[Debian-med-packaging] Bug#1105422: kmer: FTBFS with make --shuffle=reverse: make[2]: *** No rule to make target '/build/reproducible-path/kmer-0~20150903+r2013/atac-driver/libatac/libatac.a', needed by 'atac-driver/chimera/happy-clones-span-clumps'. Stop.

[Lucas Nussbaum]

Source: kmer
Version: 0~20150903+r2013-9
Severity: minor
Tags: trixie sid ftbfs
User: lucas at debian.org
Usertags: ftbfs-shuffle

Hi,

GNU Make now has a --shuffle option that simulates non-deterministic ordering
of target prerequisites. See
https://trofi.github.io/posts/238-new-make-shuffle-mode.html and also previous
work in Debian by Santiago Vila:
https://people.debian.org/~sanvila/make-shuffle/

This package fails to build with make --shuffle=reverse.
This is likely to be caused by a missing dependency in
debian/rules or an upstream Makefile.

More information about this mass bug filing is available at
https://wiki.debian.org/qa.debian.org/FTBFS/Shuffle

Relevant part (hopefully):
> make[2]: Entering directory '/build/reproducible-path/kmer-0~20150903+r2013'
> making ESTmapper/mergeCounts.C.d
> making ESTmapper/terminate.C.d
> making atac-driver/libatac/atacFeature.C.d
> making atac-driver/libatac/atacFeatureList.C.d
> making atac-driver/libatac/atacFile.C.d
> making atac-driver/libatac/atacFileStreamMerge.C.d
> making atac-driver/libatac/atacMatch.C.d
> making atac-driver/libatac/atacMatchList.C.d
> making atac-driver/libatac/atacMatchOrder.C.d
> making atac-driver/alignOverlap/overlap.C.d
> making atac-driver/alignOverlap/overlap-sort.C.d
> making atac-driver/alignOverlap/overlap-printAnno.C.d
> making atac-driver/alignOverlap/overlap-find.C.d
> making atac-driver/gapShifter/gapShifter.C.d
> making atac-driver/gapShifter/extractSequence.C.d
> making atac-driver/gapShifter/extractUnmapped.C.d
> making atac-driver/gapShifter/coalesceMatches.C.d
> making atac-driver/gapShifter/correctGaps.C.d
> making atac-driver/gapShifter/testAtac.C.d
> making atac-driver/gapShifter/cleanAtac.C.d
> making atac-driver/gapShifter/projectFeatures.C.d
> making atac-driver/lengthFilter/lengthFilter.C.d
> making atac-driver/matchExtender/matchExtender.C.d
> making atac-driver/matchExtender/matchExtender-dump.C.d
> making atac-driver/matchExtender/matchExtender-func.C.d
> making atac-driver/mismatchCounter/mismatchCounter.C.d
> making atac-driver/statsGenerator/statsGenerator.C.d
> making atac-driver/uniqueFilter/uniqueFilter.C.d
> making atac-driver/clumpMaker/clumpMaker.C.d
> making atac-driver/chainer/localalign/GF_ALN_dpaligner.C.d
> making atac-driver/chainer/localalign/GF_ALN_local.C.d
> making atac-driver/chainer/localalign/GF_ALN_overlap.C.d
> making atac-driver/chainer/localalign/GF_ALN_loverlapper.C.d
> making atac-driver/chainer/localalign/GF_ALN_pieceOlap.C.d
> making atac-driver/chainer/localalign/localAlignerInterfacemodule.C.d
> making atac-driver/chainer/halign/halign.C.d
> making atac-driver/chainer/halign/halignmodule.C.d
> making atac-driver/chimera/happy-clones-span-clumps.C.d
> making seatac/seatac.C.d
> making seatac/configuration.C.d
> making seatac/encodedQuery.C.d
> making seatac/hitMatrix.C.d
> making seatac/thr-search.C.d
> making seatac/thr-loader.C.d
> making seatac/thr-deadlock.C.d
> making seatac/hitMatrix-sort.C.d
> making leaff/leaff.C.d
> making leaff/blocks.C.d
> making leaff/dups.C.d
> making leaff/gc.C.d
> making leaff/partition.C.d
> making leaff/simseq.C.d
> making leaff/stats.C.d
> making meryl/args.C.d
> making meryl/binaryOp.C.d
> making meryl/build.C.d
> making meryl/build-threads.C.d
> making meryl/dump.C.d
> making meryl/estimate.C.d
> making meryl/merge.C.d
> making meryl/unaryOp.C.d
> making meryl/meryl.C.d
> making meryl/simple.C.d
> making meryl/mapMers.C.d
> making meryl/mapMers-depth.C.d
> making meryl/kmer-mask.C.d
> making seagen/searchGENOME.C.d
> making seagen/configuration.C.d
> making seagen/encodedQuery.C.d
> making seagen/thr-deadlock.C.d
> making seagen/thr-loader.C.d
> making seagen/thr-search.C.d
> making seagen/thr-output.C.d
> making seagen/hitMatrix-sort.C.d
> making seagen/aHit.C.d
> making seagen/hitConverter.C.d
> making seagen/filterEST.C.d
> making seagen/filterEST-complicated.C.d
> making seagen/filterMRNA.C.d
> making seagen/filterNULL.C.d
> making seagen/sortHits.C.d
> making seagen/filtertest.C.d
> making seagen/hitReader.C.d
> making seagen/hitMatrix.C.d
> making sim4dbutils/cleanPolishes.C.d
> making sim4dbutils/fixPolishesIID.C.d
> making sim4dbutils/comparePolishes.C.d
> making sim4dbutils/convertToAtac.C.d
> making sim4dbutils/convertToExtent.C.d
> making sim4dbutils/convertPolishes.C.d
> making sim4dbutils/detectChimera.C.d
> making sim4dbutils/depthOfPolishes.C.d
> making sim4dbutils/filterPolishes.C.d
> making sim4dbutils/headPolishes.C.d
> making sim4dbutils/mappedCoverage.C.d
> making sim4dbutils/mergePolishes.C.d
> making sim4dbutils/parseSNP.C.d
> making sim4dbutils/pickBestPolish.C.d
> making sim4dbutils/pickBestPair.C.d
> making sim4dbutils/pickUniquePolish.C.d
> making sim4dbutils/plotCoverageVsIdentity.C.d
> making sim4dbutils/removeDuplicate.C.d
> making sim4dbutils/sortPolishes.C.d
> making sim4dbutils/summarizePolishes.C.d
> making sim4dbutils/uniqPolishes.C.d
> making sim4dbutils/vennPolishes.C.d
> making sim4dbutils/realignPolishes.C.d
> making sim4dbutils/removeRedundant.C.d
> making sim4dbutils/reportAlignmentDifferences.C.d
> making sim4dbutils/s4p_overlap.C.d
> making sim4db/sim4th.C.d
> making snapper/snapper2.C.d
> making snapper/configuration.C.d
> making snapper/thr-search.C.d
> making snapper/thr-filter.C.d
> making snapper/thr-polish.C.d
> making snapper/thr-polish-dp.C.d
> making snapper/hitMatrix.C.d
> making snapper/hitMatrix-sort.C.d
> making tapper/tagger.C.d
> making tapper/tapper.C.d
> making tapper/tapperconvert.C.d
> making tapper/tappermerge.C.d
> making tapper/tappersort.C.d
> making tapper/tappererrorcorrect.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4command.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4parameters.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4string.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/Xtend1.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/align.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/exon_cores.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/extend.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/glimmerSplice.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/greedy.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/mspManager.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/pluri_align.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/poly.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4b1.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4b1a.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4b1-1.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4b1-2.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4b1-3.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4b1-4.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4b1_s.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sites.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sites_donor.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sites_acceptor.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sites_score.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/splice.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/table.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/util.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-compare.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-copy.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-deleteexon.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-exons.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-read.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-updatescores.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishList.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishBuilder.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishFile.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishReader.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishWriter.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-create-from-fasta.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-create-from-meryl.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-create-from-sequence.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-state.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-access.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-dump.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-file.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-mismatch.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-sort.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libkmer/driver-existDB.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libkmer/driver-posDB.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libmeryl/libmeryl.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libbio/alphabet.c.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libbio/alphabet-acgtspace.c.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libbio/alphabet-colorspace.c.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libbio/halign.c.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libbio/reversecomplement.c.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libbio/kmer.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastaFile.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastaStdin.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastqFile.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastqStdin.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStore.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libseq/sffFile.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqFactory.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqCache.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStream.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libseq/merStream.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqCache.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqStream.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-merStream.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libutil/file.c.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libutil/md5.c.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libutil/palloc.c.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libutil/qsort_mt.c.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.c.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libutil/bigQueue.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libutil/fibonacciNumbers.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libutil/readBuffer.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libutil/recordFile.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libutil/speedCounter.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libutil/sweatShop.C.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libutil/mt19937ar/mt19937ar.c.d
> gcc -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libutil/mt19937ar/mt19937ar.o -c /build/reproducible-path/kmer-0~20150903+r2013/libutil/mt19937ar/mt19937ar.c
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/mt19937ar/mt19937ar.c: In function ‘mtRandomGaussian’:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/mt19937ar/mt19937ar.c:166:34: warning: variable ‘y2’ set but not used [-Wunused-but-set-variable]
>   166 |   double  x1=0, x2=0, w=0, y1=0, y2=0;
>       |                                  ^~
> gcc -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libutil/mt19937ar/mt19937ar-test.o -c /build/reproducible-path/kmer-0~20150903+r2013/libutil/mt19937ar/mt19937ar-test.c
> gcc -Wl,-z,relro -Wl,-z,now -o /build/reproducible-path/kmer-0~20150903+r2013/libutil/mt19937ar/mt19937ar-test /build/reproducible-path/kmer-0~20150903+r2013/libutil/mt19937ar/mt19937ar.o /build/reproducible-path/kmer-0~20150903+r2013/libutil/mt19937ar/mt19937ar-test.o -pthread -ldl -lm
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/mt19937ar/mt19937ar-test | diff - /build/reproducible-path/kmer-0~20150903+r2013/libutil/mt19937ar/mt19937ar.out > /build/reproducible-path/kmer-0~20150903+r2013/libutil/mt19937ar/diffs 2>&1
> if test -s /build/reproducible-path/kmer-0~20150903+r2013/libutil/mt19937ar/diffs ; then echo 'MT19937: TEST FAILED'; else echo 'MT19937: Test Passed'; fi
> MT19937: Test Passed
> touch /build/reproducible-path/kmer-0~20150903+r2013/libutil/mt19937ar/test.c
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/mt19937ar/mt19937ar-test | diff - /build/reproducible-path/kmer-0~20150903+r2013/libutil/mt19937ar/mt19937ar.out
> making /build/reproducible-path/kmer-0~20150903+r2013/libutil/mt19937ar/test.c.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/dict.c.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/except.c.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/hash.c.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/list.c.d
> making /build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/sfx.c.d
> Make.rules:316: update target '/build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/.install-copy-SHARE' due to: target does not exist
> files=''; dirs='share/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:301: update target '/build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/.install-copy-SH' due to: target does not exist
> files=''; dirs='bin/'; sheb=''; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:286: update target '/build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/.install-copy-PERL' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/env perl'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:270: update target '/build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/.install-copy-PYTHON' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/python3'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:248: update target '/build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/.install-copy-TEX_PSPDF' due to: target does not exist
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:207: update target '/build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/.install-copy-C-CXX-INCS' due to: target does not exist
> files=''; dirs='include/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:197: update target '/build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/.install-copy-C-CXX-SHLIBS' due to: target does not exist
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F} .so`.so ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:189: update target '/build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/.install-copy-C-CXX-LIBS' due to: target does not exist
> files='/build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/libkaz.a'; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:156: update target '/build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/.install-copy-C-CXX-EXES' due to: target does not exist
> files=''; dirs='bin/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ "" != "" -a -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:316: update target '/build/reproducible-path/kmer-0~20150903+r2013/libutil/mt19937ar/.install-copy-SHARE' due to: target does not exist
> files=''; dirs='share/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:301: update target '/build/reproducible-path/kmer-0~20150903+r2013/libutil/mt19937ar/.install-copy-SH' due to: target does not exist
> files=''; dirs='bin/'; sheb=''; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:286: update target '/build/reproducible-path/kmer-0~20150903+r2013/libutil/mt19937ar/.install-copy-PERL' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/env perl'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:270: update target '/build/reproducible-path/kmer-0~20150903+r2013/libutil/mt19937ar/.install-copy-PYTHON' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/python3'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:248: update target '/build/reproducible-path/kmer-0~20150903+r2013/libutil/mt19937ar/.install-copy-TEX_PSPDF' due to: target does not exist
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:207: update target '/build/reproducible-path/kmer-0~20150903+r2013/libutil/mt19937ar/.install-copy-C-CXX-INCS' due to: target does not exist
> files=''; dirs='include/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:197: update target '/build/reproducible-path/kmer-0~20150903+r2013/libutil/mt19937ar/.install-copy-C-CXX-SHLIBS' due to: target does not exist
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F} .so`.so ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:189: update target '/build/reproducible-path/kmer-0~20150903+r2013/libutil/mt19937ar/.install-copy-C-CXX-LIBS' due to: target does not exist
> files='/build/reproducible-path/kmer-0~20150903+r2013/libutil/mt19937ar/libmt19937ar.a'; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:156: update target '/build/reproducible-path/kmer-0~20150903+r2013/libutil/mt19937ar/.install-copy-C-CXX-EXES' due to: target does not exist
> files='/build/reproducible-path/kmer-0~20150903+r2013/libutil/mt19937ar/mt19937ar-test'; dirs='bin/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ "" != "" -a -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:316: update target '/build/reproducible-path/kmer-0~20150903+r2013/libutil/.install-copy-SHARE' due to: target does not exist
> files=''; dirs='share/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:301: update target '/build/reproducible-path/kmer-0~20150903+r2013/libutil/.install-copy-SH' due to: target does not exist
> files=''; dirs='bin/'; sheb=''; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:286: update target '/build/reproducible-path/kmer-0~20150903+r2013/libutil/.install-copy-PERL' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/env perl'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:270: update target '/build/reproducible-path/kmer-0~20150903+r2013/libutil/.install-copy-PYTHON' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/python3'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:248: update target '/build/reproducible-path/kmer-0~20150903+r2013/libutil/.install-copy-TEX_PSPDF' due to: target does not exist
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:207: update target '/build/reproducible-path/kmer-0~20150903+r2013/libutil/.install-copy-C-CXX-INCS' due to: target does not exist
> files='/build/reproducible-path/kmer-0~20150903+r2013/libutil/bigQueue.H /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H /build/reproducible-path/kmer-0~20150903+r2013/libutil/endianess.H /build/reproducible-path/kmer-0~20150903+r2013/libutil/intervalList.H /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H /build/reproducible-path/kmer-0~20150903+r2013/libutil/readBuffer.H /build/reproducible-path/kmer-0~20150903+r2013/libutil/recordFile.H /build/reproducible-path/kmer-0~20150903+r2013/libutil/speedCounter.H /build/reproducible-path/kmer-0~20150903+r2013/libutil/splitToWords.H /build/reproducible-path/kmer-0~20150903+r2013/libutil/sweatShop.H /build/reproducible-path/kmer-0~20150903+r2013/libutil/uint32List.H /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitOperations.h /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPacking.h /build/reproducible-path/kmer-0~20150903+r2013/libutil/eliasDeltaEncoding.h /build/reproducible-path/kmer-0~20150903+r2013/libutil/eliasGammaEncoding.h /build/reproducible-path/kmer-0~20150903+r2013/libutil/fibonacciEncoding.h /build/reproducible-path/kmer-0~20150903+r2013/libutil/generalizedUnaryEncoding.h /build/reproducible-path/kmer-0~20150903+r2013/libutil/unaryEncoding.h /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h'; dirs='include/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:197: update target '/build/reproducible-path/kmer-0~20150903+r2013/libutil/.install-copy-C-CXX-SHLIBS' due to: target does not exist
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F} .so`.so ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:189: update target '/build/reproducible-path/kmer-0~20150903+r2013/libutil/.install-copy-C-CXX-LIBS' due to: target does not exist
> files='/build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a'; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:156: update target '/build/reproducible-path/kmer-0~20150903+r2013/libutil/.install-copy-C-CXX-EXES' due to: target does not exist
> files=''; dirs='bin/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ "" != "" -a -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:316: update target '/build/reproducible-path/kmer-0~20150903+r2013/libseq/.install-copy-SHARE' due to: target does not exist
> files=''; dirs='share/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:301: update target '/build/reproducible-path/kmer-0~20150903+r2013/libseq/.install-copy-SH' due to: target does not exist
> files=''; dirs='bin/'; sheb=''; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:286: update target '/build/reproducible-path/kmer-0~20150903+r2013/libseq/.install-copy-PERL' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/env perl'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:270: update target '/build/reproducible-path/kmer-0~20150903+r2013/libseq/.install-copy-PYTHON' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/python3'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:248: update target '/build/reproducible-path/kmer-0~20150903+r2013/libseq/.install-copy-TEX_PSPDF' due to: target does not exist
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:207: update target '/build/reproducible-path/kmer-0~20150903+r2013/libseq/.install-copy-C-CXX-INCS' due to: target does not exist
> files='/build/reproducible-path/kmer-0~20150903+r2013/libseq/seqFile.H /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastaFile.H /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastaStdin.H /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastqFile.H /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastqStdin.H /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStore.H /build/reproducible-path/kmer-0~20150903+r2013/libseq/sffFile.H /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqFactory.H /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqCache.H /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStream.H /build/reproducible-path/kmer-0~20150903+r2013/libseq/merStream.H'; dirs='include/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:197: update target '/build/reproducible-path/kmer-0~20150903+r2013/libseq/.install-copy-C-CXX-SHLIBS' due to: target does not exist
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F} .so`.so ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:189: update target '/build/reproducible-path/kmer-0~20150903+r2013/libseq/.install-copy-C-CXX-LIBS' due to: target does not exist
> files='/build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a'; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:156: update target '/build/reproducible-path/kmer-0~20150903+r2013/libseq/.install-copy-C-CXX-EXES' due to: target does not exist
> files='/build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqCache /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqStream /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-merStream'; dirs='bin/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ "" != "" -a -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:316: update target '/build/reproducible-path/kmer-0~20150903+r2013/libbio/.install-copy-SHARE' due to: target does not exist
> files=''; dirs='share/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:301: update target '/build/reproducible-path/kmer-0~20150903+r2013/libbio/.install-copy-SH' due to: target does not exist
> files=''; dirs='bin/'; sheb=''; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:286: update target '/build/reproducible-path/kmer-0~20150903+r2013/libbio/.install-copy-PERL' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/env perl'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:270: update target '/build/reproducible-path/kmer-0~20150903+r2013/libbio/.install-copy-PYTHON' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/python3'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:248: update target '/build/reproducible-path/kmer-0~20150903+r2013/libbio/.install-copy-TEX_PSPDF' due to: target does not exist
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:207: update target '/build/reproducible-path/kmer-0~20150903+r2013/libbio/.install-copy-C-CXX-INCS' due to: target does not exist
> files='/build/reproducible-path/kmer-0~20150903+r2013/libbio/alphabet.h /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h /build/reproducible-path/kmer-0~20150903+r2013/libbio/mers.h /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H /build/reproducible-path/kmer-0~20150903+r2013/libbio/kmer.H /build/reproducible-path/kmer-0~20150903+r2013/libbio/kmerhuge.H /build/reproducible-path/kmer-0~20150903+r2013/libbio/kmeriface.H /build/reproducible-path/kmer-0~20150903+r2013/libbio/kmertiny.H /build/reproducible-path/kmer-0~20150903+r2013/libbio/merCovering.H /build/reproducible-path/kmer-0~20150903+r2013/libbio/merList.H'; dirs='include/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:197: update target '/build/reproducible-path/kmer-0~20150903+r2013/libbio/.install-copy-C-CXX-SHLIBS' due to: target does not exist
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F} .so`.so ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:189: update target '/build/reproducible-path/kmer-0~20150903+r2013/libbio/.install-copy-C-CXX-LIBS' due to: target does not exist
> files='/build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a'; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:156: update target '/build/reproducible-path/kmer-0~20150903+r2013/libbio/.install-copy-C-CXX-EXES' due to: target does not exist
> files=''; dirs='bin/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ "" != "" -a -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:316: update target '/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/.install-copy-SHARE' due to: target does not exist
> files=''; dirs='share/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:301: update target '/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/.install-copy-SH' due to: target does not exist
> files=''; dirs='bin/'; sheb=''; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:286: update target '/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/.install-copy-PERL' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/env perl'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:270: update target '/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/.install-copy-PYTHON' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/python3'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:248: update target '/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/.install-copy-TEX_PSPDF' due to: target does not exist
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:207: update target '/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/.install-copy-C-CXX-INCS' due to: target does not exist
> files='/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/libmeryl.H'; dirs='include/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:197: update target '/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/.install-copy-C-CXX-SHLIBS' due to: target does not exist
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F} .so`.so ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:189: update target '/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/.install-copy-C-CXX-LIBS' due to: target does not exist
> files='/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/libmeryl.a'; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:156: update target '/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/.install-copy-C-CXX-EXES' due to: target does not exist
> files=''; dirs='bin/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ "" != "" -a -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:316: update target '/build/reproducible-path/kmer-0~20150903+r2013/libkmer/.install-copy-SHARE' due to: target does not exist
> files=''; dirs='share/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:301: update target '/build/reproducible-path/kmer-0~20150903+r2013/libkmer/.install-copy-SH' due to: target does not exist
> files=''; dirs='bin/'; sheb=''; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:286: update target '/build/reproducible-path/kmer-0~20150903+r2013/libkmer/.install-copy-PERL' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/env perl'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:270: update target '/build/reproducible-path/kmer-0~20150903+r2013/libkmer/.install-copy-PYTHON' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/python3'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:248: update target '/build/reproducible-path/kmer-0~20150903+r2013/libkmer/.install-copy-TEX_PSPDF' due to: target does not exist
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:207: update target '/build/reproducible-path/kmer-0~20150903+r2013/libkmer/.install-copy-C-CXX-INCS' due to: target does not exist
> files='/build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB.H /build/reproducible-path/kmer-0~20150903+r2013/libkmer/merTable.H /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H'; dirs='include/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:197: update target '/build/reproducible-path/kmer-0~20150903+r2013/libkmer/.install-copy-C-CXX-SHLIBS' due to: target does not exist
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F} .so`.so ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:189: update target '/build/reproducible-path/kmer-0~20150903+r2013/libkmer/.install-copy-C-CXX-LIBS' due to: target does not exist
> files='/build/reproducible-path/kmer-0~20150903+r2013/libkmer/libkmer.a'; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:156: update target '/build/reproducible-path/kmer-0~20150903+r2013/libkmer/.install-copy-C-CXX-EXES' due to: target does not exist
> files='/build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB'; dirs='bin/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ "" != "" -a -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:316: update target '/build/reproducible-path/kmer-0~20150903+r2013/libsim4/.install-copy-SHARE' due to: target does not exist
> files=''; dirs='share/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:301: update target '/build/reproducible-path/kmer-0~20150903+r2013/libsim4/.install-copy-SH' due to: target does not exist
> files=''; dirs='bin/'; sheb=''; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:286: update target '/build/reproducible-path/kmer-0~20150903+r2013/libsim4/.install-copy-PERL' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/env perl'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files='/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish.pm'; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:270: update target '/build/reproducible-path/kmer-0~20150903+r2013/libsim4/.install-copy-PYTHON' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/python3'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:248: update target '/build/reproducible-path/kmer-0~20150903+r2013/libsim4/.install-copy-TEX_PSPDF' due to: target does not exist
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:207: update target '/build/reproducible-path/kmer-0~20150903+r2013/libsim4/.install-copy-C-CXX-INCS' due to: target does not exist
> files='/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/exon.H /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/mspManager.H /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4.H /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4defines.H /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4parameters.H /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish.H /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishList.H /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishBuilder.H /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishFile.H /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishReader.H /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishWriter.H'; dirs='include/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:197: update target '/build/reproducible-path/kmer-0~20150903+r2013/libsim4/.install-copy-C-CXX-SHLIBS' due to: target does not exist
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F} .so`.so ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:189: update target '/build/reproducible-path/kmer-0~20150903+r2013/libsim4/.install-copy-C-CXX-LIBS' due to: target does not exist
> files='/build/reproducible-path/kmer-0~20150903+r2013/libsim4/libsim4.a'; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:156: update target '/build/reproducible-path/kmer-0~20150903+r2013/libsim4/.install-copy-C-CXX-EXES' due to: target does not exist
> files=''; dirs='bin/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ "" != "" -a -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:316: update target 'tapper/.install-copy-SHARE' due to: target does not exist
> files=''; dirs='share/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:301: update target 'tapper/.install-copy-SH' due to: target does not exist
> files=''; dirs='bin/'; sheb=''; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:286: update target 'tapper/.install-copy-PERL' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/env perl'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:270: update target 'tapper/.install-copy-PYTHON' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/python3'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:248: update target 'tapper/.install-copy-TEX_PSPDF' due to: target does not exist
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:207: update target 'tapper/.install-copy-C-CXX-INCS' due to: target does not exist
> files=''; dirs='include/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:197: update target 'tapper/.install-copy-C-CXX-SHLIBS' due to: target does not exist
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F} .so`.so ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:189: update target 'tapper/.install-copy-C-CXX-LIBS' due to: target does not exist
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:156: update target 'tapper/.install-copy-C-CXX-EXES' due to: target does not exist
> files='tapper/tagger tapper/tapper tapper/tapperconvert tapper/tappermerge tapper/tappersort tapper/tappererrorcorrect'; dirs='bin/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ "" != "" -a -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:316: update target 'snapper/.install-copy-SHARE' due to: target does not exist
> files=''; dirs='share/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:301: update target 'snapper/.install-copy-SH' due to: target does not exist
> files=''; dirs='bin/'; sheb=''; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:286: update target 'snapper/.install-copy-PERL' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/env perl'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:270: update target 'snapper/.install-copy-PYTHON' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/python3'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:248: update target 'snapper/.install-copy-TEX_PSPDF' due to: target does not exist
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:207: update target 'snapper/.install-copy-C-CXX-INCS' due to: target does not exist
> files=''; dirs='include/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:197: update target 'snapper/.install-copy-C-CXX-SHLIBS' due to: target does not exist
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F} .so`.so ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:189: update target 'snapper/.install-copy-C-CXX-LIBS' due to: target does not exist
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:156: update target 'snapper/.install-copy-C-CXX-EXES' due to: target does not exist
> files='snapper/snapper2'; dirs='bin/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ "" != "" -a -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:316: update target 'sim4db/.install-copy-SHARE' due to: target does not exist
> files=''; dirs='share/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:301: update target 'sim4db/.install-copy-SH' due to: target does not exist
> files=''; dirs='bin/'; sheb=''; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:286: update target 'sim4db/.install-copy-PERL' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/env perl'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:270: update target 'sim4db/.install-copy-PYTHON' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/python3'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:248: update target 'sim4db/.install-copy-TEX_PSPDF' due to: target does not exist
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:207: update target 'sim4db/.install-copy-C-CXX-INCS' due to: target does not exist
> files=''; dirs='include/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:197: update target 'sim4db/.install-copy-C-CXX-SHLIBS' due to: target does not exist
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F} .so`.so ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:189: update target 'sim4db/.install-copy-C-CXX-LIBS' due to: target does not exist
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:156: update target 'sim4db/.install-copy-C-CXX-EXES' due to: target does not exist
> files='sim4db/sim4db'; dirs='bin/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ "" != "" -a -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:316: update target 'sim4dbutils/.install-copy-SHARE' due to: target does not exist
> files=''; dirs='share/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:301: update target 'sim4dbutils/.install-copy-SH' due to: target does not exist
> files=''; dirs='bin/'; sheb=''; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:286: update target 'sim4dbutils/.install-copy-PERL' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/env perl'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:270: update target 'sim4dbutils/.install-copy-PYTHON' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/python3'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:248: update target 'sim4dbutils/.install-copy-TEX_PSPDF' due to: target does not exist
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:207: update target 'sim4dbutils/.install-copy-C-CXX-INCS' due to: target does not exist
> files=''; dirs='include/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:197: update target 'sim4dbutils/.install-copy-C-CXX-SHLIBS' due to: target does not exist
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F} .so`.so ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:189: update target 'sim4dbutils/.install-copy-C-CXX-LIBS' due to: target does not exist
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:156: update target 'sim4dbutils/.install-copy-C-CXX-EXES' due to: target does not exist
> files='sim4dbutils/cleanPolishes sim4dbutils/fixPolishesIID sim4dbutils/comparePolishes sim4dbutils/convertToAtac sim4dbutils/convertToExtent sim4dbutils/convertPolishes sim4dbutils/detectChimera sim4dbutils/depthOfPolishes sim4dbutils/filterPolishes sim4dbutils/headPolishes sim4dbutils/mappedCoverage sim4dbutils/mergePolishes sim4dbutils/parseSNP sim4dbutils/pickBestPolish sim4dbutils/pickBestPair sim4dbutils/pickUniquePolish sim4dbutils/plotCoverageVsIdentity sim4dbutils/removeDuplicate sim4dbutils/sortPolishes sim4dbutils/summarizePolishes sim4dbutils/uniqPolishes sim4dbutils/vennPolishes sim4dbutils/realignPolishes sim4dbutils/removeRedundant sim4dbutils/reportAlignmentDifferences'; dirs='bin/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ "" != "" -a -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:316: update target 'seagen/.install-copy-SHARE' due to: target does not exist
> files=''; dirs='share/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:301: update target 'seagen/.install-copy-SH' due to: target does not exist
> files=''; dirs='bin/'; sheb=''; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:286: update target 'seagen/.install-copy-PERL' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/env perl'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:270: update target 'seagen/.install-copy-PYTHON' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/python3'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:248: update target 'seagen/.install-copy-TEX_PSPDF' due to: target does not exist
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:207: update target 'seagen/.install-copy-C-CXX-INCS' due to: target does not exist
> files=''; dirs='include/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:197: update target 'seagen/.install-copy-C-CXX-SHLIBS' due to: target does not exist
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F} .so`.so ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:189: update target 'seagen/.install-copy-C-CXX-LIBS' due to: target does not exist
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:156: update target 'seagen/.install-copy-C-CXX-EXES' due to: target does not exist
> files='seagen/seagen seagen/hitConverter seagen/filterEST seagen/filterMRNA seagen/filterNULL seagen/filtertest seagen/sortHits seagen/filterESTsimple'; dirs='bin/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ "" != "" -a -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:316: update target 'meryl/.install-copy-SHARE' due to: target does not exist
> files=''; dirs='share/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:301: update target 'meryl/.install-copy-SH' due to: target does not exist
> files=''; dirs='bin/'; sheb=''; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:286: update target 'meryl/.install-copy-PERL' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/env perl'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:270: update target 'meryl/.install-copy-PYTHON' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/python3'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:248: update target 'meryl/.install-copy-TEX_PSPDF' due to: target does not exist
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:207: update target 'meryl/.install-copy-C-CXX-INCS' due to: target does not exist
> files='meryl/meryl.H'; dirs='include/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:197: update target 'meryl/.install-copy-C-CXX-SHLIBS' due to: target does not exist
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F} .so`.so ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:189: update target 'meryl/.install-copy-C-CXX-LIBS' due to: target does not exist
> files='meryl/libmerylguts.a'; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:156: update target 'meryl/.install-copy-C-CXX-EXES' due to: target does not exist
> files='meryl/meryl meryl/simple meryl/mapMers meryl/mapMers-depth meryl/kmer-mask'; dirs='bin/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ "" != "" -a -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:316: update target 'leaff/.install-copy-SHARE' due to: target does not exist
> files=''; dirs='share/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:301: update target 'leaff/.install-copy-SH' due to: target does not exist
> files=''; dirs='bin/'; sheb=''; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:286: update target 'leaff/.install-copy-PERL' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/env perl'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:270: update target 'leaff/.install-copy-PYTHON' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/python3'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:248: update target 'leaff/.install-copy-TEX_PSPDF' due to: target does not exist
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:207: update target 'leaff/.install-copy-C-CXX-INCS' due to: target does not exist
> files=''; dirs='include/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:197: update target 'leaff/.install-copy-C-CXX-SHLIBS' due to: target does not exist
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F} .so`.so ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:189: update target 'leaff/.install-copy-C-CXX-LIBS' due to: target does not exist
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:156: update target 'leaff/.install-copy-C-CXX-EXES' due to: target does not exist
> files='leaff/leaff'; dirs='bin/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ "" != "" -a -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:316: update target 'seatac/.install-copy-SHARE' due to: target does not exist
> files=''; dirs='share/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:301: update target 'seatac/.install-copy-SH' due to: target does not exist
> files=''; dirs='bin/'; sheb=''; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:286: update target 'seatac/.install-copy-PERL' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/env perl'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:270: update target 'seatac/.install-copy-PYTHON' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/python3'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:248: update target 'seatac/.install-copy-TEX_PSPDF' due to: target does not exist
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:207: update target 'seatac/.install-copy-C-CXX-INCS' due to: target does not exist
> files=''; dirs='include/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:197: update target 'seatac/.install-copy-C-CXX-SHLIBS' due to: target does not exist
> files='seatac/filter-nop.so seatac/filter-heavychains.so'; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F} .so`.so ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:189: update target 'seatac/.install-copy-C-CXX-LIBS' due to: target does not exist
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:156: update target 'seatac/.install-copy-C-CXX-EXES' due to: target does not exist
> files='seatac/seatac seatac/heavychains'; dirs='bin/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ "" != "" -a -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:316: update target 'atac-driver/chimera/.install-copy-SHARE' due to: target does not exist
> files=''; dirs='share/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:301: update target 'atac-driver/chimera/.install-copy-SH' due to: target does not exist
> files=''; dirs='bin/'; sheb=''; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:286: update target 'atac-driver/chimera/.install-copy-PERL' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/env perl'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:270: update target 'atac-driver/chimera/.install-copy-PYTHON' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/python3'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:248: update target 'atac-driver/chimera/.install-copy-TEX_PSPDF' due to: target does not exist
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:207: update target 'atac-driver/chimera/.install-copy-C-CXX-INCS' due to: target does not exist
> files=''; dirs='include/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:197: update target 'atac-driver/chimera/.install-copy-C-CXX-SHLIBS' due to: target does not exist
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F} .so`.so ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:189: update target 'atac-driver/chimera/.install-copy-C-CXX-LIBS' due to: target does not exist
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:156: update target 'atac-driver/chimera/.install-copy-C-CXX-EXES' due to: target does not exist
> files='atac-driver/chimera/happy-clones-span-clumps'; dirs='bin/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ "" != "" -a -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:316: update target 'atac-driver/chainer/.install-copy-SHARE' due to: target does not exist
> files=''; dirs='share/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:301: update target 'atac-driver/chainer/.install-copy-SH' due to: target does not exist
> files=''; dirs='bin/'; sheb=''; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:286: update target 'atac-driver/chainer/.install-copy-PERL' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/env perl'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:270: update target 'atac-driver/chainer/.install-copy-PYTHON' due to: target does not exist
> files='atac-driver/chainer/python/AtacDriver.py'; dirs='bin/'; sheb='/usr/bin/python3'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files='atac-driver/chainer/python/AtacDriver.py atac-driver/chainer/python/AtacFile.py atac-driver/chainer/python/DNA.py atac-driver/chainer/python/IdxStore.py atac-driver/chainer/python/MatchRecord.py atac-driver/chainer/python/MyFile.py atac-driver/chainer/python/PerfectRuns.py atac-driver/chainer/python/TrimMatchOverlaps.py atac-driver/chainer/python/UniqueFilter.py atac-driver/chainer/python/dedashMatches.py atac-driver/chainer/python/fillIntraRunGaps.py atac-driver/chainer/python/mkstats.py atac-driver/chainer/python/squeezeIntraRunGaps.py'; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:248: update target 'atac-driver/chainer/.install-copy-TEX_PSPDF' due to: target does not exist
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:207: update target 'atac-driver/chainer/.install-copy-C-CXX-INCS' due to: target does not exist
> files=''; dirs='include/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:197: update target 'atac-driver/chainer/.install-copy-C-CXX-SHLIBS' due to: target does not exist
> files='atac-driver/chainer/localAlignerInterfacemodule.so atac-driver/chainer/halignmodule.so'; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F} .so`.so ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:189: update target 'atac-driver/chainer/.install-copy-C-CXX-LIBS' due to: target does not exist
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:156: update target 'atac-driver/chainer/.install-copy-C-CXX-EXES' due to: target does not exist
> files=''; dirs='bin/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ "" != "" -a -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:316: update target 'atac-driver/clumpMaker/.install-copy-SHARE' due to: target does not exist
> files=''; dirs='share/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:301: update target 'atac-driver/clumpMaker/.install-copy-SH' due to: target does not exist
> files=''; dirs='bin/'; sheb=''; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:286: update target 'atac-driver/clumpMaker/.install-copy-PERL' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/env perl'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:270: update target 'atac-driver/clumpMaker/.install-copy-PYTHON' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/python3'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:248: update target 'atac-driver/clumpMaker/.install-copy-TEX_PSPDF' due to: target does not exist
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:207: update target 'atac-driver/clumpMaker/.install-copy-C-CXX-INCS' due to: target does not exist
> files=''; dirs='include/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:197: update target 'atac-driver/clumpMaker/.install-copy-C-CXX-SHLIBS' due to: target does not exist
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F} .so`.so ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:189: update target 'atac-driver/clumpMaker/.install-copy-C-CXX-LIBS' due to: target does not exist
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:156: update target 'atac-driver/clumpMaker/.install-copy-C-CXX-EXES' due to: target does not exist
> files='atac-driver/clumpMaker/clumpMaker'; dirs='bin/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ "" != "" -a -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:316: update target 'atac-driver/uniqueFilter/.install-copy-SHARE' due to: target does not exist
> files=''; dirs='share/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:301: update target 'atac-driver/uniqueFilter/.install-copy-SH' due to: target does not exist
> files=''; dirs='bin/'; sheb=''; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:286: update target 'atac-driver/uniqueFilter/.install-copy-PERL' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/env perl'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:270: update target 'atac-driver/uniqueFilter/.install-copy-PYTHON' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/python3'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:248: update target 'atac-driver/uniqueFilter/.install-copy-TEX_PSPDF' due to: target does not exist
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:207: update target 'atac-driver/uniqueFilter/.install-copy-C-CXX-INCS' due to: target does not exist
> files=''; dirs='include/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:197: update target 'atac-driver/uniqueFilter/.install-copy-C-CXX-SHLIBS' due to: target does not exist
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F} .so`.so ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:189: update target 'atac-driver/uniqueFilter/.install-copy-C-CXX-LIBS' due to: target does not exist
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:156: update target 'atac-driver/uniqueFilter/.install-copy-C-CXX-EXES' due to: target does not exist
> files='atac-driver/uniqueFilter/uniqueFilter'; dirs='bin/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ "" != "" -a -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:316: update target 'atac-driver/statsGenerator/.install-copy-SHARE' due to: target does not exist
> files=''; dirs='share/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:301: update target 'atac-driver/statsGenerator/.install-copy-SH' due to: target does not exist
> files=''; dirs='bin/'; sheb=''; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:286: update target 'atac-driver/statsGenerator/.install-copy-PERL' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/env perl'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:270: update target 'atac-driver/statsGenerator/.install-copy-PYTHON' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/python3'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:248: update target 'atac-driver/statsGenerator/.install-copy-TEX_PSPDF' due to: target does not exist
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:207: update target 'atac-driver/statsGenerator/.install-copy-C-CXX-INCS' due to: target does not exist
> files=''; dirs='include/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:197: update target 'atac-driver/statsGenerator/.install-copy-C-CXX-SHLIBS' due to: target does not exist
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F} .so`.so ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:189: update target 'atac-driver/statsGenerator/.install-copy-C-CXX-LIBS' due to: target does not exist
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:156: update target 'atac-driver/statsGenerator/.install-copy-C-CXX-EXES' due to: target does not exist
> files='atac-driver/statsGenerator/statsGenerator'; dirs='bin/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ "" != "" -a -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:316: update target 'atac-driver/mismatchCounter/.install-copy-SHARE' due to: target does not exist
> files=''; dirs='share/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:301: update target 'atac-driver/mismatchCounter/.install-copy-SH' due to: target does not exist
> files=''; dirs='bin/'; sheb=''; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:286: update target 'atac-driver/mismatchCounter/.install-copy-PERL' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/env perl'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:270: update target 'atac-driver/mismatchCounter/.install-copy-PYTHON' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/python3'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:248: update target 'atac-driver/mismatchCounter/.install-copy-TEX_PSPDF' due to: target does not exist
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:207: update target 'atac-driver/mismatchCounter/.install-copy-C-CXX-INCS' due to: target does not exist
> files=''; dirs='include/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:197: update target 'atac-driver/mismatchCounter/.install-copy-C-CXX-SHLIBS' due to: target does not exist
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F} .so`.so ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:189: update target 'atac-driver/mismatchCounter/.install-copy-C-CXX-LIBS' due to: target does not exist
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:156: update target 'atac-driver/mismatchCounter/.install-copy-C-CXX-EXES' due to: target does not exist
> files='atac-driver/mismatchCounter/mismatchCounter'; dirs='bin/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ "" != "" -a -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:316: update target 'atac-driver/matchExtender/.install-copy-SHARE' due to: target does not exist
> files=''; dirs='share/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:301: update target 'atac-driver/matchExtender/.install-copy-SH' due to: target does not exist
> files=''; dirs='bin/'; sheb=''; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:286: update target 'atac-driver/matchExtender/.install-copy-PERL' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/env perl'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:270: update target 'atac-driver/matchExtender/.install-copy-PYTHON' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/python3'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:248: update target 'atac-driver/matchExtender/.install-copy-TEX_PSPDF' due to: target does not exist
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:207: update target 'atac-driver/matchExtender/.install-copy-C-CXX-INCS' due to: target does not exist
> files=''; dirs='include/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:197: update target 'atac-driver/matchExtender/.install-copy-C-CXX-SHLIBS' due to: target does not exist
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F} .so`.so ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:189: update target 'atac-driver/matchExtender/.install-copy-C-CXX-LIBS' due to: target does not exist
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:156: update target 'atac-driver/matchExtender/.install-copy-C-CXX-EXES' due to: target does not exist
> files='atac-driver/matchExtender/matchExtender'; dirs='bin/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ "" != "" -a -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:316: update target 'atac-driver/lengthFilter/.install-copy-SHARE' due to: target does not exist
> files=''; dirs='share/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:301: update target 'atac-driver/lengthFilter/.install-copy-SH' due to: target does not exist
> files=''; dirs='bin/'; sheb=''; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:286: update target 'atac-driver/lengthFilter/.install-copy-PERL' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/env perl'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:270: update target 'atac-driver/lengthFilter/.install-copy-PYTHON' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/python3'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:248: update target 'atac-driver/lengthFilter/.install-copy-TEX_PSPDF' due to: target does not exist
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:207: update target 'atac-driver/lengthFilter/.install-copy-C-CXX-INCS' due to: target does not exist
> files=''; dirs='include/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:197: update target 'atac-driver/lengthFilter/.install-copy-C-CXX-SHLIBS' due to: target does not exist
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F} .so`.so ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:189: update target 'atac-driver/lengthFilter/.install-copy-C-CXX-LIBS' due to: target does not exist
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:156: update target 'atac-driver/lengthFilter/.install-copy-C-CXX-EXES' due to: target does not exist
> files='atac-driver/lengthFilter/lengthFilter'; dirs='bin/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ "" != "" -a -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:316: update target 'atac-driver/gapShifter/.install-copy-SHARE' due to: target does not exist
> files=''; dirs='share/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:301: update target 'atac-driver/gapShifter/.install-copy-SH' due to: target does not exist
> files=''; dirs='bin/'; sheb=''; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:286: update target 'atac-driver/gapShifter/.install-copy-PERL' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/env perl'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:270: update target 'atac-driver/gapShifter/.install-copy-PYTHON' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/python3'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:248: update target 'atac-driver/gapShifter/.install-copy-TEX_PSPDF' due to: target does not exist
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:207: update target 'atac-driver/gapShifter/.install-copy-C-CXX-INCS' due to: target does not exist
> files=''; dirs='include/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:197: update target 'atac-driver/gapShifter/.install-copy-C-CXX-SHLIBS' due to: target does not exist
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F} .so`.so ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:189: update target 'atac-driver/gapShifter/.install-copy-C-CXX-LIBS' due to: target does not exist
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:156: update target 'atac-driver/gapShifter/.install-copy-C-CXX-EXES' due to: target does not exist
> files='atac-driver/gapShifter/gapShifter atac-driver/gapShifter/extractSequence atac-driver/gapShifter/extractUnmapped atac-driver/gapShifter/coalesceMatches atac-driver/gapShifter/correctGaps atac-driver/gapShifter/testAtac atac-driver/gapShifter/cleanAtac atac-driver/gapShifter/projectFeatures'; dirs='bin/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ "" != "" -a -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:316: update target 'atac-driver/alignOverlap/.install-copy-SHARE' due to: target does not exist
> files=''; dirs='share/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:301: update target 'atac-driver/alignOverlap/.install-copy-SH' due to: target does not exist
> files=''; dirs='bin/'; sheb=''; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:286: update target 'atac-driver/alignOverlap/.install-copy-PERL' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/env perl'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:270: update target 'atac-driver/alignOverlap/.install-copy-PYTHON' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/python3'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:248: update target 'atac-driver/alignOverlap/.install-copy-TEX_PSPDF' due to: target does not exist
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:207: update target 'atac-driver/alignOverlap/.install-copy-C-CXX-INCS' due to: target does not exist
> files=''; dirs='include/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:197: update target 'atac-driver/alignOverlap/.install-copy-C-CXX-SHLIBS' due to: target does not exist
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F} .so`.so ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:189: update target 'atac-driver/alignOverlap/.install-copy-C-CXX-LIBS' due to: target does not exist
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:156: update target 'atac-driver/alignOverlap/.install-copy-C-CXX-EXES' due to: target does not exist
> files='atac-driver/alignOverlap/overlap'; dirs='bin/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ "" != "" -a -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:316: update target 'atac-driver/libatac/.install-copy-SHARE' due to: target does not exist
> files=''; dirs='share/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:301: update target 'atac-driver/libatac/.install-copy-SH' due to: target does not exist
> files=''; dirs='bin/'; sheb=''; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:286: update target 'atac-driver/libatac/.install-copy-PERL' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/env perl'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:270: update target 'atac-driver/libatac/.install-copy-PYTHON' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/python3'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:248: update target 'atac-driver/libatac/.install-copy-TEX_PSPDF' due to: target does not exist
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:207: update target 'atac-driver/libatac/.install-copy-C-CXX-INCS' due to: target does not exist
> files='atac-driver/libatac/atac.H atac-driver/libatac/atacFeature.H atac-driver/libatac/atacFeatureList.H atac-driver/libatac/atacMatch.H atac-driver/libatac/atacMatchList.H atac-driver/libatac/atacMatchOrder.H'; dirs='include/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:197: update target 'atac-driver/libatac/.install-copy-C-CXX-SHLIBS' due to: target does not exist
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F} .so`.so ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:189: update target 'atac-driver/libatac/.install-copy-C-CXX-LIBS' due to: target does not exist
> files='atac-driver/libatac/libatac.a'; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:156: update target 'atac-driver/libatac/.install-copy-C-CXX-EXES' due to: target does not exist
> files=''; dirs='bin/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ "" != "" -a -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:316: update target 'atac-driver/.install-copy-SHARE' due to: target does not exist
> files=''; dirs='share/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:301: update target 'atac-driver/.install-copy-SH' due to: target does not exist
> files=''; dirs='bin/'; sheb=''; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:286: update target 'atac-driver/.install-copy-PERL' due to: target does not exist
> files='atac-driver/atac.pl atac-driver/makeplot.pl'; dirs='bin/'; sheb='/usr/bin/env perl'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:270: update target 'atac-driver/.install-copy-PYTHON' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/python3'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:248: update target 'atac-driver/.install-copy-TEX_PSPDF' due to: target does not exist
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:207: update target 'atac-driver/.install-copy-C-CXX-INCS' due to: target does not exist
> files=''; dirs='include/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:197: update target 'atac-driver/.install-copy-C-CXX-SHLIBS' due to: target does not exist
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F} .so`.so ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:189: update target 'atac-driver/.install-copy-C-CXX-LIBS' due to: target does not exist
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:156: update target 'atac-driver/.install-copy-C-CXX-EXES' due to: target does not exist
> files=''; dirs='bin/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ "" != "" -a -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:316: update target 'ESTmapper/.install-copy-SHARE' due to: target does not exist
> files=''; dirs='share/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:301: update target 'ESTmapper/.install-copy-SH' due to: target does not exist
> files=''; dirs='bin/'; sheb=''; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:286: update target 'ESTmapper/.install-copy-PERL' due to: target does not exist
> files='ESTmapper/ESTmapper.pl ESTmapper/configureESTmapper.pl ESTmapper/runConcurrently.pl'; dirs='bin/'; sheb='/usr/bin/env perl'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files='ESTmapper/scheduler.pm'; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:270: update target 'ESTmapper/.install-copy-PYTHON' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/python3'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:248: update target 'ESTmapper/.install-copy-TEX_PSPDF' due to: target does not exist
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:207: update target 'ESTmapper/.install-copy-C-CXX-INCS' due to: target does not exist
> files=''; dirs='include/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:197: update target 'ESTmapper/.install-copy-C-CXX-SHLIBS' due to: target does not exist
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F} .so`.so ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:189: update target 'ESTmapper/.install-copy-C-CXX-LIBS' due to: target does not exist
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:156: update target 'ESTmapper/.install-copy-C-CXX-EXES' due to: target does not exist
> files='ESTmapper/mergeCounts ESTmapper/terminate'; dirs='bin/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ "" != "" -a -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:316: update target '.install-copy-SHARE' due to: target does not exist
> files=''; dirs='share/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:301: update target '.install-copy-SH' due to: target does not exist
> files=''; dirs='bin/'; sheb=''; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:286: update target '.install-copy-PERL' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/env perl'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:270: update target '.install-copy-PYTHON' due to: target does not exist
> files=''; dirs='bin/'; sheb='/usr/bin/python3'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; chmod ugo+x ${Fout} && /usr/bin/env perl -npi -e"if(0==\$i++){s|^#!.*|#!${sheb}|}" ${Fout}; done ; fi ; done ; fi
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:248: update target '.install-copy-TEX_PSPDF' due to: target does not exist
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> files=''; dirs='doc/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:207: update target '.install-copy-C-CXX-INCS' due to: target does not exist
> files=''; dirs='include/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:197: update target '.install-copy-C-CXX-SHLIBS' due to: target does not exist
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F} .so`.so ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:189: update target '.install-copy-C-CXX-LIBS' due to: target does not exist
> files=''; dirs='lib/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:156: update target '.install-copy-C-CXX-EXES' due to: target does not exist
> files=''; dirs='bin/'; if [ -n "${files}" -a -n "${dirs}" ] ; then for F in ${files} ; do if [ "" != "" -a -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; if [ -f ${F} ] ; then for D in ${dirs} ; do Fout=installdir/${D}`basename ${F}` ; mkdir -p `dirname ${Fout}` && rm -f ${Fout} && cp -fp ${F} ${Fout} ; done ; fi ; done ; fi
> Make.rules:126: update target '/build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/sfx.o' due to: target does not exist
> gcc -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/sfx.o -c /build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/sfx.c
> Make.rules:126: update target '/build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/list.o' due to: target does not exist
> gcc -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/list.o -c /build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/list.c
> Make.rules:126: update target '/build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/hash.o' due to: target does not exist
> gcc -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/hash.o -c /build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/hash.c
> Make.rules:126: update target '/build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/except.o' due to: target does not exist
> gcc -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/except.o -c /build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/except.c
> Make.rules:126: update target '/build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/dict.o' due to: target does not exist
> gcc -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/dict.o -c /build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/dict.c
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libutil/sweatShop.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libutil/sweatShop.o -c /build/reproducible-path/kmer-0~20150903+r2013/libutil/sweatShop.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libutil/sweatShop.H:7,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libutil/sweatShop.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/sweatShop.C:127:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   127 |     fprintf(stderr, "sweatShop::setThreadData()-- worker ID "uint32FMT" more than number of workers="uint32FMT"\n", t, _numberOfWorkers), exit(1);
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/sweatShop.C:127:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   127 |     fprintf(stderr, "sweatShop::setThreadData()-- worker ID "uint32FMT" more than number of workers="uint32FMT"\n", t, _numberOfWorkers), exit(1);
>       |                                                                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/sweatShop.C:390:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   390 |       fprintf(stderr, " %6.1f/s - "uint64FMTW(8)" loaded; "uint64FMTW(8)" queued for compute; "uint64FMTW(8)" finished; "uint64FMTW(8)" written; "uint64FMTW(8)" queued for output)\r",
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/sweatShop.C:390:49: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   390 |       fprintf(stderr, " %6.1f/s - "uint64FMTW(8)" loaded; "uint64FMTW(8)" queued for compute; "uint64FMTW(8)" finished; "uint64FMTW(8)" written; "uint64FMTW(8)" queued for output)\r",
>       |                                                 ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/sweatShop.C:390:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   390 |       fprintf(stderr, " %6.1f/s - "uint64FMTW(8)" loaded; "uint64FMTW(8)" queued for compute; "uint64FMTW(8)" finished; "uint64FMTW(8)" written; "uint64FMTW(8)" queued for output)\r",
>       |                                                                         ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/sweatShop.C:390:109: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   390 |       fprintf(stderr, " %6.1f/s - "uint64FMTW(8)" loaded; "uint64FMTW(8)" queued for compute; "uint64FMTW(8)" finished; "uint64FMTW(8)" written; "uint64FMTW(8)" queued for output)\r",
>       |                                                                                                             ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/sweatShop.C:390:135: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   390 |       fprintf(stderr, " %6.1f/s - "uint64FMTW(8)" loaded; "uint64FMTW(8)" queued for compute; "uint64FMTW(8)" finished; "uint64FMTW(8)" written; "uint64FMTW(8)" queued for output)\r",
>       |                                                                                                                                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/sweatShop.C:425:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   425 |     fprintf(stderr, " %6.1f/s - "uint64FMTW(8)" queued for compute; "uint64FMTW(8)" finished; "uint64FMTW(8)" queued for output)\n",
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/sweatShop.C:425:47: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   425 |     fprintf(stderr, " %6.1f/s - "uint64FMTW(8)" queued for compute; "uint64FMTW(8)" finished; "uint64FMTW(8)" queued for output)\n",
>       |                                               ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/sweatShop.C:425:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   425 |     fprintf(stderr, " %6.1f/s - "uint64FMTW(8)" queued for compute; "uint64FMTW(8)" finished; "uint64FMTW(8)" queued for output)\n",
>       |                                                                                   ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/sweatShop.C:560:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   560 |       fprintf(stderr, "sweatShop::run()--  Failed to launch worker thread "uint32FMT": %s.\n", i, strerror(err)), exit(1);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/sweatShop.C:580:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   580 |       fprintf(stderr, "sweatShop::run()--  Failed to join worker thread "uint32FMT": %s.\n", i, strerror(err)), exit(1);
>       |                       ^
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libutil/speedCounter.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libutil/speedCounter.o -c /build/reproducible-path/kmer-0~20150903+r2013/libutil/speedCounter.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libutil/speedCounter.C:4:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libutil/recordFile.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libutil/recordFile.o -c /build/reproducible-path/kmer-0~20150903+r2013/libutil/recordFile.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libutil/recordFile.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/recordFile.C:227:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   227 |     fprintf(stderr, "recordFile::seek() '%s' seek to record="uint64FMT" at fileposition="uint64FMT" failed: %s\n",
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/recordFile.C:227:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   227 |     fprintf(stderr, "recordFile::seek() '%s' seek to record="uint64FMT" at fileposition="uint64FMT" failed: %s\n",
>       |                                                                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/recordFile.C:233:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   233 |     fprintf(stderr, "recordFile::seek() '%s' read of "uint64FMT" bytes failed at record "uint64FMT", fileposition "uint64FMT"': %s\n",
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/recordFile.C:233:64: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   233 |     fprintf(stderr, "recordFile::seek() '%s' read of "uint64FMT" bytes failed at record "uint64FMT", fileposition "uint64FMT"': %s\n",
>       |                                                                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/recordFile.C:233:99: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   233 |     fprintf(stderr, "recordFile::seek() '%s' read of "uint64FMT" bytes failed at record "uint64FMT", fileposition "uint64FMT"': %s\n",
>       |                                                                                                   ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/recordFile.C: In constructor ‘recordFile::recordFile(const char*, uint32, uint32, char)’:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/recordFile.C:68:10: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>    68 |     write(_file, &recordFileMagic1,  sizeof(uint64));
>       |     ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/recordFile.C:69:10: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>    69 |     write(_file, &recordFileMagic2,  sizeof(uint64));
>       |     ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/recordFile.C:70:10: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>    70 |     write(_file, &_numRecords,       sizeof(uint64));
>       |     ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/recordFile.C:71:10: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>    71 |     write(_file, &_recordSize,       sizeof(uint32));
>       |     ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/recordFile.C:72:10: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>    72 |     write(_file, &_headerSize,       sizeof(uint32));
>       |     ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/recordFile.C:73:10: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>    73 |     write(_file,  _header,           sizeof(char) * _headerSize);
>       |     ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/recordFile.C:112:9: warning: ignoring return value of ‘ssize_t read(int, void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   112 |     read(_file, &m1,                sizeof(uint64));
>       |     ~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/recordFile.C:113:9: warning: ignoring return value of ‘ssize_t read(int, void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   113 |     read(_file, &m2,                sizeof(uint64));
>       |     ~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/recordFile.C:114:9: warning: ignoring return value of ‘ssize_t read(int, void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   114 |     read(_file, &_numRecords,       sizeof(uint64));
>       |     ~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/recordFile.C:115:9: warning: ignoring return value of ‘ssize_t read(int, void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   115 |     read(_file, &_recordSize,       sizeof(uint32));
>       |     ~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/recordFile.C:116:9: warning: ignoring return value of ‘ssize_t read(int, void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   116 |     read(_file, &_headerSize,       sizeof(uint32));
>       |     ~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/recordFile.C:117:9: warning: ignoring return value of ‘ssize_t read(int, void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   117 |     read(_file,  _header,           sizeof(char) * _headerSize);
>       |     ~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/recordFile.C: In destructor ‘recordFile::~recordFile()’:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/recordFile.C:151:10: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   151 |     write(_file, &recordFileMagic1,  sizeof(uint64));
>       |     ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/recordFile.C:152:10: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   152 |     write(_file, &recordFileMagic2,  sizeof(uint64));
>       |     ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/recordFile.C:153:10: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   153 |     write(_file, &_numRecords,       sizeof(uint64));
>       |     ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/recordFile.C:154:10: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   154 |     write(_file, &_recordSize,       sizeof(uint32));
>       |     ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/recordFile.C:155:10: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   155 |     write(_file, &_headerSize,       sizeof(uint32));
>       |     ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/recordFile.C:156:10: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   156 |     write(_file,  _header,           sizeof(char) * _headerSize);
>       |     ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/recordFile.C: In member function ‘void recordFile::flushDirty()’:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/recordFile.C:197:8: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   197 |   write(_file, _bfr, _recordSize * _rec);
>       |   ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/recordFile.C: In member function ‘void recordFile::seek(uint64, bool)’:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/recordFile.C:231:7: warning: ignoring return value of ‘ssize_t read(int, void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   231 |   read(_file, _bfr, _recordSize * _bfrmax);
>       |   ~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libutil/readBuffer.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libutil/readBuffer.o -c /build/reproducible-path/kmer-0~20150903+r2013/libutil/readBuffer.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libutil/readBuffer.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/readBuffer.C:132:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |     fprintf(stderr, "readBuffer::fillBuffer()-- only read "uint64FMT" bytes, couldn't read "uint64FMT" bytes from '%s': %s\n",
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/readBuffer.C:132:69: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |     fprintf(stderr, "readBuffer::fillBuffer()-- only read "uint64FMT" bytes, couldn't read "uint64FMT" bytes from '%s': %s\n",
>       |                                                                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/readBuffer.C:165:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   165 |       fprintf(stderr, "readBuffer()-- '%s' couldn't seek to position "int64FMT": %s\n",
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/readBuffer.C:228:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   228 |       fprintf(stderr, "readBuffer()-- couldn't read "uint64FMT" bytes from '%s': n%s\n",
>       |                       ^
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libutil/fibonacciNumbers.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libutil/fibonacciNumbers.o -c /build/reproducible-path/kmer-0~20150903+r2013/libutil/fibonacciNumbers.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/fibonacciNumbers.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.o -c /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.C:168:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   168 |     fprintf(stderr, " at position "uint64HEX"\n", file_offset);
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.C:367:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   367 |     fprintf(stderr, "bitPackedFile::seekNormal() '%s' seek to pos="uint64FMT" failed: %s\n",
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.C:376:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   376 |     fprintf(stderr, "bitPackedFile::seekNormal() '%s' read of "uint64FMT" bytes failed': %s\n",
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.C: In constructor ‘bitPackedFile::bitPackedFile(const char*, uint64, bool)’:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.C:109:10: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   109 |     write(_file,  t,  sizeof(char) * 16);
>       |     ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.C:110:10: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   110 |     write(_file, &at, sizeof(uint64));
>       |     ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.C:111:10: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   111 |     write(_file, &bt, sizeof(uint64));
>       |     ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.C: In member function ‘void bitPackedFile::flushDirty()’:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.C:232:8: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   232 |   write(_file, _bfr, sizeof(uint64) * _bfrmax);
>       |   ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.o -c /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.C:8:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.C:35:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    35 |     fprintf(stderr, "bitPackedArray::get()-- element index "uint64FMT" is out of range, only "uint64FMT" elements.\n",
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.C:35:70: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    35 |     fprintf(stderr, "bitPackedArray::get()-- element index "uint64FMT" is out of range, only "uint64FMT" elements.\n",
>       |                                                                      ^
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libutil/bigQueue.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libutil/bigQueue.o -c /build/reproducible-path/kmer-0~20150903+r2013/libutil/bigQueue.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libutil/bigQueue.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libutil/bigQueue.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bigQueue.C: In member function ‘void bigQueue::mergeTemporaryFiles()’:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bigQueue.C:204:16: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   204 |           fread(thing, _objectSize, 1, _temporaryFiles[i]);
>       |           ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bigQueue.C:255:14: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   255 |         fread(thing, _objectSize, 1, _temporaryFiles[fileid]);
>       |         ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bigQueue.C: In member function ‘bool bigQueue::next()’:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bigQueue.C:302:10: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   302 |     fread(_thingBuffer, _objectSize, 1, _temporaryFiles[0]);
>       |     ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> Make.rules:126: update target '/build/reproducible-path/kmer-0~20150903+r2013/libutil/util.o' due to: target does not exist
> gcc -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.o -c /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.c
> Make.rules:126: update target '/build/reproducible-path/kmer-0~20150903+r2013/libutil/qsort_mt.o' due to: target does not exist
> gcc -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libutil/qsort_mt.o -c /build/reproducible-path/kmer-0~20150903+r2013/libutil/qsort_mt.c
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/qsort_mt.c: In function ‘qsort_algo’:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/qsort_mt.c:264:13: warning: variable ‘id’ set but not used [-Wunused-but-set-variable]
>   264 |   pthread_t id;
>       |             ^~
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/qsort_mt.c: In function ‘qsort_thread’:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/qsort_mt.c:370:13: warning: variable ‘id’ set but not used [-Wunused-but-set-variable]
>   370 |   pthread_t id;
>       |             ^~
> Make.rules:126: update target '/build/reproducible-path/kmer-0~20150903+r2013/libutil/palloc.o' due to: target does not exist
> gcc -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libutil/palloc.o -c /build/reproducible-path/kmer-0~20150903+r2013/libutil/palloc.c
> Make.rules:126: update target '/build/reproducible-path/kmer-0~20150903+r2013/libutil/md5.o' due to: target does not exist
> gcc -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libutil/md5.o -c /build/reproducible-path/kmer-0~20150903+r2013/libutil/md5.c
> Make.rules:126: update target '/build/reproducible-path/kmer-0~20150903+r2013/libutil/file.o' due to: target does not exist
> gcc -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libutil/file.o -c /build/reproducible-path/kmer-0~20150903+r2013/libutil/file.c
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/file.c: In function ‘openFile’:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/file.c:382:9: warning: variable ‘isRW’ set but not used [-Wunused-but-set-variable]
>   382 |   int   isRW      = 1;
>       |         ^~~~
> Make.rules:167: update target '/build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a' due to: target does not exist
> rm -f /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a && ar ruvs /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a /build/reproducible-path/kmer-0~20150903+r2013/libutil/file.o /build/reproducible-path/kmer-0~20150903+r2013/libutil/md5.o /build/reproducible-path/kmer-0~20150903+r2013/libutil/palloc.o /build/reproducible-path/kmer-0~20150903+r2013/libutil/qsort_mt.o /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.o /build/reproducible-path/kmer-0~20150903+r2013/libutil/bigQueue.o /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.o /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.o /build/reproducible-path/kmer-0~20150903+r2013/libutil/fibonacciNumbers.o /build/reproducible-path/kmer-0~20150903+r2013/libutil/readBuffer.o /build/reproducible-path/kmer-0~20150903+r2013/libutil/recordFile.o /build/reproducible-path/kmer-0~20150903+r2013/libutil/speedCounter.o /build/reproducible-path/kmer-0~20150903+r2013/libutil/sweatShop.o /build/reproducible-path/kmer-0~20150903+r2013/libutil/mt19937ar/mt19937ar.o /build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/dict.o /build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/except.o /build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/hash.o /build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/list.o /build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/sfx.o
> ar: `u' modifier ignored since `D' is the default (see `U')
> ar: creating /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a
> a - /build/reproducible-path/kmer-0~20150903+r2013/libutil/file.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libutil/md5.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libutil/palloc.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libutil/qsort_mt.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libutil/bigQueue.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libutil/fibonacciNumbers.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libutil/readBuffer.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libutil/recordFile.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libutil/speedCounter.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libutil/sweatShop.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libutil/mt19937ar/mt19937ar.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/dict.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/except.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/hash.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/list.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/sfx.o
> Make.rules:167: update target '/build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/libkaz.a' due to: target does not exist
> rm -f /build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/libkaz.a && ar ruvs /build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/libkaz.a /build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/dict.o /build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/except.o /build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/hash.o /build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/list.o /build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/sfx.o
> ar: `u' modifier ignored since `D' is the default (see `U')
> ar: creating /build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/libkaz.a
> a - /build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/dict.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/except.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/hash.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/list.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libutil/kazlib/sfx.o
> Make.rules:126: update target '/build/reproducible-path/kmer-0~20150903+r2013/libutil/mt19937ar/test.o' due to: target does not exist
> gcc -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libutil/mt19937ar/test.o -c /build/reproducible-path/kmer-0~20150903+r2013/libutil/mt19937ar/test.c
> Make.rules:162: update target '/build/reproducible-path/kmer-0~20150903+r2013/libutil/mt19937ar/libmt19937ar.a' due to: target does not exist
> rm -f /build/reproducible-path/kmer-0~20150903+r2013/libutil/mt19937ar/libmt19937ar.a && ar ruvs /build/reproducible-path/kmer-0~20150903+r2013/libutil/mt19937ar/libmt19937ar.a /build/reproducible-path/kmer-0~20150903+r2013/libutil/mt19937ar/mt19937ar.o /build/reproducible-path/kmer-0~20150903+r2013/libutil/mt19937ar/test.o
> ar: `u' modifier ignored since `D' is the default (see `U')
> ar: creating /build/reproducible-path/kmer-0~20150903+r2013/libutil/mt19937ar/libmt19937ar.a
> a - /build/reproducible-path/kmer-0~20150903+r2013/libutil/mt19937ar/mt19937ar.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libutil/mt19937ar/test.o
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libseq/test-merStream.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-merStream.o -c /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-merStream.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-merStream.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqCache.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-merStream.C:3:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-merStream.C:7:
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-correctSequence.H:33:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    33 |   fprintf(stderr, "generateCorrectSequence()-- Using seed "uint32FMT"\n", seed);
>       |                   ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-correctSequence.H:34:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    34 |   fprintf(stderr, "generateCorrectSequence()-- Generating "uint32FMT" sequences of length "uint32FMT" to "uint32FMT"\n", numSeq, minLen, maxLen);
>       |                   ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-correctSequence.H:34:69: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    34 |   fprintf(stderr, "generateCorrectSequence()-- Generating "uint32FMT" sequences of length "uint32FMT" to "uint32FMT"\n", numSeq, minLen, maxLen);
>       |                                                                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-correctSequence.H:34:101: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    34 |   fprintf(stderr, "generateCorrectSequence()-- Generating "uint32FMT" sequences of length "uint32FMT" to "uint32FMT"\n", numSeq, minLen, maxLen);
>       |                                                                                                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-merStream.C:11:2: warning: #warning HOW DO WE TEST IF WE GET ALL THE MERS? [-Wcpp]
>    11 | #warning HOW DO WE TEST IF WE GET ALL THE MERS?
>       |  ^~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-merStream.C:33:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    33 |       fprintf(stdout, "MS pos="uint32FMT" posInSeq="uint64FMT" posInStr="uint64FMT" seqNum="uint64FMT"\n",
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-merStream.C:33:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    33 |       fprintf(stdout, "MS pos="uint32FMT" posInSeq="uint64FMT" posInStr="uint64FMT" seqNum="uint64FMT"\n",
>       |                                         ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-merStream.C:33:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    33 |       fprintf(stdout, "MS pos="uint32FMT" posInSeq="uint64FMT" posInStr="uint64FMT" seqNum="uint64FMT"\n",
>       |                                                              ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-merStream.C:33:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    33 |       fprintf(stdout, "MS pos="uint32FMT" posInSeq="uint64FMT" posInStr="uint64FMT" seqNum="uint64FMT"\n",
>       |                                                                                   ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-merStream.C:39:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    39 |         fprintf(stdout, "MS pos="uint32FMT" failed '%s' != '%s'.\n", pos, testmer, seq + pos);
>       |                         ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-merStream.C:124:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   124 |         fprintf(stderr, "mer stream position out of range; at "uint32FMT", range "uint32FMT"-"uint32FMT"\n",
>       |                         ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-merStream.C:124:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   124 |         fprintf(stderr, "mer stream position out of range; at "uint32FMT", range "uint32FMT"-"uint32FMT"\n",
>       |                                                                         ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-merStream.C:124:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   124 |         fprintf(stderr, "mer stream position out of range; at "uint32FMT", range "uint32FMT"-"uint32FMT"\n",
>       |                                                                                            ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-merStream.C: In function ‘int main(int, char**)’:
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-merStream.C:223:33: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings]
>   223 |     testMerStreamSimple(MS, 20, "GGGTCAACTCCGCCCGCACTCTAGC", SP);
>       |                                 ^~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-merStream.C:225:33: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings]
>   225 |     testMerStreamSimple(MS, 20, "GGGTCAACTCCGCCCGCACTCTAGC", SP);
>       |                                 ^~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-merStream.C:228:33: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings]
>   228 |     testMerStreamSimple(MS, 20, "GGGTCAACTCCGCCCGCACTCTAGC", SP);
>       |                                 ^~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-merStream.C:243:33: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings]
>   243 |     testMerStreamSimple(MS, 20, "GATCACTCGCGCACTCTAGCA", SP);
>       |                                 ^~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-merStream.C:245:33: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings]
>   245 |     testMerStreamSimple(MS, 20, "GATCACTCGCGCACTCTAGCA", SP);
>       |                                 ^~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-merStream.C:248:33: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings]
>   248 |     testMerStreamSimple(MS, 20, "GATCACTCGCGCACTCTAGCA", SP);
>       |                                 ^~~~~~~~~~~~~~~~~~~~~~~
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqStream.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqStream.o -c /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqStream.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqStream.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqCache.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqStream.C:3:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqStream.C:7:
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-correctSequence.H:33:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    33 |   fprintf(stderr, "generateCorrectSequence()-- Using seed "uint32FMT"\n", seed);
>       |                   ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-correctSequence.H:34:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    34 |   fprintf(stderr, "generateCorrectSequence()-- Generating "uint32FMT" sequences of length "uint32FMT" to "uint32FMT"\n", numSeq, minLen, maxLen);
>       |                   ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-correctSequence.H:34:69: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    34 |   fprintf(stderr, "generateCorrectSequence()-- Generating "uint32FMT" sequences of length "uint32FMT" to "uint32FMT"\n", numSeq, minLen, maxLen);
>       |                                                                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-correctSequence.H:34:101: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    34 |   fprintf(stderr, "generateCorrectSequence()-- Generating "uint32FMT" sequences of length "uint32FMT" to "uint32FMT"\n", numSeq, minLen, maxLen);
>       |                                                                                                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqStream.C:17:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    17 |   fprintf(stderr, "testIndexing()-- numSeq="uint32FMT" sep=%c sepLen="uint32FMT"\n", numSeq, sep, sepLen);
>       |                   ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqStream.C:17:54: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    17 |   fprintf(stderr, "testIndexing()-- numSeq="uint32FMT" sep=%c sepLen="uint32FMT"\n", numSeq, sep, sepLen);
>       |                                                      ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqStream.C:55:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 |       fprintf(stderr, "lengthOf "uint32FMT" returned "uint32FMT", not correct "uint32FMT"\n",
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqStream.C:55:43: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 |       fprintf(stderr, "lengthOf "uint32FMT" returned "uint32FMT", not correct "uint32FMT"\n",
>       |                                           ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqStream.C:55:64: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 |       fprintf(stderr, "lengthOf "uint32FMT" returned "uint32FMT", not correct "uint32FMT"\n",
>       |                                                                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqStream.C:60:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    60 |       fprintf(stderr, "startOf "uint32FMT" returned "uint64FMT", not correct "uint64FMT"\n",
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqStream.C:60:42: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    60 |       fprintf(stderr, "startOf "uint32FMT" returned "uint64FMT", not correct "uint64FMT"\n",
>       |                                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqStream.C:60:63: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    60 |       fprintf(stderr, "startOf "uint32FMT" returned "uint64FMT", not correct "uint64FMT"\n",
>       |                                                               ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqStream.C:65:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 |       fprintf(stderr, "IIDOf "uint32FMT" returned "uint32FMT", not correct "uint32FMT"\n",
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqStream.C:65:40: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 |       fprintf(stderr, "IIDOf "uint32FMT" returned "uint32FMT", not correct "uint32FMT"\n",
>       |                                        ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqStream.C:65:61: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 |       fprintf(stderr, "IIDOf "uint32FMT" returned "uint32FMT", not correct "uint32FMT"\n",
>       |                                                             ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqStream.C:74:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    74 |         fprintf(stderr, "sequenceNumberOfPosition "uint64FMT" returned "uint32FMT", not correct "uint32FMT".\n",
>       |                         ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqStream.C:74:61: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    74 |         fprintf(stderr, "sequenceNumberOfPosition "uint64FMT" returned "uint32FMT", not correct "uint32FMT".\n",
>       |                                                             ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqStream.C:74:82: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    74 |         fprintf(stderr, "sequenceNumberOfPosition "uint64FMT" returned "uint32FMT", not correct "uint32FMT".\n",
>       |                                                                                  ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqStream.C:95:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    95 |         fprintf(stderr, "wrong separator at sep "uint32FMT" got %d expected %d\n", x, s, sep);
>       |                         ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqStream.C:124:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   124 |         fprintf(stderr, "sp="uint32FMT" si="uint32FMT" st="uint64FMT" ch=%c -- letter wrong got'%c'\n", sp, si, st, ch, chainSeq[sib]);
>       |                         ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqStream.C:124:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   124 |         fprintf(stderr, "sp="uint32FMT" si="uint32FMT" st="uint64FMT" ch=%c -- letter wrong got'%c'\n", sp, si, st, ch, chainSeq[sib]);
>       |                                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqStream.C:124:54: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   124 |         fprintf(stderr, "sp="uint32FMT" si="uint32FMT" st="uint64FMT" ch=%c -- letter wrong got'%c'\n", sp, si, st, ch, chainSeq[sib]);
>       |                                                      ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqStream.C:128:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |         fprintf(stderr, "sp="uint32FMT" si="uint32FMT" st="uint64FMT" ch=%c -- seqPos wrong got "uint32FMT"\n", sp, si, st, ch, chainSeqPos[sib]);
>       |                         ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqStream.C:128:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |         fprintf(stderr, "sp="uint32FMT" si="uint32FMT" st="uint64FMT" ch=%c -- seqPos wrong got "uint32FMT"\n", sp, si, st, ch, chainSeqPos[sib]);
>       |                                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqStream.C:128:54: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |         fprintf(stderr, "sp="uint32FMT" si="uint32FMT" st="uint64FMT" ch=%c -- seqPos wrong got "uint32FMT"\n", sp, si, st, ch, chainSeqPos[sib]);
>       |                                                      ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqStream.C:128:69: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |         fprintf(stderr, "sp="uint32FMT" si="uint32FMT" st="uint64FMT" ch=%c -- seqPos wrong got "uint32FMT"\n", sp, si, st, ch, chainSeqPos[sib]);
>       |                                                                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqStream.C:132:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |         fprintf(stderr, "sp="uint32FMT" si="uint32FMT" st="uint64FMT" ch=%c -- seqIID wrong got"uint32FMT"\n", sp, si, st, ch, chainSeqIID[sib]);
>       |                         ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqStream.C:132:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |         fprintf(stderr, "sp="uint32FMT" si="uint32FMT" st="uint64FMT" ch=%c -- seqIID wrong got"uint32FMT"\n", sp, si, st, ch, chainSeqIID[sib]);
>       |                                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqStream.C:132:54: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |         fprintf(stderr, "sp="uint32FMT" si="uint32FMT" st="uint64FMT" ch=%c -- seqIID wrong got"uint32FMT"\n", sp, si, st, ch, chainSeqIID[sib]);
>       |                                                      ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqStream.C:132:69: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |         fprintf(stderr, "sp="uint32FMT" si="uint32FMT" st="uint64FMT" ch=%c -- seqIID wrong got"uint32FMT"\n", sp, si, st, ch, chainSeqIID[sib]);
>       |                                                                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqStream.C:136:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   136 |         fprintf(stderr, "sp="uint32FMT" si="uint32FMT" st="uint64FMT" ch=%c -- strPos wrong got "uint64FMT"\n", sp, si, st, ch, chainStrPos[sib]);
>       |                         ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqStream.C:136:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   136 |         fprintf(stderr, "sp="uint32FMT" si="uint32FMT" st="uint64FMT" ch=%c -- strPos wrong got "uint64FMT"\n", sp, si, st, ch, chainStrPos[sib]);
>       |                                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqStream.C:136:54: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   136 |         fprintf(stderr, "sp="uint32FMT" si="uint32FMT" st="uint64FMT" ch=%c -- strPos wrong got "uint64FMT"\n", sp, si, st, ch, chainStrPos[sib]);
>       |                                                      ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqStream.C:136:69: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   136 |         fprintf(stderr, "sp="uint32FMT" si="uint32FMT" st="uint64FMT" ch=%c -- strPos wrong got "uint64FMT"\n", sp, si, st, ch, chainStrPos[sib]);
>       |                                                                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqStream.C:145:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   145 |     fprintf(stderr, "iterated length wrong; sib="uint32FMT" sie="uint32FMT"\n", sib, sie);
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqStream.C:145:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   145 |     fprintf(stderr, "iterated length wrong; sib="uint32FMT" sie="uint32FMT"\n", sib, sie);
>       |                                                           ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqStream.C:159:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   159 |   fprintf(stderr, "testChaining()-- numSeq="uint32FMT" sep=%c sepLen="uint32FMT"\n", numSeq, sep, sepLen);
>       |                   ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqStream.C:159:54: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   159 |   fprintf(stderr, "testChaining()-- numSeq="uint32FMT" sep=%c sepLen="uint32FMT"\n", numSeq, sep, sepLen);
>       |                                                      ^
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqCache.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqCache.o -c /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqCache.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqCache.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqCache.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqCache.C:3:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqCache.C:7:
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-correctSequence.H:33:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    33 |   fprintf(stderr, "generateCorrectSequence()-- Using seed "uint32FMT"\n", seed);
>       |                   ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-correctSequence.H:34:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    34 |   fprintf(stderr, "generateCorrectSequence()-- Generating "uint32FMT" sequences of length "uint32FMT" to "uint32FMT"\n", numSeq, minLen, maxLen);
>       |                   ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-correctSequence.H:34:69: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    34 |   fprintf(stderr, "generateCorrectSequence()-- Generating "uint32FMT" sequences of length "uint32FMT" to "uint32FMT"\n", numSeq, minLen, maxLen);
>       |                                                                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-correctSequence.H:34:101: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    34 |   fprintf(stderr, "generateCorrectSequence()-- Generating "uint32FMT" sequences of length "uint32FMT" to "uint32FMT"\n", numSeq, minLen, maxLen);
>       |                                                                                                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqCache.C:15:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    15 |     fprintf(stderr, "testID:"uint32FMT" - empty sequence\n", testID);
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqCache.C:22:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    22 |     fprintf(stderr, "testID:"uint32FMT" - header differs '%s' vs '%s'\n", testID, S->header(), correctSequence[sid].header);
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqCache.C:26:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    26 |     fprintf(stderr, "testID:"uint32FMT" - header length differs "uint32FMT" vs "uint32FMT"\n", testID, S->headerLength(), correctSequence[sid].headerLength);
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqCache.C:26:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    26 |     fprintf(stderr, "testID:"uint32FMT" - header length differs "uint32FMT" vs "uint32FMT"\n", testID, S->headerLength(), correctSequence[sid].headerLength);
>       |                                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqCache.C:26:75: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    26 |     fprintf(stderr, "testID:"uint32FMT" - header length differs "uint32FMT" vs "uint32FMT"\n", testID, S->headerLength(), correctSequence[sid].headerLength);
>       |                                                                           ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqCache.C:30:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    30 |     fprintf(stderr, "testID:"uint32FMT" - sequence differs\n", testID);
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqCache.C:34:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    34 |     fprintf(stderr, "testID:"uint32FMT" - sequence length differs strlen "uint32FMT" vs "uint32FMT"\n", testID, (uint32)strlen(S->sequence()), correctSequence[sid].sequenceLength);
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqCache.C:34:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    34 |     fprintf(stderr, "testID:"uint32FMT" - sequence length differs strlen "uint32FMT" vs "uint32FMT"\n", testID, (uint32)strlen(S->sequence()), correctSequence[sid].sequenceLength);
>       |                                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqCache.C:34:84: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    34 |     fprintf(stderr, "testID:"uint32FMT" - sequence length differs strlen "uint32FMT" vs "uint32FMT"\n", testID, (uint32)strlen(S->sequence()), correctSequence[sid].sequenceLength);
>       |                                                                                    ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqCache.C:38:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    38 |     fprintf(stderr, "testID:"uint32FMT" - sequence length differs "uint32FMT" vs "uint32FMT"\n", testID, S->sequenceLength(), correctSequence[sid].sequenceLength);
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqCache.C:38:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    38 |     fprintf(stderr, "testID:"uint32FMT" - sequence length differs "uint32FMT" vs "uint32FMT"\n", testID, S->sequenceLength(), correctSequence[sid].sequenceLength);
>       |                                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqCache.C:38:77: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    38 |     fprintf(stderr, "testID:"uint32FMT" - sequence length differs "uint32FMT" vs "uint32FMT"\n", testID, S->sequenceLength(), correctSequence[sid].sequenceLength);
>       |                                                                             ^
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libseq/merStream.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libseq/merStream.o -c /build/reproducible-path/kmer-0~20150903+r2013/libseq/merStream.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libseq/merStream.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libseq/merStream.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStream.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStream.o -c /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStream.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqFactory.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStream.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStream.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStream.C:2:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStream.C:236:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   236 |     fprintf(stderr, "seqStream::setRange()-- ERROR: range ("uint64FMT","uint64FMT") too big; only "uint64FMT" positions.\n",
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStream.C:236:70: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   236 |     fprintf(stderr, "seqStream::setRange()-- ERROR: range ("uint64FMT","uint64FMT") too big; only "uint64FMT" positions.\n",
>       |                                                                      ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStream.C:236:82: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   236 |     fprintf(stderr, "seqStream::setRange()-- ERROR: range ("uint64FMT","uint64FMT") too big; only "uint64FMT" positions.\n",
>       |                                                                                  ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStream.C:268:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   268 |     fprintf(stderr, "seqStream::sequenceNumberOfPosition()-- WARNING: position p="uint64FMT" too big; only "uint64FMT" positions.\n",
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStream.C:268:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   268 |     fprintf(stderr, "seqStream::sequenceNumberOfPosition()-- WARNING: position p="uint64FMT" too big; only "uint64FMT" positions.\n",
>       |                                                                                            ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStream.C:340:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   340 |       fprintf(stderr, "seqStream::fillBuffer()-- Failed to getSequence(part) #1 iid="uint32FMT" bgn="uint32FMT" end="uint32FMT"\n",
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStream.C:340:95: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   340 |       fprintf(stderr, "seqStream::fillBuffer()-- Failed to getSequence(part) #1 iid="uint32FMT" bgn="uint32FMT" end="uint32FMT"\n",
>       |                                                                                               ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStream.C:340:111: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   340 |       fprintf(stderr, "seqStream::fillBuffer()-- Failed to getSequence(part) #1 iid="uint32FMT" bgn="uint32FMT" end="uint32FMT"\n",
>       |                                                                                                               ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStream.C:386:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   386 |     fprintf(stderr, "seqStream::fillBuffer()-- Failed to getSequence(part) #2 iid="uint32FMT" bgn="uint32FMT" end="uint32FMT"\n",
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStream.C:386:93: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   386 |     fprintf(stderr, "seqStream::fillBuffer()-- Failed to getSequence(part) #2 iid="uint32FMT" bgn="uint32FMT" end="uint32FMT"\n",
>       |                                                                                             ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStream.C:386:109: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   386 |     fprintf(stderr, "seqStream::fillBuffer()-- Failed to getSequence(part) #2 iid="uint32FMT" bgn="uint32FMT" end="uint32FMT"\n",
>       |                                                                                                             ^
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libseq/seqCache.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqCache.o -c /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqCache.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqCache.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqCache.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqCache.C:171:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   171 |       fprintf(stderr, "seqCache::loadAllSequences()-- Failed to load iid "uint32FMT".\n",
>       |                       ^
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libseq/seqFactory.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqFactory.o -c /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqFactory.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqFactory.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqFactory.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastaFile.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqFactory.C:3:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libseq/sffFile.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libseq/sffFile.o -c /build/reproducible-path/kmer-0~20150903+r2013/libseq/sffFile.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libseq/sffFile.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libseq/sffFile.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStore.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStore.o -c /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStore.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStore.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStore.C:2:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStore.C:129:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   129 |     fprintf(stderr, "seqStore::getSequence(full)--  iid "uint32FMT" more than number of sequences "uint32FMT"\n",
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStore.C:129:67: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   129 |     fprintf(stderr, "seqStore::getSequence(full)--  iid "uint32FMT" more than number of sequences "uint32FMT"\n",
>       |                                                                   ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStore.C:197:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   197 |     fprintf(stderr, "seqStore::getSequence(part)--  iid "uint32FMT" more than number of sequences "uint32FMT"\n",
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStore.C:197:67: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   197 |     fprintf(stderr, "seqStore::getSequence(part)--  iid "uint32FMT" more than number of sequences "uint32FMT"\n",
>       |                                                                   ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStore.C:203:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   203 |     fprintf(stderr, "seqStore::getSequence(part)--  for iid "uint32FMT"; invalid bgn="uint32FMT" end="uint32FMT"; seqLen="uint32FMT"\n",
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStore.C:203:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   203 |     fprintf(stderr, "seqStore::getSequence(part)--  for iid "uint32FMT"; invalid bgn="uint32FMT" end="uint32FMT"; seqLen="uint32FMT"\n",
>       |                                                                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStore.C:203:96: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   203 |     fprintf(stderr, "seqStore::getSequence(part)--  for iid "uint32FMT"; invalid bgn="uint32FMT" end="uint32FMT"; seqLen="uint32FMT"\n",
>       |                                                                                                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStore.C:203:112: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   203 |     fprintf(stderr, "seqStore::getSequence(part)--  for iid "uint32FMT"; invalid bgn="uint32FMT" end="uint32FMT"; seqLen="uint32FMT"\n",
>       |                                                                                                                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStore.C:463:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   463 |         fprintf(stderr, "constructSeqStore()-- sequence %s too long, must be shorter than "uint64FMT" Gbp.\n",
>       |                         ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStore.C:467:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   467 |         fprintf(stderr, "constructSeqStore()-- too many sequences, must be fewer than "uint64FMT".\n",
>       |                         ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStore.C:620:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   620 |   fprintf(stderr, "constructSeqStore()-- seqStore '%s' constructed ("uint32FMT" sequences, "uint64FMT" ACGT letters, "uint32FMT" ACGT blocks, "uint32FMT" GAP blocks).\n",
>       |                   ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStore.C:620:79: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   620 |   fprintf(stderr, "constructSeqStore()-- seqStore '%s' constructed ("uint32FMT" sequences, "uint64FMT" ACGT letters, "uint32FMT" ACGT blocks, "uint32FMT" GAP blocks).\n",
>       |                                                                               ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStore.C:620:102: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   620 |   fprintf(stderr, "constructSeqStore()-- seqStore '%s' constructed ("uint32FMT" sequences, "uint64FMT" ACGT letters, "uint32FMT" ACGT blocks, "uint32FMT" GAP blocks).\n",
>       |                                                                                                      ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStore.C:620:128: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   620 |   fprintf(stderr, "constructSeqStore()-- seqStore '%s' constructed ("uint32FMT" sequences, "uint64FMT" ACGT letters, "uint32FMT" ACGT blocks, "uint32FMT" GAP blocks).\n",
>       |                                                                                                                                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStore.C: In function ‘void constructSeqStore(char*, seqCache*)’:
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStore.C:410:9: warning: ‘memset’ used with constant zero length parameter; this could be due to transposed parameters [-Wmemset-transposed-args]
>   410 |   memset(&HEAD, sizeof(seqStoreHeader), 0);
>       |   ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStore.C: In constructor ‘seqStore::seqStore(const char*)’:
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStore.C:21:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>    21 |   fread(&_header,   sizeof(seqStoreHeader), 1, F);
>       |   ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStore.C: In member function ‘virtual seqFile* seqStore::openFile(const char*)’:
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStore.C:73:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>    73 |   fread(&magic1, sizeof(uint64), 1, F);
>       |   ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStore.C:74:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>    74 |   fread(&magic2, sizeof(uint64), 1, F);
>       |   ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStore.C: In member function ‘void seqStore::loadIndex()’:
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStore.C:318:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   318 |   fread(&_header,   sizeof(seqStoreHeader), 1, F);
>       |   ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStore.C:329:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   329 |   fread( _index,   sizeof(seqStoreIndex), _header._numberOfSequences, F);
>       |   ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStore.C:343:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   343 |   fread( _block,   sizeof(seqStoreBlock), _header._numberOfBlocks, F);
>       |   ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStore.C:347:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   347 |   fread( _names,   sizeof(char),          _header._namesLength, F);
>       |   ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libseq/fastqStdin.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastqStdin.o -c /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastqStdin.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastqStdin.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastqStdin.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastqStdin.C: In member function ‘virtual bool fastqStdin::getSequence(uint32, char*&, uint32&, uint32&, char*&, uint32&, uint32&)’:
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastqStdin.C:110:9: warning: unused variable ‘ret’ [-Wunused-variable]
>   110 |   bool  ret = true;
>       |         ^~~
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libseq/fastqFile.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastqFile.o -c /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastqFile.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastqFile.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastqFile.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastqFile.C:141:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   141 |     fprintf(stderr, "fastqFile::getSequence(full)--  iid "uint32FMT" more than number of sequences "uint32FMT"\n",
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastqFile.C:141:68: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   141 |     fprintf(stderr, "fastqFile::getSequence(full)--  iid "uint32FMT" more than number of sequences "uint32FMT"\n",
>       |                                                                    ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastqFile.C:253:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   253 |     fprintf(stderr, "fastqFile::getSequence(part)--  iid "uint32FMT" more than number of sequences "uint32FMT"\n",
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastqFile.C:253:68: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   253 |     fprintf(stderr, "fastqFile::getSequence(part)--  iid "uint32FMT" more than number of sequences "uint32FMT"\n",
>       |                                                                    ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastqFile.C:533:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   533 |       fprintf(stderr, "REALLOC len="uint32FMT" from "uint32FMT" to "uint32FMT"\n", indexLen, indexMax, indexMax * 2);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastqFile.C:533:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   533 |       fprintf(stderr, "REALLOC len="uint32FMT" from "uint32FMT" to "uint32FMT"\n", indexLen, indexMax, indexMax * 2);
>       |                                              ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastqFile.C:533:63: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   533 |       fprintf(stderr, "REALLOC len="uint32FMT" from "uint32FMT" to "uint32FMT"\n", indexLen, indexMax, indexMax * 2);
>       |                                                               ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastqFile.C: In member function ‘void fastqFile::loadIndex(char*)’:
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastqFile.C:354:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   354 |   fread(&_header, sizeof(fastqFileHeader), 1, I);
>       |   ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastqFile.C:374:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   374 |   fread(_index, sizeof(fastqFileIndex), _header._numberOfSequences, I);
>       |   ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastqFile.C:375:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   375 |   fread(_names, sizeof(char),           _header._namesLength,       I);
>       |   ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libseq/fastaStdin.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastaStdin.o -c /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastaStdin.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastaStdin.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastaStdin.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastaStdin.C: In member function ‘virtual bool fastaStdin::getSequence(uint32, char*&, uint32&, uint32&, char*&, uint32&, uint32&)’:
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastaStdin.C:110:9: warning: unused variable ‘ret’ [-Wunused-variable]
>   110 |   bool  ret = true;
>       |         ^~~
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libseq/fastaFile.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastaFile.o -c /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastaFile.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastaFile.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastaFile.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastaFile.C:151:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   151 |     fprintf(stderr, "fastaFile::getSequence(full)--  iid "uint32FMT" more than number of sequences "uint32FMT"\n",
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastaFile.C:151:68: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   151 |     fprintf(stderr, "fastaFile::getSequence(full)--  iid "uint32FMT" more than number of sequences "uint32FMT"\n",
>       |                                                                    ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastaFile.C:252:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   252 |     fprintf(stderr, "fastaFile::getSequence(part)--  iid "uint32FMT" more than number of sequences "uint32FMT"\n",
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastaFile.C:252:68: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   252 |     fprintf(stderr, "fastaFile::getSequence(part)--  iid "uint32FMT" more than number of sequences "uint32FMT"\n",
>       |                                                                    ^
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastaFile.C: In member function ‘void fastaFile::loadIndex(char*)’:
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastaFile.C:357:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   357 |   fread(&_header, sizeof(fastaFileHeader), 1, I);
>       |   ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastaFile.C:379:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   379 |   fread(_index, sizeof(fastaFileIndex), _header._numberOfSequences, I);
>       |   ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastaFile.C:380:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   380 |   fread(_names, sizeof(char),           _header._namesLength,       I);
>       |   ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> Make.rules:167: update target '/build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a' due to: target does not exist
> rm -f /build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a && ar ruvs /build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastaFile.o /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastaStdin.o /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastqFile.o /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastqStdin.o /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStore.o /build/reproducible-path/kmer-0~20150903+r2013/libseq/sffFile.o /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqFactory.o /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqCache.o /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStream.o /build/reproducible-path/kmer-0~20150903+r2013/libseq/merStream.o /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqCache.o /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqStream.o /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-merStream.o
> ar: `u' modifier ignored since `D' is the default (see `U')
> ar: creating /build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a
> a - /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastaFile.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastaStdin.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastqFile.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libseq/fastqStdin.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStore.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libseq/sffFile.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqFactory.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqCache.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libseq/seqStream.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libseq/merStream.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqCache.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqStream.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-merStream.o
> Make.rules:126: update target '/build/reproducible-path/kmer-0~20150903+r2013/libbio/alphabet.o' due to: target does not exist
> gcc -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libbio/alphabet.o -c /build/reproducible-path/kmer-0~20150903+r2013/libbio/alphabet.c
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libbio/kmer.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libbio/kmer.o -c /build/reproducible-path/kmer-0~20150903+r2013/libbio/kmer.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/kmer.H:28,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/kmer.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/kmer.H:29:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> Make.rules:126: update target '/build/reproducible-path/kmer-0~20150903+r2013/libbio/reversecomplement.o' due to: target does not exist
> gcc -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libbio/reversecomplement.o -c /build/reproducible-path/kmer-0~20150903+r2013/libbio/reversecomplement.c
> Make.rules:126: update target '/build/reproducible-path/kmer-0~20150903+r2013/libbio/halign.o' due to: target does not exist
> gcc -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libbio/halign.o -c /build/reproducible-path/kmer-0~20150903+r2013/libbio/halign.c
> /build/reproducible-path/kmer-0~20150903+r2013/libbio/halign.c: In function ‘align_path’:
> /build/reproducible-path/kmer-0~20150903+r2013/libbio/halign.c:385:7: warning: ‘head2’ may be used uninitialized [-Wmaybe-uninitialized]
>   385 |   if (head2) *tail = tail2;
>       |       ^~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libbio/halign.c:163:32: note: ‘head2’ declared here
>   163 |   edit_script *head1, *tail1, *head2, *tail2;
>       |                                ^~~~~
> Make.rules:126: update target '/build/reproducible-path/kmer-0~20150903+r2013/libbio/alphabet-colorspace.o' due to: target does not exist
> gcc -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libbio/alphabet-colorspace.o -c /build/reproducible-path/kmer-0~20150903+r2013/libbio/alphabet-colorspace.c
> Make.rules:126: update target '/build/reproducible-path/kmer-0~20150903+r2013/libbio/alphabet-acgtspace.o' due to: target does not exist
> gcc -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libbio/alphabet-acgtspace.o -c /build/reproducible-path/kmer-0~20150903+r2013/libbio/alphabet-acgtspace.c
> Make.rules:167: update target '/build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a' due to: target does not exist
> rm -f /build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a && ar ruvs /build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a /build/reproducible-path/kmer-0~20150903+r2013/libbio/alphabet.o /build/reproducible-path/kmer-0~20150903+r2013/libbio/alphabet-acgtspace.o /build/reproducible-path/kmer-0~20150903+r2013/libbio/alphabet-colorspace.o /build/reproducible-path/kmer-0~20150903+r2013/libbio/halign.o /build/reproducible-path/kmer-0~20150903+r2013/libbio/reversecomplement.o /build/reproducible-path/kmer-0~20150903+r2013/libbio/kmer.o
> ar: `u' modifier ignored since `D' is the default (see `U')
> ar: creating /build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a
> a - /build/reproducible-path/kmer-0~20150903+r2013/libbio/alphabet.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libbio/alphabet-acgtspace.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libbio/alphabet-colorspace.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libbio/halign.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libbio/reversecomplement.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libbio/kmer.o
> Make.rules:147: update target '/build/reproducible-path/kmer-0~20150903+r2013/libseq/test-merStream' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-merStream /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-merStream.o /build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a /build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:147: update target '/build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqStream' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqStream /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqStream.o /build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a /build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:147: update target '/build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqCache' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqCache /build/reproducible-path/kmer-0~20150903+r2013/libseq/test-seqCache.o /build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a /build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/libmeryl.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libmeryl/libmeryl.o -c /build/reproducible-path/kmer-0~20150903+r2013/libmeryl/libmeryl.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libmeryl/libmeryl.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libmeryl/libmeryl.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> /build/reproducible-path/kmer-0~20150903+r2013/libmeryl/libmeryl.C:72:2: warning: #warning not checking pmagic [-Wcpp]
>    72 | #warning not checking pmagic
>       |  ^~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libmeryl/libmeryl.C:134:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   134 |     fprintf(stderr, "merylStreamReader()-- ERROR: User requested mersize "uint32FMT" but '%s' is mersize "uint32FMT"\n",
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libmeryl/libmeryl.C:134:84: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   134 |     fprintf(stderr, "merylStreamReader()-- ERROR: User requested mersize "uint32FMT" but '%s' is mersize "uint32FMT"\n",
>       |                                                                                    ^
> /build/reproducible-path/kmer-0~20150903+r2013/libmeryl/libmeryl.C:6:24: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings]
>     6 | static char *ImagicV = "merylStreamIv03\n";
>       |                        ^~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libmeryl/libmeryl.C:7:24: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings]
>     7 | static char *ImagicX = "merylStreamIvXX\n";
>       |                        ^~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libmeryl/libmeryl.C:8:24: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings]
>     8 | static char *DmagicV = "merylStreamDv03\n";
>       |                        ^~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libmeryl/libmeryl.C:9:24: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings]
>     9 | static char *DmagicX = "merylStreamDvXX\n";
>       |                        ^~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libmeryl/libmeryl.C:10:24: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings]
>    10 | static char *PmagicV = "merylStreamPv03\n";
>       |                        ^~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libmeryl/libmeryl.C:11:24: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings]
>    11 | static char *PmagicX = "merylStreamPvXX\n";
>       |                        ^~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libmeryl/libmeryl.C: In constructor ‘merylStreamReader::merylStreamReader(const char*, uint32)’:
> /build/reproducible-path/kmer-0~20150903+r2013/libmeryl/libmeryl.C:42:11: warning: variable ‘Pmagic’ set but not used [-Wunused-but-set-variable]
>    42 |   char    Pmagic[16] = {0};
>       |           ^~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libmeryl/libmeryl.C: In member function ‘void merylStreamWriter::addMer(uint64, uint32, uint64, uint32, uint32, uint32*)’:
> /build/reproducible-path/kmer-0~20150903+r2013/libmeryl/libmeryl.C:469:31: warning: suggest parentheses around ‘&&’ within ‘||’ [-Wparentheses]
>   469 |       (prefix <= _thisMerPre) && (mer < _thisMerMer)) {
>       |       ~~~~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~
> Make.rules:167: update target '/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/libmeryl.a' due to: target does not exist
> rm -f /build/reproducible-path/kmer-0~20150903+r2013/libmeryl/libmeryl.a && ar ruvs /build/reproducible-path/kmer-0~20150903+r2013/libmeryl/libmeryl.a /build/reproducible-path/kmer-0~20150903+r2013/libmeryl/libmeryl.o
> ar: `u' modifier ignored since `D' is the default (see `U')
> ar: creating /build/reproducible-path/kmer-0~20150903+r2013/libmeryl/libmeryl.a
> a - /build/reproducible-path/kmer-0~20150903+r2013/libmeryl/libmeryl.o
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.o -c /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:6:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:7:
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   127 |       fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   129 |       fprintf(stderr, "M = "uint64HEX"\n", m);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   130 |       fprintf(stderr, "H = "uint64HEX"\n", h);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   131 |       fprintf(stderr, "C = "uint64HEX"\n", c);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stderr, "R = "uint64HEX"\n", r);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:46:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    46 |     fprintf(stderr, "positionDB()-- Tried to read state from '%s', but mer size is wrong (found "uint32FMT", wanted "uint32FMT").\n",
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:46:107: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    46 |     fprintf(stderr, "positionDB()-- Tried to read state from '%s', but mer size is wrong (found "uint32FMT", wanted "uint32FMT").\n",
>       |                                                                                                           ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:52:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    52 |     fprintf(stderr, "positionDB()-- Tried to read state from '%s', but mer skip is wrong (found "uint32FMT", wanted "uint32FMT").\n",
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:52:107: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    52 |     fprintf(stderr, "positionDB()-- Tried to read state from '%s', but mer skip is wrong (found "uint32FMT", wanted "uint32FMT").\n",
>       |                                                                                                           ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:58:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 |     fprintf(stderr, "positionDB()-- Tried to read state from '%s', but max number of mismatches is wrong (found "uint32FMT", wanted "uint32FMT").\n",
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:58:123: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 |     fprintf(stderr, "positionDB()-- Tried to read state from '%s', but max number of mismatches is wrong (found "uint32FMT", wanted "uint32FMT").\n",
>       |                                                                                                                           ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:127:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   127 |     fprintf(stderr, "        sm         = "uint64FMT"\n", sm);
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:128:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |     fprintf(stderr, "        lg         = "uint64FMT"\n", lg);
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:129:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   129 |     fprintf(stderr, "        merSize    = "uint32FMT" bits\n", 2 * merSize);
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:130:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   130 |     fprintf(stderr, "        approxMers = "uint64FMT" mers\n", approxMers);
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:131:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   131 |     fprintf(stderr, "        posnWidth  = "uint64FMT" bits\n", posnWidth);
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:142:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   142 |       fprintf(stderr, "potential configurations for approximately "uint64FMT" "uint32FMT"-mers (posnW="uint64FMT").\n",
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:142:77: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   142 |       fprintf(stderr, "potential configurations for approximately "uint64FMT" "uint32FMT"-mers (posnW="uint64FMT").\n",
>       |                                                                             ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:142:89: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   142 |       fprintf(stderr, "potential configurations for approximately "uint64FMT" "uint32FMT"-mers (posnW="uint64FMT").\n",
>       |                                                                                         ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:200:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   200 |         fprintf(stderr, "tblBits="uint64FMTW(2)" shifts="uint32FMTW(02)","uint32FMTW(02)" -- size %8.3fGB -- work %8.3f%s\n",
>       |                         ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:200:48: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   200 |         fprintf(stderr, "tblBits="uint64FMTW(2)" shifts="uint32FMTW(02)","uint32FMTW(02)" -- size %8.3fGB -- work %8.3f%s\n",
>       |                                                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:200:72: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   200 |         fprintf(stderr, "tblBits="uint64FMTW(2)" shifts="uint32FMTW(02)","uint32FMTW(02)" -- size %8.3fGB -- work %8.3f%s\n",
>       |                                                                        ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:217:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   217 |     fprintf(stderr, "tblBits="uint32FMT" s1="uint32FMT" s2="uint32FMT" -- merSize="uint32FMT" bits + posnWidth="uint64FMT" bits (est "uint64FMT" mers) FINAL\n",
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:217:40: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   217 |     fprintf(stderr, "tblBits="uint32FMT" s1="uint32FMT" s2="uint32FMT" -- merSize="uint32FMT" bits + posnWidth="uint64FMT" bits (est "uint64FMT" mers) FINAL\n",
>       |                                        ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:217:55: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   217 |     fprintf(stderr, "tblBits="uint32FMT" s1="uint32FMT" s2="uint32FMT" -- merSize="uint32FMT" bits + posnWidth="uint64FMT" bits (est "uint64FMT" mers) FINAL\n",
>       |                                                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:217:70: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   217 |     fprintf(stderr, "tblBits="uint32FMT" s1="uint32FMT" s2="uint32FMT" -- merSize="uint32FMT" bits + posnWidth="uint64FMT" bits (est "uint64FMT" mers) FINAL\n",
>       |                                                                      ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:217:93: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   217 |     fprintf(stderr, "tblBits="uint32FMT" s1="uint32FMT" s2="uint32FMT" -- merSize="uint32FMT" bits + posnWidth="uint64FMT" bits (est "uint64FMT" mers) FINAL\n",
>       |                                                                                             ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:217:122: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   217 |     fprintf(stderr, "tblBits="uint32FMT" s1="uint32FMT" s2="uint32FMT" -- merSize="uint32FMT" bits + posnWidth="uint64FMT" bits (est "uint64FMT" mers) FINAL\n",
>       |                                                                                                                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:326:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   326 |     fprintf(stderr, "positionDB()-- bktAlloc = new uint64 ["uint64FMT"]\n", _tableSizeInEntries / 2 + 4);
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:348:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   348 |     fprintf(stderr, "    Allocated bucket size counting space with total size "uint64FMT" KB\n", _tableSizeInEntries >> 8);
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:392:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   392 |     fprintf(stderr, "    Found "uint64FMT" mers (max position = "uint64FMT")\n", _numberOfMers, _numberOfPositions);
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:392:42: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   392 |     fprintf(stderr, "    Found "uint64FMT" mers (max position = "uint64FMT")\n", _numberOfMers, _numberOfPositions);
>       |                                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:430:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   430 |     fprintf(stderr, "    Allocated "uint64FMT"KB for buckets ("uint64FMT" 64-bit words)\n", bucketsSpace >> 7, bucketsSpace);
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:430:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   430 |     fprintf(stderr, "    Allocated "uint64FMT"KB for buckets ("uint64FMT" 64-bit words)\n", bucketsSpace >> 7, bucketsSpace);
>       |                                              ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:435:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   435 |     fprintf(stderr, "positionDB()-- _countingBuckets = new uint64 ["uint64FMT"]\n", bucketsSpace);
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:553:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   553 |     fprintf(stderr, "    Sorting and repacking buckets ("uint64FMT" buckets).\n", _tableSizeInEntries);
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:565:13: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   565 |             "    Found "uint64FMTW(12)" total mers\n"
>       |             ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:566:13: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   566 |             "    Found "uint64FMTW(12)" distinct mers\n"
>       |             ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:567:13: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   567 |             "    Found "uint64FMTW(12)" unique mers\n"
>       |             ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:568:13: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   568 |             "    Need "uint64FMT" non-unique position list entries ("uint64FMT" maximum count)\n",
>       |             ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:568:33: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   568 |             "    Need "uint64FMT" non-unique position list entries ("uint64FMT" maximum count)\n",
>       |                                 ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:637:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   637 |       fprintf(stderr, "    Allocated "uint64FMTW(10)"KB for hash table ("uint64FMT" 64-bit words)\n", hs >> 7, hs);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:637:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   637 |       fprintf(stderr, "    Allocated "uint64FMTW(10)"KB for hash table ("uint64FMT" 64-bit words)\n", hs >> 7, hs);
>       |                                                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:643:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   643 |       fprintf(stderr, "positionDB()-- _hashTable_BP = new uint64 ["uint64FMT"]\n", hs);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:662:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   662 |       fprintf(stderr, "    Reusing bucket space; Have: "uint64FMT"  Need: "uint64FMT" (64-bit words)\n", bucketsSpace, bs);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:662:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   662 |       fprintf(stderr, "    Reusing bucket space; Have: "uint64FMT"  Need: "uint64FMT" (64-bit words)\n", bucketsSpace, bs);
>       |                                                                  ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:669:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   669 |       fprintf(stderr, "    Allocated "uint64FMTW(10)"KB for buckets    ("uint64FMT" 64-bit words)\n", bs >> 7, bs);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:669:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   669 |       fprintf(stderr, "    Allocated "uint64FMTW(10)"KB for buckets    ("uint64FMT" 64-bit words)\n", bs >> 7, bs);
>       |                                                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:674:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   674 |       fprintf(stderr, "positionDB()-- _buckets = new uint64 ["uint64FMT"]\n", bs);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:680:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   680 |     fprintf(stderr, "    Allocated "uint64FMTW(10)"KB for positions  ("uint64FMT" 64-bit words)\n", ps >> 7, ps);
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:680:51: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   680 |     fprintf(stderr, "    Allocated "uint64FMTW(10)"KB for positions  ("uint64FMT" 64-bit words)\n", ps >> 7, ps);
>       |                                                   ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:685:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   685 |     fprintf(stderr, "positionDB()-- _positions = new uint64 ["uint64FMT"\n", ps);
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:695:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   695 |     fprintf(stderr, "    Transferring to final structure ("uint64FMT" buckets).\n", _tableSizeInEntries);
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:878:31: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   878 |               fprintf(stderr, "positionDB()-- ERROR:  Got position "uint64FMT", but only "uint64FMT" available!\n",
>       |                               ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:878:78: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   878 |               fprintf(stderr, "positionDB()-- ERROR:  Got position "uint64FMT", but only "uint64FMT" available!\n",
>       |                                                                              ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:916:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   916 |     fprintf(stderr, "    Avail: Bucket "uint64FMTW(12)"    Position "uint64FMTW(12)" (64-bit words)\n", bs, ps);
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:916:55: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   916 |     fprintf(stderr, "    Avail: Bucket "uint64FMTW(12)"    Position "uint64FMTW(12)" (64-bit words)\n", bs, ps);
>       |                                                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:917:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   917 |     fprintf(stderr, "    Avail: Bucket "uint64FMTW(12)"    Position "uint64FMTW(12)" (entries)\n", _numberOfDistinct, _numberOfEntries);
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:917:55: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   917 |     fprintf(stderr, "    Avail: Bucket "uint64FMTW(12)"    Position "uint64FMTW(12)" (entries)\n", _numberOfDistinct, _numberOfEntries);
>       |                                                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:918:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   918 |     fprintf(stderr, "    Used:  Bucket "uint64FMTW(12)"    Position "uint64FMTW(12)" (64-bit words)\n", currentBbit / 64, currentPbit / 64);
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:918:55: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   918 |     fprintf(stderr, "    Used:  Bucket "uint64FMTW(12)"    Position "uint64FMTW(12)" (64-bit words)\n", currentBbit / 64, currentPbit / 64);
>       |                                                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:928:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   928 |     fprintf(stderr, "    Used:  Bucket "uint64FMTW(12)"    Position "uint64FMTW(12)" (entries)\n", _numberOfDistinct, _numberOfEntries);
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:928:55: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   928 |     fprintf(stderr, "    Used:  Bucket "uint64FMTW(12)"    Position "uint64FMTW(12)" (entries)\n", _numberOfDistinct, _numberOfEntries);
>       |                                                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:930:13: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   930 |             "    Found "uint64FMTW(12)" total mers\n"
>       |             ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:931:13: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   931 |             "    Found "uint64FMTW(12)" distinct mers\n"
>       |             ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:932:13: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   932 |             "    Found "uint64FMTW(12)" unique mers\n"
>       |             ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:933:13: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   933 |             "    Need "uint64FMT" non-unique position list entries ("uint64FMT" maximum count)\n",
>       |             ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:933:33: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   933 |             "    Need "uint64FMT" non-unique position list entries ("uint64FMT" maximum count)\n",
>       |                                 ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:955:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   955 |         fprintf(stderr, "    Rebuilding the hash table, from "uint32FMT" bits wide to "uint32FMT" bits wide.\n",
>       |                         ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:955:72: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   955 |         fprintf(stderr, "    Rebuilding the hash table, from "uint32FMT" bits wide to "uint32FMT" bits wide.\n",
>       |                                                                        ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:990:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   990 |       fprintf(stderr, "    Loading "uint64FMT" mercounts.\n", counts->numberOfDistinctMers());
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:1013:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>  1013 |       fprintf(stderr, "    Loaded "uint64FMT" mercounts; largest is "uint64FMT".\n", countsLoaded, largestMerylCount);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:1013:45: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>  1013 |       fprintf(stderr, "    Loaded "uint64FMT" mercounts; largest is "uint64FMT".\n", countsLoaded, largestMerylCount);
>       |                                             ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:1017:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>  1017 |         fprintf(stderr, "    Compress sizes from "uint32FMT" bits to "uint32FMT" bits.\n",
>       |                         ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:1017:60: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>  1017 |         fprintf(stderr, "    Compress sizes from "uint32FMT" bits to "uint32FMT" bits.\n",
>       |                                                            ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C: In member function ‘void positionDB::build(merStream*, existDB*, existDB*, merylStreamReader*, uint32, uint32, bool)’:
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:324:17: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=]
>   324 |   } catch (std::bad_alloc) {
>       |                 ^~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:433:17: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=]
>   433 |   } catch (std::bad_alloc) {
>       |                 ^~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:641:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=]
>   641 |     } catch (std::bad_alloc) {
>       |                   ^~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:672:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=]
>   672 |     } catch (std::bad_alloc) {
>       |                   ^~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.C:683:17: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=]
>   683 |   } catch (std::bad_alloc) {
>       |                 ^~~~~~~~~
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-sort.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-sort.o -c /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-sort.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:5,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-sort.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   127 |       fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   129 |       fprintf(stderr, "M = "uint64HEX"\n", m);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   130 |       fprintf(stderr, "H = "uint64HEX"\n", h);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   131 |       fprintf(stderr, "C = "uint64HEX"\n", c);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stderr, "R = "uint64HEX"\n", r);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-sort.C:37:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    37 |     fprintf(stdout, "ERROR: Bucket "uint64FMT" starts at "uint64FMT" ends at "uint64FMT"?\n", b, st, ed);
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-sort.C:37:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    37 |     fprintf(stdout, "ERROR: Bucket "uint64FMT" starts at "uint64FMT" ends at "uint64FMT"?\n", b, st, ed);
>       |                                              ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-sort.C:37:68: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    37 |     fprintf(stdout, "ERROR: Bucket "uint64FMT" starts at "uint64FMT" ends at "uint64FMT"?\n", b, st, ed);
>       |                                                                    ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-sort.C:78:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    78 |       fprintf(stdout, "ERROR: unset posn bucket="uint64FMT" t="int64FMT" le="uint32FMT"\n", b, t, le);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-sort.C:78:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    78 |       fprintf(stdout, "ERROR: unset posn bucket="uint64FMT" t="int64FMT" le="uint32FMT"\n", b, t, le);
>       |                                                           ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-sort.C:78:72: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    78 |       fprintf(stdout, "ERROR: unset posn bucket="uint64FMT" t="int64FMT" le="uint32FMT"\n", b, t, le);
>       |                                                                        ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-sort.C:86:36: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    86 |       fprintf(stdout, uint32FMTW(4)"] chck="uint64HEX" posn="uint64FMT"\n", t, _sortedChck[t], _sortedPosn[t]);
>       |                                    ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-sort.C:86:54: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    86 |       fprintf(stdout, uint32FMTW(4)"] chck="uint64HEX" posn="uint64FMT"\n", t, _sortedChck[t], _sortedPosn[t]);
>       |                                                      ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-sort.C:110:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   110 |       fprintf(stdout, "ERROR: bucket="uint64FMT" t="uint32FMT" le="uint32FMT": "uint64HEX" > "uint64HEX"\n",
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-sort.C:110:48: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   110 |       fprintf(stdout, "ERROR: bucket="uint64FMT" t="uint32FMT" le="uint32FMT": "uint64HEX" > "uint64HEX"\n",
>       |                                                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-sort.C:110:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   110 |       fprintf(stdout, "ERROR: bucket="uint64FMT" t="uint32FMT" le="uint32FMT": "uint64HEX" > "uint64HEX"\n",
>       |                                                              ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-sort.C:110:77: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   110 |       fprintf(stdout, "ERROR: bucket="uint64FMT" t="uint32FMT" le="uint32FMT": "uint64HEX" > "uint64HEX"\n",
>       |                                                                             ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-sort.C:110:90: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   110 |       fprintf(stdout, "ERROR: bucket="uint64FMT" t="uint32FMT" le="uint32FMT": "uint64HEX" > "uint64HEX"\n",
>       |                                                                                          ^
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-mismatch.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-mismatch.o -c /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-mismatch.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:5,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-mismatch.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   127 |       fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   129 |       fprintf(stderr, "M = "uint64HEX"\n", m);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   130 |       fprintf(stderr, "H = "uint64HEX"\n", h);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   131 |       fprintf(stderr, "C = "uint64HEX"\n", c);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stderr, "R = "uint64HEX"\n", r);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-mismatch.C:324:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   324 |       fprintf(stderr, "positionDB::getUpToNMismatches()-- Can't allocate space for initial positions, requested "uint64FMT" uint64's.\n", posnMax);
>       |                       ^
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-file.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-file.o -c /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-file.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:5,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-file.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   127 |       fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   129 |       fprintf(stderr, "M = "uint64HEX"\n", m);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   130 |       fprintf(stderr, "H = "uint64HEX"\n", h);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   131 |       fprintf(stderr, "C = "uint64HEX"\n", c);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stderr, "R = "uint64HEX"\n", r);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-file.C:197:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   197 |   fprintf(stream, "merSizeInBases:       "uint32FMT"\n", _merSizeInBases);
>       |                   ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-file.C:198:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   198 |   fprintf(stream, "merSkipInBases:       "uint32FMT"\n", _merSkipInBases);
>       |                   ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-file.C:199:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   199 |   fprintf(stream, "tableSizeInBits:      "uint32FMT"\n", _tableSizeInBits);
>       |                   ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-file.C:200:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   200 |   fprintf(stream, "tableSizeInEntries:   "uint64FMT"\n", _tableSizeInEntries);
>       |                   ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-file.C:201:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   201 |   fprintf(stream, "hashWidth:            "uint32FMT"\n", _hashWidth);
>       |                   ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-file.C:202:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   202 |   fprintf(stream, "chckWidth:            "uint32FMT"\n", _chckWidth);
>       |                   ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-file.C:203:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   203 |   fprintf(stream, "posnWidth:            "uint32FMT"\n", _posnWidth);
>       |                   ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-file.C:204:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   204 |   fprintf(stream, "numberOfMers:         "uint64FMT"\n", _numberOfMers);
>       |                   ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-file.C:205:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   205 |   fprintf(stream, "numberOfPositions:    "uint64FMT"\n", _numberOfPositions);
>       |                   ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-file.C:206:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   206 |   fprintf(stream, "numberOfDistinct:     "uint64FMT"\n", _numberOfDistinct);
>       |                   ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-file.C:207:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   207 |   fprintf(stream, "numberOfUnique:       "uint64FMT"\n", _numberOfUnique);
>       |                   ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-file.C:208:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   208 |   fprintf(stream, "numberOfEntries:      "uint64FMT"\n", _numberOfEntries);
>       |                   ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-file.C:209:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   209 |   fprintf(stream, "maximumEntries:       "uint64FMT"\n", _maximumEntries);
>       |                   ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-file.C: In member function ‘void positionDB::saveState(const char*)’:
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-file.C:63:22: warning: cast to pointer from integer of different size [-Wint-to-pointer-cast]
>    63 |   _hashTable_FW    = (uint32 *)((_hashTable_FW) ? uint32ONE : uint32ZERO);
>       |                      ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-file.C:37:10: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>    37 |     write(F, magic, sizeof(char) * 16);
>       |     ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-file.C:39:10: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>    39 |     write(F, faild, sizeof(char) * 16);
>       |     ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-file.C:95:10: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>    95 |     write(F, magic, sizeof(char) * 16);
>       |     ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-dump.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-dump.o -c /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-dump.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:5,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-dump.C:4:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   127 |       fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   129 |       fprintf(stderr, "M = "uint64HEX"\n", m);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   130 |       fprintf(stderr, "H = "uint64HEX"\n", h);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   131 |       fprintf(stderr, "C = "uint64HEX"\n", c);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stderr, "R = "uint64HEX"\n", r);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-dump.C:25:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    25 |     fprintf(F, "B "uint64FMT" "uint64FMT"-"uint64FMT"\n", h, st, ed);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-dump.C:25:29: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    25 |     fprintf(F, "B "uint64FMT" "uint64FMT"-"uint64FMT"\n", h, st, ed);
>       |                             ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-dump.C:25:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    25 |     fprintf(F, "B "uint64FMT" "uint64FMT"-"uint64FMT"\n", h, st, ed);
>       |                                         ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-dump.C:32:18: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |       fprintf(F, "%c chk="uint64HEX" pos="uint64FMT" siz="uint64FMT,
>       |                  ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-dump.C:32:36: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |       fprintf(F, "%c chk="uint64HEX" pos="uint64FMT" siz="uint64FMT,
>       |                                    ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-dump.C:32:52: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |       fprintf(F, "%c chk="uint64HEX" pos="uint64FMT" siz="uint64FMT,
>       |                                                    ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-dump.C:40:22: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    40 |           fprintf(F, " "uint64FMT, getDecodedValue(_positions, pos, _posnWidth));
>       |                      ^
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-access.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-access.o -c /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-access.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-access.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-access.C:2:
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   127 |       fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   129 |       fprintf(stderr, "M = "uint64HEX"\n", m);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   130 |       fprintf(stderr, "H = "uint64HEX"\n", h);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   131 |       fprintf(stderr, "C = "uint64HEX"\n", c);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stderr, "R = "uint64HEX"\n", r);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-access.C:22:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    22 |       fprintf(stderr, "positionDB::get()-- Can't allocate space for more positions, requested "uint64FMT" uint64's.\n", posnMax);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-access.C:215:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   215 |   fprintf(stderr, "positionDB::filter()--  Filtering out kmers less than "uint64FMT" and more than "uint64FMT"\n", lo, hi);
>       |                   ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-access.C:215:84: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   215 |   fprintf(stderr, "positionDB::filter()--  Filtering out kmers less than "uint64FMT" and more than "uint64FMT"\n", lo, hi);
>       |                                                                                    ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-access.C:339:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   339 |   fprintf(stderr, "positionDB::filter()--  Filtered "uint64FMT" kmers less than "uint64FMT"\n", loCount, lo);
>       |                   ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-access.C:339:63: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   339 |   fprintf(stderr, "positionDB::filter()--  Filtered "uint64FMT" kmers less than "uint64FMT"\n", loCount, lo);
>       |                                                               ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-access.C:340:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   340 |   fprintf(stderr, "positionDB::filter()--  Filtered "uint64FMT" kmers more than "uint64FMT"\n", hiCount, hi);
>       |                   ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-access.C:340:63: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   340 |   fprintf(stderr, "positionDB::filter()--  Filtered "uint64FMT" kmers more than "uint64FMT"\n", hiCount, hi);
>       |                                                               ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-access.C:341:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   341 |   fprintf(stderr, "positionDB::filter()--  Saved    "uint64FMT" kmers with acceptable count\n", okCount);
>       |                   ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-access.C: In member function ‘void positionDB::filter(uint64, uint64)’:
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-access.C:204:11: warning: unused variable ‘vv’ [-Wunused-variable]
>   204 |   uint64  vv;
>       |           ^~
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB.o -c /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB.H:7,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB.C:5:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB.C:44:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    44 |       fprintf(stderr, "existDB::existDB()-- Got "uint32FMT", expected "uint32FMT"\n", _merSizeInBases, merSize);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB.C:44:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    44 |       fprintf(stderr, "existDB::existDB()-- Got "uint32FMT", expected "uint32FMT"\n", _merSizeInBases, merSize);
>       |                                                           ^
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-state.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-state.o -c /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-state.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB.H:7,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-state.C:5:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-state.C:169:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   169 |   fprintf(stream, "merSizeInBases:   "uint32FMT"\n", _merSizeInBases);
>       |                   ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-state.C:170:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   170 |   fprintf(stream, "tableBits         "uint32FMT"\n", 2 * _merSizeInBases - _shift1);
>       |                   ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-state.C:172:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   172 |   fprintf(stream, "_hashTableWords   "uint64FMT" ("uint64FMT" KB)\n", _hashTableWords, _hashTableWords >> 7);
>       |                   ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-state.C:172:48: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   172 |   fprintf(stream, "_hashTableWords   "uint64FMT" ("uint64FMT" KB)\n", _hashTableWords, _hashTableWords >> 7);
>       |                                                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-state.C:173:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   173 |   fprintf(stream, "_bucketsWords     "uint64FMT" ("uint64FMT" KB)\n", _bucketsWords, _bucketsWords >> 7);
>       |                   ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-state.C:173:48: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   173 |   fprintf(stream, "_bucketsWords     "uint64FMT" ("uint64FMT" KB)\n", _bucketsWords, _bucketsWords >> 7);
>       |                                                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-state.C:174:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   174 |   fprintf(stream, "_countsWords      "uint64FMT" ("uint64FMT" KB)\n", _countsWords, _countsWords >> 7);
>       |                   ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-state.C:174:48: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   174 |   fprintf(stream, "_countsWords      "uint64FMT" ("uint64FMT" KB)\n", _countsWords, _countsWords >> 7);
>       |                                                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-state.C:176:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   176 |   fprintf(stream, "_shift1:          "uint32FMT"\n", _shift1);
>       |                   ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-state.C:177:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   177 |   fprintf(stream, "_shift2           "uint32FMT"\n", _shift2);
>       |                   ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-state.C:178:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   178 |   fprintf(stream, "_mask1            "uint64HEX"\n", _mask1);
>       |                   ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-state.C:179:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   179 |   fprintf(stream, "_mask2            "uint64HEX"\n", _mask2);
>       |                   ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-state.C:183:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   183 |     fprintf(stream, "_hshWidth         "uint32FMT"\n", _hshWidth);
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-state.C:191:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   191 |     fprintf(stream, "_chkWidth         "uint32FMT"\n", _chkWidth);
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-state.C:199:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   199 |     fprintf(stream, "_cntWidth         "uint32FMT"\n", _cntWidth);
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-state.C: In member function ‘bool existDB::loadState(const char*, bool, bool)’:
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-state.C:80:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>    80 |   fread(cigam, sizeof(char), 16, F);
>       |   ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-state.C:124:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   124 |   fread(&_merSizeInBases, sizeof(uint32), 1, F);
>       |   ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-state.C:125:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   125 |   fread(&_shift1, sizeof(uint32), 1, F);
>       |   ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-state.C:126:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   126 |   fread(&_shift2, sizeof(uint32), 1, F);
>       |   ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-state.C:127:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   127 |   fread(&_mask1, sizeof(uint64), 1, F);
>       |   ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-state.C:128:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   128 |   fread(&_mask2, sizeof(uint64), 1, F);
>       |   ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-state.C:129:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   129 |   fread(&_hshWidth, sizeof(uint32), 1, F);  //  only valid if _compressedHash
>       |   ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-state.C:130:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   130 |   fread(&_chkWidth, sizeof(uint32), 1, F);  //  only valid if _compressedBucket
>       |   ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-state.C:131:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   131 |   fread(&_cntWidth, sizeof(uint32), 1, F);  //  only valid if _compressedCounts
>       |   ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-state.C:133:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   133 |   fread(&_hashTableWords, sizeof(uint64), 1, F);
>       |   ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-state.C:134:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   134 |   fread(&_bucketsWords,   sizeof(uint64), 1, F);
>       |   ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-state.C:135:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   135 |   fread(&_countsWords,    sizeof(uint64), 1, F);
>       |   ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-state.C:148:10: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   148 |     fread(_hashTable, sizeof(uint64), _hashTableWords, F);
>       |     ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-state.C:149:10: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   149 |     fread(_buckets,   sizeof(uint64), _bucketsWords,   F);
>       |     ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-state.C:152:12: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   152 |       fread(_counts,  sizeof(uint64), _countsWords,    F);
>       |       ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-state.C: In member function ‘void existDB::saveState(const char*)’:
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-state.C:24:10: warning: ‘char* __builtin_strncpy(char*, const char*, long unsigned int)’ output truncated before terminating nul copying 16 bytes from a string of the same length [-Wstringop-truncation]
>    24 |   strncpy(cigam, magic, 16);
>       |          ^
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-create-from-sequence.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-create-from-sequence.o -c /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-create-from-sequence.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB.H:7,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-create-from-sequence.C:5:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-create-from-sequence.C:136:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   136 |     fprintf(stderr, "existDB::createFromSequence()-- hashTable is "uint64FMT"MB\n", _hashTableWords >> 17);
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-create-from-sequence.C:137:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   137 |     fprintf(stderr, "existDB::createFromSequence()-- buckets is "uint64FMT"MB\n", _bucketsWords >> 17);
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-create-from-sequence.C:139:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   139 |       fprintf(stderr, "existDB::createFromSequence()-- counts is "uint64FMT"MB\n", _countsWords >> 17);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-create-from-sequence.C:239:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   239 |     fprintf(stderr, "Compressed from "uint64FMT" to "uint64FMT" ("uint64FMT" bits)\n",
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-create-from-sequence.C:239:48: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   239 |     fprintf(stderr, "Compressed from "uint64FMT" to "uint64FMT" ("uint64FMT" bits)\n",
>       |                                                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-create-from-sequence.C:239:63: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   239 |     fprintf(stderr, "Compressed from "uint64FMT" to "uint64FMT" ("uint64FMT" bits)\n",
>       |                                                               ^
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-create-from-meryl.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-create-from-meryl.o -c /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-create-from-meryl.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB.H:7,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-create-from-meryl.C:5:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-create-from-meryl.C:27:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    27 |     fprintf(stderr, "createFromMeryl()-- ERROR: requested merSize ("uint32FMT") is different than merSize in meryl database ("uint32FMT").\n",
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-create-from-meryl.C:27:78: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    27 |     fprintf(stderr, "createFromMeryl()-- ERROR: requested merSize ("uint32FMT") is different than merSize in meryl database ("uint32FMT").\n",
>       |                                                                              ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-create-from-meryl.C:54:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    54 |     fprintf(stderr, "createFromMeryl()-- tableSizeInEntries   "uint64FMT"\n", tableSizeInEntries);
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-create-from-meryl.C:55:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 |     fprintf(stderr, "createFromMeryl()-- count range          "uint32FMT"-"uint32FMT"\n", lo, hi);
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-create-from-meryl.C:55:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 |     fprintf(stderr, "createFromMeryl()-- count range          "uint32FMT"-"uint32FMT"\n", lo, hi);
>       |                                                                         ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-create-from-meryl.C:104:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   104 |     fprintf(stderr, "createFromMeryl()-- numberOfMers         "uint64FMT"\n", numberOfMers);
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-create-from-meryl.C:116:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   116 |     fprintf(stderr, "existDB::createFromMeryl()-- Found "uint64FMT" mers between count of "uint32FMT" and "uint32FMT"\n",
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-create-from-meryl.C:116:67: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   116 |     fprintf(stderr, "existDB::createFromMeryl()-- Found "uint64FMT" mers between count of "uint32FMT" and "uint32FMT"\n",
>       |                                                                   ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-create-from-meryl.C:116:101: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   116 |     fprintf(stderr, "existDB::createFromMeryl()-- Found "uint64FMT" mers between count of "uint32FMT" and "uint32FMT"\n",
>       |                                                                                                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-create-from-meryl.C:135:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   135 |     fprintf(stderr, "existDB::createFromMeryl()-- hashTable is "uint64FMT"MB\n", _hashTableWords >> 17);
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-create-from-meryl.C:136:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   136 |     fprintf(stderr, "existDB::createFromMeryl()-- buckets is "uint64FMT"MB\n", _bucketsWords >> 17);
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-create-from-meryl.C:138:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   138 |       fprintf(stderr, "existDB::createFromMeryl()-- counts is "uint64FMT"MB\n", _countsWords >> 17);
>       |                       ^
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-create-from-fasta.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-create-from-fasta.o -c /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-create-from-fasta.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB.H:7,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-create-from-fasta.C:5:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-create-from-fasta.C:136:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   136 |     fprintf(stderr, "existDB::createFromFastA()-- hashTable is "uint64FMT"MB\n", _hashTableWords >> 17);
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-create-from-fasta.C:137:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   137 |     fprintf(stderr, "existDB::createFromFastA()-- buckets is "uint64FMT"MB\n", _bucketsWords >> 17);
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-create-from-fasta.C:139:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   139 |       fprintf(stderr, "existDB::createFromFastA()-- counts is "uint64FMT"MB\n", _countsWords >> 17);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-create-from-fasta.C:239:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   239 |     fprintf(stderr, "Compressed from "uint64FMT" to "uint64FMT" ("uint64FMT" bits)\n",
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-create-from-fasta.C:239:48: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   239 |     fprintf(stderr, "Compressed from "uint64FMT" to "uint64FMT" ("uint64FMT" bits)\n",
>       |                                                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-create-from-fasta.C:239:63: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   239 |     fprintf(stderr, "Compressed from "uint64FMT" to "uint64FMT" ("uint64FMT" bits)\n",
>       |                                                               ^
> Make.rules:167: update target '/build/reproducible-path/kmer-0~20150903+r2013/libkmer/libkmer.a' due to: target does not exist
> rm -f /build/reproducible-path/kmer-0~20150903+r2013/libkmer/libkmer.a && ar ruvs /build/reproducible-path/kmer-0~20150903+r2013/libkmer/libkmer.a /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-create-from-fasta.o /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-create-from-meryl.o /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-create-from-sequence.o /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-state.o /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB.o /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-access.o /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-dump.o /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-file.o /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-mismatch.o /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-sort.o /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.o
> ar: `u' modifier ignored since `D' is the default (see `U')
> ar: creating /build/reproducible-path/kmer-0~20150903+r2013/libkmer/libkmer.a
> a - /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-create-from-fasta.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-create-from-meryl.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-create-from-sequence.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB-state.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-access.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-dump.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-file.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-mismatch.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB-sort.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.o
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libkmer/driver-posDB.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libkmer/driver-posDB.o -c /build/reproducible-path/kmer-0~20150903+r2013/libkmer/driver-posDB.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libkmer/driver-posDB.C:6:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libkmer/driver-posDB.C:8:
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   127 |       fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   129 |       fprintf(stderr, "M = "uint64HEX"\n", m);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   130 |       fprintf(stderr, "H = "uint64HEX"\n", h);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   131 |       fprintf(stderr, "C = "uint64HEX"\n", c);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stderr, "R = "uint64HEX"\n", r);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/driver-posDB.C:54:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    54 |         fprintf(stdout, "%s @ "uint64FMT"/"uint64FMT": Found "uint64FMT" table entries, and "uint32FMT" matching positions (",
>       |                         ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/driver-posDB.C:54:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    54 |         fprintf(stdout, "%s @ "uint64FMT"/"uint64FMT": Found "uint64FMT" table entries, and "uint32FMT" matching positions (",
>       |                                         ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/driver-posDB.C:54:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    54 |         fprintf(stdout, "%s @ "uint64FMT"/"uint64FMT": Found "uint64FMT" table entries, and "uint32FMT" matching positions (",
>       |                                                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/driver-posDB.C:54:72: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    54 |         fprintf(stdout, "%s @ "uint64FMT"/"uint64FMT": Found "uint64FMT" table entries, and "uint32FMT" matching positions (",
>       |                                                                        ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/driver-posDB.C:68:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 |       fprintf(stdout, "Found no matches for mer=%s at pos="uint64FMT"\n",
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/driver-posDB.C:101:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   101 |       fprintf(stdout, "Got a F match for mer=%s at "uint64FMT"/"uint64FMT" (in mers), numMatches="uint64FMT"\n",
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/driver-posDB.C:101:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   101 |       fprintf(stdout, "Got a F match for mer=%s at "uint64FMT"/"uint64FMT" (in mers), numMatches="uint64FMT"\n",
>       |                                                              ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/driver-posDB.C:101:74: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   101 |       fprintf(stdout, "Got a F match for mer=%s at "uint64FMT"/"uint64FMT" (in mers), numMatches="uint64FMT"\n",
>       |                                                                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/driver-posDB.C:110:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   110 |       fprintf(stdout, "Got a R match for mer=%s at "uint64FMT"/"uint64FMT" (in mers), numMatches="uint64FMT"\n",
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/driver-posDB.C:110:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   110 |       fprintf(stdout, "Got a R match for mer=%s at "uint64FMT"/"uint64FMT" (in mers), numMatches="uint64FMT"\n",
>       |                                                              ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/driver-posDB.C:110:74: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   110 |       fprintf(stdout, "Got a R match for mer=%s at "uint64FMT"/"uint64FMT" (in mers), numMatches="uint64FMT"\n",
>       |                                                                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/driver-posDB.C:255:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   255 |     fprintf(stderr, "ERROR: merbegin="uint64FMT" and merend="uint64FMT" are incompatible.\n",
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/driver-posDB.C:255:48: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   255 |     fprintf(stderr, "ERROR: merbegin="uint64FMT" and merend="uint64FMT" are incompatible.\n",
>       |                                                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/driver-posDB.C:275:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   275 |   fprintf(stderr, "Building table with merSize "uint32FMT", merSkip "uint32FMT"\n", mersize, merskip);
>       |                   ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/driver-posDB.C:275:58: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   275 |   fprintf(stderr, "Building table with merSize "uint32FMT", merSkip "uint32FMT"\n", mersize, merskip);
>       |                                                          ^
> Make.rules:147: update target '/build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB /build/reproducible-path/kmer-0~20150903+r2013/libkmer/driver-posDB.o /build/reproducible-path/kmer-0~20150903+r2013/libkmer/libkmer.a /build/reproducible-path/kmer-0~20150903+r2013/libmeryl/libmeryl.a /build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a /build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libkmer/driver-existDB.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libkmer/driver-existDB.o -c /build/reproducible-path/kmer-0~20150903+r2013/libkmer/driver-existDB.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libkmer/driver-existDB.C:6:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/driver-existDB.C:53:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    53 |       fprintf(stderr, "mer "uint64HEX" not found : e=%d  f=%d  g=%d\n", m, ee, ef, eg);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/driver-existDB.C:56:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 |       fprintf(stderr, "mer "uint64HEX" count differs : e=%u  f=%u  g=%u (exists=%d)\n", m, ce, cf, cg, ee);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/driver-existDB.C:65:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 |       fprintf(stderr, "mer "uint64HEX" : e=%u  f=%u  g=%u (exists=%d)\n", m, ce, cf, cg, ee);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/driver-existDB.C:96:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    96 |     fprintf(stderr, "Tried "uint64FMT", didn't find "uint64FMT" merStream mers in the existDB.\n", tried, lost);
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/driver-existDB.C:96:38: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    96 |     fprintf(stderr, "Tried "uint64FMT", didn't find "uint64FMT" merStream mers in the existDB.\n", tried, lost);
>       |                                      ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/driver-existDB.C:128:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |   fprintf(stderr, "Found "uint64FMT" mers in the meryl database.\n", expected);
>       |                   ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/driver-existDB.C:148:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   148 |     fprintf(stderr, "Expected to find "uint64FMT" mers, but found "uint64FMT" instead.\n",
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/driver-existDB.C:148:49: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   148 |     fprintf(stderr, "Expected to find "uint64FMT" mers, but found "uint64FMT" instead.\n",
>       |                                                 ^
> Make.rules:147: update target '/build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o /build/reproducible-path/kmer-0~20150903+r2013/libkmer/existDB /build/reproducible-path/kmer-0~20150903+r2013/libkmer/driver-existDB.o /build/reproducible-path/kmer-0~20150903+r2013/libkmer/libkmer.a /build/reproducible-path/kmer-0~20150903+r2013/libmeryl/libmeryl.a /build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a /build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishWriter.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishWriter.o -c /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishWriter.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish.H:11,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishWriter.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishWriter.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishReader.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishReader.o -c /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishReader.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish.H:11,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishReader.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishReader.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishFile.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishFile.o -c /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishFile.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish.H:11,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishFile.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishFile.C:6:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishFile.C:120:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   120 |     fprintf(stderr, "Failed to reposition %s to record "uint32FMT", only "uint32FMT" records\n", _path, ordinal, _polishRecordLen), exit(1);
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishFile.C:120:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   120 |     fprintf(stderr, "Failed to reposition %s to record "uint32FMT", only "uint32FMT" records\n", _path, ordinal, _polishRecordLen), exit(1);
>       |                                                                  ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishFile.C:248:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   248 |         fprintf(stderr, "polishes: "uint32FMT"\r", _polishRecordLen);
>       |                         ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishFile.C: In member function ‘void sim4polishFile::loadIndex()’:
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishFile.C:141:10: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   141 |     fread(&magic, sizeof(char), 8, F);
>       |     ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishFile.C:145:10: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   145 |     fread(&_polishRecordLen, sizeof(uint32), 1, F);
>       |     ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishFile.C:151:10: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   151 |     fread( _polishRecord,    sizeof(polishRecord), _polishRecordLen, F);
>       |     ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishFile.C:152:10: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   152 |     fread( _polishRecordEST, sizeof(uint32),       _polishRecordLen, F);
>       |     ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishFile.C:153:10: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   153 |     fread( _polishRecordGEN, sizeof(uint32),       _polishRecordLen, F);
>       |     ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishFile.C:155:10: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   155 |     fread(&_maxEST, sizeof(uint32), 1, F);
>       |     ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishFile.C:156:10: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   156 |     fread(&_maxGEN, sizeof(uint32), 1, F);
>       |     ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishFile.C:161:10: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   161 |     fread( _ESTiidLocation, sizeof(uint32), _maxEST, F);
>       |     ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishFile.C:162:10: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   162 |     fread( _GENiidLocation, sizeof(uint32), _maxGEN, F);
>       |     ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishBuilder.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishBuilder.o -c /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishBuilder.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishBuilder.C:6:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishBuilder.C: In member function ‘sim4polish* sim4polishBuilder::release()’:
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishBuilder.C:246:11: warning: ‘void* memcpy(void*, const void*, size_t)’ writing to an object of non-trivially copyable type ‘class sim4polishExon’; use copy-assignment or copy-initialization instead [-Wclass-memaccess]
>   246 |     memcpy(it->_exons + i, ex[i], sizeof(sim4polishExon));
>       |     ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishBuilder.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishBuilder.C:7:
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish.H:49:7: note: ‘class sim4polishExon’ declared here
>    49 | class sim4polishExon {
>       |       ^~~~~~~~~~~~~~
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishList.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishList.o -c /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishList.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishList.C:6:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish.o -c /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish.H:11,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-updatescores.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-updatescores.o -c /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-updatescores.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish.H:11,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-updatescores.C:2:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.o -c /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish.H:11,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:42:32: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    42 |   uint32 r = sscanf(lines[cl], ""uint32FMT"["uint32FMT" "uint32FMT" "uint32FMT"] "uint32FMT"["uint32FMT" "uint32FMT"] <"uint32FMT" "uint32FMT" "uint32FMT" %s %s>",
>       |                                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:42:43: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    42 |   uint32 r = sscanf(lines[cl], ""uint32FMT"["uint32FMT" "uint32FMT" "uint32FMT"] "uint32FMT"["uint32FMT" "uint32FMT"] <"uint32FMT" "uint32FMT" "uint32FMT" %s %s>",
>       |                                           ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:42:55: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    42 |   uint32 r = sscanf(lines[cl], ""uint32FMT"["uint32FMT" "uint32FMT" "uint32FMT"] "uint32FMT"["uint32FMT" "uint32FMT"] <"uint32FMT" "uint32FMT" "uint32FMT" %s %s>",
>       |                                                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:42:67: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    42 |   uint32 r = sscanf(lines[cl], ""uint32FMT"["uint32FMT" "uint32FMT" "uint32FMT"] "uint32FMT"["uint32FMT" "uint32FMT"] <"uint32FMT" "uint32FMT" "uint32FMT" %s %s>",
>       |                                                                   ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:42:79: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    42 |   uint32 r = sscanf(lines[cl], ""uint32FMT"["uint32FMT" "uint32FMT" "uint32FMT"] "uint32FMT"["uint32FMT" "uint32FMT"] <"uint32FMT" "uint32FMT" "uint32FMT" %s %s>",
>       |                                                                               ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:42:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    42 |   uint32 r = sscanf(lines[cl], ""uint32FMT"["uint32FMT" "uint32FMT" "uint32FMT"] "uint32FMT"["uint32FMT" "uint32FMT"] <"uint32FMT" "uint32FMT" "uint32FMT" %s %s>",
>       |                                                                                            ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:42:104: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    42 |   uint32 r = sscanf(lines[cl], ""uint32FMT"["uint32FMT" "uint32FMT" "uint32FMT"] "uint32FMT"["uint32FMT" "uint32FMT"] <"uint32FMT" "uint32FMT" "uint32FMT" %s %s>",
>       |                                                                                                        ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:42:116: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    42 |   uint32 r = sscanf(lines[cl], ""uint32FMT"["uint32FMT" "uint32FMT" "uint32FMT"] "uint32FMT"["uint32FMT" "uint32FMT"] <"uint32FMT" "uint32FMT" "uint32FMT" %s %s>",
>       |                                                                                                                    ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:42:130: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    42 |   uint32 r = sscanf(lines[cl], ""uint32FMT"["uint32FMT" "uint32FMT" "uint32FMT"] "uint32FMT"["uint32FMT" "uint32FMT"] <"uint32FMT" "uint32FMT" "uint32FMT" %s %s>",
>       |                                                                                                                                  ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:42:142: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    42 |   uint32 r = sscanf(lines[cl], ""uint32FMT"["uint32FMT" "uint32FMT" "uint32FMT"] "uint32FMT"["uint32FMT" "uint32FMT"] <"uint32FMT" "uint32FMT" "uint32FMT" %s %s>",
>       |                                                                                                                                              ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:55:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 |     fprintf(stderr, "sim4polish::s4p_linesToPolishS4DB()--  byte "uint32FMT": '%s'\n", startPosition, lines[cl]);
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:72:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    72 |       fprintf(stderr, "sim4polish::s4p_linesToPolishS4DB()--  byte "uint32FMT": '%s'\n", startPosition, lines[cl]);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:84:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    84 |       fprintf(stderr, "sim4polish::s4p_linesToPolishS4DB()--  byte "uint32FMT": '%s'\n", startPosition, lines[cl]);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:127:28: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   127 |   while (sscanf(lines[cl], ""uint32FMT"-"uint32FMT" ("uint32FMT"-"uint32FMT") <"uint32FMT"-"uint32FMT"-"uint32FMT">",
>       |                            ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:127:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   127 |   while (sscanf(lines[cl], ""uint32FMT"-"uint32FMT" ("uint32FMT"-"uint32FMT") <"uint32FMT"-"uint32FMT"-"uint32FMT">",
>       |                                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:127:51: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   127 |   while (sscanf(lines[cl], ""uint32FMT"-"uint32FMT" ("uint32FMT"-"uint32FMT") <"uint32FMT"-"uint32FMT"-"uint32FMT">",
>       |                                                   ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:127:64: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   127 |   while (sscanf(lines[cl], ""uint32FMT"-"uint32FMT" ("uint32FMT"-"uint32FMT") <"uint32FMT"-"uint32FMT"-"uint32FMT">",
>       |                                                                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:127:76: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   127 |   while (sscanf(lines[cl], ""uint32FMT"-"uint32FMT" ("uint32FMT"-"uint32FMT") <"uint32FMT"-"uint32FMT"-"uint32FMT">",
>       |                                                                            ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:127:90: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   127 |   while (sscanf(lines[cl], ""uint32FMT"-"uint32FMT" ("uint32FMT"-"uint32FMT") <"uint32FMT"-"uint32FMT"-"uint32FMT">",
>       |                                                                                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:127:102: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   127 |   while (sscanf(lines[cl], ""uint32FMT"-"uint32FMT" ("uint32FMT"-"uint32FMT") <"uint32FMT"-"uint32FMT"-"uint32FMT">",
>       |                                                                                                      ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:169:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   169 |     fprintf(stderr, "sim4polish::s4p_linesToPolishS4DB()--  byte "uint32FMT": '%s'\n", startPosition, lines[cl]);
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:243:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   243 |   r = sscanf(lines[cl], ""uint32FMT":%s\tsim4db\tmRNA\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t.\t",
>       |                         ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:243:36: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   243 |   r = sscanf(lines[cl], ""uint32FMT":%s\tsim4db\tmRNA\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t.\t",
>       |                                    ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:243:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   243 |   r = sscanf(lines[cl], ""uint32FMT":%s\tsim4db\tmRNA\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t.\t",
>       |                                                                  ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:243:79: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   243 |   r = sscanf(lines[cl], ""uint32FMT":%s\tsim4db\tmRNA\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t.\t",
>       |                                                                               ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:246:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   246 |     fprintf(stderr, "sim4polish::s4p_linesToPolishGFF3()--  byte "uint32FMT": '%s'\n", startPosition, lines[cl]);
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:275:28: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   275 |         r = sscanf(crttok, "ID=sim4db"uint32FMT"", &matchID);
>       |                            ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:280:28: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   280 |         r = sscanf(crttok, "Name="uint32FMT":%s", &_estID, _estDefLine);
>       |                            ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:285:28: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   285 |         r = sscanf(crttok, "Target="uint32FMT":%s "uint32FMT" "uint32FMT" %c", &_estID, _estDefLine, &dummy1, &dummy2, &mOri);
>       |                            ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:285:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   285 |         r = sscanf(crttok, "Target="uint32FMT":%s "uint32FMT" "uint32FMT" %c", &_estID, _estDefLine, &dummy1, &dummy2, &mOri);
>       |                                              ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:285:61: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   285 |         r = sscanf(crttok, "Target="uint32FMT":%s "uint32FMT" "uint32FMT" %c", &_estID, _estDefLine, &dummy1, &dummy2, &mOri);
>       |                                                             ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:293:28: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   293 |         r = sscanf(crttok, "targetLen="uint32FMT"", &_estLen);
>       |                            ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:296:28: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   296 |         r = sscanf(crttok, "pA="uint32FMT"", &_estPolyA);
>       |                            ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:299:28: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   299 |         r = sscanf(crttok, "pT="uint32FMT"", &_estPolyT);
>       |                            ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:302:28: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   302 |         r = sscanf(crttok, "genRegion="uint32FMT"-"uint32FMT"", &_genRegionOffset, &dummy1);
>       |                            ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:302:49: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   302 |         r = sscanf(crttok, "genRegion="uint32FMT"-"uint32FMT"", &_genRegionOffset, &dummy1);
>       |                                                 ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:313:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   313 |       fprintf(stderr, "sim4polish::s4p_linesToPolishGFF3()--  byte "uint32FMT": '%s'\n", startPosition, lines[cl]);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:339:27: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   339 |     r = sscanf(lines[cl], ""uint32FMT":%s\tsim4db\texon\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t.\t",
>       |                           ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:339:38: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   339 |     r = sscanf(lines[cl], ""uint32FMT":%s\tsim4db\texon\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t.\t",
>       |                                      ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:339:68: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   339 |     r = sscanf(lines[cl], ""uint32FMT":%s\tsim4db\texon\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t.\t",
>       |                                                                    ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:339:81: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   339 |     r = sscanf(lines[cl], ""uint32FMT":%s\tsim4db\texon\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t.\t",
>       |                                                                                 ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:342:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   342 |       fprintf(stderr, "sim4polish::s4p_linesToPolishGFF3()--  byte "uint32FMT": '%s'\n", startPosition, lines[cl]);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:366:30: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   366 |           r = sscanf(crttok, "Parent=sim4db"uint32FMT"", &dummy1);
>       |                              ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:370:30: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   370 |           r = sscanf(crttok, "Target=%s "uint32FMT" "uint32FMT" %c", &dummybuf, &exon._estFrom, &exon._estTo, &mOri);
>       |                              ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:370:51: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   370 |           r = sscanf(crttok, "Target=%s "uint32FMT" "uint32FMT" %c", &dummybuf, &exon._estFrom, &exon._estTo, &mOri);
>       |                                                   ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:377:30: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   377 |           r = sscanf(crttok, "nMatches="uint32FMT"", &exon._numMatches);
>       |                              ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:403:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   403 |       fprintf(stderr, "sim4polish::s4p_linesToPolishGFF3()--  byte "uint32FMT": '%s'\n", startPosition, lines[cl]);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:437:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   437 |     fprintf(stderr, "sim4polish::s4p_linesToPolishGFF3()--  byte "uint32FMT": '%s'\n", startPosition, lines[cl]);
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C: In member function ‘void sim4polish::s4p_linesToPolishS4DB(uint32, uint32, char**, uint32*)’:
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:140:13: warning: ‘void* memcpy(void*, const void*, size_t)’ writing to an object of non-trivially copyable type ‘class sim4polishExon’; use copy-assignment or copy-initialization instead [-Wclass-memaccess]
>   140 |       memcpy(nnn, _exons, sizeof(sim4polishExon) * _numExons);
>       |       ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish.H:49:7: note: ‘class sim4polishExon’ declared here
>    49 | class sim4polishExon {
>       |       ^~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C: In member function ‘void sim4polish::s4p_linesToPolishGFF3(uint32, uint32, char**, uint32*)’:
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:261:5: warning: this ‘while’ clause does not guard... [-Wmisleading-indentation]
>   261 |     while (*clptr!='\t') clptr++; clptr++;
>       |     ^~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:261:35: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the ‘while’
>   261 |     while (*clptr!='\t') clptr++; clptr++;
>       |                                   ^~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:262:5: warning: this ‘while’ clause does not guard... [-Wmisleading-indentation]
>   262 |     while (*clptr!='\t') clptr++; clptr++;
>       |     ^~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:262:35: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the ‘while’
>   262 |     while (*clptr!='\t') clptr++; clptr++;
>       |                                   ^~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:263:5: warning: this ‘while’ clause does not guard... [-Wmisleading-indentation]
>   263 |     while (*clptr!='\t') clptr++; clptr++;
>       |     ^~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:263:35: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the ‘while’
>   263 |     while (*clptr!='\t') clptr++; clptr++;
>       |                                   ^~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:264:5: warning: this ‘while’ clause does not guard... [-Wmisleading-indentation]
>   264 |     while (*clptr!='\t') clptr++; clptr++;
>       |     ^~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:264:35: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the ‘while’
>   264 |     while (*clptr!='\t') clptr++; clptr++;
>       |                                   ^~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:265:5: warning: this ‘while’ clause does not guard... [-Wmisleading-indentation]
>   265 |     while (*clptr!='\t') clptr++; clptr++;
>       |     ^~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:265:35: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the ‘while’
>   265 |     while (*clptr!='\t') clptr++; clptr++;
>       |                                   ^~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:266:5: warning: this ‘while’ clause does not guard... [-Wmisleading-indentation]
>   266 |     while (*clptr!='\t') clptr++; clptr++;
>       |     ^~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:266:35: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the ‘while’
>   266 |     while (*clptr!='\t') clptr++; clptr++;
>       |                                   ^~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:267:5: warning: this ‘while’ clause does not guard... [-Wmisleading-indentation]
>   267 |     while (*clptr!='\t') clptr++; clptr++;
>       |     ^~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:267:35: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the ‘while’
>   267 |     while (*clptr!='\t') clptr++; clptr++;
>       |                                   ^~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:268:5: warning: this ‘while’ clause does not guard... [-Wmisleading-indentation]
>   268 |     while (*clptr!='\t') clptr++; clptr++;
>       |     ^~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:268:35: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the ‘while’
>   268 |     while (*clptr!='\t') clptr++; clptr++;
>       |                                   ^~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:346:17: warning: comparison of integer expressions of different signedness: ‘int’ and ‘uint32’ {aka ‘unsigned int’} [-Wsign-compare]
>   346 |     if ((dummy1 != _genID) || strcmp(dummybuf, _genDefLine) ||
>       |          ~~~~~~~^~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:347:40: warning: suggest parentheses around ‘&&’ within ‘||’ [-Wparentheses]
>   347 |         (sOri != '+') && (sOri != '-') && (sOri != '.'))
>       |         ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:352:7: warning: this ‘while’ clause does not guard... [-Wmisleading-indentation]
>   352 |       while (*clptr!='\t') clptr++; clptr++;
>       |       ^~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:352:37: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the ‘while’
>   352 |       while (*clptr!='\t') clptr++; clptr++;
>       |                                     ^~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:353:7: warning: this ‘while’ clause does not guard... [-Wmisleading-indentation]
>   353 |       while (*clptr!='\t') clptr++; clptr++;
>       |       ^~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:353:37: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the ‘while’
>   353 |       while (*clptr!='\t') clptr++; clptr++;
>       |                                     ^~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:354:7: warning: this ‘while’ clause does not guard... [-Wmisleading-indentation]
>   354 |       while (*clptr!='\t') clptr++; clptr++;
>       |       ^~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:354:37: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the ‘while’
>   354 |       while (*clptr!='\t') clptr++; clptr++;
>       |                                     ^~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:355:7: warning: this ‘while’ clause does not guard... [-Wmisleading-indentation]
>   355 |       while (*clptr!='\t') clptr++; clptr++;
>       |       ^~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:355:37: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the ‘while’
>   355 |       while (*clptr!='\t') clptr++; clptr++;
>       |                                     ^~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:356:7: warning: this ‘while’ clause does not guard... [-Wmisleading-indentation]
>   356 |       while (*clptr!='\t') clptr++; clptr++;
>       |       ^~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:356:37: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the ‘while’
>   356 |       while (*clptr!='\t') clptr++; clptr++;
>       |                                     ^~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:357:7: warning: this ‘while’ clause does not guard... [-Wmisleading-indentation]
>   357 |       while (*clptr!='\t') clptr++; clptr++;
>       |       ^~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:357:37: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the ‘while’
>   357 |       while (*clptr!='\t') clptr++; clptr++;
>       |                                     ^~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:358:7: warning: this ‘while’ clause does not guard... [-Wmisleading-indentation]
>   358 |       while (*clptr!='\t') clptr++; clptr++;
>       |       ^~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:358:37: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the ‘while’
>   358 |       while (*clptr!='\t') clptr++; clptr++;
>       |                                     ^~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:359:7: warning: this ‘while’ clause does not guard... [-Wmisleading-indentation]
>   359 |       while (*clptr!='\t') clptr++; clptr++;
>       |       ^~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:359:37: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the ‘while’
>   359 |       while (*clptr!='\t') clptr++; clptr++;
>       |                                     ^~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:370:30: warning: format ‘%s’ expects argument of type ‘char*’, but argument 3 has type ‘char (*)[1000]’ [-Wformat=]
>   370 |           r = sscanf(crttok, "Target=%s "uint32FMT" "uint32FMT" %c", &dummybuf, &exon._estFrom, &exon._estTo, &mOri);
>       |                              ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~  ~~~~~~~~~
>       |                                                                      |
>       |                                                                      char (*)[1000]
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:383:39: warning: format ‘%s’ expects argument of type ‘char*’, but argument 3 has type ‘char (*)[1000]’ [-Wformat=]
>   383 |           r = sscanf(crttok, "intron=%s", &dummybuf);
>       |                                      ~^   ~~~~~~~~~
>       |                                       |   |
>       |                                       |   char (*)[1000]
>       |                                       char*
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.C:414:13: warning: ‘void* memcpy(void*, const void*, size_t)’ writing to an object of non-trivially copyable type ‘class sim4polishExon’; use copy-assignment or copy-initialization instead [-Wclass-memaccess]
>   414 |       memcpy(nnn, _exons, sizeof(sim4polishExon) * _numExons);
>       |       ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish.H:49:7: note: ‘class sim4polishExon’ declared here
>    49 | class sim4polishExon {
>       |       ^~~~~~~~~~~~~~
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-read.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-read.o -c /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-read.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish.H:11,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-read.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-read.C:46:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    46 |     fprintf(stderr, "sim4reader: Got '%s', expecting 'sim4begin' at byte "uint64FMT"\n",
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-read.C:65:2: warning: #warning LAZY PROGRAMMER did not extend an array [-Wcpp]
>    65 | #warning LAZY PROGRAMMER did not extend an array
>       |  ^~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-read.C:126:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   126 |       fprintf(stderr, "sim4reader: Got '%s', expecting GFF3 mRNA line at byte "uint64FMT"\n",
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-read.C:150:2: warning: #warning LAZY PROGRAMMER did not extend an array [-Wcpp]
>   150 | #warning LAZY PROGRAMMER did not extend an array
>       |  ^~~~~~~
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.o -c /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish.H:11,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:58:24: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 |           sprintf(gpp, "%c"uint32FMT" ", gaptyp, gapcnt);
>       |                        ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:68:24: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 |           sprintf(gpp, "%c"uint32FMT" ", gaptyp, gapcnt);
>       |                        ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:80:24: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    80 |           sprintf(gpp, "%c"uint32FMT" ", gaptyp, gapcnt);
>       |                        ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:91:18: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    91 |     sprintf(gpp, "%c"uint32FMT"", gaptyp, gapcnt);
>       |                  ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:163:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   163 |       fprintf(stderr, "sim4reader: Unknown matchOrientation '"uint32FMT"' in printPolish()\n", _matchOrientation);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:176:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   176 |       fprintf(stderr, "sim4reader: Unknown strandOrientation '"uint32FMT"' in printPolish()\n", _matchOrientation);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:181:17: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   181 |   sprintf(outc, "sim4begin\n"uint32FMT"["uint32FMT"-"uint32FMT"-"uint32FMT"] "uint32FMT"["uint32FMT"-"uint32FMT"] <"uint32FMT"-"uint32FMT"-"uint32FMT"-%s-%s>\n",
>       |                 ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:181:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   181 |   sprintf(outc, "sim4begin\n"uint32FMT"["uint32FMT"-"uint32FMT"-"uint32FMT"] "uint32FMT"["uint32FMT"-"uint32FMT"] <"uint32FMT"-"uint32FMT"-"uint32FMT"-%s-%s>\n",
>       |                                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:181:51: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   181 |   sprintf(outc, "sim4begin\n"uint32FMT"["uint32FMT"-"uint32FMT"-"uint32FMT"] "uint32FMT"["uint32FMT"-"uint32FMT"] <"uint32FMT"-"uint32FMT"-"uint32FMT"-%s-%s>\n",
>       |                                                   ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:181:63: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   181 |   sprintf(outc, "sim4begin\n"uint32FMT"["uint32FMT"-"uint32FMT"-"uint32FMT"] "uint32FMT"["uint32FMT"-"uint32FMT"] <"uint32FMT"-"uint32FMT"-"uint32FMT"-%s-%s>\n",
>       |                                                               ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:181:75: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   181 |   sprintf(outc, "sim4begin\n"uint32FMT"["uint32FMT"-"uint32FMT"-"uint32FMT"] "uint32FMT"["uint32FMT"-"uint32FMT"] <"uint32FMT"-"uint32FMT"-"uint32FMT"-%s-%s>\n",
>       |                                                                           ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:181:88: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   181 |   sprintf(outc, "sim4begin\n"uint32FMT"["uint32FMT"-"uint32FMT"-"uint32FMT"] "uint32FMT"["uint32FMT"-"uint32FMT"] <"uint32FMT"-"uint32FMT"-"uint32FMT"-%s-%s>\n",
>       |                                                                                        ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:181:100: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   181 |   sprintf(outc, "sim4begin\n"uint32FMT"["uint32FMT"-"uint32FMT"-"uint32FMT"] "uint32FMT"["uint32FMT"-"uint32FMT"] <"uint32FMT"-"uint32FMT"-"uint32FMT"-%s-%s>\n",
>       |                                                                                                    ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:181:112: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   181 |   sprintf(outc, "sim4begin\n"uint32FMT"["uint32FMT"-"uint32FMT"-"uint32FMT"] "uint32FMT"["uint32FMT"-"uint32FMT"] <"uint32FMT"-"uint32FMT"-"uint32FMT"-%s-%s>\n",
>       |                                                                                                                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:181:126: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   181 |   sprintf(outc, "sim4begin\n"uint32FMT"["uint32FMT"-"uint32FMT"-"uint32FMT"] "uint32FMT"["uint32FMT"-"uint32FMT"] <"uint32FMT"-"uint32FMT"-"uint32FMT"-%s-%s>\n",
>       |                                                                                                                              ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:181:138: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   181 |   sprintf(outc, "sim4begin\n"uint32FMT"["uint32FMT"-"uint32FMT"-"uint32FMT"] "uint32FMT"["uint32FMT"-"uint32FMT"] <"uint32FMT"-"uint32FMT"-"uint32FMT"-%s-%s>\n",
>       |                                                                                                                                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:212:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   212 |     sprintf(outc, ""uint32FMT"-"uint32FMT" ("uint32FMT"-"uint32FMT") <"uint32FMT"-"uint32FMT"-"uint32FMT">%s\n",
>       |                   ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:212:30: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   212 |     sprintf(outc, ""uint32FMT"-"uint32FMT" ("uint32FMT"-"uint32FMT") <"uint32FMT"-"uint32FMT"-"uint32FMT">%s\n",
>       |                              ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:212:42: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   212 |     sprintf(outc, ""uint32FMT"-"uint32FMT" ("uint32FMT"-"uint32FMT") <"uint32FMT"-"uint32FMT"-"uint32FMT">%s\n",
>       |                                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:212:55: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   212 |     sprintf(outc, ""uint32FMT"-"uint32FMT" ("uint32FMT"-"uint32FMT") <"uint32FMT"-"uint32FMT"-"uint32FMT">%s\n",
>       |                                                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:212:67: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   212 |     sprintf(outc, ""uint32FMT"-"uint32FMT" ("uint32FMT"-"uint32FMT") <"uint32FMT"-"uint32FMT"-"uint32FMT">%s\n",
>       |                                                                   ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:212:81: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   212 |     sprintf(outc, ""uint32FMT"-"uint32FMT" ("uint32FMT"-"uint32FMT") <"uint32FMT"-"uint32FMT"-"uint32FMT">%s\n",
>       |                                                                                 ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:212:93: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   212 |     sprintf(outc, ""uint32FMT"-"uint32FMT" ("uint32FMT"-"uint32FMT") <"uint32FMT"-"uint32FMT"-"uint32FMT">%s\n",
>       |                                                                                             ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:323:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   323 |       fprintf(stderr, "sim4reader: Unknown strandOrientation '"uint32FMT"' in printPolishGFF3()\n", _matchOrientation);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:346:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   346 |   sprintf(outc, uint32FMT":%s\tsim4db\tmRNA\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t.\t",
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:346:56: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   346 |   sprintf(outc, uint32FMT":%s\tsim4db\tmRNA\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t.\t",
>       |                                                        ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:346:69: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   346 |   sprintf(outc, uint32FMT":%s\tsim4db\tmRNA\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t.\t",
>       |                                                                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:350:17: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   350 |   sprintf(outc, "ID=sim4db"uint32FMT";Name="uint32FMT":%s;Target="uint32FMT":%s "uint32FMT" "uint32FMT" %c;",
>       |                 ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:350:37: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   350 |   sprintf(outc, "ID=sim4db"uint32FMT";Name="uint32FMT":%s;Target="uint32FMT":%s "uint32FMT" "uint32FMT" %c;",
>       |                                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:350:54: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   350 |   sprintf(outc, "ID=sim4db"uint32FMT";Name="uint32FMT":%s;Target="uint32FMT":%s "uint32FMT" "uint32FMT" %c;",
>       |                                                      ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:350:76: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   350 |   sprintf(outc, "ID=sim4db"uint32FMT";Name="uint32FMT":%s;Target="uint32FMT":%s "uint32FMT" "uint32FMT" %c;",
>       |                                                                            ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:350:91: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   350 |   sprintf(outc, "ID=sim4db"uint32FMT";Name="uint32FMT":%s;Target="uint32FMT":%s "uint32FMT" "uint32FMT" %c;",
>       |                                                                                           ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:354:17: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   354 |   sprintf(outc, "targetLen="uint32FMT";pA="uint32FMT";pT="uint32FMT";genRegion="uint32FMT"-"uint32FMT"\n",
>       |                 ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:354:38: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   354 |   sprintf(outc, "targetLen="uint32FMT";pA="uint32FMT";pT="uint32FMT";genRegion="uint32FMT"-"uint32FMT"\n",
>       |                                      ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:354:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   354 |   sprintf(outc, "targetLen="uint32FMT";pA="uint32FMT";pT="uint32FMT";genRegion="uint32FMT"-"uint32FMT"\n",
>       |                                                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:354:68: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   354 |   sprintf(outc, "targetLen="uint32FMT";pA="uint32FMT";pT="uint32FMT";genRegion="uint32FMT"-"uint32FMT"\n",
>       |                                                                    ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:354:90: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   354 |   sprintf(outc, "targetLen="uint32FMT";pA="uint32FMT";pT="uint32FMT";genRegion="uint32FMT"-"uint32FMT"\n",
>       |                                                                                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:363:28: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   363 |     sprintf(outc, uint32FMT":%s\tsim4db\texon\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t.\t",
>       |                            ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:363:58: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   363 |     sprintf(outc, uint32FMT":%s\tsim4db\texon\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t.\t",
>       |                                                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:363:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   363 |     sprintf(outc, uint32FMT":%s\tsim4db\texon\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t.\t",
>       |                                                                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:368:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   368 |       sprintf(outc, "Parent=sim4db"uint32FMT";Target="uint32FMT":%s "uint32FMT" "uint32FMT" %c;Gap=%s;nMatches="uint32FMT"",
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:368:45: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   368 |       sprintf(outc, "Parent=sim4db"uint32FMT";Target="uint32FMT":%s "uint32FMT" "uint32FMT" %c;Gap=%s;nMatches="uint32FMT"",
>       |                                             ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:368:64: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   368 |       sprintf(outc, "Parent=sim4db"uint32FMT";Target="uint32FMT":%s "uint32FMT" "uint32FMT" %c;Gap=%s;nMatches="uint32FMT"",
>       |                                                                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:368:79: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   368 |       sprintf(outc, "Parent=sim4db"uint32FMT";Target="uint32FMT":%s "uint32FMT" "uint32FMT" %c;Gap=%s;nMatches="uint32FMT"",
>       |                                                                               ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:368:91: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   368 |       sprintf(outc, "Parent=sim4db"uint32FMT";Target="uint32FMT":%s "uint32FMT" "uint32FMT" %c;Gap=%s;nMatches="uint32FMT"",
>       |                                                                                           ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:371:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   371 |       sprintf(outc, "Parent=sim4db"uint32FMT";Target="uint32FMT":%s "uint32FMT" "uint32FMT" %c;nMatches="uint32FMT"",
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:371:45: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   371 |       sprintf(outc, "Parent=sim4db"uint32FMT";Target="uint32FMT":%s "uint32FMT" "uint32FMT" %c;nMatches="uint32FMT"",
>       |                                             ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:371:64: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   371 |       sprintf(outc, "Parent=sim4db"uint32FMT";Target="uint32FMT":%s "uint32FMT" "uint32FMT" %c;nMatches="uint32FMT"",
>       |                                                                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:371:79: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   371 |       sprintf(outc, "Parent=sim4db"uint32FMT";Target="uint32FMT":%s "uint32FMT" "uint32FMT" %c;nMatches="uint32FMT"",
>       |                                                                               ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.C:371:91: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   371 |       sprintf(outc, "Parent=sim4db"uint32FMT";Target="uint32FMT":%s "uint32FMT" "uint32FMT" %c;nMatches="uint32FMT"",
>       |                                                                                           ^
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-exons.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-exons.o -c /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-exons.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish.H:11,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-exons.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-deleteexon.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-deleteexon.o -c /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-deleteexon.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish.H:11,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-deleteexon.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-copy.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-copy.o -c /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-copy.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish.H:11,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-copy.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-compare.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-compare.o -c /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-compare.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish.H:11,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-compare.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-compare.C:249:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   249 |     fprintf(stderr, "s4p_compareExons()-- Can't allocate "uint32FMT" + "uint32FMT" words for counting exons.\n%s\n", A->_numExons, B->_numExons, strerror(errno));
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-compare.C:249:68: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   249 |     fprintf(stderr, "s4p_compareExons()-- Can't allocate "uint32FMT" + "uint32FMT" words for counting exons.\n%s\n", A->_numExons, B->_numExons, strerror(errno));
>       |                                                                    ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-compare.C:365:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   365 |     fprintf(stderr, "s4p_compareExons()-- Can't allocate "uint32FMT" + "uint32FMT" words for counting exons.\n%s\n", A->_numExons, B->_numExons, strerror(errno));
>       |                     ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-compare.C:365:68: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   365 |     fprintf(stderr, "s4p_compareExons()-- Can't allocate "uint32FMT" + "uint32FMT" words for counting exons.\n%s\n", A->_numExons, B->_numExons, strerror(errno));
>       |                                                                    ^
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/util.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/util.o -c /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/util.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4.H:15,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/util.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/table.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/table.o -c /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/table.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4.H:15,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/table.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/table.C: In member function ‘void Sim4::bld_table(char*, int, mss_t, int)’:
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/table.C:112:9: warning: this ‘if’ clause does not guard... [-Wmisleading-indentation]
>   112 |         if (emer < 0)
>       |         ^~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/table.C:115:11: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the ‘if’
>   115 |           ecode <<= 2;
>       |           ^~~~~
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/splice.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/splice.o -c /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/splice.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4.H:15,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/splice.C:2:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sites_score.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sites_score.o -c /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sites_score.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4.H:15,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sites_score.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sites_acceptor.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sites_acceptor.o -c /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sites_acceptor.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4.H:15,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sites_acceptor.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sites_donor.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sites_donor.o -c /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sites_donor.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4.H:15,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sites_donor.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sites.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sites.o -c /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sites.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4.H:15,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sites.C:4:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sites.C: In function ‘int readtree(Sim4*, char*, tree*, int)’:
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sites.C:452:6: warning: variable ‘len’ set but not used [-Wunused-but-set-variable]
>   452 |  int len;
>       |      ^~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sites.C: In function ‘int Is_Cod_NonCod(const int*, double*, int)’:
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sites.C:751:12: warning: ‘scores’ may be used uninitialized [-Wmaybe-uninitialized]
>   751 |    double *scores;
>       |            ^~~~~~
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4b1_s.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4b1_s.o -c /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4b1_s.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4.H:15,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4b1_s.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4b1-4.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4b1-4.o -c /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4b1-4.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4.H:15,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4b1-4.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4b1-3.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4b1-3.o -c /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4b1-3.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4.H:15,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4b1-3.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4b1-2.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4b1-2.o -c /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4b1-2.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4.H:15,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4b1-2.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4b1-1.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4b1-1.o -c /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4b1-1.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4.H:15,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4b1-1.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4b1a.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4b1a.o -c /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4b1a.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4.H:15,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4b1a.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4b1.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4b1.o -c /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4b1.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4.H:15,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4b1.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/poly.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/poly.o -c /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/poly.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4.H:15,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/poly.C:2:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/pluri_align.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/pluri_align.o -c /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/pluri_align.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4.H:15,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/pluri_align.C:2:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/mspManager.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/mspManager.o -c /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/mspManager.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4.H:15,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/mspManager.C:6:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/greedy.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/greedy.o -c /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/greedy.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4.H:15,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/greedy.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/glimmerSplice.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/glimmerSplice.o -c /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/glimmerSplice.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4.H:15,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/glimmerSplice.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/glimmerSplice.C: In function ‘void readModel(Fixed_Length_ICM_t*, const char*)’:
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/glimmerSplice.C:53:10: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>    53 |    fread (line, sizeof (char), ID_STRING_LEN, fp); // skip the text header line
>       |    ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/glimmerSplice.C:84:10: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>    84 |    fread ((*fixed).permutation, sizeof (int), (*fixed).length, fp);
>       |    ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/extend.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/extend.o -c /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/extend.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4.H:15,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/extend.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/exon_cores.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/exon_cores.o -c /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/exon_cores.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4.H:15,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/exon_cores.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/align.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/align.o -c /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/align.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4.H:15,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/align.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/align.C: In member function ‘void Sim4::path(int, int, char, int, int, char, int, edit_script**, edit_script**)’:
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/align.C:777:13: warning: ‘head2’ may be used uninitialized [-Wmaybe-uninitialized]
>   777 |         if (head2) *tail = tail2;
>       |             ^~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/align.C:557:38: note: ‘head2’ declared here
>   557 |         edit_script *head1, *tail1, *head2, *tail2;
>       |                                      ^~~~~
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/Xtend1.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/Xtend1.o -c /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/Xtend1.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4.H:15,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/Xtend1.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4string.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4string.o -c /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4string.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4.H:15,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4string.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4string.C: In member function ‘void Sim4::IDISPLAY(sim4polishBuilder&, char*, char*, char*, char*, int, int, int*, int, int, int, Exon*)’:
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4string.C:681:30: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings]
>   681 |     builder.addExonAlignment("Empty exon list; no alignment possible!",
>       |                              ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4string.C:682:30: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings]
>   682 |                              "Empty exon list; no alignment possible!");
>       |                              ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4string.C:694:30: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings]
>   694 |     builder.addExonAlignment("Alignment fragment not found; no alignment possible!",
>       |                              ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4string.C:695:30: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings]
>   695 |                              "Alignment fragment not found; no alignment possible!");
>       |                              ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4parameters.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4parameters.o -c /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4parameters.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/mspManager.H:8,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4parameters.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4parameters.C:2:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> Make.rules:135: update target '/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4command.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4command.o -c /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4command.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4command.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4command.C:5:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4command.C: In member function ‘void sim4command::finalize()’:
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4command.C:147:6: warning: suggest explicit braces to avoid ambiguous ‘else’ [-Wdangling-else]
>   147 |   if (_genLo > _genHi)
>       |      ^
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4command.C: In member function ‘char* sim4command::getESTheader()’:
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4command.C:184:22: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings]
>   184 |   static char *xxx = "anonymous cDNA sequence";
>       |                      ^~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4command.C: In member function ‘char* sim4command::getGENheader()’:
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4command.C:222:15: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings]
>   222 |   char *xxx = "anonymous genomic sequence";
>       |               ^~~~~~~~~~~~~~~~~~~~~~~~~~~~
> Make.rules:167: update target '/build/reproducible-path/kmer-0~20150903+r2013/libsim4/libsim4.a' due to: target does not exist
> rm -f /build/reproducible-path/kmer-0~20150903+r2013/libsim4/libsim4.a && ar ruvs /build/reproducible-path/kmer-0~20150903+r2013/libsim4/libsim4.a /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4command.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4parameters.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4string.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/Xtend1.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/align.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/exon_cores.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/extend.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/glimmerSplice.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/greedy.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/mspManager.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/pluri_align.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/poly.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4b1.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4b1a.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4b1-1.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4b1-2.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4b1-3.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4b1-4.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4b1_s.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sites.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sites_donor.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sites_acceptor.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sites_score.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/splice.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/table.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/util.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-compare.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-copy.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-deleteexon.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-exons.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-read.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-updatescores.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishList.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishBuilder.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishFile.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishReader.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishWriter.o
> ar: `u' modifier ignored since `D' is the default (see `U')
> ar: creating /build/reproducible-path/kmer-0~20150903+r2013/libsim4/libsim4.a
> a - /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4command.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4parameters.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4string.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/Xtend1.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/align.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/exon_cores.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/extend.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/glimmerSplice.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/greedy.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/mspManager.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/pluri_align.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/poly.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4b1.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4b1a.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4b1-1.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4b1-2.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4b1-3.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4b1-4.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sim4b1_s.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sites.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sites_donor.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sites_acceptor.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/sites_score.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/splice.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/table.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4core/util.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-compare.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-copy.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-deleteexon.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-exons.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-polishtostring.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-read.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-stringtopolish.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish-updatescores.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishList.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishBuilder.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishFile.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishReader.o
> a - /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polishWriter.o
> Make.rules:135: update target 'tapper/tappererrorcorrect.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/ -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o tapper/tappererrorcorrect.o -c tapper/tappererrorcorrect.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from tapper/tappererrorcorrect.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> In file included from tapper/tappererrorcorrect.C:3:
> tapper/tapperTag.H:204:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   204 |       fprintf(stderr, "tapperTagFile()--  ERROR!  Tag file was built with TAPPER_TAG_WORDS="uint32FMT", but code has %d.\n",
>       |                       ^
> In file included from tapper/tappererrorcorrect.C:4:
> tapper/tapperResult.H:41:18: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^
> tapper/tapperResult.H:41:32: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                ^
> tapper/tapperResult.H:41:44: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                            ^
> tapper/tapperResult.H:41:56: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                        ^
> tapper/tapperResult.H:41:68: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                    ^
> tapper/tapperResult.H:41:81: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                 ^
> tapper/tapperResult.H:41:93: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                             ^
> tapper/tapperResult.H:41:105: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                         ^
> tapper/tapperResult.H:41:117: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                     ^
> tapper/tapperResult.H:41:130: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                                  ^
> tapper/tapperResult.H:41:142: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                                              ^
> tapper/tapperResult.H:41:155: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                                                           ^
> tapper/tapperResult.H:41:168: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                                                                        ^
> tapper/tapperResult.H:41:183: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                                                                                       ^
> tapper/tapperResult.H:41:198: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                                                                                                      ^
> tapper/tapperResult.H:41:213: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                                                                                                                     ^
> tapper/tapperResult.H:41:228: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                                                                                                                                    ^
> tapper/tapperResult.H:116:2: warning: #warning do not know real tag length [-Wcpp]
>   116 | #warning do not know real tag length
>       |  ^~~~~~~
> tapper/tapperResult.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                       ^
> tapper/tapperResult.H:132:37: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                     ^
> tapper/tapperResult.H:132:49: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                 ^
> tapper/tapperResult.H:132:61: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                             ^
> tapper/tapperResult.H:132:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                         ^
> tapper/tapperResult.H:132:86: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                                      ^
> tapper/tapperResult.H:132:99: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                                                   ^
> tapper/tapperResult.H:132:116: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                                                                    ^
> tapper/tapperResult.H:132:128: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                                                                                ^
> tapper/tapperResult.H:155:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                       ^
> tapper/tapperResult.H:155:37: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                     ^
> tapper/tapperResult.H:155:49: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                 ^
> tapper/tapperResult.H:155:61: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                             ^
> tapper/tapperResult.H:155:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                         ^
> tapper/tapperResult.H:155:86: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                                      ^
> tapper/tapperResult.H:155:99: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                                                   ^
> tapper/tapperResult.H:155:116: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                                                                    ^
> tapper/tapperResult.H:155:128: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                                                                                ^
> tapper/tapperResult.H:187:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                     ^
> tapper/tapperResult.H:187:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                   ^
> tapper/tapperResult.H:187:47: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                               ^
> tapper/tapperResult.H:187:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                           ^
> tapper/tapperResult.H:187:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                       ^
> tapper/tapperResult.H:187:84: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                    ^
> tapper/tapperResult.H:187:97: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                 ^
> tapper/tapperResult.H:187:114: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                  ^
> tapper/tapperResult.H:187:126: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                              ^
> tapper/tapperResult.H:187:138: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                          ^
> tapper/tapperResult.H:187:151: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                                       ^
> tapper/tapperResult.H:187:163: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                                                   ^
> tapper/tapperResult.H:187:175: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                                                               ^
> tapper/tapperResult.H:187:187: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                                                                           ^
> tapper/tapperResult.H:187:200: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                                                                                        ^
> tapper/tapperResult.H:187:213: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                                                                                                     ^
> tapper/tapperResult.H:187:230: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                                                                                                                      ^
> tapper/tapperResult.H:187:242: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                                                                                                                                  ^
> tapper/tapperResult.H:224:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                     ^
> tapper/tapperResult.H:224:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                   ^
> tapper/tapperResult.H:224:47: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                               ^
> tapper/tapperResult.H:224:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                           ^
> tapper/tapperResult.H:224:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                       ^
> tapper/tapperResult.H:224:84: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                    ^
> tapper/tapperResult.H:224:97: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                                 ^
> tapper/tapperResult.H:224:109: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                                             ^
> tapper/tapperResult.H:224:121: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                                                         ^
> tapper/tapperResult.H:224:133: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                                                                     ^
> tapper/tapperResult.H:224:146: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                                                                                  ^
> tapper/tapperResult.H:224:159: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                                                                                               ^
> tapper/tapperResult.H:224:172: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                                                                                                            ^
> In file included from tapper/tappererrorcorrect.C:6:
> tapper/tapperHit.H:17:17: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
>       |                 ^
> tapper/tapperHit.H:17:30: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
>       |                              ^
> tapper/tapperHit.H:17:43: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
>       |                                           ^
> tapper/tapperHit.H:17:55: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
>       |                                                       ^
> tapper/tapperHit.H:17:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
>       |                                                                       ^
> tapper/tapperHit.H:17:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
>       |                                                                                   ^
> In file included from tapper/tapperGlobalData.H:1,
>                  from tapper/tappererrorcorrect.C:7:
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   127 |       fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   129 |       fprintf(stderr, "M = "uint64HEX"\n", m);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   130 |       fprintf(stderr, "H = "uint64HEX"\n", h);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   131 |       fprintf(stderr, "C = "uint64HEX"\n", c);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stderr, "R = "uint64HEX"\n", r);
>       |                       ^
> tapper/tapperGlobalData.H:109:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   109 |       fprintf(stderr, "ERROR: invalid partition n="uint32FMT" m="uint32FMT".\n", thisPartition, numPartitions);
>       |                       ^
> tapper/tapperGlobalData.H:109:61: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   109 |       fprintf(stderr, "ERROR: invalid partition n="uint32FMT" m="uint32FMT".\n", thisPartition, numPartitions);
>       |                                                             ^
> tapper/tapperGlobalData.H:120:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   120 |     fprintf(stderr, "Set partition for "uint64FMT" frags or "uint64FMT" mates: -begin "uint32FMT" -end "uint32FMT"\n",
>       |                     ^
> tapper/tapperGlobalData.H:120:50: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   120 |     fprintf(stderr, "Set partition for "uint64FMT" frags or "uint64FMT" mates: -begin "uint32FMT" -end "uint32FMT"\n",
>       |                                                  ^
> tapper/tapperGlobalData.H:120:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   120 |     fprintf(stderr, "Set partition for "uint64FMT" frags or "uint64FMT" mates: -begin "uint32FMT" -end "uint32FMT"\n",
>       |                                                                       ^
> tapper/tapperGlobalData.H:120:97: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   120 |     fprintf(stderr, "Set partition for "uint64FMT" frags or "uint64FMT" mates: -begin "uint32FMT" -end "uint32FMT"\n",
>       |                                                                                                 ^
> tapper/tapperGlobalData.H:144:20: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   144 |   sprintf(colName, "%s.ms"uint32FMT".ce"uint32FMT".posDB", genName, tagSize, maxColorError);
>       |                    ^
> tapper/tapperGlobalData.H:144:36: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   144 |   sprintf(colName, "%s.ms"uint32FMT".ce"uint32FMT".posDB", genName, tagSize, maxColorError);
>       |                                    ^
> tapper/tappererrorcorrect.C:25:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    25 |       fprintf(stderr, "block "uint32FMT" has "uint32FMT" things.\n", i, alignsLen[i]);
>       |                       ^
> tapper/tappererrorcorrect.C:25:40: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    25 |       fprintf(stderr, "block "uint32FMT" has "uint32FMT" things.\n", i, alignsLen[i]);
>       |                                        ^
> tapper/tappererrorcorrect.C:49:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    49 |       fprintf(stderr, "block[0] - seq "uint32FMT" pos "uint32FMT"\n",
>       |                       ^
> tapper/tappererrorcorrect.C:49:49: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    49 |       fprintf(stderr, "block[0] - seq "uint32FMT" pos "uint32FMT"\n",
>       |                                                 ^
> tapper/tappererrorcorrect.C:62:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    62 |       fprintf(stderr, "block "uint32FMT" has "uint32FMT" things.\n", alignsMax-1, alignsLen[alignsMax-1]);
>       |                       ^
> tapper/tappererrorcorrect.C:62:40: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    62 |       fprintf(stderr, "block "uint32FMT" has "uint32FMT" things.\n", alignsMax-1, alignsLen[alignsMax-1]);
>       |                                        ^
> tapper/tappererrorcorrect.C:160:2: warning: #warning need the real read size here [-Wcpp]
>   160 | #warning need the real read size here
>       |  ^~~~~~~
> tapper/tappererrorcorrect.C:213:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   213 |       fprintf(stdout, "\nALIGN "uint32FMT"-"uint32FMT"\n", winLo, winHi);
>       |                       ^
> tapper/tappererrorcorrect.C:213:42: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   213 |       fprintf(stdout, "\nALIGN "uint32FMT"-"uint32FMT"\n", winLo, winHi);
>       |                                          ^
> tapper/tapperResult.H: In member function ‘void tapperResultIndex::print(FILE*)’:
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 11 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    44 |             _maxColrMismatchMapped, _maxBaseMismatchMapped,
>       |             ~~~~~~~~~~~~~~~~~~~~~~
>       |             |
>       |             int
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 12 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    44 |             _maxColrMismatchMapped, _maxBaseMismatchMapped,
>       |                                     ~~~~~~~~~~~~~~~~~~~~~~
>       |                                     |
>       |                                     int
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 13 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    45 |             _mean, _stddev,
>       |             ~~~~~ 
>       |             |
>       |             int
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 14 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    45 |             _mean, _stddev,
>       |                    ~~~~~~~
>       |                    |
>       |                    int
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 15 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    46 |             _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled);
>       |             ~~~~~~~~
>       |             |
>       |             int
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 16 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    46 |             _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled);
>       |                       ~~~~~~~~~~~~~~~~~
>       |                       |
>       |                       int
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 17 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    46 |             _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled);
>       |                                          ~~~~~~~~~~~~~~~~~
>       |                                          |
>       |                                          int
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 18 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    46 |             _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled);
>       |                                                             ~~~~~~~~~
>       |                                                             |
>       |                                                             int
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 19 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    46 |             _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled);
>       |                                                                        ~~~~~~~~~~~
>       |                                                                        |
>       |                                                                        int
> tapper/tapperHit.H: In member function ‘char* tapperHit::printHit(char*, uint64)’:
> tapper/tapperHit.H:17:17: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 7 has type ‘int’ [-Wformat=]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
> ......
>    20 |             _basesMismatch, _colorMismatch, _colorInconsistent);
>       |             ~~~~~~~~~~~~~~
>       |             |
>       |             int
> tapper/tapperHit.H:17:17: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 8 has type ‘int’ [-Wformat=]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
> ......
>    20 |             _basesMismatch, _colorMismatch, _colorInconsistent);
>       |                             ~~~~~~~~~~~~~~
>       |                             |
>       |                             int
> tapper/tapperHit.H:17:17: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 9 has type ‘int’ [-Wformat=]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
> ......
>    20 |             _basesMismatch, _colorMismatch, _colorInconsistent);
>       |                                             ~~~~~~~~~~~~~~~~~~
>       |                                             |
>       |                                             int
> tapper/tappererrorcorrect.C: In function ‘int main(int, char**)’:
> tapper/tappererrorcorrect.C:102:13: warning: variable ‘memoryLimit’ set but not used [-Wunused-but-set-variable]
>   102 |   uint64    memoryLimit = 1024 * 1024 * 1024;
>       |             ^~~~~~~~~~~
> tapper/tappererrorcorrect.C:141:21: warning: unused variable ‘id’ [-Wunused-variable]
>   141 |   uint16            id[4];
>       |                     ^~
> Make.rules:147: update target 'tapper/tappererrorcorrect' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o tapper/tappererrorcorrect tapper/tappererrorcorrect.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/libsim4.a /build/reproducible-path/kmer-0~20150903+r2013/libkmer/libkmer.a /build/reproducible-path/kmer-0~20150903+r2013/libmeryl/libmeryl.a /build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a /build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:135: update target 'tapper/tappersort.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/ -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o tapper/tappersort.o -c tapper/tappersort.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from tapper/tappersort.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> In file included from tapper/tappersort.C:3:
> tapper/tapperTag.H:204:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   204 |       fprintf(stderr, "tapperTagFile()--  ERROR!  Tag file was built with TAPPER_TAG_WORDS="uint32FMT", but code has %d.\n",
>       |                       ^
> In file included from tapper/tappersort.C:4:
> tapper/tapperResult.H:41:18: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^
> tapper/tapperResult.H:41:32: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                ^
> tapper/tapperResult.H:41:44: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                            ^
> tapper/tapperResult.H:41:56: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                        ^
> tapper/tapperResult.H:41:68: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                    ^
> tapper/tapperResult.H:41:81: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                 ^
> tapper/tapperResult.H:41:93: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                             ^
> tapper/tapperResult.H:41:105: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                         ^
> tapper/tapperResult.H:41:117: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                     ^
> tapper/tapperResult.H:41:130: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                                  ^
> tapper/tapperResult.H:41:142: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                                              ^
> tapper/tapperResult.H:41:155: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                                                           ^
> tapper/tapperResult.H:41:168: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                                                                        ^
> tapper/tapperResult.H:41:183: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                                                                                       ^
> tapper/tapperResult.H:41:198: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                                                                                                      ^
> tapper/tapperResult.H:41:213: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                                                                                                                     ^
> tapper/tapperResult.H:41:228: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                                                                                                                                    ^
> tapper/tapperResult.H:116:2: warning: #warning do not know real tag length [-Wcpp]
>   116 | #warning do not know real tag length
>       |  ^~~~~~~
> tapper/tapperResult.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                       ^
> tapper/tapperResult.H:132:37: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                     ^
> tapper/tapperResult.H:132:49: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                 ^
> tapper/tapperResult.H:132:61: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                             ^
> tapper/tapperResult.H:132:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                         ^
> tapper/tapperResult.H:132:86: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                                      ^
> tapper/tapperResult.H:132:99: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                                                   ^
> tapper/tapperResult.H:132:116: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                                                                    ^
> tapper/tapperResult.H:132:128: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                                                                                ^
> tapper/tapperResult.H:155:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                       ^
> tapper/tapperResult.H:155:37: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                     ^
> tapper/tapperResult.H:155:49: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                 ^
> tapper/tapperResult.H:155:61: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                             ^
> tapper/tapperResult.H:155:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                         ^
> tapper/tapperResult.H:155:86: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                                      ^
> tapper/tapperResult.H:155:99: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                                                   ^
> tapper/tapperResult.H:155:116: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                                                                    ^
> tapper/tapperResult.H:155:128: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                                                                                ^
> tapper/tapperResult.H:187:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                     ^
> tapper/tapperResult.H:187:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                   ^
> tapper/tapperResult.H:187:47: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                               ^
> tapper/tapperResult.H:187:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                           ^
> tapper/tapperResult.H:187:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                       ^
> tapper/tapperResult.H:187:84: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                    ^
> tapper/tapperResult.H:187:97: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                 ^
> tapper/tapperResult.H:187:114: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                  ^
> tapper/tapperResult.H:187:126: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                              ^
> tapper/tapperResult.H:187:138: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                          ^
> tapper/tapperResult.H:187:151: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                                       ^
> tapper/tapperResult.H:187:163: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                                                   ^
> tapper/tapperResult.H:187:175: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                                                               ^
> tapper/tapperResult.H:187:187: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                                                                           ^
> tapper/tapperResult.H:187:200: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                                                                                        ^
> tapper/tapperResult.H:187:213: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                                                                                                     ^
> tapper/tapperResult.H:187:230: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                                                                                                                      ^
> tapper/tapperResult.H:187:242: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                                                                                                                                  ^
> tapper/tapperResult.H:224:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                     ^
> tapper/tapperResult.H:224:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                   ^
> tapper/tapperResult.H:224:47: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                               ^
> tapper/tapperResult.H:224:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                           ^
> tapper/tapperResult.H:224:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                       ^
> tapper/tapperResult.H:224:84: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                    ^
> tapper/tapperResult.H:224:97: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                                 ^
> tapper/tapperResult.H:224:109: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                                             ^
> tapper/tapperResult.H:224:121: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                                                         ^
> tapper/tapperResult.H:224:133: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                                                                     ^
> tapper/tapperResult.H:224:146: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                                                                                  ^
> tapper/tapperResult.H:224:159: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                                                                                               ^
> tapper/tapperResult.H:224:172: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                                                                                                            ^
> In file included from tapper/tappersort.C:6:
> tapper/tapperHit.H:17:17: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
>       |                 ^
> tapper/tapperHit.H:17:30: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
>       |                              ^
> tapper/tapperHit.H:17:43: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
>       |                                           ^
> tapper/tapperHit.H:17:55: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
>       |                                                       ^
> tapper/tapperHit.H:17:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
>       |                                                                       ^
> tapper/tapperHit.H:17:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
>       |                                                                                   ^
> In file included from tapper/tapperGlobalData.H:1,
>                  from tapper/tappersort.C:7:
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   127 |       fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   129 |       fprintf(stderr, "M = "uint64HEX"\n", m);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   130 |       fprintf(stderr, "H = "uint64HEX"\n", h);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   131 |       fprintf(stderr, "C = "uint64HEX"\n", c);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stderr, "R = "uint64HEX"\n", r);
>       |                       ^
> tapper/tapperGlobalData.H:109:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   109 |       fprintf(stderr, "ERROR: invalid partition n="uint32FMT" m="uint32FMT".\n", thisPartition, numPartitions);
>       |                       ^
> tapper/tapperGlobalData.H:109:61: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   109 |       fprintf(stderr, "ERROR: invalid partition n="uint32FMT" m="uint32FMT".\n", thisPartition, numPartitions);
>       |                                                             ^
> tapper/tapperGlobalData.H:120:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   120 |     fprintf(stderr, "Set partition for "uint64FMT" frags or "uint64FMT" mates: -begin "uint32FMT" -end "uint32FMT"\n",
>       |                     ^
> tapper/tapperGlobalData.H:120:50: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   120 |     fprintf(stderr, "Set partition for "uint64FMT" frags or "uint64FMT" mates: -begin "uint32FMT" -end "uint32FMT"\n",
>       |                                                  ^
> tapper/tapperGlobalData.H:120:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   120 |     fprintf(stderr, "Set partition for "uint64FMT" frags or "uint64FMT" mates: -begin "uint32FMT" -end "uint32FMT"\n",
>       |                                                                       ^
> tapper/tapperGlobalData.H:120:97: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   120 |     fprintf(stderr, "Set partition for "uint64FMT" frags or "uint64FMT" mates: -begin "uint32FMT" -end "uint32FMT"\n",
>       |                                                                                                 ^
> tapper/tapperGlobalData.H:144:20: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   144 |   sprintf(colName, "%s.ms"uint32FMT".ce"uint32FMT".posDB", genName, tagSize, maxColorError);
>       |                    ^
> tapper/tapperGlobalData.H:144:36: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   144 |   sprintf(colName, "%s.ms"uint32FMT".ce"uint32FMT".posDB", genName, tagSize, maxColorError);
>       |                                    ^
> tapper/tappersort.C:148:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   148 |   sprintf(filename, "%s."uint32FMTW(03)".tapperAlignment", outputName, outputIndex);
>       |                     ^
> tapper/tappersort.C:150:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   150 |   fprintf(stderr, "Writing "uint32FMT" sorted alignments to '%s'\n", aliLen, filename);
>       |                   ^
> tapper/tappersort.C:202:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   202 |     fprintf(stderr, "Can fit "uint32FMT" alignments into "uint64FMT" bytes memory; "uint32FMT" bytes each.\n",
>       |                     ^
> tapper/tappersort.C:202:40: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   202 |     fprintf(stderr, "Can fit "uint32FMT" alignments into "uint64FMT" bytes memory; "uint32FMT" bytes each.\n",
>       |                                        ^
> tapper/tappersort.C:202:68: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   202 |     fprintf(stderr, "Can fit "uint32FMT" alignments into "uint64FMT" bytes memory; "uint32FMT" bytes each.\n",
>       |                                                                    ^
> tapper/tappersort.C:257:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   257 |       sprintf(filename, "%s."uint32FMTW(03)".tapperAlignment", outputName, x);
>       |                         ^
> tapper/tappersort.C:299:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   299 |       sprintf(filename, "%s."uint32FMTW(03)".tapperAlignment", outputName, x);
>       |                         ^
> tapper/tapperResult.H: In member function ‘void tapperResultIndex::print(FILE*)’:
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 11 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    44 |             _maxColrMismatchMapped, _maxBaseMismatchMapped,
>       |             ~~~~~~~~~~~~~~~~~~~~~~
>       |             |
>       |             int
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 12 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    44 |             _maxColrMismatchMapped, _maxBaseMismatchMapped,
>       |                                     ~~~~~~~~~~~~~~~~~~~~~~
>       |                                     |
>       |                                     int
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 13 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    45 |             _mean, _stddev,
>       |             ~~~~~ 
>       |             |
>       |             int
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 14 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    45 |             _mean, _stddev,
>       |                    ~~~~~~~
>       |                    |
>       |                    int
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 15 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    46 |             _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled);
>       |             ~~~~~~~~
>       |             |
>       |             int
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 16 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    46 |             _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled);
>       |                       ~~~~~~~~~~~~~~~~~
>       |                       |
>       |                       int
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 17 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    46 |             _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled);
>       |                                          ~~~~~~~~~~~~~~~~~
>       |                                          |
>       |                                          int
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 18 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    46 |             _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled);
>       |                                                             ~~~~~~~~~
>       |                                                             |
>       |                                                             int
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 19 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    46 |             _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled);
>       |                                                                        ~~~~~~~~~~~
>       |                                                                        |
>       |                                                                        int
> tapper/tapperHit.H: In member function ‘char* tapperHit::printHit(char*, uint64)’:
> tapper/tapperHit.H:17:17: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 7 has type ‘int’ [-Wformat=]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
> ......
>    20 |             _basesMismatch, _colorMismatch, _colorInconsistent);
>       |             ~~~~~~~~~~~~~~
>       |             |
>       |             int
> tapper/tapperHit.H:17:17: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 8 has type ‘int’ [-Wformat=]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
> ......
>    20 |             _basesMismatch, _colorMismatch, _colorInconsistent);
>       |                             ~~~~~~~~~~~~~~
>       |                             |
>       |                             int
> tapper/tapperHit.H:17:17: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 9 has type ‘int’ [-Wformat=]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
> ......
>    20 |             _basesMismatch, _colorMismatch, _colorInconsistent);
>       |                                             ~~~~~~~~~~~~~~~~~~
>       |                                             |
>       |                                             int
> Make.rules:147: update target 'tapper/tappersort' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o tapper/tappersort tapper/tappersort.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/libsim4.a /build/reproducible-path/kmer-0~20150903+r2013/libkmer/libkmer.a /build/reproducible-path/kmer-0~20150903+r2013/libmeryl/libmeryl.a /build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a /build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:135: update target 'tapper/tappermerge.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/ -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o tapper/tappermerge.o -c tapper/tappermerge.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from tapper/tapperTag.H:1,
>                  from tapper/tappermerge.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> tapper/tapperTag.H:204:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   204 |       fprintf(stderr, "tapperTagFile()--  ERROR!  Tag file was built with TAPPER_TAG_WORDS="uint32FMT", but code has %d.\n",
>       |                       ^
> In file included from tapper/tappermerge.C:2:
> tapper/tapperResult.H:41:18: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^
> tapper/tapperResult.H:41:32: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                ^
> tapper/tapperResult.H:41:44: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                            ^
> tapper/tapperResult.H:41:56: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                        ^
> tapper/tapperResult.H:41:68: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                    ^
> tapper/tapperResult.H:41:81: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                 ^
> tapper/tapperResult.H:41:93: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                             ^
> tapper/tapperResult.H:41:105: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                         ^
> tapper/tapperResult.H:41:117: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                     ^
> tapper/tapperResult.H:41:130: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                                  ^
> tapper/tapperResult.H:41:142: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                                              ^
> tapper/tapperResult.H:41:155: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                                                           ^
> tapper/tapperResult.H:41:168: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                                                                        ^
> tapper/tapperResult.H:41:183: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                                                                                       ^
> tapper/tapperResult.H:41:198: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                                                                                                      ^
> tapper/tapperResult.H:41:213: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                                                                                                                     ^
> tapper/tapperResult.H:41:228: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                                                                                                                                    ^
> tapper/tapperResult.H:116:2: warning: #warning do not know real tag length [-Wcpp]
>   116 | #warning do not know real tag length
>       |  ^~~~~~~
> tapper/tapperResult.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                       ^
> tapper/tapperResult.H:132:37: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                     ^
> tapper/tapperResult.H:132:49: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                 ^
> tapper/tapperResult.H:132:61: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                             ^
> tapper/tapperResult.H:132:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                         ^
> tapper/tapperResult.H:132:86: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                                      ^
> tapper/tapperResult.H:132:99: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                                                   ^
> tapper/tapperResult.H:132:116: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                                                                    ^
> tapper/tapperResult.H:132:128: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                                                                                ^
> tapper/tapperResult.H:155:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                       ^
> tapper/tapperResult.H:155:37: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                     ^
> tapper/tapperResult.H:155:49: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                 ^
> tapper/tapperResult.H:155:61: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                             ^
> tapper/tapperResult.H:155:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                         ^
> tapper/tapperResult.H:155:86: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                                      ^
> tapper/tapperResult.H:155:99: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                                                   ^
> tapper/tapperResult.H:155:116: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                                                                    ^
> tapper/tapperResult.H:155:128: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                                                                                ^
> tapper/tapperResult.H:187:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                     ^
> tapper/tapperResult.H:187:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                   ^
> tapper/tapperResult.H:187:47: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                               ^
> tapper/tapperResult.H:187:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                           ^
> tapper/tapperResult.H:187:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                       ^
> tapper/tapperResult.H:187:84: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                    ^
> tapper/tapperResult.H:187:97: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                 ^
> tapper/tapperResult.H:187:114: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                  ^
> tapper/tapperResult.H:187:126: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                              ^
> tapper/tapperResult.H:187:138: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                          ^
> tapper/tapperResult.H:187:151: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                                       ^
> tapper/tapperResult.H:187:163: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                                                   ^
> tapper/tapperResult.H:187:175: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                                                               ^
> tapper/tapperResult.H:187:187: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                                                                           ^
> tapper/tapperResult.H:187:200: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                                                                                        ^
> tapper/tapperResult.H:187:213: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                                                                                                     ^
> tapper/tapperResult.H:187:230: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                                                                                                                      ^
> tapper/tapperResult.H:187:242: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                                                                                                                                  ^
> tapper/tapperResult.H:224:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                     ^
> tapper/tapperResult.H:224:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                   ^
> tapper/tapperResult.H:224:47: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                               ^
> tapper/tapperResult.H:224:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                           ^
> tapper/tapperResult.H:224:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                       ^
> tapper/tapperResult.H:224:84: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                    ^
> tapper/tapperResult.H:224:97: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                                 ^
> tapper/tapperResult.H:224:109: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                                             ^
> tapper/tapperResult.H:224:121: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                                                         ^
> tapper/tapperResult.H:224:133: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                                                                     ^
> tapper/tapperResult.H:224:146: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                                                                                  ^
> tapper/tapperResult.H:224:159: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                                                                                               ^
> tapper/tapperResult.H:224:172: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                                                                                                            ^
> In file included from tapper/tappermerge.C:4:
> tapper/tapperHit.H:17:17: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
>       |                 ^
> tapper/tapperHit.H:17:30: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
>       |                              ^
> tapper/tapperHit.H:17:43: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
>       |                                           ^
> tapper/tapperHit.H:17:55: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
>       |                                                       ^
> tapper/tapperHit.H:17:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
>       |                                                                       ^
> tapper/tapperHit.H:17:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
>       |                                                                                   ^
> In file included from tapper/tapperGlobalData.H:1,
>                  from tapper/tappermerge.C:5:
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   127 |       fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   129 |       fprintf(stderr, "M = "uint64HEX"\n", m);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   130 |       fprintf(stderr, "H = "uint64HEX"\n", h);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   131 |       fprintf(stderr, "C = "uint64HEX"\n", c);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stderr, "R = "uint64HEX"\n", r);
>       |                       ^
> tapper/tapperGlobalData.H:109:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   109 |       fprintf(stderr, "ERROR: invalid partition n="uint32FMT" m="uint32FMT".\n", thisPartition, numPartitions);
>       |                       ^
> tapper/tapperGlobalData.H:109:61: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   109 |       fprintf(stderr, "ERROR: invalid partition n="uint32FMT" m="uint32FMT".\n", thisPartition, numPartitions);
>       |                                                             ^
> tapper/tapperGlobalData.H:120:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   120 |     fprintf(stderr, "Set partition for "uint64FMT" frags or "uint64FMT" mates: -begin "uint32FMT" -end "uint32FMT"\n",
>       |                     ^
> tapper/tapperGlobalData.H:120:50: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   120 |     fprintf(stderr, "Set partition for "uint64FMT" frags or "uint64FMT" mates: -begin "uint32FMT" -end "uint32FMT"\n",
>       |                                                  ^
> tapper/tapperGlobalData.H:120:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   120 |     fprintf(stderr, "Set partition for "uint64FMT" frags or "uint64FMT" mates: -begin "uint32FMT" -end "uint32FMT"\n",
>       |                                                                       ^
> tapper/tapperGlobalData.H:120:97: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   120 |     fprintf(stderr, "Set partition for "uint64FMT" frags or "uint64FMT" mates: -begin "uint32FMT" -end "uint32FMT"\n",
>       |                                                                                                 ^
> tapper/tapperGlobalData.H:144:20: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   144 |   sprintf(colName, "%s.ms"uint32FMT".ce"uint32FMT".posDB", genName, tagSize, maxColorError);
>       |                    ^
> tapper/tapperGlobalData.H:144:36: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   144 |   sprintf(colName, "%s.ms"uint32FMT".ce"uint32FMT".posDB", genName, tagSize, maxColorError);
>       |                                    ^
> tapper/tapperResult.H: In member function ‘void tapperResultIndex::print(FILE*)’:
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 11 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    44 |             _maxColrMismatchMapped, _maxBaseMismatchMapped,
>       |             ~~~~~~~~~~~~~~~~~~~~~~
>       |             |
>       |             int
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 12 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    44 |             _maxColrMismatchMapped, _maxBaseMismatchMapped,
>       |                                     ~~~~~~~~~~~~~~~~~~~~~~
>       |                                     |
>       |                                     int
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 13 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    45 |             _mean, _stddev,
>       |             ~~~~~ 
>       |             |
>       |             int
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 14 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    45 |             _mean, _stddev,
>       |                    ~~~~~~~
>       |                    |
>       |                    int
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 15 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    46 |             _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled);
>       |             ~~~~~~~~
>       |             |
>       |             int
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 16 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    46 |             _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled);
>       |                       ~~~~~~~~~~~~~~~~~
>       |                       |
>       |                       int
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 17 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    46 |             _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled);
>       |                                          ~~~~~~~~~~~~~~~~~
>       |                                          |
>       |                                          int
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 18 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    46 |             _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled);
>       |                                                             ~~~~~~~~~
>       |                                                             |
>       |                                                             int
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 19 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    46 |             _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled);
>       |                                                                        ~~~~~~~~~~~
>       |                                                                        |
>       |                                                                        int
> tapper/tapperHit.H: In member function ‘char* tapperHit::printHit(char*, uint64)’:
> tapper/tapperHit.H:17:17: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 7 has type ‘int’ [-Wformat=]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
> ......
>    20 |             _basesMismatch, _colorMismatch, _colorInconsistent);
>       |             ~~~~~~~~~~~~~~
>       |             |
>       |             int
> tapper/tapperHit.H:17:17: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 8 has type ‘int’ [-Wformat=]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
> ......
>    20 |             _basesMismatch, _colorMismatch, _colorInconsistent);
>       |                             ~~~~~~~~~~~~~~
>       |                             |
>       |                             int
> tapper/tapperHit.H:17:17: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 9 has type ‘int’ [-Wformat=]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
> ......
>    20 |             _basesMismatch, _colorMismatch, _colorInconsistent);
>       |                                             ~~~~~~~~~~~~~~~~~~
>       |                                             |
>       |                                             int
> Make.rules:147: update target 'tapper/tappermerge' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o tapper/tappermerge tapper/tappermerge.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/libsim4.a /build/reproducible-path/kmer-0~20150903+r2013/libkmer/libkmer.a /build/reproducible-path/kmer-0~20150903+r2013/libmeryl/libmeryl.a /build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a /build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:135: update target 'tapper/tapperconvert.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/ -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o tapper/tapperconvert.o -c tapper/tapperconvert.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from tapper/tapperTag.H:1,
>                  from tapper/tapperconvert.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> tapper/tapperTag.H:204:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   204 |       fprintf(stderr, "tapperTagFile()--  ERROR!  Tag file was built with TAPPER_TAG_WORDS="uint32FMT", but code has %d.\n",
>       |                       ^
> In file included from tapper/tapperconvert.C:2:
> tapper/tapperResult.H:41:18: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^
> tapper/tapperResult.H:41:32: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                ^
> tapper/tapperResult.H:41:44: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                            ^
> tapper/tapperResult.H:41:56: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                        ^
> tapper/tapperResult.H:41:68: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                    ^
> tapper/tapperResult.H:41:81: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                 ^
> tapper/tapperResult.H:41:93: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                             ^
> tapper/tapperResult.H:41:105: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                         ^
> tapper/tapperResult.H:41:117: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                     ^
> tapper/tapperResult.H:41:130: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                                  ^
> tapper/tapperResult.H:41:142: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                                              ^
> tapper/tapperResult.H:41:155: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                                                           ^
> tapper/tapperResult.H:41:168: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                                                                        ^
> tapper/tapperResult.H:41:183: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                                                                                       ^
> tapper/tapperResult.H:41:198: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                                                                                                      ^
> tapper/tapperResult.H:41:213: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                                                                                                                     ^
> tapper/tapperResult.H:41:228: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                                                                                                                                    ^
> tapper/tapperResult.H:116:2: warning: #warning do not know real tag length [-Wcpp]
>   116 | #warning do not know real tag length
>       |  ^~~~~~~
> tapper/tapperResult.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                       ^
> tapper/tapperResult.H:132:37: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                     ^
> tapper/tapperResult.H:132:49: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                 ^
> tapper/tapperResult.H:132:61: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                             ^
> tapper/tapperResult.H:132:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                         ^
> tapper/tapperResult.H:132:86: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                                      ^
> tapper/tapperResult.H:132:99: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                                                   ^
> tapper/tapperResult.H:132:116: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                                                                    ^
> tapper/tapperResult.H:132:128: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                                                                                ^
> tapper/tapperResult.H:155:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                       ^
> tapper/tapperResult.H:155:37: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                     ^
> tapper/tapperResult.H:155:49: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                 ^
> tapper/tapperResult.H:155:61: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                             ^
> tapper/tapperResult.H:155:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                         ^
> tapper/tapperResult.H:155:86: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                                      ^
> tapper/tapperResult.H:155:99: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                                                   ^
> tapper/tapperResult.H:155:116: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                                                                    ^
> tapper/tapperResult.H:155:128: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                                                                                ^
> tapper/tapperResult.H:187:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                     ^
> tapper/tapperResult.H:187:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                   ^
> tapper/tapperResult.H:187:47: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                               ^
> tapper/tapperResult.H:187:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                           ^
> tapper/tapperResult.H:187:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                       ^
> tapper/tapperResult.H:187:84: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                    ^
> tapper/tapperResult.H:187:97: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                 ^
> tapper/tapperResult.H:187:114: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                  ^
> tapper/tapperResult.H:187:126: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                              ^
> tapper/tapperResult.H:187:138: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                          ^
> tapper/tapperResult.H:187:151: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                                       ^
> tapper/tapperResult.H:187:163: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                                                   ^
> tapper/tapperResult.H:187:175: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                                                               ^
> tapper/tapperResult.H:187:187: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                                                                           ^
> tapper/tapperResult.H:187:200: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                                                                                        ^
> tapper/tapperResult.H:187:213: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                                                                                                     ^
> tapper/tapperResult.H:187:230: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                                                                                                                      ^
> tapper/tapperResult.H:187:242: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                                                                                                                                  ^
> tapper/tapperResult.H:224:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                     ^
> tapper/tapperResult.H:224:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                   ^
> tapper/tapperResult.H:224:47: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                               ^
> tapper/tapperResult.H:224:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                           ^
> tapper/tapperResult.H:224:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                       ^
> tapper/tapperResult.H:224:84: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                    ^
> tapper/tapperResult.H:224:97: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                                 ^
> tapper/tapperResult.H:224:109: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                                             ^
> tapper/tapperResult.H:224:121: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                                                         ^
> tapper/tapperResult.H:224:133: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                                                                     ^
> tapper/tapperResult.H:224:146: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                                                                                  ^
> tapper/tapperResult.H:224:159: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                                                                                               ^
> tapper/tapperResult.H:224:172: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                                                                                                            ^
> In file included from tapper/tapperconvert.C:4:
> tapper/tapperHit.H:17:17: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
>       |                 ^
> tapper/tapperHit.H:17:30: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
>       |                              ^
> tapper/tapperHit.H:17:43: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
>       |                                           ^
> tapper/tapperHit.H:17:55: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
>       |                                                       ^
> tapper/tapperHit.H:17:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
>       |                                                                       ^
> tapper/tapperHit.H:17:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
>       |                                                                                   ^
> In file included from tapper/tapperGlobalData.H:1,
>                  from tapper/tapperconvert.C:5:
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   127 |       fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   129 |       fprintf(stderr, "M = "uint64HEX"\n", m);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   130 |       fprintf(stderr, "H = "uint64HEX"\n", h);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   131 |       fprintf(stderr, "C = "uint64HEX"\n", c);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stderr, "R = "uint64HEX"\n", r);
>       |                       ^
> tapper/tapperGlobalData.H:109:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   109 |       fprintf(stderr, "ERROR: invalid partition n="uint32FMT" m="uint32FMT".\n", thisPartition, numPartitions);
>       |                       ^
> tapper/tapperGlobalData.H:109:61: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   109 |       fprintf(stderr, "ERROR: invalid partition n="uint32FMT" m="uint32FMT".\n", thisPartition, numPartitions);
>       |                                                             ^
> tapper/tapperGlobalData.H:120:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   120 |     fprintf(stderr, "Set partition for "uint64FMT" frags or "uint64FMT" mates: -begin "uint32FMT" -end "uint32FMT"\n",
>       |                     ^
> tapper/tapperGlobalData.H:120:50: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   120 |     fprintf(stderr, "Set partition for "uint64FMT" frags or "uint64FMT" mates: -begin "uint32FMT" -end "uint32FMT"\n",
>       |                                                  ^
> tapper/tapperGlobalData.H:120:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   120 |     fprintf(stderr, "Set partition for "uint64FMT" frags or "uint64FMT" mates: -begin "uint32FMT" -end "uint32FMT"\n",
>       |                                                                       ^
> tapper/tapperGlobalData.H:120:97: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   120 |     fprintf(stderr, "Set partition for "uint64FMT" frags or "uint64FMT" mates: -begin "uint32FMT" -end "uint32FMT"\n",
>       |                                                                                                 ^
> tapper/tapperGlobalData.H:144:20: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   144 |   sprintf(colName, "%s.ms"uint32FMT".ce"uint32FMT".posDB", genName, tagSize, maxColorError);
>       |                    ^
> tapper/tapperGlobalData.H:144:36: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   144 |   sprintf(colName, "%s.ms"uint32FMT".ce"uint32FMT".posDB", genName, tagSize, maxColorError);
>       |                                    ^
> tapper/tapperResult.H: In member function ‘void tapperResultIndex::print(FILE*)’:
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 11 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    44 |             _maxColrMismatchMapped, _maxBaseMismatchMapped,
>       |             ~~~~~~~~~~~~~~~~~~~~~~
>       |             |
>       |             int
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 12 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    44 |             _maxColrMismatchMapped, _maxBaseMismatchMapped,
>       |                                     ~~~~~~~~~~~~~~~~~~~~~~
>       |                                     |
>       |                                     int
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 13 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    45 |             _mean, _stddev,
>       |             ~~~~~ 
>       |             |
>       |             int
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 14 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    45 |             _mean, _stddev,
>       |                    ~~~~~~~
>       |                    |
>       |                    int
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 15 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    46 |             _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled);
>       |             ~~~~~~~~
>       |             |
>       |             int
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 16 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    46 |             _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled);
>       |                       ~~~~~~~~~~~~~~~~~
>       |                       |
>       |                       int
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 17 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    46 |             _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled);
>       |                                          ~~~~~~~~~~~~~~~~~
>       |                                          |
>       |                                          int
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 18 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    46 |             _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled);
>       |                                                             ~~~~~~~~~
>       |                                                             |
>       |                                                             int
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 19 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    46 |             _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled);
>       |                                                                        ~~~~~~~~~~~
>       |                                                                        |
>       |                                                                        int
> tapper/tapperHit.H: In member function ‘char* tapperHit::printHit(char*, uint64)’:
> tapper/tapperHit.H:17:17: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 7 has type ‘int’ [-Wformat=]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
> ......
>    20 |             _basesMismatch, _colorMismatch, _colorInconsistent);
>       |             ~~~~~~~~~~~~~~
>       |             |
>       |             int
> tapper/tapperHit.H:17:17: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 8 has type ‘int’ [-Wformat=]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
> ......
>    20 |             _basesMismatch, _colorMismatch, _colorInconsistent);
>       |                             ~~~~~~~~~~~~~~
>       |                             |
>       |                             int
> tapper/tapperHit.H:17:17: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 9 has type ‘int’ [-Wformat=]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
> ......
>    20 |             _basesMismatch, _colorMismatch, _colorInconsistent);
>       |                                             ~~~~~~~~~~~~~~~~~~
>       |                                             |
>       |                                             int
> Make.rules:147: update target 'tapper/tapperconvert' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o tapper/tapperconvert tapper/tapperconvert.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/libsim4.a /build/reproducible-path/kmer-0~20150903+r2013/libkmer/libkmer.a /build/reproducible-path/kmer-0~20150903+r2013/libmeryl/libmeryl.a /build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a /build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:135: update target 'tapper/tapper.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/ -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o tapper/tapper.o -c tapper/tapper.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from tapper/tapperTag.H:1,
>                  from tapper/tapper.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> tapper/tapperTag.H:204:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   204 |       fprintf(stderr, "tapperTagFile()--  ERROR!  Tag file was built with TAPPER_TAG_WORDS="uint32FMT", but code has %d.\n",
>       |                       ^
> In file included from tapper/tapper.C:2:
> tapper/tapperResult.H:41:18: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^
> tapper/tapperResult.H:41:32: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                ^
> tapper/tapperResult.H:41:44: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                            ^
> tapper/tapperResult.H:41:56: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                        ^
> tapper/tapperResult.H:41:68: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                    ^
> tapper/tapperResult.H:41:81: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                 ^
> tapper/tapperResult.H:41:93: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                             ^
> tapper/tapperResult.H:41:105: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                         ^
> tapper/tapperResult.H:41:117: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                     ^
> tapper/tapperResult.H:41:130: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                                  ^
> tapper/tapperResult.H:41:142: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                                              ^
> tapper/tapperResult.H:41:155: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                                                           ^
> tapper/tapperResult.H:41:168: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                                                                        ^
> tapper/tapperResult.H:41:183: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                                                                                       ^
> tapper/tapperResult.H:41:198: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                                                                                                      ^
> tapper/tapperResult.H:41:213: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                                                                                                                     ^
> tapper/tapperResult.H:41:228: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                                                                                                                                    ^
> tapper/tapperResult.H:116:2: warning: #warning do not know real tag length [-Wcpp]
>   116 | #warning do not know real tag length
>       |  ^~~~~~~
> tapper/tapperResult.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                       ^
> tapper/tapperResult.H:132:37: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                     ^
> tapper/tapperResult.H:132:49: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                 ^
> tapper/tapperResult.H:132:61: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                             ^
> tapper/tapperResult.H:132:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                         ^
> tapper/tapperResult.H:132:86: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                                      ^
> tapper/tapperResult.H:132:99: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                                                   ^
> tapper/tapperResult.H:132:116: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                                                                    ^
> tapper/tapperResult.H:132:128: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                                                                                ^
> tapper/tapperResult.H:155:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                       ^
> tapper/tapperResult.H:155:37: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                     ^
> tapper/tapperResult.H:155:49: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                 ^
> tapper/tapperResult.H:155:61: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                             ^
> tapper/tapperResult.H:155:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                         ^
> tapper/tapperResult.H:155:86: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                                      ^
> tapper/tapperResult.H:155:99: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                                                   ^
> tapper/tapperResult.H:155:116: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                                                                    ^
> tapper/tapperResult.H:155:128: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                                                                                ^
> tapper/tapperResult.H:187:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                     ^
> tapper/tapperResult.H:187:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                   ^
> tapper/tapperResult.H:187:47: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                               ^
> tapper/tapperResult.H:187:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                           ^
> tapper/tapperResult.H:187:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                       ^
> tapper/tapperResult.H:187:84: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                    ^
> tapper/tapperResult.H:187:97: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                 ^
> tapper/tapperResult.H:187:114: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                  ^
> tapper/tapperResult.H:187:126: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                              ^
> tapper/tapperResult.H:187:138: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                          ^
> tapper/tapperResult.H:187:151: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                                       ^
> tapper/tapperResult.H:187:163: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                                                   ^
> tapper/tapperResult.H:187:175: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                                                               ^
> tapper/tapperResult.H:187:187: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                                                                           ^
> tapper/tapperResult.H:187:200: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                                                                                        ^
> tapper/tapperResult.H:187:213: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                                                                                                     ^
> tapper/tapperResult.H:187:230: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                                                                                                                      ^
> tapper/tapperResult.H:187:242: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                                                                                                                                  ^
> tapper/tapperResult.H:224:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                     ^
> tapper/tapperResult.H:224:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                   ^
> tapper/tapperResult.H:224:47: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                               ^
> tapper/tapperResult.H:224:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                           ^
> tapper/tapperResult.H:224:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                       ^
> tapper/tapperResult.H:224:84: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                    ^
> tapper/tapperResult.H:224:97: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                                 ^
> tapper/tapperResult.H:224:109: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                                             ^
> tapper/tapperResult.H:224:121: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                                                         ^
> tapper/tapperResult.H:224:133: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                                                                     ^
> tapper/tapperResult.H:224:146: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                                                                                  ^
> tapper/tapperResult.H:224:159: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                                                                                               ^
> tapper/tapperResult.H:224:172: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                                                                                                            ^
> In file included from tapper/tapper.C:4:
> tapper/tapperHit.H:17:17: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
>       |                 ^
> tapper/tapperHit.H:17:30: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
>       |                              ^
> tapper/tapperHit.H:17:43: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
>       |                                           ^
> tapper/tapperHit.H:17:55: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
>       |                                                       ^
> tapper/tapperHit.H:17:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
>       |                                                                       ^
> tapper/tapperHit.H:17:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
>       |                                                                                   ^
> In file included from tapper/tapperGlobalData.H:1,
>                  from tapper/tapper.C:5:
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   127 |       fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   129 |       fprintf(stderr, "M = "uint64HEX"\n", m);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   130 |       fprintf(stderr, "H = "uint64HEX"\n", h);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   131 |       fprintf(stderr, "C = "uint64HEX"\n", c);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stderr, "R = "uint64HEX"\n", r);
>       |                       ^
> tapper/tapperGlobalData.H:109:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   109 |       fprintf(stderr, "ERROR: invalid partition n="uint32FMT" m="uint32FMT".\n", thisPartition, numPartitions);
>       |                       ^
> tapper/tapperGlobalData.H:109:61: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   109 |       fprintf(stderr, "ERROR: invalid partition n="uint32FMT" m="uint32FMT".\n", thisPartition, numPartitions);
>       |                                                             ^
> tapper/tapperGlobalData.H:120:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   120 |     fprintf(stderr, "Set partition for "uint64FMT" frags or "uint64FMT" mates: -begin "uint32FMT" -end "uint32FMT"\n",
>       |                     ^
> tapper/tapperGlobalData.H:120:50: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   120 |     fprintf(stderr, "Set partition for "uint64FMT" frags or "uint64FMT" mates: -begin "uint32FMT" -end "uint32FMT"\n",
>       |                                                  ^
> tapper/tapperGlobalData.H:120:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   120 |     fprintf(stderr, "Set partition for "uint64FMT" frags or "uint64FMT" mates: -begin "uint32FMT" -end "uint32FMT"\n",
>       |                                                                       ^
> tapper/tapperGlobalData.H:120:97: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   120 |     fprintf(stderr, "Set partition for "uint64FMT" frags or "uint64FMT" mates: -begin "uint32FMT" -end "uint32FMT"\n",
>       |                                                                                                 ^
> tapper/tapperGlobalData.H:144:20: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   144 |   sprintf(colName, "%s.ms"uint32FMT".ce"uint32FMT".posDB", genName, tagSize, maxColorError);
>       |                    ^
> tapper/tapperGlobalData.H:144:36: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   144 |   sprintf(colName, "%s.ms"uint32FMT".ce"uint32FMT".posDB", genName, tagSize, maxColorError);
>       |                                    ^
> tapper/tapper.C:633:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   633 |       fprintf(stderr, "Reallocate t->numHappiesMax to "uint32FMT"\n", t->numHappiesMax);
>       |                       ^
> tapper/tapper.C:1048:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>  1048 |   fprintf(stderr, "sizeof(tapperResultIndex) --       "sizetFMT"\n", sizeof(tapperResultIndex));
>       |                   ^
> tapper/tapper.C:1049:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>  1049 |   fprintf(stderr, "sizeof(tapperResultQV) --          "sizetFMT"\n", sizeof(tapperResultQV));
>       |                   ^
> tapper/tapper.C:1050:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>  1050 |   fprintf(stderr, "sizeof(tapperResultFragment) --    "sizetFMT"\n", sizeof(tapperResultFragment));
>       |                   ^
> tapper/tapper.C:1051:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>  1051 |   fprintf(stderr, "sizeof(tapperResultMated) --       "sizetFMT"\n", sizeof(tapperResultMated));
>       |                   ^
> tapper/tapper.C:1052:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>  1052 |   fprintf(stderr, "sizeof(tapperResultTangled) --     "sizetFMT"\n", sizeof(tapperResultTangled));
>       |                   ^
> tapper/tapper.C:1053:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>  1053 |   fprintf(stderr, "sizeof(tapperHit) --               "sizetFMT"\n", sizeof(tapperHit));
>       |                   ^
> tapper/tapper.C:1054:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>  1054 |   fprintf(stderr, "sizeof(tapperTag) --               "sizetFMT"\n", sizeof(tapperTag));
>       |                   ^
> tapper/tapper.C:1124:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>  1124 |     fprintf(stderr, "                                 all alignments.  The default is "uint32FMT".\n", g->repeatThreshold);
>       |                     ^
> tapper/tapperResult.H: In member function ‘void tapperResultIndex::print(FILE*)’:
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 11 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    44 |             _maxColrMismatchMapped, _maxBaseMismatchMapped,
>       |             ~~~~~~~~~~~~~~~~~~~~~~
>       |             |
>       |             int
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 12 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    44 |             _maxColrMismatchMapped, _maxBaseMismatchMapped,
>       |                                     ~~~~~~~~~~~~~~~~~~~~~~
>       |                                     |
>       |                                     int
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 13 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    45 |             _mean, _stddev,
>       |             ~~~~~ 
>       |             |
>       |             int
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 14 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    45 |             _mean, _stddev,
>       |                    ~~~~~~~
>       |                    |
>       |                    int
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 15 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    46 |             _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled);
>       |             ~~~~~~~~
>       |             |
>       |             int
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 16 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    46 |             _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled);
>       |                       ~~~~~~~~~~~~~~~~~
>       |                       |
>       |                       int
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 17 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    46 |             _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled);
>       |                                          ~~~~~~~~~~~~~~~~~
>       |                                          |
>       |                                          int
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 18 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    46 |             _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled);
>       |                                                             ~~~~~~~~~
>       |                                                             |
>       |                                                             int
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 19 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    46 |             _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled);
>       |                                                                        ~~~~~~~~~~~
>       |                                                                        |
>       |                                                                        int
> tapper/tapperHit.H: In member function ‘char* tapperHit::printHit(char*, uint64)’:
> tapper/tapperHit.H:17:17: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 7 has type ‘int’ [-Wformat=]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
> ......
>    20 |             _basesMismatch, _colorMismatch, _colorInconsistent);
>       |             ~~~~~~~~~~~~~~
>       |             |
>       |             int
> tapper/tapperHit.H:17:17: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 8 has type ‘int’ [-Wformat=]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
> ......
>    20 |             _basesMismatch, _colorMismatch, _colorInconsistent);
>       |                             ~~~~~~~~~~~~~~
>       |                             |
>       |                             int
> tapper/tapperHit.H:17:17: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 9 has type ‘int’ [-Wformat=]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
> ......
>    20 |             _basesMismatch, _colorMismatch, _colorInconsistent);
>       |                                             ~~~~~~~~~~~~~~~~~~
>       |                                             |
>       |                                             int
> tapper/tapper.C: In member function ‘bool tapperHit::alignToReference(tapperGlobalData*, uint32, uint32, char*, uint32)’:
> tapper/tapper.C:399:43: warning: comparison of integer expressions of different signedness: ‘int’ and ‘uint32’ {aka ‘unsigned int’} [-Wsign-compare]
>   399 |   if (_colorMismatch + _colorInconsistent > g->maxColorError)
>       |       ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~
> tapper/tapper.C:415:23: warning: comparison of integer expressions of different signedness: ‘uint32’ {aka ‘unsigned int’} and ‘int’ [-Wsign-compare]
>   415 |   for (uint32 ti=0; ti<_len-1; ti++) {
>       |                     ~~^~~~~~~
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/recordFile.H:6,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:39:
> tapper/tapper.C:468:13: warning: comparison of integer expressions of different signedness: ‘uint32’ {aka ‘unsigned int’} and ‘int’ [-Wsign-compare]
>   468 |   assert(nn == _colorMismatch + _colorInconsistent);
>       |          ~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> In file included from tapper/tapper.C:7:
> tapper/tapperComputation.H: In constructor ‘tapperComputation::tapperComputation(tapperTag*, tapperTag*)’:
> tapper/tapperComputation.H:51:28: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=]
>    51 |       tag1rseq[tag1size-1] = complementSymbol[tag1rseq[tag1size-1]];
>       |       ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> tapper/tapperComputation.H:186:38: note: at offset 4294967295 into destination object ‘tapperComputation::tag1rseq’ of size 32
>   186 |   char        tag1fseq[TAG_LEN_MAX], tag1rseq[TAG_LEN_MAX];
>       |                                      ^~~~~~~~
> tapper/tapperComputation.H:75:28: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=]
>    75 |       tag2rseq[tag2size-1] = complementSymbol[tag2rseq[tag2size-1]];
>       |       ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> tapper/tapperComputation.H:187:38: note: at offset 4294967295 into destination object ‘tapperComputation::tag2rseq’ of size 32
>   187 |   char        tag2fseq[TAG_LEN_MAX], tag2rseq[TAG_LEN_MAX];
>       |                                      ^~~~~~~~
> In constructor ‘tapperComputation::tapperComputation(tapperTag*, tapperTag*)’,
>     inlined from ‘void* tapperReader(void*)’ at tapper/tapper.C:28:39:
> tapper/tapperComputation.H:51:28: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=]
>    51 |       tag1rseq[tag1size-1] = complementSymbol[tag1rseq[tag1size-1]];
>       |       ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> tapper/tapperComputation.H: In function ‘void* tapperReader(void*)’:
> tapper/tapperComputation.H:186:38: note: at offset 4294967295 into destination object ‘tapperComputation::tag1rseq’ of size 32
>   186 |   char        tag1fseq[TAG_LEN_MAX], tag1rseq[TAG_LEN_MAX];
>       |                                      ^~~~~~~~
> Make.rules:147: update target 'tapper/tapper' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o tapper/tapper tapper/tapper.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/libsim4.a /build/reproducible-path/kmer-0~20150903+r2013/libkmer/libkmer.a /build/reproducible-path/kmer-0~20150903+r2013/libmeryl/libmeryl.a /build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a /build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:135: update target 'tapper/tagger.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/ -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o tapper/tagger.o -c tapper/tagger.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from tapper/tapperTag.H:1,
>                  from tapper/tagger.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> tapper/tapperTag.H:204:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   204 |       fprintf(stderr, "tapperTagFile()--  ERROR!  Tag file was built with TAPPER_TAG_WORDS="uint32FMT", but code has %d.\n",
>       |                       ^
> In file included from tapper/tagger.C:2:
> tapper/tapperResult.H:41:18: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^
> tapper/tapperResult.H:41:32: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                ^
> tapper/tapperResult.H:41:44: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                            ^
> tapper/tapperResult.H:41:56: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                        ^
> tapper/tapperResult.H:41:68: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                    ^
> tapper/tapperResult.H:41:81: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                 ^
> tapper/tapperResult.H:41:93: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                             ^
> tapper/tapperResult.H:41:105: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                         ^
> tapper/tapperResult.H:41:117: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                     ^
> tapper/tapperResult.H:41:130: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                                  ^
> tapper/tapperResult.H:41:142: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                                              ^
> tapper/tapperResult.H:41:155: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                                                           ^
> tapper/tapperResult.H:41:168: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                                                                        ^
> tapper/tapperResult.H:41:183: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                                                                                       ^
> tapper/tapperResult.H:41:198: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                                                                                                      ^
> tapper/tapperResult.H:41:213: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                                                                                                                     ^
> tapper/tapperResult.H:41:228: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                                                                                                                                                                                                                                    ^
> tapper/tapperResult.H:116:2: warning: #warning do not know real tag length [-Wcpp]
>   116 | #warning do not know real tag length
>       |  ^~~~~~~
> tapper/tapperResult.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                       ^
> tapper/tapperResult.H:132:37: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                     ^
> tapper/tapperResult.H:132:49: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                 ^
> tapper/tapperResult.H:132:61: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                             ^
> tapper/tapperResult.H:132:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                         ^
> tapper/tapperResult.H:132:86: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                                      ^
> tapper/tapperResult.H:132:99: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                                                   ^
> tapper/tapperResult.H:132:116: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                                                                    ^
> tapper/tapperResult.H:132:128: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                                                                                ^
> tapper/tapperResult.H:155:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                       ^
> tapper/tapperResult.H:155:37: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                     ^
> tapper/tapperResult.H:155:49: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                 ^
> tapper/tapperResult.H:155:61: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                             ^
> tapper/tapperResult.H:155:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                         ^
> tapper/tapperResult.H:155:86: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                                      ^
> tapper/tapperResult.H:155:99: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                                                   ^
> tapper/tapperResult.H:155:116: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                                                                    ^
> tapper/tapperResult.H:155:128: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   155 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n",
>       |                                                                                                                                ^
> tapper/tapperResult.H:187:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                     ^
> tapper/tapperResult.H:187:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                   ^
> tapper/tapperResult.H:187:47: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                               ^
> tapper/tapperResult.H:187:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                           ^
> tapper/tapperResult.H:187:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                       ^
> tapper/tapperResult.H:187:84: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                    ^
> tapper/tapperResult.H:187:97: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                 ^
> tapper/tapperResult.H:187:114: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                  ^
> tapper/tapperResult.H:187:126: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                              ^
> tapper/tapperResult.H:187:138: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                          ^
> tapper/tapperResult.H:187:151: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                                       ^
> tapper/tapperResult.H:187:163: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                                                   ^
> tapper/tapperResult.H:187:175: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                                                               ^
> tapper/tapperResult.H:187:187: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                                                                           ^
> tapper/tapperResult.H:187:200: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                                                                                        ^
> tapper/tapperResult.H:187:213: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                                                                                                     ^
> tapper/tapperResult.H:187:230: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                                                                                                                      ^
> tapper/tapperResult.H:187:242: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   187 |     fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n",
>       |                                                                                                                                                                                                                                                  ^
> tapper/tapperResult.H:224:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                     ^
> tapper/tapperResult.H:224:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                   ^
> tapper/tapperResult.H:224:47: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                               ^
> tapper/tapperResult.H:224:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                           ^
> tapper/tapperResult.H:224:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                       ^
> tapper/tapperResult.H:224:84: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                    ^
> tapper/tapperResult.H:224:97: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                                 ^
> tapper/tapperResult.H:224:109: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                                             ^
> tapper/tapperResult.H:224:121: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                                                         ^
> tapper/tapperResult.H:224:133: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                                                                     ^
> tapper/tapperResult.H:224:146: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                                                                                  ^
> tapper/tapperResult.H:224:159: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                                                                                               ^
> tapper/tapperResult.H:224:172: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   224 |     fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                                                                                                            ^
> In file included from tapper/tagger.C:4:
> tapper/tapperHit.H:17:17: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
>       |                 ^
> tapper/tapperHit.H:17:30: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
>       |                              ^
> tapper/tapperHit.H:17:43: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
>       |                                           ^
> tapper/tapperHit.H:17:55: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
>       |                                                       ^
> tapper/tapperHit.H:17:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
>       |                                                                       ^
> tapper/tapperHit.H:17:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
>       |                                                                                   ^
> tapper/tagger.C:151:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   151 |     fprintf(stdout, "%s\tlength\t"uint32FMT"\n", tagfile, TF->metaData()->tagSize());
>       |                     ^
> tapper/tagger.C:152:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   152 |     fprintf(stdout, "%s\tnumMates\t"uint64FMT"\n", tagfile, TF->numberOfMatePairs());
>       |                     ^
> tapper/tagger.C:153:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   153 |     fprintf(stdout, "%s\tmean\t"uint32FMT"\n", tagfile, TF->metaData()->mean());
>       |                     ^
> tapper/tagger.C:154:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   154 |     fprintf(stdout, "%s\tstddev\t"uint32FMT"\n", tagfile, TF->metaData()->stddev());
>       |                     ^
> tapper/tagger.C:157:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |     fprintf(stdout, "%s\tlength\t"uint32FMT"\n", tagfile, TF->metaData()->tagSize());
>       |                     ^
> tapper/tagger.C:158:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   158 |     fprintf(stdout, "%s\tnumTags\t"uint64FMT"\n", tagfile, TF->numberOfFragmentTags());
>       |                     ^
> tapper/tagger.C:182:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   182 |       fprintf(stdout, ">"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t%s/%s\t>"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t%s/%s\n",
>       |                       ^
> tapper/tagger.C:182:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   182 |       fprintf(stdout, ">"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t%s/%s\t>"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t%s/%s\n",
>       |                                   ^
> tapper/tagger.C:182:47: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   182 |       fprintf(stdout, ">"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t%s/%s\t>"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t%s/%s\n",
>       |                                               ^
> tapper/tagger.C:182:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   182 |       fprintf(stdout, ">"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t%s/%s\t>"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t%s/%s\n",
>       |                                                           ^
> tapper/tagger.C:182:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   182 |       fprintf(stdout, ">"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t%s/%s\t>"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t%s/%s\n",
>       |                                                                       ^
> tapper/tagger.C:182:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   182 |       fprintf(stdout, ">"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t%s/%s\t>"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t%s/%s\n",
>       |                                                                                            ^
> tapper/tagger.C:182:104: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   182 |       fprintf(stdout, ">"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t%s/%s\t>"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t%s/%s\n",
>       |                                                                                                        ^
> tapper/tagger.C:182:116: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   182 |       fprintf(stdout, ">"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t%s/%s\t>"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t%s/%s\n",
>       |                                                                                                                    ^
> tapper/tagger.C:191:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   191 |       fprintf(stdout, ">"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t%s/%s\n",
>       |                       ^
> tapper/tagger.C:191:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   191 |       fprintf(stdout, ">"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t%s/%s\n",
>       |                                   ^
> tapper/tagger.C:191:47: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   191 |       fprintf(stdout, ">"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t%s/%s\n",
>       |                                               ^
> tapper/tagger.C:191:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   191 |       fprintf(stdout, ">"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t%s/%s\n",
>       |                                                           ^
> tapper/tagger.C:362:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   362 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t0\t"uint32FMT"\t%c\t%s%s\t%s\n",
>       |                       ^
> tapper/tagger.C:362:37: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   362 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t0\t"uint32FMT"\t%c\t%s%s\t%s\n",
>       |                                     ^
> tapper/tagger.C:362:49: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   362 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t0\t"uint32FMT"\t%c\t%s%s\t%s\n",
>       |                                                 ^
> tapper/tagger.C:362:61: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   362 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t0\t"uint32FMT"\t%c\t%s%s\t%s\n",
>       |                                                             ^
> tapper/tagger.C:362:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   362 |       fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t0\t"uint32FMT"\t%c\t%s%s\t%s\n",
>       |                                                                         ^
> tapper/tapperResult.H: In member function ‘void tapperResultIndex::print(FILE*)’:
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 11 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    44 |             _maxColrMismatchMapped, _maxBaseMismatchMapped,
>       |             ~~~~~~~~~~~~~~~~~~~~~~
>       |             |
>       |             int
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 12 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    44 |             _maxColrMismatchMapped, _maxBaseMismatchMapped,
>       |                                     ~~~~~~~~~~~~~~~~~~~~~~
>       |                                     |
>       |                                     int
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 13 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    45 |             _mean, _stddev,
>       |             ~~~~~ 
>       |             |
>       |             int
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 14 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    45 |             _mean, _stddev,
>       |                    ~~~~~~~
>       |                    |
>       |                    int
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 15 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    46 |             _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled);
>       |             ~~~~~~~~
>       |             |
>       |             int
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 16 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    46 |             _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled);
>       |                       ~~~~~~~~~~~~~~~~~
>       |                       |
>       |                       int
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 17 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    46 |             _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled);
>       |                                          ~~~~~~~~~~~~~~~~~
>       |                                          |
>       |                                          int
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 18 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    46 |             _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled);
>       |                                                             ~~~~~~~~~
>       |                                                             |
>       |                                                             int
> tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 19 has type ‘int’ [-Wformat=]
>    41 |     fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n",
>       |                  ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> ......
>    46 |             _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled);
>       |                                                                        ~~~~~~~~~~~
>       |                                                                        |
>       |                                                                        int
> tapper/tapperHit.H: In member function ‘char* tapperHit::printHit(char*, uint64)’:
> tapper/tapperHit.H:17:17: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 7 has type ‘int’ [-Wformat=]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
> ......
>    20 |             _basesMismatch, _colorMismatch, _colorInconsistent);
>       |             ~~~~~~~~~~~~~~
>       |             |
>       |             int
> tapper/tapperHit.H:17:17: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 8 has type ‘int’ [-Wformat=]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
> ......
>    20 |             _basesMismatch, _colorMismatch, _colorInconsistent);
>       |                             ~~~~~~~~~~~~~~
>       |                             |
>       |                             int
> tapper/tapperHit.H:17:17: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 9 has type ‘int’ [-Wformat=]
>    17 |     sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT,
> ......
>    20 |             _basesMismatch, _colorMismatch, _colorInconsistent);
>       |                                             ~~~~~~~~~~~~~~~~~~
>       |                                             |
>       |                                             int
> tapper/tagger.C: In function ‘bool readTag(uint32, FILE*, FILE*, tapperTag*)’:
> tapper/tagger.C:52:8: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>    52 |   fgets(seqhdr, 1024, seq);
>       |   ~~~~~^~~~~~~~~~~~~~~~~~~
> tapper/tagger.C:54:10: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>    54 |     fgets(seqhdr, 1024, seq);
>       |     ~~~~~^~~~~~~~~~~~~~~~~~~
> tapper/tagger.C:55:8: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>    55 |   fgets(seqseq, 1024, seq);
>       |   ~~~~~^~~~~~~~~~~~~~~~~~~
> tapper/tagger.C:57:8: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>    57 |   fgets(qlthdr, 1024, qlt);
>       |   ~~~~~^~~~~~~~~~~~~~~~~~~
> tapper/tagger.C:59:10: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>    59 |     fgets(qlthdr, 1024, qlt);
>       |     ~~~~~^~~~~~~~~~~~~~~~~~~
> tapper/tagger.C:60:8: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>    60 |   fgets(qltseq, 1024, qlt);
>       |   ~~~~~^~~~~~~~~~~~~~~~~~~
> Make.rules:147: update target 'tapper/tagger' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o tapper/tagger tapper/tagger.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/libsim4.a /build/reproducible-path/kmer-0~20150903+r2013/libkmer/libkmer.a /build/reproducible-path/kmer-0~20150903+r2013/libmeryl/libmeryl.a /build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a /build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:135: update target 'snapper/hitMatrix-sort.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/ -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o snapper/hitMatrix-sort.o -c snapper/hitMatrix-sort.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from snapper/snapper2.H:18,
>                  from snapper/hitMatrix-sort.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> In file included from snapper/snapper2.H:20:
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   127 |       fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   129 |       fprintf(stderr, "M = "uint64HEX"\n", m);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   130 |       fprintf(stderr, "H = "uint64HEX"\n", h);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   131 |       fprintf(stderr, "C = "uint64HEX"\n", c);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stderr, "R = "uint64HEX"\n", r);
>       |                       ^
> snapper/snapper2.H:421:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   421 |       fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn);
>       |                       ^
> snapper/snapper2.H:421:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   421 |       fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn);
>       |                                                              ^
> snapper/snapper2.H: In member function ‘void hitMatrix::addHits(uint32, uint64*, uint64, uint64)’:
> snapper/snapper2.H:419:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=]
>   419 |     } catch (std::bad_alloc) {
>       |                   ^~~~~~~~~
> Make.rules:135: update target 'snapper/hitMatrix.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/ -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o snapper/hitMatrix.o -c snapper/hitMatrix.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from snapper/snapper2.H:18,
>                  from snapper/hitMatrix.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> In file included from snapper/snapper2.H:20:
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   127 |       fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   129 |       fprintf(stderr, "M = "uint64HEX"\n", m);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   130 |       fprintf(stderr, "H = "uint64HEX"\n", h);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   131 |       fprintf(stderr, "C = "uint64HEX"\n", c);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stderr, "R = "uint64HEX"\n", r);
>       |                       ^
> snapper/snapper2.H:421:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   421 |       fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn);
>       |                       ^
> snapper/snapper2.H:421:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   421 |       fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn);
>       |                                                              ^
> snapper/hitMatrix.C:385:27: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   385 |           fprintf(stderr, "hitMatrix::filter()-- tried to extend output string from "uint32FMT" to "uint32FMT".\n", theHitsPos, theHitsMax);
>       |                           ^
> snapper/hitMatrix.C:385:95: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   385 |           fprintf(stderr, "hitMatrix::filter()-- tried to extend output string from "uint32FMT" to "uint32FMT".\n", theHitsPos, theHitsMax);
>       |                                                                                               ^
> snapper/snapper2.H: In member function ‘void hitMatrix::addHits(uint32, uint64*, uint64, uint64)’:
> snapper/snapper2.H:419:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=]
>   419 |     } catch (std::bad_alloc) {
>       |                   ^~~~~~~~~
> snapper/hitMatrix.C: In member function ‘void hitMatrix::filter(char, double, uint32, aHit*&, uint32&, uint32&)’:
> snapper/hitMatrix.C:383:23: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=]
>   383 |         } catch (std::bad_alloc) {
>       |                       ^~~~~~~~~
> Make.rules:135: update target 'snapper/thr-polish-dp.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/ -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o snapper/thr-polish-dp.o -c snapper/thr-polish-dp.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from snapper/snapper2.H:18,
>                  from snapper/thr-polish-dp.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> In file included from snapper/snapper2.H:20:
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   127 |       fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   129 |       fprintf(stderr, "M = "uint64HEX"\n", m);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   130 |       fprintf(stderr, "H = "uint64HEX"\n", h);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   131 |       fprintf(stderr, "C = "uint64HEX"\n", c);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stderr, "R = "uint64HEX"\n", r);
>       |                       ^
> snapper/snapper2.H:421:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   421 |       fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn);
>       |                       ^
> snapper/snapper2.H:421:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   421 |       fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn);
>       |                                                              ^
> snapper/thr-polish-dp.C:89:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    89 |       fprintf(stderr, "dpMatrix-- reallocate to "uint32FMT" x "uint32FMT"\n", aMax, bMax);
>       |                       ^
> snapper/thr-polish-dp.C:89:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    89 |       fprintf(stderr, "dpMatrix-- reallocate to "uint32FMT" x "uint32FMT"\n", aMax, bMax);
>       |                                                           ^
> snapper/thr-polish-dp.C:441:29: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   441 |             fprintf(stderr, "doPolish()-- Can't reallocate space for the output string ("uint32FMT" bytes) in thread "uint64FMT"\n", qry->theOutputMax, state->threadID);
>       |                             ^
> snapper/thr-polish-dp.C:441:99: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   441 |             fprintf(stderr, "doPolish()-- Can't reallocate space for the output string ("uint32FMT" bytes) in thread "uint64FMT"\n", qry->theOutputMax, state->threadID);
>       |                                                                                                   ^
> snapper/snapper2.H: In member function ‘void hitMatrix::addHits(uint32, uint64*, uint64, uint64)’:
> snapper/snapper2.H:419:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=]
>   419 |     } catch (std::bad_alloc) {
>       |                   ^~~~~~~~~
> Make.rules:135: update target 'snapper/thr-polish.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/ -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o snapper/thr-polish.o -c snapper/thr-polish.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from snapper/snapper2.H:18,
>                  from snapper/thr-polish.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> In file included from snapper/snapper2.H:20:
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   127 |       fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   129 |       fprintf(stderr, "M = "uint64HEX"\n", m);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   130 |       fprintf(stderr, "H = "uint64HEX"\n", h);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   131 |       fprintf(stderr, "C = "uint64HEX"\n", c);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stderr, "R = "uint64HEX"\n", r);
>       |                       ^
> snapper/snapper2.H:421:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   421 |       fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn);
>       |                       ^
> snapper/snapper2.H:421:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   421 |       fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn);
>       |                                                              ^
> snapper/thr-polish.C:311:29: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   311 |             fprintf(stderr, "doPolish()-- Can't reallocate space for the output string ("uint32FMT" bytes) in thread "uint64FMT"\n", qry->theOutputMax, state->threadID);
>       |                             ^
> snapper/thr-polish.C:311:99: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   311 |             fprintf(stderr, "doPolish()-- Can't reallocate space for the output string ("uint32FMT" bytes) in thread "uint64FMT"\n", qry->theOutputMax, state->threadID);
>       |                                                                                                   ^
> snapper/snapper2.H: In member function ‘void hitMatrix::addHits(uint32, uint64*, uint64, uint64)’:
> snapper/snapper2.H:419:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=]
>   419 |     } catch (std::bad_alloc) {
>       |                   ^~~~~~~~~
> Make.rules:135: update target 'snapper/thr-filter.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/ -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o snapper/thr-filter.o -c snapper/thr-filter.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from snapper/snapper2.H:18,
>                  from snapper/thr-filter.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> In file included from snapper/snapper2.H:20:
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   127 |       fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   129 |       fprintf(stderr, "M = "uint64HEX"\n", m);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   130 |       fprintf(stderr, "H = "uint64HEX"\n", h);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   131 |       fprintf(stderr, "C = "uint64HEX"\n", c);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stderr, "R = "uint64HEX"\n", r);
>       |                       ^
> snapper/snapper2.H:421:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   421 |       fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn);
>       |                       ^
> snapper/snapper2.H:421:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   421 |       fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn);
>       |                                                              ^
> snapper/snapper2.H: In member function ‘void hitMatrix::addHits(uint32, uint64*, uint64, uint64)’:
> snapper/snapper2.H:419:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=]
>   419 |     } catch (std::bad_alloc) {
>       |                   ^~~~~~~~~
> Make.rules:135: update target 'snapper/thr-search.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/ -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o snapper/thr-search.o -c snapper/thr-search.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from snapper/snapper2.H:18,
>                  from snapper/thr-search.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> In file included from snapper/snapper2.H:20:
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   127 |       fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   129 |       fprintf(stderr, "M = "uint64HEX"\n", m);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   130 |       fprintf(stderr, "H = "uint64HEX"\n", h);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   131 |       fprintf(stderr, "C = "uint64HEX"\n", c);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stderr, "R = "uint64HEX"\n", r);
>       |                       ^
> snapper/snapper2.H:421:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   421 |       fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn);
>       |                       ^
> snapper/snapper2.H:421:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   421 |       fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn);
>       |                                                              ^
> snapper/snapper2.H: In member function ‘void hitMatrix::addHits(uint32, uint64*, uint64, uint64)’:
> snapper/snapper2.H:419:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=]
>   419 |     } catch (std::bad_alloc) {
>       |                   ^~~~~~~~~
> Make.rules:135: update target 'snapper/configuration.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/ -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o snapper/configuration.o -c snapper/configuration.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from snapper/snapper2.H:18,
>                  from snapper/configuration.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> In file included from snapper/snapper2.H:20:
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   127 |       fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   129 |       fprintf(stderr, "M = "uint64HEX"\n", m);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   130 |       fprintf(stderr, "H = "uint64HEX"\n", h);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   131 |       fprintf(stderr, "C = "uint64HEX"\n", c);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stderr, "R = "uint64HEX"\n", r);
>       |                       ^
> snapper/snapper2.H:421:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   421 |       fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn);
>       |                       ^
> snapper/snapper2.H:421:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   421 |       fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn);
>       |                                                              ^
> snapper/configuration.C:205:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   205 |     fprintf(stderr, "ERROR: Invalid afLength "uint32FMT", should be < 64.\n", _afLength), err++;
>       |                     ^
> snapper/snapper2.H: In member function ‘void hitMatrix::addHits(uint32, uint64*, uint64, uint64)’:
> snapper/snapper2.H:419:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=]
>   419 |     } catch (std::bad_alloc) {
>       |                   ^~~~~~~~~
> Make.rules:135: update target 'snapper/snapper2.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/ -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o snapper/snapper2.o -c snapper/snapper2.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from snapper/snapper2.H:18,
>                  from snapper/snapper2.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> In file included from snapper/snapper2.H:20:
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   127 |       fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   129 |       fprintf(stderr, "M = "uint64HEX"\n", m);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   130 |       fprintf(stderr, "H = "uint64HEX"\n", h);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   131 |       fprintf(stderr, "C = "uint64HEX"\n", c);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stderr, "R = "uint64HEX"\n", r);
>       |                       ^
> snapper/snapper2.H:421:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   421 |       fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn);
>       |                       ^
> snapper/snapper2.H:421:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   421 |       fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn);
>       |                                                              ^
> snapper/snapper2.C:59:18: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    59 |       fprintf(F, "%6.4f %6.4f %6.4f  %6.4f %6.4f  "uint32FMTW(8)" "uint32FMTW(8)" "uint32FMTW(8)" "uint32FMTW(8)"\n",
>       |                  ^
> snapper/snapper2.C:59:65: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    59 |       fprintf(F, "%6.4f %6.4f %6.4f  %6.4f %6.4f  "uint32FMTW(8)" "uint32FMTW(8)" "uint32FMTW(8)" "uint32FMTW(8)"\n",
>       |                                                                 ^
> snapper/snapper2.C:59:81: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    59 |       fprintf(F, "%6.4f %6.4f %6.4f  %6.4f %6.4f  "uint32FMTW(8)" "uint32FMTW(8)" "uint32FMTW(8)" "uint32FMTW(8)"\n",
>       |                                                                                 ^
> snapper/snapper2.C:59:97: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    59 |       fprintf(F, "%6.4f %6.4f %6.4f  %6.4f %6.4f  "uint32FMTW(8)" "uint32FMTW(8)" "uint32FMTW(8)" "uint32FMTW(8)"\n",
>       |                                                                                                 ^
> snapper/snapper2.C:248:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   248 |       fprintf(stderr, "WARNING:  Found "uint32FMT" queries shorter than minimum reportable size (-discardexonlength = "uint32FMT")\n",
>       |                       ^
> snapper/snapper2.C:248:50: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   248 |       fprintf(stderr, "WARNING:  Found "uint32FMT" queries shorter than minimum reportable size (-discardexonlength = "uint32FMT")\n",
>       |                                                  ^
> snapper/snapper2.C:254:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   254 |       fprintf(stderr, "WARNING:  Found "uint32FMT" queries longer than maximum size ("uint32FMT")\n",
>       |                       ^
> snapper/snapper2.C:254:50: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   254 |       fprintf(stderr, "WARNING:  Found "uint32FMT" queries longer than maximum size ("uint32FMT")\n",
>       |                                                  ^
> snapper/snapper2.C:295:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   295 |     fprintf(stderr, "Created "uint32FMT" filters (out of "uint32FMT" available) to test/validate.\n",
>       |                     ^
> snapper/snapper2.C:295:40: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   295 |     fprintf(stderr, "Created "uint32FMT" filters (out of "uint32FMT" available) to test/validate.\n",
>       |                                        ^
> snapper/snapper2.H: In member function ‘void hitMatrix::addHits(uint32, uint64*, uint64, uint64)’:
> snapper/snapper2.H:419:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=]
>   419 |     } catch (std::bad_alloc) {
>       |                   ^~~~~~~~~
> snapper/snapper2.C: In function ‘void writerThread(void*, void*)’:
> snapper/snapper2.C:155:10: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   155 |     write(resultFILE, qry->theOutput, sizeof(char) * qry->theOutputLen);
>       |     ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H: In member function ‘void logMsg::write(int, const char*)’:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:85:12: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>    85 |     ::write(file, _log, sizeof(char) * _logLen);
>       |     ~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> Make.rules:147: update target 'snapper/snapper2' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o snapper/snapper2 snapper/snapper2.o snapper/configuration.o snapper/thr-search.o snapper/thr-filter.o snapper/thr-polish.o snapper/thr-polish-dp.o snapper/hitMatrix.o snapper/hitMatrix-sort.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/libsim4.a /build/reproducible-path/kmer-0~20150903+r2013/libkmer/libkmer.a /build/reproducible-path/kmer-0~20150903+r2013/libmeryl/libmeryl.a /build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a /build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:135: update target 'sim4db/sim4th.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4db/sim4th.o -c sim4db/sim4th.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from sim4db/sim4th.C:34:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> sim4db/sim4th.C:327:20: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   327 |       sprintf(str, "%s -Y "uint32FMT" "uint32FMT"\n",
>       |                    ^
> sim4db/sim4th.C:327:37: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   327 |       sprintf(str, "%s -Y "uint32FMT" "uint32FMT"\n",
>       |                                     ^
> sim4db/sim4th.C: In function ‘void writer(void*, void*)’:
> sim4db/sim4th.C:316:10: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   316 |     write(fOutput, o, strlen(o) * sizeof(char));
>       |     ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> sim4db/sim4th.C:332:10: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   332 |     write(fYesNo, str, strlen(str) * sizeof(char));
>       |     ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> Make.rules:147: update target 'sim4db/sim4db' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o sim4db/sim4db sim4db/sim4th.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/libsim4.a /build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a /build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:135: update target 'sim4dbutils/reportAlignmentDifferences.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/reportAlignmentDifferences.o -c sim4dbutils/reportAlignmentDifferences.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish.H:11,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4.H:1,
>                  from sim4dbutils/reportAlignmentDifferences.C:6:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> sim4dbutils/reportAlignmentDifferences.C: In function ‘int main(int, char**)’:
> sim4dbutils/reportAlignmentDifferences.C:155:12: warning: suggest explicit braces to avoid ambiguous ‘else’ [-Wdangling-else]
>   155 |         if (e->_estAlignment[aPos] != '-')
>       |            ^
> sim4dbutils/reportAlignmentDifferences.C:201:9: warning: ignoring return value of ‘int system(const char*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   201 |   system(gnuCmd);
>       |   ~~~~~~^~~~~~~~
> sim4dbutils/reportAlignmentDifferences.C:200:30: warning: ‘%s’ directive writing up to 4095 bytes into a region of size 4086 [-Wformat-overflow=]
>   200 |   sprintf(gnuCmd, "gnuplot < %s", gnuName);
>       |                              ^~   ~~~~~~~
> In file included from /usr/include/stdio.h:970,
>                  from sim4dbutils/reportAlignmentDifferences.C:1:
> In function ‘int sprintf(char*, const char*, ...)’,
>     inlined from ‘int main(int, char**)’ at sim4dbutils/reportAlignmentDifferences.C:200:10:
> /usr/include/x86_64-linux-gnu/bits/stdio2.h:30:34: note: ‘__builtin___sprintf_chk’ output between 11 and 4106 bytes into a destination of size 4096
>    30 |   return __builtin___sprintf_chk (__s, __USE_FORTIFY_LEVEL - 1,
>       |          ~~~~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
>    31 |                                   __glibc_objsize (__s), __fmt,
>       |                                   ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
>    32 |                                   __va_arg_pack ());
>       |                                   ~~~~~~~~~~~~~~~~~
> Make.rules:147: update target 'sim4dbutils/reportAlignmentDifferences' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o sim4dbutils/reportAlignmentDifferences sim4dbutils/reportAlignmentDifferences.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/libsim4.a /build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a /build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:135: update target 'sim4dbutils/s4p_overlap.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/s4p_overlap.o -c sim4dbutils/s4p_overlap.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from sim4dbutils/s4p_overlap.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> Make.rules:135: update target 'sim4dbutils/removeRedundant.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/removeRedundant.o -c sim4dbutils/removeRedundant.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from sim4dbutils/removeRedundant.C:5:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> sim4dbutils/removeRedundant.C:107:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   107 |       fprintf(stderr, "IID="uint32FMTW(8)" -- overlap:"uint32FMT" noOverlap:"uint32FMT"\r",
>       |                       ^
> sim4dbutils/removeRedundant.C:107:42: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   107 |       fprintf(stderr, "IID="uint32FMTW(8)" -- overlap:"uint32FMT" noOverlap:"uint32FMT"\r",
>       |                                          ^
> sim4dbutils/removeRedundant.C:107:65: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   107 |       fprintf(stderr, "IID="uint32FMTW(8)" -- overlap:"uint32FMT" noOverlap:"uint32FMT"\r",
>       |                                                                 ^
> sim4dbutils/removeRedundant.C:212:29: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   212 |             fprintf(stderr, "\nNOT A PERFECT CLIQUE!  Found "uint32FMT" overlaps, wanted "uint32FMT" in the clique.\n",
>       |                             ^
> sim4dbutils/removeRedundant.C:212:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   212 |             fprintf(stderr, "\nNOT A PERFECT CLIQUE!  Found "uint32FMT" overlaps, wanted "uint32FMT" in the clique.\n",
>       |                                                                       ^
> sim4dbutils/removeRedundant.C:260:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   260 |   fprintf(stderr, "\nmatches withOvl:"uint32FMT" withoutOvl:"uint32FMT"\n",
>       |                   ^
> sim4dbutils/removeRedundant.C:260:48: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   260 |   fprintf(stderr, "\nmatches withOvl:"uint32FMT" withoutOvl:"uint32FMT"\n",
>       |                                                ^
> sim4dbutils/removeRedundant.C:262:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   262 |   fprintf(stderr, "not perfect clique:"uint32FMT"\n", notPerfectClique);
>       |                   ^
> Make.rules:147: update target 'sim4dbutils/removeRedundant' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o sim4dbutils/removeRedundant sim4dbutils/removeRedundant.o sim4dbutils/s4p_overlap.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/libsim4.a /build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a /build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:135: update target 'sim4dbutils/realignPolishes.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/realignPolishes.o -c sim4dbutils/realignPolishes.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from sim4dbutils/realignPolishes.C:6:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> sim4dbutils/realignPolishes.C:160:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   160 |                     "MERGE: "uint32FMTW(4)"-"uint32FMTW(4)" (%6.2f,%6.2f) "uint32FMTW(4)"-"uint32FMTW(4)
>       |                     ^
> sim4dbutils/realignPolishes.C:160:43: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   160 |                     "MERGE: "uint32FMTW(4)"-"uint32FMTW(4)" (%6.2f,%6.2f) "uint32FMTW(4)"-"uint32FMTW(4)
>       |                                           ^
> sim4dbutils/realignPolishes.C:160:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   160 |                     "MERGE: "uint32FMTW(4)"-"uint32FMTW(4)" (%6.2f,%6.2f) "uint32FMTW(4)"-"uint32FMTW(4)
>       |                                                           ^
> sim4dbutils/realignPolishes.C:160:89: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   160 |                     "MERGE: "uint32FMTW(4)"-"uint32FMTW(4)" (%6.2f,%6.2f) "uint32FMTW(4)"-"uint32FMTW(4)
>       |                                                                                         ^
> sim4dbutils/realignPolishes.C:161:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   161 |                     " and "uint32FMTW(8)"-"uint32FMTW(8)" (%6.2f,%6.2f) "uint32FMTW(8)"-"uint32FMTW(8)"\n",
>       |                     ^
> sim4dbutils/realignPolishes.C:161:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   161 |                     " and "uint32FMTW(8)"-"uint32FMTW(8)" (%6.2f,%6.2f) "uint32FMTW(8)"-"uint32FMTW(8)"\n",
>       |                                         ^
> sim4dbutils/realignPolishes.C:161:57: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   161 |                     " and "uint32FMTW(8)"-"uint32FMTW(8)" (%6.2f,%6.2f) "uint32FMTW(8)"-"uint32FMTW(8)"\n",
>       |                                                         ^
> sim4dbutils/realignPolishes.C:161:87: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   161 |                     " and "uint32FMTW(8)"-"uint32FMTW(8)" (%6.2f,%6.2f) "uint32FMTW(8)"-"uint32FMTW(8)"\n",
>       |                                                                                       ^
> sim4dbutils/realignPolishes.C:243:27: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   243 |           fprintf(stdout, "WARNING: CHANGED! "uint32FMT" -> "uint32FMT"\n", nm, p->_numMatches);
>       |                           ^
> sim4dbutils/realignPolishes.C:243:56: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   243 |           fprintf(stdout, "WARNING: CHANGED! "uint32FMT" -> "uint32FMT"\n", nm, p->_numMatches);
>       |                                                        ^
> sim4dbutils/realignPolishes.C:248:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   248 |       fprintf(mergeLog, "MERGED\tEST\t"uint32FMT"\tfrom\t%8.3f\t%8.3f\tto\t%8.3f\t%8.3f\n",
>       |                         ^
> Make.rules:147: update target 'sim4dbutils/realignPolishes' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o sim4dbutils/realignPolishes sim4dbutils/realignPolishes.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/libsim4.a /build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a /build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:135: update target 'sim4dbutils/vennPolishes.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/vennPolishes.o -c sim4dbutils/vennPolishes.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from sim4dbutils/vennPolishes.C:5:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> sim4dbutils/vennPolishes.C:115:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   115 |     fprintf(stderr, "WARNING:  You gave me "uint32FMT" files!  That's pretty big.  I don't know\n", numFiles);
>       |                     ^
> sim4dbutils/vennPolishes.C:175:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   175 |         fprintf(stdout, " "uint32FMTW(8)" ", counts[index]);
>       |                         ^
> sim4dbutils/vennPolishes.C:183:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   183 |       fprintf(stdout, "%c = ("uint32FMTW(8)" total) %s\n", 'A' + (char)i, sizes[i], argv[i+numArgs]);
>       |                       ^
> sim4dbutils/vennPolishes.C:189:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   189 |       fprintf(stdout, "]  "uint32FMT"\n", counts[index]);
>       |                       ^
> Make.rules:147: update target 'sim4dbutils/vennPolishes' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o sim4dbutils/vennPolishes sim4dbutils/vennPolishes.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/libsim4.a /build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a /build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:135: update target 'sim4dbutils/uniqPolishes.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/uniqPolishes.o -c sim4dbutils/uniqPolishes.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish.H:11,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4.H:1,
>                  from sim4dbutils/uniqPolishes.C:6:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> Make.rules:147: update target 'sim4dbutils/uniqPolishes' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o sim4dbutils/uniqPolishes sim4dbutils/uniqPolishes.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/libsim4.a /build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a /build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:135: update target 'sim4dbutils/summarizePolishes.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/summarizePolishes.o -c sim4dbutils/summarizePolishes.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from sim4dbutils/summarizePolishes.C:4:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> sim4dbutils/summarizePolishes.C:167:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   167 |   fprintf(stderr, "numSeqs:       "uint32FMT"\n", numSeqs);
>       |                   ^
> sim4dbutils/summarizePolishes.C:169:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   169 |   fprintf(stderr, "ids:           "uint32FMT" -- ", idLen);
>       |                   ^
> sim4dbutils/summarizePolishes.C:171:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   171 |     fprintf(stderr, " "uint32FMT"", id[i]);
>       |                     ^
> sim4dbutils/summarizePolishes.C:173:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   173 |   fprintf(stderr, "cvs:           "uint32FMT" -- ", cvLen);
>       |                   ^
> sim4dbutils/summarizePolishes.C:175:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   175 |     fprintf(stderr, " "uint32FMT"", cv[i]);
>       |                     ^
> sim4dbutils/summarizePolishes.C:244:34: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   244 |         fprintf(stdout, uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", id[i], cv[c], mapped, notmapped, uniqest, uniqgen);
>       |                                  ^
> sim4dbutils/summarizePolishes.C:244:47: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   244 |         fprintf(stdout, uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", id[i], cv[c], mapped, notmapped, uniqest, uniqgen);
>       |                                               ^
> sim4dbutils/summarizePolishes.C:244:60: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   244 |         fprintf(stdout, uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", id[i], cv[c], mapped, notmapped, uniqest, uniqgen);
>       |                                                            ^
> sim4dbutils/summarizePolishes.C:244:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   244 |         fprintf(stdout, uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", id[i], cv[c], mapped, notmapped, uniqest, uniqgen);
>       |                                                                         ^
> sim4dbutils/summarizePolishes.C:244:86: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   244 |         fprintf(stdout, uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", id[i], cv[c], mapped, notmapped, uniqest, uniqgen);
>       |                                                                                      ^
> sim4dbutils/summarizePolishes.C:247:38: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   247 |         fprintf(stdout, uint32FMTW(3)" "uint32FMTW(3)": mapped="uint32FMTW(8)" notmapped="uint32FMTW(8)"  est="uint32FMTW(8)" gen="uint32FMTW(8)"\n", id[i], cv[c], mapped, notmapped, uniqest, uniqgen);
>       |                                      ^
> sim4dbutils/summarizePolishes.C:247:54: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   247 |         fprintf(stdout, uint32FMTW(3)" "uint32FMTW(3)": mapped="uint32FMTW(8)" notmapped="uint32FMTW(8)"  est="uint32FMTW(8)" gen="uint32FMTW(8)"\n", id[i], cv[c], mapped, notmapped, uniqest, uniqgen);
>       |                                                      ^
> sim4dbutils/summarizePolishes.C:247:78: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   247 |         fprintf(stdout, uint32FMTW(3)" "uint32FMTW(3)": mapped="uint32FMTW(8)" notmapped="uint32FMTW(8)"  est="uint32FMTW(8)" gen="uint32FMTW(8)"\n", id[i], cv[c], mapped, notmapped, uniqest, uniqgen);
>       |                                                                              ^
> sim4dbutils/summarizePolishes.C:247:104: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   247 |         fprintf(stdout, uint32FMTW(3)" "uint32FMTW(3)": mapped="uint32FMTW(8)" notmapped="uint32FMTW(8)"  est="uint32FMTW(8)" gen="uint32FMTW(8)"\n", id[i], cv[c], mapped, notmapped, uniqest, uniqgen);
>       |                                                                                                        ^
> sim4dbutils/summarizePolishes.C:247:125: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   247 |         fprintf(stdout, uint32FMTW(3)" "uint32FMTW(3)": mapped="uint32FMTW(8)" notmapped="uint32FMTW(8)"  est="uint32FMTW(8)" gen="uint32FMTW(8)"\n", id[i], cv[c], mapped, notmapped, uniqest, uniqgen);
>       |                                                                                                                             ^
> Make.rules:147: update target 'sim4dbutils/summarizePolishes' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o sim4dbutils/summarizePolishes sim4dbutils/summarizePolishes.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/libsim4.a /build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a /build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:135: update target 'sim4dbutils/sortPolishes.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/sortPolishes.o -c sim4dbutils/sortPolishes.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish.H:11,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4.H:1,
>                  from sim4dbutils/sortPolishes.C:7:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> sim4dbutils/sortPolishes.C:87:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    87 |     fprintf(stderr, "Read: "uint32FMTW(8)" polishes -- "uint32FMTW(5)" temporary files -- "uint64FMTW(5)"MB / "uint64FMTW(5)"MB -- "uint64FMTW(5)" bytes/polish\r",
>       |                     ^
> sim4dbutils/sortPolishes.C:87:42: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    87 |     fprintf(stderr, "Read: "uint32FMTW(8)" polishes -- "uint32FMTW(5)" temporary files -- "uint64FMTW(5)"MB / "uint64FMTW(5)"MB -- "uint64FMTW(5)" bytes/polish\r",
>       |                                          ^
> sim4dbutils/sortPolishes.C:87:70: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    87 |     fprintf(stderr, "Read: "uint32FMTW(8)" polishes -- "uint32FMTW(5)" temporary files -- "uint64FMTW(5)"MB / "uint64FMTW(5)"MB -- "uint64FMTW(5)" bytes/polish\r",
>       |                                                                      ^
> sim4dbutils/sortPolishes.C:87:105: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    87 |     fprintf(stderr, "Read: "uint32FMTW(8)" polishes -- "uint32FMTW(5)" temporary files -- "uint64FMTW(5)"MB / "uint64FMTW(5)"MB -- "uint64FMTW(5)" bytes/polish\r",
>       |                                                                                                         ^
> sim4dbutils/sortPolishes.C:87:125: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    87 |     fprintf(stderr, "Read: "uint32FMTW(8)" polishes -- "uint32FMTW(5)" temporary files -- "uint64FMTW(5)"MB / "uint64FMTW(5)"MB -- "uint64FMTW(5)" bytes/polish\r",
>       |                                                                                                                             ^
> sim4dbutils/sortPolishes.C: In function ‘sim4polish* savePolish(sim4polish*, uint64*)’:
> sim4dbutils/sortPolishes.C:39:9: warning: ‘void* memcpy(void*, const void*, size_t)’ writing to an object of non-trivially copyable type ‘class sim4polish’; use copy-assignment or copy-initialization instead [-Wclass-memaccess]
>    39 |   memcpy(r, q, sizeof(sim4polish));
>       |   ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish.H:99:7: note: ‘class sim4polish’ declared here
>    99 | class sim4polish {
>       |       ^~~~~~~~~~
> sim4dbutils/sortPolishes.C:59:9: warning: ‘void* memcpy(void*, const void*, size_t)’ writing to an object of non-trivially copyable type ‘class sim4polishExon’; use copy-assignment or copy-initialization instead [-Wclass-memaccess]
>    59 |   memcpy(r->_exons, q->_exons, sizeof(sim4polishExon) * q->_numExons);
>       |   ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish.H:49:7: note: ‘class sim4polishExon’ declared here
>    49 | class sim4polishExon {
>       |       ^~~~~~~~~~~~~~
> Make.rules:147: update target 'sim4dbutils/sortPolishes' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o sim4dbutils/sortPolishes sim4dbutils/sortPolishes.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/libsim4.a /build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a /build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:135: update target 'sim4dbutils/removeDuplicate.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/removeDuplicate.o -c sim4dbutils/removeDuplicate.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish.H:11,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4.H:1,
>                  from sim4dbutils/removeDuplicate.C:6:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> Make.rules:147: update target 'sim4dbutils/removeDuplicate' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o sim4dbutils/removeDuplicate sim4dbutils/removeDuplicate.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/libsim4.a /build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a /build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:135: update target 'sim4dbutils/plotCoverageVsIdentity.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/plotCoverageVsIdentity.o -c sim4dbutils/plotCoverageVsIdentity.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish.H:11,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4.H:1,
>                  from sim4dbutils/plotCoverageVsIdentity.C:7:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> sim4dbutils/plotCoverageVsIdentity.C:32:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(S, uint32FMT" "uint32FMT"\n", p->_percentIdentity, p->_querySeqIdentity);
>       |                         ^
> Make.rules:147: update target 'sim4dbutils/plotCoverageVsIdentity' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o sim4dbutils/plotCoverageVsIdentity sim4dbutils/plotCoverageVsIdentity.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/libsim4.a /build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a /build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:135: update target 'sim4dbutils/pickUniquePolish.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/pickUniquePolish.o -c sim4dbutils/pickUniquePolish.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from sim4dbutils/pickUniquePolish.C:6:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish.H:11,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4.H:1,
>                  from sim4dbutils/pickUniquePolish.C:7:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> Make.rules:147: update target 'sim4dbutils/pickUniquePolish' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o sim4dbutils/pickUniquePolish sim4dbutils/pickUniquePolish.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/libsim4.a /build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a /build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:135: update target 'sim4dbutils/pickBestPair.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/pickBestPair.o -c sim4dbutils/pickBestPair.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from sim4dbutils/pickBestPair.C:5:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish.H:11,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4.H:1,
>                  from sim4dbutils/pickBestPair.C:6:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> sim4dbutils/pickBestPair.C:546:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   546 |             fprintf(LOG, "%c "uint32FMT" "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s\n",
>       |                          ^
> sim4dbutils/pickBestPair.C:546:40: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   546 |             fprintf(LOG, "%c "uint32FMT" "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s\n",
>       |                                        ^
> sim4dbutils/pickBestPair.C:546:52: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   546 |             fprintf(LOG, "%c "uint32FMT" "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s\n",
>       |                                                    ^
> sim4dbutils/pickBestPair.C:546:68: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   546 |             fprintf(LOG, "%c "uint32FMT" "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s\n",
>       |                                                                    ^
> sim4dbutils/pickBestPair.C:546:80: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   546 |             fprintf(LOG, "%c "uint32FMT" "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s\n",
>       |                                                                                ^
> sim4dbutils/pickBestPair.C:546:93: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   546 |             fprintf(LOG, "%c "uint32FMT" "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s\n",
>       |                                                                                             ^
> sim4dbutils/pickBestPair.C:546:109: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   546 |             fprintf(LOG, "%c "uint32FMT" "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s\n",
>       |                                                                                                             ^
> sim4dbutils/pickBestPair.C:546:121: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   546 |             fprintf(LOG, "%c "uint32FMT" "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s\n",
>       |                                                                                                                         ^
> sim4dbutils/pickBestPair.C:569:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   569 |             fprintf(LOG, "%c "uint32FMT" "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s\n",
>       |                          ^
> sim4dbutils/pickBestPair.C:569:40: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   569 |             fprintf(LOG, "%c "uint32FMT" "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s\n",
>       |                                        ^
> sim4dbutils/pickBestPair.C:569:52: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   569 |             fprintf(LOG, "%c "uint32FMT" "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s\n",
>       |                                                    ^
> sim4dbutils/pickBestPair.C:569:68: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   569 |             fprintf(LOG, "%c "uint32FMT" "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s\n",
>       |                                                                    ^
> sim4dbutils/pickBestPair.C:569:80: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   569 |             fprintf(LOG, "%c "uint32FMT" "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s\n",
>       |                                                                                ^
> sim4dbutils/pickBestPair.C:569:93: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   569 |             fprintf(LOG, "%c "uint32FMT" "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s\n",
>       |                                                                                             ^
> sim4dbutils/pickBestPair.C:569:109: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   569 |             fprintf(LOG, "%c "uint32FMT" "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s\n",
>       |                                                                                                             ^
> sim4dbutils/pickBestPair.C:569:121: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   569 |             fprintf(LOG, "%c "uint32FMT" "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s\n",
>       |                                                                                                                         ^
> sim4dbutils/pickBestPair.C:584:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   584 |   fprintf(STA, "alignments:      "uint32FMT" "uint32FMT"\n", mr1END, mr2END);
>       |                ^
> sim4dbutils/pickBestPair.C:584:44: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   584 |   fprintf(STA, "alignments:      "uint32FMT" "uint32FMT"\n", mr1END, mr2END);
>       |                                            ^
> sim4dbutils/pickBestPair.C: In function ‘int main(int, char**)’:
> sim4dbutils/pickBestPair.C:266:19: warning: variable ‘minIdent’ set but not used [-Wunused-but-set-variable]
>   266 |   double          minIdent    = 0;
>       |                   ^~~~~~~~
> sim4dbutils/pickBestPair.C:267:19: warning: variable ‘minLength’ set but not used [-Wunused-but-set-variable]
>   267 |   double          minLength   = 0;
>       |                   ^~~~~~~~~
> sim4dbutils/pickBestPair.C:268:19: warning: variable ‘minCoverage’ set but not used [-Wunused-but-set-variable]
>   268 |   double          minCoverage = 0;
>       |                   ^~~~~~~~~~~
> sim4dbutils/pickBestPair.C: In function ‘bool readMR(FILE*, mapResult&)’:
> sim4dbutils/pickBestPair.C:54:10: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>    54 |     fgets(line, 1024, in);
>       |     ~~~~~^~~~~~~~~~~~~~~~
> sim4dbutils/pickBestPair.C:57:8: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>    57 |   fgets(line, 1024, in);
>       |   ~~~~~^~~~~~~~~~~~~~~~
> sim4dbutils/pickBestPair.C: In function ‘bool readMRcoords(FILE*, mapResult&)’:
> sim4dbutils/pickBestPair.C:123:10: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   123 |     fgets(line, 1024, in);
>       |     ~~~~~^~~~~~~~~~~~~~~~
> sim4dbutils/pickBestPair.C:124:10: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   124 |     fgets(line, 1024, in);
>       |     ~~~~~^~~~~~~~~~~~~~~~
> sim4dbutils/pickBestPair.C:125:10: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   125 |     fgets(line, 1024, in);
>       |     ~~~~~^~~~~~~~~~~~~~~~
> sim4dbutils/pickBestPair.C:126:10: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   126 |     fgets(line, 1024, in);
>       |     ~~~~~^~~~~~~~~~~~~~~~
> sim4dbutils/pickBestPair.C:129:8: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   129 |   fgets(line, 1024, in);
>       |   ~~~~~^~~~~~~~~~~~~~~~
> sim4dbutils/pickBestPair.C: In function ‘bool readMRcoords(FILE*, mapResult&, bool&)’:
> sim4dbutils/pickBestPair.C:189:10: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   189 |     fgets(line, 1024, in);
>       |     ~~~~~^~~~~~~~~~~~~~~~
> sim4dbutils/pickBestPair.C:190:10: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   190 |     fgets(line, 1024, in);
>       |     ~~~~~^~~~~~~~~~~~~~~~
> sim4dbutils/pickBestPair.C:191:10: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   191 |     fgets(line, 1024, in);
>       |     ~~~~~^~~~~~~~~~~~~~~~
> sim4dbutils/pickBestPair.C:192:10: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   192 |     fgets(line, 1024, in);
>       |     ~~~~~^~~~~~~~~~~~~~~~
> sim4dbutils/pickBestPair.C:195:8: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   195 |   fgets(line, 1024, in);
>       |   ~~~~~^~~~~~~~~~~~~~~~
> sim4dbutils/pickBestPair.C: In function ‘int main(int, char**)’:
> sim4dbutils/pickBestPair.C:354:12: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   354 |       fgets(LL, 10240, IN);
>       |       ~~~~~^~~~~~~~~~~~~~~
> sim4dbutils/pickBestPair.C:365:14: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   365 |         fgets(LL, 10240, IN);
>       |         ~~~~~^~~~~~~~~~~~~~~
> Make.rules:147: update target 'sim4dbutils/pickBestPair' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o sim4dbutils/pickBestPair sim4dbutils/pickBestPair.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/libsim4.a /build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a /build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:135: update target 'sim4dbutils/pickBestPolish.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/pickBestPolish.o -c sim4dbutils/pickBestPolish.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from sim4dbutils/pickBestPolish.C:5:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish.H:11,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4.H:1,
>                  from sim4dbutils/pickBestPolish.C:6:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> sim4dbutils/pickBestPolish.C:35:27: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    35 |   fprintf(O, uint32FMTW(8)" "uint32FMTW(8)" "uint32FMTW(4)" "uint32FMTW(4),
>       |                           ^
> sim4dbutils/pickBestPolish.C:35:43: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    35 |   fprintf(O, uint32FMTW(8)" "uint32FMTW(8)" "uint32FMTW(4)" "uint32FMTW(4),
>       |                                           ^
> sim4dbutils/pickBestPolish.C:35:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    35 |   fprintf(O, uint32FMTW(8)" "uint32FMTW(8)" "uint32FMTW(4)" "uint32FMTW(4),
>       |                                                           ^
> sim4dbutils/pickBestPolish.C:39:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    39 |     fprintf(O, " ("uint32FMTW(6)"/"uint32FMTW(6)" "uint32FMTW(6)"/"uint32FMTW(6)" "uint32FMTW(3)")",
>       |                ^
> sim4dbutils/pickBestPolish.C:39:33: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    39 |     fprintf(O, " ("uint32FMTW(6)"/"uint32FMTW(6)" "uint32FMTW(6)"/"uint32FMTW(6)" "uint32FMTW(3)")",
>       |                                 ^
> sim4dbutils/pickBestPolish.C:39:49: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    39 |     fprintf(O, " ("uint32FMTW(6)"/"uint32FMTW(6)" "uint32FMTW(6)"/"uint32FMTW(6)" "uint32FMTW(3)")",
>       |                                                 ^
> sim4dbutils/pickBestPolish.C:39:65: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    39 |     fprintf(O, " ("uint32FMTW(6)"/"uint32FMTW(6)" "uint32FMTW(6)"/"uint32FMTW(6)" "uint32FMTW(3)")",
>       |                                                                 ^
> sim4dbutils/pickBestPolish.C:39:81: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    39 |     fprintf(O, " ("uint32FMTW(6)"/"uint32FMTW(6)" "uint32FMTW(6)"/"uint32FMTW(6)" "uint32FMTW(3)")",
>       |                                                                                 ^
> sim4dbutils/pickBestPolish.C:69:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    69 |     fprintf(stderr, "Picking Best for estID="uint32FMT" with %5d choices.\r", p[0]->_estID, pNum);
>       |                     ^
> Make.rules:147: update target 'sim4dbutils/pickBestPolish' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o sim4dbutils/pickBestPolish sim4dbutils/pickBestPolish.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/libsim4.a /build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a /build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:135: update target 'sim4dbutils/parseSNP.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/parseSNP.o -c sim4dbutils/parseSNP.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from sim4dbutils/parseSNP.C:9:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish.H:11,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4.H:1,
>                  from sim4dbutils/parseSNP.C:10:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> sim4dbutils/parseSNP.C:229:18: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   229 |       fprintf(F, "%s %s "uint32FMT" %c/%c %s global["uint32FMT" "uint32FMT"] exon["uint32FMT" "uint32FMT" "uint32FMT" "uint32FMT"]\n",
>       |                  ^
> sim4dbutils/parseSNP.C:229:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   229 |       fprintf(F, "%s %s "uint32FMT" %c/%c %s global["uint32FMT" "uint32FMT"] exon["uint32FMT" "uint32FMT" "uint32FMT" "uint32FMT"]\n",
>       |                                   ^
> sim4dbutils/parseSNP.C:229:63: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   229 |       fprintf(F, "%s %s "uint32FMT" %c/%c %s global["uint32FMT" "uint32FMT"] exon["uint32FMT" "uint32FMT" "uint32FMT" "uint32FMT"]\n",
>       |                                                               ^
> sim4dbutils/parseSNP.C:229:75: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   229 |       fprintf(F, "%s %s "uint32FMT" %c/%c %s global["uint32FMT" "uint32FMT"] exon["uint32FMT" "uint32FMT" "uint32FMT" "uint32FMT"]\n",
>       |                                                                           ^
> sim4dbutils/parseSNP.C:229:93: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   229 |       fprintf(F, "%s %s "uint32FMT" %c/%c %s global["uint32FMT" "uint32FMT"] exon["uint32FMT" "uint32FMT" "uint32FMT" "uint32FMT"]\n",
>       |                                                                                             ^
> sim4dbutils/parseSNP.C:229:105: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   229 |       fprintf(F, "%s %s "uint32FMT" %c/%c %s global["uint32FMT" "uint32FMT"] exon["uint32FMT" "uint32FMT" "uint32FMT" "uint32FMT"]\n",
>       |                                                                                                         ^
> sim4dbutils/parseSNP.C:229:117: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   229 |       fprintf(F, "%s %s "uint32FMT" %c/%c %s global["uint32FMT" "uint32FMT"] exon["uint32FMT" "uint32FMT" "uint32FMT" "uint32FMT"]\n",
>       |                                                                                                                     ^
> sim4dbutils/parseSNP.C:269:18: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   269 |       fprintf(F, "%s %s "uint32FMT" sa=%c ga=%c mo=%c pi="uint32FMT" pc="uint32FMT" nb="uint32FMT" bl="uint32FMT" bp="uint32FMT" bi="uint32FMT" bc="uint32FMT"\n",
>       |                  ^
> sim4dbutils/parseSNP.C:269:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   269 |       fprintf(F, "%s %s "uint32FMT" sa=%c ga=%c mo=%c pi="uint32FMT" pc="uint32FMT" nb="uint32FMT" bl="uint32FMT" bp="uint32FMT" bi="uint32FMT" bc="uint32FMT"\n",
>       |                                   ^
> sim4dbutils/parseSNP.C:269:68: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   269 |       fprintf(F, "%s %s "uint32FMT" sa=%c ga=%c mo=%c pi="uint32FMT" pc="uint32FMT" nb="uint32FMT" bl="uint32FMT" bp="uint32FMT" bi="uint32FMT" bc="uint32FMT"\n",
>       |                                                                    ^
> sim4dbutils/parseSNP.C:269:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   269 |       fprintf(F, "%s %s "uint32FMT" sa=%c ga=%c mo=%c pi="uint32FMT" pc="uint32FMT" nb="uint32FMT" bl="uint32FMT" bp="uint32FMT" bi="uint32FMT" bc="uint32FMT"\n",
>       |                                                                                   ^
> sim4dbutils/parseSNP.C:269:98: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   269 |       fprintf(F, "%s %s "uint32FMT" sa=%c ga=%c mo=%c pi="uint32FMT" pc="uint32FMT" nb="uint32FMT" bl="uint32FMT" bp="uint32FMT" bi="uint32FMT" bc="uint32FMT"\n",
>       |                                                                                                  ^
> sim4dbutils/parseSNP.C:269:113: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   269 |       fprintf(F, "%s %s "uint32FMT" sa=%c ga=%c mo=%c pi="uint32FMT" pc="uint32FMT" nb="uint32FMT" bl="uint32FMT" bp="uint32FMT" bi="uint32FMT" bc="uint32FMT"\n",
>       |                                                                                                                 ^
> sim4dbutils/parseSNP.C:269:128: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   269 |       fprintf(F, "%s %s "uint32FMT" sa=%c ga=%c mo=%c pi="uint32FMT" pc="uint32FMT" nb="uint32FMT" bl="uint32FMT" bp="uint32FMT" bi="uint32FMT" bc="uint32FMT"\n",
>       |                                                                                                                                ^
> sim4dbutils/parseSNP.C:269:143: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   269 |       fprintf(F, "%s %s "uint32FMT" sa=%c ga=%c mo=%c pi="uint32FMT" pc="uint32FMT" nb="uint32FMT" bl="uint32FMT" bp="uint32FMT" bi="uint32FMT" bc="uint32FMT"\n",
>       |                                                                                                                                               ^
> sim4dbutils/parseSNP.C:538:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   538 |       fprintf(stderr, "ERROR:  Polishes not sorted by SNP idx!  this="uint32FMT", looking for "uint32FMT"\n",
>       |                       ^
> sim4dbutils/parseSNP.C:538:80: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   538 |       fprintf(stderr, "ERROR:  Polishes not sorted by SNP idx!  this="uint32FMT", looking for "uint32FMT"\n",
>       |                                                                                ^
> Make.rules:147: update target 'sim4dbutils/parseSNP' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o sim4dbutils/parseSNP sim4dbutils/parseSNP.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/libsim4.a /build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a /build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:135: update target 'sim4dbutils/mergePolishes.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/mergePolishes.o -c sim4dbutils/mergePolishes.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from sim4dbutils/mergePolishes.C:5:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> sim4dbutils/mergePolishes.C: In function ‘int main(int, char**)’:
> sim4dbutils/mergePolishes.C:139:10: warning: ‘void operator delete(void*)’ called on pointer returned from a mismatched allocation function [-Wmismatched-new-delete]
>   139 |   delete inMatch;
>       |          ^~~~~~~
> sim4dbutils/mergePolishes.C:28:62: note: returned from ‘void* operator new [](std::size_t)’
>    28 |   sim4polishReader  **inMatch  = new sim4polishReader * [argc];
>       |                                                              ^
> Make.rules:147: update target 'sim4dbutils/mergePolishes' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o sim4dbutils/mergePolishes sim4dbutils/mergePolishes.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/libsim4.a /build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a /build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:135: update target 'sim4dbutils/mappedCoverage.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/mappedCoverage.o -c sim4dbutils/mappedCoverage.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from sim4dbutils/mappedCoverage.C:6:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish.H:11,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4.H:1,
>                  from sim4dbutils/mappedCoverage.C:7:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> sim4dbutils/mappedCoverage.C:94:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    94 |   fprintf(stderr, "Found "uint32FMT" sequences in the input file.\n", covMax);
>       |                   ^
> sim4dbutils/mappedCoverage.C:130:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   130 |         fprintf(stderr, "ERROR:  Found iid "uint32FMT", but only allocated "uint32FMT" places!\n",
>       |                         ^
> sim4dbutils/mappedCoverage.C:130:54: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   130 |         fprintf(stderr, "ERROR:  Found iid "uint32FMT", but only allocated "uint32FMT" places!\n",
>       |                                                      ^
> sim4dbutils/mappedCoverage.C:153:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   153 |         fprintf(stderr, "ERROR:  Found iid "uint32FMT", but only allocated "uint32FMT" places!\n",
>       |                         ^
> sim4dbutils/mappedCoverage.C:153:54: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   153 |         fprintf(stderr, "ERROR:  Found iid "uint32FMT", but only allocated "uint32FMT" places!\n",
>       |                                                      ^
> sim4dbutils/mappedCoverage.C:219:29: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   219 |             fprintf(stderr, "ERROR:  range "uint32FMT"-"uint32FMT" out of bounds (seqLen = "uint32FMT")\n",
>       |                             ^
> sim4dbutils/mappedCoverage.C:219:54: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   219 |             fprintf(stderr, "ERROR:  range "uint32FMT"-"uint32FMT" out of bounds (seqLen = "uint32FMT")\n",
>       |                                                      ^
> sim4dbutils/mappedCoverage.C:219:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   219 |             fprintf(stderr, "ERROR:  range "uint32FMT"-"uint32FMT" out of bounds (seqLen = "uint32FMT")\n",
>       |                                                                  ^
> sim4dbutils/mappedCoverage.C:242:27: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   242 |       fprintf(C, uint32FMT"\t"uint32FMT"\t%5.3f\t"uint32FMT"\t"uint32FMT"\n",
>       |                           ^
> sim4dbutils/mappedCoverage.C:242:40: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   242 |       fprintf(C, uint32FMT"\t"uint32FMT"\t%5.3f\t"uint32FMT"\t"uint32FMT"\n",
>       |                                        ^
> sim4dbutils/mappedCoverage.C:242:60: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   242 |       fprintf(C, uint32FMT"\t"uint32FMT"\t%5.3f\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                            ^
> sim4dbutils/mappedCoverage.C: In function ‘int main(int, char**)’:
> sim4dbutils/mappedCoverage.C:106:12: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   106 |       fgets(inLine, 1024, stdin);
>       |       ~~~~~^~~~~~~~~~~~~~~~~~~~~
> Make.rules:147: update target 'sim4dbutils/mappedCoverage' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o sim4dbutils/mappedCoverage sim4dbutils/mappedCoverage.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/libsim4.a /build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a /build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:135: update target 'sim4dbutils/headPolishes.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/headPolishes.o -c sim4dbutils/headPolishes.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish.H:11,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4.H:1,
>                  from sim4dbutils/headPolishes.C:6:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> Make.rules:147: update target 'sim4dbutils/headPolishes' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o sim4dbutils/headPolishes sim4dbutils/headPolishes.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/libsim4.a /build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a /build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:135: update target 'sim4dbutils/filterPolishes.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/filterPolishes.o -c sim4dbutils/filterPolishes.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from sim4dbutils/filterPolishes.C:7:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish.H:11,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4.H:1,
>                  from sim4dbutils/filterPolishes.C:8:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> sim4dbutils/filterPolishes.C:178:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   178 |     fprintf(stderr, "Filtering at "uint32FMT"%% coverage and "uint32FMT"%% identity and "uint32FMT"bp.\n", minC, minI, minL);
>       |                     ^
> sim4dbutils/filterPolishes.C:178:45: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   178 |     fprintf(stderr, "Filtering at "uint32FMT"%% coverage and "uint32FMT"%% identity and "uint32FMT"bp.\n", minC, minI, minL);
>       |                                             ^
> sim4dbutils/filterPolishes.C:178:72: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   178 |     fprintf(stderr, "Filtering at "uint32FMT"%% coverage and "uint32FMT"%% identity and "uint32FMT"bp.\n", minC, minI, minL);
>       |                                                                        ^
> sim4dbutils/filterPolishes.C:181:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   181 |       fprintf(stderr, "Filtering for cDNA idx "uint32FMT" and genomic idx "uint32FMT"\n", cdna, geno);
>       |                       ^
> sim4dbutils/filterPolishes.C:181:57: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   181 |       fprintf(stderr, "Filtering for cDNA idx "uint32FMT" and genomic idx "uint32FMT"\n", cdna, geno);
>       |                                                         ^
> sim4dbutils/filterPolishes.C:183:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   183 |       fprintf(stderr, "Filtering for cDNA idx "uint32FMT".\n", cdna);
>       |                       ^
> sim4dbutils/filterPolishes.C:185:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   185 |       fprintf(stderr, "Filtering for genomic idx "uint32FMT".\n", geno);
>       |                       ^
> sim4dbutils/filterPolishes.C:259:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   259 |         fprintf(stderr, " Filter: %6.2f%% ("uint64FMT" matches processed) ("uint64FMT" failed/intractable)\r",
>       |                         ^
> sim4dbutils/filterPolishes.C:259:54: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   259 |         fprintf(stderr, " Filter: %6.2f%% ("uint64FMT" matches processed) ("uint64FMT" failed/intractable)\r",
>       |                                                      ^
> sim4dbutils/filterPolishes.C:264:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   264 |         fprintf(stderr, " Filter: %6.2f%% ("uint64FMT" matches processed)\r",
>       |                         ^
> sim4dbutils/filterPolishes.C:274:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   274 |       fprintf(stderr, " Filter: %6.2f%% ("uint64FMT" matches processed) ("uint64FMT" failed/intractable)\n",
>       |                       ^
> sim4dbutils/filterPolishes.C:274:52: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   274 |       fprintf(stderr, " Filter: %6.2f%% ("uint64FMT" matches processed) ("uint64FMT" failed/intractable)\n",
>       |                                                    ^
> sim4dbutils/filterPolishes.C:279:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   279 |       fprintf(stderr, " Filter: %6.2f%% ("uint64FMT" matches processed)\n",
>       |                       ^
> Make.rules:147: update target 'sim4dbutils/filterPolishes' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o sim4dbutils/filterPolishes sim4dbutils/filterPolishes.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/libsim4.a /build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a /build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:135: update target 'sim4dbutils/depthOfPolishes.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/depthOfPolishes.o -c sim4dbutils/depthOfPolishes.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish.H:11,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4.H:1,
>                  from sim4dbutils/depthOfPolishes.C:6:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> sim4dbutils/depthOfPolishes.C:103:30: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   103 |     fprintf(stdout, uint32FMT"\t"uint32FMT"\t%.2f\t%.2f\t%.2f\t%.2f\t%.2f\t%.2f\t%.2f\t%.2f\t%.2f\n",
>       |                              ^
> Make.rules:147: update target 'sim4dbutils/depthOfPolishes' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o sim4dbutils/depthOfPolishes sim4dbutils/depthOfPolishes.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/libsim4.a /build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a /build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:135: update target 'sim4dbutils/detectChimera.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/detectChimera.o -c sim4dbutils/detectChimera.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish.H:11,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4.H:1,
>                  from sim4dbutils/detectChimera.C:6:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> sim4dbutils/detectChimera.C:129:40: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   129 |           fprintf(stdout, uint32FMTW(3)"-"uint32FMTW(3)" %s%s ("uint32FMT","uint32FMT")\n",
>       |                                        ^
> sim4dbutils/detectChimera.C:129:56: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   129 |           fprintf(stdout, uint32FMTW(3)"-"uint32FMTW(3)" %s%s ("uint32FMT","uint32FMT")\n",
>       |                                                        ^
> sim4dbutils/detectChimera.C:129:74: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   129 |           fprintf(stdout, uint32FMTW(3)"-"uint32FMTW(3)" %s%s ("uint32FMT","uint32FMT")\n",
>       |                                                                          ^
> sim4dbutils/detectChimera.C:153:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   153 |       fprintf(stdout, "first "uint32FMT" alignments.\n", maxPts);
>       |                       ^
> sim4dbutils/detectChimera.C: In function ‘int main(int, char**)’:
> sim4dbutils/detectChimera.C:19:10: warning: variable ‘beVerbose’ set but not used [-Wunused-but-set-variable]
>    19 |   bool   beVerbose      = false;
>       |          ^~~~~~~~~
> Make.rules:147: update target 'sim4dbutils/detectChimera' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o sim4dbutils/detectChimera sim4dbutils/detectChimera.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/libsim4.a /build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a /build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:135: update target 'sim4dbutils/convertPolishes.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/convertPolishes.o -c sim4dbutils/convertPolishes.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from sim4dbutils/convertPolishes.C:7:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish.H:11,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4.H:1,
>                  from sim4dbutils/convertPolishes.C:8:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> Make.rules:147: update target 'sim4dbutils/convertPolishes' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o sim4dbutils/convertPolishes sim4dbutils/convertPolishes.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/libsim4.a /build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a /build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:135: update target 'sim4dbutils/convertToExtent.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/convertToExtent.o -c sim4dbutils/convertToExtent.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish.H:11,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4.H:1,
>                  from sim4dbutils/convertToExtent.C:6:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> sim4dbutils/convertToExtent.C:43:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    43 |     fprintf(stdout, "%s\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%s\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%6.3f\t%6.3f\n",
>       |                     ^
> sim4dbutils/convertToExtent.C:43:36: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    43 |     fprintf(stdout, "%s\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%s\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%6.3f\t%6.3f\n",
>       |                                    ^
> sim4dbutils/convertToExtent.C:43:49: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    43 |     fprintf(stdout, "%s\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%s\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%6.3f\t%6.3f\n",
>       |                                                 ^
> sim4dbutils/convertToExtent.C:43:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    43 |     fprintf(stdout, "%s\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%s\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%6.3f\t%6.3f\n",
>       |                                                              ^
> sim4dbutils/convertToExtent.C:43:75: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    43 |     fprintf(stdout, "%s\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%s\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%6.3f\t%6.3f\n",
>       |                                                                           ^
> sim4dbutils/convertToExtent.C:43:88: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    43 |     fprintf(stdout, "%s\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%s\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%6.3f\t%6.3f\n",
>       |                                                                                        ^
> sim4dbutils/convertToExtent.C:43:105: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    43 |     fprintf(stdout, "%s\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%s\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%6.3f\t%6.3f\n",
>       |                                                                                                         ^
> sim4dbutils/convertToExtent.C:43:118: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    43 |     fprintf(stdout, "%s\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%s\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%6.3f\t%6.3f\n",
>       |                                                                                                                      ^
> sim4dbutils/convertToExtent.C:50:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    50 |     fprintf(stdout, "%s\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%s\t"uint32FMT"\t"uint32FMT"\t%6.3f\t%6.3f\n",
>       |                     ^
> sim4dbutils/convertToExtent.C:50:36: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    50 |     fprintf(stdout, "%s\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%s\t"uint32FMT"\t"uint32FMT"\t%6.3f\t%6.3f\n",
>       |                                    ^
> sim4dbutils/convertToExtent.C:50:49: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    50 |     fprintf(stdout, "%s\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%s\t"uint32FMT"\t"uint32FMT"\t%6.3f\t%6.3f\n",
>       |                                                 ^
> sim4dbutils/convertToExtent.C:50:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    50 |     fprintf(stdout, "%s\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%s\t"uint32FMT"\t"uint32FMT"\t%6.3f\t%6.3f\n",
>       |                                                              ^
> sim4dbutils/convertToExtent.C:50:75: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    50 |     fprintf(stdout, "%s\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%s\t"uint32FMT"\t"uint32FMT"\t%6.3f\t%6.3f\n",
>       |                                                                           ^
> sim4dbutils/convertToExtent.C:50:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    50 |     fprintf(stdout, "%s\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%s\t"uint32FMT"\t"uint32FMT"\t%6.3f\t%6.3f\n",
>       |                                                                                            ^
> sim4dbutils/convertToExtent.C: In function ‘int main(int, char**)’:
> sim4dbutils/convertToExtent.C:59:8: warning: variable ‘beVerbose’ set but not used [-Wunused-but-set-variable]
>    59 |   bool beVerbose     = false;
>       |        ^~~~~~~~~
> Make.rules:147: update target 'sim4dbutils/convertToExtent' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o sim4dbutils/convertToExtent sim4dbutils/convertToExtent.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/libsim4.a /build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a /build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:135: update target 'sim4dbutils/convertToAtac.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/convertToAtac.o -c sim4dbutils/convertToAtac.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish.H:11,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4.H:1,
>                  from sim4dbutils/convertToAtac.C:6:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> sim4dbutils/convertToAtac.C:279:31: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   279 |               fprintf(stdout, "M u dupr"uint32FMT" dupp"uint32FMT" %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s\n",
>       |                               ^
> sim4dbutils/convertToAtac.C:279:50: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   279 |               fprintf(stdout, "M u dupr"uint32FMT" dupp"uint32FMT" %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s\n",
>       |                                                  ^
> sim4dbutils/convertToAtac.C:279:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   279 |               fprintf(stdout, "M u dupr"uint32FMT" dupp"uint32FMT" %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s\n",
>       |                                                                  ^
> sim4dbutils/convertToAtac.C:279:81: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   279 |               fprintf(stdout, "M u dupr"uint32FMT" dupp"uint32FMT" %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s\n",
>       |                                                                                 ^
> sim4dbutils/convertToAtac.C:279:93: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   279 |               fprintf(stdout, "M u dupr"uint32FMT" dupp"uint32FMT" %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s\n",
>       |                                                                                             ^
> sim4dbutils/convertToAtac.C:279:105: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   279 |               fprintf(stdout, "M u dupr"uint32FMT" dupp"uint32FMT" %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s\n",
>       |                                                                                                         ^
> sim4dbutils/convertToAtac.C:279:122: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   279 |               fprintf(stdout, "M u dupr"uint32FMT" dupp"uint32FMT" %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s\n",
>       |                                                                                                                          ^
> sim4dbutils/convertToAtac.C:279:134: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   279 |               fprintf(stdout, "M u dupr"uint32FMT" dupp"uint32FMT" %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s\n",
>       |                                                                                                                                      ^
> sim4dbutils/convertToAtac.C:286:31: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   286 |               fprintf(stdout, "M u dupr"uint32FMT" dupp"uint32FMT" %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s\n",
>       |                               ^
> sim4dbutils/convertToAtac.C:286:50: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   286 |               fprintf(stdout, "M u dupr"uint32FMT" dupp"uint32FMT" %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s\n",
>       |                                                  ^
> sim4dbutils/convertToAtac.C:286:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   286 |               fprintf(stdout, "M u dupr"uint32FMT" dupp"uint32FMT" %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s\n",
>       |                                                                  ^
> sim4dbutils/convertToAtac.C:286:81: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   286 |               fprintf(stdout, "M u dupr"uint32FMT" dupp"uint32FMT" %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s\n",
>       |                                                                                 ^
> sim4dbutils/convertToAtac.C:286:93: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   286 |               fprintf(stdout, "M u dupr"uint32FMT" dupp"uint32FMT" %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s\n",
>       |                                                                                             ^
> sim4dbutils/convertToAtac.C:286:105: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   286 |               fprintf(stdout, "M u dupr"uint32FMT" dupp"uint32FMT" %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s\n",
>       |                                                                                                         ^
> sim4dbutils/convertToAtac.C:286:122: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   286 |               fprintf(stdout, "M u dupr"uint32FMT" dupp"uint32FMT" %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s\n",
>       |                                                                                                                          ^
> sim4dbutils/convertToAtac.C:286:134: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   286 |               fprintf(stdout, "M u dupr"uint32FMT" dupp"uint32FMT" %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s\n",
>       |                                                                                                                                      ^
> sim4dbutils/convertToAtac.C:330:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   330 |   fprintf(stderr, "Fixed "uint32FMT" indel/mismatches.\n", totalFixed);
>       |                   ^
> sim4dbutils/convertToAtac.C: In function ‘int main(int, char**)’:
> sim4dbutils/convertToAtac.C:241:12: warning: suggest explicit braces to avoid ambiguous ‘else’ [-Wdangling-else]
>   241 |         if (e->_estAlignment[aPos] != '-')
>       |            ^
> sim4dbutils/convertToAtac.C:310:16: warning: suggest explicit braces to avoid ambiguous ‘else’ [-Wdangling-else]
>   310 |             if (e->_estAlignment[aPos] != '-')
>       |                ^
> Make.rules:147: update target 'sim4dbutils/convertToAtac' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o sim4dbutils/convertToAtac sim4dbutils/convertToAtac.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/libsim4.a /build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a /build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:135: update target 'sim4dbutils/comparePolishes.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/comparePolishes.o -c sim4dbutils/comparePolishes.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from sim4dbutils/comparePolishes.C:6:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> sim4dbutils/comparePolishes.C:308:36: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   308 |           fprintf(stdout, uint32FMT"\t"uint32FMT"\t"OLAPTFMT"\t%f\t%8.3f\t%8.3f\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%8.3f\t%8.3f\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                    ^
> sim4dbutils/comparePolishes.C:308:49: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   308 |           fprintf(stdout, uint32FMT"\t"uint32FMT"\t"OLAPTFMT"\t%f\t%8.3f\t%8.3f\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%8.3f\t%8.3f\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                 ^
> sim4dbutils/comparePolishes.C:308:61: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   308 |           fprintf(stdout, uint32FMT"\t"uint32FMT"\t"OLAPTFMT"\t%f\t%8.3f\t%8.3f\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%8.3f\t%8.3f\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                             ^
> sim4dbutils/comparePolishes.C:308:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   308 |           fprintf(stdout, uint32FMT"\t"uint32FMT"\t"OLAPTFMT"\t%f\t%8.3f\t%8.3f\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%8.3f\t%8.3f\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                            ^
> sim4dbutils/comparePolishes.C:308:105: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   308 |           fprintf(stdout, uint32FMT"\t"uint32FMT"\t"OLAPTFMT"\t%f\t%8.3f\t%8.3f\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%8.3f\t%8.3f\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                                         ^
> sim4dbutils/comparePolishes.C:308:118: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   308 |           fprintf(stdout, uint32FMT"\t"uint32FMT"\t"OLAPTFMT"\t%f\t%8.3f\t%8.3f\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%8.3f\t%8.3f\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                                                      ^
> sim4dbutils/comparePolishes.C:308:145: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   308 |           fprintf(stdout, uint32FMT"\t"uint32FMT"\t"OLAPTFMT"\t%f\t%8.3f\t%8.3f\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%8.3f\t%8.3f\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                                                                                 ^
> sim4dbutils/comparePolishes.C:308:158: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   308 |           fprintf(stdout, uint32FMT"\t"uint32FMT"\t"OLAPTFMT"\t%f\t%8.3f\t%8.3f\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%8.3f\t%8.3f\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n",
>       |                                                                                                                                                              ^
> sim4dbutils/comparePolishes.C:452:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   452 |         fprintf(stderr, "ERROR!  inA="uint32FMT" inB="uint32FMT"\n", inA, inB);
>       |                         ^
> sim4dbutils/comparePolishes.C:452:48: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   452 |         fprintf(stderr, "ERROR!  inA="uint32FMT" inB="uint32FMT"\n", inA, inB);
>       |                                                ^
> sim4dbutils/comparePolishes.C:484:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   484 |       fprintf(stderr, "IID:"uint32FMTW(8)"  good:"uint32FMTW(4)" Anovel:"uint32FMTW(4)" Amulti:"uint32FMTW(4)" Bnovel:"uint32FMTW(4)" Bmulti:"uint32FMTW(4)" hairy:"uint32FMTW(4)"\r",
>       |                       ^
> sim4dbutils/comparePolishes.C:484:42: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   484 |       fprintf(stderr, "IID:"uint32FMTW(8)"  good:"uint32FMTW(4)" Anovel:"uint32FMTW(4)" Amulti:"uint32FMTW(4)" Bnovel:"uint32FMTW(4)" Bmulti:"uint32FMTW(4)" hairy:"uint32FMTW(4)"\r",
>       |                                          ^
> sim4dbutils/comparePolishes.C:484:64: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   484 |       fprintf(stderr, "IID:"uint32FMTW(8)"  good:"uint32FMTW(4)" Anovel:"uint32FMTW(4)" Amulti:"uint32FMTW(4)" Bnovel:"uint32FMTW(4)" Bmulti:"uint32FMTW(4)" hairy:"uint32FMTW(4)"\r",
>       |                                                                ^
> sim4dbutils/comparePolishes.C:484:87: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   484 |       fprintf(stderr, "IID:"uint32FMTW(8)"  good:"uint32FMTW(4)" Anovel:"uint32FMTW(4)" Amulti:"uint32FMTW(4)" Bnovel:"uint32FMTW(4)" Bmulti:"uint32FMTW(4)" hairy:"uint32FMTW(4)"\r",
>       |                                                                                       ^
> sim4dbutils/comparePolishes.C:484:110: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   484 |       fprintf(stderr, "IID:"uint32FMTW(8)"  good:"uint32FMTW(4)" Anovel:"uint32FMTW(4)" Amulti:"uint32FMTW(4)" Bnovel:"uint32FMTW(4)" Bmulti:"uint32FMTW(4)" hairy:"uint32FMTW(4)"\r",
>       |                                                                                                              ^
> sim4dbutils/comparePolishes.C:484:133: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   484 |       fprintf(stderr, "IID:"uint32FMTW(8)"  good:"uint32FMTW(4)" Anovel:"uint32FMTW(4)" Amulti:"uint32FMTW(4)" Bnovel:"uint32FMTW(4)" Bmulti:"uint32FMTW(4)" hairy:"uint32FMTW(4)"\r",
>       |                                                                                                                                     ^
> sim4dbutils/comparePolishes.C:484:156: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   484 |       fprintf(stderr, "IID:"uint32FMTW(8)"  good:"uint32FMTW(4)" Anovel:"uint32FMTW(4)" Amulti:"uint32FMTW(4)" Bnovel:"uint32FMTW(4)" Bmulti:"uint32FMTW(4)" hairy:"uint32FMTW(4)"\r",
>       |                                                                                                                                                            ^
> sim4dbutils/comparePolishes.C:520:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   520 |   fprintf(stderr, "\ngood:"uint32FMTW(4)" Anovel:"uint32FMTW(4)" Amulti:"uint32FMTW(4)" Bnovel:"uint32FMTW(4)" Bmulti:"uint32FMTW(4)" hairy:"uint32FMTW(4)"\n",
>       |                   ^
> sim4dbutils/comparePolishes.C:520:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   520 |   fprintf(stderr, "\ngood:"uint32FMTW(4)" Anovel:"uint32FMTW(4)" Amulti:"uint32FMTW(4)" Bnovel:"uint32FMTW(4)" Bmulti:"uint32FMTW(4)" hairy:"uint32FMTW(4)"\n",
>       |                                         ^
> sim4dbutils/comparePolishes.C:520:64: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   520 |   fprintf(stderr, "\ngood:"uint32FMTW(4)" Anovel:"uint32FMTW(4)" Amulti:"uint32FMTW(4)" Bnovel:"uint32FMTW(4)" Bmulti:"uint32FMTW(4)" hairy:"uint32FMTW(4)"\n",
>       |                                                                ^
> sim4dbutils/comparePolishes.C:520:87: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   520 |   fprintf(stderr, "\ngood:"uint32FMTW(4)" Anovel:"uint32FMTW(4)" Amulti:"uint32FMTW(4)" Bnovel:"uint32FMTW(4)" Bmulti:"uint32FMTW(4)" hairy:"uint32FMTW(4)"\n",
>       |                                                                                       ^
> sim4dbutils/comparePolishes.C:520:110: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   520 |   fprintf(stderr, "\ngood:"uint32FMTW(4)" Anovel:"uint32FMTW(4)" Amulti:"uint32FMTW(4)" Bnovel:"uint32FMTW(4)" Bmulti:"uint32FMTW(4)" hairy:"uint32FMTW(4)"\n",
>       |                                                                                                              ^
> sim4dbutils/comparePolishes.C:520:133: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   520 |   fprintf(stderr, "\ngood:"uint32FMTW(4)" Anovel:"uint32FMTW(4)" Amulti:"uint32FMTW(4)" Bnovel:"uint32FMTW(4)" Bmulti:"uint32FMTW(4)" hairy:"uint32FMTW(4)"\n",
>       |                                                                                                                                     ^
> sim4dbutils/comparePolishes.C: In function ‘int main(int, char**)’:
> sim4dbutils/comparePolishes.C:74:20: warning: variable ‘doGFF3’ set but not used [-Wunused-but-set-variable]
>    74 |   bool             doGFF3;
>       |                    ^~~~~~
> Make.rules:147: update target 'sim4dbutils/comparePolishes' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o sim4dbutils/comparePolishes sim4dbutils/comparePolishes.o sim4dbutils/s4p_overlap.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/libsim4.a /build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a /build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:135: update target 'sim4dbutils/fixPolishesIID.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/fixPolishesIID.o -c sim4dbutils/fixPolishesIID.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from sim4dbutils/fixPolishesIID.C:6:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4polish/sim4polish.H:11,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libsim4/sim4.H:1,
>                  from sim4dbutils/fixPolishesIID.C:7:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> Make.rules:147: update target 'sim4dbutils/fixPolishesIID' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o sim4dbutils/fixPolishesIID sim4dbutils/fixPolishesIID.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/libsim4.a /build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a /build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:135: update target 'sim4dbutils/cleanPolishes.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/cleanPolishes.o -c sim4dbutils/cleanPolishes.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from sim4dbutils/cleanPolishes.C:7:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> sim4dbutils/cleanPolishes.C:178:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   178 |     fprintf(stderr, "A big intron is one that is at least "uint32FMT"bp long.\n", intronLimit);
>       |                     ^
> Make.rules:147: update target 'sim4dbutils/cleanPolishes' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o sim4dbutils/cleanPolishes sim4dbutils/cleanPolishes.o /build/reproducible-path/kmer-0~20150903+r2013/libsim4/libsim4.a /build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a /build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:135: update target 'seagen/aHit.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seagen/aHit.o -c seagen/aHit.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from seagen/aHit.H:4,
>                  from seagen/aHit.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from seagen/aHit.H:5:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> seagen/aHit.C:20:14: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    20 |   fprintf(F, "-%c -e "uint32FMT" -D "uint32FMT" "uint32FMT" "uint32FMT" -M "uint32FMT" "uint32FMT" "uint32FMT"\n",
>       |              ^
> seagen/aHit.C:20:32: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    20 |   fprintf(F, "-%c -e "uint32FMT" -D "uint32FMT" "uint32FMT" "uint32FMT" -M "uint32FMT" "uint32FMT" "uint32FMT"\n",
>       |                                ^
> seagen/aHit.C:20:47: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    20 |   fprintf(F, "-%c -e "uint32FMT" -D "uint32FMT" "uint32FMT" "uint32FMT" -M "uint32FMT" "uint32FMT" "uint32FMT"\n",
>       |                                               ^
> seagen/aHit.C:20:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    20 |   fprintf(F, "-%c -e "uint32FMT" -D "uint32FMT" "uint32FMT" "uint32FMT" -M "uint32FMT" "uint32FMT" "uint32FMT"\n",
>       |                                                           ^
> seagen/aHit.C:20:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    20 |   fprintf(F, "-%c -e "uint32FMT" -D "uint32FMT" "uint32FMT" "uint32FMT" -M "uint32FMT" "uint32FMT" "uint32FMT"\n",
>       |                                                                       ^
> seagen/aHit.C:20:86: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    20 |   fprintf(F, "-%c -e "uint32FMT" -D "uint32FMT" "uint32FMT" "uint32FMT" -M "uint32FMT" "uint32FMT" "uint32FMT"\n",
>       |                                                                                      ^
> seagen/aHit.C:20:98: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    20 |   fprintf(F, "-%c -e "uint32FMT" -D "uint32FMT" "uint32FMT" "uint32FMT" -M "uint32FMT" "uint32FMT" "uint32FMT"\n",
>       |                                                                                                  ^
> seagen/aHit.C: In function ‘void ahit_readBinary(aHit*, FILE*)’:
> seagen/aHit.C:12:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>    12 |   fread(a, sizeof(aHit), 1, F);
>       |   ~~~~~^~~~~~~~~~~~~~~~~~~~~~~
> Make.rules:135: update target 'seagen/hitReader.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seagen/hitReader.o -c seagen/hitReader.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from seagen/hitReader.H:7,
>                  from seagen/hitReader.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from seagen/aHit.H:5,
>                  from seagen/hitReader.H:8:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> seagen/hitReader.H:62:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    62 |       fprintf(stderr, "hitReader::operator[]()-- ERROR: asked for hit "uint32FMT" out of "uint32FMT".\n", x, _listLen);
>       |                       ^
> seagen/hitReader.H:62:81: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    62 |       fprintf(stderr, "hitReader::operator[]()-- ERROR: asked for hit "uint32FMT" out of "uint32FMT".\n", x, _listLen);
>       |                                                                                 ^
> Make.rules:135: update target 'seagen/filterESTsimple.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seagen/filterESTsimple.o -c seagen/filterESTsimple.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from seagen/aHit.H:4,
>                  from seagen/filterESTsimple.C:6:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from seagen/aHit.H:5:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> In file included from seagen/filterESTsimple.C:12:
> seagen/hitReader.H:62:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    62 |       fprintf(stderr, "hitReader::operator[]()-- ERROR: asked for hit "uint32FMT" out of "uint32FMT".\n", x, _listLen);
>       |                       ^
> seagen/hitReader.H:62:81: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    62 |       fprintf(stderr, "hitReader::operator[]()-- ERROR: asked for hit "uint32FMT" out of "uint32FMT".\n", x, _listLen);
>       |                                                                                 ^
> Make.rules:147: update target 'seagen/filterESTsimple' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o seagen/filterESTsimple seagen/filterESTsimple.o seagen/hitReader.o seagen/aHit.o /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:135: update target 'seagen/sortHits.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seagen/sortHits.o -c seagen/sortHits.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from seagen/aHit.H:4,
>                  from seagen/sortHits.C:6:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from seagen/aHit.H:5:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> seagen/sortHits.C: In member function ‘bool aHitReader::readHit(aHit&)’:
> seagen/sortHits.C:52:12: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>    52 |       fgets(buffer, 1024, theFile);
>       |       ~~~~~^~~~~~~~~~~~~~~~~~~~~~~
> seagen/sortHits.C: In member function ‘void aHitTemporary::nextHit()’:
> seagen/sortHits.C:119:12: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   119 |       fread(&hit, sizeof(aHit), 1, theFile);
>       |       ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> Make.rules:147: update target 'seagen/sortHits' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o seagen/sortHits seagen/sortHits.o seagen/aHit.o /build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:135: update target 'seagen/filtertest.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seagen/filtertest.o -c seagen/filtertest.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from seagen/filtertest.C:7:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> seagen/filtertest.C:180:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   180 |         fprintf(stderr, "reading hits "uint32FMT"\r", hitsLen);
>       |                         ^
> seagen/filtertest.C:186:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   186 |   fprintf(stderr, "reading hits "uint32FMT"\n", hitsLen);
>       |                   ^
> seagen/filtertest.C:308:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   308 |         fprintf(stdout, "%f %f %f  %6.4f %6.4f  "uint32FMT" "uint32FMT" "uint32FMT" "uint32FMT"\n",
>       |                         ^
> seagen/filtertest.C:308:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   308 |         fprintf(stdout, "%f %f %f  %6.4f %6.4f  "uint32FMT" "uint32FMT" "uint32FMT" "uint32FMT"\n",
>       |                                                           ^
> seagen/filtertest.C:308:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   308 |         fprintf(stdout, "%f %f %f  %6.4f %6.4f  "uint32FMT" "uint32FMT" "uint32FMT" "uint32FMT"\n",
>       |                                                                       ^
> seagen/filtertest.C:308:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   308 |         fprintf(stdout, "%f %f %f  %6.4f %6.4f  "uint32FMT" "uint32FMT" "uint32FMT" "uint32FMT"\n",
>       |                                                                                   ^
> seagen/filtertest.C: In function ‘void ahit_readBinary(aHit*, FILE*)’:
> seagen/filtertest.C:39:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>    39 |   fread(a, sizeof(aHit), 1, F);
>       |   ~~~~~^~~~~~~~~~~~~~~~~~~~~~~
> seagen/filtertest.C: In function ‘int main(int, char**)’:
> seagen/filtertest.C:162:10: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   162 |     fgets(hitLine, 1024, stdin);
>       |     ~~~~~^~~~~~~~~~~~~~~~~~~~~~
> Make.rules:147: update target 'seagen/filtertest' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o seagen/filtertest seagen/filtertest.o -pthread -ldl -lm
> Make.rules:135: update target 'seagen/filterNULL.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seagen/filterNULL.o -c seagen/filterNULL.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from seagen/aHit.H:4,
>                  from seagen/filterNULL.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from seagen/aHit.H:5:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> In file included from seagen/filterNULL.C:2:
> seagen/hitReader.H:62:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    62 |       fprintf(stderr, "hitReader::operator[]()-- ERROR: asked for hit "uint32FMT" out of "uint32FMT".\n", x, _listLen);
>       |                       ^
> seagen/hitReader.H:62:81: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    62 |       fprintf(stderr, "hitReader::operator[]()-- ERROR: asked for hit "uint32FMT" out of "uint32FMT".\n", x, _listLen);
>       |                                                                                 ^
> Make.rules:147: update target 'seagen/filterNULL' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o seagen/filterNULL seagen/filterNULL.o seagen/hitReader.o seagen/aHit.o /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:135: update target 'seagen/filterMRNA.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seagen/filterMRNA.o -c seagen/filterMRNA.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from seagen/aHit.H:4,
>                  from seagen/filterMRNA.C:6:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from seagen/aHit.H:5:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> In file included from seagen/filterMRNA.C:7:
> seagen/hitReader.H:62:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    62 |       fprintf(stderr, "hitReader::operator[]()-- ERROR: asked for hit "uint32FMT" out of "uint32FMT".\n", x, _listLen);
>       |                       ^
> seagen/hitReader.H:62:81: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    62 |       fprintf(stderr, "hitReader::operator[]()-- ERROR: asked for hit "uint32FMT" out of "uint32FMT".\n", x, _listLen);
>       |                                                                                 ^
> seagen/filterMRNA.C:53:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    53 |     fprintf(stderr, "  scores at least %4.2f AND at least "uint32FMT" bases covered are always output\n", MC, ML);
>       |                     ^
> Make.rules:147: update target 'seagen/filterMRNA' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o seagen/filterMRNA seagen/filterMRNA.o seagen/hitReader.o seagen/aHit.o /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:135: update target 'seagen/filterEST-complicated.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seagen/filterEST-complicated.o -c seagen/filterEST-complicated.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from seagen/aHit.H:4,
>                  from seagen/filterEST-complicated.C:6:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from seagen/aHit.H:5:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> In file included from seagen/filterEST-complicated.C:7:
> seagen/hitReader.H:62:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    62 |       fprintf(stderr, "hitReader::operator[]()-- ERROR: asked for hit "uint32FMT" out of "uint32FMT".\n", x, _listLen);
>       |                       ^
> seagen/hitReader.H:62:81: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    62 |       fprintf(stderr, "hitReader::operator[]()-- ERROR: asked for hit "uint32FMT" out of "uint32FMT".\n", x, _listLen);
>       |                                                                                 ^
> seagen/filterEST-complicated.C:67:33: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    67 |       fprintf(logFile, uint32FMT"] unique: aggressively filtered to "uint32FMT" hits out of "uint32FMT" hits.\n",
>       |                                 ^
> seagen/filterEST-complicated.C:67:79: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    67 |       fprintf(logFile, uint32FMT"] unique: aggressively filtered to "uint32FMT" hits out of "uint32FMT" hits.\n",
>       |                                                                               ^
> seagen/filterEST-complicated.C:115:33: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   115 |       fprintf(logFile, uint32FMT"] knee: filtered "uint32FMT" hits down to "uint32FMT" hits using threshold %f\n",
>       |                                 ^
> seagen/filterEST-complicated.C:115:61: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   115 |       fprintf(logFile, uint32FMT"] knee: filtered "uint32FMT" hits down to "uint32FMT" hits using threshold %f\n",
>       |                                                             ^
> seagen/filterEST-complicated.C:139:33: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   139 |       fprintf(logFile, uint32FMT"] uniform: uniform signal strength, saving the first "uint32FMT" hits out of "uint32FMT" hits, best=%f, worst=%f\n",
>       |                                 ^
> seagen/filterEST-complicated.C:139:97: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   139 |       fprintf(logFile, uint32FMT"] uniform: uniform signal strength, saving the first "uint32FMT" hits out of "uint32FMT" hits, best=%f, worst=%f\n",
>       |                                                                                                 ^
> seagen/filterEST-complicated.C:174:33: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   174 |       fprintf(logFile, uint32FMT"] diff: has no clear signal knee, saving the first "uint32FMT" hits out of "uint32FMT" hits, best=%f, worst=%f, largestdiff=%f\n",
>       |                                 ^
> seagen/filterEST-complicated.C:174:95: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   174 |       fprintf(logFile, uint32FMT"] diff: has no clear signal knee, saving the first "uint32FMT" hits out of "uint32FMT" hits, best=%f, worst=%f, largestdiff=%f\n",
>       |                                                                                               ^
> seagen/filterEST-complicated.C:228:33: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   228 |       fprintf(logFile, uint32FMT"] spike: at "uint32FMT", "uint32FMT" hits saved:  thresh=%f, "uint32FMT" hits, best=%f, worst=%f\n",
>       |                                 ^
> seagen/filterEST-complicated.C:228:56: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   228 |       fprintf(logFile, uint32FMT"] spike: at "uint32FMT", "uint32FMT" hits saved:  thresh=%f, "uint32FMT" hits, best=%f, worst=%f\n",
>       |                                                        ^
> seagen/filterEST-complicated.C:228:69: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   228 |       fprintf(logFile, uint32FMT"] spike: at "uint32FMT", "uint32FMT" hits saved:  thresh=%f, "uint32FMT" hits, best=%f, worst=%f\n",
>       |                                                                     ^
> seagen/filterEST-complicated.C:277:31: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   277 |     fprintf(logFile, uint32FMT"] is an unclassified signal, "uint32FMT" hits saved out of "uint32FMT" hits, best=%f, worst=%f\n",
>       |                               ^
> seagen/filterEST-complicated.C:277:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   277 |     fprintf(logFile, uint32FMT"] is an unclassified signal, "uint32FMT" hits saved out of "uint32FMT" hits, best=%f, worst=%f\n",
>       |                                                                       ^
> Make.rules:135: update target 'seagen/filterEST.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seagen/filterEST.o -c seagen/filterEST.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from seagen/aHit.H:4,
>                  from seagen/filterEST.C:6:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from seagen/aHit.H:5:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> In file included from seagen/filterEST.C:7:
> seagen/hitReader.H:62:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    62 |       fprintf(stderr, "hitReader::operator[]()-- ERROR: asked for hit "uint32FMT" out of "uint32FMT".\n", x, _listLen);
>       |                       ^
> seagen/hitReader.H:62:81: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    62 |       fprintf(stderr, "hitReader::operator[]()-- ERROR: asked for hit "uint32FMT" out of "uint32FMT".\n", x, _listLen);
>       |                                                                                 ^
> seagen/filterEST.C:76:11: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    76 |           "  hits saved:"uint32FMTW(8)"/"uint32FMTW(8)" = %6.3f%%\r",
>       |           ^
> seagen/filterEST.C:76:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    76 |           "  hits saved:"uint32FMTW(8)"/"uint32FMTW(8)" = %6.3f%%\r",
>       |                                       ^
> Make.rules:147: update target 'seagen/filterEST' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o seagen/filterEST seagen/filterEST.o seagen/filterEST-complicated.o seagen/hitReader.o seagen/aHit.o /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:135: update target 'seagen/hitConverter.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seagen/hitConverter.o -c seagen/hitConverter.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from seagen/aHit.H:4,
>                  from seagen/hitConverter.C:3:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from seagen/aHit.H:5:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> seagen/hitConverter.C: In function ‘void asc2bin(FILE*, FILE*)’:
> seagen/hitConverter.C:39:10: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>    39 |     fgets(b, 1024, I);
>       |     ~~~~~^~~~~~~~~~~~
> Make.rules:147: update target 'seagen/hitConverter' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o seagen/hitConverter seagen/hitConverter.o seagen/aHit.o /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:135: update target 'seagen/hitMatrix-sort.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seagen/hitMatrix-sort.o -c seagen/hitMatrix-sort.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from seagen/hitMatrix.H:8,
>                  from seagen/hitMatrix-sort.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> In file included from seagen/hitMatrix.H:9:
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   127 |       fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   129 |       fprintf(stderr, "M = "uint64HEX"\n", m);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   130 |       fprintf(stderr, "H = "uint64HEX"\n", h);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   131 |       fprintf(stderr, "C = "uint64HEX"\n", c);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stderr, "R = "uint64HEX"\n", r);
>       |                       ^
> seagen/hitMatrix.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn);
>       |                       ^
> seagen/hitMatrix.H:128:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn);
>       |                                                              ^
> seagen/hitMatrix.H: In member function ‘void hitMatrix::addHits(uint32, uint64*, uint64)’:
> seagen/hitMatrix.H:126:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=]
>   126 |     } catch (std::bad_alloc) {
>       |                   ^~~~~~~~~
> Make.rules:135: update target 'seagen/thr-output.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seagen/thr-output.o -c seagen/thr-output.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from seagen/searchGENOME.H:20,
>                  from seagen/thr-output.C:5:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> In file included from seagen/searchGENOME.H:22:
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   127 |       fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   129 |       fprintf(stderr, "M = "uint64HEX"\n", m);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   130 |       fprintf(stderr, "H = "uint64HEX"\n", h);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   131 |       fprintf(stderr, "C = "uint64HEX"\n", c);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stderr, "R = "uint64HEX"\n", r);
>       |                       ^
> In file included from seagen/searchGENOME.H:25:
> seagen/hitMatrix.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn);
>       |                       ^
> seagen/hitMatrix.H:128:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn);
>       |                                                              ^
> seagen/hitMatrix.H: In member function ‘void hitMatrix::addHits(uint32, uint64*, uint64)’:
> seagen/hitMatrix.H:126:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=]
>   126 |     } catch (std::bad_alloc) {
>       |                   ^~~~~~~~~
> seagen/thr-output.C: In function ‘void* writerThread(void*, void*)’:
> seagen/thr-output.C:48:10: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>    48 |     write(config._outputFile, query->theOutput(), query->theOutputLength());
>       |     ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> seagen/thr-output.C:62:10: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>    62 |     write(config._matchCountsFile, str, strlen(str));
>       |     ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> Make.rules:135: update target 'seagen/thr-search.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seagen/thr-search.o -c seagen/thr-search.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from seagen/searchGENOME.H:20,
>                  from seagen/thr-search.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> In file included from seagen/searchGENOME.H:22:
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   127 |       fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   129 |       fprintf(stderr, "M = "uint64HEX"\n", m);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   130 |       fprintf(stderr, "H = "uint64HEX"\n", h);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   131 |       fprintf(stderr, "C = "uint64HEX"\n", c);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stderr, "R = "uint64HEX"\n", r);
>       |                       ^
> In file included from seagen/searchGENOME.H:25:
> seagen/hitMatrix.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn);
>       |                       ^
> seagen/hitMatrix.H:128:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn);
>       |                                                              ^
> seagen/hitMatrix.H: In member function ‘void hitMatrix::addHits(uint32, uint64*, uint64)’:
> seagen/hitMatrix.H:126:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=]
>   126 |     } catch (std::bad_alloc) {
>       |                   ^~~~~~~~~
> Make.rules:135: update target 'seagen/thr-loader.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seagen/thr-loader.o -c seagen/thr-loader.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from seagen/searchGENOME.H:20,
>                  from seagen/thr-loader.C:5:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> In file included from seagen/searchGENOME.H:22:
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   127 |       fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   129 |       fprintf(stderr, "M = "uint64HEX"\n", m);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   130 |       fprintf(stderr, "H = "uint64HEX"\n", h);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   131 |       fprintf(stderr, "C = "uint64HEX"\n", c);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stderr, "R = "uint64HEX"\n", r);
>       |                       ^
> In file included from seagen/searchGENOME.H:25:
> seagen/hitMatrix.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn);
>       |                       ^
> seagen/hitMatrix.H:128:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn);
>       |                                                              ^
> seagen/hitMatrix.H: In member function ‘void hitMatrix::addHits(uint32, uint64*, uint64)’:
> seagen/hitMatrix.H:126:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=]
>   126 |     } catch (std::bad_alloc) {
>       |                   ^~~~~~~~~
> seagen/thr-loader.C: In function ‘void* loaderThread(void*)’:
> seagen/thr-loader.C:14:17: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=]
>    14 |   } catch (std::bad_alloc) {
>       |                 ^~~~~~~~~
> Make.rules:135: update target 'seagen/thr-deadlock.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seagen/thr-deadlock.o -c seagen/thr-deadlock.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from seagen/searchGENOME.H:20,
>                  from seagen/thr-deadlock.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> In file included from seagen/searchGENOME.H:22:
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   127 |       fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   129 |       fprintf(stderr, "M = "uint64HEX"\n", m);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   130 |       fprintf(stderr, "H = "uint64HEX"\n", h);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   131 |       fprintf(stderr, "C = "uint64HEX"\n", c);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stderr, "R = "uint64HEX"\n", r);
>       |                       ^
> In file included from seagen/searchGENOME.H:25:
> seagen/hitMatrix.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn);
>       |                       ^
> seagen/hitMatrix.H:128:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn);
>       |                                                              ^
> seagen/hitMatrix.H: In member function ‘void hitMatrix::addHits(uint32, uint64*, uint64)’:
> seagen/hitMatrix.H:126:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=]
>   126 |     } catch (std::bad_alloc) {
>       |                   ^~~~~~~~~
> Make.rules:135: update target 'seagen/encodedQuery.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seagen/encodedQuery.o -c seagen/encodedQuery.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from seagen/encodedQuery.H:6,
>                  from seagen/encodedQuery.C:3:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> seagen/encodedQuery.C:142:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   142 |     fprintf(stderr, "encodedQuery::test()-- mersAvail incorrect:  Recomputed:"uint32FMT"  Real:"uint32FMT"\n", _mersAvail, _r_mersAvail);
>       |                     ^
> seagen/encodedQuery.C:142:88: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   142 |     fprintf(stderr, "encodedQuery::test()-- mersAvail incorrect:  Recomputed:"uint32FMT"  Real:"uint32FMT"\n", _mersAvail, _r_mersAvail);
>       |                                                                                        ^
> seagen/encodedQuery.C:152:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   152 |       fprintf(stderr, "encodedQuery::test()-- skip["uint32FMTW(4)"] incorrect:  Acc:%d  Real:%d\n", i, getSkip(i, true), _r_skip[i]);
>       |                       ^
> seagen/encodedQuery.C:160:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   160 |         fprintf(stderr, "encodedQuery::test()-- mers["uint32FMTW(4)"] incorrect:  Acc:"uint64HEX" %s   Real:"uint64HEX" %s\n",
>       |                         ^
> seagen/encodedQuery.C:160:68: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   160 |         fprintf(stderr, "encodedQuery::test()-- mers["uint32FMTW(4)"] incorrect:  Acc:"uint64HEX" %s   Real:"uint64HEX" %s\n",
>       |                                                                    ^
> seagen/encodedQuery.C:160:97: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   160 |         fprintf(stderr, "encodedQuery::test()-- mers["uint32FMTW(4)"] incorrect:  Acc:"uint64HEX" %s   Real:"uint64HEX" %s\n",
>       |                                                                                                 ^
> seagen/encodedQuery.C:209:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   209 |       fprintf(stderr, "encodedQuery::addOutput()-- from "uint32FMT" to "uint32FMT" bytes.\n",
>       |                       ^
> seagen/encodedQuery.C:209:67: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   209 |       fprintf(stderr, "encodedQuery::addOutput()-- from "uint32FMT" to "uint32FMT" bytes.\n",
>       |                                                                   ^
> seagen/encodedQuery.C: In member function ‘void encodedQuery::addOutput(void*, uint32)’:
> seagen/encodedQuery.C:207:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=]
>   207 |     } catch (std::bad_alloc) {
>       |                   ^~~~~~~~~
> Make.rules:135: update target 'seagen/configuration.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seagen/configuration.o -c seagen/configuration.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from seagen/searchGENOME.H:20,
>                  from seagen/configuration.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> In file included from seagen/searchGENOME.H:22:
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   127 |       fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   129 |       fprintf(stderr, "M = "uint64HEX"\n", m);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   130 |       fprintf(stderr, "H = "uint64HEX"\n", h);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   131 |       fprintf(stderr, "C = "uint64HEX"\n", c);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stderr, "R = "uint64HEX"\n", r);
>       |                       ^
> In file included from seagen/searchGENOME.H:25:
> seagen/hitMatrix.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn);
>       |                       ^
> seagen/hitMatrix.H:128:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn);
>       |                                                              ^
> seagen/configuration.C:84:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    84 |     fprintf(stderr, "\n"uint32FMTW(7)" sequences in %5.2f seconds, %8.3f per second.\n", nq, tm, nq/tm);
>       |                     ^
> seagen/hitMatrix.H: In member function ‘void hitMatrix::addHits(uint32, uint64*, uint64)’:
> seagen/hitMatrix.H:126:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=]
>   126 |     } catch (std::bad_alloc) {
>       |                   ^~~~~~~~~
> Make.rules:135: update target 'seagen/searchGENOME.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seagen/searchGENOME.o -c seagen/searchGENOME.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from seagen/searchGENOME.H:20,
>                  from seagen/searchGENOME.C:4:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> In file included from seagen/searchGENOME.H:22:
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   127 |       fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   129 |       fprintf(stderr, "M = "uint64HEX"\n", m);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   130 |       fprintf(stderr, "H = "uint64HEX"\n", h);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   131 |       fprintf(stderr, "C = "uint64HEX"\n", c);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stderr, "R = "uint64HEX"\n", r);
>       |                       ^
> In file included from seagen/searchGENOME.H:25:
> seagen/hitMatrix.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn);
>       |                       ^
> seagen/hitMatrix.H:128:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn);
>       |                                                              ^
> seagen/hitMatrix.H: In member function ‘void hitMatrix::addHits(uint32, uint64*, uint64)’:
> seagen/hitMatrix.H:126:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=]
>   126 |     } catch (std::bad_alloc) {
>       |                   ^~~~~~~~~
> Make.rules:135: update target 'seagen/hitMatrix.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seagen/hitMatrix.o -c seagen/hitMatrix.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from seagen/searchGENOME.H:20,
>                  from seagen/hitMatrix.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> In file included from seagen/searchGENOME.H:22:
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   127 |       fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   129 |       fprintf(stderr, "M = "uint64HEX"\n", m);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   130 |       fprintf(stderr, "H = "uint64HEX"\n", h);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   131 |       fprintf(stderr, "C = "uint64HEX"\n", c);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stderr, "R = "uint64HEX"\n", r);
>       |                       ^
> In file included from seagen/searchGENOME.H:25:
> seagen/hitMatrix.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn);
>       |                       ^
> seagen/hitMatrix.H:128:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn);
>       |                                                              ^
> seagen/hitMatrix.C:642:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   642 |         sprintf(line, "-%c -e "uint32FMT" -D "uint32FMT" "uint32FMT" "uint32FMT" -M "uint32FMT" "uint32FMT" "uint32FMT"\n",
>       |                       ^
> seagen/hitMatrix.C:642:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   642 |         sprintf(line, "-%c -e "uint32FMT" -D "uint32FMT" "uint32FMT" "uint32FMT" -M "uint32FMT" "uint32FMT" "uint32FMT"\n",
>       |                                         ^
> seagen/hitMatrix.C:642:56: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   642 |         sprintf(line, "-%c -e "uint32FMT" -D "uint32FMT" "uint32FMT" "uint32FMT" -M "uint32FMT" "uint32FMT" "uint32FMT"\n",
>       |                                                        ^
> seagen/hitMatrix.C:642:68: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   642 |         sprintf(line, "-%c -e "uint32FMT" -D "uint32FMT" "uint32FMT" "uint32FMT" -M "uint32FMT" "uint32FMT" "uint32FMT"\n",
>       |                                                                    ^
> seagen/hitMatrix.C:642:80: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   642 |         sprintf(line, "-%c -e "uint32FMT" -D "uint32FMT" "uint32FMT" "uint32FMT" -M "uint32FMT" "uint32FMT" "uint32FMT"\n",
>       |                                                                                ^
> seagen/hitMatrix.C:642:95: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   642 |         sprintf(line, "-%c -e "uint32FMT" -D "uint32FMT" "uint32FMT" "uint32FMT" -M "uint32FMT" "uint32FMT" "uint32FMT"\n",
>       |                                                                                               ^
> seagen/hitMatrix.C:642:107: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   642 |         sprintf(line, "-%c -e "uint32FMT" -D "uint32FMT" "uint32FMT" "uint32FMT" -M "uint32FMT" "uint32FMT" "uint32FMT"\n",
>       |                                                                                                           ^
> seagen/hitMatrix.H: In member function ‘void hitMatrix::addHits(uint32, uint64*, uint64)’:
> seagen/hitMatrix.H:126:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=]
>   126 |     } catch (std::bad_alloc) {
>       |                   ^~~~~~~~~
> Make.rules:147: update target 'seagen/seagen' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o seagen/seagen seagen/hitMatrix.o seagen/searchGENOME.o seagen/configuration.o seagen/encodedQuery.o seagen/thr-deadlock.o seagen/thr-loader.o seagen/thr-search.o seagen/thr-output.o seagen/hitMatrix-sort.o seagen/aHit.o /build/reproducible-path/kmer-0~20150903+r2013/libkmer/libkmer.a /build/reproducible-path/kmer-0~20150903+r2013/libmeryl/libmeryl.a /build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a /build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:135: update target 'meryl/unaryOp.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/ -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o meryl/unaryOp.o -c meryl/unaryOp.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from meryl/meryl.H:4,
>                  from meryl/unaryOp.C:5:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> Make.rules:135: update target 'meryl/merge.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/ -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o meryl/merge.o -c meryl/merge.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from meryl/meryl.H:4,
>                  from meryl/merge.C:5:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> meryl/merge.C:14:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    14 |     fprintf(stderr, "ERROR - must have at least two databases (you gave "uint32FMT")!\n", args->mergeFilesLen);
>       |                     ^
> meryl/merge.C: In function ‘void multipleOperations(merylArgs*)’:
> meryl/merge.C:237:10: warning: ‘void operator delete(void*)’ called on pointer returned from a mismatched allocation function [-Wmismatched-new-delete]
>   237 |   delete R;
>       |          ^
> meryl/merge.C:37:71: note: returned from ‘void* operator new [](std::size_t)’
>    37 |   merylStreamReader  **R = new merylStreamReader* [args->mergeFilesLen];
>       |                                                                       ^
> Make.rules:135: update target 'meryl/estimate.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/ -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o meryl/estimate.o -c meryl/estimate.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from meryl/estimate.C:4:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> meryl/estimate.C:54:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    54 |     fprintf(stdout, "Can fit "uint64FMT" mers into table with prefix of "uint64FMT" bits, using %.3fMB (%.3fMB for positions)\n",
>       |                     ^
> meryl/estimate.C:54:40: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    54 |     fprintf(stdout, "Can fit "uint64FMT" mers into table with prefix of "uint64FMT" bits, using %.3fMB (%.3fMB for positions)\n",
>       |                                        ^
> meryl/estimate.C:162:28: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   162 |   fprintf(stderr, uint64FMT" "uint32FMT"-mers can be computed using "uint64FMT"MB memory.\n",
>       |                            ^
> meryl/estimate.C:162:40: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   162 |   fprintf(stderr, uint64FMT" "uint32FMT"-mers can be computed using "uint64FMT"MB memory.\n",
>       |                                        ^
> meryl/estimate.C: In function ‘uint64 estimateMemory(uint32, uint64, bool)’:
> meryl/estimate.C:77:13: warning: unused variable ‘N’ [-Wunused-variable]
>    77 |     uint64  N       = logBaseTwo64(numMers);  //  Width of the bucket pointer table
>       |             ^
> meryl/estimate.C:73:11: warning: variable ‘tMin’ set but not used [-Wunused-but-set-variable]
>    73 |   uint64  tMin   = tMax;
>       |           ^~~~
> Make.rules:135: update target 'meryl/dump.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/ -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o meryl/dump.o -c meryl/dump.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from meryl/meryl.H:4,
>                  from meryl/dump.C:5:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> meryl/dump.C:17:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    17 |       fprintf(stdout, ">"uint64FMT"\n%s\n",
>       |                       ^
> meryl/dump.C:35:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    35 |       fprintf(stdout, ">"uint64FMT, M->theCount());
>       |                       ^
> meryl/dump.C:37:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    37 |         fprintf(stdout, " "uint32FMT, M->getPosition(i));
>       |                         ^
> meryl/dump.C:50:2: warning: #warning make this a test [-Wcpp]
>    50 | #warning make this a test
>       |  ^~~~~~~
> meryl/dump.C:72:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    72 |   fprintf(stdout, "Found "uint64FMT" mers.\n",          M->numberOfTotalMers());
>       |                   ^
> meryl/dump.C:73:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    73 |   fprintf(stdout, "Found "uint64FMT" distinct mers.\n", M->numberOfDistinctMers());
>       |                   ^
> meryl/dump.C:74:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    74 |   fprintf(stdout, "Found "uint64FMT" unique mers.\n",   M->numberOfUniqueMers());
>       |                   ^
> meryl/dump.C:87:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    87 |   fprintf(stderr, "Found "uint64FMT" mers.\n",          M->numberOfTotalMers());
>       |                   ^
> meryl/dump.C:88:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    88 |   fprintf(stderr, "Found "uint64FMT" distinct mers.\n", M->numberOfDistinctMers());
>       |                   ^
> meryl/dump.C:89:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    89 |   fprintf(stderr, "Found "uint64FMT" unique mers.\n",   M->numberOfUniqueMers());
>       |                   ^
> meryl/dump.C:91:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    91 |   fprintf(stderr, "Largest mercount is "uint64FMT"; "uint64FMT" mers are too big for histogram.\n",
>       |                   ^
> meryl/dump.C:91:50: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    91 |   fprintf(stderr, "Largest mercount is "uint64FMT"; "uint64FMT" mers are too big for histogram.\n",
>       |                                                  ^
> meryl/dump.C:101:32: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   101 |       fprintf(stdout, uint32FMT"\t"uint64FMT"\t%.4f\t%.4f\n",
>       |                                ^
> meryl/dump.C:148:34: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   148 |         fprintf(stderr, uint32FMT"\t"uint64FMT"\n", d, hist[d]);
>       |                                  ^
> meryl/dump.C:151:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   151 |       fprintf(stderr, "huge\t"uint64FMT"\n", histHuge);
>       |                       ^
> Make.rules:135: update target 'meryl/build-threads.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/ -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o meryl/build-threads.o -c meryl/build-threads.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from meryl/build-threads.C:7:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> Make.rules:135: update target 'meryl/build.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/ -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o meryl/build.o -c meryl/build.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from meryl/build.C:7:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> meryl/build.C:153:18: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   153 |     sprintf(cmd, "qsub -t 1-"uint64FMT" -cwd -b n -j y -o %s-count-\\$TASK_ID.err %s -N mc%s %s-count.sh",
>       |                  ^
> meryl/build.C:156:18: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   156 |     sprintf(cmd, "qsub -t 1-"uint64FMT" -cwd -b n -j y -o %s-count-\\$TASK_ID.err -N mc%s %s-count.sh",
>       |                  ^
> meryl/build.C:238:2: warning: #warning not submitting prepareBatch to grid [-Wcpp]
>   238 | #warning not submitting prepareBatch to grid
>       |  ^~~~~~~
> meryl/build.C:293:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   293 |     fprintf(stderr, "  numMersActual      = "uint64FMT"\n", args->numMersActual);
>       |                     ^
> meryl/build.C:294:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   294 |     fprintf(stderr, "  mersPerBatch       = "uint64FMT"\n", args->mersPerBatch);
>       |                     ^
> meryl/build.C:295:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   295 |     fprintf(stderr, "  basesPerBatch      = "uint64FMT"\n", args->basesPerBatch);
>       |                     ^
> meryl/build.C:296:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   296 |     fprintf(stderr, "  numBuckets         = "uint64FMT" ("uint32FMT" bits)\n", args->numBuckets, args->numBuckets_log2);
>       |                     ^
> meryl/build.C:296:55: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   296 |     fprintf(stderr, "  numBuckets         = "uint64FMT" ("uint32FMT" bits)\n", args->numBuckets, args->numBuckets_log2);
>       |                                                       ^
> meryl/build.C:297:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   297 |     fprintf(stderr, "  bucketPointerWidth = "uint32FMT"\n", args->bucketPointerWidth);
>       |                     ^
> meryl/build.C:298:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   298 |     fprintf(stderr, "  merDataWidth       = "uint32FMT"\n", args->merDataWidth);
>       |                     ^
> meryl/build.C:305:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   305 |       fprintf(stderr, "Computing "uint64FMT" segments using "uint32FMT" threads and "uint64FMT"MB memory ("uint64FMT"MB if in one batch).\n",
>       |                       ^
> meryl/build.C:305:44: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   305 |       fprintf(stderr, "Computing "uint64FMT" segments using "uint32FMT" threads and "uint64FMT"MB memory ("uint64FMT"MB if in one batch).\n",
>       |                                            ^
> meryl/build.C:305:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   305 |       fprintf(stderr, "Computing "uint64FMT" segments using "uint32FMT" threads and "uint64FMT"MB memory ("uint64FMT"MB if in one batch).\n",
>       |                                                                       ^
> meryl/build.C:305:95: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   305 |       fprintf(stderr, "Computing "uint64FMT" segments using "uint32FMT" threads and "uint64FMT"MB memory ("uint64FMT"MB if in one batch).\n",
>       |                                                                                               ^
> meryl/build.C:310:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   310 |       fprintf(stderr, "Computing "uint64FMT" segments using "uint32FMT" threads and "uint64FMT"MB memory ("uint64FMT"MB if in one batch).\n",
>       |                       ^
> meryl/build.C:310:44: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   310 |       fprintf(stderr, "Computing "uint64FMT" segments using "uint32FMT" threads and "uint64FMT"MB memory ("uint64FMT"MB if in one batch).\n",
>       |                                            ^
> meryl/build.C:310:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   310 |       fprintf(stderr, "Computing "uint64FMT" segments using "uint32FMT" threads and "uint64FMT"MB memory ("uint64FMT"MB if in one batch).\n",
>       |                                                                       ^
> meryl/build.C:310:95: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   310 |       fprintf(stderr, "Computing "uint64FMT" segments using "uint32FMT" threads and "uint64FMT"MB memory ("uint64FMT"MB if in one batch).\n",
>       |                                                                                               ^
> meryl/build.C:314:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   314 |     fprintf(stderr, "  numMersActual      = "uint64FMT"\n", args->numMersActual);
>       |                     ^
> meryl/build.C:315:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   315 |     fprintf(stderr, "  mersPerBatch       = "uint64FMT"\n", args->mersPerBatch);
>       |                     ^
> meryl/build.C:316:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   316 |     fprintf(stderr, "  basesPerBatch      = "uint64FMT"\n", args->basesPerBatch);
>       |                     ^
> meryl/build.C:317:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   317 |     fprintf(stderr, "  numBuckets         = "uint64FMT" ("uint32FMT" bits)\n", args->numBuckets, args->numBuckets_log2);
>       |                     ^
> meryl/build.C:317:55: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   317 |     fprintf(stderr, "  numBuckets         = "uint64FMT" ("uint32FMT" bits)\n", args->numBuckets, args->numBuckets_log2);
>       |                                                       ^
> meryl/build.C:318:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   318 |     fprintf(stderr, "  bucketPointerWidth = "uint32FMT"\n", args->bucketPointerWidth);
>       |                     ^
> meryl/build.C:319:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   319 |     fprintf(stderr, "  merDataWidth       = "uint32FMT"\n", args->merDataWidth);
>       |                     ^
> meryl/build.C:342:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   342 |   sprintf(filename, "%s.batch"uint64FMT".mcdat", args->outputFile, segment);
>       |                     ^
> meryl/build.C:346:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   346 |       fprintf(stderr, "Found result for batch "uint64FMT" in %s.\n", segment, filename);
>       |                       ^
> meryl/build.C:352:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   352 |     fprintf(stderr, "Computing segment "uint64FMT" of "uint64FMT".\n", segment+1, args->segmentLimit);
>       |                     ^
> meryl/build.C:352:50: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   352 |     fprintf(stderr, "Computing segment "uint64FMT" of "uint64FMT".\n", segment+1, args->segmentLimit);
>       |                                                  ^
> meryl/build.C:365:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   365 |     fprintf(stderr, " Allocating "uint64FMT"MB for mer storage ("uint32FMT" bits wide).\n",
>       |                     ^
> meryl/build.C:365:44: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   365 |     fprintf(stderr, " Allocating "uint64FMT"MB for mer storage ("uint32FMT" bits wide).\n",
>       |                                            ^
> meryl/build.C:384:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   384 |       fprintf(stderr, " Allocating "uint64FMT"MB for mer position storage.\n",
>       |                       ^
> meryl/build.C:390:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   390 |     fprintf(stderr, " Allocating "uint64FMT"MB for bucket pointer table ("uint32FMT" bits wide).\n",
>       |                     ^
> meryl/build.C:390:44: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   390 |     fprintf(stderr, " Allocating "uint64FMT"MB for bucket pointer table ("uint32FMT" bits wide).\n",
>       |                                            ^
> meryl/build.C:396:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   396 |     fprintf(stderr, " Allocating "uint64FMT"MB for counting the size of each bucket.\n", args->numBuckets >> 18);
>       |                     ^
> meryl/build.C:477:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   477 |     fprintf(stderr, " Releasing "uint64FMT"MB from counting the size of each bucket.\n", args->numBuckets >> 18);
>       |                     ^
> meryl/build.C:532:28: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   532 |   sprintf(batchOutputFile, "%s.batch"uint64FMT, args->outputFile, segment);
>       |                            ^
> meryl/build.C:552:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   552 |       fprintf(stderr, "ERROR: In segment "uint64FMT"\n", segment);
>       |                       ^
> meryl/build.C:553:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   553 |       fprintf(stderr, "ERROR: Bucket "uint64FMT" (out of "uint64FMT") ends before it starts!\n",
>       |                       ^
> meryl/build.C:553:48: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   553 |       fprintf(stderr, "ERROR: Bucket "uint64FMT" (out of "uint64FMT") ends before it starts!\n",
>       |                                                ^
> meryl/build.C:555:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   555 |       fprintf(stderr, "ERROR: start="uint64FMT"\n", st);
>       |                       ^
> meryl/build.C:556:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   556 |       fprintf(stderr, "ERROR: end  ="uint64FMT"\n", ed);
>       |                       ^
> meryl/build.C:561:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   561 |       fprintf(stderr, "ERROR: In segment "uint64FMT"\n", segment);
>       |                       ^
> meryl/build.C:562:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   562 |       fprintf(stderr, "ERROR: Bucket "uint64FMT" (out of "uint64FMT") is HUGE!\n",
>       |                       ^
> meryl/build.C:562:48: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   562 |       fprintf(stderr, "ERROR: Bucket "uint64FMT" (out of "uint64FMT") is HUGE!\n",
>       |                                                ^
> meryl/build.C:564:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   564 |       fprintf(stderr, "ERROR: start="uint64FMT"\n", st);
>       |                       ^
> meryl/build.C:565:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   565 |       fprintf(stderr, "ERROR: end  ="uint64FMT"\n", ed);
>       |                       ^
> meryl/build.C:667:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   667 |     fprintf(stderr, "Segment "uint64FMT" finished.\n", segment);
>       |                     ^
> meryl/build.C:705:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   705 |         fprintf(stdout, "%s -countbatch "uint64FMT" -o %s\n", args->execName, s, args->outputFile);
>       |                         ^
> meryl/build.C:783:27: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   783 |       sprintf(argv[argc], "%s.batch"uint32FMT, args->outputFile, i);
>       |                           ^
> meryl/build.C:807:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   807 |       sprintf(filename, "%s.batch"uint32FMT".mcidx", args->outputFile, i);
>       |                         ^
> meryl/build.C:809:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   809 |       sprintf(filename, "%s.batch"uint32FMT".mcdat", args->outputFile, i);
>       |                         ^
> meryl/build.C:811:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   811 |       sprintf(filename, "%s.batch"uint32FMT".mcpos", args->outputFile, i);
>       |                         ^
> meryl/build.C: In function ‘void prepareBatch(merylArgs*)’:
> meryl/build.C:310:23: warning: format ‘%u’ expects argument of type ‘unsigned int’, but argument 4 has type ‘uint64’ {aka ‘long unsigned int’} [-Wformat=]
>   310 |       fprintf(stderr, "Computing "uint64FMT" segments using "uint32FMT" threads and "uint64FMT"MB memory ("uint64FMT"MB if in one batch).\n",
>       |                       ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
>   311 |               estimateMemory(args->merSize, args->mersPerBatch, args->positionsEnabled) * args->numThreads,
>   312 |               estimateMemory(args->merSize, args->numMersActual, args->positionsEnabled));
>       |               ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
>       |                             |
>       |                             uint64 {aka long unsigned int}
> meryl/build.C:310:23: warning: format ‘%lu’ expects a matching ‘long unsigned int’ argument [-Wformat=]
> meryl/build.C:310:23: warning: format ‘%lu’ expects a matching ‘long unsigned int’ argument [-Wformat=]
> meryl/build.C: In function ‘void runSegment(merylArgs*, uint64)’:
> meryl/build.C:412:8: warning: unused variable ‘mstring’ [-Wunused-variable]
>   412 |   char mstring[256];
>       |        ^~~~~~~
> meryl/build.C: In function ‘void build(merylArgs*)’:
> meryl/build.C:769:41: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings]
>   769 |     arga[argc] = false;  argv[argc++] = "meryl-build-merge";
>       |                                         ^~~~~~~~~~~~~~~~~~~
> meryl/build.C:770:41: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings]
>   770 |     arga[argc] = false;  argv[argc++] = "-M";
>       |                                         ^~~~
> meryl/build.C:771:41: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings]
>   771 |     arga[argc] = false;  argv[argc++] = "merge";
>       |                                         ^~~~~~~
> meryl/build.C:775:22: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings]
>   775 |       argv[argc++] = "-v";
>       |                      ^~~~
> meryl/build.C:780:22: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings]
>   780 |       argv[argc++] = "-s";
>       |                      ^~~~
> meryl/build.C:787:41: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings]
>   787 |     arga[argc] = false;  argv[argc++] = "-o";
>       |                                         ^~~~
> Make.rules:135: update target 'meryl/binaryOp.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/ -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o meryl/binaryOp.o -c meryl/binaryOp.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from meryl/meryl.H:4,
>                  from meryl/binaryOp.C:6:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> meryl/binaryOp.C:43:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    43 |     fprintf(stderr, "ERROR - mersize of '%s' is "uint32FMT"\n", args->mergeFiles[0], A->merSize());
>       |                     ^
> meryl/binaryOp.C:44:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    44 |     fprintf(stderr, "ERROR - mersize of '%s' is "uint32FMT"\n", args->mergeFiles[1], B->merSize());
>       |                     ^
> Make.rules:135: update target 'meryl/args.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/ -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o meryl/args.o -c meryl/args.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from meryl/args.C:6:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> meryl/args.C:26:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    26 |     fprintf(stderr, "writeString()-- Failed to write string of length "uint32FMT": %s\n", len, strerror(errno));
>       |                     ^
> meryl/args.C: In function ‘char* readString(FILE*)’:
> meryl/args.C:40:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>    40 |   fread(&len, sizeof(uint32), 1, F);
>       |   ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~
> meryl/args.C:50:10: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>    50 |     fread(str, sizeof(char), len, F);
>       |     ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~
> meryl/args.C: In constructor ‘merylArgs::merylArgs(const char*)’:
> meryl/args.C:513:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   513 |   fread(magic, sizeof(char), 16, F);
>       |   ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~
> meryl/args.C:521:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>   521 |   fread(this, sizeof(merylArgs), 1, F);
>       |   ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> Make.rules:167: update target 'meryl/libmerylguts.a' due to: target does not exist
> rm -f meryl/libmerylguts.a && ar ruvs meryl/libmerylguts.a meryl/args.o meryl/binaryOp.o meryl/build.o meryl/build-threads.o meryl/dump.o meryl/estimate.o meryl/merge.o meryl/unaryOp.o
> ar: `u' modifier ignored since `D' is the default (see `U')
> ar: creating meryl/libmerylguts.a
> a - meryl/args.o
> a - meryl/binaryOp.o
> a - meryl/build.o
> a - meryl/build-threads.o
> a - meryl/dump.o
> a - meryl/estimate.o
> a - meryl/merge.o
> a - meryl/unaryOp.o
> Make.rules:135: update target 'meryl/kmer-mask.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/ -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o meryl/kmer-mask.o -c meryl/kmer-mask.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from meryl/kmer-mask.C:4:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> meryl/kmer-mask.C:754:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   754 |       fprintf(stderr, "aClean "FW"\n", g->thresholdCounts[0][0]);
>       |                       ^
> meryl/kmer-mask.C:755:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   755 |       fprintf(stderr, "aMurky "FW"\n", g->thresholdCounts[1][0]);
>       |                       ^
> meryl/kmer-mask.C:756:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   756 |       fprintf(stderr, "aMatch "FW"\n", g->thresholdCounts[2][0]);
>       |                       ^
> meryl/kmer-mask.C:757:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   757 |       fprintf(stderr, "aMixed "FW"\n", g->thresholdCounts[3][0]);
>       |                       ^
> meryl/kmer-mask.C:760:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   760 |       fprintf(stderr, "aClean "FW"  "FW"  "FW"  "FW"\n", g->thresholdCounts[0][0], g->thresholdCounts[0][1], g->thresholdCounts[0][2], g->thresholdCounts[0][3]);
>       |                       ^
> meryl/kmer-mask.C:760:34: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   760 |       fprintf(stderr, "aClean "FW"  "FW"  "FW"  "FW"\n", g->thresholdCounts[0][0], g->thresholdCounts[0][1], g->thresholdCounts[0][2], g->thresholdCounts[0][3]);
>       |                                  ^
> meryl/kmer-mask.C:760:40: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   760 |       fprintf(stderr, "aClean "FW"  "FW"  "FW"  "FW"\n", g->thresholdCounts[0][0], g->thresholdCounts[0][1], g->thresholdCounts[0][2], g->thresholdCounts[0][3]);
>       |                                        ^
> meryl/kmer-mask.C:760:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   760 |       fprintf(stderr, "aClean "FW"  "FW"  "FW"  "FW"\n", g->thresholdCounts[0][0], g->thresholdCounts[0][1], g->thresholdCounts[0][2], g->thresholdCounts[0][3]);
>       |                                              ^
> meryl/kmer-mask.C:761:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   761 |       fprintf(stderr, "aMurky "FW"  "FW"  "FW"  "FW"\n", g->thresholdCounts[1][0], g->thresholdCounts[1][1], g->thresholdCounts[1][2], g->thresholdCounts[1][3]);
>       |                       ^
> meryl/kmer-mask.C:761:34: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   761 |       fprintf(stderr, "aMurky "FW"  "FW"  "FW"  "FW"\n", g->thresholdCounts[1][0], g->thresholdCounts[1][1], g->thresholdCounts[1][2], g->thresholdCounts[1][3]);
>       |                                  ^
> meryl/kmer-mask.C:761:40: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   761 |       fprintf(stderr, "aMurky "FW"  "FW"  "FW"  "FW"\n", g->thresholdCounts[1][0], g->thresholdCounts[1][1], g->thresholdCounts[1][2], g->thresholdCounts[1][3]);
>       |                                        ^
> meryl/kmer-mask.C:761:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   761 |       fprintf(stderr, "aMurky "FW"  "FW"  "FW"  "FW"\n", g->thresholdCounts[1][0], g->thresholdCounts[1][1], g->thresholdCounts[1][2], g->thresholdCounts[1][3]);
>       |                                              ^
> meryl/kmer-mask.C:762:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   762 |       fprintf(stderr, "aMatch "FW"  "FW"  "FW"  "FW"\n", g->thresholdCounts[2][0], g->thresholdCounts[2][1], g->thresholdCounts[2][2], g->thresholdCounts[2][3]);
>       |                       ^
> meryl/kmer-mask.C:762:34: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   762 |       fprintf(stderr, "aMatch "FW"  "FW"  "FW"  "FW"\n", g->thresholdCounts[2][0], g->thresholdCounts[2][1], g->thresholdCounts[2][2], g->thresholdCounts[2][3]);
>       |                                  ^
> meryl/kmer-mask.C:762:40: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   762 |       fprintf(stderr, "aMatch "FW"  "FW"  "FW"  "FW"\n", g->thresholdCounts[2][0], g->thresholdCounts[2][1], g->thresholdCounts[2][2], g->thresholdCounts[2][3]);
>       |                                        ^
> meryl/kmer-mask.C:762:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   762 |       fprintf(stderr, "aMatch "FW"  "FW"  "FW"  "FW"\n", g->thresholdCounts[2][0], g->thresholdCounts[2][1], g->thresholdCounts[2][2], g->thresholdCounts[2][3]);
>       |                                              ^
> meryl/kmer-mask.C:763:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   763 |       fprintf(stderr, "aMixed "FW"  "FW"  "FW"  "FW"\n", g->thresholdCounts[3][0], g->thresholdCounts[3][1], g->thresholdCounts[3][2], g->thresholdCounts[3][3]);
>       |                       ^
> meryl/kmer-mask.C:763:34: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   763 |       fprintf(stderr, "aMixed "FW"  "FW"  "FW"  "FW"\n", g->thresholdCounts[3][0], g->thresholdCounts[3][1], g->thresholdCounts[3][2], g->thresholdCounts[3][3]);
>       |                                  ^
> meryl/kmer-mask.C:763:40: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   763 |       fprintf(stderr, "aMixed "FW"  "FW"  "FW"  "FW"\n", g->thresholdCounts[3][0], g->thresholdCounts[3][1], g->thresholdCounts[3][2], g->thresholdCounts[3][3]);
>       |                                        ^
> meryl/kmer-mask.C:763:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   763 |       fprintf(stderr, "aMixed "FW"  "FW"  "FW"  "FW"\n", g->thresholdCounts[3][0], g->thresholdCounts[3][1], g->thresholdCounts[3][2], g->thresholdCounts[3][3]);
>       |                                              ^
> meryl/kmer-mask.C: In member function ‘bool fastqRecord::load(FILE*, FILE*)’:
> meryl/kmer-mask.C:69:12: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>    69 |       fgets(a1,      1024, FASTQ1);  chomp(a1);
>       |       ~~~~~^~~~~~~~~~~~~~~~~~~~~~~
> meryl/kmer-mask.C:70:12: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>    70 |       fgets(a2, maxLength, FASTQ1);  chomp(a2);
>       |       ~~~~~^~~~~~~~~~~~~~~~~~~~~~~
> meryl/kmer-mask.C:71:12: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>    71 |       fgets(a3,      1024, FASTQ1);  chomp(a3);
>       |       ~~~~~^~~~~~~~~~~~~~~~~~~~~~~
> meryl/kmer-mask.C:72:12: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>    72 |       fgets(a4, maxLength, FASTQ1);  chomp(a4);
>       |       ~~~~~^~~~~~~~~~~~~~~~~~~~~~~
> meryl/kmer-mask.C:83:12: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>    83 |       fgets(b1,      1024, FASTQ2);  chomp(b1);
>       |       ~~~~~^~~~~~~~~~~~~~~~~~~~~~~
> meryl/kmer-mask.C:84:12: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>    84 |       fgets(b2, maxLength, FASTQ2);  chomp(b2);
>       |       ~~~~~^~~~~~~~~~~~~~~~~~~~~~~
> meryl/kmer-mask.C:85:12: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>    85 |       fgets(b3,      1024, FASTQ2);  chomp(b3);
>       |       ~~~~~^~~~~~~~~~~~~~~~~~~~~~~
> meryl/kmer-mask.C:86:12: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result]
>    86 |       fgets(b4, maxLength, FASTQ2);  chomp(b4);
>       |       ~~~~~^~~~~~~~~~~~~~~~~~~~~~~
> Make.rules:147: update target 'meryl/kmer-mask' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o meryl/kmer-mask meryl/kmer-mask.o /build/reproducible-path/kmer-0~20150903+r2013/libkmer/libkmer.a /build/reproducible-path/kmer-0~20150903+r2013/libmeryl/libmeryl.a /build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a /build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:135: update target 'meryl/mapMers-depth.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/ -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o meryl/mapMers-depth.o -c meryl/mapMers-depth.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from meryl/mapMers-depth.C:5:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> Make.rules:147: update target 'meryl/mapMers-depth' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o meryl/mapMers-depth meryl/mapMers-depth.o /build/reproducible-path/kmer-0~20150903+r2013/libkmer/libkmer.a /build/reproducible-path/kmer-0~20150903+r2013/libmeryl/libmeryl.a /build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a /build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:135: update target 'meryl/mapMers.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/ -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o meryl/mapMers.o -c meryl/mapMers.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from meryl/mapMers.C:5:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> meryl/mapMers.C:135:24: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   135 |               uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"
>       |                        ^
> meryl/mapMers.C:135:37: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   135 |               uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"
>       |                                     ^
> meryl/mapMers.C:136:24: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   136 |               uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"
>       |                        ^
> meryl/mapMers.C:136:37: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   136 |               uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"
>       |                                     ^
> meryl/mapMers.C:136:50: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   136 |               uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"
>       |                                                  ^
> meryl/mapMers.C:136:63: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   136 |               uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"
>       |                                                               ^
> meryl/mapMers.C:136:76: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   136 |               uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"
>       |                                                                            ^
> meryl/mapMers.C:136:89: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   136 |               uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"
>       |                                                                                         ^
> meryl/mapMers.C:136:102: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   136 |               uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"
>       |                                                                                                      ^
> meryl/mapMers.C:137:24: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   137 |               uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\n",
>       |                        ^
> meryl/mapMers.C:137:37: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   137 |               uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\n",
>       |                                     ^
> meryl/mapMers.C:137:50: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   137 |               uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\n",
>       |                                                  ^
> meryl/mapMers.C:137:63: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   137 |               uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\n",
>       |                                                               ^
> meryl/mapMers.C:137:76: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   137 |               uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\n",
>       |                                                                            ^
> meryl/mapMers.C:137:89: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   137 |               uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\n",
>       |                                                                                         ^
> meryl/mapMers.C:137:102: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   137 |               uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\n",
>       |                                                                                                      ^
> meryl/mapMers.C:165:29: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   165 |             fprintf(stdout, "%s\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\n", S->header(), beg, end+merSize, end+merSize - beg);
>       |                             ^
> meryl/mapMers.C:165:44: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   165 |             fprintf(stdout, "%s\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\n", S->header(), beg, end+merSize, end+merSize - beg);
>       |                                            ^
> meryl/mapMers.C:165:57: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   165 |             fprintf(stdout, "%s\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\n", S->header(), beg, end+merSize, end+merSize - beg);
>       |                                                         ^
> meryl/mapMers.C:171:27: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   171 |           fprintf(stdout, "%s\t"uint64FMT"\tuncovered\n", S->header(), MS->thePositionInSequence());
>       |                           ^
> meryl/mapMers.C:176:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   176 |         fprintf(stdout, "%s\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\n", S->header(), beg, end+merSize, end+merSize - beg);
>       |                         ^
> meryl/mapMers.C:176:40: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   176 |         fprintf(stdout, "%s\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\n", S->header(), beg, end+merSize, end+merSize - beg);
>       |                                        ^
> meryl/mapMers.C:176:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   176 |         fprintf(stdout, "%s\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\n", S->header(), beg, end+merSize, end+merSize - beg);
>       |                                                     ^
> meryl/mapMers.C:178:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   178 |       fprintf(stderr, "numCovReg: "uint64FMT"\n", numCovReg);
>       |                       ^
> meryl/mapMers.C:179:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   179 |       fprintf(stderr, "lenCovReg: "uint64FMT"\n", lenCovReg);
>       |                       ^
> meryl/mapMers.C:193:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   193 |         fprintf(stdout, "%s\t%s\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\n",
>       |                         ^
> meryl/mapMers.C:193:44: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   193 |         fprintf(stdout, "%s\t%s\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\n",
>       |                                            ^
> meryl/mapMers.C:193:57: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   193 |         fprintf(stdout, "%s\t%s\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\n",
>       |                                                         ^
> meryl/mapMers.C:193:70: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   193 |         fprintf(stdout, "%s\t%s\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\n",
>       |                                                                      ^
> meryl/mapMers.C:193:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   193 |         fprintf(stdout, "%s\t%s\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\n",
>       |                                                                                   ^
> meryl/mapMers.C: In function ‘int main(int, char**)’:
> meryl/mapMers.C:21:13: warning: variable ‘beVerbose’ set but not used [-Wunused-but-set-variable]
>    21 |   bool      beVerbose  = false;
>       |             ^~~~~~~~~
> Make.rules:147: update target 'meryl/mapMers' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o meryl/mapMers meryl/mapMers.o /build/reproducible-path/kmer-0~20150903+r2013/libkmer/libkmer.a /build/reproducible-path/kmer-0~20150903+r2013/libmeryl/libmeryl.a /build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a /build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:135: update target 'meryl/simple.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/ -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o meryl/simple.o -c meryl/simple.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from meryl/simple.C:8:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> meryl/simple.C:98:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    98 |   fprintf(stderr, "Guessing "uint64FMT" mers in input '%s'\n", numMers, inName);
>       |                   ^
> meryl/simple.C:99:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    99 |   fprintf(stderr, "Allocating "uint64FMT"MB for mer storage.\n", numMers * 8 >> 20);
>       |                   ^
> meryl/simple.C:129:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   129 |   fprintf(stderr, "Found "uint64FMT" mers in input '%s'\n", theMersLen, inName);
>       |                   ^
> Make.rules:147: update target 'meryl/simple' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o meryl/simple meryl/simple.o /build/reproducible-path/kmer-0~20150903+r2013/libmeryl/libmeryl.a /build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a /build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:135: update target 'meryl/meryl.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libmeryl/ -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o meryl/meryl.o -c meryl/meryl.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from meryl/meryl.C:6:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> Make.rules:147: update target 'meryl/meryl' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o meryl/meryl meryl/meryl.o meryl/libmerylguts.a /build/reproducible-path/kmer-0~20150903+r2013/libmeryl/libmeryl.a /build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a /build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:135: update target 'leaff/stats.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o leaff/stats.o -c leaff/stats.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from leaff/stats.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> leaff/stats.C:110:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   110 |   fprintf(stdout, "numSeqs  "uint32FMT"\n", numSeq);
>       |                   ^
> leaff/stats.C:112:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   112 |   fprintf(stdout, "SPAN (smallest "uint32FMT" largest "uint32FMT")\n", Ls[numSeq-1], Ls[0]);
>       |                   ^
> leaff/stats.C:112:45: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   112 |   fprintf(stdout, "SPAN (smallest "uint32FMT" largest "uint32FMT")\n", Ls[numSeq-1], Ls[0]);
>       |                                             ^
> leaff/stats.C:114:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   114 |     fprintf(stdout, "n"uint32FMT"      "uint32FMT" at index "uint32FMT"\n", 10 * i, n50s[i], l50s[i]);
>       |                     ^
> leaff/stats.C:114:33: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   114 |     fprintf(stdout, "n"uint32FMT"      "uint32FMT" at index "uint32FMT"\n", 10 * i, n50s[i], l50s[i]);
>       |                                 ^
> leaff/stats.C:114:50: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   114 |     fprintf(stdout, "n"uint32FMT"      "uint32FMT" at index "uint32FMT"\n", 10 * i, n50s[i], l50s[i]);
>       |                                                  ^
> leaff/stats.C:115:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   115 |   fprintf(stdout, "totLen   "uint64FMTW(10)"\n", Ss);
>       |                   ^
> leaff/stats.C:116:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   116 |   fprintf(stdout, "refLen   "uint64FMTW(10)"\n", Rs);
>       |                   ^
> leaff/stats.C:118:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   118 |   fprintf(stdout, "BASES (smallest "uint32FMT" largest "uint32FMT")\n", Lb[numSeq-1], Lb[0]);
>       |                   ^
> leaff/stats.C:118:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   118 |   fprintf(stdout, "BASES (smallest "uint32FMT" largest "uint32FMT")\n", Lb[numSeq-1], Lb[0]);
>       |                                              ^
> leaff/stats.C:120:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   120 |     fprintf(stdout, "n"uint32FMT"      "uint32FMT" at index "uint32FMT"\n", 10 * i, n50b[i], l50b[i]);
>       |                     ^
> leaff/stats.C:120:33: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   120 |     fprintf(stdout, "n"uint32FMT"      "uint32FMT" at index "uint32FMT"\n", 10 * i, n50b[i], l50b[i]);
>       |                                 ^
> leaff/stats.C:120:50: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   120 |     fprintf(stdout, "n"uint32FMT"      "uint32FMT" at index "uint32FMT"\n", 10 * i, n50b[i], l50b[i]);
>       |                                                  ^
> leaff/stats.C:121:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   121 |   fprintf(stdout, "totLen   "uint64FMTW(10)"\n", Sb);
>       |                   ^
> leaff/stats.C:122:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   122 |   fprintf(stdout, "refLen   "uint64FMTW(10)"\n", Rb);
>       |                   ^
> Make.rules:135: update target 'leaff/simseq.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o leaff/simseq.o -c leaff/simseq.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from leaff/simseq.C:7:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> Make.rules:135: update target 'leaff/partition.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o leaff/partition.o -c leaff/partition.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from leaff/partition.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> leaff/partition.C:55:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 |       fprintf(stderr, "ERROR: Failed to partition "uint32FMT"\n", i);
>       |                       ^
> leaff/partition.C:62:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    62 |       sprintf(filename, "%s-"uint32FMTW(03)".fasta", prefix, o);
>       |                         ^
> leaff/partition.C:77:29: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    77 |             fprintf(stderr, "Huh?  '%s' "uint32FMT" != "uint32FMT"\n", S->header(), S->sequenceLength(), p[i].length);
>       |                             ^
> leaff/partition.C:77:51: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    77 |             fprintf(stderr, "Huh?  '%s' "uint32FMT" != "uint32FMT"\n", S->header(), S->sequenceLength(), p[i].length);
>       |                                                   ^
> leaff/partition.C:96:32: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    96 |       fprintf(stdout, uint32FMT"]("uint32FMT")", o, sizeP);
>       |                                ^
> leaff/partition.C:99:27: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    99 |           fprintf(stdout, " "uint32FMT"("uint32FMT")", p[i].index, p[i].length);
>       |                           ^
> leaff/partition.C:99:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    99 |           fprintf(stdout, " "uint32FMT"("uint32FMT")", p[i].index, p[i].length);
>       |                                       ^
> Make.rules:135: update target 'leaff/gc.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o leaff/gc.o -c leaff/gc.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from leaff/gc.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> leaff/gc.C:68:32: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 |       fprintf(stdout, uint32FMT"\t"uint32FMT"\t%.2f\t%.2f\t%.2f\t%.2f\t%.2f\t%.2f\t%.2f\t%.2f\t%.2f\n",
>       |                                ^
> Make.rules:135: update target 'leaff/dups.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o leaff/dups.o -c leaff/dups.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from leaff/dups.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> leaff/dups.C:26:30: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    26 |     fprintf(stdout, uint32FMT" <-> "uint32FMT"\n", sa->getIID(), sb->getIID());
>       |                              ^
> leaff/dups.C:28:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    28 |     fprintf(stderr, "COLLISION DETECTED BETWEEN %s:"uint32FMT" AND %s:"uint32FMT"!\nPLEASE REPORT THIS TO bri at walenz.org!\n",
>       |                     ^
> leaff/dups.C:28:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    28 |     fprintf(stderr, "COLLISION DETECTED BETWEEN %s:"uint32FMT" AND %s:"uint32FMT"!\nPLEASE REPORT THIS TO bri at walenz.org!\n",
>       |                                                              ^
> leaff/dups.C:52:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    52 |         fprintf(stderr, "Internal error: found two copies of the same sequence iid ("uint32FMT")!\n", result[idx].i);
>       |                         ^
> leaff/dups.C:60:34: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    60 |         fprintf(stdout, uint32FMT":%s\n"uint32FMT":%s\n\n",
>       |                                  ^
> leaff/dups.C:64:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    64 |         fprintf(stderr, "COLLISION DETECTED BETWEEN IID "uint32FMT" AND "uint32FMT"!\nPLEASE REPORT THIS TO bri at walenz.org!\n",
>       |                         ^
> leaff/dups.C:64:67: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    64 |         fprintf(stderr, "COLLISION DETECTED BETWEEN IID "uint32FMT" AND "uint32FMT"!\nPLEASE REPORT THIS TO bri at walenz.org!\n",
>       |                                                                   ^
> Make.rules:135: update target 'leaff/blocks.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o leaff/blocks.o -c leaff/blocks.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from leaff/blocks.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> leaff/blocks.C:32:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |         fprintf(stdout, "%c "uint32FMT" "uint32FMT" "uint32FMT" "uint32FMT"\n",
>       |                         ^
> leaff/blocks.C:32:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |         fprintf(stdout, "%c "uint32FMT" "uint32FMT" "uint32FMT" "uint32FMT"\n",
>       |                                       ^
> leaff/blocks.C:32:51: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |         fprintf(stdout, "%c "uint32FMT" "uint32FMT" "uint32FMT" "uint32FMT"\n",
>       |                                                   ^
> leaff/blocks.C:32:63: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |         fprintf(stdout, "%c "uint32FMT" "uint32FMT" "uint32FMT" "uint32FMT"\n",
>       |                                                               ^
> leaff/blocks.C:40:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    40 |     fprintf(stdout, "%c "uint32FMT" "uint32FMT" "uint32FMT" "uint32FMT"\n",
>       |                     ^
> leaff/blocks.C:40:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    40 |     fprintf(stdout, "%c "uint32FMT" "uint32FMT" "uint32FMT" "uint32FMT"\n",
>       |                                   ^
> leaff/blocks.C:40:47: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    40 |     fprintf(stdout, "%c "uint32FMT" "uint32FMT" "uint32FMT" "uint32FMT"\n",
>       |                                               ^
> leaff/blocks.C:40:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    40 |     fprintf(stdout, "%c "uint32FMT" "uint32FMT" "uint32FMT" "uint32FMT"\n",
>       |                                                           ^
> leaff/blocks.C:42:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    42 |     fprintf(stdout, ". "uint32FMT" "uint32FMT" "uint32FMT"\n", s, pos, uint32ZERO);
>       |                     ^
> leaff/blocks.C:42:34: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    42 |     fprintf(stdout, ". "uint32FMT" "uint32FMT" "uint32FMT"\n", s, pos, uint32ZERO);
>       |                                  ^
> leaff/blocks.C:42:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    42 |     fprintf(stdout, ". "uint32FMT" "uint32FMT" "uint32FMT"\n", s, pos, uint32ZERO);
>       |                                              ^
> leaff/blocks.C: In function ‘void dumpBlocks(char*)’:
> leaff/blocks.C:7:16: warning: unused variable ‘S’ [-Wunused-variable]
>     7 |   seqInCore   *S     = 0L;
>       |                ^
> Make.rules:135: update target 'leaff/leaff.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o leaff/leaff.o -c leaff/leaff.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from leaff/leaff.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> leaff/leaff.C:311:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   311 |     fprintf(stderr, "WARNING: Didn't find sequence with iid '"uint32FMT"'\n", sid);
>       |                     ^
> leaff/leaff.C:400:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   400 |         fprintf(stdout, "G\tseq\t%s:"uint32FMT"\t"uint32FMT"\t%s\n",
>       |                         ^
> leaff/leaff.C:400:47: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   400 |         fprintf(stdout, "G\tseq\t%s:"uint32FMT"\t"uint32FMT"\t%s\n",
>       |                                               ^
> leaff/leaff.C:469:22: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   469 |         sprintf(def, "random"uint32FMTW(06), i);
>       |                      ^
> leaff/leaff.C:727:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   727 |       fprintf(stderr, "Couldn't read "uint64FMT" bytes from '%s': %s\n",
>       |                       ^
> Make.rules:147: update target 'leaff/leaff' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o leaff/leaff leaff/leaff.o leaff/blocks.o leaff/dups.o leaff/gc.o leaff/partition.o leaff/simseq.o leaff/stats.o /build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a /build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> Make.rules:135: update target 'seatac/heavychains.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seatac/heavychains.o -c seatac/heavychains.C
> In file included from seatac/heavychains.H:11,
>                  from seatac/heavychains.C:22:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> seatac/heavychains.C:96:22: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    96 |       fprintf(stderr,"HeavyChains: filtering strands "uint32FMT" "uint32FMT" "uint32FMT"\n", iid1, iid2, Plen);
>       |                      ^
> seatac/heavychains.C:96:64: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    96 |       fprintf(stderr,"HeavyChains: filtering strands "uint32FMT" "uint32FMT" "uint32FMT"\n", iid1, iid2, Plen);
>       |                                                                ^
> seatac/heavychains.C:96:76: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    96 |       fprintf(stderr,"HeavyChains: filtering strands "uint32FMT" "uint32FMT" "uint32FMT"\n", iid1, iid2, Plen);
>       |                                                                            ^
> seatac/heavychains.C:164:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   164 |         fprintf(stderr, "heavychains: out "uint32FMTW(8)" %8d %8d -- "uint32FMTW(8)" %8d %8d\n",
>       |                         ^
> seatac/heavychains.C:164:57: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   164 |         fprintf(stderr, "heavychains: out "uint32FMTW(8)" %8d %8d -- "uint32FMTW(8)" %8d %8d\n",
>       |                                                         ^
> seatac/heavychains.C:169:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   169 |       fprintf(outF, "M x H"uint64FMT" . %s:"uint32FMT" %d %d %d %s:"uint32FMT" %d %d %d > /hf=%.1f /hr=%.1f\n",
>       |                     ^
> seatac/heavychains.C:169:37: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   169 |       fprintf(outF, "M x H"uint64FMT" . %s:"uint32FMT" %d %d %d %s:"uint32FMT" %d %d %d > /hf=%.1f /hr=%.1f\n",
>       |                                     ^
> seatac/heavychains.C:169:54: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   169 |       fprintf(outF, "M x H"uint64FMT" . %s:"uint32FMT" %d %d %d %s:"uint32FMT" %d %d %d > /hf=%.1f /hr=%.1f\n",
>       |                                                      ^
> seatac/heavychains.C:186:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   186 |       fprintf(stderr, "HeavyChains: finished strands "uint32FMTW(8)" "uint32FMTW(8)" maxlen1=%f maxlen2=%f maxScoreFwd=%f maxScoreRef=%f\n",
>       |                       ^
> seatac/heavychains.C:186:68: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   186 |       fprintf(stderr, "HeavyChains: finished strands "uint32FMTW(8)" "uint32FMTW(8)" maxlen1=%f maxlen2=%f maxScoreFwd=%f maxScoreRef=%f\n",
>       |                                                                    ^
> seatac/heavychains.H: In member function ‘double DPTree::matchScore(kd_node, Match&)’:
> seatac/heavychains.H:374:19: warning: suggest parentheses around ‘&&’ within ‘||’ [-Wparentheses]
>   374 |     if ( (flo.X() && node[flo.intv].lo <= p.xlo ||
>       |           ~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> Make.rules:135: update target 'seatac/filter-heavychains.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seatac/filter-heavychains.o -c seatac/filter-heavychains.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:4,
>                  from seatac/filter-heavychains.C:24:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> In file included from seatac/filter-heavychains.C:25:
> seatac/heavychains.H: In member function ‘double DPTree::matchScore(kd_node, Match&)’:
> seatac/heavychains.H:374:19: warning: suggest parentheses around ‘&&’ within ‘||’ [-Wparentheses]
>   374 |     if ( (flo.X() && node[flo.intv].lo <= p.xlo ||
>       |           ~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> seatac/heavychains.H: In function ‘void addHit(void*, char, uint32, uint32, uint32, uint32, uint32, uint32, uint32)’:
> seatac/heavychains.H:53:12: warning: ‘char* __builtin_strncpy(char*, const char*, long unsigned int)’ output may be truncated copying 31 bytes from a string of length 31 [-Wstringop-truncation]
>    53 |     strncpy(assemblyId1, assemblyid1, 31);
>       |            ^
> seatac/heavychains.H:54:12: warning: ‘char* __builtin_strncpy(char*, const char*, long unsigned int)’ output may be truncated copying 31 bytes from a string of length 31 [-Wstringop-truncation]
>    54 |     strncpy(assemblyId2, assemblyid2, 31);
>       |            ^
> seatac/heavychains.H:53:12: warning: ‘char* __builtin_strncpy(char*, const char*, long unsigned int)’ output may be truncated copying 31 bytes from a string of length 31 [-Wstringop-truncation]
>    53 |     strncpy(assemblyId1, assemblyid1, 31);
>       |            ^
> seatac/heavychains.H:54:12: warning: ‘char* __builtin_strncpy(char*, const char*, long unsigned int)’ output may be truncated copying 31 bytes from a string of length 31 [-Wstringop-truncation]
>    54 |     strncpy(assemblyId2, assemblyid2, 31);
>       |            ^
> seatac/heavychains.H:53:12: warning: ‘char* __builtin_strncpy(char*, const char*, long unsigned int)’ output may be truncated copying 31 bytes from a string of length 31 [-Wstringop-truncation]
>    53 |     strncpy(assemblyId1, assemblyid1, 31);
>       |            ^
> seatac/heavychains.H:54:12: warning: ‘char* __builtin_strncpy(char*, const char*, long unsigned int)’ output may be truncated copying 31 bytes from a string of length 31 [-Wstringop-truncation]
>    54 |     strncpy(assemblyId2, assemblyid2, 31);
>       |            ^
> Make.rules:180: update target 'seatac/filter-heavychains.so' due to: target does not exist
> rm -f seatac/filter-heavychains.so && g++ -Wl,-z,relro -Wl,-z,now -shared  -o seatac/filter-heavychains.so seatac/filter-heavychains.o seatac/heavychains.o -pthread -ldl -lm
> Make.rules:135: update target 'seatac/filter-nop.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seatac/filter-nop.o -c seatac/filter-nop.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from seatac/filter-nop.C:9:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from seatac/filter-nop.C:10:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> seatac/filter-nop.C:67:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    67 |               "M x . . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |               ^
> seatac/filter-nop.C:67:37: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    67 |               "M x . . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                     ^
> seatac/filter-nop.C:67:49: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    67 |               "M x . . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                                 ^
> seatac/filter-nop.C:67:61: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    67 |               "M x . . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                                             ^
> seatac/filter-nop.C:67:78: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    67 |               "M x . . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                                                              ^
> seatac/filter-nop.C:67:90: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    67 |               "M x . . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                                                                          ^
> seatac/filter-nop.C:67:102: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    67 |               "M x . . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                                                                                      ^
> seatac/filter-nop.C: In function ‘void* construct(char*)’:
> seatac/filter-nop.C:116:16: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings]
>   116 |   char *seq1 = "UNK";
>       |                ^~~~~
> seatac/filter-nop.C:117:16: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings]
>   117 |   char *seq2 = "UNK";
>       |                ^~~~~
> Make.rules:180: update target 'seatac/filter-nop.so' due to: target does not exist
> rm -f seatac/filter-nop.so && g++ -Wl,-z,relro -Wl,-z,now -shared  -o seatac/filter-nop.so seatac/filter-nop.o -pthread -ldl -lm
> Make.rules:135: update target 'seatac/heavychains-driver.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seatac/heavychains-driver.o -c seatac/heavychains-driver.C
> In file included from seatac/heavychains.H:11,
>                  from seatac/heavychains-driver.C:24:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> seatac/heavychains.H: In member function ‘double DPTree::matchScore(kd_node, Match&)’:
> seatac/heavychains.H:374:19: warning: suggest parentheses around ‘&&’ within ‘||’ [-Wparentheses]
>   374 |     if ( (flo.X() && node[flo.intv].lo <= p.xlo ||
>       |           ~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> Make.rules:147: update target 'seatac/heavychains' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o seatac/heavychains seatac/heavychains-driver.o seatac/heavychains.o -pthread -ldl -lm
> Make.rules:135: update target 'seatac/hitMatrix-sort.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seatac/hitMatrix-sort.o -c seatac/hitMatrix-sort.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from seatac/hitMatrix.H:8,
>                  from seatac/hitMatrix-sort.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> In file included from seatac/hitMatrix.H:9:
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   127 |       fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   129 |       fprintf(stderr, "M = "uint64HEX"\n", m);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   130 |       fprintf(stderr, "H = "uint64HEX"\n", h);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   131 |       fprintf(stderr, "C = "uint64HEX"\n", c);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stderr, "R = "uint64HEX"\n", r);
>       |                       ^
> In file included from seatac/hitMatrix.H:10:
> seatac/filterObj.H:148:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   148 |         fprintf(stderr, "hitMatrix::filter()-- tried to extend output string from "uint32FMT" to "uint32FMT" bytes.\n", theOutputPos, theOutputMax);
>       |                         ^
> seatac/filterObj.H:148:93: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   148 |         fprintf(stderr, "hitMatrix::filter()-- tried to extend output string from "uint32FMT" to "uint32FMT" bytes.\n", theOutputPos, theOutputMax);
>       |                                                                                             ^
> seatac/filterObj.H:157:13: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |             ^
> seatac/filterObj.H:157:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                              ^
> seatac/filterObj.H:157:58: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                                          ^
> seatac/filterObj.H:157:70: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                                                      ^
> seatac/filterObj.H:157:87: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                                                                       ^
> seatac/filterObj.H:157:99: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                                                                                   ^
> seatac/filterObj.H:157:111: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                                                                                               ^
> seatac/filterObj.H:212:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   212 |         fprintf(stderr, "WARNING:  there isn't enough space in the match to insert the match id "uint64FMT" '%s'!\n",
>       |                         ^
> seatac/hitMatrix.H:84:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    84 |       fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn);
>       |                       ^
> seatac/hitMatrix.H:84:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    84 |       fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn);
>       |                                                              ^
> seatac/filterObj.H: In member function ‘void filterObj::addHit(char, uint32, uint32, uint32, uint32, uint32, uint32, uint32)’:
> seatac/filterObj.H:146:21: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=]
>   146 |       } catch (std::bad_alloc) {
>       |                     ^~~~~~~~~
> seatac/hitMatrix.H: In member function ‘void hitMatrix::addHits(uint32, uint64*, uint64)’:
> seatac/hitMatrix.H:82:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=]
>    82 |     } catch (std::bad_alloc) {
>       |                   ^~~~~~~~~
> Make.rules:135: update target 'seatac/thr-deadlock.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seatac/thr-deadlock.o -c seatac/thr-deadlock.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from seatac/seatac.H:20,
>                  from seatac/thr-deadlock.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> In file included from seatac/seatac.H:25:
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   127 |       fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   129 |       fprintf(stderr, "M = "uint64HEX"\n", m);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   130 |       fprintf(stderr, "H = "uint64HEX"\n", h);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   131 |       fprintf(stderr, "C = "uint64HEX"\n", c);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stderr, "R = "uint64HEX"\n", r);
>       |                       ^
> In file included from seatac/hitMatrix.H:10,
>                  from seatac/seatac.H:27:
> seatac/filterObj.H:148:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   148 |         fprintf(stderr, "hitMatrix::filter()-- tried to extend output string from "uint32FMT" to "uint32FMT" bytes.\n", theOutputPos, theOutputMax);
>       |                         ^
> seatac/filterObj.H:148:93: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   148 |         fprintf(stderr, "hitMatrix::filter()-- tried to extend output string from "uint32FMT" to "uint32FMT" bytes.\n", theOutputPos, theOutputMax);
>       |                                                                                             ^
> seatac/filterObj.H:157:13: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |             ^
> seatac/filterObj.H:157:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                              ^
> seatac/filterObj.H:157:58: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                                          ^
> seatac/filterObj.H:157:70: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                                                      ^
> seatac/filterObj.H:157:87: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                                                                       ^
> seatac/filterObj.H:157:99: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                                                                                   ^
> seatac/filterObj.H:157:111: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                                                                                               ^
> seatac/filterObj.H:212:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   212 |         fprintf(stderr, "WARNING:  there isn't enough space in the match to insert the match id "uint64FMT" '%s'!\n",
>       |                         ^
> seatac/hitMatrix.H:84:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    84 |       fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn);
>       |                       ^
> seatac/hitMatrix.H:84:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    84 |       fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn);
>       |                                                              ^
> seatac/filterObj.H: In member function ‘void filterObj::addHit(char, uint32, uint32, uint32, uint32, uint32, uint32, uint32)’:
> seatac/filterObj.H:146:21: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=]
>   146 |       } catch (std::bad_alloc) {
>       |                     ^~~~~~~~~
> seatac/hitMatrix.H: In member function ‘void hitMatrix::addHits(uint32, uint64*, uint64)’:
> seatac/hitMatrix.H:82:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=]
>    82 |     } catch (std::bad_alloc) {
>       |                   ^~~~~~~~~
> Make.rules:135: update target 'seatac/thr-loader.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seatac/thr-loader.o -c seatac/thr-loader.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from seatac/seatac.H:20,
>                  from seatac/thr-loader.C:5:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> In file included from seatac/seatac.H:25:
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   127 |       fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   129 |       fprintf(stderr, "M = "uint64HEX"\n", m);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   130 |       fprintf(stderr, "H = "uint64HEX"\n", h);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   131 |       fprintf(stderr, "C = "uint64HEX"\n", c);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stderr, "R = "uint64HEX"\n", r);
>       |                       ^
> In file included from seatac/hitMatrix.H:10,
>                  from seatac/seatac.H:27:
> seatac/filterObj.H:148:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   148 |         fprintf(stderr, "hitMatrix::filter()-- tried to extend output string from "uint32FMT" to "uint32FMT" bytes.\n", theOutputPos, theOutputMax);
>       |                         ^
> seatac/filterObj.H:148:93: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   148 |         fprintf(stderr, "hitMatrix::filter()-- tried to extend output string from "uint32FMT" to "uint32FMT" bytes.\n", theOutputPos, theOutputMax);
>       |                                                                                             ^
> seatac/filterObj.H:157:13: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |             ^
> seatac/filterObj.H:157:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                              ^
> seatac/filterObj.H:157:58: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                                          ^
> seatac/filterObj.H:157:70: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                                                      ^
> seatac/filterObj.H:157:87: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                                                                       ^
> seatac/filterObj.H:157:99: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                                                                                   ^
> seatac/filterObj.H:157:111: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                                                                                               ^
> seatac/filterObj.H:212:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   212 |         fprintf(stderr, "WARNING:  there isn't enough space in the match to insert the match id "uint64FMT" '%s'!\n",
>       |                         ^
> seatac/hitMatrix.H:84:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    84 |       fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn);
>       |                       ^
> seatac/hitMatrix.H:84:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    84 |       fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn);
>       |                                                              ^
> seatac/filterObj.H: In member function ‘void filterObj::addHit(char, uint32, uint32, uint32, uint32, uint32, uint32, uint32)’:
> seatac/filterObj.H:146:21: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=]
>   146 |       } catch (std::bad_alloc) {
>       |                     ^~~~~~~~~
> seatac/hitMatrix.H: In member function ‘void hitMatrix::addHits(uint32, uint64*, uint64)’:
> seatac/hitMatrix.H:82:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=]
>    82 |     } catch (std::bad_alloc) {
>       |                   ^~~~~~~~~
> seatac/thr-loader.C: In function ‘void* loaderThread(void*)’:
> seatac/thr-loader.C:68:21: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=]
>    68 |       } catch (std::bad_alloc) {
>       |                     ^~~~~~~~~
> Make.rules:135: update target 'seatac/thr-search.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seatac/thr-search.o -c seatac/thr-search.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from seatac/seatac.H:20,
>                  from seatac/thr-search.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> In file included from seatac/seatac.H:25:
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   127 |       fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   129 |       fprintf(stderr, "M = "uint64HEX"\n", m);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   130 |       fprintf(stderr, "H = "uint64HEX"\n", h);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   131 |       fprintf(stderr, "C = "uint64HEX"\n", c);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stderr, "R = "uint64HEX"\n", r);
>       |                       ^
> In file included from seatac/hitMatrix.H:10,
>                  from seatac/seatac.H:27:
> seatac/filterObj.H:148:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   148 |         fprintf(stderr, "hitMatrix::filter()-- tried to extend output string from "uint32FMT" to "uint32FMT" bytes.\n", theOutputPos, theOutputMax);
>       |                         ^
> seatac/filterObj.H:148:93: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   148 |         fprintf(stderr, "hitMatrix::filter()-- tried to extend output string from "uint32FMT" to "uint32FMT" bytes.\n", theOutputPos, theOutputMax);
>       |                                                                                             ^
> seatac/filterObj.H:157:13: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |             ^
> seatac/filterObj.H:157:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                              ^
> seatac/filterObj.H:157:58: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                                          ^
> seatac/filterObj.H:157:70: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                                                      ^
> seatac/filterObj.H:157:87: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                                                                       ^
> seatac/filterObj.H:157:99: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                                                                                   ^
> seatac/filterObj.H:157:111: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                                                                                               ^
> seatac/filterObj.H:212:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   212 |         fprintf(stderr, "WARNING:  there isn't enough space in the match to insert the match id "uint64FMT" '%s'!\n",
>       |                         ^
> seatac/hitMatrix.H:84:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    84 |       fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn);
>       |                       ^
> seatac/hitMatrix.H:84:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    84 |       fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn);
>       |                                                              ^
> seatac/thr-search.C:3:24: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>     3 | char const *srchGbye = "[%ld] computed: "uint64FMTW(8)"  blocked: "uint64FMTW(4)"/"uint64FMTW(4)"  encodeTime: %7.2f   searchTime: %7.2f   processTime: %7.2f\n";
>       |                        ^
> seatac/thr-search.C:3:55: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>     3 | char const *srchGbye = "[%ld] computed: "uint64FMTW(8)"  blocked: "uint64FMTW(4)"/"uint64FMTW(4)"  encodeTime: %7.2f   searchTime: %7.2f   processTime: %7.2f\n";
>       |                                                       ^
> seatac/thr-search.C:3:81: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>     3 | char const *srchGbye = "[%ld] computed: "uint64FMTW(8)"  blocked: "uint64FMTW(4)"/"uint64FMTW(4)"  encodeTime: %7.2f   searchTime: %7.2f   processTime: %7.2f\n";
>       |                                                                                 ^
> seatac/thr-search.C:130:38: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   130 |             fprintf(stderr, uint64FMT" Blocked by output (idx = "uint32FMT", outputPos = "uint32FMT").\n", (long)U, idx, outputPos);
>       |                                      ^
> seatac/thr-search.C:130:75: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   130 |             fprintf(stderr, uint64FMT" Blocked by output (idx = "uint32FMT", outputPos = "uint32FMT").\n", (long)U, idx, outputPos);
>       |                                                                           ^
> seatac/filterObj.H: In member function ‘void filterObj::addHit(char, uint32, uint32, uint32, uint32, uint32, uint32, uint32)’:
> seatac/filterObj.H:146:21: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=]
>   146 |       } catch (std::bad_alloc) {
>       |                     ^~~~~~~~~
> seatac/hitMatrix.H: In member function ‘void hitMatrix::addHits(uint32, uint64*, uint64)’:
> seatac/hitMatrix.H:82:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=]
>    82 |     } catch (std::bad_alloc) {
>       |                   ^~~~~~~~~
> Make.rules:135: update target 'seatac/hitMatrix.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seatac/hitMatrix.o -c seatac/hitMatrix.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from seatac/seatac.H:20,
>                  from seatac/hitMatrix.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> In file included from seatac/seatac.H:25:
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   127 |       fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   129 |       fprintf(stderr, "M = "uint64HEX"\n", m);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   130 |       fprintf(stderr, "H = "uint64HEX"\n", h);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   131 |       fprintf(stderr, "C = "uint64HEX"\n", c);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stderr, "R = "uint64HEX"\n", r);
>       |                       ^
> In file included from seatac/hitMatrix.H:10,
>                  from seatac/seatac.H:27:
> seatac/filterObj.H:148:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   148 |         fprintf(stderr, "hitMatrix::filter()-- tried to extend output string from "uint32FMT" to "uint32FMT" bytes.\n", theOutputPos, theOutputMax);
>       |                         ^
> seatac/filterObj.H:148:93: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   148 |         fprintf(stderr, "hitMatrix::filter()-- tried to extend output string from "uint32FMT" to "uint32FMT" bytes.\n", theOutputPos, theOutputMax);
>       |                                                                                             ^
> seatac/filterObj.H:157:13: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |             ^
> seatac/filterObj.H:157:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                              ^
> seatac/filterObj.H:157:58: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                                          ^
> seatac/filterObj.H:157:70: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                                                      ^
> seatac/filterObj.H:157:87: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                                                                       ^
> seatac/filterObj.H:157:99: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                                                                                   ^
> seatac/filterObj.H:157:111: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                                                                                               ^
> seatac/filterObj.H:212:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   212 |         fprintf(stderr, "WARNING:  there isn't enough space in the match to insert the match id "uint64FMT" '%s'!\n",
>       |                         ^
> seatac/hitMatrix.H:84:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    84 |       fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn);
>       |                       ^
> seatac/hitMatrix.H:84:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    84 |       fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn);
>       |                                                              ^
> seatac/filterObj.H: In member function ‘void filterObj::addHit(char, uint32, uint32, uint32, uint32, uint32, uint32, uint32)’:
> seatac/filterObj.H:146:21: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=]
>   146 |       } catch (std::bad_alloc) {
>       |                     ^~~~~~~~~
> seatac/hitMatrix.H: In member function ‘void hitMatrix::addHits(uint32, uint64*, uint64)’:
> seatac/hitMatrix.H:82:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=]
>    82 |     } catch (std::bad_alloc) {
>       |                   ^~~~~~~~~
> Make.rules:135: update target 'seatac/encodedQuery.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seatac/encodedQuery.o -c seatac/encodedQuery.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from seatac/seatac.H:20,
>                  from seatac/encodedQuery.C:3:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> In file included from seatac/seatac.H:25:
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   127 |       fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   129 |       fprintf(stderr, "M = "uint64HEX"\n", m);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   130 |       fprintf(stderr, "H = "uint64HEX"\n", h);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   131 |       fprintf(stderr, "C = "uint64HEX"\n", c);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stderr, "R = "uint64HEX"\n", r);
>       |                       ^
> In file included from seatac/hitMatrix.H:10,
>                  from seatac/seatac.H:27:
> seatac/filterObj.H:148:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   148 |         fprintf(stderr, "hitMatrix::filter()-- tried to extend output string from "uint32FMT" to "uint32FMT" bytes.\n", theOutputPos, theOutputMax);
>       |                         ^
> seatac/filterObj.H:148:93: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   148 |         fprintf(stderr, "hitMatrix::filter()-- tried to extend output string from "uint32FMT" to "uint32FMT" bytes.\n", theOutputPos, theOutputMax);
>       |                                                                                             ^
> seatac/filterObj.H:157:13: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |             ^
> seatac/filterObj.H:157:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                              ^
> seatac/filterObj.H:157:58: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                                          ^
> seatac/filterObj.H:157:70: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                                                      ^
> seatac/filterObj.H:157:87: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                                                                       ^
> seatac/filterObj.H:157:99: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                                                                                   ^
> seatac/filterObj.H:157:111: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                                                                                               ^
> seatac/filterObj.H:212:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   212 |         fprintf(stderr, "WARNING:  there isn't enough space in the match to insert the match id "uint64FMT" '%s'!\n",
>       |                         ^
> seatac/hitMatrix.H:84:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    84 |       fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn);
>       |                       ^
> seatac/hitMatrix.H:84:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    84 |       fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn);
>       |                                                              ^
> seatac/filterObj.H: In member function ‘void filterObj::addHit(char, uint32, uint32, uint32, uint32, uint32, uint32, uint32)’:
> seatac/filterObj.H:146:21: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=]
>   146 |       } catch (std::bad_alloc) {
>       |                     ^~~~~~~~~
> seatac/hitMatrix.H: In member function ‘void hitMatrix::addHits(uint32, uint64*, uint64)’:
> seatac/hitMatrix.H:82:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=]
>    82 |     } catch (std::bad_alloc) {
>       |                   ^~~~~~~~~
> Make.rules:135: update target 'seatac/configuration.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seatac/configuration.o -c seatac/configuration.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from seatac/seatac.H:20,
>                  from seatac/configuration.C:1:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> In file included from seatac/seatac.H:25:
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   127 |       fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   129 |       fprintf(stderr, "M = "uint64HEX"\n", m);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   130 |       fprintf(stderr, "H = "uint64HEX"\n", h);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   131 |       fprintf(stderr, "C = "uint64HEX"\n", c);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stderr, "R = "uint64HEX"\n", r);
>       |                       ^
> In file included from seatac/hitMatrix.H:10,
>                  from seatac/seatac.H:27:
> seatac/filterObj.H:148:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   148 |         fprintf(stderr, "hitMatrix::filter()-- tried to extend output string from "uint32FMT" to "uint32FMT" bytes.\n", theOutputPos, theOutputMax);
>       |                         ^
> seatac/filterObj.H:148:93: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   148 |         fprintf(stderr, "hitMatrix::filter()-- tried to extend output string from "uint32FMT" to "uint32FMT" bytes.\n", theOutputPos, theOutputMax);
>       |                                                                                             ^
> seatac/filterObj.H:157:13: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |             ^
> seatac/filterObj.H:157:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                              ^
> seatac/filterObj.H:157:58: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                                          ^
> seatac/filterObj.H:157:70: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                                                      ^
> seatac/filterObj.H:157:87: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                                                                       ^
> seatac/filterObj.H:157:99: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                                                                                   ^
> seatac/filterObj.H:157:111: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                                                                                               ^
> seatac/filterObj.H:212:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   212 |         fprintf(stderr, "WARNING:  there isn't enough space in the match to insert the match id "uint64FMT" '%s'!\n",
>       |                         ^
> seatac/hitMatrix.H:84:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    84 |       fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn);
>       |                       ^
> seatac/hitMatrix.H:84:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    84 |       fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn);
>       |                                                              ^
> seatac/configuration.C:259:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   259 |   fprintf(out, "/seatacNumSearchThreads="uint32FMT"\n", _numSearchThreads);
>       |                ^
> seatac/configuration.C:260:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   260 |   fprintf(out, "/seatacLoaderHighWaterMark="uint32FMT"\n", _loaderHighWaterMark);
>       |                ^
> seatac/configuration.C:264:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   264 |   fprintf(out, "/seatacWriterHighWaterMark="uint32FMT"\n", _writerHighWaterMark);
>       |                ^
> seatac/configuration.C:267:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   267 |   fprintf(out, "/seatacMaxDiagonal="uint32FMT"\n", _maxDiagonal);
>       |                ^
> seatac/configuration.C:268:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   268 |   fprintf(out, "/seatacMaxGap="uint32FMT"\n", _maxGap);
>       |                ^
> seatac/configuration.C:269:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   269 |   fprintf(out, "/seatacQsOverlap="uint32FMT"\n", _qsOverlap);
>       |                ^
> seatac/configuration.C:270:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   270 |   fprintf(out, "/seatacDsOverlap="uint32FMT"\n", _dsOverlap);
>       |                ^
> seatac/configuration.C:271:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   271 |   fprintf(out, "/seatacMinLength="uint32FMT"\n", _minLength + _merSize);
>       |                ^
> seatac/configuration.C:272:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   272 |   fprintf(out, "/seatacMerSize="uint32FMT"\n", _merSize);
>       |                ^
> seatac/configuration.C:273:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   273 |   fprintf(out, "/seatacMerSkip="uint32FMT"\n", _merSkip);
>       |                ^
> seatac/filterObj.H: In member function ‘void filterObj::addHit(char, uint32, uint32, uint32, uint32, uint32, uint32, uint32)’:
> seatac/filterObj.H:146:21: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=]
>   146 |       } catch (std::bad_alloc) {
>       |                     ^~~~~~~~~
> seatac/hitMatrix.H: In member function ‘void hitMatrix::addHits(uint32, uint64*, uint64)’:
> seatac/hitMatrix.H:82:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=]
>    82 |     } catch (std::bad_alloc) {
>       |                   ^~~~~~~~~
> Make.rules:135: update target 'seatac/seatac.o' due to: target does not exist
> g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/build/reproducible-path/kmer-0~20150903+r2013=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/build/reproducible-path/kmer-0~20150903+r2013/libkmer/ -I/build/reproducible-path/kmer-0~20150903+r2013/libbio/ -I/build/reproducible-path/kmer-0~20150903+r2013/libseq/ -I/build/reproducible-path/kmer-0~20150903+r2013/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seatac/seatac.o -c seatac/seatac.C
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio.h:4,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:14,
>                  from seatac/seatac.H:20,
>                  from seatac/seatac.C:4:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    55 | #define  uint64FMT       "%"PRIu64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    56 | #define  uint64HEX       "0x%016"PRIx64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    58 | #define  int64FMT        "%"PRId64
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    65 | #define  uint32FMT       "%"PRIu32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    66 | #define  uint32HEX       "0x%08"PRIx32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    68 | #define  int32FMT        "%"PRId32
>       |                          ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 | #define  uint16FMT       "%"PRIu16
>       |                          ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:37,
>                  from /build/reproducible-path/kmer-0~20150903+r2013/libbio/bio++.H:15:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   222 |       fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i));
>       |                                       ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:38:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                ^
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    32 |     fprintf(f, "inside: "uint64FMT"  outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside);
>       |                                   ^
> In file included from /build/reproducible-path/kmer-0~20150903+r2013/libutil/util++.H:43:
> /build/reproducible-path/kmer-0~20150903+r2013/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    75 |               "logMsg::add()-- HEY!  I wrote "uint32FMT" bytes beyond the end of the buffer!\n"
>       |               ^
> In file included from seatac/seatac.H:25:
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   127 |       fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   128 |       fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   129 |       fprintf(stderr, "M = "uint64HEX"\n", m);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   130 |       fprintf(stderr, "H = "uint64HEX"\n", h);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   131 |       fprintf(stderr, "C = "uint64HEX"\n", c);
>       |                       ^
> /build/reproducible-path/kmer-0~20150903+r2013/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   132 |       fprintf(stderr, "R = "uint64HEX"\n", r);
>       |                       ^
> In file included from seatac/hitMatrix.H:10,
>                  from seatac/seatac.H:27:
> seatac/filterObj.H:148:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   148 |         fprintf(stderr, "hitMatrix::filter()-- tried to extend output string from "uint32FMT" to "uint32FMT" bytes.\n", theOutputPos, theOutputMax);
>       |                         ^
> seatac/filterObj.H:148:93: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   148 |         fprintf(stderr, "hitMatrix::filter()-- tried to extend output string from "uint32FMT" to "uint32FMT" bytes.\n", theOutputPos, theOutputMax);
>       |                                                                                             ^
> seatac/filterObj.H:157:13: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |             ^
> seatac/filterObj.H:157:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                              ^
> seatac/filterObj.H:157:58: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                                          ^
> seatac/filterObj.H:157:70: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                                                      ^
> seatac/filterObj.H:157:87: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                                                                       ^
> seatac/filterObj.H:157:99: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                                                                                   ^
> seatac/filterObj.H:157:111: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   157 |             "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n",
>       |                                                                                                               ^
> seatac/filterObj.H:212:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   212 |         fprintf(stderr, "WARNING:  there isn't enough space in the match to insert the match id "uint64FMT" '%s'!\n",
>       |                         ^
> seatac/hitMatrix.H:84:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    84 |       fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn);
>       |                       ^
> seatac/hitMatrix.H:84:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>    84 |       fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn);
>       |                                                              ^
> seatac/seatac.C:201:17: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   201 |                 "O:"uint32FMTW(7)" S:"uint32FMTW(7)" I:"uint32FMTW(7)" T:"uint32FMTW(7)" (%5.1f%%; %8.3f/sec) Finish in %5.2f seconds.\r",
>       |                 ^
> seatac/seatac.C:201:34: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   201 |                 "O:"uint32FMTW(7)" S:"uint32FMTW(7)" I:"uint32FMTW(7)" T:"uint32FMTW(7)" (%5.1f%%; %8.3f/sec) Finish in %5.2f seconds.\r",
>       |                                  ^
> seatac/seatac.C:201:52: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   201 |                 "O:"uint32FMTW(7)" S:"uint32FMTW(7)" I:"uint32FMTW(7)" T:"uint32FMTW(7)" (%5.1f%%; %8.3f/sec) Finish in %5.2f seconds.\r",
>       |                                                    ^
> seatac/seatac.C:201:70: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   201 |                 "O:"uint32FMTW(7)" S:"uint32FMTW(7)" I:"uint32FMTW(7)" T:"uint32FMTW(7)" (%5.1f%%; %8.3f/sec) Finish in %5.2f seconds.\r",
>       |                                                                      ^
> seatac/seatac.C:239:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat]
>   239 |     fprintf(stderr, "\n"uint32FMTW(7)" sequences (%5.1f%%; %8.3f/sec) %5.2f seconds.\n",
>       |                     ^
> seatac/filterObj.H: In member function ‘void filterObj::addHit(char, uint32, uint32, uint32, uint32, uint32, uint32, uint32)’:
> seatac/filterObj.H:146:21: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=]
>   146 |       } catch (std::bad_alloc) {
>       |                     ^~~~~~~~~
> seatac/hitMatrix.H: In member function ‘void hitMatrix::addHits(uint32, uint64*, uint64)’:
> seatac/hitMatrix.H:82:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=]
>    82 |     } catch (std::bad_alloc) {
>       |                   ^~~~~~~~~
> Make.rules:147: update target 'seatac/seatac' due to: target does not exist
> g++ -Wl,-z,relro -Wl,-z,now -o seatac/seatac seatac/seatac.o seatac/configuration.o seatac/encodedQuery.o seatac/hitMatrix.o seatac/thr-search.o seatac/thr-loader.o seatac/thr-deadlock.o seatac/hitMatrix-sort.o /build/reproducible-path/kmer-0~20150903+r2013/libkmer/libkmer.a /build/reproducible-path/kmer-0~20150903+r2013/libmeryl/libmeryl.a /build/reproducible-path/kmer-0~20150903+r2013/libseq/libseq.a /build/reproducible-path/kmer-0~20150903+r2013/libbio/libbio.a /build/reproducible-path/kmer-0~20150903+r2013/libutil/libutil.a -pthread -ldl -lm
> make[2]: *** No rule to make target '/build/reproducible-path/kmer-0~20150903+r2013/atac-driver/libatac/libatac.a', needed by 'atac-driver/chimera/happy-clones-span-clumps'.  Stop.
> make[2]: Leaving directory '/build/reproducible-path/kmer-0~20150903+r2013'
> make[1]: *** [debian/rules:27: override_dh_auto_build] Error 2 shuffle=reverse


The full build log is available from:
http://qa-logs.debian.net/2025/05/05/shuffle/reverse/kmer_0~20150903+r2013-9_unstable_reverse.log

If you reassign this bug to another package, please mark it as 'affects'-ing
this package. See https://www.debian.org/Bugs/server-control#affects