[Debian-med-packaging] Bug#963313: vg: FTBFS: configure: error: Could not find a version of the library!
Lucas Nussbaum
lucas at debian.org
Sun Jun 21 21:03:07 BST 2020
Source: vg
Version: 1.24.0+ds-1
Severity: serious
Justification: FTBFS on amd64
Tags: bullseye sid ftbfs
Usertags: ftbfs-20200620 ftbfs-bullseye
Hi,
During a rebuild of all packages in sid, your package failed to build
on amd64.
Relevant part (hopefully):
> debian/rules override_dh_auto_test-arch
> make[1]: Entering directory '/<<PKGBUILDDIR>>'
> export PATH=$PATH:/<<PKGBUILDDIR>>/debian/help && . ./source_me.sh && cd test && prove -v t
> index file /tmp/vg-gguSCo/vg-syE3Ap.fai not found, generating...
> index file /tmp/vg-gguSCo/vg-6RlV5n.fai not found, generating...
> index file /tmp/vg-gguSCo/vg-1W23ar.fai not found, generating...
> index file /tmp/vg-gguSCo/vg-ud2rPq.fai not found, generating...
> warning:[vg::Constructor] Unsupported variant allele "<DEL>"; Skipping variant(s) x 9 sv1 N <DEL> 99 PASS AC=1;CIEND=-3,0;CIPOS=0,3;END=29;NA=1;NS=1;SVTYPE=DEL GT !
> index file /tmp/vg-gguSCo/vg-1iuP8q.fai not found, generating...
> index file /tmp/vg-gguSCo/vg-rn9CWm.fai not found, generating...
> index file /tmp/vg-gguSCo/vg-HdBZ9o.fai not found, generating...
> index file /tmp/vg-gguSCo/vg-WDJHMp.fai not found, generating...
> index file /tmp/vg-gguSCo/vg-sP84vq.fai not found, generating...
> index file /tmp/vg-gguSCo/vg-btF5Cn.fai not found, generating...
> index file /tmp/vg-gguSCo/vg-y1Zapp.fai not found, generating...
> index file /tmp/vg-gguSCo/vg-3c0pFn.fai not found, generating...
> index file /tmp/vg-gguSCo/vg-6Gfjco.fai not found, generating...
> index file /tmp/vg-gguSCo/vg-a1SZun.fai not found, generating...
> Warning: deletion END and SVLEN do not agree [canonicalize] x 9 sv1 N <DEL> 99 PASS AC=1;CIEND=-3,0;CIPOS=0,3;END=29;NA=1;NS=1;SPAN=19;SVLEN=-19;SVTYPE=DEL GT
> END: 29 SVLEN: -19
> index file /tmp/vg-gguSCo/vg-FhOCUm.fai not found, generating...
> Warning: deletion END and SVLEN do not agree [canonicalize] x 9 sv1 N <DEL> 99 PASS AC=1;CIEND=-3,0;CIPOS=0,3;END=29;NA=1;NS=1;SPAN=19;SVLEN=-19;SVTYPE=DEL GT
> END: 29 SVLEN: -19
> index file /tmp/vg-gguSCo/vg-EH5Jlp.fai not found, generating...
> index file /tmp/vg-gguSCo/vg-wnyCyq.fai not found, generating...
> index file /tmp/vg-gguSCo/vg-QMWW0p.fai not found, generating...
> index file /tmp/vg-gguSCo/vg-R33A1o.fai not found, generating...
> index file /tmp/vg-gguSCo/vg-lZXqKq.fai not found, generating...
> index file /tmp/vg-gguSCo/vg-mv5Yzn.fai not found, generating...
> index file /tmp/vg-gguSCo/vg-Ig3qeq.fai not found, generating...
> index file /tmp/vg-gguSCo/vg-DVYKTm.fai not found, generating...
> index file /tmp/vg-gguSCo/vg-17Wq4n.fai not found, generating...
> Warning: insertion END and POS do not agree (complex insertions not canonicalizeable) [canonicalize] x 9 sv1 N <INS> 99 PASS AC=1;CIPOS=0,3;END=18;NA=1;NS=1;SEQ=ACTG;SPAN=4;SVLEN=4;SVTYPE=INS GT
> END: 18 POS: 9
> index file /tmp/vg-gguSCo/vg-Teyo8o.fai not found, generating...
> Warning: insertion END and POS do not agree (complex insertions not canonicalizeable) [canonicalize] x 9 sv1 N <INS> 99 PASS AC=1;CIPOS=0,3;END=18;NA=1;NS=1;SEQ=ACTG;SPAN=4;SVLEN=4;SVTYPE=INS GT
> END: 18 POS: 9
> index file /tmp/vg-gguSCo/vg-mo7Ran.fai not found, generating...
> Warning: insertion END and POS do not agree (complex insertions not canonicalizeable) [canonicalize] x 9 sv1 N <INS> 99 PASS AC=1;CIPOS=0,3;END=13;NA=1;NS=1;SEQ=ACTG;SPAN=4;SVLEN=4;SVTYPE=INS GT
> END: 13 POS: 9
> Warning: VCF writer incorrecty produced END = POS + SVLEN for an insertion. Fixing END to POS.
> index file /tmp/vg-gguSCo/vg-TZReAn.fai not found, generating...
> Warning: insertion END and POS do not agree (complex insertions not canonicalizeable) [canonicalize] x 9 sv1 N <INS> 99 PASS AC=1;CIPOS=0,3;END=13;NA=1;NS=1;SEQ=ACTG;SPAN=4;SVLEN=4;SVTYPE=INS GT
> END: 13 POS: 9
> Warning: VCF writer incorrecty produced END = POS + SVLEN for an insertion. Fixing END to POS.
> index file /tmp/vg-gguSCo/vg-oWYqqo.fai not found, generating...
> index file /tmp/vg-gguSCo/vg-m8Na5q.fai not found, generating...
> index file /tmp/vg-gguSCo/vg-31hESq.fai not found, generating...
> warning:[vg::Constructor] Lowercase characters found in x; coercing to uppercase.
> index file /tmp/vg-gguSCo/vg-eG31xq.fai not found, generating...
> warning:[vg::Constructor] Lowercase characters found in x; coercing to uppercase.
> index file /tmp/vg-gguSCo/vg-TBAUoq.fai not found, generating...
> index file /tmp/vg-gguSCo/vg-WQEhkn.fai not found, generating...
> index file /tmp/vg-gguSCo/vg-JWE3bp.fai not found, generating...
> index file /tmp/vg-gguSCo/vg-fy4xbn.fai not found, generating...
> Warning: Cactus does not currently support finding snarls in a single-node connected component
> t/00_unittest.t .......
> 1..1
> ===============================================================================
> All tests passed (7524960 assertions in 429 test cases)
> ok 1 - vg unit tests complete successfully
> ok
> t/01_build_graph.t ....
> 1..1
> ok 1 - graph building with the API
> ok
> warning:[vg::Constructor] Unsupported variant allele "<CN0>"; Skipping variant(s) z 13790 BI_GS_DEL1_B1_P2734_15 T <CN0> 100 PASS AC=1;AF=0.000199681;AFR_AF=0;AMR_AF=0;AN=5008;CIEND=-75,76;CIPOS=-75,76;CS=DEL_union;DP=15541;EAS_AF=0;END=1017354;EUR_AF=0.001;NS=2504;SAS_AF=0;SVLEN=-3562;SVTYPE=DEL !
> warning:[vg::Constructor] Unsupported variant allele "<INS:ME:ALU>"; Skipping variant(s) z 14169 ALU_umary_ALU_12010 G <INS:ME:ALU> 100 PASS AC=43;AF=0.00858626;AFR_AF=0.0303;AMR_AF=0.0043;AN=5008;CS=ALU_umary;DP=18053;EAS_AF=0;EUR_AF=0;MEINFO=AluUndef,2,281,+;NS=2504;SAS_AF=0;SVLEN=279;SVTYPE=ALU;TSD=null !
> warning:[vg::Constructor] Unsupported variant allele "<CN2>"; Skipping variant(s) z 490168 DUP_gs_CNV_20_1490168_1549769 G <CN2> 100 PASS AC=1;AF=0.000199681;AFR_AF=0;AMR_AF=0;AN=5008;CS=DUP_gs;DP=21874;EAS_AF=0;END=1549769;EUR_AF=0;NS=2504;SAS_AF=0.001;SVTYPE=DUP !
> warning:[vg::Constructor] Unsupported variant allele "<CN0>"; Skipping variant(s) z 13790 BI_GS_DEL1_B1_P2734_15 T <CN0> 100 PASS AC=1;AF=0.000199681;AFR_AF=0;AMR_AF=0;AN=5008;CIEND=-75,76;CIPOS=-75,76;CS=DEL_union;DP=15541;EAS_AF=0;END=1017354;EUR_AF=0.001;NS=2504;SAS_AF=0;SVLEN=-3562;SVTYPE=DEL !
> warning:[vg::Constructor] Unsupported variant allele "<INS:ME:ALU>"; Skipping variant(s) z 14169 ALU_umary_ALU_12010 G <INS:ME:ALU> 100 PASS AC=43;AF=0.00858626;AFR_AF=0.0303;AMR_AF=0.0043;AN=5008;CS=ALU_umary;DP=18053;EAS_AF=0;EUR_AF=0;MEINFO=AluUndef,2,281,+;NS=2504;SAS_AF=0;SVLEN=279;SVTYPE=ALU;TSD=null !
> Restricting to gi|568815592:29791752-29792749 from 1 to end
> index file sv/x.fa.fai not found, generating...
> error:[vg::Constructor] non-ATGCN characters found in variant:
> x 973 . G A,* 99 . AC=2;LEN=1;NA=2;NS=1;TYPE=snp
> index file tiny/ambiguous.fa.fai not found, generating...
> warning:[vg::Constructor] Unsupported IUPAC ambiguity codes found in x; coercing to N.
> t/02_vg_construct.t ...
> 1..28
> ok 1 - construction produces the right number of nodes
> ok 2 - construction produces the right number of edges
> ok 3 - construction obeys rename and region options
> ok 4 - construction of a 1 megabase graph from the 1000 Genomes succeeds
> ok 5 - the 1mb graph has the expected number of nodes
> ok 6 - the 1mb graph has the expected number of edges
> ok 7 - node size is manageable by default
> ok 8 - construction of a very complex region succeeds
> ok 9 - the complex graph has the expected number of nodes
> ok 10 - the complex graph has the expected number of edges
> ok 11 - the ordering of variants at the same position has no effect on the resulting graph
> ok 12 - construction does not fail when the first position in the VCF is repeated and has an indel
> ok 13 - the size of the regions used in construction has no effect on the graph
> ok 14 - the number of threads used in construction has no effect on the graph
> ok 15 - the number of threads and regions used in construction has no effect on the graph
> ok 16 - construction of a graph with two head nodes succeeds
> ok 17 - the graph contains all the sequence in the reference and VCF
> ok 18 - varying the max node size does not affect graph length
> ok 19 - nodes are correctly capped in size
> ok 20 - -R --region flag is respected
> ok 21 - vg construct does not require a vcf
> ok 22 - vg construct respects node size limit
> ok 23 - --region can be interpreted to be a reference sequence (and not parsed as a region spec)
> ok 24 - vg constructs the correct graph for inversions
> ok 25 - vg construct skips variants with . ALTs
> ok 26 - VCF with * alleles is rejected
> ok 27 - Reference with ambiguity codes has them coerced to Ns
> ok 28 - Expected number of Ns are created
> ok
> t/03_vg_view.t ........
> 1..19
> ok 1 - view produces the expected number of lines of dot output
> ok 2 - view produces the expected number of lines of GFA output
> ok 3 - view converts back and forth between GFA and vg format
> ok 4 - view can convert BAM to GAM
> ok 5 - view can round-trip JSON and GAM
> ok 6 - view can reconstruct a VG graph from JSON
> ok 7 - view can pass through VG when loading as vg::VG
> ok 8 - view can pass through semantically identical VG normally
> ok 9 - view parses sample names
> ok 10 - view can handle fastq input
> ok 11 - view can translate graphs with 2-node cycles
> ok 12 - view outputs properly oriented GFA
> ok 13 - view produces the expected number of lines of dot output from a cyclic graph
> ok 14 - streaming JSON output produces the expected number of chunks
> ok 15 - duplicate warnings can be suppressed when loading as vg::VG
> ok 16 - gfa graphs with overlaps are rejected
> ok 17 - GFA import produces a concise error message when overlaps are present
> ok 18 - GFA import rejects a GFA file with an overlap that goes beyond its sequences
> ok 19 - GFA import produces a concise error message in that case
> ok
> [vg augment] warning: reading the entire GAM from stdin into memory. it is recommended to pass in a filename rather than - so it can be streamed over two passes
> t/04_vg_align.t .......
> 1..20
> ok 1 - alignment traverses the correct path
> ok 2 - alignment score is as expected
> ok 3 - full length bonus works and is included by default
> ok 4 - bonuses are included on only one end for pinned alignments
> ok 5 - scoring parameters are respected
> ok 6 - score-matrix file should give same results as --match 2 --mismatch 2: scoring parameters are respected
> ok 7 - alignment does not contain excessive soft clips under lenient scoring
> ok 8 - score-matrix file should give same results as --match 2 --mismatch 2: alignment does not contain excessive soft clips under lenient scoring
> ok 9 - alignment score does not overflow at 255 when using 8x16bit vectors
> ok 10 - score-matrix file should give same results as --match 2 --mismatch 2: alignment score does not overflow at 255 when using 8x16bit vectors
> ok 11 - Ns do not cause excessive soft clipping
> ok 12 - nodes are only referenced if they have mappings
> ok 13 - align can use query names and outputs GAM
> ok 14 - alignment to cyclic graphs works
> ok 15 - graphs where duplicated nodes need flipping can be used for alignment
> ok 16 - node flipping doesn't destroy the alignment
> ok 17 - alignment correctly handles an inversion
> ok 18 - the exploding graph doesn't blow up
> ok 19 - pinning doesn't cause problems for gssw
> ok 20 - left pinning is correctly handled
> ok
> graph path 'x' invalid: edge from 202 end to 205 start does not exist
> [vg view] warning: graph is invalid!
> t/05_vg_find.t ........
> 1..28
> ok 1 - construction
> ok 2 - a path can be queried from the xg index
> ok 3 - a node near another can be obtained using context from the xg index
> ok 4 - each perfect read contains one maximal exact match
> ok 5 - vg find -D finds approximate distance between 2 adjacent node starts
> ok 6 - vg find -D finds approximate distance between node start and adjacent snp
> ok 7 - vg find -D jumps deletion
> ok 8 - vg find -D jumps deletion from other allele in snp
> ok 9 - vg find -L finds same number of nodes (with -c 1)
> ok 10 - vg find -L works with -r. it scans from start position of first node in range
> ok 11 - vg find -L tracks length from start position of input node
> ok 12 - vg find -L works with more than one input node
> ok 13 - we find the 4 canonical SMEMs from @lh3's bwa mem poster
> ok 14 - we can find the right MEMs for a sequence with Ns
> ok 15 - we find the same MEMs sequences with different lengths of Ns
> ok 16 - the index can return the set of alignments mapping to a particular node
> ok 17 - a subgraph query may be used to obtain a particular subset of alignments
> ok 18 - the GAM index can return the set of alignments mapping to a node
> ok 19 - a subgraph query may be used to obtain a particular subset of alignments from a sorted GAM
> ok 20 - the index can be queried using GAM alignments
> ok 21 - find gets connected edges between queried nodes by default
> ok 22 - find gets nodes provided in a node file list
> ok 23 - extracting by path adds no extra edges
> ok 24 - pattern based path extraction works
> ok 25 - path DAG range query works
> ok 26 - we can extract a set of targets to separate files
> ok 27 - the same extraction can be made using BED input
> ok 28 - we see the expected number of kmers in the given targets
> ok
> t/06_vg_index.t: line 8: warning: setlocale: LC_ALL: cannot change locale (en_US.utf8): No such file or directory
> error: could not parse i from argument "x.vg"
> t/06_vg_index.t .......
> 1..62
> ok 1 - building an XG index of a graph
> ok 2 - building a GCSA index of a graph
> ok 3 - building both indexes at once
> ok 4 - the indexes are identical when built one at a time and together
> ok 5 - building GCSA from XG
> ok 6 - the GCSA indexes are identical when built from vg and from xg
> ok 7 - building a GBWT index of a graph with haplotypes
> ok 8 - building an XG index of a graph with haplotypes
> ok 9 - xg index does not contain alt paths by default
> ok 10 - building an XG index of a graph with haplotypes and alt paths included
> ok 11 - xg index does contains alt paths with index -L
> ok 12 - building a GCSA index of a graph with haplotypes
> ok 13 - building all indexes at once
> ok 14 - the indexes are identical
> ok 15 - building all indexes at once, while leaving alt paths in xg
> ok 16 - the indexes are identical with -L
> ok 17 - xg index does contains alt paths with index -L all at once
> ok 18 - storing a VCF parse for a graph with haplotypes
> ok 19 - building a GBWT index from the VCF parse
> ok 20 - the indexes are identical
> ok 21 - samples can be excluded from haplotype indexing
> ok 22 - excluded samples were not included in the GBWT index
> ok 23 - building GBWT index for a regional graph
> ok 24 - no warnings about missing variants produced
> ok 25 - building an XG index of multiple graphs
> ok 26 - building a GCSA index of multiple graphs
> ok 27 - building both indexes at once
> ok 28 - the indexes are identical
> ok 29 - building a GBWT index of multiple graphs with haplotypes
> ok 30 - building an XG index of multiple graphs with haplotypes
> ok 31 - building a GCSA index of multiple graphs with haplotypes
> ok 32 - building all three indexes at once
> ok 33 - the indexes are identical
> ok 34 - storing a VCF parse for multiple graphs with haplotypes
> ok 35 - building a GBWT index from the VCF parses
> ok 36 - the indexes are identical
> ok 37 - GBWT can be built for paths
> ok 38 - GBWT can be built for both paths and haplotypes
> ok 39 - fail with nonexistent file
> ok 40 - a prebuilt deBruijn graph in GCSA2 format may be used
> ok 41 - index can store alignments
> ok 42 - index can dump alignments
> ok 43 - alignment index stores unmapped reads
> ok 44 - alignment index can be loaded using sequential invocations; next_nonce persistence
> ok 45 - index stores all mappings
> ok 46 - vg index and vg gamsort produce identical sorted GAM indexes
> ok 47 - threads may be exported to binary for use in GBWT construction
> ok 48 - storage of multiple graphs in an index succeeds
> ok 49 - can index backward nodes
> ok 50 - can index kmers for backward nodes
> ok 51 - index can store alignments to backward nodes
> ok 52 - index can store alignments to cyclic graphs
> ok 53 - GCSA2 index works on cyclic graphs with heads and tails
> ok 54 - GCSA2 index works on cyclic graphs with no heads or tails
> ok 55 - GCSA2 index works on cyclic graphs with self loops
> ok 56 - GCSA2 index works on general cyclic graphs
> ok 57 - GCSA2 indexing of a tiny graph works
> ok 58 - GCSA2 indexing succeeds on a single-node graph
> ok 59 - GCSA2 indexing succeeds on graph with heads but no tails
> ok 60 - a useful error message is produced when nodes are too large
> ok 61 - building a distance index of a graph
> ok 62 - building a distance index of a graph without maximum index
> ok
> t/07_vg_map.t: line 134: column: command not found
> [vg::alignment.cpp] couldn't open reads/NONEXISTENT
> [vg::alignment.cpp] couldn't open reads/NONEXISTENT
> [vg::alignment.cpp] couldn't open reads/NONEXISTENT
> [vg::alignment.cpp] couldn't open reads/NONEXISTENT
> index file t.fa.fai not found, generating...
> t/07_vg_map.t .........
> 1..54
> ok 1 - offset counts unused bases from the start of the node on the forward strand
> ok 2 - xdrop alignment obtains the expected result
> ok 3 - xdrop alignment obtains the expected result for the reverse complement
> ok 4 - score-matrix defaults match 1 mismatch -4 should produce same results: with matrixoffset counts unused bases from the start of the node on the forward strand
> ok 5 - offset counts unused bases from the start of the node on the reverse strand
> ok 6 - global alignment traverses the correct path
> ok 7 - alignment score is as expected
> ok 8 - scoring parameters are respected
> ok 9 - score-matrix file should give same results as --match 2 --mismatch 2: scoring parameters are respected
> ok 10 - full length bonus always be included
> ok 11 - full length bonus can be set to 0
> ok 12 - vg map takes -d as input without a variant graph
> ok 13 - vg map can align across a SNP
> ok 14 - alignment works on a small graph
> ok 15 - binary alignment format is equivalent to json version
> ok 16 - alignment from BAM correctly handles qualities
> ok 17 - chunky-banded alignment works
> ok 18 - multiple alignments are returned in descending score order
> ok 19 - only a single primary alignment is returned
> ok 20 - mapping of BAM file produces expected number of alignments
> ok 21 - mapping from a fastq produces the expected number of alignments
> ok 22 - allowing secondary alignments with MEM mapping does not change number of primary alignments
> ok 23 - vg connects paired-end reads in gam output
> ok 24 - mapping to graphs that can't be oriented without swapping edges works correctly
> ok 25 - reads multi-map to multiple possible locations
> ok 26 - vg map works based on gcsa and xg indexes
> ok 27 - the mapping quality may be capped
> ok 28 - paired read alignments forced to be consistent have lower score than unrestricted alignments
> ok 29 - paired read alignments forced to be consistent are closer together in node id space than unrestricted alignments
> ok 30 - only primary alignments have mapping quality scores
> ok 31 - unpaired reads produce mapping quality scores
> ok 32 - map returns same output on xg and vg (single threaded)
> not ok 33 - unnamed test
> # got: '10'
> # expected: 'base quality adjusted alignment produces higher scores if mismatches have low quality'
> ok 34 - error on vg map -f <nonexistent-file> (unpaired)
> ok 35 - error on vg map -f <nonexistent-file> (interleaved)
> ok 36 - error on vg map -f <nonexistent-file> (paired, LHS)
> ok 37 - error on vg map -f <nonexistent-file> (paired, RHS)
> ok 38 - mapping a read that touches unused nodes gets the base score
> ok 39 - mapping a read that matches a haplotype gets a small penalty
> ok 40 - mapping a read that matches a haplotype with exponent 0 gets the base score
> ok 41 - mapping a read that matches no haplotypes gets a larger penalty
> ok 42 - surjection of paired reads to SAM yields correct positions
> ok 43 - surjection of paired reads to SAM yields correct pair partner positions
> ok 44 - surjection of paired reads to SAM yields properly matched QNAMEs
> ok 45 - surjection of paired reads to SAM produces correct pair partner contigs
> ok 46 - surjection of paired reads to SAM produces correct flags
> ok 47 - surjection of unpaired reads to SAM yields correct positions
> ok 48 - surjection of unpaired reads to SAM yields correct pair partner positions
> ok 49 - surjection of unpaired reads to SAM yields distinct QNAMEs
> ok 50 - surjection of unpaired reads to SAM produces absent partner contigs
> ok 51 - surjection of unpaired reads to SAM produces correct flags
> ok 52 - mapper can read FASTA input
> ok 53 - mapper can read multiline FASTA input
> ok 54 - xdrop works on a reversed read
> Failed 1/54 subtests
> t/08_vg_ids.t .........
> 1..10
> ok 1 - minimum node as expected (id compaction correct)
> ok 2 - maximum node is as expected (id compaction correct)
> ok 3 - correctly generated joint id space for several graphs
> ok 4 - can sort and re-number a graph with self loops
> ok 5 - can sort and renumber a complex cyclic graph
> ok 6 - sorting removes back-edges in a DAG
> ok 7 - sorting assigns node IDs in topological order
> ok 8 - sorting does not affect id range
> ok 9 - sorting does not affect id range of vg
> ok 10 - sorting does not affect id range of hg
> ok
> t/09_vg_concat.t ......
> 1..4
> ok 1 - concat doubles the number of nodes
> ok 2 - concat doubles the number of edges + 1
> ok 3 - concat -p doubles the number of nodes on reversing graph
> ok 4 - concat -p doubles the number of edges + 1 on reversing graph
> ok
> t/100_code_quality.t ..
> 1..1
> ok 1 - code quality is acceptable
> ok
> warning:[vg::Constructor] Unsupported variant allele "<CN0>"; Skipping variant(s) z 13790 BI_GS_DEL1_B1_P2734_15 T <CN0> 100 PASS AC=1;AF=0.000199681;AFR_AF=0;AMR_AF=0;AN=5008;CIEND=-75,76;CIPOS=-75,76;CS=DEL_union;DP=15541;EAS_AF=0;END=1017354;EUR_AF=0.001;NS=2504;SAS_AF=0;SVLEN=-3562;SVTYPE=DEL !
> warning:[vg::Constructor] Unsupported variant allele "<INS:ME:ALU>"; Skipping variant(s) z 14169 ALU_umary_ALU_12010 G <INS:ME:ALU> 100 PASS AC=43;AF=0.00858626;AFR_AF=0.0303;AMR_AF=0.0043;AN=5008;CS=ALU_umary;DP=18053;EAS_AF=0;EUR_AF=0;MEINFO=AluUndef,2,281,+;NS=2504;SAS_AF=0;SVLEN=279;SVTYPE=ALU;TSD=null !
> warning:[vg::Constructor] Unsupported variant allele "<CN2>"; Skipping variant(s) z 490168 DUP_gs_CNV_20_1490168_1549769 G <CN2> 100 PASS AC=1;AF=0.000199681;AFR_AF=0;AMR_AF=0;AN=5008;CS=DUP_gs;DP=21874;EAS_AF=0;END=1549769;EUR_AF=0;NS=2504;SAS_AF=0.001;SVTYPE=DUP !
> t/10_vg_stats.t .......
> 1..11
> ok 1 - vg stats reports the expected number of nodes
> ok 2 - vg stats reports the expected number of edges
> ok 3 - vg stats reports the expected graph length
> ok 4 - vg stats reports the correct number of subgraphs
> ok 5 - vg stats reports the correct subgraph length
> ok 6 - distance to head is correct
> ok 7 - distance to tail is correct
> ok 8 - aligned read stats are computed correctly
> ok 9 - basic stats agree between graph formats
> ok 10 - stats can be computed for GAM files without graphs
> ok 11 - a path overlap description of a test graph has the expected length
> ok
> t/11_vg_paths.t .......
> 1..13
> ok 1 - path listing works from vg
> ok 2 - path listing works from XG
> ok 3 - thread listing works from GBWT
> ok 4 - thread selection by name prefix works correctly
> ok 5 - thread selection by sample name works correctly
> ok 6 - no threads are reported for invalid samples
> ok 7 - vg paths may be used to extract threads
> ok 8 - Fasta extracted from xg is the same as the input fasta
> ok 9 - Fasta extracted from vg is the same as the input fasta
> ok 10 - Fasta extracted from threads has correct number of lines
> ok 11 - a single path may be retained
> ok 12 - path filtering does not modify the graph
> ok 13 - alt allele paths can be dropped
> ok
> warning[vg mod]: -o is deprecated. Dangling edges are now automatically removed.
> t/12_vg_kmers.t .......
> 1..10
> ok 1 - correct numbers of kmers in the graph
> ok 2 - to_end edges are handled correctly
> ok 3 - from_start edges are handled correctly
> ok 4 - GCSA2 output produces the expected number of lines
> ok 5 - GCSA2 binary output produces the expected number bytes
> ok 6 - GCSA2 output works when next position is multiple
> ok 7 - GCSA2 output works when previous characters are multiple
> ok 8 - edge-max correctly bounds the number of kmers in a complex graph
> ok 9 - start/stop node IDs can be specified in GCSA2 output
> ok 10 - attempting to generate kmers longer than the longest path in a graph correctly yields no kmers
> ok
> index file n.fa.fai not found, generating...
> t/13_vg_sim.t .........
> 1..18
> ok 1 - vg sim creates the correct number of reads
> ok 2 - end bonuses are included
> ok 3 - alignments may be generated rather than read sequences
> ok 4 - alignments are produced on both strands
> ok 5 - high simulated error rates do not change the number of bases generated
> ok 6 - vg sim creates forward-strand reads when asked
> ok 7 - vg sim can simulate from just a path
> ok 8 - vg sim can simulate from just a path in FASTQ mode
> ok 9 - reads can be simulated from all paths
> ok 10 - simulation was successful
> ok 11 - reads can be simulated from GBWT samples
> ok 12 - simulation was successful
> ok 13 - pairs simulated even when fragments overlap
> ok 14 - sim does not emit reads with Ns
> ok 15 - sim can emit reads with Ns when asked to
> ok 16 - sim doesn't emit Ns even with pair and errors
> ok 17 - ngs trained simulator works
> ok 18 - ngs trained simulator generates gam
> ok
> warning[load_proto_to_graph]: dangling edges on missing node 199474497 and 2 other missing nodes removed
> [algorithms::normalize] iteration 1 current length 160
> [algorithms::normalize] iteration 2 current length 154
> [algorithms::normalize] iteration 3 current length 154
> [algorithms::normalize] normalized in 2 steps
> [algorithms::normalize] iteration 1 current length 160
> [algorithms::normalize] iteration 2 current length 154
> [algorithms::normalize] iteration 3 current length 154
> [algorithms::normalize] normalized in 2 steps
> [algorithms::normalize] iteration 1 current length 160
> [algorithms::normalize] iteration 2 current length 154
> [algorithms::normalize] iteration 3 current length 154
> [algorithms::normalize] normalized in 2 steps
> [algorithms::normalize] iteration 1 current length 95
> [algorithms::normalize] iteration 2 current length 95
> [algorithms::normalize] normalized in 1 steps
> [algorithms::normalize] iteration 1 current length 100
> [algorithms::normalize] iteration 2 current length 100
> [algorithms::normalize] normalized in 1 steps
> [algorithms::normalize] iteration 1 current length 100
> [algorithms::normalize] iteration 2 current length 100
> [algorithms::normalize] normalized in 1 steps
> [algorithms::normalize] iteration 1 current length 5
> [algorithms::normalize] normalized in 0 steps
> [algorithms::normalize] iteration 1 current length 5
> [algorithms::normalize] normalized in 0 steps
> [algorithms::normalize] iteration 1 current length 106
> [algorithms::normalize] iteration 2 current length 105
> [algorithms::normalize] iteration 3 current length 105
> [algorithms::normalize] normalized in 2 steps
> [algorithms::normalize] iteration 1 current length 103
> [algorithms::normalize] iteration 2 current length 100
> [algorithms::normalize] iteration 3 current length 100
> [algorithms::normalize] normalized in 2 steps
> t/14_vg_mod.t .........
> 1..32
> ok 1 - vg mod yields a graph with only a particular path
> ok 2 - orphan edge removal is automatic
> ok 3 - graph complexity reduction works as expected
> ok 4 - short subgraph pruning works
> ok 5 - normalization produces the correct number of nodes
> ok 6 - normalization removes redundant SNP alleles
> ok 7 - normalization produces a valid graph
> ok 8 - looped normalization produces a valid graph
> ok 9 - unchop produces a valid graph
> ok 10 - normalization removes redundant sequence in the graph
> ok 11 - normalization doesn't introduce cycles and does remove redundancy in bubbles
> ok 12 - vg mod removes non-path nodes and edge
> ok 13 - chopping a graph works correctly with reverse mappings
> ok 14 - unchop correctly handles paths
> ok 15 - unchop correctly handles a graph with an inversion
> ok 16 - unchop handles doubly-reversing edges
> ok 17 - normalization works on a graph with an inversion
> ok 18 - mod successfully unchops a difficult graph
> ok 19 - chopping self-cycling nodes retains the cycle
> ok 20 - unrolling works and produces a valid graph
> ok 21 - unfolding works and produces a valid graph
> ok 22 - dagify-unroll produces a graph with the same kmers as the original graph
> ok 23 - unfold produces a graph with the same kmers as the original graph
> ok 24 - dagify handles a graph with two strongly connected components
> ok 25 - unfold followed by dagify produces a graph with no cycles
> ok 26 - unfold followed by dagify produces a graph with the same kmers as the original graph
> ok 27 - dagify unrolls the un-unrollable graph
> ok 28 - sibling simplification does not disrupt paths
> ok 29 - dagify correctly calculates the minimum distance through the unrolled component
> ok 30 - dagify produces a graph of the correct size
> ok 31 - subsetting a flat-alleles graph to a sample graph works
> ok 32 - removal of high-degree nodes results in the expected number of subgraphs
> ok
> t/15_vg_surject.t .....
> 1..27
> ok 1 - reads are generated
> ok 2 - vg surject works perfectly for perfect reads without misaligned homopolymer indels derived from the reference
> ok 3 - vg surject actually places reads on the correct path
> ok 4 - vg surject doesn't need to be told which path to use
> ok 5 - vg surject works for every read simulated from a dense graph
> ok 6 - vg surject spliced algorithm works for every read simulated from a dense graph
> ok 7 - vg surject produces valid SAM output
> ok 8 - vg map may surject reads to produce valid SAM output
> ok 9 - vg map may surject reads to produce valid BAM output
> ok 10 - vg surject retains read names
> ok 11 - vg surject can set sample and read group
> ok 12 - we respect the original mapping's softclips
> ok 13 - forward and reverse orientations of a read produce the same surjected SAM, ignoring flags
> ok 14 - vg surject produces valid BAM output
> ok 15 - mapping quality is preserved through surjection
> ok 16 - read pairing is preserved through GAM->GAM surjection
> ok 17 - surjection of paired reads to SAM yields correct positions
> ok 18 - surjection of paired reads to SAM yields correct pair partner positions
> ok 19 - surjection of paired reads to SAM yields properly matched QNAMEs
> ok 20 - surjection of paired reads to SAM produces correct pair partner contigs
> ok 21 - surjection of paired reads to SAM produces correct flags
> ok 22 - surjection of paired reads to SAM tags both reads with a read group
> ok 23 - surjection of paired reads to SAM creates RG header
> ok 24 - surjection works for a longer (151bp) read
> ok 25 - surjection works for another difficult read
> ok 26 - mapping reproduces qualities from BAM input
> ok 27 - mapping reproduces qualities from fastq input
> ok
> [algorithms::normalize] iteration 1 current length 1014
> [algorithms::normalize] normalized in 0 steps
> [algorithms::normalize] iteration 1 current length 1014
> [algorithms::normalize] normalized in 0 steps
> [algorithms::normalize] iteration 1 current length 100
> [algorithms::normalize] normalized in 0 steps
> could not open msgas/t.fa
> error[VPKG::load_one]: Correct input type not found while loading handlegraph::MutablePathDeletableHandleGraph
> error[VPKG::load_one]: Correct input type not found while loading handlegraph::MutablePathDeletableHandleGraph
> error[VPKG::load_one]: Correct input type not found while loading handlegraph::PathHandleGraph
> could not open msgas/t.fa
> error[VPKG::load_one]: Correct input type not found while loading handlegraph::MutablePathDeletableHandleGraph
> error[VPKG::load_one]: Correct input type not found while loading handlegraph::MutablePathDeletableHandleGraph
> error[VPKG::load_one]: Correct input type not found while loading handlegraph::PathHandleGraph
> [algorithms::normalize] iteration 1 current length 100
> [algorithms::normalize] iteration 2 current length 100
> [algorithms::normalize] normalized in 1 steps
> index file msgas/s-rev.fa.fai not found, generating...
> [algorithms::normalize] iteration 1 current length 100
> [algorithms::normalize] normalized in 0 steps
> index file GRCh38_alts/FASTA/HLA/K-3138.fa.fai not found, generating...
> index file msgas/inv.fa.fai not found, generating...
> [algorithms::normalize] iteration 1 current length 210
> [algorithms::normalize] iteration 2 current length 210
> [algorithms::normalize] normalized in 1 steps
> index file GRCh38_alts/FASTA/HLA/B-3106.fa.fai not found, generating...
> t/16_vg_msga.t ........
> 1..14
> ok 1 - MSGA produces the expected graph for GRCh38 HLA-V
> ok 2 - X-drop DP MSGA produces the expected graph for GRCh38 HLA-V
> {"edge": [{"from": "5", "from_start": true, "to": "6", "to_end": true}, {"from": "5", "from_start": true, "to": "7", "to_end": true}, {"from": "6", "to": "7"}], "node": [{"id": "5", "sequence": "GGACTAAGGACAAAGGTGCGGGGAG"}, {"id": "7", "sequence": "AACTACTCCACATCAAAGCTACCCAGGCCATTTTAAGTTTCCTGT"}, {"id": "6", "sequence": "TCAGATTCTCATCCCTCCTCAAGGGCTTCT"}], "path": [{"mapping": [{"edit": [{"from_length": 30, "to_length": 30}], "position": {"node_id": "6"}, "rank": "1"}, {"edit": [{"from_length": 45, "to_length": 45}], "position": {"node_id": "7"}, "rank": "2"}, {"edit": [{"from_length": 25, "to_length": 25}], "position": {"node_id": "5"}, "rank": "3"}], "name": "s1"}, {"mapping": [{"edit": [{"from_length": 30, "to_length": 30}], "position": {"node_id": "6"}, "rank": "1"}, {"edit": [{"from_length": 25, "to_length": 25}], "position": {"node_id": "5"}, "rank": "2"}], "name": "s2"}]}
> ok 3 - soft clips at node boundaries (start) are included correctly
> ok 4 - soft clips at node boundaries (end) are included correctly
> ok 5 - region hints (-p) produce same graph
> ok 6 - adding in existing sequences in reverse doesn't change graph
> ok 7 - the paths of the graph encode the original sequences used to build it
> ok 8 - even when banding the paths of the graph encode the original sequences used to build it
> ok 9 - HLA K-3138 correctly includes all input paths
> ok 10 - a difficult cyclic path can be included to produce a valid graph
> ok 11 - a reference sequence set representing an inversion in it may be msga'd and detected
> ok 12 - edges in cycles with two nodes are correctly included
> ok 13 - HLA B-3106 is assembled into a valid graph
> ok 14 - odd-sized overlaps may be used for chunked alignment
> ok
> [vg augment] warning: -a / --augmentation-mode option is deprecated
> [vg augment] warning: -a / --augmentation-mode option is deprecated
> [vg augment] warning: -a / --augmentation-mode option is deprecated
> [vg augment] warning: reading the entire GAM from stdin into memory. it is recommended to pass in a filename rather than - so it can be streamed over two passes
> [vg augment] warning: reading the entire GAM from stdin into memory. it is recommended to pass in a filename rather than - so it can be streamed over two passes
> [vg augment] warning: reading the entire GAM from stdin into memory. it is recommended to pass in a filename rather than - so it can be streamed over two passes
> warning: when streaming in a GAM with -A, the output GAM will lose all non-Path related fields from the input
> t/17_vg_augment.t: line 50: jq.: command not found
> [vg augment] warning: reading the entire GAM from stdin into memory. it is recommended to pass in a filename rather than - so it can be streamed over two passes
> [vg augment] warning: reading the entire GAM from stdin into memory. it is recommended to pass in a filename rather than - so it can be streamed over two passes
> [vg augment] warning: reading the entire GAM from stdin into memory. it is recommended to pass in a filename rather than - so it can be streamed over two passes
> [vg augment] warning: reading the entire GAM from stdin into memory. it is recommended to pass in a filename rather than - so it can be streamed over two passes
> [vg augment] warning: reading the entire GAM from stdin into memory. it is recommended to pass in a filename rather than - so it can be streamed over two passes
> [vg augment] warning: reading the entire GAM from stdin into memory. it is recommended to pass in a filename rather than - so it can be streamed over two passes
> [vg augment] warning: reading the entire GAM from stdin into memory. it is recommended to pass in a filename rather than - so it can be streamed over two passes
> [vg augment] warning: reading the entire GAM from stdin into memory. it is recommended to pass in a filename rather than - so it can be streamed over two passes
> [vg augment] warning: reading the entire GAM from stdin into memory. it is recommended to pass in a filename rather than - so it can be streamed over two passes
> [vg augment] warning: reading the entire GAM from stdin into memory. it is recommended to pass in a filename rather than - so it can be streamed over two passes
> [vg augment] warning: reading the entire GAM from stdin into memory. it is recommended to pass in a filename rather than - so it can be streamed over two passes
> [vg augment] warning: reading the entire GAM from stdin into memory. it is recommended to pass in a filename rather than - so it can be streamed over two passes
> [vg augment] warning: reading the entire GAM from stdin into memory. it is recommended to pass in a filename rather than - so it can be streamed over two passes
> [vg augment] warning: reading the entire GAM from stdin into memory. it is recommended to pass in a filename rather than - so it can be streamed over two passes
> [vg augment] warning: reading the entire GAM from stdin into memory. it is recommended to pass in a filename rather than - so it can be streamed over two passes
> t/17_vg_augment.t .....
> 1..37
> ok 1 - direct augmentation embeds reads fully for well-supported SNPs
> ok 2 - adding a well-supported SNP by direct augmentation adds 3 more nodes
> ok 3 - adding a well-supported SNP by direct augmentation adds 3 more nodes with -m 1
> ok 4 - direct augmentation embeds reads fully for probable errors
> ok 5 - adding a probable error by direct augmentation adds 3 more nodes
> ok 6 - path inclusion does not modify the graph when alignment is a perfect match
> ok 7 - path inclusion does not modify the graph when alignment has a SNP but doesnt meet the coverage threshold
> ok 8 - path inclusion does not modify the included path when alignment has a SNP but doesnt meet the coverage threshold
> ok 9 - 0
> ok 10 - path inclusion with a complex variant introduces the right number of nodes
> ok 11 - path inclusion works for deletions
> ok 12 - SNPs can be included in the graph
> ok 13 - a soft clip at read start becomes a new head of the graph
> ok 14 - a soft clip at read end becomes a new tail of the graph
> ok 15 - augment -s works as desired
> ok 16 - the expected graph translation is exported when the graph is edited
> ok 17 - editing the graph with many SNP-containing alignments does not introduce duplicate identical nodes
> ok 18 - augmenting 2 snps with -m 1 produces the same nodes as default
> ok 19 - augmenting 2 snps and 2 errors with -m 11 produces the same nodes as with just the snps
> ok 20 - augmenting with 2snps makes correct number of nodes
> ok 21 - low-quality snp is filtered
> ok 22 - augmenting a packed graph produces same results as a vg graph
> ok 23 - augmenting a hash graph produces same results as a vg graph
> ok 24 - augmenting between nodes without filters works as expected
> ok 25 - augmenting between nodes with inactive filters works as expected
> ok 26 - augmenting between nodes N filter works as expected
> ok 27 - augmenting between nodes without filters works as expected on reverse strand
> ok 28 - augmenting between nodes with inactive filters works as expected on reverse strand
> ok 29 - augmenting between nodes N filter works as expected on reverse strand
> ok 30 - augmenting within node without filters works as expected
> ok 31 - augmenting within node with inactive filters works as expected
> ok 32 - augmenting within node with N filter works as expected
> ok 33 - augmenting within node without filters works as expected on reverse strand
> ok 34 - augmenting within node with inactive filters works as expected on reverse strand
> ok 35 - augmenting within node with N filter works as expected on reverse strand
> ok 36 - sequence in filtered alignment has removed insertion
> ok 37 - sequence in filtered alignment has removed insertion on reverse strand
> ok
> index file inverting/miniFasta.fa.fai not found, generating...
> index file m.fa.fai not found, generating...
> t/18_vg_call.t ........
> 1..9
> ok 1 - calling empty gam gives empty VCF
> ok 2 - Called microinversion
> ok 3 - Called no microinversion with haploid setting
> ok 4 - Fewer than 8 differences between called and true SV genotypes
> ok 5 - Fewer than 8 differences between called haploid and truncated true SV genotypes
> ok 6 - call output same on vg as xg
> ok 7 - call output same on vg as xg
> ok 8 - vg call finds true homozygous variants in a cyclic graph
> ok 9 - vg call finds same variants when using gbwt to enumerate traversals
> ok
> t/19_vg_compare.t ..... skipped: (no reason given)
> rapper: Parsing file <stdin> with parser turtle and base URI http://example.org/vg
> rapper: Parsing returned 85 triples
> rapper: Parsing file <stdin> with parser turtle and base URI http://example.org/vg
> rapper: Parsing returned 75 triples
> t/20_vgtordf.t ........
> 1..6
> ok 1 - vg view produces the expected number of lines of turtle
> ok 2 - vg view produces the expected number of lines of turtle
> ok 3 - rapper passed
> ok 4 - rapper passed
> ok 5 - vg view produces the expected number of lines of turtle
> ok 6 - vg view produces the expected number of lines of turtle
> ok
> t/21_vg_filter.t ......
> 1..10
> ok 1 - vg filter with no options preserves input.
> ok 2 - vg filter downsamples correctly
> ok 3 - samtools 1.0+ and vg filter agree on how to select downsampled paired reads
> ok 4 - samtools 1.0+ and vg filter agree on how to select downsampled unpaired reads
> ok 5 - reads with refpos annotations not matching an exclusion regex are let through
> ok 6 - reads with refpos annotations matching an exclusion regex are removed
> ok 7 - negating a non-filter results in no reads
> ok 8 - a filter and its complement should form the entire file
> ok 9 - read pairs can be tropped by feature
> ok 10 - read pairs can be kept if only one read fails
> ok
> t/22_ggsv.t ........... skipped: (no reason given)
> t/23_vectorize.t ...... skipped: (no reason given)
> t/25_circularize.t ....
> 1..2
> ok 1 - a path may be circularized
> ok 2 - a circular path survives a round trip to/from xg
> ok
> [algorithms::normalize] iteration 1 current length 1014
> [algorithms::normalize] normalized in 0 steps
> graph path 'alt2.3' invalid: edge from 15 end to 1 start does not exist
> [vg view] warning: graph is invalid!
> t/26_deconstruct.t ....
> 1..19
> ok 1 - deconstruct retrieved original VCF (modulo adjacent snp allele)
> ok 2 - deconstructed hla vcf has correct number of sites
> ok 3 - deconstructed hla vcf has correct insertion
> ok 4 - deconstructed hla vcf with other path has correct number of sites
> ok 5 - deconstructed hla vcf has correct deletion
> ok 6 - path-based and exhaustive decontruction give equivalent sites when expected
> ok 7 - path that differs from reference in every alt has correct genotype
> ok 8 - path that is same as reference in every alt has correct genotype
> ok 9 - reference contig correctly written
> ok 10 - deconstruct correctly handles a simple inversion
> ok 11 - deconstruct correctly handles a simple inversion when the reference contains the reversing edge
> ok 12 - deconstruct correctly handles a cycle in the reference path when contained inside snarl
> ok 13 - deconstruct correctly handles a cycle in the alt path
> ok 14 - cyclic reference deconstruction has correct number of variants
> ok 15 - deconstruct correctly handles cycle in the reference path that spans snarl
> ok 16 - -P -A options return correct number of variants
> ok 17 - -P -A options use correct reference name
> ok 18 - -P -A identifies conflict in alt1 in second variant
> ok 19 - deconstructing vg graph gives same output as xg graph
> ok
> Statistics:
> Number of Non-Degenerate Snarls: 4
> Snarls traversed by reads: 4
> Snarls on reference: 0
> Snarl length distribution:
> Statistics:
> Number of Non-Degenerate Snarls: 4
> Snarls traversed by reads: 4
> Snarls on reference: 4
> Snarl length distribution:
> 2 1
> 1 3
> index file flat1.fa.fai not found, generating...
> index file flat2.fa.fai not found, generating...
> Statistics:
> Number of Non-Degenerate Snarls: 8
> Snarls traversed by reads: 8
> Snarls on reference: 0
> Snarl length distribution:
> index file flats.fa.fai not found, generating...
> Warning: realigned read CCTACAGACATA doesn't touch either end of its snarl!
> Warning: realigned read TTACAATGAGCC doesn't touch either end of its snarl!
> Warning: realigned read CCCTACAGACAT doesn't touch either end of its snarl!
> Warning: realigned read GTTACAATGAGC doesn't touch either end of its snarl!
> Warning: realigned read GCCCTACAGACA doesn't touch either end of its snarl!
> Warning: realigned read CTCATTGTAACG doesn't touch either end of its snarl!
> Warning: realigned read TACAGACATATC doesn't touch either end of its snarl!
> Warning: realigned read TGAGCCCTACAG doesn't touch either end of its snarl!
> Warning: realigned read TAGGGCTCATTG doesn't touch either end of its snarl!
> Warning: realigned read GAGCCCTACAGA doesn't touch either end of its snarl!
> Warning: realigned read TGTCTGTAGGGC doesn't touch either end of its snarl!
> Warning: realigned read ACGTTACAATGA doesn't touch either end of its snarl!
> Warning: realigned read GCTCATTGTAAC doesn't touch either end of its snarl!
> Warning: realigned read AGGGCTCATTGT doesn't touch either end of its snarl!
> Warning: realigned read TGTCTGTAGGGC doesn't touch either end of its snarl!
> Warning: realigned read GTAGGGCTCATT doesn't touch either end of its snarl!
> Warning: realigned read GTCTGTAGGGCT doesn't touch either end of its snarl!
> Warning: realigned read ACGTTACAATGA doesn't touch either end of its snarl!
> Warning: realigned read TACAATGAGCCC doesn't touch either end of its snarl!
> Warning: realigned read GGGCTCATTGTA doesn't touch either end of its snarl!
> Warning: realigned read CTGTAGGGCTCA doesn't touch either end of its snarl!
> Warning: realigned read TATGTCTGTAGG doesn't touch either end of its snarl!
> Warning: realigned read GCTCATTGTAAC doesn't touch either end of its snarl!
> Warning: realigned read CTGTAGGGCTCA doesn't touch either end of its snarl!
> Warning: realigned read TACAATGAGCCC doesn't touch either end of its snarl!
> Statistics:
> Number of Non-Degenerate Snarls: 1
> Snarls traversed by reads: 1
> Snarls on reference: 1
> Snarl length distribution:
> 0 1
> t/27_vg_genotype.t ....
> 1..5
> ok 1 - vg genotype runs successfully
> ok 2 - vg genotype runs successfully when emitting vcf
> ok 3 - called genotypes are correct in a small simulated example
> ok 4 - genotype format can be converted to and from JSON
> ok 5 - genotype finds big insert
> ok
> [algorithms::normalize] iteration 1 current length 58
> [algorithms::normalize] normalized in 0 steps
> [algorithms::normalize] iteration 1 current length 58
> [algorithms::normalize] normalized in 0 steps
> t/28_translate.t ......
> 1..2
> ok 1 - alignments used to modify a graph may be projected back to the original graph and used to regenerate the same graph
> ok 2 - translation overlay works and produces a sane result
> ok
> Statistics:
> Number of Non-Degenerate Snarls: 4
> Snarls traversed by reads: 4
> Snarls on reference: 0
> Snarl length distribution:
> Statistics:
> Number of Non-Degenerate Snarls: 4
> Snarls traversed by reads: 4
> Snarls on reference: 0
> Snarl length distribution:
> t/29_vg_locify.t ......
> 1..9
> ok 1 - locify produces output for each input alignment
> ok 2 - the sorted list of loci has one locus per snarl
> ok 3 - the first locus is as expected
> ok 4 - a middle locus is as expected
> ok 5 - the last locus is as expected
> ok 6 - limitation to 2-best works
> ok 7 - limitation to 3-best works
> ok 8 - limitation to 4-best works
> ok 9 - we always get one allele when all the reads match the graph
> ok
> [vg] warning: node ID 44 appears multiple times. Skipping.
> [vg] warning: node ID 45 appears multiple times. Skipping.
> [vg] warning: node ID 43 appears multiple times. Skipping.
> [vg] warning: edge 43 end <-> 44 start appears multiple times. Skipping.
> [vg] warning: edge 43 end <-> 45 start appears multiple times. Skipping.
> [vg] warning: node ID 87 appears multiple times. Skipping.
> [vg] warning: node ID 88 appears multiple times. Skipping.
> [vg] warning: node ID 85 appears multiple times. Skipping.
> [vg] warning: node ID 86 appears multiple times. Skipping.
> [vg] warning: edge 87 end <-> 88 start appears multiple times. Skipping.
> [vg] warning: edge 85 end <-> 87 start appears multiple times. Skipping.
> [vg] warning: edge 85 end <-> 86 start appears multiple times. Skipping.
> [vg] warning: edge 86 end <-> 88 start appears multiple times. Skipping.
> [vg] warning: node ID 130 appears multiple times. Skipping.
> [vg] warning: node ID 131 appears multiple times. Skipping.
> [vg] warning: node ID 129 appears multiple times. Skipping.
> [vg] warning: edge 130 end <-> 131 start appears multiple times. Skipping.
> [vg] warning: edge 129 end <-> 130 start appears multiple times. Skipping.
> [vg] warning: edge 129 end <-> 131 start appears multiple times. Skipping.
> [vg] warning: node ID 173 appears multiple times. Skipping.
> [vg] warning: node ID 174 appears multiple times. Skipping.
> [vg] warning: node ID 172 appears multiple times. Skipping.
> [vg] warning: edge 173 end <-> 174 start appears multiple times. Skipping.
> [vg] warning: edge 172 end <-> 173 start appears multiple times. Skipping.
> [vg] warning: edge 172 end <-> 174 start appears multiple times. Skipping.
> Restricting to x from 1 to end
> Restricting to y from 1 to end
> t/30_vg_chunk.t .......
> 1..24
> ok 1 - vg chunk with no options preserves nodes
> ok 2 - vg chunk with no options preserves edges
> ok 3 - chunk has path going through node 9
> ok 4 - chunk has path going through node 9
> ok 5 - -s produces correct number of chunks
> ok 6 - gam chunker produces correct number of graphs
> ok 7 - gam chunker produces correct number of gams
> ok 8 - gam chunker produces bed with correct number of chunks
> ok 9 - gam chunker emits each matching read at most once
> ok 10 - chunk contains the expected number of alignments
> ok 11 - id chunker produces correct chunk size
> ok 12 - id chunker produces correct single chunk
> ok 13 - id chunker traces correct chunk size
> ok 14 - chunker extracts no threads from an empty gPBWT
> ok 15 - chunker extracts 2 local threads from a gBWT with 2 locally distinct threads in it
> ok 16 - chunker can extract a partial haplotype from a GBWT
> ok 17 - n-chunking works and chunks over the full graph
> ok 18 - path-based components finds subgraphs
> ok 19 - x gam chunk has correct number of reads
> ok 20 - y gam chunk has correct number of reads
> ok 21 - x gam chunk has correct number of reads with -p path
> ok 22 - y gam chunk has correct number of reads with -p path
> ok 23 - path-based component contains correct path length
> ok 24 - components finds subgraphs
> ok
> index file add/ref.fa.fai not found, generating...
> Variant 1: 3 haplotypes at ref:18: 32 bp vs. 33 bp haplotypes vs. graphs average
> Variant 2: 3 haplotypes at ref:21: 32 bp vs. 34 bp haplotypes vs. graphs average
> Variant 3: 3 haplotypes at ref:23: 33 bp vs. 34 bp haplotypes vs. graphs average
> Variant 1: 3 haplotypes at chrR:18: 32 bp vs. 33 bp haplotypes vs. graphs average
> Variant 2: 3 haplotypes at chrR:21: 32 bp vs. 34 bp haplotypes vs. graphs average
> Variant 3: 3 haplotypes at chrR:23: 33 bp vs. 34 bp haplotypes vs. graphs average
> Variant 1: 3 haplotypes at ref:18: 32 bp vs. 33 bp haplotypes vs. graphs average
> Variant 2: 3 haplotypes at ref:21: 32 bp vs. 34 bp haplotypes vs. graphs average
> Variant 3: 3 haplotypes at ref:23: 33 bp vs. 34 bp haplotypes vs. graphs average
> Variant 1: 4 haplotypes at ref:2: 33 bp vs. 34 bp haplotypes vs. graphs average
> Variant 2: 4 haplotypes at ref:21: 33 bp vs. 36 bp haplotypes vs. graphs average
> Variant 3: 4 haplotypes at ref:32: 33 bp vs. 36 bp haplotypes vs. graphs average
> index file add/refN.fa.fai not found, generating...
> Variant 1: 4 haplotypes at ref:2: 33 bp vs. 34 bp haplotypes vs. graphs average
> Variant 2: 4 haplotypes at ref:21: 33 bp vs. 36 bp haplotypes vs. graphs average
> Variant 3: 4 haplotypes at ref:32: 33 bp vs. 36 bp haplotypes vs. graphs average
> index file add/ngap.fa.fai not found, generating...
> Variant 1: 2 haplotypes at ngap:10923: 224 bp vs. 224 bp haplotypes vs. graphs average
> Variant 2: 5 haplotypes at ngap:11014: 256 bp vs. 258 bp haplotypes vs. graphs average
> Variant 3: 5 haplotypes at ngap:11030: 256 bp vs. 261 bp haplotypes vs. graphs average
> Variant 4: 5 haplotypes at ngap:11035: 256 bp vs. 261 bp haplotypes vs. graphs average
> Variant 5: 5 haplotypes at ngap:11043: 256 bp vs. 261 bp haplotypes vs. graphs average
> Variant 1: 2 haplotypes at x:9: 160 bp vs. 161 bp haplotypes vs. graphs average
> Variant 2: 2 haplotypes at x:10: 160 bp vs. 167 bp haplotypes vs. graphs average
> Variant 3: 2 haplotypes at x:14: 160 bp vs. 167 bp haplotypes vs. graphs average
> Variant 4: 2 haplotypes at x:34: 160 bp vs. 167 bp haplotypes vs. graphs average
> Variant 5: 2 haplotypes at x:39: 160 bp vs. 167 bp haplotypes vs. graphs average
> Variant 6: 2 haplotypes at x:52: 224 bp vs. 231 bp haplotypes vs. graphs average
> Variant 7: 2 haplotypes at x:58: 224 bp vs. 232 bp haplotypes vs. graphs average
> Variant 8: 2 haplotypes at x:100: 256 bp vs. 265 bp haplotypes vs. graphs average
> Variant 9: 2 haplotypes at x:103: 256 bp vs. 267 bp haplotypes vs. graphs average
> Variant 10: 2 haplotypes at x:122: 288 bp vs. 299 bp haplotypes vs. graphs average
> Variant 11: 2 haplotypes at x:142: 288 bp vs. 301 bp haplotypes vs. graphs average
> Variant 12: 2 haplotypes at x:160: 306 bp vs. 319 bp haplotypes vs. graphs average
> Variant 13: 2 haplotypes at x:172: 338 bp vs. 353 bp haplotypes vs. graphs average
> Variant 14: 2 haplotypes at x:178: 313 bp vs. 327 bp haplotypes vs. graphs average
> Variant 15: 2 haplotypes at x:187: 313 bp vs. 327 bp haplotypes vs. graphs average
> Variant 16: 2 haplotypes at x:200: 294 bp vs. 306 bp haplotypes vs. graphs average
> Variant 17: 2 haplotypes at x:204: 294 bp vs. 306 bp haplotypes vs. graphs average
> Variant 18: 2 haplotypes at x:218: 288 bp vs. 300 bp haplotypes vs. graphs average
> Variant 19: 2 haplotypes at x:221: 288 bp vs. 300 bp haplotypes vs. graphs average
> Variant 20: 2 haplotypes at x:272: 256 bp vs. 266 bp haplotypes vs. graphs average
> Variant 21: 2 haplotypes at x:277: 256 bp vs. 272 bp haplotypes vs. graphs average
> Variant 22: 2 haplotypes at x:287: 256 bp vs. 272 bp haplotypes vs. graphs average
> Variant 23: 2 haplotypes at x:294: 256 bp vs. 272 bp haplotypes vs. graphs average
> Variant 24: 2 haplotypes at x:297: 291 bp vs. 305 bp haplotypes vs. graphs average
> Variant 25: 2 haplotypes at x:312: 323 bp vs. 340 bp haplotypes vs. graphs average
> Variant 26: 2 haplotypes at x:313: 323 bp vs. 341 bp haplotypes vs. graphs average
> Variant 27: 2 haplotypes at x:345: 291 bp vs. 306 bp haplotypes vs. graphs average
> Variant 28: 2 haplotypes at x:347: 323 bp vs. 339 bp haplotypes vs. graphs average
> Variant 29: 2 haplotypes at x:353: 311 bp vs. 326 bp haplotypes vs. graphs average
> Variant 30: 2 haplotypes at x:373: 291 bp vs. 306 bp haplotypes vs. graphs average
> Variant 31: 2 haplotypes at x:397: 288 bp vs. 307 bp haplotypes vs. graphs average
> Variant 32: 2 haplotypes at x:398: 288 bp vs. 307 bp haplotypes vs. graphs average
> Variant 33: 2 haplotypes at x:405: 241 bp vs. 258 bp haplotypes vs. graphs average
> Variant 34: 2 haplotypes at x:408: 241 bp vs. 258 bp haplotypes vs. graphs average
> Variant 35: 2 haplotypes at x:466: 254 bp vs. 260 bp haplotypes vs. graphs average
> Variant 36: 2 haplotypes at x:474: 286 bp vs. 295 bp haplotypes vs. graphs average
> Variant 37: 2 haplotypes at x:489: 286 bp vs. 296 bp haplotypes vs. graphs average
> Variant 38: 2 haplotypes at x:500: 286 bp vs. 297 bp haplotypes vs. graphs average
> Variant 39: 2 haplotypes at x:523: 300 bp vs. 309 bp haplotypes vs. graphs average
> Variant 40: 2 haplotypes at x:533: 289 bp vs. 299 bp haplotypes vs. graphs average
> Variant 41: 1 haplotypes at x:553: 257 bp vs. 263 bp haplotypes vs. graphs average
> Variant 42: 1 haplotypes at x:566: 257 bp vs. 263 bp haplotypes vs. graphs average
> Variant 43: 2 haplotypes at x:629: 277 bp vs. 281 bp haplotypes vs. graphs average
> Variant 44: 2 haplotypes at x:647: 278 bp vs. 285 bp haplotypes vs. graphs average
> Variant 45: 2 haplotypes at x:654: 278 bp vs. 287 bp haplotypes vs. graphs average
> Variant 46: 2 haplotypes at x:668: 310 bp vs. 320 bp haplotypes vs. graphs average
> Variant 47: 2 haplotypes at x:669: 310 bp vs. 321 bp haplotypes vs. graphs average
> Variant 48: 2 haplotypes at x:681: 289 bp vs. 299 bp haplotypes vs. graphs average
> Variant 49: 2 haplotypes at x:688: 289 bp vs. 299 bp haplotypes vs. graphs average
> Variant 50: 2 haplotypes at x:698: 280 bp vs. 289 bp haplotypes vs. graphs average
> Variant 51: 2 haplotypes at x:714: 299 bp vs. 307 bp haplotypes vs. graphs average
> Variant 52: 2 haplotypes at x:757: 287 bp vs. 299 bp haplotypes vs. graphs average
> Variant 53: 2 haplotypes at x:775: 273 bp vs. 285 bp haplotypes vs. graphs average
> Variant 54: 2 haplotypes at x:777: 273 bp vs. 286 bp haplotypes vs. graphs average
> Variant 55: 2 haplotypes at x:789: 273 bp vs. 287 bp haplotypes vs. graphs average
> Variant 56: 2 haplotypes at x:795: 273 bp vs. 287 bp haplotypes vs. graphs average
> Variant 57: 2 haplotypes at x:813: 287 bp vs. 300 bp haplotypes vs. graphs average
> Variant 58: 2 haplotypes at x:823: 287 bp vs. 302 bp haplotypes vs. graphs average
> Variant 59: 2 haplotypes at x:827: 319 bp vs. 334 bp haplotypes vs. graphs average
> Variant 60: 2 haplotypes at x:858: 297 bp vs. 310 bp haplotypes vs. graphs average
> Variant 61: 2 haplotypes at x:859: 297 bp vs. 312 bp haplotypes vs. graphs average
> Variant 62: 2 haplotypes at x:860: 297 bp vs. 312 bp haplotypes vs. graphs average
> Variant 63: 2 haplotypes at x:877: 287 bp vs. 303 bp haplotypes vs. graphs average
> Variant 64: 2 haplotypes at x:888: 244 bp vs. 262 bp haplotypes vs. graphs average
> Variant 65: 2 haplotypes at x:899: 243 bp vs. 263 bp haplotypes vs. graphs average
> Variant 66: 2 haplotypes at x:901: 243 bp vs. 264 bp haplotypes vs. graphs average
> Variant 67: 2 haplotypes at x:916: 224 bp vs. 243 bp haplotypes vs. graphs average
> Variant 68: 2 haplotypes at x:917: 224 bp vs. 243 bp haplotypes vs. graphs average
> Variant 69: 2 haplotypes at x:923: 223 bp vs. 243 bp haplotypes vs. graphs average
> Variant 70: 2 haplotypes at x:925: 223 bp vs. 243 bp haplotypes vs. graphs average
> Variant 71: 2 haplotypes at x:929: 222 bp vs. 242 bp haplotypes vs. graphs average
> Variant 72: 2 haplotypes at x:939: 204 bp vs. 223 bp haplotypes vs. graphs average
> Variant 73: 2 haplotypes at x:945: 204 bp vs. 223 bp haplotypes vs. graphs average
> Variant 74: 2 haplotypes at x:972: 177 bp vs. 194 bp haplotypes vs. graphs average
> Variant 75: 2 haplotypes at x:1000: 136 bp vs. 149 bp haplotypes vs. graphs average
> Variant 1: 3 haplotypes at ref:18: 32 bp vs. 33 bp haplotypes vs. graphs average
> Variant 2: 3 haplotypes at ref:21: 32 bp vs. 34 bp haplotypes vs. graphs average
> Variant 3: 3 haplotypes at ref:23: 33 bp vs. 34 bp haplotypes vs. graphs average
> Variant 1: 3 haplotypes at ref:18: 32 bp vs. 33 bp haplotypes vs. graphs average
> Variant 2: 3 haplotypes at ref:21: 32 bp vs. 34 bp haplotypes vs. graphs average
> Variant 3: 3 haplotypes at ref:23: 33 bp vs. 34 bp haplotypes vs. graphs average
> t/31_vg_add.t .........
> 1..11
> ok 1 - vg add can create a graph
> ok 2 - vg add can create a graph with contig renames
> ok 3 - vg add produces the same graph from VCFs with different contig names
> ok 4 - vg add can create a graph from a PackedGraph
> ok 5 - vg add produces the same graph from the same input in different formats
> ok 6 - having reference Ns does not affect the graph topology
> ok 7 - adding variants adds only the alt bases near large N gaps
> ok 8 - vg add can create a slightly larger graph
> ok 9 - ranks are calculated for emitted paths
> ok 10 - graphs with backward nodes can be added to
> ok 11 - graphs with backward and forward nodes can be added to
> ok
> Restricting to x from 1 to end
> Restricting to y from 1 to end
> t/32_vg_snarls.t ......
> 1..9
> ok 1 - vg snarls made right number of protobuf Snarls
> ok 2 - vg snarls made right number of protobuf SnarlTraversals
> ok 3 - vg snarls on xg made right number of protobuf Snarls
> ok 4 - vg snarls on xg made right number of protobuf SnarlTraversals
> ok 5 - vcf traversals are the same as exhaustive traversals for tiny graph
> ok 6 - vcf traversals are the same as exhaustive traversals for inversion
> ok 7 - vcf traversals are the same as exhaustive traversals for ins_and_del graph
> ok 8 - correct number of snarls when parallelizing on compoents
> ok 9 - same number of snarls when parallelizing on components
> ok
> [vg mpmap] Executing command: vg mpmap -B -P 1 -x xy2.xg -g xy2.gcsa -f reads/xy2.match.fq -S
> [vg mpmap] Loading graph from xy2.xg
> [vg mpmap] Graph is in XG format. XG is a good graph format for most mapping use cases. PackedGraph may be selected if memory usage is too high. See `vg convert` if you want to change graph formats.
> [vg mpmap] Loading GCSA2 from xy2.gcsa
> [vg mpmap] Loading LCP from xy2.gcsa.lcp
> [vg mpmap] Mapping reads from reads/xy2.match.fq using 4 threads
> [vg mpmap] Mapping finished. Mapped 1 reads.
> [vg mpmap] Executing command: vg mpmap -B -P 1 -x xy2.xg -g xy2.gcsa --gbwt-name xy2.gbwt -f reads/xy2.match.fq -S
> [vg mpmap] Loading graph from xy2.xg
> [vg mpmap] Graph is in XG format. XG is a good graph format for most mapping use cases. PackedGraph may be selected if memory usage is too high. See `vg convert` if you want to change graph formats.
> [vg mpmap] Loading GCSA2 from xy2.gcsa
> [vg mpmap] Loading LCP from xy2.gcsa.lcp
> [vg mpmap] Loading GBWT from xy2.gbwt
> [vg mpmap] Mapping reads from reads/xy2.match.fq using 4 threads
> [vg mpmap] Mapping finished. Mapped 1 reads.
> [vg mpmap] Executing command: vg mpmap -B -P 1 -I 200 -D 200 -x xy2.xg -g xy2.gcsa -f reads/xy2.matchpaired.fq -i -S
> [vg mpmap] Loading graph from xy2.xg
> [vg mpmap] Graph is in XG format. XG is a good graph format for most mapping use cases. PackedGraph may be selected if memory usage is too high. See `vg convert` if you want to change graph formats.
> [vg mpmap] Loading GCSA2 from xy2.gcsa
> [vg mpmap] Loading LCP from xy2.gcsa.lcp
> [vg mpmap] Mapping reads from reads/xy2.matchpaired.fq using 4 threads
> [vg mpmap] Mapping finished. Mapped 1 read pairs.
> [vg mpmap] Executing command: vg mpmap -B -P 1 -I 200 -D 200 -x xy2.xg -g xy2.gcsa --gbwt-name xy2.gbwt -f reads/xy2.matchpaired.fq -i -S
> [vg mpmap] Loading graph from xy2.xg
> [vg mpmap] Graph is in XG format. XG is a good graph format for most mapping use cases. PackedGraph may be selected if memory usage is too high. See `vg convert` if you want to change graph formats.
> [vg mpmap] Loading GCSA2 from xy2.gcsa
> [vg mpmap] Loading LCP from xy2.gcsa.lcp
> [vg mpmap] Loading GBWT from xy2.gbwt
> [vg mpmap] Mapping reads from reads/xy2.matchpaired.fq using 4 threads
> [vg mpmap] Mapping finished. Mapped 1 read pairs.
> warning:[vg mpmap] Snarl file (-s) is ignored in single path mode (-S) without multipath population scoring (--max-paths).
> [vg mpmap] Executing command: vg mpmap -B -P 1 -x xy2.xg -g xy2.gcsa -s xy2.snarls -f reads/xy2.discordant.fq -S
> [vg mpmap] Loading graph from xy2.xg
> [vg mpmap] Graph is in XG format. XG is a good graph format for most mapping use cases. PackedGraph may be selected if memory usage is too high. See `vg convert` if you want to change graph formats.
> [vg mpmap] Loading GCSA2 from xy2.gcsa
> [vg mpmap] Loading LCP from xy2.gcsa.lcp
> [vg mpmap] Mapping reads from reads/xy2.discordant.fq using 4 threads
> [vg mpmap] Mapping finished. Mapped 1 reads.
> warning:[vg mpmap] Snarl file (-s) is ignored in single path mode (-S) without multipath population scoring (--max-paths).
> [vg mpmap] Executing command: vg mpmap -B -P 1 -x xy2.xg -g xy2.gcsa -s xy2.snarls -f reads/xy2.discordant.fq -S
> [vg mpmap] Loading graph from xy2.xg
> [vg mpmap] Graph is in XG format. XG is a good graph format for most mapping use cases. PackedGraph may be selected if memory usage is too high. See `vg convert` if you want to change graph formats.
> [vg mpmap] Loading GCSA2 from xy2.gcsa
> [vg mpmap] Loading LCP from xy2.gcsa.lcp
> [vg mpmap] Mapping reads from reads/xy2.discordant.fq using 4 threads
> [vg mpmap] Mapping finished. Mapped 1 reads.
> [vg mpmap] Executing command: vg mpmap -B -P 1 -x xy2.xg -g xy2.gcsa --gbwt-name xy2.gbwt -s xy2.snarls -f reads/xy2.discordant.fq -t 1 -S
> [vg mpmap] Loading graph from xy2.xg
> [vg mpmap] Graph is in XG format. XG is a good graph format for most mapping use cases. PackedGraph may be selected if memory usage is too high. See `vg convert` if you want to change graph formats.
> [vg mpmap] Loading GCSA2 from xy2.gcsa
> [vg mpmap] Loading LCP from xy2.gcsa.lcp
> [vg mpmap] Loading GBWT from xy2.gbwt
> [vg mpmap] Loading snarls from xy2.snarls
> [vg mpmap] Mapping reads from reads/xy2.discordant.fq using 1 threads
> [vg mpmap] Mapping finished. Mapped 1 reads.
> [vg mpmap] Executing command: vg mpmap -B -P 1 -x xy2.xg -g xy2.gcsa --gbwt-name xy2.gbwt -s xy2.snarls -f reads/xy2.discordant.fq -S
> [vg mpmap] Loading graph from xy2.xg
> [vg mpmap] Graph is in XG format. XG is a good graph format for most mapping use cases. PackedGraph may be selected if memory usage is too high. See `vg convert` if you want to change graph formats.
> [vg mpmap] Loading GCSA2 from xy2.gcsa
> [vg mpmap] Loading LCP from xy2.gcsa.lcp
> [vg mpmap] Loading GBWT from xy2.gbwt
> [vg mpmap] Loading snarls from xy2.snarls
> [vg mpmap] Mapping reads from reads/xy2.discordant.fq using 4 threads
> [vg mpmap] Mapping finished. Mapped 1 reads.
> [vg mpmap] Executing command: vg mpmap -x graphs/refonly-lrc_kir.vg.xg -g graphs/refonly-lrc_kir.vg.gcsa -f reads/grch38_lrc_kir_paired.fq -B -i -I 10 -D 50 -S
> [vg mpmap] Loading graph from graphs/refonly-lrc_kir.vg.xg
> [vg mpmap] Graph is in XG format. XG is a good graph format for most mapping use cases. PackedGraph may be selected if memory usage is too high. See `vg convert` if you want to change graph formats.
> [vg mpmap] Loading GCSA2 from graphs/refonly-lrc_kir.vg.gcsa
> [vg mpmap] Loading LCP from graphs/refonly-lrc_kir.vg.gcsa.lcp
> [vg mpmap] Mapping reads from reads/grch38_lrc_kir_paired.fq using 4 threads
> [vg mpmap] Mapping finished. Mapped 1 read pairs.
> [vg mpmap] Executing command: vg mpmap -x graphs/refonly-lrc_kir.vg.xg -g graphs/refonly-lrc_kir.vg.gcsa -f reads/grch38_lrc_kir_paired.fq -B -i -I 100000 -D 5 -S
> [vg mpmap] Loading graph from graphs/refonly-lrc_kir.vg.xg
> [vg mpmap] Graph is in XG format. XG is a good graph format for most mapping use cases. PackedGraph may be selected if memory usage is too high. See `vg convert` if you want to change graph formats.
> [vg mpmap] Loading GCSA2 from graphs/refonly-lrc_kir.vg.gcsa
> [vg mpmap] Loading LCP from graphs/refonly-lrc_kir.vg.gcsa.lcp
> [vg mpmap] Mapping reads from reads/grch38_lrc_kir_paired.fq using 4 threads
> [vg mpmap] Mapping finished. Mapped 1 read pairs.
> [vg mpmap] Executing command: vg mpmap -x graphs/refonly-lrc_kir.vg.xg -g graphs/refonly-lrc_kir.vg.gcsa -f reads/grch38_lrc_kir_paired.fq -B -i -S
> [vg mpmap] Loading graph from graphs/refonly-lrc_kir.vg.xg
> [vg mpmap] Graph is in XG format. XG is a good graph format for most mapping use cases. PackedGraph may be selected if memory usage is too high. See `vg convert` if you want to change graph formats.
> [vg mpmap] Loading GCSA2 from graphs/refonly-lrc_kir.vg.gcsa
> [vg mpmap] Loading LCP from graphs/refonly-lrc_kir.vg.gcsa.lcp
> [vg mpmap] Mapping reads from reads/grch38_lrc_kir_paired.fq using 4 threads
> warning:[vg mpmap] Could not find 1000 (-b) unambiguous read pair mappings to estimate fragment length ditribution. This can happen due to data issues (e.g. unpaired reads being mapped as pairs) or because the sample size is too large for the read set. Mapping read pairs as independent single-ended reads.
> [vg mpmap] Mapping finished. Mapped 1 read pairs.
> [vg mpmap] Executing command: vg mpmap -B -x graphs/refonly-lrc_kir.vg.xg -g graphs/refonly-lrc_kir.vg.gcsa -G input.gam -i --single-path-mode --no-qual-adjust
> [vg mpmap] Loading graph from graphs/refonly-lrc_kir.vg.xg
> [vg mpmap] Graph is in XG format. XG is a good graph format for most mapping use cases. PackedGraph may be selected if memory usage is too high. See `vg convert` if you want to change graph formats.
> [vg mpmap] Loading GCSA2 from graphs/refonly-lrc_kir.vg.gcsa
> [vg mpmap] Loading LCP from graphs/refonly-lrc_kir.vg.gcsa.lcp
> [vg mpmap] Mapping reads from input.gam using 4 threads
> [vg mpmap] Mapping reads from input.gam
> warning:[vg mpmap] Could not find 1000 (-b) unambiguous read pair mappings to estimate fragment length ditribution. This can happen due to data issues (e.g. unpaired reads being mapped as pairs) or because the sample size is too large for the read set. Mapping read pairs as independent single-ended reads.
> [vg mpmap] Mapping finished. Mapped 1000 read pairs.
> [vg mpmap] Executing command: vg mpmap -B -x t.xg -g t.gcsa -f t.fq
> [vg mpmap] Loading graph from t.xg
> [vg mpmap] Graph is in XG format. XG is a good graph format for most mapping use cases. PackedGraph may be selected if memory usage is too high. See `vg convert` if you want to change graph formats.
> [vg mpmap] Loading GCSA2 from t.gcsa
> [vg mpmap] Loading LCP from t.gcsa.lcp
> [vg mpmap] Mapping reads from t.fq using 4 threads
> [vg mpmap] Mapping finished. Mapped 3 reads.
> t/33_vg_mpmap.t .......
> 1..14
> ok 1 - MAPQ is 50% without haplotype info
> ok 2 - haplotype match can disambiguate
> ok 3 - MAPQ is 50% when paired without haplotype info
> ok 4 - haplotype match can disambiguate paired
> ok 5 - use of haplotype-aware mapping is recorded
> ok 6 - Haplotype-oblivious mapping places read on the wrong contig
> ok 7 - Haplotype-oblivious mapping places read with MAPQ of 50%
> ok 8 - Haplotype-aware mapping places read on the right contig
> ok 9 - Haplotype-aware mapping places read with MAPQ > 50%
> ok 10 - paired read alignments forced to be consistent have lower score than unrestricted alignments
> ok 11 - paired read alignments forced to be consistent are closer together in node id space than unrestricted alignments
> ok 12 - paired read alignments forced to be near each other are closer together in node id space than those forced to be far apart
> ok 13 - small batches are still all paired in the output
> ok 14 - multipath mapping works in scenarios that trigger branch point trimming
> ok
> t/34_vg_pack.t ........
> 1..16
> ok 1 - allele observation packing detects 2 SNPs
> ok 2 - pileup packs agree with graph coverage
> ok 3 - graph coverages are merged from multiple .cx indexes
> ok 4 - edit records are merged from multiple .cx indexes
> ok 5 - binned edit accumulation does not affect the result
> ok 6 - pack records are filtered by node id
> ok 7 - pack records are filtered by node id
> ok 8 - pack index merging produces the expected result
> ok 9 - pack index merging produces the expected result for edges
> ok 10 - pack computes the same total edge coverage as pileup
> ok 11 - pack stores the correct edge pileup to disk
> ok 12 - node packs on vg same as xg
> ok 13 - edge packs on vg same as xg
> ok 14 - node packs same on vg when using 3 threads as when using 1
> ok 15 - edge packs same on vg when using 2 threads as when using 1
> ok 16 - average node qualities are correct
> ok
> t/36_vg_annotate.t ....
> 1..7
> ok 1 - we can detect when reads contain non-reference variation
> ok 2 - vg annotate finds the right number of reads overlapping a feature
> ok 3 - all reads overlapping a feature fall on its node
> ok 4 - vg annotate finds no reads touching both of two distant features
> ok 5 - vg annotate shows reads having to go through one feature to get to another at the end
> ok 6 - vg annotate shows all reads overlapping a whole-reference-covering feature
> ok 7 - annotations derived from BED can span the end/start joins of circular paths
> ok
> t/37_vg_gbwt.t ........
> 1..42
> ok 1 - chromosome x: 2 threads
> ok 2 - chromosome x: 1 contig
> ok 3 - chromosome x: 2 haplotypes
> ok 4 - chromosome x: 1 sample
> ok 5 - chromosome x: 2 thread names
> ok 6 - chromosome x: 1 contig name
> ok 7 - chromosome x: 1 sample name
> ok 8 - chromosome y: 2 threads
> ok 9 - chromosome y: 1 contig
> ok 10 - chromosome y: 2 haplotypes
> ok 11 - chromosome y: 1 sample
> ok 12 - GBWT indexes can be merged
> ok 13 - merge: 4 threads
> ok 14 - merge: 2 contigs
> ok 15 - merge: 2 haplotypes
> ok 16 - merge: 1 sample
> ok 17 - GBWT indexes can be merged with the fast algorithm
> ok 18 - fast merge: 4 threads
> ok 19 - fast merge: 2 contigs
> ok 20 - fast merge: 2 haplotypes
> ok 21 - fast merge: 1 sample
> ok 22 - the merged indexes are identical
> ok 23 - there is 1 thread in the index
> ok 24 - there are 3 threads in the index
> ok 25 - samples can be removed from a GBWT index
> ok 26 - the sample was removed
> ok 27 - threads can be extracted from GBWT
> ok 28 - the thread files are identical
> ok 29 - GBWTGraph construction was successful
> ok 30 - GBWTGraph was correctly serialized
> ok 31 - GBWT/GBWTGraph construction from path cover was successful
> ok 32 - GBWTGraph was correctly serialized
> ok 33 - path cover: 32 threads
> ok 34 - path cover: 2 contigs
> ok 35 - path cover: 16 haplotypes
> ok 36 - path cover: 16 samples
> ok 37 - GBWT/GBWTGraph construction from local haplotypes was successful
> ok 38 - GBWTGraph was correctly serialized
> ok 39 - local haplotypes: 32 threads
> ok 40 - local haplotypes: 2 contigs
> ok 41 - local haplotypes: 16 haplotypes
> ok 42 - local haplotypes: 16 samples
> ok
> t/38_vg_prune.t: line 61: hexdump: command not found
> t/38_vg_prune.t: line 63: hexdump: command not found
> t/38_vg_prune.t: line 65: hexdump: command not found
> t/38_vg_prune.t .......
> 1..18
> ok 1 - pruning produces the correct number of components
> ok 2 - pruning leaves the correct number of nodes
> ok 3 - pruning leaves the correct number of edges
> ok 4 - pruning without high-degree nodes produces the correct number of components
> ok 5 - pruning without high-degree nodes leaves the correct number of nodes
> ok 6 - pruning without high-degree nodes leaves the correct number of edges
> ok 7 - pruning with path restoring produces the correct number of components
> ok 8 - pruning with path restoring leaves the correct number of nodes
> ok 9 - pruning with path restoring leaves the correct number of edges
> ok 10 - pruning with path/thread unfolding produces the correct number of components
> ok 11 - pruning with path/thread unfolding produces the correct number of nodes
> ok 12 - pruning with path/thread unfolding produces the correct number of edges
> ok 13 - pruning with path unfolding produces the correct number of components
> ok 14 - pruning with path unfolding produces the correct number of nodes
> ok 15 - pruning with path unfolding produces the correct number of edges
> not ok 16 - unnamed test
> # got: '99_0_99_0_'
> # expected: 'empty mapping starts from the right node id'
> not ok 17 - unnamed test
> # got: '99_0_128_0_'
> # expected: 'the first unfolded graph adds the correct number of nodes to the mapping'
> not ok 18 - unnamed test
> # got: '99_0_156_0_'
> # expected: 'the second unfolded graph adds the correct number of nodes to the mapping'
> Failed 3/18 subtests
> t/39_vg_inject.t ......
> 1..10
> ok 1 - reads are generated
> ok 2 - vg inject works for all reads included in the original bam
> ok 3 - vg inject retains read names
> ok 4 - vg inject works perfectly for the position of alignment in the simple graph
> ok 5 - vg inject works perfectly for the position of alignment
> ok 6 - vg inject works perfectly for the mapping quality of alignment
> ok 7 - vg inject works perfectly for the cigar of alignment in the simple graph
> ok 8 - vg inject works perfectly for the cigar of alignment
> ok 9 - vg inject preserves all reads
> ok 10 - vg inject works perfectly for the reads flagged as is_reverse
> ok
> 1000 reads correct
> t/40_vg_gamcompare.t ..
> 1..2
> ok 1 - gamcompare completes
> ok 2 - gamcompare says the truth is correctly mapped
> ok
> t/41_vg_viz.t .........
> 1..1
> ok 1 - vg viz runs
> ok
> t/42_vg_gamsort.t .....
> 1..3
> ok 1 - Sorting a GAM orders the alignments by min node ID
> ok 2 - sorted GAMs can be indexed during the sort
> ok 3 - Sorting a GAM with RocksDB orders the alignments by min node ID
> ok
> t/43_vg_simplify.t ....
> 1..5
> ok 1 - vg simplify runs through when popping small bubbles
> ok 2 - simplification pops all the bubbles in a simple graph
> ok 3 - vg simplify runs through when removing rare variants
> ok 4 - the graph is valid after removing rare variants
> ok 5 - simplification keeps only some variants
> ok
> t/44_vg_benchmark.t ...
> 1..1
> ok 1 - vg benchmark completes succesfully
> ok
> t/45_vg_sort.t ........
> 1..6
> ok 1 - ids in our test graph are not initially in sorted order
> ok 2 - a vg graph can be sorted and indexed by ID without crashing
> ok 3 - sort by ID actually puts nodes in ID order
> ok 4 - a vg graph can be sorted topologically
> ok 5 - a vg graph can be sorted with Eades algorithm without crashing
> ok 6 - a vg graph can be sorted with the max-flow algorithm without crashing
> ok
> t/46_vg_minimizer.t ...
> 1..12
> ok 1 - default parameters
> ok 2 - single-threaded construction
> ok 3 - construction is deterministic
> ok 4 - minimizer parameters
> ok 5 - setting -k -w works correctly
> ok 6 - construction from GBWTGraph
> ok 7 - construction is deterministic
> ok 8 - construction with payload
> ok 9 - construction is deterministic
> ok 10 - multiple graphs: first
> ok 11 - multiple graphs: second
> ok 12 - construction is deterministic
> ok
> t/47_vg_dotplot.t .....
> 1..1
> ok 1 - vg dotplot runs successfully
> ok
> t/48_vg_convert.t .....
> 1..12
> ok 1 - vg convert maintains same nodes throughout xg conversion
> ok 2 - vg convert maintains same nodes throughout hash-graph conversion
> ok 3 - vg convert maintains same nodes throughout packed-graph conversion
> ok 4 - vg convert maintains same nodes throughout ODGI conversion
> ok 5 - hash graph conversion looks good
> ok 6 - packed graph conversion looks good
> ok 7 - vg conversion looks good
> ok 8 - odgi conversion looks good
> ok 9 - xg conversion looks good
> ok 10 - on disk gfa conversion looks good
> ok 11 - streaming gfa conversion looks good
> ok 12 - gfa to xg conversion looks good
> ok
> t/49_vg_depth.t .......
> 1..3
> ok 1 - vg depth gets correct depth from gam
> ok 2 - vg depth gets correct depth from pack
> ok 3 - vg depth gets correct number of bins
> ok
> index file x.fa.fai not found, generating...
> t/50_vg_gaffe.t .......
> 1..4
> ok 1 - a read can be mapped with all indexes specified without crashing
> ok 2 - a read can be mapped with just FASTA and VCF without crashing
> ok 3 - mapping with just a FASTA and a VCF produced JSON-able alignments
> ok 4 - mapping to manually-generated indexes and automatically-generated indexes is the same
> ok
>
> Test Summary Report
> -------------------
> t/07_vg_map.t (Wstat: 0 Tests: 54 Failed: 1)
> Failed test: 33
> t/38_vg_prune.t (Wstat: 0 Tests: 18 Failed: 3)
> Failed tests: 16-18
> Files=50, Tests=653, 186 wallclock secs ( 0.24 usr 0.05 sys + 289.05 cusr 49.70 csys = 339.04 CPU)
> Result: FAIL
> make[1]: *** [debian/rules:59: override_dh_auto_test-arch] Error 1
> make[1]: Leaving directory '/<<PKGBUILDDIR>>'
The full build log is available from:
http://qa-logs.debian.net/2020/06/20/vg_1.24.0+ds-1_unstable.log
A list of current common problems and possible solutions is available at
http://wiki.debian.org/qa.debian.org/FTBFS . You're welcome to contribute!
About the archive rebuild: The rebuild was done on EC2 VM instances from
Amazon Web Services, using a clean, minimal and up-to-date chroot. Every
failed build was retried once to eliminate random failures.
More information about the Debian-med-packaging
mailing list