[med-svn] [hyphy] 02/05: Imported Upstream version 2.2.7+dfsg
Andreas Tille
tille at debian.org
Thu Aug 25 09:30:10 UTC 2016
This is an automated email from the git hooks/post-receive script.
tille pushed a commit to branch master
in repository hyphy.
commit 35f6a34247e0297855a50897479b5595791360ea
Author: Andreas Tille <tille at debian.org>
Date: Tue Aug 16 09:27:49 2016 +0200
Imported Upstream version 2.2.7+dfsg
---
.travis.yml | 52 +
CMakeLists.txt | 13 +-
README.md | 97 +-
package.json | 12 -
res/TemplateBatchFiles/BUSTED.bf | 2 +-
res/TemplateBatchFiles/files.lst | 1 +
src/gui/HYChartWindow.cpp | 24 +-
src/gui/HYModelWindow.cpp | 2 +-
.../gtk/WindowClasses/HYPlatformModelWindow.cpp | 2 +-
src/lib/Examples/HBL/F81.bf | 1 -
src/lib/Examples/HBL/HKY85.bf | 1 -
src/lib/Examples/HBL/data/hiv.nuc | 1 -
src/lib/Examples/Python/BasicHyPhy.py | 112 -
src/lib/Examples/R/BasicHyPhy.R | 126 -
src/lib/LibraryModules/Python/HyPhy/__init__.py | 78 -
src/lib/LibraryModules/R/HyPhy.R | 1338 ----
src/lib/README | 53 -
src/lib/SWIGWrappers/THyPhy_R.cpp | 3344 ---------
src/lib/SWIGWrappers/THyPhy_py3.cpp | 7440 --------------------
src/lib/SWIGWrappers/THyPhy_python.cpp | 7440 --------------------
src/lib/build.sh | 186 -
src/lib/{Link => link}/THyPhy.cpp | 0
src/lib/{Link => link}/THyPhy.h | 0
src/lib/setup.py | 97 -
24 files changed, 148 insertions(+), 20274 deletions(-)
diff --git a/.travis.yml b/.travis.yml
new file mode 100644
index 0000000..6f3f089
--- /dev/null
+++ b/.travis.yml
@@ -0,0 +1,52 @@
+# OpenMP projects should set the environment variable OMP_NUM_THREADS to a reasonably small value (say, 4).
+
+sudo : false
+
+notifications:
+ email:
+ recipients:
+ - steven at stevenweaver.org
+ - spond at temple.edu
+ on_success: always
+ on_failure: always
+
+branches:
+ only:
+ - master
+ - v2.3-alpha
+
+cache:
+ directories:
+ - $HOME/cmake-3.3.2-Linux-x86_64/
+
+env:
+ - MPI=openmpi
+
+language: c++
+compiler:
+ - gcc
+
+addons:
+ apt:
+ sources:
+ - llvm-toolchain-precise
+ - ubuntu-toolchain-r-test
+ - george-edison55-precise-backports
+ packages:
+ - g++-5
+ - gcc-5
+
+before_install:
+ - wget http://www.cmake.org/files/v3.3/cmake-3.3.2-Linux-x86_64.tar.gz --no-check-certificate
+ - tar xvzf cmake-3.3.2-Linux-x86_64.tar.gz -C $HOME
+
+install:
+ - if [ "$CXX" = "g++" ]; then export CXX="g++-5" CC="gcc-5"; fi
+ - if [ "$CXX" = "clang++" ]; then export CXX="clang++-3.7" CC="clang-3.7"; fi
+ - $HOME/cmake-3.3.2-Linux-x86_64/bin/cmake .
+ - make HYPHYMP
+ - make HYPHYGTEST
+
+script:
+ - ./HYPHYGTEST
+
diff --git a/CMakeLists.txt b/CMakeLists.txt
index 9ce7fc1..08e4b53 100644
--- a/CMakeLists.txt
+++ b/CMakeLists.txt
@@ -109,6 +109,10 @@ if(CMAKE_COMPILER_IS_GNUCC OR CMAKE_COMPILER_IS_GNUCXX)
set(GCC46 true)
endif(${GCC_VERSION} VERSION_GREATER 4.6 OR ${GCC_VERSION} VERSION_EQUAL 4.6)
+ if(${GCC_VERSION} VERSION_GREATER 6.0 OR ${GCC_VERSION} VERSION_EQUAL 6.0)
+ set(GCC6 true)
+ endif(${GCC_VERSION} VERSION_GREATER 6.0 OR ${GCC_VERSION} VERSION_EQUAL 6.0)
+
if(${MACOSX_LION})
set(DEFAULT_WARNING_FLAGS "-Wno-int-to-pointer-cast -Wno-conversion-null -Wno-dangling-else -Wno-logical-op-parentheses")
endif(${MACOSX_LION})
@@ -122,7 +126,12 @@ if(CMAKE_COMPILER_IS_GNUCC OR CMAKE_COMPILER_IS_GNUCXX)
if(${GCC46})
set(DEFAULT_WARNING_FLAGS "-Wno-int-to-pointer-cast -Wno-conversion-null")
endif(${GCC46})
-
+
+ if(${GCC6})
+ set(DEFAULT_COMPILE_FLAGS "${DEFAULT_COMPILE_FLAGS} -std=gnu++98 -fno-strict-aliasing -fpermissive")
+ set(DEFAULT_WARNING_FLAGS "${DEFAULT_WARNING_FLAGS} -Wno-error=narrowing")
+ endif(${GCC6})
+
PCL_CHECK_FOR_AVX()
if(${HAVE_AVX_EXTENSIONS})
set(DEFAULT_COMPILE_FLAGS "${DEFAULT_COMPILE_FLAGS} -march=corei7-avx -mtune=corei7-avx")
@@ -209,7 +218,7 @@ file(GLOB SRC_GUI src/gui/*.cpp src/gui/Components/*.cpp)
file(GLOB SRC_GTESTS tests/gtests/*.cpp)
file(GLOB SRC_NEW src/new/*.cpp)
-set(SRC_LINK src/lib/Link/THyPhy.cpp)
+set(SRC_LINK src/lib/link/THyPhy.cpp)
set(SRC_PREFS src/gui/preferences.cpp)
set(SRC_SQLITE3 contrib/SQLite-3.8.2/sqlite3.c)
set(SRC_UNIXMAIN src/mains/unix.cpp)
diff --git a/README.md b/README.md
index ce3055a..80c6144 100644
--- a/README.md
+++ b/README.md
@@ -1,54 +1,95 @@
-HyPhy - Hypothesis testing using Phylogenies
+[](http://hyphy.org) HyPhy - Hypothesis testing using Phylogenies
============================================
+[](https://travis-ci.org/veg/hyphy)
+
+Introduction
+------------
+HyPhy is an open-source software package for the analysis of genetic sequences using techniques in phylogenetics, molecular evolution, and machine learning. It features a complete graphical user interface (GUI) and a rich scripting language for limitless customization of analyses. Additionally, HyPhy features support for parallel computing environments (via message passing interface (MPI)) and it can be compiled as a shared library and called from other programming environments such as P [...]
+
Installation
------------
-HyPhy now uses CMake for its build system.
-To install, make sure you have CMake installed,
-then configure the project from the source directory using
+Hyphy depends on CMake for its build system.
+
+To install, make sure you have CMake >3.0 installed. Hyphy is dependent on other development libraries like
+libcurl and libpthread. Libcurl requires development libraries such as crypto++ and openssl ( or gnutls depending on your configuration)
+On Ubuntu these are libcurl-dev, libcrypto++-dev and libssl-dev.
+
+You can download a specific release from this repository or if you prefer the master branch simply
+clone the repo with
+
+`git clone git at github.com:veg/hyphy.git`
+
+Change your directory to the newly cloned directory
+
+`cd hyphy`
+
+Configure the project from the source directory using CMake.
+
`cmake .`
-By default, CMake produces Makefiles (I think),
-so if you prefer other build systems, such as Xcode,
-configure using the -G switch, e.g.
+
+If you prefer to use other build systems, such as Xcode,
+configure using the -G switch
+
`cmake -G Xcode .`
-CMake has a number of build system generators,
+
+CMake supports a number of build system generators,
feel free to peruse these and use them if you wish.
-One should also be aware, HyPhy requires development libraries
-for libcurl, its requirements, and libpthread.
-Additionally, libcurl requires development libraries for
-crypto++ and openssl (or gnutls, if your packages are so configured).
-On Ubuntu, these are libcurl-dev, libcrypto++-dev, and libssl-dev.
+By default, HyPhy installs into `/usr/local`
+but it can be installed on any location of your system
+by providing an installation prefix
+
+`cmake -DINSTALL_PREFIX=/location/of/choice`
+
+For example, this configuration will install hyphy at /opt/hyphy
-By default, HyPhy installs into /usr/local,
-but can be made to install anywhere by passing
-`-DINSTALL_PREFIX=/wherever/you/want`
-to cmake during the configuration, e.g.
-`cmake -DINSTALL_PREFIX=/opt/hyphy .`.
+`mkdir -p /opt/hyphy`
-Occasionally, you may have to specify which OSX SDK you are using. e.g.
-`cmake -DCMAKE_OSX_SYSROOT=/Developer/SDKs/MacOSX10.9.sdk/ .`.
+`cmake -DINSTALL_PREFIX=/opt/hyphy .`
+
+If you are on an OS X platform, you can specify which OS X SDK to use
+
+`cmake -DCMAKE_OSX_SYSROOT=/Developer/SDKs/MacOSX10.9.sdk/ .`
If you're on a UNIX-compatible system,
and you're comfortable with GNU make,
-then just `make` away with one of the following targets:
+then run `make` with one of the following build targets:
+ MAC - build a Mac Carbon application
+ HYPHYGTK - HYPHY with GTK
+ SP - build a HyPhy executable (HYPHYSP) without multiprocessing
+ MP2 - build a HyPhy executable (HYPHYMP) using pthreads to do multiprocessing
+ MPI - build a HyPhy executable (HYPHYMPI) using MPI to do multiprocessing
++ HYPHYMPI - build a HyPhy executable (HYPHYMPI) using openMPI
+ LIB - build a HyPhy library (libhyphy_mp) using pthreads to do multiprocessing
- GTEST - build HyPhy's gtest testing executable (HYPHYGTEST)
-A subsequent `make install` should put everything where they belong:
+For example to create a MPI build of HYPHY using openMPI ensure that you
+have openmpi installed and available on your path. You can check if this
+is the case after running
+`cmake .` you should see something similar to this in your output
+
+`-- Found MPI_C: /opt/scyld/openmpi/1.6.3/gnu/lib/libmpi.so;/usr/lib64/libibverbs.so;/usr/lib64/libdat.so;/usr/lib64/librt.so;/usr/lib64/libnsl.so;/usr/lib64/libutil.so;/usr/lib64/libm.so;/usr/lib64/libtorque.so;/usr/lib64/libm.so;/usr/lib64/libnuma.so;/usr/lib64/librt.so;/usr/lib64/libnsl.so;/usr/lib64/libutil.so;/usr/lib64/libm.so `
-+ HYPHYMP(I) goes into /installation/prefix/bin
-+ libhyphy_mp.(so/dylib/dll) goes into /installation/prefix/lib
-+ HyPhy's standard library of batchfiles goes into /installation/prefix/lib/hyphy
+`-- Found MPI_CXX: /opt/scyld/openmpi/1.6.3/gnu/lib/libmpi_cxx.so;/opt/scyld/openmpi/1.6.3/gnu/lib/libmpi.so;/usr/lib64/libibverbs.so;/usr/lib64/libdat.so;/usr/lib64/librt.so;/usr/lib64/libnsl.so;/usr/lib64/libutil.so;/usr/lib64/libm.so;/usr/lib64/libtorque.so;/usr/lib64/libm.so;/usr/lib64/libnuma.so;/usr/lib64/librt.so;/usr/lib64/libnsl.so;/usr/lib64/libutil.so;/usr/lib64/libm.so `
+
+Then run
+
+ `make HYPHYMPI`
+
+And then run make install to install the software
+
+`make install`
+
++ HYPHYMP(I) will be installed at `/location/of/choice/bin`
++ libhyphy_mp.(so/dylib/dll) will be installed at `/location/of/choice/lib`
++ HyPhy's standard library of batchfiles will go into `/location/of/choice/lib/hyphy`
HYPHYGTEST isn't installed normally,
-as it serves no utility outside of testing.
-To test HyPhy,
-build the GTEST target and run ./HYPHYGTEST from the source directory.
+because it serves no utility outside of testing.
+
+To test HyPhy, build with the GTEST target and run ./HYPHYGTEST from the source directory.
+`make GTEST`
+`./HYPHYGTEST`
diff --git a/package.json b/package.json
deleted file mode 100644
index fc977e7..0000000
--- a/package.json
+++ /dev/null
@@ -1,12 +0,0 @@
-{
- "name": "hyphy",
- "version": "2.2.1",
- "author": "Sergei L Kosakovsky Pond",
- "repository": {
- "type": "git",
- "url": "https://github.com/veg/hyphy.git"
- },
- "scripts": {
- "install": "/usr/local/bin/cmake .;make HYPHYMP"
- }
-}
diff --git a/res/TemplateBatchFiles/BUSTED.bf b/res/TemplateBatchFiles/BUSTED.bf
index 560bb72..ad68f36 100644
--- a/res/TemplateBatchFiles/BUSTED.bf
+++ b/res/TemplateBatchFiles/BUSTED.bf
@@ -1,4 +1,4 @@
-RequireVersion ("2.1320141020");
+RequireVersion ("2.220141023");
_BUSTED_timers = {3,1};
busted.taskTimerStart (2);
diff --git a/res/TemplateBatchFiles/files.lst b/res/TemplateBatchFiles/files.lst
index 01e42a8..912cd42 100644
--- a/res/TemplateBatchFiles/files.lst
+++ b/res/TemplateBatchFiles/files.lst
@@ -77,6 +77,7 @@
"NY","Test for positive selection using the approach of Nielsen and Yabg, by sampling global dN/dS from an array of distributions, and using Bayesian posterior to identify the sites with dN/dS>1.","NielsenYang.bf";
"PSM","Test for positive selection using the approach of Nielsen and Yang, by sampling global dN/dS from an array of distributions, and using Bayesian posterior to identify the sites with dN/dS>1. Multiple subsets of one data set with shared dN/dS.","MFPositiveSelection.bf";
"QSD","Quickly test for positive selection using several approaches.","QuickSelectionDetection.bf";
+"RELAX","Test whether selected branches are under relaxed or intensified selection against reference branches","RELAX.bf";
"SSD","Use approximate likelihoods at a site to test for subtree specific selective pressure.","SubtreeSelectionComparison.bf";
"DST","Perform a random effects (D)irectional (E)volution on (P)rotein (S)equences test to identify sites which evolve directionally towards a given residue [MPI enabled].","DirectionalREL.bf";
"MEDS","Test for Episodic Directional Selection on a set of labeled branches","MEDS.bf";
diff --git a/src/gui/HYChartWindow.cpp b/src/gui/HYChartWindow.cpp
index a725a22..3c1a806 100644
--- a/src/gui/HYChartWindow.cpp
+++ b/src/gui/HYChartWindow.cpp
@@ -100,16 +100,16 @@ extern _String donotWarnAgain,
windowTypeDistribTable;
_HYColor chartColors [HY_CHART_COLOR_COUNT] = {
- {255*.94, 255*.12, 255*.11 },//(Red)
- {255*.41, 255*.46, 255*.91 },//(Evening Blue)
- {255 , 255*.91, 255*.34 },//(Banana)
- {255*.18, 255*.55, 255*.13 },//(Clover)
- {255*.55, 255*.38, 255*.21 },//(Dirt)
- {255*.42, 255*.09, 255*.69 },//(Royal Violet)
- {255*.09, 255*.29, 255*.51 },//(Sea Blue)
- {255 , 255*.57, 255*.09 },//(Orange)
- {255*.67, 255*.67, 255*.67 },//(Concrete)
- {255*.85, 255*.27, 255*.42 } //(Carnation)
+ {255*94/100, 255*12/100, 255*11/100 },//(Red)
+ {255*41/100, 255*46/100, 255*91/100 },//(Evening Blue)
+ {255 , 255*91/100, 255*34/100 },//(Banana)
+ {255*18/100, 255*55/100, 255*13/100 },//(Clover)
+ {255*55/100, 255*38/100, 255*21/100 },//(Dirt)
+ {255*42/100, 255*9/100, 255*69/100 },//(Royal Violet)
+ {255*9/100, 255*29/100, 255*51/100 },//(Sea Blue)
+ {255 , 255*57/100, 255*9/100 },//(Orange)
+ {255*67/100, 255*67/100, 255*67/100 },//(Concrete)
+ {255*85/100, 255*27/100, 255*42/100 } //(Carnation)
};
extern _Parameter pi_const;
@@ -3007,7 +3007,7 @@ bool ReadDataFromFile (_String fileName, char delimiter, _Matrix& data, _List
for (long k=0; k<columns; k++) {
_String * thisString = (_String*)readStrings (lastRead*columns+k);
if ((thisString->sLength)&&(thisString->FirstNonSpaceIndex (0,-1)>=0)) {
- _Formula f (*thisString,nil,false);
+ _Formula f (*thisString,nil,nil);
v.SetValue (k);
if (!f.IsEmpty()) {
data.MStore (&h,&v,f);
@@ -4527,7 +4527,7 @@ void _HYDistributionChartWindow::AddVariable (_String * expr)
aPrompt = newExpression;
- _Formula f (newExpression, nil,false);
+ _Formula f (newExpression, nil, nil);
if (f.IsEmpty()) {
newExpression = _String("Failed to parse the expression :") & aPrompt;
diff --git a/src/gui/HYModelWindow.cpp b/src/gui/HYModelWindow.cpp
index bfef5f1..1f7d712 100644
--- a/src/gui/HYModelWindow.cpp
+++ b/src/gui/HYModelWindow.cpp
@@ -857,7 +857,7 @@ bool _HYModelWindow::ProcessEvent (_HYEvent* e)
_HYButtonBar* bb3 = (_HYButtonBar*)GetCellObject (MODEL_BUTTON_ROW,6);
_String cText (tl->GetText());
- _Formula f (cText,nil,false);
+ _Formula f (cText,nil,nil);
if (f.GetList().lLength) {
clipboardString = cText;
SyncEditBox ();
diff --git a/src/gui/gtk/WindowClasses/HYPlatformModelWindow.cpp b/src/gui/gtk/WindowClasses/HYPlatformModelWindow.cpp
index f4c77ea..f8c41d0 100644
--- a/src/gui/gtk/WindowClasses/HYPlatformModelWindow.cpp
+++ b/src/gui/gtk/WindowClasses/HYPlatformModelWindow.cpp
@@ -173,7 +173,7 @@ bool _HYModelWindow::_CheckClipboard (void)
{
_String cText ((char*)scrapHandle);
skipWarningMessages = true;
- _Formula f (cText,nil,false);
+ _Formula f (cText,nil,nil);
skipWarningMessages = false;
if (f.GetList().lLength)
{
diff --git a/src/lib/Examples/HBL/F81.bf b/src/lib/Examples/HBL/F81.bf
deleted file mode 100644
index 362c4c6..0000000
--- a/src/lib/Examples/HBL/F81.bf
+++ /dev/null
@@ -1 +0,0 @@
-/* This is an example HY-PHY Batch File.
It reads in a '#' nucleotide dataset data/hiv.nuc and estimates
maximum ln-likelihood based on the tree contained in the data file,
using Felsenstein 81 model.
Output is printed out as a Newick Style tree with branch lengths
representing the number of expected substitutions per branch (which
is the default setting for nucleotide models w/o rate variation).
Sergei L. Kosakovsky Pond and Spencer V. Muse
December 1999.
*/
/* 1. Read in the data and store the result in a DataSet variable.*/
DataSet nucleotideSequences = ReadDataFile ("data/hiv.nuc");
/* 2. Filter the data, specifying that all of the data is to be used
and that it is to be treated as nucleotides.*/
DataSetFilter filteredData = CreateFilter (nucleotideSequences,1);
/* 3. Collect observed nucleotide frequencies from the filtered data. observedFreqs will
store the vector of frequencies. */
HarvestFrequencies (observedFreqs, filteredData, 1, 1, 1);
/* 4. Define the F81 substitution matrix. '*' is defined to be -(sum of off-diag row elements) */
F81RateMatrix =
{{*,mu,mu,mu}
{mu,*,mu,mu}
{mu,mu,*,mu}
{mu,mu,mu,*}};
/*5. Define the F81 models, by combining the substitution matrix with the vector of observed (equilibrium)
frequencies. */
Model F81 = (F81RateMatrix, observedFreqs);
/*6. Now we can define the tree variable, using the tree string read from the data file,
and, by default, assigning the last defined model (F81) to all tree branches. */
Tree givenTree = DATAFILE_TREE;
/*7. Since all the likelihood function ingredients (data, tree, equilibrium frequencies)
have been defined we are ready to construct the likelihood function. */
LikelihoodFunction theLnLik = (filteredData, givenTree);
/*8. Maximize the likelihood function, storing parameter values in the matrix paramValues */
Optimize (paramValues, theLnLik);
/*9. Print the tree with optimal branch lengths to the console. */
fprintf (stdout, theLnLik);
\ No newline at end of file
diff --git a/src/lib/Examples/HBL/HKY85.bf b/src/lib/Examples/HBL/HKY85.bf
deleted file mode 100644
index 745d371..0000000
--- a/src/lib/Examples/HBL/HKY85.bf
+++ /dev/null
@@ -1 +0,0 @@
-DataSet nucleotideSequences = ReadDataFile ("data/hiv.nuc");
DataSetFilter filteredData = CreateFilter (nucleotideSequences,1);
HarvestFrequencies (observedFreqs, filteredData, 1, 1, 1);
global R = 1;
HKY85RateMatrix =
{{*,trvs,R*trvs,trvs}
{trvs,*,trvs,R*trvs}
{R*trvs,trvs,*,trvs}
{trvs,R*trvs,trvs,*}};
Model HKY85 = (HKY85RateMatrix, observedFreqs);
Tree givenTree = DATAFILE_TREE;
LikelihoodFunction theLnLik = (filteredData, givenTree);
Optimize (paramValues, theLnLik);
function _THyPhyAskFor (key)
{
if (key == "LogL")
{
return paramValues[1][0];
}
if (key == "kappa")
{
return R;
}
if (key == "Tree")
{
return Format(givenTree,1,1);
}
if (key == "Branch lengths")
{
return BranchLength (givenTree,-1);
}
return "_THyPhy_NOT_HANDLED_";
}
\ No newline at end of file
diff --git a/src/lib/Examples/HBL/data/hiv.nuc b/src/lib/Examples/HBL/data/hiv.nuc
deleted file mode 100644
index ef9f921..0000000
--- a/src/lib/Examples/HBL/data/hiv.nuc
+++ /dev/null
@@ -1 +0,0 @@
-#719
ATAGTAATTAGATCTGAAAACTTCTCGAACAATGCTAAAACCATAATAGTACAGCTAAAT
AAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAGTATACAT
TTCGGACCAGGGAAAGCATTTTATGCAGGAGAAATAATAGGAGATATAAGACAAGCA
TATTGTACTCTTAATGGAGCAGAATGGAATAACACTGTAAAACAGGTAGCTGCAAAATTA
AGAGAAAAATTTAATAAAACAATAATCTTTAATCAATCC
#136
GTAGTAATTAGATCTGAAAACTTCTCGAACAATGCTAAAACCATAATAGTACAGCTAAAT
AAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAGAAGTATACAT
TTTGGACCAGGGAAAGCATTTTATGCAGGAGAAATAATAGGAGATATAAGACAAGCA
TATTGTACCCTTAATGGAACAGAATGGAATAACACTTTAAAACAGGTAGCTGAAAAATTA
AGAGAACAATTTATTAAAACAATAGTTTTTAATCAATCC
#135
GTAGTAATTAGATCTGAAAACTTCACGAACAATGCTAAAACCATAATAGTACAGCTAAAT
AAATCTGTAGAAATTAATTGTGTAAGACCCGGCAACAATACAAGAAGAAGTATACAT
ATAGGACCAGGGAGAGCATATTATACAGGAGAAGTAATAGGAGATATAAGACAAGCA
CATTGTAACCTTAGTAGAACAGACTGGAATAAAACTTTAAAACAGGTAGCTGAAAAATTA
AGAGAACAATTTAATACAACAATAGTCTTTAATCAATCC
#105r
ATAGTAATTAGATCTGAAAACTTCACGAACAATGCTAAAACCATAATAGTACAGCTAAAT
AAATCTGTAGAAATTAAGTGTGAAAGACCCAACAACAATACAAGAAAAAGTGTACAT
ATAGGACCAGGGAAAGCATATTATACAGGAGAAATAATAGGAGATATAAGACAAGCA
CATTGTAACCTTAGTGGAACAGAATGGAGGGAAACTTTAAAACAGGTAGCTGAAAAATTA
AGAGAACAATTTAATAAAACAATAGTCTTTAATCAATCC
#529
ATAGTAATTAGATCTGAAAACTTCACGAACAATGCTAAAACCATAATAGTACATCTAAAT
GAATCTGTAGAAATTATTTGTGAAAGACCCAACAACAATACAAGAAAAAGTGTACAT
ATGGGACCAGGGAGAGCATATTACACAGGAGAAATAATAGGAGATATAAGACAAGCA
CATTGTAACATTAGTAGAACAAATTGGACGGAAACTTTAAAACAGGTAGCTGAAAAATTA
AGAGAACAATTTAATAAAACAATAGTCTTTAATCAATCC
#317
GTAGTAATTAGATCTGAAAACTTCACGAACAATGCTAAGACCATAATAGTACAGCTAAAT
AAACCTGTAAAAATTAATTGTACAAGACCCAACAACAATGCAAAAATAAGAATACAT
ATAGGACCAGGGAGACCATTTTATACAGCAGGAGAAATAGGAAATATAAGACAAGCA
CATTGTAACCTTAGTAGAACAGACTGGAATAACACTTTAAAACTGGTAGCTGAAAAATTA
AGAGAACAATTTAATAAAACAATAGTCTTTAATCAATCC
#6767
GTAGTAATTAGATCTGAAAACTTCACGAACAATGCTAAGACCATAATAGTACAGCTAAAT
AACTCTGTAACAATTAAGTGTGAAAGACCCAACAACAATACAAGAAAAAGTATACCT
ATAGGACCAGGGAGAGCCTTTTATACAACAGGAGACATAGGAGATATAAGACAAGCA
CATTGTAACCTTAGTAGAAAAGACTGGAATGACACTTTAAGACAGGTAGTTGGAAAGTTA
AGAGAACAATTTGGAAGAACAATAATCTTTAATCAATCC
#6760
ATAGTAATTAGATCTGAAAACTTCACGAACAATGCTAAAACCATAATAGTACAGCTAAAG
GAACCTGTAAACATTACTTGTGAAAGACCCAGCAACAATACAAGAAAAAGTATACAT
ATAGGACCAGGAAAAGCATTTTATGCAACAGGAGAAATAGGAGATATAAGACGAGCA
CATTGTAACCTTAATAGAACAGCATGGAATAAAACTTTAAAACAGGTAGTTGAAAAATTA
AGAGAACAATTTAAGAAAACAATAACCTTTAACCAATCC
#9939
ATAGTAATCAGATCTGAAAACTTCTCGGACAATGCTAAAACCATAATAGTACAGCTAAAC
AACACTGTAAACATTACTTGTGAAAGACCCAACAACAATACAAGAAAAAGGATACAT
ATAGGACCAGGGAGAGCAGTTTATACAACAGGACAAATAGGAGATATAAGAAAAGCA
CATTGTAACCTTAGTAGAACAAATTGGACTGAAACTTTAAGACAAGTAGCTGAAAAATTA
AAAGAACAATTTAATAAAACAATAATCTTTAATAATTCC
#113
GTAGTAATTCGATCTGAAAACTTCACGGACAATGCTAAAACCATAATAGTACAGCTAAAC
AAATCTGTAGAAATTACTTGTGTAAGACCCAACAACAATACAAGAAAAAGTATAAAT
ATAAGACCAGGGAGAGCATTTTATACAACAGGAGAAATAGGAGATATAAGACAAGCA
CATTGTAACCTTAGTAGAACAGCATGGAATGAAGCTTTAAGACAAGTAGCTAAAAAATTA
AAAGAACAATTTAATAGAACAATAGTCTTTAATCAATCC
#822
ATAGTAATTAGATCTGAAAACTTCACAGACAATGCTAAAACCATAATAGTACAGCTAAAC
AAATCTGTAGAAATTAATTGTATAAGACCCAACAACAATACAAGAAAAAGTATACAT
ATAGGACCAGGGAGAGCATTTTATACAACAGGAGACATAGGAGATATAAGACAAGCA
TATTGTAACCTTAGTAGAACAGCATGGAATGAAACTTTAAGACAAGTAGCTCAAAAATTA
AAAGAACAATTTAATAGAACAATAGTCTTTAATCAATCC
#159
ATAGTAATTAGATCTGAAAACTTCACAGACAATGCTAAAACCATAATAGTACAGCTAAAT
AAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACAT
ATAGGACCAGGGAGAGCTTTTTATACAACAGGTGAAATAGGAGATTTAAGACAAGCA
CATTGTAACCTTAGTAGAACAGCATGGAATGAAACTTTAAGACAAGTAGCTAAAAAATTA
AAAGAACAATTTAATAGAACAATAGTTTTTAATCAATCC
#256
ATAGTAATTAGATCTGAAAACTTCACGGACAATGCTAAAACCATAATAGTACAGCTAAAT
AAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAAAT
ATAGGACCAGGGAGAGCATTTTATACAACAGGTGAAATAGGAAATTTAAGACAAGCA
CATTGTAACCTTAGTAGAACAGCATGGAATGAAACTTTAAGACAAGTAGCTAAAAAACTA
AAAGAACAATTTAATAGAACAATAGTTTTTAATCAATCC
(((317,6767),((135,(529,105r)),(719,136))),6760,((113,9939),(256,(822,159))))
\ No newline at end of file
diff --git a/src/lib/Examples/Python/BasicHyPhy.py b/src/lib/Examples/Python/BasicHyPhy.py
deleted file mode 100644
index 3ad1ac3..0000000
--- a/src/lib/Examples/Python/BasicHyPhy.py
+++ /dev/null
@@ -1,112 +0,0 @@
-# import the HyPhy library
-# and standard OS utilities
-
-import os, HyPhy
-
-# first, create a HyPhy interface instance (class _THyPhy)
-# the first argument defines the root directory for HyPhy
-# and the second - how many threads the computational core
-# should spawn
-
-hyphyInstance = HyPhy._THyPhy (os.getcwd(),2)
-
-# the basic interface command is 'ExecuteBF' which
-# executes HyPhy batch language commands in HyPhy
-# and returns a string representation of the return value
-# (if any) from HYPHY
-# The returned object is of type _THyPhyString with
-# sData and sLength fields
-# HyPhy will take care of disposing of the memory needed
-# to store the result
-
-hyphyResult = hyphyInstance.ExecuteBF ("return 2+2;");
-print "Testing a trivial HyPhy command. 2+2 = ", hyphyResult.sData
-
-# an optional second argument to ExecuteBF
-# can be used to "flush" the current state of the system
-
-# this is the default option for the call of ExecuteBF
-# passing the second argument of False or 0 will preserve
-# the execution state
-
-print "Consecutive command exection"
-hyphyInstance.ExecuteBF ("z:=x+y;",False);
-hyphyInstance.ExecuteBF ("x=3;",False);
-hyphyInstance.ExecuteBF ("y=5;",False);
-hyphyResult = hyphyInstance.ExecuteBF ("return z;",False);
-print "The value of z is ", hyphyResult.sData
-
-print "Resetting the state of the execution erases the value of 'z'"
-hyphyResult = hyphyInstance.ExecuteBF ("return z;");
-print "The value of z is ", hyphyResult.sData
-
-# the real utility of the interface is to be able
-# to execute prewritten analyses from HBL files
-
-print "Executing the example F81.bf file"
-hyphyResult = hyphyInstance.ExecuteBF ("ExecuteAFile(\"../HBL/F81.bf\")");
-
-# retrive the standard output, error and runtime warnings
-
-hyphyOut = hyphyInstance.GetStdout()
-#errors will be empty UNLESS there was an exection error
-hyphyErrors = hyphyInstance.GetErrors()
-hyphyWarnings = hyphyInstance.GetWarnings()
-
-print "Standard out: \n", hyphyOut.sData
-print "Errors: \n", hyphyErrors.sData
-print "Warnings/Log messages: \n", hyphyWarnings.sData
-
-# these variables can be explicitly deleted when they are no longer needed
-# python garbage collection should take care of disposing of disused variables
-
-del hyphyOut
-del hyphyErrors
-del hyphyWarnings
-
-# A tighter intergration can be achieved by defining a retrieval function
-# with the reserved name _THyPhyAskFor in the HBL file; it retrieves data
-# by key and returns them in a internal format that can be converted
-# to one of the basic return types: number, string or matrix
-
-def retrieveValueByKey (key, returnType,hyphyInstance):
- theResult = hyphyInstance.AskFor(key)
- # see if HyPhy can retrieve a value with the requested key
- if theResult:
- canICast = hyphyInstance.CanCast(theResult,returnType)
- # see if HyPhy can cast the value to the requested type
- if canICast:
- # do the casting
- theResult = hyphyInstance.CastResult(theResult,returnType)
- # the last step is to convert from the basic return type
- # to a derived class that we can use in python directly
- if (returnType == HyPhy.THYPHY_TYPE_NUMBER):
- return theResult.castToNumber()
- if (returnType == HyPhy.THYPHY_TYPE_STRING):
- return theResult.castToString()
- if (returnType == HyPhy.THYPHY_TYPE_MATRIX):
- return theResult.castToMatrix()
- return null
-
-
-hyphyResult = hyphyInstance.ExecuteBF ("ExecuteAFile(\"../HBL/HKY85.bf\")");
-
-print "Log-L = ", retrieveValueByKey ("LogL", HyPhy.THYPHY_TYPE_NUMBER, hyphyInstance).nValue;
-print "kappa = ", retrieveValueByKey ("kappa", HyPhy.THYPHY_TYPE_NUMBER, hyphyInstance).nValue;
-print "tree string = ", retrieveValueByKey ("Tree", HyPhy.THYPHY_TYPE_STRING, hyphyInstance).sData;
-bl = retrieveValueByKey ("Branch lengths", HyPhy.THYPHY_TYPE_MATRIX, hyphyInstance);
-print "retrieved ", bl.mCols-1, "branch lengths"
-for i in range(0,bl.mCols-1):
- print "Branch ", i+1, " has length ", bl.MatrixCell(0,i)
-
-
-
-
-
-
-
-
-
-
-
-
diff --git a/src/lib/Examples/R/BasicHyPhy.R b/src/lib/Examples/R/BasicHyPhy.R
deleted file mode 100644
index 206cf64..0000000
--- a/src/lib/Examples/R/BasicHyPhy.R
+++ /dev/null
@@ -1,126 +0,0 @@
-# import the HyPhy library and R glue
-# change the paths according to your distribution
-
-dyn.load ("LibraryModules/R/HyPhy.so")
-source ("LibraryModules/R/HyPhy.R")
-
-# first, create a HyPhy interface instance (class _THyPhy)
-# the first argument defines the root directory for HyPhy
-# and the second - how many threads the computational core
-# should spawn
-
-hyphyInstance<-`_THyPhy` (paste(getwd(),'/',sep=''),2)
-
-# the basic interface command is 'ExecuteBF' which
-# executes HyPhy batch language commands in HyPhy
-# and returns a string representation of the return value
-# (if any) from HYPHY
-# The returned object is of type _THyPhyString with
-# sData and sLength fields
-# HyPhy will take care of disposing of the memory needed
-# to store the result
-
-hyphyResult<-hyphyInstance$ExecuteBF (hyphyInstance,"return 2+2;")
-print(paste("Testing a trivial HyPhy command. 2+2 = ",hyphyResult$sData))
-
-# an optional second argument to ExecuteBF
-# can be used to "flush" the current state of the system
-
-# this is the default option for the call of ExecuteBF
-# passing the second argument of FALSE or 0 will preserve
-# the execution state
-
-print("Consecutive command exection")
-hyphyInstance$ExecuteBF (hyphyInstance,"z:=x+y;",FALSE)
-hyphyInstance$ExecuteBF (hyphyInstance,"x=3;",FALSE)
-hyphyInstance$ExecuteBF (hyphyInstance,"y=5;",FALSE)
-hyphyResult = hyphyInstance$ExecuteBF (hyphyInstance,"return z;",FALSE)
-print(paste("The value of z is ",hyphyResult$sData))
-
-print("Resetting the state of the execution erases the value of 'z'")
-hyphyResult<-hyphyInstance$ExecuteBF (hyphyInstance,"return z;");
-print(paste("The value of z is ",hyphyResult$sData))
-
-# the real utility of the interface is to be able
-# to execute prewritten analyses from HBL files
-
-print("Executing the example F81.bf file")
-hyphyResult<-hyphyInstance$ExecuteBF (hyphyInstance,"ExecuteAFile(\"Examples/HBL/F81.bf\")");
-
-# retrive the standard output, error and runtime warnings
-
-hyphyOut <- hyphyInstance$GetStdout(hyphyInstance)
-#errors will be empty UNLESS there was an exection error
-hyphyErrors <- hyphyInstance$GetErrors(hyphyInstance)
-hyphyWarnings <- hyphyInstance$GetWarnings(hyphyInstance)
-
-print (paste("Standard out: \n", hyphyOut$sData))
-print (paste("Errors: \n", hyphyErrors$sData))
-print (paste("Warnings/Log messages: \n", hyphyWarnings$sData))
-
-# these variables can be explicitly deleted when they are no longer needed
-# R garbage collection should take care of disposing of disused variables
-
-rm('hyphyOut')
-rm('hyphyErrors')
-rm('hyphyWarnings')
-
-# A tighter intergration can be achieved by defining a retrieval function
-# with the reserved name _THyPhyAskFor in the HBL file; it retrieves data
-# by key and returns them in a internal format that can be converted
-# to one of the basic return types: number(0), string(1) or matrix(2)
-
-retrieveValueByKey <- function(key, returnType, hyphyInstance){
- theResult <- hyphyInstance$AskFor(hyphyInstance,key);
- # see if HyPhy can retrieve a value with the requested key
- if (!is.null(theResult))
- {
- canICast <- hyphyInstance$CanCast(hyphyInstance,theResult,returnType);
- # see if HyPhy can cast the value to the requested type
- if(canICast)
- {
- # do the casting
- theResult <- hyphyInstance$CastResult(hyphyInstance,theResult,returnType);
- # the last step is to convert from the basic return type
- # to a derived class that we can use in python directly
- if (returnType == 0)
- {
- return(theResult$castToNumber(theResult));
- }
- if (returnType == 1)
- {
- return(theResult$castToString(theResult));
- }
- if (returnType == 2)
- {
- return(theResult$castToMatrix(theResult));
- }
- }
- }
- return(NULL);
-}
-
-
-
-hyphyResult<-hyphyInstance$ExecuteBF (hyphyInstance,"ExecuteAFile(\"Examples/HBL/HKY85.bf\")");
-
-print(paste("Log-L = ", retrieveValueByKey ("LogL", 0, hyphyInstance)$nValue))
-print(paste("kappa = ", retrieveValueByKey ("kappa", 0, hyphyInstance)$nValue))
-print(paste("tree string = ", retrieveValueByKey ("Tree", 1, hyphyInstance)$sData))
-bl<-retrieveValueByKey ("Branch lengths", 2, hyphyInstance)
-print(paste("retrieved ", bl$mCols-1, "branch lengths"))
-for(i in 0:(bl$mCols-2))
-{
- print (paste("Branch ", i+1, " has length ", bl$MatrixCell(bl,0,i)))
-}
-
-
-
-
-
-
-
-
-
-
-
diff --git a/src/lib/LibraryModules/Python/HyPhy/__init__.py b/src/lib/LibraryModules/Python/HyPhy/__init__.py
deleted file mode 100644
index 994bdd7..0000000
--- a/src/lib/LibraryModules/Python/HyPhy/__init__.py
+++ /dev/null
@@ -1,78 +0,0 @@
-# This file was automatically generated by SWIG (http://www.swig.org).
-# Version 2.0.4
-#
-# Do not make changes to this file unless you know what you are doing--modify
-# the SWIG interface file instead.
-
-
-
-from sys import version_info
-if version_info >= (2,6,0):
- def swig_import_helper():
- from os.path import dirname
- import imp
- fp = None
- try:
- fp, pathname, description = imp.find_module('_HyPhy', [dirname(__file__)])
- except ImportError:
- import _HyPhy
- return _HyPhy
- if fp is not None:
- try:
- _mod = imp.load_module('_HyPhy', fp, pathname, description)
- finally:
- fp.close()
- return _mod
- _HyPhy = swig_import_helper()
- del swig_import_helper
-else:
- import _HyPhy
-del version_info
-from _HyPhy import *
-try:
- _swig_property = property
-except NameError:
- pass # Python < 2.2 doesn't have 'property'.
-def _swig_setattr_nondynamic(self,class_type,name,value,static=1):
- if (name == "thisown"): return self.this.own(value)
- if (name == "this"):
- if type(value).__name__ == 'SwigPyObject':
- self.__dict__[name] = value
- return
- method = class_type.__swig_setmethods__.get(name,None)
- if method: return method(self,value)
- if (not static):
- self.__dict__[name] = value
- else:
- raise AttributeError("You cannot add attributes to %s" % self)
-
-def _swig_setattr(self,class_type,name,value):
- return _swig_setattr_nondynamic(self,class_type,name,value,0)
-
-def _swig_getattr(self,class_type,name):
- if (name == "thisown"): return self.this.own()
- method = class_type.__swig_getmethods__.get(name,None)
- if method: return method(self)
- raise AttributeError(name)
-
-def _swig_repr(self):
- try: strthis = "proxy of " + self.this.__repr__()
- except: strthis = ""
- return "<%s.%s; %s >" % (self.__class__.__module__, self.__class__.__name__, strthis,)
-
-try:
- _object = object
- _newclass = 1
-except AttributeError:
- class _object : pass
- _newclass = 0
-
-
-
-
-
-
-
-# This file is compatible with both classic and new-style classes.
-
-
diff --git a/src/lib/LibraryModules/R/HyPhy.R b/src/lib/LibraryModules/R/HyPhy.R
deleted file mode 100644
index fb4a08d..0000000
--- a/src/lib/LibraryModules/R/HyPhy.R
+++ /dev/null
@@ -1,1338 +0,0 @@
-# This file was automatically generated by SWIG (http://www.swig.org).
-# Version 2.0.4
-#
-# Do not make changes to this file unless you know what you are doing--modify
-# the SWIG interface file instead.
-
-## Generated via the command line invocation:
-## swig -c++ -r THyPhy.h
-
-
-# srun.swg #
-#
-# This is the basic code that is needed at run time within R to
-# provide and define the relevant classes. It is included
-# automatically in the generated code by copying the contents of
-# srun.swg into the newly created binding code.
-
-
-# This could be provided as a separate run-time library but this
-# approach allows the code to to be included directly into the
-# generated bindings and so removes the need to have and install an
-# additional library. We may however end up with multiple copies of
-# this and some confusion at run-time as to which class to use. This
-# is an issue when we use NAMESPACES as we may need to export certain
-# classes.
-
-######################################################################
-
-if(length(getClassDef("RSWIGStruct")) == 0)
- setClass("RSWIGStruct", representation("VIRTUAL"))
-
-
-
-if(length(getClassDef("ExternalReference")) == 0)
-# Should be virtual but this means it loses its slots currently
-#representation("VIRTUAL")
- setClass("ExternalReference", representation( ref = "externalptr"))
-
-
-
-if(length(getClassDef("NativeRoutinePointer")) == 0)
- setClass("NativeRoutinePointer",
- representation(parameterTypes = "character",
- returnType = "character",
- "VIRTUAL"),
- contains = "ExternalReference")
-
-if(length(getClassDef("CRoutinePointer")) == 0)
- setClass("CRoutinePointer", contains = "NativeRoutinePointer")
-
-
-if(length(getClassDef("EnumerationValue")) == 0)
- setClass("EnumerationValue", contains = "integer")
-
-
-if(!isGeneric("copyToR"))
- setGeneric("copyToR",
- function(value, obj = new(gsub("Ref$", "", class(value))))
- standardGeneric("copyToR"
- ))
-
-setGeneric("delete", function(obj) standardGeneric("delete"))
-
-
-SWIG_createNewRef =
-function(className, ..., append = TRUE)
-{
- f = get(paste("new", className, sep = "_"), mode = "function")
-
- f(...)
-}
-
-if(!isGeneric("copyToC"))
- setGeneric("copyToC",
- function(value, obj = RSWIG_createNewRef(class(value)))
- standardGeneric("copyToC"
- ))
-
-
-#
-defineEnumeration =
-function(name, .values, where = topenv(parent.frame()), suffix = "Value")
-{
- # Mirror the class definitions via the E analogous to .__C__
- defName = paste(".__E__", name, sep = "")
- assign(defName, .values, envir = where)
-
- if(nchar(suffix))
- name = paste(name, suffix, sep = "")
-
- setClass(name, contains = "EnumerationValue", where = where)
-}
-
-enumToInteger <- function(name,type)
-{
- if (is.character(name)) {
- ans <- as.integer(get(paste(".__E__", type, sep = ""))[name])
- if (is.na(ans)) {warning("enum not found ", name, " ", type)}
- ans
- }
-}
-
-enumFromInteger =
-function(i,type)
-{
- itemlist <- get(paste(".__E__", type, sep=""))
- names(itemlist)[match(i, itemlist)]
-}
-
-coerceIfNotSubclass =
-function(obj, type)
-{
- if(!is(obj, type)) {as(obj, type)} else obj
-}
-
-
-setClass("SWIGArray", representation(dims = "integer"), contains = "ExternalReference")
-
-setMethod("length", "SWIGArray", function(x) x at dims[1])
-
-
-defineEnumeration("SCopyReferences",
- .values = c( "FALSE" = 0, "TRUE" = 1, "DEEP" = 2))
-
-assert =
-function(condition, message = "")
-{
- if(!condition)
- stop(message)
-
- TRUE
-}
-
-
-if(FALSE) {
-print.SWIGFunction =
-function(x, ...)
- {
- }
-}
-
-
-#######################################################################
-
-R_SWIG_getCallbackFunctionStack =
-function()
-{
- # No PACKAGE argument as we don't know what the DLL is.
- .Call("R_SWIG_debug_getCallbackFunctionData")
-}
-
-R_SWIG_addCallbackFunctionStack =
-function(fun, userData = NULL)
-{
- # No PACKAGE argument as we don't know what the DLL is.
- .Call("R_SWIG_R_pushCallbackFunctionData", fun, userData)
-}
-
-
-#######################################################################
-
-
-setClass('C++Reference', contains = 'ExternalReference')
-setClass('_p__THyPhyReturnObject', contains = 'C++Reference')
-setClass('_p__THyPhyString', contains = c('_p__THyPhyReturnObject'))
-setClass('_p__THyPhyNumber', contains = c('_p__THyPhyReturnObject'))
-setClass('_p__THyPhyMatrix', contains = c('_p__THyPhyReturnObject'))
-setClass('_p__THyPhy', contains = 'C++Reference')
-
-
-
-setMethod('[', "ExternalReference",
-function(x,i,j, ..., drop=TRUE)
-if (!is.null(x$"__getitem__"))
-sapply(i, function(n) x$"__getitem__"(i=as.integer(n-1))))
-
-setMethod('[<-' , "ExternalReference",
-function(x,i,j, ..., value)
-if (!is.null(x$"__setitem__")) {
-sapply(1:length(i), function(n)
-x$"__setitem__"(i=as.integer(i[n]-1), x=value[n]))
-x
-})
-
-setAs('ExternalReference', 'character',
-function(from) {if (!is.null(from$"__str__")) from$"__str__"()})
-
-setMethod('print', 'ExternalReference',
-function(x) {print(as(x, "character"))})
-
-# Start of _THyPhyReturnObject_myType
-
-`_THyPhyReturnObject_myType` = function(self, .copy = FALSE)
-{
- ;.Call('R_swig__THyPhyReturnObject_myType', self, as.logical(.copy), PACKAGE='HyPhy');
-
-}
-
-attr(`_THyPhyReturnObject_myType`, 'returnType') = 'integer'
-attr(`_THyPhyReturnObject_myType`, "inputTypes") = c('_p__THyPhyReturnObject')
-class(`_THyPhyReturnObject_myType`) = c("SWIGFunction", class('_THyPhyReturnObject_myType'))
-
-# Start of delete__THyPhyReturnObject
-
-`delete__THyPhyReturnObject` = function(self)
-{
- ;.Call('R_swig_delete__THyPhyReturnObject', self, PACKAGE='HyPhy');
-
-}
-
-attr(`delete__THyPhyReturnObject`, 'returnType') = 'void'
-attr(`delete__THyPhyReturnObject`, "inputTypes") = c('_p__THyPhyReturnObject')
-class(`delete__THyPhyReturnObject`) = c("SWIGFunction", class('delete__THyPhyReturnObject'))
-
-# Start of _THyPhyReturnObject_castToString
-
-`_THyPhyReturnObject_castToString` = function(self)
-{
- ;ans = .Call('R_swig__THyPhyReturnObject_castToString', self, PACKAGE='HyPhy');
- class(ans) <- "_p__THyPhyString";
-
- ans
-
-}
-
-attr(`_THyPhyReturnObject_castToString`, 'returnType') = '_p__THyPhyString'
-attr(`_THyPhyReturnObject_castToString`, "inputTypes") = c('_p__THyPhyReturnObject')
-class(`_THyPhyReturnObject_castToString`) = c("SWIGFunction", class('_THyPhyReturnObject_castToString'))
-
-# Start of _THyPhyReturnObject_castToNumber
-
-`_THyPhyReturnObject_castToNumber` = function(self)
-{
- ;ans = .Call('R_swig__THyPhyReturnObject_castToNumber', self, PACKAGE='HyPhy');
- class(ans) <- "_p__THyPhyNumber";
-
- ans
-
-}
-
-attr(`_THyPhyReturnObject_castToNumber`, 'returnType') = '_p__THyPhyNumber'
-attr(`_THyPhyReturnObject_castToNumber`, "inputTypes") = c('_p__THyPhyReturnObject')
-class(`_THyPhyReturnObject_castToNumber`) = c("SWIGFunction", class('_THyPhyReturnObject_castToNumber'))
-
-# Start of _THyPhyReturnObject_castToMatrix
-
-`_THyPhyReturnObject_castToMatrix` = function(self)
-{
- ;ans = .Call('R_swig__THyPhyReturnObject_castToMatrix', self, PACKAGE='HyPhy');
- class(ans) <- "_p__THyPhyMatrix";
-
- ans
-
-}
-
-attr(`_THyPhyReturnObject_castToMatrix`, 'returnType') = '_p__THyPhyMatrix'
-attr(`_THyPhyReturnObject_castToMatrix`, "inputTypes") = c('_p__THyPhyReturnObject')
-class(`_THyPhyReturnObject_castToMatrix`) = c("SWIGFunction", class('_THyPhyReturnObject_castToMatrix'))
-
-# Start of accessor method for _THyPhyReturnObject
-setMethod('$', '_p__THyPhyReturnObject', function(x, name)
-
-{
- accessorFuns = list('myType' = _THyPhyReturnObject_myType, 'castToString' = _THyPhyReturnObject_castToString, 'castToNumber' = _THyPhyReturnObject_castToNumber, 'castToMatrix' = _THyPhyReturnObject_castToMatrix);
- ; idx = pmatch(name, names(accessorFuns));
- if(is.na(idx))
- return(callNextMethod(x, name));
- f = accessorFuns[[idx]];
- formals(f)[[1]] = x;
- f;
-}
-
-
-);
-# end of accessor method for _THyPhyReturnObject
-setMethod('delete', '_p__THyPhyReturnObject', function(obj) {delete__THyPhyReturnObject(obj)})
-# Start of new__THyPhyString
-
-`_THyPhyString__SWIG_0` = function(s_arg1, s_arg2)
-{
- s_arg1 = as(s_arg1, "character");
- s_arg2 = as.integer(s_arg2);
-
- if(length(s_arg2) > 1) {
- warning("using only the first element of s_arg2");
- };
-
- ;ans = .Call('R_swig_new__THyPhyString__SWIG_0', s_arg1, s_arg2, PACKAGE='HyPhy');
- class(ans) <- "_p__THyPhyString";
-
- reg.finalizer(ans, delete__THyPhyString)
- ans
-
-}
-
-attr(`_THyPhyString__SWIG_0`, 'returnType') = '_p__THyPhyString'
-attr(`_THyPhyString__SWIG_0`, "inputTypes") = c('character', 'integer')
-class(`_THyPhyString__SWIG_0`) = c("SWIGFunction", class('_THyPhyString__SWIG_0'))
-
-# Start of new__THyPhyString
-
-`_THyPhyString__SWIG_1` = function(s_arg1)
-{
- s_arg1 = as(s_arg1, "character");
- ;ans = .Call('R_swig_new__THyPhyString__SWIG_1', s_arg1, PACKAGE='HyPhy');
- class(ans) <- "_p__THyPhyString";
-
- reg.finalizer(ans, delete__THyPhyString)
- ans
-
-}
-
-attr(`_THyPhyString__SWIG_1`, 'returnType') = '_p__THyPhyString'
-attr(`_THyPhyString__SWIG_1`, "inputTypes") = c('character')
-class(`_THyPhyString__SWIG_1`) = c("SWIGFunction", class('_THyPhyString__SWIG_1'))
-
-# Start of new__THyPhyString
-
-`_THyPhyString__SWIG_2` = function()
-{
- ;ans = .Call('R_swig_new__THyPhyString__SWIG_2', PACKAGE='HyPhy');
- class(ans) <- "_p__THyPhyString";
-
- reg.finalizer(ans, delete__THyPhyString)
- ans
-
-}
-
-attr(`_THyPhyString__SWIG_2`, 'returnType') = '_p__THyPhyString'
-class(`_THyPhyString__SWIG_2`) = c("SWIGFunction", class('_THyPhyString__SWIG_2'))
-
-`_THyPhyString` <- function(...) {
- argtypes <- mapply(class, list(...));
- argv <- list(...);
- argc <- length(argtypes);
-# dispatch functions 3
- if (argc == 0) {
- f <- _THyPhyString__SWIG_2;
- } else if (argc == 1) {
- if (is.character(argv[[1]])) {
- f <- _THyPhyString__SWIG_1;
- }
- } else if (argc == 2) {
- if (is.character(argv[[1]]) && (is.integer(argv[[2]]) || is.numeric(argv[[2]]))) {
- f <- _THyPhyString__SWIG_0;
- }
- } else {
- stop("cannot find overloaded function for _THyPhyString with argtypes (",toString(argtypes),")");
- };
- f(...);
-}
-
-# Dispatch function
-# Start of _THyPhyString_myType
-
-`_THyPhyString_myType` = function(self, .copy = FALSE)
-{
- ;.Call('R_swig__THyPhyString_myType', self, as.logical(.copy), PACKAGE='HyPhy');
-
-}
-
-attr(`_THyPhyString_myType`, 'returnType') = 'integer'
-attr(`_THyPhyString_myType`, "inputTypes") = c('_p__THyPhyString')
-class(`_THyPhyString_myType`) = c("SWIGFunction", class('_THyPhyString_myType'))
-
-# Start of delete__THyPhyString
-
-`delete__THyPhyString` = function(self)
-{
- ;.Call('R_swig_delete__THyPhyString', self, PACKAGE='HyPhy');
-
-}
-
-attr(`delete__THyPhyString`, 'returnType') = 'void'
-attr(`delete__THyPhyString`, "inputTypes") = c('_p__THyPhyString')
-class(`delete__THyPhyString`) = c("SWIGFunction", class('delete__THyPhyString'))
-
-# Start of _THyPhyString_sLength_set
-
-`_THyPhyString_sLength_set` = function(self, s_sLength)
-{
- s_sLength = as.integer(s_sLength);
-
- if(length(s_sLength) > 1) {
- warning("using only the first element of s_sLength");
- };
-
- ;.Call('R_swig__THyPhyString_sLength_set', self, s_sLength, PACKAGE='HyPhy');
-
-}
-
-attr(`_THyPhyString_sLength_set`, 'returnType') = 'void'
-attr(`_THyPhyString_sLength_set`, "inputTypes") = c('_p__THyPhyString', 'integer')
-class(`_THyPhyString_sLength_set`) = c("SWIGFunction", class('_THyPhyString_sLength_set'))
-
-# Start of _THyPhyString_sLength_get
-
-`_THyPhyString_sLength_get` = function(self, .copy = FALSE)
-{
- ;.Call('R_swig__THyPhyString_sLength_get', self, as.logical(.copy), PACKAGE='HyPhy');
-
-}
-
-attr(`_THyPhyString_sLength_get`, 'returnType') = 'integer'
-attr(`_THyPhyString_sLength_get`, "inputTypes") = c('_p__THyPhyString')
-class(`_THyPhyString_sLength_get`) = c("SWIGFunction", class('_THyPhyString_sLength_get'))
-
-# Start of _THyPhyString_sData_set
-
-`_THyPhyString_sData_set` = function(self, s_sData)
-{
- s_sData = as(s_sData, "character");
- ;.Call('R_swig__THyPhyString_sData_set', self, s_sData, PACKAGE='HyPhy');
-
-}
-
-attr(`_THyPhyString_sData_set`, 'returnType') = 'void'
-attr(`_THyPhyString_sData_set`, "inputTypes") = c('_p__THyPhyString', 'character')
-class(`_THyPhyString_sData_set`) = c("SWIGFunction", class('_THyPhyString_sData_set'))
-
-# Start of _THyPhyString_sData_get
-
-`_THyPhyString_sData_get` = function(self)
-{
- ;.Call('R_swig__THyPhyString_sData_get', self, PACKAGE='HyPhy');
-
-}
-
-attr(`_THyPhyString_sData_get`, 'returnType') = 'character'
-attr(`_THyPhyString_sData_get`, "inputTypes") = c('_p__THyPhyString')
-class(`_THyPhyString_sData_get`) = c("SWIGFunction", class('_THyPhyString_sData_get'))
-
-# Start of accessor method for _THyPhyString
-setMethod('$', '_p__THyPhyString', function(x, name)
-
-{
- accessorFuns = list('myType' = _THyPhyString_myType, 'sLength' = _THyPhyString_sLength_get, 'sData' = _THyPhyString_sData_get);
- vaccessors = c('sLength', 'sData');
- ; idx = pmatch(name, names(accessorFuns));
- if(is.na(idx))
- return(callNextMethod(x, name));
- f = accessorFuns[[idx]];
- formals(f)[[1]] = x;
- if (is.na(match(name, vaccessors))) f else f(x);
-}
-
-
-);
-# end of accessor method for _THyPhyString
-# Start of accessor method for _THyPhyString
-setMethod('$<-', '_p__THyPhyString', function(x, name, value)
-
-{
- accessorFuns = list('sLength' = _THyPhyString_sLength_set, 'sData' = _THyPhyString_sData_set);
- ; idx = pmatch(name, names(accessorFuns));
- if(is.na(idx))
- return(callNextMethod(x, name, value));
- f = accessorFuns[[idx]];
- f(x, value);
- x;
-}
-
-
-);
-setMethod('[[<-', c('_p__THyPhyString', 'character'),function(x, i, j, ..., value)
-
-{
- name = i;
- accessorFuns = list('sLength' = _THyPhyString_sLength_set, 'sData' = _THyPhyString_sData_set);
- ; idx = pmatch(name, names(accessorFuns));
- if(is.na(idx))
- return(callNextMethod(x, name, value));
- f = accessorFuns[[idx]];
- f(x, value);
- x;
-}
-
-
-);
-# end of accessor method for _THyPhyString
-setMethod('delete', '_p__THyPhyString', function(obj) {delete__THyPhyString(obj)})
-# Start of new__THyPhyNumber
-
-`_THyPhyNumber__SWIG_0` = function(s_arg1)
-{
- ;ans = .Call('R_swig_new__THyPhyNumber__SWIG_0', s_arg1, PACKAGE='HyPhy');
- class(ans) <- "_p__THyPhyNumber";
-
- reg.finalizer(ans, delete__THyPhyNumber)
- ans
-
-}
-
-attr(`_THyPhyNumber__SWIG_0`, 'returnType') = '_p__THyPhyNumber'
-attr(`_THyPhyNumber__SWIG_0`, "inputTypes") = c('numeric')
-class(`_THyPhyNumber__SWIG_0`) = c("SWIGFunction", class('_THyPhyNumber__SWIG_0'))
-
-# Start of new__THyPhyNumber
-
-`_THyPhyNumber__SWIG_1` = function()
-{
- ;ans = .Call('R_swig_new__THyPhyNumber__SWIG_1', PACKAGE='HyPhy');
- class(ans) <- "_p__THyPhyNumber";
-
- reg.finalizer(ans, delete__THyPhyNumber)
- ans
-
-}
-
-attr(`_THyPhyNumber__SWIG_1`, 'returnType') = '_p__THyPhyNumber'
-class(`_THyPhyNumber__SWIG_1`) = c("SWIGFunction", class('_THyPhyNumber__SWIG_1'))
-
-`_THyPhyNumber` <- function(...) {
- argtypes <- mapply(class, list(...));
- argv <- list(...);
- argc <- length(argtypes);
-# dispatch functions 2
- if (argc == 0) {
- f <- _THyPhyNumber__SWIG_1;
- } else if (argc == 1) {
- if (is.numeric(argv[[1]])) {
- f <- _THyPhyNumber__SWIG_0;
- }
- } else {
- stop("cannot find overloaded function for _THyPhyNumber with argtypes (",toString(argtypes),")");
- };
- f(...);
-}
-
-# Dispatch function
-# Start of _THyPhyNumber_myType
-
-`_THyPhyNumber_myType` = function(self, .copy = FALSE)
-{
- ;.Call('R_swig__THyPhyNumber_myType', self, as.logical(.copy), PACKAGE='HyPhy');
-
-}
-
-attr(`_THyPhyNumber_myType`, 'returnType') = 'integer'
-attr(`_THyPhyNumber_myType`, "inputTypes") = c('_p__THyPhyNumber')
-class(`_THyPhyNumber_myType`) = c("SWIGFunction", class('_THyPhyNumber_myType'))
-
-# Start of delete__THyPhyNumber
-
-`delete__THyPhyNumber` = function(self)
-{
- ;.Call('R_swig_delete__THyPhyNumber', self, PACKAGE='HyPhy');
-
-}
-
-attr(`delete__THyPhyNumber`, 'returnType') = 'void'
-attr(`delete__THyPhyNumber`, "inputTypes") = c('_p__THyPhyNumber')
-class(`delete__THyPhyNumber`) = c("SWIGFunction", class('delete__THyPhyNumber'))
-
-# Start of _THyPhyNumber_nValue_set
-
-`_THyPhyNumber_nValue_set` = function(self, s_nValue)
-{
- ;.Call('R_swig__THyPhyNumber_nValue_set', self, s_nValue, PACKAGE='HyPhy');
-
-}
-
-attr(`_THyPhyNumber_nValue_set`, 'returnType') = 'void'
-attr(`_THyPhyNumber_nValue_set`, "inputTypes") = c('_p__THyPhyNumber', 'numeric')
-class(`_THyPhyNumber_nValue_set`) = c("SWIGFunction", class('_THyPhyNumber_nValue_set'))
-
-# Start of _THyPhyNumber_nValue_get
-
-`_THyPhyNumber_nValue_get` = function(self, .copy = FALSE)
-{
- ;.Call('R_swig__THyPhyNumber_nValue_get', self, as.logical(.copy), PACKAGE='HyPhy');
-
-}
-
-attr(`_THyPhyNumber_nValue_get`, 'returnType') = 'numeric'
-attr(`_THyPhyNumber_nValue_get`, "inputTypes") = c('_p__THyPhyNumber')
-class(`_THyPhyNumber_nValue_get`) = c("SWIGFunction", class('_THyPhyNumber_nValue_get'))
-
-# Start of accessor method for _THyPhyNumber
-setMethod('$', '_p__THyPhyNumber', function(x, name)
-
-{
- accessorFuns = list('myType' = _THyPhyNumber_myType, 'nValue' = _THyPhyNumber_nValue_get);
- vaccessors = c('nValue');
- ; idx = pmatch(name, names(accessorFuns));
- if(is.na(idx))
- return(callNextMethod(x, name));
- f = accessorFuns[[idx]];
- formals(f)[[1]] = x;
- if (is.na(match(name, vaccessors))) f else f(x);
-}
-
-
-);
-# end of accessor method for _THyPhyNumber
-# Start of accessor method for _THyPhyNumber
-setMethod('$<-', '_p__THyPhyNumber', function(x, name, value)
-
-{
- accessorFuns = list('nValue' = _THyPhyNumber_nValue_set);
- ; idx = pmatch(name, names(accessorFuns));
- if(is.na(idx))
- return(callNextMethod(x, name, value));
- f = accessorFuns[[idx]];
- f(x, value);
- x;
-}
-
-
-);
-setMethod('[[<-', c('_p__THyPhyNumber', 'character'),function(x, i, j, ..., value)
-
-{
- name = i;
- accessorFuns = list('nValue' = _THyPhyNumber_nValue_set);
- ; idx = pmatch(name, names(accessorFuns));
- if(is.na(idx))
- return(callNextMethod(x, name, value));
- f = accessorFuns[[idx]];
- f(x, value);
- x;
-}
-
-
-);
-# end of accessor method for _THyPhyNumber
-setMethod('delete', '_p__THyPhyNumber', function(obj) {delete__THyPhyNumber(obj)})
-# Start of new__THyPhyMatrix
-
-`_THyPhyMatrix__SWIG_0` = function()
-{
- ;ans = .Call('R_swig_new__THyPhyMatrix__SWIG_0', PACKAGE='HyPhy');
- class(ans) <- "_p__THyPhyMatrix";
-
- reg.finalizer(ans, delete__THyPhyMatrix)
- ans
-
-}
-
-attr(`_THyPhyMatrix__SWIG_0`, 'returnType') = '_p__THyPhyMatrix'
-class(`_THyPhyMatrix__SWIG_0`) = c("SWIGFunction", class('_THyPhyMatrix__SWIG_0'))
-
-# Start of new__THyPhyMatrix
-
-`_THyPhyMatrix__SWIG_1` = function(s_arg1, s_arg2, s_arg3)
-{
- s_arg1 = as.integer(s_arg1);
-
- if(length(s_arg1) > 1) {
- warning("using only the first element of s_arg1");
- };
-
- s_arg2 = as.integer(s_arg2);
-
- if(length(s_arg2) > 1) {
- warning("using only the first element of s_arg2");
- };
-
-
- ;ans = .Call('R_swig_new__THyPhyMatrix__SWIG_1', s_arg1, s_arg2, s_arg3, PACKAGE='HyPhy');
- class(ans) <- "_p__THyPhyMatrix";
-
- reg.finalizer(ans, delete__THyPhyMatrix)
- ans
-
-}
-
-attr(`_THyPhyMatrix__SWIG_1`, 'returnType') = '_p__THyPhyMatrix'
-attr(`_THyPhyMatrix__SWIG_1`, "inputTypes") = c('integer', 'integer', 'numeric')
-class(`_THyPhyMatrix__SWIG_1`) = c("SWIGFunction", class('_THyPhyMatrix__SWIG_1'))
-
-`_THyPhyMatrix` <- function(...) {
- argtypes <- mapply(class, list(...));
- argv <- list(...);
- argc <- length(argtypes);
-# dispatch functions 2
- if (argc == 0) {
- f <- _THyPhyMatrix__SWIG_0;
- } else if (argc == 3) {
- if ((is.integer(argv[[1]]) || is.numeric(argv[[1]])) && (is.integer(argv[[2]]) || is.numeric(argv[[2]])) && is.numeric(argv[[3]])) {
- f <- _THyPhyMatrix__SWIG_1;
- }
- } else {
- stop("cannot find overloaded function for _THyPhyMatrix with argtypes (",toString(argtypes),")");
- };
- f(...);
-}
-
-# Dispatch function
-# Start of _THyPhyMatrix_myType
-
-`_THyPhyMatrix_myType` = function(self, .copy = FALSE)
-{
- ;.Call('R_swig__THyPhyMatrix_myType', self, as.logical(.copy), PACKAGE='HyPhy');
-
-}
-
-attr(`_THyPhyMatrix_myType`, 'returnType') = 'integer'
-attr(`_THyPhyMatrix_myType`, "inputTypes") = c('_p__THyPhyMatrix')
-class(`_THyPhyMatrix_myType`) = c("SWIGFunction", class('_THyPhyMatrix_myType'))
-
-# Start of delete__THyPhyMatrix
-
-`delete__THyPhyMatrix` = function(self)
-{
- ;.Call('R_swig_delete__THyPhyMatrix', self, PACKAGE='HyPhy');
-
-}
-
-attr(`delete__THyPhyMatrix`, 'returnType') = 'void'
-attr(`delete__THyPhyMatrix`, "inputTypes") = c('_p__THyPhyMatrix')
-class(`delete__THyPhyMatrix`) = c("SWIGFunction", class('delete__THyPhyMatrix'))
-
-# Start of _THyPhyMatrix_MatrixCell
-
-`_THyPhyMatrix_MatrixCell` = function(self, s_arg2, s_arg3, .copy = FALSE)
-{
- s_arg2 = as.integer(s_arg2);
-
- if(length(s_arg2) > 1) {
- warning("using only the first element of s_arg2");
- };
-
- s_arg3 = as.integer(s_arg3);
-
- if(length(s_arg3) > 1) {
- warning("using only the first element of s_arg3");
- };
-
- ;.Call('R_swig__THyPhyMatrix_MatrixCell', self, s_arg2, s_arg3, as.logical(.copy), PACKAGE='HyPhy');
-
-}
-
-attr(`_THyPhyMatrix_MatrixCell`, 'returnType') = 'numeric'
-attr(`_THyPhyMatrix_MatrixCell`, "inputTypes") = c('_p__THyPhyMatrix', 'integer', 'integer')
-class(`_THyPhyMatrix_MatrixCell`) = c("SWIGFunction", class('_THyPhyMatrix_MatrixCell'))
-
-# Start of _THyPhyMatrix_mRows_set
-
-`_THyPhyMatrix_mRows_set` = function(self, s_mRows)
-{
- s_mRows = as.integer(s_mRows);
-
- if(length(s_mRows) > 1) {
- warning("using only the first element of s_mRows");
- };
-
- ;.Call('R_swig__THyPhyMatrix_mRows_set', self, s_mRows, PACKAGE='HyPhy');
-
-}
-
-attr(`_THyPhyMatrix_mRows_set`, 'returnType') = 'void'
-attr(`_THyPhyMatrix_mRows_set`, "inputTypes") = c('_p__THyPhyMatrix', 'integer')
-class(`_THyPhyMatrix_mRows_set`) = c("SWIGFunction", class('_THyPhyMatrix_mRows_set'))
-
-# Start of _THyPhyMatrix_mRows_get
-
-`_THyPhyMatrix_mRows_get` = function(self, .copy = FALSE)
-{
- ;.Call('R_swig__THyPhyMatrix_mRows_get', self, as.logical(.copy), PACKAGE='HyPhy');
-
-}
-
-attr(`_THyPhyMatrix_mRows_get`, 'returnType') = 'integer'
-attr(`_THyPhyMatrix_mRows_get`, "inputTypes") = c('_p__THyPhyMatrix')
-class(`_THyPhyMatrix_mRows_get`) = c("SWIGFunction", class('_THyPhyMatrix_mRows_get'))
-
-# Start of _THyPhyMatrix_mCols_set
-
-`_THyPhyMatrix_mCols_set` = function(self, s_mCols)
-{
- s_mCols = as.integer(s_mCols);
-
- if(length(s_mCols) > 1) {
- warning("using only the first element of s_mCols");
- };
-
- ;.Call('R_swig__THyPhyMatrix_mCols_set', self, s_mCols, PACKAGE='HyPhy');
-
-}
-
-attr(`_THyPhyMatrix_mCols_set`, 'returnType') = 'void'
-attr(`_THyPhyMatrix_mCols_set`, "inputTypes") = c('_p__THyPhyMatrix', 'integer')
-class(`_THyPhyMatrix_mCols_set`) = c("SWIGFunction", class('_THyPhyMatrix_mCols_set'))
-
-# Start of _THyPhyMatrix_mCols_get
-
-`_THyPhyMatrix_mCols_get` = function(self, .copy = FALSE)
-{
- ;.Call('R_swig__THyPhyMatrix_mCols_get', self, as.logical(.copy), PACKAGE='HyPhy');
-
-}
-
-attr(`_THyPhyMatrix_mCols_get`, 'returnType') = 'integer'
-attr(`_THyPhyMatrix_mCols_get`, "inputTypes") = c('_p__THyPhyMatrix')
-class(`_THyPhyMatrix_mCols_get`) = c("SWIGFunction", class('_THyPhyMatrix_mCols_get'))
-
-# Start of _THyPhyMatrix_mData_set
-
-`_THyPhyMatrix_mData_set` = function(self, s_mData)
-{
- ;.Call('R_swig__THyPhyMatrix_mData_set', self, s_mData, PACKAGE='HyPhy');
-
-}
-
-attr(`_THyPhyMatrix_mData_set`, 'returnType') = 'void'
-attr(`_THyPhyMatrix_mData_set`, "inputTypes") = c('_p__THyPhyMatrix', 'numeric')
-class(`_THyPhyMatrix_mData_set`) = c("SWIGFunction", class('_THyPhyMatrix_mData_set'))
-
-# Start of _THyPhyMatrix_mData_get
-
-`_THyPhyMatrix_mData_get` = function(self)
-{
- ;ans = .Call('R_swig__THyPhyMatrix_mData_get', self, PACKAGE='HyPhy');
- class(ans) <- "_p_double";
-
- ans
-
-}
-
-attr(`_THyPhyMatrix_mData_get`, 'returnType') = 'numeric'
-attr(`_THyPhyMatrix_mData_get`, "inputTypes") = c('_p__THyPhyMatrix')
-class(`_THyPhyMatrix_mData_get`) = c("SWIGFunction", class('_THyPhyMatrix_mData_get'))
-
-# Start of accessor method for _THyPhyMatrix
-setMethod('$', '_p__THyPhyMatrix', function(x, name)
-
-{
- accessorFuns = list('myType' = _THyPhyMatrix_myType, 'MatrixCell' = _THyPhyMatrix_MatrixCell, 'mRows' = _THyPhyMatrix_mRows_get, 'mCols' = _THyPhyMatrix_mCols_get, 'mData' = _THyPhyMatrix_mData_get);
- vaccessors = c('mRows', 'mCols', 'mData');
- ; idx = pmatch(name, names(accessorFuns));
- if(is.na(idx))
- return(callNextMethod(x, name));
- f = accessorFuns[[idx]];
- formals(f)[[1]] = x;
- if (is.na(match(name, vaccessors))) f else f(x);
-}
-
-
-);
-# end of accessor method for _THyPhyMatrix
-# Start of accessor method for _THyPhyMatrix
-setMethod('$<-', '_p__THyPhyMatrix', function(x, name, value)
-
-{
- accessorFuns = list('mRows' = _THyPhyMatrix_mRows_set, 'mCols' = _THyPhyMatrix_mCols_set, 'mData' = _THyPhyMatrix_mData_set);
- ; idx = pmatch(name, names(accessorFuns));
- if(is.na(idx))
- return(callNextMethod(x, name, value));
- f = accessorFuns[[idx]];
- f(x, value);
- x;
-}
-
-
-);
-setMethod('[[<-', c('_p__THyPhyMatrix', 'character'),function(x, i, j, ..., value)
-
-{
- name = i;
- accessorFuns = list('mRows' = _THyPhyMatrix_mRows_set, 'mCols' = _THyPhyMatrix_mCols_set, 'mData' = _THyPhyMatrix_mData_set);
- ; idx = pmatch(name, names(accessorFuns));
- if(is.na(idx))
- return(callNextMethod(x, name, value));
- f = accessorFuns[[idx]];
- f(x, value);
- x;
-}
-
-
-);
-# end of accessor method for _THyPhyMatrix
-setMethod('delete', '_p__THyPhyMatrix', function(obj) {delete__THyPhyMatrix(obj)})
-# Start of new__THyPhy
-
-`_THyPhy__SWIG_0` = function(s_arg1, s_arg2, s_arg3)
-{
- s_arg2 = as(s_arg2, "character");
- s_arg3 = as.integer(s_arg3);
-
- if(length(s_arg3) > 1) {
- warning("using only the first element of s_arg3");
- };
-
- ;ans = .Call('R_swig_new__THyPhy__SWIG_0', s_arg1, s_arg2, s_arg3, PACKAGE='HyPhy');
- class(ans) <- "_p__THyPhy";
-
- reg.finalizer(ans, delete__THyPhy)
- ans
-
-}
-
-attr(`_THyPhy__SWIG_0`, 'returnType') = '_p__THyPhy'
-attr(`_THyPhy__SWIG_0`, "inputTypes") = c('_p_f_p_char_int_double__bool', 'character', 'integer')
-class(`_THyPhy__SWIG_0`) = c("SWIGFunction", class('_THyPhy__SWIG_0'))
-
-# Start of new__THyPhy
-
-`_THyPhy__SWIG_1` = function(s_arg1, s_arg2)
-{
- s_arg2 = as(s_arg2, "character");
- ;ans = .Call('R_swig_new__THyPhy__SWIG_1', s_arg1, s_arg2, PACKAGE='HyPhy');
- class(ans) <- "_p__THyPhy";
-
- reg.finalizer(ans, delete__THyPhy)
- ans
-
-}
-
-attr(`_THyPhy__SWIG_1`, 'returnType') = '_p__THyPhy'
-attr(`_THyPhy__SWIG_1`, "inputTypes") = c('_p_f_p_char_int_double__bool', 'character')
-class(`_THyPhy__SWIG_1`) = c("SWIGFunction", class('_THyPhy__SWIG_1'))
-
-# Start of new__THyPhy
-
-`_THyPhy__SWIG_2` = function(s_arg1, s_arg2)
-{
- s_arg1 = as(s_arg1, "character");
- s_arg2 = as.integer(s_arg2);
-
- if(length(s_arg2) > 1) {
- warning("using only the first element of s_arg2");
- };
-
- ;ans = .Call('R_swig_new__THyPhy__SWIG_2', s_arg1, s_arg2, PACKAGE='HyPhy');
- class(ans) <- "_p__THyPhy";
-
- reg.finalizer(ans, delete__THyPhy)
- ans
-
-}
-
-attr(`_THyPhy__SWIG_2`, 'returnType') = '_p__THyPhy'
-attr(`_THyPhy__SWIG_2`, "inputTypes") = c('character', 'integer')
-class(`_THyPhy__SWIG_2`) = c("SWIGFunction", class('_THyPhy__SWIG_2'))
-
-# Start of new__THyPhy
-
-`_THyPhy__SWIG_3` = function(s_arg1)
-{
- s_arg1 = as(s_arg1, "character");
- ;ans = .Call('R_swig_new__THyPhy__SWIG_3', s_arg1, PACKAGE='HyPhy');
- class(ans) <- "_p__THyPhy";
-
- reg.finalizer(ans, delete__THyPhy)
- ans
-
-}
-
-attr(`_THyPhy__SWIG_3`, 'returnType') = '_p__THyPhy'
-attr(`_THyPhy__SWIG_3`, "inputTypes") = c('character')
-class(`_THyPhy__SWIG_3`) = c("SWIGFunction", class('_THyPhy__SWIG_3'))
-
-`_THyPhy` <- function(...) {
- argtypes <- mapply(class, list(...));
- argv <- list(...);
- argc <- length(argtypes);
-# dispatch functions 4
- if (argc == 1) {
- if (is.character(argv[[1]])) {
- f <- _THyPhy__SWIG_3;
- }
- } else if (argc == 2) {
- if (extends(argtypes[1], '_p_f_p_char_int_double__bool') && is.character(argv[[2]])) {
- f <- _THyPhy__SWIG_1;
- }
- else if (is.character(argv[[1]]) && (is.integer(argv[[2]]) || is.numeric(argv[[2]]))) {
- f <- _THyPhy__SWIG_2;
- }
- } else if (argc == 3) {
- if (extends(argtypes[1], '_p_f_p_char_int_double__bool') && is.character(argv[[2]]) && (is.integer(argv[[3]]) || is.numeric(argv[[3]]))) {
- f <- _THyPhy__SWIG_0;
- }
- } else {
- stop("cannot find overloaded function for _THyPhy with argtypes (",toString(argtypes),")");
- };
- f(...);
-}
-
-# Dispatch function
-# Start of delete__THyPhy
-
-`delete__THyPhy` = function(self)
-{
- ;.Call('R_swig_delete__THyPhy', self, PACKAGE='HyPhy');
-
-}
-
-attr(`delete__THyPhy`, 'returnType') = 'void'
-attr(`delete__THyPhy`, "inputTypes") = c('_p__THyPhy')
-class(`delete__THyPhy`) = c("SWIGFunction", class('delete__THyPhy'))
-
-# Start of _THyPhy_ExecuteBF
-
-`_THyPhy_ExecuteBF__SWIG_0` = function(self, s_arg2, s_arg3)
-{
- s_arg2 = as(s_arg2, "character");
- s_arg3 = as.logical(s_arg3);
- ;ans = .Call('R_swig__THyPhy_ExecuteBF__SWIG_0', self, s_arg2, s_arg3, PACKAGE='HyPhy');
- class(ans) <- "_p__THyPhyString";
-
- ans
-
-}
-
-attr(`_THyPhy_ExecuteBF__SWIG_0`, 'returnType') = '_p__THyPhyString'
-attr(`_THyPhy_ExecuteBF__SWIG_0`, "inputTypes") = c('_p__THyPhy', 'character', 'logical')
-class(`_THyPhy_ExecuteBF__SWIG_0`) = c("SWIGFunction", class('_THyPhy_ExecuteBF__SWIG_0'))
-
-# Start of _THyPhy_ExecuteBF
-
-`_THyPhy_ExecuteBF__SWIG_1` = function(self, s_arg2)
-{
- s_arg2 = as(s_arg2, "character");
- ;ans = .Call('R_swig__THyPhy_ExecuteBF__SWIG_1', self, s_arg2, PACKAGE='HyPhy');
- class(ans) <- "_p__THyPhyString";
-
- ans
-
-}
-
-attr(`_THyPhy_ExecuteBF__SWIG_1`, 'returnType') = '_p__THyPhyString'
-attr(`_THyPhy_ExecuteBF__SWIG_1`, "inputTypes") = c('_p__THyPhy', 'character')
-class(`_THyPhy_ExecuteBF__SWIG_1`) = c("SWIGFunction", class('_THyPhy_ExecuteBF__SWIG_1'))
-
-`_THyPhy_ExecuteBF` <- function(...) {
- argtypes <- mapply(class, list(...));
- argv <- list(...);
- argc <- length(argtypes);
-# dispatch functions 2
- if (argc == 2) {
- if (extends(argtypes[1], '_p__THyPhy') && is.character(argv[[2]])) {
- f <- _THyPhy_ExecuteBF__SWIG_1;
- }
- } else if (argc == 3) {
- if (extends(argtypes[1], '_p__THyPhy') && is.character(argv[[2]]) && extends(argtypes[3], 'logical')) {
- f <- _THyPhy_ExecuteBF__SWIG_0;
- }
- } else {
- stop("cannot find overloaded function for _THyPhy_ExecuteBF with argtypes (",toString(argtypes),")");
- };
- f(...);
-}
-
-# Dispatch function
-# Start of _THyPhy_InitTHyPhy
-
-`_THyPhy_InitTHyPhy` = function(self, s_arg2, s_arg3, s_arg4)
-{
- s_arg3 = as(s_arg3, "character");
- s_arg4 = as.integer(s_arg4);
-
- if(length(s_arg4) > 1) {
- warning("using only the first element of s_arg4");
- };
-
- ;.Call('R_swig__THyPhy_InitTHyPhy', self, s_arg2, s_arg3, s_arg4, PACKAGE='HyPhy');
-
-}
-
-attr(`_THyPhy_InitTHyPhy`, 'returnType') = 'void'
-attr(`_THyPhy_InitTHyPhy`, "inputTypes") = c('_p__THyPhy', '_p_f_p_char_int_double__bool', 'character', 'integer')
-class(`_THyPhy_InitTHyPhy`) = c("SWIGFunction", class('_THyPhy_InitTHyPhy'))
-
-# Start of _THyPhy_ClearAll
-
-`_THyPhy_ClearAll` = function(self)
-{
- ;.Call('R_swig__THyPhy_ClearAll', self, PACKAGE='HyPhy');
-
-}
-
-attr(`_THyPhy_ClearAll`, 'returnType') = 'void'
-attr(`_THyPhy_ClearAll`, "inputTypes") = c('_p__THyPhy')
-class(`_THyPhy_ClearAll`) = c("SWIGFunction", class('_THyPhy_ClearAll'))
-
-# Start of _THyPhy_AskFor
-
-`_THyPhy_AskFor` = function(self, s_arg2)
-{
- s_arg2 = as(s_arg2, "character");
- ;ans = .Call('R_swig__THyPhy_AskFor', self, s_arg2, PACKAGE='HyPhy');
- class(ans) <- "_p_void";
-
- ans
-
-}
-
-attr(`_THyPhy_AskFor`, 'returnType') = '_p_void'
-attr(`_THyPhy_AskFor`, "inputTypes") = c('_p__THyPhy', 'character')
-class(`_THyPhy_AskFor`) = c("SWIGFunction", class('_THyPhy_AskFor'))
-
-# Start of _THyPhy_DumpResult
-
-`_THyPhy_DumpResult` = function(self, s_arg2)
-{
- ;.Call('R_swig__THyPhy_DumpResult', self, s_arg2, PACKAGE='HyPhy');
-
-}
-
-attr(`_THyPhy_DumpResult`, 'returnType') = 'void'
-attr(`_THyPhy_DumpResult`, "inputTypes") = c('_p__THyPhy', '_p_void')
-class(`_THyPhy_DumpResult`) = c("SWIGFunction", class('_THyPhy_DumpResult'))
-
-# Start of _THyPhy_CanCast
-
-`_THyPhy_CanCast` = function(self, s_arg2, s_arg3, .copy = FALSE)
-{
- s_arg3 = as.integer(s_arg3);
-
- if(length(s_arg3) > 1) {
- warning("using only the first element of s_arg3");
- };
-
- ;.Call('R_swig__THyPhy_CanCast', self, s_arg2, s_arg3, as.logical(.copy), PACKAGE='HyPhy');
-
-}
-
-attr(`_THyPhy_CanCast`, 'returnType') = 'logical'
-attr(`_THyPhy_CanCast`, "inputTypes") = c('_p__THyPhy', '_p_void', 'integer')
-class(`_THyPhy_CanCast`) = c("SWIGFunction", class('_THyPhy_CanCast'))
-
-# Start of _THyPhy_CastResult
-
-`_THyPhy_CastResult` = function(self, s_arg2, s_arg3)
-{
- s_arg3 = as.integer(s_arg3);
-
- if(length(s_arg3) > 1) {
- warning("using only the first element of s_arg3");
- };
-
- ;ans = .Call('R_swig__THyPhy_CastResult', self, s_arg2, s_arg3, PACKAGE='HyPhy');
- class(ans) <- "_p__THyPhyReturnObject";
-
- ans
-
-}
-
-attr(`_THyPhy_CastResult`, 'returnType') = '_p__THyPhyReturnObject'
-attr(`_THyPhy_CastResult`, "inputTypes") = c('_p__THyPhy', '_p_void', 'integer')
-class(`_THyPhy_CastResult`) = c("SWIGFunction", class('_THyPhy_CastResult'))
-
-# Start of _THyPhy_SetCallbackHandler
-
-`_THyPhy_SetCallbackHandler` = function(self, s_arg2)
-{
- ;.Call('R_swig__THyPhy_SetCallbackHandler', self, s_arg2, PACKAGE='HyPhy');
-
-}
-
-attr(`_THyPhy_SetCallbackHandler`, 'returnType') = 'void'
-attr(`_THyPhy_SetCallbackHandler`, "inputTypes") = c('_p__THyPhy', '_p_f_p_char_int_double__bool')
-class(`_THyPhy_SetCallbackHandler`) = c("SWIGFunction", class('_THyPhy_SetCallbackHandler'))
-
-# Start of _THyPhy_GetCallbackHandler
-
-`_THyPhy_GetCallbackHandler` = function(self)
-{
- ;ans = .Call('R_swig__THyPhy_GetCallbackHandler', self, PACKAGE='HyPhy');
- class(ans) <- "_p_f_p_char_int_double__bool";
-
- ans
-
-}
-
-attr(`_THyPhy_GetCallbackHandler`, 'returnType') = '_p_f_p_char_int_double__bool'
-attr(`_THyPhy_GetCallbackHandler`, "inputTypes") = c('_p__THyPhy')
-class(`_THyPhy_GetCallbackHandler`) = c("SWIGFunction", class('_THyPhy_GetCallbackHandler'))
-
-# Start of _THyPhy_GetWarnings
-
-`_THyPhy_GetWarnings` = function(self)
-{
- ;ans = .Call('R_swig__THyPhy_GetWarnings', self, PACKAGE='HyPhy');
- class(ans) <- "_p__THyPhyString";
-
- ans
-
-}
-
-attr(`_THyPhy_GetWarnings`, 'returnType') = '_p__THyPhyString'
-attr(`_THyPhy_GetWarnings`, "inputTypes") = c('_p__THyPhy')
-class(`_THyPhy_GetWarnings`) = c("SWIGFunction", class('_THyPhy_GetWarnings'))
-
-# Start of _THyPhy_GetErrors
-
-`_THyPhy_GetErrors` = function(self)
-{
- ;ans = .Call('R_swig__THyPhy_GetErrors', self, PACKAGE='HyPhy');
- class(ans) <- "_p__THyPhyString";
-
- ans
-
-}
-
-attr(`_THyPhy_GetErrors`, 'returnType') = '_p__THyPhyString'
-attr(`_THyPhy_GetErrors`, "inputTypes") = c('_p__THyPhy')
-class(`_THyPhy_GetErrors`) = c("SWIGFunction", class('_THyPhy_GetErrors'))
-
-# Start of _THyPhy_GetStdout
-
-`_THyPhy_GetStdout` = function(self)
-{
- ;ans = .Call('R_swig__THyPhy_GetStdout', self, PACKAGE='HyPhy');
- class(ans) <- "_p__THyPhyString";
-
- ans
-
-}
-
-attr(`_THyPhy_GetStdout`, 'returnType') = '_p__THyPhyString'
-attr(`_THyPhy_GetStdout`, "inputTypes") = c('_p__THyPhy')
-class(`_THyPhy_GetStdout`) = c("SWIGFunction", class('_THyPhy_GetStdout'))
-
-# Start of _THyPhy_PushWarning
-
-`_THyPhy_PushWarning` = function(self, s_arg2)
-{
- ;.Call('R_swig__THyPhy_PushWarning', self, s_arg2, PACKAGE='HyPhy');
-
-}
-
-attr(`_THyPhy_PushWarning`, 'returnType') = 'void'
-attr(`_THyPhy_PushWarning`, "inputTypes") = c('_p__THyPhy', '_p_void')
-class(`_THyPhy_PushWarning`) = c("SWIGFunction", class('_THyPhy_PushWarning'))
-
-# Start of _THyPhy_PushError
-
-`_THyPhy_PushError` = function(self, s_arg2)
-{
- ;.Call('R_swig__THyPhy_PushError', self, s_arg2, PACKAGE='HyPhy');
-
-}
-
-attr(`_THyPhy_PushError`, 'returnType') = 'void'
-attr(`_THyPhy_PushError`, "inputTypes") = c('_p__THyPhy', '_p_void')
-class(`_THyPhy_PushError`) = c("SWIGFunction", class('_THyPhy_PushError'))
-
-# Start of _THyPhy_PushOutString
-
-`_THyPhy_PushOutString` = function(self, s_arg2)
-{
- ;.Call('R_swig__THyPhy_PushOutString', self, s_arg2, PACKAGE='HyPhy');
-
-}
-
-attr(`_THyPhy_PushOutString`, 'returnType') = 'void'
-attr(`_THyPhy_PushOutString`, "inputTypes") = c('_p__THyPhy', '_p_void')
-class(`_THyPhy_PushOutString`) = c("SWIGFunction", class('_THyPhy_PushOutString'))
-
-# Start of accessor method for _THyPhy
-setMethod('$', '_p__THyPhy', function(x, name)
-
-{
- accessorFuns = list('ExecuteBF' = _THyPhy_ExecuteBF, 'InitTHyPhy' = _THyPhy_InitTHyPhy, 'ClearAll' = _THyPhy_ClearAll, 'AskFor' = _THyPhy_AskFor, 'DumpResult' = _THyPhy_DumpResult, 'CanCast' = _THyPhy_CanCast, 'CastResult' = _THyPhy_CastResult, 'SetCallbackHandler' = _THyPhy_SetCallbackHandler, 'GetCallbackHandler' = _THyPhy_GetCallbackHandler, 'GetWarnings' = _THyPhy_GetWarnings, 'GetErrors' = _THyPhy_GetErrors, 'GetStdout' = _THyPhy_GetStdout, 'PushWarning' = _THyPhy_PushWarning, 'Pu [...]
- ; idx = pmatch(name, names(accessorFuns));
- if(is.na(idx))
- return(callNextMethod(x, name));
- f = accessorFuns[[idx]];
- formals(f)[[1]] = x;
- f;
-}
-
-
-);
-# end of accessor method for _THyPhy
-setMethod('delete', '_p__THyPhy', function(obj) {delete__THyPhy(obj)})
-# Start of _THyPhyGetLongStatus
-
-`_THyPhyGetLongStatus` = function(.copy = FALSE)
-{
- ;.Call('R_swig__THyPhyGetLongStatus', as.logical(.copy), PACKAGE='HyPhy');
-
-}
-
-attr(`_THyPhyGetLongStatus`, 'returnType') = 'integer'
-class(`_THyPhyGetLongStatus`) = c("SWIGFunction", class('_THyPhyGetLongStatus'))
-
-# Start of _THyPhyGetStringStatus
-
-`_THyPhyGetStringStatus` = function()
-{
- ;.Call('R_swig__THyPhyGetStringStatus', PACKAGE='HyPhy');
-
-}
-
-attr(`_THyPhyGetStringStatus`, 'returnType') = 'character'
-class(`_THyPhyGetStringStatus`) = c("SWIGFunction", class('_THyPhyGetStringStatus'))
-
-# Start of _THyPhyGetDoubleStatus
-
-`_THyPhyGetDoubleStatus` = function(.copy = FALSE)
-{
- ;.Call('R_swig__THyPhyGetDoubleStatus', as.logical(.copy), PACKAGE='HyPhy');
-
-}
-
-attr(`_THyPhyGetDoubleStatus`, 'returnType') = 'numeric'
-class(`_THyPhyGetDoubleStatus`) = c("SWIGFunction", class('_THyPhyGetDoubleStatus'))
-
-# Start of globalInterfaceInstance_set
-
-`globalInterfaceInstance_set` = function(s_globalInterfaceInstance)
-{
- ;.Call('R_swig_globalInterfaceInstance_set', s_globalInterfaceInstance, PACKAGE='HyPhy');
-
-}
-
-attr(`globalInterfaceInstance_set`, 'returnType') = 'void'
-attr(`globalInterfaceInstance_set`, "inputTypes") = c('_p__THyPhy')
-class(`globalInterfaceInstance_set`) = c("SWIGFunction", class('globalInterfaceInstance_set'))
-
-# Start of globalInterfaceInstance_get
-
-`globalInterfaceInstance_get` = function()
-{
- ;ans = .Call('R_swig_globalInterfaceInstance_get', PACKAGE='HyPhy');
- class(ans) <- "_p__THyPhy";
-
- ans
-
-}
-
-attr(`globalInterfaceInstance_get`, 'returnType') = '_p__THyPhy'
-class(`globalInterfaceInstance_get`) = c("SWIGFunction", class('globalInterfaceInstance_get'))
-
-globalInterfaceInstance =
-function(value)
-{
- if(missing(value)) {
- globalInterfaceInstance_get()
- } else {
- globalInterfaceInstance_set(value)
- }
-}
-
-
diff --git a/src/lib/README b/src/lib/README
deleted file mode 100644
index ea2d3ce..0000000
--- a/src/lib/README
+++ /dev/null
@@ -1,53 +0,0 @@
-README
-
-This directory contains my first stab at SWIG-wrapped HyPhy libraries for
-Python and R.
-
-This has been tested on a Mac OS X.5 with Python 2.5.1 and R 2.6.2, but it
-should work with slightly older versions and on Linux as well. Both Python
-and R are expected to be in the PATH variable
-
-Prior to running these scripts, please execute the buildFromSVN.sh script
-(inside the Scripts directory), then cd to ../../HYPHY/Library directory (relative
-to the Scripts directory).
-
-Python:
--------
-
-To build, type
-
-$python setup.py install
-
-To test, cd to Examples/Python and run
-
-$python BasicHyPhy.py
-
-Look at the comments inside BasicHyPhy.py for simple library usage
-example. Also take a look at Examples/HBL/HKY85.bf for how to define
-an object retrieval function.
-
-
-R:
---
-
-To build, type
-
-$sh build.sh LIBRARY R
-
-The resulting shared library will be placed inside LibraryModules/R/
-
-To test, type (from the root of the HyPhy library directory)
-
-$R
-
-Once inside R, execute
-
-source ('Examples/R/BasicHyPhy.R')
-
-Look at the comments inside BasicHyPhy.R for simple library usage
-example. Also take a look at Examples/HBL/HKY85.bf for how to define
-an object retrieval function.
-
-
-
-
diff --git a/src/lib/SWIGWrappers/THyPhy_R.cpp b/src/lib/SWIGWrappers/THyPhy_R.cpp
deleted file mode 100644
index 7ca6c71..0000000
--- a/src/lib/SWIGWrappers/THyPhy_R.cpp
+++ /dev/null
@@ -1,3344 +0,0 @@
-/* ----------------------------------------------------------------------------
- * This file was automatically generated by SWIG (http://www.swig.org).
- * Version 2.0.4
- *
- * This file is not intended to be easily readable and contains a number of
- * coding conventions designed to improve portability and efficiency. Do not make
- * changes to this file unless you know what you are doing--modify the SWIG
- * interface file instead.
- * ----------------------------------------------------------------------------- */
-
-#define SWIGR
-
-
-#ifdef __cplusplus
-/* SwigValueWrapper is described in swig.swg */
-template<typename T> class SwigValueWrapper {
- struct SwigMovePointer {
- T *ptr;
- SwigMovePointer(T *p) : ptr(p) { }
- ~SwigMovePointer() { delete ptr; }
- SwigMovePointer& operator=(SwigMovePointer& rhs) { T* oldptr = ptr; ptr = 0; delete oldptr; ptr = rhs.ptr; rhs.ptr = 0; return *this; }
- } pointer;
- SwigValueWrapper& operator=(const SwigValueWrapper<T>& rhs);
- SwigValueWrapper(const SwigValueWrapper<T>& rhs);
-public:
- SwigValueWrapper() : pointer(0) { }
- SwigValueWrapper& operator=(const T& t) { SwigMovePointer tmp(new T(t)); pointer = tmp; return *this; }
- operator T&() const { return *pointer.ptr; }
- T *operator&() { return pointer.ptr; }
-};
-
-template <typename T> T SwigValueInit() {
- return T();
-}
-#endif
-
-/* -----------------------------------------------------------------------------
- * This section contains generic SWIG labels for method/variable
- * declarations/attributes, and other compiler dependent labels.
- * ----------------------------------------------------------------------------- */
-
-/* template workaround for compilers that cannot correctly implement the C++ standard */
-#ifndef SWIGTEMPLATEDISAMBIGUATOR
-# if defined(__SUNPRO_CC) && (__SUNPRO_CC <= 0x560)
-# define SWIGTEMPLATEDISAMBIGUATOR template
-# elif defined(__HP_aCC)
-/* Needed even with `aCC -AA' when `aCC -V' reports HP ANSI C++ B3910B A.03.55 */
-/* If we find a maximum version that requires this, the test would be __HP_aCC <= 35500 for A.03.55 */
-# define SWIGTEMPLATEDISAMBIGUATOR template
-# else
-# define SWIGTEMPLATEDISAMBIGUATOR
-# endif
-#endif
-
-/* inline attribute */
-#ifndef SWIGINLINE
-# if defined(__cplusplus) || (defined(__GNUC__) && !defined(__STRICT_ANSI__))
-# define SWIGINLINE inline
-# else
-# define SWIGINLINE
-# endif
-#endif
-
-/* attribute recognised by some compilers to avoid 'unused' warnings */
-#ifndef SWIGUNUSED
-# if defined(__GNUC__)
-# if !(defined(__cplusplus)) || (__GNUC__ > 3 || (__GNUC__ == 3 && __GNUC_MINOR__ >= 4))
-# define SWIGUNUSED __attribute__ ((__unused__))
-# else
-# define SWIGUNUSED
-# endif
-# elif defined(__ICC)
-# define SWIGUNUSED __attribute__ ((__unused__))
-# else
-# define SWIGUNUSED
-# endif
-#endif
-
-#ifndef SWIG_MSC_UNSUPPRESS_4505
-# if defined(_MSC_VER)
-# pragma warning(disable : 4505) /* unreferenced local function has been removed */
-# endif
-#endif
-
-#ifndef SWIGUNUSEDPARM
-# ifdef __cplusplus
-# define SWIGUNUSEDPARM(p)
-# else
-# define SWIGUNUSEDPARM(p) p SWIGUNUSED
-# endif
-#endif
-
-/* internal SWIG method */
-#ifndef SWIGINTERN
-# define SWIGINTERN static SWIGUNUSED
-#endif
-
-/* internal inline SWIG method */
-#ifndef SWIGINTERNINLINE
-# define SWIGINTERNINLINE SWIGINTERN SWIGINLINE
-#endif
-
-/* exporting methods */
-#if (__GNUC__ >= 4) || (__GNUC__ == 3 && __GNUC_MINOR__ >= 4)
-# ifndef GCC_HASCLASSVISIBILITY
-# define GCC_HASCLASSVISIBILITY
-# endif
-#endif
-
-#ifndef SWIGEXPORT
-# if defined(_WIN32) || defined(__WIN32__) || defined(__CYGWIN__)
-# if defined(STATIC_LINKED)
-# define SWIGEXPORT
-# else
-# define SWIGEXPORT __declspec(dllexport)
-# endif
-# else
-# if defined(__GNUC__) && defined(GCC_HASCLASSVISIBILITY)
-# define SWIGEXPORT __attribute__ ((visibility("default")))
-# else
-# define SWIGEXPORT
-# endif
-# endif
-#endif
-
-/* calling conventions for Windows */
-#ifndef SWIGSTDCALL
-# if defined(_WIN32) || defined(__WIN32__) || defined(__CYGWIN__)
-# define SWIGSTDCALL __stdcall
-# else
-# define SWIGSTDCALL
-# endif
-#endif
-
-/* Deal with Microsoft's attempt at deprecating C standard runtime functions */
-#if !defined(SWIG_NO_CRT_SECURE_NO_DEPRECATE) && defined(_MSC_VER) && !defined(_CRT_SECURE_NO_DEPRECATE)
-# define _CRT_SECURE_NO_DEPRECATE
-#endif
-
-/* Deal with Microsoft's attempt at deprecating methods in the standard C++ library */
-#if !defined(SWIG_NO_SCL_SECURE_NO_DEPRECATE) && defined(_MSC_VER) && !defined(_SCL_SECURE_NO_DEPRECATE)
-# define _SCL_SECURE_NO_DEPRECATE
-#endif
-
-
-/* -----------------------------------------------------------------------------
- * swigrun.swg
- *
- * This file contains generic C API SWIG runtime support for pointer
- * type checking.
- * ----------------------------------------------------------------------------- */
-
-/* This should only be incremented when either the layout of swig_type_info changes,
- or for whatever reason, the runtime changes incompatibly */
-#define SWIG_RUNTIME_VERSION "4"
-
-/* define SWIG_TYPE_TABLE_NAME as "SWIG_TYPE_TABLE" */
-#ifdef SWIG_TYPE_TABLE
-# define SWIG_QUOTE_STRING(x) #x
-# define SWIG_EXPAND_AND_QUOTE_STRING(x) SWIG_QUOTE_STRING(x)
-# define SWIG_TYPE_TABLE_NAME SWIG_EXPAND_AND_QUOTE_STRING(SWIG_TYPE_TABLE)
-#else
-# define SWIG_TYPE_TABLE_NAME
-#endif
-
-/*
- You can use the SWIGRUNTIME and SWIGRUNTIMEINLINE macros for
- creating a static or dynamic library from the SWIG runtime code.
- In 99.9% of the cases, SWIG just needs to declare them as 'static'.
-
- But only do this if strictly necessary, ie, if you have problems
- with your compiler or suchlike.
-*/
-
-#ifndef SWIGRUNTIME
-# define SWIGRUNTIME SWIGINTERN
-#endif
-
-#ifndef SWIGRUNTIMEINLINE
-# define SWIGRUNTIMEINLINE SWIGRUNTIME SWIGINLINE
-#endif
-
-/* Generic buffer size */
-#ifndef SWIG_BUFFER_SIZE
-# define SWIG_BUFFER_SIZE 1024
-#endif
-
-/* Flags for pointer conversions */
-#define SWIG_POINTER_DISOWN 0x1
-#define SWIG_CAST_NEW_MEMORY 0x2
-
-/* Flags for new pointer objects */
-#define SWIG_POINTER_OWN 0x1
-
-
-/*
- Flags/methods for returning states.
-
- The SWIG conversion methods, as ConvertPtr, return an integer
- that tells if the conversion was successful or not. And if not,
- an error code can be returned (see swigerrors.swg for the codes).
-
- Use the following macros/flags to set or process the returning
- states.
-
- In old versions of SWIG, code such as the following was usually written:
-
- if (SWIG_ConvertPtr(obj,vptr,ty.flags) != -1) {
- // success code
- } else {
- //fail code
- }
-
- Now you can be more explicit:
-
- int res = SWIG_ConvertPtr(obj,vptr,ty.flags);
- if (SWIG_IsOK(res)) {
- // success code
- } else {
- // fail code
- }
-
- which is the same really, but now you can also do
-
- Type *ptr;
- int res = SWIG_ConvertPtr(obj,(void **)(&ptr),ty.flags);
- if (SWIG_IsOK(res)) {
- // success code
- if (SWIG_IsNewObj(res) {
- ...
- delete *ptr;
- } else {
- ...
- }
- } else {
- // fail code
- }
-
- I.e., now SWIG_ConvertPtr can return new objects and you can
- identify the case and take care of the deallocation. Of course that
- also requires SWIG_ConvertPtr to return new result values, such as
-
- int SWIG_ConvertPtr(obj, ptr,...) {
- if (<obj is ok>) {
- if (<need new object>) {
- *ptr = <ptr to new allocated object>;
- return SWIG_NEWOBJ;
- } else {
- *ptr = <ptr to old object>;
- return SWIG_OLDOBJ;
- }
- } else {
- return SWIG_BADOBJ;
- }
- }
-
- Of course, returning the plain '0(success)/-1(fail)' still works, but you can be
- more explicit by returning SWIG_BADOBJ, SWIG_ERROR or any of the
- SWIG errors code.
-
- Finally, if the SWIG_CASTRANK_MODE is enabled, the result code
- allows to return the 'cast rank', for example, if you have this
-
- int food(double)
- int fooi(int);
-
- and you call
-
- food(1) // cast rank '1' (1 -> 1.0)
- fooi(1) // cast rank '0'
-
- just use the SWIG_AddCast()/SWIG_CheckState()
-*/
-
-#define SWIG_OK (0)
-#define SWIG_ERROR (-1)
-#define SWIG_IsOK(r) (r >= 0)
-#define SWIG_ArgError(r) ((r != SWIG_ERROR) ? r : SWIG_TypeError)
-
-/* The CastRankLimit says how many bits are used for the cast rank */
-#define SWIG_CASTRANKLIMIT (1 << 8)
-/* The NewMask denotes the object was created (using new/malloc) */
-#define SWIG_NEWOBJMASK (SWIG_CASTRANKLIMIT << 1)
-/* The TmpMask is for in/out typemaps that use temporal objects */
-#define SWIG_TMPOBJMASK (SWIG_NEWOBJMASK << 1)
-/* Simple returning values */
-#define SWIG_BADOBJ (SWIG_ERROR)
-#define SWIG_OLDOBJ (SWIG_OK)
-#define SWIG_NEWOBJ (SWIG_OK | SWIG_NEWOBJMASK)
-#define SWIG_TMPOBJ (SWIG_OK | SWIG_TMPOBJMASK)
-/* Check, add and del mask methods */
-#define SWIG_AddNewMask(r) (SWIG_IsOK(r) ? (r | SWIG_NEWOBJMASK) : r)
-#define SWIG_DelNewMask(r) (SWIG_IsOK(r) ? (r & ~SWIG_NEWOBJMASK) : r)
-#define SWIG_IsNewObj(r) (SWIG_IsOK(r) && (r & SWIG_NEWOBJMASK))
-#define SWIG_AddTmpMask(r) (SWIG_IsOK(r) ? (r | SWIG_TMPOBJMASK) : r)
-#define SWIG_DelTmpMask(r) (SWIG_IsOK(r) ? (r & ~SWIG_TMPOBJMASK) : r)
-#define SWIG_IsTmpObj(r) (SWIG_IsOK(r) && (r & SWIG_TMPOBJMASK))
-
-/* Cast-Rank Mode */
-#if defined(SWIG_CASTRANK_MODE)
-# ifndef SWIG_TypeRank
-# define SWIG_TypeRank unsigned long
-# endif
-# ifndef SWIG_MAXCASTRANK /* Default cast allowed */
-# define SWIG_MAXCASTRANK (2)
-# endif
-# define SWIG_CASTRANKMASK ((SWIG_CASTRANKLIMIT) -1)
-# define SWIG_CastRank(r) (r & SWIG_CASTRANKMASK)
-SWIGINTERNINLINE int SWIG_AddCast(int r) {
- return SWIG_IsOK(r) ? ((SWIG_CastRank(r) < SWIG_MAXCASTRANK) ? (r + 1) : SWIG_ERROR) : r;
-}
-SWIGINTERNINLINE int SWIG_CheckState(int r) {
- return SWIG_IsOK(r) ? SWIG_CastRank(r) + 1 : 0;
-}
-#else /* no cast-rank mode */
-# define SWIG_AddCast
-# define SWIG_CheckState(r) (SWIG_IsOK(r) ? 1 : 0)
-#endif
-
-
-#include <string.h>
-
-#ifdef __cplusplus
-extern "C" {
-#endif
-
-typedef void *(*swig_converter_func)(void *, int *);
-typedef struct swig_type_info *(*swig_dycast_func)(void **);
-
-/* Structure to store information on one type */
-typedef struct swig_type_info {
- const char *name; /* mangled name of this type */
- const char *str; /* human readable name of this type */
- swig_dycast_func dcast; /* dynamic cast function down a hierarchy */
- struct swig_cast_info *cast; /* linked list of types that can cast into this type */
- void *clientdata; /* language specific type data */
- int owndata; /* flag if the structure owns the clientdata */
-} swig_type_info;
-
-/* Structure to store a type and conversion function used for casting */
-typedef struct swig_cast_info {
- swig_type_info *type; /* pointer to type that is equivalent to this type */
- swig_converter_func converter; /* function to cast the void pointers */
- struct swig_cast_info *next; /* pointer to next cast in linked list */
- struct swig_cast_info *prev; /* pointer to the previous cast */
-} swig_cast_info;
-
-/* Structure used to store module information
- * Each module generates one structure like this, and the runtime collects
- * all of these structures and stores them in a circularly linked list.*/
-typedef struct swig_module_info {
- swig_type_info **types; /* Array of pointers to swig_type_info structures that are in this module */
- size_t size; /* Number of types in this module */
- struct swig_module_info *next; /* Pointer to next element in circularly linked list */
- swig_type_info **type_initial; /* Array of initially generated type structures */
- swig_cast_info **cast_initial; /* Array of initially generated casting structures */
- void *clientdata; /* Language specific module data */
-} swig_module_info;
-
-/*
- Compare two type names skipping the space characters, therefore
- "char*" == "char *" and "Class<int>" == "Class<int >", etc.
-
- Return 0 when the two name types are equivalent, as in
- strncmp, but skipping ' '.
-*/
-SWIGRUNTIME int
-SWIG_TypeNameComp(const char *f1, const char *l1,
- const char *f2, const char *l2) {
- for (;(f1 != l1) && (f2 != l2); ++f1, ++f2) {
- while ((*f1 == ' ') && (f1 != l1)) ++f1;
- while ((*f2 == ' ') && (f2 != l2)) ++f2;
- if (*f1 != *f2) return (*f1 > *f2) ? 1 : -1;
- }
- return (int)((l1 - f1) - (l2 - f2));
-}
-
-/*
- Check type equivalence in a name list like <name1>|<name2>|...
- Return 0 if not equal, 1 if equal
-*/
-SWIGRUNTIME int
-SWIG_TypeEquiv(const char *nb, const char *tb) {
- int equiv = 0;
- const char* te = tb + strlen(tb);
- const char* ne = nb;
- while (!equiv && *ne) {
- for (nb = ne; *ne; ++ne) {
- if (*ne == '|') break;
- }
- equiv = (SWIG_TypeNameComp(nb, ne, tb, te) == 0) ? 1 : 0;
- if (*ne) ++ne;
- }
- return equiv;
-}
-
-/*
- Check type equivalence in a name list like <name1>|<name2>|...
- Return 0 if equal, -1 if nb < tb, 1 if nb > tb
-*/
-SWIGRUNTIME int
-SWIG_TypeCompare(const char *nb, const char *tb) {
- int equiv = 0;
- const char* te = tb + strlen(tb);
- const char* ne = nb;
- while (!equiv && *ne) {
- for (nb = ne; *ne; ++ne) {
- if (*ne == '|') break;
- }
- equiv = (SWIG_TypeNameComp(nb, ne, tb, te) == 0) ? 1 : 0;
- if (*ne) ++ne;
- }
- return equiv;
-}
-
-
-/*
- Check the typename
-*/
-SWIGRUNTIME swig_cast_info *
-SWIG_TypeCheck(const char *c, swig_type_info *ty) {
- if (ty) {
- swig_cast_info *iter = ty->cast;
- while (iter) {
- if (strcmp(iter->type->name, c) == 0) {
- if (iter == ty->cast)
- return iter;
- /* Move iter to the top of the linked list */
- iter->prev->next = iter->next;
- if (iter->next)
- iter->next->prev = iter->prev;
- iter->next = ty->cast;
- iter->prev = 0;
- if (ty->cast) ty->cast->prev = iter;
- ty->cast = iter;
- return iter;
- }
- iter = iter->next;
- }
- }
- return 0;
-}
-
-/*
- Identical to SWIG_TypeCheck, except strcmp is replaced with a pointer comparison
-*/
-SWIGRUNTIME swig_cast_info *
-SWIG_TypeCheckStruct(swig_type_info *from, swig_type_info *ty) {
- if (ty) {
- swig_cast_info *iter = ty->cast;
- while (iter) {
- if (iter->type == from) {
- if (iter == ty->cast)
- return iter;
- /* Move iter to the top of the linked list */
- iter->prev->next = iter->next;
- if (iter->next)
- iter->next->prev = iter->prev;
- iter->next = ty->cast;
- iter->prev = 0;
- if (ty->cast) ty->cast->prev = iter;
- ty->cast = iter;
- return iter;
- }
- iter = iter->next;
- }
- }
- return 0;
-}
-
-/*
- Cast a pointer up an inheritance hierarchy
-*/
-SWIGRUNTIMEINLINE void *
-SWIG_TypeCast(swig_cast_info *ty, void *ptr, int *newmemory) {
- return ((!ty) || (!ty->converter)) ? ptr : (*ty->converter)(ptr, newmemory);
-}
-
-/*
- Dynamic pointer casting. Down an inheritance hierarchy
-*/
-SWIGRUNTIME swig_type_info *
-SWIG_TypeDynamicCast(swig_type_info *ty, void **ptr) {
- swig_type_info *lastty = ty;
- if (!ty || !ty->dcast) return ty;
- while (ty && (ty->dcast)) {
- ty = (*ty->dcast)(ptr);
- if (ty) lastty = ty;
- }
- return lastty;
-}
-
-/*
- Return the name associated with this type
-*/
-SWIGRUNTIMEINLINE const char *
-SWIG_TypeName(const swig_type_info *ty) {
- return ty->name;
-}
-
-/*
- Return the pretty name associated with this type,
- that is an unmangled type name in a form presentable to the user.
-*/
-SWIGRUNTIME const char *
-SWIG_TypePrettyName(const swig_type_info *type) {
- /* The "str" field contains the equivalent pretty names of the
- type, separated by vertical-bar characters. We choose
- to print the last name, as it is often (?) the most
- specific. */
- if (!type) return NULL;
- if (type->str != NULL) {
- const char *last_name = type->str;
- const char *s;
- for (s = type->str; *s; s++)
- if (*s == '|') last_name = s+1;
- return last_name;
- }
- else
- return type->name;
-}
-
-/*
- Set the clientdata field for a type
-*/
-SWIGRUNTIME void
-SWIG_TypeClientData(swig_type_info *ti, void *clientdata) {
- swig_cast_info *cast = ti->cast;
- /* if (ti->clientdata == clientdata) return; */
- ti->clientdata = clientdata;
-
- while (cast) {
- if (!cast->converter) {
- swig_type_info *tc = cast->type;
- if (!tc->clientdata) {
- SWIG_TypeClientData(tc, clientdata);
- }
- }
- cast = cast->next;
- }
-}
-SWIGRUNTIME void
-SWIG_TypeNewClientData(swig_type_info *ti, void *clientdata) {
- SWIG_TypeClientData(ti, clientdata);
- ti->owndata = 1;
-}
-
-/*
- Search for a swig_type_info structure only by mangled name
- Search is a O(log #types)
-
- We start searching at module start, and finish searching when start == end.
- Note: if start == end at the beginning of the function, we go all the way around
- the circular list.
-*/
-SWIGRUNTIME swig_type_info *
-SWIG_MangledTypeQueryModule(swig_module_info *start,
- swig_module_info *end,
- const char *name) {
- swig_module_info *iter = start;
- do {
- if (iter->size) {
- register size_t l = 0;
- register size_t r = iter->size - 1;
- do {
- /* since l+r >= 0, we can (>> 1) instead (/ 2) */
- register size_t i = (l + r) >> 1;
- const char *iname = iter->types[i]->name;
- if (iname) {
- register int compare = strcmp(name, iname);
- if (compare == 0) {
- return iter->types[i];
- } else if (compare < 0) {
- if (i) {
- r = i - 1;
- } else {
- break;
- }
- } else if (compare > 0) {
- l = i + 1;
- }
- } else {
- break; /* should never happen */
- }
- } while (l <= r);
- }
- iter = iter->next;
- } while (iter != end);
- return 0;
-}
-
-/*
- Search for a swig_type_info structure for either a mangled name or a human readable name.
- It first searches the mangled names of the types, which is a O(log #types)
- If a type is not found it then searches the human readable names, which is O(#types).
-
- We start searching at module start, and finish searching when start == end.
- Note: if start == end at the beginning of the function, we go all the way around
- the circular list.
-*/
-SWIGRUNTIME swig_type_info *
-SWIG_TypeQueryModule(swig_module_info *start,
- swig_module_info *end,
- const char *name) {
- /* STEP 1: Search the name field using binary search */
- swig_type_info *ret = SWIG_MangledTypeQueryModule(start, end, name);
- if (ret) {
- return ret;
- } else {
- /* STEP 2: If the type hasn't been found, do a complete search
- of the str field (the human readable name) */
- swig_module_info *iter = start;
- do {
- register size_t i = 0;
- for (; i < iter->size; ++i) {
- if (iter->types[i]->str && (SWIG_TypeEquiv(iter->types[i]->str, name)))
- return iter->types[i];
- }
- iter = iter->next;
- } while (iter != end);
- }
-
- /* neither found a match */
- return 0;
-}
-
-/*
- Pack binary data into a string
-*/
-SWIGRUNTIME char *
-SWIG_PackData(char *c, void *ptr, size_t sz) {
- static const char hex[17] = "0123456789abcdef";
- register const unsigned char *u = (unsigned char *) ptr;
- register const unsigned char *eu = u + sz;
- for (; u != eu; ++u) {
- register unsigned char uu = *u;
- *(c++) = hex[(uu & 0xf0) >> 4];
- *(c++) = hex[uu & 0xf];
- }
- return c;
-}
-
-/*
- Unpack binary data from a string
-*/
-SWIGRUNTIME const char *
-SWIG_UnpackData(const char *c, void *ptr, size_t sz) {
- register unsigned char *u = (unsigned char *) ptr;
- register const unsigned char *eu = u + sz;
- for (; u != eu; ++u) {
- register char d = *(c++);
- register unsigned char uu;
- if ((d >= '0') && (d <= '9'))
- uu = ((d - '0') << 4);
- else if ((d >= 'a') && (d <= 'f'))
- uu = ((d - ('a'-10)) << 4);
- else
- return (char *) 0;
- d = *(c++);
- if ((d >= '0') && (d <= '9'))
- uu |= (d - '0');
- else if ((d >= 'a') && (d <= 'f'))
- uu |= (d - ('a'-10));
- else
- return (char *) 0;
- *u = uu;
- }
- return c;
-}
-
-/*
- Pack 'void *' into a string buffer.
-*/
-SWIGRUNTIME char *
-SWIG_PackVoidPtr(char *buff, void *ptr, const char *name, size_t bsz) {
- char *r = buff;
- if ((2*sizeof(void *) + 2) > bsz) return 0;
- *(r++) = '_';
- r = SWIG_PackData(r,&ptr,sizeof(void *));
- if (strlen(name) + 1 > (bsz - (r - buff))) return 0;
- strcpy(r,name);
- return buff;
-}
-
-SWIGRUNTIME const char *
-SWIG_UnpackVoidPtr(const char *c, void **ptr, const char *name) {
- if (*c != '_') {
- if (strcmp(c,"NULL") == 0) {
- *ptr = (void *) 0;
- return name;
- } else {
- return 0;
- }
- }
- return SWIG_UnpackData(++c,ptr,sizeof(void *));
-}
-
-SWIGRUNTIME char *
-SWIG_PackDataName(char *buff, void *ptr, size_t sz, const char *name, size_t bsz) {
- char *r = buff;
- size_t lname = (name ? strlen(name) : 0);
- if ((2*sz + 2 + lname) > bsz) return 0;
- *(r++) = '_';
- r = SWIG_PackData(r,ptr,sz);
- if (lname) {
- strncpy(r,name,lname+1);
- } else {
- *r = 0;
- }
- return buff;
-}
-
-SWIGRUNTIME const char *
-SWIG_UnpackDataName(const char *c, void *ptr, size_t sz, const char *name) {
- if (*c != '_') {
- if (strcmp(c,"NULL") == 0) {
- memset(ptr,0,sz);
- return name;
- } else {
- return 0;
- }
- }
- return SWIG_UnpackData(++c,ptr,sz);
-}
-
-#ifdef __cplusplus
-}
-#endif
-
-
-#ifdef __cplusplus
-extern "C" {
-#endif
-
-/* Remove global namespace pollution */
-#if !defined(SWIG_NO_R_NO_REMAP)
-# define R_NO_REMAP
-#endif
-#if !defined(SWIG_NO_STRICT_R_HEADERS)
-# define STRICT_R_HEADERS
-#endif
-
-#include <Rdefines.h>
-#include <Rversion.h>
-#include <stdlib.h>
-#include <assert.h>
-
-#if R_VERSION >= R_Version(2,6,0)
-#define VMAXTYPE void *
-#else
-#define VMAXTYPE char *
-#endif
-
-/*
- This is mainly a way to avoid having lots of local variables that may
- conflict with those in the routine.
-
- Change name to R_SWIG_Callb....
-*/
-typedef struct RCallbackFunctionData {
-
- SEXP fun;
- SEXP userData;
-
-
- SEXP expr;
- SEXP retValue;
- int errorOccurred;
-
- SEXP el; /* Temporary pointer used in the construction of the expression to call the R function. */
-
- struct RCallbackFunctionData *previous; /* Stack */
-
-} RCallbackFunctionData;
-
-static RCallbackFunctionData *callbackFunctionDataStack;
-
-
-SWIGRUNTIME SEXP
-R_SWIG_debug_getCallbackFunctionData()
-{
- int n, i;
- SEXP ans;
- RCallbackFunctionData *p = callbackFunctionDataStack;
-
- n = 0;
- while(p) {
- n++;
- p = p->previous;
- }
-
- Rf_protect(ans = Rf_allocVector(VECSXP, n));
- for(p = callbackFunctionDataStack, i = 0; i < n; p = p->previous, i++)
- SET_VECTOR_ELT(ans, i, p->fun);
-
- Rf_unprotect(1);
-
- return(ans);
-}
-
-
-
-SWIGRUNTIME RCallbackFunctionData *
-R_SWIG_pushCallbackFunctionData(SEXP fun, SEXP userData)
-{
- RCallbackFunctionData *el;
- el = (RCallbackFunctionData *) calloc(1, sizeof(RCallbackFunctionData));
- el->fun = fun;
- el->userData = userData;
- el->previous = callbackFunctionDataStack;
-
- callbackFunctionDataStack = el;
-
- return(el);
-}
-
-
-SWIGRUNTIME SEXP
-R_SWIG_R_pushCallbackFunctionData(SEXP fun, SEXP userData)
-{
- R_SWIG_pushCallbackFunctionData(fun, userData);
- return R_NilValue;
-}
-
-SWIGRUNTIME RCallbackFunctionData *
-R_SWIG_getCallbackFunctionData()
-{
- if(!callbackFunctionDataStack) {
- Rf_error("Supposedly impossible error occurred in the SWIG callback mechanism."
- " No callback function data set.");
- }
-
- return callbackFunctionDataStack;
-}
-
-SWIGRUNTIME void
-R_SWIG_popCallbackFunctionData(int doFree)
-{
- RCallbackFunctionData *el = NULL;
- if(!callbackFunctionDataStack)
- return ; /* Error !!! */
-
- el = callbackFunctionDataStack ;
- callbackFunctionDataStack = callbackFunctionDataStack->previous;
-
- if(doFree)
- free(el);
-}
-
-
-/*
- Interface to S function
- is(obj, type)
- which is to be used to determine if an
- external pointer inherits from the right class.
-
- Ideally, we would like to be able to do this without an explicit call to the is() function.
- When the S4 class system uses its own SEXP types, then we will hopefully be able to do this
- in the C code.
-
- Should we make the expression static and preserve it to avoid the overhead of
- allocating each time.
-*/
-SWIGRUNTIME int
-R_SWIG_checkInherits(SEXP obj, SEXP tag, const char *type)
-{
- SEXP e, val;
- int check_err = 0;
-
- Rf_protect(e = Rf_allocVector(LANGSXP, 3));
- SETCAR(e, Rf_install("extends"));
-
- SETCAR(CDR(e), Rf_mkString(CHAR(PRINTNAME(tag))));
- SETCAR(CDR(CDR(e)), Rf_mkString(type));
-
- val = R_tryEval(e, R_GlobalEnv, &check_err);
- Rf_unprotect(1);
- if(check_err)
- return(0);
-
-
- return(LOGICAL(val)[0]);
-}
-
-
-SWIGRUNTIME void *
-R_SWIG_resolveExternalRef(SEXP arg, const char * const type, const char * const argName, Rboolean nullOk)
-{
- void *ptr;
- SEXP orig = arg;
-
- if(TYPEOF(arg) != EXTPTRSXP)
- arg = GET_SLOT(arg, Rf_mkString("ref"));
-
-
- if(TYPEOF(arg) != EXTPTRSXP) {
- Rf_error("argument %s must be an external pointer (from an ExternalReference)", argName);
- }
-
-
- ptr = R_ExternalPtrAddr(arg);
-
- if(ptr == NULL && nullOk == (Rboolean) FALSE) {
- Rf_error("the external pointer (of type %s) for argument %s has value NULL", argName, type);
- }
-
- if(type[0] && R_ExternalPtrTag(arg) != Rf_install(type) && strcmp(type, "voidRef")
- && !R_SWIG_checkInherits(orig, R_ExternalPtrTag(arg), type)) {
- Rf_error("the external pointer for argument %s has tag %s, not the expected value %s",
- argName, CHAR(PRINTNAME(R_ExternalPtrTag(arg))), type);
- }
-
-
- return(ptr);
-}
-
-SWIGRUNTIME void
-R_SWIG_ReferenceFinalizer(SEXP el)
-{
- void *ptr = R_SWIG_resolveExternalRef(el, "", "<finalizer>", (Rboolean) 1);
- fprintf(stderr, "In R_SWIG_ReferenceFinalizer for %p\n", ptr);
- Rf_PrintValue(el);
-
- if(ptr) {
- if(TYPEOF(el) != EXTPTRSXP)
- el = GET_SLOT(el, Rf_mkString("ref"));
-
- if(TYPEOF(el) == EXTPTRSXP)
- R_ClearExternalPtr(el);
-
- free(ptr);
- }
-
- return;
-}
-
-typedef enum {R_SWIG_EXTERNAL, R_SWIG_OWNER } R_SWIG_Owner;
-
-SWIGRUNTIME SEXP
-SWIG_MakePtr(void *ptr, const char *typeName, R_SWIG_Owner owner)
-{
- SEXP external, r_obj;
- const char *p = typeName;
-
- if(typeName[0] == '_')
- p = typeName + 1;
-
- Rf_protect(external = R_MakeExternalPtr(ptr, Rf_install(typeName), R_NilValue));
- Rf_protect(r_obj = NEW_OBJECT(MAKE_CLASS((char *) typeName)));
-
- if(owner)
- R_RegisterCFinalizer(external, R_SWIG_ReferenceFinalizer);
-
- r_obj = SET_SLOT(r_obj, Rf_mkString((char *) "ref"), external);
- SET_S4_OBJECT(r_obj);
- Rf_unprotect(2);
-
- return(r_obj);
-}
-
-
-SWIGRUNTIME SEXP
-R_SWIG_create_SWIG_R_Array(const char *typeName, SEXP ref, int len)
-{
- SEXP arr;
-
-/*XXX remove the char * cast when we can. MAKE_CLASS should be declared appropriately. */
- Rf_protect(arr = NEW_OBJECT(MAKE_CLASS((char *) typeName)));
- Rf_protect(arr = R_do_slot_assign(arr, Rf_mkString("ref"), ref));
- Rf_protect(arr = R_do_slot_assign(arr, Rf_mkString("dims"), Rf_ScalarInteger(len)));
-
- Rf_unprotect(3);
- SET_S4_OBJECT(arr);
- return arr;
-}
-
-#define ADD_OUTPUT_ARG(result, pos, value, name) r_ans = AddOutputArgToReturn(pos, value, name, OutputValues);
-
-SWIGRUNTIME SEXP
-AddOutputArgToReturn(int pos, SEXP value, const char *name, SEXP output)
-{
- SET_VECTOR_ELT(output, pos, value);
-
- return(output);
-}
-
-/* Create a new pointer object */
-SWIGRUNTIMEINLINE SEXP
-SWIG_R_NewPointerObj(void *ptr, swig_type_info *type, int flags) {
- SEXP rptr = R_MakeExternalPtr(ptr,
- R_MakeExternalPtr(type, R_NilValue, R_NilValue), R_NilValue);
- SET_S4_OBJECT(rptr);
-// rptr = Rf_setAttrib(rptr, R_ClassSymbol, mkChar(SWIG_TypeName(type)));
- return rptr;
-}
-
-/* Convert a pointer value */
-SWIGRUNTIMEINLINE int
-SWIG_R_ConvertPtr(SEXP obj, void **ptr, swig_type_info *ty, int flags) {
- void *vptr;
- if (!obj) return SWIG_ERROR;
- if (obj == R_NilValue) {
- if (ptr) *ptr = NULL;
- return SWIG_OK;
- }
-
- vptr = R_ExternalPtrAddr(obj);
- if (ty) {
- swig_type_info *to = (swig_type_info*)
- R_ExternalPtrAddr(R_ExternalPtrTag(obj));
- if (to == ty) {
- if (ptr) *ptr = vptr;
- } else {
- swig_cast_info *tc = SWIG_TypeCheck(to->name,ty);
- int newmemory = 0;
- if (ptr) *ptr = SWIG_TypeCast(tc,vptr,&newmemory);
- assert(!newmemory); /* newmemory handling not yet implemented */
- }
- } else {
- if (ptr) *ptr = vptr;
- }
- return SWIG_OK;
-}
-
-SWIGRUNTIME swig_module_info *
-SWIG_GetModule(void *v) {
- static void *type_pointer = (void *)0;
- return (swig_module_info *) type_pointer;
-}
-
-SWIGRUNTIME void
-SWIG_SetModule(void *v, swig_module_info *swig_module) {
-}
-
-typedef struct {
- void *pack;
- swig_type_info *ty;
- size_t size;
-} RSwigPacked;
-
-/* Create a new packed object */
-
-SWIGRUNTIMEINLINE SEXP RSwigPacked_New(void *ptr, size_t sz,
- swig_type_info *ty) {
- SEXP rptr;
- RSwigPacked *sobj =
- (RSwigPacked*) malloc(sizeof(RSwigPacked));
- if (sobj) {
- void *pack = malloc(sz);
- if (pack) {
- memcpy(pack, ptr, sz);
- sobj->pack = pack;
- sobj->ty = ty;
- sobj->size = sz;
- } else {
- sobj = 0;
- }
- }
- rptr = R_MakeExternalPtr(sobj, R_NilValue, R_NilValue);
- return rptr;
-}
-
-SWIGRUNTIME swig_type_info *
-RSwigPacked_UnpackData(SEXP obj, void *ptr, size_t size)
-{
- RSwigPacked *sobj =
- (RSwigPacked *)R_ExternalPtrAddr(obj);
- if (sobj->size != size) return 0;
- memcpy(ptr, sobj->pack, size);
- return sobj->ty;
-}
-
-SWIGRUNTIMEINLINE SEXP
-SWIG_R_NewPackedObj(void *ptr, size_t sz, swig_type_info *type) {
- return ptr ? RSwigPacked_New((void *) ptr, sz, type) : R_NilValue;
-}
-
-/* Convert a packed value value */
-
-SWIGRUNTIME int
-SWIG_R_ConvertPacked(SEXP obj, void *ptr, size_t sz, swig_type_info *ty) {
- swig_type_info *to = RSwigPacked_UnpackData(obj, ptr, sz);
- if (!to) return SWIG_ERROR;
- if (ty) {
- if (to != ty) {
- /* check type cast? */
- swig_cast_info *tc = SWIG_TypeCheck(to->name,ty);
- if (!tc) return SWIG_ERROR;
- }
- }
- return SWIG_OK;
-}
-
-#ifdef __cplusplus
-}
-#endif
-
-
-
-#define SWIG_exception_fail(code, msg) do { Rf_warning(msg); return Rf_ScalarLogical(NA_LOGICAL); return Rf_ScalarLogical(NA_LOGICAL); } while(0)
-
-#define SWIG_contract_assert(expr, msg) if (!(expr)) { Rf_warning(msg); return Rf_ScalarLogical(NA_LOGICAL); return Rf_ScalarLogical(NA_LOGICAL); } else
-
-
-
-/* -------- TYPES TABLE (BEGIN) -------- */
-
-#define SWIGTYPE_p__THyPhy swig_types[0]
-#define SWIGTYPE_p__THyPhyMatrix swig_types[1]
-#define SWIGTYPE_p__THyPhyNumber swig_types[2]
-#define SWIGTYPE_p__THyPhyReturnObject swig_types[3]
-#define SWIGTYPE_p__THyPhyString swig_types[4]
-#define SWIGTYPE_p_char swig_types[5]
-#define SWIGTYPE_p_double swig_types[6]
-#define SWIGTYPE_p_f_p_char_int_double__bool swig_types[7]
-#define SWIGTYPE_p_void swig_types[8]
-static swig_type_info *swig_types[10];
-static swig_module_info swig_module = {swig_types, 9, 0, 0, 0, 0};
-#define SWIG_TypeQuery(name) SWIG_TypeQueryModule(&swig_module, &swig_module, name)
-#define SWIG_MangledTypeQuery(name) SWIG_MangledTypeQueryModule(&swig_module, &swig_module, name)
-
-/* -------- TYPES TABLE (END) -------- */
-
-
-/* -----------------------------------------------------------------------------
- * This section contains generic SWIG labels for method/variable
- * declarations/attributes, and other compiler dependent labels.
- * ----------------------------------------------------------------------------- */
-
-/* template workaround for compilers that cannot correctly implement the C++ standard */
-#ifndef SWIGTEMPLATEDISAMBIGUATOR
-# if defined(__SUNPRO_CC) && (__SUNPRO_CC <= 0x560)
-# define SWIGTEMPLATEDISAMBIGUATOR template
-# elif defined(__HP_aCC)
-/* Needed even with `aCC -AA' when `aCC -V' reports HP ANSI C++ B3910B A.03.55 */
-/* If we find a maximum version that requires this, the test would be __HP_aCC <= 35500 for A.03.55 */
-# define SWIGTEMPLATEDISAMBIGUATOR template
-# else
-# define SWIGTEMPLATEDISAMBIGUATOR
-# endif
-#endif
-
-/* inline attribute */
-#ifndef SWIGINLINE
-# if defined(__cplusplus) || (defined(__GNUC__) && !defined(__STRICT_ANSI__))
-# define SWIGINLINE inline
-# else
-# define SWIGINLINE
-# endif
-#endif
-
-/* attribute recognised by some compilers to avoid 'unused' warnings */
-#ifndef SWIGUNUSED
-# if defined(__GNUC__)
-# if !(defined(__cplusplus)) || (__GNUC__ > 3 || (__GNUC__ == 3 && __GNUC_MINOR__ >= 4))
-# define SWIGUNUSED __attribute__ ((__unused__))
-# else
-# define SWIGUNUSED
-# endif
-# elif defined(__ICC)
-# define SWIGUNUSED __attribute__ ((__unused__))
-# else
-# define SWIGUNUSED
-# endif
-#endif
-
-#ifndef SWIG_MSC_UNSUPPRESS_4505
-# if defined(_MSC_VER)
-# pragma warning(disable : 4505) /* unreferenced local function has been removed */
-# endif
-#endif
-
-#ifndef SWIGUNUSEDPARM
-# ifdef __cplusplus
-# define SWIGUNUSEDPARM(p)
-# else
-# define SWIGUNUSEDPARM(p) p SWIGUNUSED
-# endif
-#endif
-
-/* internal SWIG method */
-#ifndef SWIGINTERN
-# define SWIGINTERN static SWIGUNUSED
-#endif
-
-/* internal inline SWIG method */
-#ifndef SWIGINTERNINLINE
-# define SWIGINTERNINLINE SWIGINTERN SWIGINLINE
-#endif
-
-/* exporting methods */
-#if (__GNUC__ >= 4) || (__GNUC__ == 3 && __GNUC_MINOR__ >= 4)
-# ifndef GCC_HASCLASSVISIBILITY
-# define GCC_HASCLASSVISIBILITY
-# endif
-#endif
-
-#ifndef SWIGEXPORT
-# if defined(_WIN32) || defined(__WIN32__) || defined(__CYGWIN__)
-# if defined(STATIC_LINKED)
-# define SWIGEXPORT
-# else
-# define SWIGEXPORT __declspec(dllexport)
-# endif
-# else
-# if defined(__GNUC__) && defined(GCC_HASCLASSVISIBILITY)
-# define SWIGEXPORT __attribute__ ((visibility("default")))
-# else
-# define SWIGEXPORT
-# endif
-# endif
-#endif
-
-/* calling conventions for Windows */
-#ifndef SWIGSTDCALL
-# if defined(_WIN32) || defined(__WIN32__) || defined(__CYGWIN__)
-# define SWIGSTDCALL __stdcall
-# else
-# define SWIGSTDCALL
-# endif
-#endif
-
-/* Deal with Microsoft's attempt at deprecating C standard runtime functions */
-#if !defined(SWIG_NO_CRT_SECURE_NO_DEPRECATE) && defined(_MSC_VER) && !defined(_CRT_SECURE_NO_DEPRECATE)
-# define _CRT_SECURE_NO_DEPRECATE
-#endif
-
-/* Deal with Microsoft's attempt at deprecating methods in the standard C++ library */
-#if !defined(SWIG_NO_SCL_SECURE_NO_DEPRECATE) && defined(_MSC_VER) && !defined(_SCL_SECURE_NO_DEPRECATE)
-# define _SCL_SECURE_NO_DEPRECATE
-#endif
-
-
-/* Errors in SWIG */
-#define SWIG_UnknownError -1
-#define SWIG_IOError -2
-#define SWIG_RuntimeError -3
-#define SWIG_IndexError -4
-#define SWIG_TypeError -5
-#define SWIG_DivisionByZero -6
-#define SWIG_OverflowError -7
-#define SWIG_SyntaxError -8
-#define SWIG_ValueError -9
-#define SWIG_SystemError -10
-#define SWIG_AttributeError -11
-#define SWIG_MemoryError -12
-#define SWIG_NullReferenceError -13
-
-
-
-
-#define SWIGVERSION 0x020004
-#define SWIG_VERSION SWIGVERSION
-
-
-#define SWIG_as_voidptr(a) const_cast< void * >(static_cast< const void * >(a))
-#define SWIG_as_voidptrptr(a) ((void)SWIG_as_voidptr(*a),reinterpret_cast< void** >(a))
-
-
-#include <stdexcept>
-
-
-#include "THyPhy.h"
-
-
-SWIGINTERN int
-SWIG_AsCharPtrAndSize(SEXP obj, char** cptr, size_t* psize, int *alloc)
-{
- if (cptr && Rf_isString(obj)) {
- char *cstr = const_cast< char * >(CHAR(STRING_ELT(obj, 0)));
- int len = strlen(cstr);
-
- if (alloc) {
- if (*alloc == SWIG_NEWOBJ) {
- *cptr = reinterpret_cast< char* >(memcpy((new char[len + 1]), cstr, sizeof(char)*(len + 1)));
- *alloc = SWIG_NEWOBJ;
- } else {
- *cptr = cstr;
- }
- } else {
- *cptr = reinterpret_cast< char * >(malloc(len + 1));
- *cptr = strcpy(*cptr, cstr);
- }
- if (psize) *psize = len + 1;
- return SWIG_OK;
- }
- return SWIG_TypeError;
-}
-
-
-
-
-
-SWIGINTERNINLINE int
-SWIG_AsVal_long (SEXP obj, long *val)
-{
- if (val) *val = Rf_asInteger(obj);
- return SWIG_OK;
-}
-
-
-SWIGINTERN char *
-SWIG_strdup(const char *str)
-{
- char *newstr = reinterpret_cast< char * >(malloc(strlen(str) + 1));
- return strcpy(newstr, str);
-}
-
-
-SWIGINTERNINLINE int
-SWIG_AsVal_double (SEXP obj, double *val)
-{
- if (val) *val = Rf_asReal(obj);
- return SWIG_OK;
-}
-
-
-SWIGINTERNINLINE SEXP
-SWIG_From_double (double value)
-{
- return Rf_ScalarReal(value);
-}
-
-
-SWIGINTERN int
-SWIG_AsVal_bool (SEXP obj, bool *val)
-{
- long v;
- int res = SWIG_AsVal_long (obj, val ? &v : 0);
- if (SWIG_IsOK(res)) {
- if (val) *val = v ? true : false;
- return res;
- }
- return SWIG_TypeError;
-}
-
-
-#include <limits.h>
-#if !defined(SWIG_NO_LLONG_MAX)
-# if !defined(LLONG_MAX) && defined(__GNUC__) && defined (__LONG_LONG_MAX__)
-# define LLONG_MAX __LONG_LONG_MAX__
-# define LLONG_MIN (-LLONG_MAX - 1LL)
-# define ULLONG_MAX (LLONG_MAX * 2ULL + 1ULL)
-# endif
-#endif
-
-
-SWIGINTERN int
-SWIG_AsVal_int (SEXP obj, int *val)
-{
- long v;
- int res = SWIG_AsVal_long (obj, &v);
- if (SWIG_IsOK(res)) {
- if ((v < INT_MIN || v > INT_MAX)) {
- return SWIG_OverflowError;
- } else {
- if (val) *val = static_cast< int >(v);
- }
- }
- return res;
-}
-
-
-#ifdef __cplusplus
-extern "C" {
-#endif
-
-SWIGEXPORT SEXP
-R_swig__THyPhyReturnObject_myType ( SEXP self, SEXP s_swig_copy)
-{
- int result;
- _THyPhyReturnObject *arg1 = (_THyPhyReturnObject *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- res1 = SWIG_R_ConvertPtr(self, &argp1, SWIGTYPE_p__THyPhyReturnObject, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyReturnObject_myType" "', argument " "1"" of type '" "_THyPhyReturnObject *""'");
- }
- arg1 = reinterpret_cast< _THyPhyReturnObject * >(argp1);
- result = (int)(arg1)->myType();
- r_ans = Rf_ScalarInteger(result);
-
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig_delete__THyPhyReturnObject ( SEXP self)
-{
- _THyPhyReturnObject *arg1 = (_THyPhyReturnObject *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- res1 = SWIG_R_ConvertPtr(self, &argp1, SWIGTYPE_p__THyPhyReturnObject, SWIG_POINTER_DISOWN | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "delete__THyPhyReturnObject" "', argument " "1"" of type '" "_THyPhyReturnObject *""'");
- }
- arg1 = reinterpret_cast< _THyPhyReturnObject * >(argp1);
- delete arg1;
- r_ans = R_NilValue;
-
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- R_ClearExternalPtr(self);
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig__THyPhyReturnObject_castToString ( SEXP self)
-{
- _THyPhyString *result = 0 ;
- _THyPhyReturnObject *arg1 = (_THyPhyReturnObject *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- res1 = SWIG_R_ConvertPtr(self, &argp1, SWIGTYPE_p__THyPhyReturnObject, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyReturnObject_castToString" "', argument " "1"" of type '" "_THyPhyReturnObject *""'");
- }
- arg1 = reinterpret_cast< _THyPhyReturnObject * >(argp1);
- result = (_THyPhyString *)(arg1)->castToString();
- r_ans = SWIG_R_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhyString, R_SWIG_EXTERNAL | 0 );
-
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig__THyPhyReturnObject_castToNumber ( SEXP self)
-{
- _THyPhyNumber *result = 0 ;
- _THyPhyReturnObject *arg1 = (_THyPhyReturnObject *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- res1 = SWIG_R_ConvertPtr(self, &argp1, SWIGTYPE_p__THyPhyReturnObject, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyReturnObject_castToNumber" "', argument " "1"" of type '" "_THyPhyReturnObject *""'");
- }
- arg1 = reinterpret_cast< _THyPhyReturnObject * >(argp1);
- result = (_THyPhyNumber *)(arg1)->castToNumber();
- r_ans = SWIG_R_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhyNumber, R_SWIG_EXTERNAL | 0 );
-
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig__THyPhyReturnObject_castToMatrix ( SEXP self)
-{
- _THyPhyMatrix *result = 0 ;
- _THyPhyReturnObject *arg1 = (_THyPhyReturnObject *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- res1 = SWIG_R_ConvertPtr(self, &argp1, SWIGTYPE_p__THyPhyReturnObject, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyReturnObject_castToMatrix" "', argument " "1"" of type '" "_THyPhyReturnObject *""'");
- }
- arg1 = reinterpret_cast< _THyPhyReturnObject * >(argp1);
- result = (_THyPhyMatrix *)(arg1)->castToMatrix();
- r_ans = SWIG_R_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhyMatrix, R_SWIG_EXTERNAL | 0 );
-
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig_new__THyPhyString__SWIG_0 ( SEXP s_arg1, SEXP s_arg2)
-{
- _THyPhyString *result = 0 ;
- char *arg1 = (char *) 0 ;
- long arg2 ;
- int res1 ;
- char *buf1 = 0 ;
- int alloc1 = 0 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- res1 = SWIG_AsCharPtrAndSize(s_arg1, &buf1, NULL, &alloc1);
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "new__THyPhyString" "', argument " "1"" of type '" "char const *""'");
- }
- arg1 = reinterpret_cast< char * >(buf1);
- arg2 = static_cast< long >(INTEGER(s_arg2)[0]);
- result = (_THyPhyString *)new _THyPhyString((char const *)arg1,arg2);
- r_ans = SWIG_R_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhyString, R_SWIG_OWNER | 0 );
- if (alloc1 == SWIG_NEWOBJ) delete[] buf1;
-
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig_new__THyPhyString__SWIG_1 ( SEXP s_arg1)
-{
- _THyPhyString *result = 0 ;
- char *arg1 = (char *) 0 ;
- int res1 ;
- char *buf1 = 0 ;
- int alloc1 = 0 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- res1 = SWIG_AsCharPtrAndSize(s_arg1, &buf1, NULL, &alloc1);
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "new__THyPhyString" "', argument " "1"" of type '" "char const *""'");
- }
- arg1 = reinterpret_cast< char * >(buf1);
- result = (_THyPhyString *)new _THyPhyString((char const *)arg1);
- r_ans = SWIG_R_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhyString, R_SWIG_OWNER | 0 );
- if (alloc1 == SWIG_NEWOBJ) delete[] buf1;
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig_new__THyPhyString__SWIG_2 ( )
-{
- _THyPhyString *result = 0 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- result = (_THyPhyString *)new _THyPhyString();
- r_ans = SWIG_R_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhyString, R_SWIG_OWNER | 0 );
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig__THyPhyString_myType ( SEXP self, SEXP s_swig_copy)
-{
- int result;
- _THyPhyString *arg1 = (_THyPhyString *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- res1 = SWIG_R_ConvertPtr(self, &argp1, SWIGTYPE_p__THyPhyString, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyString_myType" "', argument " "1"" of type '" "_THyPhyString *""'");
- }
- arg1 = reinterpret_cast< _THyPhyString * >(argp1);
- result = (int)(arg1)->myType();
- r_ans = Rf_ScalarInteger(result);
-
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig_delete__THyPhyString ( SEXP self)
-{
- _THyPhyString *arg1 = (_THyPhyString *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- res1 = SWIG_R_ConvertPtr(self, &argp1, SWIGTYPE_p__THyPhyString, SWIG_POINTER_DISOWN | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "delete__THyPhyString" "', argument " "1"" of type '" "_THyPhyString *""'");
- }
- arg1 = reinterpret_cast< _THyPhyString * >(argp1);
- delete arg1;
- r_ans = R_NilValue;
-
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- R_ClearExternalPtr(self);
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig__THyPhyString_sLength_set ( SEXP self, SEXP s_sLength)
-{
- _THyPhyString *arg1 = (_THyPhyString *) 0 ;
- long arg2 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- res1 = SWIG_R_ConvertPtr(self, &argp1, SWIGTYPE_p__THyPhyString, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyString_sLength_set" "', argument " "1"" of type '" "_THyPhyString *""'");
- }
- arg1 = reinterpret_cast< _THyPhyString * >(argp1);
- arg2 = static_cast< long >(INTEGER(s_sLength)[0]);
- if (arg1) (arg1)->sLength = arg2;
- r_ans = R_NilValue;
-
-
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig__THyPhyString_sLength_get ( SEXP self, SEXP s_swig_copy)
-{
- long result;
- _THyPhyString *arg1 = (_THyPhyString *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- res1 = SWIG_R_ConvertPtr(self, &argp1, SWIGTYPE_p__THyPhyString, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyString_sLength_get" "', argument " "1"" of type '" "_THyPhyString *""'");
- }
- arg1 = reinterpret_cast< _THyPhyString * >(argp1);
- result = (long) ((arg1)->sLength);
- r_ans = Rf_ScalarInteger(result);
-
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig__THyPhyString_sData_set ( SEXP self, SEXP s_sData)
-{
- _THyPhyString *arg1 = (_THyPhyString *) 0 ;
- char *arg2 = (char *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- res1 = SWIG_R_ConvertPtr(self, &argp1, SWIGTYPE_p__THyPhyString, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyString_sData_set" "', argument " "1"" of type '" "_THyPhyString *""'");
- }
- arg1 = reinterpret_cast< _THyPhyString * >(argp1);
- arg2 = reinterpret_cast< char * >(SWIG_strdup(CHAR(STRING_ELT(s_sData, 0))));
- if (arg1->sData) delete[] arg1->sData;
- if (arg2) {
- size_t size = strlen(reinterpret_cast< const char * >(arg2)) + 1;
- arg1->sData = (char *)reinterpret_cast< char* >(memcpy((new char[size]), reinterpret_cast< const char * >(arg2), sizeof(char)*(size)));
- } else {
- arg1->sData = 0;
- }
- r_ans = R_NilValue;
-
- free(arg2);
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig__THyPhyString_sData_get ( SEXP self)
-{
- char *result = 0 ;
- _THyPhyString *arg1 = (_THyPhyString *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- res1 = SWIG_R_ConvertPtr(self, &argp1, SWIGTYPE_p__THyPhyString, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyString_sData_get" "', argument " "1"" of type '" "_THyPhyString *""'");
- }
- arg1 = reinterpret_cast< _THyPhyString * >(argp1);
- result = (char *) ((arg1)->sData);
- r_ans = result ? Rf_mkString(reinterpret_cast< char * >(result)) : R_NilValue;
-
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig_new__THyPhyNumber__SWIG_0 ( SEXP s_arg1)
-{
- _THyPhyNumber *result = 0 ;
- double arg1 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- arg1 = static_cast< double >(REAL(s_arg1)[0]);
- result = (_THyPhyNumber *)new _THyPhyNumber(arg1);
- r_ans = SWIG_R_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhyNumber, R_SWIG_OWNER | 0 );
-
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig_new__THyPhyNumber__SWIG_1 ( )
-{
- _THyPhyNumber *result = 0 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- result = (_THyPhyNumber *)new _THyPhyNumber();
- r_ans = SWIG_R_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhyNumber, R_SWIG_OWNER | 0 );
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig__THyPhyNumber_myType ( SEXP self, SEXP s_swig_copy)
-{
- int result;
- _THyPhyNumber *arg1 = (_THyPhyNumber *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- res1 = SWIG_R_ConvertPtr(self, &argp1, SWIGTYPE_p__THyPhyNumber, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyNumber_myType" "', argument " "1"" of type '" "_THyPhyNumber *""'");
- }
- arg1 = reinterpret_cast< _THyPhyNumber * >(argp1);
- result = (int)(arg1)->myType();
- r_ans = Rf_ScalarInteger(result);
-
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig_delete__THyPhyNumber ( SEXP self)
-{
- _THyPhyNumber *arg1 = (_THyPhyNumber *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- res1 = SWIG_R_ConvertPtr(self, &argp1, SWIGTYPE_p__THyPhyNumber, SWIG_POINTER_DISOWN | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "delete__THyPhyNumber" "', argument " "1"" of type '" "_THyPhyNumber *""'");
- }
- arg1 = reinterpret_cast< _THyPhyNumber * >(argp1);
- delete arg1;
- r_ans = R_NilValue;
-
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- R_ClearExternalPtr(self);
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig__THyPhyNumber_nValue_set ( SEXP self, SEXP s_nValue)
-{
- _THyPhyNumber *arg1 = (_THyPhyNumber *) 0 ;
- double arg2 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- res1 = SWIG_R_ConvertPtr(self, &argp1, SWIGTYPE_p__THyPhyNumber, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyNumber_nValue_set" "', argument " "1"" of type '" "_THyPhyNumber *""'");
- }
- arg1 = reinterpret_cast< _THyPhyNumber * >(argp1);
- arg2 = static_cast< double >(REAL(s_nValue)[0]);
- if (arg1) (arg1)->nValue = arg2;
- r_ans = R_NilValue;
-
-
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig__THyPhyNumber_nValue_get ( SEXP self, SEXP s_swig_copy)
-{
- double result;
- _THyPhyNumber *arg1 = (_THyPhyNumber *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- res1 = SWIG_R_ConvertPtr(self, &argp1, SWIGTYPE_p__THyPhyNumber, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyNumber_nValue_get" "', argument " "1"" of type '" "_THyPhyNumber *""'");
- }
- arg1 = reinterpret_cast< _THyPhyNumber * >(argp1);
- result = (double) ((arg1)->nValue);
- r_ans = SWIG_From_double(static_cast< double >(result));
-
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig_new__THyPhyMatrix__SWIG_0 ( )
-{
- _THyPhyMatrix *result = 0 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- result = (_THyPhyMatrix *)new _THyPhyMatrix();
- r_ans = SWIG_R_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhyMatrix, R_SWIG_OWNER | 0 );
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig_new__THyPhyMatrix__SWIG_1 ( SEXP s_arg1, SEXP s_arg2, SEXP s_arg3)
-{
- _THyPhyMatrix *result = 0 ;
- long arg1 ;
- long arg2 ;
- double *arg3 = (double *) 0 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- arg1 = static_cast< long >(INTEGER(s_arg1)[0]);
- arg2 = static_cast< long >(INTEGER(s_arg2)[0]);
- {
- {
- int _rswigi;
- int _rswiglen = LENGTH(s_arg3);
- arg3 = static_cast< double * >(calloc(sizeof(double), _rswiglen));
- for (_rswigi=0; _rswigi<_rswiglen; _rswigi++) {
- arg3[_rswigi] = REAL(s_arg3)[_rswigi];
- }
- }
- }
- result = (_THyPhyMatrix *)new _THyPhyMatrix(arg1,arg2,(double const *)arg3);
- r_ans = SWIG_R_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhyMatrix, R_SWIG_OWNER | 0 );
-
-
-
- free(arg3);
-
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig__THyPhyMatrix_myType ( SEXP self, SEXP s_swig_copy)
-{
- int result;
- _THyPhyMatrix *arg1 = (_THyPhyMatrix *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- res1 = SWIG_R_ConvertPtr(self, &argp1, SWIGTYPE_p__THyPhyMatrix, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyMatrix_myType" "', argument " "1"" of type '" "_THyPhyMatrix *""'");
- }
- arg1 = reinterpret_cast< _THyPhyMatrix * >(argp1);
- result = (int)(arg1)->myType();
- r_ans = Rf_ScalarInteger(result);
-
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig_delete__THyPhyMatrix ( SEXP self)
-{
- _THyPhyMatrix *arg1 = (_THyPhyMatrix *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- res1 = SWIG_R_ConvertPtr(self, &argp1, SWIGTYPE_p__THyPhyMatrix, SWIG_POINTER_DISOWN | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "delete__THyPhyMatrix" "', argument " "1"" of type '" "_THyPhyMatrix *""'");
- }
- arg1 = reinterpret_cast< _THyPhyMatrix * >(argp1);
- delete arg1;
- r_ans = R_NilValue;
-
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- R_ClearExternalPtr(self);
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig__THyPhyMatrix_MatrixCell ( SEXP self, SEXP s_arg2, SEXP s_arg3, SEXP s_swig_copy)
-{
- double result;
- _THyPhyMatrix *arg1 = (_THyPhyMatrix *) 0 ;
- long arg2 ;
- long arg3 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- res1 = SWIG_R_ConvertPtr(self, &argp1, SWIGTYPE_p__THyPhyMatrix, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyMatrix_MatrixCell" "', argument " "1"" of type '" "_THyPhyMatrix *""'");
- }
- arg1 = reinterpret_cast< _THyPhyMatrix * >(argp1);
- arg2 = static_cast< long >(INTEGER(s_arg2)[0]);
- arg3 = static_cast< long >(INTEGER(s_arg3)[0]);
- result = (double)(arg1)->MatrixCell(arg2,arg3);
- r_ans = SWIG_From_double(static_cast< double >(result));
-
-
-
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig__THyPhyMatrix_mRows_set ( SEXP self, SEXP s_mRows)
-{
- _THyPhyMatrix *arg1 = (_THyPhyMatrix *) 0 ;
- long arg2 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- res1 = SWIG_R_ConvertPtr(self, &argp1, SWIGTYPE_p__THyPhyMatrix, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyMatrix_mRows_set" "', argument " "1"" of type '" "_THyPhyMatrix *""'");
- }
- arg1 = reinterpret_cast< _THyPhyMatrix * >(argp1);
- arg2 = static_cast< long >(INTEGER(s_mRows)[0]);
- if (arg1) (arg1)->mRows = arg2;
- r_ans = R_NilValue;
-
-
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig__THyPhyMatrix_mRows_get ( SEXP self, SEXP s_swig_copy)
-{
- long result;
- _THyPhyMatrix *arg1 = (_THyPhyMatrix *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- res1 = SWIG_R_ConvertPtr(self, &argp1, SWIGTYPE_p__THyPhyMatrix, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyMatrix_mRows_get" "', argument " "1"" of type '" "_THyPhyMatrix *""'");
- }
- arg1 = reinterpret_cast< _THyPhyMatrix * >(argp1);
- result = (long) ((arg1)->mRows);
- r_ans = Rf_ScalarInteger(result);
-
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig__THyPhyMatrix_mCols_set ( SEXP self, SEXP s_mCols)
-{
- _THyPhyMatrix *arg1 = (_THyPhyMatrix *) 0 ;
- long arg2 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- res1 = SWIG_R_ConvertPtr(self, &argp1, SWIGTYPE_p__THyPhyMatrix, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyMatrix_mCols_set" "', argument " "1"" of type '" "_THyPhyMatrix *""'");
- }
- arg1 = reinterpret_cast< _THyPhyMatrix * >(argp1);
- arg2 = static_cast< long >(INTEGER(s_mCols)[0]);
- if (arg1) (arg1)->mCols = arg2;
- r_ans = R_NilValue;
-
-
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig__THyPhyMatrix_mCols_get ( SEXP self, SEXP s_swig_copy)
-{
- long result;
- _THyPhyMatrix *arg1 = (_THyPhyMatrix *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- res1 = SWIG_R_ConvertPtr(self, &argp1, SWIGTYPE_p__THyPhyMatrix, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyMatrix_mCols_get" "', argument " "1"" of type '" "_THyPhyMatrix *""'");
- }
- arg1 = reinterpret_cast< _THyPhyMatrix * >(argp1);
- result = (long) ((arg1)->mCols);
- r_ans = Rf_ScalarInteger(result);
-
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig__THyPhyMatrix_mData_set ( SEXP self, SEXP s_mData)
-{
- _THyPhyMatrix *arg1 = (_THyPhyMatrix *) 0 ;
- double *arg2 = (double *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- res1 = SWIG_R_ConvertPtr(self, &argp1, SWIGTYPE_p__THyPhyMatrix, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyMatrix_mData_set" "', argument " "1"" of type '" "_THyPhyMatrix *""'");
- }
- arg1 = reinterpret_cast< _THyPhyMatrix * >(argp1);
- {
- {
- int _rswigi;
- int _rswiglen = LENGTH(s_mData);
- arg2 = static_cast< double * >(calloc(sizeof(double), _rswiglen));
- for (_rswigi=0; _rswigi<_rswiglen; _rswigi++) {
- arg2[_rswigi] = REAL(s_mData)[_rswigi];
- }
- }
- }
- if (arg1) (arg1)->mData = arg2;
- r_ans = R_NilValue;
-
-
- free(arg2);
-
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig__THyPhyMatrix_mData_get ( SEXP self)
-{
- double *result = 0 ;
- _THyPhyMatrix *arg1 = (_THyPhyMatrix *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- res1 = SWIG_R_ConvertPtr(self, &argp1, SWIGTYPE_p__THyPhyMatrix, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyMatrix_mData_get" "', argument " "1"" of type '" "_THyPhyMatrix *""'");
- }
- arg1 = reinterpret_cast< _THyPhyMatrix * >(argp1);
- result = (double *) ((arg1)->mData);
- r_ans = SWIG_R_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p_double, R_SWIG_EXTERNAL | 0 );
-
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig_new__THyPhy__SWIG_0 ( SEXP s_arg1, SEXP s_arg2, SEXP s_arg3)
-{
- _THyPhy *result = 0 ;
- _ProgressCancelHandler *arg1 = (_ProgressCancelHandler *) 0 ;
- char *arg2 = (char *) 0 ;
- long arg3 ;
- int res2 ;
- char *buf2 = 0 ;
- int alloc2 = 0 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- {
- int res = SWIG_R_ConvertPtr(s_arg1, (void**)(&arg1), SWIGTYPE_p_f_p_char_int_double__bool, 0);
- if (!SWIG_IsOK(res)) {
- SWIG_exception_fail(SWIG_ArgError(res), "in method '" "new__THyPhy" "', argument " "1"" of type '" "_ProgressCancelHandler *""'");
- }
- }
- res2 = SWIG_AsCharPtrAndSize(s_arg2, &buf2, NULL, &alloc2);
- if (!SWIG_IsOK(res2)) {
- SWIG_exception_fail(SWIG_ArgError(res2), "in method '" "new__THyPhy" "', argument " "2"" of type '" "char const *""'");
- }
- arg2 = reinterpret_cast< char * >(buf2);
- arg3 = static_cast< long >(INTEGER(s_arg3)[0]);
- result = (_THyPhy *)new _THyPhy(arg1,(char const *)arg2,arg3);
- r_ans = SWIG_R_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhy, R_SWIG_OWNER | 0 );
-
- if (alloc2 == SWIG_NEWOBJ) delete[] buf2;
-
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig_new__THyPhy__SWIG_1 ( SEXP s_arg1, SEXP s_arg2)
-{
- _THyPhy *result = 0 ;
- _ProgressCancelHandler *arg1 = (_ProgressCancelHandler *) 0 ;
- char *arg2 = (char *) 0 ;
- int res2 ;
- char *buf2 = 0 ;
- int alloc2 = 0 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- {
- int res = SWIG_R_ConvertPtr(s_arg1, (void**)(&arg1), SWIGTYPE_p_f_p_char_int_double__bool, 0);
- if (!SWIG_IsOK(res)) {
- SWIG_exception_fail(SWIG_ArgError(res), "in method '" "new__THyPhy" "', argument " "1"" of type '" "_ProgressCancelHandler *""'");
- }
- }
- res2 = SWIG_AsCharPtrAndSize(s_arg2, &buf2, NULL, &alloc2);
- if (!SWIG_IsOK(res2)) {
- SWIG_exception_fail(SWIG_ArgError(res2), "in method '" "new__THyPhy" "', argument " "2"" of type '" "char const *""'");
- }
- arg2 = reinterpret_cast< char * >(buf2);
- result = (_THyPhy *)new _THyPhy(arg1,(char const *)arg2);
- r_ans = SWIG_R_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhy, R_SWIG_OWNER | 0 );
-
- if (alloc2 == SWIG_NEWOBJ) delete[] buf2;
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig_new__THyPhy__SWIG_2 ( SEXP s_arg1, SEXP s_arg2)
-{
- _THyPhy *result = 0 ;
- char *arg1 = (char *) 0 ;
- long arg2 ;
- int res1 ;
- char *buf1 = 0 ;
- int alloc1 = 0 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- res1 = SWIG_AsCharPtrAndSize(s_arg1, &buf1, NULL, &alloc1);
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "new__THyPhy" "', argument " "1"" of type '" "char const *""'");
- }
- arg1 = reinterpret_cast< char * >(buf1);
- arg2 = static_cast< long >(INTEGER(s_arg2)[0]);
- result = (_THyPhy *)new _THyPhy((char const *)arg1,arg2);
- r_ans = SWIG_R_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhy, R_SWIG_OWNER | 0 );
- if (alloc1 == SWIG_NEWOBJ) delete[] buf1;
-
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig_new__THyPhy__SWIG_3 ( SEXP s_arg1)
-{
- _THyPhy *result = 0 ;
- char *arg1 = (char *) 0 ;
- int res1 ;
- char *buf1 = 0 ;
- int alloc1 = 0 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- res1 = SWIG_AsCharPtrAndSize(s_arg1, &buf1, NULL, &alloc1);
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "new__THyPhy" "', argument " "1"" of type '" "char const *""'");
- }
- arg1 = reinterpret_cast< char * >(buf1);
- result = (_THyPhy *)new _THyPhy((char const *)arg1);
- r_ans = SWIG_R_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhy, R_SWIG_OWNER | 0 );
- if (alloc1 == SWIG_NEWOBJ) delete[] buf1;
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig_delete__THyPhy ( SEXP self)
-{
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- res1 = SWIG_R_ConvertPtr(self, &argp1, SWIGTYPE_p__THyPhy, SWIG_POINTER_DISOWN | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "delete__THyPhy" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- delete arg1;
- r_ans = R_NilValue;
-
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- R_ClearExternalPtr(self);
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig__THyPhy_ExecuteBF__SWIG_0 ( SEXP self, SEXP s_arg2, SEXP s_arg3)
-{
- _THyPhyString *result = 0 ;
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- char *arg2 = (char *) 0 ;
- bool arg3 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- int res2 ;
- char *buf2 = 0 ;
- int alloc2 = 0 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- res1 = SWIG_R_ConvertPtr(self, &argp1, SWIGTYPE_p__THyPhy, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhy_ExecuteBF" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- res2 = SWIG_AsCharPtrAndSize(s_arg2, &buf2, NULL, &alloc2);
- if (!SWIG_IsOK(res2)) {
- SWIG_exception_fail(SWIG_ArgError(res2), "in method '" "_THyPhy_ExecuteBF" "', argument " "2"" of type '" "char const *""'");
- }
- arg2 = reinterpret_cast< char * >(buf2);
- arg3 = LOGICAL(s_arg3)[0] ? true : false;
- result = (_THyPhyString *)(arg1)->ExecuteBF((char const *)arg2,arg3);
- r_ans = SWIG_R_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhyString, R_SWIG_EXTERNAL | 0 );
-
- if (alloc2 == SWIG_NEWOBJ) delete[] buf2;
-
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig__THyPhy_ExecuteBF__SWIG_1 ( SEXP self, SEXP s_arg2)
-{
- _THyPhyString *result = 0 ;
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- char *arg2 = (char *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- int res2 ;
- char *buf2 = 0 ;
- int alloc2 = 0 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- res1 = SWIG_R_ConvertPtr(self, &argp1, SWIGTYPE_p__THyPhy, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhy_ExecuteBF" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- res2 = SWIG_AsCharPtrAndSize(s_arg2, &buf2, NULL, &alloc2);
- if (!SWIG_IsOK(res2)) {
- SWIG_exception_fail(SWIG_ArgError(res2), "in method '" "_THyPhy_ExecuteBF" "', argument " "2"" of type '" "char const *""'");
- }
- arg2 = reinterpret_cast< char * >(buf2);
- result = (_THyPhyString *)(arg1)->ExecuteBF((char const *)arg2);
- r_ans = SWIG_R_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhyString, R_SWIG_EXTERNAL | 0 );
-
- if (alloc2 == SWIG_NEWOBJ) delete[] buf2;
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig__THyPhy_InitTHyPhy ( SEXP self, SEXP s_arg2, SEXP s_arg3, SEXP s_arg4)
-{
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- _ProgressCancelHandler *arg2 = (_ProgressCancelHandler *) 0 ;
- char *arg3 = (char *) 0 ;
- long arg4 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- int res3 ;
- char *buf3 = 0 ;
- int alloc3 = 0 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- res1 = SWIG_R_ConvertPtr(self, &argp1, SWIGTYPE_p__THyPhy, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhy_InitTHyPhy" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- {
- int res = SWIG_R_ConvertPtr(s_arg2, (void**)(&arg2), SWIGTYPE_p_f_p_char_int_double__bool, 0);
- if (!SWIG_IsOK(res)) {
- SWIG_exception_fail(SWIG_ArgError(res), "in method '" "_THyPhy_InitTHyPhy" "', argument " "2"" of type '" "_ProgressCancelHandler *""'");
- }
- }
- res3 = SWIG_AsCharPtrAndSize(s_arg3, &buf3, NULL, &alloc3);
- if (!SWIG_IsOK(res3)) {
- SWIG_exception_fail(SWIG_ArgError(res3), "in method '" "_THyPhy_InitTHyPhy" "', argument " "3"" of type '" "char const *""'");
- }
- arg3 = reinterpret_cast< char * >(buf3);
- arg4 = static_cast< long >(INTEGER(s_arg4)[0]);
- (arg1)->InitTHyPhy(arg2,(char const *)arg3,arg4);
- r_ans = R_NilValue;
-
-
- if (alloc3 == SWIG_NEWOBJ) delete[] buf3;
-
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig__THyPhy_ClearAll ( SEXP self)
-{
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- res1 = SWIG_R_ConvertPtr(self, &argp1, SWIGTYPE_p__THyPhy, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhy_ClearAll" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- (arg1)->ClearAll();
- r_ans = R_NilValue;
-
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig__THyPhy_AskFor ( SEXP self, SEXP s_arg2)
-{
- void *result = 0 ;
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- char *arg2 = (char *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- int res2 ;
- char *buf2 = 0 ;
- int alloc2 = 0 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- res1 = SWIG_R_ConvertPtr(self, &argp1, SWIGTYPE_p__THyPhy, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhy_AskFor" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- res2 = SWIG_AsCharPtrAndSize(s_arg2, &buf2, NULL, &alloc2);
- if (!SWIG_IsOK(res2)) {
- SWIG_exception_fail(SWIG_ArgError(res2), "in method '" "_THyPhy_AskFor" "', argument " "2"" of type '" "char const *""'");
- }
- arg2 = reinterpret_cast< char * >(buf2);
- result = (void *)(arg1)->AskFor((char const *)arg2);
- r_ans = SWIG_R_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p_void, R_SWIG_EXTERNAL | 0 );
-
- if (alloc2 == SWIG_NEWOBJ) delete[] buf2;
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig__THyPhy_DumpResult ( SEXP self, SEXP s_arg2)
-{
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- void *arg2 = (void *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- int res2 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- res1 = SWIG_R_ConvertPtr(self, &argp1, SWIGTYPE_p__THyPhy, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhy_DumpResult" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- res2 = SWIG_R_ConvertPtr(s_arg2, SWIG_as_voidptrptr(&arg2), 0, 0);
- if (!SWIG_IsOK(res2)) {
- SWIG_exception_fail(SWIG_ArgError(res2), "in method '" "_THyPhy_DumpResult" "', argument " "2"" of type '" "void *""'");
- }
- (arg1)->DumpResult(arg2);
- r_ans = R_NilValue;
-
-
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig__THyPhy_CanCast ( SEXP self, SEXP s_arg2, SEXP s_arg3, SEXP s_swig_copy)
-{
- bool result;
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- void *arg2 = (void *) 0 ;
- int arg3 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- int res2 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- res1 = SWIG_R_ConvertPtr(self, &argp1, SWIGTYPE_p__THyPhy, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhy_CanCast" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- res2 = SWIG_R_ConvertPtr(s_arg2, SWIG_as_voidptrptr(&arg2), 0, 0);
- if (!SWIG_IsOK(res2)) {
- SWIG_exception_fail(SWIG_ArgError(res2), "in method '" "_THyPhy_CanCast" "', argument " "2"" of type '" "void const *""'");
- }
- arg3 = static_cast< int >(INTEGER(s_arg3)[0]);
- result = (bool)(arg1)->CanCast((void const *)arg2,arg3);
- r_ans = Rf_ScalarLogical(result);
-
-
-
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig__THyPhy_CastResult ( SEXP self, SEXP s_arg2, SEXP s_arg3)
-{
- _THyPhyReturnObject *result = 0 ;
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- void *arg2 = (void *) 0 ;
- int arg3 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- int res2 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- res1 = SWIG_R_ConvertPtr(self, &argp1, SWIGTYPE_p__THyPhy, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhy_CastResult" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- res2 = SWIG_R_ConvertPtr(s_arg2, SWIG_as_voidptrptr(&arg2), 0, 0);
- if (!SWIG_IsOK(res2)) {
- SWIG_exception_fail(SWIG_ArgError(res2), "in method '" "_THyPhy_CastResult" "', argument " "2"" of type '" "void const *""'");
- }
- arg3 = static_cast< int >(INTEGER(s_arg3)[0]);
- result = (_THyPhyReturnObject *)(arg1)->CastResult((void const *)arg2,arg3);
- r_ans = SWIG_R_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhyReturnObject, R_SWIG_EXTERNAL | 0 );
-
-
-
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig__THyPhy_SetCallbackHandler ( SEXP self, SEXP s_arg2)
-{
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- _ProgressCancelHandler *arg2 = (_ProgressCancelHandler *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- res1 = SWIG_R_ConvertPtr(self, &argp1, SWIGTYPE_p__THyPhy, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhy_SetCallbackHandler" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- {
- int res = SWIG_R_ConvertPtr(s_arg2, (void**)(&arg2), SWIGTYPE_p_f_p_char_int_double__bool, 0);
- if (!SWIG_IsOK(res)) {
- SWIG_exception_fail(SWIG_ArgError(res), "in method '" "_THyPhy_SetCallbackHandler" "', argument " "2"" of type '" "_ProgressCancelHandler *""'");
- }
- }
- (arg1)->SetCallbackHandler(arg2);
- r_ans = R_NilValue;
-
-
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig__THyPhy_GetCallbackHandler ( SEXP self)
-{
- _ProgressCancelHandler *result = 0 ;
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- res1 = SWIG_R_ConvertPtr(self, &argp1, SWIGTYPE_p__THyPhy, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhy_GetCallbackHandler" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- result = (_ProgressCancelHandler *)(arg1)->GetCallbackHandler();
- r_ans = SWIG_R_NewPointerObj((void *)(result), SWIGTYPE_p_f_p_char_int_double__bool, 0);
-
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig__THyPhy_GetWarnings ( SEXP self)
-{
- _THyPhyString *result = 0 ;
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- res1 = SWIG_R_ConvertPtr(self, &argp1, SWIGTYPE_p__THyPhy, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhy_GetWarnings" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- result = (_THyPhyString *)(arg1)->GetWarnings();
- r_ans = SWIG_R_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhyString, R_SWIG_EXTERNAL | 0 );
-
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig__THyPhy_GetErrors ( SEXP self)
-{
- _THyPhyString *result = 0 ;
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- res1 = SWIG_R_ConvertPtr(self, &argp1, SWIGTYPE_p__THyPhy, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhy_GetErrors" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- result = (_THyPhyString *)(arg1)->GetErrors();
- r_ans = SWIG_R_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhyString, R_SWIG_EXTERNAL | 0 );
-
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig__THyPhy_GetStdout ( SEXP self)
-{
- _THyPhyString *result = 0 ;
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- res1 = SWIG_R_ConvertPtr(self, &argp1, SWIGTYPE_p__THyPhy, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhy_GetStdout" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- result = (_THyPhyString *)(arg1)->GetStdout();
- r_ans = SWIG_R_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhyString, R_SWIG_EXTERNAL | 0 );
-
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig__THyPhy_PushWarning ( SEXP self, SEXP s_arg2)
-{
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- void *arg2 = (void *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- int res2 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- res1 = SWIG_R_ConvertPtr(self, &argp1, SWIGTYPE_p__THyPhy, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhy_PushWarning" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- res2 = SWIG_R_ConvertPtr(s_arg2, SWIG_as_voidptrptr(&arg2), 0, 0);
- if (!SWIG_IsOK(res2)) {
- SWIG_exception_fail(SWIG_ArgError(res2), "in method '" "_THyPhy_PushWarning" "', argument " "2"" of type '" "void *""'");
- }
- (arg1)->PushWarning(arg2);
- r_ans = R_NilValue;
-
-
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig__THyPhy_PushError ( SEXP self, SEXP s_arg2)
-{
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- void *arg2 = (void *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- int res2 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- res1 = SWIG_R_ConvertPtr(self, &argp1, SWIGTYPE_p__THyPhy, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhy_PushError" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- res2 = SWIG_R_ConvertPtr(s_arg2, SWIG_as_voidptrptr(&arg2), 0, 0);
- if (!SWIG_IsOK(res2)) {
- SWIG_exception_fail(SWIG_ArgError(res2), "in method '" "_THyPhy_PushError" "', argument " "2"" of type '" "void *""'");
- }
- (arg1)->PushError(arg2);
- r_ans = R_NilValue;
-
-
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig__THyPhy_PushOutString ( SEXP self, SEXP s_arg2)
-{
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- void *arg2 = (void *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- int res2 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- res1 = SWIG_R_ConvertPtr(self, &argp1, SWIGTYPE_p__THyPhy, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhy_PushOutString" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- res2 = SWIG_R_ConvertPtr(s_arg2, SWIG_as_voidptrptr(&arg2), 0, 0);
- if (!SWIG_IsOK(res2)) {
- SWIG_exception_fail(SWIG_ArgError(res2), "in method '" "_THyPhy_PushOutString" "', argument " "2"" of type '" "void *""'");
- }
- (arg1)->PushOutString(arg2);
- r_ans = R_NilValue;
-
-
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig__THyPhyGetLongStatus ( SEXP s_swig_copy)
-{
- long result;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- result = (long)_THyPhyGetLongStatus();
- r_ans = Rf_ScalarInteger(result);
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig__THyPhyGetStringStatus ( )
-{
- char *result = 0 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- result = (char *)_THyPhyGetStringStatus();
- r_ans = result ? Rf_mkString(reinterpret_cast< char * >(result)) : R_NilValue;
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig__THyPhyGetDoubleStatus ( SEXP s_swig_copy)
-{
- double result;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- result = (double)_THyPhyGetDoubleStatus();
- r_ans = SWIG_From_double(static_cast< double >(result));
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig_globalInterfaceInstance_set ( SEXP s_globalInterfaceInstance)
-{
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- res1 = SWIG_R_ConvertPtr(s_globalInterfaceInstance, &argp1, SWIGTYPE_p__THyPhy, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "globalInterfaceInstance_set" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- globalInterfaceInstance = arg1;
- r_ans = R_NilValue;
-
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-SWIGEXPORT SEXP
-R_swig_globalInterfaceInstance_get ( )
-{
- _THyPhy *result = 0 ;
- unsigned int r_nprotect = 0;
- SEXP r_ans = R_NilValue ;
- VMAXTYPE r_vmax = vmaxget() ;
-
- result = (_THyPhy *)globalInterfaceInstance;
- r_ans = SWIG_R_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhy, R_SWIG_EXTERNAL | 0 );
- vmaxset(r_vmax);
- if(r_nprotect) Rf_unprotect(r_nprotect);
-
- return r_ans;
-}
-
-
-#ifdef __cplusplus
-}
-#endif
-
-/* -------- TYPE CONVERSION AND EQUIVALENCE RULES (BEGIN) -------- */
-
-static void *_p__THyPhyNumberTo_p__THyPhyReturnObject(void *x, int *SWIGUNUSEDPARM(newmemory)) {
- return (void *)((_THyPhyReturnObject *) ((_THyPhyNumber *) x));
-}
-static void *_p__THyPhyMatrixTo_p__THyPhyReturnObject(void *x, int *SWIGUNUSEDPARM(newmemory)) {
- return (void *)((_THyPhyReturnObject *) ((_THyPhyMatrix *) x));
-}
-static void *_p__THyPhyStringTo_p__THyPhyReturnObject(void *x, int *SWIGUNUSEDPARM(newmemory)) {
- return (void *)((_THyPhyReturnObject *) ((_THyPhyString *) x));
-}
-static swig_type_info _swigt__p__THyPhy = {"_p__THyPhy", "_THyPhy *", 0, 0, (void*)0, 0};
-static swig_type_info _swigt__p__THyPhyMatrix = {"_p__THyPhyMatrix", "_THyPhyMatrix *", 0, 0, (void*)0, 0};
-static swig_type_info _swigt__p__THyPhyNumber = {"_p__THyPhyNumber", "_THyPhyNumber *", 0, 0, (void*)0, 0};
-static swig_type_info _swigt__p__THyPhyReturnObject = {"_p__THyPhyReturnObject", "_THyPhyReturnObject *", 0, 0, (void*)0, 0};
-static swig_type_info _swigt__p__THyPhyString = {"_p__THyPhyString", "_THyPhyString *", 0, 0, (void*)0, 0};
-static swig_type_info _swigt__p_char = {"_p_char", "char *", 0, 0, (void*)0, 0};
-static swig_type_info _swigt__p_double = {"_p_double", "double *", 0, 0, (void*)0, 0};
-static swig_type_info _swigt__p_f_p_char_int_double__bool = {"_p_f_p_char_int_double__bool", "_ProgressCancelHandler *|bool (*)(char *,int,double)", 0, 0, (void*)0, 0};
-static swig_type_info _swigt__p_void = {"_p_void", "void *", 0, 0, (void*)0, 0};
-
-static swig_type_info *swig_type_initial[] = {
- &_swigt__p__THyPhy,
- &_swigt__p__THyPhyMatrix,
- &_swigt__p__THyPhyNumber,
- &_swigt__p__THyPhyReturnObject,
- &_swigt__p__THyPhyString,
- &_swigt__p_char,
- &_swigt__p_double,
- &_swigt__p_f_p_char_int_double__bool,
- &_swigt__p_void,
-};
-
-static swig_cast_info _swigc__p__THyPhy[] = { {&_swigt__p__THyPhy, 0, 0, 0},{0, 0, 0, 0}};
-static swig_cast_info _swigc__p__THyPhyMatrix[] = { {&_swigt__p__THyPhyMatrix, 0, 0, 0},{0, 0, 0, 0}};
-static swig_cast_info _swigc__p__THyPhyNumber[] = { {&_swigt__p__THyPhyNumber, 0, 0, 0},{0, 0, 0, 0}};
-static swig_cast_info _swigc__p__THyPhyReturnObject[] = { {&_swigt__p__THyPhyReturnObject, 0, 0, 0}, {&_swigt__p__THyPhyNumber, _p__THyPhyNumberTo_p__THyPhyReturnObject, 0, 0}, {&_swigt__p__THyPhyMatrix, _p__THyPhyMatrixTo_p__THyPhyReturnObject, 0, 0}, {&_swigt__p__THyPhyString, _p__THyPhyStringTo_p__THyPhyReturnObject, 0, 0},{0, 0, 0, 0}};
-static swig_cast_info _swigc__p__THyPhyString[] = { {&_swigt__p__THyPhyString, 0, 0, 0},{0, 0, 0, 0}};
-static swig_cast_info _swigc__p_char[] = { {&_swigt__p_char, 0, 0, 0},{0, 0, 0, 0}};
-static swig_cast_info _swigc__p_double[] = { {&_swigt__p_double, 0, 0, 0},{0, 0, 0, 0}};
-static swig_cast_info _swigc__p_f_p_char_int_double__bool[] = { {&_swigt__p_f_p_char_int_double__bool, 0, 0, 0},{0, 0, 0, 0}};
-static swig_cast_info _swigc__p_void[] = { {&_swigt__p_void, 0, 0, 0},{0, 0, 0, 0}};
-
-static swig_cast_info *swig_cast_initial[] = {
- _swigc__p__THyPhy,
- _swigc__p__THyPhyMatrix,
- _swigc__p__THyPhyNumber,
- _swigc__p__THyPhyReturnObject,
- _swigc__p__THyPhyString,
- _swigc__p_char,
- _swigc__p_double,
- _swigc__p_f_p_char_int_double__bool,
- _swigc__p_void,
-};
-
-
-/* -------- TYPE CONVERSION AND EQUIVALENCE RULES (END) -------- */
-
-
-/* -----------------------------------------------------------------------------
- * Type initialization:
- * This problem is tough by the requirement that no dynamic
- * memory is used. Also, since swig_type_info structures store pointers to
- * swig_cast_info structures and swig_cast_info structures store pointers back
- * to swig_type_info structures, we need some lookup code at initialization.
- * The idea is that swig generates all the structures that are needed.
- * The runtime then collects these partially filled structures.
- * The SWIG_InitializeModule function takes these initial arrays out of
- * swig_module, and does all the lookup, filling in the swig_module.types
- * array with the correct data and linking the correct swig_cast_info
- * structures together.
- *
- * The generated swig_type_info structures are assigned staticly to an initial
- * array. We just loop through that array, and handle each type individually.
- * First we lookup if this type has been already loaded, and if so, use the
- * loaded structure instead of the generated one. Then we have to fill in the
- * cast linked list. The cast data is initially stored in something like a
- * two-dimensional array. Each row corresponds to a type (there are the same
- * number of rows as there are in the swig_type_initial array). Each entry in
- * a column is one of the swig_cast_info structures for that type.
- * The cast_initial array is actually an array of arrays, because each row has
- * a variable number of columns. So to actually build the cast linked list,
- * we find the array of casts associated with the type, and loop through it
- * adding the casts to the list. The one last trick we need to do is making
- * sure the type pointer in the swig_cast_info struct is correct.
- *
- * First off, we lookup the cast->type name to see if it is already loaded.
- * There are three cases to handle:
- * 1) If the cast->type has already been loaded AND the type we are adding
- * casting info to has not been loaded (it is in this module), THEN we
- * replace the cast->type pointer with the type pointer that has already
- * been loaded.
- * 2) If BOTH types (the one we are adding casting info to, and the
- * cast->type) are loaded, THEN the cast info has already been loaded by
- * the previous module so we just ignore it.
- * 3) Finally, if cast->type has not already been loaded, then we add that
- * swig_cast_info to the linked list (because the cast->type) pointer will
- * be correct.
- * ----------------------------------------------------------------------------- */
-
-#ifdef __cplusplus
-extern "C" {
-#if 0
-} /* c-mode */
-#endif
-#endif
-
-#if 0
-#define SWIGRUNTIME_DEBUG
-#endif
-
-
-SWIGRUNTIME void
-SWIG_InitializeModule(void *clientdata) {
- size_t i;
- swig_module_info *module_head, *iter;
- int found, init;
-
- clientdata = clientdata;
-
- /* check to see if the circular list has been setup, if not, set it up */
- if (swig_module.next==0) {
- /* Initialize the swig_module */
- swig_module.type_initial = swig_type_initial;
- swig_module.cast_initial = swig_cast_initial;
- swig_module.next = &swig_module;
- init = 1;
- } else {
- init = 0;
- }
-
- /* Try and load any already created modules */
- module_head = SWIG_GetModule(clientdata);
- if (!module_head) {
- /* This is the first module loaded for this interpreter */
- /* so set the swig module into the interpreter */
- SWIG_SetModule(clientdata, &swig_module);
- module_head = &swig_module;
- } else {
- /* the interpreter has loaded a SWIG module, but has it loaded this one? */
- found=0;
- iter=module_head;
- do {
- if (iter==&swig_module) {
- found=1;
- break;
- }
- iter=iter->next;
- } while (iter!= module_head);
-
- /* if the is found in the list, then all is done and we may leave */
- if (found) return;
- /* otherwise we must add out module into the list */
- swig_module.next = module_head->next;
- module_head->next = &swig_module;
- }
-
- /* When multiple interpeters are used, a module could have already been initialized in
- a different interpreter, but not yet have a pointer in this interpreter.
- In this case, we do not want to continue adding types... everything should be
- set up already */
- if (init == 0) return;
-
- /* Now work on filling in swig_module.types */
-#ifdef SWIGRUNTIME_DEBUG
- printf("SWIG_InitializeModule: size %d\n", swig_module.size);
-#endif
- for (i = 0; i < swig_module.size; ++i) {
- swig_type_info *type = 0;
- swig_type_info *ret;
- swig_cast_info *cast;
-
-#ifdef SWIGRUNTIME_DEBUG
- printf("SWIG_InitializeModule: type %d %s\n", i, swig_module.type_initial[i]->name);
-#endif
-
- /* if there is another module already loaded */
- if (swig_module.next != &swig_module) {
- type = SWIG_MangledTypeQueryModule(swig_module.next, &swig_module, swig_module.type_initial[i]->name);
- }
- if (type) {
- /* Overwrite clientdata field */
-#ifdef SWIGRUNTIME_DEBUG
- printf("SWIG_InitializeModule: found type %s\n", type->name);
-#endif
- if (swig_module.type_initial[i]->clientdata) {
- type->clientdata = swig_module.type_initial[i]->clientdata;
-#ifdef SWIGRUNTIME_DEBUG
- printf("SWIG_InitializeModule: found and overwrite type %s \n", type->name);
-#endif
- }
- } else {
- type = swig_module.type_initial[i];
- }
-
- /* Insert casting types */
- cast = swig_module.cast_initial[i];
- while (cast->type) {
-
- /* Don't need to add information already in the list */
- ret = 0;
-#ifdef SWIGRUNTIME_DEBUG
- printf("SWIG_InitializeModule: look cast %s\n", cast->type->name);
-#endif
- if (swig_module.next != &swig_module) {
- ret = SWIG_MangledTypeQueryModule(swig_module.next, &swig_module, cast->type->name);
-#ifdef SWIGRUNTIME_DEBUG
- if (ret) printf("SWIG_InitializeModule: found cast %s\n", ret->name);
-#endif
- }
- if (ret) {
- if (type == swig_module.type_initial[i]) {
-#ifdef SWIGRUNTIME_DEBUG
- printf("SWIG_InitializeModule: skip old type %s\n", ret->name);
-#endif
- cast->type = ret;
- ret = 0;
- } else {
- /* Check for casting already in the list */
- swig_cast_info *ocast = SWIG_TypeCheck(ret->name, type);
-#ifdef SWIGRUNTIME_DEBUG
- if (ocast) printf("SWIG_InitializeModule: skip old cast %s\n", ret->name);
-#endif
- if (!ocast) ret = 0;
- }
- }
-
- if (!ret) {
-#ifdef SWIGRUNTIME_DEBUG
- printf("SWIG_InitializeModule: adding cast %s\n", cast->type->name);
-#endif
- if (type->cast) {
- type->cast->prev = cast;
- cast->next = type->cast;
- }
- type->cast = cast;
- }
- cast++;
- }
- /* Set entry in modules->types array equal to the type */
- swig_module.types[i] = type;
- }
- swig_module.types[i] = 0;
-
-#ifdef SWIGRUNTIME_DEBUG
- printf("**** SWIG_InitializeModule: Cast List ******\n");
- for (i = 0; i < swig_module.size; ++i) {
- int j = 0;
- swig_cast_info *cast = swig_module.cast_initial[i];
- printf("SWIG_InitializeModule: type %d %s\n", i, swig_module.type_initial[i]->name);
- while (cast->type) {
- printf("SWIG_InitializeModule: cast type %s\n", cast->type->name);
- cast++;
- ++j;
- }
- printf("---- Total casts: %d\n",j);
- }
- printf("**** SWIG_InitializeModule: Cast List ******\n");
-#endif
-}
-
-/* This function will propagate the clientdata field of type to
-* any new swig_type_info structures that have been added into the list
-* of equivalent types. It is like calling
-* SWIG_TypeClientData(type, clientdata) a second time.
-*/
-SWIGRUNTIME void
-SWIG_PropagateClientData(void) {
- size_t i;
- swig_cast_info *equiv;
- static int init_run = 0;
-
- if (init_run) return;
- init_run = 1;
-
- for (i = 0; i < swig_module.size; i++) {
- if (swig_module.types[i]->clientdata) {
- equiv = swig_module.types[i]->cast;
- while (equiv) {
- if (!equiv->converter) {
- if (equiv->type && !equiv->type->clientdata)
- SWIG_TypeClientData(equiv->type, swig_module.types[i]->clientdata);
- }
- equiv = equiv->next;
- }
- }
- }
-}
-
-#ifdef __cplusplus
-#if 0
-{ /* c-mode */
-#endif
-}
-#endif
-
-
-SWIGEXPORT void SWIG_init(void) {
-
-}
-#ifdef __cplusplus
-extern "C" {
-#endif
-
-#include <R_ext/Rdynload.h>
-
-#ifdef __cplusplus
-}
-#endif
-
-SWIGINTERN R_CallMethodDef CallEntries[] = {
- {"R_swig_new__THyPhy__SWIG_1", (DL_FUNC) &R_swig_new__THyPhy__SWIG_1, 2},
- {"R_swig_new__THyPhyMatrix__SWIG_1", (DL_FUNC) &R_swig_new__THyPhyMatrix__SWIG_1, 3},
- {"R_swig_new__THyPhyNumber__SWIG_1", (DL_FUNC) &R_swig_new__THyPhyNumber__SWIG_1, 0},
- {"R_swig_new__THyPhyString__SWIG_1", (DL_FUNC) &R_swig_new__THyPhyString__SWIG_1, 1},
- {"R_swig__THyPhy_ExecuteBF__SWIG_1", (DL_FUNC) &R_swig__THyPhy_ExecuteBF__SWIG_1, 2},
- {"R_swig__THyPhyGetLongStatus", (DL_FUNC) &R_swig__THyPhyGetLongStatus, 1},
- {"R_swig__THyPhyGetStringStatus", (DL_FUNC) &R_swig__THyPhyGetStringStatus, 0},
- {"R_swig__THyPhyGetDoubleStatus", (DL_FUNC) &R_swig__THyPhyGetDoubleStatus, 1},
- {"R_swig_delete__THyPhyMatrix", (DL_FUNC) &R_swig_delete__THyPhyMatrix, 1},
- {"R_swig__THyPhyReturnObject_castToMatrix", (DL_FUNC) &R_swig__THyPhyReturnObject_castToMatrix, 1},
- {"R_swig_new__THyPhy__SWIG_2", (DL_FUNC) &R_swig_new__THyPhy__SWIG_2, 2},
- {"R_swig_new__THyPhyString__SWIG_2", (DL_FUNC) &R_swig_new__THyPhyString__SWIG_2, 0},
- {"R_swig_new__THyPhy__SWIG_3", (DL_FUNC) &R_swig_new__THyPhy__SWIG_3, 1},
- {"R_swig__THyPhyMatrix_mRows_get", (DL_FUNC) &R_swig__THyPhyMatrix_mRows_get, 2},
- {"R_swig_globalInterfaceInstance_get", (DL_FUNC) &R_swig_globalInterfaceInstance_get, 0},
- {"R_swig__THyPhyMatrix_mCols_get", (DL_FUNC) &R_swig__THyPhyMatrix_mCols_get, 2},
- {"R_swig__THyPhy_GetStdout", (DL_FUNC) &R_swig__THyPhy_GetStdout, 1},
- {"R_swig__THyPhyMatrix_mRows_set", (DL_FUNC) &R_swig__THyPhyMatrix_mRows_set, 2},
- {"R_swig_globalInterfaceInstance_set", (DL_FUNC) &R_swig_globalInterfaceInstance_set, 1},
- {"R_swig__THyPhyMatrix_mCols_set", (DL_FUNC) &R_swig__THyPhyMatrix_mCols_set, 2},
- {"R_swig__THyPhy_AskFor", (DL_FUNC) &R_swig__THyPhy_AskFor, 2},
- {"R_swig__THyPhyMatrix_MatrixCell", (DL_FUNC) &R_swig__THyPhyMatrix_MatrixCell, 4},
- {"R_swig_delete__THyPhyReturnObject", (DL_FUNC) &R_swig_delete__THyPhyReturnObject, 1},
- {"R_swig__THyPhy_CanCast", (DL_FUNC) &R_swig__THyPhy_CanCast, 4},
- {"R_swig__THyPhyMatrix_mData_get", (DL_FUNC) &R_swig__THyPhyMatrix_mData_get, 1},
- {"R_swig__THyPhyString_sData_get", (DL_FUNC) &R_swig__THyPhyString_sData_get, 1},
- {"R_swig__THyPhy_PushWarning", (DL_FUNC) &R_swig__THyPhy_PushWarning, 2},
- {"R_swig__THyPhy_PushOutString", (DL_FUNC) &R_swig__THyPhy_PushOutString, 2},
- {"R_swig__THyPhyMatrix_myType", (DL_FUNC) &R_swig__THyPhyMatrix_myType, 2},
- {"R_swig__THyPhyNumber_myType", (DL_FUNC) &R_swig__THyPhyNumber_myType, 2},
- {"R_swig__THyPhyReturnObject_myType", (DL_FUNC) &R_swig__THyPhyReturnObject_myType, 2},
- {"R_swig__THyPhyString_myType", (DL_FUNC) &R_swig__THyPhyString_myType, 2},
- {"R_swig__THyPhy_InitTHyPhy", (DL_FUNC) &R_swig__THyPhy_InitTHyPhy, 4},
- {"R_swig__THyPhy_SetCallbackHandler", (DL_FUNC) &R_swig__THyPhy_SetCallbackHandler, 2},
- {"R_swig__THyPhy_GetCallbackHandler", (DL_FUNC) &R_swig__THyPhy_GetCallbackHandler, 1},
- {"R_swig__THyPhyMatrix_mData_set", (DL_FUNC) &R_swig__THyPhyMatrix_mData_set, 2},
- {"R_swig__THyPhyString_sData_set", (DL_FUNC) &R_swig__THyPhyString_sData_set, 2},
- {"R_swig_delete__THyPhyNumber", (DL_FUNC) &R_swig_delete__THyPhyNumber, 1},
- {"R_swig__THyPhyReturnObject_castToNumber", (DL_FUNC) &R_swig__THyPhyReturnObject_castToNumber, 1},
- {"R_swig__THyPhy_ClearAll", (DL_FUNC) &R_swig__THyPhy_ClearAll, 1},
- {"R_swig__THyPhy_GetWarnings", (DL_FUNC) &R_swig__THyPhy_GetWarnings, 1},
- {"R_swig__THyPhyString_sLength_get", (DL_FUNC) &R_swig__THyPhyString_sLength_get, 2},
- {"R_swig__THyPhyReturnObject_castToString", (DL_FUNC) &R_swig__THyPhyReturnObject_castToString, 1},
- {"R_swig_delete__THyPhyString", (DL_FUNC) &R_swig_delete__THyPhyString, 1},
- {"R_swig__THyPhyString_sLength_set", (DL_FUNC) &R_swig__THyPhyString_sLength_set, 2},
- {"R_swig_delete__THyPhy", (DL_FUNC) &R_swig_delete__THyPhy, 1},
- {"R_swig__THyPhy_PushError", (DL_FUNC) &R_swig__THyPhy_PushError, 2},
- {"R_swig__THyPhyNumber_nValue_get", (DL_FUNC) &R_swig__THyPhyNumber_nValue_get, 2},
- {"R_swig__THyPhy_DumpResult", (DL_FUNC) &R_swig__THyPhy_DumpResult, 2},
- {"R_swig__THyPhy_CastResult", (DL_FUNC) &R_swig__THyPhy_CastResult, 3},
- {"R_swig__THyPhy_GetErrors", (DL_FUNC) &R_swig__THyPhy_GetErrors, 1},
- {"R_swig_new__THyPhy__SWIG_0", (DL_FUNC) &R_swig_new__THyPhy__SWIG_0, 3},
- {"R_swig_new__THyPhyMatrix__SWIG_0", (DL_FUNC) &R_swig_new__THyPhyMatrix__SWIG_0, 0},
- {"R_swig_new__THyPhyNumber__SWIG_0", (DL_FUNC) &R_swig_new__THyPhyNumber__SWIG_0, 1},
- {"R_swig_new__THyPhyString__SWIG_0", (DL_FUNC) &R_swig_new__THyPhyString__SWIG_0, 2},
- {"R_swig__THyPhyNumber_nValue_set", (DL_FUNC) &R_swig__THyPhyNumber_nValue_set, 2},
- {"R_swig__THyPhy_ExecuteBF__SWIG_0", (DL_FUNC) &R_swig__THyPhy_ExecuteBF__SWIG_0, 3},
- {NULL, NULL, 0}
-};
-
-extern "C" SWIGEXPORT void R_init_HyPhy(DllInfo *dll) {
- R_registerRoutines(dll, NULL, CallEntries, NULL, NULL);
-
-
-SWIG_init();
-SWIG_InitializeModule(0);
-
-
-}
-
diff --git a/src/lib/SWIGWrappers/THyPhy_py3.cpp b/src/lib/SWIGWrappers/THyPhy_py3.cpp
deleted file mode 100644
index 1d2120a..0000000
--- a/src/lib/SWIGWrappers/THyPhy_py3.cpp
+++ /dev/null
@@ -1,7440 +0,0 @@
-/* ----------------------------------------------------------------------------
- * This file was automatically generated by SWIG (http://www.swig.org).
- * Version 2.0.4
- *
- * This file is not intended to be easily readable and contains a number of
- * coding conventions designed to improve portability and efficiency. Do not make
- * changes to this file unless you know what you are doing--modify the SWIG
- * interface file instead.
- * ----------------------------------------------------------------------------- */
-
-#define SWIGPYTHON
-#define SWIG_PYTHON_DIRECTOR_NO_VTABLE
-#define SWIGPYTHON_BUILTIN
-
-
-#ifdef __cplusplus
-/* SwigValueWrapper is described in swig.swg */
-template<typename T> class SwigValueWrapper {
- struct SwigMovePointer {
- T *ptr;
- SwigMovePointer(T *p) : ptr(p) { }
- ~SwigMovePointer() { delete ptr; }
- SwigMovePointer& operator=(SwigMovePointer& rhs) { T* oldptr = ptr; ptr = 0; delete oldptr; ptr = rhs.ptr; rhs.ptr = 0; return *this; }
- } pointer;
- SwigValueWrapper& operator=(const SwigValueWrapper<T>& rhs);
- SwigValueWrapper(const SwigValueWrapper<T>& rhs);
-public:
- SwigValueWrapper() : pointer(0) { }
- SwigValueWrapper& operator=(const T& t) { SwigMovePointer tmp(new T(t)); pointer = tmp; return *this; }
- operator T&() const { return *pointer.ptr; }
- T *operator&() { return pointer.ptr; }
-};
-
-template <typename T> T SwigValueInit() {
- return T();
-}
-#endif
-
-/* -----------------------------------------------------------------------------
- * This section contains generic SWIG labels for method/variable
- * declarations/attributes, and other compiler dependent labels.
- * ----------------------------------------------------------------------------- */
-
-/* template workaround for compilers that cannot correctly implement the C++ standard */
-#ifndef SWIGTEMPLATEDISAMBIGUATOR
-# if defined(__SUNPRO_CC) && (__SUNPRO_CC <= 0x560)
-# define SWIGTEMPLATEDISAMBIGUATOR template
-# elif defined(__HP_aCC)
-/* Needed even with `aCC -AA' when `aCC -V' reports HP ANSI C++ B3910B A.03.55 */
-/* If we find a maximum version that requires this, the test would be __HP_aCC <= 35500 for A.03.55 */
-# define SWIGTEMPLATEDISAMBIGUATOR template
-# else
-# define SWIGTEMPLATEDISAMBIGUATOR
-# endif
-#endif
-
-/* inline attribute */
-#ifndef SWIGINLINE
-# if defined(__cplusplus) || (defined(__GNUC__) && !defined(__STRICT_ANSI__))
-# define SWIGINLINE inline
-# else
-# define SWIGINLINE
-# endif
-#endif
-
-/* attribute recognised by some compilers to avoid 'unused' warnings */
-#ifndef SWIGUNUSED
-# if defined(__GNUC__)
-# if !(defined(__cplusplus)) || (__GNUC__ > 3 || (__GNUC__ == 3 && __GNUC_MINOR__ >= 4))
-# define SWIGUNUSED __attribute__ ((__unused__))
-# else
-# define SWIGUNUSED
-# endif
-# elif defined(__ICC)
-# define SWIGUNUSED __attribute__ ((__unused__))
-# else
-# define SWIGUNUSED
-# endif
-#endif
-
-#ifndef SWIG_MSC_UNSUPPRESS_4505
-# if defined(_MSC_VER)
-# pragma warning(disable : 4505) /* unreferenced local function has been removed */
-# endif
-#endif
-
-#ifndef SWIGUNUSEDPARM
-# ifdef __cplusplus
-# define SWIGUNUSEDPARM(p)
-# else
-# define SWIGUNUSEDPARM(p) p SWIGUNUSED
-# endif
-#endif
-
-/* internal SWIG method */
-#ifndef SWIGINTERN
-# define SWIGINTERN static SWIGUNUSED
-#endif
-
-/* internal inline SWIG method */
-#ifndef SWIGINTERNINLINE
-# define SWIGINTERNINLINE SWIGINTERN SWIGINLINE
-#endif
-
-/* exporting methods */
-#if (__GNUC__ >= 4) || (__GNUC__ == 3 && __GNUC_MINOR__ >= 4)
-# ifndef GCC_HASCLASSVISIBILITY
-# define GCC_HASCLASSVISIBILITY
-# endif
-#endif
-
-#ifndef SWIGEXPORT
-# if defined(_WIN32) || defined(__WIN32__) || defined(__CYGWIN__)
-# if defined(STATIC_LINKED)
-# define SWIGEXPORT
-# else
-# define SWIGEXPORT __declspec(dllexport)
-# endif
-# else
-# if defined(__GNUC__) && defined(GCC_HASCLASSVISIBILITY)
-# define SWIGEXPORT __attribute__ ((visibility("default")))
-# else
-# define SWIGEXPORT
-# endif
-# endif
-#endif
-
-/* calling conventions for Windows */
-#ifndef SWIGSTDCALL
-# if defined(_WIN32) || defined(__WIN32__) || defined(__CYGWIN__)
-# define SWIGSTDCALL __stdcall
-# else
-# define SWIGSTDCALL
-# endif
-#endif
-
-/* Deal with Microsoft's attempt at deprecating C standard runtime functions */
-#if !defined(SWIG_NO_CRT_SECURE_NO_DEPRECATE) && defined(_MSC_VER) && !defined(_CRT_SECURE_NO_DEPRECATE)
-# define _CRT_SECURE_NO_DEPRECATE
-#endif
-
-/* Deal with Microsoft's attempt at deprecating methods in the standard C++ library */
-#if !defined(SWIG_NO_SCL_SECURE_NO_DEPRECATE) && defined(_MSC_VER) && !defined(_SCL_SECURE_NO_DEPRECATE)
-# define _SCL_SECURE_NO_DEPRECATE
-#endif
-
-
-
-/* Python.h has to appear first */
-#include <Python.h>
-
-/* -----------------------------------------------------------------------------
- * swigrun.swg
- *
- * This file contains generic C API SWIG runtime support for pointer
- * type checking.
- * ----------------------------------------------------------------------------- */
-
-/* This should only be incremented when either the layout of swig_type_info changes,
- or for whatever reason, the runtime changes incompatibly */
-#define SWIG_RUNTIME_VERSION "4"
-
-/* define SWIG_TYPE_TABLE_NAME as "SWIG_TYPE_TABLE" */
-#ifdef SWIG_TYPE_TABLE
-# define SWIG_QUOTE_STRING(x) #x
-# define SWIG_EXPAND_AND_QUOTE_STRING(x) SWIG_QUOTE_STRING(x)
-# define SWIG_TYPE_TABLE_NAME SWIG_EXPAND_AND_QUOTE_STRING(SWIG_TYPE_TABLE)
-#else
-# define SWIG_TYPE_TABLE_NAME
-#endif
-
-/*
- You can use the SWIGRUNTIME and SWIGRUNTIMEINLINE macros for
- creating a static or dynamic library from the SWIG runtime code.
- In 99.9% of the cases, SWIG just needs to declare them as 'static'.
-
- But only do this if strictly necessary, ie, if you have problems
- with your compiler or suchlike.
-*/
-
-#ifndef SWIGRUNTIME
-# define SWIGRUNTIME SWIGINTERN
-#endif
-
-#ifndef SWIGRUNTIMEINLINE
-# define SWIGRUNTIMEINLINE SWIGRUNTIME SWIGINLINE
-#endif
-
-/* Generic buffer size */
-#ifndef SWIG_BUFFER_SIZE
-# define SWIG_BUFFER_SIZE 1024
-#endif
-
-/* Flags for pointer conversions */
-#define SWIG_POINTER_DISOWN 0x1
-#define SWIG_CAST_NEW_MEMORY 0x2
-
-/* Flags for new pointer objects */
-#define SWIG_POINTER_OWN 0x1
-
-
-/*
- Flags/methods for returning states.
-
- The SWIG conversion methods, as ConvertPtr, return an integer
- that tells if the conversion was successful or not. And if not,
- an error code can be returned (see swigerrors.swg for the codes).
-
- Use the following macros/flags to set or process the returning
- states.
-
- In old versions of SWIG, code such as the following was usually written:
-
- if (SWIG_ConvertPtr(obj,vptr,ty.flags) != -1) {
- // success code
- } else {
- //fail code
- }
-
- Now you can be more explicit:
-
- int res = SWIG_ConvertPtr(obj,vptr,ty.flags);
- if (SWIG_IsOK(res)) {
- // success code
- } else {
- // fail code
- }
-
- which is the same really, but now you can also do
-
- Type *ptr;
- int res = SWIG_ConvertPtr(obj,(void **)(&ptr),ty.flags);
- if (SWIG_IsOK(res)) {
- // success code
- if (SWIG_IsNewObj(res) {
- ...
- delete *ptr;
- } else {
- ...
- }
- } else {
- // fail code
- }
-
- I.e., now SWIG_ConvertPtr can return new objects and you can
- identify the case and take care of the deallocation. Of course that
- also requires SWIG_ConvertPtr to return new result values, such as
-
- int SWIG_ConvertPtr(obj, ptr,...) {
- if (<obj is ok>) {
- if (<need new object>) {
- *ptr = <ptr to new allocated object>;
- return SWIG_NEWOBJ;
- } else {
- *ptr = <ptr to old object>;
- return SWIG_OLDOBJ;
- }
- } else {
- return SWIG_BADOBJ;
- }
- }
-
- Of course, returning the plain '0(success)/-1(fail)' still works, but you can be
- more explicit by returning SWIG_BADOBJ, SWIG_ERROR or any of the
- SWIG errors code.
-
- Finally, if the SWIG_CASTRANK_MODE is enabled, the result code
- allows to return the 'cast rank', for example, if you have this
-
- int food(double)
- int fooi(int);
-
- and you call
-
- food(1) // cast rank '1' (1 -> 1.0)
- fooi(1) // cast rank '0'
-
- just use the SWIG_AddCast()/SWIG_CheckState()
-*/
-
-#define SWIG_OK (0)
-#define SWIG_ERROR (-1)
-#define SWIG_IsOK(r) (r >= 0)
-#define SWIG_ArgError(r) ((r != SWIG_ERROR) ? r : SWIG_TypeError)
-
-/* The CastRankLimit says how many bits are used for the cast rank */
-#define SWIG_CASTRANKLIMIT (1 << 8)
-/* The NewMask denotes the object was created (using new/malloc) */
-#define SWIG_NEWOBJMASK (SWIG_CASTRANKLIMIT << 1)
-/* The TmpMask is for in/out typemaps that use temporal objects */
-#define SWIG_TMPOBJMASK (SWIG_NEWOBJMASK << 1)
-/* Simple returning values */
-#define SWIG_BADOBJ (SWIG_ERROR)
-#define SWIG_OLDOBJ (SWIG_OK)
-#define SWIG_NEWOBJ (SWIG_OK | SWIG_NEWOBJMASK)
-#define SWIG_TMPOBJ (SWIG_OK | SWIG_TMPOBJMASK)
-/* Check, add and del mask methods */
-#define SWIG_AddNewMask(r) (SWIG_IsOK(r) ? (r | SWIG_NEWOBJMASK) : r)
-#define SWIG_DelNewMask(r) (SWIG_IsOK(r) ? (r & ~SWIG_NEWOBJMASK) : r)
-#define SWIG_IsNewObj(r) (SWIG_IsOK(r) && (r & SWIG_NEWOBJMASK))
-#define SWIG_AddTmpMask(r) (SWIG_IsOK(r) ? (r | SWIG_TMPOBJMASK) : r)
-#define SWIG_DelTmpMask(r) (SWIG_IsOK(r) ? (r & ~SWIG_TMPOBJMASK) : r)
-#define SWIG_IsTmpObj(r) (SWIG_IsOK(r) && (r & SWIG_TMPOBJMASK))
-
-/* Cast-Rank Mode */
-#if defined(SWIG_CASTRANK_MODE)
-# ifndef SWIG_TypeRank
-# define SWIG_TypeRank unsigned long
-# endif
-# ifndef SWIG_MAXCASTRANK /* Default cast allowed */
-# define SWIG_MAXCASTRANK (2)
-# endif
-# define SWIG_CASTRANKMASK ((SWIG_CASTRANKLIMIT) -1)
-# define SWIG_CastRank(r) (r & SWIG_CASTRANKMASK)
-SWIGINTERNINLINE int SWIG_AddCast(int r) {
- return SWIG_IsOK(r) ? ((SWIG_CastRank(r) < SWIG_MAXCASTRANK) ? (r + 1) : SWIG_ERROR) : r;
-}
-SWIGINTERNINLINE int SWIG_CheckState(int r) {
- return SWIG_IsOK(r) ? SWIG_CastRank(r) + 1 : 0;
-}
-#else /* no cast-rank mode */
-# define SWIG_AddCast
-# define SWIG_CheckState(r) (SWIG_IsOK(r) ? 1 : 0)
-#endif
-
-
-#include <string.h>
-
-#ifdef __cplusplus
-extern "C" {
-#endif
-
-typedef void *(*swig_converter_func)(void *, int *);
-typedef struct swig_type_info *(*swig_dycast_func)(void **);
-
-/* Structure to store information on one type */
-typedef struct swig_type_info {
- const char *name; /* mangled name of this type */
- const char *str; /* human readable name of this type */
- swig_dycast_func dcast; /* dynamic cast function down a hierarchy */
- struct swig_cast_info *cast; /* linked list of types that can cast into this type */
- void *clientdata; /* language specific type data */
- int owndata; /* flag if the structure owns the clientdata */
-} swig_type_info;
-
-/* Structure to store a type and conversion function used for casting */
-typedef struct swig_cast_info {
- swig_type_info *type; /* pointer to type that is equivalent to this type */
- swig_converter_func converter; /* function to cast the void pointers */
- struct swig_cast_info *next; /* pointer to next cast in linked list */
- struct swig_cast_info *prev; /* pointer to the previous cast */
-} swig_cast_info;
-
-/* Structure used to store module information
- * Each module generates one structure like this, and the runtime collects
- * all of these structures and stores them in a circularly linked list.*/
-typedef struct swig_module_info {
- swig_type_info **types; /* Array of pointers to swig_type_info structures that are in this module */
- size_t size; /* Number of types in this module */
- struct swig_module_info *next; /* Pointer to next element in circularly linked list */
- swig_type_info **type_initial; /* Array of initially generated type structures */
- swig_cast_info **cast_initial; /* Array of initially generated casting structures */
- void *clientdata; /* Language specific module data */
-} swig_module_info;
-
-/*
- Compare two type names skipping the space characters, therefore
- "char*" == "char *" and "Class<int>" == "Class<int >", etc.
-
- Return 0 when the two name types are equivalent, as in
- strncmp, but skipping ' '.
-*/
-SWIGRUNTIME int
-SWIG_TypeNameComp(const char *f1, const char *l1,
- const char *f2, const char *l2) {
- for (;(f1 != l1) && (f2 != l2); ++f1, ++f2) {
- while ((*f1 == ' ') && (f1 != l1)) ++f1;
- while ((*f2 == ' ') && (f2 != l2)) ++f2;
- if (*f1 != *f2) return (*f1 > *f2) ? 1 : -1;
- }
- return (int)((l1 - f1) - (l2 - f2));
-}
-
-/*
- Check type equivalence in a name list like <name1>|<name2>|...
- Return 0 if not equal, 1 if equal
-*/
-SWIGRUNTIME int
-SWIG_TypeEquiv(const char *nb, const char *tb) {
- int equiv = 0;
- const char* te = tb + strlen(tb);
- const char* ne = nb;
- while (!equiv && *ne) {
- for (nb = ne; *ne; ++ne) {
- if (*ne == '|') break;
- }
- equiv = (SWIG_TypeNameComp(nb, ne, tb, te) == 0) ? 1 : 0;
- if (*ne) ++ne;
- }
- return equiv;
-}
-
-/*
- Check type equivalence in a name list like <name1>|<name2>|...
- Return 0 if equal, -1 if nb < tb, 1 if nb > tb
-*/
-SWIGRUNTIME int
-SWIG_TypeCompare(const char *nb, const char *tb) {
- int equiv = 0;
- const char* te = tb + strlen(tb);
- const char* ne = nb;
- while (!equiv && *ne) {
- for (nb = ne; *ne; ++ne) {
- if (*ne == '|') break;
- }
- equiv = (SWIG_TypeNameComp(nb, ne, tb, te) == 0) ? 1 : 0;
- if (*ne) ++ne;
- }
- return equiv;
-}
-
-
-/*
- Check the typename
-*/
-SWIGRUNTIME swig_cast_info *
-SWIG_TypeCheck(const char *c, swig_type_info *ty) {
- if (ty) {
- swig_cast_info *iter = ty->cast;
- while (iter) {
- if (strcmp(iter->type->name, c) == 0) {
- if (iter == ty->cast)
- return iter;
- /* Move iter to the top of the linked list */
- iter->prev->next = iter->next;
- if (iter->next)
- iter->next->prev = iter->prev;
- iter->next = ty->cast;
- iter->prev = 0;
- if (ty->cast) ty->cast->prev = iter;
- ty->cast = iter;
- return iter;
- }
- iter = iter->next;
- }
- }
- return 0;
-}
-
-/*
- Identical to SWIG_TypeCheck, except strcmp is replaced with a pointer comparison
-*/
-SWIGRUNTIME swig_cast_info *
-SWIG_TypeCheckStruct(swig_type_info *from, swig_type_info *ty) {
- if (ty) {
- swig_cast_info *iter = ty->cast;
- while (iter) {
- if (iter->type == from) {
- if (iter == ty->cast)
- return iter;
- /* Move iter to the top of the linked list */
- iter->prev->next = iter->next;
- if (iter->next)
- iter->next->prev = iter->prev;
- iter->next = ty->cast;
- iter->prev = 0;
- if (ty->cast) ty->cast->prev = iter;
- ty->cast = iter;
- return iter;
- }
- iter = iter->next;
- }
- }
- return 0;
-}
-
-/*
- Cast a pointer up an inheritance hierarchy
-*/
-SWIGRUNTIMEINLINE void *
-SWIG_TypeCast(swig_cast_info *ty, void *ptr, int *newmemory) {
- return ((!ty) || (!ty->converter)) ? ptr : (*ty->converter)(ptr, newmemory);
-}
-
-/*
- Dynamic pointer casting. Down an inheritance hierarchy
-*/
-SWIGRUNTIME swig_type_info *
-SWIG_TypeDynamicCast(swig_type_info *ty, void **ptr) {
- swig_type_info *lastty = ty;
- if (!ty || !ty->dcast) return ty;
- while (ty && (ty->dcast)) {
- ty = (*ty->dcast)(ptr);
- if (ty) lastty = ty;
- }
- return lastty;
-}
-
-/*
- Return the name associated with this type
-*/
-SWIGRUNTIMEINLINE const char *
-SWIG_TypeName(const swig_type_info *ty) {
- return ty->name;
-}
-
-/*
- Return the pretty name associated with this type,
- that is an unmangled type name in a form presentable to the user.
-*/
-SWIGRUNTIME const char *
-SWIG_TypePrettyName(const swig_type_info *type) {
- /* The "str" field contains the equivalent pretty names of the
- type, separated by vertical-bar characters. We choose
- to print the last name, as it is often (?) the most
- specific. */
- if (!type) return NULL;
- if (type->str != NULL) {
- const char *last_name = type->str;
- const char *s;
- for (s = type->str; *s; s++)
- if (*s == '|') last_name = s+1;
- return last_name;
- }
- else
- return type->name;
-}
-
-/*
- Set the clientdata field for a type
-*/
-SWIGRUNTIME void
-SWIG_TypeClientData(swig_type_info *ti, void *clientdata) {
- swig_cast_info *cast = ti->cast;
- /* if (ti->clientdata == clientdata) return; */
- ti->clientdata = clientdata;
-
- while (cast) {
- if (!cast->converter) {
- swig_type_info *tc = cast->type;
- if (!tc->clientdata) {
- SWIG_TypeClientData(tc, clientdata);
- }
- }
- cast = cast->next;
- }
-}
-SWIGRUNTIME void
-SWIG_TypeNewClientData(swig_type_info *ti, void *clientdata) {
- SWIG_TypeClientData(ti, clientdata);
- ti->owndata = 1;
-}
-
-/*
- Search for a swig_type_info structure only by mangled name
- Search is a O(log #types)
-
- We start searching at module start, and finish searching when start == end.
- Note: if start == end at the beginning of the function, we go all the way around
- the circular list.
-*/
-SWIGRUNTIME swig_type_info *
-SWIG_MangledTypeQueryModule(swig_module_info *start,
- swig_module_info *end,
- const char *name) {
- swig_module_info *iter = start;
- do {
- if (iter->size) {
- register size_t l = 0;
- register size_t r = iter->size - 1;
- do {
- /* since l+r >= 0, we can (>> 1) instead (/ 2) */
- register size_t i = (l + r) >> 1;
- const char *iname = iter->types[i]->name;
- if (iname) {
- register int compare = strcmp(name, iname);
- if (compare == 0) {
- return iter->types[i];
- } else if (compare < 0) {
- if (i) {
- r = i - 1;
- } else {
- break;
- }
- } else if (compare > 0) {
- l = i + 1;
- }
- } else {
- break; /* should never happen */
- }
- } while (l <= r);
- }
- iter = iter->next;
- } while (iter != end);
- return 0;
-}
-
-/*
- Search for a swig_type_info structure for either a mangled name or a human readable name.
- It first searches the mangled names of the types, which is a O(log #types)
- If a type is not found it then searches the human readable names, which is O(#types).
-
- We start searching at module start, and finish searching when start == end.
- Note: if start == end at the beginning of the function, we go all the way around
- the circular list.
-*/
-SWIGRUNTIME swig_type_info *
-SWIG_TypeQueryModule(swig_module_info *start,
- swig_module_info *end,
- const char *name) {
- /* STEP 1: Search the name field using binary search */
- swig_type_info *ret = SWIG_MangledTypeQueryModule(start, end, name);
- if (ret) {
- return ret;
- } else {
- /* STEP 2: If the type hasn't been found, do a complete search
- of the str field (the human readable name) */
- swig_module_info *iter = start;
- do {
- register size_t i = 0;
- for (; i < iter->size; ++i) {
- if (iter->types[i]->str && (SWIG_TypeEquiv(iter->types[i]->str, name)))
- return iter->types[i];
- }
- iter = iter->next;
- } while (iter != end);
- }
-
- /* neither found a match */
- return 0;
-}
-
-/*
- Pack binary data into a string
-*/
-SWIGRUNTIME char *
-SWIG_PackData(char *c, void *ptr, size_t sz) {
- static const char hex[17] = "0123456789abcdef";
- register const unsigned char *u = (unsigned char *) ptr;
- register const unsigned char *eu = u + sz;
- for (; u != eu; ++u) {
- register unsigned char uu = *u;
- *(c++) = hex[(uu & 0xf0) >> 4];
- *(c++) = hex[uu & 0xf];
- }
- return c;
-}
-
-/*
- Unpack binary data from a string
-*/
-SWIGRUNTIME const char *
-SWIG_UnpackData(const char *c, void *ptr, size_t sz) {
- register unsigned char *u = (unsigned char *) ptr;
- register const unsigned char *eu = u + sz;
- for (; u != eu; ++u) {
- register char d = *(c++);
- register unsigned char uu;
- if ((d >= '0') && (d <= '9'))
- uu = ((d - '0') << 4);
- else if ((d >= 'a') && (d <= 'f'))
- uu = ((d - ('a'-10)) << 4);
- else
- return (char *) 0;
- d = *(c++);
- if ((d >= '0') && (d <= '9'))
- uu |= (d - '0');
- else if ((d >= 'a') && (d <= 'f'))
- uu |= (d - ('a'-10));
- else
- return (char *) 0;
- *u = uu;
- }
- return c;
-}
-
-/*
- Pack 'void *' into a string buffer.
-*/
-SWIGRUNTIME char *
-SWIG_PackVoidPtr(char *buff, void *ptr, const char *name, size_t bsz) {
- char *r = buff;
- if ((2*sizeof(void *) + 2) > bsz) return 0;
- *(r++) = '_';
- r = SWIG_PackData(r,&ptr,sizeof(void *));
- if (strlen(name) + 1 > (bsz - (r - buff))) return 0;
- strcpy(r,name);
- return buff;
-}
-
-SWIGRUNTIME const char *
-SWIG_UnpackVoidPtr(const char *c, void **ptr, const char *name) {
- if (*c != '_') {
- if (strcmp(c,"NULL") == 0) {
- *ptr = (void *) 0;
- return name;
- } else {
- return 0;
- }
- }
- return SWIG_UnpackData(++c,ptr,sizeof(void *));
-}
-
-SWIGRUNTIME char *
-SWIG_PackDataName(char *buff, void *ptr, size_t sz, const char *name, size_t bsz) {
- char *r = buff;
- size_t lname = (name ? strlen(name) : 0);
- if ((2*sz + 2 + lname) > bsz) return 0;
- *(r++) = '_';
- r = SWIG_PackData(r,ptr,sz);
- if (lname) {
- strncpy(r,name,lname+1);
- } else {
- *r = 0;
- }
- return buff;
-}
-
-SWIGRUNTIME const char *
-SWIG_UnpackDataName(const char *c, void *ptr, size_t sz, const char *name) {
- if (*c != '_') {
- if (strcmp(c,"NULL") == 0) {
- memset(ptr,0,sz);
- return name;
- } else {
- return 0;
- }
- }
- return SWIG_UnpackData(++c,ptr,sz);
-}
-
-#ifdef __cplusplus
-}
-#endif
-
-/* Errors in SWIG */
-#define SWIG_UnknownError -1
-#define SWIG_IOError -2
-#define SWIG_RuntimeError -3
-#define SWIG_IndexError -4
-#define SWIG_TypeError -5
-#define SWIG_DivisionByZero -6
-#define SWIG_OverflowError -7
-#define SWIG_SyntaxError -8
-#define SWIG_ValueError -9
-#define SWIG_SystemError -10
-#define SWIG_AttributeError -11
-#define SWIG_MemoryError -12
-#define SWIG_NullReferenceError -13
-
-
-
-/* Compatibility macros for Python 3 */
-#if PY_VERSION_HEX >= 0x03000000
-
-#define PyClass_Check(obj) PyObject_IsInstance(obj, (PyObject *)&PyType_Type)
-#define PyInt_Check(x) PyLong_Check(x)
-#define PyInt_AsLong(x) PyLong_AsLong(x)
-#define PyInt_FromLong(x) PyLong_FromLong(x)
-#define PyString_Check(name) PyBytes_Check(name)
-#define PyString_FromString(x) PyUnicode_FromString(x)
-#define PyString_Format(fmt, args) PyUnicode_Format(fmt, args)
-#define PyString_AsString(str) PyBytes_AsString(str)
-#define PyString_Size(str) PyBytes_Size(str)
-#define PyString_InternFromString(key) PyUnicode_InternFromString(key)
-#define Py_TPFLAGS_HAVE_CLASS Py_TPFLAGS_BASETYPE
-#define PyString_AS_STRING(x) PyUnicode_AS_STRING(x)
-#define _PyLong_FromSsize_t(x) PyLong_FromSsize_t(x)
-
-#endif
-
-#ifndef Py_TYPE
-# define Py_TYPE(op) ((op)->ob_type)
-#endif
-
-/* SWIG APIs for compatibility of both Python 2 & 3 */
-
-#if PY_VERSION_HEX >= 0x03000000
-# define SWIG_Python_str_FromFormat PyUnicode_FromFormat
-#else
-# define SWIG_Python_str_FromFormat PyString_FromFormat
-#endif
-
-
-/* Warning: This function will allocate a new string in Python 3,
- * so please call SWIG_Python_str_DelForPy3(x) to free the space.
- */
-SWIGINTERN char*
-SWIG_Python_str_AsChar(PyObject *str)
-{
-#if PY_VERSION_HEX >= 0x03000000
- char *cstr;
- char *newstr;
- Py_ssize_t len;
- str = PyUnicode_AsUTF8String(str);
- PyBytes_AsStringAndSize(str, &cstr, &len);
- newstr = (char *) malloc(len+1);
- memcpy(newstr, cstr, len+1);
- Py_XDECREF(str);
- return newstr;
-#else
- return PyString_AsString(str);
-#endif
-}
-
-#if PY_VERSION_HEX >= 0x03000000
-# define SWIG_Python_str_DelForPy3(x) free( (void*) (x) )
-#else
-# define SWIG_Python_str_DelForPy3(x)
-#endif
-
-
-SWIGINTERN PyObject*
-SWIG_Python_str_FromChar(const char *c)
-{
-#if PY_VERSION_HEX >= 0x03000000
- return PyUnicode_FromString(c);
-#else
- return PyString_FromString(c);
-#endif
-}
-
-/* Add PyOS_snprintf for old Pythons */
-#if PY_VERSION_HEX < 0x02020000
-# if defined(_MSC_VER) || defined(__BORLANDC__) || defined(_WATCOM)
-# define PyOS_snprintf _snprintf
-# else
-# define PyOS_snprintf snprintf
-# endif
-#endif
-
-/* A crude PyString_FromFormat implementation for old Pythons */
-#if PY_VERSION_HEX < 0x02020000
-
-#ifndef SWIG_PYBUFFER_SIZE
-# define SWIG_PYBUFFER_SIZE 1024
-#endif
-
-static PyObject *
-PyString_FromFormat(const char *fmt, ...) {
- va_list ap;
- char buf[SWIG_PYBUFFER_SIZE * 2];
- int res;
- va_start(ap, fmt);
- res = vsnprintf(buf, sizeof(buf), fmt, ap);
- va_end(ap);
- return (res < 0 || res >= (int)sizeof(buf)) ? 0 : PyString_FromString(buf);
-}
-#endif
-
-/* Add PyObject_Del for old Pythons */
-#if PY_VERSION_HEX < 0x01060000
-# define PyObject_Del(op) PyMem_DEL((op))
-#endif
-#ifndef PyObject_DEL
-# define PyObject_DEL PyObject_Del
-#endif
-
-/* A crude PyExc_StopIteration exception for old Pythons */
-#if PY_VERSION_HEX < 0x02020000
-# ifndef PyExc_StopIteration
-# define PyExc_StopIteration PyExc_RuntimeError
-# endif
-# ifndef PyObject_GenericGetAttr
-# define PyObject_GenericGetAttr 0
-# endif
-#endif
-
-/* Py_NotImplemented is defined in 2.1 and up. */
-#if PY_VERSION_HEX < 0x02010000
-# ifndef Py_NotImplemented
-# define Py_NotImplemented PyExc_RuntimeError
-# endif
-#endif
-
-/* A crude PyString_AsStringAndSize implementation for old Pythons */
-#if PY_VERSION_HEX < 0x02010000
-# ifndef PyString_AsStringAndSize
-# define PyString_AsStringAndSize(obj, s, len) {*s = PyString_AsString(obj); *len = *s ? strlen(*s) : 0;}
-# endif
-#endif
-
-/* PySequence_Size for old Pythons */
-#if PY_VERSION_HEX < 0x02000000
-# ifndef PySequence_Size
-# define PySequence_Size PySequence_Length
-# endif
-#endif
-
-/* PyBool_FromLong for old Pythons */
-#if PY_VERSION_HEX < 0x02030000
-static
-PyObject *PyBool_FromLong(long ok)
-{
- PyObject *result = ok ? Py_True : Py_False;
- Py_INCREF(result);
- return result;
-}
-#endif
-
-/* Py_ssize_t for old Pythons */
-/* This code is as recommended by: */
-/* http://www.python.org/dev/peps/pep-0353/#conversion-guidelines */
-#if PY_VERSION_HEX < 0x02050000 && !defined(PY_SSIZE_T_MIN)
-typedef int Py_ssize_t;
-# define PY_SSIZE_T_MAX INT_MAX
-# define PY_SSIZE_T_MIN INT_MIN
-typedef inquiry lenfunc;
-typedef intargfunc ssizeargfunc;
-typedef intintargfunc ssizessizeargfunc;
-typedef intobjargproc ssizeobjargproc;
-typedef intintobjargproc ssizessizeobjargproc;
-typedef getreadbufferproc readbufferproc;
-typedef getwritebufferproc writebufferproc;
-typedef getsegcountproc segcountproc;
-typedef getcharbufferproc charbufferproc;
-static long PyNumber_AsSsize_t (PyObject *x, void *SWIGUNUSEDPARM(exc))
-{
- long result = 0;
- PyObject *i = PyNumber_Int(x);
- if (i) {
- result = PyInt_AsLong(i);
- Py_DECREF(i);
- }
- return result;
-}
-#endif
-
-#if PY_VERSION_HEX < 0x02040000
-#define Py_VISIT(op) \
- do { \
- if (op) { \
- int vret = visit((op), arg); \
- if (vret) \
- return vret; \
- } \
- } while (0)
-#endif
-
-#if PY_VERSION_HEX < 0x02030000
-typedef struct {
- PyTypeObject type;
- PyNumberMethods as_number;
- PyMappingMethods as_mapping;
- PySequenceMethods as_sequence;
- PyBufferProcs as_buffer;
- PyObject *name, *slots;
-} PyHeapTypeObject;
-#endif
-
-#if PY_VERSION_HEX < 0x02030000
-typedef destructor freefunc;
-#endif
-
-#if ((PY_MAJOR_VERSION == 2 && PY_MINOR_VERSION > 6) || \
- (PY_MAJOR_VERSION == 3 && PY_MINOR_VERSION > 0) || \
- (PY_MAJOR_VERSION > 3))
-# define SWIGPY_USE_CAPSULE
-# define SWIGPY_CAPSULE_NAME ((char*)"swig_runtime_data" SWIG_RUNTIME_VERSION ".type_pointer_capsule" SWIG_TYPE_TABLE_NAME)
-#endif
-
-#if PY_VERSION_HEX < 0x03020000
-#define PyDescr_TYPE(x) (((PyDescrObject *)(x))->d_type)
-#define PyDescr_NAME(x) (((PyDescrObject *)(x))->d_name)
-#endif
-
-/* -----------------------------------------------------------------------------
- * error manipulation
- * ----------------------------------------------------------------------------- */
-
-SWIGRUNTIME PyObject*
-SWIG_Python_ErrorType(int code) {
- PyObject* type = 0;
- switch(code) {
- case SWIG_MemoryError:
- type = PyExc_MemoryError;
- break;
- case SWIG_IOError:
- type = PyExc_IOError;
- break;
- case SWIG_RuntimeError:
- type = PyExc_RuntimeError;
- break;
- case SWIG_IndexError:
- type = PyExc_IndexError;
- break;
- case SWIG_TypeError:
- type = PyExc_TypeError;
- break;
- case SWIG_DivisionByZero:
- type = PyExc_ZeroDivisionError;
- break;
- case SWIG_OverflowError:
- type = PyExc_OverflowError;
- break;
- case SWIG_SyntaxError:
- type = PyExc_SyntaxError;
- break;
- case SWIG_ValueError:
- type = PyExc_ValueError;
- break;
- case SWIG_SystemError:
- type = PyExc_SystemError;
- break;
- case SWIG_AttributeError:
- type = PyExc_AttributeError;
- break;
- default:
- type = PyExc_RuntimeError;
- }
- return type;
-}
-
-
-SWIGRUNTIME void
-SWIG_Python_AddErrorMsg(const char* mesg)
-{
- PyObject *type = 0;
- PyObject *value = 0;
- PyObject *traceback = 0;
-
- if (PyErr_Occurred()) PyErr_Fetch(&type, &value, &traceback);
- if (value) {
- char *tmp;
- PyObject *old_str = PyObject_Str(value);
- PyErr_Clear();
- Py_XINCREF(type);
-
- PyErr_Format(type, "%s %s", tmp = SWIG_Python_str_AsChar(old_str), mesg);
- SWIG_Python_str_DelForPy3(tmp);
- Py_DECREF(old_str);
- Py_DECREF(value);
- } else {
- PyErr_SetString(PyExc_RuntimeError, mesg);
- }
-}
-
-#if defined(SWIG_PYTHON_NO_THREADS)
-# if defined(SWIG_PYTHON_THREADS)
-# undef SWIG_PYTHON_THREADS
-# endif
-#endif
-#if defined(SWIG_PYTHON_THREADS) /* Threading support is enabled */
-# if !defined(SWIG_PYTHON_USE_GIL) && !defined(SWIG_PYTHON_NO_USE_GIL)
-# if (PY_VERSION_HEX >= 0x02030000) /* For 2.3 or later, use the PyGILState calls */
-# define SWIG_PYTHON_USE_GIL
-# endif
-# endif
-# if defined(SWIG_PYTHON_USE_GIL) /* Use PyGILState threads calls */
-# ifndef SWIG_PYTHON_INITIALIZE_THREADS
-# define SWIG_PYTHON_INITIALIZE_THREADS PyEval_InitThreads()
-# endif
-# ifdef __cplusplus /* C++ code */
- class SWIG_Python_Thread_Block {
- bool status;
- PyGILState_STATE state;
- public:
- void end() { if (status) { PyGILState_Release(state); status = false;} }
- SWIG_Python_Thread_Block() : status(true), state(PyGILState_Ensure()) {}
- ~SWIG_Python_Thread_Block() { end(); }
- };
- class SWIG_Python_Thread_Allow {
- bool status;
- PyThreadState *save;
- public:
- void end() { if (status) { PyEval_RestoreThread(save); status = false; }}
- SWIG_Python_Thread_Allow() : status(true), save(PyEval_SaveThread()) {}
- ~SWIG_Python_Thread_Allow() { end(); }
- };
-# define SWIG_PYTHON_THREAD_BEGIN_BLOCK SWIG_Python_Thread_Block _swig_thread_block
-# define SWIG_PYTHON_THREAD_END_BLOCK _swig_thread_block.end()
-# define SWIG_PYTHON_THREAD_BEGIN_ALLOW SWIG_Python_Thread_Allow _swig_thread_allow
-# define SWIG_PYTHON_THREAD_END_ALLOW _swig_thread_allow.end()
-# else /* C code */
-# define SWIG_PYTHON_THREAD_BEGIN_BLOCK PyGILState_STATE _swig_thread_block = PyGILState_Ensure()
-# define SWIG_PYTHON_THREAD_END_BLOCK PyGILState_Release(_swig_thread_block)
-# define SWIG_PYTHON_THREAD_BEGIN_ALLOW PyThreadState *_swig_thread_allow = PyEval_SaveThread()
-# define SWIG_PYTHON_THREAD_END_ALLOW PyEval_RestoreThread(_swig_thread_allow)
-# endif
-# else /* Old thread way, not implemented, user must provide it */
-# if !defined(SWIG_PYTHON_INITIALIZE_THREADS)
-# define SWIG_PYTHON_INITIALIZE_THREADS
-# endif
-# if !defined(SWIG_PYTHON_THREAD_BEGIN_BLOCK)
-# define SWIG_PYTHON_THREAD_BEGIN_BLOCK
-# endif
-# if !defined(SWIG_PYTHON_THREAD_END_BLOCK)
-# define SWIG_PYTHON_THREAD_END_BLOCK
-# endif
-# if !defined(SWIG_PYTHON_THREAD_BEGIN_ALLOW)
-# define SWIG_PYTHON_THREAD_BEGIN_ALLOW
-# endif
-# if !defined(SWIG_PYTHON_THREAD_END_ALLOW)
-# define SWIG_PYTHON_THREAD_END_ALLOW
-# endif
-# endif
-#else /* No thread support */
-# define SWIG_PYTHON_INITIALIZE_THREADS
-# define SWIG_PYTHON_THREAD_BEGIN_BLOCK
-# define SWIG_PYTHON_THREAD_END_BLOCK
-# define SWIG_PYTHON_THREAD_BEGIN_ALLOW
-# define SWIG_PYTHON_THREAD_END_ALLOW
-#endif
-
-/* -----------------------------------------------------------------------------
- * Python API portion that goes into the runtime
- * ----------------------------------------------------------------------------- */
-
-#ifdef __cplusplus
-extern "C" {
-#endif
-
-/* -----------------------------------------------------------------------------
- * Constant declarations
- * ----------------------------------------------------------------------------- */
-
-/* Constant Types */
-#define SWIG_PY_POINTER 4
-#define SWIG_PY_BINARY 5
-
-/* Constant information structure */
-typedef struct swig_const_info {
- int type;
- char *name;
- long lvalue;
- double dvalue;
- void *pvalue;
- swig_type_info **ptype;
-} swig_const_info;
-
-
-/* -----------------------------------------------------------------------------
- * Wrapper of PyInstanceMethod_New() used in Python 3
- * It is exported to the generated module, used for -fastproxy
- * ----------------------------------------------------------------------------- */
-#if PY_VERSION_HEX >= 0x03000000
-SWIGRUNTIME PyObject* SWIG_PyInstanceMethod_New(PyObject *SWIGUNUSEDPARM(self), PyObject *func)
-{
- return PyInstanceMethod_New(func);
-}
-#else
-SWIGRUNTIME PyObject* SWIG_PyInstanceMethod_New(PyObject *SWIGUNUSEDPARM(self), PyObject *SWIGUNUSEDPARM(func))
-{
- return NULL;
-}
-#endif
-
-#ifdef __cplusplus
-}
-#endif
-
-
-/* -----------------------------------------------------------------------------
- * pyrun.swg
- *
- * This file contains the runtime support for Python modules
- * and includes code for managing global variables and pointer
- * type checking.
- *
- * ----------------------------------------------------------------------------- */
-
-/* Common SWIG API */
-
-/* for raw pointers */
-#define SWIG_Python_ConvertPtr(obj, pptr, type, flags) SWIG_Python_ConvertPtrAndOwn(obj, pptr, type, flags, 0)
-#define SWIG_ConvertPtr(obj, pptr, type, flags) SWIG_Python_ConvertPtr(obj, pptr, type, flags)
-#define SWIG_ConvertPtrAndOwn(obj,pptr,type,flags,own) SWIG_Python_ConvertPtrAndOwn(obj, pptr, type, flags, own)
-
-#ifdef SWIGPYTHON_BUILTIN
-#define SWIG_NewPointerObj(ptr, type, flags) SWIG_Python_NewPointerObj(self, ptr, type, flags)
-#else
-#define SWIG_NewPointerObj(ptr, type, flags) SWIG_Python_NewPointerObj(NULL, ptr, type, flags)
-#endif
-
-#define SWIG_InternalNewPointerObj(ptr, type, flags) SWIG_Python_NewPointerObj(NULL, ptr, type, flags)
-
-#define SWIG_CheckImplicit(ty) SWIG_Python_CheckImplicit(ty)
-#define SWIG_AcquirePtr(ptr, src) SWIG_Python_AcquirePtr(ptr, src)
-#define swig_owntype int
-
-/* for raw packed data */
-#define SWIG_ConvertPacked(obj, ptr, sz, ty) SWIG_Python_ConvertPacked(obj, ptr, sz, ty)
-#define SWIG_NewPackedObj(ptr, sz, type) SWIG_Python_NewPackedObj(ptr, sz, type)
-
-/* for class or struct pointers */
-#define SWIG_ConvertInstance(obj, pptr, type, flags) SWIG_ConvertPtr(obj, pptr, type, flags)
-#define SWIG_NewInstanceObj(ptr, type, flags) SWIG_NewPointerObj(ptr, type, flags)
-
-/* for C or C++ function pointers */
-#define SWIG_ConvertFunctionPtr(obj, pptr, type) SWIG_Python_ConvertFunctionPtr(obj, pptr, type)
-#define SWIG_NewFunctionPtrObj(ptr, type) SWIG_Python_NewPointerObj(NULL, ptr, type, 0)
-
-/* for C++ member pointers, ie, member methods */
-#define SWIG_ConvertMember(obj, ptr, sz, ty) SWIG_Python_ConvertPacked(obj, ptr, sz, ty)
-#define SWIG_NewMemberObj(ptr, sz, type) SWIG_Python_NewPackedObj(ptr, sz, type)
-
-
-/* Runtime API */
-
-#define SWIG_GetModule(clientdata) SWIG_Python_GetModule()
-#define SWIG_SetModule(clientdata, pointer) SWIG_Python_SetModule(pointer)
-#define SWIG_NewClientData(obj) SwigPyClientData_New(obj)
-
-#define SWIG_SetErrorObj SWIG_Python_SetErrorObj
-#define SWIG_SetErrorMsg SWIG_Python_SetErrorMsg
-#define SWIG_ErrorType(code) SWIG_Python_ErrorType(code)
-#define SWIG_Error(code, msg) SWIG_Python_SetErrorMsg(SWIG_ErrorType(code), msg)
-#define SWIG_fail goto fail
-
-
-/* Runtime API implementation */
-
-/* Error manipulation */
-
-SWIGINTERN void
-SWIG_Python_SetErrorObj(PyObject *errtype, PyObject *obj) {
- SWIG_PYTHON_THREAD_BEGIN_BLOCK;
- PyErr_SetObject(errtype, obj);
- Py_DECREF(obj);
- SWIG_PYTHON_THREAD_END_BLOCK;
-}
-
-SWIGINTERN void
-SWIG_Python_SetErrorMsg(PyObject *errtype, const char *msg) {
- SWIG_PYTHON_THREAD_BEGIN_BLOCK;
- PyErr_SetString(errtype, (char *) msg);
- SWIG_PYTHON_THREAD_END_BLOCK;
-}
-
-#define SWIG_Python_Raise(obj, type, desc) SWIG_Python_SetErrorObj(SWIG_Python_ExceptionType(desc), obj)
-
-/* Set a constant value */
-
-#if defined(SWIGPYTHON_BUILTIN)
-
-SWIGINTERN void
-SwigPyBuiltin_AddPublicSymbol(PyObject *seq, const char *key) {
- PyObject *s = PyString_InternFromString(key);
- PyList_Append(seq, s);
- Py_DECREF(s);
-}
-
-SWIGINTERN void
-SWIG_Python_SetConstant(PyObject *d, PyObject *public_interface, const char *name, PyObject *obj) {
- PyDict_SetItemString(d, (char *)name, obj);
- Py_DECREF(obj);
- if (public_interface)
- SwigPyBuiltin_AddPublicSymbol(public_interface, name);
-}
-
-#else
-
-SWIGINTERN void
-SWIG_Python_SetConstant(PyObject *d, const char *name, PyObject *obj) {
- PyDict_SetItemString(d, (char *)name, obj);
- Py_DECREF(obj);
-}
-
-#endif
-
-/* Append a value to the result obj */
-
-SWIGINTERN PyObject*
-SWIG_Python_AppendOutput(PyObject* result, PyObject* obj) {
-#if !defined(SWIG_PYTHON_OUTPUT_TUPLE)
- if (!result) {
- result = obj;
- } else if (result == Py_None) {
- Py_DECREF(result);
- result = obj;
- } else {
- if (!PyList_Check(result)) {
- PyObject *o2 = result;
- result = PyList_New(1);
- PyList_SetItem(result, 0, o2);
- }
- PyList_Append(result,obj);
- Py_DECREF(obj);
- }
- return result;
-#else
- PyObject* o2;
- PyObject* o3;
- if (!result) {
- result = obj;
- } else if (result == Py_None) {
- Py_DECREF(result);
- result = obj;
- } else {
- if (!PyTuple_Check(result)) {
- o2 = result;
- result = PyTuple_New(1);
- PyTuple_SET_ITEM(result, 0, o2);
- }
- o3 = PyTuple_New(1);
- PyTuple_SET_ITEM(o3, 0, obj);
- o2 = result;
- result = PySequence_Concat(o2, o3);
- Py_DECREF(o2);
- Py_DECREF(o3);
- }
- return result;
-#endif
-}
-
-/* Unpack the argument tuple */
-
-SWIGINTERN int
-SWIG_Python_UnpackTuple(PyObject *args, const char *name, Py_ssize_t min, Py_ssize_t max, PyObject **objs)
-{
- if (!args) {
- if (!min && !max) {
- return 1;
- } else {
- PyErr_Format(PyExc_TypeError, "%s expected %s%d arguments, got none",
- name, (min == max ? "" : "at least "), (int)min);
- return 0;
- }
- }
- if (!PyTuple_Check(args)) {
- if (min <= 1 && max >= 1) {
- register int i;
- objs[0] = args;
- for (i = 1; i < max; ++i) {
- objs[i] = 0;
- }
- return 2;
- }
- PyErr_SetString(PyExc_SystemError, "UnpackTuple() argument list is not a tuple");
- return 0;
- } else {
- register Py_ssize_t l = PyTuple_GET_SIZE(args);
- if (l < min) {
- PyErr_Format(PyExc_TypeError, "%s expected %s%d arguments, got %d",
- name, (min == max ? "" : "at least "), (int)min, (int)l);
- return 0;
- } else if (l > max) {
- PyErr_Format(PyExc_TypeError, "%s expected %s%d arguments, got %d",
- name, (min == max ? "" : "at most "), (int)max, (int)l);
- return 0;
- } else {
- register int i;
- for (i = 0; i < l; ++i) {
- objs[i] = PyTuple_GET_ITEM(args, i);
- }
- for (; l < max; ++l) {
- objs[l] = 0;
- }
- return i + 1;
- }
- }
-}
-
-/* A functor is a function object with one single object argument */
-#if PY_VERSION_HEX >= 0x02020000
-#define SWIG_Python_CallFunctor(functor, obj) PyObject_CallFunctionObjArgs(functor, obj, NULL);
-#else
-#define SWIG_Python_CallFunctor(functor, obj) PyObject_CallFunction(functor, "O", obj);
-#endif
-
-/*
- Helper for static pointer initialization for both C and C++ code, for example
- static PyObject *SWIG_STATIC_POINTER(MyVar) = NewSomething(...);
-*/
-#ifdef __cplusplus
-#define SWIG_STATIC_POINTER(var) var
-#else
-#define SWIG_STATIC_POINTER(var) var = 0; if (!var) var
-#endif
-
-/* -----------------------------------------------------------------------------
- * Pointer declarations
- * ----------------------------------------------------------------------------- */
-
-/* Flags for new pointer objects */
-#define SWIG_POINTER_NOSHADOW (SWIG_POINTER_OWN << 1)
-#define SWIG_POINTER_NEW (SWIG_POINTER_NOSHADOW | SWIG_POINTER_OWN)
-
-#define SWIG_POINTER_IMPLICIT_CONV (SWIG_POINTER_DISOWN << 1)
-
-#define SWIG_BUILTIN_TP_INIT (SWIG_POINTER_OWN << 2)
-#define SWIG_BUILTIN_INIT (SWIG_BUILTIN_TP_INIT | SWIG_POINTER_OWN)
-
-#ifdef __cplusplus
-extern "C" {
-#endif
-
-/* How to access Py_None */
-#if defined(_WIN32) || defined(__WIN32__) || defined(__CYGWIN__)
-# ifndef SWIG_PYTHON_NO_BUILD_NONE
-# ifndef SWIG_PYTHON_BUILD_NONE
-# define SWIG_PYTHON_BUILD_NONE
-# endif
-# endif
-#endif
-
-#ifdef SWIG_PYTHON_BUILD_NONE
-# ifdef Py_None
-# undef Py_None
-# define Py_None SWIG_Py_None()
-# endif
-SWIGRUNTIMEINLINE PyObject *
-_SWIG_Py_None(void)
-{
- PyObject *none = Py_BuildValue((char*)"");
- Py_DECREF(none);
- return none;
-}
-SWIGRUNTIME PyObject *
-SWIG_Py_None(void)
-{
- static PyObject *SWIG_STATIC_POINTER(none) = _SWIG_Py_None();
- return none;
-}
-#endif
-
-/* The python void return value */
-
-SWIGRUNTIMEINLINE PyObject *
-SWIG_Py_Void(void)
-{
- PyObject *none = Py_None;
- Py_INCREF(none);
- return none;
-}
-
-/* SwigPyClientData */
-
-typedef struct {
- PyObject *klass;
- PyObject *newraw;
- PyObject *newargs;
- PyObject *destroy;
- int delargs;
- int implicitconv;
- PyTypeObject *pytype;
-} SwigPyClientData;
-
-SWIGRUNTIMEINLINE int
-SWIG_Python_CheckImplicit(swig_type_info *ty)
-{
- SwigPyClientData *data = (SwigPyClientData *)ty->clientdata;
- return data ? data->implicitconv : 0;
-}
-
-SWIGRUNTIMEINLINE PyObject *
-SWIG_Python_ExceptionType(swig_type_info *desc) {
- SwigPyClientData *data = desc ? (SwigPyClientData *) desc->clientdata : 0;
- PyObject *klass = data ? data->klass : 0;
- return (klass ? klass : PyExc_RuntimeError);
-}
-
-
-SWIGRUNTIME SwigPyClientData *
-SwigPyClientData_New(PyObject* obj)
-{
- if (!obj) {
- return 0;
- } else {
- SwigPyClientData *data = (SwigPyClientData *)malloc(sizeof(SwigPyClientData));
- /* the klass element */
- data->klass = obj;
- Py_INCREF(data->klass);
- /* the newraw method and newargs arguments used to create a new raw instance */
- if (PyClass_Check(obj)) {
- data->newraw = 0;
- data->newargs = obj;
- Py_INCREF(obj);
- } else {
-#if (PY_VERSION_HEX < 0x02020000)
- data->newraw = 0;
-#else
- data->newraw = PyObject_GetAttrString(data->klass, (char *)"__new__");
-#endif
- if (data->newraw) {
- Py_INCREF(data->newraw);
- data->newargs = PyTuple_New(1);
- PyTuple_SetItem(data->newargs, 0, obj);
- } else {
- data->newargs = obj;
- }
- Py_INCREF(data->newargs);
- }
- /* the destroy method, aka as the C++ delete method */
- data->destroy = PyObject_GetAttrString(data->klass, (char *)"__swig_destroy__");
- if (PyErr_Occurred()) {
- PyErr_Clear();
- data->destroy = 0;
- }
- if (data->destroy) {
- int flags;
- Py_INCREF(data->destroy);
- flags = PyCFunction_GET_FLAGS(data->destroy);
-#ifdef METH_O
- data->delargs = !(flags & (METH_O));
-#else
- data->delargs = 0;
-#endif
- } else {
- data->delargs = 0;
- }
- data->implicitconv = 0;
- data->pytype = 0;
- return data;
- }
-}
-
-SWIGRUNTIME void
-SwigPyClientData_Del(SwigPyClientData *data) {
- Py_XDECREF(data->newraw);
- Py_XDECREF(data->newargs);
- Py_XDECREF(data->destroy);
-}
-
-/* =============== SwigPyObject =====================*/
-
-typedef struct {
- PyObject_HEAD
- void *ptr;
- swig_type_info *ty;
- int own;
- PyObject *next;
-#ifdef SWIGPYTHON_BUILTIN
- PyObject *dict;
-#endif
-} SwigPyObject;
-
-SWIGRUNTIME PyObject *
-SwigPyObject_long(SwigPyObject *v)
-{
- return PyLong_FromVoidPtr(v->ptr);
-}
-
-SWIGRUNTIME PyObject *
-SwigPyObject_format(const char* fmt, SwigPyObject *v)
-{
- PyObject *res = NULL;
- PyObject *args = PyTuple_New(1);
- if (args) {
- if (PyTuple_SetItem(args, 0, SwigPyObject_long(v)) == 0) {
- PyObject *ofmt = SWIG_Python_str_FromChar(fmt);
- if (ofmt) {
-#if PY_VERSION_HEX >= 0x03000000
- res = PyUnicode_Format(ofmt,args);
-#else
- res = PyString_Format(ofmt,args);
-#endif
- Py_DECREF(ofmt);
- }
- Py_DECREF(args);
- }
- }
- return res;
-}
-
-SWIGRUNTIME PyObject *
-SwigPyObject_oct(SwigPyObject *v)
-{
- return SwigPyObject_format("%o",v);
-}
-
-SWIGRUNTIME PyObject *
-SwigPyObject_hex(SwigPyObject *v)
-{
- return SwigPyObject_format("%x",v);
-}
-
-SWIGRUNTIME PyObject *
-#ifdef METH_NOARGS
-SwigPyObject_repr(SwigPyObject *v)
-#else
-SwigPyObject_repr(SwigPyObject *v, PyObject *args)
-#endif
-{
- const char *name = SWIG_TypePrettyName(v->ty);
- PyObject *repr = SWIG_Python_str_FromFormat("<Swig Object of type '%s' at %p>", name, (void *)v);
- if (v->next) {
-# ifdef METH_NOARGS
- PyObject *nrep = SwigPyObject_repr((SwigPyObject *)v->next);
-# else
- PyObject *nrep = SwigPyObject_repr((SwigPyObject *)v->next, args);
-# endif
-# if PY_VERSION_HEX >= 0x03000000
- PyObject *joined = PyUnicode_Concat(repr, nrep);
- Py_DecRef(repr);
- Py_DecRef(nrep);
- repr = joined;
-# else
- PyString_ConcatAndDel(&repr,nrep);
-# endif
- }
- return repr;
-}
-
-SWIGRUNTIME int
-SwigPyObject_print(SwigPyObject *v, FILE *fp, int SWIGUNUSEDPARM(flags))
-{
- char *str;
-#ifdef METH_NOARGS
- PyObject *repr = SwigPyObject_repr(v);
-#else
- PyObject *repr = SwigPyObject_repr(v, NULL);
-#endif
- if (repr) {
- str = SWIG_Python_str_AsChar(repr);
- fputs(str, fp);
- SWIG_Python_str_DelForPy3(str);
- Py_DECREF(repr);
- return 0;
- } else {
- return 1;
- }
-}
-
-SWIGRUNTIME PyObject *
-SwigPyObject_str(SwigPyObject *v)
-{
- char result[SWIG_BUFFER_SIZE];
- return SWIG_PackVoidPtr(result, v->ptr, v->ty->name, sizeof(result)) ?
- SWIG_Python_str_FromChar(result) : 0;
-}
-
-SWIGRUNTIME int
-SwigPyObject_compare(SwigPyObject *v, SwigPyObject *w)
-{
- void *i = v->ptr;
- void *j = w->ptr;
- return (i < j) ? -1 : ((i > j) ? 1 : 0);
-}
-
-/* Added for Python 3.x, would it also be useful for Python 2.x? */
-SWIGRUNTIME PyObject*
-SwigPyObject_richcompare(SwigPyObject *v, SwigPyObject *w, int op)
-{
- PyObject* res;
- if( op != Py_EQ && op != Py_NE ) {
- Py_INCREF(Py_NotImplemented);
- return Py_NotImplemented;
- }
- res = PyBool_FromLong( (SwigPyObject_compare(v, w)==0) == (op == Py_EQ) ? 1 : 0);
- return res;
-}
-
-
-SWIGRUNTIME PyTypeObject* SwigPyObject_TypeOnce(void);
-
-#ifdef SWIGPYTHON_BUILTIN
-static swig_type_info *SwigPyObject_stype = 0;
-SWIGRUNTIME PyTypeObject*
-SwigPyObject_type(void) {
- SwigPyClientData *cd;
- assert(SwigPyObject_stype);
- cd = (SwigPyClientData*) SwigPyObject_stype->clientdata;
- assert(cd);
- assert(cd->pytype);
- return cd->pytype;
-}
-#else
-SWIGRUNTIME PyTypeObject*
-SwigPyObject_type(void) {
- static PyTypeObject *SWIG_STATIC_POINTER(type) = SwigPyObject_TypeOnce();
- return type;
-}
-#endif
-
-SWIGRUNTIMEINLINE int
-SwigPyObject_Check(PyObject *op) {
-#ifdef SWIGPYTHON_BUILTIN
- PyTypeObject *target_tp = SwigPyObject_type();
- if (PyType_IsSubtype(op->ob_type, target_tp))
- return 1;
- return (strcmp(op->ob_type->tp_name, "SwigPyObject") == 0);
-#else
- return (Py_TYPE(op) == SwigPyObject_type())
- || (strcmp(Py_TYPE(op)->tp_name,"SwigPyObject") == 0);
-#endif
-}
-
-SWIGRUNTIME PyObject *
-SwigPyObject_New(void *ptr, swig_type_info *ty, int own);
-
-SWIGRUNTIME void
-SwigPyObject_dealloc(PyObject *v)
-{
- SwigPyObject *sobj = (SwigPyObject *) v;
- PyObject *next = sobj->next;
- if (sobj->own == SWIG_POINTER_OWN) {
- swig_type_info *ty = sobj->ty;
- SwigPyClientData *data = ty ? (SwigPyClientData *) ty->clientdata : 0;
- PyObject *destroy = data ? data->destroy : 0;
- if (destroy) {
- /* destroy is always a VARARGS method */
- PyObject *res;
- if (data->delargs) {
- /* we need to create a temporary object to carry the destroy operation */
- PyObject *tmp = SwigPyObject_New(sobj->ptr, ty, 0);
- res = SWIG_Python_CallFunctor(destroy, tmp);
- Py_DECREF(tmp);
- } else {
- PyCFunction meth = PyCFunction_GET_FUNCTION(destroy);
- PyObject *mself = PyCFunction_GET_SELF(destroy);
- res = ((*meth)(mself, v));
- }
- Py_XDECREF(res);
- }
-#if !defined(SWIG_PYTHON_SILENT_MEMLEAK)
- else {
- const char *name = SWIG_TypePrettyName(ty);
- printf("swig/python detected a memory leak of type '%s', no destructor found.\n", (name ? name : "unknown"));
- }
-#endif
- }
- Py_XDECREF(next);
- PyObject_DEL(v);
-}
-
-SWIGRUNTIME PyObject*
-SwigPyObject_append(PyObject* v, PyObject* next)
-{
- SwigPyObject *sobj = (SwigPyObject *) v;
-#ifndef METH_O
- PyObject *tmp = 0;
- if (!PyArg_ParseTuple(next,(char *)"O:append", &tmp)) return NULL;
- next = tmp;
-#endif
- if (!SwigPyObject_Check(next)) {
- return NULL;
- }
- sobj->next = next;
- Py_INCREF(next);
- return SWIG_Py_Void();
-}
-
-SWIGRUNTIME PyObject*
-#ifdef METH_NOARGS
-SwigPyObject_next(PyObject* v)
-#else
-SwigPyObject_next(PyObject* v, PyObject *SWIGUNUSEDPARM(args))
-#endif
-{
- SwigPyObject *sobj = (SwigPyObject *) v;
- if (sobj->next) {
- Py_INCREF(sobj->next);
- return sobj->next;
- } else {
- return SWIG_Py_Void();
- }
-}
-
-SWIGINTERN PyObject*
-#ifdef METH_NOARGS
-SwigPyObject_disown(PyObject *v)
-#else
-SwigPyObject_disown(PyObject* v, PyObject *SWIGUNUSEDPARM(args))
-#endif
-{
- SwigPyObject *sobj = (SwigPyObject *)v;
- sobj->own = 0;
- return SWIG_Py_Void();
-}
-
-SWIGINTERN PyObject*
-#ifdef METH_NOARGS
-SwigPyObject_acquire(PyObject *v)
-#else
-SwigPyObject_acquire(PyObject* v, PyObject *SWIGUNUSEDPARM(args))
-#endif
-{
- SwigPyObject *sobj = (SwigPyObject *)v;
- sobj->own = SWIG_POINTER_OWN;
- return SWIG_Py_Void();
-}
-
-SWIGINTERN PyObject*
-SwigPyObject_own(PyObject *v, PyObject *args)
-{
- PyObject *val = 0;
-#if (PY_VERSION_HEX < 0x02020000)
- if (!PyArg_ParseTuple(args,(char *)"|O:own",&val))
-#else
- if (!PyArg_UnpackTuple(args, (char *)"own", 0, 1, &val))
-#endif
- {
- return NULL;
- }
- else
- {
- SwigPyObject *sobj = (SwigPyObject *)v;
- PyObject *obj = PyBool_FromLong(sobj->own);
- if (val) {
-#ifdef METH_NOARGS
- if (PyObject_IsTrue(val)) {
- SwigPyObject_acquire(v);
- } else {
- SwigPyObject_disown(v);
- }
-#else
- if (PyObject_IsTrue(val)) {
- SwigPyObject_acquire(v,args);
- } else {
- SwigPyObject_disown(v,args);
- }
-#endif
- }
- return obj;
- }
-}
-
-#ifdef METH_O
-static PyMethodDef
-swigobject_methods[] = {
- {(char *)"disown", (PyCFunction)SwigPyObject_disown, METH_NOARGS, (char *)"releases ownership of the pointer"},
- {(char *)"acquire", (PyCFunction)SwigPyObject_acquire, METH_NOARGS, (char *)"aquires ownership of the pointer"},
- {(char *)"own", (PyCFunction)SwigPyObject_own, METH_VARARGS, (char *)"returns/sets ownership of the pointer"},
- {(char *)"append", (PyCFunction)SwigPyObject_append, METH_O, (char *)"appends another 'this' object"},
- {(char *)"next", (PyCFunction)SwigPyObject_next, METH_NOARGS, (char *)"returns the next 'this' object"},
- {(char *)"__repr__",(PyCFunction)SwigPyObject_repr, METH_NOARGS, (char *)"returns object representation"},
- {0, 0, 0, 0}
-};
-#else
-static PyMethodDef
-swigobject_methods[] = {
- {(char *)"disown", (PyCFunction)SwigPyObject_disown, METH_VARARGS, (char *)"releases ownership of the pointer"},
- {(char *)"acquire", (PyCFunction)SwigPyObject_acquire, METH_VARARGS, (char *)"aquires ownership of the pointer"},
- {(char *)"own", (PyCFunction)SwigPyObject_own, METH_VARARGS, (char *)"returns/sets ownership of the pointer"},
- {(char *)"append", (PyCFunction)SwigPyObject_append, METH_VARARGS, (char *)"appends another 'this' object"},
- {(char *)"next", (PyCFunction)SwigPyObject_next, METH_VARARGS, (char *)"returns the next 'this' object"},
- {(char *)"__repr__",(PyCFunction)SwigPyObject_repr, METH_VARARGS, (char *)"returns object representation"},
- {0, 0, 0, 0}
-};
-#endif
-
-#if PY_VERSION_HEX < 0x02020000
-SWIGINTERN PyObject *
-SwigPyObject_getattr(SwigPyObject *sobj,char *name)
-{
- return Py_FindMethod(swigobject_methods, (PyObject *)sobj, name);
-}
-#endif
-
-SWIGRUNTIME PyTypeObject*
-SwigPyObject_TypeOnce(void) {
- static char swigobject_doc[] = "Swig object carries a C/C++ instance pointer";
-
- static PyNumberMethods SwigPyObject_as_number = {
- (binaryfunc)0, /*nb_add*/
- (binaryfunc)0, /*nb_subtract*/
- (binaryfunc)0, /*nb_multiply*/
- /* nb_divide removed in Python 3 */
-#if PY_VERSION_HEX < 0x03000000
- (binaryfunc)0, /*nb_divide*/
-#endif
- (binaryfunc)0, /*nb_remainder*/
- (binaryfunc)0, /*nb_divmod*/
- (ternaryfunc)0,/*nb_power*/
- (unaryfunc)0, /*nb_negative*/
- (unaryfunc)0, /*nb_positive*/
- (unaryfunc)0, /*nb_absolute*/
- (inquiry)0, /*nb_nonzero*/
- 0, /*nb_invert*/
- 0, /*nb_lshift*/
- 0, /*nb_rshift*/
- 0, /*nb_and*/
- 0, /*nb_xor*/
- 0, /*nb_or*/
-#if PY_VERSION_HEX < 0x03000000
- 0, /*nb_coerce*/
-#endif
- (unaryfunc)SwigPyObject_long, /*nb_int*/
-#if PY_VERSION_HEX < 0x03000000
- (unaryfunc)SwigPyObject_long, /*nb_long*/
-#else
- 0, /*nb_reserved*/
-#endif
- (unaryfunc)0, /*nb_float*/
-#if PY_VERSION_HEX < 0x03000000
- (unaryfunc)SwigPyObject_oct, /*nb_oct*/
- (unaryfunc)SwigPyObject_hex, /*nb_hex*/
-#endif
-#if PY_VERSION_HEX >= 0x03000000 /* 3.0 */
- 0,0,0,0,0,0,0,0,0,0,0,0,0,0,0 /* nb_inplace_add -> nb_index, nb_inplace_divide removed */
-#elif PY_VERSION_HEX >= 0x02050000 /* 2.5.0 */
- 0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0 /* nb_inplace_add -> nb_index */
-#elif PY_VERSION_HEX >= 0x02020000 /* 2.2.0 */
- 0,0,0,0,0,0,0,0,0,0,0,0,0,0,0 /* nb_inplace_add -> nb_inplace_true_divide */
-#elif PY_VERSION_HEX >= 0x02000000 /* 2.0.0 */
- 0,0,0,0,0,0,0,0,0,0,0 /* nb_inplace_add -> nb_inplace_or */
-#endif
- };
-
- static PyTypeObject swigpyobject_type;
- static int type_init = 0;
- if (!type_init) {
- const PyTypeObject tmp = {
- /* PyObject header changed in Python 3 */
-#if PY_VERSION_HEX >= 0x03000000
- PyVarObject_HEAD_INIT(NULL, 0)
-#else
- PyObject_HEAD_INIT(NULL)
- 0, /* ob_size */
-#endif
- (char *)"SwigPyObject", /* tp_name */
- sizeof(SwigPyObject), /* tp_basicsize */
- 0, /* tp_itemsize */
- (destructor)SwigPyObject_dealloc, /* tp_dealloc */
- (printfunc)SwigPyObject_print, /* tp_print */
-#if PY_VERSION_HEX < 0x02020000
- (getattrfunc)SwigPyObject_getattr, /* tp_getattr */
-#else
- (getattrfunc)0, /* tp_getattr */
-#endif
- (setattrfunc)0, /* tp_setattr */
-#if PY_VERSION_HEX >= 0x03000000
- 0, /* tp_reserved in 3.0.1, tp_compare in 3.0.0 but not used */
-#else
- (cmpfunc)SwigPyObject_compare, /* tp_compare */
-#endif
- (reprfunc)SwigPyObject_repr, /* tp_repr */
- &SwigPyObject_as_number, /* tp_as_number */
- 0, /* tp_as_sequence */
- 0, /* tp_as_mapping */
- (hashfunc)0, /* tp_hash */
- (ternaryfunc)0, /* tp_call */
- (reprfunc)SwigPyObject_str, /* tp_str */
- PyObject_GenericGetAttr, /* tp_getattro */
- 0, /* tp_setattro */
- 0, /* tp_as_buffer */
- Py_TPFLAGS_DEFAULT, /* tp_flags */
- swigobject_doc, /* tp_doc */
- 0, /* tp_traverse */
- 0, /* tp_clear */
- (richcmpfunc)SwigPyObject_richcompare,/* tp_richcompare */
- 0, /* tp_weaklistoffset */
-#if PY_VERSION_HEX >= 0x02020000
- 0, /* tp_iter */
- 0, /* tp_iternext */
- swigobject_methods, /* tp_methods */
- 0, /* tp_members */
- 0, /* tp_getset */
- 0, /* tp_base */
- 0, /* tp_dict */
- 0, /* tp_descr_get */
- 0, /* tp_descr_set */
- 0, /* tp_dictoffset */
- 0, /* tp_init */
- 0, /* tp_alloc */
- 0, /* tp_new */
- 0, /* tp_free */
- 0, /* tp_is_gc */
- 0, /* tp_bases */
- 0, /* tp_mro */
- 0, /* tp_cache */
- 0, /* tp_subclasses */
- 0, /* tp_weaklist */
-#endif
-#if PY_VERSION_HEX >= 0x02030000
- 0, /* tp_del */
-#endif
-#if PY_VERSION_HEX >= 0x02060000
- 0, /* tp_version */
-#endif
-#ifdef COUNT_ALLOCS
- 0,0,0,0 /* tp_alloc -> tp_next */
-#endif
- };
- swigpyobject_type = tmp;
- type_init = 1;
-#if PY_VERSION_HEX < 0x02020000
- swigpyobject_type.ob_type = &PyType_Type;
-#else
- if (PyType_Ready(&swigpyobject_type) < 0)
- return NULL;
-#endif
- }
- return &swigpyobject_type;
-}
-
-SWIGRUNTIME PyObject *
-SwigPyObject_New(void *ptr, swig_type_info *ty, int own)
-{
- SwigPyObject *sobj = PyObject_NEW(SwigPyObject, SwigPyObject_type());
- if (sobj) {
- sobj->ptr = ptr;
- sobj->ty = ty;
- sobj->own = own;
- sobj->next = 0;
- }
- return (PyObject *)sobj;
-}
-
-/* -----------------------------------------------------------------------------
- * Implements a simple Swig Packed type, and use it instead of string
- * ----------------------------------------------------------------------------- */
-
-typedef struct {
- PyObject_HEAD
- void *pack;
- swig_type_info *ty;
- size_t size;
-} SwigPyPacked;
-
-SWIGRUNTIME int
-SwigPyPacked_print(SwigPyPacked *v, FILE *fp, int SWIGUNUSEDPARM(flags))
-{
- char result[SWIG_BUFFER_SIZE];
- fputs("<Swig Packed ", fp);
- if (SWIG_PackDataName(result, v->pack, v->size, 0, sizeof(result))) {
- fputs("at ", fp);
- fputs(result, fp);
- }
- fputs(v->ty->name,fp);
- fputs(">", fp);
- return 0;
-}
-
-SWIGRUNTIME PyObject *
-SwigPyPacked_repr(SwigPyPacked *v)
-{
- char result[SWIG_BUFFER_SIZE];
- if (SWIG_PackDataName(result, v->pack, v->size, 0, sizeof(result))) {
- return SWIG_Python_str_FromFormat("<Swig Packed at %s%s>", result, v->ty->name);
- } else {
- return SWIG_Python_str_FromFormat("<Swig Packed %s>", v->ty->name);
- }
-}
-
-SWIGRUNTIME PyObject *
-SwigPyPacked_str(SwigPyPacked *v)
-{
- char result[SWIG_BUFFER_SIZE];
- if (SWIG_PackDataName(result, v->pack, v->size, 0, sizeof(result))){
- return SWIG_Python_str_FromFormat("%s%s", result, v->ty->name);
- } else {
- return SWIG_Python_str_FromChar(v->ty->name);
- }
-}
-
-SWIGRUNTIME int
-SwigPyPacked_compare(SwigPyPacked *v, SwigPyPacked *w)
-{
- size_t i = v->size;
- size_t j = w->size;
- int s = (i < j) ? -1 : ((i > j) ? 1 : 0);
- return s ? s : strncmp((char *)v->pack, (char *)w->pack, 2*v->size);
-}
-
-SWIGRUNTIME PyTypeObject* SwigPyPacked_TypeOnce(void);
-
-SWIGRUNTIME PyTypeObject*
-SwigPyPacked_type(void) {
- static PyTypeObject *SWIG_STATIC_POINTER(type) = SwigPyPacked_TypeOnce();
- return type;
-}
-
-SWIGRUNTIMEINLINE int
-SwigPyPacked_Check(PyObject *op) {
- return ((op)->ob_type == SwigPyPacked_TypeOnce())
- || (strcmp((op)->ob_type->tp_name,"SwigPyPacked") == 0);
-}
-
-SWIGRUNTIME void
-SwigPyPacked_dealloc(PyObject *v)
-{
- if (SwigPyPacked_Check(v)) {
- SwigPyPacked *sobj = (SwigPyPacked *) v;
- free(sobj->pack);
- }
- PyObject_DEL(v);
-}
-
-SWIGRUNTIME PyTypeObject*
-SwigPyPacked_TypeOnce(void) {
- static char swigpacked_doc[] = "Swig object carries a C/C++ instance pointer";
- static PyTypeObject swigpypacked_type;
- static int type_init = 0;
- if (!type_init) {
- const PyTypeObject tmp = {
- /* PyObject header changed in Python 3 */
-#if PY_VERSION_HEX>=0x03000000
- PyVarObject_HEAD_INIT(NULL, 0)
-#else
- PyObject_HEAD_INIT(NULL)
- 0, /* ob_size */
-#endif
- (char *)"SwigPyPacked", /* tp_name */
- sizeof(SwigPyPacked), /* tp_basicsize */
- 0, /* tp_itemsize */
- (destructor)SwigPyPacked_dealloc, /* tp_dealloc */
- (printfunc)SwigPyPacked_print, /* tp_print */
- (getattrfunc)0, /* tp_getattr */
- (setattrfunc)0, /* tp_setattr */
-#if PY_VERSION_HEX>=0x03000000
- 0, /* tp_reserved in 3.0.1 */
-#else
- (cmpfunc)SwigPyPacked_compare, /* tp_compare */
-#endif
- (reprfunc)SwigPyPacked_repr, /* tp_repr */
- 0, /* tp_as_number */
- 0, /* tp_as_sequence */
- 0, /* tp_as_mapping */
- (hashfunc)0, /* tp_hash */
- (ternaryfunc)0, /* tp_call */
- (reprfunc)SwigPyPacked_str, /* tp_str */
- PyObject_GenericGetAttr, /* tp_getattro */
- 0, /* tp_setattro */
- 0, /* tp_as_buffer */
- Py_TPFLAGS_DEFAULT, /* tp_flags */
- swigpacked_doc, /* tp_doc */
- 0, /* tp_traverse */
- 0, /* tp_clear */
- 0, /* tp_richcompare */
- 0, /* tp_weaklistoffset */
-#if PY_VERSION_HEX >= 0x02020000
- 0, /* tp_iter */
- 0, /* tp_iternext */
- 0, /* tp_methods */
- 0, /* tp_members */
- 0, /* tp_getset */
- 0, /* tp_base */
- 0, /* tp_dict */
- 0, /* tp_descr_get */
- 0, /* tp_descr_set */
- 0, /* tp_dictoffset */
- 0, /* tp_init */
- 0, /* tp_alloc */
- 0, /* tp_new */
- 0, /* tp_free */
- 0, /* tp_is_gc */
- 0, /* tp_bases */
- 0, /* tp_mro */
- 0, /* tp_cache */
- 0, /* tp_subclasses */
- 0, /* tp_weaklist */
-#endif
-#if PY_VERSION_HEX >= 0x02030000
- 0, /* tp_del */
-#endif
-#if PY_VERSION_HEX >= 0x02060000
- 0, /* tp_version */
-#endif
-#ifdef COUNT_ALLOCS
- 0,0,0,0 /* tp_alloc -> tp_next */
-#endif
- };
- swigpypacked_type = tmp;
- type_init = 1;
-#if PY_VERSION_HEX < 0x02020000
- swigpypacked_type.ob_type = &PyType_Type;
-#else
- if (PyType_Ready(&swigpypacked_type) < 0)
- return NULL;
-#endif
- }
- return &swigpypacked_type;
-}
-
-SWIGRUNTIME PyObject *
-SwigPyPacked_New(void *ptr, size_t size, swig_type_info *ty)
-{
- SwigPyPacked *sobj = PyObject_NEW(SwigPyPacked, SwigPyPacked_type());
- if (sobj) {
- void *pack = malloc(size);
- if (pack) {
- memcpy(pack, ptr, size);
- sobj->pack = pack;
- sobj->ty = ty;
- sobj->size = size;
- } else {
- PyObject_DEL((PyObject *) sobj);
- sobj = 0;
- }
- }
- return (PyObject *) sobj;
-}
-
-SWIGRUNTIME swig_type_info *
-SwigPyPacked_UnpackData(PyObject *obj, void *ptr, size_t size)
-{
- if (SwigPyPacked_Check(obj)) {
- SwigPyPacked *sobj = (SwigPyPacked *)obj;
- if (sobj->size != size) return 0;
- memcpy(ptr, sobj->pack, size);
- return sobj->ty;
- } else {
- return 0;
- }
-}
-
-/* -----------------------------------------------------------------------------
- * pointers/data manipulation
- * ----------------------------------------------------------------------------- */
-
-SWIGRUNTIMEINLINE PyObject *
-_SWIG_This(void)
-{
- return SWIG_Python_str_FromChar("this");
-}
-
-static PyObject *swig_this = NULL;
-
-SWIGRUNTIME PyObject *
-SWIG_This(void)
-{
- if (swig_this == NULL)
- swig_this = _SWIG_This();
- return swig_this;
-}
-
-/* #define SWIG_PYTHON_SLOW_GETSET_THIS */
-
-/* TODO: I don't know how to implement the fast getset in Python 3 right now */
-#if PY_VERSION_HEX>=0x03000000
-#define SWIG_PYTHON_SLOW_GETSET_THIS
-#endif
-
-SWIGRUNTIME SwigPyObject *
-SWIG_Python_GetSwigThis(PyObject *pyobj)
-{
- PyObject *obj;
-
- if (SwigPyObject_Check(pyobj))
- return (SwigPyObject *) pyobj;
-
-#ifdef SWIGPYTHON_BUILTIN
- (void)obj;
-# ifdef PyWeakref_CheckProxy
- if (PyWeakref_CheckProxy(pyobj)) {
- pyobj = PyWeakref_GET_OBJECT(pyobj);
- if (pyobj && SwigPyObject_Check(pyobj))
- return (SwigPyObject*) pyobj;
- }
-# endif
- return NULL;
-#else
-
- obj = 0;
-
-#if (!defined(SWIG_PYTHON_SLOW_GETSET_THIS) && (PY_VERSION_HEX >= 0x02030000))
- if (PyInstance_Check(pyobj)) {
- obj = _PyInstance_Lookup(pyobj, SWIG_This());
- } else {
- PyObject **dictptr = _PyObject_GetDictPtr(pyobj);
- if (dictptr != NULL) {
- PyObject *dict = *dictptr;
- obj = dict ? PyDict_GetItem(dict, SWIG_This()) : 0;
- } else {
-#ifdef PyWeakref_CheckProxy
- if (PyWeakref_CheckProxy(pyobj)) {
- PyObject *wobj = PyWeakref_GET_OBJECT(pyobj);
- return wobj ? SWIG_Python_GetSwigThis(wobj) : 0;
- }
-#endif
- obj = PyObject_GetAttr(pyobj,SWIG_This());
- if (obj) {
- Py_DECREF(obj);
- } else {
- if (PyErr_Occurred()) PyErr_Clear();
- return 0;
- }
- }
- }
-#else
- obj = PyObject_GetAttr(pyobj,SWIG_This());
- if (obj) {
- Py_DECREF(obj);
- } else {
- if (PyErr_Occurred()) PyErr_Clear();
- return 0;
- }
-#endif
- if (obj && !SwigPyObject_Check(obj)) {
- /* a PyObject is called 'this', try to get the 'real this'
- SwigPyObject from it */
- return SWIG_Python_GetSwigThis(obj);
- }
- return (SwigPyObject *)obj;
-#endif
-}
-
-/* Acquire a pointer value */
-
-SWIGRUNTIME int
-SWIG_Python_AcquirePtr(PyObject *obj, int own) {
- if (own == SWIG_POINTER_OWN) {
- SwigPyObject *sobj = SWIG_Python_GetSwigThis(obj);
- if (sobj) {
- int oldown = sobj->own;
- sobj->own = own;
- return oldown;
- }
- }
- return 0;
-}
-
-/* Convert a pointer value */
-
-SWIGRUNTIME int
-SWIG_Python_ConvertPtrAndOwn(PyObject *obj, void **ptr, swig_type_info *ty, int flags, int *own) {
- int res;
- SwigPyObject *sobj;
-
- if (!obj)
- return SWIG_ERROR;
- if (obj == Py_None) {
- if (ptr)
- *ptr = 0;
- return SWIG_OK;
- }
-
- res = SWIG_ERROR;
-
- sobj = SWIG_Python_GetSwigThis(obj);
- if (own)
- *own = 0;
- while (sobj) {
- void *vptr = sobj->ptr;
- if (ty) {
- swig_type_info *to = sobj->ty;
- if (to == ty) {
- /* no type cast needed */
- if (ptr) *ptr = vptr;
- break;
- } else {
- swig_cast_info *tc = SWIG_TypeCheck(to->name,ty);
- if (!tc) {
- sobj = (SwigPyObject *)sobj->next;
- } else {
- if (ptr) {
- int newmemory = 0;
- *ptr = SWIG_TypeCast(tc,vptr,&newmemory);
- if (newmemory == SWIG_CAST_NEW_MEMORY) {
- assert(own); /* badly formed typemap which will lead to a memory leak - it must set and use own to delete *ptr */
- if (own)
- *own = *own | SWIG_CAST_NEW_MEMORY;
- }
- }
- break;
- }
- }
- } else {
- if (ptr) *ptr = vptr;
- break;
- }
- }
- if (sobj) {
- if (own)
- *own = *own | sobj->own;
- if (flags & SWIG_POINTER_DISOWN) {
- sobj->own = 0;
- }
- res = SWIG_OK;
- } else {
- if (flags & SWIG_POINTER_IMPLICIT_CONV) {
- SwigPyClientData *data = ty ? (SwigPyClientData *) ty->clientdata : 0;
- if (data && !data->implicitconv) {
- PyObject *klass = data->klass;
- if (klass) {
- PyObject *impconv;
- data->implicitconv = 1; /* avoid recursion and call 'explicit' constructors*/
- impconv = SWIG_Python_CallFunctor(klass, obj);
- data->implicitconv = 0;
- if (PyErr_Occurred()) {
- PyErr_Clear();
- impconv = 0;
- }
- if (impconv) {
- SwigPyObject *iobj = SWIG_Python_GetSwigThis(impconv);
- if (iobj) {
- void *vptr;
- res = SWIG_Python_ConvertPtrAndOwn((PyObject*)iobj, &vptr, ty, 0, 0);
- if (SWIG_IsOK(res)) {
- if (ptr) {
- *ptr = vptr;
- /* transfer the ownership to 'ptr' */
- iobj->own = 0;
- res = SWIG_AddCast(res);
- res = SWIG_AddNewMask(res);
- } else {
- res = SWIG_AddCast(res);
- }
- }
- }
- Py_DECREF(impconv);
- }
- }
- }
- }
- }
- return res;
-}
-
-/* Convert a function ptr value */
-
-SWIGRUNTIME int
-SWIG_Python_ConvertFunctionPtr(PyObject *obj, void **ptr, swig_type_info *ty) {
- if (!PyCFunction_Check(obj)) {
- return SWIG_ConvertPtr(obj, ptr, ty, 0);
- } else {
- void *vptr = 0;
-
- /* here we get the method pointer for callbacks */
- const char *doc = (((PyCFunctionObject *)obj) -> m_ml -> ml_doc);
- const char *desc = doc ? strstr(doc, "swig_ptr: ") : 0;
- if (desc)
- desc = ty ? SWIG_UnpackVoidPtr(desc + 10, &vptr, ty->name) : 0;
- if (!desc)
- return SWIG_ERROR;
- if (ty) {
- swig_cast_info *tc = SWIG_TypeCheck(desc,ty);
- if (tc) {
- int newmemory = 0;
- *ptr = SWIG_TypeCast(tc,vptr,&newmemory);
- assert(!newmemory); /* newmemory handling not yet implemented */
- } else {
- return SWIG_ERROR;
- }
- } else {
- *ptr = vptr;
- }
- return SWIG_OK;
- }
-}
-
-/* Convert a packed value value */
-
-SWIGRUNTIME int
-SWIG_Python_ConvertPacked(PyObject *obj, void *ptr, size_t sz, swig_type_info *ty) {
- swig_type_info *to = SwigPyPacked_UnpackData(obj, ptr, sz);
- if (!to) return SWIG_ERROR;
- if (ty) {
- if (to != ty) {
- /* check type cast? */
- swig_cast_info *tc = SWIG_TypeCheck(to->name,ty);
- if (!tc) return SWIG_ERROR;
- }
- }
- return SWIG_OK;
-}
-
-/* -----------------------------------------------------------------------------
- * Create a new pointer object
- * ----------------------------------------------------------------------------- */
-
-/*
- Create a new instance object, without calling __init__, and set the
- 'this' attribute.
-*/
-
-SWIGRUNTIME PyObject*
-SWIG_Python_NewShadowInstance(SwigPyClientData *data, PyObject *swig_this)
-{
-#if (PY_VERSION_HEX >= 0x02020000)
- PyObject *inst = 0;
- PyObject *newraw = data->newraw;
- if (newraw) {
- inst = PyObject_Call(newraw, data->newargs, NULL);
- if (inst) {
-#if !defined(SWIG_PYTHON_SLOW_GETSET_THIS)
- PyObject **dictptr = _PyObject_GetDictPtr(inst);
- if (dictptr != NULL) {
- PyObject *dict = *dictptr;
- if (dict == NULL) {
- dict = PyDict_New();
- *dictptr = dict;
- PyDict_SetItem(dict, SWIG_This(), swig_this);
- }
- }
-#else
- PyObject *key = SWIG_This();
- PyObject_SetAttr(inst, key, swig_this);
-#endif
- }
- } else {
-#if PY_VERSION_HEX >= 0x03000000
- inst = PyBaseObject_Type.tp_new((PyTypeObject*) data->newargs, Py_None, Py_None);
- PyObject_SetAttr(inst, SWIG_This(), swig_this);
- Py_TYPE(inst)->tp_flags &= ~Py_TPFLAGS_VALID_VERSION_TAG;
-#else
- PyObject *dict = PyDict_New();
- PyDict_SetItem(dict, SWIG_This(), swig_this);
- inst = PyInstance_NewRaw(data->newargs, dict);
- Py_DECREF(dict);
-#endif
- }
- return inst;
-#else
-#if (PY_VERSION_HEX >= 0x02010000)
- PyObject *inst;
- PyObject *dict = PyDict_New();
- PyDict_SetItem(dict, SWIG_This(), swig_this);
- inst = PyInstance_NewRaw(data->newargs, dict);
- Py_DECREF(dict);
- return (PyObject *) inst;
-#else
- PyInstanceObject *inst = PyObject_NEW(PyInstanceObject, &PyInstance_Type);
- if (inst == NULL) {
- return NULL;
- }
- inst->in_class = (PyClassObject *)data->newargs;
- Py_INCREF(inst->in_class);
- inst->in_dict = PyDict_New();
- if (inst->in_dict == NULL) {
- Py_DECREF(inst);
- return NULL;
- }
-#ifdef Py_TPFLAGS_HAVE_WEAKREFS
- inst->in_weakreflist = NULL;
-#endif
-#ifdef Py_TPFLAGS_GC
- PyObject_GC_Init(inst);
-#endif
- PyDict_SetItem(inst->in_dict, SWIG_This(), swig_this);
- return (PyObject *) inst;
-#endif
-#endif
-}
-
-SWIGRUNTIME void
-SWIG_Python_SetSwigThis(PyObject *inst, PyObject *swig_this)
-{
- PyObject *dict;
-#if (PY_VERSION_HEX >= 0x02020000) && !defined(SWIG_PYTHON_SLOW_GETSET_THIS)
- PyObject **dictptr = _PyObject_GetDictPtr(inst);
- if (dictptr != NULL) {
- dict = *dictptr;
- if (dict == NULL) {
- dict = PyDict_New();
- *dictptr = dict;
- }
- PyDict_SetItem(dict, SWIG_This(), swig_this);
- return;
- }
-#endif
- dict = PyObject_GetAttrString(inst, (char*)"__dict__");
- PyDict_SetItem(dict, SWIG_This(), swig_this);
- Py_DECREF(dict);
-}
-
-
-SWIGINTERN PyObject *
-SWIG_Python_InitShadowInstance(PyObject *args) {
- PyObject *obj[2];
- if (!SWIG_Python_UnpackTuple(args,(char*)"swiginit", 2, 2, obj)) {
- return NULL;
- } else {
- SwigPyObject *sthis = SWIG_Python_GetSwigThis(obj[0]);
- if (sthis) {
- SwigPyObject_append((PyObject*) sthis, obj[1]);
- } else {
- SWIG_Python_SetSwigThis(obj[0], obj[1]);
- }
- return SWIG_Py_Void();
- }
-}
-
-/* Create a new pointer object */
-
-SWIGRUNTIME PyObject *
-SWIG_Python_NewPointerObj(PyObject *self, void *ptr, swig_type_info *type, int flags) {
- SwigPyClientData *clientdata;
- PyObject * robj;
- int own;
-
- if (!ptr)
- return SWIG_Py_Void();
-
- clientdata = type ? (SwigPyClientData *)(type->clientdata) : 0;
- own = (flags & SWIG_POINTER_OWN) ? SWIG_POINTER_OWN : 0;
- if (clientdata && clientdata->pytype) {
- SwigPyObject *newobj;
- if (flags & SWIG_BUILTIN_TP_INIT) {
- newobj = (SwigPyObject*) self;
- if (newobj->ptr) {
- PyObject *next_self = clientdata->pytype->tp_alloc(clientdata->pytype, 0);
- while (newobj->next)
- newobj = (SwigPyObject *) newobj->next;
- newobj->next = next_self;
- newobj = (SwigPyObject *)next_self;
- }
- } else {
- newobj = PyObject_New(SwigPyObject, clientdata->pytype);
- }
- if (newobj) {
- newobj->ptr = ptr;
- newobj->ty = type;
- newobj->own = own;
- newobj->next = 0;
-#ifdef SWIGPYTHON_BUILTIN
- newobj->dict = 0;
-#endif
- return (PyObject*) newobj;
- }
- return SWIG_Py_Void();
- }
-
- assert(!(flags & SWIG_BUILTIN_TP_INIT));
-
- robj = SwigPyObject_New(ptr, type, own);
- if (clientdata && !(flags & SWIG_POINTER_NOSHADOW)) {
- PyObject *inst = SWIG_Python_NewShadowInstance(clientdata, robj);
- if (inst) {
- Py_DECREF(robj);
- robj = inst;
- }
- }
- return robj;
-}
-
-/* Create a new packed object */
-
-SWIGRUNTIMEINLINE PyObject *
-SWIG_Python_NewPackedObj(void *ptr, size_t sz, swig_type_info *type) {
- return ptr ? SwigPyPacked_New((void *) ptr, sz, type) : SWIG_Py_Void();
-}
-
-/* -----------------------------------------------------------------------------*
- * Get type list
- * -----------------------------------------------------------------------------*/
-
-#ifdef SWIG_LINK_RUNTIME
-void *SWIG_ReturnGlobalTypeList(void *);
-#endif
-
-SWIGRUNTIME swig_module_info *
-SWIG_Python_GetModule(void) {
- static void *type_pointer = (void *)0;
- /* first check if module already created */
- if (!type_pointer) {
-#ifdef SWIG_LINK_RUNTIME
- type_pointer = SWIG_ReturnGlobalTypeList((void *)0);
-#else
-# ifdef SWIGPY_USE_CAPSULE
- type_pointer = PyCapsule_Import(SWIGPY_CAPSULE_NAME, 0);
-# else
- type_pointer = PyCObject_Import((char*)"swig_runtime_data" SWIG_RUNTIME_VERSION,
- (char*)"type_pointer" SWIG_TYPE_TABLE_NAME);
-# endif
- if (PyErr_Occurred()) {
- PyErr_Clear();
- type_pointer = (void *)0;
- }
-#endif
- }
- return (swig_module_info *) type_pointer;
-}
-
-#if PY_MAJOR_VERSION < 2
-/* PyModule_AddObject function was introduced in Python 2.0. The following function
- is copied out of Python/modsupport.c in python version 2.3.4 */
-SWIGINTERN int
-PyModule_AddObject(PyObject *m, char *name, PyObject *o)
-{
- PyObject *dict;
- if (!PyModule_Check(m)) {
- PyErr_SetString(PyExc_TypeError,
- "PyModule_AddObject() needs module as first arg");
- return SWIG_ERROR;
- }
- if (!o) {
- PyErr_SetString(PyExc_TypeError,
- "PyModule_AddObject() needs non-NULL value");
- return SWIG_ERROR;
- }
-
- dict = PyModule_GetDict(m);
- if (dict == NULL) {
- /* Internal error -- modules must have a dict! */
- PyErr_Format(PyExc_SystemError, "module '%s' has no __dict__",
- PyModule_GetName(m));
- return SWIG_ERROR;
- }
- if (PyDict_SetItemString(dict, name, o))
- return SWIG_ERROR;
- Py_DECREF(o);
- return SWIG_OK;
-}
-#endif
-
-SWIGRUNTIME void
-#ifdef SWIGPY_USE_CAPSULE
-SWIG_Python_DestroyModule(PyObject *obj)
-#else
-SWIG_Python_DestroyModule(void *vptr)
-#endif
-{
-#ifdef SWIGPY_USE_CAPSULE
- swig_module_info *swig_module = (swig_module_info *) PyCapsule_GetPointer(obj, SWIGPY_CAPSULE_NAME);
-#else
- swig_module_info *swig_module = (swig_module_info *) vptr;
-#endif
- swig_type_info **types = swig_module->types;
- size_t i;
- for (i =0; i < swig_module->size; ++i) {
- swig_type_info *ty = types[i];
- if (ty->owndata) {
- SwigPyClientData *data = (SwigPyClientData *) ty->clientdata;
- if (data) SwigPyClientData_Del(data);
- }
- }
- Py_DECREF(SWIG_This());
- swig_this = NULL;
-}
-
-SWIGRUNTIME void
-SWIG_Python_SetModule(swig_module_info *swig_module) {
-#if PY_VERSION_HEX >= 0x03000000
- /* Add a dummy module object into sys.modules */
- PyObject *module = PyImport_AddModule((char*)"swig_runtime_data" SWIG_RUNTIME_VERSION);
-#else
- static PyMethodDef swig_empty_runtime_method_table[] = { {NULL, NULL, 0, NULL} }; /* Sentinel */
- PyObject *module = Py_InitModule((char*)"swig_runtime_data" SWIG_RUNTIME_VERSION, swig_empty_runtime_method_table);
-#endif
-#ifdef SWIGPY_USE_CAPSULE
- PyObject *pointer = PyCapsule_New((void *) swig_module, SWIGPY_CAPSULE_NAME, SWIG_Python_DestroyModule);
- if (pointer && module) {
- PyModule_AddObject(module, (char*)"type_pointer_capsule" SWIG_TYPE_TABLE_NAME, pointer);
- } else {
- Py_XDECREF(pointer);
- }
-#else
- PyObject *pointer = PyCObject_FromVoidPtr((void *) swig_module, SWIG_Python_DestroyModule);
- if (pointer && module) {
- PyModule_AddObject(module, (char*)"type_pointer" SWIG_TYPE_TABLE_NAME, pointer);
- } else {
- Py_XDECREF(pointer);
- }
-#endif
-}
-
-/* The python cached type query */
-SWIGRUNTIME PyObject *
-SWIG_Python_TypeCache(void) {
- static PyObject *SWIG_STATIC_POINTER(cache) = PyDict_New();
- return cache;
-}
-
-SWIGRUNTIME swig_type_info *
-SWIG_Python_TypeQuery(const char *type)
-{
- PyObject *cache = SWIG_Python_TypeCache();
- PyObject *key = SWIG_Python_str_FromChar(type);
- PyObject *obj = PyDict_GetItem(cache, key);
- swig_type_info *descriptor;
- if (obj) {
-#ifdef SWIGPY_USE_CAPSULE
- descriptor = (swig_type_info *) PyCapsule_GetPointer(obj, NULL);
-#else
- descriptor = (swig_type_info *) PyCObject_AsVoidPtr(obj);
-#endif
- } else {
- swig_module_info *swig_module = SWIG_Python_GetModule();
- descriptor = SWIG_TypeQueryModule(swig_module, swig_module, type);
- if (descriptor) {
-#ifdef SWIGPY_USE_CAPSULE
- obj = PyCapsule_New((void*) descriptor, NULL, NULL);
-#else
- obj = PyCObject_FromVoidPtr(descriptor, NULL);
-#endif
- PyDict_SetItem(cache, key, obj);
- Py_DECREF(obj);
- }
- }
- Py_DECREF(key);
- return descriptor;
-}
-
-/*
- For backward compatibility only
-*/
-#define SWIG_POINTER_EXCEPTION 0
-#define SWIG_arg_fail(arg) SWIG_Python_ArgFail(arg)
-#define SWIG_MustGetPtr(p, type, argnum, flags) SWIG_Python_MustGetPtr(p, type, argnum, flags)
-
-SWIGRUNTIME int
-SWIG_Python_AddErrMesg(const char* mesg, int infront)
-{
- if (PyErr_Occurred()) {
- PyObject *type = 0;
- PyObject *value = 0;
- PyObject *traceback = 0;
- PyErr_Fetch(&type, &value, &traceback);
- if (value) {
- char *tmp;
- PyObject *old_str = PyObject_Str(value);
- Py_XINCREF(type);
- PyErr_Clear();
- if (infront) {
- PyErr_Format(type, "%s %s", mesg, tmp = SWIG_Python_str_AsChar(old_str));
- } else {
- PyErr_Format(type, "%s %s", tmp = SWIG_Python_str_AsChar(old_str), mesg);
- }
- SWIG_Python_str_DelForPy3(tmp);
- Py_DECREF(old_str);
- }
- return 1;
- } else {
- return 0;
- }
-}
-
-SWIGRUNTIME int
-SWIG_Python_ArgFail(int argnum)
-{
- if (PyErr_Occurred()) {
- /* add information about failing argument */
- char mesg[256];
- PyOS_snprintf(mesg, sizeof(mesg), "argument number %d:", argnum);
- return SWIG_Python_AddErrMesg(mesg, 1);
- } else {
- return 0;
- }
-}
-
-SWIGRUNTIMEINLINE const char *
-SwigPyObject_GetDesc(PyObject *self)
-{
- SwigPyObject *v = (SwigPyObject *)self;
- swig_type_info *ty = v ? v->ty : 0;
- return ty ? ty->str : (char*)"";
-}
-
-SWIGRUNTIME void
-SWIG_Python_TypeError(const char *type, PyObject *obj)
-{
- if (type) {
-#if defined(SWIG_COBJECT_TYPES)
- if (obj && SwigPyObject_Check(obj)) {
- const char *otype = (const char *) SwigPyObject_GetDesc(obj);
- if (otype) {
- PyErr_Format(PyExc_TypeError, "a '%s' is expected, 'SwigPyObject(%s)' is received",
- type, otype);
- return;
- }
- } else
-#endif
- {
- const char *otype = (obj ? obj->ob_type->tp_name : 0);
- if (otype) {
- PyObject *str = PyObject_Str(obj);
- const char *cstr = str ? SWIG_Python_str_AsChar(str) : 0;
- if (cstr) {
- PyErr_Format(PyExc_TypeError, "a '%s' is expected, '%s(%s)' is received",
- type, otype, cstr);
- SWIG_Python_str_DelForPy3(cstr);
- } else {
- PyErr_Format(PyExc_TypeError, "a '%s' is expected, '%s' is received",
- type, otype);
- }
- Py_XDECREF(str);
- return;
- }
- }
- PyErr_Format(PyExc_TypeError, "a '%s' is expected", type);
- } else {
- PyErr_Format(PyExc_TypeError, "unexpected type is received");
- }
-}
-
-
-/* Convert a pointer value, signal an exception on a type mismatch */
-SWIGRUNTIME void *
-SWIG_Python_MustGetPtr(PyObject *obj, swig_type_info *ty, int SWIGUNUSEDPARM(argnum), int flags) {
- void *result;
- if (SWIG_Python_ConvertPtr(obj, &result, ty, flags) == -1) {
- PyErr_Clear();
-#if SWIG_POINTER_EXCEPTION
- if (flags) {
- SWIG_Python_TypeError(SWIG_TypePrettyName(ty), obj);
- SWIG_Python_ArgFail(argnum);
- }
-#endif
- }
- return result;
-}
-
-SWIGRUNTIME int
-SWIG_Python_NonDynamicSetAttr(PyObject *obj, PyObject *name, PyObject *value) {
- PyTypeObject *tp = obj->ob_type;
- PyObject *descr;
- PyObject *encoded_name;
- descrsetfunc f;
- int res;
-
-#ifdef Py_USING_UNICODE
- if (PyString_Check(name)) {
- name = PyUnicode_Decode(PyString_AsString(name), PyString_Size(name), NULL, NULL);
- if (!name)
- return -1;
- } else if (!PyUnicode_Check(name))
-#else
- if (!PyString_Check(name))
-#endif
- {
- PyErr_Format(PyExc_TypeError, "attribute name must be string, not '%.200s'", name->ob_type->tp_name);
- return -1;
- } else {
- Py_INCREF(name);
- }
-
- if (!tp->tp_dict) {
- if (PyType_Ready(tp) < 0)
- goto done;
- }
-
- res = -1;
- descr = _PyType_Lookup(tp, name);
- f = NULL;
- if (descr != NULL)
- f = descr->ob_type->tp_descr_set;
- if (!f) {
- if (PyString_Check(name)) {
- encoded_name = name;
- Py_INCREF(name);
- } else {
- encoded_name = PyUnicode_AsUTF8String(name);
- }
- PyErr_Format(PyExc_AttributeError, "'%.100s' object has no attribute '%.200s'", tp->tp_name, PyString_AsString(encoded_name));
- Py_DECREF(encoded_name);
- } else {
- res = f(descr, obj, value);
- }
-
- done:
- Py_DECREF(name);
- return res;
-}
-
-
-#ifdef __cplusplus
-}
-#endif
-
-#define SWIGPY_UNARYFUNC_CLOSURE(wrapper) \
-SWIGINTERN PyObject * \
-wrapper##_closure(PyObject *a) { \
- return wrapper(a, NULL); \
-}
-
-#define SWIGPY_DESTRUCTOR_CLOSURE(wrapper) \
-SWIGINTERN void \
-wrapper##_closure(PyObject *a) { \
- SwigPyObject *sobj; \
- sobj = (SwigPyObject *)a; \
- if (sobj->own) { \
- PyObject *o = wrapper(a, NULL); \
- Py_XDECREF(o); \
- } \
-}
-
-#define SWIGPY_INQUIRY_CLOSURE(wrapper) \
-SWIGINTERN int \
-wrapper##_closure(PyObject *a) { \
- PyObject *pyresult; \
- int result; \
- pyresult = wrapper(a, NULL); \
- result = pyresult && PyObject_IsTrue(pyresult) ? 1 : 0; \
- Py_XDECREF(pyresult); \
- return result; \
-}
-
-#define SWIGPY_BINARYFUNC_CLOSURE(wrapper) \
-SWIGINTERN PyObject * \
-wrapper##_closure(PyObject *a, PyObject *b) { \
- PyObject *tuple, *result; \
- tuple = PyTuple_New(1); \
- assert(tuple); \
- PyTuple_SET_ITEM(tuple, 0, b); \
- Py_XINCREF(b); \
- result = wrapper(a, tuple); \
- Py_DECREF(tuple); \
- return result; \
-}
-
-#define SWIGPY_TERNARYFUNC_CLOSURE(wrapper) \
-SWIGINTERN PyObject * \
-wrapper##_closure(PyObject *a, PyObject *b, PyObject *c) { \
- PyObject *tuple, *result; \
- tuple = PyTuple_New(2); \
- assert(tuple); \
- PyTuple_SET_ITEM(tuple, 0, b); \
- PyTuple_SET_ITEM(tuple, 1, c); \
- Py_XINCREF(b); \
- Py_XINCREF(c); \
- result = wrapper(a, tuple); \
- Py_DECREF(tuple); \
- return result; \
-}
-
-#define SWIGPY_LENFUNC_CLOSURE(wrapper) \
-SWIGINTERN Py_ssize_t \
-wrapper##_closure(PyObject *a) { \
- PyObject *resultobj; \
- Py_ssize_t result; \
- resultobj = wrapper(a, NULL); \
- result = PyNumber_AsSsize_t(resultobj, NULL); \
- Py_DECREF(resultobj); \
- return result; \
-}
-
-#define SWIGPY_SSIZESSIZEARGFUNC_CLOSURE(wrapper) \
-SWIGINTERN PyObject * \
-wrapper##_closure(PyObject *a, Py_ssize_t b, Py_ssize_t c) { \
- PyObject *tuple, *result; \
- tuple = PyTuple_New(2); \
- assert(tuple); \
- PyTuple_SET_ITEM(tuple, 0, _PyLong_FromSsize_t(b)); \
- PyTuple_SET_ITEM(tuple, 1, _PyLong_FromSsize_t(c)); \
- result = wrapper(a, tuple); \
- Py_DECREF(tuple); \
- return result; \
-}
-
-#define SWIGPY_SSIZESSIZEOBJARGPROC_CLOSURE(wrapper) \
-SWIGINTERN int \
-wrapper##_closure(PyObject *a, Py_ssize_t b, Py_ssize_t c, PyObject *d) { \
- PyObject *tuple, *resultobj; \
- int result; \
- tuple = PyTuple_New(d ? 3 : 2); \
- assert(tuple); \
- PyTuple_SET_ITEM(tuple, 0, _PyLong_FromSsize_t(b)); \
- PyTuple_SET_ITEM(tuple, 1, _PyLong_FromSsize_t(c)); \
- if (d) { \
- PyTuple_SET_ITEM(tuple, 2, d); \
- Py_INCREF(d); \
- } \
- resultobj = wrapper(a, tuple); \
- result = resultobj ? 0 : -1; \
- Py_DECREF(tuple); \
- Py_XDECREF(resultobj); \
- return result; \
-}
-
-#define SWIGPY_SSIZEARGFUNC_CLOSURE(wrapper) \
-SWIGINTERN PyObject * \
-wrapper##_closure(PyObject *a, Py_ssize_t b) { \
- PyObject *tuple, *result; \
- tuple = PyTuple_New(1); \
- assert(tuple); \
- PyTuple_SET_ITEM(tuple, 0, _PyLong_FromSsize_t(b)); \
- result = wrapper(a, tuple); \
- Py_DECREF(tuple); \
- return result; \
-}
-
-#define SWIGPY_FUNPACK_SSIZEARGFUNC_CLOSURE(wrapper) \
-SWIGINTERN PyObject * \
-wrapper##_closure(PyObject *a, Py_ssize_t b) { \
- PyObject *arg, *result; \
- arg = _PyLong_FromSsize_t(b); \
- result = wrapper(a, arg); \
- Py_DECREF(arg); \
- return result; \
-}
-
-#define SWIGPY_SSIZEOBJARGPROC_CLOSURE(wrapper) \
-SWIGINTERN int \
-wrapper##_closure(PyObject *a, Py_ssize_t b, PyObject *c) { \
- PyObject *tuple, *resultobj; \
- int result; \
- tuple = PyTuple_New(2); \
- assert(tuple); \
- PyTuple_SET_ITEM(tuple, 0, _PyLong_FromSsize_t(b)); \
- PyTuple_SET_ITEM(tuple, 1, c); \
- Py_XINCREF(c); \
- resultobj = wrapper(a, tuple); \
- result = resultobj ? 0 : -1; \
- Py_XDECREF(resultobj); \
- Py_DECREF(tuple); \
- return result; \
-}
-
-#define SWIGPY_OBJOBJARGPROC_CLOSURE(wrapper) \
-SWIGINTERN int \
-wrapper##_closure(PyObject *a, PyObject *b, PyObject *c) { \
- PyObject *tuple, *resultobj; \
- int result; \
- tuple = PyTuple_New(c ? 2 : 1); \
- assert(tuple); \
- PyTuple_SET_ITEM(tuple, 0, b); \
- Py_XINCREF(b); \
- if (c) { \
- PyTuple_SET_ITEM(tuple, 1, c); \
- Py_XINCREF(c); \
- } \
- resultobj = wrapper(a, tuple); \
- result = resultobj ? 0 : -1; \
- Py_XDECREF(resultobj); \
- Py_DECREF(tuple); \
- return result; \
-}
-
-#define SWIGPY_REPRFUNC_CLOSURE(wrapper) \
-SWIGINTERN PyObject * \
-wrapper##_closure(PyObject *a) { \
- return wrapper(a, NULL); \
-}
-
-#define SWIGPY_HASHFUNC_CLOSURE(wrapper) \
-SWIGINTERN long \
-wrapper##_closure(PyObject *a) { \
- PyObject *pyresult; \
- long result; \
- pyresult = wrapper(a, NULL); \
- if (!pyresult || !PyLong_Check(pyresult)) \
- return -1; \
- result = PyLong_AsLong(pyresult); \
- Py_DECREF(pyresult); \
- return result; \
-}
-
-#define SWIGPY_ITERNEXT_CLOSURE(wrapper) \
-SWIGINTERN PyObject * \
-wrapper##_closure(PyObject *a) { \
- PyObject *result; \
- result = wrapper(a, NULL); \
- if (result && result == Py_None) { \
- Py_DECREF(result); \
- result = NULL; \
- } \
- return result; \
-}
-
-#ifdef __cplusplus
-extern "C" {
-#endif
-
-SWIGINTERN int
-SwigPyBuiltin_BadInit(PyObject *self, PyObject *SWIGUNUSEDPARM(args), PyObject *SWIGUNUSEDPARM(kwds)) {
- PyErr_Format(PyExc_TypeError, "Cannot create new instances of type '%.300s'", self->ob_type->tp_name);
- return -1;
-}
-
-SWIGINTERN void
-SwigPyBuiltin_BadDealloc(PyObject *pyobj) {
- SwigPyObject *sobj;
- sobj = (SwigPyObject *)pyobj;
- if (sobj->own) {
- PyErr_Format(PyExc_TypeError, "Swig detected a memory leak in type '%.300s': no callable destructor found.", pyobj->ob_type->tp_name);
- }
-}
-
-typedef struct {
- PyCFunction get;
- PyCFunction set;
-} SwigPyGetSet;
-
-SWIGINTERN PyObject *
-SwigPyBuiltin_GetterClosure (PyObject *obj, void *closure) {
- SwigPyGetSet *getset;
- PyObject *tuple, *result;
- if (!closure)
- return SWIG_Py_Void();
- getset = (SwigPyGetSet *)closure;
- if (!getset->get)
- return SWIG_Py_Void();
- tuple = PyTuple_New(0);
- assert(tuple);
- result = (*getset->get)(obj, tuple);
- Py_DECREF(tuple);
- return result;
-}
-
-SWIGINTERN PyObject *
-SwigPyBuiltin_FunpackGetterClosure (PyObject *obj, void *closure) {
- SwigPyGetSet *getset;
- PyObject *result;
- if (!closure)
- return SWIG_Py_Void();
- getset = (SwigPyGetSet *)closure;
- if (!getset->get)
- return SWIG_Py_Void();
- result = (*getset->get)(obj, NULL);
- return result;
-}
-
-SWIGINTERN int
-SwigPyBuiltin_SetterClosure (PyObject *obj, PyObject *val, void *closure) {
- SwigPyGetSet *getset;
- PyObject *tuple, *result;
- if (!closure) {
- PyErr_Format(PyExc_TypeError, "Missing getset closure");
- return -1;
- }
- getset = (SwigPyGetSet *)closure;
- if (!getset->set) {
- PyErr_Format(PyExc_TypeError, "Illegal member variable assignment in type '%.300s'", obj->ob_type->tp_name);
- return -1;
- }
- tuple = PyTuple_New(1);
- assert(tuple);
- PyTuple_SET_ITEM(tuple, 0, val);
- Py_XINCREF(val);
- result = (*getset->set)(obj, tuple);
- Py_DECREF(tuple);
- Py_XDECREF(result);
- return result ? 0 : -1;
-}
-
-SWIGINTERN int
-SwigPyBuiltin_FunpackSetterClosure (PyObject *obj, PyObject *val, void *closure) {
- SwigPyGetSet *getset;
- PyObject *result;
- if (!closure) {
- PyErr_Format(PyExc_TypeError, "Missing getset closure");
- return -1;
- }
- getset = (SwigPyGetSet *)closure;
- if (!getset->set) {
- PyErr_Format(PyExc_TypeError, "Illegal member variable assignment in type '%.300s'", obj->ob_type->tp_name);
- return -1;
- }
- result = (*getset->set)(obj, val);
- Py_XDECREF(result);
- return result ? 0 : -1;
-}
-
-SWIGINTERN void
-SwigPyStaticVar_dealloc(PyDescrObject *descr) {
- _PyObject_GC_UNTRACK(descr);
- Py_XDECREF(PyDescr_TYPE(descr));
- Py_XDECREF(PyDescr_NAME(descr));
- PyObject_GC_Del(descr);
-}
-
-SWIGINTERN PyObject *
-SwigPyStaticVar_repr(PyGetSetDescrObject *descr) {
-#if PY_VERSION_HEX >= 0x03000000
-
- return PyUnicode_FromFormat("<class attribute '%S' of type '%s'>", PyDescr_NAME(descr), PyDescr_TYPE(descr)->tp_name);
-#else
- return PyString_FromFormat("<class attribute '%s' of type '%s'>", PyString_AsString(PyDescr_NAME(descr)), PyDescr_TYPE(descr)->tp_name);
-#endif
-}
-
-SWIGINTERN int
-SwigPyStaticVar_traverse(PyObject *self, visitproc visit, void *arg) {
- PyDescrObject *descr;
- descr = (PyDescrObject *)self;
- Py_VISIT((PyObject*) PyDescr_TYPE(descr));
- return 0;
-}
-
-SWIGINTERN PyObject *
-SwigPyStaticVar_get(PyGetSetDescrObject *descr, PyObject *obj, PyObject *SWIGUNUSEDPARM(type)) {
- if (descr->d_getset->get != NULL)
- return descr->d_getset->get(obj, descr->d_getset->closure);
-#if PY_VERSION_HEX >= 0x03000000
- PyErr_Format(PyExc_AttributeError, "attribute '%.300S' of '%.100s' objects is not readable", PyDescr_NAME(descr), PyDescr_TYPE(descr)->tp_name);
-#else
- PyErr_Format(PyExc_AttributeError, "attribute '%.300s' of '%.100s' objects is not readable", PyString_AsString(PyDescr_NAME(descr)), PyDescr_TYPE(descr)->tp_name);
-#endif
- return NULL;
-}
-
-SWIGINTERN int
-SwigPyStaticVar_set(PyGetSetDescrObject *descr, PyObject *obj, PyObject *value) {
- if (descr->d_getset->set != NULL)
- return descr->d_getset->set(obj, value, descr->d_getset->closure);
-#if PY_VERSION_HEX >= 0x03000000
- PyErr_Format(PyExc_AttributeError, "attribute '%.300S' of '%.100s' objects is not writable", PyDescr_NAME(descr), PyDescr_TYPE(descr)->tp_name);
-#else
- PyErr_Format(PyExc_AttributeError, "attribute '%.300s' of '%.100s' objects is not writable", PyString_AsString(PyDescr_NAME(descr)), PyDescr_TYPE(descr)->tp_name);
-#endif
- return -1;
-}
-
-SWIGINTERN int
-SwigPyObjectType_setattro(PyTypeObject *type, PyObject *name, PyObject *value) {
- PyObject *attribute;
- descrsetfunc local_set;
- attribute = _PyType_Lookup(type, name);
- if (attribute != NULL) {
- /* Implement descriptor functionality, if any */
- local_set = attribute->ob_type->tp_descr_set;
- if (local_set != NULL)
- return local_set(attribute, (PyObject *)type, value);
-#if PY_VERSION_HEX >= 0x03000000
- PyErr_Format(PyExc_AttributeError, "cannot modify read-only attribute '%.50s.%.400S'", type->tp_name, name);
-#else
- PyErr_Format(PyExc_AttributeError, "cannot modify read-only attribute '%.50s.%.400s'", type->tp_name, PyString_AS_STRING(name));
-#endif
- } else {
-#if PY_VERSION_HEX >= 0x03000000
- PyErr_Format(PyExc_AttributeError, "type '%.50s' has no attribute '%.400S'", type->tp_name, name);
-#else
- PyErr_Format(PyExc_AttributeError, "type '%.50s' has no attribute '%.400s'", type->tp_name, PyString_AS_STRING(name));
-#endif
- }
-
- return -1;
-}
-
-SWIGINTERN PyTypeObject*
-SwigPyStaticVar_Type(void) {
- static PyTypeObject staticvar_type;
- static int type_init = 0;
- if (!type_init) {
- const PyTypeObject tmp = {
- /* PyObject header changed in Python 3 */
-#if PY_VERSION_HEX >= 0x03000000
- PyVarObject_HEAD_INIT(&PyType_Type, 0)
-#else
- PyObject_HEAD_INIT(&PyType_Type)
- 0,
-#endif
- "swig_static_var_getset_descriptor",
- sizeof(PyGetSetDescrObject),
- 0,
- (destructor)SwigPyStaticVar_dealloc, /* tp_dealloc */
- 0, /* tp_print */
- 0, /* tp_getattr */
- 0, /* tp_setattr */
- 0, /* tp_compare */
- (reprfunc)SwigPyStaticVar_repr, /* tp_repr */
- 0, /* tp_as_number */
- 0, /* tp_as_sequence */
- 0, /* tp_as_mapping */
- 0, /* tp_hash */
- 0, /* tp_call */
- 0, /* tp_str */
- PyObject_GenericGetAttr, /* tp_getattro */
- 0, /* tp_setattro */
- 0, /* tp_as_buffer */
- Py_TPFLAGS_DEFAULT|Py_TPFLAGS_HAVE_GC|Py_TPFLAGS_HAVE_CLASS, /* tp_flags */
- 0, /* tp_doc */
- SwigPyStaticVar_traverse, /* tp_traverse */
- 0, /* tp_clear */
- 0, /* tp_richcompare */
- 0, /* tp_weaklistoffset */
- 0, /* tp_iter */
- 0, /* tp_iternext */
- 0, /* tp_methods */
- 0, /* tp_members */
- 0, /* tp_getset */
- 0, /* tp_base */
- 0, /* tp_dict */
- (descrgetfunc)SwigPyStaticVar_get, /* tp_descr_get */
- (descrsetfunc)SwigPyStaticVar_set, /* tp_descr_set */
- 0, /* tp_dictoffset */
- 0, /* tp_init */
- 0, /* tp_alloc */
- 0, /* tp_new */
- 0, /* tp_free */
- 0, /* tp_is_gc */
- 0, /* tp_bases */
- 0, /* tp_mro */
- 0, /* tp_cache */
- 0, /* tp_subclasses */
- 0, /* tp_weaklist */
-#if PY_VERSION_HEX >= 0x02030000
- 0, /* tp_del */
-#endif
-#if PY_VERSION_HEX >= 0x02060000
- 0, /* tp_version */
-#endif
-#ifdef COUNT_ALLOCS
- 0,0,0,0 /* tp_alloc -> tp_next */
-#endif
- };
- staticvar_type = tmp;
- type_init = 1;
-#if PY_VERSION_HEX < 0x02020000
- staticvar_type.ob_type = &PyType_Type;
-#else
- if (PyType_Ready(&staticvar_type) < 0)
- return NULL;
-#endif
- }
- return &staticvar_type;
-}
-
-SWIGINTERN PyGetSetDescrObject *
-SwigPyStaticVar_new_getset(PyTypeObject *type, PyGetSetDef *getset) {
-
- PyGetSetDescrObject *descr;
- descr = (PyGetSetDescrObject *)PyType_GenericAlloc(SwigPyStaticVar_Type(), 0);
- assert(descr);
- Py_XINCREF(type);
- PyDescr_TYPE(descr) = type;
- PyDescr_NAME(descr) = PyString_InternFromString(getset->name);
- descr->d_getset = getset;
- if (PyDescr_NAME(descr) == NULL) {
- Py_DECREF(descr);
- descr = NULL;
- }
- return descr;
-}
-
-SWIGINTERN void
-SwigPyBuiltin_InitBases (PyTypeObject *type, PyTypeObject **bases) {
- int base_count = 0;
- PyTypeObject **b;
- PyObject *tuple;
- int i;
-
- if (!bases[0]) {
- bases[0] = SwigPyObject_type();
- bases[1] = NULL;
- }
- type->tp_base = bases[0];
- Py_INCREF((PyObject *)bases[0]);
- for (b = bases; *b != NULL; ++b)
- ++base_count;
- tuple = PyTuple_New(base_count);
- for (i = 0; i < base_count; ++i) {
- PyTuple_SET_ITEM(tuple, i, (PyObject *)bases[i]);
- Py_INCREF((PyObject *)bases[i]);
- }
- type->tp_bases = tuple;
-}
-
-SWIGINTERN PyObject *
-SwigPyBuiltin_ThisClosure (PyObject *self, void *SWIGUNUSEDPARM(closure)) {
- PyObject *result;
- result = (PyObject *)SWIG_Python_GetSwigThis(self);
- Py_XINCREF(result);
- return result;
-}
-
-SWIGINTERN void
-SwigPyBuiltin_SetMetaType (PyTypeObject *type, PyTypeObject *metatype)
-{
-#if PY_VERSION_HEX >= 0x03000000
- type->ob_base.ob_base.ob_type = metatype;
-#else
- type->ob_type = metatype;
-#endif
-}
-
-#ifdef __cplusplus
-}
-#endif
-
-
-
-#define SWIG_exception_fail(code, msg) do { SWIG_Error(code, msg); SWIG_fail; } while(0)
-
-#define SWIG_contract_assert(expr, msg) if (!(expr)) { SWIG_Error(SWIG_RuntimeError, msg); SWIG_fail; } else
-
-
-
-/* -------- TYPES TABLE (BEGIN) -------- */
-
-#define SWIGTYPE_p_SwigPyObject swig_types[0]
-#define SWIGTYPE_p__THyPhy swig_types[1]
-#define SWIGTYPE_p__THyPhyMatrix swig_types[2]
-#define SWIGTYPE_p__THyPhyNumber swig_types[3]
-#define SWIGTYPE_p__THyPhyReturnObject swig_types[4]
-#define SWIGTYPE_p__THyPhyString swig_types[5]
-#define SWIGTYPE_p_char swig_types[6]
-#define SWIGTYPE_p_double swig_types[7]
-#define SWIGTYPE_p_f_p_char_int_double__bool swig_types[8]
-#define SWIGTYPE_p_void swig_types[9]
-static swig_type_info *swig_types[11];
-static swig_module_info swig_module = {swig_types, 10, 0, 0, 0, 0};
-#define SWIG_TypeQuery(name) SWIG_TypeQueryModule(&swig_module, &swig_module, name)
-#define SWIG_MangledTypeQuery(name) SWIG_MangledTypeQueryModule(&swig_module, &swig_module, name)
-
-/* -------- TYPES TABLE (END) -------- */
-
-#if (PY_VERSION_HEX <= 0x02000000)
-# if !defined(SWIG_PYTHON_CLASSIC)
-# error "This python version requires swig to be run with the '-classic' option"
-# endif
-#endif
-
-/*-----------------------------------------------
- @(target):= _HyPhy.so
- ------------------------------------------------*/
-#if PY_VERSION_HEX >= 0x03000000
-# define SWIG_init PyInit__HyPhy
-
-#else
-# define SWIG_init init_HyPhy
-
-#endif
-#define SWIG_name "_HyPhy"
-
-#define SWIGVERSION 0x020004
-#define SWIG_VERSION SWIGVERSION
-
-
-#define SWIG_as_voidptr(a) const_cast< void * >(static_cast< const void * >(a))
-#define SWIG_as_voidptrptr(a) ((void)SWIG_as_voidptr(*a),reinterpret_cast< void** >(a))
-
-
-#include <stdexcept>
-
-
-namespace swig {
- class SwigPtr_PyObject {
- protected:
- PyObject *_obj;
-
- public:
- SwigPtr_PyObject() :_obj(0)
- {
- }
-
- SwigPtr_PyObject(const SwigPtr_PyObject& item) : _obj(item._obj)
- {
- Py_XINCREF(_obj);
- }
-
- SwigPtr_PyObject(PyObject *obj, bool initial_ref = true) :_obj(obj)
- {
- if (initial_ref) {
- Py_XINCREF(_obj);
- }
- }
-
- SwigPtr_PyObject & operator=(const SwigPtr_PyObject& item)
- {
- Py_XINCREF(item._obj);
- Py_XDECREF(_obj);
- _obj = item._obj;
- return *this;
- }
-
- ~SwigPtr_PyObject()
- {
- Py_XDECREF(_obj);
- }
-
- operator PyObject *() const
- {
- return _obj;
- }
-
- PyObject *operator->() const
- {
- return _obj;
- }
- };
-}
-
-
-namespace swig {
- struct SwigVar_PyObject : SwigPtr_PyObject {
- SwigVar_PyObject(PyObject* obj = 0) : SwigPtr_PyObject(obj, false) { }
-
- SwigVar_PyObject & operator = (PyObject* obj)
- {
- Py_XDECREF(_obj);
- _obj = obj;
- return *this;
- }
- };
-}
-
-
-#include "THyPhy.h"
-
-
- #define SWIG_From_long PyInt_FromLong
-
-
-SWIGINTERNINLINE PyObject *
-SWIG_From_int (int value)
-{
- return SWIG_From_long (value);
-}
-
-
-SWIGINTERN swig_type_info*
-SWIG_pchar_descriptor(void)
-{
- static int init = 0;
- static swig_type_info* info = 0;
- if (!init) {
- info = SWIG_TypeQuery("_p_char");
- init = 1;
- }
- return info;
-}
-
-
-SWIGINTERN int
-SWIG_AsCharPtrAndSize(PyObject *obj, char** cptr, size_t* psize, int *alloc)
-{
-#if PY_VERSION_HEX>=0x03000000
- if (PyUnicode_Check(obj))
-#else
- if (PyString_Check(obj))
-#endif
- {
- char *cstr; Py_ssize_t len;
-#if PY_VERSION_HEX>=0x03000000
- if (!alloc && cptr) {
- /* We can't allow converting without allocation, since the internal
- representation of string in Python 3 is UCS-2/UCS-4 but we require
- a UTF-8 representation.
- TODO(bhy) More detailed explanation */
- return SWIG_RuntimeError;
- }
- obj = PyUnicode_AsUTF8String(obj);
- PyBytes_AsStringAndSize(obj, &cstr, &len);
- if(alloc) *alloc = SWIG_NEWOBJ;
-#else
- PyString_AsStringAndSize(obj, &cstr, &len);
-#endif
- if (cptr) {
- if (alloc) {
- /*
- In python the user should not be able to modify the inner
- string representation. To warranty that, if you define
- SWIG_PYTHON_SAFE_CSTRINGS, a new/copy of the python string
- buffer is always returned.
-
- The default behavior is just to return the pointer value,
- so, be careful.
- */
-#if defined(SWIG_PYTHON_SAFE_CSTRINGS)
- if (*alloc != SWIG_OLDOBJ)
-#else
- if (*alloc == SWIG_NEWOBJ)
-#endif
- {
- *cptr = reinterpret_cast< char* >(memcpy((new char[len + 1]), cstr, sizeof(char)*(len + 1)));
- *alloc = SWIG_NEWOBJ;
- }
- else {
- *cptr = cstr;
- *alloc = SWIG_OLDOBJ;
- }
- } else {
- #if PY_VERSION_HEX>=0x03000000
- assert(0); /* Should never reach here in Python 3 */
- #endif
- *cptr = SWIG_Python_str_AsChar(obj);
- }
- }
- if (psize) *psize = len + 1;
-#if PY_VERSION_HEX>=0x03000000
- Py_XDECREF(obj);
-#endif
- return SWIG_OK;
- } else {
- swig_type_info* pchar_descriptor = SWIG_pchar_descriptor();
- if (pchar_descriptor) {
- void* vptr = 0;
- if (SWIG_ConvertPtr(obj, &vptr, pchar_descriptor, 0) == SWIG_OK) {
- if (cptr) *cptr = (char *) vptr;
- if (psize) *psize = vptr ? (strlen((char *)vptr) + 1) : 0;
- if (alloc) *alloc = SWIG_OLDOBJ;
- return SWIG_OK;
- }
- }
- }
- return SWIG_TypeError;
-}
-
-
-
-
-
-SWIGINTERN int
-SWIG_AsVal_double (PyObject *obj, double *val)
-{
- int res = SWIG_TypeError;
- if (PyFloat_Check(obj)) {
- if (val) *val = PyFloat_AsDouble(obj);
- return SWIG_OK;
- } else if (PyInt_Check(obj)) {
- if (val) *val = PyInt_AsLong(obj);
- return SWIG_OK;
- } else if (PyLong_Check(obj)) {
- double v = PyLong_AsDouble(obj);
- if (!PyErr_Occurred()) {
- if (val) *val = v;
- return SWIG_OK;
- } else {
- PyErr_Clear();
- }
- }
-#ifdef SWIG_PYTHON_CAST_MODE
- {
- int dispatch = 0;
- double d = PyFloat_AsDouble(obj);
- if (!PyErr_Occurred()) {
- if (val) *val = d;
- return SWIG_AddCast(SWIG_OK);
- } else {
- PyErr_Clear();
- }
- if (!dispatch) {
- long v = PyLong_AsLong(obj);
- if (!PyErr_Occurred()) {
- if (val) *val = v;
- return SWIG_AddCast(SWIG_AddCast(SWIG_OK));
- } else {
- PyErr_Clear();
- }
- }
- }
-#endif
- return res;
-}
-
-
-#include <float.h>
-
-
-#include <math.h>
-
-
-SWIGINTERNINLINE int
-SWIG_CanCastAsInteger(double *d, double min, double max) {
- double x = *d;
- if ((min <= x && x <= max)) {
- double fx = floor(x);
- double cx = ceil(x);
- double rd = ((x - fx) < 0.5) ? fx : cx; /* simple rint */
- if ((errno == EDOM) || (errno == ERANGE)) {
- errno = 0;
- } else {
- double summ, reps, diff;
- if (rd < x) {
- diff = x - rd;
- } else if (rd > x) {
- diff = rd - x;
- } else {
- return 1;
- }
- summ = rd + x;
- reps = diff/summ;
- if (reps < 8*DBL_EPSILON) {
- *d = rd;
- return 1;
- }
- }
- }
- return 0;
-}
-
-
-SWIGINTERN int
-SWIG_AsVal_long (PyObject *obj, long* val)
-{
- if (PyInt_Check(obj)) {
- if (val) *val = PyInt_AsLong(obj);
- return SWIG_OK;
- } else if (PyLong_Check(obj)) {
- long v = PyLong_AsLong(obj);
- if (!PyErr_Occurred()) {
- if (val) *val = v;
- return SWIG_OK;
- } else {
- PyErr_Clear();
- }
- }
-#ifdef SWIG_PYTHON_CAST_MODE
- {
- int dispatch = 0;
- long v = PyInt_AsLong(obj);
- if (!PyErr_Occurred()) {
- if (val) *val = v;
- return SWIG_AddCast(SWIG_OK);
- } else {
- PyErr_Clear();
- }
- if (!dispatch) {
- double d;
- int res = SWIG_AddCast(SWIG_AsVal_double (obj,&d));
- if (SWIG_IsOK(res) && SWIG_CanCastAsInteger(&d, LONG_MIN, LONG_MAX)) {
- if (val) *val = (long)(d);
- return res;
- }
- }
- }
-#endif
- return SWIG_TypeError;
-}
-
-
-SWIGINTERNINLINE PyObject *
-SWIG_FromCharPtrAndSize(const char* carray, size_t size)
-{
- if (carray) {
- if (size > INT_MAX) {
- swig_type_info* pchar_descriptor = SWIG_pchar_descriptor();
- return pchar_descriptor ?
- SWIG_InternalNewPointerObj(const_cast< char * >(carray), pchar_descriptor, 0) : SWIG_Py_Void();
- } else {
-#if PY_VERSION_HEX >= 0x03000000
- return PyUnicode_FromStringAndSize(carray, static_cast< int >(size));
-#else
- return PyString_FromStringAndSize(carray, static_cast< int >(size));
-#endif
- }
- } else {
- return SWIG_Py_Void();
- }
-}
-
-
-SWIGINTERNINLINE PyObject *
-SWIG_FromCharPtr(const char *cptr)
-{
- return SWIG_FromCharPtrAndSize(cptr, (cptr ? strlen(cptr) : 0));
-}
-
-
- #define SWIG_From_double PyFloat_FromDouble
-
-
-SWIGINTERN int
-SWIG_AsVal_bool (PyObject *obj, bool *val)
-{
- int r = PyObject_IsTrue(obj);
- if (r == -1)
- return SWIG_ERROR;
- if (val) *val = r ? true : false;
- return SWIG_OK;
-}
-
-
-#include <limits.h>
-#if !defined(SWIG_NO_LLONG_MAX)
-# if !defined(LLONG_MAX) && defined(__GNUC__) && defined (__LONG_LONG_MAX__)
-# define LLONG_MAX __LONG_LONG_MAX__
-# define LLONG_MIN (-LLONG_MAX - 1LL)
-# define ULLONG_MAX (LLONG_MAX * 2ULL + 1ULL)
-# endif
-#endif
-
-
-SWIGINTERN int
-SWIG_AsVal_int (PyObject * obj, int *val)
-{
- long v;
- int res = SWIG_AsVal_long (obj, &v);
- if (SWIG_IsOK(res)) {
- if ((v < INT_MIN || v > INT_MAX)) {
- return SWIG_OverflowError;
- } else {
- if (val) *val = static_cast< int >(v);
- }
- }
- return res;
-}
-
-
-SWIGINTERNINLINE PyObject*
- SWIG_From_bool (bool value)
-{
- return PyBool_FromLong(value ? 1 : 0);
-}
-
-#ifdef __cplusplus
-extern "C" {
-#endif
-SWIGINTERN PyObject *_wrap__THyPhyReturnObject_myType(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyReturnObject *arg1 = (_THyPhyReturnObject *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- int result;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhyReturnObject, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyReturnObject_myType" "', argument " "1"" of type '" "_THyPhyReturnObject *""'");
- }
- arg1 = reinterpret_cast< _THyPhyReturnObject * >(argp1);
- result = (int)(arg1)->myType();
- resultobj = SWIG_From_int(static_cast< int >(result));
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap_delete__THyPhyReturnObject(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyReturnObject *arg1 = (_THyPhyReturnObject *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhyReturnObject, SWIG_POINTER_DISOWN | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "delete__THyPhyReturnObject" "', argument " "1"" of type '" "_THyPhyReturnObject *""'");
- }
- arg1 = reinterpret_cast< _THyPhyReturnObject * >(argp1);
- delete arg1;
- resultobj = SWIG_Py_Void();
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhyReturnObject_castToString(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyReturnObject *arg1 = (_THyPhyReturnObject *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- _THyPhyString *result = 0 ;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhyReturnObject, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyReturnObject_castToString" "', argument " "1"" of type '" "_THyPhyReturnObject *""'");
- }
- arg1 = reinterpret_cast< _THyPhyReturnObject * >(argp1);
- result = (_THyPhyString *)(arg1)->castToString();
- resultobj = SWIG_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhyString, 0 | 0 );
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhyReturnObject_castToNumber(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyReturnObject *arg1 = (_THyPhyReturnObject *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- _THyPhyNumber *result = 0 ;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhyReturnObject, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyReturnObject_castToNumber" "', argument " "1"" of type '" "_THyPhyReturnObject *""'");
- }
- arg1 = reinterpret_cast< _THyPhyReturnObject * >(argp1);
- result = (_THyPhyNumber *)(arg1)->castToNumber();
- resultobj = SWIG_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhyNumber, 0 | 0 );
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhyReturnObject_castToMatrix(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyReturnObject *arg1 = (_THyPhyReturnObject *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- _THyPhyMatrix *result = 0 ;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhyReturnObject, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyReturnObject_castToMatrix" "', argument " "1"" of type '" "_THyPhyReturnObject *""'");
- }
- arg1 = reinterpret_cast< _THyPhyReturnObject * >(argp1);
- result = (_THyPhyMatrix *)(arg1)->castToMatrix();
- resultobj = SWIG_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhyMatrix, 0 | 0 );
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN int _wrap_new__THyPhyString__SWIG_0(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- char *arg1 = (char *) 0 ;
- long arg2 ;
- int res1 ;
- char *buf1 = 0 ;
- int alloc1 = 0 ;
- long val2 ;
- int ecode2 = 0 ;
- PyObject * obj1 = 0 ;
- PyObject * obj2 = 0 ;
- _THyPhyString *result = 0 ;
-
- if (!PyArg_ParseTuple(args,(char *)"OO:new__THyPhyString",&obj1,&obj2)) SWIG_fail;
- res1 = SWIG_AsCharPtrAndSize(obj1, &buf1, NULL, &alloc1);
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "new__THyPhyString" "', argument " "1"" of type '" "char const *""'");
- }
- arg1 = reinterpret_cast< char * >(buf1);
- ecode2 = SWIG_AsVal_long(obj2, &val2);
- if (!SWIG_IsOK(ecode2)) {
- SWIG_exception_fail(SWIG_ArgError(ecode2), "in method '" "new__THyPhyString" "', argument " "2"" of type '" "long""'");
- }
- arg2 = static_cast< long >(val2);
- result = (_THyPhyString *)new _THyPhyString((char const *)arg1,arg2);
- resultobj = SWIG_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhyString, SWIG_BUILTIN_INIT | 0 );
- if (alloc1 == SWIG_NEWOBJ) delete[] buf1;
- return resultobj == Py_None ? 1 : 0;
-fail:
- if (alloc1 == SWIG_NEWOBJ) delete[] buf1;
- return -1;
-}
-
-
-SWIGINTERN int _wrap_new__THyPhyString__SWIG_1(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- char *arg1 = (char *) 0 ;
- int res1 ;
- char *buf1 = 0 ;
- int alloc1 = 0 ;
- PyObject * obj1 = 0 ;
- _THyPhyString *result = 0 ;
-
- if (!PyArg_ParseTuple(args,(char *)"O:new__THyPhyString",&obj1)) SWIG_fail;
- res1 = SWIG_AsCharPtrAndSize(obj1, &buf1, NULL, &alloc1);
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "new__THyPhyString" "', argument " "1"" of type '" "char const *""'");
- }
- arg1 = reinterpret_cast< char * >(buf1);
- result = (_THyPhyString *)new _THyPhyString((char const *)arg1);
- resultobj = SWIG_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhyString, SWIG_BUILTIN_INIT | 0 );
- if (alloc1 == SWIG_NEWOBJ) delete[] buf1;
- return resultobj == Py_None ? 1 : 0;
-fail:
- if (alloc1 == SWIG_NEWOBJ) delete[] buf1;
- return -1;
-}
-
-
-SWIGINTERN int _wrap_new__THyPhyString__SWIG_2(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyString *result = 0 ;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- result = (_THyPhyString *)new _THyPhyString();
- resultobj = SWIG_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhyString, SWIG_BUILTIN_INIT | 0 );
- return resultobj == Py_None ? 1 : 0;
-fail:
- return -1;
-}
-
-
-SWIGINTERN int _wrap_new__THyPhyString(PyObject *self, PyObject *args) {
- int argc;
- PyObject *argv[3];
- int ii;
-
- if (!PyTuple_Check(args)) SWIG_fail;
- argc = args ? (int)PyObject_Length(args) : 0;
- for (ii = 0; (ii < 2) && (ii < argc); ii++) {
- argv[ii] = PyTuple_GET_ITEM(args,ii);
- }
- if (argc == 0) {
- return _wrap_new__THyPhyString__SWIG_2(self, args);
- }
- if (argc == 1) {
- int _v;
- int res = SWIG_AsCharPtrAndSize(argv[0], 0, NULL, 0);
- _v = SWIG_CheckState(res);
- if (_v) {
- return _wrap_new__THyPhyString__SWIG_1(self, args);
- }
- }
- if (argc == 2) {
- int _v;
- int res = SWIG_AsCharPtrAndSize(argv[0], 0, NULL, 0);
- _v = SWIG_CheckState(res);
- if (_v) {
- {
- int res = SWIG_AsVal_long(argv[1], NULL);
- _v = SWIG_CheckState(res);
- }
- if (_v) {
- return _wrap_new__THyPhyString__SWIG_0(self, args);
- }
- }
- }
-
-fail:
- SWIG_SetErrorMsg(PyExc_NotImplementedError,"Wrong number or type of arguments for overloaded function 'new__THyPhyString'.\n"
- " Possible C/C++ prototypes are:\n"
- " _THyPhyString::_THyPhyString(char const *,long)\n"
- " _THyPhyString::_THyPhyString(char const *)\n"
- " _THyPhyString::_THyPhyString()\n");
- return -1;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhyString_myType(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyString *arg1 = (_THyPhyString *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- int result;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhyString, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyString_myType" "', argument " "1"" of type '" "_THyPhyString *""'");
- }
- arg1 = reinterpret_cast< _THyPhyString * >(argp1);
- result = (int)(arg1)->myType();
- resultobj = SWIG_From_int(static_cast< int >(result));
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap_delete__THyPhyString(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyString *arg1 = (_THyPhyString *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhyString, SWIG_POINTER_DISOWN | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "delete__THyPhyString" "', argument " "1"" of type '" "_THyPhyString *""'");
- }
- arg1 = reinterpret_cast< _THyPhyString * >(argp1);
- delete arg1;
- resultobj = SWIG_Py_Void();
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhyString_sLength_set(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyString *arg1 = (_THyPhyString *) 0 ;
- long arg2 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- long val2 ;
- int ecode2 = 0 ;
- PyObject * obj1 = 0 ;
-
- if (!PyArg_ParseTuple(args,(char *)"O:_THyPhyString_sLength_set",&obj1)) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhyString, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyString_sLength_set" "', argument " "1"" of type '" "_THyPhyString *""'");
- }
- arg1 = reinterpret_cast< _THyPhyString * >(argp1);
- ecode2 = SWIG_AsVal_long(obj1, &val2);
- if (!SWIG_IsOK(ecode2)) {
- SWIG_exception_fail(SWIG_ArgError(ecode2), "in method '" "_THyPhyString_sLength_set" "', argument " "2"" of type '" "long""'");
- }
- arg2 = static_cast< long >(val2);
- if (arg1) (arg1)->sLength = arg2;
- resultobj = SWIG_Py_Void();
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhyString_sLength_get(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyString *arg1 = (_THyPhyString *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- long result;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhyString, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyString_sLength_get" "', argument " "1"" of type '" "_THyPhyString *""'");
- }
- arg1 = reinterpret_cast< _THyPhyString * >(argp1);
- result = (long) ((arg1)->sLength);
- resultobj = SWIG_From_long(static_cast< long >(result));
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhyString_sData_set(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyString *arg1 = (_THyPhyString *) 0 ;
- char *arg2 = (char *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- int res2 ;
- char *buf2 = 0 ;
- int alloc2 = 0 ;
- PyObject * obj1 = 0 ;
-
- if (!PyArg_ParseTuple(args,(char *)"O:_THyPhyString_sData_set",&obj1)) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhyString, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyString_sData_set" "', argument " "1"" of type '" "_THyPhyString *""'");
- }
- arg1 = reinterpret_cast< _THyPhyString * >(argp1);
- res2 = SWIG_AsCharPtrAndSize(obj1, &buf2, NULL, &alloc2);
- if (!SWIG_IsOK(res2)) {
- SWIG_exception_fail(SWIG_ArgError(res2), "in method '" "_THyPhyString_sData_set" "', argument " "2"" of type '" "char *""'");
- }
- arg2 = reinterpret_cast< char * >(buf2);
- if (arg1->sData) delete[] arg1->sData;
- if (arg2) {
- size_t size = strlen(reinterpret_cast< const char * >(arg2)) + 1;
- arg1->sData = (char *)reinterpret_cast< char* >(memcpy((new char[size]), reinterpret_cast< const char * >(arg2), sizeof(char)*(size)));
- } else {
- arg1->sData = 0;
- }
- resultobj = SWIG_Py_Void();
- if (alloc2 == SWIG_NEWOBJ) delete[] buf2;
- return resultobj;
-fail:
- if (alloc2 == SWIG_NEWOBJ) delete[] buf2;
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhyString_sData_get(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyString *arg1 = (_THyPhyString *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- char *result = 0 ;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhyString, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyString_sData_get" "', argument " "1"" of type '" "_THyPhyString *""'");
- }
- arg1 = reinterpret_cast< _THyPhyString * >(argp1);
- result = (char *) ((arg1)->sData);
- resultobj = SWIG_FromCharPtr((const char *)result);
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN int _wrap_new__THyPhyNumber__SWIG_0(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- double arg1 ;
- double val1 ;
- int ecode1 = 0 ;
- PyObject * obj1 = 0 ;
- _THyPhyNumber *result = 0 ;
-
- if (!PyArg_ParseTuple(args,(char *)"O:new__THyPhyNumber",&obj1)) SWIG_fail;
- ecode1 = SWIG_AsVal_double(obj1, &val1);
- if (!SWIG_IsOK(ecode1)) {
- SWIG_exception_fail(SWIG_ArgError(ecode1), "in method '" "new__THyPhyNumber" "', argument " "1"" of type '" "double""'");
- }
- arg1 = static_cast< double >(val1);
- result = (_THyPhyNumber *)new _THyPhyNumber(arg1);
- resultobj = SWIG_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhyNumber, SWIG_BUILTIN_INIT | 0 );
- return resultobj == Py_None ? 1 : 0;
-fail:
- return -1;
-}
-
-
-SWIGINTERN int _wrap_new__THyPhyNumber__SWIG_1(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyNumber *result = 0 ;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- result = (_THyPhyNumber *)new _THyPhyNumber();
- resultobj = SWIG_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhyNumber, SWIG_BUILTIN_INIT | 0 );
- return resultobj == Py_None ? 1 : 0;
-fail:
- return -1;
-}
-
-
-SWIGINTERN int _wrap_new__THyPhyNumber(PyObject *self, PyObject *args) {
- int argc;
- PyObject *argv[2];
- int ii;
-
- if (!PyTuple_Check(args)) SWIG_fail;
- argc = args ? (int)PyObject_Length(args) : 0;
- for (ii = 0; (ii < 1) && (ii < argc); ii++) {
- argv[ii] = PyTuple_GET_ITEM(args,ii);
- }
- if (argc == 0) {
- return _wrap_new__THyPhyNumber__SWIG_1(self, args);
- }
- if (argc == 1) {
- int _v;
- {
- int res = SWIG_AsVal_double(argv[0], NULL);
- _v = SWIG_CheckState(res);
- }
- if (_v) {
- return _wrap_new__THyPhyNumber__SWIG_0(self, args);
- }
- }
-
-fail:
- SWIG_SetErrorMsg(PyExc_NotImplementedError,"Wrong number or type of arguments for overloaded function 'new__THyPhyNumber'.\n"
- " Possible C/C++ prototypes are:\n"
- " _THyPhyNumber::_THyPhyNumber(double)\n"
- " _THyPhyNumber::_THyPhyNumber()\n");
- return -1;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhyNumber_myType(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyNumber *arg1 = (_THyPhyNumber *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- int result;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhyNumber, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyNumber_myType" "', argument " "1"" of type '" "_THyPhyNumber *""'");
- }
- arg1 = reinterpret_cast< _THyPhyNumber * >(argp1);
- result = (int)(arg1)->myType();
- resultobj = SWIG_From_int(static_cast< int >(result));
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap_delete__THyPhyNumber(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyNumber *arg1 = (_THyPhyNumber *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhyNumber, SWIG_POINTER_DISOWN | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "delete__THyPhyNumber" "', argument " "1"" of type '" "_THyPhyNumber *""'");
- }
- arg1 = reinterpret_cast< _THyPhyNumber * >(argp1);
- delete arg1;
- resultobj = SWIG_Py_Void();
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhyNumber_nValue_set(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyNumber *arg1 = (_THyPhyNumber *) 0 ;
- double arg2 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- double val2 ;
- int ecode2 = 0 ;
- PyObject * obj1 = 0 ;
-
- if (!PyArg_ParseTuple(args,(char *)"O:_THyPhyNumber_nValue_set",&obj1)) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhyNumber, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyNumber_nValue_set" "', argument " "1"" of type '" "_THyPhyNumber *""'");
- }
- arg1 = reinterpret_cast< _THyPhyNumber * >(argp1);
- ecode2 = SWIG_AsVal_double(obj1, &val2);
- if (!SWIG_IsOK(ecode2)) {
- SWIG_exception_fail(SWIG_ArgError(ecode2), "in method '" "_THyPhyNumber_nValue_set" "', argument " "2"" of type '" "double""'");
- }
- arg2 = static_cast< double >(val2);
- if (arg1) (arg1)->nValue = arg2;
- resultobj = SWIG_Py_Void();
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhyNumber_nValue_get(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyNumber *arg1 = (_THyPhyNumber *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- double result;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhyNumber, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyNumber_nValue_get" "', argument " "1"" of type '" "_THyPhyNumber *""'");
- }
- arg1 = reinterpret_cast< _THyPhyNumber * >(argp1);
- result = (double) ((arg1)->nValue);
- resultobj = SWIG_From_double(static_cast< double >(result));
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN int _wrap_new__THyPhyMatrix__SWIG_0(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyMatrix *result = 0 ;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- result = (_THyPhyMatrix *)new _THyPhyMatrix();
- resultobj = SWIG_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhyMatrix, SWIG_BUILTIN_INIT | 0 );
- return resultobj == Py_None ? 1 : 0;
-fail:
- return -1;
-}
-
-
-SWIGINTERN int _wrap_new__THyPhyMatrix__SWIG_1(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- long arg1 ;
- long arg2 ;
- double *arg3 = (double *) 0 ;
- long val1 ;
- int ecode1 = 0 ;
- long val2 ;
- int ecode2 = 0 ;
- void *argp3 = 0 ;
- int res3 = 0 ;
- PyObject * obj1 = 0 ;
- PyObject * obj2 = 0 ;
- PyObject * obj3 = 0 ;
- _THyPhyMatrix *result = 0 ;
-
- if (!PyArg_ParseTuple(args,(char *)"OOO:new__THyPhyMatrix",&obj1,&obj2,&obj3)) SWIG_fail;
- ecode1 = SWIG_AsVal_long(obj1, &val1);
- if (!SWIG_IsOK(ecode1)) {
- SWIG_exception_fail(SWIG_ArgError(ecode1), "in method '" "new__THyPhyMatrix" "', argument " "1"" of type '" "long""'");
- }
- arg1 = static_cast< long >(val1);
- ecode2 = SWIG_AsVal_long(obj2, &val2);
- if (!SWIG_IsOK(ecode2)) {
- SWIG_exception_fail(SWIG_ArgError(ecode2), "in method '" "new__THyPhyMatrix" "', argument " "2"" of type '" "long""'");
- }
- arg2 = static_cast< long >(val2);
- res3 = SWIG_ConvertPtr(obj3, &argp3,SWIGTYPE_p_double, 0 | 0 );
- if (!SWIG_IsOK(res3)) {
- SWIG_exception_fail(SWIG_ArgError(res3), "in method '" "new__THyPhyMatrix" "', argument " "3"" of type '" "double const *""'");
- }
- arg3 = reinterpret_cast< double * >(argp3);
- result = (_THyPhyMatrix *)new _THyPhyMatrix(arg1,arg2,(double const *)arg3);
- resultobj = SWIG_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhyMatrix, SWIG_BUILTIN_INIT | 0 );
- return resultobj == Py_None ? 1 : 0;
-fail:
- return -1;
-}
-
-
-SWIGINTERN int _wrap_new__THyPhyMatrix(PyObject *self, PyObject *args) {
- int argc;
- PyObject *argv[4];
- int ii;
-
- if (!PyTuple_Check(args)) SWIG_fail;
- argc = args ? (int)PyObject_Length(args) : 0;
- for (ii = 0; (ii < 3) && (ii < argc); ii++) {
- argv[ii] = PyTuple_GET_ITEM(args,ii);
- }
- if (argc == 0) {
- return _wrap_new__THyPhyMatrix__SWIG_0(self, args);
- }
- if (argc == 3) {
- int _v;
- {
- int res = SWIG_AsVal_long(argv[0], NULL);
- _v = SWIG_CheckState(res);
- }
- if (_v) {
- {
- int res = SWIG_AsVal_long(argv[1], NULL);
- _v = SWIG_CheckState(res);
- }
- if (_v) {
- void *vptr = 0;
- int res = SWIG_ConvertPtr(argv[2], &vptr, SWIGTYPE_p_double, 0);
- _v = SWIG_CheckState(res);
- if (_v) {
- return _wrap_new__THyPhyMatrix__SWIG_1(self, args);
- }
- }
- }
- }
-
-fail:
- SWIG_SetErrorMsg(PyExc_NotImplementedError,"Wrong number or type of arguments for overloaded function 'new__THyPhyMatrix'.\n"
- " Possible C/C++ prototypes are:\n"
- " _THyPhyMatrix::_THyPhyMatrix()\n"
- " _THyPhyMatrix::_THyPhyMatrix(long const,long const,double const *)\n");
- return -1;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhyMatrix_myType(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyMatrix *arg1 = (_THyPhyMatrix *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- int result;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhyMatrix, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyMatrix_myType" "', argument " "1"" of type '" "_THyPhyMatrix *""'");
- }
- arg1 = reinterpret_cast< _THyPhyMatrix * >(argp1);
- result = (int)(arg1)->myType();
- resultobj = SWIG_From_int(static_cast< int >(result));
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap_delete__THyPhyMatrix(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyMatrix *arg1 = (_THyPhyMatrix *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhyMatrix, SWIG_POINTER_DISOWN | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "delete__THyPhyMatrix" "', argument " "1"" of type '" "_THyPhyMatrix *""'");
- }
- arg1 = reinterpret_cast< _THyPhyMatrix * >(argp1);
- delete arg1;
- resultobj = SWIG_Py_Void();
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhyMatrix_MatrixCell(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyMatrix *arg1 = (_THyPhyMatrix *) 0 ;
- long arg2 ;
- long arg3 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- long val2 ;
- int ecode2 = 0 ;
- long val3 ;
- int ecode3 = 0 ;
- PyObject * obj1 = 0 ;
- PyObject * obj2 = 0 ;
- double result;
-
- if (!PyArg_ParseTuple(args,(char *)"OO:_THyPhyMatrix_MatrixCell",&obj1,&obj2)) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhyMatrix, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyMatrix_MatrixCell" "', argument " "1"" of type '" "_THyPhyMatrix *""'");
- }
- arg1 = reinterpret_cast< _THyPhyMatrix * >(argp1);
- ecode2 = SWIG_AsVal_long(obj1, &val2);
- if (!SWIG_IsOK(ecode2)) {
- SWIG_exception_fail(SWIG_ArgError(ecode2), "in method '" "_THyPhyMatrix_MatrixCell" "', argument " "2"" of type '" "long""'");
- }
- arg2 = static_cast< long >(val2);
- ecode3 = SWIG_AsVal_long(obj2, &val3);
- if (!SWIG_IsOK(ecode3)) {
- SWIG_exception_fail(SWIG_ArgError(ecode3), "in method '" "_THyPhyMatrix_MatrixCell" "', argument " "3"" of type '" "long""'");
- }
- arg3 = static_cast< long >(val3);
- result = (double)(arg1)->MatrixCell(arg2,arg3);
- resultobj = SWIG_From_double(static_cast< double >(result));
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhyMatrix_mRows_set(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyMatrix *arg1 = (_THyPhyMatrix *) 0 ;
- long arg2 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- long val2 ;
- int ecode2 = 0 ;
- PyObject * obj1 = 0 ;
-
- if (!PyArg_ParseTuple(args,(char *)"O:_THyPhyMatrix_mRows_set",&obj1)) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhyMatrix, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyMatrix_mRows_set" "', argument " "1"" of type '" "_THyPhyMatrix *""'");
- }
- arg1 = reinterpret_cast< _THyPhyMatrix * >(argp1);
- ecode2 = SWIG_AsVal_long(obj1, &val2);
- if (!SWIG_IsOK(ecode2)) {
- SWIG_exception_fail(SWIG_ArgError(ecode2), "in method '" "_THyPhyMatrix_mRows_set" "', argument " "2"" of type '" "long""'");
- }
- arg2 = static_cast< long >(val2);
- if (arg1) (arg1)->mRows = arg2;
- resultobj = SWIG_Py_Void();
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhyMatrix_mRows_get(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyMatrix *arg1 = (_THyPhyMatrix *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- long result;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhyMatrix, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyMatrix_mRows_get" "', argument " "1"" of type '" "_THyPhyMatrix *""'");
- }
- arg1 = reinterpret_cast< _THyPhyMatrix * >(argp1);
- result = (long) ((arg1)->mRows);
- resultobj = SWIG_From_long(static_cast< long >(result));
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhyMatrix_mCols_set(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyMatrix *arg1 = (_THyPhyMatrix *) 0 ;
- long arg2 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- long val2 ;
- int ecode2 = 0 ;
- PyObject * obj1 = 0 ;
-
- if (!PyArg_ParseTuple(args,(char *)"O:_THyPhyMatrix_mCols_set",&obj1)) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhyMatrix, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyMatrix_mCols_set" "', argument " "1"" of type '" "_THyPhyMatrix *""'");
- }
- arg1 = reinterpret_cast< _THyPhyMatrix * >(argp1);
- ecode2 = SWIG_AsVal_long(obj1, &val2);
- if (!SWIG_IsOK(ecode2)) {
- SWIG_exception_fail(SWIG_ArgError(ecode2), "in method '" "_THyPhyMatrix_mCols_set" "', argument " "2"" of type '" "long""'");
- }
- arg2 = static_cast< long >(val2);
- if (arg1) (arg1)->mCols = arg2;
- resultobj = SWIG_Py_Void();
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhyMatrix_mCols_get(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyMatrix *arg1 = (_THyPhyMatrix *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- long result;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhyMatrix, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyMatrix_mCols_get" "', argument " "1"" of type '" "_THyPhyMatrix *""'");
- }
- arg1 = reinterpret_cast< _THyPhyMatrix * >(argp1);
- result = (long) ((arg1)->mCols);
- resultobj = SWIG_From_long(static_cast< long >(result));
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhyMatrix_mData_set(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyMatrix *arg1 = (_THyPhyMatrix *) 0 ;
- double *arg2 = (double *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- void *argp2 = 0 ;
- int res2 = 0 ;
- PyObject * obj1 = 0 ;
-
- if (!PyArg_ParseTuple(args,(char *)"O:_THyPhyMatrix_mData_set",&obj1)) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhyMatrix, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyMatrix_mData_set" "', argument " "1"" of type '" "_THyPhyMatrix *""'");
- }
- arg1 = reinterpret_cast< _THyPhyMatrix * >(argp1);
- res2 = SWIG_ConvertPtr(obj1, &argp2,SWIGTYPE_p_double, SWIG_POINTER_DISOWN | 0 );
- if (!SWIG_IsOK(res2)) {
- SWIG_exception_fail(SWIG_ArgError(res2), "in method '" "_THyPhyMatrix_mData_set" "', argument " "2"" of type '" "double *""'");
- }
- arg2 = reinterpret_cast< double * >(argp2);
- if (arg1) (arg1)->mData = arg2;
- resultobj = SWIG_Py_Void();
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhyMatrix_mData_get(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyMatrix *arg1 = (_THyPhyMatrix *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- double *result = 0 ;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhyMatrix, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyMatrix_mData_get" "', argument " "1"" of type '" "_THyPhyMatrix *""'");
- }
- arg1 = reinterpret_cast< _THyPhyMatrix * >(argp1);
- result = (double *) ((arg1)->mData);
- resultobj = SWIG_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p_double, 0 | 0 );
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN int _wrap_new__THyPhy__SWIG_0(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _ProgressCancelHandler *arg1 = (_ProgressCancelHandler *) 0 ;
- char *arg2 = (char *) 0 ;
- long arg3 ;
- int res2 ;
- char *buf2 = 0 ;
- int alloc2 = 0 ;
- long val3 ;
- int ecode3 = 0 ;
- PyObject * obj1 = 0 ;
- PyObject * obj2 = 0 ;
- PyObject * obj3 = 0 ;
- _THyPhy *result = 0 ;
-
- if (!PyArg_ParseTuple(args,(char *)"OOO:new__THyPhy",&obj1,&obj2,&obj3)) SWIG_fail;
- {
- int res = SWIG_ConvertFunctionPtr(obj1, (void**)(&arg1), SWIGTYPE_p_f_p_char_int_double__bool);
- if (!SWIG_IsOK(res)) {
- SWIG_exception_fail(SWIG_ArgError(res), "in method '" "new__THyPhy" "', argument " "1"" of type '" "_ProgressCancelHandler *""'");
- }
- }
- res2 = SWIG_AsCharPtrAndSize(obj2, &buf2, NULL, &alloc2);
- if (!SWIG_IsOK(res2)) {
- SWIG_exception_fail(SWIG_ArgError(res2), "in method '" "new__THyPhy" "', argument " "2"" of type '" "char const *""'");
- }
- arg2 = reinterpret_cast< char * >(buf2);
- ecode3 = SWIG_AsVal_long(obj3, &val3);
- if (!SWIG_IsOK(ecode3)) {
- SWIG_exception_fail(SWIG_ArgError(ecode3), "in method '" "new__THyPhy" "', argument " "3"" of type '" "long""'");
- }
- arg3 = static_cast< long >(val3);
- result = (_THyPhy *)new _THyPhy(arg1,(char const *)arg2,arg3);
- resultobj = SWIG_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhy, SWIG_BUILTIN_INIT | 0 );
- if (alloc2 == SWIG_NEWOBJ) delete[] buf2;
- return resultobj == Py_None ? 1 : 0;
-fail:
- if (alloc2 == SWIG_NEWOBJ) delete[] buf2;
- return -1;
-}
-
-
-SWIGINTERN int _wrap_new__THyPhy__SWIG_1(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _ProgressCancelHandler *arg1 = (_ProgressCancelHandler *) 0 ;
- char *arg2 = (char *) 0 ;
- int res2 ;
- char *buf2 = 0 ;
- int alloc2 = 0 ;
- PyObject * obj1 = 0 ;
- PyObject * obj2 = 0 ;
- _THyPhy *result = 0 ;
-
- if (!PyArg_ParseTuple(args,(char *)"OO:new__THyPhy",&obj1,&obj2)) SWIG_fail;
- {
- int res = SWIG_ConvertFunctionPtr(obj1, (void**)(&arg1), SWIGTYPE_p_f_p_char_int_double__bool);
- if (!SWIG_IsOK(res)) {
- SWIG_exception_fail(SWIG_ArgError(res), "in method '" "new__THyPhy" "', argument " "1"" of type '" "_ProgressCancelHandler *""'");
- }
- }
- res2 = SWIG_AsCharPtrAndSize(obj2, &buf2, NULL, &alloc2);
- if (!SWIG_IsOK(res2)) {
- SWIG_exception_fail(SWIG_ArgError(res2), "in method '" "new__THyPhy" "', argument " "2"" of type '" "char const *""'");
- }
- arg2 = reinterpret_cast< char * >(buf2);
- result = (_THyPhy *)new _THyPhy(arg1,(char const *)arg2);
- resultobj = SWIG_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhy, SWIG_BUILTIN_INIT | 0 );
- if (alloc2 == SWIG_NEWOBJ) delete[] buf2;
- return resultobj == Py_None ? 1 : 0;
-fail:
- if (alloc2 == SWIG_NEWOBJ) delete[] buf2;
- return -1;
-}
-
-
-SWIGINTERN int _wrap_new__THyPhy__SWIG_2(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- char *arg1 = (char *) 0 ;
- long arg2 ;
- int res1 ;
- char *buf1 = 0 ;
- int alloc1 = 0 ;
- long val2 ;
- int ecode2 = 0 ;
- PyObject * obj1 = 0 ;
- PyObject * obj2 = 0 ;
- _THyPhy *result = 0 ;
-
- if (!PyArg_ParseTuple(args,(char *)"OO:new__THyPhy",&obj1,&obj2)) SWIG_fail;
- res1 = SWIG_AsCharPtrAndSize(obj1, &buf1, NULL, &alloc1);
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "new__THyPhy" "', argument " "1"" of type '" "char const *""'");
- }
- arg1 = reinterpret_cast< char * >(buf1);
- ecode2 = SWIG_AsVal_long(obj2, &val2);
- if (!SWIG_IsOK(ecode2)) {
- SWIG_exception_fail(SWIG_ArgError(ecode2), "in method '" "new__THyPhy" "', argument " "2"" of type '" "long""'");
- }
- arg2 = static_cast< long >(val2);
- result = (_THyPhy *)new _THyPhy((char const *)arg1,arg2);
- resultobj = SWIG_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhy, SWIG_BUILTIN_INIT | 0 );
- if (alloc1 == SWIG_NEWOBJ) delete[] buf1;
- return resultobj == Py_None ? 1 : 0;
-fail:
- if (alloc1 == SWIG_NEWOBJ) delete[] buf1;
- return -1;
-}
-
-
-SWIGINTERN int _wrap_new__THyPhy__SWIG_3(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- char *arg1 = (char *) 0 ;
- int res1 ;
- char *buf1 = 0 ;
- int alloc1 = 0 ;
- PyObject * obj1 = 0 ;
- _THyPhy *result = 0 ;
-
- if (!PyArg_ParseTuple(args,(char *)"O:new__THyPhy",&obj1)) SWIG_fail;
- res1 = SWIG_AsCharPtrAndSize(obj1, &buf1, NULL, &alloc1);
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "new__THyPhy" "', argument " "1"" of type '" "char const *""'");
- }
- arg1 = reinterpret_cast< char * >(buf1);
- result = (_THyPhy *)new _THyPhy((char const *)arg1);
- resultobj = SWIG_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhy, SWIG_BUILTIN_INIT | 0 );
- if (alloc1 == SWIG_NEWOBJ) delete[] buf1;
- return resultobj == Py_None ? 1 : 0;
-fail:
- if (alloc1 == SWIG_NEWOBJ) delete[] buf1;
- return -1;
-}
-
-
-SWIGINTERN int _wrap_new__THyPhy(PyObject *self, PyObject *args) {
- int argc;
- PyObject *argv[4];
- int ii;
-
- if (!PyTuple_Check(args)) SWIG_fail;
- argc = args ? (int)PyObject_Length(args) : 0;
- for (ii = 0; (ii < 3) && (ii < argc); ii++) {
- argv[ii] = PyTuple_GET_ITEM(args,ii);
- }
- if (argc == 1) {
- int _v;
- int res = SWIG_AsCharPtrAndSize(argv[0], 0, NULL, 0);
- _v = SWIG_CheckState(res);
- if (_v) {
- return _wrap_new__THyPhy__SWIG_3(self, args);
- }
- }
- if (argc == 2) {
- int _v;
- void *ptr = 0;
- int res = SWIG_ConvertFunctionPtr(argv[0], &ptr, SWIGTYPE_p_f_p_char_int_double__bool);
- _v = SWIG_CheckState(res);
- if (_v) {
- int res = SWIG_AsCharPtrAndSize(argv[1], 0, NULL, 0);
- _v = SWIG_CheckState(res);
- if (_v) {
- return _wrap_new__THyPhy__SWIG_1(self, args);
- }
- }
- }
- if (argc == 2) {
- int _v;
- int res = SWIG_AsCharPtrAndSize(argv[0], 0, NULL, 0);
- _v = SWIG_CheckState(res);
- if (_v) {
- {
- int res = SWIG_AsVal_long(argv[1], NULL);
- _v = SWIG_CheckState(res);
- }
- if (_v) {
- return _wrap_new__THyPhy__SWIG_2(self, args);
- }
- }
- }
- if (argc == 3) {
- int _v;
- void *ptr = 0;
- int res = SWIG_ConvertFunctionPtr(argv[0], &ptr, SWIGTYPE_p_f_p_char_int_double__bool);
- _v = SWIG_CheckState(res);
- if (_v) {
- int res = SWIG_AsCharPtrAndSize(argv[1], 0, NULL, 0);
- _v = SWIG_CheckState(res);
- if (_v) {
- {
- int res = SWIG_AsVal_long(argv[2], NULL);
- _v = SWIG_CheckState(res);
- }
- if (_v) {
- return _wrap_new__THyPhy__SWIG_0(self, args);
- }
- }
- }
- }
-
-fail:
- SWIG_SetErrorMsg(PyExc_NotImplementedError,"Wrong number or type of arguments for overloaded function 'new__THyPhy'.\n"
- " Possible C/C++ prototypes are:\n"
- " _THyPhy::_THyPhy(_ProgressCancelHandler *,char const *,long)\n"
- " _THyPhy::_THyPhy(_ProgressCancelHandler *,char const *)\n"
- " _THyPhy::_THyPhy(char const *,long)\n"
- " _THyPhy::_THyPhy(char const *)\n");
- return -1;
-}
-
-
-SWIGINTERN PyObject *_wrap_delete__THyPhy(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhy, SWIG_POINTER_DISOWN | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "delete__THyPhy" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- delete arg1;
- resultobj = SWIG_Py_Void();
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhy_ExecuteBF__SWIG_0(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- char *arg2 = (char *) 0 ;
- bool arg3 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- int res2 ;
- char *buf2 = 0 ;
- int alloc2 = 0 ;
- bool val3 ;
- int ecode3 = 0 ;
- PyObject * obj1 = 0 ;
- PyObject * obj2 = 0 ;
- _THyPhyString *result = 0 ;
-
- if (!PyArg_ParseTuple(args,(char *)"OO:_THyPhy_ExecuteBF",&obj1,&obj2)) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhy, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhy_ExecuteBF" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- res2 = SWIG_AsCharPtrAndSize(obj1, &buf2, NULL, &alloc2);
- if (!SWIG_IsOK(res2)) {
- SWIG_exception_fail(SWIG_ArgError(res2), "in method '" "_THyPhy_ExecuteBF" "', argument " "2"" of type '" "char const *""'");
- }
- arg2 = reinterpret_cast< char * >(buf2);
- ecode3 = SWIG_AsVal_bool(obj2, &val3);
- if (!SWIG_IsOK(ecode3)) {
- SWIG_exception_fail(SWIG_ArgError(ecode3), "in method '" "_THyPhy_ExecuteBF" "', argument " "3"" of type '" "bool""'");
- }
- arg3 = static_cast< bool >(val3);
- result = (_THyPhyString *)(arg1)->ExecuteBF((char const *)arg2,arg3);
- resultobj = SWIG_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhyString, 0 | 0 );
- if (alloc2 == SWIG_NEWOBJ) delete[] buf2;
- return resultobj;
-fail:
- if (alloc2 == SWIG_NEWOBJ) delete[] buf2;
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhy_ExecuteBF__SWIG_1(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- char *arg2 = (char *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- int res2 ;
- char *buf2 = 0 ;
- int alloc2 = 0 ;
- PyObject * obj1 = 0 ;
- _THyPhyString *result = 0 ;
-
- if (!PyArg_ParseTuple(args,(char *)"O:_THyPhy_ExecuteBF",&obj1)) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhy, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhy_ExecuteBF" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- res2 = SWIG_AsCharPtrAndSize(obj1, &buf2, NULL, &alloc2);
- if (!SWIG_IsOK(res2)) {
- SWIG_exception_fail(SWIG_ArgError(res2), "in method '" "_THyPhy_ExecuteBF" "', argument " "2"" of type '" "char const *""'");
- }
- arg2 = reinterpret_cast< char * >(buf2);
- result = (_THyPhyString *)(arg1)->ExecuteBF((char const *)arg2);
- resultobj = SWIG_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhyString, 0 | 0 );
- if (alloc2 == SWIG_NEWOBJ) delete[] buf2;
- return resultobj;
-fail:
- if (alloc2 == SWIG_NEWOBJ) delete[] buf2;
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhy_ExecuteBF(PyObject *self, PyObject *args) {
- int argc;
- PyObject *argv[4];
- int ii;
-
- if (!PyTuple_Check(args)) SWIG_fail;
- argc = args ? (int)PyObject_Length(args) : 0;
- argv[0] = self;
- for (ii = 0; (ii < 2) && (ii < argc); ii++) {
- argv[ii + 1] = PyTuple_GET_ITEM(args,ii);
- }
- argc++;
- if (argc == 2) {
- int _v;
- void *vptr = 0;
- int res = SWIG_ConvertPtr(argv[0], &vptr, SWIGTYPE_p__THyPhy, 0);
- _v = SWIG_CheckState(res);
- if (_v) {
- int res = SWIG_AsCharPtrAndSize(argv[1], 0, NULL, 0);
- _v = SWIG_CheckState(res);
- if (_v) {
- return _wrap__THyPhy_ExecuteBF__SWIG_1(self, args);
- }
- }
- }
- if (argc == 3) {
- int _v;
- void *vptr = 0;
- int res = SWIG_ConvertPtr(argv[0], &vptr, SWIGTYPE_p__THyPhy, 0);
- _v = SWIG_CheckState(res);
- if (_v) {
- int res = SWIG_AsCharPtrAndSize(argv[1], 0, NULL, 0);
- _v = SWIG_CheckState(res);
- if (_v) {
- {
- int res = SWIG_AsVal_bool(argv[2], NULL);
- _v = SWIG_CheckState(res);
- }
- if (_v) {
- return _wrap__THyPhy_ExecuteBF__SWIG_0(self, args);
- }
- }
- }
- }
-
-fail:
- SWIG_SetErrorMsg(PyExc_NotImplementedError,"Wrong number or type of arguments for overloaded function '_THyPhy_ExecuteBF'.\n"
- " Possible C/C++ prototypes are:\n"
- " _THyPhy::ExecuteBF(char const *,bool)\n"
- " _THyPhy::ExecuteBF(char const *)\n");
- return 0;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhy_InitTHyPhy(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- _ProgressCancelHandler *arg2 = (_ProgressCancelHandler *) 0 ;
- char *arg3 = (char *) 0 ;
- long arg4 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- int res3 ;
- char *buf3 = 0 ;
- int alloc3 = 0 ;
- long val4 ;
- int ecode4 = 0 ;
- PyObject * obj1 = 0 ;
- PyObject * obj2 = 0 ;
- PyObject * obj3 = 0 ;
-
- if (!PyArg_ParseTuple(args,(char *)"OOO:_THyPhy_InitTHyPhy",&obj1,&obj2,&obj3)) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhy, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhy_InitTHyPhy" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- {
- int res = SWIG_ConvertFunctionPtr(obj1, (void**)(&arg2), SWIGTYPE_p_f_p_char_int_double__bool);
- if (!SWIG_IsOK(res)) {
- SWIG_exception_fail(SWIG_ArgError(res), "in method '" "_THyPhy_InitTHyPhy" "', argument " "2"" of type '" "_ProgressCancelHandler *""'");
- }
- }
- res3 = SWIG_AsCharPtrAndSize(obj2, &buf3, NULL, &alloc3);
- if (!SWIG_IsOK(res3)) {
- SWIG_exception_fail(SWIG_ArgError(res3), "in method '" "_THyPhy_InitTHyPhy" "', argument " "3"" of type '" "char const *""'");
- }
- arg3 = reinterpret_cast< char * >(buf3);
- ecode4 = SWIG_AsVal_long(obj3, &val4);
- if (!SWIG_IsOK(ecode4)) {
- SWIG_exception_fail(SWIG_ArgError(ecode4), "in method '" "_THyPhy_InitTHyPhy" "', argument " "4"" of type '" "long""'");
- }
- arg4 = static_cast< long >(val4);
- (arg1)->InitTHyPhy(arg2,(char const *)arg3,arg4);
- resultobj = SWIG_Py_Void();
- if (alloc3 == SWIG_NEWOBJ) delete[] buf3;
- return resultobj;
-fail:
- if (alloc3 == SWIG_NEWOBJ) delete[] buf3;
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhy_ClearAll(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhy, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhy_ClearAll" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- (arg1)->ClearAll();
- resultobj = SWIG_Py_Void();
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhy_AskFor(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- char *arg2 = (char *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- int res2 ;
- char *buf2 = 0 ;
- int alloc2 = 0 ;
- PyObject * obj1 = 0 ;
- void *result = 0 ;
-
- if (!PyArg_ParseTuple(args,(char *)"O:_THyPhy_AskFor",&obj1)) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhy, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhy_AskFor" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- res2 = SWIG_AsCharPtrAndSize(obj1, &buf2, NULL, &alloc2);
- if (!SWIG_IsOK(res2)) {
- SWIG_exception_fail(SWIG_ArgError(res2), "in method '" "_THyPhy_AskFor" "', argument " "2"" of type '" "char const *""'");
- }
- arg2 = reinterpret_cast< char * >(buf2);
- result = (void *)(arg1)->AskFor((char const *)arg2);
- resultobj = SWIG_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p_void, 0 | 0 );
- if (alloc2 == SWIG_NEWOBJ) delete[] buf2;
- return resultobj;
-fail:
- if (alloc2 == SWIG_NEWOBJ) delete[] buf2;
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhy_DumpResult(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- void *arg2 = (void *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- int res2 ;
- PyObject * obj1 = 0 ;
-
- if (!PyArg_ParseTuple(args,(char *)"O:_THyPhy_DumpResult",&obj1)) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhy, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhy_DumpResult" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- res2 = SWIG_ConvertPtr(obj1,SWIG_as_voidptrptr(&arg2), 0, 0);
- if (!SWIG_IsOK(res2)) {
- SWIG_exception_fail(SWIG_ArgError(res2), "in method '" "_THyPhy_DumpResult" "', argument " "2"" of type '" "void *""'");
- }
- (arg1)->DumpResult(arg2);
- resultobj = SWIG_Py_Void();
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhy_CanCast(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- void *arg2 = (void *) 0 ;
- int arg3 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- int res2 ;
- int val3 ;
- int ecode3 = 0 ;
- PyObject * obj1 = 0 ;
- PyObject * obj2 = 0 ;
- bool result;
-
- if (!PyArg_ParseTuple(args,(char *)"OO:_THyPhy_CanCast",&obj1,&obj2)) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhy, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhy_CanCast" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- res2 = SWIG_ConvertPtr(obj1,SWIG_as_voidptrptr(&arg2), 0, 0);
- if (!SWIG_IsOK(res2)) {
- SWIG_exception_fail(SWIG_ArgError(res2), "in method '" "_THyPhy_CanCast" "', argument " "2"" of type '" "void const *""'");
- }
- ecode3 = SWIG_AsVal_int(obj2, &val3);
- if (!SWIG_IsOK(ecode3)) {
- SWIG_exception_fail(SWIG_ArgError(ecode3), "in method '" "_THyPhy_CanCast" "', argument " "3"" of type '" "int""'");
- }
- arg3 = static_cast< int >(val3);
- result = (bool)(arg1)->CanCast((void const *)arg2,arg3);
- resultobj = SWIG_From_bool(static_cast< bool >(result));
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhy_CastResult(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- void *arg2 = (void *) 0 ;
- int arg3 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- int res2 ;
- int val3 ;
- int ecode3 = 0 ;
- PyObject * obj1 = 0 ;
- PyObject * obj2 = 0 ;
- _THyPhyReturnObject *result = 0 ;
-
- if (!PyArg_ParseTuple(args,(char *)"OO:_THyPhy_CastResult",&obj1,&obj2)) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhy, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhy_CastResult" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- res2 = SWIG_ConvertPtr(obj1,SWIG_as_voidptrptr(&arg2), 0, 0);
- if (!SWIG_IsOK(res2)) {
- SWIG_exception_fail(SWIG_ArgError(res2), "in method '" "_THyPhy_CastResult" "', argument " "2"" of type '" "void const *""'");
- }
- ecode3 = SWIG_AsVal_int(obj2, &val3);
- if (!SWIG_IsOK(ecode3)) {
- SWIG_exception_fail(SWIG_ArgError(ecode3), "in method '" "_THyPhy_CastResult" "', argument " "3"" of type '" "int""'");
- }
- arg3 = static_cast< int >(val3);
- result = (_THyPhyReturnObject *)(arg1)->CastResult((void const *)arg2,arg3);
- resultobj = SWIG_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhyReturnObject, 0 | 0 );
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhy_SetCallbackHandler(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- _ProgressCancelHandler *arg2 = (_ProgressCancelHandler *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- PyObject * obj1 = 0 ;
-
- if (!PyArg_ParseTuple(args,(char *)"O:_THyPhy_SetCallbackHandler",&obj1)) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhy, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhy_SetCallbackHandler" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- {
- int res = SWIG_ConvertFunctionPtr(obj1, (void**)(&arg2), SWIGTYPE_p_f_p_char_int_double__bool);
- if (!SWIG_IsOK(res)) {
- SWIG_exception_fail(SWIG_ArgError(res), "in method '" "_THyPhy_SetCallbackHandler" "', argument " "2"" of type '" "_ProgressCancelHandler *""'");
- }
- }
- (arg1)->SetCallbackHandler(arg2);
- resultobj = SWIG_Py_Void();
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhy_GetCallbackHandler(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- _ProgressCancelHandler *result = 0 ;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhy, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhy_GetCallbackHandler" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- result = (_ProgressCancelHandler *)(arg1)->GetCallbackHandler();
- resultobj = SWIG_NewFunctionPtrObj((void *)(result), SWIGTYPE_p_f_p_char_int_double__bool);
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhy_GetWarnings(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- _THyPhyString *result = 0 ;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhy, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhy_GetWarnings" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- result = (_THyPhyString *)(arg1)->GetWarnings();
- resultobj = SWIG_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhyString, 0 | 0 );
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhy_GetErrors(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- _THyPhyString *result = 0 ;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhy, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhy_GetErrors" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- result = (_THyPhyString *)(arg1)->GetErrors();
- resultobj = SWIG_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhyString, 0 | 0 );
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhy_GetStdout(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- _THyPhyString *result = 0 ;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhy, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhy_GetStdout" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- result = (_THyPhyString *)(arg1)->GetStdout();
- resultobj = SWIG_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhyString, 0 | 0 );
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhy_PushWarning(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- void *arg2 = (void *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- int res2 ;
- PyObject * obj1 = 0 ;
-
- if (!PyArg_ParseTuple(args,(char *)"O:_THyPhy_PushWarning",&obj1)) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhy, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhy_PushWarning" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- res2 = SWIG_ConvertPtr(obj1,SWIG_as_voidptrptr(&arg2), 0, 0);
- if (!SWIG_IsOK(res2)) {
- SWIG_exception_fail(SWIG_ArgError(res2), "in method '" "_THyPhy_PushWarning" "', argument " "2"" of type '" "void *""'");
- }
- (arg1)->PushWarning(arg2);
- resultobj = SWIG_Py_Void();
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhy_PushError(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- void *arg2 = (void *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- int res2 ;
- PyObject * obj1 = 0 ;
-
- if (!PyArg_ParseTuple(args,(char *)"O:_THyPhy_PushError",&obj1)) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhy, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhy_PushError" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- res2 = SWIG_ConvertPtr(obj1,SWIG_as_voidptrptr(&arg2), 0, 0);
- if (!SWIG_IsOK(res2)) {
- SWIG_exception_fail(SWIG_ArgError(res2), "in method '" "_THyPhy_PushError" "', argument " "2"" of type '" "void *""'");
- }
- (arg1)->PushError(arg2);
- resultobj = SWIG_Py_Void();
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhy_PushOutString(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- void *arg2 = (void *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- int res2 ;
- PyObject * obj1 = 0 ;
-
- if (!PyArg_ParseTuple(args,(char *)"O:_THyPhy_PushOutString",&obj1)) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhy, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhy_PushOutString" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- res2 = SWIG_ConvertPtr(obj1,SWIG_as_voidptrptr(&arg2), 0, 0);
- if (!SWIG_IsOK(res2)) {
- SWIG_exception_fail(SWIG_ArgError(res2), "in method '" "_THyPhy_PushOutString" "', argument " "2"" of type '" "void *""'");
- }
- (arg1)->PushOutString(arg2);
- resultobj = SWIG_Py_Void();
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhyGetLongStatus(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- long result;
-
- if (!PyArg_ParseTuple(args,(char *)":_THyPhyGetLongStatus")) SWIG_fail;
- result = (long)_THyPhyGetLongStatus();
- resultobj = SWIG_From_long(static_cast< long >(result));
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhyGetStringStatus(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- char *result = 0 ;
-
- if (!PyArg_ParseTuple(args,(char *)":_THyPhyGetStringStatus")) SWIG_fail;
- result = (char *)_THyPhyGetStringStatus();
- resultobj = SWIG_FromCharPtr((const char *)result);
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhyGetDoubleStatus(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- double result;
-
- if (!PyArg_ParseTuple(args,(char *)":_THyPhyGetDoubleStatus")) SWIG_fail;
- result = (double)_THyPhyGetDoubleStatus();
- resultobj = SWIG_From_double(static_cast< double >(result));
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN int Swig_var_globalInterfaceInstance_set(PyObject *_val) {
- {
- void *argp = 0;
- int res = SWIG_ConvertPtr(_val, &argp, SWIGTYPE_p__THyPhy, 0 );
- if (!SWIG_IsOK(res)) {
- SWIG_exception_fail(SWIG_ArgError(res), "in variable '""globalInterfaceInstance""' of type '""_THyPhy *""'");
- }
- globalInterfaceInstance = reinterpret_cast< _THyPhy * >(argp);
- }
- return 0;
-fail:
- return 1;
-}
-
-
-SWIGINTERN PyObject *Swig_var_globalInterfaceInstance_get(void) {
- PyObject *pyobj = 0;
- PyObject *self = 0;
-
- (void)self;
- pyobj = SWIG_NewPointerObj(SWIG_as_voidptr(globalInterfaceInstance), SWIGTYPE_p__THyPhy, 0 );
- return pyobj;
-}
-
-
-static PyMethodDef SwigMethods[] = {
- { (char *)"SWIG_PyInstanceMethod_New", (PyCFunction)SWIG_PyInstanceMethod_New, METH_O, NULL},
- { (char *)"_THyPhyGetLongStatus", _wrap__THyPhyGetLongStatus, METH_VARARGS, NULL},
- { (char *)"_THyPhyGetStringStatus", _wrap__THyPhyGetStringStatus, METH_VARARGS, NULL},
- { (char *)"_THyPhyGetDoubleStatus", _wrap__THyPhyGetDoubleStatus, METH_VARARGS, NULL},
- { NULL, NULL, 0, NULL }
-};
-
-SWIGPY_DESTRUCTOR_CLOSURE(_wrap_delete__THyPhyReturnObject)
-SWIGINTERN PyGetSetDef SwigPyBuiltin___THyPhyReturnObject_getset[] = {
- {NULL, NULL, NULL, NULL, NULL} /* Sentinel */
-};
-
-SWIGINTERN PyObject *
-SwigPyBuiltin___THyPhyReturnObject_richcompare(PyObject *self, PyObject *other, int op) {
- PyObject *result = NULL;
- PyObject *tuple = PyTuple_New(1);
- assert(tuple);
- PyTuple_SET_ITEM(tuple, 0, other);
- Py_XINCREF(other);
- if (!result) {
- if (SwigPyObject_Check(self) && SwigPyObject_Check(other)) {
- result = SwigPyObject_richcompare((SwigPyObject *)self, (SwigPyObject *)other, op);
- } else {
- result = Py_NotImplemented;
- Py_INCREF(result);
- }
- }
- Py_DECREF(tuple);
- return result;
-}
-
-SWIGINTERN PyMethodDef SwigPyBuiltin___THyPhyReturnObject_methods[] = {
- { "myType", (PyCFunction) _wrap__THyPhyReturnObject_myType, METH_VARARGS, (char*) "" },
- { "castToString", (PyCFunction) _wrap__THyPhyReturnObject_castToString, METH_VARARGS, (char*) "" },
- { "castToNumber", (PyCFunction) _wrap__THyPhyReturnObject_castToNumber, METH_VARARGS, (char*) "" },
- { "castToMatrix", (PyCFunction) _wrap__THyPhyReturnObject_castToMatrix, METH_VARARGS, (char*) "" },
- { NULL, NULL, 0, NULL } /* Sentinel */
-};
-
-static PyHeapTypeObject SwigPyBuiltin___THyPhyReturnObject_type = {
- {
-#if PY_VERSION_HEX >= 0x03000000
- PyVarObject_HEAD_INIT(NULL, 0)
-#else
- PyObject_HEAD_INIT(NULL)
- 0, /* ob_size */
-#endif
- "_THyPhyReturnObject", /* tp_name */
- sizeof(SwigPyObject), /* tp_basicsize */
- 0, /* tp_itemsize */
- (destructor) _wrap_delete__THyPhyReturnObject_closure, /* tp_dealloc */
- (printfunc) 0, /* tp_print */
- (getattrfunc) 0, /* tp_getattr */
- (setattrfunc) 0, /* tp_setattr */
-#if PY_VERSION_HEX >= 0x03000000
- 0, /* tp_compare */
-#else
- (cmpfunc) 0, /* tp_compare */
-#endif
- (reprfunc) 0, /* tp_repr */
- &SwigPyBuiltin___THyPhyReturnObject_type.as_number, /* tp_as_number */
- &SwigPyBuiltin___THyPhyReturnObject_type.as_sequence, /* tp_as_sequence */
- &SwigPyBuiltin___THyPhyReturnObject_type.as_mapping, /* tp_as_mapping */
- (hashfunc) 0, /* tp_hash */
- (ternaryfunc) 0, /* tp_call */
- (reprfunc) 0, /* tp_str */
- (getattrofunc) 0, /* tp_getattro */
- (setattrofunc) 0, /* tp_setattro */
- &SwigPyBuiltin___THyPhyReturnObject_type.as_buffer, /* tp_as_buffer */
-#if PY_VERSION_HEX >= 0x03000000
- Py_TPFLAGS_DEFAULT|Py_TPFLAGS_BASETYPE, /* tp_flags */
-#else
- Py_TPFLAGS_DEFAULT|Py_TPFLAGS_BASETYPE|Py_TPFLAGS_CHECKTYPES, /* tp_flags */
-#endif
- "::_THyPhyReturnObject", /* tp_doc */
- (traverseproc) 0, /* tp_traverse */
- (inquiry) 0, /* tp_clear */
- (richcmpfunc) SwigPyBuiltin___THyPhyReturnObject_richcompare, /* feature:python:tp_richcompare */
- 0, /* tp_weaklistoffset */
- (getiterfunc) 0, /* tp_iter */
- (iternextfunc) 0, /* tp_iternext */
- SwigPyBuiltin___THyPhyReturnObject_methods, /* tp_methods */
- 0, /* tp_members */
- SwigPyBuiltin___THyPhyReturnObject_getset, /* tp_getset */
- 0, /* tp_base */
- 0, /* tp_dict */
- (descrgetfunc) 0, /* tp_descr_get */
- (descrsetfunc) 0, /* tp_descr_set */
- (size_t)(((char*)&((SwigPyObject *) 64L)->dict) - (char*) 64L), /* tp_dictoffset */
- (initproc) SwigPyBuiltin_BadInit, /* tp_init */
- (allocfunc) 0, /* tp_alloc */
- (newfunc) 0, /* tp_new */
- (freefunc) 0, /* tp_free */
- (inquiry) 0, /* tp_is_gc */
- (PyObject*) 0, /* tp_bases */
- (PyObject*) 0, /* tp_mro */
- (PyObject*) 0, /* tp_cache */
- (PyObject*) 0, /* tp_subclasses */
- (PyObject*) 0, /* tp_weaklist */
- (destructor) 0, /* tp_del */
-#if PY_VERSION_HEX >= 0x02060000
- (int) 0, /* tp_version_tag */
-#endif
- },
- {
- (binaryfunc) 0, /* nb_add */
- (binaryfunc) 0, /* nb_subtract */
- (binaryfunc) 0, /* nb_multiply */
-#if PY_VERSION_HEX < 0x03000000
- (binaryfunc) 0, /* nb_divide */
-#endif
- (binaryfunc) 0, /* nb_remainder */
- (binaryfunc) 0, /* nb_divmod */
- (ternaryfunc) 0, /* nb_power */
- (unaryfunc) 0, /* nb_negative */
- (unaryfunc) 0, /* nb_positive */
- (unaryfunc) 0, /* nb_absolute */
- (inquiry) 0, /* nb_nonzero */
- (unaryfunc) 0, /* nb_invert */
- (binaryfunc) 0, /* nb_lshift */
- (binaryfunc) 0, /* nb_rshift */
- (binaryfunc) 0, /* nb_and */
- (binaryfunc) 0, /* nb_xor */
- (binaryfunc) 0, /* nb_or */
-#if PY_VERSION_HEX < 0x03000000
- (coercion) 0, /* nb_coerce */
-#endif
- (unaryfunc) 0, /* nb_int */
-#if PY_VERSION_HEX >= 0x03000000
- (void*) 0, /* nb_reserved */
-#else
- (unaryfunc) 0, /* nb_long */
-#endif
- (unaryfunc) 0, /* nb_float */
-#if PY_VERSION_HEX < 0x03000000
- (unaryfunc) 0, /* nb_oct */
- (unaryfunc) 0, /* nb_hex */
-#endif
- (binaryfunc) 0, /* nb_inplace_add */
- (binaryfunc) 0, /* nb_inplace_subtract */
- (binaryfunc) 0, /* nb_inplace_multiply */
-#if PY_VERSION_HEX < 0x03000000
- (binaryfunc) 0, /* nb_inplace_divide */
-#endif
- (binaryfunc) 0, /* nb_inplace_remainder */
- (ternaryfunc) 0, /* nb_inplace_power */
- (binaryfunc) 0, /* nb_inplace_lshift */
- (binaryfunc) 0, /* nb_inplace_rshift */
- (binaryfunc) 0, /* nb_inplace_and */
- (binaryfunc) 0, /* nb_inplace_xor */
- (binaryfunc) 0, /* nb_inplace_or */
- (binaryfunc) 0, /* nb_floor_divide */
- (binaryfunc) 0, /* nb_true_divide */
- (binaryfunc) 0, /* nb_inplace_floor_divide */
- (binaryfunc) 0, /* nb_inplace_true_divide */
-#if PY_VERSION_HEX >= 0x02050000
- (unaryfunc) 0, /* nb_index */
-#endif
- },
- {
- (lenfunc) 0, /* mp_length */
- (binaryfunc) 0, /* mp_subscript */
- (objobjargproc) 0, /* mp_ass_subscript */
- },
- {
- (lenfunc) 0, /* sq_length */
- (binaryfunc) 0, /* sq_concat */
- (ssizeargfunc) 0, /* sq_repeat */
- (ssizeargfunc) 0, /* sq_item */
-#if PY_VERSION_HEX >= 0x03000000
- (void*) 0, /* was_sq_slice */
-#else
- (ssizessizeargfunc) 0, /* sq_slice */
-#endif
- (ssizeobjargproc) 0, /* sq_ass_item */
-#if PY_VERSION_HEX >= 0x03000000
- (void*) 0, /* was_sq_ass_slice */
-#else
- (ssizessizeobjargproc) 0, /* sq_ass_slice */
-#endif
- (objobjproc) 0, /* sq_contains */
- (binaryfunc) 0, /* sq_inplace_concat */
- (ssizeargfunc) 0, /* sq_inplace_repeat */
- },
- {
-#if PY_VERSION_HEX < 0x03000000
- (readbufferproc) 0, /* bf_getreadbuffer */
- (writebufferproc) 0, /* bf_getwritebuffer */
- (segcountproc) 0, /* bf_getsegcount */
- (charbufferproc) 0, /* bf_getcharbuffer */
-#endif
-#if PY_VERSION_HEX >= 0x02060000
- (getbufferproc) 0, /* bf_getbuffer */
- (releasebufferproc) 0, /* bf_releasebuffer */
-#endif
- },
- (PyObject*) 0, /* ht_name */
- (PyObject*) 0, /* ht_slots */
-};
-
-SWIGINTERN SwigPyClientData SwigPyBuiltin___THyPhyReturnObject_clientdata = {0, 0, 0, 0, 0, 0, (PyTypeObject *)&SwigPyBuiltin___THyPhyReturnObject_type};
-
-SWIGPY_DESTRUCTOR_CLOSURE(_wrap_delete__THyPhyString)
-static SwigPyGetSet _THyPhyString_sData_getset = { _wrap__THyPhyString_sData_get, _wrap__THyPhyString_sData_set };
-static SwigPyGetSet _THyPhyString_sLength_getset = { _wrap__THyPhyString_sLength_get, _wrap__THyPhyString_sLength_set };
-SWIGINTERN PyGetSetDef SwigPyBuiltin___THyPhyString_getset[] = {
- { (char*) "sData", (getter) SwigPyBuiltin_GetterClosure, (setter) SwigPyBuiltin_SetterClosure, (char*)"_THyPhyString.sData", (void*) &_THyPhyString_sData_getset }
-,
- { (char*) "sLength", (getter) SwigPyBuiltin_GetterClosure, (setter) SwigPyBuiltin_SetterClosure, (char*)"_THyPhyString.sLength", (void*) &_THyPhyString_sLength_getset }
-,
- {NULL, NULL, NULL, NULL, NULL} /* Sentinel */
-};
-
-SWIGINTERN PyObject *
-SwigPyBuiltin___THyPhyString_richcompare(PyObject *self, PyObject *other, int op) {
- PyObject *result = NULL;
- PyObject *tuple = PyTuple_New(1);
- assert(tuple);
- PyTuple_SET_ITEM(tuple, 0, other);
- Py_XINCREF(other);
- if (!result) {
- if (SwigPyObject_Check(self) && SwigPyObject_Check(other)) {
- result = SwigPyObject_richcompare((SwigPyObject *)self, (SwigPyObject *)other, op);
- } else {
- result = Py_NotImplemented;
- Py_INCREF(result);
- }
- }
- Py_DECREF(tuple);
- return result;
-}
-
-SWIGINTERN PyMethodDef SwigPyBuiltin___THyPhyString_methods[] = {
- { "myType", (PyCFunction) _wrap__THyPhyString_myType, METH_VARARGS, (char*) "" },
- { NULL, NULL, 0, NULL } /* Sentinel */
-};
-
-static PyHeapTypeObject SwigPyBuiltin___THyPhyString_type = {
- {
-#if PY_VERSION_HEX >= 0x03000000
- PyVarObject_HEAD_INIT(NULL, 0)
-#else
- PyObject_HEAD_INIT(NULL)
- 0, /* ob_size */
-#endif
- "_THyPhyString", /* tp_name */
- sizeof(SwigPyObject), /* tp_basicsize */
- 0, /* tp_itemsize */
- (destructor) _wrap_delete__THyPhyString_closure, /* tp_dealloc */
- (printfunc) 0, /* tp_print */
- (getattrfunc) 0, /* tp_getattr */
- (setattrfunc) 0, /* tp_setattr */
-#if PY_VERSION_HEX >= 0x03000000
- 0, /* tp_compare */
-#else
- (cmpfunc) 0, /* tp_compare */
-#endif
- (reprfunc) 0, /* tp_repr */
- &SwigPyBuiltin___THyPhyString_type.as_number, /* tp_as_number */
- &SwigPyBuiltin___THyPhyString_type.as_sequence, /* tp_as_sequence */
- &SwigPyBuiltin___THyPhyString_type.as_mapping, /* tp_as_mapping */
- (hashfunc) 0, /* tp_hash */
- (ternaryfunc) 0, /* tp_call */
- (reprfunc) 0, /* tp_str */
- (getattrofunc) 0, /* tp_getattro */
- (setattrofunc) 0, /* tp_setattro */
- &SwigPyBuiltin___THyPhyString_type.as_buffer, /* tp_as_buffer */
-#if PY_VERSION_HEX >= 0x03000000
- Py_TPFLAGS_DEFAULT|Py_TPFLAGS_BASETYPE, /* tp_flags */
-#else
- Py_TPFLAGS_DEFAULT|Py_TPFLAGS_BASETYPE|Py_TPFLAGS_CHECKTYPES, /* tp_flags */
-#endif
- "::_THyPhyString", /* tp_doc */
- (traverseproc) 0, /* tp_traverse */
- (inquiry) 0, /* tp_clear */
- (richcmpfunc) SwigPyBuiltin___THyPhyString_richcompare, /* feature:python:tp_richcompare */
- 0, /* tp_weaklistoffset */
- (getiterfunc) 0, /* tp_iter */
- (iternextfunc) 0, /* tp_iternext */
- SwigPyBuiltin___THyPhyString_methods, /* tp_methods */
- 0, /* tp_members */
- SwigPyBuiltin___THyPhyString_getset, /* tp_getset */
- 0, /* tp_base */
- 0, /* tp_dict */
- (descrgetfunc) 0, /* tp_descr_get */
- (descrsetfunc) 0, /* tp_descr_set */
- (size_t)(((char*)&((SwigPyObject *) 64L)->dict) - (char*) 64L), /* tp_dictoffset */
- (initproc) _wrap_new__THyPhyString, /* tp_init */
- (allocfunc) 0, /* tp_alloc */
- (newfunc) 0, /* tp_new */
- (freefunc) 0, /* tp_free */
- (inquiry) 0, /* tp_is_gc */
- (PyObject*) 0, /* tp_bases */
- (PyObject*) 0, /* tp_mro */
- (PyObject*) 0, /* tp_cache */
- (PyObject*) 0, /* tp_subclasses */
- (PyObject*) 0, /* tp_weaklist */
- (destructor) 0, /* tp_del */
-#if PY_VERSION_HEX >= 0x02060000
- (int) 0, /* tp_version_tag */
-#endif
- },
- {
- (binaryfunc) 0, /* nb_add */
- (binaryfunc) 0, /* nb_subtract */
- (binaryfunc) 0, /* nb_multiply */
-#if PY_VERSION_HEX < 0x03000000
- (binaryfunc) 0, /* nb_divide */
-#endif
- (binaryfunc) 0, /* nb_remainder */
- (binaryfunc) 0, /* nb_divmod */
- (ternaryfunc) 0, /* nb_power */
- (unaryfunc) 0, /* nb_negative */
- (unaryfunc) 0, /* nb_positive */
- (unaryfunc) 0, /* nb_absolute */
- (inquiry) 0, /* nb_nonzero */
- (unaryfunc) 0, /* nb_invert */
- (binaryfunc) 0, /* nb_lshift */
- (binaryfunc) 0, /* nb_rshift */
- (binaryfunc) 0, /* nb_and */
- (binaryfunc) 0, /* nb_xor */
- (binaryfunc) 0, /* nb_or */
-#if PY_VERSION_HEX < 0x03000000
- (coercion) 0, /* nb_coerce */
-#endif
- (unaryfunc) 0, /* nb_int */
-#if PY_VERSION_HEX >= 0x03000000
- (void*) 0, /* nb_reserved */
-#else
- (unaryfunc) 0, /* nb_long */
-#endif
- (unaryfunc) 0, /* nb_float */
-#if PY_VERSION_HEX < 0x03000000
- (unaryfunc) 0, /* nb_oct */
- (unaryfunc) 0, /* nb_hex */
-#endif
- (binaryfunc) 0, /* nb_inplace_add */
- (binaryfunc) 0, /* nb_inplace_subtract */
- (binaryfunc) 0, /* nb_inplace_multiply */
-#if PY_VERSION_HEX < 0x03000000
- (binaryfunc) 0, /* nb_inplace_divide */
-#endif
- (binaryfunc) 0, /* nb_inplace_remainder */
- (ternaryfunc) 0, /* nb_inplace_power */
- (binaryfunc) 0, /* nb_inplace_lshift */
- (binaryfunc) 0, /* nb_inplace_rshift */
- (binaryfunc) 0, /* nb_inplace_and */
- (binaryfunc) 0, /* nb_inplace_xor */
- (binaryfunc) 0, /* nb_inplace_or */
- (binaryfunc) 0, /* nb_floor_divide */
- (binaryfunc) 0, /* nb_true_divide */
- (binaryfunc) 0, /* nb_inplace_floor_divide */
- (binaryfunc) 0, /* nb_inplace_true_divide */
-#if PY_VERSION_HEX >= 0x02050000
- (unaryfunc) 0, /* nb_index */
-#endif
- },
- {
- (lenfunc) 0, /* mp_length */
- (binaryfunc) 0, /* mp_subscript */
- (objobjargproc) 0, /* mp_ass_subscript */
- },
- {
- (lenfunc) 0, /* sq_length */
- (binaryfunc) 0, /* sq_concat */
- (ssizeargfunc) 0, /* sq_repeat */
- (ssizeargfunc) 0, /* sq_item */
-#if PY_VERSION_HEX >= 0x03000000
- (void*) 0, /* was_sq_slice */
-#else
- (ssizessizeargfunc) 0, /* sq_slice */
-#endif
- (ssizeobjargproc) 0, /* sq_ass_item */
-#if PY_VERSION_HEX >= 0x03000000
- (void*) 0, /* was_sq_ass_slice */
-#else
- (ssizessizeobjargproc) 0, /* sq_ass_slice */
-#endif
- (objobjproc) 0, /* sq_contains */
- (binaryfunc) 0, /* sq_inplace_concat */
- (ssizeargfunc) 0, /* sq_inplace_repeat */
- },
- {
-#if PY_VERSION_HEX < 0x03000000
- (readbufferproc) 0, /* bf_getreadbuffer */
- (writebufferproc) 0, /* bf_getwritebuffer */
- (segcountproc) 0, /* bf_getsegcount */
- (charbufferproc) 0, /* bf_getcharbuffer */
-#endif
-#if PY_VERSION_HEX >= 0x02060000
- (getbufferproc) 0, /* bf_getbuffer */
- (releasebufferproc) 0, /* bf_releasebuffer */
-#endif
- },
- (PyObject*) 0, /* ht_name */
- (PyObject*) 0, /* ht_slots */
-};
-
-SWIGINTERN SwigPyClientData SwigPyBuiltin___THyPhyString_clientdata = {0, 0, 0, 0, 0, 0, (PyTypeObject *)&SwigPyBuiltin___THyPhyString_type};
-
-SWIGPY_DESTRUCTOR_CLOSURE(_wrap_delete__THyPhyNumber)
-static SwigPyGetSet _THyPhyNumber_nValue_getset = { _wrap__THyPhyNumber_nValue_get, _wrap__THyPhyNumber_nValue_set };
-SWIGINTERN PyGetSetDef SwigPyBuiltin___THyPhyNumber_getset[] = {
- { (char*) "nValue", (getter) SwigPyBuiltin_GetterClosure, (setter) SwigPyBuiltin_SetterClosure, (char*)"_THyPhyNumber.nValue", (void*) &_THyPhyNumber_nValue_getset }
-,
- {NULL, NULL, NULL, NULL, NULL} /* Sentinel */
-};
-
-SWIGINTERN PyObject *
-SwigPyBuiltin___THyPhyNumber_richcompare(PyObject *self, PyObject *other, int op) {
- PyObject *result = NULL;
- PyObject *tuple = PyTuple_New(1);
- assert(tuple);
- PyTuple_SET_ITEM(tuple, 0, other);
- Py_XINCREF(other);
- if (!result) {
- if (SwigPyObject_Check(self) && SwigPyObject_Check(other)) {
- result = SwigPyObject_richcompare((SwigPyObject *)self, (SwigPyObject *)other, op);
- } else {
- result = Py_NotImplemented;
- Py_INCREF(result);
- }
- }
- Py_DECREF(tuple);
- return result;
-}
-
-SWIGINTERN PyMethodDef SwigPyBuiltin___THyPhyNumber_methods[] = {
- { "myType", (PyCFunction) _wrap__THyPhyNumber_myType, METH_VARARGS, (char*) "" },
- { NULL, NULL, 0, NULL } /* Sentinel */
-};
-
-static PyHeapTypeObject SwigPyBuiltin___THyPhyNumber_type = {
- {
-#if PY_VERSION_HEX >= 0x03000000
- PyVarObject_HEAD_INIT(NULL, 0)
-#else
- PyObject_HEAD_INIT(NULL)
- 0, /* ob_size */
-#endif
- "_THyPhyNumber", /* tp_name */
- sizeof(SwigPyObject), /* tp_basicsize */
- 0, /* tp_itemsize */
- (destructor) _wrap_delete__THyPhyNumber_closure, /* tp_dealloc */
- (printfunc) 0, /* tp_print */
- (getattrfunc) 0, /* tp_getattr */
- (setattrfunc) 0, /* tp_setattr */
-#if PY_VERSION_HEX >= 0x03000000
- 0, /* tp_compare */
-#else
- (cmpfunc) 0, /* tp_compare */
-#endif
- (reprfunc) 0, /* tp_repr */
- &SwigPyBuiltin___THyPhyNumber_type.as_number, /* tp_as_number */
- &SwigPyBuiltin___THyPhyNumber_type.as_sequence, /* tp_as_sequence */
- &SwigPyBuiltin___THyPhyNumber_type.as_mapping, /* tp_as_mapping */
- (hashfunc) 0, /* tp_hash */
- (ternaryfunc) 0, /* tp_call */
- (reprfunc) 0, /* tp_str */
- (getattrofunc) 0, /* tp_getattro */
- (setattrofunc) 0, /* tp_setattro */
- &SwigPyBuiltin___THyPhyNumber_type.as_buffer, /* tp_as_buffer */
-#if PY_VERSION_HEX >= 0x03000000
- Py_TPFLAGS_DEFAULT|Py_TPFLAGS_BASETYPE, /* tp_flags */
-#else
- Py_TPFLAGS_DEFAULT|Py_TPFLAGS_BASETYPE|Py_TPFLAGS_CHECKTYPES, /* tp_flags */
-#endif
- "::_THyPhyNumber", /* tp_doc */
- (traverseproc) 0, /* tp_traverse */
- (inquiry) 0, /* tp_clear */
- (richcmpfunc) SwigPyBuiltin___THyPhyNumber_richcompare, /* feature:python:tp_richcompare */
- 0, /* tp_weaklistoffset */
- (getiterfunc) 0, /* tp_iter */
- (iternextfunc) 0, /* tp_iternext */
- SwigPyBuiltin___THyPhyNumber_methods, /* tp_methods */
- 0, /* tp_members */
- SwigPyBuiltin___THyPhyNumber_getset, /* tp_getset */
- 0, /* tp_base */
- 0, /* tp_dict */
- (descrgetfunc) 0, /* tp_descr_get */
- (descrsetfunc) 0, /* tp_descr_set */
- (size_t)(((char*)&((SwigPyObject *) 64L)->dict) - (char*) 64L), /* tp_dictoffset */
- (initproc) _wrap_new__THyPhyNumber, /* tp_init */
- (allocfunc) 0, /* tp_alloc */
- (newfunc) 0, /* tp_new */
- (freefunc) 0, /* tp_free */
- (inquiry) 0, /* tp_is_gc */
- (PyObject*) 0, /* tp_bases */
- (PyObject*) 0, /* tp_mro */
- (PyObject*) 0, /* tp_cache */
- (PyObject*) 0, /* tp_subclasses */
- (PyObject*) 0, /* tp_weaklist */
- (destructor) 0, /* tp_del */
-#if PY_VERSION_HEX >= 0x02060000
- (int) 0, /* tp_version_tag */
-#endif
- },
- {
- (binaryfunc) 0, /* nb_add */
- (binaryfunc) 0, /* nb_subtract */
- (binaryfunc) 0, /* nb_multiply */
-#if PY_VERSION_HEX < 0x03000000
- (binaryfunc) 0, /* nb_divide */
-#endif
- (binaryfunc) 0, /* nb_remainder */
- (binaryfunc) 0, /* nb_divmod */
- (ternaryfunc) 0, /* nb_power */
- (unaryfunc) 0, /* nb_negative */
- (unaryfunc) 0, /* nb_positive */
- (unaryfunc) 0, /* nb_absolute */
- (inquiry) 0, /* nb_nonzero */
- (unaryfunc) 0, /* nb_invert */
- (binaryfunc) 0, /* nb_lshift */
- (binaryfunc) 0, /* nb_rshift */
- (binaryfunc) 0, /* nb_and */
- (binaryfunc) 0, /* nb_xor */
- (binaryfunc) 0, /* nb_or */
-#if PY_VERSION_HEX < 0x03000000
- (coercion) 0, /* nb_coerce */
-#endif
- (unaryfunc) 0, /* nb_int */
-#if PY_VERSION_HEX >= 0x03000000
- (void*) 0, /* nb_reserved */
-#else
- (unaryfunc) 0, /* nb_long */
-#endif
- (unaryfunc) 0, /* nb_float */
-#if PY_VERSION_HEX < 0x03000000
- (unaryfunc) 0, /* nb_oct */
- (unaryfunc) 0, /* nb_hex */
-#endif
- (binaryfunc) 0, /* nb_inplace_add */
- (binaryfunc) 0, /* nb_inplace_subtract */
- (binaryfunc) 0, /* nb_inplace_multiply */
-#if PY_VERSION_HEX < 0x03000000
- (binaryfunc) 0, /* nb_inplace_divide */
-#endif
- (binaryfunc) 0, /* nb_inplace_remainder */
- (ternaryfunc) 0, /* nb_inplace_power */
- (binaryfunc) 0, /* nb_inplace_lshift */
- (binaryfunc) 0, /* nb_inplace_rshift */
- (binaryfunc) 0, /* nb_inplace_and */
- (binaryfunc) 0, /* nb_inplace_xor */
- (binaryfunc) 0, /* nb_inplace_or */
- (binaryfunc) 0, /* nb_floor_divide */
- (binaryfunc) 0, /* nb_true_divide */
- (binaryfunc) 0, /* nb_inplace_floor_divide */
- (binaryfunc) 0, /* nb_inplace_true_divide */
-#if PY_VERSION_HEX >= 0x02050000
- (unaryfunc) 0, /* nb_index */
-#endif
- },
- {
- (lenfunc) 0, /* mp_length */
- (binaryfunc) 0, /* mp_subscript */
- (objobjargproc) 0, /* mp_ass_subscript */
- },
- {
- (lenfunc) 0, /* sq_length */
- (binaryfunc) 0, /* sq_concat */
- (ssizeargfunc) 0, /* sq_repeat */
- (ssizeargfunc) 0, /* sq_item */
-#if PY_VERSION_HEX >= 0x03000000
- (void*) 0, /* was_sq_slice */
-#else
- (ssizessizeargfunc) 0, /* sq_slice */
-#endif
- (ssizeobjargproc) 0, /* sq_ass_item */
-#if PY_VERSION_HEX >= 0x03000000
- (void*) 0, /* was_sq_ass_slice */
-#else
- (ssizessizeobjargproc) 0, /* sq_ass_slice */
-#endif
- (objobjproc) 0, /* sq_contains */
- (binaryfunc) 0, /* sq_inplace_concat */
- (ssizeargfunc) 0, /* sq_inplace_repeat */
- },
- {
-#if PY_VERSION_HEX < 0x03000000
- (readbufferproc) 0, /* bf_getreadbuffer */
- (writebufferproc) 0, /* bf_getwritebuffer */
- (segcountproc) 0, /* bf_getsegcount */
- (charbufferproc) 0, /* bf_getcharbuffer */
-#endif
-#if PY_VERSION_HEX >= 0x02060000
- (getbufferproc) 0, /* bf_getbuffer */
- (releasebufferproc) 0, /* bf_releasebuffer */
-#endif
- },
- (PyObject*) 0, /* ht_name */
- (PyObject*) 0, /* ht_slots */
-};
-
-SWIGINTERN SwigPyClientData SwigPyBuiltin___THyPhyNumber_clientdata = {0, 0, 0, 0, 0, 0, (PyTypeObject *)&SwigPyBuiltin___THyPhyNumber_type};
-
-SWIGPY_DESTRUCTOR_CLOSURE(_wrap_delete__THyPhyMatrix)
-static SwigPyGetSet _THyPhyMatrix_mRows_getset = { _wrap__THyPhyMatrix_mRows_get, _wrap__THyPhyMatrix_mRows_set };
-static SwigPyGetSet _THyPhyMatrix_mCols_getset = { _wrap__THyPhyMatrix_mCols_get, _wrap__THyPhyMatrix_mCols_set };
-static SwigPyGetSet _THyPhyMatrix_mData_getset = { _wrap__THyPhyMatrix_mData_get, _wrap__THyPhyMatrix_mData_set };
-SWIGINTERN PyGetSetDef SwigPyBuiltin___THyPhyMatrix_getset[] = {
- { (char*) "mRows", (getter) SwigPyBuiltin_GetterClosure, (setter) SwigPyBuiltin_SetterClosure, (char*)"_THyPhyMatrix.mRows", (void*) &_THyPhyMatrix_mRows_getset }
-,
- { (char*) "mCols", (getter) SwigPyBuiltin_GetterClosure, (setter) SwigPyBuiltin_SetterClosure, (char*)"_THyPhyMatrix.mCols", (void*) &_THyPhyMatrix_mCols_getset }
-,
- { (char*) "mData", (getter) SwigPyBuiltin_GetterClosure, (setter) SwigPyBuiltin_SetterClosure, (char*)"_THyPhyMatrix.mData", (void*) &_THyPhyMatrix_mData_getset }
-,
- {NULL, NULL, NULL, NULL, NULL} /* Sentinel */
-};
-
-SWIGINTERN PyObject *
-SwigPyBuiltin___THyPhyMatrix_richcompare(PyObject *self, PyObject *other, int op) {
- PyObject *result = NULL;
- PyObject *tuple = PyTuple_New(1);
- assert(tuple);
- PyTuple_SET_ITEM(tuple, 0, other);
- Py_XINCREF(other);
- if (!result) {
- if (SwigPyObject_Check(self) && SwigPyObject_Check(other)) {
- result = SwigPyObject_richcompare((SwigPyObject *)self, (SwigPyObject *)other, op);
- } else {
- result = Py_NotImplemented;
- Py_INCREF(result);
- }
- }
- Py_DECREF(tuple);
- return result;
-}
-
-SWIGINTERN PyMethodDef SwigPyBuiltin___THyPhyMatrix_methods[] = {
- { "myType", (PyCFunction) _wrap__THyPhyMatrix_myType, METH_VARARGS, (char*) "" },
- { "MatrixCell", (PyCFunction) _wrap__THyPhyMatrix_MatrixCell, METH_VARARGS, (char*) "" },
- { NULL, NULL, 0, NULL } /* Sentinel */
-};
-
-static PyHeapTypeObject SwigPyBuiltin___THyPhyMatrix_type = {
- {
-#if PY_VERSION_HEX >= 0x03000000
- PyVarObject_HEAD_INIT(NULL, 0)
-#else
- PyObject_HEAD_INIT(NULL)
- 0, /* ob_size */
-#endif
- "_THyPhyMatrix", /* tp_name */
- sizeof(SwigPyObject), /* tp_basicsize */
- 0, /* tp_itemsize */
- (destructor) _wrap_delete__THyPhyMatrix_closure, /* tp_dealloc */
- (printfunc) 0, /* tp_print */
- (getattrfunc) 0, /* tp_getattr */
- (setattrfunc) 0, /* tp_setattr */
-#if PY_VERSION_HEX >= 0x03000000
- 0, /* tp_compare */
-#else
- (cmpfunc) 0, /* tp_compare */
-#endif
- (reprfunc) 0, /* tp_repr */
- &SwigPyBuiltin___THyPhyMatrix_type.as_number, /* tp_as_number */
- &SwigPyBuiltin___THyPhyMatrix_type.as_sequence, /* tp_as_sequence */
- &SwigPyBuiltin___THyPhyMatrix_type.as_mapping, /* tp_as_mapping */
- (hashfunc) 0, /* tp_hash */
- (ternaryfunc) 0, /* tp_call */
- (reprfunc) 0, /* tp_str */
- (getattrofunc) 0, /* tp_getattro */
- (setattrofunc) 0, /* tp_setattro */
- &SwigPyBuiltin___THyPhyMatrix_type.as_buffer, /* tp_as_buffer */
-#if PY_VERSION_HEX >= 0x03000000
- Py_TPFLAGS_DEFAULT|Py_TPFLAGS_BASETYPE, /* tp_flags */
-#else
- Py_TPFLAGS_DEFAULT|Py_TPFLAGS_BASETYPE|Py_TPFLAGS_CHECKTYPES, /* tp_flags */
-#endif
- "::_THyPhyMatrix", /* tp_doc */
- (traverseproc) 0, /* tp_traverse */
- (inquiry) 0, /* tp_clear */
- (richcmpfunc) SwigPyBuiltin___THyPhyMatrix_richcompare, /* feature:python:tp_richcompare */
- 0, /* tp_weaklistoffset */
- (getiterfunc) 0, /* tp_iter */
- (iternextfunc) 0, /* tp_iternext */
- SwigPyBuiltin___THyPhyMatrix_methods, /* tp_methods */
- 0, /* tp_members */
- SwigPyBuiltin___THyPhyMatrix_getset, /* tp_getset */
- 0, /* tp_base */
- 0, /* tp_dict */
- (descrgetfunc) 0, /* tp_descr_get */
- (descrsetfunc) 0, /* tp_descr_set */
- (size_t)(((char*)&((SwigPyObject *) 64L)->dict) - (char*) 64L), /* tp_dictoffset */
- (initproc) _wrap_new__THyPhyMatrix, /* tp_init */
- (allocfunc) 0, /* tp_alloc */
- (newfunc) 0, /* tp_new */
- (freefunc) 0, /* tp_free */
- (inquiry) 0, /* tp_is_gc */
- (PyObject*) 0, /* tp_bases */
- (PyObject*) 0, /* tp_mro */
- (PyObject*) 0, /* tp_cache */
- (PyObject*) 0, /* tp_subclasses */
- (PyObject*) 0, /* tp_weaklist */
- (destructor) 0, /* tp_del */
-#if PY_VERSION_HEX >= 0x02060000
- (int) 0, /* tp_version_tag */
-#endif
- },
- {
- (binaryfunc) 0, /* nb_add */
- (binaryfunc) 0, /* nb_subtract */
- (binaryfunc) 0, /* nb_multiply */
-#if PY_VERSION_HEX < 0x03000000
- (binaryfunc) 0, /* nb_divide */
-#endif
- (binaryfunc) 0, /* nb_remainder */
- (binaryfunc) 0, /* nb_divmod */
- (ternaryfunc) 0, /* nb_power */
- (unaryfunc) 0, /* nb_negative */
- (unaryfunc) 0, /* nb_positive */
- (unaryfunc) 0, /* nb_absolute */
- (inquiry) 0, /* nb_nonzero */
- (unaryfunc) 0, /* nb_invert */
- (binaryfunc) 0, /* nb_lshift */
- (binaryfunc) 0, /* nb_rshift */
- (binaryfunc) 0, /* nb_and */
- (binaryfunc) 0, /* nb_xor */
- (binaryfunc) 0, /* nb_or */
-#if PY_VERSION_HEX < 0x03000000
- (coercion) 0, /* nb_coerce */
-#endif
- (unaryfunc) 0, /* nb_int */
-#if PY_VERSION_HEX >= 0x03000000
- (void*) 0, /* nb_reserved */
-#else
- (unaryfunc) 0, /* nb_long */
-#endif
- (unaryfunc) 0, /* nb_float */
-#if PY_VERSION_HEX < 0x03000000
- (unaryfunc) 0, /* nb_oct */
- (unaryfunc) 0, /* nb_hex */
-#endif
- (binaryfunc) 0, /* nb_inplace_add */
- (binaryfunc) 0, /* nb_inplace_subtract */
- (binaryfunc) 0, /* nb_inplace_multiply */
-#if PY_VERSION_HEX < 0x03000000
- (binaryfunc) 0, /* nb_inplace_divide */
-#endif
- (binaryfunc) 0, /* nb_inplace_remainder */
- (ternaryfunc) 0, /* nb_inplace_power */
- (binaryfunc) 0, /* nb_inplace_lshift */
- (binaryfunc) 0, /* nb_inplace_rshift */
- (binaryfunc) 0, /* nb_inplace_and */
- (binaryfunc) 0, /* nb_inplace_xor */
- (binaryfunc) 0, /* nb_inplace_or */
- (binaryfunc) 0, /* nb_floor_divide */
- (binaryfunc) 0, /* nb_true_divide */
- (binaryfunc) 0, /* nb_inplace_floor_divide */
- (binaryfunc) 0, /* nb_inplace_true_divide */
-#if PY_VERSION_HEX >= 0x02050000
- (unaryfunc) 0, /* nb_index */
-#endif
- },
- {
- (lenfunc) 0, /* mp_length */
- (binaryfunc) 0, /* mp_subscript */
- (objobjargproc) 0, /* mp_ass_subscript */
- },
- {
- (lenfunc) 0, /* sq_length */
- (binaryfunc) 0, /* sq_concat */
- (ssizeargfunc) 0, /* sq_repeat */
- (ssizeargfunc) 0, /* sq_item */
-#if PY_VERSION_HEX >= 0x03000000
- (void*) 0, /* was_sq_slice */
-#else
- (ssizessizeargfunc) 0, /* sq_slice */
-#endif
- (ssizeobjargproc) 0, /* sq_ass_item */
-#if PY_VERSION_HEX >= 0x03000000
- (void*) 0, /* was_sq_ass_slice */
-#else
- (ssizessizeobjargproc) 0, /* sq_ass_slice */
-#endif
- (objobjproc) 0, /* sq_contains */
- (binaryfunc) 0, /* sq_inplace_concat */
- (ssizeargfunc) 0, /* sq_inplace_repeat */
- },
- {
-#if PY_VERSION_HEX < 0x03000000
- (readbufferproc) 0, /* bf_getreadbuffer */
- (writebufferproc) 0, /* bf_getwritebuffer */
- (segcountproc) 0, /* bf_getsegcount */
- (charbufferproc) 0, /* bf_getcharbuffer */
-#endif
-#if PY_VERSION_HEX >= 0x02060000
- (getbufferproc) 0, /* bf_getbuffer */
- (releasebufferproc) 0, /* bf_releasebuffer */
-#endif
- },
- (PyObject*) 0, /* ht_name */
- (PyObject*) 0, /* ht_slots */
-};
-
-SWIGINTERN SwigPyClientData SwigPyBuiltin___THyPhyMatrix_clientdata = {0, 0, 0, 0, 0, 0, (PyTypeObject *)&SwigPyBuiltin___THyPhyMatrix_type};
-
-SWIGPY_DESTRUCTOR_CLOSURE(_wrap_delete__THyPhy)
-SWIGINTERN PyGetSetDef SwigPyBuiltin___THyPhy_getset[] = {
- {NULL, NULL, NULL, NULL, NULL} /* Sentinel */
-};
-
-SWIGINTERN PyObject *
-SwigPyBuiltin___THyPhy_richcompare(PyObject *self, PyObject *other, int op) {
- PyObject *result = NULL;
- PyObject *tuple = PyTuple_New(1);
- assert(tuple);
- PyTuple_SET_ITEM(tuple, 0, other);
- Py_XINCREF(other);
- if (!result) {
- if (SwigPyObject_Check(self) && SwigPyObject_Check(other)) {
- result = SwigPyObject_richcompare((SwigPyObject *)self, (SwigPyObject *)other, op);
- } else {
- result = Py_NotImplemented;
- Py_INCREF(result);
- }
- }
- Py_DECREF(tuple);
- return result;
-}
-
-SWIGINTERN PyMethodDef SwigPyBuiltin___THyPhy_methods[] = {
- { "ExecuteBF", (PyCFunction) _wrap__THyPhy_ExecuteBF, METH_VARARGS, (char*) "" },
- { "InitTHyPhy", (PyCFunction) _wrap__THyPhy_InitTHyPhy, METH_VARARGS, (char*) "" },
- { "ClearAll", (PyCFunction) _wrap__THyPhy_ClearAll, METH_VARARGS, (char*) "" },
- { "AskFor", (PyCFunction) _wrap__THyPhy_AskFor, METH_VARARGS, (char*) "" },
- { "DumpResult", (PyCFunction) _wrap__THyPhy_DumpResult, METH_VARARGS, (char*) "" },
- { "CanCast", (PyCFunction) _wrap__THyPhy_CanCast, METH_VARARGS, (char*) "" },
- { "CastResult", (PyCFunction) _wrap__THyPhy_CastResult, METH_VARARGS, (char*) "" },
- { "SetCallbackHandler", (PyCFunction) _wrap__THyPhy_SetCallbackHandler, METH_VARARGS, (char*) "" },
- { "GetCallbackHandler", (PyCFunction) _wrap__THyPhy_GetCallbackHandler, METH_VARARGS, (char*) "" },
- { "GetWarnings", (PyCFunction) _wrap__THyPhy_GetWarnings, METH_VARARGS, (char*) "" },
- { "GetErrors", (PyCFunction) _wrap__THyPhy_GetErrors, METH_VARARGS, (char*) "" },
- { "GetStdout", (PyCFunction) _wrap__THyPhy_GetStdout, METH_VARARGS, (char*) "" },
- { "PushWarning", (PyCFunction) _wrap__THyPhy_PushWarning, METH_VARARGS, (char*) "" },
- { "PushError", (PyCFunction) _wrap__THyPhy_PushError, METH_VARARGS, (char*) "" },
- { "PushOutString", (PyCFunction) _wrap__THyPhy_PushOutString, METH_VARARGS, (char*) "" },
- { NULL, NULL, 0, NULL } /* Sentinel */
-};
-
-static PyHeapTypeObject SwigPyBuiltin___THyPhy_type = {
- {
-#if PY_VERSION_HEX >= 0x03000000
- PyVarObject_HEAD_INIT(NULL, 0)
-#else
- PyObject_HEAD_INIT(NULL)
- 0, /* ob_size */
-#endif
- "_THyPhy", /* tp_name */
- sizeof(SwigPyObject), /* tp_basicsize */
- 0, /* tp_itemsize */
- (destructor) _wrap_delete__THyPhy_closure, /* tp_dealloc */
- (printfunc) 0, /* tp_print */
- (getattrfunc) 0, /* tp_getattr */
- (setattrfunc) 0, /* tp_setattr */
-#if PY_VERSION_HEX >= 0x03000000
- 0, /* tp_compare */
-#else
- (cmpfunc) 0, /* tp_compare */
-#endif
- (reprfunc) 0, /* tp_repr */
- &SwigPyBuiltin___THyPhy_type.as_number, /* tp_as_number */
- &SwigPyBuiltin___THyPhy_type.as_sequence, /* tp_as_sequence */
- &SwigPyBuiltin___THyPhy_type.as_mapping, /* tp_as_mapping */
- (hashfunc) 0, /* tp_hash */
- (ternaryfunc) 0, /* tp_call */
- (reprfunc) 0, /* tp_str */
- (getattrofunc) 0, /* tp_getattro */
- (setattrofunc) 0, /* tp_setattro */
- &SwigPyBuiltin___THyPhy_type.as_buffer, /* tp_as_buffer */
-#if PY_VERSION_HEX >= 0x03000000
- Py_TPFLAGS_DEFAULT|Py_TPFLAGS_BASETYPE, /* tp_flags */
-#else
- Py_TPFLAGS_DEFAULT|Py_TPFLAGS_BASETYPE|Py_TPFLAGS_CHECKTYPES, /* tp_flags */
-#endif
- "::_THyPhy", /* tp_doc */
- (traverseproc) 0, /* tp_traverse */
- (inquiry) 0, /* tp_clear */
- (richcmpfunc) SwigPyBuiltin___THyPhy_richcompare, /* feature:python:tp_richcompare */
- 0, /* tp_weaklistoffset */
- (getiterfunc) 0, /* tp_iter */
- (iternextfunc) 0, /* tp_iternext */
- SwigPyBuiltin___THyPhy_methods, /* tp_methods */
- 0, /* tp_members */
- SwigPyBuiltin___THyPhy_getset, /* tp_getset */
- 0, /* tp_base */
- 0, /* tp_dict */
- (descrgetfunc) 0, /* tp_descr_get */
- (descrsetfunc) 0, /* tp_descr_set */
- (size_t)(((char*)&((SwigPyObject *) 64L)->dict) - (char*) 64L), /* tp_dictoffset */
- (initproc) _wrap_new__THyPhy, /* tp_init */
- (allocfunc) 0, /* tp_alloc */
- (newfunc) 0, /* tp_new */
- (freefunc) 0, /* tp_free */
- (inquiry) 0, /* tp_is_gc */
- (PyObject*) 0, /* tp_bases */
- (PyObject*) 0, /* tp_mro */
- (PyObject*) 0, /* tp_cache */
- (PyObject*) 0, /* tp_subclasses */
- (PyObject*) 0, /* tp_weaklist */
- (destructor) 0, /* tp_del */
-#if PY_VERSION_HEX >= 0x02060000
- (int) 0, /* tp_version_tag */
-#endif
- },
- {
- (binaryfunc) 0, /* nb_add */
- (binaryfunc) 0, /* nb_subtract */
- (binaryfunc) 0, /* nb_multiply */
-#if PY_VERSION_HEX < 0x03000000
- (binaryfunc) 0, /* nb_divide */
-#endif
- (binaryfunc) 0, /* nb_remainder */
- (binaryfunc) 0, /* nb_divmod */
- (ternaryfunc) 0, /* nb_power */
- (unaryfunc) 0, /* nb_negative */
- (unaryfunc) 0, /* nb_positive */
- (unaryfunc) 0, /* nb_absolute */
- (inquiry) 0, /* nb_nonzero */
- (unaryfunc) 0, /* nb_invert */
- (binaryfunc) 0, /* nb_lshift */
- (binaryfunc) 0, /* nb_rshift */
- (binaryfunc) 0, /* nb_and */
- (binaryfunc) 0, /* nb_xor */
- (binaryfunc) 0, /* nb_or */
-#if PY_VERSION_HEX < 0x03000000
- (coercion) 0, /* nb_coerce */
-#endif
- (unaryfunc) 0, /* nb_int */
-#if PY_VERSION_HEX >= 0x03000000
- (void*) 0, /* nb_reserved */
-#else
- (unaryfunc) 0, /* nb_long */
-#endif
- (unaryfunc) 0, /* nb_float */
-#if PY_VERSION_HEX < 0x03000000
- (unaryfunc) 0, /* nb_oct */
- (unaryfunc) 0, /* nb_hex */
-#endif
- (binaryfunc) 0, /* nb_inplace_add */
- (binaryfunc) 0, /* nb_inplace_subtract */
- (binaryfunc) 0, /* nb_inplace_multiply */
-#if PY_VERSION_HEX < 0x03000000
- (binaryfunc) 0, /* nb_inplace_divide */
-#endif
- (binaryfunc) 0, /* nb_inplace_remainder */
- (ternaryfunc) 0, /* nb_inplace_power */
- (binaryfunc) 0, /* nb_inplace_lshift */
- (binaryfunc) 0, /* nb_inplace_rshift */
- (binaryfunc) 0, /* nb_inplace_and */
- (binaryfunc) 0, /* nb_inplace_xor */
- (binaryfunc) 0, /* nb_inplace_or */
- (binaryfunc) 0, /* nb_floor_divide */
- (binaryfunc) 0, /* nb_true_divide */
- (binaryfunc) 0, /* nb_inplace_floor_divide */
- (binaryfunc) 0, /* nb_inplace_true_divide */
-#if PY_VERSION_HEX >= 0x02050000
- (unaryfunc) 0, /* nb_index */
-#endif
- },
- {
- (lenfunc) 0, /* mp_length */
- (binaryfunc) 0, /* mp_subscript */
- (objobjargproc) 0, /* mp_ass_subscript */
- },
- {
- (lenfunc) 0, /* sq_length */
- (binaryfunc) 0, /* sq_concat */
- (ssizeargfunc) 0, /* sq_repeat */
- (ssizeargfunc) 0, /* sq_item */
-#if PY_VERSION_HEX >= 0x03000000
- (void*) 0, /* was_sq_slice */
-#else
- (ssizessizeargfunc) 0, /* sq_slice */
-#endif
- (ssizeobjargproc) 0, /* sq_ass_item */
-#if PY_VERSION_HEX >= 0x03000000
- (void*) 0, /* was_sq_ass_slice */
-#else
- (ssizessizeobjargproc) 0, /* sq_ass_slice */
-#endif
- (objobjproc) 0, /* sq_contains */
- (binaryfunc) 0, /* sq_inplace_concat */
- (ssizeargfunc) 0, /* sq_inplace_repeat */
- },
- {
-#if PY_VERSION_HEX < 0x03000000
- (readbufferproc) 0, /* bf_getreadbuffer */
- (writebufferproc) 0, /* bf_getwritebuffer */
- (segcountproc) 0, /* bf_getsegcount */
- (charbufferproc) 0, /* bf_getcharbuffer */
-#endif
-#if PY_VERSION_HEX >= 0x02060000
- (getbufferproc) 0, /* bf_getbuffer */
- (releasebufferproc) 0, /* bf_releasebuffer */
-#endif
- },
- (PyObject*) 0, /* ht_name */
- (PyObject*) 0, /* ht_slots */
-};
-
-SWIGINTERN SwigPyClientData SwigPyBuiltin___THyPhy_clientdata = {0, 0, 0, 0, 0, 0, (PyTypeObject *)&SwigPyBuiltin___THyPhy_type};
-
-
-/* -------- TYPE CONVERSION AND EQUIVALENCE RULES (BEGIN) -------- */
-
-static void *_p__THyPhyNumberTo_p__THyPhyReturnObject(void *x, int *SWIGUNUSEDPARM(newmemory)) {
- return (void *)((_THyPhyReturnObject *) ((_THyPhyNumber *) x));
-}
-static void *_p__THyPhyMatrixTo_p__THyPhyReturnObject(void *x, int *SWIGUNUSEDPARM(newmemory)) {
- return (void *)((_THyPhyReturnObject *) ((_THyPhyMatrix *) x));
-}
-static void *_p__THyPhyStringTo_p__THyPhyReturnObject(void *x, int *SWIGUNUSEDPARM(newmemory)) {
- return (void *)((_THyPhyReturnObject *) ((_THyPhyString *) x));
-}
-static swig_type_info _swigt__p_SwigPyObject = {"_p_SwigPyObject", "SwigPyObject *", 0, 0, (void*)0, 0};
-static swig_type_info _swigt__p__THyPhy = {"_p__THyPhy", "_THyPhy *", 0, 0, (void*)&SwigPyBuiltin___THyPhy_clientdata, 0};
-static swig_type_info _swigt__p__THyPhyMatrix = {"_p__THyPhyMatrix", "_THyPhyMatrix *", 0, 0, (void*)&SwigPyBuiltin___THyPhyMatrix_clientdata, 0};
-static swig_type_info _swigt__p__THyPhyNumber = {"_p__THyPhyNumber", "_THyPhyNumber *", 0, 0, (void*)&SwigPyBuiltin___THyPhyNumber_clientdata, 0};
-static swig_type_info _swigt__p__THyPhyReturnObject = {"_p__THyPhyReturnObject", "_THyPhyReturnObject *", 0, 0, (void*)&SwigPyBuiltin___THyPhyReturnObject_clientdata, 0};
-static swig_type_info _swigt__p__THyPhyString = {"_p__THyPhyString", "_THyPhyString *", 0, 0, (void*)&SwigPyBuiltin___THyPhyString_clientdata, 0};
-static swig_type_info _swigt__p_char = {"_p_char", "char *", 0, 0, (void*)0, 0};
-static swig_type_info _swigt__p_double = {"_p_double", "double *", 0, 0, (void*)0, 0};
-static swig_type_info _swigt__p_f_p_char_int_double__bool = {"_p_f_p_char_int_double__bool", "_ProgressCancelHandler *|bool (*)(char *,int,double)", 0, 0, (void*)0, 0};
-static swig_type_info _swigt__p_void = {"_p_void", "void *", 0, 0, (void*)0, 0};
-
-static swig_type_info *swig_type_initial[] = {
- &_swigt__p_SwigPyObject,
- &_swigt__p__THyPhy,
- &_swigt__p__THyPhyMatrix,
- &_swigt__p__THyPhyNumber,
- &_swigt__p__THyPhyReturnObject,
- &_swigt__p__THyPhyString,
- &_swigt__p_char,
- &_swigt__p_double,
- &_swigt__p_f_p_char_int_double__bool,
- &_swigt__p_void,
-};
-
-static swig_cast_info _swigc__p_SwigPyObject[] = { {&_swigt__p_SwigPyObject, 0, 0, 0},{0, 0, 0, 0}};
-static swig_cast_info _swigc__p__THyPhy[] = { {&_swigt__p__THyPhy, 0, 0, 0},{0, 0, 0, 0}};
-static swig_cast_info _swigc__p__THyPhyMatrix[] = { {&_swigt__p__THyPhyMatrix, 0, 0, 0},{0, 0, 0, 0}};
-static swig_cast_info _swigc__p__THyPhyNumber[] = { {&_swigt__p__THyPhyNumber, 0, 0, 0},{0, 0, 0, 0}};
-static swig_cast_info _swigc__p__THyPhyReturnObject[] = { {&_swigt__p__THyPhyReturnObject, 0, 0, 0}, {&_swigt__p__THyPhyNumber, _p__THyPhyNumberTo_p__THyPhyReturnObject, 0, 0}, {&_swigt__p__THyPhyMatrix, _p__THyPhyMatrixTo_p__THyPhyReturnObject, 0, 0}, {&_swigt__p__THyPhyString, _p__THyPhyStringTo_p__THyPhyReturnObject, 0, 0},{0, 0, 0, 0}};
-static swig_cast_info _swigc__p__THyPhyString[] = { {&_swigt__p__THyPhyString, 0, 0, 0},{0, 0, 0, 0}};
-static swig_cast_info _swigc__p_char[] = { {&_swigt__p_char, 0, 0, 0},{0, 0, 0, 0}};
-static swig_cast_info _swigc__p_double[] = { {&_swigt__p_double, 0, 0, 0},{0, 0, 0, 0}};
-static swig_cast_info _swigc__p_f_p_char_int_double__bool[] = { {&_swigt__p_f_p_char_int_double__bool, 0, 0, 0},{0, 0, 0, 0}};
-static swig_cast_info _swigc__p_void[] = { {&_swigt__p_void, 0, 0, 0},{0, 0, 0, 0}};
-
-static swig_cast_info *swig_cast_initial[] = {
- _swigc__p_SwigPyObject,
- _swigc__p__THyPhy,
- _swigc__p__THyPhyMatrix,
- _swigc__p__THyPhyNumber,
- _swigc__p__THyPhyReturnObject,
- _swigc__p__THyPhyString,
- _swigc__p_char,
- _swigc__p_double,
- _swigc__p_f_p_char_int_double__bool,
- _swigc__p_void,
-};
-
-
-/* -------- TYPE CONVERSION AND EQUIVALENCE RULES (END) -------- */
-
-static swig_const_info swig_const_table[] = {
-{0, 0, 0, 0.0, 0, 0}};
-
-#ifdef __cplusplus
-}
-#endif
-static PyTypeObject *builtin_bases[3];
-
-/* -----------------------------------------------------------------------------
- * Type initialization:
- * This problem is tough by the requirement that no dynamic
- * memory is used. Also, since swig_type_info structures store pointers to
- * swig_cast_info structures and swig_cast_info structures store pointers back
- * to swig_type_info structures, we need some lookup code at initialization.
- * The idea is that swig generates all the structures that are needed.
- * The runtime then collects these partially filled structures.
- * The SWIG_InitializeModule function takes these initial arrays out of
- * swig_module, and does all the lookup, filling in the swig_module.types
- * array with the correct data and linking the correct swig_cast_info
- * structures together.
- *
- * The generated swig_type_info structures are assigned staticly to an initial
- * array. We just loop through that array, and handle each type individually.
- * First we lookup if this type has been already loaded, and if so, use the
- * loaded structure instead of the generated one. Then we have to fill in the
- * cast linked list. The cast data is initially stored in something like a
- * two-dimensional array. Each row corresponds to a type (there are the same
- * number of rows as there are in the swig_type_initial array). Each entry in
- * a column is one of the swig_cast_info structures for that type.
- * The cast_initial array is actually an array of arrays, because each row has
- * a variable number of columns. So to actually build the cast linked list,
- * we find the array of casts associated with the type, and loop through it
- * adding the casts to the list. The one last trick we need to do is making
- * sure the type pointer in the swig_cast_info struct is correct.
- *
- * First off, we lookup the cast->type name to see if it is already loaded.
- * There are three cases to handle:
- * 1) If the cast->type has already been loaded AND the type we are adding
- * casting info to has not been loaded (it is in this module), THEN we
- * replace the cast->type pointer with the type pointer that has already
- * been loaded.
- * 2) If BOTH types (the one we are adding casting info to, and the
- * cast->type) are loaded, THEN the cast info has already been loaded by
- * the previous module so we just ignore it.
- * 3) Finally, if cast->type has not already been loaded, then we add that
- * swig_cast_info to the linked list (because the cast->type) pointer will
- * be correct.
- * ----------------------------------------------------------------------------- */
-
-#ifdef __cplusplus
-extern "C" {
-#if 0
-} /* c-mode */
-#endif
-#endif
-
-#if 0
-#define SWIGRUNTIME_DEBUG
-#endif
-
-
-SWIGRUNTIME void
-SWIG_InitializeModule(void *clientdata) {
- size_t i;
- swig_module_info *module_head, *iter;
- int found, init;
-
- clientdata = clientdata;
-
- /* check to see if the circular list has been setup, if not, set it up */
- if (swig_module.next==0) {
- /* Initialize the swig_module */
- swig_module.type_initial = swig_type_initial;
- swig_module.cast_initial = swig_cast_initial;
- swig_module.next = &swig_module;
- init = 1;
- } else {
- init = 0;
- }
-
- /* Try and load any already created modules */
- module_head = SWIG_GetModule(clientdata);
- if (!module_head) {
- /* This is the first module loaded for this interpreter */
- /* so set the swig module into the interpreter */
- SWIG_SetModule(clientdata, &swig_module);
- module_head = &swig_module;
- } else {
- /* the interpreter has loaded a SWIG module, but has it loaded this one? */
- found=0;
- iter=module_head;
- do {
- if (iter==&swig_module) {
- found=1;
- break;
- }
- iter=iter->next;
- } while (iter!= module_head);
-
- /* if the is found in the list, then all is done and we may leave */
- if (found) return;
- /* otherwise we must add out module into the list */
- swig_module.next = module_head->next;
- module_head->next = &swig_module;
- }
-
- /* When multiple interpeters are used, a module could have already been initialized in
- a different interpreter, but not yet have a pointer in this interpreter.
- In this case, we do not want to continue adding types... everything should be
- set up already */
- if (init == 0) return;
-
- /* Now work on filling in swig_module.types */
-#ifdef SWIGRUNTIME_DEBUG
- printf("SWIG_InitializeModule: size %d\n", swig_module.size);
-#endif
- for (i = 0; i < swig_module.size; ++i) {
- swig_type_info *type = 0;
- swig_type_info *ret;
- swig_cast_info *cast;
-
-#ifdef SWIGRUNTIME_DEBUG
- printf("SWIG_InitializeModule: type %d %s\n", i, swig_module.type_initial[i]->name);
-#endif
-
- /* if there is another module already loaded */
- if (swig_module.next != &swig_module) {
- type = SWIG_MangledTypeQueryModule(swig_module.next, &swig_module, swig_module.type_initial[i]->name);
- }
- if (type) {
- /* Overwrite clientdata field */
-#ifdef SWIGRUNTIME_DEBUG
- printf("SWIG_InitializeModule: found type %s\n", type->name);
-#endif
- if (swig_module.type_initial[i]->clientdata) {
- type->clientdata = swig_module.type_initial[i]->clientdata;
-#ifdef SWIGRUNTIME_DEBUG
- printf("SWIG_InitializeModule: found and overwrite type %s \n", type->name);
-#endif
- }
- } else {
- type = swig_module.type_initial[i];
- }
-
- /* Insert casting types */
- cast = swig_module.cast_initial[i];
- while (cast->type) {
- /* Don't need to add information already in the list */
- ret = 0;
-#ifdef SWIGRUNTIME_DEBUG
- printf("SWIG_InitializeModule: look cast %s\n", cast->type->name);
-#endif
- if (swig_module.next != &swig_module) {
- ret = SWIG_MangledTypeQueryModule(swig_module.next, &swig_module, cast->type->name);
-#ifdef SWIGRUNTIME_DEBUG
- if (ret) printf("SWIG_InitializeModule: found cast %s\n", ret->name);
-#endif
- }
- if (ret) {
- if (type == swig_module.type_initial[i]) {
-#ifdef SWIGRUNTIME_DEBUG
- printf("SWIG_InitializeModule: skip old type %s\n", ret->name);
-#endif
- cast->type = ret;
- ret = 0;
- } else {
- /* Check for casting already in the list */
- swig_cast_info *ocast = SWIG_TypeCheck(ret->name, type);
-#ifdef SWIGRUNTIME_DEBUG
- if (ocast) printf("SWIG_InitializeModule: skip old cast %s\n", ret->name);
-#endif
- if (!ocast) ret = 0;
- }
- }
-
- if (!ret) {
-#ifdef SWIGRUNTIME_DEBUG
- printf("SWIG_InitializeModule: adding cast %s\n", cast->type->name);
-#endif
- if (type->cast) {
- type->cast->prev = cast;
- cast->next = type->cast;
- }
- type->cast = cast;
- }
- cast++;
- }
- /* Set entry in modules->types array equal to the type */
- swig_module.types[i] = type;
- }
- swig_module.types[i] = 0;
-
-#ifdef SWIGRUNTIME_DEBUG
- printf("**** SWIG_InitializeModule: Cast List ******\n");
- for (i = 0; i < swig_module.size; ++i) {
- int j = 0;
- swig_cast_info *cast = swig_module.cast_initial[i];
- printf("SWIG_InitializeModule: type %d %s\n", i, swig_module.type_initial[i]->name);
- while (cast->type) {
- printf("SWIG_InitializeModule: cast type %s\n", cast->type->name);
- cast++;
- ++j;
- }
- printf("---- Total casts: %d\n",j);
- }
- printf("**** SWIG_InitializeModule: Cast List ******\n");
-#endif
-}
-
-/* This function will propagate the clientdata field of type to
-* any new swig_type_info structures that have been added into the list
-* of equivalent types. It is like calling
-* SWIG_TypeClientData(type, clientdata) a second time.
-*/
-SWIGRUNTIME void
-SWIG_PropagateClientData(void) {
- size_t i;
- swig_cast_info *equiv;
- static int init_run = 0;
-
- if (init_run) return;
- init_run = 1;
-
- for (i = 0; i < swig_module.size; i++) {
- if (swig_module.types[i]->clientdata) {
- equiv = swig_module.types[i]->cast;
- while (equiv) {
- if (!equiv->converter) {
- if (equiv->type && !equiv->type->clientdata)
- SWIG_TypeClientData(equiv->type, swig_module.types[i]->clientdata);
- }
- equiv = equiv->next;
- }
- }
- }
-}
-
-#ifdef __cplusplus
-#if 0
-{
- /* c-mode */
-#endif
-}
-#endif
-
-
-
-#ifdef __cplusplus
-extern "C" {
-#endif
-
- /* Python-specific SWIG API */
-#define SWIG_newvarlink() SWIG_Python_newvarlink()
-#define SWIG_addvarlink(p, name, get_attr, set_attr) SWIG_Python_addvarlink(p, name, get_attr, set_attr)
-#define SWIG_InstallConstants(d, constants) SWIG_Python_InstallConstants(d, constants)
-
- /* -----------------------------------------------------------------------------
- * global variable support code.
- * ----------------------------------------------------------------------------- */
-
- typedef struct swig_globalvar {
- char *name; /* Name of global variable */
- PyObject *(*get_attr)(void); /* Return the current value */
- int (*set_attr)(PyObject *); /* Set the value */
- struct swig_globalvar *next;
- } swig_globalvar;
-
- typedef struct swig_varlinkobject {
- PyObject_HEAD
- swig_globalvar *vars;
- } swig_varlinkobject;
-
- SWIGINTERN PyObject *
- swig_varlink_repr(swig_varlinkobject *SWIGUNUSEDPARM(v)) {
-#if PY_VERSION_HEX >= 0x03000000
- return PyUnicode_InternFromString("<Swig global variables>");
-#else
- return PyString_FromString("<Swig global variables>");
-#endif
- }
-
- SWIGINTERN PyObject *
- swig_varlink_str(swig_varlinkobject *v) {
-#if PY_VERSION_HEX >= 0x03000000
- PyObject *str = PyUnicode_InternFromString("(");
- PyObject *tail;
- PyObject *joined;
- swig_globalvar *var;
- for (var = v->vars; var; var=var->next) {
- tail = PyUnicode_FromString(var->name);
- joined = PyUnicode_Concat(str, tail);
- Py_DecRef(str);
- Py_DecRef(tail);
- str = joined;
- if (var->next) {
- tail = PyUnicode_InternFromString(", ");
- joined = PyUnicode_Concat(str, tail);
- Py_DecRef(str);
- Py_DecRef(tail);
- str = joined;
- }
- }
- tail = PyUnicode_InternFromString(")");
- joined = PyUnicode_Concat(str, tail);
- Py_DecRef(str);
- Py_DecRef(tail);
- str = joined;
-#else
- PyObject *str = PyString_FromString("(");
- swig_globalvar *var;
- for (var = v->vars; var; var=var->next) {
- PyString_ConcatAndDel(&str,PyString_FromString(var->name));
- if (var->next) PyString_ConcatAndDel(&str,PyString_FromString(", "));
- }
- PyString_ConcatAndDel(&str,PyString_FromString(")"));
-#endif
- return str;
- }
-
- SWIGINTERN int
- swig_varlink_print(swig_varlinkobject *v, FILE *fp, int SWIGUNUSEDPARM(flags)) {
- char *tmp;
- PyObject *str = swig_varlink_str(v);
- fprintf(fp,"Swig global variables ");
- fprintf(fp,"%s\n", tmp = SWIG_Python_str_AsChar(str));
- SWIG_Python_str_DelForPy3(tmp);
- Py_DECREF(str);
- return 0;
- }
-
- SWIGINTERN void
- swig_varlink_dealloc(swig_varlinkobject *v) {
- swig_globalvar *var = v->vars;
- while (var) {
- swig_globalvar *n = var->next;
- free(var->name);
- free(var);
- var = n;
- }
- }
-
- SWIGINTERN PyObject *
- swig_varlink_getattr(swig_varlinkobject *v, char *n) {
- PyObject *res = NULL;
- swig_globalvar *var = v->vars;
- while (var) {
- if (strcmp(var->name,n) == 0) {
- res = (*var->get_attr)();
- break;
- }
- var = var->next;
- }
- if (res == NULL && !PyErr_Occurred()) {
- PyErr_SetString(PyExc_NameError,"Unknown C global variable");
- }
- return res;
- }
-
- SWIGINTERN int
- swig_varlink_setattr(swig_varlinkobject *v, char *n, PyObject *p) {
- int res = 1;
- swig_globalvar *var = v->vars;
- while (var) {
- if (strcmp(var->name,n) == 0) {
- res = (*var->set_attr)(p);
- break;
- }
- var = var->next;
- }
- if (res == 1 && !PyErr_Occurred()) {
- PyErr_SetString(PyExc_NameError,"Unknown C global variable");
- }
- return res;
- }
-
- SWIGINTERN PyTypeObject*
- swig_varlink_type(void) {
- static char varlink__doc__[] = "Swig var link object";
- static PyTypeObject varlink_type;
- static int type_init = 0;
- if (!type_init) {
- const PyTypeObject tmp = {
- /* PyObject header changed in Python 3 */
-#if PY_VERSION_HEX >= 0x03000000
- PyVarObject_HEAD_INIT(NULL, 0)
-#else
- PyObject_HEAD_INIT(NULL)
- 0, /* ob_size */
-#endif
- (char *)"swigvarlink", /* tp_name */
- sizeof(swig_varlinkobject), /* tp_basicsize */
- 0, /* tp_itemsize */
- (destructor) swig_varlink_dealloc, /* tp_dealloc */
- (printfunc) swig_varlink_print, /* tp_print */
- (getattrfunc) swig_varlink_getattr, /* tp_getattr */
- (setattrfunc) swig_varlink_setattr, /* tp_setattr */
- 0, /* tp_compare */
- (reprfunc) swig_varlink_repr, /* tp_repr */
- 0, /* tp_as_number */
- 0, /* tp_as_sequence */
- 0, /* tp_as_mapping */
- 0, /* tp_hash */
- 0, /* tp_call */
- (reprfunc) swig_varlink_str, /* tp_str */
- 0, /* tp_getattro */
- 0, /* tp_setattro */
- 0, /* tp_as_buffer */
- 0, /* tp_flags */
- varlink__doc__, /* tp_doc */
- 0, /* tp_traverse */
- 0, /* tp_clear */
- 0, /* tp_richcompare */
- 0, /* tp_weaklistoffset */
-#if PY_VERSION_HEX >= 0x02020000
- 0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0, /* tp_iter -> tp_weaklist */
-#endif
-#if PY_VERSION_HEX >= 0x02030000
- 0, /* tp_del */
-#endif
-#if PY_VERSION_HEX >= 0x02060000
- 0, /* tp_version */
-#endif
-#ifdef COUNT_ALLOCS
- 0,0,0,0 /* tp_alloc -> tp_next */
-#endif
- };
- varlink_type = tmp;
- type_init = 1;
-#if PY_VERSION_HEX < 0x02020000
- varlink_type.ob_type = &PyType_Type;
-#else
- if (PyType_Ready(&varlink_type) < 0)
- return NULL;
-#endif
- }
- return &varlink_type;
- }
-
- /* Create a variable linking object for use later */
- SWIGINTERN PyObject *
- SWIG_Python_newvarlink(void) {
- swig_varlinkobject *result = PyObject_NEW(swig_varlinkobject, swig_varlink_type());
- if (result) {
- result->vars = 0;
- }
- return ((PyObject*) result);
- }
-
- SWIGINTERN void
- SWIG_Python_addvarlink(PyObject *p, char *name, PyObject *(*get_attr)(void), int (*set_attr)(PyObject *p)) {
- swig_varlinkobject *v = (swig_varlinkobject *) p;
- swig_globalvar *gv = (swig_globalvar *) malloc(sizeof(swig_globalvar));
- if (gv) {
- size_t size = strlen(name)+1;
- gv->name = (char *)malloc(size);
- if (gv->name) {
- strncpy(gv->name,name,size);
- gv->get_attr = get_attr;
- gv->set_attr = set_attr;
- gv->next = v->vars;
- }
- }
- v->vars = gv;
- }
-
- SWIGINTERN PyObject *
- SWIG_globals(void) {
- static PyObject *_SWIG_globals = 0;
- if (!_SWIG_globals) _SWIG_globals = SWIG_newvarlink();
- return _SWIG_globals;
- }
-
- /* -----------------------------------------------------------------------------
- * constants/methods manipulation
- * ----------------------------------------------------------------------------- */
-
- /* Install Constants */
- SWIGINTERN void
- SWIG_Python_InstallConstants(PyObject *d, swig_const_info constants[]) {
- PyObject *obj = 0;
- size_t i;
- for (i = 0; constants[i].type; ++i) {
- switch(constants[i].type) {
- case SWIG_PY_POINTER:
- obj = SWIG_InternalNewPointerObj(constants[i].pvalue, *(constants[i]).ptype,0);
- break;
- case SWIG_PY_BINARY:
- obj = SWIG_NewPackedObj(constants[i].pvalue, constants[i].lvalue, *(constants[i].ptype));
- break;
- default:
- obj = 0;
- break;
- }
- if (obj) {
- PyDict_SetItemString(d, constants[i].name, obj);
- Py_DECREF(obj);
- }
- }
- }
-
- /* -----------------------------------------------------------------------------*/
- /* Fix SwigMethods to carry the callback ptrs when needed */
- /* -----------------------------------------------------------------------------*/
-
- SWIGINTERN void
- SWIG_Python_FixMethods(PyMethodDef *methods,
- swig_const_info *const_table,
- swig_type_info **types,
- swig_type_info **types_initial) {
- size_t i;
- for (i = 0; methods[i].ml_name; ++i) {
- const char *c = methods[i].ml_doc;
- if (c && (c = strstr(c, "swig_ptr: "))) {
- int j;
- swig_const_info *ci = 0;
- const char *name = c + 10;
- for (j = 0; const_table[j].type; ++j) {
- if (strncmp(const_table[j].name, name,
- strlen(const_table[j].name)) == 0) {
- ci = &(const_table[j]);
- break;
- }
- }
- if (ci) {
- void *ptr = (ci->type == SWIG_PY_POINTER) ? ci->pvalue : 0;
- if (ptr) {
- size_t shift = (ci->ptype) - types;
- swig_type_info *ty = types_initial[shift];
- size_t ldoc = (c - methods[i].ml_doc);
- size_t lptr = strlen(ty->name)+2*sizeof(void*)+2;
- char *ndoc = (char*)malloc(ldoc + lptr + 10);
- if (ndoc) {
- char *buff = ndoc;
- strncpy(buff, methods[i].ml_doc, ldoc);
- buff += ldoc;
- strncpy(buff, "swig_ptr: ", 10);
- buff += 10;
- SWIG_PackVoidPtr(buff, ptr, ty->name, lptr);
- methods[i].ml_doc = ndoc;
- }
- }
- }
- }
- }
- }
-
-#ifdef __cplusplus
-}
-#endif
-
-/* -----------------------------------------------------------------------------*
- * Partial Init method
- * -----------------------------------------------------------------------------*/
-
-#ifdef __cplusplus
-extern "C"
-#endif
-
-SWIGEXPORT
-#if PY_VERSION_HEX >= 0x03000000
-PyObject*
-#else
-void
-#endif
-SWIG_init(void) {
- PyObject *m, *d, *md;
-#if PY_VERSION_HEX >= 0x03000000
- static struct PyModuleDef SWIG_module = {
-# if PY_VERSION_HEX >= 0x03020000
- PyModuleDef_HEAD_INIT,
-# else
- {
- PyObject_HEAD_INIT(NULL)
- NULL, /* m_init */
- 0, /* m_index */
- NULL, /* m_copy */
- },
-# endif
- (char *) SWIG_name,
- NULL,
- -1,
- SwigMethods,
- NULL,
- NULL,
- NULL,
- NULL
- };
-#endif
-
-#if defined(SWIGPYTHON_BUILTIN)
- static SwigPyClientData SwigPyObject_clientdata = {
- 0, 0, 0, 0, 0, 0, 0
- };
- static PyGetSetDef this_getset_def = {
- (char *)"this", &SwigPyBuiltin_ThisClosure, NULL, NULL, NULL
- };
- static SwigPyGetSet thisown_getset_closure = {
- (PyCFunction) SwigPyObject_own,
- (PyCFunction) SwigPyObject_own
- };
- static PyGetSetDef thisown_getset_def = {
- (char *)"thisown", SwigPyBuiltin_GetterClosure, SwigPyBuiltin_SetterClosure, NULL, &thisown_getset_closure
- };
- PyObject *metatype_args;
- PyTypeObject *builtin_pytype;
- int builtin_base_count;
- swig_type_info *builtin_basetype;
- PyObject *tuple;
- PyGetSetDescrObject *static_getset;
- PyTypeObject *metatype;
- SwigPyClientData *cd;
- PyObject *public_interface, *public_symbol;
- PyObject *this_descr;
- PyObject *thisown_descr;
- int i;
-
- (void)builtin_pytype;
- (void)builtin_base_count;
- (void)builtin_basetype;
- (void)tuple;
- (void)static_getset;
-
- /* metatype is used to implement static member variables. */
- metatype_args = Py_BuildValue("(s(O){})", "SwigPyObjectType", &PyType_Type);
- assert(metatype_args);
- metatype = (PyTypeObject *) PyType_Type.tp_call((PyObject *) &PyType_Type, metatype_args, NULL);
- assert(metatype);
- Py_DECREF(metatype_args);
- metatype->tp_setattro = (setattrofunc) &SwigPyObjectType_setattro;
- assert(PyType_Ready(metatype) >= 0);
-#endif
-
- /* Fix SwigMethods to carry the callback ptrs when needed */
- SWIG_Python_FixMethods(SwigMethods, swig_const_table, swig_types, swig_type_initial);
-
-#if PY_VERSION_HEX >= 0x03000000
- m = PyModule_Create(&SWIG_module);
-#else
- m = Py_InitModule((char *) SWIG_name, SwigMethods);
-#endif
- md = d = PyModule_GetDict(m);
-
- SWIG_InitializeModule(0);
-
-#ifdef SWIGPYTHON_BUILTIN
- SwigPyObject_stype = SWIG_MangledTypeQuery("_p_SwigPyObject");
- assert(SwigPyObject_stype);
- cd = (SwigPyClientData*) SwigPyObject_stype->clientdata;
- if (!cd) {
- SwigPyObject_stype->clientdata = &SwigPyObject_clientdata;
- SwigPyObject_clientdata.pytype = SwigPyObject_TypeOnce();
- } else if (SwigPyObject_TypeOnce()->tp_basicsize != cd->pytype->tp_basicsize) {
- PyErr_SetString(PyExc_RuntimeError, "Import error: attempted to load two incompatible swig-generated modules.");
-# if PY_VERSION_HEX >= 0x03000000
- return NULL;
-# else
- return;
-# endif
- }
-
- /* All objects have a 'this' attribute */
- this_descr = PyDescr_NewGetSet(SwigPyObject_type(), &this_getset_def);
- (void)this_descr;
-
- /* All objects have a 'thisown' attribute */
- thisown_descr = PyDescr_NewGetSet(SwigPyObject_type(), &thisown_getset_def);
- (void)thisown_descr;
-
- public_interface = PyList_New(0);
- public_symbol = 0;
- (void)public_symbol;
-
- PyDict_SetItemString(md, "__all__", public_interface);
- Py_DECREF(public_interface);
- for (i = 0; SwigMethods[i].ml_name != NULL; ++i)
- SwigPyBuiltin_AddPublicSymbol(public_interface, SwigMethods[i].ml_name);
- for (i = 0; swig_const_table[i].name != 0; ++i)
- SwigPyBuiltin_AddPublicSymbol(public_interface, swig_const_table[i].name);
-#endif
-
- SWIG_InstallConstants(d,swig_const_table);
-
- SWIG_Python_SetConstant(d, d == md ? public_interface : NULL, "THYPHY_TYPE_COUNT",SWIG_From_int(static_cast< int >(3)));
- SWIG_Python_SetConstant(d, d == md ? public_interface : NULL, "THYPHY_TYPE_STRING",SWIG_From_int(static_cast< int >(0)));
- SWIG_Python_SetConstant(d, d == md ? public_interface : NULL, "THYPHY_TYPE_NUMBER",SWIG_From_int(static_cast< int >(1)));
- SWIG_Python_SetConstant(d, d == md ? public_interface : NULL, "THYPHY_TYPE_MATRIX",SWIG_From_int(static_cast< int >(2)));
-
- /* type '::_THyPhyReturnObject' */
- builtin_pytype = (PyTypeObject *)&SwigPyBuiltin___THyPhyReturnObject_type;
- builtin_pytype->tp_dict = d = PyDict_New();
- SwigPyBuiltin_SetMetaType(builtin_pytype, metatype);
- builtin_pytype->tp_new = PyType_GenericNew;
- builtin_base_count = 0;
- builtin_bases[builtin_base_count] = NULL;
- SwigPyBuiltin_InitBases(builtin_pytype, builtin_bases);
- PyDict_SetItemString(d, "this", this_descr);
- PyDict_SetItemString(d, "thisown", thisown_descr);
- if (PyType_Ready(builtin_pytype) < 0) {
- PyErr_SetString(PyExc_TypeError, "Could not create type '_THyPhyReturnObject'.");
-#if PY_VERSION_HEX >= 0x03000000
- return NULL;
-#else
- return;
-#endif
- }
- Py_INCREF(builtin_pytype);
- PyModule_AddObject(m, "_THyPhyReturnObject", (PyObject*) builtin_pytype);
- SwigPyBuiltin_AddPublicSymbol(public_interface, "_THyPhyReturnObject");
- d = md;
-
- /* type '::_THyPhyString' */
- builtin_pytype = (PyTypeObject *)&SwigPyBuiltin___THyPhyString_type;
- builtin_pytype->tp_dict = d = PyDict_New();
- SwigPyBuiltin_SetMetaType(builtin_pytype, metatype);
- builtin_pytype->tp_new = PyType_GenericNew;
- builtin_base_count = 0;
- builtin_basetype = SWIG_MangledTypeQuery("_p__THyPhyReturnObject");
- if (builtin_basetype && builtin_basetype->clientdata && ((SwigPyClientData*) builtin_basetype->clientdata)->pytype) {
- builtin_bases[builtin_base_count++] = ((SwigPyClientData*) builtin_basetype->clientdata)->pytype;
- } else {
- PyErr_SetString(PyExc_TypeError, "Could not create type '_THyPhyString' as base '_THyPhyReturnObject' has not been initialized.\n");
-#if PY_VERSION_HEX >= 0x03000000
- return NULL;
-#else
- return;
-#endif
- }
- builtin_bases[builtin_base_count] = NULL;
- SwigPyBuiltin_InitBases(builtin_pytype, builtin_bases);
- PyDict_SetItemString(d, "this", this_descr);
- PyDict_SetItemString(d, "thisown", thisown_descr);
- if (PyType_Ready(builtin_pytype) < 0) {
- PyErr_SetString(PyExc_TypeError, "Could not create type '_THyPhyString'.");
-#if PY_VERSION_HEX >= 0x03000000
- return NULL;
-#else
- return;
-#endif
- }
- Py_INCREF(builtin_pytype);
- PyModule_AddObject(m, "_THyPhyString", (PyObject*) builtin_pytype);
- SwigPyBuiltin_AddPublicSymbol(public_interface, "_THyPhyString");
- d = md;
-
- /* type '::_THyPhyNumber' */
- builtin_pytype = (PyTypeObject *)&SwigPyBuiltin___THyPhyNumber_type;
- builtin_pytype->tp_dict = d = PyDict_New();
- SwigPyBuiltin_SetMetaType(builtin_pytype, metatype);
- builtin_pytype->tp_new = PyType_GenericNew;
- builtin_base_count = 0;
- builtin_basetype = SWIG_MangledTypeQuery("_p__THyPhyReturnObject");
- if (builtin_basetype && builtin_basetype->clientdata && ((SwigPyClientData*) builtin_basetype->clientdata)->pytype) {
- builtin_bases[builtin_base_count++] = ((SwigPyClientData*) builtin_basetype->clientdata)->pytype;
- } else {
- PyErr_SetString(PyExc_TypeError, "Could not create type '_THyPhyNumber' as base '_THyPhyReturnObject' has not been initialized.\n");
-#if PY_VERSION_HEX >= 0x03000000
- return NULL;
-#else
- return;
-#endif
- }
- builtin_bases[builtin_base_count] = NULL;
- SwigPyBuiltin_InitBases(builtin_pytype, builtin_bases);
- PyDict_SetItemString(d, "this", this_descr);
- PyDict_SetItemString(d, "thisown", thisown_descr);
- if (PyType_Ready(builtin_pytype) < 0) {
- PyErr_SetString(PyExc_TypeError, "Could not create type '_THyPhyNumber'.");
-#if PY_VERSION_HEX >= 0x03000000
- return NULL;
-#else
- return;
-#endif
- }
- Py_INCREF(builtin_pytype);
- PyModule_AddObject(m, "_THyPhyNumber", (PyObject*) builtin_pytype);
- SwigPyBuiltin_AddPublicSymbol(public_interface, "_THyPhyNumber");
- d = md;
-
- /* type '::_THyPhyMatrix' */
- builtin_pytype = (PyTypeObject *)&SwigPyBuiltin___THyPhyMatrix_type;
- builtin_pytype->tp_dict = d = PyDict_New();
- SwigPyBuiltin_SetMetaType(builtin_pytype, metatype);
- builtin_pytype->tp_new = PyType_GenericNew;
- builtin_base_count = 0;
- builtin_basetype = SWIG_MangledTypeQuery("_p__THyPhyReturnObject");
- if (builtin_basetype && builtin_basetype->clientdata && ((SwigPyClientData*) builtin_basetype->clientdata)->pytype) {
- builtin_bases[builtin_base_count++] = ((SwigPyClientData*) builtin_basetype->clientdata)->pytype;
- } else {
- PyErr_SetString(PyExc_TypeError, "Could not create type '_THyPhyMatrix' as base '_THyPhyReturnObject' has not been initialized.\n");
-#if PY_VERSION_HEX >= 0x03000000
- return NULL;
-#else
- return;
-#endif
- }
- builtin_bases[builtin_base_count] = NULL;
- SwigPyBuiltin_InitBases(builtin_pytype, builtin_bases);
- PyDict_SetItemString(d, "this", this_descr);
- PyDict_SetItemString(d, "thisown", thisown_descr);
- if (PyType_Ready(builtin_pytype) < 0) {
- PyErr_SetString(PyExc_TypeError, "Could not create type '_THyPhyMatrix'.");
-#if PY_VERSION_HEX >= 0x03000000
- return NULL;
-#else
- return;
-#endif
- }
- Py_INCREF(builtin_pytype);
- PyModule_AddObject(m, "_THyPhyMatrix", (PyObject*) builtin_pytype);
- SwigPyBuiltin_AddPublicSymbol(public_interface, "_THyPhyMatrix");
- d = md;
-
- /* type '::_THyPhy' */
- builtin_pytype = (PyTypeObject *)&SwigPyBuiltin___THyPhy_type;
- builtin_pytype->tp_dict = d = PyDict_New();
- SwigPyBuiltin_SetMetaType(builtin_pytype, metatype);
- builtin_pytype->tp_new = PyType_GenericNew;
- builtin_base_count = 0;
- builtin_bases[builtin_base_count] = NULL;
- SwigPyBuiltin_InitBases(builtin_pytype, builtin_bases);
- PyDict_SetItemString(d, "this", this_descr);
- PyDict_SetItemString(d, "thisown", thisown_descr);
- if (PyType_Ready(builtin_pytype) < 0) {
- PyErr_SetString(PyExc_TypeError, "Could not create type '_THyPhy'.");
-#if PY_VERSION_HEX >= 0x03000000
- return NULL;
-#else
- return;
-#endif
- }
- Py_INCREF(builtin_pytype);
- PyModule_AddObject(m, "_THyPhy", (PyObject*) builtin_pytype);
- SwigPyBuiltin_AddPublicSymbol(public_interface, "_THyPhy");
- d = md;
- PyDict_SetItemString(md,(char*)"cvar", SWIG_globals());
- SwigPyBuiltin_AddPublicSymbol(public_interface, "cvar");
- SWIG_addvarlink(SWIG_globals(),(char*)"globalInterfaceInstance",Swig_var_globalInterfaceInstance_get, Swig_var_globalInterfaceInstance_set);
-#if PY_VERSION_HEX >= 0x03000000
- return m;
-#else
- return;
-#endif
-}
-
diff --git a/src/lib/SWIGWrappers/THyPhy_python.cpp b/src/lib/SWIGWrappers/THyPhy_python.cpp
deleted file mode 100644
index 1d2120a..0000000
--- a/src/lib/SWIGWrappers/THyPhy_python.cpp
+++ /dev/null
@@ -1,7440 +0,0 @@
-/* ----------------------------------------------------------------------------
- * This file was automatically generated by SWIG (http://www.swig.org).
- * Version 2.0.4
- *
- * This file is not intended to be easily readable and contains a number of
- * coding conventions designed to improve portability and efficiency. Do not make
- * changes to this file unless you know what you are doing--modify the SWIG
- * interface file instead.
- * ----------------------------------------------------------------------------- */
-
-#define SWIGPYTHON
-#define SWIG_PYTHON_DIRECTOR_NO_VTABLE
-#define SWIGPYTHON_BUILTIN
-
-
-#ifdef __cplusplus
-/* SwigValueWrapper is described in swig.swg */
-template<typename T> class SwigValueWrapper {
- struct SwigMovePointer {
- T *ptr;
- SwigMovePointer(T *p) : ptr(p) { }
- ~SwigMovePointer() { delete ptr; }
- SwigMovePointer& operator=(SwigMovePointer& rhs) { T* oldptr = ptr; ptr = 0; delete oldptr; ptr = rhs.ptr; rhs.ptr = 0; return *this; }
- } pointer;
- SwigValueWrapper& operator=(const SwigValueWrapper<T>& rhs);
- SwigValueWrapper(const SwigValueWrapper<T>& rhs);
-public:
- SwigValueWrapper() : pointer(0) { }
- SwigValueWrapper& operator=(const T& t) { SwigMovePointer tmp(new T(t)); pointer = tmp; return *this; }
- operator T&() const { return *pointer.ptr; }
- T *operator&() { return pointer.ptr; }
-};
-
-template <typename T> T SwigValueInit() {
- return T();
-}
-#endif
-
-/* -----------------------------------------------------------------------------
- * This section contains generic SWIG labels for method/variable
- * declarations/attributes, and other compiler dependent labels.
- * ----------------------------------------------------------------------------- */
-
-/* template workaround for compilers that cannot correctly implement the C++ standard */
-#ifndef SWIGTEMPLATEDISAMBIGUATOR
-# if defined(__SUNPRO_CC) && (__SUNPRO_CC <= 0x560)
-# define SWIGTEMPLATEDISAMBIGUATOR template
-# elif defined(__HP_aCC)
-/* Needed even with `aCC -AA' when `aCC -V' reports HP ANSI C++ B3910B A.03.55 */
-/* If we find a maximum version that requires this, the test would be __HP_aCC <= 35500 for A.03.55 */
-# define SWIGTEMPLATEDISAMBIGUATOR template
-# else
-# define SWIGTEMPLATEDISAMBIGUATOR
-# endif
-#endif
-
-/* inline attribute */
-#ifndef SWIGINLINE
-# if defined(__cplusplus) || (defined(__GNUC__) && !defined(__STRICT_ANSI__))
-# define SWIGINLINE inline
-# else
-# define SWIGINLINE
-# endif
-#endif
-
-/* attribute recognised by some compilers to avoid 'unused' warnings */
-#ifndef SWIGUNUSED
-# if defined(__GNUC__)
-# if !(defined(__cplusplus)) || (__GNUC__ > 3 || (__GNUC__ == 3 && __GNUC_MINOR__ >= 4))
-# define SWIGUNUSED __attribute__ ((__unused__))
-# else
-# define SWIGUNUSED
-# endif
-# elif defined(__ICC)
-# define SWIGUNUSED __attribute__ ((__unused__))
-# else
-# define SWIGUNUSED
-# endif
-#endif
-
-#ifndef SWIG_MSC_UNSUPPRESS_4505
-# if defined(_MSC_VER)
-# pragma warning(disable : 4505) /* unreferenced local function has been removed */
-# endif
-#endif
-
-#ifndef SWIGUNUSEDPARM
-# ifdef __cplusplus
-# define SWIGUNUSEDPARM(p)
-# else
-# define SWIGUNUSEDPARM(p) p SWIGUNUSED
-# endif
-#endif
-
-/* internal SWIG method */
-#ifndef SWIGINTERN
-# define SWIGINTERN static SWIGUNUSED
-#endif
-
-/* internal inline SWIG method */
-#ifndef SWIGINTERNINLINE
-# define SWIGINTERNINLINE SWIGINTERN SWIGINLINE
-#endif
-
-/* exporting methods */
-#if (__GNUC__ >= 4) || (__GNUC__ == 3 && __GNUC_MINOR__ >= 4)
-# ifndef GCC_HASCLASSVISIBILITY
-# define GCC_HASCLASSVISIBILITY
-# endif
-#endif
-
-#ifndef SWIGEXPORT
-# if defined(_WIN32) || defined(__WIN32__) || defined(__CYGWIN__)
-# if defined(STATIC_LINKED)
-# define SWIGEXPORT
-# else
-# define SWIGEXPORT __declspec(dllexport)
-# endif
-# else
-# if defined(__GNUC__) && defined(GCC_HASCLASSVISIBILITY)
-# define SWIGEXPORT __attribute__ ((visibility("default")))
-# else
-# define SWIGEXPORT
-# endif
-# endif
-#endif
-
-/* calling conventions for Windows */
-#ifndef SWIGSTDCALL
-# if defined(_WIN32) || defined(__WIN32__) || defined(__CYGWIN__)
-# define SWIGSTDCALL __stdcall
-# else
-# define SWIGSTDCALL
-# endif
-#endif
-
-/* Deal with Microsoft's attempt at deprecating C standard runtime functions */
-#if !defined(SWIG_NO_CRT_SECURE_NO_DEPRECATE) && defined(_MSC_VER) && !defined(_CRT_SECURE_NO_DEPRECATE)
-# define _CRT_SECURE_NO_DEPRECATE
-#endif
-
-/* Deal with Microsoft's attempt at deprecating methods in the standard C++ library */
-#if !defined(SWIG_NO_SCL_SECURE_NO_DEPRECATE) && defined(_MSC_VER) && !defined(_SCL_SECURE_NO_DEPRECATE)
-# define _SCL_SECURE_NO_DEPRECATE
-#endif
-
-
-
-/* Python.h has to appear first */
-#include <Python.h>
-
-/* -----------------------------------------------------------------------------
- * swigrun.swg
- *
- * This file contains generic C API SWIG runtime support for pointer
- * type checking.
- * ----------------------------------------------------------------------------- */
-
-/* This should only be incremented when either the layout of swig_type_info changes,
- or for whatever reason, the runtime changes incompatibly */
-#define SWIG_RUNTIME_VERSION "4"
-
-/* define SWIG_TYPE_TABLE_NAME as "SWIG_TYPE_TABLE" */
-#ifdef SWIG_TYPE_TABLE
-# define SWIG_QUOTE_STRING(x) #x
-# define SWIG_EXPAND_AND_QUOTE_STRING(x) SWIG_QUOTE_STRING(x)
-# define SWIG_TYPE_TABLE_NAME SWIG_EXPAND_AND_QUOTE_STRING(SWIG_TYPE_TABLE)
-#else
-# define SWIG_TYPE_TABLE_NAME
-#endif
-
-/*
- You can use the SWIGRUNTIME and SWIGRUNTIMEINLINE macros for
- creating a static or dynamic library from the SWIG runtime code.
- In 99.9% of the cases, SWIG just needs to declare them as 'static'.
-
- But only do this if strictly necessary, ie, if you have problems
- with your compiler or suchlike.
-*/
-
-#ifndef SWIGRUNTIME
-# define SWIGRUNTIME SWIGINTERN
-#endif
-
-#ifndef SWIGRUNTIMEINLINE
-# define SWIGRUNTIMEINLINE SWIGRUNTIME SWIGINLINE
-#endif
-
-/* Generic buffer size */
-#ifndef SWIG_BUFFER_SIZE
-# define SWIG_BUFFER_SIZE 1024
-#endif
-
-/* Flags for pointer conversions */
-#define SWIG_POINTER_DISOWN 0x1
-#define SWIG_CAST_NEW_MEMORY 0x2
-
-/* Flags for new pointer objects */
-#define SWIG_POINTER_OWN 0x1
-
-
-/*
- Flags/methods for returning states.
-
- The SWIG conversion methods, as ConvertPtr, return an integer
- that tells if the conversion was successful or not. And if not,
- an error code can be returned (see swigerrors.swg for the codes).
-
- Use the following macros/flags to set or process the returning
- states.
-
- In old versions of SWIG, code such as the following was usually written:
-
- if (SWIG_ConvertPtr(obj,vptr,ty.flags) != -1) {
- // success code
- } else {
- //fail code
- }
-
- Now you can be more explicit:
-
- int res = SWIG_ConvertPtr(obj,vptr,ty.flags);
- if (SWIG_IsOK(res)) {
- // success code
- } else {
- // fail code
- }
-
- which is the same really, but now you can also do
-
- Type *ptr;
- int res = SWIG_ConvertPtr(obj,(void **)(&ptr),ty.flags);
- if (SWIG_IsOK(res)) {
- // success code
- if (SWIG_IsNewObj(res) {
- ...
- delete *ptr;
- } else {
- ...
- }
- } else {
- // fail code
- }
-
- I.e., now SWIG_ConvertPtr can return new objects and you can
- identify the case and take care of the deallocation. Of course that
- also requires SWIG_ConvertPtr to return new result values, such as
-
- int SWIG_ConvertPtr(obj, ptr,...) {
- if (<obj is ok>) {
- if (<need new object>) {
- *ptr = <ptr to new allocated object>;
- return SWIG_NEWOBJ;
- } else {
- *ptr = <ptr to old object>;
- return SWIG_OLDOBJ;
- }
- } else {
- return SWIG_BADOBJ;
- }
- }
-
- Of course, returning the plain '0(success)/-1(fail)' still works, but you can be
- more explicit by returning SWIG_BADOBJ, SWIG_ERROR or any of the
- SWIG errors code.
-
- Finally, if the SWIG_CASTRANK_MODE is enabled, the result code
- allows to return the 'cast rank', for example, if you have this
-
- int food(double)
- int fooi(int);
-
- and you call
-
- food(1) // cast rank '1' (1 -> 1.0)
- fooi(1) // cast rank '0'
-
- just use the SWIG_AddCast()/SWIG_CheckState()
-*/
-
-#define SWIG_OK (0)
-#define SWIG_ERROR (-1)
-#define SWIG_IsOK(r) (r >= 0)
-#define SWIG_ArgError(r) ((r != SWIG_ERROR) ? r : SWIG_TypeError)
-
-/* The CastRankLimit says how many bits are used for the cast rank */
-#define SWIG_CASTRANKLIMIT (1 << 8)
-/* The NewMask denotes the object was created (using new/malloc) */
-#define SWIG_NEWOBJMASK (SWIG_CASTRANKLIMIT << 1)
-/* The TmpMask is for in/out typemaps that use temporal objects */
-#define SWIG_TMPOBJMASK (SWIG_NEWOBJMASK << 1)
-/* Simple returning values */
-#define SWIG_BADOBJ (SWIG_ERROR)
-#define SWIG_OLDOBJ (SWIG_OK)
-#define SWIG_NEWOBJ (SWIG_OK | SWIG_NEWOBJMASK)
-#define SWIG_TMPOBJ (SWIG_OK | SWIG_TMPOBJMASK)
-/* Check, add and del mask methods */
-#define SWIG_AddNewMask(r) (SWIG_IsOK(r) ? (r | SWIG_NEWOBJMASK) : r)
-#define SWIG_DelNewMask(r) (SWIG_IsOK(r) ? (r & ~SWIG_NEWOBJMASK) : r)
-#define SWIG_IsNewObj(r) (SWIG_IsOK(r) && (r & SWIG_NEWOBJMASK))
-#define SWIG_AddTmpMask(r) (SWIG_IsOK(r) ? (r | SWIG_TMPOBJMASK) : r)
-#define SWIG_DelTmpMask(r) (SWIG_IsOK(r) ? (r & ~SWIG_TMPOBJMASK) : r)
-#define SWIG_IsTmpObj(r) (SWIG_IsOK(r) && (r & SWIG_TMPOBJMASK))
-
-/* Cast-Rank Mode */
-#if defined(SWIG_CASTRANK_MODE)
-# ifndef SWIG_TypeRank
-# define SWIG_TypeRank unsigned long
-# endif
-# ifndef SWIG_MAXCASTRANK /* Default cast allowed */
-# define SWIG_MAXCASTRANK (2)
-# endif
-# define SWIG_CASTRANKMASK ((SWIG_CASTRANKLIMIT) -1)
-# define SWIG_CastRank(r) (r & SWIG_CASTRANKMASK)
-SWIGINTERNINLINE int SWIG_AddCast(int r) {
- return SWIG_IsOK(r) ? ((SWIG_CastRank(r) < SWIG_MAXCASTRANK) ? (r + 1) : SWIG_ERROR) : r;
-}
-SWIGINTERNINLINE int SWIG_CheckState(int r) {
- return SWIG_IsOK(r) ? SWIG_CastRank(r) + 1 : 0;
-}
-#else /* no cast-rank mode */
-# define SWIG_AddCast
-# define SWIG_CheckState(r) (SWIG_IsOK(r) ? 1 : 0)
-#endif
-
-
-#include <string.h>
-
-#ifdef __cplusplus
-extern "C" {
-#endif
-
-typedef void *(*swig_converter_func)(void *, int *);
-typedef struct swig_type_info *(*swig_dycast_func)(void **);
-
-/* Structure to store information on one type */
-typedef struct swig_type_info {
- const char *name; /* mangled name of this type */
- const char *str; /* human readable name of this type */
- swig_dycast_func dcast; /* dynamic cast function down a hierarchy */
- struct swig_cast_info *cast; /* linked list of types that can cast into this type */
- void *clientdata; /* language specific type data */
- int owndata; /* flag if the structure owns the clientdata */
-} swig_type_info;
-
-/* Structure to store a type and conversion function used for casting */
-typedef struct swig_cast_info {
- swig_type_info *type; /* pointer to type that is equivalent to this type */
- swig_converter_func converter; /* function to cast the void pointers */
- struct swig_cast_info *next; /* pointer to next cast in linked list */
- struct swig_cast_info *prev; /* pointer to the previous cast */
-} swig_cast_info;
-
-/* Structure used to store module information
- * Each module generates one structure like this, and the runtime collects
- * all of these structures and stores them in a circularly linked list.*/
-typedef struct swig_module_info {
- swig_type_info **types; /* Array of pointers to swig_type_info structures that are in this module */
- size_t size; /* Number of types in this module */
- struct swig_module_info *next; /* Pointer to next element in circularly linked list */
- swig_type_info **type_initial; /* Array of initially generated type structures */
- swig_cast_info **cast_initial; /* Array of initially generated casting structures */
- void *clientdata; /* Language specific module data */
-} swig_module_info;
-
-/*
- Compare two type names skipping the space characters, therefore
- "char*" == "char *" and "Class<int>" == "Class<int >", etc.
-
- Return 0 when the two name types are equivalent, as in
- strncmp, but skipping ' '.
-*/
-SWIGRUNTIME int
-SWIG_TypeNameComp(const char *f1, const char *l1,
- const char *f2, const char *l2) {
- for (;(f1 != l1) && (f2 != l2); ++f1, ++f2) {
- while ((*f1 == ' ') && (f1 != l1)) ++f1;
- while ((*f2 == ' ') && (f2 != l2)) ++f2;
- if (*f1 != *f2) return (*f1 > *f2) ? 1 : -1;
- }
- return (int)((l1 - f1) - (l2 - f2));
-}
-
-/*
- Check type equivalence in a name list like <name1>|<name2>|...
- Return 0 if not equal, 1 if equal
-*/
-SWIGRUNTIME int
-SWIG_TypeEquiv(const char *nb, const char *tb) {
- int equiv = 0;
- const char* te = tb + strlen(tb);
- const char* ne = nb;
- while (!equiv && *ne) {
- for (nb = ne; *ne; ++ne) {
- if (*ne == '|') break;
- }
- equiv = (SWIG_TypeNameComp(nb, ne, tb, te) == 0) ? 1 : 0;
- if (*ne) ++ne;
- }
- return equiv;
-}
-
-/*
- Check type equivalence in a name list like <name1>|<name2>|...
- Return 0 if equal, -1 if nb < tb, 1 if nb > tb
-*/
-SWIGRUNTIME int
-SWIG_TypeCompare(const char *nb, const char *tb) {
- int equiv = 0;
- const char* te = tb + strlen(tb);
- const char* ne = nb;
- while (!equiv && *ne) {
- for (nb = ne; *ne; ++ne) {
- if (*ne == '|') break;
- }
- equiv = (SWIG_TypeNameComp(nb, ne, tb, te) == 0) ? 1 : 0;
- if (*ne) ++ne;
- }
- return equiv;
-}
-
-
-/*
- Check the typename
-*/
-SWIGRUNTIME swig_cast_info *
-SWIG_TypeCheck(const char *c, swig_type_info *ty) {
- if (ty) {
- swig_cast_info *iter = ty->cast;
- while (iter) {
- if (strcmp(iter->type->name, c) == 0) {
- if (iter == ty->cast)
- return iter;
- /* Move iter to the top of the linked list */
- iter->prev->next = iter->next;
- if (iter->next)
- iter->next->prev = iter->prev;
- iter->next = ty->cast;
- iter->prev = 0;
- if (ty->cast) ty->cast->prev = iter;
- ty->cast = iter;
- return iter;
- }
- iter = iter->next;
- }
- }
- return 0;
-}
-
-/*
- Identical to SWIG_TypeCheck, except strcmp is replaced with a pointer comparison
-*/
-SWIGRUNTIME swig_cast_info *
-SWIG_TypeCheckStruct(swig_type_info *from, swig_type_info *ty) {
- if (ty) {
- swig_cast_info *iter = ty->cast;
- while (iter) {
- if (iter->type == from) {
- if (iter == ty->cast)
- return iter;
- /* Move iter to the top of the linked list */
- iter->prev->next = iter->next;
- if (iter->next)
- iter->next->prev = iter->prev;
- iter->next = ty->cast;
- iter->prev = 0;
- if (ty->cast) ty->cast->prev = iter;
- ty->cast = iter;
- return iter;
- }
- iter = iter->next;
- }
- }
- return 0;
-}
-
-/*
- Cast a pointer up an inheritance hierarchy
-*/
-SWIGRUNTIMEINLINE void *
-SWIG_TypeCast(swig_cast_info *ty, void *ptr, int *newmemory) {
- return ((!ty) || (!ty->converter)) ? ptr : (*ty->converter)(ptr, newmemory);
-}
-
-/*
- Dynamic pointer casting. Down an inheritance hierarchy
-*/
-SWIGRUNTIME swig_type_info *
-SWIG_TypeDynamicCast(swig_type_info *ty, void **ptr) {
- swig_type_info *lastty = ty;
- if (!ty || !ty->dcast) return ty;
- while (ty && (ty->dcast)) {
- ty = (*ty->dcast)(ptr);
- if (ty) lastty = ty;
- }
- return lastty;
-}
-
-/*
- Return the name associated with this type
-*/
-SWIGRUNTIMEINLINE const char *
-SWIG_TypeName(const swig_type_info *ty) {
- return ty->name;
-}
-
-/*
- Return the pretty name associated with this type,
- that is an unmangled type name in a form presentable to the user.
-*/
-SWIGRUNTIME const char *
-SWIG_TypePrettyName(const swig_type_info *type) {
- /* The "str" field contains the equivalent pretty names of the
- type, separated by vertical-bar characters. We choose
- to print the last name, as it is often (?) the most
- specific. */
- if (!type) return NULL;
- if (type->str != NULL) {
- const char *last_name = type->str;
- const char *s;
- for (s = type->str; *s; s++)
- if (*s == '|') last_name = s+1;
- return last_name;
- }
- else
- return type->name;
-}
-
-/*
- Set the clientdata field for a type
-*/
-SWIGRUNTIME void
-SWIG_TypeClientData(swig_type_info *ti, void *clientdata) {
- swig_cast_info *cast = ti->cast;
- /* if (ti->clientdata == clientdata) return; */
- ti->clientdata = clientdata;
-
- while (cast) {
- if (!cast->converter) {
- swig_type_info *tc = cast->type;
- if (!tc->clientdata) {
- SWIG_TypeClientData(tc, clientdata);
- }
- }
- cast = cast->next;
- }
-}
-SWIGRUNTIME void
-SWIG_TypeNewClientData(swig_type_info *ti, void *clientdata) {
- SWIG_TypeClientData(ti, clientdata);
- ti->owndata = 1;
-}
-
-/*
- Search for a swig_type_info structure only by mangled name
- Search is a O(log #types)
-
- We start searching at module start, and finish searching when start == end.
- Note: if start == end at the beginning of the function, we go all the way around
- the circular list.
-*/
-SWIGRUNTIME swig_type_info *
-SWIG_MangledTypeQueryModule(swig_module_info *start,
- swig_module_info *end,
- const char *name) {
- swig_module_info *iter = start;
- do {
- if (iter->size) {
- register size_t l = 0;
- register size_t r = iter->size - 1;
- do {
- /* since l+r >= 0, we can (>> 1) instead (/ 2) */
- register size_t i = (l + r) >> 1;
- const char *iname = iter->types[i]->name;
- if (iname) {
- register int compare = strcmp(name, iname);
- if (compare == 0) {
- return iter->types[i];
- } else if (compare < 0) {
- if (i) {
- r = i - 1;
- } else {
- break;
- }
- } else if (compare > 0) {
- l = i + 1;
- }
- } else {
- break; /* should never happen */
- }
- } while (l <= r);
- }
- iter = iter->next;
- } while (iter != end);
- return 0;
-}
-
-/*
- Search for a swig_type_info structure for either a mangled name or a human readable name.
- It first searches the mangled names of the types, which is a O(log #types)
- If a type is not found it then searches the human readable names, which is O(#types).
-
- We start searching at module start, and finish searching when start == end.
- Note: if start == end at the beginning of the function, we go all the way around
- the circular list.
-*/
-SWIGRUNTIME swig_type_info *
-SWIG_TypeQueryModule(swig_module_info *start,
- swig_module_info *end,
- const char *name) {
- /* STEP 1: Search the name field using binary search */
- swig_type_info *ret = SWIG_MangledTypeQueryModule(start, end, name);
- if (ret) {
- return ret;
- } else {
- /* STEP 2: If the type hasn't been found, do a complete search
- of the str field (the human readable name) */
- swig_module_info *iter = start;
- do {
- register size_t i = 0;
- for (; i < iter->size; ++i) {
- if (iter->types[i]->str && (SWIG_TypeEquiv(iter->types[i]->str, name)))
- return iter->types[i];
- }
- iter = iter->next;
- } while (iter != end);
- }
-
- /* neither found a match */
- return 0;
-}
-
-/*
- Pack binary data into a string
-*/
-SWIGRUNTIME char *
-SWIG_PackData(char *c, void *ptr, size_t sz) {
- static const char hex[17] = "0123456789abcdef";
- register const unsigned char *u = (unsigned char *) ptr;
- register const unsigned char *eu = u + sz;
- for (; u != eu; ++u) {
- register unsigned char uu = *u;
- *(c++) = hex[(uu & 0xf0) >> 4];
- *(c++) = hex[uu & 0xf];
- }
- return c;
-}
-
-/*
- Unpack binary data from a string
-*/
-SWIGRUNTIME const char *
-SWIG_UnpackData(const char *c, void *ptr, size_t sz) {
- register unsigned char *u = (unsigned char *) ptr;
- register const unsigned char *eu = u + sz;
- for (; u != eu; ++u) {
- register char d = *(c++);
- register unsigned char uu;
- if ((d >= '0') && (d <= '9'))
- uu = ((d - '0') << 4);
- else if ((d >= 'a') && (d <= 'f'))
- uu = ((d - ('a'-10)) << 4);
- else
- return (char *) 0;
- d = *(c++);
- if ((d >= '0') && (d <= '9'))
- uu |= (d - '0');
- else if ((d >= 'a') && (d <= 'f'))
- uu |= (d - ('a'-10));
- else
- return (char *) 0;
- *u = uu;
- }
- return c;
-}
-
-/*
- Pack 'void *' into a string buffer.
-*/
-SWIGRUNTIME char *
-SWIG_PackVoidPtr(char *buff, void *ptr, const char *name, size_t bsz) {
- char *r = buff;
- if ((2*sizeof(void *) + 2) > bsz) return 0;
- *(r++) = '_';
- r = SWIG_PackData(r,&ptr,sizeof(void *));
- if (strlen(name) + 1 > (bsz - (r - buff))) return 0;
- strcpy(r,name);
- return buff;
-}
-
-SWIGRUNTIME const char *
-SWIG_UnpackVoidPtr(const char *c, void **ptr, const char *name) {
- if (*c != '_') {
- if (strcmp(c,"NULL") == 0) {
- *ptr = (void *) 0;
- return name;
- } else {
- return 0;
- }
- }
- return SWIG_UnpackData(++c,ptr,sizeof(void *));
-}
-
-SWIGRUNTIME char *
-SWIG_PackDataName(char *buff, void *ptr, size_t sz, const char *name, size_t bsz) {
- char *r = buff;
- size_t lname = (name ? strlen(name) : 0);
- if ((2*sz + 2 + lname) > bsz) return 0;
- *(r++) = '_';
- r = SWIG_PackData(r,ptr,sz);
- if (lname) {
- strncpy(r,name,lname+1);
- } else {
- *r = 0;
- }
- return buff;
-}
-
-SWIGRUNTIME const char *
-SWIG_UnpackDataName(const char *c, void *ptr, size_t sz, const char *name) {
- if (*c != '_') {
- if (strcmp(c,"NULL") == 0) {
- memset(ptr,0,sz);
- return name;
- } else {
- return 0;
- }
- }
- return SWIG_UnpackData(++c,ptr,sz);
-}
-
-#ifdef __cplusplus
-}
-#endif
-
-/* Errors in SWIG */
-#define SWIG_UnknownError -1
-#define SWIG_IOError -2
-#define SWIG_RuntimeError -3
-#define SWIG_IndexError -4
-#define SWIG_TypeError -5
-#define SWIG_DivisionByZero -6
-#define SWIG_OverflowError -7
-#define SWIG_SyntaxError -8
-#define SWIG_ValueError -9
-#define SWIG_SystemError -10
-#define SWIG_AttributeError -11
-#define SWIG_MemoryError -12
-#define SWIG_NullReferenceError -13
-
-
-
-/* Compatibility macros for Python 3 */
-#if PY_VERSION_HEX >= 0x03000000
-
-#define PyClass_Check(obj) PyObject_IsInstance(obj, (PyObject *)&PyType_Type)
-#define PyInt_Check(x) PyLong_Check(x)
-#define PyInt_AsLong(x) PyLong_AsLong(x)
-#define PyInt_FromLong(x) PyLong_FromLong(x)
-#define PyString_Check(name) PyBytes_Check(name)
-#define PyString_FromString(x) PyUnicode_FromString(x)
-#define PyString_Format(fmt, args) PyUnicode_Format(fmt, args)
-#define PyString_AsString(str) PyBytes_AsString(str)
-#define PyString_Size(str) PyBytes_Size(str)
-#define PyString_InternFromString(key) PyUnicode_InternFromString(key)
-#define Py_TPFLAGS_HAVE_CLASS Py_TPFLAGS_BASETYPE
-#define PyString_AS_STRING(x) PyUnicode_AS_STRING(x)
-#define _PyLong_FromSsize_t(x) PyLong_FromSsize_t(x)
-
-#endif
-
-#ifndef Py_TYPE
-# define Py_TYPE(op) ((op)->ob_type)
-#endif
-
-/* SWIG APIs for compatibility of both Python 2 & 3 */
-
-#if PY_VERSION_HEX >= 0x03000000
-# define SWIG_Python_str_FromFormat PyUnicode_FromFormat
-#else
-# define SWIG_Python_str_FromFormat PyString_FromFormat
-#endif
-
-
-/* Warning: This function will allocate a new string in Python 3,
- * so please call SWIG_Python_str_DelForPy3(x) to free the space.
- */
-SWIGINTERN char*
-SWIG_Python_str_AsChar(PyObject *str)
-{
-#if PY_VERSION_HEX >= 0x03000000
- char *cstr;
- char *newstr;
- Py_ssize_t len;
- str = PyUnicode_AsUTF8String(str);
- PyBytes_AsStringAndSize(str, &cstr, &len);
- newstr = (char *) malloc(len+1);
- memcpy(newstr, cstr, len+1);
- Py_XDECREF(str);
- return newstr;
-#else
- return PyString_AsString(str);
-#endif
-}
-
-#if PY_VERSION_HEX >= 0x03000000
-# define SWIG_Python_str_DelForPy3(x) free( (void*) (x) )
-#else
-# define SWIG_Python_str_DelForPy3(x)
-#endif
-
-
-SWIGINTERN PyObject*
-SWIG_Python_str_FromChar(const char *c)
-{
-#if PY_VERSION_HEX >= 0x03000000
- return PyUnicode_FromString(c);
-#else
- return PyString_FromString(c);
-#endif
-}
-
-/* Add PyOS_snprintf for old Pythons */
-#if PY_VERSION_HEX < 0x02020000
-# if defined(_MSC_VER) || defined(__BORLANDC__) || defined(_WATCOM)
-# define PyOS_snprintf _snprintf
-# else
-# define PyOS_snprintf snprintf
-# endif
-#endif
-
-/* A crude PyString_FromFormat implementation for old Pythons */
-#if PY_VERSION_HEX < 0x02020000
-
-#ifndef SWIG_PYBUFFER_SIZE
-# define SWIG_PYBUFFER_SIZE 1024
-#endif
-
-static PyObject *
-PyString_FromFormat(const char *fmt, ...) {
- va_list ap;
- char buf[SWIG_PYBUFFER_SIZE * 2];
- int res;
- va_start(ap, fmt);
- res = vsnprintf(buf, sizeof(buf), fmt, ap);
- va_end(ap);
- return (res < 0 || res >= (int)sizeof(buf)) ? 0 : PyString_FromString(buf);
-}
-#endif
-
-/* Add PyObject_Del for old Pythons */
-#if PY_VERSION_HEX < 0x01060000
-# define PyObject_Del(op) PyMem_DEL((op))
-#endif
-#ifndef PyObject_DEL
-# define PyObject_DEL PyObject_Del
-#endif
-
-/* A crude PyExc_StopIteration exception for old Pythons */
-#if PY_VERSION_HEX < 0x02020000
-# ifndef PyExc_StopIteration
-# define PyExc_StopIteration PyExc_RuntimeError
-# endif
-# ifndef PyObject_GenericGetAttr
-# define PyObject_GenericGetAttr 0
-# endif
-#endif
-
-/* Py_NotImplemented is defined in 2.1 and up. */
-#if PY_VERSION_HEX < 0x02010000
-# ifndef Py_NotImplemented
-# define Py_NotImplemented PyExc_RuntimeError
-# endif
-#endif
-
-/* A crude PyString_AsStringAndSize implementation for old Pythons */
-#if PY_VERSION_HEX < 0x02010000
-# ifndef PyString_AsStringAndSize
-# define PyString_AsStringAndSize(obj, s, len) {*s = PyString_AsString(obj); *len = *s ? strlen(*s) : 0;}
-# endif
-#endif
-
-/* PySequence_Size for old Pythons */
-#if PY_VERSION_HEX < 0x02000000
-# ifndef PySequence_Size
-# define PySequence_Size PySequence_Length
-# endif
-#endif
-
-/* PyBool_FromLong for old Pythons */
-#if PY_VERSION_HEX < 0x02030000
-static
-PyObject *PyBool_FromLong(long ok)
-{
- PyObject *result = ok ? Py_True : Py_False;
- Py_INCREF(result);
- return result;
-}
-#endif
-
-/* Py_ssize_t for old Pythons */
-/* This code is as recommended by: */
-/* http://www.python.org/dev/peps/pep-0353/#conversion-guidelines */
-#if PY_VERSION_HEX < 0x02050000 && !defined(PY_SSIZE_T_MIN)
-typedef int Py_ssize_t;
-# define PY_SSIZE_T_MAX INT_MAX
-# define PY_SSIZE_T_MIN INT_MIN
-typedef inquiry lenfunc;
-typedef intargfunc ssizeargfunc;
-typedef intintargfunc ssizessizeargfunc;
-typedef intobjargproc ssizeobjargproc;
-typedef intintobjargproc ssizessizeobjargproc;
-typedef getreadbufferproc readbufferproc;
-typedef getwritebufferproc writebufferproc;
-typedef getsegcountproc segcountproc;
-typedef getcharbufferproc charbufferproc;
-static long PyNumber_AsSsize_t (PyObject *x, void *SWIGUNUSEDPARM(exc))
-{
- long result = 0;
- PyObject *i = PyNumber_Int(x);
- if (i) {
- result = PyInt_AsLong(i);
- Py_DECREF(i);
- }
- return result;
-}
-#endif
-
-#if PY_VERSION_HEX < 0x02040000
-#define Py_VISIT(op) \
- do { \
- if (op) { \
- int vret = visit((op), arg); \
- if (vret) \
- return vret; \
- } \
- } while (0)
-#endif
-
-#if PY_VERSION_HEX < 0x02030000
-typedef struct {
- PyTypeObject type;
- PyNumberMethods as_number;
- PyMappingMethods as_mapping;
- PySequenceMethods as_sequence;
- PyBufferProcs as_buffer;
- PyObject *name, *slots;
-} PyHeapTypeObject;
-#endif
-
-#if PY_VERSION_HEX < 0x02030000
-typedef destructor freefunc;
-#endif
-
-#if ((PY_MAJOR_VERSION == 2 && PY_MINOR_VERSION > 6) || \
- (PY_MAJOR_VERSION == 3 && PY_MINOR_VERSION > 0) || \
- (PY_MAJOR_VERSION > 3))
-# define SWIGPY_USE_CAPSULE
-# define SWIGPY_CAPSULE_NAME ((char*)"swig_runtime_data" SWIG_RUNTIME_VERSION ".type_pointer_capsule" SWIG_TYPE_TABLE_NAME)
-#endif
-
-#if PY_VERSION_HEX < 0x03020000
-#define PyDescr_TYPE(x) (((PyDescrObject *)(x))->d_type)
-#define PyDescr_NAME(x) (((PyDescrObject *)(x))->d_name)
-#endif
-
-/* -----------------------------------------------------------------------------
- * error manipulation
- * ----------------------------------------------------------------------------- */
-
-SWIGRUNTIME PyObject*
-SWIG_Python_ErrorType(int code) {
- PyObject* type = 0;
- switch(code) {
- case SWIG_MemoryError:
- type = PyExc_MemoryError;
- break;
- case SWIG_IOError:
- type = PyExc_IOError;
- break;
- case SWIG_RuntimeError:
- type = PyExc_RuntimeError;
- break;
- case SWIG_IndexError:
- type = PyExc_IndexError;
- break;
- case SWIG_TypeError:
- type = PyExc_TypeError;
- break;
- case SWIG_DivisionByZero:
- type = PyExc_ZeroDivisionError;
- break;
- case SWIG_OverflowError:
- type = PyExc_OverflowError;
- break;
- case SWIG_SyntaxError:
- type = PyExc_SyntaxError;
- break;
- case SWIG_ValueError:
- type = PyExc_ValueError;
- break;
- case SWIG_SystemError:
- type = PyExc_SystemError;
- break;
- case SWIG_AttributeError:
- type = PyExc_AttributeError;
- break;
- default:
- type = PyExc_RuntimeError;
- }
- return type;
-}
-
-
-SWIGRUNTIME void
-SWIG_Python_AddErrorMsg(const char* mesg)
-{
- PyObject *type = 0;
- PyObject *value = 0;
- PyObject *traceback = 0;
-
- if (PyErr_Occurred()) PyErr_Fetch(&type, &value, &traceback);
- if (value) {
- char *tmp;
- PyObject *old_str = PyObject_Str(value);
- PyErr_Clear();
- Py_XINCREF(type);
-
- PyErr_Format(type, "%s %s", tmp = SWIG_Python_str_AsChar(old_str), mesg);
- SWIG_Python_str_DelForPy3(tmp);
- Py_DECREF(old_str);
- Py_DECREF(value);
- } else {
- PyErr_SetString(PyExc_RuntimeError, mesg);
- }
-}
-
-#if defined(SWIG_PYTHON_NO_THREADS)
-# if defined(SWIG_PYTHON_THREADS)
-# undef SWIG_PYTHON_THREADS
-# endif
-#endif
-#if defined(SWIG_PYTHON_THREADS) /* Threading support is enabled */
-# if !defined(SWIG_PYTHON_USE_GIL) && !defined(SWIG_PYTHON_NO_USE_GIL)
-# if (PY_VERSION_HEX >= 0x02030000) /* For 2.3 or later, use the PyGILState calls */
-# define SWIG_PYTHON_USE_GIL
-# endif
-# endif
-# if defined(SWIG_PYTHON_USE_GIL) /* Use PyGILState threads calls */
-# ifndef SWIG_PYTHON_INITIALIZE_THREADS
-# define SWIG_PYTHON_INITIALIZE_THREADS PyEval_InitThreads()
-# endif
-# ifdef __cplusplus /* C++ code */
- class SWIG_Python_Thread_Block {
- bool status;
- PyGILState_STATE state;
- public:
- void end() { if (status) { PyGILState_Release(state); status = false;} }
- SWIG_Python_Thread_Block() : status(true), state(PyGILState_Ensure()) {}
- ~SWIG_Python_Thread_Block() { end(); }
- };
- class SWIG_Python_Thread_Allow {
- bool status;
- PyThreadState *save;
- public:
- void end() { if (status) { PyEval_RestoreThread(save); status = false; }}
- SWIG_Python_Thread_Allow() : status(true), save(PyEval_SaveThread()) {}
- ~SWIG_Python_Thread_Allow() { end(); }
- };
-# define SWIG_PYTHON_THREAD_BEGIN_BLOCK SWIG_Python_Thread_Block _swig_thread_block
-# define SWIG_PYTHON_THREAD_END_BLOCK _swig_thread_block.end()
-# define SWIG_PYTHON_THREAD_BEGIN_ALLOW SWIG_Python_Thread_Allow _swig_thread_allow
-# define SWIG_PYTHON_THREAD_END_ALLOW _swig_thread_allow.end()
-# else /* C code */
-# define SWIG_PYTHON_THREAD_BEGIN_BLOCK PyGILState_STATE _swig_thread_block = PyGILState_Ensure()
-# define SWIG_PYTHON_THREAD_END_BLOCK PyGILState_Release(_swig_thread_block)
-# define SWIG_PYTHON_THREAD_BEGIN_ALLOW PyThreadState *_swig_thread_allow = PyEval_SaveThread()
-# define SWIG_PYTHON_THREAD_END_ALLOW PyEval_RestoreThread(_swig_thread_allow)
-# endif
-# else /* Old thread way, not implemented, user must provide it */
-# if !defined(SWIG_PYTHON_INITIALIZE_THREADS)
-# define SWIG_PYTHON_INITIALIZE_THREADS
-# endif
-# if !defined(SWIG_PYTHON_THREAD_BEGIN_BLOCK)
-# define SWIG_PYTHON_THREAD_BEGIN_BLOCK
-# endif
-# if !defined(SWIG_PYTHON_THREAD_END_BLOCK)
-# define SWIG_PYTHON_THREAD_END_BLOCK
-# endif
-# if !defined(SWIG_PYTHON_THREAD_BEGIN_ALLOW)
-# define SWIG_PYTHON_THREAD_BEGIN_ALLOW
-# endif
-# if !defined(SWIG_PYTHON_THREAD_END_ALLOW)
-# define SWIG_PYTHON_THREAD_END_ALLOW
-# endif
-# endif
-#else /* No thread support */
-# define SWIG_PYTHON_INITIALIZE_THREADS
-# define SWIG_PYTHON_THREAD_BEGIN_BLOCK
-# define SWIG_PYTHON_THREAD_END_BLOCK
-# define SWIG_PYTHON_THREAD_BEGIN_ALLOW
-# define SWIG_PYTHON_THREAD_END_ALLOW
-#endif
-
-/* -----------------------------------------------------------------------------
- * Python API portion that goes into the runtime
- * ----------------------------------------------------------------------------- */
-
-#ifdef __cplusplus
-extern "C" {
-#endif
-
-/* -----------------------------------------------------------------------------
- * Constant declarations
- * ----------------------------------------------------------------------------- */
-
-/* Constant Types */
-#define SWIG_PY_POINTER 4
-#define SWIG_PY_BINARY 5
-
-/* Constant information structure */
-typedef struct swig_const_info {
- int type;
- char *name;
- long lvalue;
- double dvalue;
- void *pvalue;
- swig_type_info **ptype;
-} swig_const_info;
-
-
-/* -----------------------------------------------------------------------------
- * Wrapper of PyInstanceMethod_New() used in Python 3
- * It is exported to the generated module, used for -fastproxy
- * ----------------------------------------------------------------------------- */
-#if PY_VERSION_HEX >= 0x03000000
-SWIGRUNTIME PyObject* SWIG_PyInstanceMethod_New(PyObject *SWIGUNUSEDPARM(self), PyObject *func)
-{
- return PyInstanceMethod_New(func);
-}
-#else
-SWIGRUNTIME PyObject* SWIG_PyInstanceMethod_New(PyObject *SWIGUNUSEDPARM(self), PyObject *SWIGUNUSEDPARM(func))
-{
- return NULL;
-}
-#endif
-
-#ifdef __cplusplus
-}
-#endif
-
-
-/* -----------------------------------------------------------------------------
- * pyrun.swg
- *
- * This file contains the runtime support for Python modules
- * and includes code for managing global variables and pointer
- * type checking.
- *
- * ----------------------------------------------------------------------------- */
-
-/* Common SWIG API */
-
-/* for raw pointers */
-#define SWIG_Python_ConvertPtr(obj, pptr, type, flags) SWIG_Python_ConvertPtrAndOwn(obj, pptr, type, flags, 0)
-#define SWIG_ConvertPtr(obj, pptr, type, flags) SWIG_Python_ConvertPtr(obj, pptr, type, flags)
-#define SWIG_ConvertPtrAndOwn(obj,pptr,type,flags,own) SWIG_Python_ConvertPtrAndOwn(obj, pptr, type, flags, own)
-
-#ifdef SWIGPYTHON_BUILTIN
-#define SWIG_NewPointerObj(ptr, type, flags) SWIG_Python_NewPointerObj(self, ptr, type, flags)
-#else
-#define SWIG_NewPointerObj(ptr, type, flags) SWIG_Python_NewPointerObj(NULL, ptr, type, flags)
-#endif
-
-#define SWIG_InternalNewPointerObj(ptr, type, flags) SWIG_Python_NewPointerObj(NULL, ptr, type, flags)
-
-#define SWIG_CheckImplicit(ty) SWIG_Python_CheckImplicit(ty)
-#define SWIG_AcquirePtr(ptr, src) SWIG_Python_AcquirePtr(ptr, src)
-#define swig_owntype int
-
-/* for raw packed data */
-#define SWIG_ConvertPacked(obj, ptr, sz, ty) SWIG_Python_ConvertPacked(obj, ptr, sz, ty)
-#define SWIG_NewPackedObj(ptr, sz, type) SWIG_Python_NewPackedObj(ptr, sz, type)
-
-/* for class or struct pointers */
-#define SWIG_ConvertInstance(obj, pptr, type, flags) SWIG_ConvertPtr(obj, pptr, type, flags)
-#define SWIG_NewInstanceObj(ptr, type, flags) SWIG_NewPointerObj(ptr, type, flags)
-
-/* for C or C++ function pointers */
-#define SWIG_ConvertFunctionPtr(obj, pptr, type) SWIG_Python_ConvertFunctionPtr(obj, pptr, type)
-#define SWIG_NewFunctionPtrObj(ptr, type) SWIG_Python_NewPointerObj(NULL, ptr, type, 0)
-
-/* for C++ member pointers, ie, member methods */
-#define SWIG_ConvertMember(obj, ptr, sz, ty) SWIG_Python_ConvertPacked(obj, ptr, sz, ty)
-#define SWIG_NewMemberObj(ptr, sz, type) SWIG_Python_NewPackedObj(ptr, sz, type)
-
-
-/* Runtime API */
-
-#define SWIG_GetModule(clientdata) SWIG_Python_GetModule()
-#define SWIG_SetModule(clientdata, pointer) SWIG_Python_SetModule(pointer)
-#define SWIG_NewClientData(obj) SwigPyClientData_New(obj)
-
-#define SWIG_SetErrorObj SWIG_Python_SetErrorObj
-#define SWIG_SetErrorMsg SWIG_Python_SetErrorMsg
-#define SWIG_ErrorType(code) SWIG_Python_ErrorType(code)
-#define SWIG_Error(code, msg) SWIG_Python_SetErrorMsg(SWIG_ErrorType(code), msg)
-#define SWIG_fail goto fail
-
-
-/* Runtime API implementation */
-
-/* Error manipulation */
-
-SWIGINTERN void
-SWIG_Python_SetErrorObj(PyObject *errtype, PyObject *obj) {
- SWIG_PYTHON_THREAD_BEGIN_BLOCK;
- PyErr_SetObject(errtype, obj);
- Py_DECREF(obj);
- SWIG_PYTHON_THREAD_END_BLOCK;
-}
-
-SWIGINTERN void
-SWIG_Python_SetErrorMsg(PyObject *errtype, const char *msg) {
- SWIG_PYTHON_THREAD_BEGIN_BLOCK;
- PyErr_SetString(errtype, (char *) msg);
- SWIG_PYTHON_THREAD_END_BLOCK;
-}
-
-#define SWIG_Python_Raise(obj, type, desc) SWIG_Python_SetErrorObj(SWIG_Python_ExceptionType(desc), obj)
-
-/* Set a constant value */
-
-#if defined(SWIGPYTHON_BUILTIN)
-
-SWIGINTERN void
-SwigPyBuiltin_AddPublicSymbol(PyObject *seq, const char *key) {
- PyObject *s = PyString_InternFromString(key);
- PyList_Append(seq, s);
- Py_DECREF(s);
-}
-
-SWIGINTERN void
-SWIG_Python_SetConstant(PyObject *d, PyObject *public_interface, const char *name, PyObject *obj) {
- PyDict_SetItemString(d, (char *)name, obj);
- Py_DECREF(obj);
- if (public_interface)
- SwigPyBuiltin_AddPublicSymbol(public_interface, name);
-}
-
-#else
-
-SWIGINTERN void
-SWIG_Python_SetConstant(PyObject *d, const char *name, PyObject *obj) {
- PyDict_SetItemString(d, (char *)name, obj);
- Py_DECREF(obj);
-}
-
-#endif
-
-/* Append a value to the result obj */
-
-SWIGINTERN PyObject*
-SWIG_Python_AppendOutput(PyObject* result, PyObject* obj) {
-#if !defined(SWIG_PYTHON_OUTPUT_TUPLE)
- if (!result) {
- result = obj;
- } else if (result == Py_None) {
- Py_DECREF(result);
- result = obj;
- } else {
- if (!PyList_Check(result)) {
- PyObject *o2 = result;
- result = PyList_New(1);
- PyList_SetItem(result, 0, o2);
- }
- PyList_Append(result,obj);
- Py_DECREF(obj);
- }
- return result;
-#else
- PyObject* o2;
- PyObject* o3;
- if (!result) {
- result = obj;
- } else if (result == Py_None) {
- Py_DECREF(result);
- result = obj;
- } else {
- if (!PyTuple_Check(result)) {
- o2 = result;
- result = PyTuple_New(1);
- PyTuple_SET_ITEM(result, 0, o2);
- }
- o3 = PyTuple_New(1);
- PyTuple_SET_ITEM(o3, 0, obj);
- o2 = result;
- result = PySequence_Concat(o2, o3);
- Py_DECREF(o2);
- Py_DECREF(o3);
- }
- return result;
-#endif
-}
-
-/* Unpack the argument tuple */
-
-SWIGINTERN int
-SWIG_Python_UnpackTuple(PyObject *args, const char *name, Py_ssize_t min, Py_ssize_t max, PyObject **objs)
-{
- if (!args) {
- if (!min && !max) {
- return 1;
- } else {
- PyErr_Format(PyExc_TypeError, "%s expected %s%d arguments, got none",
- name, (min == max ? "" : "at least "), (int)min);
- return 0;
- }
- }
- if (!PyTuple_Check(args)) {
- if (min <= 1 && max >= 1) {
- register int i;
- objs[0] = args;
- for (i = 1; i < max; ++i) {
- objs[i] = 0;
- }
- return 2;
- }
- PyErr_SetString(PyExc_SystemError, "UnpackTuple() argument list is not a tuple");
- return 0;
- } else {
- register Py_ssize_t l = PyTuple_GET_SIZE(args);
- if (l < min) {
- PyErr_Format(PyExc_TypeError, "%s expected %s%d arguments, got %d",
- name, (min == max ? "" : "at least "), (int)min, (int)l);
- return 0;
- } else if (l > max) {
- PyErr_Format(PyExc_TypeError, "%s expected %s%d arguments, got %d",
- name, (min == max ? "" : "at most "), (int)max, (int)l);
- return 0;
- } else {
- register int i;
- for (i = 0; i < l; ++i) {
- objs[i] = PyTuple_GET_ITEM(args, i);
- }
- for (; l < max; ++l) {
- objs[l] = 0;
- }
- return i + 1;
- }
- }
-}
-
-/* A functor is a function object with one single object argument */
-#if PY_VERSION_HEX >= 0x02020000
-#define SWIG_Python_CallFunctor(functor, obj) PyObject_CallFunctionObjArgs(functor, obj, NULL);
-#else
-#define SWIG_Python_CallFunctor(functor, obj) PyObject_CallFunction(functor, "O", obj);
-#endif
-
-/*
- Helper for static pointer initialization for both C and C++ code, for example
- static PyObject *SWIG_STATIC_POINTER(MyVar) = NewSomething(...);
-*/
-#ifdef __cplusplus
-#define SWIG_STATIC_POINTER(var) var
-#else
-#define SWIG_STATIC_POINTER(var) var = 0; if (!var) var
-#endif
-
-/* -----------------------------------------------------------------------------
- * Pointer declarations
- * ----------------------------------------------------------------------------- */
-
-/* Flags for new pointer objects */
-#define SWIG_POINTER_NOSHADOW (SWIG_POINTER_OWN << 1)
-#define SWIG_POINTER_NEW (SWIG_POINTER_NOSHADOW | SWIG_POINTER_OWN)
-
-#define SWIG_POINTER_IMPLICIT_CONV (SWIG_POINTER_DISOWN << 1)
-
-#define SWIG_BUILTIN_TP_INIT (SWIG_POINTER_OWN << 2)
-#define SWIG_BUILTIN_INIT (SWIG_BUILTIN_TP_INIT | SWIG_POINTER_OWN)
-
-#ifdef __cplusplus
-extern "C" {
-#endif
-
-/* How to access Py_None */
-#if defined(_WIN32) || defined(__WIN32__) || defined(__CYGWIN__)
-# ifndef SWIG_PYTHON_NO_BUILD_NONE
-# ifndef SWIG_PYTHON_BUILD_NONE
-# define SWIG_PYTHON_BUILD_NONE
-# endif
-# endif
-#endif
-
-#ifdef SWIG_PYTHON_BUILD_NONE
-# ifdef Py_None
-# undef Py_None
-# define Py_None SWIG_Py_None()
-# endif
-SWIGRUNTIMEINLINE PyObject *
-_SWIG_Py_None(void)
-{
- PyObject *none = Py_BuildValue((char*)"");
- Py_DECREF(none);
- return none;
-}
-SWIGRUNTIME PyObject *
-SWIG_Py_None(void)
-{
- static PyObject *SWIG_STATIC_POINTER(none) = _SWIG_Py_None();
- return none;
-}
-#endif
-
-/* The python void return value */
-
-SWIGRUNTIMEINLINE PyObject *
-SWIG_Py_Void(void)
-{
- PyObject *none = Py_None;
- Py_INCREF(none);
- return none;
-}
-
-/* SwigPyClientData */
-
-typedef struct {
- PyObject *klass;
- PyObject *newraw;
- PyObject *newargs;
- PyObject *destroy;
- int delargs;
- int implicitconv;
- PyTypeObject *pytype;
-} SwigPyClientData;
-
-SWIGRUNTIMEINLINE int
-SWIG_Python_CheckImplicit(swig_type_info *ty)
-{
- SwigPyClientData *data = (SwigPyClientData *)ty->clientdata;
- return data ? data->implicitconv : 0;
-}
-
-SWIGRUNTIMEINLINE PyObject *
-SWIG_Python_ExceptionType(swig_type_info *desc) {
- SwigPyClientData *data = desc ? (SwigPyClientData *) desc->clientdata : 0;
- PyObject *klass = data ? data->klass : 0;
- return (klass ? klass : PyExc_RuntimeError);
-}
-
-
-SWIGRUNTIME SwigPyClientData *
-SwigPyClientData_New(PyObject* obj)
-{
- if (!obj) {
- return 0;
- } else {
- SwigPyClientData *data = (SwigPyClientData *)malloc(sizeof(SwigPyClientData));
- /* the klass element */
- data->klass = obj;
- Py_INCREF(data->klass);
- /* the newraw method and newargs arguments used to create a new raw instance */
- if (PyClass_Check(obj)) {
- data->newraw = 0;
- data->newargs = obj;
- Py_INCREF(obj);
- } else {
-#if (PY_VERSION_HEX < 0x02020000)
- data->newraw = 0;
-#else
- data->newraw = PyObject_GetAttrString(data->klass, (char *)"__new__");
-#endif
- if (data->newraw) {
- Py_INCREF(data->newraw);
- data->newargs = PyTuple_New(1);
- PyTuple_SetItem(data->newargs, 0, obj);
- } else {
- data->newargs = obj;
- }
- Py_INCREF(data->newargs);
- }
- /* the destroy method, aka as the C++ delete method */
- data->destroy = PyObject_GetAttrString(data->klass, (char *)"__swig_destroy__");
- if (PyErr_Occurred()) {
- PyErr_Clear();
- data->destroy = 0;
- }
- if (data->destroy) {
- int flags;
- Py_INCREF(data->destroy);
- flags = PyCFunction_GET_FLAGS(data->destroy);
-#ifdef METH_O
- data->delargs = !(flags & (METH_O));
-#else
- data->delargs = 0;
-#endif
- } else {
- data->delargs = 0;
- }
- data->implicitconv = 0;
- data->pytype = 0;
- return data;
- }
-}
-
-SWIGRUNTIME void
-SwigPyClientData_Del(SwigPyClientData *data) {
- Py_XDECREF(data->newraw);
- Py_XDECREF(data->newargs);
- Py_XDECREF(data->destroy);
-}
-
-/* =============== SwigPyObject =====================*/
-
-typedef struct {
- PyObject_HEAD
- void *ptr;
- swig_type_info *ty;
- int own;
- PyObject *next;
-#ifdef SWIGPYTHON_BUILTIN
- PyObject *dict;
-#endif
-} SwigPyObject;
-
-SWIGRUNTIME PyObject *
-SwigPyObject_long(SwigPyObject *v)
-{
- return PyLong_FromVoidPtr(v->ptr);
-}
-
-SWIGRUNTIME PyObject *
-SwigPyObject_format(const char* fmt, SwigPyObject *v)
-{
- PyObject *res = NULL;
- PyObject *args = PyTuple_New(1);
- if (args) {
- if (PyTuple_SetItem(args, 0, SwigPyObject_long(v)) == 0) {
- PyObject *ofmt = SWIG_Python_str_FromChar(fmt);
- if (ofmt) {
-#if PY_VERSION_HEX >= 0x03000000
- res = PyUnicode_Format(ofmt,args);
-#else
- res = PyString_Format(ofmt,args);
-#endif
- Py_DECREF(ofmt);
- }
- Py_DECREF(args);
- }
- }
- return res;
-}
-
-SWIGRUNTIME PyObject *
-SwigPyObject_oct(SwigPyObject *v)
-{
- return SwigPyObject_format("%o",v);
-}
-
-SWIGRUNTIME PyObject *
-SwigPyObject_hex(SwigPyObject *v)
-{
- return SwigPyObject_format("%x",v);
-}
-
-SWIGRUNTIME PyObject *
-#ifdef METH_NOARGS
-SwigPyObject_repr(SwigPyObject *v)
-#else
-SwigPyObject_repr(SwigPyObject *v, PyObject *args)
-#endif
-{
- const char *name = SWIG_TypePrettyName(v->ty);
- PyObject *repr = SWIG_Python_str_FromFormat("<Swig Object of type '%s' at %p>", name, (void *)v);
- if (v->next) {
-# ifdef METH_NOARGS
- PyObject *nrep = SwigPyObject_repr((SwigPyObject *)v->next);
-# else
- PyObject *nrep = SwigPyObject_repr((SwigPyObject *)v->next, args);
-# endif
-# if PY_VERSION_HEX >= 0x03000000
- PyObject *joined = PyUnicode_Concat(repr, nrep);
- Py_DecRef(repr);
- Py_DecRef(nrep);
- repr = joined;
-# else
- PyString_ConcatAndDel(&repr,nrep);
-# endif
- }
- return repr;
-}
-
-SWIGRUNTIME int
-SwigPyObject_print(SwigPyObject *v, FILE *fp, int SWIGUNUSEDPARM(flags))
-{
- char *str;
-#ifdef METH_NOARGS
- PyObject *repr = SwigPyObject_repr(v);
-#else
- PyObject *repr = SwigPyObject_repr(v, NULL);
-#endif
- if (repr) {
- str = SWIG_Python_str_AsChar(repr);
- fputs(str, fp);
- SWIG_Python_str_DelForPy3(str);
- Py_DECREF(repr);
- return 0;
- } else {
- return 1;
- }
-}
-
-SWIGRUNTIME PyObject *
-SwigPyObject_str(SwigPyObject *v)
-{
- char result[SWIG_BUFFER_SIZE];
- return SWIG_PackVoidPtr(result, v->ptr, v->ty->name, sizeof(result)) ?
- SWIG_Python_str_FromChar(result) : 0;
-}
-
-SWIGRUNTIME int
-SwigPyObject_compare(SwigPyObject *v, SwigPyObject *w)
-{
- void *i = v->ptr;
- void *j = w->ptr;
- return (i < j) ? -1 : ((i > j) ? 1 : 0);
-}
-
-/* Added for Python 3.x, would it also be useful for Python 2.x? */
-SWIGRUNTIME PyObject*
-SwigPyObject_richcompare(SwigPyObject *v, SwigPyObject *w, int op)
-{
- PyObject* res;
- if( op != Py_EQ && op != Py_NE ) {
- Py_INCREF(Py_NotImplemented);
- return Py_NotImplemented;
- }
- res = PyBool_FromLong( (SwigPyObject_compare(v, w)==0) == (op == Py_EQ) ? 1 : 0);
- return res;
-}
-
-
-SWIGRUNTIME PyTypeObject* SwigPyObject_TypeOnce(void);
-
-#ifdef SWIGPYTHON_BUILTIN
-static swig_type_info *SwigPyObject_stype = 0;
-SWIGRUNTIME PyTypeObject*
-SwigPyObject_type(void) {
- SwigPyClientData *cd;
- assert(SwigPyObject_stype);
- cd = (SwigPyClientData*) SwigPyObject_stype->clientdata;
- assert(cd);
- assert(cd->pytype);
- return cd->pytype;
-}
-#else
-SWIGRUNTIME PyTypeObject*
-SwigPyObject_type(void) {
- static PyTypeObject *SWIG_STATIC_POINTER(type) = SwigPyObject_TypeOnce();
- return type;
-}
-#endif
-
-SWIGRUNTIMEINLINE int
-SwigPyObject_Check(PyObject *op) {
-#ifdef SWIGPYTHON_BUILTIN
- PyTypeObject *target_tp = SwigPyObject_type();
- if (PyType_IsSubtype(op->ob_type, target_tp))
- return 1;
- return (strcmp(op->ob_type->tp_name, "SwigPyObject") == 0);
-#else
- return (Py_TYPE(op) == SwigPyObject_type())
- || (strcmp(Py_TYPE(op)->tp_name,"SwigPyObject") == 0);
-#endif
-}
-
-SWIGRUNTIME PyObject *
-SwigPyObject_New(void *ptr, swig_type_info *ty, int own);
-
-SWIGRUNTIME void
-SwigPyObject_dealloc(PyObject *v)
-{
- SwigPyObject *sobj = (SwigPyObject *) v;
- PyObject *next = sobj->next;
- if (sobj->own == SWIG_POINTER_OWN) {
- swig_type_info *ty = sobj->ty;
- SwigPyClientData *data = ty ? (SwigPyClientData *) ty->clientdata : 0;
- PyObject *destroy = data ? data->destroy : 0;
- if (destroy) {
- /* destroy is always a VARARGS method */
- PyObject *res;
- if (data->delargs) {
- /* we need to create a temporary object to carry the destroy operation */
- PyObject *tmp = SwigPyObject_New(sobj->ptr, ty, 0);
- res = SWIG_Python_CallFunctor(destroy, tmp);
- Py_DECREF(tmp);
- } else {
- PyCFunction meth = PyCFunction_GET_FUNCTION(destroy);
- PyObject *mself = PyCFunction_GET_SELF(destroy);
- res = ((*meth)(mself, v));
- }
- Py_XDECREF(res);
- }
-#if !defined(SWIG_PYTHON_SILENT_MEMLEAK)
- else {
- const char *name = SWIG_TypePrettyName(ty);
- printf("swig/python detected a memory leak of type '%s', no destructor found.\n", (name ? name : "unknown"));
- }
-#endif
- }
- Py_XDECREF(next);
- PyObject_DEL(v);
-}
-
-SWIGRUNTIME PyObject*
-SwigPyObject_append(PyObject* v, PyObject* next)
-{
- SwigPyObject *sobj = (SwigPyObject *) v;
-#ifndef METH_O
- PyObject *tmp = 0;
- if (!PyArg_ParseTuple(next,(char *)"O:append", &tmp)) return NULL;
- next = tmp;
-#endif
- if (!SwigPyObject_Check(next)) {
- return NULL;
- }
- sobj->next = next;
- Py_INCREF(next);
- return SWIG_Py_Void();
-}
-
-SWIGRUNTIME PyObject*
-#ifdef METH_NOARGS
-SwigPyObject_next(PyObject* v)
-#else
-SwigPyObject_next(PyObject* v, PyObject *SWIGUNUSEDPARM(args))
-#endif
-{
- SwigPyObject *sobj = (SwigPyObject *) v;
- if (sobj->next) {
- Py_INCREF(sobj->next);
- return sobj->next;
- } else {
- return SWIG_Py_Void();
- }
-}
-
-SWIGINTERN PyObject*
-#ifdef METH_NOARGS
-SwigPyObject_disown(PyObject *v)
-#else
-SwigPyObject_disown(PyObject* v, PyObject *SWIGUNUSEDPARM(args))
-#endif
-{
- SwigPyObject *sobj = (SwigPyObject *)v;
- sobj->own = 0;
- return SWIG_Py_Void();
-}
-
-SWIGINTERN PyObject*
-#ifdef METH_NOARGS
-SwigPyObject_acquire(PyObject *v)
-#else
-SwigPyObject_acquire(PyObject* v, PyObject *SWIGUNUSEDPARM(args))
-#endif
-{
- SwigPyObject *sobj = (SwigPyObject *)v;
- sobj->own = SWIG_POINTER_OWN;
- return SWIG_Py_Void();
-}
-
-SWIGINTERN PyObject*
-SwigPyObject_own(PyObject *v, PyObject *args)
-{
- PyObject *val = 0;
-#if (PY_VERSION_HEX < 0x02020000)
- if (!PyArg_ParseTuple(args,(char *)"|O:own",&val))
-#else
- if (!PyArg_UnpackTuple(args, (char *)"own", 0, 1, &val))
-#endif
- {
- return NULL;
- }
- else
- {
- SwigPyObject *sobj = (SwigPyObject *)v;
- PyObject *obj = PyBool_FromLong(sobj->own);
- if (val) {
-#ifdef METH_NOARGS
- if (PyObject_IsTrue(val)) {
- SwigPyObject_acquire(v);
- } else {
- SwigPyObject_disown(v);
- }
-#else
- if (PyObject_IsTrue(val)) {
- SwigPyObject_acquire(v,args);
- } else {
- SwigPyObject_disown(v,args);
- }
-#endif
- }
- return obj;
- }
-}
-
-#ifdef METH_O
-static PyMethodDef
-swigobject_methods[] = {
- {(char *)"disown", (PyCFunction)SwigPyObject_disown, METH_NOARGS, (char *)"releases ownership of the pointer"},
- {(char *)"acquire", (PyCFunction)SwigPyObject_acquire, METH_NOARGS, (char *)"aquires ownership of the pointer"},
- {(char *)"own", (PyCFunction)SwigPyObject_own, METH_VARARGS, (char *)"returns/sets ownership of the pointer"},
- {(char *)"append", (PyCFunction)SwigPyObject_append, METH_O, (char *)"appends another 'this' object"},
- {(char *)"next", (PyCFunction)SwigPyObject_next, METH_NOARGS, (char *)"returns the next 'this' object"},
- {(char *)"__repr__",(PyCFunction)SwigPyObject_repr, METH_NOARGS, (char *)"returns object representation"},
- {0, 0, 0, 0}
-};
-#else
-static PyMethodDef
-swigobject_methods[] = {
- {(char *)"disown", (PyCFunction)SwigPyObject_disown, METH_VARARGS, (char *)"releases ownership of the pointer"},
- {(char *)"acquire", (PyCFunction)SwigPyObject_acquire, METH_VARARGS, (char *)"aquires ownership of the pointer"},
- {(char *)"own", (PyCFunction)SwigPyObject_own, METH_VARARGS, (char *)"returns/sets ownership of the pointer"},
- {(char *)"append", (PyCFunction)SwigPyObject_append, METH_VARARGS, (char *)"appends another 'this' object"},
- {(char *)"next", (PyCFunction)SwigPyObject_next, METH_VARARGS, (char *)"returns the next 'this' object"},
- {(char *)"__repr__",(PyCFunction)SwigPyObject_repr, METH_VARARGS, (char *)"returns object representation"},
- {0, 0, 0, 0}
-};
-#endif
-
-#if PY_VERSION_HEX < 0x02020000
-SWIGINTERN PyObject *
-SwigPyObject_getattr(SwigPyObject *sobj,char *name)
-{
- return Py_FindMethod(swigobject_methods, (PyObject *)sobj, name);
-}
-#endif
-
-SWIGRUNTIME PyTypeObject*
-SwigPyObject_TypeOnce(void) {
- static char swigobject_doc[] = "Swig object carries a C/C++ instance pointer";
-
- static PyNumberMethods SwigPyObject_as_number = {
- (binaryfunc)0, /*nb_add*/
- (binaryfunc)0, /*nb_subtract*/
- (binaryfunc)0, /*nb_multiply*/
- /* nb_divide removed in Python 3 */
-#if PY_VERSION_HEX < 0x03000000
- (binaryfunc)0, /*nb_divide*/
-#endif
- (binaryfunc)0, /*nb_remainder*/
- (binaryfunc)0, /*nb_divmod*/
- (ternaryfunc)0,/*nb_power*/
- (unaryfunc)0, /*nb_negative*/
- (unaryfunc)0, /*nb_positive*/
- (unaryfunc)0, /*nb_absolute*/
- (inquiry)0, /*nb_nonzero*/
- 0, /*nb_invert*/
- 0, /*nb_lshift*/
- 0, /*nb_rshift*/
- 0, /*nb_and*/
- 0, /*nb_xor*/
- 0, /*nb_or*/
-#if PY_VERSION_HEX < 0x03000000
- 0, /*nb_coerce*/
-#endif
- (unaryfunc)SwigPyObject_long, /*nb_int*/
-#if PY_VERSION_HEX < 0x03000000
- (unaryfunc)SwigPyObject_long, /*nb_long*/
-#else
- 0, /*nb_reserved*/
-#endif
- (unaryfunc)0, /*nb_float*/
-#if PY_VERSION_HEX < 0x03000000
- (unaryfunc)SwigPyObject_oct, /*nb_oct*/
- (unaryfunc)SwigPyObject_hex, /*nb_hex*/
-#endif
-#if PY_VERSION_HEX >= 0x03000000 /* 3.0 */
- 0,0,0,0,0,0,0,0,0,0,0,0,0,0,0 /* nb_inplace_add -> nb_index, nb_inplace_divide removed */
-#elif PY_VERSION_HEX >= 0x02050000 /* 2.5.0 */
- 0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0 /* nb_inplace_add -> nb_index */
-#elif PY_VERSION_HEX >= 0x02020000 /* 2.2.0 */
- 0,0,0,0,0,0,0,0,0,0,0,0,0,0,0 /* nb_inplace_add -> nb_inplace_true_divide */
-#elif PY_VERSION_HEX >= 0x02000000 /* 2.0.0 */
- 0,0,0,0,0,0,0,0,0,0,0 /* nb_inplace_add -> nb_inplace_or */
-#endif
- };
-
- static PyTypeObject swigpyobject_type;
- static int type_init = 0;
- if (!type_init) {
- const PyTypeObject tmp = {
- /* PyObject header changed in Python 3 */
-#if PY_VERSION_HEX >= 0x03000000
- PyVarObject_HEAD_INIT(NULL, 0)
-#else
- PyObject_HEAD_INIT(NULL)
- 0, /* ob_size */
-#endif
- (char *)"SwigPyObject", /* tp_name */
- sizeof(SwigPyObject), /* tp_basicsize */
- 0, /* tp_itemsize */
- (destructor)SwigPyObject_dealloc, /* tp_dealloc */
- (printfunc)SwigPyObject_print, /* tp_print */
-#if PY_VERSION_HEX < 0x02020000
- (getattrfunc)SwigPyObject_getattr, /* tp_getattr */
-#else
- (getattrfunc)0, /* tp_getattr */
-#endif
- (setattrfunc)0, /* tp_setattr */
-#if PY_VERSION_HEX >= 0x03000000
- 0, /* tp_reserved in 3.0.1, tp_compare in 3.0.0 but not used */
-#else
- (cmpfunc)SwigPyObject_compare, /* tp_compare */
-#endif
- (reprfunc)SwigPyObject_repr, /* tp_repr */
- &SwigPyObject_as_number, /* tp_as_number */
- 0, /* tp_as_sequence */
- 0, /* tp_as_mapping */
- (hashfunc)0, /* tp_hash */
- (ternaryfunc)0, /* tp_call */
- (reprfunc)SwigPyObject_str, /* tp_str */
- PyObject_GenericGetAttr, /* tp_getattro */
- 0, /* tp_setattro */
- 0, /* tp_as_buffer */
- Py_TPFLAGS_DEFAULT, /* tp_flags */
- swigobject_doc, /* tp_doc */
- 0, /* tp_traverse */
- 0, /* tp_clear */
- (richcmpfunc)SwigPyObject_richcompare,/* tp_richcompare */
- 0, /* tp_weaklistoffset */
-#if PY_VERSION_HEX >= 0x02020000
- 0, /* tp_iter */
- 0, /* tp_iternext */
- swigobject_methods, /* tp_methods */
- 0, /* tp_members */
- 0, /* tp_getset */
- 0, /* tp_base */
- 0, /* tp_dict */
- 0, /* tp_descr_get */
- 0, /* tp_descr_set */
- 0, /* tp_dictoffset */
- 0, /* tp_init */
- 0, /* tp_alloc */
- 0, /* tp_new */
- 0, /* tp_free */
- 0, /* tp_is_gc */
- 0, /* tp_bases */
- 0, /* tp_mro */
- 0, /* tp_cache */
- 0, /* tp_subclasses */
- 0, /* tp_weaklist */
-#endif
-#if PY_VERSION_HEX >= 0x02030000
- 0, /* tp_del */
-#endif
-#if PY_VERSION_HEX >= 0x02060000
- 0, /* tp_version */
-#endif
-#ifdef COUNT_ALLOCS
- 0,0,0,0 /* tp_alloc -> tp_next */
-#endif
- };
- swigpyobject_type = tmp;
- type_init = 1;
-#if PY_VERSION_HEX < 0x02020000
- swigpyobject_type.ob_type = &PyType_Type;
-#else
- if (PyType_Ready(&swigpyobject_type) < 0)
- return NULL;
-#endif
- }
- return &swigpyobject_type;
-}
-
-SWIGRUNTIME PyObject *
-SwigPyObject_New(void *ptr, swig_type_info *ty, int own)
-{
- SwigPyObject *sobj = PyObject_NEW(SwigPyObject, SwigPyObject_type());
- if (sobj) {
- sobj->ptr = ptr;
- sobj->ty = ty;
- sobj->own = own;
- sobj->next = 0;
- }
- return (PyObject *)sobj;
-}
-
-/* -----------------------------------------------------------------------------
- * Implements a simple Swig Packed type, and use it instead of string
- * ----------------------------------------------------------------------------- */
-
-typedef struct {
- PyObject_HEAD
- void *pack;
- swig_type_info *ty;
- size_t size;
-} SwigPyPacked;
-
-SWIGRUNTIME int
-SwigPyPacked_print(SwigPyPacked *v, FILE *fp, int SWIGUNUSEDPARM(flags))
-{
- char result[SWIG_BUFFER_SIZE];
- fputs("<Swig Packed ", fp);
- if (SWIG_PackDataName(result, v->pack, v->size, 0, sizeof(result))) {
- fputs("at ", fp);
- fputs(result, fp);
- }
- fputs(v->ty->name,fp);
- fputs(">", fp);
- return 0;
-}
-
-SWIGRUNTIME PyObject *
-SwigPyPacked_repr(SwigPyPacked *v)
-{
- char result[SWIG_BUFFER_SIZE];
- if (SWIG_PackDataName(result, v->pack, v->size, 0, sizeof(result))) {
- return SWIG_Python_str_FromFormat("<Swig Packed at %s%s>", result, v->ty->name);
- } else {
- return SWIG_Python_str_FromFormat("<Swig Packed %s>", v->ty->name);
- }
-}
-
-SWIGRUNTIME PyObject *
-SwigPyPacked_str(SwigPyPacked *v)
-{
- char result[SWIG_BUFFER_SIZE];
- if (SWIG_PackDataName(result, v->pack, v->size, 0, sizeof(result))){
- return SWIG_Python_str_FromFormat("%s%s", result, v->ty->name);
- } else {
- return SWIG_Python_str_FromChar(v->ty->name);
- }
-}
-
-SWIGRUNTIME int
-SwigPyPacked_compare(SwigPyPacked *v, SwigPyPacked *w)
-{
- size_t i = v->size;
- size_t j = w->size;
- int s = (i < j) ? -1 : ((i > j) ? 1 : 0);
- return s ? s : strncmp((char *)v->pack, (char *)w->pack, 2*v->size);
-}
-
-SWIGRUNTIME PyTypeObject* SwigPyPacked_TypeOnce(void);
-
-SWIGRUNTIME PyTypeObject*
-SwigPyPacked_type(void) {
- static PyTypeObject *SWIG_STATIC_POINTER(type) = SwigPyPacked_TypeOnce();
- return type;
-}
-
-SWIGRUNTIMEINLINE int
-SwigPyPacked_Check(PyObject *op) {
- return ((op)->ob_type == SwigPyPacked_TypeOnce())
- || (strcmp((op)->ob_type->tp_name,"SwigPyPacked") == 0);
-}
-
-SWIGRUNTIME void
-SwigPyPacked_dealloc(PyObject *v)
-{
- if (SwigPyPacked_Check(v)) {
- SwigPyPacked *sobj = (SwigPyPacked *) v;
- free(sobj->pack);
- }
- PyObject_DEL(v);
-}
-
-SWIGRUNTIME PyTypeObject*
-SwigPyPacked_TypeOnce(void) {
- static char swigpacked_doc[] = "Swig object carries a C/C++ instance pointer";
- static PyTypeObject swigpypacked_type;
- static int type_init = 0;
- if (!type_init) {
- const PyTypeObject tmp = {
- /* PyObject header changed in Python 3 */
-#if PY_VERSION_HEX>=0x03000000
- PyVarObject_HEAD_INIT(NULL, 0)
-#else
- PyObject_HEAD_INIT(NULL)
- 0, /* ob_size */
-#endif
- (char *)"SwigPyPacked", /* tp_name */
- sizeof(SwigPyPacked), /* tp_basicsize */
- 0, /* tp_itemsize */
- (destructor)SwigPyPacked_dealloc, /* tp_dealloc */
- (printfunc)SwigPyPacked_print, /* tp_print */
- (getattrfunc)0, /* tp_getattr */
- (setattrfunc)0, /* tp_setattr */
-#if PY_VERSION_HEX>=0x03000000
- 0, /* tp_reserved in 3.0.1 */
-#else
- (cmpfunc)SwigPyPacked_compare, /* tp_compare */
-#endif
- (reprfunc)SwigPyPacked_repr, /* tp_repr */
- 0, /* tp_as_number */
- 0, /* tp_as_sequence */
- 0, /* tp_as_mapping */
- (hashfunc)0, /* tp_hash */
- (ternaryfunc)0, /* tp_call */
- (reprfunc)SwigPyPacked_str, /* tp_str */
- PyObject_GenericGetAttr, /* tp_getattro */
- 0, /* tp_setattro */
- 0, /* tp_as_buffer */
- Py_TPFLAGS_DEFAULT, /* tp_flags */
- swigpacked_doc, /* tp_doc */
- 0, /* tp_traverse */
- 0, /* tp_clear */
- 0, /* tp_richcompare */
- 0, /* tp_weaklistoffset */
-#if PY_VERSION_HEX >= 0x02020000
- 0, /* tp_iter */
- 0, /* tp_iternext */
- 0, /* tp_methods */
- 0, /* tp_members */
- 0, /* tp_getset */
- 0, /* tp_base */
- 0, /* tp_dict */
- 0, /* tp_descr_get */
- 0, /* tp_descr_set */
- 0, /* tp_dictoffset */
- 0, /* tp_init */
- 0, /* tp_alloc */
- 0, /* tp_new */
- 0, /* tp_free */
- 0, /* tp_is_gc */
- 0, /* tp_bases */
- 0, /* tp_mro */
- 0, /* tp_cache */
- 0, /* tp_subclasses */
- 0, /* tp_weaklist */
-#endif
-#if PY_VERSION_HEX >= 0x02030000
- 0, /* tp_del */
-#endif
-#if PY_VERSION_HEX >= 0x02060000
- 0, /* tp_version */
-#endif
-#ifdef COUNT_ALLOCS
- 0,0,0,0 /* tp_alloc -> tp_next */
-#endif
- };
- swigpypacked_type = tmp;
- type_init = 1;
-#if PY_VERSION_HEX < 0x02020000
- swigpypacked_type.ob_type = &PyType_Type;
-#else
- if (PyType_Ready(&swigpypacked_type) < 0)
- return NULL;
-#endif
- }
- return &swigpypacked_type;
-}
-
-SWIGRUNTIME PyObject *
-SwigPyPacked_New(void *ptr, size_t size, swig_type_info *ty)
-{
- SwigPyPacked *sobj = PyObject_NEW(SwigPyPacked, SwigPyPacked_type());
- if (sobj) {
- void *pack = malloc(size);
- if (pack) {
- memcpy(pack, ptr, size);
- sobj->pack = pack;
- sobj->ty = ty;
- sobj->size = size;
- } else {
- PyObject_DEL((PyObject *) sobj);
- sobj = 0;
- }
- }
- return (PyObject *) sobj;
-}
-
-SWIGRUNTIME swig_type_info *
-SwigPyPacked_UnpackData(PyObject *obj, void *ptr, size_t size)
-{
- if (SwigPyPacked_Check(obj)) {
- SwigPyPacked *sobj = (SwigPyPacked *)obj;
- if (sobj->size != size) return 0;
- memcpy(ptr, sobj->pack, size);
- return sobj->ty;
- } else {
- return 0;
- }
-}
-
-/* -----------------------------------------------------------------------------
- * pointers/data manipulation
- * ----------------------------------------------------------------------------- */
-
-SWIGRUNTIMEINLINE PyObject *
-_SWIG_This(void)
-{
- return SWIG_Python_str_FromChar("this");
-}
-
-static PyObject *swig_this = NULL;
-
-SWIGRUNTIME PyObject *
-SWIG_This(void)
-{
- if (swig_this == NULL)
- swig_this = _SWIG_This();
- return swig_this;
-}
-
-/* #define SWIG_PYTHON_SLOW_GETSET_THIS */
-
-/* TODO: I don't know how to implement the fast getset in Python 3 right now */
-#if PY_VERSION_HEX>=0x03000000
-#define SWIG_PYTHON_SLOW_GETSET_THIS
-#endif
-
-SWIGRUNTIME SwigPyObject *
-SWIG_Python_GetSwigThis(PyObject *pyobj)
-{
- PyObject *obj;
-
- if (SwigPyObject_Check(pyobj))
- return (SwigPyObject *) pyobj;
-
-#ifdef SWIGPYTHON_BUILTIN
- (void)obj;
-# ifdef PyWeakref_CheckProxy
- if (PyWeakref_CheckProxy(pyobj)) {
- pyobj = PyWeakref_GET_OBJECT(pyobj);
- if (pyobj && SwigPyObject_Check(pyobj))
- return (SwigPyObject*) pyobj;
- }
-# endif
- return NULL;
-#else
-
- obj = 0;
-
-#if (!defined(SWIG_PYTHON_SLOW_GETSET_THIS) && (PY_VERSION_HEX >= 0x02030000))
- if (PyInstance_Check(pyobj)) {
- obj = _PyInstance_Lookup(pyobj, SWIG_This());
- } else {
- PyObject **dictptr = _PyObject_GetDictPtr(pyobj);
- if (dictptr != NULL) {
- PyObject *dict = *dictptr;
- obj = dict ? PyDict_GetItem(dict, SWIG_This()) : 0;
- } else {
-#ifdef PyWeakref_CheckProxy
- if (PyWeakref_CheckProxy(pyobj)) {
- PyObject *wobj = PyWeakref_GET_OBJECT(pyobj);
- return wobj ? SWIG_Python_GetSwigThis(wobj) : 0;
- }
-#endif
- obj = PyObject_GetAttr(pyobj,SWIG_This());
- if (obj) {
- Py_DECREF(obj);
- } else {
- if (PyErr_Occurred()) PyErr_Clear();
- return 0;
- }
- }
- }
-#else
- obj = PyObject_GetAttr(pyobj,SWIG_This());
- if (obj) {
- Py_DECREF(obj);
- } else {
- if (PyErr_Occurred()) PyErr_Clear();
- return 0;
- }
-#endif
- if (obj && !SwigPyObject_Check(obj)) {
- /* a PyObject is called 'this', try to get the 'real this'
- SwigPyObject from it */
- return SWIG_Python_GetSwigThis(obj);
- }
- return (SwigPyObject *)obj;
-#endif
-}
-
-/* Acquire a pointer value */
-
-SWIGRUNTIME int
-SWIG_Python_AcquirePtr(PyObject *obj, int own) {
- if (own == SWIG_POINTER_OWN) {
- SwigPyObject *sobj = SWIG_Python_GetSwigThis(obj);
- if (sobj) {
- int oldown = sobj->own;
- sobj->own = own;
- return oldown;
- }
- }
- return 0;
-}
-
-/* Convert a pointer value */
-
-SWIGRUNTIME int
-SWIG_Python_ConvertPtrAndOwn(PyObject *obj, void **ptr, swig_type_info *ty, int flags, int *own) {
- int res;
- SwigPyObject *sobj;
-
- if (!obj)
- return SWIG_ERROR;
- if (obj == Py_None) {
- if (ptr)
- *ptr = 0;
- return SWIG_OK;
- }
-
- res = SWIG_ERROR;
-
- sobj = SWIG_Python_GetSwigThis(obj);
- if (own)
- *own = 0;
- while (sobj) {
- void *vptr = sobj->ptr;
- if (ty) {
- swig_type_info *to = sobj->ty;
- if (to == ty) {
- /* no type cast needed */
- if (ptr) *ptr = vptr;
- break;
- } else {
- swig_cast_info *tc = SWIG_TypeCheck(to->name,ty);
- if (!tc) {
- sobj = (SwigPyObject *)sobj->next;
- } else {
- if (ptr) {
- int newmemory = 0;
- *ptr = SWIG_TypeCast(tc,vptr,&newmemory);
- if (newmemory == SWIG_CAST_NEW_MEMORY) {
- assert(own); /* badly formed typemap which will lead to a memory leak - it must set and use own to delete *ptr */
- if (own)
- *own = *own | SWIG_CAST_NEW_MEMORY;
- }
- }
- break;
- }
- }
- } else {
- if (ptr) *ptr = vptr;
- break;
- }
- }
- if (sobj) {
- if (own)
- *own = *own | sobj->own;
- if (flags & SWIG_POINTER_DISOWN) {
- sobj->own = 0;
- }
- res = SWIG_OK;
- } else {
- if (flags & SWIG_POINTER_IMPLICIT_CONV) {
- SwigPyClientData *data = ty ? (SwigPyClientData *) ty->clientdata : 0;
- if (data && !data->implicitconv) {
- PyObject *klass = data->klass;
- if (klass) {
- PyObject *impconv;
- data->implicitconv = 1; /* avoid recursion and call 'explicit' constructors*/
- impconv = SWIG_Python_CallFunctor(klass, obj);
- data->implicitconv = 0;
- if (PyErr_Occurred()) {
- PyErr_Clear();
- impconv = 0;
- }
- if (impconv) {
- SwigPyObject *iobj = SWIG_Python_GetSwigThis(impconv);
- if (iobj) {
- void *vptr;
- res = SWIG_Python_ConvertPtrAndOwn((PyObject*)iobj, &vptr, ty, 0, 0);
- if (SWIG_IsOK(res)) {
- if (ptr) {
- *ptr = vptr;
- /* transfer the ownership to 'ptr' */
- iobj->own = 0;
- res = SWIG_AddCast(res);
- res = SWIG_AddNewMask(res);
- } else {
- res = SWIG_AddCast(res);
- }
- }
- }
- Py_DECREF(impconv);
- }
- }
- }
- }
- }
- return res;
-}
-
-/* Convert a function ptr value */
-
-SWIGRUNTIME int
-SWIG_Python_ConvertFunctionPtr(PyObject *obj, void **ptr, swig_type_info *ty) {
- if (!PyCFunction_Check(obj)) {
- return SWIG_ConvertPtr(obj, ptr, ty, 0);
- } else {
- void *vptr = 0;
-
- /* here we get the method pointer for callbacks */
- const char *doc = (((PyCFunctionObject *)obj) -> m_ml -> ml_doc);
- const char *desc = doc ? strstr(doc, "swig_ptr: ") : 0;
- if (desc)
- desc = ty ? SWIG_UnpackVoidPtr(desc + 10, &vptr, ty->name) : 0;
- if (!desc)
- return SWIG_ERROR;
- if (ty) {
- swig_cast_info *tc = SWIG_TypeCheck(desc,ty);
- if (tc) {
- int newmemory = 0;
- *ptr = SWIG_TypeCast(tc,vptr,&newmemory);
- assert(!newmemory); /* newmemory handling not yet implemented */
- } else {
- return SWIG_ERROR;
- }
- } else {
- *ptr = vptr;
- }
- return SWIG_OK;
- }
-}
-
-/* Convert a packed value value */
-
-SWIGRUNTIME int
-SWIG_Python_ConvertPacked(PyObject *obj, void *ptr, size_t sz, swig_type_info *ty) {
- swig_type_info *to = SwigPyPacked_UnpackData(obj, ptr, sz);
- if (!to) return SWIG_ERROR;
- if (ty) {
- if (to != ty) {
- /* check type cast? */
- swig_cast_info *tc = SWIG_TypeCheck(to->name,ty);
- if (!tc) return SWIG_ERROR;
- }
- }
- return SWIG_OK;
-}
-
-/* -----------------------------------------------------------------------------
- * Create a new pointer object
- * ----------------------------------------------------------------------------- */
-
-/*
- Create a new instance object, without calling __init__, and set the
- 'this' attribute.
-*/
-
-SWIGRUNTIME PyObject*
-SWIG_Python_NewShadowInstance(SwigPyClientData *data, PyObject *swig_this)
-{
-#if (PY_VERSION_HEX >= 0x02020000)
- PyObject *inst = 0;
- PyObject *newraw = data->newraw;
- if (newraw) {
- inst = PyObject_Call(newraw, data->newargs, NULL);
- if (inst) {
-#if !defined(SWIG_PYTHON_SLOW_GETSET_THIS)
- PyObject **dictptr = _PyObject_GetDictPtr(inst);
- if (dictptr != NULL) {
- PyObject *dict = *dictptr;
- if (dict == NULL) {
- dict = PyDict_New();
- *dictptr = dict;
- PyDict_SetItem(dict, SWIG_This(), swig_this);
- }
- }
-#else
- PyObject *key = SWIG_This();
- PyObject_SetAttr(inst, key, swig_this);
-#endif
- }
- } else {
-#if PY_VERSION_HEX >= 0x03000000
- inst = PyBaseObject_Type.tp_new((PyTypeObject*) data->newargs, Py_None, Py_None);
- PyObject_SetAttr(inst, SWIG_This(), swig_this);
- Py_TYPE(inst)->tp_flags &= ~Py_TPFLAGS_VALID_VERSION_TAG;
-#else
- PyObject *dict = PyDict_New();
- PyDict_SetItem(dict, SWIG_This(), swig_this);
- inst = PyInstance_NewRaw(data->newargs, dict);
- Py_DECREF(dict);
-#endif
- }
- return inst;
-#else
-#if (PY_VERSION_HEX >= 0x02010000)
- PyObject *inst;
- PyObject *dict = PyDict_New();
- PyDict_SetItem(dict, SWIG_This(), swig_this);
- inst = PyInstance_NewRaw(data->newargs, dict);
- Py_DECREF(dict);
- return (PyObject *) inst;
-#else
- PyInstanceObject *inst = PyObject_NEW(PyInstanceObject, &PyInstance_Type);
- if (inst == NULL) {
- return NULL;
- }
- inst->in_class = (PyClassObject *)data->newargs;
- Py_INCREF(inst->in_class);
- inst->in_dict = PyDict_New();
- if (inst->in_dict == NULL) {
- Py_DECREF(inst);
- return NULL;
- }
-#ifdef Py_TPFLAGS_HAVE_WEAKREFS
- inst->in_weakreflist = NULL;
-#endif
-#ifdef Py_TPFLAGS_GC
- PyObject_GC_Init(inst);
-#endif
- PyDict_SetItem(inst->in_dict, SWIG_This(), swig_this);
- return (PyObject *) inst;
-#endif
-#endif
-}
-
-SWIGRUNTIME void
-SWIG_Python_SetSwigThis(PyObject *inst, PyObject *swig_this)
-{
- PyObject *dict;
-#if (PY_VERSION_HEX >= 0x02020000) && !defined(SWIG_PYTHON_SLOW_GETSET_THIS)
- PyObject **dictptr = _PyObject_GetDictPtr(inst);
- if (dictptr != NULL) {
- dict = *dictptr;
- if (dict == NULL) {
- dict = PyDict_New();
- *dictptr = dict;
- }
- PyDict_SetItem(dict, SWIG_This(), swig_this);
- return;
- }
-#endif
- dict = PyObject_GetAttrString(inst, (char*)"__dict__");
- PyDict_SetItem(dict, SWIG_This(), swig_this);
- Py_DECREF(dict);
-}
-
-
-SWIGINTERN PyObject *
-SWIG_Python_InitShadowInstance(PyObject *args) {
- PyObject *obj[2];
- if (!SWIG_Python_UnpackTuple(args,(char*)"swiginit", 2, 2, obj)) {
- return NULL;
- } else {
- SwigPyObject *sthis = SWIG_Python_GetSwigThis(obj[0]);
- if (sthis) {
- SwigPyObject_append((PyObject*) sthis, obj[1]);
- } else {
- SWIG_Python_SetSwigThis(obj[0], obj[1]);
- }
- return SWIG_Py_Void();
- }
-}
-
-/* Create a new pointer object */
-
-SWIGRUNTIME PyObject *
-SWIG_Python_NewPointerObj(PyObject *self, void *ptr, swig_type_info *type, int flags) {
- SwigPyClientData *clientdata;
- PyObject * robj;
- int own;
-
- if (!ptr)
- return SWIG_Py_Void();
-
- clientdata = type ? (SwigPyClientData *)(type->clientdata) : 0;
- own = (flags & SWIG_POINTER_OWN) ? SWIG_POINTER_OWN : 0;
- if (clientdata && clientdata->pytype) {
- SwigPyObject *newobj;
- if (flags & SWIG_BUILTIN_TP_INIT) {
- newobj = (SwigPyObject*) self;
- if (newobj->ptr) {
- PyObject *next_self = clientdata->pytype->tp_alloc(clientdata->pytype, 0);
- while (newobj->next)
- newobj = (SwigPyObject *) newobj->next;
- newobj->next = next_self;
- newobj = (SwigPyObject *)next_self;
- }
- } else {
- newobj = PyObject_New(SwigPyObject, clientdata->pytype);
- }
- if (newobj) {
- newobj->ptr = ptr;
- newobj->ty = type;
- newobj->own = own;
- newobj->next = 0;
-#ifdef SWIGPYTHON_BUILTIN
- newobj->dict = 0;
-#endif
- return (PyObject*) newobj;
- }
- return SWIG_Py_Void();
- }
-
- assert(!(flags & SWIG_BUILTIN_TP_INIT));
-
- robj = SwigPyObject_New(ptr, type, own);
- if (clientdata && !(flags & SWIG_POINTER_NOSHADOW)) {
- PyObject *inst = SWIG_Python_NewShadowInstance(clientdata, robj);
- if (inst) {
- Py_DECREF(robj);
- robj = inst;
- }
- }
- return robj;
-}
-
-/* Create a new packed object */
-
-SWIGRUNTIMEINLINE PyObject *
-SWIG_Python_NewPackedObj(void *ptr, size_t sz, swig_type_info *type) {
- return ptr ? SwigPyPacked_New((void *) ptr, sz, type) : SWIG_Py_Void();
-}
-
-/* -----------------------------------------------------------------------------*
- * Get type list
- * -----------------------------------------------------------------------------*/
-
-#ifdef SWIG_LINK_RUNTIME
-void *SWIG_ReturnGlobalTypeList(void *);
-#endif
-
-SWIGRUNTIME swig_module_info *
-SWIG_Python_GetModule(void) {
- static void *type_pointer = (void *)0;
- /* first check if module already created */
- if (!type_pointer) {
-#ifdef SWIG_LINK_RUNTIME
- type_pointer = SWIG_ReturnGlobalTypeList((void *)0);
-#else
-# ifdef SWIGPY_USE_CAPSULE
- type_pointer = PyCapsule_Import(SWIGPY_CAPSULE_NAME, 0);
-# else
- type_pointer = PyCObject_Import((char*)"swig_runtime_data" SWIG_RUNTIME_VERSION,
- (char*)"type_pointer" SWIG_TYPE_TABLE_NAME);
-# endif
- if (PyErr_Occurred()) {
- PyErr_Clear();
- type_pointer = (void *)0;
- }
-#endif
- }
- return (swig_module_info *) type_pointer;
-}
-
-#if PY_MAJOR_VERSION < 2
-/* PyModule_AddObject function was introduced in Python 2.0. The following function
- is copied out of Python/modsupport.c in python version 2.3.4 */
-SWIGINTERN int
-PyModule_AddObject(PyObject *m, char *name, PyObject *o)
-{
- PyObject *dict;
- if (!PyModule_Check(m)) {
- PyErr_SetString(PyExc_TypeError,
- "PyModule_AddObject() needs module as first arg");
- return SWIG_ERROR;
- }
- if (!o) {
- PyErr_SetString(PyExc_TypeError,
- "PyModule_AddObject() needs non-NULL value");
- return SWIG_ERROR;
- }
-
- dict = PyModule_GetDict(m);
- if (dict == NULL) {
- /* Internal error -- modules must have a dict! */
- PyErr_Format(PyExc_SystemError, "module '%s' has no __dict__",
- PyModule_GetName(m));
- return SWIG_ERROR;
- }
- if (PyDict_SetItemString(dict, name, o))
- return SWIG_ERROR;
- Py_DECREF(o);
- return SWIG_OK;
-}
-#endif
-
-SWIGRUNTIME void
-#ifdef SWIGPY_USE_CAPSULE
-SWIG_Python_DestroyModule(PyObject *obj)
-#else
-SWIG_Python_DestroyModule(void *vptr)
-#endif
-{
-#ifdef SWIGPY_USE_CAPSULE
- swig_module_info *swig_module = (swig_module_info *) PyCapsule_GetPointer(obj, SWIGPY_CAPSULE_NAME);
-#else
- swig_module_info *swig_module = (swig_module_info *) vptr;
-#endif
- swig_type_info **types = swig_module->types;
- size_t i;
- for (i =0; i < swig_module->size; ++i) {
- swig_type_info *ty = types[i];
- if (ty->owndata) {
- SwigPyClientData *data = (SwigPyClientData *) ty->clientdata;
- if (data) SwigPyClientData_Del(data);
- }
- }
- Py_DECREF(SWIG_This());
- swig_this = NULL;
-}
-
-SWIGRUNTIME void
-SWIG_Python_SetModule(swig_module_info *swig_module) {
-#if PY_VERSION_HEX >= 0x03000000
- /* Add a dummy module object into sys.modules */
- PyObject *module = PyImport_AddModule((char*)"swig_runtime_data" SWIG_RUNTIME_VERSION);
-#else
- static PyMethodDef swig_empty_runtime_method_table[] = { {NULL, NULL, 0, NULL} }; /* Sentinel */
- PyObject *module = Py_InitModule((char*)"swig_runtime_data" SWIG_RUNTIME_VERSION, swig_empty_runtime_method_table);
-#endif
-#ifdef SWIGPY_USE_CAPSULE
- PyObject *pointer = PyCapsule_New((void *) swig_module, SWIGPY_CAPSULE_NAME, SWIG_Python_DestroyModule);
- if (pointer && module) {
- PyModule_AddObject(module, (char*)"type_pointer_capsule" SWIG_TYPE_TABLE_NAME, pointer);
- } else {
- Py_XDECREF(pointer);
- }
-#else
- PyObject *pointer = PyCObject_FromVoidPtr((void *) swig_module, SWIG_Python_DestroyModule);
- if (pointer && module) {
- PyModule_AddObject(module, (char*)"type_pointer" SWIG_TYPE_TABLE_NAME, pointer);
- } else {
- Py_XDECREF(pointer);
- }
-#endif
-}
-
-/* The python cached type query */
-SWIGRUNTIME PyObject *
-SWIG_Python_TypeCache(void) {
- static PyObject *SWIG_STATIC_POINTER(cache) = PyDict_New();
- return cache;
-}
-
-SWIGRUNTIME swig_type_info *
-SWIG_Python_TypeQuery(const char *type)
-{
- PyObject *cache = SWIG_Python_TypeCache();
- PyObject *key = SWIG_Python_str_FromChar(type);
- PyObject *obj = PyDict_GetItem(cache, key);
- swig_type_info *descriptor;
- if (obj) {
-#ifdef SWIGPY_USE_CAPSULE
- descriptor = (swig_type_info *) PyCapsule_GetPointer(obj, NULL);
-#else
- descriptor = (swig_type_info *) PyCObject_AsVoidPtr(obj);
-#endif
- } else {
- swig_module_info *swig_module = SWIG_Python_GetModule();
- descriptor = SWIG_TypeQueryModule(swig_module, swig_module, type);
- if (descriptor) {
-#ifdef SWIGPY_USE_CAPSULE
- obj = PyCapsule_New((void*) descriptor, NULL, NULL);
-#else
- obj = PyCObject_FromVoidPtr(descriptor, NULL);
-#endif
- PyDict_SetItem(cache, key, obj);
- Py_DECREF(obj);
- }
- }
- Py_DECREF(key);
- return descriptor;
-}
-
-/*
- For backward compatibility only
-*/
-#define SWIG_POINTER_EXCEPTION 0
-#define SWIG_arg_fail(arg) SWIG_Python_ArgFail(arg)
-#define SWIG_MustGetPtr(p, type, argnum, flags) SWIG_Python_MustGetPtr(p, type, argnum, flags)
-
-SWIGRUNTIME int
-SWIG_Python_AddErrMesg(const char* mesg, int infront)
-{
- if (PyErr_Occurred()) {
- PyObject *type = 0;
- PyObject *value = 0;
- PyObject *traceback = 0;
- PyErr_Fetch(&type, &value, &traceback);
- if (value) {
- char *tmp;
- PyObject *old_str = PyObject_Str(value);
- Py_XINCREF(type);
- PyErr_Clear();
- if (infront) {
- PyErr_Format(type, "%s %s", mesg, tmp = SWIG_Python_str_AsChar(old_str));
- } else {
- PyErr_Format(type, "%s %s", tmp = SWIG_Python_str_AsChar(old_str), mesg);
- }
- SWIG_Python_str_DelForPy3(tmp);
- Py_DECREF(old_str);
- }
- return 1;
- } else {
- return 0;
- }
-}
-
-SWIGRUNTIME int
-SWIG_Python_ArgFail(int argnum)
-{
- if (PyErr_Occurred()) {
- /* add information about failing argument */
- char mesg[256];
- PyOS_snprintf(mesg, sizeof(mesg), "argument number %d:", argnum);
- return SWIG_Python_AddErrMesg(mesg, 1);
- } else {
- return 0;
- }
-}
-
-SWIGRUNTIMEINLINE const char *
-SwigPyObject_GetDesc(PyObject *self)
-{
- SwigPyObject *v = (SwigPyObject *)self;
- swig_type_info *ty = v ? v->ty : 0;
- return ty ? ty->str : (char*)"";
-}
-
-SWIGRUNTIME void
-SWIG_Python_TypeError(const char *type, PyObject *obj)
-{
- if (type) {
-#if defined(SWIG_COBJECT_TYPES)
- if (obj && SwigPyObject_Check(obj)) {
- const char *otype = (const char *) SwigPyObject_GetDesc(obj);
- if (otype) {
- PyErr_Format(PyExc_TypeError, "a '%s' is expected, 'SwigPyObject(%s)' is received",
- type, otype);
- return;
- }
- } else
-#endif
- {
- const char *otype = (obj ? obj->ob_type->tp_name : 0);
- if (otype) {
- PyObject *str = PyObject_Str(obj);
- const char *cstr = str ? SWIG_Python_str_AsChar(str) : 0;
- if (cstr) {
- PyErr_Format(PyExc_TypeError, "a '%s' is expected, '%s(%s)' is received",
- type, otype, cstr);
- SWIG_Python_str_DelForPy3(cstr);
- } else {
- PyErr_Format(PyExc_TypeError, "a '%s' is expected, '%s' is received",
- type, otype);
- }
- Py_XDECREF(str);
- return;
- }
- }
- PyErr_Format(PyExc_TypeError, "a '%s' is expected", type);
- } else {
- PyErr_Format(PyExc_TypeError, "unexpected type is received");
- }
-}
-
-
-/* Convert a pointer value, signal an exception on a type mismatch */
-SWIGRUNTIME void *
-SWIG_Python_MustGetPtr(PyObject *obj, swig_type_info *ty, int SWIGUNUSEDPARM(argnum), int flags) {
- void *result;
- if (SWIG_Python_ConvertPtr(obj, &result, ty, flags) == -1) {
- PyErr_Clear();
-#if SWIG_POINTER_EXCEPTION
- if (flags) {
- SWIG_Python_TypeError(SWIG_TypePrettyName(ty), obj);
- SWIG_Python_ArgFail(argnum);
- }
-#endif
- }
- return result;
-}
-
-SWIGRUNTIME int
-SWIG_Python_NonDynamicSetAttr(PyObject *obj, PyObject *name, PyObject *value) {
- PyTypeObject *tp = obj->ob_type;
- PyObject *descr;
- PyObject *encoded_name;
- descrsetfunc f;
- int res;
-
-#ifdef Py_USING_UNICODE
- if (PyString_Check(name)) {
- name = PyUnicode_Decode(PyString_AsString(name), PyString_Size(name), NULL, NULL);
- if (!name)
- return -1;
- } else if (!PyUnicode_Check(name))
-#else
- if (!PyString_Check(name))
-#endif
- {
- PyErr_Format(PyExc_TypeError, "attribute name must be string, not '%.200s'", name->ob_type->tp_name);
- return -1;
- } else {
- Py_INCREF(name);
- }
-
- if (!tp->tp_dict) {
- if (PyType_Ready(tp) < 0)
- goto done;
- }
-
- res = -1;
- descr = _PyType_Lookup(tp, name);
- f = NULL;
- if (descr != NULL)
- f = descr->ob_type->tp_descr_set;
- if (!f) {
- if (PyString_Check(name)) {
- encoded_name = name;
- Py_INCREF(name);
- } else {
- encoded_name = PyUnicode_AsUTF8String(name);
- }
- PyErr_Format(PyExc_AttributeError, "'%.100s' object has no attribute '%.200s'", tp->tp_name, PyString_AsString(encoded_name));
- Py_DECREF(encoded_name);
- } else {
- res = f(descr, obj, value);
- }
-
- done:
- Py_DECREF(name);
- return res;
-}
-
-
-#ifdef __cplusplus
-}
-#endif
-
-#define SWIGPY_UNARYFUNC_CLOSURE(wrapper) \
-SWIGINTERN PyObject * \
-wrapper##_closure(PyObject *a) { \
- return wrapper(a, NULL); \
-}
-
-#define SWIGPY_DESTRUCTOR_CLOSURE(wrapper) \
-SWIGINTERN void \
-wrapper##_closure(PyObject *a) { \
- SwigPyObject *sobj; \
- sobj = (SwigPyObject *)a; \
- if (sobj->own) { \
- PyObject *o = wrapper(a, NULL); \
- Py_XDECREF(o); \
- } \
-}
-
-#define SWIGPY_INQUIRY_CLOSURE(wrapper) \
-SWIGINTERN int \
-wrapper##_closure(PyObject *a) { \
- PyObject *pyresult; \
- int result; \
- pyresult = wrapper(a, NULL); \
- result = pyresult && PyObject_IsTrue(pyresult) ? 1 : 0; \
- Py_XDECREF(pyresult); \
- return result; \
-}
-
-#define SWIGPY_BINARYFUNC_CLOSURE(wrapper) \
-SWIGINTERN PyObject * \
-wrapper##_closure(PyObject *a, PyObject *b) { \
- PyObject *tuple, *result; \
- tuple = PyTuple_New(1); \
- assert(tuple); \
- PyTuple_SET_ITEM(tuple, 0, b); \
- Py_XINCREF(b); \
- result = wrapper(a, tuple); \
- Py_DECREF(tuple); \
- return result; \
-}
-
-#define SWIGPY_TERNARYFUNC_CLOSURE(wrapper) \
-SWIGINTERN PyObject * \
-wrapper##_closure(PyObject *a, PyObject *b, PyObject *c) { \
- PyObject *tuple, *result; \
- tuple = PyTuple_New(2); \
- assert(tuple); \
- PyTuple_SET_ITEM(tuple, 0, b); \
- PyTuple_SET_ITEM(tuple, 1, c); \
- Py_XINCREF(b); \
- Py_XINCREF(c); \
- result = wrapper(a, tuple); \
- Py_DECREF(tuple); \
- return result; \
-}
-
-#define SWIGPY_LENFUNC_CLOSURE(wrapper) \
-SWIGINTERN Py_ssize_t \
-wrapper##_closure(PyObject *a) { \
- PyObject *resultobj; \
- Py_ssize_t result; \
- resultobj = wrapper(a, NULL); \
- result = PyNumber_AsSsize_t(resultobj, NULL); \
- Py_DECREF(resultobj); \
- return result; \
-}
-
-#define SWIGPY_SSIZESSIZEARGFUNC_CLOSURE(wrapper) \
-SWIGINTERN PyObject * \
-wrapper##_closure(PyObject *a, Py_ssize_t b, Py_ssize_t c) { \
- PyObject *tuple, *result; \
- tuple = PyTuple_New(2); \
- assert(tuple); \
- PyTuple_SET_ITEM(tuple, 0, _PyLong_FromSsize_t(b)); \
- PyTuple_SET_ITEM(tuple, 1, _PyLong_FromSsize_t(c)); \
- result = wrapper(a, tuple); \
- Py_DECREF(tuple); \
- return result; \
-}
-
-#define SWIGPY_SSIZESSIZEOBJARGPROC_CLOSURE(wrapper) \
-SWIGINTERN int \
-wrapper##_closure(PyObject *a, Py_ssize_t b, Py_ssize_t c, PyObject *d) { \
- PyObject *tuple, *resultobj; \
- int result; \
- tuple = PyTuple_New(d ? 3 : 2); \
- assert(tuple); \
- PyTuple_SET_ITEM(tuple, 0, _PyLong_FromSsize_t(b)); \
- PyTuple_SET_ITEM(tuple, 1, _PyLong_FromSsize_t(c)); \
- if (d) { \
- PyTuple_SET_ITEM(tuple, 2, d); \
- Py_INCREF(d); \
- } \
- resultobj = wrapper(a, tuple); \
- result = resultobj ? 0 : -1; \
- Py_DECREF(tuple); \
- Py_XDECREF(resultobj); \
- return result; \
-}
-
-#define SWIGPY_SSIZEARGFUNC_CLOSURE(wrapper) \
-SWIGINTERN PyObject * \
-wrapper##_closure(PyObject *a, Py_ssize_t b) { \
- PyObject *tuple, *result; \
- tuple = PyTuple_New(1); \
- assert(tuple); \
- PyTuple_SET_ITEM(tuple, 0, _PyLong_FromSsize_t(b)); \
- result = wrapper(a, tuple); \
- Py_DECREF(tuple); \
- return result; \
-}
-
-#define SWIGPY_FUNPACK_SSIZEARGFUNC_CLOSURE(wrapper) \
-SWIGINTERN PyObject * \
-wrapper##_closure(PyObject *a, Py_ssize_t b) { \
- PyObject *arg, *result; \
- arg = _PyLong_FromSsize_t(b); \
- result = wrapper(a, arg); \
- Py_DECREF(arg); \
- return result; \
-}
-
-#define SWIGPY_SSIZEOBJARGPROC_CLOSURE(wrapper) \
-SWIGINTERN int \
-wrapper##_closure(PyObject *a, Py_ssize_t b, PyObject *c) { \
- PyObject *tuple, *resultobj; \
- int result; \
- tuple = PyTuple_New(2); \
- assert(tuple); \
- PyTuple_SET_ITEM(tuple, 0, _PyLong_FromSsize_t(b)); \
- PyTuple_SET_ITEM(tuple, 1, c); \
- Py_XINCREF(c); \
- resultobj = wrapper(a, tuple); \
- result = resultobj ? 0 : -1; \
- Py_XDECREF(resultobj); \
- Py_DECREF(tuple); \
- return result; \
-}
-
-#define SWIGPY_OBJOBJARGPROC_CLOSURE(wrapper) \
-SWIGINTERN int \
-wrapper##_closure(PyObject *a, PyObject *b, PyObject *c) { \
- PyObject *tuple, *resultobj; \
- int result; \
- tuple = PyTuple_New(c ? 2 : 1); \
- assert(tuple); \
- PyTuple_SET_ITEM(tuple, 0, b); \
- Py_XINCREF(b); \
- if (c) { \
- PyTuple_SET_ITEM(tuple, 1, c); \
- Py_XINCREF(c); \
- } \
- resultobj = wrapper(a, tuple); \
- result = resultobj ? 0 : -1; \
- Py_XDECREF(resultobj); \
- Py_DECREF(tuple); \
- return result; \
-}
-
-#define SWIGPY_REPRFUNC_CLOSURE(wrapper) \
-SWIGINTERN PyObject * \
-wrapper##_closure(PyObject *a) { \
- return wrapper(a, NULL); \
-}
-
-#define SWIGPY_HASHFUNC_CLOSURE(wrapper) \
-SWIGINTERN long \
-wrapper##_closure(PyObject *a) { \
- PyObject *pyresult; \
- long result; \
- pyresult = wrapper(a, NULL); \
- if (!pyresult || !PyLong_Check(pyresult)) \
- return -1; \
- result = PyLong_AsLong(pyresult); \
- Py_DECREF(pyresult); \
- return result; \
-}
-
-#define SWIGPY_ITERNEXT_CLOSURE(wrapper) \
-SWIGINTERN PyObject * \
-wrapper##_closure(PyObject *a) { \
- PyObject *result; \
- result = wrapper(a, NULL); \
- if (result && result == Py_None) { \
- Py_DECREF(result); \
- result = NULL; \
- } \
- return result; \
-}
-
-#ifdef __cplusplus
-extern "C" {
-#endif
-
-SWIGINTERN int
-SwigPyBuiltin_BadInit(PyObject *self, PyObject *SWIGUNUSEDPARM(args), PyObject *SWIGUNUSEDPARM(kwds)) {
- PyErr_Format(PyExc_TypeError, "Cannot create new instances of type '%.300s'", self->ob_type->tp_name);
- return -1;
-}
-
-SWIGINTERN void
-SwigPyBuiltin_BadDealloc(PyObject *pyobj) {
- SwigPyObject *sobj;
- sobj = (SwigPyObject *)pyobj;
- if (sobj->own) {
- PyErr_Format(PyExc_TypeError, "Swig detected a memory leak in type '%.300s': no callable destructor found.", pyobj->ob_type->tp_name);
- }
-}
-
-typedef struct {
- PyCFunction get;
- PyCFunction set;
-} SwigPyGetSet;
-
-SWIGINTERN PyObject *
-SwigPyBuiltin_GetterClosure (PyObject *obj, void *closure) {
- SwigPyGetSet *getset;
- PyObject *tuple, *result;
- if (!closure)
- return SWIG_Py_Void();
- getset = (SwigPyGetSet *)closure;
- if (!getset->get)
- return SWIG_Py_Void();
- tuple = PyTuple_New(0);
- assert(tuple);
- result = (*getset->get)(obj, tuple);
- Py_DECREF(tuple);
- return result;
-}
-
-SWIGINTERN PyObject *
-SwigPyBuiltin_FunpackGetterClosure (PyObject *obj, void *closure) {
- SwigPyGetSet *getset;
- PyObject *result;
- if (!closure)
- return SWIG_Py_Void();
- getset = (SwigPyGetSet *)closure;
- if (!getset->get)
- return SWIG_Py_Void();
- result = (*getset->get)(obj, NULL);
- return result;
-}
-
-SWIGINTERN int
-SwigPyBuiltin_SetterClosure (PyObject *obj, PyObject *val, void *closure) {
- SwigPyGetSet *getset;
- PyObject *tuple, *result;
- if (!closure) {
- PyErr_Format(PyExc_TypeError, "Missing getset closure");
- return -1;
- }
- getset = (SwigPyGetSet *)closure;
- if (!getset->set) {
- PyErr_Format(PyExc_TypeError, "Illegal member variable assignment in type '%.300s'", obj->ob_type->tp_name);
- return -1;
- }
- tuple = PyTuple_New(1);
- assert(tuple);
- PyTuple_SET_ITEM(tuple, 0, val);
- Py_XINCREF(val);
- result = (*getset->set)(obj, tuple);
- Py_DECREF(tuple);
- Py_XDECREF(result);
- return result ? 0 : -1;
-}
-
-SWIGINTERN int
-SwigPyBuiltin_FunpackSetterClosure (PyObject *obj, PyObject *val, void *closure) {
- SwigPyGetSet *getset;
- PyObject *result;
- if (!closure) {
- PyErr_Format(PyExc_TypeError, "Missing getset closure");
- return -1;
- }
- getset = (SwigPyGetSet *)closure;
- if (!getset->set) {
- PyErr_Format(PyExc_TypeError, "Illegal member variable assignment in type '%.300s'", obj->ob_type->tp_name);
- return -1;
- }
- result = (*getset->set)(obj, val);
- Py_XDECREF(result);
- return result ? 0 : -1;
-}
-
-SWIGINTERN void
-SwigPyStaticVar_dealloc(PyDescrObject *descr) {
- _PyObject_GC_UNTRACK(descr);
- Py_XDECREF(PyDescr_TYPE(descr));
- Py_XDECREF(PyDescr_NAME(descr));
- PyObject_GC_Del(descr);
-}
-
-SWIGINTERN PyObject *
-SwigPyStaticVar_repr(PyGetSetDescrObject *descr) {
-#if PY_VERSION_HEX >= 0x03000000
-
- return PyUnicode_FromFormat("<class attribute '%S' of type '%s'>", PyDescr_NAME(descr), PyDescr_TYPE(descr)->tp_name);
-#else
- return PyString_FromFormat("<class attribute '%s' of type '%s'>", PyString_AsString(PyDescr_NAME(descr)), PyDescr_TYPE(descr)->tp_name);
-#endif
-}
-
-SWIGINTERN int
-SwigPyStaticVar_traverse(PyObject *self, visitproc visit, void *arg) {
- PyDescrObject *descr;
- descr = (PyDescrObject *)self;
- Py_VISIT((PyObject*) PyDescr_TYPE(descr));
- return 0;
-}
-
-SWIGINTERN PyObject *
-SwigPyStaticVar_get(PyGetSetDescrObject *descr, PyObject *obj, PyObject *SWIGUNUSEDPARM(type)) {
- if (descr->d_getset->get != NULL)
- return descr->d_getset->get(obj, descr->d_getset->closure);
-#if PY_VERSION_HEX >= 0x03000000
- PyErr_Format(PyExc_AttributeError, "attribute '%.300S' of '%.100s' objects is not readable", PyDescr_NAME(descr), PyDescr_TYPE(descr)->tp_name);
-#else
- PyErr_Format(PyExc_AttributeError, "attribute '%.300s' of '%.100s' objects is not readable", PyString_AsString(PyDescr_NAME(descr)), PyDescr_TYPE(descr)->tp_name);
-#endif
- return NULL;
-}
-
-SWIGINTERN int
-SwigPyStaticVar_set(PyGetSetDescrObject *descr, PyObject *obj, PyObject *value) {
- if (descr->d_getset->set != NULL)
- return descr->d_getset->set(obj, value, descr->d_getset->closure);
-#if PY_VERSION_HEX >= 0x03000000
- PyErr_Format(PyExc_AttributeError, "attribute '%.300S' of '%.100s' objects is not writable", PyDescr_NAME(descr), PyDescr_TYPE(descr)->tp_name);
-#else
- PyErr_Format(PyExc_AttributeError, "attribute '%.300s' of '%.100s' objects is not writable", PyString_AsString(PyDescr_NAME(descr)), PyDescr_TYPE(descr)->tp_name);
-#endif
- return -1;
-}
-
-SWIGINTERN int
-SwigPyObjectType_setattro(PyTypeObject *type, PyObject *name, PyObject *value) {
- PyObject *attribute;
- descrsetfunc local_set;
- attribute = _PyType_Lookup(type, name);
- if (attribute != NULL) {
- /* Implement descriptor functionality, if any */
- local_set = attribute->ob_type->tp_descr_set;
- if (local_set != NULL)
- return local_set(attribute, (PyObject *)type, value);
-#if PY_VERSION_HEX >= 0x03000000
- PyErr_Format(PyExc_AttributeError, "cannot modify read-only attribute '%.50s.%.400S'", type->tp_name, name);
-#else
- PyErr_Format(PyExc_AttributeError, "cannot modify read-only attribute '%.50s.%.400s'", type->tp_name, PyString_AS_STRING(name));
-#endif
- } else {
-#if PY_VERSION_HEX >= 0x03000000
- PyErr_Format(PyExc_AttributeError, "type '%.50s' has no attribute '%.400S'", type->tp_name, name);
-#else
- PyErr_Format(PyExc_AttributeError, "type '%.50s' has no attribute '%.400s'", type->tp_name, PyString_AS_STRING(name));
-#endif
- }
-
- return -1;
-}
-
-SWIGINTERN PyTypeObject*
-SwigPyStaticVar_Type(void) {
- static PyTypeObject staticvar_type;
- static int type_init = 0;
- if (!type_init) {
- const PyTypeObject tmp = {
- /* PyObject header changed in Python 3 */
-#if PY_VERSION_HEX >= 0x03000000
- PyVarObject_HEAD_INIT(&PyType_Type, 0)
-#else
- PyObject_HEAD_INIT(&PyType_Type)
- 0,
-#endif
- "swig_static_var_getset_descriptor",
- sizeof(PyGetSetDescrObject),
- 0,
- (destructor)SwigPyStaticVar_dealloc, /* tp_dealloc */
- 0, /* tp_print */
- 0, /* tp_getattr */
- 0, /* tp_setattr */
- 0, /* tp_compare */
- (reprfunc)SwigPyStaticVar_repr, /* tp_repr */
- 0, /* tp_as_number */
- 0, /* tp_as_sequence */
- 0, /* tp_as_mapping */
- 0, /* tp_hash */
- 0, /* tp_call */
- 0, /* tp_str */
- PyObject_GenericGetAttr, /* tp_getattro */
- 0, /* tp_setattro */
- 0, /* tp_as_buffer */
- Py_TPFLAGS_DEFAULT|Py_TPFLAGS_HAVE_GC|Py_TPFLAGS_HAVE_CLASS, /* tp_flags */
- 0, /* tp_doc */
- SwigPyStaticVar_traverse, /* tp_traverse */
- 0, /* tp_clear */
- 0, /* tp_richcompare */
- 0, /* tp_weaklistoffset */
- 0, /* tp_iter */
- 0, /* tp_iternext */
- 0, /* tp_methods */
- 0, /* tp_members */
- 0, /* tp_getset */
- 0, /* tp_base */
- 0, /* tp_dict */
- (descrgetfunc)SwigPyStaticVar_get, /* tp_descr_get */
- (descrsetfunc)SwigPyStaticVar_set, /* tp_descr_set */
- 0, /* tp_dictoffset */
- 0, /* tp_init */
- 0, /* tp_alloc */
- 0, /* tp_new */
- 0, /* tp_free */
- 0, /* tp_is_gc */
- 0, /* tp_bases */
- 0, /* tp_mro */
- 0, /* tp_cache */
- 0, /* tp_subclasses */
- 0, /* tp_weaklist */
-#if PY_VERSION_HEX >= 0x02030000
- 0, /* tp_del */
-#endif
-#if PY_VERSION_HEX >= 0x02060000
- 0, /* tp_version */
-#endif
-#ifdef COUNT_ALLOCS
- 0,0,0,0 /* tp_alloc -> tp_next */
-#endif
- };
- staticvar_type = tmp;
- type_init = 1;
-#if PY_VERSION_HEX < 0x02020000
- staticvar_type.ob_type = &PyType_Type;
-#else
- if (PyType_Ready(&staticvar_type) < 0)
- return NULL;
-#endif
- }
- return &staticvar_type;
-}
-
-SWIGINTERN PyGetSetDescrObject *
-SwigPyStaticVar_new_getset(PyTypeObject *type, PyGetSetDef *getset) {
-
- PyGetSetDescrObject *descr;
- descr = (PyGetSetDescrObject *)PyType_GenericAlloc(SwigPyStaticVar_Type(), 0);
- assert(descr);
- Py_XINCREF(type);
- PyDescr_TYPE(descr) = type;
- PyDescr_NAME(descr) = PyString_InternFromString(getset->name);
- descr->d_getset = getset;
- if (PyDescr_NAME(descr) == NULL) {
- Py_DECREF(descr);
- descr = NULL;
- }
- return descr;
-}
-
-SWIGINTERN void
-SwigPyBuiltin_InitBases (PyTypeObject *type, PyTypeObject **bases) {
- int base_count = 0;
- PyTypeObject **b;
- PyObject *tuple;
- int i;
-
- if (!bases[0]) {
- bases[0] = SwigPyObject_type();
- bases[1] = NULL;
- }
- type->tp_base = bases[0];
- Py_INCREF((PyObject *)bases[0]);
- for (b = bases; *b != NULL; ++b)
- ++base_count;
- tuple = PyTuple_New(base_count);
- for (i = 0; i < base_count; ++i) {
- PyTuple_SET_ITEM(tuple, i, (PyObject *)bases[i]);
- Py_INCREF((PyObject *)bases[i]);
- }
- type->tp_bases = tuple;
-}
-
-SWIGINTERN PyObject *
-SwigPyBuiltin_ThisClosure (PyObject *self, void *SWIGUNUSEDPARM(closure)) {
- PyObject *result;
- result = (PyObject *)SWIG_Python_GetSwigThis(self);
- Py_XINCREF(result);
- return result;
-}
-
-SWIGINTERN void
-SwigPyBuiltin_SetMetaType (PyTypeObject *type, PyTypeObject *metatype)
-{
-#if PY_VERSION_HEX >= 0x03000000
- type->ob_base.ob_base.ob_type = metatype;
-#else
- type->ob_type = metatype;
-#endif
-}
-
-#ifdef __cplusplus
-}
-#endif
-
-
-
-#define SWIG_exception_fail(code, msg) do { SWIG_Error(code, msg); SWIG_fail; } while(0)
-
-#define SWIG_contract_assert(expr, msg) if (!(expr)) { SWIG_Error(SWIG_RuntimeError, msg); SWIG_fail; } else
-
-
-
-/* -------- TYPES TABLE (BEGIN) -------- */
-
-#define SWIGTYPE_p_SwigPyObject swig_types[0]
-#define SWIGTYPE_p__THyPhy swig_types[1]
-#define SWIGTYPE_p__THyPhyMatrix swig_types[2]
-#define SWIGTYPE_p__THyPhyNumber swig_types[3]
-#define SWIGTYPE_p__THyPhyReturnObject swig_types[4]
-#define SWIGTYPE_p__THyPhyString swig_types[5]
-#define SWIGTYPE_p_char swig_types[6]
-#define SWIGTYPE_p_double swig_types[7]
-#define SWIGTYPE_p_f_p_char_int_double__bool swig_types[8]
-#define SWIGTYPE_p_void swig_types[9]
-static swig_type_info *swig_types[11];
-static swig_module_info swig_module = {swig_types, 10, 0, 0, 0, 0};
-#define SWIG_TypeQuery(name) SWIG_TypeQueryModule(&swig_module, &swig_module, name)
-#define SWIG_MangledTypeQuery(name) SWIG_MangledTypeQueryModule(&swig_module, &swig_module, name)
-
-/* -------- TYPES TABLE (END) -------- */
-
-#if (PY_VERSION_HEX <= 0x02000000)
-# if !defined(SWIG_PYTHON_CLASSIC)
-# error "This python version requires swig to be run with the '-classic' option"
-# endif
-#endif
-
-/*-----------------------------------------------
- @(target):= _HyPhy.so
- ------------------------------------------------*/
-#if PY_VERSION_HEX >= 0x03000000
-# define SWIG_init PyInit__HyPhy
-
-#else
-# define SWIG_init init_HyPhy
-
-#endif
-#define SWIG_name "_HyPhy"
-
-#define SWIGVERSION 0x020004
-#define SWIG_VERSION SWIGVERSION
-
-
-#define SWIG_as_voidptr(a) const_cast< void * >(static_cast< const void * >(a))
-#define SWIG_as_voidptrptr(a) ((void)SWIG_as_voidptr(*a),reinterpret_cast< void** >(a))
-
-
-#include <stdexcept>
-
-
-namespace swig {
- class SwigPtr_PyObject {
- protected:
- PyObject *_obj;
-
- public:
- SwigPtr_PyObject() :_obj(0)
- {
- }
-
- SwigPtr_PyObject(const SwigPtr_PyObject& item) : _obj(item._obj)
- {
- Py_XINCREF(_obj);
- }
-
- SwigPtr_PyObject(PyObject *obj, bool initial_ref = true) :_obj(obj)
- {
- if (initial_ref) {
- Py_XINCREF(_obj);
- }
- }
-
- SwigPtr_PyObject & operator=(const SwigPtr_PyObject& item)
- {
- Py_XINCREF(item._obj);
- Py_XDECREF(_obj);
- _obj = item._obj;
- return *this;
- }
-
- ~SwigPtr_PyObject()
- {
- Py_XDECREF(_obj);
- }
-
- operator PyObject *() const
- {
- return _obj;
- }
-
- PyObject *operator->() const
- {
- return _obj;
- }
- };
-}
-
-
-namespace swig {
- struct SwigVar_PyObject : SwigPtr_PyObject {
- SwigVar_PyObject(PyObject* obj = 0) : SwigPtr_PyObject(obj, false) { }
-
- SwigVar_PyObject & operator = (PyObject* obj)
- {
- Py_XDECREF(_obj);
- _obj = obj;
- return *this;
- }
- };
-}
-
-
-#include "THyPhy.h"
-
-
- #define SWIG_From_long PyInt_FromLong
-
-
-SWIGINTERNINLINE PyObject *
-SWIG_From_int (int value)
-{
- return SWIG_From_long (value);
-}
-
-
-SWIGINTERN swig_type_info*
-SWIG_pchar_descriptor(void)
-{
- static int init = 0;
- static swig_type_info* info = 0;
- if (!init) {
- info = SWIG_TypeQuery("_p_char");
- init = 1;
- }
- return info;
-}
-
-
-SWIGINTERN int
-SWIG_AsCharPtrAndSize(PyObject *obj, char** cptr, size_t* psize, int *alloc)
-{
-#if PY_VERSION_HEX>=0x03000000
- if (PyUnicode_Check(obj))
-#else
- if (PyString_Check(obj))
-#endif
- {
- char *cstr; Py_ssize_t len;
-#if PY_VERSION_HEX>=0x03000000
- if (!alloc && cptr) {
- /* We can't allow converting without allocation, since the internal
- representation of string in Python 3 is UCS-2/UCS-4 but we require
- a UTF-8 representation.
- TODO(bhy) More detailed explanation */
- return SWIG_RuntimeError;
- }
- obj = PyUnicode_AsUTF8String(obj);
- PyBytes_AsStringAndSize(obj, &cstr, &len);
- if(alloc) *alloc = SWIG_NEWOBJ;
-#else
- PyString_AsStringAndSize(obj, &cstr, &len);
-#endif
- if (cptr) {
- if (alloc) {
- /*
- In python the user should not be able to modify the inner
- string representation. To warranty that, if you define
- SWIG_PYTHON_SAFE_CSTRINGS, a new/copy of the python string
- buffer is always returned.
-
- The default behavior is just to return the pointer value,
- so, be careful.
- */
-#if defined(SWIG_PYTHON_SAFE_CSTRINGS)
- if (*alloc != SWIG_OLDOBJ)
-#else
- if (*alloc == SWIG_NEWOBJ)
-#endif
- {
- *cptr = reinterpret_cast< char* >(memcpy((new char[len + 1]), cstr, sizeof(char)*(len + 1)));
- *alloc = SWIG_NEWOBJ;
- }
- else {
- *cptr = cstr;
- *alloc = SWIG_OLDOBJ;
- }
- } else {
- #if PY_VERSION_HEX>=0x03000000
- assert(0); /* Should never reach here in Python 3 */
- #endif
- *cptr = SWIG_Python_str_AsChar(obj);
- }
- }
- if (psize) *psize = len + 1;
-#if PY_VERSION_HEX>=0x03000000
- Py_XDECREF(obj);
-#endif
- return SWIG_OK;
- } else {
- swig_type_info* pchar_descriptor = SWIG_pchar_descriptor();
- if (pchar_descriptor) {
- void* vptr = 0;
- if (SWIG_ConvertPtr(obj, &vptr, pchar_descriptor, 0) == SWIG_OK) {
- if (cptr) *cptr = (char *) vptr;
- if (psize) *psize = vptr ? (strlen((char *)vptr) + 1) : 0;
- if (alloc) *alloc = SWIG_OLDOBJ;
- return SWIG_OK;
- }
- }
- }
- return SWIG_TypeError;
-}
-
-
-
-
-
-SWIGINTERN int
-SWIG_AsVal_double (PyObject *obj, double *val)
-{
- int res = SWIG_TypeError;
- if (PyFloat_Check(obj)) {
- if (val) *val = PyFloat_AsDouble(obj);
- return SWIG_OK;
- } else if (PyInt_Check(obj)) {
- if (val) *val = PyInt_AsLong(obj);
- return SWIG_OK;
- } else if (PyLong_Check(obj)) {
- double v = PyLong_AsDouble(obj);
- if (!PyErr_Occurred()) {
- if (val) *val = v;
- return SWIG_OK;
- } else {
- PyErr_Clear();
- }
- }
-#ifdef SWIG_PYTHON_CAST_MODE
- {
- int dispatch = 0;
- double d = PyFloat_AsDouble(obj);
- if (!PyErr_Occurred()) {
- if (val) *val = d;
- return SWIG_AddCast(SWIG_OK);
- } else {
- PyErr_Clear();
- }
- if (!dispatch) {
- long v = PyLong_AsLong(obj);
- if (!PyErr_Occurred()) {
- if (val) *val = v;
- return SWIG_AddCast(SWIG_AddCast(SWIG_OK));
- } else {
- PyErr_Clear();
- }
- }
- }
-#endif
- return res;
-}
-
-
-#include <float.h>
-
-
-#include <math.h>
-
-
-SWIGINTERNINLINE int
-SWIG_CanCastAsInteger(double *d, double min, double max) {
- double x = *d;
- if ((min <= x && x <= max)) {
- double fx = floor(x);
- double cx = ceil(x);
- double rd = ((x - fx) < 0.5) ? fx : cx; /* simple rint */
- if ((errno == EDOM) || (errno == ERANGE)) {
- errno = 0;
- } else {
- double summ, reps, diff;
- if (rd < x) {
- diff = x - rd;
- } else if (rd > x) {
- diff = rd - x;
- } else {
- return 1;
- }
- summ = rd + x;
- reps = diff/summ;
- if (reps < 8*DBL_EPSILON) {
- *d = rd;
- return 1;
- }
- }
- }
- return 0;
-}
-
-
-SWIGINTERN int
-SWIG_AsVal_long (PyObject *obj, long* val)
-{
- if (PyInt_Check(obj)) {
- if (val) *val = PyInt_AsLong(obj);
- return SWIG_OK;
- } else if (PyLong_Check(obj)) {
- long v = PyLong_AsLong(obj);
- if (!PyErr_Occurred()) {
- if (val) *val = v;
- return SWIG_OK;
- } else {
- PyErr_Clear();
- }
- }
-#ifdef SWIG_PYTHON_CAST_MODE
- {
- int dispatch = 0;
- long v = PyInt_AsLong(obj);
- if (!PyErr_Occurred()) {
- if (val) *val = v;
- return SWIG_AddCast(SWIG_OK);
- } else {
- PyErr_Clear();
- }
- if (!dispatch) {
- double d;
- int res = SWIG_AddCast(SWIG_AsVal_double (obj,&d));
- if (SWIG_IsOK(res) && SWIG_CanCastAsInteger(&d, LONG_MIN, LONG_MAX)) {
- if (val) *val = (long)(d);
- return res;
- }
- }
- }
-#endif
- return SWIG_TypeError;
-}
-
-
-SWIGINTERNINLINE PyObject *
-SWIG_FromCharPtrAndSize(const char* carray, size_t size)
-{
- if (carray) {
- if (size > INT_MAX) {
- swig_type_info* pchar_descriptor = SWIG_pchar_descriptor();
- return pchar_descriptor ?
- SWIG_InternalNewPointerObj(const_cast< char * >(carray), pchar_descriptor, 0) : SWIG_Py_Void();
- } else {
-#if PY_VERSION_HEX >= 0x03000000
- return PyUnicode_FromStringAndSize(carray, static_cast< int >(size));
-#else
- return PyString_FromStringAndSize(carray, static_cast< int >(size));
-#endif
- }
- } else {
- return SWIG_Py_Void();
- }
-}
-
-
-SWIGINTERNINLINE PyObject *
-SWIG_FromCharPtr(const char *cptr)
-{
- return SWIG_FromCharPtrAndSize(cptr, (cptr ? strlen(cptr) : 0));
-}
-
-
- #define SWIG_From_double PyFloat_FromDouble
-
-
-SWIGINTERN int
-SWIG_AsVal_bool (PyObject *obj, bool *val)
-{
- int r = PyObject_IsTrue(obj);
- if (r == -1)
- return SWIG_ERROR;
- if (val) *val = r ? true : false;
- return SWIG_OK;
-}
-
-
-#include <limits.h>
-#if !defined(SWIG_NO_LLONG_MAX)
-# if !defined(LLONG_MAX) && defined(__GNUC__) && defined (__LONG_LONG_MAX__)
-# define LLONG_MAX __LONG_LONG_MAX__
-# define LLONG_MIN (-LLONG_MAX - 1LL)
-# define ULLONG_MAX (LLONG_MAX * 2ULL + 1ULL)
-# endif
-#endif
-
-
-SWIGINTERN int
-SWIG_AsVal_int (PyObject * obj, int *val)
-{
- long v;
- int res = SWIG_AsVal_long (obj, &v);
- if (SWIG_IsOK(res)) {
- if ((v < INT_MIN || v > INT_MAX)) {
- return SWIG_OverflowError;
- } else {
- if (val) *val = static_cast< int >(v);
- }
- }
- return res;
-}
-
-
-SWIGINTERNINLINE PyObject*
- SWIG_From_bool (bool value)
-{
- return PyBool_FromLong(value ? 1 : 0);
-}
-
-#ifdef __cplusplus
-extern "C" {
-#endif
-SWIGINTERN PyObject *_wrap__THyPhyReturnObject_myType(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyReturnObject *arg1 = (_THyPhyReturnObject *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- int result;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhyReturnObject, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyReturnObject_myType" "', argument " "1"" of type '" "_THyPhyReturnObject *""'");
- }
- arg1 = reinterpret_cast< _THyPhyReturnObject * >(argp1);
- result = (int)(arg1)->myType();
- resultobj = SWIG_From_int(static_cast< int >(result));
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap_delete__THyPhyReturnObject(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyReturnObject *arg1 = (_THyPhyReturnObject *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhyReturnObject, SWIG_POINTER_DISOWN | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "delete__THyPhyReturnObject" "', argument " "1"" of type '" "_THyPhyReturnObject *""'");
- }
- arg1 = reinterpret_cast< _THyPhyReturnObject * >(argp1);
- delete arg1;
- resultobj = SWIG_Py_Void();
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhyReturnObject_castToString(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyReturnObject *arg1 = (_THyPhyReturnObject *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- _THyPhyString *result = 0 ;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhyReturnObject, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyReturnObject_castToString" "', argument " "1"" of type '" "_THyPhyReturnObject *""'");
- }
- arg1 = reinterpret_cast< _THyPhyReturnObject * >(argp1);
- result = (_THyPhyString *)(arg1)->castToString();
- resultobj = SWIG_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhyString, 0 | 0 );
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhyReturnObject_castToNumber(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyReturnObject *arg1 = (_THyPhyReturnObject *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- _THyPhyNumber *result = 0 ;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhyReturnObject, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyReturnObject_castToNumber" "', argument " "1"" of type '" "_THyPhyReturnObject *""'");
- }
- arg1 = reinterpret_cast< _THyPhyReturnObject * >(argp1);
- result = (_THyPhyNumber *)(arg1)->castToNumber();
- resultobj = SWIG_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhyNumber, 0 | 0 );
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhyReturnObject_castToMatrix(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyReturnObject *arg1 = (_THyPhyReturnObject *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- _THyPhyMatrix *result = 0 ;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhyReturnObject, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyReturnObject_castToMatrix" "', argument " "1"" of type '" "_THyPhyReturnObject *""'");
- }
- arg1 = reinterpret_cast< _THyPhyReturnObject * >(argp1);
- result = (_THyPhyMatrix *)(arg1)->castToMatrix();
- resultobj = SWIG_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhyMatrix, 0 | 0 );
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN int _wrap_new__THyPhyString__SWIG_0(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- char *arg1 = (char *) 0 ;
- long arg2 ;
- int res1 ;
- char *buf1 = 0 ;
- int alloc1 = 0 ;
- long val2 ;
- int ecode2 = 0 ;
- PyObject * obj1 = 0 ;
- PyObject * obj2 = 0 ;
- _THyPhyString *result = 0 ;
-
- if (!PyArg_ParseTuple(args,(char *)"OO:new__THyPhyString",&obj1,&obj2)) SWIG_fail;
- res1 = SWIG_AsCharPtrAndSize(obj1, &buf1, NULL, &alloc1);
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "new__THyPhyString" "', argument " "1"" of type '" "char const *""'");
- }
- arg1 = reinterpret_cast< char * >(buf1);
- ecode2 = SWIG_AsVal_long(obj2, &val2);
- if (!SWIG_IsOK(ecode2)) {
- SWIG_exception_fail(SWIG_ArgError(ecode2), "in method '" "new__THyPhyString" "', argument " "2"" of type '" "long""'");
- }
- arg2 = static_cast< long >(val2);
- result = (_THyPhyString *)new _THyPhyString((char const *)arg1,arg2);
- resultobj = SWIG_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhyString, SWIG_BUILTIN_INIT | 0 );
- if (alloc1 == SWIG_NEWOBJ) delete[] buf1;
- return resultobj == Py_None ? 1 : 0;
-fail:
- if (alloc1 == SWIG_NEWOBJ) delete[] buf1;
- return -1;
-}
-
-
-SWIGINTERN int _wrap_new__THyPhyString__SWIG_1(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- char *arg1 = (char *) 0 ;
- int res1 ;
- char *buf1 = 0 ;
- int alloc1 = 0 ;
- PyObject * obj1 = 0 ;
- _THyPhyString *result = 0 ;
-
- if (!PyArg_ParseTuple(args,(char *)"O:new__THyPhyString",&obj1)) SWIG_fail;
- res1 = SWIG_AsCharPtrAndSize(obj1, &buf1, NULL, &alloc1);
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "new__THyPhyString" "', argument " "1"" of type '" "char const *""'");
- }
- arg1 = reinterpret_cast< char * >(buf1);
- result = (_THyPhyString *)new _THyPhyString((char const *)arg1);
- resultobj = SWIG_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhyString, SWIG_BUILTIN_INIT | 0 );
- if (alloc1 == SWIG_NEWOBJ) delete[] buf1;
- return resultobj == Py_None ? 1 : 0;
-fail:
- if (alloc1 == SWIG_NEWOBJ) delete[] buf1;
- return -1;
-}
-
-
-SWIGINTERN int _wrap_new__THyPhyString__SWIG_2(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyString *result = 0 ;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- result = (_THyPhyString *)new _THyPhyString();
- resultobj = SWIG_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhyString, SWIG_BUILTIN_INIT | 0 );
- return resultobj == Py_None ? 1 : 0;
-fail:
- return -1;
-}
-
-
-SWIGINTERN int _wrap_new__THyPhyString(PyObject *self, PyObject *args) {
- int argc;
- PyObject *argv[3];
- int ii;
-
- if (!PyTuple_Check(args)) SWIG_fail;
- argc = args ? (int)PyObject_Length(args) : 0;
- for (ii = 0; (ii < 2) && (ii < argc); ii++) {
- argv[ii] = PyTuple_GET_ITEM(args,ii);
- }
- if (argc == 0) {
- return _wrap_new__THyPhyString__SWIG_2(self, args);
- }
- if (argc == 1) {
- int _v;
- int res = SWIG_AsCharPtrAndSize(argv[0], 0, NULL, 0);
- _v = SWIG_CheckState(res);
- if (_v) {
- return _wrap_new__THyPhyString__SWIG_1(self, args);
- }
- }
- if (argc == 2) {
- int _v;
- int res = SWIG_AsCharPtrAndSize(argv[0], 0, NULL, 0);
- _v = SWIG_CheckState(res);
- if (_v) {
- {
- int res = SWIG_AsVal_long(argv[1], NULL);
- _v = SWIG_CheckState(res);
- }
- if (_v) {
- return _wrap_new__THyPhyString__SWIG_0(self, args);
- }
- }
- }
-
-fail:
- SWIG_SetErrorMsg(PyExc_NotImplementedError,"Wrong number or type of arguments for overloaded function 'new__THyPhyString'.\n"
- " Possible C/C++ prototypes are:\n"
- " _THyPhyString::_THyPhyString(char const *,long)\n"
- " _THyPhyString::_THyPhyString(char const *)\n"
- " _THyPhyString::_THyPhyString()\n");
- return -1;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhyString_myType(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyString *arg1 = (_THyPhyString *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- int result;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhyString, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyString_myType" "', argument " "1"" of type '" "_THyPhyString *""'");
- }
- arg1 = reinterpret_cast< _THyPhyString * >(argp1);
- result = (int)(arg1)->myType();
- resultobj = SWIG_From_int(static_cast< int >(result));
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap_delete__THyPhyString(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyString *arg1 = (_THyPhyString *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhyString, SWIG_POINTER_DISOWN | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "delete__THyPhyString" "', argument " "1"" of type '" "_THyPhyString *""'");
- }
- arg1 = reinterpret_cast< _THyPhyString * >(argp1);
- delete arg1;
- resultobj = SWIG_Py_Void();
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhyString_sLength_set(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyString *arg1 = (_THyPhyString *) 0 ;
- long arg2 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- long val2 ;
- int ecode2 = 0 ;
- PyObject * obj1 = 0 ;
-
- if (!PyArg_ParseTuple(args,(char *)"O:_THyPhyString_sLength_set",&obj1)) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhyString, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyString_sLength_set" "', argument " "1"" of type '" "_THyPhyString *""'");
- }
- arg1 = reinterpret_cast< _THyPhyString * >(argp1);
- ecode2 = SWIG_AsVal_long(obj1, &val2);
- if (!SWIG_IsOK(ecode2)) {
- SWIG_exception_fail(SWIG_ArgError(ecode2), "in method '" "_THyPhyString_sLength_set" "', argument " "2"" of type '" "long""'");
- }
- arg2 = static_cast< long >(val2);
- if (arg1) (arg1)->sLength = arg2;
- resultobj = SWIG_Py_Void();
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhyString_sLength_get(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyString *arg1 = (_THyPhyString *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- long result;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhyString, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyString_sLength_get" "', argument " "1"" of type '" "_THyPhyString *""'");
- }
- arg1 = reinterpret_cast< _THyPhyString * >(argp1);
- result = (long) ((arg1)->sLength);
- resultobj = SWIG_From_long(static_cast< long >(result));
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhyString_sData_set(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyString *arg1 = (_THyPhyString *) 0 ;
- char *arg2 = (char *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- int res2 ;
- char *buf2 = 0 ;
- int alloc2 = 0 ;
- PyObject * obj1 = 0 ;
-
- if (!PyArg_ParseTuple(args,(char *)"O:_THyPhyString_sData_set",&obj1)) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhyString, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyString_sData_set" "', argument " "1"" of type '" "_THyPhyString *""'");
- }
- arg1 = reinterpret_cast< _THyPhyString * >(argp1);
- res2 = SWIG_AsCharPtrAndSize(obj1, &buf2, NULL, &alloc2);
- if (!SWIG_IsOK(res2)) {
- SWIG_exception_fail(SWIG_ArgError(res2), "in method '" "_THyPhyString_sData_set" "', argument " "2"" of type '" "char *""'");
- }
- arg2 = reinterpret_cast< char * >(buf2);
- if (arg1->sData) delete[] arg1->sData;
- if (arg2) {
- size_t size = strlen(reinterpret_cast< const char * >(arg2)) + 1;
- arg1->sData = (char *)reinterpret_cast< char* >(memcpy((new char[size]), reinterpret_cast< const char * >(arg2), sizeof(char)*(size)));
- } else {
- arg1->sData = 0;
- }
- resultobj = SWIG_Py_Void();
- if (alloc2 == SWIG_NEWOBJ) delete[] buf2;
- return resultobj;
-fail:
- if (alloc2 == SWIG_NEWOBJ) delete[] buf2;
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhyString_sData_get(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyString *arg1 = (_THyPhyString *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- char *result = 0 ;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhyString, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyString_sData_get" "', argument " "1"" of type '" "_THyPhyString *""'");
- }
- arg1 = reinterpret_cast< _THyPhyString * >(argp1);
- result = (char *) ((arg1)->sData);
- resultobj = SWIG_FromCharPtr((const char *)result);
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN int _wrap_new__THyPhyNumber__SWIG_0(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- double arg1 ;
- double val1 ;
- int ecode1 = 0 ;
- PyObject * obj1 = 0 ;
- _THyPhyNumber *result = 0 ;
-
- if (!PyArg_ParseTuple(args,(char *)"O:new__THyPhyNumber",&obj1)) SWIG_fail;
- ecode1 = SWIG_AsVal_double(obj1, &val1);
- if (!SWIG_IsOK(ecode1)) {
- SWIG_exception_fail(SWIG_ArgError(ecode1), "in method '" "new__THyPhyNumber" "', argument " "1"" of type '" "double""'");
- }
- arg1 = static_cast< double >(val1);
- result = (_THyPhyNumber *)new _THyPhyNumber(arg1);
- resultobj = SWIG_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhyNumber, SWIG_BUILTIN_INIT | 0 );
- return resultobj == Py_None ? 1 : 0;
-fail:
- return -1;
-}
-
-
-SWIGINTERN int _wrap_new__THyPhyNumber__SWIG_1(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyNumber *result = 0 ;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- result = (_THyPhyNumber *)new _THyPhyNumber();
- resultobj = SWIG_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhyNumber, SWIG_BUILTIN_INIT | 0 );
- return resultobj == Py_None ? 1 : 0;
-fail:
- return -1;
-}
-
-
-SWIGINTERN int _wrap_new__THyPhyNumber(PyObject *self, PyObject *args) {
- int argc;
- PyObject *argv[2];
- int ii;
-
- if (!PyTuple_Check(args)) SWIG_fail;
- argc = args ? (int)PyObject_Length(args) : 0;
- for (ii = 0; (ii < 1) && (ii < argc); ii++) {
- argv[ii] = PyTuple_GET_ITEM(args,ii);
- }
- if (argc == 0) {
- return _wrap_new__THyPhyNumber__SWIG_1(self, args);
- }
- if (argc == 1) {
- int _v;
- {
- int res = SWIG_AsVal_double(argv[0], NULL);
- _v = SWIG_CheckState(res);
- }
- if (_v) {
- return _wrap_new__THyPhyNumber__SWIG_0(self, args);
- }
- }
-
-fail:
- SWIG_SetErrorMsg(PyExc_NotImplementedError,"Wrong number or type of arguments for overloaded function 'new__THyPhyNumber'.\n"
- " Possible C/C++ prototypes are:\n"
- " _THyPhyNumber::_THyPhyNumber(double)\n"
- " _THyPhyNumber::_THyPhyNumber()\n");
- return -1;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhyNumber_myType(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyNumber *arg1 = (_THyPhyNumber *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- int result;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhyNumber, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyNumber_myType" "', argument " "1"" of type '" "_THyPhyNumber *""'");
- }
- arg1 = reinterpret_cast< _THyPhyNumber * >(argp1);
- result = (int)(arg1)->myType();
- resultobj = SWIG_From_int(static_cast< int >(result));
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap_delete__THyPhyNumber(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyNumber *arg1 = (_THyPhyNumber *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhyNumber, SWIG_POINTER_DISOWN | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "delete__THyPhyNumber" "', argument " "1"" of type '" "_THyPhyNumber *""'");
- }
- arg1 = reinterpret_cast< _THyPhyNumber * >(argp1);
- delete arg1;
- resultobj = SWIG_Py_Void();
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhyNumber_nValue_set(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyNumber *arg1 = (_THyPhyNumber *) 0 ;
- double arg2 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- double val2 ;
- int ecode2 = 0 ;
- PyObject * obj1 = 0 ;
-
- if (!PyArg_ParseTuple(args,(char *)"O:_THyPhyNumber_nValue_set",&obj1)) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhyNumber, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyNumber_nValue_set" "', argument " "1"" of type '" "_THyPhyNumber *""'");
- }
- arg1 = reinterpret_cast< _THyPhyNumber * >(argp1);
- ecode2 = SWIG_AsVal_double(obj1, &val2);
- if (!SWIG_IsOK(ecode2)) {
- SWIG_exception_fail(SWIG_ArgError(ecode2), "in method '" "_THyPhyNumber_nValue_set" "', argument " "2"" of type '" "double""'");
- }
- arg2 = static_cast< double >(val2);
- if (arg1) (arg1)->nValue = arg2;
- resultobj = SWIG_Py_Void();
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhyNumber_nValue_get(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyNumber *arg1 = (_THyPhyNumber *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- double result;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhyNumber, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyNumber_nValue_get" "', argument " "1"" of type '" "_THyPhyNumber *""'");
- }
- arg1 = reinterpret_cast< _THyPhyNumber * >(argp1);
- result = (double) ((arg1)->nValue);
- resultobj = SWIG_From_double(static_cast< double >(result));
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN int _wrap_new__THyPhyMatrix__SWIG_0(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyMatrix *result = 0 ;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- result = (_THyPhyMatrix *)new _THyPhyMatrix();
- resultobj = SWIG_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhyMatrix, SWIG_BUILTIN_INIT | 0 );
- return resultobj == Py_None ? 1 : 0;
-fail:
- return -1;
-}
-
-
-SWIGINTERN int _wrap_new__THyPhyMatrix__SWIG_1(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- long arg1 ;
- long arg2 ;
- double *arg3 = (double *) 0 ;
- long val1 ;
- int ecode1 = 0 ;
- long val2 ;
- int ecode2 = 0 ;
- void *argp3 = 0 ;
- int res3 = 0 ;
- PyObject * obj1 = 0 ;
- PyObject * obj2 = 0 ;
- PyObject * obj3 = 0 ;
- _THyPhyMatrix *result = 0 ;
-
- if (!PyArg_ParseTuple(args,(char *)"OOO:new__THyPhyMatrix",&obj1,&obj2,&obj3)) SWIG_fail;
- ecode1 = SWIG_AsVal_long(obj1, &val1);
- if (!SWIG_IsOK(ecode1)) {
- SWIG_exception_fail(SWIG_ArgError(ecode1), "in method '" "new__THyPhyMatrix" "', argument " "1"" of type '" "long""'");
- }
- arg1 = static_cast< long >(val1);
- ecode2 = SWIG_AsVal_long(obj2, &val2);
- if (!SWIG_IsOK(ecode2)) {
- SWIG_exception_fail(SWIG_ArgError(ecode2), "in method '" "new__THyPhyMatrix" "', argument " "2"" of type '" "long""'");
- }
- arg2 = static_cast< long >(val2);
- res3 = SWIG_ConvertPtr(obj3, &argp3,SWIGTYPE_p_double, 0 | 0 );
- if (!SWIG_IsOK(res3)) {
- SWIG_exception_fail(SWIG_ArgError(res3), "in method '" "new__THyPhyMatrix" "', argument " "3"" of type '" "double const *""'");
- }
- arg3 = reinterpret_cast< double * >(argp3);
- result = (_THyPhyMatrix *)new _THyPhyMatrix(arg1,arg2,(double const *)arg3);
- resultobj = SWIG_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhyMatrix, SWIG_BUILTIN_INIT | 0 );
- return resultobj == Py_None ? 1 : 0;
-fail:
- return -1;
-}
-
-
-SWIGINTERN int _wrap_new__THyPhyMatrix(PyObject *self, PyObject *args) {
- int argc;
- PyObject *argv[4];
- int ii;
-
- if (!PyTuple_Check(args)) SWIG_fail;
- argc = args ? (int)PyObject_Length(args) : 0;
- for (ii = 0; (ii < 3) && (ii < argc); ii++) {
- argv[ii] = PyTuple_GET_ITEM(args,ii);
- }
- if (argc == 0) {
- return _wrap_new__THyPhyMatrix__SWIG_0(self, args);
- }
- if (argc == 3) {
- int _v;
- {
- int res = SWIG_AsVal_long(argv[0], NULL);
- _v = SWIG_CheckState(res);
- }
- if (_v) {
- {
- int res = SWIG_AsVal_long(argv[1], NULL);
- _v = SWIG_CheckState(res);
- }
- if (_v) {
- void *vptr = 0;
- int res = SWIG_ConvertPtr(argv[2], &vptr, SWIGTYPE_p_double, 0);
- _v = SWIG_CheckState(res);
- if (_v) {
- return _wrap_new__THyPhyMatrix__SWIG_1(self, args);
- }
- }
- }
- }
-
-fail:
- SWIG_SetErrorMsg(PyExc_NotImplementedError,"Wrong number or type of arguments for overloaded function 'new__THyPhyMatrix'.\n"
- " Possible C/C++ prototypes are:\n"
- " _THyPhyMatrix::_THyPhyMatrix()\n"
- " _THyPhyMatrix::_THyPhyMatrix(long const,long const,double const *)\n");
- return -1;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhyMatrix_myType(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyMatrix *arg1 = (_THyPhyMatrix *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- int result;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhyMatrix, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyMatrix_myType" "', argument " "1"" of type '" "_THyPhyMatrix *""'");
- }
- arg1 = reinterpret_cast< _THyPhyMatrix * >(argp1);
- result = (int)(arg1)->myType();
- resultobj = SWIG_From_int(static_cast< int >(result));
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap_delete__THyPhyMatrix(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyMatrix *arg1 = (_THyPhyMatrix *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhyMatrix, SWIG_POINTER_DISOWN | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "delete__THyPhyMatrix" "', argument " "1"" of type '" "_THyPhyMatrix *""'");
- }
- arg1 = reinterpret_cast< _THyPhyMatrix * >(argp1);
- delete arg1;
- resultobj = SWIG_Py_Void();
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhyMatrix_MatrixCell(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyMatrix *arg1 = (_THyPhyMatrix *) 0 ;
- long arg2 ;
- long arg3 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- long val2 ;
- int ecode2 = 0 ;
- long val3 ;
- int ecode3 = 0 ;
- PyObject * obj1 = 0 ;
- PyObject * obj2 = 0 ;
- double result;
-
- if (!PyArg_ParseTuple(args,(char *)"OO:_THyPhyMatrix_MatrixCell",&obj1,&obj2)) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhyMatrix, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyMatrix_MatrixCell" "', argument " "1"" of type '" "_THyPhyMatrix *""'");
- }
- arg1 = reinterpret_cast< _THyPhyMatrix * >(argp1);
- ecode2 = SWIG_AsVal_long(obj1, &val2);
- if (!SWIG_IsOK(ecode2)) {
- SWIG_exception_fail(SWIG_ArgError(ecode2), "in method '" "_THyPhyMatrix_MatrixCell" "', argument " "2"" of type '" "long""'");
- }
- arg2 = static_cast< long >(val2);
- ecode3 = SWIG_AsVal_long(obj2, &val3);
- if (!SWIG_IsOK(ecode3)) {
- SWIG_exception_fail(SWIG_ArgError(ecode3), "in method '" "_THyPhyMatrix_MatrixCell" "', argument " "3"" of type '" "long""'");
- }
- arg3 = static_cast< long >(val3);
- result = (double)(arg1)->MatrixCell(arg2,arg3);
- resultobj = SWIG_From_double(static_cast< double >(result));
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhyMatrix_mRows_set(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyMatrix *arg1 = (_THyPhyMatrix *) 0 ;
- long arg2 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- long val2 ;
- int ecode2 = 0 ;
- PyObject * obj1 = 0 ;
-
- if (!PyArg_ParseTuple(args,(char *)"O:_THyPhyMatrix_mRows_set",&obj1)) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhyMatrix, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyMatrix_mRows_set" "', argument " "1"" of type '" "_THyPhyMatrix *""'");
- }
- arg1 = reinterpret_cast< _THyPhyMatrix * >(argp1);
- ecode2 = SWIG_AsVal_long(obj1, &val2);
- if (!SWIG_IsOK(ecode2)) {
- SWIG_exception_fail(SWIG_ArgError(ecode2), "in method '" "_THyPhyMatrix_mRows_set" "', argument " "2"" of type '" "long""'");
- }
- arg2 = static_cast< long >(val2);
- if (arg1) (arg1)->mRows = arg2;
- resultobj = SWIG_Py_Void();
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhyMatrix_mRows_get(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyMatrix *arg1 = (_THyPhyMatrix *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- long result;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhyMatrix, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyMatrix_mRows_get" "', argument " "1"" of type '" "_THyPhyMatrix *""'");
- }
- arg1 = reinterpret_cast< _THyPhyMatrix * >(argp1);
- result = (long) ((arg1)->mRows);
- resultobj = SWIG_From_long(static_cast< long >(result));
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhyMatrix_mCols_set(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyMatrix *arg1 = (_THyPhyMatrix *) 0 ;
- long arg2 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- long val2 ;
- int ecode2 = 0 ;
- PyObject * obj1 = 0 ;
-
- if (!PyArg_ParseTuple(args,(char *)"O:_THyPhyMatrix_mCols_set",&obj1)) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhyMatrix, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyMatrix_mCols_set" "', argument " "1"" of type '" "_THyPhyMatrix *""'");
- }
- arg1 = reinterpret_cast< _THyPhyMatrix * >(argp1);
- ecode2 = SWIG_AsVal_long(obj1, &val2);
- if (!SWIG_IsOK(ecode2)) {
- SWIG_exception_fail(SWIG_ArgError(ecode2), "in method '" "_THyPhyMatrix_mCols_set" "', argument " "2"" of type '" "long""'");
- }
- arg2 = static_cast< long >(val2);
- if (arg1) (arg1)->mCols = arg2;
- resultobj = SWIG_Py_Void();
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhyMatrix_mCols_get(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyMatrix *arg1 = (_THyPhyMatrix *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- long result;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhyMatrix, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyMatrix_mCols_get" "', argument " "1"" of type '" "_THyPhyMatrix *""'");
- }
- arg1 = reinterpret_cast< _THyPhyMatrix * >(argp1);
- result = (long) ((arg1)->mCols);
- resultobj = SWIG_From_long(static_cast< long >(result));
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhyMatrix_mData_set(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyMatrix *arg1 = (_THyPhyMatrix *) 0 ;
- double *arg2 = (double *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- void *argp2 = 0 ;
- int res2 = 0 ;
- PyObject * obj1 = 0 ;
-
- if (!PyArg_ParseTuple(args,(char *)"O:_THyPhyMatrix_mData_set",&obj1)) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhyMatrix, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyMatrix_mData_set" "', argument " "1"" of type '" "_THyPhyMatrix *""'");
- }
- arg1 = reinterpret_cast< _THyPhyMatrix * >(argp1);
- res2 = SWIG_ConvertPtr(obj1, &argp2,SWIGTYPE_p_double, SWIG_POINTER_DISOWN | 0 );
- if (!SWIG_IsOK(res2)) {
- SWIG_exception_fail(SWIG_ArgError(res2), "in method '" "_THyPhyMatrix_mData_set" "', argument " "2"" of type '" "double *""'");
- }
- arg2 = reinterpret_cast< double * >(argp2);
- if (arg1) (arg1)->mData = arg2;
- resultobj = SWIG_Py_Void();
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhyMatrix_mData_get(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhyMatrix *arg1 = (_THyPhyMatrix *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- double *result = 0 ;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhyMatrix, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhyMatrix_mData_get" "', argument " "1"" of type '" "_THyPhyMatrix *""'");
- }
- arg1 = reinterpret_cast< _THyPhyMatrix * >(argp1);
- result = (double *) ((arg1)->mData);
- resultobj = SWIG_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p_double, 0 | 0 );
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN int _wrap_new__THyPhy__SWIG_0(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _ProgressCancelHandler *arg1 = (_ProgressCancelHandler *) 0 ;
- char *arg2 = (char *) 0 ;
- long arg3 ;
- int res2 ;
- char *buf2 = 0 ;
- int alloc2 = 0 ;
- long val3 ;
- int ecode3 = 0 ;
- PyObject * obj1 = 0 ;
- PyObject * obj2 = 0 ;
- PyObject * obj3 = 0 ;
- _THyPhy *result = 0 ;
-
- if (!PyArg_ParseTuple(args,(char *)"OOO:new__THyPhy",&obj1,&obj2,&obj3)) SWIG_fail;
- {
- int res = SWIG_ConvertFunctionPtr(obj1, (void**)(&arg1), SWIGTYPE_p_f_p_char_int_double__bool);
- if (!SWIG_IsOK(res)) {
- SWIG_exception_fail(SWIG_ArgError(res), "in method '" "new__THyPhy" "', argument " "1"" of type '" "_ProgressCancelHandler *""'");
- }
- }
- res2 = SWIG_AsCharPtrAndSize(obj2, &buf2, NULL, &alloc2);
- if (!SWIG_IsOK(res2)) {
- SWIG_exception_fail(SWIG_ArgError(res2), "in method '" "new__THyPhy" "', argument " "2"" of type '" "char const *""'");
- }
- arg2 = reinterpret_cast< char * >(buf2);
- ecode3 = SWIG_AsVal_long(obj3, &val3);
- if (!SWIG_IsOK(ecode3)) {
- SWIG_exception_fail(SWIG_ArgError(ecode3), "in method '" "new__THyPhy" "', argument " "3"" of type '" "long""'");
- }
- arg3 = static_cast< long >(val3);
- result = (_THyPhy *)new _THyPhy(arg1,(char const *)arg2,arg3);
- resultobj = SWIG_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhy, SWIG_BUILTIN_INIT | 0 );
- if (alloc2 == SWIG_NEWOBJ) delete[] buf2;
- return resultobj == Py_None ? 1 : 0;
-fail:
- if (alloc2 == SWIG_NEWOBJ) delete[] buf2;
- return -1;
-}
-
-
-SWIGINTERN int _wrap_new__THyPhy__SWIG_1(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _ProgressCancelHandler *arg1 = (_ProgressCancelHandler *) 0 ;
- char *arg2 = (char *) 0 ;
- int res2 ;
- char *buf2 = 0 ;
- int alloc2 = 0 ;
- PyObject * obj1 = 0 ;
- PyObject * obj2 = 0 ;
- _THyPhy *result = 0 ;
-
- if (!PyArg_ParseTuple(args,(char *)"OO:new__THyPhy",&obj1,&obj2)) SWIG_fail;
- {
- int res = SWIG_ConvertFunctionPtr(obj1, (void**)(&arg1), SWIGTYPE_p_f_p_char_int_double__bool);
- if (!SWIG_IsOK(res)) {
- SWIG_exception_fail(SWIG_ArgError(res), "in method '" "new__THyPhy" "', argument " "1"" of type '" "_ProgressCancelHandler *""'");
- }
- }
- res2 = SWIG_AsCharPtrAndSize(obj2, &buf2, NULL, &alloc2);
- if (!SWIG_IsOK(res2)) {
- SWIG_exception_fail(SWIG_ArgError(res2), "in method '" "new__THyPhy" "', argument " "2"" of type '" "char const *""'");
- }
- arg2 = reinterpret_cast< char * >(buf2);
- result = (_THyPhy *)new _THyPhy(arg1,(char const *)arg2);
- resultobj = SWIG_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhy, SWIG_BUILTIN_INIT | 0 );
- if (alloc2 == SWIG_NEWOBJ) delete[] buf2;
- return resultobj == Py_None ? 1 : 0;
-fail:
- if (alloc2 == SWIG_NEWOBJ) delete[] buf2;
- return -1;
-}
-
-
-SWIGINTERN int _wrap_new__THyPhy__SWIG_2(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- char *arg1 = (char *) 0 ;
- long arg2 ;
- int res1 ;
- char *buf1 = 0 ;
- int alloc1 = 0 ;
- long val2 ;
- int ecode2 = 0 ;
- PyObject * obj1 = 0 ;
- PyObject * obj2 = 0 ;
- _THyPhy *result = 0 ;
-
- if (!PyArg_ParseTuple(args,(char *)"OO:new__THyPhy",&obj1,&obj2)) SWIG_fail;
- res1 = SWIG_AsCharPtrAndSize(obj1, &buf1, NULL, &alloc1);
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "new__THyPhy" "', argument " "1"" of type '" "char const *""'");
- }
- arg1 = reinterpret_cast< char * >(buf1);
- ecode2 = SWIG_AsVal_long(obj2, &val2);
- if (!SWIG_IsOK(ecode2)) {
- SWIG_exception_fail(SWIG_ArgError(ecode2), "in method '" "new__THyPhy" "', argument " "2"" of type '" "long""'");
- }
- arg2 = static_cast< long >(val2);
- result = (_THyPhy *)new _THyPhy((char const *)arg1,arg2);
- resultobj = SWIG_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhy, SWIG_BUILTIN_INIT | 0 );
- if (alloc1 == SWIG_NEWOBJ) delete[] buf1;
- return resultobj == Py_None ? 1 : 0;
-fail:
- if (alloc1 == SWIG_NEWOBJ) delete[] buf1;
- return -1;
-}
-
-
-SWIGINTERN int _wrap_new__THyPhy__SWIG_3(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- char *arg1 = (char *) 0 ;
- int res1 ;
- char *buf1 = 0 ;
- int alloc1 = 0 ;
- PyObject * obj1 = 0 ;
- _THyPhy *result = 0 ;
-
- if (!PyArg_ParseTuple(args,(char *)"O:new__THyPhy",&obj1)) SWIG_fail;
- res1 = SWIG_AsCharPtrAndSize(obj1, &buf1, NULL, &alloc1);
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "new__THyPhy" "', argument " "1"" of type '" "char const *""'");
- }
- arg1 = reinterpret_cast< char * >(buf1);
- result = (_THyPhy *)new _THyPhy((char const *)arg1);
- resultobj = SWIG_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhy, SWIG_BUILTIN_INIT | 0 );
- if (alloc1 == SWIG_NEWOBJ) delete[] buf1;
- return resultobj == Py_None ? 1 : 0;
-fail:
- if (alloc1 == SWIG_NEWOBJ) delete[] buf1;
- return -1;
-}
-
-
-SWIGINTERN int _wrap_new__THyPhy(PyObject *self, PyObject *args) {
- int argc;
- PyObject *argv[4];
- int ii;
-
- if (!PyTuple_Check(args)) SWIG_fail;
- argc = args ? (int)PyObject_Length(args) : 0;
- for (ii = 0; (ii < 3) && (ii < argc); ii++) {
- argv[ii] = PyTuple_GET_ITEM(args,ii);
- }
- if (argc == 1) {
- int _v;
- int res = SWIG_AsCharPtrAndSize(argv[0], 0, NULL, 0);
- _v = SWIG_CheckState(res);
- if (_v) {
- return _wrap_new__THyPhy__SWIG_3(self, args);
- }
- }
- if (argc == 2) {
- int _v;
- void *ptr = 0;
- int res = SWIG_ConvertFunctionPtr(argv[0], &ptr, SWIGTYPE_p_f_p_char_int_double__bool);
- _v = SWIG_CheckState(res);
- if (_v) {
- int res = SWIG_AsCharPtrAndSize(argv[1], 0, NULL, 0);
- _v = SWIG_CheckState(res);
- if (_v) {
- return _wrap_new__THyPhy__SWIG_1(self, args);
- }
- }
- }
- if (argc == 2) {
- int _v;
- int res = SWIG_AsCharPtrAndSize(argv[0], 0, NULL, 0);
- _v = SWIG_CheckState(res);
- if (_v) {
- {
- int res = SWIG_AsVal_long(argv[1], NULL);
- _v = SWIG_CheckState(res);
- }
- if (_v) {
- return _wrap_new__THyPhy__SWIG_2(self, args);
- }
- }
- }
- if (argc == 3) {
- int _v;
- void *ptr = 0;
- int res = SWIG_ConvertFunctionPtr(argv[0], &ptr, SWIGTYPE_p_f_p_char_int_double__bool);
- _v = SWIG_CheckState(res);
- if (_v) {
- int res = SWIG_AsCharPtrAndSize(argv[1], 0, NULL, 0);
- _v = SWIG_CheckState(res);
- if (_v) {
- {
- int res = SWIG_AsVal_long(argv[2], NULL);
- _v = SWIG_CheckState(res);
- }
- if (_v) {
- return _wrap_new__THyPhy__SWIG_0(self, args);
- }
- }
- }
- }
-
-fail:
- SWIG_SetErrorMsg(PyExc_NotImplementedError,"Wrong number or type of arguments for overloaded function 'new__THyPhy'.\n"
- " Possible C/C++ prototypes are:\n"
- " _THyPhy::_THyPhy(_ProgressCancelHandler *,char const *,long)\n"
- " _THyPhy::_THyPhy(_ProgressCancelHandler *,char const *)\n"
- " _THyPhy::_THyPhy(char const *,long)\n"
- " _THyPhy::_THyPhy(char const *)\n");
- return -1;
-}
-
-
-SWIGINTERN PyObject *_wrap_delete__THyPhy(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhy, SWIG_POINTER_DISOWN | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "delete__THyPhy" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- delete arg1;
- resultobj = SWIG_Py_Void();
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhy_ExecuteBF__SWIG_0(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- char *arg2 = (char *) 0 ;
- bool arg3 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- int res2 ;
- char *buf2 = 0 ;
- int alloc2 = 0 ;
- bool val3 ;
- int ecode3 = 0 ;
- PyObject * obj1 = 0 ;
- PyObject * obj2 = 0 ;
- _THyPhyString *result = 0 ;
-
- if (!PyArg_ParseTuple(args,(char *)"OO:_THyPhy_ExecuteBF",&obj1,&obj2)) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhy, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhy_ExecuteBF" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- res2 = SWIG_AsCharPtrAndSize(obj1, &buf2, NULL, &alloc2);
- if (!SWIG_IsOK(res2)) {
- SWIG_exception_fail(SWIG_ArgError(res2), "in method '" "_THyPhy_ExecuteBF" "', argument " "2"" of type '" "char const *""'");
- }
- arg2 = reinterpret_cast< char * >(buf2);
- ecode3 = SWIG_AsVal_bool(obj2, &val3);
- if (!SWIG_IsOK(ecode3)) {
- SWIG_exception_fail(SWIG_ArgError(ecode3), "in method '" "_THyPhy_ExecuteBF" "', argument " "3"" of type '" "bool""'");
- }
- arg3 = static_cast< bool >(val3);
- result = (_THyPhyString *)(arg1)->ExecuteBF((char const *)arg2,arg3);
- resultobj = SWIG_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhyString, 0 | 0 );
- if (alloc2 == SWIG_NEWOBJ) delete[] buf2;
- return resultobj;
-fail:
- if (alloc2 == SWIG_NEWOBJ) delete[] buf2;
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhy_ExecuteBF__SWIG_1(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- char *arg2 = (char *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- int res2 ;
- char *buf2 = 0 ;
- int alloc2 = 0 ;
- PyObject * obj1 = 0 ;
- _THyPhyString *result = 0 ;
-
- if (!PyArg_ParseTuple(args,(char *)"O:_THyPhy_ExecuteBF",&obj1)) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhy, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhy_ExecuteBF" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- res2 = SWIG_AsCharPtrAndSize(obj1, &buf2, NULL, &alloc2);
- if (!SWIG_IsOK(res2)) {
- SWIG_exception_fail(SWIG_ArgError(res2), "in method '" "_THyPhy_ExecuteBF" "', argument " "2"" of type '" "char const *""'");
- }
- arg2 = reinterpret_cast< char * >(buf2);
- result = (_THyPhyString *)(arg1)->ExecuteBF((char const *)arg2);
- resultobj = SWIG_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhyString, 0 | 0 );
- if (alloc2 == SWIG_NEWOBJ) delete[] buf2;
- return resultobj;
-fail:
- if (alloc2 == SWIG_NEWOBJ) delete[] buf2;
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhy_ExecuteBF(PyObject *self, PyObject *args) {
- int argc;
- PyObject *argv[4];
- int ii;
-
- if (!PyTuple_Check(args)) SWIG_fail;
- argc = args ? (int)PyObject_Length(args) : 0;
- argv[0] = self;
- for (ii = 0; (ii < 2) && (ii < argc); ii++) {
- argv[ii + 1] = PyTuple_GET_ITEM(args,ii);
- }
- argc++;
- if (argc == 2) {
- int _v;
- void *vptr = 0;
- int res = SWIG_ConvertPtr(argv[0], &vptr, SWIGTYPE_p__THyPhy, 0);
- _v = SWIG_CheckState(res);
- if (_v) {
- int res = SWIG_AsCharPtrAndSize(argv[1], 0, NULL, 0);
- _v = SWIG_CheckState(res);
- if (_v) {
- return _wrap__THyPhy_ExecuteBF__SWIG_1(self, args);
- }
- }
- }
- if (argc == 3) {
- int _v;
- void *vptr = 0;
- int res = SWIG_ConvertPtr(argv[0], &vptr, SWIGTYPE_p__THyPhy, 0);
- _v = SWIG_CheckState(res);
- if (_v) {
- int res = SWIG_AsCharPtrAndSize(argv[1], 0, NULL, 0);
- _v = SWIG_CheckState(res);
- if (_v) {
- {
- int res = SWIG_AsVal_bool(argv[2], NULL);
- _v = SWIG_CheckState(res);
- }
- if (_v) {
- return _wrap__THyPhy_ExecuteBF__SWIG_0(self, args);
- }
- }
- }
- }
-
-fail:
- SWIG_SetErrorMsg(PyExc_NotImplementedError,"Wrong number or type of arguments for overloaded function '_THyPhy_ExecuteBF'.\n"
- " Possible C/C++ prototypes are:\n"
- " _THyPhy::ExecuteBF(char const *,bool)\n"
- " _THyPhy::ExecuteBF(char const *)\n");
- return 0;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhy_InitTHyPhy(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- _ProgressCancelHandler *arg2 = (_ProgressCancelHandler *) 0 ;
- char *arg3 = (char *) 0 ;
- long arg4 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- int res3 ;
- char *buf3 = 0 ;
- int alloc3 = 0 ;
- long val4 ;
- int ecode4 = 0 ;
- PyObject * obj1 = 0 ;
- PyObject * obj2 = 0 ;
- PyObject * obj3 = 0 ;
-
- if (!PyArg_ParseTuple(args,(char *)"OOO:_THyPhy_InitTHyPhy",&obj1,&obj2,&obj3)) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhy, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhy_InitTHyPhy" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- {
- int res = SWIG_ConvertFunctionPtr(obj1, (void**)(&arg2), SWIGTYPE_p_f_p_char_int_double__bool);
- if (!SWIG_IsOK(res)) {
- SWIG_exception_fail(SWIG_ArgError(res), "in method '" "_THyPhy_InitTHyPhy" "', argument " "2"" of type '" "_ProgressCancelHandler *""'");
- }
- }
- res3 = SWIG_AsCharPtrAndSize(obj2, &buf3, NULL, &alloc3);
- if (!SWIG_IsOK(res3)) {
- SWIG_exception_fail(SWIG_ArgError(res3), "in method '" "_THyPhy_InitTHyPhy" "', argument " "3"" of type '" "char const *""'");
- }
- arg3 = reinterpret_cast< char * >(buf3);
- ecode4 = SWIG_AsVal_long(obj3, &val4);
- if (!SWIG_IsOK(ecode4)) {
- SWIG_exception_fail(SWIG_ArgError(ecode4), "in method '" "_THyPhy_InitTHyPhy" "', argument " "4"" of type '" "long""'");
- }
- arg4 = static_cast< long >(val4);
- (arg1)->InitTHyPhy(arg2,(char const *)arg3,arg4);
- resultobj = SWIG_Py_Void();
- if (alloc3 == SWIG_NEWOBJ) delete[] buf3;
- return resultobj;
-fail:
- if (alloc3 == SWIG_NEWOBJ) delete[] buf3;
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhy_ClearAll(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhy, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhy_ClearAll" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- (arg1)->ClearAll();
- resultobj = SWIG_Py_Void();
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhy_AskFor(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- char *arg2 = (char *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- int res2 ;
- char *buf2 = 0 ;
- int alloc2 = 0 ;
- PyObject * obj1 = 0 ;
- void *result = 0 ;
-
- if (!PyArg_ParseTuple(args,(char *)"O:_THyPhy_AskFor",&obj1)) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhy, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhy_AskFor" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- res2 = SWIG_AsCharPtrAndSize(obj1, &buf2, NULL, &alloc2);
- if (!SWIG_IsOK(res2)) {
- SWIG_exception_fail(SWIG_ArgError(res2), "in method '" "_THyPhy_AskFor" "', argument " "2"" of type '" "char const *""'");
- }
- arg2 = reinterpret_cast< char * >(buf2);
- result = (void *)(arg1)->AskFor((char const *)arg2);
- resultobj = SWIG_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p_void, 0 | 0 );
- if (alloc2 == SWIG_NEWOBJ) delete[] buf2;
- return resultobj;
-fail:
- if (alloc2 == SWIG_NEWOBJ) delete[] buf2;
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhy_DumpResult(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- void *arg2 = (void *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- int res2 ;
- PyObject * obj1 = 0 ;
-
- if (!PyArg_ParseTuple(args,(char *)"O:_THyPhy_DumpResult",&obj1)) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhy, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhy_DumpResult" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- res2 = SWIG_ConvertPtr(obj1,SWIG_as_voidptrptr(&arg2), 0, 0);
- if (!SWIG_IsOK(res2)) {
- SWIG_exception_fail(SWIG_ArgError(res2), "in method '" "_THyPhy_DumpResult" "', argument " "2"" of type '" "void *""'");
- }
- (arg1)->DumpResult(arg2);
- resultobj = SWIG_Py_Void();
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhy_CanCast(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- void *arg2 = (void *) 0 ;
- int arg3 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- int res2 ;
- int val3 ;
- int ecode3 = 0 ;
- PyObject * obj1 = 0 ;
- PyObject * obj2 = 0 ;
- bool result;
-
- if (!PyArg_ParseTuple(args,(char *)"OO:_THyPhy_CanCast",&obj1,&obj2)) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhy, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhy_CanCast" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- res2 = SWIG_ConvertPtr(obj1,SWIG_as_voidptrptr(&arg2), 0, 0);
- if (!SWIG_IsOK(res2)) {
- SWIG_exception_fail(SWIG_ArgError(res2), "in method '" "_THyPhy_CanCast" "', argument " "2"" of type '" "void const *""'");
- }
- ecode3 = SWIG_AsVal_int(obj2, &val3);
- if (!SWIG_IsOK(ecode3)) {
- SWIG_exception_fail(SWIG_ArgError(ecode3), "in method '" "_THyPhy_CanCast" "', argument " "3"" of type '" "int""'");
- }
- arg3 = static_cast< int >(val3);
- result = (bool)(arg1)->CanCast((void const *)arg2,arg3);
- resultobj = SWIG_From_bool(static_cast< bool >(result));
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhy_CastResult(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- void *arg2 = (void *) 0 ;
- int arg3 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- int res2 ;
- int val3 ;
- int ecode3 = 0 ;
- PyObject * obj1 = 0 ;
- PyObject * obj2 = 0 ;
- _THyPhyReturnObject *result = 0 ;
-
- if (!PyArg_ParseTuple(args,(char *)"OO:_THyPhy_CastResult",&obj1,&obj2)) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhy, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhy_CastResult" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- res2 = SWIG_ConvertPtr(obj1,SWIG_as_voidptrptr(&arg2), 0, 0);
- if (!SWIG_IsOK(res2)) {
- SWIG_exception_fail(SWIG_ArgError(res2), "in method '" "_THyPhy_CastResult" "', argument " "2"" of type '" "void const *""'");
- }
- ecode3 = SWIG_AsVal_int(obj2, &val3);
- if (!SWIG_IsOK(ecode3)) {
- SWIG_exception_fail(SWIG_ArgError(ecode3), "in method '" "_THyPhy_CastResult" "', argument " "3"" of type '" "int""'");
- }
- arg3 = static_cast< int >(val3);
- result = (_THyPhyReturnObject *)(arg1)->CastResult((void const *)arg2,arg3);
- resultobj = SWIG_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhyReturnObject, 0 | 0 );
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhy_SetCallbackHandler(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- _ProgressCancelHandler *arg2 = (_ProgressCancelHandler *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- PyObject * obj1 = 0 ;
-
- if (!PyArg_ParseTuple(args,(char *)"O:_THyPhy_SetCallbackHandler",&obj1)) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhy, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhy_SetCallbackHandler" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- {
- int res = SWIG_ConvertFunctionPtr(obj1, (void**)(&arg2), SWIGTYPE_p_f_p_char_int_double__bool);
- if (!SWIG_IsOK(res)) {
- SWIG_exception_fail(SWIG_ArgError(res), "in method '" "_THyPhy_SetCallbackHandler" "', argument " "2"" of type '" "_ProgressCancelHandler *""'");
- }
- }
- (arg1)->SetCallbackHandler(arg2);
- resultobj = SWIG_Py_Void();
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhy_GetCallbackHandler(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- _ProgressCancelHandler *result = 0 ;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhy, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhy_GetCallbackHandler" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- result = (_ProgressCancelHandler *)(arg1)->GetCallbackHandler();
- resultobj = SWIG_NewFunctionPtrObj((void *)(result), SWIGTYPE_p_f_p_char_int_double__bool);
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhy_GetWarnings(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- _THyPhyString *result = 0 ;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhy, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhy_GetWarnings" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- result = (_THyPhyString *)(arg1)->GetWarnings();
- resultobj = SWIG_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhyString, 0 | 0 );
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhy_GetErrors(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- _THyPhyString *result = 0 ;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhy, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhy_GetErrors" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- result = (_THyPhyString *)(arg1)->GetErrors();
- resultobj = SWIG_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhyString, 0 | 0 );
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhy_GetStdout(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- _THyPhyString *result = 0 ;
-
- if (args && PyTuple_Check(args) && PyTuple_GET_SIZE(args) > 0) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhy, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhy_GetStdout" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- result = (_THyPhyString *)(arg1)->GetStdout();
- resultobj = SWIG_NewPointerObj(SWIG_as_voidptr(result), SWIGTYPE_p__THyPhyString, 0 | 0 );
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhy_PushWarning(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- void *arg2 = (void *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- int res2 ;
- PyObject * obj1 = 0 ;
-
- if (!PyArg_ParseTuple(args,(char *)"O:_THyPhy_PushWarning",&obj1)) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhy, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhy_PushWarning" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- res2 = SWIG_ConvertPtr(obj1,SWIG_as_voidptrptr(&arg2), 0, 0);
- if (!SWIG_IsOK(res2)) {
- SWIG_exception_fail(SWIG_ArgError(res2), "in method '" "_THyPhy_PushWarning" "', argument " "2"" of type '" "void *""'");
- }
- (arg1)->PushWarning(arg2);
- resultobj = SWIG_Py_Void();
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhy_PushError(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- void *arg2 = (void *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- int res2 ;
- PyObject * obj1 = 0 ;
-
- if (!PyArg_ParseTuple(args,(char *)"O:_THyPhy_PushError",&obj1)) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhy, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhy_PushError" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- res2 = SWIG_ConvertPtr(obj1,SWIG_as_voidptrptr(&arg2), 0, 0);
- if (!SWIG_IsOK(res2)) {
- SWIG_exception_fail(SWIG_ArgError(res2), "in method '" "_THyPhy_PushError" "', argument " "2"" of type '" "void *""'");
- }
- (arg1)->PushError(arg2);
- resultobj = SWIG_Py_Void();
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhy_PushOutString(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- _THyPhy *arg1 = (_THyPhy *) 0 ;
- void *arg2 = (void *) 0 ;
- void *argp1 = 0 ;
- int res1 = 0 ;
- int res2 ;
- PyObject * obj1 = 0 ;
-
- if (!PyArg_ParseTuple(args,(char *)"O:_THyPhy_PushOutString",&obj1)) SWIG_fail;
- res1 = SWIG_ConvertPtr(self, &argp1,SWIGTYPE_p__THyPhy, 0 | 0 );
- if (!SWIG_IsOK(res1)) {
- SWIG_exception_fail(SWIG_ArgError(res1), "in method '" "_THyPhy_PushOutString" "', argument " "1"" of type '" "_THyPhy *""'");
- }
- arg1 = reinterpret_cast< _THyPhy * >(argp1);
- res2 = SWIG_ConvertPtr(obj1,SWIG_as_voidptrptr(&arg2), 0, 0);
- if (!SWIG_IsOK(res2)) {
- SWIG_exception_fail(SWIG_ArgError(res2), "in method '" "_THyPhy_PushOutString" "', argument " "2"" of type '" "void *""'");
- }
- (arg1)->PushOutString(arg2);
- resultobj = SWIG_Py_Void();
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhyGetLongStatus(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- long result;
-
- if (!PyArg_ParseTuple(args,(char *)":_THyPhyGetLongStatus")) SWIG_fail;
- result = (long)_THyPhyGetLongStatus();
- resultobj = SWIG_From_long(static_cast< long >(result));
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhyGetStringStatus(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- char *result = 0 ;
-
- if (!PyArg_ParseTuple(args,(char *)":_THyPhyGetStringStatus")) SWIG_fail;
- result = (char *)_THyPhyGetStringStatus();
- resultobj = SWIG_FromCharPtr((const char *)result);
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN PyObject *_wrap__THyPhyGetDoubleStatus(PyObject *self, PyObject *args) {
- PyObject *resultobj = 0;
- double result;
-
- if (!PyArg_ParseTuple(args,(char *)":_THyPhyGetDoubleStatus")) SWIG_fail;
- result = (double)_THyPhyGetDoubleStatus();
- resultobj = SWIG_From_double(static_cast< double >(result));
- return resultobj;
-fail:
- return NULL;
-}
-
-
-SWIGINTERN int Swig_var_globalInterfaceInstance_set(PyObject *_val) {
- {
- void *argp = 0;
- int res = SWIG_ConvertPtr(_val, &argp, SWIGTYPE_p__THyPhy, 0 );
- if (!SWIG_IsOK(res)) {
- SWIG_exception_fail(SWIG_ArgError(res), "in variable '""globalInterfaceInstance""' of type '""_THyPhy *""'");
- }
- globalInterfaceInstance = reinterpret_cast< _THyPhy * >(argp);
- }
- return 0;
-fail:
- return 1;
-}
-
-
-SWIGINTERN PyObject *Swig_var_globalInterfaceInstance_get(void) {
- PyObject *pyobj = 0;
- PyObject *self = 0;
-
- (void)self;
- pyobj = SWIG_NewPointerObj(SWIG_as_voidptr(globalInterfaceInstance), SWIGTYPE_p__THyPhy, 0 );
- return pyobj;
-}
-
-
-static PyMethodDef SwigMethods[] = {
- { (char *)"SWIG_PyInstanceMethod_New", (PyCFunction)SWIG_PyInstanceMethod_New, METH_O, NULL},
- { (char *)"_THyPhyGetLongStatus", _wrap__THyPhyGetLongStatus, METH_VARARGS, NULL},
- { (char *)"_THyPhyGetStringStatus", _wrap__THyPhyGetStringStatus, METH_VARARGS, NULL},
- { (char *)"_THyPhyGetDoubleStatus", _wrap__THyPhyGetDoubleStatus, METH_VARARGS, NULL},
- { NULL, NULL, 0, NULL }
-};
-
-SWIGPY_DESTRUCTOR_CLOSURE(_wrap_delete__THyPhyReturnObject)
-SWIGINTERN PyGetSetDef SwigPyBuiltin___THyPhyReturnObject_getset[] = {
- {NULL, NULL, NULL, NULL, NULL} /* Sentinel */
-};
-
-SWIGINTERN PyObject *
-SwigPyBuiltin___THyPhyReturnObject_richcompare(PyObject *self, PyObject *other, int op) {
- PyObject *result = NULL;
- PyObject *tuple = PyTuple_New(1);
- assert(tuple);
- PyTuple_SET_ITEM(tuple, 0, other);
- Py_XINCREF(other);
- if (!result) {
- if (SwigPyObject_Check(self) && SwigPyObject_Check(other)) {
- result = SwigPyObject_richcompare((SwigPyObject *)self, (SwigPyObject *)other, op);
- } else {
- result = Py_NotImplemented;
- Py_INCREF(result);
- }
- }
- Py_DECREF(tuple);
- return result;
-}
-
-SWIGINTERN PyMethodDef SwigPyBuiltin___THyPhyReturnObject_methods[] = {
- { "myType", (PyCFunction) _wrap__THyPhyReturnObject_myType, METH_VARARGS, (char*) "" },
- { "castToString", (PyCFunction) _wrap__THyPhyReturnObject_castToString, METH_VARARGS, (char*) "" },
- { "castToNumber", (PyCFunction) _wrap__THyPhyReturnObject_castToNumber, METH_VARARGS, (char*) "" },
- { "castToMatrix", (PyCFunction) _wrap__THyPhyReturnObject_castToMatrix, METH_VARARGS, (char*) "" },
- { NULL, NULL, 0, NULL } /* Sentinel */
-};
-
-static PyHeapTypeObject SwigPyBuiltin___THyPhyReturnObject_type = {
- {
-#if PY_VERSION_HEX >= 0x03000000
- PyVarObject_HEAD_INIT(NULL, 0)
-#else
- PyObject_HEAD_INIT(NULL)
- 0, /* ob_size */
-#endif
- "_THyPhyReturnObject", /* tp_name */
- sizeof(SwigPyObject), /* tp_basicsize */
- 0, /* tp_itemsize */
- (destructor) _wrap_delete__THyPhyReturnObject_closure, /* tp_dealloc */
- (printfunc) 0, /* tp_print */
- (getattrfunc) 0, /* tp_getattr */
- (setattrfunc) 0, /* tp_setattr */
-#if PY_VERSION_HEX >= 0x03000000
- 0, /* tp_compare */
-#else
- (cmpfunc) 0, /* tp_compare */
-#endif
- (reprfunc) 0, /* tp_repr */
- &SwigPyBuiltin___THyPhyReturnObject_type.as_number, /* tp_as_number */
- &SwigPyBuiltin___THyPhyReturnObject_type.as_sequence, /* tp_as_sequence */
- &SwigPyBuiltin___THyPhyReturnObject_type.as_mapping, /* tp_as_mapping */
- (hashfunc) 0, /* tp_hash */
- (ternaryfunc) 0, /* tp_call */
- (reprfunc) 0, /* tp_str */
- (getattrofunc) 0, /* tp_getattro */
- (setattrofunc) 0, /* tp_setattro */
- &SwigPyBuiltin___THyPhyReturnObject_type.as_buffer, /* tp_as_buffer */
-#if PY_VERSION_HEX >= 0x03000000
- Py_TPFLAGS_DEFAULT|Py_TPFLAGS_BASETYPE, /* tp_flags */
-#else
- Py_TPFLAGS_DEFAULT|Py_TPFLAGS_BASETYPE|Py_TPFLAGS_CHECKTYPES, /* tp_flags */
-#endif
- "::_THyPhyReturnObject", /* tp_doc */
- (traverseproc) 0, /* tp_traverse */
- (inquiry) 0, /* tp_clear */
- (richcmpfunc) SwigPyBuiltin___THyPhyReturnObject_richcompare, /* feature:python:tp_richcompare */
- 0, /* tp_weaklistoffset */
- (getiterfunc) 0, /* tp_iter */
- (iternextfunc) 0, /* tp_iternext */
- SwigPyBuiltin___THyPhyReturnObject_methods, /* tp_methods */
- 0, /* tp_members */
- SwigPyBuiltin___THyPhyReturnObject_getset, /* tp_getset */
- 0, /* tp_base */
- 0, /* tp_dict */
- (descrgetfunc) 0, /* tp_descr_get */
- (descrsetfunc) 0, /* tp_descr_set */
- (size_t)(((char*)&((SwigPyObject *) 64L)->dict) - (char*) 64L), /* tp_dictoffset */
- (initproc) SwigPyBuiltin_BadInit, /* tp_init */
- (allocfunc) 0, /* tp_alloc */
- (newfunc) 0, /* tp_new */
- (freefunc) 0, /* tp_free */
- (inquiry) 0, /* tp_is_gc */
- (PyObject*) 0, /* tp_bases */
- (PyObject*) 0, /* tp_mro */
- (PyObject*) 0, /* tp_cache */
- (PyObject*) 0, /* tp_subclasses */
- (PyObject*) 0, /* tp_weaklist */
- (destructor) 0, /* tp_del */
-#if PY_VERSION_HEX >= 0x02060000
- (int) 0, /* tp_version_tag */
-#endif
- },
- {
- (binaryfunc) 0, /* nb_add */
- (binaryfunc) 0, /* nb_subtract */
- (binaryfunc) 0, /* nb_multiply */
-#if PY_VERSION_HEX < 0x03000000
- (binaryfunc) 0, /* nb_divide */
-#endif
- (binaryfunc) 0, /* nb_remainder */
- (binaryfunc) 0, /* nb_divmod */
- (ternaryfunc) 0, /* nb_power */
- (unaryfunc) 0, /* nb_negative */
- (unaryfunc) 0, /* nb_positive */
- (unaryfunc) 0, /* nb_absolute */
- (inquiry) 0, /* nb_nonzero */
- (unaryfunc) 0, /* nb_invert */
- (binaryfunc) 0, /* nb_lshift */
- (binaryfunc) 0, /* nb_rshift */
- (binaryfunc) 0, /* nb_and */
- (binaryfunc) 0, /* nb_xor */
- (binaryfunc) 0, /* nb_or */
-#if PY_VERSION_HEX < 0x03000000
- (coercion) 0, /* nb_coerce */
-#endif
- (unaryfunc) 0, /* nb_int */
-#if PY_VERSION_HEX >= 0x03000000
- (void*) 0, /* nb_reserved */
-#else
- (unaryfunc) 0, /* nb_long */
-#endif
- (unaryfunc) 0, /* nb_float */
-#if PY_VERSION_HEX < 0x03000000
- (unaryfunc) 0, /* nb_oct */
- (unaryfunc) 0, /* nb_hex */
-#endif
- (binaryfunc) 0, /* nb_inplace_add */
- (binaryfunc) 0, /* nb_inplace_subtract */
- (binaryfunc) 0, /* nb_inplace_multiply */
-#if PY_VERSION_HEX < 0x03000000
- (binaryfunc) 0, /* nb_inplace_divide */
-#endif
- (binaryfunc) 0, /* nb_inplace_remainder */
- (ternaryfunc) 0, /* nb_inplace_power */
- (binaryfunc) 0, /* nb_inplace_lshift */
- (binaryfunc) 0, /* nb_inplace_rshift */
- (binaryfunc) 0, /* nb_inplace_and */
- (binaryfunc) 0, /* nb_inplace_xor */
- (binaryfunc) 0, /* nb_inplace_or */
- (binaryfunc) 0, /* nb_floor_divide */
- (binaryfunc) 0, /* nb_true_divide */
- (binaryfunc) 0, /* nb_inplace_floor_divide */
- (binaryfunc) 0, /* nb_inplace_true_divide */
-#if PY_VERSION_HEX >= 0x02050000
- (unaryfunc) 0, /* nb_index */
-#endif
- },
- {
- (lenfunc) 0, /* mp_length */
- (binaryfunc) 0, /* mp_subscript */
- (objobjargproc) 0, /* mp_ass_subscript */
- },
- {
- (lenfunc) 0, /* sq_length */
- (binaryfunc) 0, /* sq_concat */
- (ssizeargfunc) 0, /* sq_repeat */
- (ssizeargfunc) 0, /* sq_item */
-#if PY_VERSION_HEX >= 0x03000000
- (void*) 0, /* was_sq_slice */
-#else
- (ssizessizeargfunc) 0, /* sq_slice */
-#endif
- (ssizeobjargproc) 0, /* sq_ass_item */
-#if PY_VERSION_HEX >= 0x03000000
- (void*) 0, /* was_sq_ass_slice */
-#else
- (ssizessizeobjargproc) 0, /* sq_ass_slice */
-#endif
- (objobjproc) 0, /* sq_contains */
- (binaryfunc) 0, /* sq_inplace_concat */
- (ssizeargfunc) 0, /* sq_inplace_repeat */
- },
- {
-#if PY_VERSION_HEX < 0x03000000
- (readbufferproc) 0, /* bf_getreadbuffer */
- (writebufferproc) 0, /* bf_getwritebuffer */
- (segcountproc) 0, /* bf_getsegcount */
- (charbufferproc) 0, /* bf_getcharbuffer */
-#endif
-#if PY_VERSION_HEX >= 0x02060000
- (getbufferproc) 0, /* bf_getbuffer */
- (releasebufferproc) 0, /* bf_releasebuffer */
-#endif
- },
- (PyObject*) 0, /* ht_name */
- (PyObject*) 0, /* ht_slots */
-};
-
-SWIGINTERN SwigPyClientData SwigPyBuiltin___THyPhyReturnObject_clientdata = {0, 0, 0, 0, 0, 0, (PyTypeObject *)&SwigPyBuiltin___THyPhyReturnObject_type};
-
-SWIGPY_DESTRUCTOR_CLOSURE(_wrap_delete__THyPhyString)
-static SwigPyGetSet _THyPhyString_sData_getset = { _wrap__THyPhyString_sData_get, _wrap__THyPhyString_sData_set };
-static SwigPyGetSet _THyPhyString_sLength_getset = { _wrap__THyPhyString_sLength_get, _wrap__THyPhyString_sLength_set };
-SWIGINTERN PyGetSetDef SwigPyBuiltin___THyPhyString_getset[] = {
- { (char*) "sData", (getter) SwigPyBuiltin_GetterClosure, (setter) SwigPyBuiltin_SetterClosure, (char*)"_THyPhyString.sData", (void*) &_THyPhyString_sData_getset }
-,
- { (char*) "sLength", (getter) SwigPyBuiltin_GetterClosure, (setter) SwigPyBuiltin_SetterClosure, (char*)"_THyPhyString.sLength", (void*) &_THyPhyString_sLength_getset }
-,
- {NULL, NULL, NULL, NULL, NULL} /* Sentinel */
-};
-
-SWIGINTERN PyObject *
-SwigPyBuiltin___THyPhyString_richcompare(PyObject *self, PyObject *other, int op) {
- PyObject *result = NULL;
- PyObject *tuple = PyTuple_New(1);
- assert(tuple);
- PyTuple_SET_ITEM(tuple, 0, other);
- Py_XINCREF(other);
- if (!result) {
- if (SwigPyObject_Check(self) && SwigPyObject_Check(other)) {
- result = SwigPyObject_richcompare((SwigPyObject *)self, (SwigPyObject *)other, op);
- } else {
- result = Py_NotImplemented;
- Py_INCREF(result);
- }
- }
- Py_DECREF(tuple);
- return result;
-}
-
-SWIGINTERN PyMethodDef SwigPyBuiltin___THyPhyString_methods[] = {
- { "myType", (PyCFunction) _wrap__THyPhyString_myType, METH_VARARGS, (char*) "" },
- { NULL, NULL, 0, NULL } /* Sentinel */
-};
-
-static PyHeapTypeObject SwigPyBuiltin___THyPhyString_type = {
- {
-#if PY_VERSION_HEX >= 0x03000000
- PyVarObject_HEAD_INIT(NULL, 0)
-#else
- PyObject_HEAD_INIT(NULL)
- 0, /* ob_size */
-#endif
- "_THyPhyString", /* tp_name */
- sizeof(SwigPyObject), /* tp_basicsize */
- 0, /* tp_itemsize */
- (destructor) _wrap_delete__THyPhyString_closure, /* tp_dealloc */
- (printfunc) 0, /* tp_print */
- (getattrfunc) 0, /* tp_getattr */
- (setattrfunc) 0, /* tp_setattr */
-#if PY_VERSION_HEX >= 0x03000000
- 0, /* tp_compare */
-#else
- (cmpfunc) 0, /* tp_compare */
-#endif
- (reprfunc) 0, /* tp_repr */
- &SwigPyBuiltin___THyPhyString_type.as_number, /* tp_as_number */
- &SwigPyBuiltin___THyPhyString_type.as_sequence, /* tp_as_sequence */
- &SwigPyBuiltin___THyPhyString_type.as_mapping, /* tp_as_mapping */
- (hashfunc) 0, /* tp_hash */
- (ternaryfunc) 0, /* tp_call */
- (reprfunc) 0, /* tp_str */
- (getattrofunc) 0, /* tp_getattro */
- (setattrofunc) 0, /* tp_setattro */
- &SwigPyBuiltin___THyPhyString_type.as_buffer, /* tp_as_buffer */
-#if PY_VERSION_HEX >= 0x03000000
- Py_TPFLAGS_DEFAULT|Py_TPFLAGS_BASETYPE, /* tp_flags */
-#else
- Py_TPFLAGS_DEFAULT|Py_TPFLAGS_BASETYPE|Py_TPFLAGS_CHECKTYPES, /* tp_flags */
-#endif
- "::_THyPhyString", /* tp_doc */
- (traverseproc) 0, /* tp_traverse */
- (inquiry) 0, /* tp_clear */
- (richcmpfunc) SwigPyBuiltin___THyPhyString_richcompare, /* feature:python:tp_richcompare */
- 0, /* tp_weaklistoffset */
- (getiterfunc) 0, /* tp_iter */
- (iternextfunc) 0, /* tp_iternext */
- SwigPyBuiltin___THyPhyString_methods, /* tp_methods */
- 0, /* tp_members */
- SwigPyBuiltin___THyPhyString_getset, /* tp_getset */
- 0, /* tp_base */
- 0, /* tp_dict */
- (descrgetfunc) 0, /* tp_descr_get */
- (descrsetfunc) 0, /* tp_descr_set */
- (size_t)(((char*)&((SwigPyObject *) 64L)->dict) - (char*) 64L), /* tp_dictoffset */
- (initproc) _wrap_new__THyPhyString, /* tp_init */
- (allocfunc) 0, /* tp_alloc */
- (newfunc) 0, /* tp_new */
- (freefunc) 0, /* tp_free */
- (inquiry) 0, /* tp_is_gc */
- (PyObject*) 0, /* tp_bases */
- (PyObject*) 0, /* tp_mro */
- (PyObject*) 0, /* tp_cache */
- (PyObject*) 0, /* tp_subclasses */
- (PyObject*) 0, /* tp_weaklist */
- (destructor) 0, /* tp_del */
-#if PY_VERSION_HEX >= 0x02060000
- (int) 0, /* tp_version_tag */
-#endif
- },
- {
- (binaryfunc) 0, /* nb_add */
- (binaryfunc) 0, /* nb_subtract */
- (binaryfunc) 0, /* nb_multiply */
-#if PY_VERSION_HEX < 0x03000000
- (binaryfunc) 0, /* nb_divide */
-#endif
- (binaryfunc) 0, /* nb_remainder */
- (binaryfunc) 0, /* nb_divmod */
- (ternaryfunc) 0, /* nb_power */
- (unaryfunc) 0, /* nb_negative */
- (unaryfunc) 0, /* nb_positive */
- (unaryfunc) 0, /* nb_absolute */
- (inquiry) 0, /* nb_nonzero */
- (unaryfunc) 0, /* nb_invert */
- (binaryfunc) 0, /* nb_lshift */
- (binaryfunc) 0, /* nb_rshift */
- (binaryfunc) 0, /* nb_and */
- (binaryfunc) 0, /* nb_xor */
- (binaryfunc) 0, /* nb_or */
-#if PY_VERSION_HEX < 0x03000000
- (coercion) 0, /* nb_coerce */
-#endif
- (unaryfunc) 0, /* nb_int */
-#if PY_VERSION_HEX >= 0x03000000
- (void*) 0, /* nb_reserved */
-#else
- (unaryfunc) 0, /* nb_long */
-#endif
- (unaryfunc) 0, /* nb_float */
-#if PY_VERSION_HEX < 0x03000000
- (unaryfunc) 0, /* nb_oct */
- (unaryfunc) 0, /* nb_hex */
-#endif
- (binaryfunc) 0, /* nb_inplace_add */
- (binaryfunc) 0, /* nb_inplace_subtract */
- (binaryfunc) 0, /* nb_inplace_multiply */
-#if PY_VERSION_HEX < 0x03000000
- (binaryfunc) 0, /* nb_inplace_divide */
-#endif
- (binaryfunc) 0, /* nb_inplace_remainder */
- (ternaryfunc) 0, /* nb_inplace_power */
- (binaryfunc) 0, /* nb_inplace_lshift */
- (binaryfunc) 0, /* nb_inplace_rshift */
- (binaryfunc) 0, /* nb_inplace_and */
- (binaryfunc) 0, /* nb_inplace_xor */
- (binaryfunc) 0, /* nb_inplace_or */
- (binaryfunc) 0, /* nb_floor_divide */
- (binaryfunc) 0, /* nb_true_divide */
- (binaryfunc) 0, /* nb_inplace_floor_divide */
- (binaryfunc) 0, /* nb_inplace_true_divide */
-#if PY_VERSION_HEX >= 0x02050000
- (unaryfunc) 0, /* nb_index */
-#endif
- },
- {
- (lenfunc) 0, /* mp_length */
- (binaryfunc) 0, /* mp_subscript */
- (objobjargproc) 0, /* mp_ass_subscript */
- },
- {
- (lenfunc) 0, /* sq_length */
- (binaryfunc) 0, /* sq_concat */
- (ssizeargfunc) 0, /* sq_repeat */
- (ssizeargfunc) 0, /* sq_item */
-#if PY_VERSION_HEX >= 0x03000000
- (void*) 0, /* was_sq_slice */
-#else
- (ssizessizeargfunc) 0, /* sq_slice */
-#endif
- (ssizeobjargproc) 0, /* sq_ass_item */
-#if PY_VERSION_HEX >= 0x03000000
- (void*) 0, /* was_sq_ass_slice */
-#else
- (ssizessizeobjargproc) 0, /* sq_ass_slice */
-#endif
- (objobjproc) 0, /* sq_contains */
- (binaryfunc) 0, /* sq_inplace_concat */
- (ssizeargfunc) 0, /* sq_inplace_repeat */
- },
- {
-#if PY_VERSION_HEX < 0x03000000
- (readbufferproc) 0, /* bf_getreadbuffer */
- (writebufferproc) 0, /* bf_getwritebuffer */
- (segcountproc) 0, /* bf_getsegcount */
- (charbufferproc) 0, /* bf_getcharbuffer */
-#endif
-#if PY_VERSION_HEX >= 0x02060000
- (getbufferproc) 0, /* bf_getbuffer */
- (releasebufferproc) 0, /* bf_releasebuffer */
-#endif
- },
- (PyObject*) 0, /* ht_name */
- (PyObject*) 0, /* ht_slots */
-};
-
-SWIGINTERN SwigPyClientData SwigPyBuiltin___THyPhyString_clientdata = {0, 0, 0, 0, 0, 0, (PyTypeObject *)&SwigPyBuiltin___THyPhyString_type};
-
-SWIGPY_DESTRUCTOR_CLOSURE(_wrap_delete__THyPhyNumber)
-static SwigPyGetSet _THyPhyNumber_nValue_getset = { _wrap__THyPhyNumber_nValue_get, _wrap__THyPhyNumber_nValue_set };
-SWIGINTERN PyGetSetDef SwigPyBuiltin___THyPhyNumber_getset[] = {
- { (char*) "nValue", (getter) SwigPyBuiltin_GetterClosure, (setter) SwigPyBuiltin_SetterClosure, (char*)"_THyPhyNumber.nValue", (void*) &_THyPhyNumber_nValue_getset }
-,
- {NULL, NULL, NULL, NULL, NULL} /* Sentinel */
-};
-
-SWIGINTERN PyObject *
-SwigPyBuiltin___THyPhyNumber_richcompare(PyObject *self, PyObject *other, int op) {
- PyObject *result = NULL;
- PyObject *tuple = PyTuple_New(1);
- assert(tuple);
- PyTuple_SET_ITEM(tuple, 0, other);
- Py_XINCREF(other);
- if (!result) {
- if (SwigPyObject_Check(self) && SwigPyObject_Check(other)) {
- result = SwigPyObject_richcompare((SwigPyObject *)self, (SwigPyObject *)other, op);
- } else {
- result = Py_NotImplemented;
- Py_INCREF(result);
- }
- }
- Py_DECREF(tuple);
- return result;
-}
-
-SWIGINTERN PyMethodDef SwigPyBuiltin___THyPhyNumber_methods[] = {
- { "myType", (PyCFunction) _wrap__THyPhyNumber_myType, METH_VARARGS, (char*) "" },
- { NULL, NULL, 0, NULL } /* Sentinel */
-};
-
-static PyHeapTypeObject SwigPyBuiltin___THyPhyNumber_type = {
- {
-#if PY_VERSION_HEX >= 0x03000000
- PyVarObject_HEAD_INIT(NULL, 0)
-#else
- PyObject_HEAD_INIT(NULL)
- 0, /* ob_size */
-#endif
- "_THyPhyNumber", /* tp_name */
- sizeof(SwigPyObject), /* tp_basicsize */
- 0, /* tp_itemsize */
- (destructor) _wrap_delete__THyPhyNumber_closure, /* tp_dealloc */
- (printfunc) 0, /* tp_print */
- (getattrfunc) 0, /* tp_getattr */
- (setattrfunc) 0, /* tp_setattr */
-#if PY_VERSION_HEX >= 0x03000000
- 0, /* tp_compare */
-#else
- (cmpfunc) 0, /* tp_compare */
-#endif
- (reprfunc) 0, /* tp_repr */
- &SwigPyBuiltin___THyPhyNumber_type.as_number, /* tp_as_number */
- &SwigPyBuiltin___THyPhyNumber_type.as_sequence, /* tp_as_sequence */
- &SwigPyBuiltin___THyPhyNumber_type.as_mapping, /* tp_as_mapping */
- (hashfunc) 0, /* tp_hash */
- (ternaryfunc) 0, /* tp_call */
- (reprfunc) 0, /* tp_str */
- (getattrofunc) 0, /* tp_getattro */
- (setattrofunc) 0, /* tp_setattro */
- &SwigPyBuiltin___THyPhyNumber_type.as_buffer, /* tp_as_buffer */
-#if PY_VERSION_HEX >= 0x03000000
- Py_TPFLAGS_DEFAULT|Py_TPFLAGS_BASETYPE, /* tp_flags */
-#else
- Py_TPFLAGS_DEFAULT|Py_TPFLAGS_BASETYPE|Py_TPFLAGS_CHECKTYPES, /* tp_flags */
-#endif
- "::_THyPhyNumber", /* tp_doc */
- (traverseproc) 0, /* tp_traverse */
- (inquiry) 0, /* tp_clear */
- (richcmpfunc) SwigPyBuiltin___THyPhyNumber_richcompare, /* feature:python:tp_richcompare */
- 0, /* tp_weaklistoffset */
- (getiterfunc) 0, /* tp_iter */
- (iternextfunc) 0, /* tp_iternext */
- SwigPyBuiltin___THyPhyNumber_methods, /* tp_methods */
- 0, /* tp_members */
- SwigPyBuiltin___THyPhyNumber_getset, /* tp_getset */
- 0, /* tp_base */
- 0, /* tp_dict */
- (descrgetfunc) 0, /* tp_descr_get */
- (descrsetfunc) 0, /* tp_descr_set */
- (size_t)(((char*)&((SwigPyObject *) 64L)->dict) - (char*) 64L), /* tp_dictoffset */
- (initproc) _wrap_new__THyPhyNumber, /* tp_init */
- (allocfunc) 0, /* tp_alloc */
- (newfunc) 0, /* tp_new */
- (freefunc) 0, /* tp_free */
- (inquiry) 0, /* tp_is_gc */
- (PyObject*) 0, /* tp_bases */
- (PyObject*) 0, /* tp_mro */
- (PyObject*) 0, /* tp_cache */
- (PyObject*) 0, /* tp_subclasses */
- (PyObject*) 0, /* tp_weaklist */
- (destructor) 0, /* tp_del */
-#if PY_VERSION_HEX >= 0x02060000
- (int) 0, /* tp_version_tag */
-#endif
- },
- {
- (binaryfunc) 0, /* nb_add */
- (binaryfunc) 0, /* nb_subtract */
- (binaryfunc) 0, /* nb_multiply */
-#if PY_VERSION_HEX < 0x03000000
- (binaryfunc) 0, /* nb_divide */
-#endif
- (binaryfunc) 0, /* nb_remainder */
- (binaryfunc) 0, /* nb_divmod */
- (ternaryfunc) 0, /* nb_power */
- (unaryfunc) 0, /* nb_negative */
- (unaryfunc) 0, /* nb_positive */
- (unaryfunc) 0, /* nb_absolute */
- (inquiry) 0, /* nb_nonzero */
- (unaryfunc) 0, /* nb_invert */
- (binaryfunc) 0, /* nb_lshift */
- (binaryfunc) 0, /* nb_rshift */
- (binaryfunc) 0, /* nb_and */
- (binaryfunc) 0, /* nb_xor */
- (binaryfunc) 0, /* nb_or */
-#if PY_VERSION_HEX < 0x03000000
- (coercion) 0, /* nb_coerce */
-#endif
- (unaryfunc) 0, /* nb_int */
-#if PY_VERSION_HEX >= 0x03000000
- (void*) 0, /* nb_reserved */
-#else
- (unaryfunc) 0, /* nb_long */
-#endif
- (unaryfunc) 0, /* nb_float */
-#if PY_VERSION_HEX < 0x03000000
- (unaryfunc) 0, /* nb_oct */
- (unaryfunc) 0, /* nb_hex */
-#endif
- (binaryfunc) 0, /* nb_inplace_add */
- (binaryfunc) 0, /* nb_inplace_subtract */
- (binaryfunc) 0, /* nb_inplace_multiply */
-#if PY_VERSION_HEX < 0x03000000
- (binaryfunc) 0, /* nb_inplace_divide */
-#endif
- (binaryfunc) 0, /* nb_inplace_remainder */
- (ternaryfunc) 0, /* nb_inplace_power */
- (binaryfunc) 0, /* nb_inplace_lshift */
- (binaryfunc) 0, /* nb_inplace_rshift */
- (binaryfunc) 0, /* nb_inplace_and */
- (binaryfunc) 0, /* nb_inplace_xor */
- (binaryfunc) 0, /* nb_inplace_or */
- (binaryfunc) 0, /* nb_floor_divide */
- (binaryfunc) 0, /* nb_true_divide */
- (binaryfunc) 0, /* nb_inplace_floor_divide */
- (binaryfunc) 0, /* nb_inplace_true_divide */
-#if PY_VERSION_HEX >= 0x02050000
- (unaryfunc) 0, /* nb_index */
-#endif
- },
- {
- (lenfunc) 0, /* mp_length */
- (binaryfunc) 0, /* mp_subscript */
- (objobjargproc) 0, /* mp_ass_subscript */
- },
- {
- (lenfunc) 0, /* sq_length */
- (binaryfunc) 0, /* sq_concat */
- (ssizeargfunc) 0, /* sq_repeat */
- (ssizeargfunc) 0, /* sq_item */
-#if PY_VERSION_HEX >= 0x03000000
- (void*) 0, /* was_sq_slice */
-#else
- (ssizessizeargfunc) 0, /* sq_slice */
-#endif
- (ssizeobjargproc) 0, /* sq_ass_item */
-#if PY_VERSION_HEX >= 0x03000000
- (void*) 0, /* was_sq_ass_slice */
-#else
- (ssizessizeobjargproc) 0, /* sq_ass_slice */
-#endif
- (objobjproc) 0, /* sq_contains */
- (binaryfunc) 0, /* sq_inplace_concat */
- (ssizeargfunc) 0, /* sq_inplace_repeat */
- },
- {
-#if PY_VERSION_HEX < 0x03000000
- (readbufferproc) 0, /* bf_getreadbuffer */
- (writebufferproc) 0, /* bf_getwritebuffer */
- (segcountproc) 0, /* bf_getsegcount */
- (charbufferproc) 0, /* bf_getcharbuffer */
-#endif
-#if PY_VERSION_HEX >= 0x02060000
- (getbufferproc) 0, /* bf_getbuffer */
- (releasebufferproc) 0, /* bf_releasebuffer */
-#endif
- },
- (PyObject*) 0, /* ht_name */
- (PyObject*) 0, /* ht_slots */
-};
-
-SWIGINTERN SwigPyClientData SwigPyBuiltin___THyPhyNumber_clientdata = {0, 0, 0, 0, 0, 0, (PyTypeObject *)&SwigPyBuiltin___THyPhyNumber_type};
-
-SWIGPY_DESTRUCTOR_CLOSURE(_wrap_delete__THyPhyMatrix)
-static SwigPyGetSet _THyPhyMatrix_mRows_getset = { _wrap__THyPhyMatrix_mRows_get, _wrap__THyPhyMatrix_mRows_set };
-static SwigPyGetSet _THyPhyMatrix_mCols_getset = { _wrap__THyPhyMatrix_mCols_get, _wrap__THyPhyMatrix_mCols_set };
-static SwigPyGetSet _THyPhyMatrix_mData_getset = { _wrap__THyPhyMatrix_mData_get, _wrap__THyPhyMatrix_mData_set };
-SWIGINTERN PyGetSetDef SwigPyBuiltin___THyPhyMatrix_getset[] = {
- { (char*) "mRows", (getter) SwigPyBuiltin_GetterClosure, (setter) SwigPyBuiltin_SetterClosure, (char*)"_THyPhyMatrix.mRows", (void*) &_THyPhyMatrix_mRows_getset }
-,
- { (char*) "mCols", (getter) SwigPyBuiltin_GetterClosure, (setter) SwigPyBuiltin_SetterClosure, (char*)"_THyPhyMatrix.mCols", (void*) &_THyPhyMatrix_mCols_getset }
-,
- { (char*) "mData", (getter) SwigPyBuiltin_GetterClosure, (setter) SwigPyBuiltin_SetterClosure, (char*)"_THyPhyMatrix.mData", (void*) &_THyPhyMatrix_mData_getset }
-,
- {NULL, NULL, NULL, NULL, NULL} /* Sentinel */
-};
-
-SWIGINTERN PyObject *
-SwigPyBuiltin___THyPhyMatrix_richcompare(PyObject *self, PyObject *other, int op) {
- PyObject *result = NULL;
- PyObject *tuple = PyTuple_New(1);
- assert(tuple);
- PyTuple_SET_ITEM(tuple, 0, other);
- Py_XINCREF(other);
- if (!result) {
- if (SwigPyObject_Check(self) && SwigPyObject_Check(other)) {
- result = SwigPyObject_richcompare((SwigPyObject *)self, (SwigPyObject *)other, op);
- } else {
- result = Py_NotImplemented;
- Py_INCREF(result);
- }
- }
- Py_DECREF(tuple);
- return result;
-}
-
-SWIGINTERN PyMethodDef SwigPyBuiltin___THyPhyMatrix_methods[] = {
- { "myType", (PyCFunction) _wrap__THyPhyMatrix_myType, METH_VARARGS, (char*) "" },
- { "MatrixCell", (PyCFunction) _wrap__THyPhyMatrix_MatrixCell, METH_VARARGS, (char*) "" },
- { NULL, NULL, 0, NULL } /* Sentinel */
-};
-
-static PyHeapTypeObject SwigPyBuiltin___THyPhyMatrix_type = {
- {
-#if PY_VERSION_HEX >= 0x03000000
- PyVarObject_HEAD_INIT(NULL, 0)
-#else
- PyObject_HEAD_INIT(NULL)
- 0, /* ob_size */
-#endif
- "_THyPhyMatrix", /* tp_name */
- sizeof(SwigPyObject), /* tp_basicsize */
- 0, /* tp_itemsize */
- (destructor) _wrap_delete__THyPhyMatrix_closure, /* tp_dealloc */
- (printfunc) 0, /* tp_print */
- (getattrfunc) 0, /* tp_getattr */
- (setattrfunc) 0, /* tp_setattr */
-#if PY_VERSION_HEX >= 0x03000000
- 0, /* tp_compare */
-#else
- (cmpfunc) 0, /* tp_compare */
-#endif
- (reprfunc) 0, /* tp_repr */
- &SwigPyBuiltin___THyPhyMatrix_type.as_number, /* tp_as_number */
- &SwigPyBuiltin___THyPhyMatrix_type.as_sequence, /* tp_as_sequence */
- &SwigPyBuiltin___THyPhyMatrix_type.as_mapping, /* tp_as_mapping */
- (hashfunc) 0, /* tp_hash */
- (ternaryfunc) 0, /* tp_call */
- (reprfunc) 0, /* tp_str */
- (getattrofunc) 0, /* tp_getattro */
- (setattrofunc) 0, /* tp_setattro */
- &SwigPyBuiltin___THyPhyMatrix_type.as_buffer, /* tp_as_buffer */
-#if PY_VERSION_HEX >= 0x03000000
- Py_TPFLAGS_DEFAULT|Py_TPFLAGS_BASETYPE, /* tp_flags */
-#else
- Py_TPFLAGS_DEFAULT|Py_TPFLAGS_BASETYPE|Py_TPFLAGS_CHECKTYPES, /* tp_flags */
-#endif
- "::_THyPhyMatrix", /* tp_doc */
- (traverseproc) 0, /* tp_traverse */
- (inquiry) 0, /* tp_clear */
- (richcmpfunc) SwigPyBuiltin___THyPhyMatrix_richcompare, /* feature:python:tp_richcompare */
- 0, /* tp_weaklistoffset */
- (getiterfunc) 0, /* tp_iter */
- (iternextfunc) 0, /* tp_iternext */
- SwigPyBuiltin___THyPhyMatrix_methods, /* tp_methods */
- 0, /* tp_members */
- SwigPyBuiltin___THyPhyMatrix_getset, /* tp_getset */
- 0, /* tp_base */
- 0, /* tp_dict */
- (descrgetfunc) 0, /* tp_descr_get */
- (descrsetfunc) 0, /* tp_descr_set */
- (size_t)(((char*)&((SwigPyObject *) 64L)->dict) - (char*) 64L), /* tp_dictoffset */
- (initproc) _wrap_new__THyPhyMatrix, /* tp_init */
- (allocfunc) 0, /* tp_alloc */
- (newfunc) 0, /* tp_new */
- (freefunc) 0, /* tp_free */
- (inquiry) 0, /* tp_is_gc */
- (PyObject*) 0, /* tp_bases */
- (PyObject*) 0, /* tp_mro */
- (PyObject*) 0, /* tp_cache */
- (PyObject*) 0, /* tp_subclasses */
- (PyObject*) 0, /* tp_weaklist */
- (destructor) 0, /* tp_del */
-#if PY_VERSION_HEX >= 0x02060000
- (int) 0, /* tp_version_tag */
-#endif
- },
- {
- (binaryfunc) 0, /* nb_add */
- (binaryfunc) 0, /* nb_subtract */
- (binaryfunc) 0, /* nb_multiply */
-#if PY_VERSION_HEX < 0x03000000
- (binaryfunc) 0, /* nb_divide */
-#endif
- (binaryfunc) 0, /* nb_remainder */
- (binaryfunc) 0, /* nb_divmod */
- (ternaryfunc) 0, /* nb_power */
- (unaryfunc) 0, /* nb_negative */
- (unaryfunc) 0, /* nb_positive */
- (unaryfunc) 0, /* nb_absolute */
- (inquiry) 0, /* nb_nonzero */
- (unaryfunc) 0, /* nb_invert */
- (binaryfunc) 0, /* nb_lshift */
- (binaryfunc) 0, /* nb_rshift */
- (binaryfunc) 0, /* nb_and */
- (binaryfunc) 0, /* nb_xor */
- (binaryfunc) 0, /* nb_or */
-#if PY_VERSION_HEX < 0x03000000
- (coercion) 0, /* nb_coerce */
-#endif
- (unaryfunc) 0, /* nb_int */
-#if PY_VERSION_HEX >= 0x03000000
- (void*) 0, /* nb_reserved */
-#else
- (unaryfunc) 0, /* nb_long */
-#endif
- (unaryfunc) 0, /* nb_float */
-#if PY_VERSION_HEX < 0x03000000
- (unaryfunc) 0, /* nb_oct */
- (unaryfunc) 0, /* nb_hex */
-#endif
- (binaryfunc) 0, /* nb_inplace_add */
- (binaryfunc) 0, /* nb_inplace_subtract */
- (binaryfunc) 0, /* nb_inplace_multiply */
-#if PY_VERSION_HEX < 0x03000000
- (binaryfunc) 0, /* nb_inplace_divide */
-#endif
- (binaryfunc) 0, /* nb_inplace_remainder */
- (ternaryfunc) 0, /* nb_inplace_power */
- (binaryfunc) 0, /* nb_inplace_lshift */
- (binaryfunc) 0, /* nb_inplace_rshift */
- (binaryfunc) 0, /* nb_inplace_and */
- (binaryfunc) 0, /* nb_inplace_xor */
- (binaryfunc) 0, /* nb_inplace_or */
- (binaryfunc) 0, /* nb_floor_divide */
- (binaryfunc) 0, /* nb_true_divide */
- (binaryfunc) 0, /* nb_inplace_floor_divide */
- (binaryfunc) 0, /* nb_inplace_true_divide */
-#if PY_VERSION_HEX >= 0x02050000
- (unaryfunc) 0, /* nb_index */
-#endif
- },
- {
- (lenfunc) 0, /* mp_length */
- (binaryfunc) 0, /* mp_subscript */
- (objobjargproc) 0, /* mp_ass_subscript */
- },
- {
- (lenfunc) 0, /* sq_length */
- (binaryfunc) 0, /* sq_concat */
- (ssizeargfunc) 0, /* sq_repeat */
- (ssizeargfunc) 0, /* sq_item */
-#if PY_VERSION_HEX >= 0x03000000
- (void*) 0, /* was_sq_slice */
-#else
- (ssizessizeargfunc) 0, /* sq_slice */
-#endif
- (ssizeobjargproc) 0, /* sq_ass_item */
-#if PY_VERSION_HEX >= 0x03000000
- (void*) 0, /* was_sq_ass_slice */
-#else
- (ssizessizeobjargproc) 0, /* sq_ass_slice */
-#endif
- (objobjproc) 0, /* sq_contains */
- (binaryfunc) 0, /* sq_inplace_concat */
- (ssizeargfunc) 0, /* sq_inplace_repeat */
- },
- {
-#if PY_VERSION_HEX < 0x03000000
- (readbufferproc) 0, /* bf_getreadbuffer */
- (writebufferproc) 0, /* bf_getwritebuffer */
- (segcountproc) 0, /* bf_getsegcount */
- (charbufferproc) 0, /* bf_getcharbuffer */
-#endif
-#if PY_VERSION_HEX >= 0x02060000
- (getbufferproc) 0, /* bf_getbuffer */
- (releasebufferproc) 0, /* bf_releasebuffer */
-#endif
- },
- (PyObject*) 0, /* ht_name */
- (PyObject*) 0, /* ht_slots */
-};
-
-SWIGINTERN SwigPyClientData SwigPyBuiltin___THyPhyMatrix_clientdata = {0, 0, 0, 0, 0, 0, (PyTypeObject *)&SwigPyBuiltin___THyPhyMatrix_type};
-
-SWIGPY_DESTRUCTOR_CLOSURE(_wrap_delete__THyPhy)
-SWIGINTERN PyGetSetDef SwigPyBuiltin___THyPhy_getset[] = {
- {NULL, NULL, NULL, NULL, NULL} /* Sentinel */
-};
-
-SWIGINTERN PyObject *
-SwigPyBuiltin___THyPhy_richcompare(PyObject *self, PyObject *other, int op) {
- PyObject *result = NULL;
- PyObject *tuple = PyTuple_New(1);
- assert(tuple);
- PyTuple_SET_ITEM(tuple, 0, other);
- Py_XINCREF(other);
- if (!result) {
- if (SwigPyObject_Check(self) && SwigPyObject_Check(other)) {
- result = SwigPyObject_richcompare((SwigPyObject *)self, (SwigPyObject *)other, op);
- } else {
- result = Py_NotImplemented;
- Py_INCREF(result);
- }
- }
- Py_DECREF(tuple);
- return result;
-}
-
-SWIGINTERN PyMethodDef SwigPyBuiltin___THyPhy_methods[] = {
- { "ExecuteBF", (PyCFunction) _wrap__THyPhy_ExecuteBF, METH_VARARGS, (char*) "" },
- { "InitTHyPhy", (PyCFunction) _wrap__THyPhy_InitTHyPhy, METH_VARARGS, (char*) "" },
- { "ClearAll", (PyCFunction) _wrap__THyPhy_ClearAll, METH_VARARGS, (char*) "" },
- { "AskFor", (PyCFunction) _wrap__THyPhy_AskFor, METH_VARARGS, (char*) "" },
- { "DumpResult", (PyCFunction) _wrap__THyPhy_DumpResult, METH_VARARGS, (char*) "" },
- { "CanCast", (PyCFunction) _wrap__THyPhy_CanCast, METH_VARARGS, (char*) "" },
- { "CastResult", (PyCFunction) _wrap__THyPhy_CastResult, METH_VARARGS, (char*) "" },
- { "SetCallbackHandler", (PyCFunction) _wrap__THyPhy_SetCallbackHandler, METH_VARARGS, (char*) "" },
- { "GetCallbackHandler", (PyCFunction) _wrap__THyPhy_GetCallbackHandler, METH_VARARGS, (char*) "" },
- { "GetWarnings", (PyCFunction) _wrap__THyPhy_GetWarnings, METH_VARARGS, (char*) "" },
- { "GetErrors", (PyCFunction) _wrap__THyPhy_GetErrors, METH_VARARGS, (char*) "" },
- { "GetStdout", (PyCFunction) _wrap__THyPhy_GetStdout, METH_VARARGS, (char*) "" },
- { "PushWarning", (PyCFunction) _wrap__THyPhy_PushWarning, METH_VARARGS, (char*) "" },
- { "PushError", (PyCFunction) _wrap__THyPhy_PushError, METH_VARARGS, (char*) "" },
- { "PushOutString", (PyCFunction) _wrap__THyPhy_PushOutString, METH_VARARGS, (char*) "" },
- { NULL, NULL, 0, NULL } /* Sentinel */
-};
-
-static PyHeapTypeObject SwigPyBuiltin___THyPhy_type = {
- {
-#if PY_VERSION_HEX >= 0x03000000
- PyVarObject_HEAD_INIT(NULL, 0)
-#else
- PyObject_HEAD_INIT(NULL)
- 0, /* ob_size */
-#endif
- "_THyPhy", /* tp_name */
- sizeof(SwigPyObject), /* tp_basicsize */
- 0, /* tp_itemsize */
- (destructor) _wrap_delete__THyPhy_closure, /* tp_dealloc */
- (printfunc) 0, /* tp_print */
- (getattrfunc) 0, /* tp_getattr */
- (setattrfunc) 0, /* tp_setattr */
-#if PY_VERSION_HEX >= 0x03000000
- 0, /* tp_compare */
-#else
- (cmpfunc) 0, /* tp_compare */
-#endif
- (reprfunc) 0, /* tp_repr */
- &SwigPyBuiltin___THyPhy_type.as_number, /* tp_as_number */
- &SwigPyBuiltin___THyPhy_type.as_sequence, /* tp_as_sequence */
- &SwigPyBuiltin___THyPhy_type.as_mapping, /* tp_as_mapping */
- (hashfunc) 0, /* tp_hash */
- (ternaryfunc) 0, /* tp_call */
- (reprfunc) 0, /* tp_str */
- (getattrofunc) 0, /* tp_getattro */
- (setattrofunc) 0, /* tp_setattro */
- &SwigPyBuiltin___THyPhy_type.as_buffer, /* tp_as_buffer */
-#if PY_VERSION_HEX >= 0x03000000
- Py_TPFLAGS_DEFAULT|Py_TPFLAGS_BASETYPE, /* tp_flags */
-#else
- Py_TPFLAGS_DEFAULT|Py_TPFLAGS_BASETYPE|Py_TPFLAGS_CHECKTYPES, /* tp_flags */
-#endif
- "::_THyPhy", /* tp_doc */
- (traverseproc) 0, /* tp_traverse */
- (inquiry) 0, /* tp_clear */
- (richcmpfunc) SwigPyBuiltin___THyPhy_richcompare, /* feature:python:tp_richcompare */
- 0, /* tp_weaklistoffset */
- (getiterfunc) 0, /* tp_iter */
- (iternextfunc) 0, /* tp_iternext */
- SwigPyBuiltin___THyPhy_methods, /* tp_methods */
- 0, /* tp_members */
- SwigPyBuiltin___THyPhy_getset, /* tp_getset */
- 0, /* tp_base */
- 0, /* tp_dict */
- (descrgetfunc) 0, /* tp_descr_get */
- (descrsetfunc) 0, /* tp_descr_set */
- (size_t)(((char*)&((SwigPyObject *) 64L)->dict) - (char*) 64L), /* tp_dictoffset */
- (initproc) _wrap_new__THyPhy, /* tp_init */
- (allocfunc) 0, /* tp_alloc */
- (newfunc) 0, /* tp_new */
- (freefunc) 0, /* tp_free */
- (inquiry) 0, /* tp_is_gc */
- (PyObject*) 0, /* tp_bases */
- (PyObject*) 0, /* tp_mro */
- (PyObject*) 0, /* tp_cache */
- (PyObject*) 0, /* tp_subclasses */
- (PyObject*) 0, /* tp_weaklist */
- (destructor) 0, /* tp_del */
-#if PY_VERSION_HEX >= 0x02060000
- (int) 0, /* tp_version_tag */
-#endif
- },
- {
- (binaryfunc) 0, /* nb_add */
- (binaryfunc) 0, /* nb_subtract */
- (binaryfunc) 0, /* nb_multiply */
-#if PY_VERSION_HEX < 0x03000000
- (binaryfunc) 0, /* nb_divide */
-#endif
- (binaryfunc) 0, /* nb_remainder */
- (binaryfunc) 0, /* nb_divmod */
- (ternaryfunc) 0, /* nb_power */
- (unaryfunc) 0, /* nb_negative */
- (unaryfunc) 0, /* nb_positive */
- (unaryfunc) 0, /* nb_absolute */
- (inquiry) 0, /* nb_nonzero */
- (unaryfunc) 0, /* nb_invert */
- (binaryfunc) 0, /* nb_lshift */
- (binaryfunc) 0, /* nb_rshift */
- (binaryfunc) 0, /* nb_and */
- (binaryfunc) 0, /* nb_xor */
- (binaryfunc) 0, /* nb_or */
-#if PY_VERSION_HEX < 0x03000000
- (coercion) 0, /* nb_coerce */
-#endif
- (unaryfunc) 0, /* nb_int */
-#if PY_VERSION_HEX >= 0x03000000
- (void*) 0, /* nb_reserved */
-#else
- (unaryfunc) 0, /* nb_long */
-#endif
- (unaryfunc) 0, /* nb_float */
-#if PY_VERSION_HEX < 0x03000000
- (unaryfunc) 0, /* nb_oct */
- (unaryfunc) 0, /* nb_hex */
-#endif
- (binaryfunc) 0, /* nb_inplace_add */
- (binaryfunc) 0, /* nb_inplace_subtract */
- (binaryfunc) 0, /* nb_inplace_multiply */
-#if PY_VERSION_HEX < 0x03000000
- (binaryfunc) 0, /* nb_inplace_divide */
-#endif
- (binaryfunc) 0, /* nb_inplace_remainder */
- (ternaryfunc) 0, /* nb_inplace_power */
- (binaryfunc) 0, /* nb_inplace_lshift */
- (binaryfunc) 0, /* nb_inplace_rshift */
- (binaryfunc) 0, /* nb_inplace_and */
- (binaryfunc) 0, /* nb_inplace_xor */
- (binaryfunc) 0, /* nb_inplace_or */
- (binaryfunc) 0, /* nb_floor_divide */
- (binaryfunc) 0, /* nb_true_divide */
- (binaryfunc) 0, /* nb_inplace_floor_divide */
- (binaryfunc) 0, /* nb_inplace_true_divide */
-#if PY_VERSION_HEX >= 0x02050000
- (unaryfunc) 0, /* nb_index */
-#endif
- },
- {
- (lenfunc) 0, /* mp_length */
- (binaryfunc) 0, /* mp_subscript */
- (objobjargproc) 0, /* mp_ass_subscript */
- },
- {
- (lenfunc) 0, /* sq_length */
- (binaryfunc) 0, /* sq_concat */
- (ssizeargfunc) 0, /* sq_repeat */
- (ssizeargfunc) 0, /* sq_item */
-#if PY_VERSION_HEX >= 0x03000000
- (void*) 0, /* was_sq_slice */
-#else
- (ssizessizeargfunc) 0, /* sq_slice */
-#endif
- (ssizeobjargproc) 0, /* sq_ass_item */
-#if PY_VERSION_HEX >= 0x03000000
- (void*) 0, /* was_sq_ass_slice */
-#else
- (ssizessizeobjargproc) 0, /* sq_ass_slice */
-#endif
- (objobjproc) 0, /* sq_contains */
- (binaryfunc) 0, /* sq_inplace_concat */
- (ssizeargfunc) 0, /* sq_inplace_repeat */
- },
- {
-#if PY_VERSION_HEX < 0x03000000
- (readbufferproc) 0, /* bf_getreadbuffer */
- (writebufferproc) 0, /* bf_getwritebuffer */
- (segcountproc) 0, /* bf_getsegcount */
- (charbufferproc) 0, /* bf_getcharbuffer */
-#endif
-#if PY_VERSION_HEX >= 0x02060000
- (getbufferproc) 0, /* bf_getbuffer */
- (releasebufferproc) 0, /* bf_releasebuffer */
-#endif
- },
- (PyObject*) 0, /* ht_name */
- (PyObject*) 0, /* ht_slots */
-};
-
-SWIGINTERN SwigPyClientData SwigPyBuiltin___THyPhy_clientdata = {0, 0, 0, 0, 0, 0, (PyTypeObject *)&SwigPyBuiltin___THyPhy_type};
-
-
-/* -------- TYPE CONVERSION AND EQUIVALENCE RULES (BEGIN) -------- */
-
-static void *_p__THyPhyNumberTo_p__THyPhyReturnObject(void *x, int *SWIGUNUSEDPARM(newmemory)) {
- return (void *)((_THyPhyReturnObject *) ((_THyPhyNumber *) x));
-}
-static void *_p__THyPhyMatrixTo_p__THyPhyReturnObject(void *x, int *SWIGUNUSEDPARM(newmemory)) {
- return (void *)((_THyPhyReturnObject *) ((_THyPhyMatrix *) x));
-}
-static void *_p__THyPhyStringTo_p__THyPhyReturnObject(void *x, int *SWIGUNUSEDPARM(newmemory)) {
- return (void *)((_THyPhyReturnObject *) ((_THyPhyString *) x));
-}
-static swig_type_info _swigt__p_SwigPyObject = {"_p_SwigPyObject", "SwigPyObject *", 0, 0, (void*)0, 0};
-static swig_type_info _swigt__p__THyPhy = {"_p__THyPhy", "_THyPhy *", 0, 0, (void*)&SwigPyBuiltin___THyPhy_clientdata, 0};
-static swig_type_info _swigt__p__THyPhyMatrix = {"_p__THyPhyMatrix", "_THyPhyMatrix *", 0, 0, (void*)&SwigPyBuiltin___THyPhyMatrix_clientdata, 0};
-static swig_type_info _swigt__p__THyPhyNumber = {"_p__THyPhyNumber", "_THyPhyNumber *", 0, 0, (void*)&SwigPyBuiltin___THyPhyNumber_clientdata, 0};
-static swig_type_info _swigt__p__THyPhyReturnObject = {"_p__THyPhyReturnObject", "_THyPhyReturnObject *", 0, 0, (void*)&SwigPyBuiltin___THyPhyReturnObject_clientdata, 0};
-static swig_type_info _swigt__p__THyPhyString = {"_p__THyPhyString", "_THyPhyString *", 0, 0, (void*)&SwigPyBuiltin___THyPhyString_clientdata, 0};
-static swig_type_info _swigt__p_char = {"_p_char", "char *", 0, 0, (void*)0, 0};
-static swig_type_info _swigt__p_double = {"_p_double", "double *", 0, 0, (void*)0, 0};
-static swig_type_info _swigt__p_f_p_char_int_double__bool = {"_p_f_p_char_int_double__bool", "_ProgressCancelHandler *|bool (*)(char *,int,double)", 0, 0, (void*)0, 0};
-static swig_type_info _swigt__p_void = {"_p_void", "void *", 0, 0, (void*)0, 0};
-
-static swig_type_info *swig_type_initial[] = {
- &_swigt__p_SwigPyObject,
- &_swigt__p__THyPhy,
- &_swigt__p__THyPhyMatrix,
- &_swigt__p__THyPhyNumber,
- &_swigt__p__THyPhyReturnObject,
- &_swigt__p__THyPhyString,
- &_swigt__p_char,
- &_swigt__p_double,
- &_swigt__p_f_p_char_int_double__bool,
- &_swigt__p_void,
-};
-
-static swig_cast_info _swigc__p_SwigPyObject[] = { {&_swigt__p_SwigPyObject, 0, 0, 0},{0, 0, 0, 0}};
-static swig_cast_info _swigc__p__THyPhy[] = { {&_swigt__p__THyPhy, 0, 0, 0},{0, 0, 0, 0}};
-static swig_cast_info _swigc__p__THyPhyMatrix[] = { {&_swigt__p__THyPhyMatrix, 0, 0, 0},{0, 0, 0, 0}};
-static swig_cast_info _swigc__p__THyPhyNumber[] = { {&_swigt__p__THyPhyNumber, 0, 0, 0},{0, 0, 0, 0}};
-static swig_cast_info _swigc__p__THyPhyReturnObject[] = { {&_swigt__p__THyPhyReturnObject, 0, 0, 0}, {&_swigt__p__THyPhyNumber, _p__THyPhyNumberTo_p__THyPhyReturnObject, 0, 0}, {&_swigt__p__THyPhyMatrix, _p__THyPhyMatrixTo_p__THyPhyReturnObject, 0, 0}, {&_swigt__p__THyPhyString, _p__THyPhyStringTo_p__THyPhyReturnObject, 0, 0},{0, 0, 0, 0}};
-static swig_cast_info _swigc__p__THyPhyString[] = { {&_swigt__p__THyPhyString, 0, 0, 0},{0, 0, 0, 0}};
-static swig_cast_info _swigc__p_char[] = { {&_swigt__p_char, 0, 0, 0},{0, 0, 0, 0}};
-static swig_cast_info _swigc__p_double[] = { {&_swigt__p_double, 0, 0, 0},{0, 0, 0, 0}};
-static swig_cast_info _swigc__p_f_p_char_int_double__bool[] = { {&_swigt__p_f_p_char_int_double__bool, 0, 0, 0},{0, 0, 0, 0}};
-static swig_cast_info _swigc__p_void[] = { {&_swigt__p_void, 0, 0, 0},{0, 0, 0, 0}};
-
-static swig_cast_info *swig_cast_initial[] = {
- _swigc__p_SwigPyObject,
- _swigc__p__THyPhy,
- _swigc__p__THyPhyMatrix,
- _swigc__p__THyPhyNumber,
- _swigc__p__THyPhyReturnObject,
- _swigc__p__THyPhyString,
- _swigc__p_char,
- _swigc__p_double,
- _swigc__p_f_p_char_int_double__bool,
- _swigc__p_void,
-};
-
-
-/* -------- TYPE CONVERSION AND EQUIVALENCE RULES (END) -------- */
-
-static swig_const_info swig_const_table[] = {
-{0, 0, 0, 0.0, 0, 0}};
-
-#ifdef __cplusplus
-}
-#endif
-static PyTypeObject *builtin_bases[3];
-
-/* -----------------------------------------------------------------------------
- * Type initialization:
- * This problem is tough by the requirement that no dynamic
- * memory is used. Also, since swig_type_info structures store pointers to
- * swig_cast_info structures and swig_cast_info structures store pointers back
- * to swig_type_info structures, we need some lookup code at initialization.
- * The idea is that swig generates all the structures that are needed.
- * The runtime then collects these partially filled structures.
- * The SWIG_InitializeModule function takes these initial arrays out of
- * swig_module, and does all the lookup, filling in the swig_module.types
- * array with the correct data and linking the correct swig_cast_info
- * structures together.
- *
- * The generated swig_type_info structures are assigned staticly to an initial
- * array. We just loop through that array, and handle each type individually.
- * First we lookup if this type has been already loaded, and if so, use the
- * loaded structure instead of the generated one. Then we have to fill in the
- * cast linked list. The cast data is initially stored in something like a
- * two-dimensional array. Each row corresponds to a type (there are the same
- * number of rows as there are in the swig_type_initial array). Each entry in
- * a column is one of the swig_cast_info structures for that type.
- * The cast_initial array is actually an array of arrays, because each row has
- * a variable number of columns. So to actually build the cast linked list,
- * we find the array of casts associated with the type, and loop through it
- * adding the casts to the list. The one last trick we need to do is making
- * sure the type pointer in the swig_cast_info struct is correct.
- *
- * First off, we lookup the cast->type name to see if it is already loaded.
- * There are three cases to handle:
- * 1) If the cast->type has already been loaded AND the type we are adding
- * casting info to has not been loaded (it is in this module), THEN we
- * replace the cast->type pointer with the type pointer that has already
- * been loaded.
- * 2) If BOTH types (the one we are adding casting info to, and the
- * cast->type) are loaded, THEN the cast info has already been loaded by
- * the previous module so we just ignore it.
- * 3) Finally, if cast->type has not already been loaded, then we add that
- * swig_cast_info to the linked list (because the cast->type) pointer will
- * be correct.
- * ----------------------------------------------------------------------------- */
-
-#ifdef __cplusplus
-extern "C" {
-#if 0
-} /* c-mode */
-#endif
-#endif
-
-#if 0
-#define SWIGRUNTIME_DEBUG
-#endif
-
-
-SWIGRUNTIME void
-SWIG_InitializeModule(void *clientdata) {
- size_t i;
- swig_module_info *module_head, *iter;
- int found, init;
-
- clientdata = clientdata;
-
- /* check to see if the circular list has been setup, if not, set it up */
- if (swig_module.next==0) {
- /* Initialize the swig_module */
- swig_module.type_initial = swig_type_initial;
- swig_module.cast_initial = swig_cast_initial;
- swig_module.next = &swig_module;
- init = 1;
- } else {
- init = 0;
- }
-
- /* Try and load any already created modules */
- module_head = SWIG_GetModule(clientdata);
- if (!module_head) {
- /* This is the first module loaded for this interpreter */
- /* so set the swig module into the interpreter */
- SWIG_SetModule(clientdata, &swig_module);
- module_head = &swig_module;
- } else {
- /* the interpreter has loaded a SWIG module, but has it loaded this one? */
- found=0;
- iter=module_head;
- do {
- if (iter==&swig_module) {
- found=1;
- break;
- }
- iter=iter->next;
- } while (iter!= module_head);
-
- /* if the is found in the list, then all is done and we may leave */
- if (found) return;
- /* otherwise we must add out module into the list */
- swig_module.next = module_head->next;
- module_head->next = &swig_module;
- }
-
- /* When multiple interpeters are used, a module could have already been initialized in
- a different interpreter, but not yet have a pointer in this interpreter.
- In this case, we do not want to continue adding types... everything should be
- set up already */
- if (init == 0) return;
-
- /* Now work on filling in swig_module.types */
-#ifdef SWIGRUNTIME_DEBUG
- printf("SWIG_InitializeModule: size %d\n", swig_module.size);
-#endif
- for (i = 0; i < swig_module.size; ++i) {
- swig_type_info *type = 0;
- swig_type_info *ret;
- swig_cast_info *cast;
-
-#ifdef SWIGRUNTIME_DEBUG
- printf("SWIG_InitializeModule: type %d %s\n", i, swig_module.type_initial[i]->name);
-#endif
-
- /* if there is another module already loaded */
- if (swig_module.next != &swig_module) {
- type = SWIG_MangledTypeQueryModule(swig_module.next, &swig_module, swig_module.type_initial[i]->name);
- }
- if (type) {
- /* Overwrite clientdata field */
-#ifdef SWIGRUNTIME_DEBUG
- printf("SWIG_InitializeModule: found type %s\n", type->name);
-#endif
- if (swig_module.type_initial[i]->clientdata) {
- type->clientdata = swig_module.type_initial[i]->clientdata;
-#ifdef SWIGRUNTIME_DEBUG
- printf("SWIG_InitializeModule: found and overwrite type %s \n", type->name);
-#endif
- }
- } else {
- type = swig_module.type_initial[i];
- }
-
- /* Insert casting types */
- cast = swig_module.cast_initial[i];
- while (cast->type) {
- /* Don't need to add information already in the list */
- ret = 0;
-#ifdef SWIGRUNTIME_DEBUG
- printf("SWIG_InitializeModule: look cast %s\n", cast->type->name);
-#endif
- if (swig_module.next != &swig_module) {
- ret = SWIG_MangledTypeQueryModule(swig_module.next, &swig_module, cast->type->name);
-#ifdef SWIGRUNTIME_DEBUG
- if (ret) printf("SWIG_InitializeModule: found cast %s\n", ret->name);
-#endif
- }
- if (ret) {
- if (type == swig_module.type_initial[i]) {
-#ifdef SWIGRUNTIME_DEBUG
- printf("SWIG_InitializeModule: skip old type %s\n", ret->name);
-#endif
- cast->type = ret;
- ret = 0;
- } else {
- /* Check for casting already in the list */
- swig_cast_info *ocast = SWIG_TypeCheck(ret->name, type);
-#ifdef SWIGRUNTIME_DEBUG
- if (ocast) printf("SWIG_InitializeModule: skip old cast %s\n", ret->name);
-#endif
- if (!ocast) ret = 0;
- }
- }
-
- if (!ret) {
-#ifdef SWIGRUNTIME_DEBUG
- printf("SWIG_InitializeModule: adding cast %s\n", cast->type->name);
-#endif
- if (type->cast) {
- type->cast->prev = cast;
- cast->next = type->cast;
- }
- type->cast = cast;
- }
- cast++;
- }
- /* Set entry in modules->types array equal to the type */
- swig_module.types[i] = type;
- }
- swig_module.types[i] = 0;
-
-#ifdef SWIGRUNTIME_DEBUG
- printf("**** SWIG_InitializeModule: Cast List ******\n");
- for (i = 0; i < swig_module.size; ++i) {
- int j = 0;
- swig_cast_info *cast = swig_module.cast_initial[i];
- printf("SWIG_InitializeModule: type %d %s\n", i, swig_module.type_initial[i]->name);
- while (cast->type) {
- printf("SWIG_InitializeModule: cast type %s\n", cast->type->name);
- cast++;
- ++j;
- }
- printf("---- Total casts: %d\n",j);
- }
- printf("**** SWIG_InitializeModule: Cast List ******\n");
-#endif
-}
-
-/* This function will propagate the clientdata field of type to
-* any new swig_type_info structures that have been added into the list
-* of equivalent types. It is like calling
-* SWIG_TypeClientData(type, clientdata) a second time.
-*/
-SWIGRUNTIME void
-SWIG_PropagateClientData(void) {
- size_t i;
- swig_cast_info *equiv;
- static int init_run = 0;
-
- if (init_run) return;
- init_run = 1;
-
- for (i = 0; i < swig_module.size; i++) {
- if (swig_module.types[i]->clientdata) {
- equiv = swig_module.types[i]->cast;
- while (equiv) {
- if (!equiv->converter) {
- if (equiv->type && !equiv->type->clientdata)
- SWIG_TypeClientData(equiv->type, swig_module.types[i]->clientdata);
- }
- equiv = equiv->next;
- }
- }
- }
-}
-
-#ifdef __cplusplus
-#if 0
-{
- /* c-mode */
-#endif
-}
-#endif
-
-
-
-#ifdef __cplusplus
-extern "C" {
-#endif
-
- /* Python-specific SWIG API */
-#define SWIG_newvarlink() SWIG_Python_newvarlink()
-#define SWIG_addvarlink(p, name, get_attr, set_attr) SWIG_Python_addvarlink(p, name, get_attr, set_attr)
-#define SWIG_InstallConstants(d, constants) SWIG_Python_InstallConstants(d, constants)
-
- /* -----------------------------------------------------------------------------
- * global variable support code.
- * ----------------------------------------------------------------------------- */
-
- typedef struct swig_globalvar {
- char *name; /* Name of global variable */
- PyObject *(*get_attr)(void); /* Return the current value */
- int (*set_attr)(PyObject *); /* Set the value */
- struct swig_globalvar *next;
- } swig_globalvar;
-
- typedef struct swig_varlinkobject {
- PyObject_HEAD
- swig_globalvar *vars;
- } swig_varlinkobject;
-
- SWIGINTERN PyObject *
- swig_varlink_repr(swig_varlinkobject *SWIGUNUSEDPARM(v)) {
-#if PY_VERSION_HEX >= 0x03000000
- return PyUnicode_InternFromString("<Swig global variables>");
-#else
- return PyString_FromString("<Swig global variables>");
-#endif
- }
-
- SWIGINTERN PyObject *
- swig_varlink_str(swig_varlinkobject *v) {
-#if PY_VERSION_HEX >= 0x03000000
- PyObject *str = PyUnicode_InternFromString("(");
- PyObject *tail;
- PyObject *joined;
- swig_globalvar *var;
- for (var = v->vars; var; var=var->next) {
- tail = PyUnicode_FromString(var->name);
- joined = PyUnicode_Concat(str, tail);
- Py_DecRef(str);
- Py_DecRef(tail);
- str = joined;
- if (var->next) {
- tail = PyUnicode_InternFromString(", ");
- joined = PyUnicode_Concat(str, tail);
- Py_DecRef(str);
- Py_DecRef(tail);
- str = joined;
- }
- }
- tail = PyUnicode_InternFromString(")");
- joined = PyUnicode_Concat(str, tail);
- Py_DecRef(str);
- Py_DecRef(tail);
- str = joined;
-#else
- PyObject *str = PyString_FromString("(");
- swig_globalvar *var;
- for (var = v->vars; var; var=var->next) {
- PyString_ConcatAndDel(&str,PyString_FromString(var->name));
- if (var->next) PyString_ConcatAndDel(&str,PyString_FromString(", "));
- }
- PyString_ConcatAndDel(&str,PyString_FromString(")"));
-#endif
- return str;
- }
-
- SWIGINTERN int
- swig_varlink_print(swig_varlinkobject *v, FILE *fp, int SWIGUNUSEDPARM(flags)) {
- char *tmp;
- PyObject *str = swig_varlink_str(v);
- fprintf(fp,"Swig global variables ");
- fprintf(fp,"%s\n", tmp = SWIG_Python_str_AsChar(str));
- SWIG_Python_str_DelForPy3(tmp);
- Py_DECREF(str);
- return 0;
- }
-
- SWIGINTERN void
- swig_varlink_dealloc(swig_varlinkobject *v) {
- swig_globalvar *var = v->vars;
- while (var) {
- swig_globalvar *n = var->next;
- free(var->name);
- free(var);
- var = n;
- }
- }
-
- SWIGINTERN PyObject *
- swig_varlink_getattr(swig_varlinkobject *v, char *n) {
- PyObject *res = NULL;
- swig_globalvar *var = v->vars;
- while (var) {
- if (strcmp(var->name,n) == 0) {
- res = (*var->get_attr)();
- break;
- }
- var = var->next;
- }
- if (res == NULL && !PyErr_Occurred()) {
- PyErr_SetString(PyExc_NameError,"Unknown C global variable");
- }
- return res;
- }
-
- SWIGINTERN int
- swig_varlink_setattr(swig_varlinkobject *v, char *n, PyObject *p) {
- int res = 1;
- swig_globalvar *var = v->vars;
- while (var) {
- if (strcmp(var->name,n) == 0) {
- res = (*var->set_attr)(p);
- break;
- }
- var = var->next;
- }
- if (res == 1 && !PyErr_Occurred()) {
- PyErr_SetString(PyExc_NameError,"Unknown C global variable");
- }
- return res;
- }
-
- SWIGINTERN PyTypeObject*
- swig_varlink_type(void) {
- static char varlink__doc__[] = "Swig var link object";
- static PyTypeObject varlink_type;
- static int type_init = 0;
- if (!type_init) {
- const PyTypeObject tmp = {
- /* PyObject header changed in Python 3 */
-#if PY_VERSION_HEX >= 0x03000000
- PyVarObject_HEAD_INIT(NULL, 0)
-#else
- PyObject_HEAD_INIT(NULL)
- 0, /* ob_size */
-#endif
- (char *)"swigvarlink", /* tp_name */
- sizeof(swig_varlinkobject), /* tp_basicsize */
- 0, /* tp_itemsize */
- (destructor) swig_varlink_dealloc, /* tp_dealloc */
- (printfunc) swig_varlink_print, /* tp_print */
- (getattrfunc) swig_varlink_getattr, /* tp_getattr */
- (setattrfunc) swig_varlink_setattr, /* tp_setattr */
- 0, /* tp_compare */
- (reprfunc) swig_varlink_repr, /* tp_repr */
- 0, /* tp_as_number */
- 0, /* tp_as_sequence */
- 0, /* tp_as_mapping */
- 0, /* tp_hash */
- 0, /* tp_call */
- (reprfunc) swig_varlink_str, /* tp_str */
- 0, /* tp_getattro */
- 0, /* tp_setattro */
- 0, /* tp_as_buffer */
- 0, /* tp_flags */
- varlink__doc__, /* tp_doc */
- 0, /* tp_traverse */
- 0, /* tp_clear */
- 0, /* tp_richcompare */
- 0, /* tp_weaklistoffset */
-#if PY_VERSION_HEX >= 0x02020000
- 0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0, /* tp_iter -> tp_weaklist */
-#endif
-#if PY_VERSION_HEX >= 0x02030000
- 0, /* tp_del */
-#endif
-#if PY_VERSION_HEX >= 0x02060000
- 0, /* tp_version */
-#endif
-#ifdef COUNT_ALLOCS
- 0,0,0,0 /* tp_alloc -> tp_next */
-#endif
- };
- varlink_type = tmp;
- type_init = 1;
-#if PY_VERSION_HEX < 0x02020000
- varlink_type.ob_type = &PyType_Type;
-#else
- if (PyType_Ready(&varlink_type) < 0)
- return NULL;
-#endif
- }
- return &varlink_type;
- }
-
- /* Create a variable linking object for use later */
- SWIGINTERN PyObject *
- SWIG_Python_newvarlink(void) {
- swig_varlinkobject *result = PyObject_NEW(swig_varlinkobject, swig_varlink_type());
- if (result) {
- result->vars = 0;
- }
- return ((PyObject*) result);
- }
-
- SWIGINTERN void
- SWIG_Python_addvarlink(PyObject *p, char *name, PyObject *(*get_attr)(void), int (*set_attr)(PyObject *p)) {
- swig_varlinkobject *v = (swig_varlinkobject *) p;
- swig_globalvar *gv = (swig_globalvar *) malloc(sizeof(swig_globalvar));
- if (gv) {
- size_t size = strlen(name)+1;
- gv->name = (char *)malloc(size);
- if (gv->name) {
- strncpy(gv->name,name,size);
- gv->get_attr = get_attr;
- gv->set_attr = set_attr;
- gv->next = v->vars;
- }
- }
- v->vars = gv;
- }
-
- SWIGINTERN PyObject *
- SWIG_globals(void) {
- static PyObject *_SWIG_globals = 0;
- if (!_SWIG_globals) _SWIG_globals = SWIG_newvarlink();
- return _SWIG_globals;
- }
-
- /* -----------------------------------------------------------------------------
- * constants/methods manipulation
- * ----------------------------------------------------------------------------- */
-
- /* Install Constants */
- SWIGINTERN void
- SWIG_Python_InstallConstants(PyObject *d, swig_const_info constants[]) {
- PyObject *obj = 0;
- size_t i;
- for (i = 0; constants[i].type; ++i) {
- switch(constants[i].type) {
- case SWIG_PY_POINTER:
- obj = SWIG_InternalNewPointerObj(constants[i].pvalue, *(constants[i]).ptype,0);
- break;
- case SWIG_PY_BINARY:
- obj = SWIG_NewPackedObj(constants[i].pvalue, constants[i].lvalue, *(constants[i].ptype));
- break;
- default:
- obj = 0;
- break;
- }
- if (obj) {
- PyDict_SetItemString(d, constants[i].name, obj);
- Py_DECREF(obj);
- }
- }
- }
-
- /* -----------------------------------------------------------------------------*/
- /* Fix SwigMethods to carry the callback ptrs when needed */
- /* -----------------------------------------------------------------------------*/
-
- SWIGINTERN void
- SWIG_Python_FixMethods(PyMethodDef *methods,
- swig_const_info *const_table,
- swig_type_info **types,
- swig_type_info **types_initial) {
- size_t i;
- for (i = 0; methods[i].ml_name; ++i) {
- const char *c = methods[i].ml_doc;
- if (c && (c = strstr(c, "swig_ptr: "))) {
- int j;
- swig_const_info *ci = 0;
- const char *name = c + 10;
- for (j = 0; const_table[j].type; ++j) {
- if (strncmp(const_table[j].name, name,
- strlen(const_table[j].name)) == 0) {
- ci = &(const_table[j]);
- break;
- }
- }
- if (ci) {
- void *ptr = (ci->type == SWIG_PY_POINTER) ? ci->pvalue : 0;
- if (ptr) {
- size_t shift = (ci->ptype) - types;
- swig_type_info *ty = types_initial[shift];
- size_t ldoc = (c - methods[i].ml_doc);
- size_t lptr = strlen(ty->name)+2*sizeof(void*)+2;
- char *ndoc = (char*)malloc(ldoc + lptr + 10);
- if (ndoc) {
- char *buff = ndoc;
- strncpy(buff, methods[i].ml_doc, ldoc);
- buff += ldoc;
- strncpy(buff, "swig_ptr: ", 10);
- buff += 10;
- SWIG_PackVoidPtr(buff, ptr, ty->name, lptr);
- methods[i].ml_doc = ndoc;
- }
- }
- }
- }
- }
- }
-
-#ifdef __cplusplus
-}
-#endif
-
-/* -----------------------------------------------------------------------------*
- * Partial Init method
- * -----------------------------------------------------------------------------*/
-
-#ifdef __cplusplus
-extern "C"
-#endif
-
-SWIGEXPORT
-#if PY_VERSION_HEX >= 0x03000000
-PyObject*
-#else
-void
-#endif
-SWIG_init(void) {
- PyObject *m, *d, *md;
-#if PY_VERSION_HEX >= 0x03000000
- static struct PyModuleDef SWIG_module = {
-# if PY_VERSION_HEX >= 0x03020000
- PyModuleDef_HEAD_INIT,
-# else
- {
- PyObject_HEAD_INIT(NULL)
- NULL, /* m_init */
- 0, /* m_index */
- NULL, /* m_copy */
- },
-# endif
- (char *) SWIG_name,
- NULL,
- -1,
- SwigMethods,
- NULL,
- NULL,
- NULL,
- NULL
- };
-#endif
-
-#if defined(SWIGPYTHON_BUILTIN)
- static SwigPyClientData SwigPyObject_clientdata = {
- 0, 0, 0, 0, 0, 0, 0
- };
- static PyGetSetDef this_getset_def = {
- (char *)"this", &SwigPyBuiltin_ThisClosure, NULL, NULL, NULL
- };
- static SwigPyGetSet thisown_getset_closure = {
- (PyCFunction) SwigPyObject_own,
- (PyCFunction) SwigPyObject_own
- };
- static PyGetSetDef thisown_getset_def = {
- (char *)"thisown", SwigPyBuiltin_GetterClosure, SwigPyBuiltin_SetterClosure, NULL, &thisown_getset_closure
- };
- PyObject *metatype_args;
- PyTypeObject *builtin_pytype;
- int builtin_base_count;
- swig_type_info *builtin_basetype;
- PyObject *tuple;
- PyGetSetDescrObject *static_getset;
- PyTypeObject *metatype;
- SwigPyClientData *cd;
- PyObject *public_interface, *public_symbol;
- PyObject *this_descr;
- PyObject *thisown_descr;
- int i;
-
- (void)builtin_pytype;
- (void)builtin_base_count;
- (void)builtin_basetype;
- (void)tuple;
- (void)static_getset;
-
- /* metatype is used to implement static member variables. */
- metatype_args = Py_BuildValue("(s(O){})", "SwigPyObjectType", &PyType_Type);
- assert(metatype_args);
- metatype = (PyTypeObject *) PyType_Type.tp_call((PyObject *) &PyType_Type, metatype_args, NULL);
- assert(metatype);
- Py_DECREF(metatype_args);
- metatype->tp_setattro = (setattrofunc) &SwigPyObjectType_setattro;
- assert(PyType_Ready(metatype) >= 0);
-#endif
-
- /* Fix SwigMethods to carry the callback ptrs when needed */
- SWIG_Python_FixMethods(SwigMethods, swig_const_table, swig_types, swig_type_initial);
-
-#if PY_VERSION_HEX >= 0x03000000
- m = PyModule_Create(&SWIG_module);
-#else
- m = Py_InitModule((char *) SWIG_name, SwigMethods);
-#endif
- md = d = PyModule_GetDict(m);
-
- SWIG_InitializeModule(0);
-
-#ifdef SWIGPYTHON_BUILTIN
- SwigPyObject_stype = SWIG_MangledTypeQuery("_p_SwigPyObject");
- assert(SwigPyObject_stype);
- cd = (SwigPyClientData*) SwigPyObject_stype->clientdata;
- if (!cd) {
- SwigPyObject_stype->clientdata = &SwigPyObject_clientdata;
- SwigPyObject_clientdata.pytype = SwigPyObject_TypeOnce();
- } else if (SwigPyObject_TypeOnce()->tp_basicsize != cd->pytype->tp_basicsize) {
- PyErr_SetString(PyExc_RuntimeError, "Import error: attempted to load two incompatible swig-generated modules.");
-# if PY_VERSION_HEX >= 0x03000000
- return NULL;
-# else
- return;
-# endif
- }
-
- /* All objects have a 'this' attribute */
- this_descr = PyDescr_NewGetSet(SwigPyObject_type(), &this_getset_def);
- (void)this_descr;
-
- /* All objects have a 'thisown' attribute */
- thisown_descr = PyDescr_NewGetSet(SwigPyObject_type(), &thisown_getset_def);
- (void)thisown_descr;
-
- public_interface = PyList_New(0);
- public_symbol = 0;
- (void)public_symbol;
-
- PyDict_SetItemString(md, "__all__", public_interface);
- Py_DECREF(public_interface);
- for (i = 0; SwigMethods[i].ml_name != NULL; ++i)
- SwigPyBuiltin_AddPublicSymbol(public_interface, SwigMethods[i].ml_name);
- for (i = 0; swig_const_table[i].name != 0; ++i)
- SwigPyBuiltin_AddPublicSymbol(public_interface, swig_const_table[i].name);
-#endif
-
- SWIG_InstallConstants(d,swig_const_table);
-
- SWIG_Python_SetConstant(d, d == md ? public_interface : NULL, "THYPHY_TYPE_COUNT",SWIG_From_int(static_cast< int >(3)));
- SWIG_Python_SetConstant(d, d == md ? public_interface : NULL, "THYPHY_TYPE_STRING",SWIG_From_int(static_cast< int >(0)));
- SWIG_Python_SetConstant(d, d == md ? public_interface : NULL, "THYPHY_TYPE_NUMBER",SWIG_From_int(static_cast< int >(1)));
- SWIG_Python_SetConstant(d, d == md ? public_interface : NULL, "THYPHY_TYPE_MATRIX",SWIG_From_int(static_cast< int >(2)));
-
- /* type '::_THyPhyReturnObject' */
- builtin_pytype = (PyTypeObject *)&SwigPyBuiltin___THyPhyReturnObject_type;
- builtin_pytype->tp_dict = d = PyDict_New();
- SwigPyBuiltin_SetMetaType(builtin_pytype, metatype);
- builtin_pytype->tp_new = PyType_GenericNew;
- builtin_base_count = 0;
- builtin_bases[builtin_base_count] = NULL;
- SwigPyBuiltin_InitBases(builtin_pytype, builtin_bases);
- PyDict_SetItemString(d, "this", this_descr);
- PyDict_SetItemString(d, "thisown", thisown_descr);
- if (PyType_Ready(builtin_pytype) < 0) {
- PyErr_SetString(PyExc_TypeError, "Could not create type '_THyPhyReturnObject'.");
-#if PY_VERSION_HEX >= 0x03000000
- return NULL;
-#else
- return;
-#endif
- }
- Py_INCREF(builtin_pytype);
- PyModule_AddObject(m, "_THyPhyReturnObject", (PyObject*) builtin_pytype);
- SwigPyBuiltin_AddPublicSymbol(public_interface, "_THyPhyReturnObject");
- d = md;
-
- /* type '::_THyPhyString' */
- builtin_pytype = (PyTypeObject *)&SwigPyBuiltin___THyPhyString_type;
- builtin_pytype->tp_dict = d = PyDict_New();
- SwigPyBuiltin_SetMetaType(builtin_pytype, metatype);
- builtin_pytype->tp_new = PyType_GenericNew;
- builtin_base_count = 0;
- builtin_basetype = SWIG_MangledTypeQuery("_p__THyPhyReturnObject");
- if (builtin_basetype && builtin_basetype->clientdata && ((SwigPyClientData*) builtin_basetype->clientdata)->pytype) {
- builtin_bases[builtin_base_count++] = ((SwigPyClientData*) builtin_basetype->clientdata)->pytype;
- } else {
- PyErr_SetString(PyExc_TypeError, "Could not create type '_THyPhyString' as base '_THyPhyReturnObject' has not been initialized.\n");
-#if PY_VERSION_HEX >= 0x03000000
- return NULL;
-#else
- return;
-#endif
- }
- builtin_bases[builtin_base_count] = NULL;
- SwigPyBuiltin_InitBases(builtin_pytype, builtin_bases);
- PyDict_SetItemString(d, "this", this_descr);
- PyDict_SetItemString(d, "thisown", thisown_descr);
- if (PyType_Ready(builtin_pytype) < 0) {
- PyErr_SetString(PyExc_TypeError, "Could not create type '_THyPhyString'.");
-#if PY_VERSION_HEX >= 0x03000000
- return NULL;
-#else
- return;
-#endif
- }
- Py_INCREF(builtin_pytype);
- PyModule_AddObject(m, "_THyPhyString", (PyObject*) builtin_pytype);
- SwigPyBuiltin_AddPublicSymbol(public_interface, "_THyPhyString");
- d = md;
-
- /* type '::_THyPhyNumber' */
- builtin_pytype = (PyTypeObject *)&SwigPyBuiltin___THyPhyNumber_type;
- builtin_pytype->tp_dict = d = PyDict_New();
- SwigPyBuiltin_SetMetaType(builtin_pytype, metatype);
- builtin_pytype->tp_new = PyType_GenericNew;
- builtin_base_count = 0;
- builtin_basetype = SWIG_MangledTypeQuery("_p__THyPhyReturnObject");
- if (builtin_basetype && builtin_basetype->clientdata && ((SwigPyClientData*) builtin_basetype->clientdata)->pytype) {
- builtin_bases[builtin_base_count++] = ((SwigPyClientData*) builtin_basetype->clientdata)->pytype;
- } else {
- PyErr_SetString(PyExc_TypeError, "Could not create type '_THyPhyNumber' as base '_THyPhyReturnObject' has not been initialized.\n");
-#if PY_VERSION_HEX >= 0x03000000
- return NULL;
-#else
- return;
-#endif
- }
- builtin_bases[builtin_base_count] = NULL;
- SwigPyBuiltin_InitBases(builtin_pytype, builtin_bases);
- PyDict_SetItemString(d, "this", this_descr);
- PyDict_SetItemString(d, "thisown", thisown_descr);
- if (PyType_Ready(builtin_pytype) < 0) {
- PyErr_SetString(PyExc_TypeError, "Could not create type '_THyPhyNumber'.");
-#if PY_VERSION_HEX >= 0x03000000
- return NULL;
-#else
- return;
-#endif
- }
- Py_INCREF(builtin_pytype);
- PyModule_AddObject(m, "_THyPhyNumber", (PyObject*) builtin_pytype);
- SwigPyBuiltin_AddPublicSymbol(public_interface, "_THyPhyNumber");
- d = md;
-
- /* type '::_THyPhyMatrix' */
- builtin_pytype = (PyTypeObject *)&SwigPyBuiltin___THyPhyMatrix_type;
- builtin_pytype->tp_dict = d = PyDict_New();
- SwigPyBuiltin_SetMetaType(builtin_pytype, metatype);
- builtin_pytype->tp_new = PyType_GenericNew;
- builtin_base_count = 0;
- builtin_basetype = SWIG_MangledTypeQuery("_p__THyPhyReturnObject");
- if (builtin_basetype && builtin_basetype->clientdata && ((SwigPyClientData*) builtin_basetype->clientdata)->pytype) {
- builtin_bases[builtin_base_count++] = ((SwigPyClientData*) builtin_basetype->clientdata)->pytype;
- } else {
- PyErr_SetString(PyExc_TypeError, "Could not create type '_THyPhyMatrix' as base '_THyPhyReturnObject' has not been initialized.\n");
-#if PY_VERSION_HEX >= 0x03000000
- return NULL;
-#else
- return;
-#endif
- }
- builtin_bases[builtin_base_count] = NULL;
- SwigPyBuiltin_InitBases(builtin_pytype, builtin_bases);
- PyDict_SetItemString(d, "this", this_descr);
- PyDict_SetItemString(d, "thisown", thisown_descr);
- if (PyType_Ready(builtin_pytype) < 0) {
- PyErr_SetString(PyExc_TypeError, "Could not create type '_THyPhyMatrix'.");
-#if PY_VERSION_HEX >= 0x03000000
- return NULL;
-#else
- return;
-#endif
- }
- Py_INCREF(builtin_pytype);
- PyModule_AddObject(m, "_THyPhyMatrix", (PyObject*) builtin_pytype);
- SwigPyBuiltin_AddPublicSymbol(public_interface, "_THyPhyMatrix");
- d = md;
-
- /* type '::_THyPhy' */
- builtin_pytype = (PyTypeObject *)&SwigPyBuiltin___THyPhy_type;
- builtin_pytype->tp_dict = d = PyDict_New();
- SwigPyBuiltin_SetMetaType(builtin_pytype, metatype);
- builtin_pytype->tp_new = PyType_GenericNew;
- builtin_base_count = 0;
- builtin_bases[builtin_base_count] = NULL;
- SwigPyBuiltin_InitBases(builtin_pytype, builtin_bases);
- PyDict_SetItemString(d, "this", this_descr);
- PyDict_SetItemString(d, "thisown", thisown_descr);
- if (PyType_Ready(builtin_pytype) < 0) {
- PyErr_SetString(PyExc_TypeError, "Could not create type '_THyPhy'.");
-#if PY_VERSION_HEX >= 0x03000000
- return NULL;
-#else
- return;
-#endif
- }
- Py_INCREF(builtin_pytype);
- PyModule_AddObject(m, "_THyPhy", (PyObject*) builtin_pytype);
- SwigPyBuiltin_AddPublicSymbol(public_interface, "_THyPhy");
- d = md;
- PyDict_SetItemString(md,(char*)"cvar", SWIG_globals());
- SwigPyBuiltin_AddPublicSymbol(public_interface, "cvar");
- SWIG_addvarlink(SWIG_globals(),(char*)"globalInterfaceInstance",Swig_var_globalInterfaceInstance_get, Swig_var_globalInterfaceInstance_set);
-#if PY_VERSION_HEX >= 0x03000000
- return m;
-#else
- return;
-#endif
-}
-
diff --git a/src/lib/build.sh b/src/lib/build.sh
deleted file mode 100644
index 0a2d47f..0000000
--- a/src/lib/build.sh
+++ /dev/null
@@ -1,186 +0,0 @@
-#!/bin/sh
-
-
-TARGET_NAME="BLANK"
-LIBRARY_BINDINGS=""
-
-if [ $# -ne 1 -a $# -ne 2 ]
-then
- TARGET_NAME="HELP";
-else
- if [ $1 != "SP" -a $1 != "MP" -a $1 != "MP2" -a $1 != "MPI" -a $1 != "DEBUG" -a $1 != "LIBRARY" ]
- then
- $TARGET_NAME = "HELP"
- else
- TARGET_NAME=$1
- fi
-fi
-
-if [ $TARGET_NAME = "HELP" ]
-then
- echo "Usage: build.sh package_name"
- echo " LIBRARY [Python|R]: multi-threaded library version with optional wrappers for Python or R."
- exit 1
-fi
-
-if [ $TARGET_NAME = "LIBRARY" -a $# -eq 2 ]
-then
- if [ $2 != "R" -a $2 != "Python" ]
- then
- echo "Library binding options must be one of the following:"
- echo " LIBRARY [Python|R]: multi-threaded library version with optional wrappers for Python or R."
- exit 1
- else
- echo "Library bindings for $2 will be linked into the library. See README for details"
- LIBRARY_BINDINGS=$2
- fi
-fi
-
-
-# MODIFY THESE BASED ON YOUR SYSTEM
-# DEFAULT SETTINGS ARE FOR GCC
-
-COMPILER="g++";
-COMPILERC="gcc";
-sysName=`uname`;
-echo $sysName;
-CURL_LINKER_LIBS=" -lssl -lcrypto -lcurl";
-
-if [ $sysName == "Darwin" ]
-then
- machName=`machine`;
- if [ $machName == "ppc7450" ]
- then
- COMPILER_FLAGS=" -D __UNIX__ -w -c -fsigned-char -fast -mcpu=7450 -fpermissive -I`pwd`/../Core -I`pwd`/../NewerFunctionality -I`pwd`/../../SQLite/trunk -D SQLITE_PTR_SIZE=sizeof(long) "
- else
- COMPILER_FLAGS=" -D __UNIX__ -w -c -fsigned-char -fast -fpermissive -I`pwd`/../Core -I`pwd`/../NewerFunctionality -I`pwd`/../../SQLite/trunk -D SQLITE_PTR_SIZE=sizeof(long) "
- fi
- COMPILER_LINK_FLAGS=" -w -fsigned-char ";
-else
- if [ $sysName == "AIX" ]
- then
- COMPILER="xlC";
- COMPILERC="xlc";
- COMPILER_FLAGS=" -c -qchar=signed -O3 -D SQLITE_PTR_SIZE=sizeof(long) -D __UNIX__ -I`pwd`/../Core -I`pwd`/../NewerFunctionality -I`pwd`/../../SQLite/trunk ";
- COMPILER_LINK_FLAGS=" -qchar=signed ";
- else
- COMPILER_LINK_FLAGS=" -w -fsigned-char ";
- COMPILER_FLAGS=" -w -c -fsigned-char -O3 -fpermissive -I`pwd`/../Core -I`pwd`/../NewerFunctionality -I`pwd`/../../SQLite/trunk -D SQLITE_PTR_SIZE=sizeof(long) -D __UNIX__ ";
- fi
-fi
-
-
-# END MODIFY
-
-echo "Checking for curl";
-echo "#include <curl/curl.h>\nint main(void) {return 0;}" > curl_check.cpp
-
-if `$COMPILER -o curl_check -w $CURL_LINKER_LIBS curl_check.cpp`
-then
- echo "Curl seems to be present"
-else
- echo "Curl seems to be absent (setting up compiler options skip CURL code)";
- CURL_LINKER_LIBS="";
- COMPILER_FLAGS=$COMPILER_FLAGS" -D__HYPHY_NO_CURL__";
- COMPILER_LINK_FLAGS=$COMPILER_LINK_FLAGS" -D__HYPHY_NO_CURL__";
-fi
-
-rm -rf curl_check*
-
-
-makedir () {
- if [ -f $1 ]
- then
- echo "Insufficient permissions to create an object directory";
- exit 1;
- fi
-
- if [ ! -d $1 ]
- then
- if [ `mkdir $1` ]
- then
- echo "Failed to create directory $1";
- exit 1;
- fi
- fi
-}
-
-compileAll () {
- cd $1
- for fileName in *$2
- do
- obj_file=$3/$OBJ_DIR_NAME/${fileName}.o;
- if [ $obj_file -nt $fileName ]
- then
- echo File "$fileName" is up to date
- else
- echo Building "$fileName";
- if [ $2 = "c" ]
- then
- ccd=$COMPILERC
- else
- ccd=$COMPILER
- fi
- if `$ccd -o $obj_file $COMPILER_FLAGS -fvisibility=hidden $fileName `
- then
- echo Complete
- else
- echo Error during compilation;
- exit 1;
- fi
- fi
- done
- cd $3
-}
-
-OBJ_DIR_NAME="obj_$TARGET_NAME"
-
-if [ -f $OBJ_DIR_NAME ]
-then
- rm -rf $OBJ_DIR_NAME;
-fi
-
-makedir $OBJ_DIR_NAME
-
-
-if [ $1 = "LIBRARY" ]
-then
- LINKER_FLAGS=$CURL_LINKER_LIBS" -ldl -lm -lpthread ";
- echo "+-----------------------------------------------------------+"
- echo "|Building a multi-threaded HYPHY library version |"
- echo "+-----------------------------------------------------------+"
- if [ $sysName == "Darwin" ]
- then
- TARGET_NAME="libhyphy.so";
- COMPILER_FLAGS=$COMPILER_FLAGS" -fno-strict-aliasing -D __MP__ -D __MP2__ -D __HEADLESS__ -fPIC -I`pwd`/Link "
- COMPILER_LINK_FLAGS=$COMPILER_LINK_FLAGS" -bundle -flat_namespace -undefined suppress "
- else
- COMPILER_FLAGS=$COMPILER_FLAGS" -D __MP__ -D __MP2__ -D __HEADLESS__ -fPIC -I`pwd`/Link "
- COMPILER_LINK_FLAGS=$COMPILER_LINK_FLAGS" -Wl,-shared "
- fi
-
-fi
-
-COMPILER_FLAGS=$COMPILER_FLAGS" -I `pwd`/../Source"
-
-echo "COMPILER=$COMPILER, $COMPILERC";
-echo "COMPILER_FLAGS=$COMPILER_FLAGS";
-
-compileAll ../Source cpp ../Library
-compileAll ../GUI preferences.cpp ../Library
-compileAll ../Source/SQLite c ../../Library
-
-if [ $LIBRARY_BINDINGS = "R" ]
-then
- echo $COMPILER_FLAGS
- compileAll Link THyPhy.cpp ../
- echo Linking HyPhy.so
- cppf="PKG_CPPFLAGS=\"-I`pwd`/Link/\""
- #echo $cppf R CMD SHLIB -o LibraryModules/R/HyPhy.so $OBJ_DIR_NAME/*.o Link/Source/THyPhy_R.cpp $LINKER_FLAGS
- export $cppf; R CMD SHLIB -o LibraryModules/R/HyPhy.so $OBJ_DIR_NAME/*.o SWIGWrappers/THyPhy_R.cpp $LINKER_FLAGS
- echo R library written to `pwd`/LibraryModules/R/HyPhy.so
-fi
-
-echo Finished
-
-
diff --git a/src/lib/Link/THyPhy.cpp b/src/lib/link/THyPhy.cpp
similarity index 100%
rename from src/lib/Link/THyPhy.cpp
rename to src/lib/link/THyPhy.cpp
diff --git a/src/lib/Link/THyPhy.h b/src/lib/link/THyPhy.h
similarity index 100%
rename from src/lib/Link/THyPhy.h
rename to src/lib/link/THyPhy.h
diff --git a/src/lib/setup.py b/src/lib/setup.py
deleted file mode 100644
index 3bad511..0000000
--- a/src/lib/setup.py
+++ /dev/null
@@ -1,97 +0,0 @@
-#!/usr/bin/python
-
-from distutils.core import setup, Extension
-from distutils.sysconfig import get_python_inc
-from os import listdir, getcwd, path
-from glob import glob
-import sys
-
-from platform import architecture, mac_ver
-
-#incdir = get_python_inc(plat_specific=1)
-#print incdir
-
-
-#build the list of Source files
-
-scriptPath = path.realpath(path.dirname(sys.argv[0]))
-srcPath, libDir = path.split(scriptPath)
-hyphyPath, srcDir = path.split(srcPath)
-# with open('batchfiles.list') as fh:
-# resFiles = [(f, path.join(*(['..'] * 5 + f.split('/')))) for f in fh.read().split('\n') if f != '']
-
-contribPath = path.join(hyphyPath, 'contrib')
-sqlitePath = path.join(contribPath, 'SQLite-3.8.2')
-
-linkPath = path.join(scriptPath, 'Link')
-coreSrcPath = path.join(srcPath, 'core')
-newSrcPath = path.join(srcPath, 'new')
-guiSrcPath = path.join(srcPath, 'gui')
-prefFile = [path.join(guiSrcPath, 'preferences.cpp')]
-
-if sys.version_info >= (3,0,0):
- swigFile = [path.join(scriptPath, 'SWIGWrappers', 'THyPhy_py3.cpp')]
-else:
- swigFile = [path.join(scriptPath, 'SWIGWrappers', 'THyPhy_python.cpp')]
-
-coreSrcFiles = glob(path.join(coreSrcPath, '*.cpp'))
-newSrcFiles = glob(path.join(newSrcPath, '*.cpp'))
-sqliteFiles = glob(path.join(sqlitePath, '*.c'))
-linkFiles = glob(path.join(linkPath, '*.cpp')) # + glob(path.join(linkPath, '*.cxx'))
-utilFiles = glob(path.join(srcPath, 'utils', '*.cpp'))
-
-sourceFiles = coreSrcFiles + newSrcFiles + sqliteFiles + prefFile + linkFiles + swigFile + utilFiles
-
-includePaths = [path.join(p, 'include') for p in [coreSrcPath, newSrcPath, guiSrcPath]]
-includePaths += [linkPath, contribPath, sqlitePath]
-
-# check for 64bit and define as such
-define_macros = [('__HYPHY_64__', None)] if '64' in architecture()[0] else []
-
-# openmp on Mac OS X Lion is broken
-major, minor, patch = mac_ver()[0].split('.')
-openmp = ['-fopenmp'] if int(major) < 10 or (int(major) == 10 and int(minor) < 7) else []
-
-setup(
- name = 'HyPhy',
- version = '0.1.1',
- description = 'HyPhy package interface library',
- author = 'Sergei L Kosakovsky Pond',
- author_email = 'spond at ucsd.edu',
- url = 'http://www.hyphy.org/',
- packages = ['HyPhy'],
- package_dir = {'HyPhy': 'LibraryModules/Python/HyPhy'},
-# data_files = resFiles,
- # py_modules = ['HyPhy'],
- ext_modules = [Extension('_HyPhy',
- sourceFiles,
- include_dirs = includePaths,
- define_macros = [('SQLITE_PTR_SIZE','sizeof(long)'),
- ('__UNIX__', None),
- ('__MP__', None),
- ('__MP2__', None),
- ('_SLKP_LFENGINE_REWRITE_', None),
- ('__AFYP_REWRITE_BGM__', None),
- ('__HEADLESS__', None),
- ('_HYPHY_LIBDIRECTORY_', '"/usr/local/lib/hyphy"')] + define_macros,
- libraries = ['pthread', 'ssl', 'crypto', 'curl'],
- extra_compile_args = [
- '-Wno-int-to-pointer-cast',
- # '-Wno-pointer-to-int-cast',
- '-Wno-char-subscripts',
- '-Wno-sign-compare',
- '-Wno-parentheses',
- '-Wno-uninitialized',
-# '-Wno-conversion-null',
- '-Wno-unused-variable',
-# '-Wno-unused-but-set-variable',
- '-Wno-shorten-64-to-32',
- '-fsigned-char',
- '-O3',
- '-fpermissive',
- '-fPIC',
- ] + openmp,
- extra_link_args = [
- ] + openmp
- )]
-)
--
Alioth's /usr/local/bin/git-commit-notice on /srv/git.debian.org/git/debian-med/hyphy.git
More information about the debian-med-commit
mailing list