSEQS
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
+.\" Date: 07/16/2010
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.3.0
+.\" Language: English
+.\"
+.TH "MARTSEQS" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+martseqs \- Show Biomart datasets that can return sequences
+.SH "SYNOPSIS"
+.HP \w'\fBmartseqs\fR\ 'u
+\fBmartseqs\fR \fB\-host\ \fR\fB\fIstring\fR\fR \fB\-path\ \fR\fB\fIstring\fR\fR \fB\-port\ \fR\fB\fIinteger\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP \w'\fBmartseqs\fR\ 'u
+\fBmartseqs\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBmartseqs\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-host\fR \fIstring\fR
+.RS 4
+Default value: www\&.biomart\&.org
+.RE
+.PP
+\fB\-path\fR \fIstring\fR
+.RS 4
+Default value: /biomart/martservice
+.RE
+.PP
+\fB\-port\fR \fIinteger\fR
+.RS 4
+Default value: 80
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+martseqs is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/maskambignuc.1e b/debian/manpages/maskambignuc.1e
index b19326a..8cc4673 100644
--- a/debian/manpages/maskambignuc.1e
+++ b/debian/manpages/maskambignuc.1e
@@ -2,12 +2,21 @@
.\" Title: MASKAMBIGNUC
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "MASKAMBIGNUC" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "MASKAMBIGNUC" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/maskambigprot.1e b/debian/manpages/maskambigprot.1e
index 49c1f74..60c0637 100644
--- a/debian/manpages/maskambigprot.1e
+++ b/debian/manpages/maskambigprot.1e
@@ -2,12 +2,21 @@
.\" Title: MASKAMBIGPROT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "MASKAMBIGPROT" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "MASKAMBIGPROT" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/maskfeat.1e b/debian/manpages/maskfeat.1e
index 2388461..6aa6612 100644
--- a/debian/manpages/maskfeat.1e
+++ b/debian/manpages/maskfeat.1e
@@ -2,12 +2,21 @@
.\" Title: MASKFEAT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "MASKFEAT" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "MASKFEAT" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -39,17 +48,17 @@ is a command line program from EMBOSS (\(lqthe European Molecular Biology Open S
.PP
\fB\-type\fR \fIstring\fR
.RS 4
-By default any feature in the feature table with a type starting \'repeat\' is masked\&. You can set this to be any feature type you wish to mask\&. See http://www3\&.ebi\&.ac\&.uk/Services/WebFeat/ for a list of the EMBL feature types and see Appendix A of the Swissprot user manual in http://www\&.expasy\&.ch/txt/userman\&.txt for a list of the Swissprot feature types\&. The type may be wildcarded by using \'*\'\&. If you wish to mask more than one type, separate their names with spaces or commas, eg: *UTR repeat* Default value: repeat*
+By default any feature in the feature table with a type starting \*(Aqrepeat\*(Aq is masked\&. You can set this to be any feature type you wish to mask\&. See http://www\&.ebi\&.ac\&.uk/embl/WebFeat/ for a list of the EMBL feature types and see Appendix A of the Swissprot user manual in http://www\&.expasy\&.org/sprot/userman\&.html for a list of the Swissprot feature types\&. The type may be wildcarded by using \*(Aq*\*(Aq\&. If you wish to mask more than one type, separate their names with spaces or commas, eg: *UTR repeat* Default value: repeat*
.RE
.PP
\fB\-tolower\fR \fItoggle\fR
.RS 4
-The region can be \'masked\' by converting the sequence characters to lower\-case, some non\-EMBOSS programs e\&.g\&. fasta can interpret this as a masked region\&. The sequence is unchanged apart from the case change\&. You might like to ensure that the whole sequence is in upper\-case before masking the specified regions to lower\-case by using the \'\-supper\' flag\&. Default value: N
+The region can be \*(Aqmasked\*(Aq by converting the sequence characters to lower\-case, some non\-EMBOSS programs e\&.g\&. fasta can interpret this as a masked region\&. The sequence is unchanged apart from the case change\&. You might like to ensure that the whole sequence is in upper\-case before masking the specified regions to lower\-case by using the \*(Aq\-supper\*(Aq flag\&. Default value: N
.RE
.PP
\fB\-maskchar\fR \fIstring\fR
.RS 4
-Character to use when masking\&. Default is \'X\' for protein sequences, \'N\' for nucleic sequences\&. If the mask character is set to be the SPACE character or a null character, then the sequence is \'masked\' by changing it to lower\-case, just as with the \'\-lowercase\' flag\&. Default value: @($(acdprotein)?X:N)
+Character to use when masking\&. Default is \*(AqX\*(Aq for protein sequences, \*(AqN\*(Aq for nucleic sequences\&. If the mask character is set to be the SPACE character or a null character, then the sequence is \*(Aqmasked\*(Aq by changing it to lower\-case, just as with the \*(Aq\-lowercase\*(Aq flag\&. Default value: @($(acdprotein)?X:N)
.RE
.SS "Output section"
.PP
diff --git a/debian/manpages/maskseq.1e b/debian/manpages/maskseq.1e
index 862a882..2c56cb3 100644
--- a/debian/manpages/maskseq.1e
+++ b/debian/manpages/maskseq.1e
@@ -2,12 +2,21 @@
.\" Title: MASKSEQ
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "MASKSEQ" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "MASKSEQ" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -45,12 +54,12 @@ Regions to mask\&. A set of regions is specified by a set of pairs of positions\
.PP
\fB\-tolower\fR \fItoggle\fR
.RS 4
-The region can be \'masked\' by converting the sequence characters to lower\-case, some non\-EMBOSS programs e\&.g\&. fasta can interpret this as a masked region\&. The sequence is unchanged apart from the case change\&. You might like to ensure that the whole sequence is in upper\-case before masking the specified regions to lower\-case by using the \'\-supper\' flag\&. Default value: N
+The region can be \*(Aqmasked\*(Aq by converting the sequence characters to lower\-case, some non\-EMBOSS programs e\&.g\&. fasta can interpret this as a masked region\&. The sequence is unchanged apart from the case change\&. You might like to ensure that the whole sequence is in upper\-case before masking the specified regions to lower\-case by using the \*(Aq\-supper\*(Aq flag\&. Default value: N
.RE
.PP
\fB\-maskchar\fR \fIstring\fR
.RS 4
-Character to use when masking\&. Default is \'X\' for protein sequences, \'N\' for nucleic sequences\&. If the mask character is set to be the SPACE character or a null character, then the sequence is \'masked\' by changing it to lower\-case, just as with the \'\-lowercase\' flag\&. Default value: @($(acdprotein)?X:N)
+Character to use when masking\&. Default is \*(AqX\*(Aq for protein sequences, \*(AqN\*(Aq for nucleic sequences\&. If the mask character is set to be the SPACE character or a null character, then the sequence is \*(Aqmasked\*(Aq by changing it to lower\-case, just as with the \*(Aq\-lowercase\*(Aq flag\&. Default value: @($(acdprotein)?X:N)
.RE
.SS "Output section"
.PP
diff --git a/debian/manpages/matcher.1e b/debian/manpages/matcher.1e
index 3da98f3..75d027d 100644
--- a/debian/manpages/matcher.1e
+++ b/debian/manpages/matcher.1e
@@ -2,12 +2,21 @@
.\" Title: MATCHER
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "MATCHER" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "MATCHER" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -42,7 +51,7 @@ is a command line program from EMBOSS (\(lqthe European Molecular Biology Open S
.PP
\fB\-datafile\fR \fImatrix\fR
.RS 4
-This is the scoring matrix file used when comparing sequences\&. By default it is the file \'EBLOSUM62\' (for proteins) or the file \'EDNAFULL\' (for nucleic sequences)\&. These files are found in the \'data\' directory of the EMBOSS installation\&.
+This is the scoring matrix file used when comparing sequences\&. By default it is the file \*(AqEBLOSUM62\*(Aq (for proteins) or the file \*(AqEDNAFULL\*(Aq (for nucleic sequences)\&. These files are found in the \*(Aqdata\*(Aq directory of the EMBOSS installation\&.
.RE
.SS "Additional section"
.PP
diff --git a/debian/manpages/megamerger.1e b/debian/manpages/megamerger.1e
index 028289b..a002684 100644
--- a/debian/manpages/megamerger.1e
+++ b/debian/manpages/megamerger.1e
@@ -2,12 +2,21 @@
.\" Title: MEGAMERGER
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "MEGAMERGER" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "MEGAMERGER" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -49,7 +58,7 @@ Default value: 20
.PP
\fB\-prefer\fR \fIboolean\fR
.RS 4
-When a mismatch between the two sequence is discovered, one or other of the two sequences must be used to create the merged sequence over this mismatch region\&. The default action is to create the merged sequence using the sequence where the mismatch is closest to that sequence\'s centre\&. If this option is used, then the first sequence (seqa) will always be used in preference to the other sequence when there is a mismatch\&. Default value: N
+When a mismatch between the two sequence is discovered, one or other of the two sequences must be used to create the merged sequence over this mismatch region\&. The default action is to create the merged sequence using the sequence where the mismatch is closest to that sequence\*(Aqs centre\&. If this option is used, then the first sequence (seqa) will always be used in preference to the other sequence when there is a mismatch\&. Default value: N
.RE
.SS "Output section"
.PP
diff --git a/debian/manpages/merger.1e b/debian/manpages/merger.1e
index 2006815..eba84e3 100644
--- a/debian/manpages/merger.1e
+++ b/debian/manpages/merger.1e
@@ -2,12 +2,21 @@
.\" Title: MERGER
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "MERGER" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "MERGER" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -42,7 +51,7 @@ is a command line program from EMBOSS (\(lqthe European Molecular Biology Open S
.PP
\fB\-datafile\fR \fImatrixf\fR
.RS 4
-This is the scoring matrix file used when comparing sequences\&. By default it is the file \'EBLOSUM62\' (for proteins) or the file \'EDNAFULL\' (for nucleic sequences)\&. These files are found in the \'data\' directory of the EMBOSS installation\&.
+This is the scoring matrix file used when comparing sequences\&. By default it is the file \*(AqEBLOSUM62\*(Aq (for proteins) or the file \*(AqEDNAFULL\*(Aq (for nucleic sequences)\&. These files are found in the \*(Aqdata\*(Aq directory of the EMBOSS installation\&.
.RE
.SS "Additional section"
.PP
diff --git a/debian/manpages/msbar.1e b/debian/manpages/msbar.1e
index c17d1dc..daebf33 100644
--- a/debian/manpages/msbar.1e
+++ b/debian/manpages/msbar.1e
@@ -2,12 +2,21 @@
.\" Title: MSBAR
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "MSBAR" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "MSBAR" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/mwcontam.1e b/debian/manpages/mwcontam.1e
index 8018306..7ab69cf 100644
--- a/debian/manpages/mwcontam.1e
+++ b/debian/manpages/mwcontam.1e
@@ -2,12 +2,21 @@
.\" Title: MWCONTAM
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "MWCONTAM" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "MWCONTAM" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/mwfilter.1e b/debian/manpages/mwfilter.1e
index eb9f5d8..faacb32 100644
--- a/debian/manpages/mwfilter.1e
+++ b/debian/manpages/mwfilter.1e
@@ -2,12 +2,21 @@
.\" Title: MWFILTER
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "MWFILTER" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "MWFILTER" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/needle.1e b/debian/manpages/needle.1e
index 9012f07..bb3ef1d 100644
--- a/debian/manpages/needle.1e
+++ b/debian/manpages/needle.1e
@@ -2,12 +2,21 @@
.\" Title: NEEDLE
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "NEEDLE" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "NEEDLE" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -42,7 +51,7 @@ is a command line program from EMBOSS (\(lqthe European Molecular Biology Open S
.PP
\fB\-datafile\fR \fImatrixf\fR
.RS 4
-This is the scoring matrix file used when comparing sequences\&. By default it is the file \'EBLOSUM62\' (for proteins) or the file \'EDNAFULL\' (for nucleic sequences)\&. These files are found in the \'data\' directory of the EMBOSS installation\&.
+This is the scoring matrix file used when comparing sequences\&. By default it is the file \*(AqEBLOSUM62\*(Aq (for proteins) or the file \*(AqEDNAFULL\*(Aq (for nucleic sequences)\&. These files are found in the \*(Aqdata\*(Aq directory of the EMBOSS installation\&.
.RE
.SS "Required section"
.PP
@@ -55,6 +64,7 @@ The gap open penalty is the score taken away when a gap is created\&. The best v
.RS 4
The gap extension, penalty is added to the standard gap penalty for each base or residue in the gap\&. This is how long gaps are penalized\&. Usually you will expect a few long gaps rather than many short gaps, so the gap extension penalty should be lower than the gap penalty\&. An exception is where one or both sequences are single reads with possible sequencing errors in which case you would expect many single base gaps\&. You can get this result by setting the gap open penalty to zero (or very low) and using the gap extension penalty to control gap scoring\&. Default value: @($(acdprotein)? 0\&.5 : 0\&.5 )
.RE
+.SS "Additional section"
.PP
\fB\-endweight\fR \fIboolean\fR
.RS 4
diff --git a/debian/manpages/needleall.1e b/debian/manpages/needleall.1e
index 9ce5a9b..85aee21 100644
--- a/debian/manpages/needleall.1e
+++ b/debian/manpages/needleall.1e
@@ -2,12 +2,21 @@
.\" Title: NEEDLEALL
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "NEEDLEALL" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "NEEDLEALL" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -42,7 +51,7 @@ is a command line program from EMBOSS (\(lqthe European Molecular Biology Open S
.PP
\fB\-datafile\fR \fImatrixf\fR
.RS 4
-This is the scoring matrix file used when comparing sequences\&. By default it is the file \'EBLOSUM62\' (for proteins) or the file \'EDNAFULL\' (for nucleic sequences)\&. These files are found in the \'data\' directory of the EMBOSS installation\&.
+This is the scoring matrix file used when comparing sequences\&. By default it is the file \*(AqEBLOSUM62\*(Aq (for proteins) or the file \*(AqEDNAFULL\*(Aq (for nucleic sequences)\&. These files are found in the \*(Aqdata\*(Aq directory of the EMBOSS installation\&.
.RE
.SS "Required section"
.PP
diff --git a/debian/manpages/newcoils.1e b/debian/manpages/newcoils.1e
index fcaeae5..13b13cb 100644
--- a/debian/manpages/newcoils.1e
+++ b/debian/manpages/newcoils.1e
@@ -2,12 +2,21 @@
.\" Title: NEWCOILS
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "NEWCOILS" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "NEWCOILS" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/newcpgreport.1e b/debian/manpages/newcpgreport.1e
index 6f04b9e..c09527a 100644
--- a/debian/manpages/newcpgreport.1e
+++ b/debian/manpages/newcpgreport.1e
@@ -2,12 +2,21 @@
.\" Title: NEWCPGREPORT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "NEWCPGREPORT" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "NEWCPGREPORT" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/newcpgseek.1e b/debian/manpages/newcpgseek.1e
index 2391a16..6b2767a 100644
--- a/debian/manpages/newcpgseek.1e
+++ b/debian/manpages/newcpgseek.1e
@@ -2,12 +2,21 @@
.\" Title: NEWCPGSEEK
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "NEWCPGSEEK" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "NEWCPGSEEK" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/newseq.1e b/debian/manpages/newseq.1e
index c8877dc..8c5bff9 100644
--- a/debian/manpages/newseq.1e
+++ b/debian/manpages/newseq.1e
@@ -2,12 +2,21 @@
.\" Title: NEWSEQ
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "NEWSEQ" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "NEWSEQ" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/nohtml.1e b/debian/manpages/nohtml.1e
index c9fd63f..bc76f6b 100644
--- a/debian/manpages/nohtml.1e
+++ b/debian/manpages/nohtml.1e
@@ -2,12 +2,21 @@
.\" Title: NOHTML
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "NOHTML" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "NOHTML" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/noreturn.1e b/debian/manpages/noreturn.1e
index 613bb91..2449b90 100644
--- a/debian/manpages/noreturn.1e
+++ b/debian/manpages/noreturn.1e
@@ -2,12 +2,21 @@
.\" Title: NORETURN
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "NORETURN" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "NORETURN" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/nospace.1e b/debian/manpages/nospace.1e
index 802ae2c..c06b06a 100644
--- a/debian/manpages/nospace.1e
+++ b/debian/manpages/nospace.1e
@@ -2,12 +2,21 @@
.\" Title: NOSPACE
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "NOSPACE" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "NOSPACE" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -19,10 +28,10 @@
.\" * MAIN CONTENT STARTS HERE *
.\" -----------------------------------------------------------------
.SH "NAME"
-nospace \- Remove all whitespace from an ASCII text file
+nospace \- Remove whitespace from an ASCII text file
.SH "SYNOPSIS"
.HP \w'\fBnospace\fR\ 'u
-\fBnospace\fR \fB\-infile\ \fR\fB\fIinfile\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+\fBnospace\fR \fB\-infile\ \fR\fB\fIinfile\fR\fR [\fB\-menu\ \fR\fB\fIlist\fR\fR] \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
.HP \w'\fBnospace\fR\ 'u
\fBnospace\fR \fB\-help\fR
.SH "DESCRIPTION"
@@ -37,6 +46,11 @@ is a command line program from EMBOSS (\(lqthe European Molecular Biology Open S
.RE
.SS "Required section"
.SS "Additional section"
+.PP
+\fB\-menu\fR \fIlist\fR
+.RS 4
+Default value: all
+.RE
.SS "Advanced section"
.SS "Output section"
.PP
diff --git a/debian/manpages/notab.1e b/debian/manpages/notab.1e
index eb2a69c..8deba38 100644
--- a/debian/manpages/notab.1e
+++ b/debian/manpages/notab.1e
@@ -2,12 +2,21 @@
.\" Title: NOTAB
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "NOTAB" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "NOTAB" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/notseq.1e b/debian/manpages/notseq.1e
index 3467093..4a1cbe5 100644
--- a/debian/manpages/notseq.1e
+++ b/debian/manpages/notseq.1e
@@ -2,12 +2,21 @@
.\" Title: NOTSEQ
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "NOTSEQ" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "NOTSEQ" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -39,7 +48,7 @@ is a command line program from EMBOSS (\(lqthe European Molecular Biology Open S
.PP
\fB\-exclude\fR \fIstring\fR
.RS 4
-Enter a list of sequence names or accession numbers to exclude from the sequences read in\&. The excluded sequences will be written to the file specified in the \'junkout\' parameter\&. The remainder will be written out to the file specified in the \'outseq\' parameter\&. The list of sequence names can be separated by either spaces or commas\&. The sequence names can be wildcarded\&. The sequence names are case independent\&. An example of a list of sequences to be excluded is: myseq, hs*, one two three a file containing a list of sequence names can be specified by giving the file name preceeded by a \'@\', eg: \'@names\&.dat\'
+Enter a list of sequence names or accession numbers to exclude from the sequences read in\&. The excluded sequences will be written to the file specified in the \*(Aqjunkout\*(Aq parameter\&. The remainder will be written out to the file specified in the \*(Aqoutseq\*(Aq parameter\&. The list of sequence names can be separated by either spaces or commas\&. The sequence names can be wildcarded\&. The sequence names are case independent\&. An example of a list of sequences to be excluded is: myseq, hs*, one two three a file containing a list of sequence names can be specified by giving the file name preceeded by a \*(Aq@\*(Aq, eg: \*(Aq at names\&.dat\*(Aq
.RE
.SS "Output section"
.PP
diff --git a/debian/manpages/nthseq.1e b/debian/manpages/nthseq.1e
index 4a29190..443a257 100644
--- a/debian/manpages/nthseq.1e
+++ b/debian/manpages/nthseq.1e
@@ -2,12 +2,21 @@
.\" Title: NTHSEQ
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "NTHSEQ" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "NTHSEQ" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/nthseqset.1e b/debian/manpages/nthseqset.1e
index 197b8ec..53a9346 100644
--- a/debian/manpages/nthseqset.1e
+++ b/debian/manpages/nthseqset.1e
@@ -2,12 +2,21 @@
.\" Title: NTHSEQSET
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "NTHSEQSET" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "NTHSEQSET" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/octanol.1e b/debian/manpages/octanol.1e
index 541de2e..13283e4 100644
--- a/debian/manpages/octanol.1e
+++ b/debian/manpages/octanol.1e
@@ -2,12 +2,21 @@
.\" Title: OCTANOL
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "OCTANOL" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "OCTANOL" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/oddcomp.1e b/debian/manpages/oddcomp.1e
index bb52fd7..46faa4e 100644
--- a/debian/manpages/oddcomp.1e
+++ b/debian/manpages/oddcomp.1e
@@ -2,12 +2,21 @@
.\" Title: ODDCOMP
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "ODDCOMP" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "ODDCOMP" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -38,13 +47,13 @@ is a command line program from EMBOSS (\(lqthe European Molecular Biology Open S
.PP
\fB\-infile\fR \fIinfile\fR
.RS 4
-This is a file in the format of the output produced by \'compseq\' that is used to set the minimum frequencies of words in this analysis\&.
+This is a file in the format of the output produced by \*(Aqcompseq\*(Aq that is used to set the minimum frequencies of words in this analysis\&.
.RE
.SS "Required section"
.PP
\fB\-fullwindow\fR \fItoggle\fR
.RS 4
-Set this option on (Y) if you want the window size to be set to the length of the current protein\&. Otherwise, leave this option unset, in which case you\'ll be prompted for a window size to use\&. Default value: N
+Set this option on (Y) if you want the window size to be set to the length of the current protein\&. Otherwise, leave this option unset, in which case you\*(Aqll be prompted for a window size to use\&. Default value: N
.RE
.PP
\fB\-window\fR \fIinteger\fR
@@ -55,7 +64,7 @@ This is the size of window in which to count\&. Thus if you want to count freque
.PP
\fB\-ignorebz\fR \fIboolean\fR
.RS 4
-The amino acid code B represents Asparagine or Aspartic acid and the code Z represents Glutamine or Glutamic acid\&. These are not commonly used codes and you may wish not to count words containing them, just noting them in the count of \'Other\' words\&. Default value: Y
+The amino acid code B represents Asparagine or Aspartic acid and the code Z represents Glutamine or Glutamic acid\&. These are not commonly used codes and you may wish not to count words containing them, just noting them in the count of \*(AqOther\*(Aq words\&. Default value: Y
.RE
.SS "Output section"
.PP
diff --git a/debian/manpages/origsplitter.1e b/debian/manpages/origsplitter.1e
index 0dcfa0a..3f8d7eb 100644
--- a/debian/manpages/origsplitter.1e
+++ b/debian/manpages/origsplitter.1e
@@ -2,12 +2,21 @@
.\" Title: ORIGSPLITTER
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "ORIGSPLITTER" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "ORIGSPLITTER" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/origunion.1e b/debian/manpages/origunion.1e
index dd07a0b..fe8f547 100644
--- a/debian/manpages/origunion.1e
+++ b/debian/manpages/origunion.1e
@@ -2,12 +2,21 @@
.\" Title: ORIGUNION
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "ORIGUNION" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "ORIGUNION" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/palindrome.1e b/debian/manpages/palindrome.1e
index bdce766..321b54a 100644
--- a/debian/manpages/palindrome.1e
+++ b/debian/manpages/palindrome.1e
@@ -2,12 +2,21 @@
.\" Title: PALINDROME
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "PALINDROME" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "PALINDROME" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/pasteseq.1e b/debian/manpages/pasteseq.1e
index 6acba86..c79cb64 100644
--- a/debian/manpages/pasteseq.1e
+++ b/debian/manpages/pasteseq.1e
@@ -2,12 +2,21 @@
.\" Title: PASTESEQ
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "PASTESEQ" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "PASTESEQ" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/patmatdb.1e b/debian/manpages/patmatdb.1e
index e628c4d..5cf1b3b 100644
--- a/debian/manpages/patmatdb.1e
+++ b/debian/manpages/patmatdb.1e
@@ -2,12 +2,21 @@
.\" Title: PATMATDB
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "PATMATDB" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "PATMATDB" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -39,7 +48,7 @@ is a command line program from EMBOSS (\(lqthe European Molecular Biology Open S
.PP
\fB\-motif\fR \fIstring\fR
.RS 4
-Patterns for patmatdb are based on the format of pattern used in the PROSITE database\&. For example: \'[DE](2)HS{P}X(2)PX(2,4)C\' means two Asps or Glus in any order followed by His, Ser, any residue other then Pro, then two of any residue followed by Pro followed by two to four of any residue followed by Cys\&. The search is case\-independent, so \'AAA\' matches \'aaa\'\&.
+Patterns for patmatdb are based on the format of pattern used in the PROSITE database\&. For example: \*(Aq[DE](2)HS{P}X(2)PX(2,4)C\*(Aq means two Asps or Glus in any order followed by His, Ser, any residue other then Pro, then two of any residue followed by Pro followed by two to four of any residue followed by Cys\&. The search is case\-independent, so \*(AqAAA\*(Aq matches \*(Aqaaa\*(Aq\&.
.RE
.SS "Output section"
.PP
diff --git a/debian/manpages/patmatmotifs.1e b/debian/manpages/patmatmotifs.1e
index 413f1f8..9f64c79 100644
--- a/debian/manpages/patmatmotifs.1e
+++ b/debian/manpages/patmatmotifs.1e
@@ -2,12 +2,21 @@
.\" Title: PATMATMOTIFS
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "PATMATMOTIFS" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "PATMATMOTIFS" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/patmattest.1e b/debian/manpages/patmattest.1e
index 62841bc..bf5f8a4 100644
--- a/debian/manpages/patmattest.1e
+++ b/debian/manpages/patmattest.1e
@@ -2,12 +2,21 @@
.\" Title: PATMATTEST
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "PATMATTEST" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "PATMATTEST" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/pepcoil.1e b/debian/manpages/pepcoil.1e
index 2580349..66df458 100644
--- a/debian/manpages/pepcoil.1e
+++ b/debian/manpages/pepcoil.1e
@@ -2,12 +2,21 @@
.\" Title: PEPCOIL
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "PEPCOIL" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "PEPCOIL" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/pepinfo.1e b/debian/manpages/pepinfo.1e
index 9cce5c2..2b9ffd9 100644
--- a/debian/manpages/pepinfo.1e
+++ b/debian/manpages/pepinfo.1e
@@ -2,12 +2,21 @@
.\" Title: PEPINFO
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "PEPINFO" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "PEPINFO" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/pepnet.1e b/debian/manpages/pepnet.1e
index d0074c7..55f910b 100644
--- a/debian/manpages/pepnet.1e
+++ b/debian/manpages/pepnet.1e
@@ -2,12 +2,21 @@
.\" Title: PEPNET
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "PEPNET" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "PEPNET" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -39,7 +48,7 @@ is a command line program from EMBOSS (\(lqthe European Molecular Biology Open S
.PP
\fB\-amphipathic\fR \fItoggle\fR
.RS 4
-If this is true then the residues ACFGILMVWY are marked as squares and all other residues are unmarked\&. This overrides any other markup that you may have specified using the qualifiers \'\-squares\', \'\-diamonds\' and \'\-octags\'\&.
+If this is true then the residues ACFGILMVWY are marked as squares and all other residues are unmarked\&. This overrides any other markup that you may have specified using the qualifiers \*(Aq\-squares\*(Aq, \*(Aq\-diamonds\*(Aq and \*(Aq\-octags\*(Aq\&.
.RE
.PP
\fB\-squares\fR \fIstring\fR
diff --git a/debian/manpages/pepstats.1e b/debian/manpages/pepstats.1e
index 08401cd..81767a5 100644
--- a/debian/manpages/pepstats.1e
+++ b/debian/manpages/pepstats.1e
@@ -2,12 +2,21 @@
.\" Title: PEPSTATS
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "PEPSTATS" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "PEPSTATS" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/pepwheel.1e b/debian/manpages/pepwheel.1e
index 9fbd66d..5f68227 100644
--- a/debian/manpages/pepwheel.1e
+++ b/debian/manpages/pepwheel.1e
@@ -2,12 +2,21 @@
.\" Title: PEPWHEEL
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "PEPWHEEL" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "PEPWHEEL" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -44,12 +53,12 @@ Default value: Y
.PP
\fB\-steps\fR \fIinteger\fR
.RS 4
-The number of residues plotted per turn is this value divided by the \'turns\' value\&. Default value: 18
+The number of residues plotted per turn is this value divided by the \*(Aqturns\*(Aq value\&. Default value: 18
.RE
.PP
\fB\-turns\fR \fIinteger\fR
.RS 4
-The number of residues plotted per turn is the \'steps\' value divided by this value\&. Default value: 5
+The number of residues plotted per turn is the \*(Aqsteps\*(Aq value divided by this value\&. Default value: 5
.RE
.PP
\fB\-graph\fR \fIgraph\fR
@@ -59,7 +68,7 @@ The number of residues plotted per turn is the \'steps\' value divided by this v
.PP
\fB\-amphipathic\fR \fItoggle\fR
.RS 4
-If this is true then the residues ACFGILMVWY are marked as squares and all other residues are unmarked\&. This overrides any other markup that you may have specified using the qualifiers \'\-squares\', \'\-diamonds\' and \'\-octags\'\&.
+If this is true then the residues ACFGILMVWY are marked as squares and all other residues are unmarked\&. This overrides any other markup that you may have specified using the qualifiers \*(Aq\-squares\*(Aq, \*(Aq\-diamonds\*(Aq and \*(Aq\-octags\*(Aq\&.
.RE
.PP
\fB\-squares\fR \fIstring\fR
diff --git a/debian/manpages/pepwindow.1e b/debian/manpages/pepwindow.1e
index 7fa283c..1848ee7 100644
--- a/debian/manpages/pepwindow.1e
+++ b/debian/manpages/pepwindow.1e
@@ -2,12 +2,21 @@
.\" Title: PEPWINDOW
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "PEPWINDOW" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "PEPWINDOW" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/pepwindowall.1e b/debian/manpages/pepwindowall.1e
index 6e02b1a..4d954ce 100644
--- a/debian/manpages/pepwindowall.1e
+++ b/debian/manpages/pepwindowall.1e
@@ -2,12 +2,21 @@
.\" Title: PEPWINDOWALL
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "PEPWINDOWALL" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "PEPWINDOWALL" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/plotcon.1e b/debian/manpages/plotcon.1e
index de8e2e0..a35f4f9 100644
--- a/debian/manpages/plotcon.1e
+++ b/debian/manpages/plotcon.1e
@@ -2,12 +2,21 @@
.\" Title: PLOTCON
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "PLOTCON" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "PLOTCON" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -39,7 +48,7 @@ File containing a sequence alignment
.PP
\fB\-scorefile\fR \fImatrix\fR
.RS 4
-This is the scoring matrix file used when comparing sequences\&. By default it is the file \'EBLOSUM62\' (for proteins) or the file \'EDNAFULL\' (for nucleic sequences)\&. These files are found in the \'data\' directory of the EMBOSS installation\&.
+This is the scoring matrix file used when comparing sequences\&. By default it is the file \*(AqEBLOSUM62\*(Aq (for proteins) or the file \*(AqEDNAFULL\*(Aq (for nucleic sequences)\&. These files are found in the \*(Aqdata\*(Aq directory of the EMBOSS installation\&.
.RE
.SS "Required section"
.PP
diff --git a/debian/manpages/plotorf.1e b/debian/manpages/plotorf.1e
index 549caf3..b99049d 100644
--- a/debian/manpages/plotorf.1e
+++ b/debian/manpages/plotorf.1e
@@ -2,12 +2,21 @@
.\" Title: PLOTORF
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "PLOTORF" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "PLOTORF" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/polydot.1e b/debian/manpages/polydot.1e
index 66f42ad..063cb26 100644
--- a/debian/manpages/polydot.1e
+++ b/debian/manpages/polydot.1e
@@ -2,12 +2,21 @@
.\" Title: POLYDOT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "POLYDOT" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "POLYDOT" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/preg.1e b/debian/manpages/preg.1e
index db5c10a..3604f7d 100644
--- a/debian/manpages/preg.1e
+++ b/debian/manpages/preg.1e
@@ -2,12 +2,21 @@
.\" Title: PREG
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "PREG" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "PREG" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/prettyplot.1e b/debian/manpages/prettyplot.1e
index d3e6b8f..cead98e 100644
--- a/debian/manpages/prettyplot.1e
+++ b/debian/manpages/prettyplot.1e
@@ -2,12 +2,21 @@
.\" Title: PRETTYPLOT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "PRETTYPLOT" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "PRETTYPLOT" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -38,7 +47,7 @@ is a command line program from EMBOSS (\(lqthe European Molecular Biology Open S
.PP
\fB\-matrixfile\fR \fImatrix\fR
.RS 4
-This is the scoring matrix file used when comparing sequences\&. By default it is the file \'EBLOSUM62\' (for proteins) or the file \'EDNAFULL\' (for nucleic sequences)\&. These files are found in the \'data\' directory of the EMBOSS installation\&.
+This is the scoring matrix file used when comparing sequences\&. By default it is the file \*(AqEBLOSUM62\*(Aq (for proteins) or the file \*(AqEDNAFULL\*(Aq (for nucleic sequences)\&. These files are found in the \*(Aqdata\*(Aq directory of the EMBOSS installation\&.
.RE
.SS "Additional section"
.PP
diff --git a/debian/manpages/prettyseq.1e b/debian/manpages/prettyseq.1e
index 18bd970..f9ef4a7 100644
--- a/debian/manpages/prettyseq.1e
+++ b/debian/manpages/prettyseq.1e
@@ -2,12 +2,21 @@
.\" Title: PRETTYSEQ
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "PRETTYSEQ" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "PRETTYSEQ" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/prima.1e b/debian/manpages/prima.1e
index 32a4d53..1adf526 100644
--- a/debian/manpages/prima.1e
+++ b/debian/manpages/prima.1e
@@ -2,12 +2,21 @@
.\" Title: PRIMA
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "PRIMA" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "PRIMA" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/primers.1e b/debian/manpages/primers.1e
index cb9fab5..99bfffd 100644
--- a/debian/manpages/primers.1e
+++ b/debian/manpages/primers.1e
@@ -2,12 +2,21 @@
.\" Title: PRIMERS
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "PRIMERS" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "PRIMERS" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -34,7 +43,7 @@ is a command line program from EMBOSS (\(lqthe European Molecular Biology Open S
.PP
\fB\-sequence\fR \fIseqall\fR
.RS 4
-The sequence from which to choose primers\&. The sequence must be presented 5\' \-> 3\'
+The sequence from which to choose primers\&. The sequence must be presented 5\*(Aq \-> 3\*(Aq
.RE
.SS "Additional section"
.PP
@@ -50,7 +59,7 @@ Minimum acceptable length of a primer\&. Must be greater than 0 and less than or
.PP
\fB\-maxsize\fR \fIinteger\fR
.RS 4
-Maximum acceptable length (in bases) of a primer\&. Currently this parameter cannot be larger than 35\&. This limit is governed by the maximum oligo size for which Primer3\'s melting\-temperature is valid\&. Default value: 27
+Maximum acceptable length (in bases) of a primer\&. Currently this parameter cannot be larger than 35\&. This limit is governed by the maximum oligo size for which Primer3\*(Aqs melting\-temperature is valid\&. Default value: 27
.RE
.PP
\fB\-maxdifftm\fR \fIfloat\fR
@@ -66,7 +75,7 @@ If this flag is non\-0, produce LEFT\-EXPLAIN and RIGHT\-EXPLAIN, output, which
.PP
\fB\-numreturn\fR \fIinteger\fR
.RS 4
-The maximum number of primer pairs to return\&. Primer pairs returned are sorted by their \'quality\', in other words by the value of the objective function (where a lower number indicates a better primer pair)\&. Caution: setting this parameter to a large value will increase running time\&. Default value: 5
+The maximum number of primer pairs to return\&. Primer pairs returned are sorted by their \*(Aqquality\*(Aq, in other words by the value of the objective function (where a lower number indicates a better primer pair)\&. Caution: setting this parameter to a large value will increase running time\&. Default value: 5
.RE
.PP
\fB\-outfile\fR \fIoutfile\fR
diff --git a/debian/manpages/primersearch.1e b/debian/manpages/primersearch.1e
index fc3cea1..9e84f26 100644
--- a/debian/manpages/primersearch.1e
+++ b/debian/manpages/primersearch.1e
@@ -2,12 +2,21 @@
.\" Title: PRIMERSEARCH
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "PRIMERSEARCH" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "PRIMERSEARCH" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/printsextract.1e b/debian/manpages/printsextract.1e
index 6b8e8bb..373c42d 100644
--- a/debian/manpages/printsextract.1e
+++ b/debian/manpages/printsextract.1e
@@ -2,12 +2,21 @@
.\" Title: PRINTSEXTRACT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "PRINTSEXTRACT" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "PRINTSEXTRACT" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/profit.1e b/debian/manpages/profit.1e
index 1af8ed0..e954fd7 100644
--- a/debian/manpages/profit.1e
+++ b/debian/manpages/profit.1e
@@ -2,12 +2,21 @@
.\" Title: PROFIT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "PROFIT" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "PROFIT" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/prophecy.1e b/debian/manpages/prophecy.1e
index 94e9e08..d22cbcb 100644
--- a/debian/manpages/prophecy.1e
+++ b/debian/manpages/prophecy.1e
@@ -2,12 +2,21 @@
.\" Title: PROPHECY
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "PROPHECY" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "PROPHECY" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/prophet.1e b/debian/manpages/prophet.1e
index 7c8a9ea..d78aea8 100644
--- a/debian/manpages/prophet.1e
+++ b/debian/manpages/prophet.1e
@@ -2,12 +2,21 @@
.\" Title: PROPHET
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "PROPHET" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "PROPHET" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/prosextract.1e b/debian/manpages/prosextract.1e
index 43b31b3..6779143 100644
--- a/debian/manpages/prosextract.1e
+++ b/debian/manpages/prosextract.1e
@@ -2,12 +2,21 @@
.\" Title: PROSEXTRACT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "PROSEXTRACT" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "PROSEXTRACT" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/pscan.1e b/debian/manpages/pscan.1e
index 1266202..a2b51e7 100644
--- a/debian/manpages/pscan.1e
+++ b/debian/manpages/pscan.1e
@@ -2,12 +2,21 @@
.\" Title: PSCAN
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "PSCAN" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "PSCAN" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/psiphi.1e b/debian/manpages/psiphi.1e
index e81afbd..9b9a33e 100644
--- a/debian/manpages/psiphi.1e
+++ b/debian/manpages/psiphi.1e
@@ -2,12 +2,21 @@
.\" Title: PSIPHI
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "PSIPHI" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "PSIPHI" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/rebaseextract.1e b/debian/manpages/rebaseextract.1e
index 8adae13..09effd6 100644
--- a/debian/manpages/rebaseextract.1e
+++ b/debian/manpages/rebaseextract.1e
@@ -2,12 +2,21 @@
.\" Title: REBASEEXTRACT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "REBASEEXTRACT" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "REBASEEXTRACT" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/recoder.1e b/debian/manpages/recoder.1e
index 03e6ffb..d922854 100644
--- a/debian/manpages/recoder.1e
+++ b/debian/manpages/recoder.1e
@@ -2,12 +2,21 @@
.\" Title: RECODER
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "RECODER" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "RECODER" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/redata.1e b/debian/manpages/redata.1e
index 11a9db0..b1cea4b 100644
--- a/debian/manpages/redata.1e
+++ b/debian/manpages/redata.1e
@@ -2,12 +2,21 @@
.\" Title: REDATA
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "REDATA" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "REDATA" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -34,7 +43,7 @@ is a command line program from EMBOSS (\(lqthe European Molecular Biology Open S
.PP
\fB\-enzyme\fR \fIstring\fR
.RS 4
-Enter the name of the restriction enzyme that you wish to get details of\&. The names often have a \'I\' in them \- this is a capital \'i\', not a \'1\' or an \'l\'\&. The names are case\-independent (\'AaeI\' is the same as \'aaei\') Default value: BamHI
+Enter the name of the restriction enzyme that you wish to get details of\&. The names often have a \*(AqI\*(Aq in them \- this is a capital \*(Aqi\*(Aq, not a \*(Aq1\*(Aq or an \*(Aql\*(Aq\&. The names are case\-independent (\*(AqAaeI\*(Aq is the same as \*(Aqaaei\*(Aq) Default value: BamHI
.RE
.SS "Output section"
.PP
diff --git a/debian/manpages/remap.1e b/debian/manpages/remap.1e
index b7f16c2..e0067a4 100644
--- a/debian/manpages/remap.1e
+++ b/debian/manpages/remap.1e
@@ -2,12 +2,21 @@
.\" Title: REMAP
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "REMAP" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "REMAP" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -44,7 +53,7 @@ Default value: Emethylsites\&.dat
.PP
\fB\-enzymes\fR \fIstring\fR
.RS 4
-The name \'all\' reads in all enzyme names from the REBASE database\&. You can specify enzymes by giving their names with commas between then, such as: \'HincII,hinfI,ppiI,hindiii\'\&. The case of the names is not important\&. You can specify a file of enzyme names to read in by giving the name of the file holding the enzyme names with a \'@\' character in front of it, for example, \'@enz\&.list\'\&. Blank lines and lines starting with a hash character or \'!\' are ignored and all other lines are concatenated together with a comma character \',\' and then treated as the list of enzymes to search for\&. An example of a file of enzyme names is: ! my enzymes HincII, ppiII ! other enzymes hindiii HinfI PpiI Default value: all
+The name \*(Aqall\*(Aq reads in all enzyme names from the REBASE database\&. You can specify enzymes by giving their names with commas between then, such as: \*(AqHincII,hinfI,ppiI,hindiii\*(Aq\&. The case of the names is not important\&. You can specify a file of enzyme names to read in by giving the name of the file holding the enzyme names with a \*(Aq@\*(Aq character in front of it, for example, \*(Aq at enz\&.list\*(Aq\&. Blank lines and lines starting with a hash character or \*(Aq!\*(Aq are ignored and all other lines are concatenated together with a comma character \*(Aq,\*(Aq and then treated as the list of enzymes to search for\&. An example of a file of enzyme names is: ! my enzymes HincII, ppiII ! other enzymes hindiii HinfI PpiI Default value: all
.RE
.PP
\fB\-sitelen\fR \fIinteger\fR
@@ -80,7 +89,7 @@ This allows those enzymes which cut at different positions on the forward and re
.PP
\fB\-ambiguity\fR \fIboolean\fR
.RS 4
-This allows those enzymes which have one or more \'N\' ambiguity codes in their pattern to be considered Default value: Y
+This allows those enzymes which have one or more \*(AqN\*(Aq ambiguity codes in their pattern to be considered Default value: Y
.RE
.PP
\fB\-plasmid\fR \fIboolean\fR
@@ -95,7 +104,7 @@ If this is set then RE recognition sites will not match methylated bases\&. Defa
.PP
\fB\-commercial\fR \fIboolean\fR
.RS 4
-If this is set, then only those enzymes with a commercial supplier will be searched for\&. This qualifier is ignored if you have specified an explicit list of enzymes to search for, rather than searching through \'all\' the enzymes in the REBASE database\&. It is assumed that, if you are asking for an explicit enzyme, then you probably know where to get it from and so all enzymes names that you have asked to be searched for, and which cut, will be reported whether or not they have a commercial supplier\&. Default value: Y
+If this is set, then only those enzymes with a commercial supplier will be searched for\&. This qualifier is ignored if you have specified an explicit list of enzymes to search for, rather than searching through \*(Aqall\*(Aq the enzymes in the REBASE database\&. It is assumed that, if you are asking for an explicit enzyme, then you probably know where to get it from and so all enzymes names that you have asked to be searched for, and which cut, will be reported whether or not they have a commercial supplier\&. Default value: Y
.RE
.PP
\fB\-table\fR \fIlist\fR
@@ -119,12 +128,12 @@ This produces lists in the output of the enzymes that cut, those that cut but ar
.PP
\fB\-flatreformat\fR \fIboolean\fR
.RS 4
-This changes the output format to one where the recognition site is indicated by a row of \'===\' characters and the cut site is pointed to by a \'>\' character in the forward sense, or a \'<\' in the reverse sense strand\&. Default value: N
+This changes the output format to one where the recognition site is indicated by a row of \*(Aq===\*(Aq characters and the cut site is pointed to by a \*(Aq>\*(Aq character in the forward sense, or a \*(Aq<\*(Aq in the reverse sense strand\&. Default value: N
.RE
.PP
\fB\-limit\fR \fIboolean\fR
.RS 4
-This limits the reporting of enzymes to just one enzyme from each group of isoschizomers\&. The enzyme chosen to represent an isoschizomer group is the prototype indicated in the data file \'embossre\&.equ\', which is created by the program \'rebaseextract\'\&. If you prefer different prototypes to be used, make a copy of embossre\&.equ in your home directory and edit it\&. If this value is set to be false then all of the input enzymes will be reported\&. You might like to set this to false if you are supplying an explicit set of enzymes rather than searching \'all\' of them\&. Default value: Y
+This limits the reporting of enzymes to just one enzyme from each group of isoschizomers\&. The enzyme chosen to represent an isoschizomer group is the prototype indicated in the data file \*(Aqembossre\&.equ\*(Aq, which is created by the program \*(Aqrebaseextract\*(Aq\&. If you prefer different prototypes to be used, make a copy of embossre\&.equ in your home directory and edit it\&. If this value is set to be false then all of the input enzymes will be reported\&. You might like to set this to false if you are supplying an explicit set of enzymes rather than searching \*(Aqall\*(Aq of them\&. Default value: Y
.RE
.PP
\fB\-translation\fR \fIboolean\fR
@@ -139,7 +148,7 @@ This displays the cut sites and translation of the reverse sense\&. Default valu
.PP
\fB\-orfminsize\fR \fIinteger\fR
.RS 4
-This sets the minimum size of Open Reading Frames (ORFs) to display in the translations\&. All other translation regions are masked by changing the amino acids to \'\-\' characters\&.
+This sets the minimum size of Open Reading Frames (ORFs) to display in the translations\&. All other translation regions are masked by changing the amino acids to \*(Aq\-\*(Aq characters\&.
.RE
.PP
\fB\-uppercase\fR \fIrange\fR
@@ -149,7 +158,7 @@ Regions to put in uppercase\&. If this is left blank, then the sequence case is
.PP
\fB\-highlight\fR \fIrange\fR
.RS 4
-Regions to colour if formatting for HTML\&. If this is left blank, then the sequence is left alone\&. A set of regions is specified by a set of pairs of positions\&. The positions are integers\&. They are followed by any valid HTML font colour\&. Examples of region specifications are: 24\-45 blue 56\-78 orange 1\-100 green 120\-156 red A file of ranges to colour (one range per line) can be specified as \'@filename\'\&.
+Regions to colour if formatting for HTML\&. If this is left blank, then the sequence is left alone\&. A set of regions is specified by a set of pairs of positions\&. The positions are integers\&. They are followed by any valid HTML font colour\&. Examples of region specifications are: 24\-45 blue 56\-78 orange 1\-100 green 120\-156 red A file of ranges to colour (one range per line) can be specified as \*(Aq at filename\*(Aq\&.
.RE
.PP
\fB\-threeletter\fR \fIboolean\fR
diff --git a/debian/manpages/restover.1e b/debian/manpages/restover.1e
index a8d5479..eab3c56 100644
--- a/debian/manpages/restover.1e
+++ b/debian/manpages/restover.1e
@@ -2,12 +2,21 @@
.\" Title: RESTOVER
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "RESTOVER" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "RESTOVER" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/restrict.1e b/debian/manpages/restrict.1e
index d53cfbd..fdb18a0 100644
--- a/debian/manpages/restrict.1e
+++ b/debian/manpages/restrict.1e
@@ -2,12 +2,21 @@
.\" Title: RESTRICT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "RESTRICT" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "RESTRICT" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -53,7 +62,7 @@ This sets the minimum length of the restriction enzyme recognition site\&. Any e
.PP
\fB\-enzymes\fR \fIstring\fR
.RS 4
-The name \'all\' reads in all enzyme names from the REBASE database\&. You can specify enzymes by giving their names with commas between then, such as: \'HincII,hinfI,ppiI,hindiii\'\&. The case of the names is not important\&. You can specify a file of enzyme names to read in by giving the name of the file holding the enzyme names with a \'@\' character in front of it, for example, \'@enz\&.list\'\&. Blank lines and lines starting with a hash character or \'!\' are ignored and all other lines are concatenated together with a comma character \',\' and then treated as the list of enzymes to search for\&. An example of a file of enzyme names is: ! my enzymes HincII, ppiII ! other enzymes hindiii HinfI PpiI Default value: all
+The name \*(Aqall\*(Aq reads in all enzyme names from the REBASE database\&. You can specify enzymes by giving their names with commas between then, such as: \*(AqHincII,hinfI,ppiI,hindiii\*(Aq\&. The case of the names is not important\&. You can specify a file of enzyme names to read in by giving the name of the file holding the enzyme names with a \*(Aq@\*(Aq character in front of it, for example, \*(Aq at enz\&.list\*(Aq\&. Blank lines and lines starting with a hash character or \*(Aq!\*(Aq are ignored and all other lines are concatenated together with a comma character \*(Aq,\*(Aq and then treated as the list of enzymes to search for\&. An example of a file of enzyme names is: ! my enzymes HincII, ppiII ! other enzymes hindiii HinfI PpiI Default value: all
.RE
.SS "Advanced section"
.PP
@@ -89,7 +98,7 @@ This allows those enzymes which cut at different positions on the forward and re
.PP
\fB\-ambiguity\fR \fIboolean\fR
.RS 4
-This allows those enzymes which have one or more \'N\' ambiguity codes in their pattern to be considered Default value: Y
+This allows those enzymes which have one or more \*(AqN\*(Aq ambiguity codes in their pattern to be considered Default value: Y
.RE
.PP
\fB\-plasmid\fR \fIboolean\fR
@@ -104,13 +113,13 @@ If this is set then RE recognition sites will not match methylated bases\&. Defa
.PP
\fB\-commercial\fR \fIboolean\fR
.RS 4
-If this is set, then only those enzymes with a commercial supplier will be searched for\&. This qualifier is ignored if you have specified an explicit list of enzymes to search for, rather than searching through \'all\' the enzymes in the REBASE database\&. It is assumed that, if you are asking for an explicit enzyme, then you probably know where to get it from and so all enzymes names that you have asked to be searched for, and which cut, will be reported whether or not they have a commercial supplier\&. Default value: Y
+If this is set, then only those enzymes with a commercial supplier will be searched for\&. This qualifier is ignored if you have specified an explicit list of enzymes to search for, rather than searching through \*(Aqall\*(Aq the enzymes in the REBASE database\&. It is assumed that, if you are asking for an explicit enzyme, then you probably know where to get it from and so all enzymes names that you have asked to be searched for, and which cut, will be reported whether or not they have a commercial supplier\&. Default value: Y
.RE
.SS "Output section"
.PP
\fB\-limit\fR \fIboolean\fR
.RS 4
-This limits the reporting of enzymes to just one enzyme from each group of isoschizomers\&. The enzyme chosen to represent an isoschizomer group is the prototype indicated in the data file \'embossre\&.equ\', which is created by the program \'rebaseextract\'\&. If you prefer different prototypes to be used, make a copy of embossre\&.equ in your home directory and edit it\&. If this value is set to be false then all of the input enzymes will be reported\&. You might like to set this to false if you are supplying an explicit set of enzymes rather than searching \'all\' of them\&. Default value: Y
+This limits the reporting of enzymes to just one enzyme from each group of isoschizomers\&. The enzyme chosen to represent an isoschizomer group is the prototype indicated in the data file \*(Aqembossre\&.equ\*(Aq, which is created by the program \*(Aqrebaseextract\*(Aq\&. If you prefer different prototypes to be used, make a copy of embossre\&.equ in your home directory and edit it\&. If this value is set to be false then all of the input enzymes will be reported\&. You might like to set this to false if you are supplying an explicit set of enzymes rather than searching \*(Aqall\*(Aq of them\&. Default value: Y
.RE
.PP
\fB\-alphabetic\fR \fIboolean\fR
diff --git a/debian/manpages/revseq.1e b/debian/manpages/revseq.1e
index 72b1028..8bd4214 100644
--- a/debian/manpages/revseq.1e
+++ b/debian/manpages/revseq.1e
@@ -2,12 +2,21 @@
.\" Title: REVSEQ
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "REVSEQ" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "REVSEQ" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/seealso.1e b/debian/manpages/seealso.1e
index e491703..96da2fe 100644
--- a/debian/manpages/seealso.1e
+++ b/debian/manpages/seealso.1e
@@ -2,12 +2,21 @@
.\" Title: SEEALSO
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "SEEALSO" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "SEEALSO" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -40,7 +49,7 @@ Enter the name of an EMBOSS program
.PP
\fB\-explode\fR \fIboolean\fR
.RS 4
-The groups that EMBOSS applications belong to have two forms, exploded and not exploded\&. The exploded group names are more numerous and often vaguely phrased than the non\-exploded ones\&. The exploded names are formed from definitions of the group names that start like NAME1:NAME2 and which are then expanded into many combinations of the names as: \'NAME1\', \'NAME2\', \'NAME1 NAME2\', NAME2 NAME1\'\&. The non\-expanded names are simply like: \'NAME1 NAME2\'\&. Using expanded group names will find many more programs which share at least some of the expanded names than using the non\-exploded names and so you will get more programs reported as sharing a similar function than you will if you specify that you wish to use non\-exploded names Default value: N
+The groups that EMBOSS applications belong to have two forms, exploded and not exploded\&. The exploded group names are more numerous and often vaguely phrased than the non\-exploded ones\&. The exploded names are formed from definitions of the group names that start like NAME1:NAME2 and which are then expanded into many combinations of the names as: \*(AqNAME1\*(Aq, \*(AqNAME2\*(Aq, \*(AqNAME1 NAME2\*(Aq, NAME2 NAME1\*(Aq\&. The non\-expanded names are simply like: \*(AqNAME1 NAME2\*(Aq\&. Using expanded group names will find many more programs which share at least some of the expanded names than using the non\-exploded names and so you will get more programs reported as sharing a similar function than you will if you specify that you wish to use non\-exploded names Default value: N
.RE
.SS "Advanced section"
.PP
@@ -78,7 +87,7 @@ If you use this option, then only the group names will output to the file Defaul
.PP
\fB\-colon\fR \fIboolean\fR
.RS 4
-The groups that EMBOSS applications belong to have up to two levels, for example the primary group \'ALIGNMENT\' has several sub\-groups, or second\-level groups, e\&.g\&.: CONSENSUS, DIFFERENCES, DOT PLOTS, GLOBAL, LOCAL, MULTIPLE\&. To aid programs that parse the output of seealso that require the names of these subgroups, a colon \':\' will be placed between the first and second level of the group name if this option is true\&. Default value: N
+The groups that EMBOSS applications belong to have up to two levels, for example the primary group \*(AqALIGNMENT\*(Aq has several sub\-groups, or second\-level groups, e\&.g\&.: CONSENSUS, DIFFERENCES, DOT PLOTS, GLOBAL, LOCAL, MULTIPLE\&. To aid programs that parse the output of seealso that require the names of these subgroups, a colon \*(Aq:\*(Aq will be placed between the first and second level of the group name if this option is true\&. Default value: N
.RE
.SH "BUGS"
.PP
diff --git a/debian/manpages/seqinfo.1e b/debian/manpages/seqinfo.1e
index 9cdbcb2..7f7a91e 100644
--- a/debian/manpages/seqinfo.1e
+++ b/debian/manpages/seqinfo.1e
@@ -2,12 +2,21 @@
.\" Title: SEQINFO
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "SEQINFO" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "SEQINFO" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/seqmatchall.1e b/debian/manpages/seqmatchall.1e
index 9a48974..70880fc 100644
--- a/debian/manpages/seqmatchall.1e
+++ b/debian/manpages/seqmatchall.1e
@@ -2,12 +2,21 @@
.\" Title: SEQMATCHALL
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "SEQMATCHALL" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "SEQMATCHALL" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/seqret.1e b/debian/manpages/seqret.1e
index 4ee4501..13eebfd 100644
--- a/debian/manpages/seqret.1e
+++ b/debian/manpages/seqret.1e
@@ -2,12 +2,21 @@
.\" Title: SEQRET
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "SEQRET" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "SEQRET" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/seqretall.1e b/debian/manpages/seqretall.1e
index 59c0176..6637f8b 100644
--- a/debian/manpages/seqretall.1e
+++ b/debian/manpages/seqretall.1e
@@ -2,12 +2,21 @@
.\" Title: SEQRETALL
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "SEQRETALL" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "SEQRETALL" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/seqretallfeat.1e b/debian/manpages/seqretallfeat.1e
index 8a9ec3d..d7917e3 100644
--- a/debian/manpages/seqretallfeat.1e
+++ b/debian/manpages/seqretallfeat.1e
@@ -2,12 +2,21 @@
.\" Title: SEQRETALLFEAT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "SEQRETALLFEAT" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "SEQRETALLFEAT" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/seqretset.1e b/debian/manpages/seqretset.1e
index f3e23a3..14e61b3 100644
--- a/debian/manpages/seqretset.1e
+++ b/debian/manpages/seqretset.1e
@@ -2,12 +2,21 @@
.\" Title: SEQRETSET
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "SEQRETSET" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "SEQRETSET" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/seqretsetall.1e b/debian/manpages/seqretsetall.1e
index dfaa209..459f3f4 100644
--- a/debian/manpages/seqretsetall.1e
+++ b/debian/manpages/seqretsetall.1e
@@ -2,12 +2,21 @@
.\" Title: SEQRETSETALL
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "SEQRETSETALL" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "SEQRETSETALL" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/seqretsingle.1e b/debian/manpages/seqretsingle.1e
index 60f304e..3c281df 100644
--- a/debian/manpages/seqretsingle.1e
+++ b/debian/manpages/seqretsingle.1e
@@ -2,12 +2,21 @@
.\" Title: SEQRETSINGLE
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "SEQRETSINGLE" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "SEQRETSINGLE" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/seqretsplit.1e b/debian/manpages/seqretsplit.1e
index a9fa236..d01d9b8 100644
--- a/debian/manpages/seqretsplit.1e
+++ b/debian/manpages/seqretsplit.1e
@@ -2,12 +2,21 @@
.\" Title: SEQRETSPLIT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "SEQRETSPLIT" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "SEQRETSPLIT" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/seqrettype.1e b/debian/manpages/seqrettype.1e
index ec1a803..692bb3c 100644
--- a/debian/manpages/seqrettype.1e
+++ b/debian/manpages/seqrettype.1e
@@ -2,12 +2,21 @@
.\" Title: SEQRETTYPE
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "SEQRETTYPE" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "SEQRETTYPE" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/seqxrefall.1e b/debian/manpages/seqxrefall.1e
index f26df25..6102553 100644
--- a/debian/manpages/seqxrefall.1e
+++ b/debian/manpages/seqxrefall.1e
@@ -2,12 +2,21 @@
.\" Title: SEQXREFALL
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "SEQXREFALL" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "SEQXREFALL" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/showalign.1e b/debian/manpages/showalign.1e
index e129f2a..ab03e51 100644
--- a/debian/manpages/showalign.1e
+++ b/debian/manpages/showalign.1e
@@ -2,12 +2,21 @@
.\" Title: SHOWALIGN
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "SHOWALIGN" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "SHOWALIGN" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -39,18 +48,18 @@ The sequence alignment to be displayed\&.
.PP
\fB\-matrix\fR \fImatrix\fR
.RS 4
-This is the scoring matrix file used when comparing sequences\&. By default it is the file \'EBLOSUM62\' (for proteins) or the file \'EDNAFULL\' (for nucleic sequences)\&. These files are found in the \'data\' directory of the EMBOSS installation\&.
+This is the scoring matrix file used when comparing sequences\&. By default it is the file \*(AqEBLOSUM62\*(Aq (for proteins) or the file \*(AqEDNAFULL\*(Aq (for nucleic sequences)\&. These files are found in the \*(Aqdata\*(Aq directory of the EMBOSS installation\&.
.RE
.SS "Additional section"
.PP
\fB\-refseq\fR \fIstring\fR
.RS 4
-If you give the number in the alignment or the name of a sequence, it will be taken to be the reference sequence\&. The reference sequence is always show in full and is the one against which all the other sequences are compared\&. If this is set to 0 then the consensus sequence will be used as the reference sequence\&. By default the consensus sequence is used as the reference sequence\&.
+If you give the number in the alignment or the name of a sequence, it will be taken to be the reference sequence\&. The reference sequence is always shown in full and is the one against which all the other sequences are compared\&. If this is set to 0 then the consensus sequence will be used as the reference sequence\&. By default the consensus sequence is used as the reference sequence\&.
.RE
.PP
\fB\-bottom\fR \fIboolean\fR
.RS 4
-If this is true then the reference sequence is displayed at the bottom of the alignment as well as at the top\&. Default value: Y
+If this is true then the reference sequence is displayed at the bottom of the alignment instead of the top\&. Default value: Y
.RE
.PP
\fB\-show\fR \fIlist\fR
@@ -65,7 +74,7 @@ Default value: I
.PP
\fB\-similarcase\fR \fIboolean\fR
.RS 4
-If this is set True, then when \-show is set to \'Similarities\' or \'Non\-identities\' and a residue is similar but not identical to the reference sequence residue, it will be changed to lower\-case\&. If \-show is set to \'All\' then non\-identical, non\-similar residues will be changed to lower\-case\&. If this is False then no change to the case of the residues is made on the basis of their similarity to the reference sequence\&. Default value: Y
+If this is set True, then when \-show is set to \*(AqSimilarities\*(Aq or \*(AqNon\-identities\*(Aq and a residue is similar but not identical to the reference sequence residue, it will be changed to lower\-case\&. If \-show is set to \*(AqAll\*(Aq then non\-identical, non\-similar residues will be changed to lower\-case\&. If this is False then no change to the case of the residues is made on the basis of their similarity to the reference sequence\&. Default value: Y
.RE
.PP
\fB\-consensus\fR \fIboolean\fR
@@ -106,7 +115,7 @@ Default value: N
.PP
\fB\-highlight\fR \fIrange\fR
.RS 4
-Regions to colour if formatting for HTML\&. If this is left blank, then the sequence is left alone\&. A set of regions is specified by a set of pairs of positions\&. The positions are integers\&. They are followed by any valid HTML font colour\&. Examples of region specifications are: 24\-45 blue 56\-78 orange 1\-100 green 120\-156 red A file of ranges to colour (one range per line) can be specified as \'@filename\'\&.
+Regions to colour if formatting for HTML\&. If this is left blank, then the sequence is left alone\&. A set of regions is specified by a set of pairs of positions\&. The positions are integers\&. They are followed by any valid HTML font colour\&. Examples of region specifications are: 24\-45 blue 56\-78 orange 1\-100 green 120\-156 red A file of ranges to colour (one range per line) can be specified as \*(Aq at filename\*(Aq\&.
.RE
.PP
\fB\-plurality\fR \fIfloat\fR
@@ -126,7 +135,7 @@ Provides the facility of setting the required number of identities at a position
.PP
\fB\-gaps\fR \fIboolean\fR
.RS 4
-If this option is true then gap characters can appear in the consensus\&. The alternative is \'N\' for nucleotide, or \'X\' for protein Default value: Y
+If this option is true then gap characters can appear in the consensus\&. The alternative is \*(AqN\*(Aq for nucleotide, or \*(AqX\*(Aq for protein Default value: Y
.RE
.SS "Output section"
.PP
diff --git a/debian/manpages/showdb.1e b/debian/manpages/showdb.1e
index a3c8648..84db7e2 100644
--- a/debian/manpages/showdb.1e
+++ b/debian/manpages/showdb.1e
@@ -2,12 +2,21 @@
.\" Title: SHOWDB
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "SHOWDB" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "SHOWDB" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -64,7 +73,7 @@ This displays the access methods that can be used on this database, for all, que
.PP
\fB\-fields\fR \fIboolean\fR
.RS 4
-This displays the search fields that can be used on this database, other than the standard \'id\' or \'acc\' fields\&. Default value: $(full)
+This displays the search fields that can be used on this database, other than the standard \*(Aqid\*(Aq or \*(Aqacc\*(Aq fields\&. Default value: $(full)
.RE
.PP
\fB\-defined\fR \fIboolean\fR
@@ -80,7 +89,7 @@ Default value: $(full)
.PP
\fB\-only\fR \fItoggle\fR
.RS 4
-This is a way of shortening the command line if you only want a few standard columns to be displayed\&. Instead of specifying: \'\-nohead \-notype \-noid \-noquery \-noall\' to get only the comment output, you can specify \'\-only \-comment\' Default value: N
+This is a way of shortening the command line if you only want a few standard columns to be displayed\&. Instead of specifying: \*(Aq\-nohead \-notype \-noid \-noquery \-noall\*(Aq to get only the comment output, you can specify \*(Aq\-only \-comment\*(Aq Default value: N
.RE
.PP
\fB\-heading\fR \fIboolean\fR
diff --git a/debian/manpages/showdball.1e b/debian/manpages/showdball.1e
index a6673a8..7c2c711 100644
--- a/debian/manpages/showdball.1e
+++ b/debian/manpages/showdball.1e
@@ -2,12 +2,21 @@
.\" Title: SHOWDBALL
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "SHOWDBALL" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "SHOWDBALL" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -34,7 +43,7 @@ is a command line program from EMBOSS (\(lqthe European Molecular Biology Open S
.PP
\fB\-name\fR \fIarraystring\fR
.RS 4
-Standard names of databases are given in the EMBOSS datafile \'dbref\&.dat\'\&.
+Standard names of databases are given in the EMBOSS datafile \*(Aqdbref\&.dat\*(Aq\&.
.RE
.PP
\fB\-dbref\fR \fIdatafile\fR
@@ -60,7 +69,7 @@ This specifies the SwissProt categories of database to display in the output fil
.PP
\fB\-display\fR \fIselection\fR
.RS 4
-The output can include named database(s) only (\'database\' option), databases in one or more categories from SwissProt (\'category\') or the EDAM ontology (\'edam\'), or all known databases (\'all\')\&. Default value: database
+The output can include named database(s) only (\*(Aqdatabase\*(Aq option), databases in one or more categories from SwissProt (\*(Aqcategory\*(Aq) or the EDAM ontology (\*(Aqedam\*(Aq), or all known databases (\*(Aqall\*(Aq)\&. Default value: database
.RE
.SS "Additional section"
.PP
@@ -75,7 +84,7 @@ Default value: N
.PP
\fB\-all\fR \fItoggle\fR
.RS 4
-This will display all available columns\&. It can be combined with \-noCOLNMAE to display all but the named columns e\&.g\&. \'\-full \-nodesc\'\&. Default value: N
+This will display all available columns\&. It can be combined with \-noCOLNMAE to display all but the named columns e\&.g\&. \*(Aq\-full \-nodesc\*(Aq\&. Default value: N
.RE
.PP
\fB\-name\fR \fIboolean\fR
diff --git a/debian/manpages/showfeat.1e b/debian/manpages/showfeat.1e
index 73effc6..af7b0a8 100644
--- a/debian/manpages/showfeat.1e
+++ b/debian/manpages/showfeat.1e
@@ -2,12 +2,21 @@
.\" Title: SHOWFEAT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "SHOWFEAT" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "SHOWFEAT" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -39,22 +48,22 @@ is a command line program from EMBOSS (\(lqthe European Molecular Biology Open S
.PP
\fB\-sourcematch\fR \fIstring\fR
.RS 4
-By default any feature source in the feature table is shown\&. You can set this to match any feature source you wish to show\&. The source name is usually either the name of the program that detected the feature or it is the feature table (eg: EMBL) that the feature came from\&. The source may be wildcarded by using \'*\'\&. If you wish to show more than one source, separate their names with the character \'|\', eg: gene* | embl Default value: *
+By default any feature source in the feature table is shown\&. You can set this to match any feature source you wish to show\&. The source name is usually either the name of the program that detected the feature or it is the feature table (eg: EMBL) that the feature came from\&. The source may be wildcarded by using \*(Aq*\*(Aq\&. If you wish to show more than one source, separate their names with the character \*(Aq|\*(Aq, eg: gene* | embl Default value: *
.RE
.PP
\fB\-typematch\fR \fIstring\fR
.RS 4
-By default any feature type in the feature table is shown\&. You can set this to match any feature type you wish to show\&. See http://www3\&.ebi\&.ac\&.uk/Services/WebFeat/ for a list of the EMBL feature types and see Appendix A of the Swissprot user manual in http://www\&.expasy\&.ch/txt/userman\&.txt for a list of the Swissprot feature types\&. The type may be wildcarded by using \'*\'\&. If you wish to show more than one type, separate their names with the character \'|\', eg: *UTR | intron Default value: *
+By default any feature type in the feature table is shown\&. You can set this to match any feature type you wish to show\&. See http://www\&.ebi\&.ac\&.uk/embl/WebFeat/ for a list of the EMBL feature types and see Appendix A of the Swissprot user manual in http://www\&.expasy\&.org/sprot/userman\&.html for a list of the Swissprot feature types\&. The type may be wildcarded by using \*(Aq*\*(Aq\&. If you wish to show more than one type, separate their names with the character \*(Aq|\*(Aq, eg: *UTR | intron Default value: *
.RE
.PP
\fB\-tagmatch\fR \fIstring\fR
.RS 4
-Tags are the types of extra values that a feature may have\&. For example in the EMBL feature table, a \'CDS\' type of feature may have the tags \'/codon\', \'/codon_start\', \'/db_xref\', \'/EC_number\', \'/evidence\', \'/exception\', \'/function\', \'/gene\', \'/label\', \'/map\', \'/note\', \'/number\', \'/partial\', \'/product\', \'/protein_id\', \'/pseudo\', \'/standard_name\', \'/translation\', \'/transl_except\', \'/transl_table\', or \'/usedin\'\&. Some of these tags also have values, for example \'/gene\' can have the value of the gene name\&. By default any feature tag in the feature table is shown\&. You can set this to match any feature tag you wish to show\&. The tag may be wildcarded by using \'*\'\&. If you wish to show more than one tag, separate their names with the character \'|\', eg: gene | label Default value: *
+Tags are the types of extra values that a feature may have\&. For example in the EMBL feature table, a \*(AqCDS\*(Aq type of feature may have the tags \*(Aq/codon\*(Aq, \*(Aq/codon_start\*(Aq, \*(Aq/db_xref\*(Aq, \*(Aq/EC_number\*(Aq, \*(Aq/evidence\*(Aq, \*(Aq/exception\*(Aq, \*(Aq/function\*(Aq, \*(Aq/gene\*(Aq, \*(Aq/label\*(Aq, \*(Aq/map\*(Aq, \*(Aq/note\*(Aq, \*(Aq/number\*(Aq, \*(Aq/partial\*(Aq, \*(Aq/product\*(Aq, \*(Aq/protein_id\*(Aq, \*(Aq/pseudo\*(Aq, \*(Aq/standard_name\*(Aq, \*(Aq/translation\*(Aq, \*(Aq/transl_except\*(Aq, \*(Aq/transl_table\*(Aq, or \*(Aq/usedin\*(Aq\&. Some of these tags also have values, for example \*(Aq/gene\*(Aq can have the value of the gene name\&. By default any feature tag in the feature table is shown\&. You can set this to match any feature tag you wish to show\&. The tag may be wildcarded by using \*(Aq*\*(Aq\&. If you wish to show more than one tag, separate their names with the character \*(Aq|\*(Aq, eg: gene | label Default value: *
.RE
.PP
\fB\-valuematch\fR \fIstring\fR
.RS 4
-Tag values are the values associated with a feature tag\&. Tags are the types of extra values that a feature may have\&. For example in the EMBL feature table, a \'CDS\' type of feature may have the tags \'/codon\', \'/codon_start\', \'/db_xref\', \'/EC_number\', \'/evidence\', \'/exception\', \'/function\', \'/gene\', \'/label\', \'/map\', \'/note\', \'/number\', \'/partial\', \'/product\', \'/protein_id\', \'/pseudo\', \'/standard_name\', \'/translation\', \'/transl_except\', \'/transl_table\', or \'/usedin\'\&. Only some of these tags can have values, for example \'/gene\' can have the value of the gene name\&. By default any feature tag value in the feature table is shown\&. You can set this to match any feature tag value you wish to show\&. The tag value may be wildcarded by using \'*\'\&. If you wish to show more than one tag value, separate their names with the character \'|\', eg: pax* | 10 Default value: *
+Tag values are the values associated with a feature tag\&. Tags are the types of extra values that a feature may have\&. For example in the EMBL feature table, a \*(AqCDS\*(Aq type of feature may have the tags \*(Aq/codon\*(Aq, \*(Aq/codon_start\*(Aq, \*(Aq/db_xref\*(Aq, \*(Aq/EC_number\*(Aq, \*(Aq/evidence\*(Aq, \*(Aq/exception\*(Aq, \*(Aq/function\*(Aq, \*(Aq/gene\*(Aq, \*(Aq/label\*(Aq, \*(Aq/map\*(Aq, \*(Aq/note\*(Aq, \*(Aq/number\*(Aq, \*(Aq/partial\*(Aq, \*(Aq/product\*(Aq, \*(Aq/protein_id\*(Aq, \*(Aq/pseudo\*(Aq, \*(Aq/standard_name\*(Aq, \*(Aq/translation\*(Aq, \*(Aq/transl_except\*(Aq, \*(Aq/transl_table\*(Aq, or \*(Aq/usedin\*(Aq\&. Only some of these tags can have values, for example \*(Aq/gene\*(Aq can have the value of the gene name\&. By default any feature tag value in the feature table is shown\&. You can set this to match any feature tag value you wish to show\&. The tag value may be wildcarded by using \*(Aq*\*(Aq\&. If you wish to show more than one tag value, separate their names with the character \*(Aq|\*(Aq, eg: pax* | 10 Default value: *
.RE
.PP
\fB\-sort\fR \fIlist\fR
@@ -69,7 +78,7 @@ Default value: N
.PP
\fB\-annotation\fR \fIrange\fR
.RS 4
-Regions to annotate by marking\&. If this is left blank, then no annotation is added\&. A set of regions is specified by a set of pairs of positions followed by optional text\&. The positions are integers\&. They are followed by any text (but not digits when on the command\-line)\&. Examples of region specifications are: 24\-45 new domain 56\-78 match to Mouse 1\-100 First part 120\-156 oligo A file of ranges to annotate (one range per line) can be specified as \'@filename\'\&.
+Regions to annotate by marking\&. If this is left blank, then no annotation is added\&. A set of regions is specified by a set of pairs of positions followed by optional text\&. The positions are integers\&. They are followed by any text (but not digits when on the command\-line)\&. Examples of region specifications are: 24\-45 new domain 56\-78 match to Mouse 1\-100 First part 120\-156 oligo A file of ranges to annotate (one range per line) can be specified as \*(Aq at filename\*(Aq\&.
.RE
.SS "Advanced section"
.PP
@@ -100,7 +109,7 @@ You can expand (or contract) the width of the ASCII\-character graphics display
.PP
\fB\-collapse\fR \fIboolean\fR
.RS 4
-If this is set, then features from the same source and of the same type and sense are all printed on the same line\&. For instance if there are several features from the EMBL feature table (ie\&. the same source) which are all of type \'exon\' in the same sense, then they will all be displayed on the same line\&. This makes it hard to distinguish overlapping features\&. If this is set to false then each feature is displayed on a separate line making it easier to distinguish where features start and end\&. Default value: N
+If this is set, then features from the same source and of the same type and sense are all printed on the same line\&. For instance if there are several features from the EMBL feature table (ie\&. the same source) which are all of type \*(Aqexon\*(Aq in the same sense, then they will all be displayed on the same line\&. This makes it hard to distinguish overlapping features\&. If this is set to false then each feature is displayed on a separate line making it easier to distinguish where features start and end\&. Default value: N
.RE
.PP
\fB\-forward\fR \fIboolean\fR
@@ -120,7 +129,7 @@ Set this to be false if you do not wish to display unknown sense features\&. (ie
.PP
\fB\-strand\fR \fIboolean\fR
.RS 4
-Set this if you wish to display the strand of the features\&. Protein features are always directionless (indicated by \'0\'), forward is indicated by \'+\' and reverse is \'\-\'\&. Default value: N
+Set this if you wish to display the strand of the features\&. Protein features are always directionless (indicated by \*(Aq0\*(Aq), forward is indicated by \*(Aq+\*(Aq and reverse is \*(Aq\-\*(Aq\&. Default value: N
.RE
.PP
\fB\-origin\fR \fIboolean\fR
@@ -130,7 +139,7 @@ Set this if you wish to display the origin of the features\&. The source name is
.PP
\fB\-position\fR \fIboolean\fR
.RS 4
-Set this if you wish to display the start and end position of the features\&. If several features are being displayed on the same line, then the start and end positions will be joined by a comma, for example: \'189\-189,225\-225\'\&. Default value: N
+Set this if you wish to display the start and end position of the features\&. If several features are being displayed on the same line, then the start and end positions will be joined by a comma, for example: \*(Aq189\-189,225\-225\*(Aq\&. Default value: N
.RE
.PP
\fB\-type\fR \fIboolean\fR
@@ -145,7 +154,7 @@ Set this to be false if you do not wish to display the tags and values of the fe
.PP
\fB\-values\fR \fIboolean\fR
.RS 4
-Set this to be false if you do not wish to display the tag values of the features\&. If this is set to be false, only the tag names will be displayed\&. If the tags are not displayed, then the values will not be displayed\&. The value of the \'translation\' tag is never displayed as it is often extremely long\&. Default value: Y
+Set this to be false if you do not wish to display the tag values of the features\&. If this is set to be false, only the tag names will be displayed\&. If the tags are not displayed, then the values will not be displayed\&. The value of the \*(Aqtranslation\*(Aq tag is never displayed as it is often extremely long\&. Default value: Y
.RE
.PP
\fB\-stricttags\fR \fIboolean\fR
diff --git a/debian/manpages/showorf.1e b/debian/manpages/showorf.1e
index 0d487b8..a517d31 100644
--- a/debian/manpages/showorf.1e
+++ b/debian/manpages/showorf.1e
@@ -2,12 +2,21 @@
.\" Title: SHOWORF
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "SHOWORF" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "SHOWORF" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/showpep.1e b/debian/manpages/showpep.1e
index 33a9903..1afc070 100644
--- a/debian/manpages/showpep.1e
+++ b/debian/manpages/showpep.1e
@@ -2,12 +2,21 @@
.\" Title: SHOWPEP
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "SHOWPEP" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "SHOWPEP" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -44,7 +53,7 @@ Default value: 2
.PP
\fB\-things\fR \fIlist\fR
.RS 4
-Specify a list of one or more code characters in the order in which you wish things to be displayed one above the other down the page\&. For example if you wish to see things displayed in the order: sequence, ticks line, blank line; then you should enter \'S,T,B\'\&. Default value: B,N,T,S,A,F
+Specify a list of one or more code characters in the order in which you wish things to be displayed one above the other down the page\&. For example if you wish to see things displayed in the order: sequence, ticks line, blank line; then you should enter \*(AqS,T,B\*(Aq\&. Default value: B,N,T,S,A,F
.RE
.SS "Additional section"
.PP
@@ -55,23 +64,23 @@ Regions to put in uppercase\&. If this is left blank, then the sequence case is
.PP
\fB\-highlight\fR \fIrange\fR
.RS 4
-Regions to colour if formatting for HTML\&. If this is left blank, then the sequence is left alone\&. A set of regions is specified by a set of pairs of positions\&. The positions are integers\&. They are followed by any valid HTML font colour\&. Examples of region specifications are: 24\-45 blue 56\-78 orange 1\-100 green 120\-156 red A file of ranges to colour (one range per line) can be specified as \'@filename\'\&.
+Regions to colour if formatting for HTML\&. If this is left blank, then the sequence is left alone\&. A set of regions is specified by a set of pairs of positions\&. The positions are integers\&. They are followed by any valid HTML font colour\&. Examples of region specifications are: 24\-45 blue 56\-78 orange 1\-100 green 120\-156 red A file of ranges to colour (one range per line) can be specified as \*(Aq at filename\*(Aq\&.
.RE
.PP
\fB\-annotation\fR \fIrange\fR
.RS 4
-Regions to annotate by marking\&. If this is left blank, then no annotation is added\&. A set of regions is specified by a set of pairs of positions followed by optional text\&. The positions are integers\&. They are followed by any text (but not digits when on the command\-line)\&. Examples of region specifications are: 24\-45 new domain 56\-78 match to Mouse 1\-100 First part 120\-156 oligo A file of ranges to annotate (one range per line) can be specified as \'@filename\'\&.
+Regions to annotate by marking\&. If this is left blank, then no annotation is added\&. A set of regions is specified by a set of pairs of positions followed by optional text\&. The positions are integers\&. They are followed by any text (but not digits when on the command\-line)\&. Examples of region specifications are: 24\-45 new domain 56\-78 match to Mouse 1\-100 First part 120\-156 oligo A file of ranges to annotate (one range per line) can be specified as \*(Aq at filename\*(Aq\&.
.RE
.SS "Feature display options"
.PP
\fB\-sourcematch\fR \fIstring\fR
.RS 4
-By default any feature source in the feature table is shown\&. You can set this to match any feature source you wish to show\&. The source name is usually either the name of the program that detected the feature or it is the feature table (eg: EMBL) that the feature came from\&. The source may be wildcarded by using \'*\'\&. If you wish to show more than one source, separate their names with the character \'|\', eg: gene* | embl Default value: *
+By default any feature source in the feature table is shown\&. You can set this to match any feature source you wish to show\&. The source name is usually either the name of the program that detected the feature or it is the feature table (eg: EMBL) that the feature came from\&. The source may be wildcarded by using \*(Aq*\*(Aq\&. If you wish to show more than one source, separate their names with the character \*(Aq|\*(Aq, eg: gene* | embl Default value: *
.RE
.PP
\fB\-typematch\fR \fIstring\fR
.RS 4
-By default any feature type in the feature table is shown\&. You can set this to match any feature type you wish to show\&. See http://www3\&.ebi\&.ac\&.uk/Services/WebFeat/ for a list of the EMBL feature types and see Appendix A of the Swissprot user manual in http://www\&.expasy\&.ch/txt/userman\&.txt for a list of the Swissprot feature types\&. The type may be wildcarded by using \'*\'\&. If you wish to show more than one type, separate their names with the character \'|\', eg: *UTR | intron Default value: *
+By default any feature type in the feature table is shown\&. You can set this to match any feature type you wish to show\&. See http://www\&.ebi\&.ac\&.uk/embl/WebFeat/ for a list of the EMBL feature types and see Appendix A of the Swissprot user manual in http://www\&.expasy\&.org/sprot/userman\&.html for a list of the Swissprot feature types\&. The type may be wildcarded by using \*(Aq*\*(Aq\&. If you wish to show more than one type, separate their names with the character \*(Aq|\*(Aq, eg: *UTR | intron Default value: *
.RE
.PP
\fB\-minscore\fR \fIfloat\fR
@@ -86,12 +95,12 @@ Maximum score of feature to display\&. If both minscore and maxscore are zero (t
.PP
\fB\-tagmatch\fR \fIstring\fR
.RS 4
-Tags are the types of extra values that a feature may have\&. By default any feature tag in the feature table is shown\&. You can set this to match any feature tag you wish to show\&. The tag may be wildcarded by using \'*\'\&. If you wish to show more than one tag, separate their names with the character \'|\', eg: gene | label Default value: *
+Tags are the types of extra values that a feature may have\&. By default any feature tag in the feature table is shown\&. You can set this to match any feature tag you wish to show\&. The tag may be wildcarded by using \*(Aq*\*(Aq\&. If you wish to show more than one tag, separate their names with the character \*(Aq|\*(Aq, eg: gene | label Default value: *
.RE
.PP
\fB\-valuematch\fR \fIstring\fR
.RS 4
-Tag values are the values associated with a feature tag\&. Tags are the types of extra values that a feature may have\&. By default any feature tag value in the feature table is shown\&. You can set this to match any feature tag value you wish to show\&. The tag value may be wildcarded by using \'*\'\&. If you wish to show more than one tag value, separate their names with the character \'|\', eg: pax* | 10 Default value: *
+Tag values are the values associated with a feature tag\&. Tags are the types of extra values that a feature may have\&. By default any feature tag value in the feature table is shown\&. You can set this to match any feature tag value you wish to show\&. The tag value may be wildcarded by using \*(Aq*\*(Aq\&. If you wish to show more than one tag value, separate their names with the character \*(Aq|\*(Aq, eg: pax* | 10 Default value: *
.RE
.PP
\fB\-stricttags\fR \fIboolean\fR
diff --git a/debian/manpages/showseq.1e b/debian/manpages/showseq.1e
index 4b7cb49..0288dd5 100644
--- a/debian/manpages/showseq.1e
+++ b/debian/manpages/showseq.1e
@@ -2,12 +2,21 @@
.\" Title: SHOWSEQ
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "SHOWSEQ" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "SHOWSEQ" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -49,7 +58,7 @@ Default value: 2
.PP
\fB\-things\fR \fIlist\fR
.RS 4
-Specify a list of one or more code characters in the order in which you wish things to be displayed one above the other down the page\&. For example if you wish to see things displayed in the order: sequence, complement sequence, ticks line, frame 1 translation, blank line; then you should enter \'S,C,T,1,B\'\&. Default value: B,N,T,S,A,F
+Specify a list of one or more code characters in the order in which you wish things to be displayed one above the other down the page\&. For example if you wish to see things displayed in the order: sequence, complement sequence, ticks line, frame 1 translation, blank line; then you should enter \*(AqS,C,T,1,B\*(Aq\&. Default value: B,N,T,S,A,F
.RE
.SS "Additional section"
.PP
@@ -70,17 +79,17 @@ Regions to put in uppercase\&. If this is left blank, then the sequence case is
.PP
\fB\-highlight\fR \fIrange\fR
.RS 4
-Regions to colour if formatting for HTML\&. If this is left blank, then the sequence is left alone\&. A set of regions is specified by a set of pairs of positions\&. The positions are integers\&. They are followed by any valid HTML font colour\&. Examples of region specifications are: 24\-45 blue 56\-78 orange 1\-100 green 120\-156 red A file of ranges to colour (one range per line) can be specified as \'@filename\'\&.
+Regions to colour if formatting for HTML\&. If this is left blank, then the sequence is left alone\&. A set of regions is specified by a set of pairs of positions\&. The positions are integers\&. They are followed by any valid HTML font colour\&. Examples of region specifications are: 24\-45 blue 56\-78 orange 1\-100 green 120\-156 red A file of ranges to colour (one range per line) can be specified as \*(Aq at filename\*(Aq\&.
.RE
.PP
\fB\-annotation\fR \fIrange\fR
.RS 4
-Regions to annotate by marking\&. If this is left blank, then no annotation is added\&. A set of regions is specified by a set of pairs of positions followed by optional text\&. The positions are integers\&. They are followed by any text (but not digits when on the command\-line)\&. Examples of region specifications are: 24\-45 new domain 56\-78 match to Mouse 1\-100 First part 120\-156 oligo A file of ranges to annotate (one range per line) can be specified as \'@filename\'\&.
+Regions to annotate by marking\&. If this is left blank, then no annotation is added\&. A set of regions is specified by a set of pairs of positions followed by optional text\&. The positions are integers\&. They are followed by any text (but not digits when on the command\-line)\&. Examples of region specifications are: 24\-45 new domain 56\-78 match to Mouse 1\-100 First part 120\-156 oligo A file of ranges to annotate (one range per line) can be specified as \*(Aq at filename\*(Aq\&.
.RE
.PP
\fB\-enzymes\fR \fIstring\fR
.RS 4
-The name \'all\' reads in all enzyme names from the REBASE database\&. You can specify enzymes by giving their names with commas between then, such as: \'HincII,hinfI,ppiI,hindiii\'\&. The case of the names is not important\&. You can specify a file of enzyme names to read in by giving the name of the file holding the enzyme names with a \'@\' character in front of it, for example, \'@enz\&.list\'\&. Blank lines and lines starting with a hash character or \'!\' are ignored and all other lines are concatenated together with a comma character \',\' and then treated as the list of enzymes to search for\&. An example of a file of enzyme names is: ! my enzymes HincII, ppiII ! other enzymes hindiii HinfI PpiI Default value: all
+The name \*(Aqall\*(Aq reads in all enzyme names from the REBASE database\&. You can specify enzymes by giving their names with commas between then, such as: \*(AqHincII,hinfI,ppiI,hindiii\*(Aq\&. The case of the names is not important\&. You can specify a file of enzyme names to read in by giving the name of the file holding the enzyme names with a \*(Aq@\*(Aq character in front of it, for example, \*(Aq at enz\&.list\*(Aq\&. Blank lines and lines starting with a hash character or \*(Aq!\*(Aq are ignored and all other lines are concatenated together with a comma character \*(Aq,\*(Aq and then treated as the list of enzymes to search for\&. An example of a file of enzyme names is: ! my enzymes HincII, ppiII ! other enzymes hindiii HinfI PpiI Default value: all
.RE
.PP
\fB\-table\fR \fIlist\fR
@@ -90,12 +99,12 @@ The name \'all\' reads in all enzyme names from the REBASE database\&. You can s
.PP
\fB\-sourcematch\fR \fIstring\fR
.RS 4
-By default any feature source in the feature table is shown\&. You can set this to match any feature source you wish to show\&. The source name is usually either the name of the program that detected the feature or it is the feature table (eg: EMBL) that the feature came from\&. The source may be wildcarded by using \'*\'\&. If you wish to show more than one source, separate their names with the character \'|\', eg: gene* | embl Default value: *
+By default any feature source in the feature table is shown\&. You can set this to match any feature source you wish to show\&. The source name is usually either the name of the program that detected the feature or it is the feature table (eg: EMBL) that the feature came from\&. The source may be wildcarded by using \*(Aq*\*(Aq\&. If you wish to show more than one source, separate their names with the character \*(Aq|\*(Aq, eg: gene* | embl Default value: *
.RE
.PP
\fB\-typematch\fR \fIstring\fR
.RS 4
-By default any feature type in the feature table is shown\&. You can set this to match any feature type you wish to show\&. See http://www3\&.ebi\&.ac\&.uk/Services/WebFeat/ for a list of the EMBL feature types and see Appendix A of the Swissprot user manual in http://www\&.expasy\&.ch/txt/userman\&.txt for a list of the Swissprot feature types\&. The type may be wildcarded by using \'*\'\&. If you wish to show more than one type, separate their names with the character \'|\', eg: *UTR | intron Default value: *
+By default any feature type in the feature table is shown\&. You can set this to match any feature type you wish to show\&. See http://www\&.ebi\&.ac\&.uk/embl/WebFeat/ for a list of the EMBL feature types and see Appendix A of the Swissprot user manual in http://www\&.expasy\&.org/sprot/userman\&.html for a list of the Swissprot feature types\&. The type may be wildcarded by using \*(Aq*\*(Aq\&. If you wish to show more than one type, separate their names with the character \*(Aq|\*(Aq, eg: *UTR | intron Default value: *
.RE
.PP
\fB\-sensematch\fR \fIinteger\fR
@@ -115,12 +124,12 @@ Maximum score of feature to display\&. If both minscore and maxscore are zero (t
.PP
\fB\-tagmatch\fR \fIstring\fR
.RS 4
-Tags are the types of extra values that a feature may have\&. For example in the EMBL feature table, a \'CDS\' type of feature may have the tags \'/codon\', \'/codon_start\', \'/db_xref\', \'/EC_number\', \'/evidence\', \'/exception\', \'/function\', \'/gene\', \'/label\', \'/map\', \'/note\', \'/number\', \'/partial\', \'/product\', \'/protein_id\', \'/pseudo\', \'/standard_name\', \'/translation\', \'/transl_except\', \'/transl_table\', or \'/usedin\'\&. Some of these tags also have values, for example \'/gene\' can have the value of the gene name\&. By default any feature tag in the feature table is shown\&. You can set this to match any feature tag you wish to show\&. The tag may be wildcarded by using \'*\'\&. If you wish to show more than one tag, separate their names with the character \'|\', eg: gene | label Default value: *
+Tags are the types of extra values that a feature may have\&. For example in the EMBL feature table, a \*(AqCDS\*(Aq type of feature may have the tags \*(Aq/codon\*(Aq, \*(Aq/codon_start\*(Aq, \*(Aq/db_xref\*(Aq, \*(Aq/EC_number\*(Aq, \*(Aq/evidence\*(Aq, \*(Aq/exception\*(Aq, \*(Aq/function\*(Aq, \*(Aq/gene\*(Aq, \*(Aq/label\*(Aq, \*(Aq/map\*(Aq, \*(Aq/note\*(Aq, \*(Aq/number\*(Aq, \*(Aq/partial\*(Aq, \*(Aq/product\*(Aq, \*(Aq/protein_id\*(Aq, \*(Aq/pseudo\*(Aq, \*(Aq/standard_name\*(Aq, \*(Aq/translation\*(Aq, \*(Aq/transl_except\*(Aq, \*(Aq/transl_table\*(Aq, or \*(Aq/usedin\*(Aq\&. Some of these tags also have values, for example \*(Aq/gene\*(Aq can have the value of the gene name\&. By default any feature tag in the feature table is shown\&. You can set this to match any feature tag you wish to show\&. The tag may be wildcarded by using \*(Aq*\*(Aq\&. If you wish to show more than one tag, separate their names with the character \*(Aq|\*(Aq, eg: gene | label Default value: *
.RE
.PP
\fB\-valuematch\fR \fIstring\fR
.RS 4
-Tag values are the values associated with a feature tag\&. Tags are the types of extra values that a feature may have\&. For example in the EMBL feature table, a \'CDS\' type of feature may have the tags \'/codon\', \'/codon_start\', \'/db_xref\', \'/EC_number\', \'/evidence\', \'/exception\', \'/function\', \'/gene\', \'/label\', \'/map\', \'/note\', \'/number\', \'/partial\', \'/product\', \'/protein_id\', \'/pseudo\', \'/standard_name\', \'/translation\', \'/transl_except\', \'/transl_table\', or \'/usedin\'\&. Only some of these tags can have values, for example \'/gene\' can have the value of the gene name\&. By default any feature tag value in the feature table is shown\&. You can set this to match any feature tag value you wish to show\&. The tag value may be wildcarded by using \'*\'\&. If you wish to show more than one tag value, separate their names with the character \'|\', eg: pax* | 10 Default value: *
+Tag values are the values associated with a feature tag\&. Tags are the types of extra values that a feature may have\&. For example in the EMBL feature table, a \*(AqCDS\*(Aq type of feature may have the tags \*(Aq/codon\*(Aq, \*(Aq/codon_start\*(Aq, \*(Aq/db_xref\*(Aq, \*(Aq/EC_number\*(Aq, \*(Aq/evidence\*(Aq, \*(Aq/exception\*(Aq, \*(Aq/function\*(Aq, \*(Aq/gene\*(Aq, \*(Aq/label\*(Aq, \*(Aq/map\*(Aq, \*(Aq/note\*(Aq, \*(Aq/number\*(Aq, \*(Aq/partial\*(Aq, \*(Aq/product\*(Aq, \*(Aq/protein_id\*(Aq, \*(Aq/pseudo\*(Aq, \*(Aq/standard_name\*(Aq, \*(Aq/translation\*(Aq, \*(Aq/transl_except\*(Aq, \*(Aq/transl_table\*(Aq, or \*(Aq/usedin\*(Aq\&. Only some of these tags can have values, for example \*(Aq/gene\*(Aq can have the value of the gene name\&. By default any feature tag value in the feature table is shown\&. You can set this to match any feature tag value you wish to show\&. The tag value may be wildcarded by using \*(Aq*\*(Aq\&. If you wish to show more than one tag value, separate their names with the character \*(Aq|\*(Aq, eg: pax* | 10 Default value: *
.RE
.PP
\fB\-stricttags\fR \fIboolean\fR
@@ -132,7 +141,7 @@ By default if any tag/value pair in a feature matches the specified tag and valu
.PP
\fB\-flatreformat\fR \fIboolean\fR
.RS 4
-This changes the output format to one where the recognition site is indicated by a row of \'===\' characters and the cut site is pointed to by a \'>\' character in the forward sense, or a \'<\' in the reverse sense strand\&. Default value: N
+This changes the output format to one where the recognition site is indicated by a row of \*(Aq===\*(Aq characters and the cut site is pointed to by a \*(Aq>\*(Aq character in the forward sense, or a \*(Aq<\*(Aq in the reverse sense strand\&. Default value: N
.RE
.PP
\fB\-mincuts\fR \fIinteger\fR
@@ -167,7 +176,7 @@ This allows those enzymes which cut at different positions on the forward and re
.PP
\fB\-ambiguity\fR \fIboolean\fR
.RS 4
-This allows those enzymes which have one or more \'N\' ambiguity codes in their pattern to be considered Default value: Y
+This allows those enzymes which have one or more \*(AqN\*(Aq ambiguity codes in their pattern to be considered Default value: Y
.RE
.PP
\fB\-plasmid\fR \fIboolean\fR
@@ -182,17 +191,17 @@ If this is set then RE recognition sites will not match methylated bases\&. Defa
.PP
\fB\-commercial\fR \fIboolean\fR
.RS 4
-If this is set, then only those enzymes with a commercial supplier will be searched for\&. This qualifier is ignored if you have specified an explicit list of enzymes to search for, rather than searching through \'all\' the enzymes in the REBASE database\&. It is assumed that, if you are asking for an explicit enzyme, then you probably know where to get it from and so all enzymes names that you have asked to be searched for, and which cut, will be reported whether or not they have a commercial supplier\&. Default value: Y
+If this is set, then only those enzymes with a commercial supplier will be searched for\&. This qualifier is ignored if you have specified an explicit list of enzymes to search for, rather than searching through \*(Aqall\*(Aq the enzymes in the REBASE database\&. It is assumed that, if you are asking for an explicit enzyme, then you probably know where to get it from and so all enzymes names that you have asked to be searched for, and which cut, will be reported whether or not they have a commercial supplier\&. Default value: Y
.RE
.PP
\fB\-limit\fR \fIboolean\fR
.RS 4
-This limits the reporting of enzymes to just one enzyme from each group of isoschizomers\&. The enzyme chosen to represent an isoschizomer group is the prototype indicated in the data file \'embossre\&.equ\', which is created by the program \'rebaseextract\'\&. If you prefer different prototypes to be used, make a copy of embossre\&.equ in your home directory and edit it\&. If this value is set to be false then all of the input enzymes will be reported\&. You might like to set this to false if you are supplying an explicit set of enzymes rather than searching \'all\' of them\&. Default value: Y
+This limits the reporting of enzymes to just one enzyme from each group of isoschizomers\&. The enzyme chosen to represent an isoschizomer group is the prototype indicated in the data file \*(Aqembossre\&.equ\*(Aq, which is created by the program \*(Aqrebaseextract\*(Aq\&. If you prefer different prototypes to be used, make a copy of embossre\&.equ in your home directory and edit it\&. If this value is set to be false then all of the input enzymes will be reported\&. You might like to set this to false if you are supplying an explicit set of enzymes rather than searching \*(Aqall\*(Aq of them\&. Default value: Y
.RE
.PP
\fB\-orfminsize\fR \fIinteger\fR
.RS 4
-This sets the minimum size of Open Reading Frames (ORFs) to display in the translations\&. All other translation regions are masked by changing the amino acids to \'\-\' characters\&.
+This sets the minimum size of Open Reading Frames (ORFs) to display in the translations\&. All other translation regions are masked by changing the amino acids to \*(Aq\-\*(Aq characters\&.
.RE
.PP
\fB\-threeletter\fR \fIboolean\fR
diff --git a/debian/manpages/shuffleseq.1e b/debian/manpages/shuffleseq.1e
index bcc8312..9334057 100644
--- a/debian/manpages/shuffleseq.1e
+++ b/debian/manpages/shuffleseq.1e
@@ -2,12 +2,21 @@
.\" Title: SHUFFLESEQ
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "SHUFFLESEQ" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "SHUFFLESEQ" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/sigcleave.1e b/debian/manpages/sigcleave.1e
index e777061..4bb7f59 100644
--- a/debian/manpages/sigcleave.1e
+++ b/debian/manpages/sigcleave.1e
@@ -2,12 +2,21 @@
.\" Title: SIGCLEAVE
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "SIGCLEAVE" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "SIGCLEAVE" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/silent.1e b/debian/manpages/silent.1e
index bc73e47..daecf2d 100644
--- a/debian/manpages/silent.1e
+++ b/debian/manpages/silent.1e
@@ -2,12 +2,21 @@
.\" Title: SILENT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "SILENT" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "SILENT" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/sirna.1e b/debian/manpages/sirna.1e
index d84a9e1..7ddddf5 100644
--- a/debian/manpages/sirna.1e
+++ b/debian/manpages/sirna.1e
@@ -2,12 +2,21 @@
.\" Title: SIRNA
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "SIRNA" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "SIRNA" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -54,13 +63,13 @@ This option allows you to select only those 23 base regions that end with TT\&.
.PP
\fB\-polybase\fR \fIboolean\fR
.RS 4
-If this option is FALSE then only those 23 base regions that have no repeat of 4 or more of any bases in a row will be reported\&. No regions will ever be reported that have 4 or more G\'s in a row\&. Default value: Y
+If this option is FALSE then only those 23 base regions that have no repeat of 4 or more of any bases in a row will be reported\&. No regions will ever be reported that have 4 or more G\*(Aqs in a row\&. Default value: Y
.RE
.SS "Output section"
.PP
\fB\-outfile\fR \fIreport\fR
.RS 4
-The output is a table of the forward and reverse parts of the 21 base siRNA duplex\&. Both the forward and reverse sequences are written 5\' to 3\', ready to be ordered\&. The last two bases have been replaced by \'dTdT\'\&. The starting position of the 23 base region and the %GC content is also given\&. If you wish to see the complete 23 base sequence, then either look at the sequence in the other output file, or use the qualifier \'\-context\' which will display the 23 bases of the forward sequence in this report with the first two bases in brackets\&. These first two bases do not form part of the siRNA probe to be ordered\&.
+The output is a table of the forward and reverse parts of the 21 base siRNA duplex\&. Both the forward and reverse sequences are written 5\*(Aq to 3\*(Aq, ready to be ordered\&. The last two bases have been replaced by \*(AqdTdT\*(Aq\&. The starting position of the 23 base region and the %GC content is also given\&. If you wish to see the complete 23 base sequence, then either look at the sequence in the other output file, or use the qualifier \*(Aq\-context\*(Aq which will display the 23 bases of the forward sequence in this report with the first two bases in brackets\&. These first two bases do not form part of the siRNA probe to be ordered\&.
.RE
.PP
\fB\-outseq\fR \fIseqoutall\fR
@@ -70,7 +79,7 @@ This is a file of the sequences of the 23 base regions that the siRNAs are selec
.PP
\fB\-context\fR \fIboolean\fR
.RS 4
-The output report file gives the sequences of the 21 base siRNA regions ready to be ordered\&. This does not give you an indication of the 2 bases before the 21 bases\&. It is often interesting to see which of the suggested possible probe regions have an \'AA\' in front of them (i\&.e\&. it is useful to see which of the 23 base regions start with an \'AA\')\&. This option displays the whole 23 bases of the region with the first two bases in brackets, e\&.g\&. \'(AA)\' to give you some context for the probe region\&. YOU SHOULD NOT INCLUDE THE TWO BASES IN BRACKETS WHEN YOU PLACE AN ORDER FOR THE PROBES\&. Default value: N
+The output report file gives the sequences of the 21 base siRNA regions ready to be ordered\&. This does not give you an indication of the 2 bases before the 21 bases\&. It is often interesting to see which of the suggested possible probe regions have an \*(AqAA\*(Aq in front of them (i\&.e\&. it is useful to see which of the 23 base regions start with an \*(AqAA\*(Aq)\&. This option displays the whole 23 bases of the region with the first two bases in brackets, e\&.g\&. \*(Aq(AA)\*(Aq to give you some context for the probe region\&. YOU SHOULD NOT INCLUDE THE TWO BASES IN BRACKETS WHEN YOU PLACE AN ORDER FOR THE PROBES\&. Default value: N
.RE
.SH "BUGS"
.PP
diff --git a/debian/manpages/sixpack.1e b/debian/manpages/sixpack.1e
index fc8c0c2..52eb5c4 100644
--- a/debian/manpages/sixpack.1e
+++ b/debian/manpages/sixpack.1e
@@ -2,12 +2,21 @@
.\" Title: SIXPACK
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "SIXPACK" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "SIXPACK" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -44,12 +53,12 @@ Genetics code used for the translation
.PP
\fB\-firstorf\fR \fIboolean\fR
.RS 4
-Count the beginning of a sequence as a possible ORF, even if it\'s inferior to the minimal ORF size\&. Default value: Y
+Count the beginning of a sequence as a possible ORF, even if it\*(Aqs inferior to the minimal ORF size\&. Default value: Y
.RE
.PP
\fB\-lastorf\fR \fIboolean\fR
.RS 4
-Count the end of a sequence as a possible ORF, even if it\'s not finishing with a STOP, or inferior to the minimal ORF size\&. Default value: Y
+Count the end of a sequence as a possible ORF, even if it\*(Aqs not finishing with a STOP, or inferior to the minimal ORF size\&. Default value: Y
.RE
.PP
\fB\-mstart\fR \fIboolean\fR
@@ -84,7 +93,7 @@ Regions to put in uppercase\&. If this is left blank, then the sequence case is
.PP
\fB\-highlight\fR \fIrange\fR
.RS 4
-Regions to colour if formatting for HTML\&. If this is left blank, then the sequence is left alone\&. A set of regions is specified by a set of pairs of positions\&. The positions are integers\&. They are followed by any valid HTML font colour\&. Examples of region specifications are: 24\-45 blue 56\-78 orange 1\-100 green 120\-156 red A file of ranges to colour (one range per line) can be specified as \'@filename\'\&.
+Regions to colour if formatting for HTML\&. If this is left blank, then the sequence is left alone\&. A set of regions is specified by a set of pairs of positions\&. The positions are integers\&. They are followed by any valid HTML font colour\&. Examples of region specifications are: 24\-45 blue 56\-78 orange 1\-100 green 120\-156 red A file of ranges to colour (one range per line) can be specified as \*(Aq at filename\*(Aq\&.
.RE
.PP
\fB\-number\fR \fIboolean\fR
diff --git a/debian/manpages/sizeseq.1e b/debian/manpages/sizeseq.1e
index afec3c3..b195ddc 100644
--- a/debian/manpages/sizeseq.1e
+++ b/debian/manpages/sizeseq.1e
@@ -2,12 +2,21 @@
.\" Title: SIZESEQ
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "SIZESEQ" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "SIZESEQ" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/skipredundant.1e b/debian/manpages/skipredundant.1e
index a72c6ee..c2271c6 100644
--- a/debian/manpages/skipredundant.1e
+++ b/debian/manpages/skipredundant.1e
@@ -2,12 +2,21 @@
.\" Title: SKIPREDUNDANT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "SKIPREDUNDANT" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "SKIPREDUNDANT" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -43,7 +52,7 @@ Sequence feature information will be retained if this option is set\&.
.PP
\fB\-datafile\fR \fImatrixf\fR
.RS 4
-This is the scoring matrix file used when comparing sequences\&. By default it is the file \'EBLOSUM62\' (for proteins) or the file \'EDNAFULL\' (for nucleic sequences)\&. These files are found in the \'data\' directory of the EMBOSS installation\&.
+This is the scoring matrix file used when comparing sequences\&. By default it is the file \*(AqEBLOSUM62\*(Aq (for proteins) or the file \*(AqEDNAFULL\*(Aq (for nucleic sequences)\&. These files are found in the \*(Aqdata\*(Aq directory of the EMBOSS installation\&.
.RE
.SS "Required section"
.PP
diff --git a/debian/manpages/skipseq.1e b/debian/manpages/skipseq.1e
index e0532d1..de3036a 100644
--- a/debian/manpages/skipseq.1e
+++ b/debian/manpages/skipseq.1e
@@ -2,12 +2,21 @@
.\" Title: SKIPSEQ
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "SKIPSEQ" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "SKIPSEQ" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/splitsource.1e b/debian/manpages/splitsource.1e
index f6b196e..fda9370 100644
--- a/debian/manpages/splitsource.1e
+++ b/debian/manpages/splitsource.1e
@@ -2,12 +2,21 @@
.\" Title: SPLITSOURCE
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "SPLITSOURCE" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "SPLITSOURCE" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/splitter.1e b/debian/manpages/splitter.1e
index 6d52cb0..079637e 100644
--- a/debian/manpages/splitter.1e
+++ b/debian/manpages/splitter.1e
@@ -2,12 +2,21 @@
.\" Title: SPLITTER
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "SPLITTER" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "SPLITTER" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/sqltest.1e b/debian/manpages/sqltest.1e
index f54f72f..17652d4 100644
--- a/debian/manpages/sqltest.1e
+++ b/debian/manpages/sqltest.1e
@@ -2,12 +2,21 @@
.\" Title: SQLTEST
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "SQLTEST" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "SQLTEST" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/stretcher.1e b/debian/manpages/stretcher.1e
index f615c62..b9d208b 100644
--- a/debian/manpages/stretcher.1e
+++ b/debian/manpages/stretcher.1e
@@ -2,12 +2,21 @@
.\" Title: STRETCHER
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "STRETCHER" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "STRETCHER" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -42,7 +51,7 @@ is a command line program from EMBOSS (\(lqthe European Molecular Biology Open S
.PP
\fB\-datafile\fR \fImatrix\fR
.RS 4
-This is the scoring matrix file used when comparing sequences\&. By default it is the file \'EBLOSUM62\' (for proteins) or the file \'EDNAFULL\' (for nucleic sequences)\&. These files are found in the \'data\' directory of the EMBOSS installation\&.
+This is the scoring matrix file used when comparing sequences\&. By default it is the file \*(AqEBLOSUM62\*(Aq (for proteins) or the file \*(AqEDNAFULL\*(Aq (for nucleic sequences)\&. These files are found in the \*(Aqdata\*(Aq directory of the EMBOSS installation\&.
.RE
.SS "Additional section"
.PP
diff --git a/debian/manpages/stssearch.1e b/debian/manpages/stssearch.1e
index e1d00fd..8573324 100644
--- a/debian/manpages/stssearch.1e
+++ b/debian/manpages/stssearch.1e
@@ -2,12 +2,21 @@
.\" Title: STSSEARCH
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "STSSEARCH" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "STSSEARCH" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/supermatcher.1e b/debian/manpages/supermatcher.1e
index 901be92..1506183 100644
--- a/debian/manpages/supermatcher.1e
+++ b/debian/manpages/supermatcher.1e
@@ -2,12 +2,21 @@
.\" Title: SUPERMATCHER
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "SUPERMATCHER" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "SUPERMATCHER" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -22,7 +31,7 @@
supermatcher \- Calculate approximate local pair\-wise alignments of larger sequences
.SH "SYNOPSIS"
.HP \w'\fBsupermatcher\fR\ 'u
-\fBsupermatcher\fR \fB\-asequence\ \fR\fB\fIseqall\fR\fR \fB\-bsequence\ \fR\fB\fIseqset\fR\fR [\fB\-datafile\ \fR\fB\fImatrixf\fR\fR] \fB\-gapopen\ \fR\fB\fIfloat\fR\fR \fB\-gapextend\ \fR\fB\fIfloat\fR\fR [\fB\-width\ \fR\fB\fIinteger\fR\fR] [\fB\-wordlen\ \fR\fB\fIinteger\fR\fR] \fB\-outfile\ \fR\fB\fIalign\fR\fR [\fB\-errorfile\ \fR\fB\fIoutfile\fR\fR]
+\fBsupermatcher\fR \fB\-asequence\ \fR\fB\fIseqall\fR\fR \fB\-bsequence\ \fR\fB\fIseqset\fR\fR [\fB\-datafile\ \fR\fB\fImatrixf\fR\fR] [\fB\-minscore\ \fR\fB\fIfloat\fR\fR] \fB\-gapopen\ \fR\fB\fIfloat\fR\fR \fB\-gapextend\ \fR\fB\fIfloat\fR\fR [\fB\-width\ \fR\fB\fIinteger\fR\fR] [\fB\-wordlen\ \fR\fB\fIinteger\fR\fR] \fB\-outfile\ \fR\fB\fIalign\fR\fR [\fB\-errorfile\ \fR\fB\fIoutfile\fR\fR]
.HP \w'\fBsupermatcher\fR\ 'u
\fBsupermatcher\fR \fB\-help\fR
.SH "DESCRIPTION"
@@ -42,7 +51,12 @@ is a command line program from EMBOSS (\(lqthe European Molecular Biology Open S
.PP
\fB\-datafile\fR \fImatrixf\fR
.RS 4
-This is the scoring matrix file used when comparing sequences\&. By default it is the file \'EBLOSUM62\' (for proteins) or the file \'EDNAFULL\' (for nucleic sequences)\&. These files are found in the \'data\' directory of the EMBOSS installation\&.
+This is the scoring matrix file used when comparing sequences\&. By default it is the file \*(AqEBLOSUM62\*(Aq (for proteins) or the file \*(AqEDNAFULL\*(Aq (for nucleic sequences)\&. These files are found in the \*(Aqdata\*(Aq directory of the EMBOSS installation\&.
+.RE
+.PP
+\fB\-minscore\fR \fIfloat\fR
+.RS 4
+Minimum alignment score to report an alignment\&.
.RE
.SS "Required section"
.PP
diff --git a/debian/manpages/syco.1e b/debian/manpages/syco.1e
index af6b17c..7fb2442 100644
--- a/debian/manpages/syco.1e
+++ b/debian/manpages/syco.1e
@@ -2,12 +2,21 @@
.\" Title: SYCO
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "SYCO" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "SYCO" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/tcode.1e b/debian/manpages/tcode.1e
index 4d4781c..88d82df 100644
--- a/debian/manpages/tcode.1e
+++ b/debian/manpages/tcode.1e
@@ -2,12 +2,21 @@
.\" Title: TCODE
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "TCODE" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "TCODE" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/testplot.1e b/debian/manpages/testplot.1e
index 45fd41b..fe1947a 100644
--- a/debian/manpages/testplot.1e
+++ b/debian/manpages/testplot.1e
@@ -2,12 +2,21 @@
.\" Title: TESTPLOT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "TESTPLOT" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "TESTPLOT" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/textsearch.1e b/debian/manpages/textsearch.1e
index eb7030e..2432239 100644
--- a/debian/manpages/textsearch.1e
+++ b/debian/manpages/textsearch.1e
@@ -2,12 +2,21 @@
.\" Title: TEXTSEARCH
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "TEXTSEARCH" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "TEXTSEARCH" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -39,7 +48,7 @@ is a command line program from EMBOSS (\(lqthe European Molecular Biology Open S
.PP
\fB\-pattern\fR \fIstring\fR
.RS 4
-The search pattern is a regular expression\&. Use a | to indicate OR\&. For example: human|mouse will find text with either \'human\' OR \'mouse\' in the text
+The search pattern is a regular expression\&. Use a | to indicate OR\&. For example: human|mouse will find text with either \*(Aqhuman\*(Aq OR \*(Aqmouse\*(Aq in the text
.RE
.SS "Additional section"
.PP
@@ -56,7 +65,7 @@ Default value: N
.PP
\fB\-only\fR \fIboolean\fR
.RS 4
-This is a way of shortening the command line if you only want a few things to be displayed\&. Instead of specifying: \'\-nohead \-noname \-nousa \-noacc \-nodesc\' to get only the name output, you can specify \'\-only \-name\' Default value: N
+This is a way of shortening the command line if you only want a few things to be displayed\&. Instead of specifying: \*(Aq\-nohead \-noname \-nousa \-noacc \-nodesc\*(Aq to get only the name output, you can specify \*(Aq\-only \-name\*(Aq Default value: N
.RE
.PP
\fB\-heading\fR \fIboolean\fR
diff --git a/debian/manpages/tfextract.1e b/debian/manpages/tfextract.1e
index 7c46860..e796e89 100644
--- a/debian/manpages/tfextract.1e
+++ b/debian/manpages/tfextract.1e
@@ -2,12 +2,21 @@
.\" Title: TFEXTRACT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "TFEXTRACT" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "TFEXTRACT" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/tfm.1e b/debian/manpages/tfm.1e
index 3ed600a..a53fa95 100644
--- a/debian/manpages/tfm.1e
+++ b/debian/manpages/tfm.1e
@@ -2,12 +2,21 @@
.\" Title: TFM
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "TFM" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "TFM" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -50,7 +59,7 @@ This will format the output for displaying as a WWW document\&. Default value: N
.PP
\fB\-more\fR \fIboolean\fR
.RS 4
-This uses the standard UNIX utility \'more\' to display the text page\-by\-page, waiting for you to read one screen\-full before going on to the next page\&. When you have finished reading a page, press the SPACE bar to proceed to the next page\&. Default value: @(!$(html))
+This uses the standard UNIX utility \*(Aqmore\*(Aq to display the text page\-by\-page, waiting for you to read one screen\-full before going on to the next page\&. When you have finished reading a page, press the SPACE bar to proceed to the next page\&. Default value: @(!$(html))
.RE
.SH "BUGS"
.PP
diff --git a/debian/manpages/tfscan.1e b/debian/manpages/tfscan.1e
index 3304949..9c940fb 100644
--- a/debian/manpages/tfscan.1e
+++ b/debian/manpages/tfscan.1e
@@ -2,12 +2,21 @@
.\" Title: TFSCAN
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "TFSCAN" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "TFSCAN" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -22,7 +31,7 @@
tfscan \- Identify transcription factor binding sites in DNA sequences
.SH "SYNOPSIS"
.HP \w'\fBtfscan\fR\ 'u
-\fBtfscan\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-menu\ \fR\fB\fIlist\fR\fR \fB\-custom\ \fR\fB\fIdatafile\fR\fR \fB\-mismatch\ \fR\fB\fIinteger\fR\fR [\fB\-minlength\ \fR\fB\fIinteger\fR\fR] \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+\fBtfscan\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-menu\ \fR\fB\fIlist\fR\fR \fB\-custom\ \fR\fB\fIdatafile\fR\fR \fB\-mismatch\ \fR\fB\fIinteger\fR\fR [\fB\-minlength\ \fR\fB\fIinteger\fR\fR] \fB\-outfile\ \fR\fB\fIreport\fR\fR
.HP \w'\fBtfscan\fR\ 'u
\fBtfscan\fR \fB\-help\fR
.SH "DESCRIPTION"
@@ -57,7 +66,7 @@ Default value: 1
.RE
.SS "Output section"
.PP
-\fB\-outfile\fR \fIoutfile\fR
+\fB\-outfile\fR \fIreport\fR
.RS 4
.RE
.SH "BUGS"
diff --git a/debian/manpages/tmap.1e b/debian/manpages/tmap.1e
index 612da82..6bd9f08 100644
--- a/debian/manpages/tmap.1e
+++ b/debian/manpages/tmap.1e
@@ -2,12 +2,21 @@
.\" Title: TMAP
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "TMAP" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "TMAP" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/tranalign.1e b/debian/manpages/tranalign.1e
index 9b33be9..6e6afd2 100644
--- a/debian/manpages/tranalign.1e
+++ b/debian/manpages/tranalign.1e
@@ -2,12 +2,21 @@
.\" Title: TRANALIGN
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "TRANALIGN" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "TRANALIGN" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/transeq.1e b/debian/manpages/transeq.1e
index 7b8d43c..563fec5 100644
--- a/debian/manpages/transeq.1e
+++ b/debian/manpages/transeq.1e
@@ -2,12 +2,21 @@
.\" Title: TRANSEQ
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "TRANSEQ" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "TRANSEQ" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -53,18 +62,18 @@ Regions to translate\&. If this is left blank, then the complete sequence is tra
.PP
\fB\-trim\fR \fIboolean\fR
.RS 4
-This removes all \'X\' and \'*\' characters from the right end of the translation\&. The trimming process starts at the end and continues until the next character is not a \'X\' or a \'*\' Default value: N
+This removes all \*(AqX\*(Aq and \*(Aq*\*(Aq characters from the right end of the translation\&. The trimming process starts at the end and continues until the next character is not a \*(AqX\*(Aq or a \*(Aq*\*(Aq Default value: N
.RE
.PP
\fB\-clean\fR \fIboolean\fR
.RS 4
-This changes all STOP codon positions from the \'*\' character to \'X\' (an unknown residue)\&. This is useful because some programs will not accept protein sequences with \'*\' characters in them\&. Default value: N
+This changes all STOP codon positions from the \*(Aq*\*(Aq character to \*(AqX\*(Aq (an unknown residue)\&. This is useful because some programs will not accept protein sequences with \*(Aq*\*(Aq characters in them\&. Default value: N
.RE
.SS "Advanced section"
.PP
\fB\-alternative\fR \fIboolean\fR
.RS 4
-The default definition of frame \'\-1\' is the reverse\-complement of the set of codons used in frame 1\&. (Frame \-2 is the set of codons used by frame 2, similarly frames \-3 and 3)\&. This is a common standard, used by the Staden package and other programs\&. If you prefer to define frame \'\-1\' as using the set of codons starting with the last codon of the sequence, then set this to be true\&. Default value: N
+The default definition of frame \*(Aq\-1\*(Aq is the reverse\-complement of the set of codons used in frame 1\&. (Frame \-2 is the set of codons used by frame 2, similarly frames \-3 and 3)\&. This is a common standard, used by the Staden package and other programs\&. If you prefer to define frame \*(Aq\-1\*(Aq as using the set of codons starting with the last codon of the sequence, then set this to be true\&. Default value: N
.RE
.SS "Output section"
.PP
diff --git a/debian/manpages/treetypedisplay.1e b/debian/manpages/treetypedisplay.1e
index 181d57c..7f13a80 100644
--- a/debian/manpages/treetypedisplay.1e
+++ b/debian/manpages/treetypedisplay.1e
@@ -2,12 +2,21 @@
.\" Title: TREETYPEDISPLAY
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "TREETYPEDISPLAY" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "TREETYPEDISPLAY" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/trimest.1e b/debian/manpages/trimest.1e
index 4e776b7..076eb40 100644
--- a/debian/manpages/trimest.1e
+++ b/debian/manpages/trimest.1e
@@ -2,12 +2,21 @@
.\" Title: TRIMEST
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "TRIMEST" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "TRIMEST" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -44,23 +53,23 @@ This is the minimum length that a poly\-A (or poly\-T) tail must have before it
.PP
\fB\-mismatches\fR \fIinteger\fR
.RS 4
-If there are this number or fewer contiguous non\-A bases in a poly\-A tail then, if there are \'\-minlength\' \'A\' bases before them, they will be considered part of the tail and removed \&. For example the terminal 4 A\'s of GCAGAAAA would be removed with the default values of \-minlength=4 and \-mismatches=1 (There are not at least 4 A\'s before the last \'G\' and so only the A\'s after it are considered to be part of the tail)\&. The terminal 9 bases of GCAAAAGAAAA would be removed; There are at least \-minlength A\'s preceeding the last \'G\', so it is part of the tail\&. Default value: 1
+If there are this number or fewer contiguous non\-A bases in a poly\-A tail then, if there are \*(Aq\-minlength\*(Aq \*(AqA\*(Aq bases before them, they will be considered part of the tail and removed \&. For example the terminal 4 A\*(Aqs of GCAGAAAA would be removed with the default values of \-minlength=4 and \-mismatches=1 (There are not at least 4 A\*(Aqs before the last \*(AqG\*(Aq and so only the A\*(Aqs after it are considered to be part of the tail)\&. The terminal 9 bases of GCAAAAGAAAA would be removed; There are at least \-minlength A\*(Aqs preceeding the last \*(AqG\*(Aq, so it is part of the tail\&. Default value: 1
.RE
.PP
\fB\-reverse\fR \fIboolean\fR
.RS 4
-When a poly\-T region at the 5\' end of the sequence is found and removed, it is likely that the sequence is in the reverse sense\&. This option will change the sequence to the forward sense when it is written out\&. If this option is not set, then the sense will not be changed\&. Default value: Y
+When a poly\-T region at the 5\*(Aq end of the sequence is found and removed, it is likely that the sequence is in the reverse sense\&. This option will change the sequence to the forward sense when it is written out\&. If this option is not set, then the sense will not be changed\&. Default value: Y
.RE
.PP
\fB\-tolower\fR \fItoggle\fR
.RS 4
-The poly\-A region can be \'masked\' by converting the sequence characters to lower\-case\&. Some non\-EMBOSS programs e\&.g\&. fasta can interpret this as a masked region\&. The sequence is unchanged apart from the case change\&. You might like to ensure that the whole sequence is in upper\-case before masking the specified regions to lower\-case by using the \'\-supper\' sequence qualifier\&. Default value: N
+The poly\-A region can be \*(Aqmasked\*(Aq by converting the sequence characters to lower\-case\&. Some non\-EMBOSS programs e\&.g\&. fasta can interpret this as a masked region\&. The sequence is unchanged apart from the case change\&. You might like to ensure that the whole sequence is in upper\-case before masking the specified regions to lower\-case by using the \*(Aq\-supper\*(Aq sequence qualifier\&. Default value: N
.RE
.SS "Advanced section"
.PP
\fB\-fiveprime\fR \fIboolean\fR
.RS 4
-If this is set true, then the 5\' end of the sequence is inspected for poly\-T tails\&. These will be removed if they are longer than any 3\' poly\-A tails\&. If this is false, then the 5\' end is ignored\&. Default value: Y
+If this is set true, then the 5\*(Aq end of the sequence is inspected for poly\-T tails\&. These will be removed if they are longer than any 3\*(Aq poly\-A tails\&. If this is false, then the 5\*(Aq end is ignored\&. Default value: Y
.RE
.SS "Output section"
.PP
diff --git a/debian/manpages/trimseq.1e b/debian/manpages/trimseq.1e
index 1d46ebf..509a1f8 100644
--- a/debian/manpages/trimseq.1e
+++ b/debian/manpages/trimseq.1e
@@ -2,12 +2,21 @@
.\" Title: TRIMSEQ
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "TRIMSEQ" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "TRIMSEQ" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -49,12 +58,12 @@ This is the threshold of the percentage ambiguity in the window required in orde
.PP
\fB\-strict\fR \fIboolean\fR
.RS 4
-In nucleic sequences, trim off not only N\'s and X\'s, but also the nucleotide IUPAC ambiguity codes M, R, W, S, Y, K, V, H, D and B\&. In protein sequences, trim off not only X\'s but also B and Z\&. Default value: N
+In nucleic sequences, trim off not only N\*(Aqs and X\*(Aqs, but also the nucleotide IUPAC ambiguity codes M, R, W, S, Y, K, V, H, D and B\&. In protein sequences, trim off not only X\*(Aqs but also B and Z\&. Default value: N
.RE
.PP
\fB\-star\fR \fIboolean\fR
.RS 4
-In protein sequences, trim off not only X\'s, but also the *\'s Default value: N
+In protein sequences, trim off not only X\*(Aqs, but also the *\*(Aqs Default value: N
.RE
.SS "Advanced section"
.PP
diff --git a/debian/manpages/trimspace.1e b/debian/manpages/trimspace.1e
index 6688cb7..1ba35c5 100644
--- a/debian/manpages/trimspace.1e
+++ b/debian/manpages/trimspace.1e
@@ -2,12 +2,21 @@
.\" Title: TRIMSPACE
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "TRIMSPACE" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "TRIMSPACE" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/twofeat.1e b/debian/manpages/twofeat.1e
index a0dab08..8dce37a 100644
--- a/debian/manpages/twofeat.1e
+++ b/debian/manpages/twofeat.1e
@@ -2,12 +2,21 @@
.\" Title: TWOFEAT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "TWOFEAT" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "TWOFEAT" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -39,12 +48,12 @@ is a command line program from EMBOSS (\(lqthe European Molecular Biology Open S
.PP
\fB\-asource\fR \fIstring\fR
.RS 4
-By default any feature source in the feature table is allowed\&. You can set this to match any feature source you wish to allow\&. The source name is usually either the name of the program that detected the feature or it is the feature table (eg: EMBL) that the feature came from\&. The source may be wildcarded by using \'*\'\&. If you wish to allow more than one source, separate their names with the character \'|\', eg: gene* | embl Default value: *
+By default any feature source in the feature table is allowed\&. You can set this to match any feature source you wish to allow\&. The source name is usually either the name of the program that detected the feature or it is the feature table (eg: EMBL) that the feature came from\&. The source may be wildcarded by using \*(Aq*\*(Aq\&. If you wish to allow more than one source, separate their names with the character \*(Aq|\*(Aq, eg: gene* | embl Default value: *
.RE
.PP
\fB\-atype\fR \fIstring\fR
.RS 4
-By default every feature in the feature table is allowed\&. You can set this to be any feature type you wish to allow\&. See http://www3\&.ebi\&.ac\&.uk/Services/WebFeat/ for a list of the EMBL feature types and see Appendix A of the Swissprot user manual in http://www\&.expasy\&.ch/txt/userman\&.txt for a list of the Swissprot feature types\&. The type may be wildcarded by using \'*\'\&. If you wish to allow more than one type, separate their names with the character \'|\', eg: *UTR | intron Default value: *
+By default every feature in the feature table is allowed\&. You can set this to be any feature type you wish to allow\&. See http://www\&.ebi\&.ac\&.uk/embl/WebFeat/ for a list of the EMBL feature types and see Appendix A of the Swissprot user manual in http://www\&.expasy\&.org/sprot/userman\&.html for a list of the Swissprot feature types\&. The type may be wildcarded by using \*(Aq*\*(Aq\&. If you wish to allow more than one type, separate their names with the character \*(Aq|\*(Aq, eg: *UTR | intron Default value: *
.RE
.PP
\fB\-asense\fR \fIlist\fR
@@ -64,23 +73,23 @@ If this is less than or equal to the maximum score, then any score is permitted\
.PP
\fB\-atag\fR \fIstring\fR
.RS 4
-Tags are the types of extra values that a feature may have\&. For example in the EMBL feature table, a \'CDS\' type of feature may have the tags \'/codon\', \'/codon_start\', \'/db_xref\', \'/EC_number\', \'/evidence\', \'/exception\', \'/function\', \'/gene\', \'/label\', \'/map\', \'/note\', \'/number\', \'/partial\', \'/product\', \'/protein_id\', \'/pseudo\', \'/standard_name\', \'/translation\', \'/transl_except\', \'/transl_table\', or \'/usedin\'\&. Some of these tags also have values, for example \'/gene\' can have the value of the gene name\&. By default any feature tag in the feature table is allowed\&. You can set this to match any feature tag you wish to allow\&. The tag may be wildcarded by using \'*\'\&. If you wish to allow more than one tag, separate their names with the character \'|\', eg: gene | label Default value: *
+Tags are the types of extra values that a feature may have\&. For example in the EMBL feature table, a \*(AqCDS\*(Aq type of feature may have the tags \*(Aq/codon\*(Aq, \*(Aq/codon_start\*(Aq, \*(Aq/db_xref\*(Aq, \*(Aq/EC_number\*(Aq, \*(Aq/evidence\*(Aq, \*(Aq/exception\*(Aq, \*(Aq/function\*(Aq, \*(Aq/gene\*(Aq, \*(Aq/label\*(Aq, \*(Aq/map\*(Aq, \*(Aq/note\*(Aq, \*(Aq/number\*(Aq, \*(Aq/partial\*(Aq, \*(Aq/product\*(Aq, \*(Aq/protein_id\*(Aq, \*(Aq/pseudo\*(Aq, \*(Aq/standard_name\*(Aq, \*(Aq/translation\*(Aq, \*(Aq/transl_except\*(Aq, \*(Aq/transl_table\*(Aq, or \*(Aq/usedin\*(Aq\&. Some of these tags also have values, for example \*(Aq/gene\*(Aq can have the value of the gene name\&. By default any feature tag in the feature table is allowed\&. You can set this to match any feature tag you wish to allow\&. The tag may be wildcarded by using \*(Aq*\*(Aq\&. If you wish to allow more than one tag, separate their names with the character \*(Aq|\*(Aq, eg: gene | label Default value: *
.RE
.PP
\fB\-avalue\fR \fIstring\fR
.RS 4
-Tag values are the values associated with a feature tag\&. Tags are the types of extra values that a feature may have\&. For example in the EMBL feature table, a \'CDS\' type of feature may have the tags \'/codon\', \'/codon_start\', \'/db_xref\', \'/EC_number\', \'/evidence\', \'/exception\', \'/function\', \'/gene\', \'/label\', \'/map\', \'/note\', \'/number\', \'/partial\', \'/product\', \'/protein_id\', \'/pseudo\', \'/standard_name\', \'/translation\', \'/transl_except\', \'/transl_table\', or \'/usedin\'\&. Only some of these tags can have values, for example \'/gene\' can have the value of the gene name\&. By default any feature tag value in the feature table is allowed\&. You can set this to match any feature tag value you wish to allow\&. The tag value may be wildcarded by using \'*\'\&. If you wish to allow more than one tag value, separate their names with the character \'|\', eg: pax* | 10 Default value: *
+Tag values are the values associated with a feature tag\&. Tags are the types of extra values that a feature may have\&. For example in the EMBL feature table, a \*(AqCDS\*(Aq type of feature may have the tags \*(Aq/codon\*(Aq, \*(Aq/codon_start\*(Aq, \*(Aq/db_xref\*(Aq, \*(Aq/EC_number\*(Aq, \*(Aq/evidence\*(Aq, \*(Aq/exception\*(Aq, \*(Aq/function\*(Aq, \*(Aq/gene\*(Aq, \*(Aq/label\*(Aq, \*(Aq/map\*(Aq, \*(Aq/note\*(Aq, \*(Aq/number\*(Aq, \*(Aq/partial\*(Aq, \*(Aq/product\*(Aq, \*(Aq/protein_id\*(Aq, \*(Aq/pseudo\*(Aq, \*(Aq/standard_name\*(Aq, \*(Aq/translation\*(Aq, \*(Aq/transl_except\*(Aq, \*(Aq/transl_table\*(Aq, or \*(Aq/usedin\*(Aq\&. Only some of these tags can have values, for example \*(Aq/gene\*(Aq can have the value of the gene name\&. By default any feature tag value in the feature table is allowed\&. You can set this to match any feature tag value you wish to allow\&. The tag value may be wildcarded by using \*(Aq*\*(Aq\&. If you wish to allow more than one tag value, separate their names with the character \*(Aq|\*(Aq, eg: pax* | 10 Default value: *
.RE
.SS "Second feature options"
.PP
\fB\-bsource\fR \fIstring\fR
.RS 4
-By default any feature source in the feature table is allowed\&. You can set this to match any feature source you wish to allow\&. The source name is usually either the name of the program that detected the feature or it is the feature table (eg: EMBL) that the feature came from\&. The source may be wildcarded by using \'*\'\&. If you wish to allow more than one source, separate their names with the character \'|\', eg: gene* | embl Default value: *
+By default any feature source in the feature table is allowed\&. You can set this to match any feature source you wish to allow\&. The source name is usually either the name of the program that detected the feature or it is the feature table (eg: EMBL) that the feature came from\&. The source may be wildcarded by using \*(Aq*\*(Aq\&. If you wish to allow more than one source, separate their names with the character \*(Aq|\*(Aq, eg: gene* | embl Default value: *
.RE
.PP
\fB\-btype\fR \fIstring\fR
.RS 4
-By default every feature in the feature table is allowed\&. You can set this to be any feature type you wish to allow\&. See http://www3\&.ebi\&.ac\&.uk/Services/WebFeat/ for a list of the EMBL feature types and see Appendix A of the Swissprot user manual in http://www\&.expasy\&.ch/txt/userman\&.txt for a list of the Swissprot feature types\&. The type may be wildcarded by using \'*\'\&. If you wish to allow more than one type, separate their names with the character \'|\', eg: *UTR | intron Default value: *
+By default every feature in the feature table is allowed\&. You can set this to be any feature type you wish to allow\&. See http://www\&.ebi\&.ac\&.uk/embl/WebFeat/ for a list of the EMBL feature types and see Appendix A of the Swissprot user manual in http://www\&.expasy\&.org/sprot/userman\&.html for a list of the Swissprot feature types\&. The type may be wildcarded by using \*(Aq*\*(Aq\&. If you wish to allow more than one type, separate their names with the character \*(Aq|\*(Aq, eg: *UTR | intron Default value: *
.RE
.PP
\fB\-bsense\fR \fIlist\fR
@@ -100,12 +109,12 @@ If this is less than or equal to the maximum score, then any score is permitted\
.PP
\fB\-btag\fR \fIstring\fR
.RS 4
-Tags are the types of extra values that a feature may have\&. For example in the EMBL feature table, a \'CDS\' type of feature may have the tags \'/codon\', \'/codon_start\', \'/db_xref\', \'/EC_number\', \'/evidence\', \'/exception\', \'/function\', \'/gene\', \'/label\', \'/map\', \'/note\', \'/number\', \'/partial\', \'/product\', \'/protein_id\', \'/pseudo\', \'/standard_name\', \'/translation\', \'/transl_except\', \'/transl_table\', or \'/usedin\'\&. Some of these tags also have values, for example \'/gene\' can have the value of the gene name\&. By default any feature tag in the feature table is allowed\&. You can set this to match any feature tag you wish to allow\&. The tag may be wildcarded by using \'*\'\&. If you wish to allow more than one tag, separate their names with the character \'|\', eg: gene | label Default value: *
+Tags are the types of extra values that a feature may have\&. For example in the EMBL feature table, a \*(AqCDS\*(Aq type of feature may have the tags \*(Aq/codon\*(Aq, \*(Aq/codon_start\*(Aq, \*(Aq/db_xref\*(Aq, \*(Aq/EC_number\*(Aq, \*(Aq/evidence\*(Aq, \*(Aq/exception\*(Aq, \*(Aq/function\*(Aq, \*(Aq/gene\*(Aq, \*(Aq/label\*(Aq, \*(Aq/map\*(Aq, \*(Aq/note\*(Aq, \*(Aq/number\*(Aq, \*(Aq/partial\*(Aq, \*(Aq/product\*(Aq, \*(Aq/protein_id\*(Aq, \*(Aq/pseudo\*(Aq, \*(Aq/standard_name\*(Aq, \*(Aq/translation\*(Aq, \*(Aq/transl_except\*(Aq, \*(Aq/transl_table\*(Aq, or \*(Aq/usedin\*(Aq\&. Some of these tags also have values, for example \*(Aq/gene\*(Aq can have the value of the gene name\&. By default any feature tag in the feature table is allowed\&. You can set this to match any feature tag you wish to allow\&. The tag may be wildcarded by using \*(Aq*\*(Aq\&. If you wish to allow more than one tag, separate their names with the character \*(Aq|\*(Aq, eg: gene | label Default value: *
.RE
.PP
\fB\-bvalue\fR \fIstring\fR
.RS 4
-Tag values are the values associated with a feature tag\&. Tags are the types of extra values that a feature may have\&. For example in the EMBL feature table, a \'CDS\' type of feature may have the tags \'/codon\', \'/codon_start\', \'/db_xref\', \'/EC_number\', \'/evidence\', \'/exception\', \'/function\', \'/gene\', \'/label\', \'/map\', \'/note\', \'/number\', \'/partial\', \'/product\', \'/protein_id\', \'/pseudo\', \'/standard_name\', \'/translation\', \'/transl_except\', \'/transl_table\', or \'/usedin\'\&. Only some of these tags can have values, for example \'/gene\' can have the value of the gene name\&. By default any feature tag value in the feature table is allowed\&. You can set this to match any feature tag value you wish to allow\&. The tag value may be wildcarded by using \'*\'\&. If you wish to allow more than one tag value, separate their names with the character \'|\', eg: pax* | 10 Default value: *
+Tag values are the values associated with a feature tag\&. Tags are the types of extra values that a feature may have\&. For example in the EMBL feature table, a \*(AqCDS\*(Aq type of feature may have the tags \*(Aq/codon\*(Aq, \*(Aq/codon_start\*(Aq, \*(Aq/db_xref\*(Aq, \*(Aq/EC_number\*(Aq, \*(Aq/evidence\*(Aq, \*(Aq/exception\*(Aq, \*(Aq/function\*(Aq, \*(Aq/gene\*(Aq, \*(Aq/label\*(Aq, \*(Aq/map\*(Aq, \*(Aq/note\*(Aq, \*(Aq/number\*(Aq, \*(Aq/partial\*(Aq, \*(Aq/product\*(Aq, \*(Aq/protein_id\*(Aq, \*(Aq/pseudo\*(Aq, \*(Aq/standard_name\*(Aq, \*(Aq/translation\*(Aq, \*(Aq/transl_except\*(Aq, \*(Aq/transl_table\*(Aq, or \*(Aq/usedin\*(Aq\&. Only some of these tags can have values, for example \*(Aq/gene\*(Aq can have the value of the gene name\&. By default any feature tag value in the feature table is allowed\&. You can set this to match any feature tag value you wish to allow\&. The tag value may be wildcarded by using \*(Aq*\*(Aq\&. If you wish to allow more than one tag value, separate their names with the character \*(Aq|\*(Aq, eg: pax* | 10 Default value: *
.RE
.SS "Feature relation options"
.PP
@@ -116,12 +125,12 @@ This allows you to specify the allowed overlaps of the features A and B\&. You c
.PP
\fB\-minrange\fR \fIinteger\fR
.RS 4
-If this is greater or equal to \'maxrange\', then no min or max range is specified
+If this is greater or equal to \*(Aqmaxrange\*(Aq, then no min or max range is specified
.RE
.PP
\fB\-maxrange\fR \fIinteger\fR
.RS 4
-If this is less than or equal to \'minrange\', then no min or max range is specified
+If this is less than or equal to \*(Aqminrange\*(Aq, then no min or max range is specified
.RE
.PP
\fB\-rangetype\fR \fIlist\fR
@@ -131,7 +140,7 @@ This allows you to specify the positions from which the allowed minimum or maxim
.PP
\fB\-sense\fR \fIlist\fR
.RS 4
-This allows you to specify the required sense that the two features must be on\&. This is ignored (always \'Any\') when looking at protein sequence features\&. Default value: A
+This allows you to specify the required sense that the two features must be on\&. This is ignored (always \*(AqAny\*(Aq) when looking at protein sequence features\&. Default value: A
.RE
.PP
\fB\-order\fR \fIlist\fR
@@ -147,7 +156,7 @@ If you set this to be true, then the two features themselves will be written out
.PP
\fB\-typeout\fR \fIstring\fR
.RS 4
-If you have specified that the pairs of features that are found should be reported as one feature in the ouput, then you can specify the \'type\' name of the new feature here\&. By default every feature in the feature table is allowed\&. See http://www3\&.ebi\&.ac\&.uk/Services/WebFeat/ for a list of the EMBL feature types and see Appendix A of the Swissprot user manual in http://www\&.expasy\&.ch/txt/userman\&.txt for a list of the Swissprot feature types\&. If you specify an invalid feature type name, then the default name \'misc_feature\' is used\&. Default value: misc_feature
+If you have specified that the pairs of features that are found should be reported as one feature in the ouput, then you can specify the \*(Aqtype\*(Aq name of the new feature here\&. By default every feature in the feature table is allowed\&. See http://www\&.ebi\&.ac\&.uk/embl/WebFeat/ for a list of the EMBL feature types and see Appendix A of the Swissprot user manual in http://www\&.expasy\&.org/sprot/userman\&.html for a list of the Swissprot feature types\&. If you specify an invalid feature type name, then the default name \*(Aqmisc_feature\*(Aq is used\&. Default value: misc_feature
.RE
.PP
\fB\-outfile\fR \fIreport\fR
diff --git a/debian/manpages/union.1e b/debian/manpages/union.1e
index fc6220d..0f50ded 100644
--- a/debian/manpages/union.1e
+++ b/debian/manpages/union.1e
@@ -2,12 +2,21 @@
.\" Title: UNION
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "UNION" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "UNION" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/vectorstrip.1e b/debian/manpages/vectorstrip.1e
index b8d3d2b..410d384 100644
--- a/debian/manpages/vectorstrip.1e
+++ b/debian/manpages/vectorstrip.1e
@@ -2,12 +2,21 @@
.\" Title: VECTORSTRIP
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "VECTORSTRIP" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "VECTORSTRIP" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/water.1e b/debian/manpages/water.1e
index 0849262..3072998 100644
--- a/debian/manpages/water.1e
+++ b/debian/manpages/water.1e
@@ -2,12 +2,21 @@
.\" Title: WATER
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "WATER" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "WATER" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -42,7 +51,7 @@ is a command line program from EMBOSS (\(lqthe European Molecular Biology Open S
.PP
\fB\-datafile\fR \fImatrixf\fR
.RS 4
-This is the scoring matrix file used when comparing sequences\&. By default it is the file \'EBLOSUM62\' (for proteins) or the file \'EDNAFULL\' (for nucleic sequences)\&. These files are found in the \'data\' directory of the EMBOSS installation\&.
+This is the scoring matrix file used when comparing sequences\&. By default it is the file \*(AqEBLOSUM62\*(Aq (for proteins) or the file \*(AqEDNAFULL\*(Aq (for nucleic sequences)\&. These files are found in the \*(Aqdata\*(Aq directory of the EMBOSS installation\&.
.RE
.SS "Required section"
.PP
diff --git a/debian/manpages/whichdb.1e b/debian/manpages/whichdb.1e
index ab9eb4c..ed6ef18 100644
--- a/debian/manpages/whichdb.1e
+++ b/debian/manpages/whichdb.1e
@@ -2,12 +2,21 @@
.\" Title: WHICHDB
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "WHICHDB" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "WHICHDB" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/wobble.1e b/debian/manpages/wobble.1e
index 8954e30..2f640d5 100644
--- a/debian/manpages/wobble.1e
+++ b/debian/manpages/wobble.1e
@@ -2,12 +2,21 @@
.\" Title: WOBBLE
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "WOBBLE" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "WOBBLE" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/wordcount.1e b/debian/manpages/wordcount.1e
index d660503..6670eee 100644
--- a/debian/manpages/wordcount.1e
+++ b/debian/manpages/wordcount.1e
@@ -2,12 +2,21 @@
.\" Title: WORDCOUNT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "WORDCOUNT" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "WORDCOUNT" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/wordfinder.1e b/debian/manpages/wordfinder.1e
index 1d958c4..d673b7c 100644
--- a/debian/manpages/wordfinder.1e
+++ b/debian/manpages/wordfinder.1e
@@ -2,12 +2,21 @@
.\" Title: WORDFINDER
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "WORDFINDER" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "WORDFINDER" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -42,7 +51,7 @@ is a command line program from EMBOSS (\(lqthe European Molecular Biology Open S
.PP
\fB\-datafile\fR \fImatrixf\fR
.RS 4
-This is the scoring matrix file used when comparing sequences\&. By default it is the file \'EBLOSUM62\' (for proteins) or the file \'EDNAFULL\' (for nucleic sequences)\&. These files are found in the \'data\' directory of the EMBOSS installation\&.
+This is the scoring matrix file used when comparing sequences\&. By default it is the file \*(AqEBLOSUM62\*(Aq (for proteins) or the file \*(AqEDNAFULL\*(Aq (for nucleic sequences)\&. These files are found in the \*(Aqdata\*(Aq directory of the EMBOSS installation\&.
.RE
.SS "Required section"
.PP
diff --git a/debian/manpages/wordmatch.1e b/debian/manpages/wordmatch.1e
index 77479a8..35959da 100644
--- a/debian/manpages/wordmatch.1e
+++ b/debian/manpages/wordmatch.1e
@@ -2,12 +2,21 @@
.\" Title: WORDMATCH
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "WORDMATCH" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "WORDMATCH" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -58,7 +67,7 @@ Default value: Y
.PP
\fB\-logfile\fR \fIoutfile\fR
.RS 4
-Log file reports statistics on kmer frequency distribution and number of matches in the seqall sequences for each sequence in the seqset Default value: wordmatch\&.log
+Statistics on distribution of kmers and matches Default value: wordmatch\&.log
.RE
.PP
\fB\-dumpfeat\fR \fItoggle\fR
diff --git a/debian/manpages/wossname.1e b/debian/manpages/wossname.1e
index 76b908c..8bdd03d 100644
--- a/debian/manpages/wossname.1e
+++ b/debian/manpages/wossname.1e
@@ -2,12 +2,21 @@
.\" Title: WOSSNAME
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "WOSSNAME" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "WOSSNAME" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
@@ -40,7 +49,7 @@ Enter a word or words here and a case\-independent search for it will be made in
.PP
\fB\-explode\fR \fIboolean\fR
.RS 4
-The groups that EMBOSS applications belong to have two forms, exploded and not exploded\&. The exploded group names are more numerous and often vaguely phrased than the non\-exploded ones\&. The exploded names are formed from definitions of the group names that start like NAME1:NAME2 and which are then expanded into many combinations of the names as: \'NAME1\', \'NAME2\', \'NAME1 NAME2\', NAME2 NAME1\'\&. The non\-expanded names are simply like: \'NAME1 NAME2\'\&. Default value: N
+The groups that EMBOSS applications belong to have two forms, exploded and not exploded\&. The exploded group names are more numerous and often vaguely phrased than the non\-exploded ones\&. The exploded names are formed from definitions of the group names that start like NAME1:NAME2 and which are then expanded into many combinations of the names as: \*(AqNAME1\*(Aq, \*(AqNAME2\*(Aq, \*(AqNAME1 NAME2\*(Aq, NAME2 NAME1\*(Aq\&. The non\-expanded names are simply like: \*(AqNAME1 NAME2\*(Aq\&. Default value: N
.RE
.PP
\fB\-allmatch\fR \fIboolean\fR
@@ -71,7 +80,7 @@ If you use this option then this EMBASSY package program documentation will be s
.PP
\fB\-colon\fR \fIboolean\fR
.RS 4
-The groups that EMBOSS applications belong to up to two levels, for example the primary group \'ALIGNMENT\' has several sub\-groups, or second\-level groups, e\&.g\&.: CONSENSUS, DIFFERENCES, DOT PLOTS, GLOBAL, LOCAL, MULTIPLE\&. To aid programs that parse the output of wossname that require the names of these subgroups, a colon \':\' will be placed between the first and second level of the group name if this option is true\&. Note: This does not apply if the group names have been exploded with the \'explode\' option\&. Default value: N
+The groups that EMBOSS applications belong to up to two levels, for example the primary group \*(AqALIGNMENT\*(Aq has several sub\-groups, or second\-level groups, e\&.g\&.: CONSENSUS, DIFFERENCES, DOT PLOTS, GLOBAL, LOCAL, MULTIPLE\&. To aid programs that parse the output of wossname that require the names of these subgroups, a colon \*(Aq:\*(Aq will be placed between the first and second level of the group name if this option is true\&. Note: This does not apply if the group names have been exploded with the \*(Aqexplode\*(Aq option\&. Default value: N
.RE
.PP
\fB\-gui\fR \fIboolean\fR
diff --git a/debian/manpages/yank.1e b/debian/manpages/yank.1e
index c43ff34..f21a69a 100644
--- a/debian/manpages/yank.1e
+++ b/debian/manpages/yank.1e
@@ -2,12 +2,21 @@
.\" Title: YANK
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 02/22/2010
+.\" Date: 07/16/2010
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.2.0
+.\" Source: EMBOSS 6.3.0
.\" Language: English
.\"
-.TH "YANK" "1e" "02/22/2010" "EMBOSS 6.2.0" "EMBOSS Manual for Debian"
+.TH "YANK" "1e" "07/16/2010" "EMBOSS 6.3.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
--
The European Molecular Biology Open Software Suite.
More information about the Debian-med-packaging
mailing list