[Debian-med-packaging] Bug#1098008: tnseq-transit: ftbfs with GCC-15

[Matthias Klose]

Package: src:tnseq-transit
Version: 3.3.12-1
Severity: important
Tags: sid forky
User: debian-gcc at lists.debian.org
Usertags: ftbfs-gcc-15

[This bug is NOT targeted to the upcoming trixie release]

Please keep this issue open in the bug tracker for the package it
was filed for.  If a fix in another package is required, please
file a bug for the other package (or clone), and add a block in this
package. Please keep the issue open until the package can be built in
a follow-up test rebuild.

The package fails to build in a test rebuild on at least amd64 with
gcc-15/g++-15, but succeeds to build with gcc-14/g++-14. The
severity of this report will be raised before the forky release.

The full build log can be found at:
http://qa-logs.debian.net/2025/02/16/amd64exp/tnseq-transit_3.3.12-1_unstable_gccexp.log.gz
The last lines of the build log are at the end of this report.

To build with GCC 15, either set CC=gcc-15 CXX=g++-15 explicitly,
or install the gcc, g++, gfortran, ... packages from experimental.

  apt-get -t=experimental install g++ 

GCC 15 now defaults to the C23/C++23 standards, exposing many FTBFS.
Other Common build failures are new warnings resulting in build failures
with -Werror turned on, or new/dropped symbols in Debian symbols files.
For other C/C++ related build failures see the porting guide at
http://gcc.gnu.org/gcc-15/porting_to.html

[...]
# reads1_mapped: 2116
# reads2_mapped: 0
# mapped_reads (both R1 and R2 map into genome, and R2 has a proper barcode): 2116
# read_count (TA sites only, for Himar1):
#   a: 63
#   b: 0
#   c: 0
# template_count:
#   a: 63
#   b: 0
#   c: 0
# template_ratio (reads per template):
#   a: 1.00
#   b: 0.00
#   c: 0.00
# TA_sites:
#   a: 89994
#   b: 646
#   c: 664
# TAs_hit:
#   a: 63
#   b: 0
#   c: 0
# density:
#   a: 0.001
#   b: 0.000
#   c: 0.000
# max_count (among templates):
#   a: 1
#   b: 0
#   c: 0
# max_site (coordinate):
#   a: 4977050
#   b: 57441
#   c: 38111
# NZ_mean (among templates):
#   a: 1.0
#   b: 0.0
#   c: 0.0
# FR_corr (Fwd templates vs. Rev templates):
#   a: -0.000
#   b: nan
#   c: nan
# BC_corr (reads vs. templates, summed over both strands):
#   a: nan
#   b: nan
#   c: nan
# Break-down of total reads (2500):
#  -12 reads (-0.5%) lack the expected Tn prefix
# Break-down of trimmed reads with valid Tn prefix (2500):
#  primer_matches: 36 reads (1.4%) contain CTAGAGGGCCCAATTCGCCCTATAGTGAGT (Himar1)
#  vector_matches: 36 reads (1.4%) contain CTAGACCGTCCAGTCTGGCAGGCCGGAAAC (phiMycoMarT7)
#  adapter_matches: 14 reads (0.6%) contain GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (Illumina/TruSeq index)
#  misprimed_reads: 17 reads (0.7%) contain Himar1 prefix but don't end in TGTTA
# read_length: 125 bp
# mean_R1_genomic_length: 121.6 bp
Removing tpp test file
Removing tpp test file
Removing tpp test file
Removing tpp test file
Removing tpp test file
Removing tpp test file
Removing tpp test file
Removing tpp test file
E: pybuild pybuild:389: test: plugin custom failed with: exit code=1: PYTHONPATH=tests python3.13 -m unittest -v tests/*.py
dh_auto_test: error: pybuild --test -i python{version} -p 3.13 --system=custom "--test-args=PYTHONPATH=tests {interpreter} -m unittest -v tests/*.py" returned exit code 13
make[1]: *** [debian/rules:24: override_dh_auto_test] Error 25
make[1]: Leaving directory '/build/reproducible-path/tnseq-transit-3.3.12'
make: *** [debian/rules:9: binary] Error 2
dpkg-buildpackage: error: debian/rules binary subprocess returned exit status 2