[Debian-med-packaging] Problem with getorf command

[Andreas Tille]

Hi,

I guess you need to contact the upstream authors of EMBOSS.  We are just
packaging their software and I'm not sure whether there is any active
user amongst those people who volunteer to package the EMBOSS software
suite for Debian.  While EMBOSS development is stalled there might be
some user lists to discuss this kind of problems.

Kind regards

      Andreas.

On Mon, Aug 09, 2021 at 02:30:37PM +0430, m.baraty wrote:
> Hello Dear,
> I have a problem using the getorf command. According to the image, the
> input sequence ID is not the same as the sequence ID in the output file.
> How can I solve this problem?
> Thanks a lot
> 
> input:
> 
> >wheat1A02G000100|wheat1A02G000100.1
> 
> GAGCCCAGTCCTCAGAGCAAATCCTTTTCCCGAAGTTACGGATCCGTTTTGCCGACTTCCCTTGCCTACATTG
> 
> output:
> 
> >EMBOSS_001_1 [134 - 235] ATGAACGGTACTCGGTCCTCCGGATTTTCATGGGCCGCCGGG

> _______________________________________________
> Debian-med-packaging mailing list
> Debian-med-packaging at alioth-lists.debian.net
> https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-packaging


-- 
http://fam-tille.de